Sample records for changing world skip

  1. Skipping breakfast and 5‐year changes in body mass index and waist circumference in Japanese men and women

    PubMed Central

    Yoshita, K.; Nakamura, K.; Miura, K.; Takamura, T.; Nagasawa, S.Y.; Morikawa, Y.; Kido, T.; Naruse, Y.; Nogawa, K.; Suwazono, Y.; Sasaki, S.; Ishizaki, M.; Nakagawa, H.

    2017-01-01

    Summary Objective This study investigated the relationship between frequency of skipping breakfast and annual changes in body mass index (BMI) and waist circumference (WC). Methods The participants were 4,430 factory employees. BMI and WC were measured repeatedly at annual medical examinations over a 5‐year period. The association between frequency of skipping breakfast at the baseline examination and annual changes in anthropometric indices was evaluated using the generalized estimating equation method. Results The mean (standard deviation) BMI was 23.3 (3.0) kg m−2 for men and 21.9 (3.6) kg m−2 for women; and the mean WC was 82.6 (8.7) cm for men and 77.8 (9.8) cm for women. During the follow‐up period, mean BMI increased by 0.2 kg m−2 for men and women, and mean WC increased by 1.1 cm for men and 1.0 cm for women. The annual change in the BMI of men who skipped breakfast four to six times per week was 0.061 kg m−2 higher, and that of those who skipped breakfast seven times per week was 0.046 kg m−2 higher, compared with those who did not skip breakfast. Annual changes in the WC of male participants who skipped breakfast seven times per week was 0.248 cm higher than that of those who did not skip breakfast. Skipping breakfast was not associated with changes in BMI or WC in women. Conclusions Skipping breakfast was closely associated with annual changes in BMI and WC among men, and eating breakfast more than four times per week may prevent the excessive body weight gain associated with skipping breakfast. PMID:28702211

  2. Water Bouncing Balls: how material stiffness affects water entry

    NASA Astrophysics Data System (ADS)

    Truscott, Tadd

    2014-03-01

    It is well known that one can skip a stone across the water surface, but less well known that a ball can also be skipped on water. Even though 17th century ship gunners were aware that cannonballs could be skipped on the water surface, they did not know that using elastic spheres rather than rigid ones could greatly improve skipping performance (yet would have made for more peaceful volleys). The water bouncing ball (Waboba®) is an elastic ball used in a game of aquatic keep away in which players pass the ball by skipping it along the water surface. The ball skips easily along the surface creating a sense that breaking the world record for number of skips could easily be achieved (51 rock skips Russell Byers 2007). We investigate the physics of skipping elastic balls to elucidate the mechanisms by which they bounce off of the water. High-speed video reveals that, upon impact with the water, the balls create a cavity and deform significantly due to the extreme elasticity; the flattened spheres resemble skipping stones. With an increased wetted surface area, a large hydrodynamic lift force is generated causing the ball to launch back into the air. Unlike stone skipping, the elasticity of the ball plays an important roll in determining the success of the skip. Through experimentation, we demonstrate that the deformation timescale during impact must be longer than the collision time in order to achieve a successful skip. Further, several material deformation modes can be excited upon free surface impact. The effect of impact velocity and angle on the two governing timescales and material wave modes are also experimentally investigated. Scaling for the deformation and collision times are derived and used to establish criteria for skipping in terms of relevant physical parameters.

  3. New scene change control scheme based on pseudoskipped picture

    NASA Astrophysics Data System (ADS)

    Lee, Youngsun; Lee, Jinwhan; Chang, Hyunsik; Nam, Jae Y.

    1997-01-01

    A new scene change control scheme which improves the video coding performance for sequences that have many scene changed pictures is proposed in this paper. The scene changed pictures except intra-coded picture usually need more bits than normal pictures in order to maintain constant picture quality. The major idea of this paper is how to obtain extra bits which are needed to encode scene changed pictures. We encode a B picture which is located before a scene changed picture like a skipped picture. We call such a B picture as a pseudo-skipped picture. By generating the pseudo-skipped picture like a skipped picture. We call such a B picture as a pseudo-skipped picture. By generating the pseudo-skipped picture, we can save some bits and they are added to the originally allocated target bits to encode the scene changed picture. The simulation results show that the proposed algorithm improves encoding performance about 0.5 to approximately 2.0 dB of PSNR compared to MPEG-2 TM5 rate controls scheme. In addition, the suggested algorithm is compatible with MPEG-2 video syntax and the picture repetition is not recognizable.

  4. Performance enhancing water skipping: successive free surface impacts of elastic spheres

    NASA Astrophysics Data System (ADS)

    Hurd, Randy; Truscott, Tadd; Belden, Jesse

    2014-11-01

    From naval gunners skipping cannonballs to children skipping stones, physicists have long been enamored with the repeated ricochet of objects on the water surface. Elastic spheres, such as the toy Waboba ball, make water skipping more accessible to the masses by expanding the range of impact parameters over which objects can be skipped. For example, it is not difficult to achieve more than twenty skips with such spheres, where skipping a stone twenty times is very difficult. In this talk we discuss the dynamics of water skipping elastic spheres over several successive skips. High-speed video captured using a unique experimental setup reveals how dynamics change with each skip as a result of lost kinetic energy. We place these observations in the context of previous work on single oblique impacts to identify material vibration modes that are excited during ricochet. The material modes excited with each successive impact are seen to decay from high-energy modes to low energy modes until water entry finally occurs. A model for estimating skipping outcome from initial conditions is proposed.

  5. Skipping of Chinese characters does not rely on word-based processing.

    PubMed

    Lin, Nan; Angele, Bernhard; Hua, Huimin; Shen, Wei; Zhou, Junyi; Li, Xingshan

    2018-02-01

    Previous eye-movement studies have indicated that people tend to skip extremely high-frequency words in sentence reading, such as "the" in English and "/de" in Chinese. Two alternative hypotheses have been proposed to explain how this frequent skipping happens in Chinese reading: one assumes that skipping happens when the preview has been fully identified at the word level (word-based skipping); the other assumes that skipping happens whenever the preview character is easy to identify regardless of whether lexical processing has been completed or not (character-based skipping). Using the gaze-contingent display change paradigm, we examined the two hypotheses by substituting the preview of the third character of a four-character Chinese word with the high-frequency Chinese character "/de", which should disrupt the ongoing word-level processing. The character-based skipping hypothesis predicts that this manipulation will enhance the skipping probability of the target character (i.e., the third character of the target word), because the character "/de" has much higher character frequency than the original character. The word-based skipping hypothesis instead predicts a reduction of the skipping probability of the target character because the presence of the character "/de" is lexically infelicitous at word level. The results supported the character-based skipping hypothesis, indicating that in Chinese reading the decision of skipping a character can be made before integrating it into a word.

  6. ACHP | News

    Science.gov Websites

    Search skip specific nav links Home arrow News arrow August 17, 2012 World Heritage Sites Report Released ), and the U.S. National Commission on UNESCO convened a symposium on U.S. World Heritage Sites at the University of Virginia, itself a World Heritage Site. The symposium was supported by the ACHP Alumni

  7. Breakfast skipping as a risk correlate of overweight and obesity in school-going ethnic Fijian adolescent girls

    PubMed Central

    Thompson-McCormick, Jonas J; Thomas, Jennifer J; Bainivualiku, Asenaca; Khan, A Nisha; Becker, Anne E

    2013-01-01

    The prevalence of overweight and obesity has increased globally, and population data suggest that it is also increasing among ethnic Fijian youth. Among numerous behavioural changes contributing to overweight in youth residing in nations undergoing rapid economic and social change, meal skipping has not been examined as a potential risk factor. The study objectives were to assess the prevalence of overweight, obesity, and breakfast skipping and examine their cross-sectional association in a community sample of school-going ethnic Fijian adolescent girls (n=523). We measured height and weight, and assessed dietary patterns, eating pathology, dimensions of acculturation, and other socio-demographic and cultural data by self-report. We observed a high prevalence of both overweight (41%, including 15% who were obese) and breakfast skipping (68%). In addition, in multivariable analyses unadjusted for eating pathology, we found that more frequent breakfast skipping was associated with greater odds of overweight (odds ratio (OR)=1.15, confidence interval (CI)=1.06, 1.26, p<0.01) and obesity (OR=1.18, CI=1.05, 1.33, p<0.01). Regression models adjusting for eating pathology attenuated this relation so that it was non-significant, but demonstrated that greater eating pathology was associated with greater odds of both overweight and obesity. Future research is necessary to clarify the relation among breakfast skipping, eating pathology, and overweight in ethnic Fijian girls, and to identify whether breakfast skipping may be a modifiable risk factor for overweight in this population. PMID:20805082

  8. School Breakfast-Club Program Changes and Youth Eating Breakfast during the School Week in the COMPASS Study

    ERIC Educational Resources Information Center

    Leatherdale, Scott T.; Stefanczyk, Jennifer M.; Kirkpatrick, Sharon I.

    2016-01-01

    Background: Despite the importance of breakfast consumption, breakfast skipping is common among Canadian youth. This study examines how changes to school-based breakfast programs are associated with breakfast-skipping behavior. Methods: Using school-level longitudinal data from Year 1 (Y[subscript 1]: 2012-2013) and Year 2 (Y[subscript 2]:…

  9. Sexual divergence in microtubule function: the novel intranasal microtubule targeting SKIP normalizes axonal transport and enhances memory.

    PubMed

    Amram, N; Hacohen-Kleiman, G; Sragovich, S; Malishkevich, A; Katz, J; Touloumi, O; Lagoudaki, R; Grigoriadis, N C; Giladi, E; Yeheskel, A; Pasmanik-Chor, M; Jouroukhin, Y; Gozes, I

    2016-10-01

    Activity-dependent neuroprotective protein (ADNP), essential for brain formation, is a frequent autism spectrum disorder (ASD)-mutated gene. ADNP associates with microtubule end-binding proteins (EBs) through its SxIP motif, to regulate dendritic spine formation and brain plasticity. Here, we reveal SKIP, a novel four-amino-acid peptide representing an EB-binding site, as a replacement therapy in an outbred Adnp-deficient mouse model. We discovered, for the first time, axonal transport deficits in Adnp(+/-) mice (measured by manganese-enhanced magnetic resonance imaging), with significant male-female differences. RNA sequencing evaluations showed major age, sex and genotype differences. Function enrichment and focus on major gene expression changes further implicated channel/transporter function and the cytoskeleton. In particular, a significant maturation change (1 month-five months) was observed in beta1 tubulin (Tubb1) mRNA, only in Adnp(+/+) males, and sex-dependent increase in calcium channel mRNA (Cacna1e) in Adnp(+/+) males compared with females. At the protein level, the Adnp(+/-) mice exhibited impaired hippocampal expression of the calcium channel (voltage-dependent calcium channel, Cacnb1) as well as other key ASD-linked genes including the serotonin transporter (Slc6a4), and the autophagy regulator, BECN1 (Beclin1), in a sex-dependent manner. Intranasal SKIP treatment normalized social memory in 8- to 9-month-old Adnp(+/-)-treated mice to placebo-control levels, while protecting axonal transport and ameliorating changes in ASD-like gene expression. The control, all d-amino analog D-SKIP, did not mimic SKIP activity. SKIP presents a novel prototype for potential ASD drug development, a prevalent unmet medical need.

  10. An examination of the role of feeding regimens in regulating metabolism during the broiler breeder grower period. 1. Hepatic lipid metabolism.

    PubMed

    de Beer, M; Rosebrough, R W; Russell, B A; Poch, S M; Richards, M P; Coon, C N

    2007-08-01

    A trial was conducted to determine the effects of feeding regimens on hepatic lipid metabolism in 16-wk-old broiler breeder pullets. A flock of 350 Cobb 500 breeder pullets was divided into 2 at 4 wk of age and fed either every day (ED) or skip-a-day (SKIP) from 4 to 16 wk of age. Total feed intake did not differ between the 2 groups. At 112 d, 52 randomly selected ED-fed pullets, and 76 SKIP-fed pullets were individually caged and fed a 74-g (ED) or 148-g (SKIP) meal. Four pullets from each group were killed at intervals after feeding and livers were collected, weighed, and snap-frozen for determination of lipogenic gene expression. Total RNA was isolated from livers using Trizol reagent and then quantitatively measured by noting the optical density 260:280 ratio and qualitatively measured by gel electrophoresis. The expression of certain regulatory genes in metabolism [acetyl coenzyme A carboxylase; fatty acid synthase; malic enzyme (MAE); isocitrate dehydrogenase (ICDH); and aspartate aminotransferase (AAT)] were determined by real-time reverse-transcription PCR. Remaining liver portions were analyzed for enzyme activity of MAE, ICDH, and AAT as well as glycogen and lipid contents. Liver weight was higher in SKIP than in ED birds. Feeding caused dramatic increases in liver weight, glycogen, and lipids of SKIP birds. Expression of acetyl coenzyme A carboxylase, FAS, and MAE genes were increased in SKIP birds 12 and 24 h after feeding, with the increases in MAE expression from 0 to 24 h after feeding being of the greatest magnitude. In contrast, SKIP decreased ICDH and AAT gene expression, which parallels findings noted in fasting-refeeding experiments conducted with much younger birds. Skip-a-day feeding resulted in far greater changes in gene expression compared with ED, which was indicative of the inconsistent supply of nutrients in such regimens. Enzyme activity of MAE, ICDH, and AAT was reflective of noted changes in gene expression. In summary, the feeding regimen greatly affected hepatic gene expression in breeder pullets.

  11. Antisense-mediated exon skipping: A versatile tool with therapeutic and research applications

    PubMed Central

    Aartsma-Rus, Annemieke; van Ommen, Gert-Jan B.

    2007-01-01

    Antisense-mediated modulation of splicing is one of the few fields where antisense oligonucleotides (AONs) have been able to live up to their expectations. In this approach, AONs are implemented to restore cryptic splicing, to change levels of alternatively spliced genes, or, in case of Duchenne muscular dystrophy (DMD), to skip an exon in order to restore a disrupted reading frame. The latter allows the generation of internally deleted, but largely functional, dystrophin proteins and would convert a severe DMD into a milder Becker muscular dystrophy phenotype. In fact, exon skipping is currently one of the most promising therapeutic tools for DMD, and a successful first-in-man trial has recently been completed. In this review the applicability of exon skipping for DMD and other diseases is described. For DMD AONs have been designed for numerous exons, which has given us insight into their mode of action, splicing in general, and splicing of the DMD gene in particular. In addition, retrospective analysis resulted in guidelines for AON design for DMD and most likely other genes as well. This knowledge allows us to optimize therapeutic exon skipping, but also opens up a range of other applications for the exon skipping approach. PMID:17684229

  12. SKIPing With Head Start Teachers: Influence of T-SKIP on Object-Control Skills.

    PubMed

    Brian, Ali; Goodway, Jacqueline D; Logan, Jessica A; Sutherland, Sue

    2017-12-01

    Children from disadvantaged settings are at risk for delays in their object-control (OC) skills. Fundamental motor skill interventions, such as the Successful Kinesthetic Instruction for Preschoolers (SKIP) Program, are highly successful when led by motor development experts. However, few preschools employ such experts. This study examined the extent to which Head Start teachers delivering an 8-week teacher-led SKIP (T-SKIP) intervention elicited learning of OC skills for Head Start children. Head Start teachers (n = 5) delivered T-SKIP for 8 weeks (450 min). Control teachers (n = 5) implemented the typical standard of practice, or well-equipped free play. All children (N = 122) were pretested and posttested on the OC Skill subscale of the Test of Gross Motor Development-2. Descriptive analyses at pretest identified 81% of the children were developmentally delayed in OC skills (below the 30th percentile). A 2-level hierarchical linear model demonstrated the effectiveness of T-SKIP with significant differences (β = 4.70), t(8) = 7.02, p < .001, η2 = .56, between T-SKIP children (n = 63) and control children (n = 59) at posttest. Head Start teachers who delivered T-SKIP could bring about positive changes in children's OC skills, thereby remediating the initial developmental delays presented. Control children remained delayed in their OC skills in spite of daily well-equipped free play, giving rise to concerns about their future motor competence and physical activity levels.

  13. Data from: Solving the Robot-World Hand-Eye(s) Calibration Problem with

    Science.gov Websites

    Iterative Methods | National Agricultural Library Skip to main content Home National Agricultural Library United States Department of Agriculture Ag Data Commons Beta Toggle navigation Datasets . License U.S. Public Domain Funding Source(s) National Science Foundation IOS-1339211 Agricultural Research

  14. Home Page, Division of Fishes, Department of Vertebrate Zoology, NMNH

    Science.gov Websites

    Skip to main content. Smithsonian National Museum of Natural History Donate Website Search Box National Museum of Natural History, is the largest in the world, with approximately 540,000 lots (a lot the Smithsonian Learn about the history of ichthyology at the Smithsonian Institution, beginning with

  15. Fishing-induced changes in adult length are mediated by skipped-spawning.

    PubMed

    Wang, Hui-Yu; Chen, Ying-Shiuan; Hsu, Chien-Chung; Shen, Sheng-Feng

    2017-01-01

    Elucidating fishing effects on fish population dynamics is a critical step toward sustainable fisheries management. Despite previous studies that have suggested age or size truncation in exploited fish populations, other aspects of fishing effects on population demography, e.g., via altering life histories and density, have received less attention. Here, we investigated the fishing effects altering adult demography via shifting reproductive trade-offs in the iconic, overexploited, Pacific bluefin tuna Thunnus orientalis. We found that, contrary to our expectation, mean lengths of catch increased over time in longline fisheries. On the other hand, mean catch lengths for purse seine fisheries did not show such increasing trends. We hypothesized that the size-dependent energetic cost of the spawning migration and elevated fishing mortality on the spawning grounds potentially drive size-dependent skipped spawning for adult tuna, mediating the observed changes in the catch lengths. Using eco-genetic individual-based modeling, we demonstrated that fishing-induced evolution of skipped spawning and size truncation interacted to shape the observed temporal changes in mean catch lengths for tuna. Skipped spawning of the small adults led to increased mean catch lengths for the longline fisheries, while truncation of small adults by the purse seines could offset such a pattern. Our results highlight the eco-evolutionary dynamics of fishing effects on population demography and caution against using demographic traits as a basis for fisheries management of the Pacific bluefin tuna as well as other migratory species. © 2016 by the Ecological Society of America.

  16. Optimum Orbit Plane Change Using a Skip Reentry Trajectory for the Space Shuttle Orbiter.

    DTIC Science & Technology

    1978-12-01

    by the hat symbol, " , and i,j,k represent unit vectors for the YW frame. The angular velocity of the earth is constant and denoted by w. Thus V re is...the equations of motion can be found. In component form the equations are: (6M/r3)x + 4 (Cos - sn ) vst 1 mm Msv 3 b1 bm y - (uM/r3)y + L (coso...plane change, due to the skip reentry maneuver is determined by comparing the states of the system before and after the maneuver. The angular momentum

  17. ACHP | News | Native Hawaiian Federal Interagency Working Group Created

    Science.gov Websites

    Search skip specific nav links Home arrow News arrow Heritage Tourism Gets Boost with House Vote Heritage Tourism Gets Boost with House Vote On July 22, 2014, the U.S. House of Representatives passed H.R. 4450 to tourism draw to the United States from people all over the world. "Brand USA" was established by

  18. Sustainability for behaviour change in the fight against antibiotic resistance: a social marketing framework.

    PubMed

    Edgar, Timothy; Boyd, Stephanie D; Palamé, Megan J

    2009-02-01

    Antibiotic resistance is one of today's most urgent public health problems, threatening to undermine the effectiveness of infectious disease treatment in every country of the world. Specific individual behaviours such as not taking the entire antibiotic regimen and skipping doses contribute to resistance development as does the taking of antibiotics for colds and other illnesses that antibiotics cannot treat. Antibiotic resistance is as much a societal problem as it is an individual one; if mass behaviour change across the population does not occur, the problem of resistance cannot be mitigated at community levels. The problem is one that potentially can be solved if both providers and patients become sufficiently aware of the issue and if they engage in appropriate behaviours. Although a number of initiatives have been implemented in various parts of the world to elicit behaviour change, results have been mixed, and there is little evidence that trial programmes with positive outcomes serve as models of sustainability. In recent years, several scholars have suggested social marketing as the framework for behaviour change that has the greatest chance of sustained success, but the antibiotic resistance literature provides no specifics for how the principles of social marketing should be applied. This paper provides an overview of previous communication-based initiatives and offers a detailed approach to social marketing to guide future efforts.

  19. DOE Office of Scientific and Technical Information (OSTI.GOV)

    James, S. R.; Knox, H. A.; Abbott, R. E.

    Cross correlations of seismic noise can potentially record large changes in subsurface velocity due to permafrost dynamics and be valuable for long-term Arctic monitoring. We applied seismic interferometry, using moving window cross-spectral analysis (MWCS), to 2 years of ambient noise data recorded in central Alaska to investigate whether seismic noise could be used to quantify relative velocity changes due to seasonal active-layer dynamics. The large velocity changes (>75%) between frozen and thawed soil caused prevalent cycle-skipping which made the method unusable in this setting. We developed an improved MWCS procedure which uses a moving reference to measure daily velocity variationsmore » that are then accumulated to recover the full seasonal change. This approach reduced cycle-skipping and recovered a seasonal trend that corresponded well with the timing of active-layer freeze and thaw. Lastly, this improvement opens the possibility of measuring large velocity changes by using MWCS and permafrost monitoring by using ambient noise.« less

  20. Potential Association between Breakfast Skipping and Concomitant Late-Night-Dinner Eating with Metabolic Syndrome and Proteinuria in the Japanese Population.

    PubMed

    Kutsuma, Ayano; Nakajima, Kei; Suwa, Kaname

    2014-01-01

    Skipping breakfast is considered to be an unhealthy eating habit linked to predispositions to obesity and type 2 diabetes. Because eating dinner late at night can elicit subsequent breakfast skipping, we investigated if skipping breakfast concomitant with late-night-dinner eating (LNDE) was associated with metabolic syndrome (MetS) and proteinuria in the general Japanese population. We examined self-reported habitual breakfast skipping and LNDE, MetS (modified ATP-III criteria), and proteinuria in a cross-sectional study of 60,800 Japanese adults aged 20-75 years. A total of 14,068 subjects (23.1%) skipped breakfast, of whom approximately half (52.8%) skipped breakfast alone (without LNDE). The percentages of subjects who skipped breakfast showed a J-shaped relationship with body mass index (BMI). Multivariate logistic regression analysis showed that skipping breakfast concomitant with LNDE (n = 6,645) was significantly associated with MetS and proteinuria, even after adjusting for relevant confounders (odds ratio (95% CI), 1.17 (1.08-1.28), P = 0.0003, and 1.37 (1.24-1.52), P < 0.0001, resp.). Skipping breakfast alone and LNDE alone were not associated with MetS and proteinuria, respectively. In conclusion, habitual breakfast skipping concomitant with LNDE may represent poorer eating behavior than skipping breakfast alone, associated with MetS, asymptomatic proteinuria, obesity, and low body weight in the general Japanese population.

  1. Reading skill and word skipping: Implications for visual and linguistic accounts of word skipping.

    PubMed

    Eskenazi, Michael A; Folk, Jocelyn R

    2015-11-01

    We investigated whether high-skill readers skip more words than low-skill readers as a result of parafoveal processing differences based on reading skill. We manipulated foveal load and word length, two variables that strongly influence word skipping, and measured reading skill using the Nelson-Denny Reading Test. We found that reading skill did not influence the probability of skipping five-letter words, but low-skill readers were less likely to skip three-letter words when foveal load was high. Thus, reading skill is likely to influence word skipping when the amount of information in the parafovea falls within the word identification span. We interpret the data in the context of visual-based (extended optimal viewing position model) and linguistic based (E-Z Reader model) accounts of word skipping. The models make different predictions about how and why a word and skipped; however, the data indicate that both models should take into account the fact that different factors influence skipping rates for high- and low-skill readers. (c) 2015 APA, all rights reserved).

  2. Longitudinal effect of eteplirsen versus historical control on ambulation in Duchenne muscular dystrophy

    PubMed Central

    Goemans, Nathalie; Lowes, Linda P.; Alfano, Lindsay N.; Berry, Katherine; Shao, James; Kaye, Edward M.; Mercuri, Eugenio; Hamid, Hoda Abdel; Byrne, Barry J.; Connolly, Anne M.; Dracker, Robert A.; Matthew Frank, L.; Heydemann, Peter T.; O'Brien, Kevin C.; Sparks, Susan E.; Specht, Linda A.; Rodino‐Klapac, Louise; Sahenk, Zarife; Al‐Zaidy, Samiah; Cripe, Linda H.; Lewis, Sarah; M, Pane; E, Mazzone; S, Messina; GL, Vita; Bertini, D Amico A; Casimiro, Berardinelli A; Y, Torrente; F, Magri; GP, Comi; G, Baranello; T, Mongini; A, Pini; R, Battini; E, Pegoraro; C, Bruno; L, Politano; S, Previtali

    2016-01-01

    Objective To continue evaluation of the long‐term efficacy and safety of eteplirsen, a phosphorodiamidate morpholino oligomer designed to skip DMD exon 51 in patients with Duchenne muscular dystrophy (DMD). Three‐year progression of eteplirsen‐treated patients was compared to matched historical controls (HC). Methods Ambulatory DMD patients who were ≥7 years old and amenable to exon 51 skipping were randomized to eteplirsen (30/50mg/kg) or placebo for 24 weeks. Thereafter, all received eteplirsen on an open‐label basis. The primary functional assessment in this study was the 6‐Minute Walk Test (6MWT). Respiratory muscle function was assessed by pulmonary function testing (PFT). Longitudinal natural history data were used for comparative analysis of 6MWT performance at baseline and months 12, 24, and 36. Patients were matched to the eteplirsen group based on age, corticosteroid use, and genotype. Results At 36 months, eteplirsen‐treated patients (n = 12) demonstrated a statistically significant advantage of 151m (p < 0.01) on 6MWT and experienced a lower incidence of loss of ambulation in comparison to matched HC (n = 13) amenable to exon 51 skipping. PFT results remained relatively stable in eteplirsen‐treated patients. Eteplirsen was well tolerated. Analysis of HC confirmed the previously observed change in disease trajectory at age 7 years, and more severe progression was observed in patients with mutations amenable to exon skipping than in those not amenable. The subset of patients amenable to exon 51 skipping showed a more severe disease course than those amenable to any exon skipping. Interpretation Over 3 years of follow‐up, eteplirsen‐treated patients showed a slower rate of decline in ambulation assessed by 6MWT compared to untreated matched HC. Ann Neurol 2016;79:257–271 PMID:26573217

  3. Do older adults use the Method of Loci? Results from the ACTIVE Study

    PubMed Central

    Gross, Alden L.; Brandt, Jason; Bandeen-Roche, Karen; Carlson, Michelle C.; Stuart, Elizabeth A.; Marsiske, Michael; Rebok, George W.

    2013-01-01

    Background The method of loci (MoL) is a complex visuospatial mnemonic strategy. Previous research suggests older adults could potentially benefit from using the MoL, but that it is too attentionally demanding for them to use in practice. We evaluated the hypotheses that training can increase the use of MoL, and that MoL use is associated with better memory. Methods We analyzed skip patterns on response forms for the Auditory Verbal Learning Test (AVLT) in the Advanced Cognitive Training for Independent and Vital Elderly (ACTIVE, n=1,401) trial using 5 years of longitudinal follow-up. Results At baseline, 2% of participants skipped spaces. Fewer than 2% of control participants skipped spaces at any visit across 5 years, but 25% of memory-trained participants, taught the MoL, did so. Participants who skipped spaces used more serial clustering, a hallmark of the MoL (p<0.001). Trained participants who skipped spaces showed greater memory improvement after training than memory-trained participants who did not skip spaces (Cohen's d=0.84, P=0.007), and did not differ in the subsequent rate of long-term memory decline through up to 5 years of follow-up. Conclusion Despite being attentionally demanding, this study suggests that after training, the MoL is used by up to 25% of older adults, and that its use is associated with immediate memory improvement that was sustained through the course of follow-up. Findings are consistent with the notion that older adults balance complexity with novelty in strategy selection, and that changes in strategies used following memory training result in observable qualitative and quantitative differences in memory performance. PMID:24625044

  4. Skipped Stage Modeling and Testing of the CPAS Main Parachutes

    NASA Technical Reports Server (NTRS)

    Varela, Jose G.; Ray, Eric S.

    2013-01-01

    The Capsule Parachute Assembly System (CPAS) has undergone the transition from modeling a skipped stage event using a simulation that treats a cluster of parachutes as a single composite canopy to the capability of simulating each parachute individually. This capability along with data obtained from skipped stage flight tests has been crucial in modeling the behavior of a skipping canopy as well as the crowding effect on non-skipping ("lagging") neighbors. For the finite mass inflation of CPAS Main parachutes, the cluster is assumed to inflate nominally through the nominal fill time, at which point the skipping parachute continues inflating. This sub-phase modeling method was used to reconstruct three flight tests involving skipped stages. Best fit inflation parameters were determined for both the skipping and lagging canopies.

  5. Correlates of meal skipping in young adults: a systematic review.

    PubMed

    Pendergast, Felicity J; Livingstone, Katherine M; Worsley, Anthony; McNaughton, Sarah A

    2016-12-01

    Meal skipping rates may be highest during young adulthood, a period of transition and development. Although these dietary behaviours may increase future risk of chronic disease, limited research has investigated correlates of meal skipping in young adults. A systematic literature search was conducted to identify studies that investigated correlates of meal skipping behaviours in young adults (aged 18-30 years). EBSCO host, MEDLINE Complete, Global Health, Scopus, EMBASE, Web of Science and Informit platforms were searched for eligible articles. Correlates were defined as any factor that was either associated with meal skipping or was self-reported by the participant to have an influence on meal skipping. Randomised controlled trials, prospective cohort studies, case-control studies, nested case-control studies, cross-sectional studies, and longitudinal studies were eligible for inclusion. Three-hundred and thirty-one articles were identified, 141 full-text articles assessed for eligibility, resulting in 35 included studies. Multiple methodological and reporting weaknesses were apparent in the reviewed studies with 28 of the 35 studies scoring a negative rating in the risk of bias assessment. Meal skipping (any meal), defined as the skipping of any meal throughout the day, was reported in 12 studies with prevalence ranging between 5 and 83%. The remaining 25 studies identified specific meals and their skipping rates, with breakfast the most frequently skipped meal 14-88% compared to lunch 8-57% and dinner 4-57%. Lack of time was consistently reported as an important correlate of meal skipping, compared with correlates such as cost and weight control, while sex was the most commonly reported associated correlate. Breakfast skipping was more common among men while lunch or dinner skipping being more common among women. This review is the first to examine potential correlates of meal skipping in young adults. Future research would benefit from stronger design and reporting strategies, using a standardised approach for measuring and defining meal skipping.

  6. Processing "the" in the Parafovea: Are Articles Skipped Automatically?

    ERIC Educational Resources Information Center

    Angele, Bernhard; Rayner, Keith

    2013-01-01

    One of the words that readers of English skip most often is the definite article "the". Most accounts of reading assume that in order for a reader to skip a word, it must have received some lexical processing. The definite article is skipped so regularly, however, that the oculomotor system might have learned to skip the letter string…

  7. Social Inequalities in Young Children’s Meal Skipping Behaviors: The Generation R Study

    PubMed Central

    Wijtzes, Anne I.; Jansen, Wilma; Jaddoe, Vincent W. V.; Franco, Oscar H.; Hofman, Albert; van Lenthe, Frank J.; Raat, Hein

    2015-01-01

    Background Regular meal consumption is considered an important aspect of a healthy diet. While ample evidence shows social inequalities in breakfast skipping among adolescents, little is known about social inequalities in breakfast skipping and skipping of other meals among young school-aged children. Such information is crucial in targeting interventions aimed to promote a healthy diet in children. Methods We examined data from 4704 ethnically diverse children participating in the Generation R Study, a population-based prospective cohort study in Rotterdam, the Netherlands. Information on family socioeconomic position (SEP), ethnic background, and meal skipping behaviors was assessed by parent-reported questionnaire when the child was 6 years old. Multiple logistic regression analyses were performed to assess the associations of family SEP (educational level, household income, employment status, family composition) and ethnic background with meal skipping behaviors, using high SEP children and native Dutch children as reference groups. Results Meal skipping prevalence ranged from 3% (dinner) to 11% (lunch). The prevalence of meal skipping was higher among low SEP children and ethnic minority children. Maternal educational level was independently associated with breakfast skipping ([low maternal educational level] OR: 2.21; 95% CI: 1.24,3.94). Paternal educational level was independently associated with lunch skipping ([low paternal educational level] OR: 1.53; 95% CI: 1.06,2.20) and dinner skipping ([mid-high paternal educational level] OR: 0.39; 95% CI: 0.20,0.76). Household income was independently associated with breakfast skipping ([low income] OR: 2.43, 95% CI: 1.40,4.22) and dinner skipping ([low income] OR: 2.44; 95% CI: 1.22,4.91). In general, ethnic minority children were more likely to skip breakfast, lunch, and dinner compared with native Dutch children. Adjustment for family SEP attenuated the associations of ethnic minority background with meal skipping behaviors considerably. Conclusion Low SEP children and ethnic minority children are at an increased risk of breakfast, lunch, and dinner skipping compared with high SEP children and native Dutch children, respectively. Given these inequalities, interventions aimed to promote regular meal consumption, breakfast consumption in particular, should target children from low socioeconomic groups and ethnic minority children. More qualitative research to investigate the pathways underlying social inequalities in children’s meal skipping behaviors is warranted. PMID:26225757

  8. Social Inequalities in Young Children's Meal Skipping Behaviors: The Generation R Study.

    PubMed

    Wijtzes, Anne I; Jansen, Wilma; Jaddoe, Vincent W V; Franco, Oscar H; Hofman, Albert; van Lenthe, Frank J; Raat, Hein

    2015-01-01

    Regular meal consumption is considered an important aspect of a healthy diet. While ample evidence shows social inequalities in breakfast skipping among adolescents, little is known about social inequalities in breakfast skipping and skipping of other meals among young school-aged children. Such information is crucial in targeting interventions aimed to promote a healthy diet in children. We examined data from 4704 ethnically diverse children participating in the Generation R Study, a population-based prospective cohort study in Rotterdam, the Netherlands. Information on family socioeconomic position (SEP), ethnic background, and meal skipping behaviors was assessed by parent-reported questionnaire when the child was 6 years old. Multiple logistic regression analyses were performed to assess the associations of family SEP (educational level, household income, employment status, family composition) and ethnic background with meal skipping behaviors, using high SEP children and native Dutch children as reference groups. Meal skipping prevalence ranged from 3% (dinner) to 11% (lunch). The prevalence of meal skipping was higher among low SEP children and ethnic minority children. Maternal educational level was independently associated with breakfast skipping ([low maternal educational level] OR: 2.21; 95% CI: 1.24,3.94). Paternal educational level was independently associated with lunch skipping ([low paternal educational level] OR: 1.53; 95% CI: 1.06,2.20) and dinner skipping ([mid-high paternal educational level] OR: 0.39; 95% CI: 0.20,0.76). Household income was independently associated with breakfast skipping ([low income] OR: 2.43, 95% CI: 1.40,4.22) and dinner skipping ([low income] OR: 2.44; 95% CI: 1.22,4.91). In general, ethnic minority children were more likely to skip breakfast, lunch, and dinner compared with native Dutch children. Adjustment for family SEP attenuated the associations of ethnic minority background with meal skipping behaviors considerably. Low SEP children and ethnic minority children are at an increased risk of breakfast, lunch, and dinner skipping compared with high SEP children and native Dutch children, respectively. Given these inequalities, interventions aimed to promote regular meal consumption, breakfast consumption in particular, should target children from low socioeconomic groups and ethnic minority children. More qualitative research to investigate the pathways underlying social inequalities in children's meal skipping behaviors is warranted.

  9. Potential Association between Breakfast Skipping and Concomitant Late-Night-Dinner Eating with Metabolic Syndrome and Proteinuria in the Japanese Population

    PubMed Central

    Kutsuma, Ayano; Suwa, Kaname

    2014-01-01

    Skipping breakfast is considered to be an unhealthy eating habit linked to predispositions to obesity and type 2 diabetes. Because eating dinner late at night can elicit subsequent breakfast skipping, we investigated if skipping breakfast concomitant with late-night-dinner eating (LNDE) was associated with metabolic syndrome (MetS) and proteinuria in the general Japanese population. We examined self-reported habitual breakfast skipping and LNDE, MetS (modified ATP-III criteria), and proteinuria in a cross-sectional study of 60,800 Japanese adults aged 20–75 years. A total of 14,068 subjects (23.1%) skipped breakfast, of whom approximately half (52.8%) skipped breakfast alone (without LNDE). The percentages of subjects who skipped breakfast showed a J-shaped relationship with body mass index (BMI). Multivariate logistic regression analysis showed that skipping breakfast concomitant with LNDE (n = 6,645) was significantly associated with MetS and proteinuria, even after adjusting for relevant confounders (odds ratio (95% CI), 1.17 (1.08–1.28), P = 0.0003, and 1.37 (1.24–1.52), P < 0.0001, resp.). Skipping breakfast alone and LNDE alone were not associated with MetS and proteinuria, respectively. In conclusion, habitual breakfast skipping concomitant with LNDE may represent poorer eating behavior than skipping breakfast alone, associated with MetS, asymptomatic proteinuria, obesity, and low body weight in the general Japanese population. PMID:24982814

  10. Television viewing, computer game play and book reading during meals are predictors of meal skipping in a cross-sectional sample of 12-, 14- and 16-year-olds.

    PubMed

    Custers, Kathleen; Van den Bulck, Jan

    2010-04-01

    To examine whether television viewing, computer game playing or book reading during meals predicts meal skipping with the aim of watching television, playing computer games or reading books (media meal skipping). A cross-sectional study was conducted using a standardized self-administered questionnaire. Analyses were controlled for age, gender and BMI. Data were obtained from a random sample of adolescents in Flanders, Belgium. Seven hundred and ten participants aged 12, 14 and 16 years. Of the participants, 11.8 % skipped meals to watch television, 10.5 % skipped meals to play computer games and 8.2 % skipped meals to read books. Compared with those who did not use these media during meals, the risk of skipping meals in order to watch television was significantly higher for those children who watched television during meals (2.9 times higher in those who watched television during at least one meal a day). The risk of skipping meals for computer game playing was 9.5 times higher in those who played computer games weekly or more while eating, and the risk of meal skipping in order to read books was 22.9 times higher in those who read books during meals less than weekly. The more meals the respondents ate with the entire family, the less likely they were to skip meals to watch television. The use of media during meals predicts meal skipping for using that same medium. Family meals appear to be inversely related to meal skipping for television viewing.

  11. Assessment of the feasibility of exon 45–55 multiexon skipping for duchenne muscular dystrophy

    PubMed Central

    van Vliet, Laura; de Winter, Christa L; van Deutekom, Judith CT; van Ommen, Gert-Jan B; Aartsma-Rus, Annemieke

    2008-01-01

    Background The specific skipping of an exon, induced by antisense oligonucleotides (AON) during splicing, has shown to be a promising therapeutic approach for Duchenne muscular dystrophy (DMD) patients. As different mutations require skipping of different exons, this approach is mutation dependent. The skipping of an entire stretch of exons (e.g. exons 45 to 55) has recently been suggested as an approach applicable to larger groups of patients. However, this multiexon skipping approach is technically challenging. The levels of intended multiexon skips are typically low and highly variable, and may be dependent on the order of intron removal. We hypothesized that the splicing order might favor the induction of multiexon 45–55 skipping. Methods We here tested the feasibility of inducing multiexon 45–55 in control and patient muscle cell cultures using various AON cocktails. Results In all experiments, the exon 45–55 skip frequencies were minimal and comparable to those observed in untreated cells. Conclusion We conclude that current state of the art does not sufficiently support clinical development of multiexon skipping for DMD. PMID:19046429

  12. Improved moving window cross-spectral analysis for resolving large temporal seismic velocity changes in permafrost

    DOE PAGES

    James, S. R.; Knox, H. A.; Abbott, R. E.; ...

    2017-04-13

    Cross correlations of seismic noise can potentially record large changes in subsurface velocity due to permafrost dynamics and be valuable for long-term Arctic monitoring. We applied seismic interferometry, using moving window cross-spectral analysis (MWCS), to 2 years of ambient noise data recorded in central Alaska to investigate whether seismic noise could be used to quantify relative velocity changes due to seasonal active-layer dynamics. The large velocity changes (>75%) between frozen and thawed soil caused prevalent cycle-skipping which made the method unusable in this setting. We developed an improved MWCS procedure which uses a moving reference to measure daily velocity variationsmore » that are then accumulated to recover the full seasonal change. This approach reduced cycle-skipping and recovered a seasonal trend that corresponded well with the timing of active-layer freeze and thaw. Lastly, this improvement opens the possibility of measuring large velocity changes by using MWCS and permafrost monitoring by using ambient noise.« less

  13. Photos

    Science.gov Websites

    Skip to Content Skip to Search Skip to Utility Navigation Skip to Top Navigation Los Alamos National Laboratory Search Site submit About Mission Business Newsroom Publications Los Alamos National Innovation Research Capabilities Deploying Innovation Technology Opportunities Innovation in New Mexico Los

  14. Newsroom

    Science.gov Websites

    Skip to Content Skip to Search Skip to Utility Navigation Skip to Top Navigation Los Alamos National Laboratory Search Site submit About Mission Business Newsroom Publications Los Alamos National Innovation Research Capabilities Deploying Innovation Technology Opportunities Innovation in New Mexico Los

  15. Anticipating syntax during reading: Evidence from the boundary change paradigm.

    PubMed

    Brothers, Trevor; Traxler, Matthew J

    2016-12-01

    Previous evidence suggests that grammatical constraints have a rapid influence during language comprehension, particularly at the level of word categories (noun, verb, preposition). These findings are in conflict with a recent study from Angele, Laishley, Rayner, and Liversedge (2014), in which sentential fit had no early influence on word skipping rates during reading. In the present study, we used a gaze-contingent boundary change paradigm to manipulate the syntactic congruity of an upcoming noun or verb outside of participants' awareness. Across 3 experiments (total N = 148), we observed higher skipping rates for syntactically valid previews (The admiral would not confess . . .), when compared with violation previews (The admiral would not surgeon . . .). Readers were less likely to skip an ungrammatical continuation, even when that word was repeated within the same sentence (The admiral would not admiral . . .), suggesting that word-class constraints can take precedence over lexical repetition effects. To our knowledge, these results provide the first evidence for an influence of syntactic context during parafoveal word recognition. On the basis of the early time-course of this effect, we argue that readers can use grammatical constraints to generate syntactic expectations for upcoming words. (PsycINFO Database Record (c) 2016 APA, all rights reserved).

  16. Maternal and best friends' influences on meal-skipping behaviours.

    PubMed

    Pearson, Natalie; Williams, Lauren; Crawford, David; Ball, Kylie

    2012-09-01

    Skipping meals is particularly common during adolescence and can have a detrimental effect on multiple aspects of adolescent health. Understanding the correlates of meal-skipping behaviours is important for the design of nutrition interventions. The present study examined maternal and best friends' influences on adolescent meal-skipping behaviours. Frequency of skipping breakfast, lunch and dinner was assessed using a Web-based survey completed by 3001 adolescent boys and girls from years 7 and 9 of secondary schools in Victoria, Australia. Perceived best friend and maternal meal skipping, modelling of healthy eating (eating healthy food, limiting junk food, eating fruit and vegetables) and weight watching were assessed. Best friend and maternal factors were differentially associated with meal-skipping behaviours. For example, boys and girls who perceived that their best friend often skipped meals were more likely to skip lunch (OR = 2·01, 95 % CI 1·33, 3·04 and OR = 1·93, 95 % CI 1·41, 2·65; P < 0·001). Boys and girls who perceived that their mother often skipped meals were more likely to skip breakfast (OR = 1·48, 95 % CI 1·01, 2·15; P < 0·05 and OR = 1·93, 95 % CI 1·42, 2·59; P < 0·001) and lunch (OR = 2·05, 95 % CI 1·35, 3·12 and OR = 2·02, 95 % CI 1·43, 2·86; P < 0·001). Educating adolescents on how to assess and interpret unhealthy eating behaviours that they observe from significant others may be one nutrition promotion strategy to reduce meal-skipping behaviour. The involvement of mothers may be particularly important in such efforts. Encouraging a peer subculture that promotes regular consumption of meals and educates adolescents on the detrimental impact of meal-skipping behaviour on health may also offer a promising nutrition promotion strategy.

  17. Stability in skipping gaits

    NASA Astrophysics Data System (ADS)

    Andrada, Emanuel; Müller, Roy; Blickhan, Reinhard

    2016-11-01

    As an alternative to walking and running, humans are able to skip. However, adult humans avoid it. This fact seems to be related to the higher energetic costs associated with skipping. Still, children, some birds, lemurs and lizards use skipping gaits during daily locomotion. We combined experimental data on humans with numerical simulations to test whether stability and robustness motivate this choice. Parameters for modelling were obtained from 10 male subjects. They locomoted using unilateral skipping along a 12 m runway. We used a bipedal spring loaded inverted pendulum to model and to describe the dynamics of skipping. The subjects displayed higher peak ground reaction forces and leg stiffness in the first landing leg (trailing leg) compared to the second landing leg (leading leg). In numerical simulations, we found that skipping is stable across an amazing speed range from skipping on the spot to fast running speeds. Higher leg stiffness in the trailing leg permits longer strides at same system energy. However, this strategy is at the same time less robust to sudden drop perturbations than skipping with a stiffer leading leg. A slightly higher stiffness in the leading leg is most robust, but might be costlier.

  18. Processing the in the parafovea: are articles skipped automatically?

    PubMed

    Angele, Bernhard; Rayner, Keith

    2013-03-01

    One of the words that readers of English skip most often is the definite article the. Most accounts of reading assume that in order for a reader to skip a word, it must have received some lexical processing. The definite article is skipped so regularly, however, that the oculomotor system might have learned to skip the letter string t-h-e automatically. We tested whether skipping of articles in English is sensitive to context information or whether it is truly automatic in the sense that any occurrence of the letter string the will trigger a skip. This was done using the gaze-contingent boundary paradigm (Rayner, 1975) to provide readers with false parafoveal previews of the article the. All experimental sentences contained a short target verb, the preview of which could be correct (i.e., identical to the actual subsequent word in the sentence; e.g., ace), a nonword (tda), or an infelicitous article preview (the). Our results indicated that readers tended to skip the infelicitous the previews frequently, suggesting that, in many cases, they seemed to be unable to detect the syntactic anomaly in the preview and based their skipping decision solely on the orthographic properties of the article. However, there was some evidence that readers sometimes detected the anomaly, as they also showed increased skipping of the pretarget word in the the preview condition. (c) 2013 APA, all rights reserved.

  19. CINT - Center for Integrated Nanotechnologies

    Science.gov Websites

    Skip to Content Skip to Search Skip to Utility Navigation Skip to Top Navigation Search Site submit Facilities Discovery Platform Integration Lab User Facilities LUMOS Research Science Thrusts Integration Challenges Accepted User Proposals Data Management Becoming a User Call for Proposals Proposal Guidelines

  20. Breakfast skipping in prepubertal obese children: hormonal, metabolic and cognitive consequences.

    PubMed

    Maffeis, C; Fornari, E; Surano, M G; Comencini, E; Corradi, M; Tommasi, M; Fasan, I; Cortese, S

    2012-03-01

    Skipping breakfast influences cognitive performance. The aim of our study was to investigate the relationship between the variation of hormonal and metabolic postprandial parameters induced by breakfast consumption or fasting and cognitive performance in obese children. Cross-sectional study for repeated measures. Memory and attention assessment tests, hormones and nutrient oxidation were measured before and after consuming breakfast vs fasting in 10 prepubertal obese children. Fasting induced a significant (P<0.05) increase of the Overall Index of the Continuous Performance Test II (a global index of inattention) and the Test of Memory and Learning Word Selective Reminding (a test of verbal memory), whereas no changes were found after breakfast. Fasting was associated with a reduction of insulin and an increase in glucagon, with no changes in glucose. The increase in inattention was associated with a reduction of carbohydrate oxidation (ρ=-0.66, P<0.05). We found no difference in the area under the curve of peptide YY and glucagon-like peptide-1 after breakfast or fasting, whereas Ghrelin was significantly lower. No association between postprandial hormone variation and cognitive performance was found. Attention and visual memory performance in the morning were reduced when the children skipped breakfast. No association was found with hormones or metabolic changes, but we did find an association with a reduction of carbohydrate oxidation. Nevertheless, these preliminary findings need confirmation in larger sample size.

  1. Effects of different modes of exercise on appetite and appetite-regulating hormones.

    PubMed

    Kawano, Hiroshi; Mineta, Mayuko; Asaka, Meiko; Miyashita, Masashi; Numao, Shigeharu; Gando, Yuko; Ando, Takafumi; Sakamoto, Shizuo; Higuchi, Mitsuru

    2013-07-01

    The present study determined the changes in appetite and appetite-regulating gut hormones during and following bouts of both rope skipping exercise (weight-bearing) and bicycle ergometer exercise (non-weight-bearing). After a 12-h fast, 15 young men (mean ± SD, age 24.4 ± 1.7 yrs, maximal oxygen uptake 47.0 ± 6.5 mL/kg/min) participated in three 160 min trials: (1) rope skipping exercise (295 ± 40 kcal, 3 sets × 10 min with 5-min interval, then rested for 120 min); (2) bicycle ergometer exercise (288 ± 36 kcal, 3 sets × 10 min with 5-min interval, then rested for 120 min); (3) control (rested for 160 min). Ratings of perceived hunger and acylated ghrelin were suppressed and total peptide YY (PYY) were increased during and immediately after exercise in both exercise trials, but glucagon liked peptide-1 was not changed. Furthermore, suppressed hunger during rope skipping exercise was greater than that during bicycle ergometer exercise, but there were no differences in acylated ghrelin and total PYY. These results indicate that weight-bearing exercise has a greater exercise-induced appetite suppressive effect compared with non-weight-bearing exercise, and both forms of exercise lowered acylated ghrelin and increased total PYY, but the changes did not differ significantly between exercise modes. Copyright © 2013 Elsevier Ltd. All rights reserved.

  2. Feeling 'too fat' rather than being 'too fat' increases unhealthy eating habits among adolescents - even in boys.

    PubMed

    van Vliet, Jolanda S; Gustafsson, Per A; Nelson, Nina

    2016-01-01

    Adolescence is a period of gender-specific physical changes, during which eating habits develop. To better understand what factors determine unhealthy eating habits such as dieting to lose weight, skipping meals, and consumption of unhealthy foods, we studied how physical measurements and body perception relate to eating habits in boys and girls, before and during adolescence. For this cross-sectional study, we obtained data from both written questionnaires and physical measurements of height, weight, and waist circumference (WC). Dieting to lose weight and skipping breakfast were more common among adolescents than among younger boys and girls (p<0.05). The strongest risk factor for dieting in both boys and girls was perception of overweight, which persisted after adjusting for age and for being overweight (p<0.01). Another independent risk factor for dieting behaviour was overweight, as defined by body mass index (BMI) among boys (p<0.01) and WC among girls (p<0.05). In both boys and girls, skipping breakfast was associated with both a more negative body perception and higher BMI (p<0.05). Skipping breakfast was also associated with age- and gender-specific unhealthy eating habits such as skipping other meals, lower consumption of fruits and vegetables, and higher consumption of sweets and sugary drinks (p<0.05). Body perception among adolescents is an important factor relating to unhealthy eating habits, not only in girls, but even in boys. Focus on body perception and eating breakfast daily is crucial for the development of healthy food consumption behaviours during adolescence and tracking into adulthood.

  3. A protocol of rope skipping exercise for primary school children: A pilot test

    NASA Astrophysics Data System (ADS)

    Radzi, A. N. M.; Rambely, A. S.; Chellapan, K.

    2014-06-01

    This paper aims to investigate the methods and sample used in rope skipping as an exercise approach. A systematic literature review was approached in identifying skipping performance in the related researches. The methods were compared to determine the best methodological approach for the targeted skipping based research measure. A pilot test was performed among seven students below 12 years old. As the outcome of the review, a skipping protocol design has been proposed for 10 years old primary school students. The proposed protocol design is to be submitted to PPUKM Ethical Committee for approval prior to its implementation in investigation memory enhancement in relation to designed skipping activities.

  4. The effect of high- and low-frequency previews and sentential fit on word skipping during reading

    PubMed Central

    Angele, Bernhard; Laishley, Abby; Rayner, Keith; Liversedge, Simon P.

    2014-01-01

    In a previous gaze-contingent boundary experiment, Angele and Rayner (2012) found that readers are likely to skip a word that appears to be the definite article the even when syntactic constraints do not allow for articles to occur in that position. In the present study, we investigated whether the word frequency of the preview of a three-letter target word influences a reader’s decision to fixate or skip that word. We found that the word frequency rather than the felicitousness (syntactic fit) of the preview affected how often the upcoming word was skipped. These results indicate that visual information about the upcoming word trumps information from the sentence context when it comes to making a skipping decision. Skipping parafoveal instances of the therefore may simply be an extreme case of skipping high-frequency words. PMID:24707791

  5. The Relation between Breakfast Skipping and School Performance in Adolescents

    ERIC Educational Resources Information Center

    Boschloo, Annemarie; Ouwehand, Carolijn; Dekker, Sanne; Lee, Nikki; de Groot, Renate; Krabbendam, Lydia; Jolles, Jelle

    2012-01-01

    Breakfast skipping is common in adolescents, but research on the effects of breakfast skipping on school performance is scarce. This current cross-sectional survey study of 605 adolescents aged 11-18 years investigated whether adolescents who habitually skip breakfast have lower end-of-term grades than adolescents who eat breakfast daily.…

  6. Is snack consumption associated with meal skipping in children and adolescents? The CASPIAN-IV study.

    PubMed

    Kelishadi, Roya; Mozafarian, Nafiseh; Qorbani, Mostafa; Motlagh, Mohammad Esmaeil; Safiri, Saeid; Ardalan, Gelayol; Keikhah, Mojtaba; Rezaei, Fatemeh; Heshmat, Ramin

    2017-06-01

    The present inquiry set to assess the relationship between snack consumption and meal skipping in Iranian children and adolescents. Overall, 14,880 students, aged 6-18 years, were selected via multistage cluster sampling method from rural and urban areas of 30 provinces of Iran. A validated questionnaire of food behaviors including questions on snacks consumption and taking/skipping meals was completed. Consuming and skipping meals and their related factors were reported in both crude and adjusted models. Overall, 13,486 students with a mean age of 12.47 ± 3.36 years completed the study (90.6% participation rate). Among them, 32.08, 8.89, and 10.90% skipped breakfast, lunch, and dinner, respectively. Compared to their counterpart groups, the frequency of meal skipping was higher in girls, urban inhabitants, and students in higher school grades (P < 0.05). Snack consumption was associated with an increased odds ratio of meal skipping in many types of snack groups. Meal skipping and snack consumption were frequent among Iranian children and adolescents. Evidence based interventions are proposed to improve the students' eating habits.

  7. MET Exon 14 Skipping Mutations in Lung Adenocarcinoma: Clinicopathologic Implications and Prognostic Values.

    PubMed

    Lee, Geun Dong; Lee, Seung Eun; Oh, Doo-Yi; Yu, Dan-Bi; Jeong, Hae Min; Kim, Jooseok; Hong, Sungyoul; Jung, Hun Soon; Oh, Ensel; Song, Ji-Young; Lee, Mi-Sook; Kim, Mingi; Jung, Kyungsoo; Kim, Jhingook; Shin, Young Kee; Choi, Yoon-La; Kim, Hyeong Ryul

    2017-08-01

    Response to mesenchymal-epithelial transition (MET) inhibitors in NSCLC with mesenchymal-epithelial transition gene (MET) exon 14 skipping (METex14) has fueled molecular screening efforts and the search for optimal therapies. However, further work is needed to refine the clinicopathologic and prognostic implications of METex14 skipping. Among 795 East Asian patients who underwent a surgical procedure for NSCLC, we screened 45 patients with quintuple-negative (EGFR-negative/KRAS-negative/anaplastic lymphoma kinase gene [ALK]-negative/ROS1-negative/ret proto-oncogene [RET]-negative) lung adenocarcinomas by using reverse-transcriptase polymerase chain reaction and found 17 patients (37.8%) with METex14 skipping. We also investigated the effect of small interfering RNA (siRNA) targeting skipping junction in cells with METex14 skipping. The median age of the 17 patients was 73 years. The acinar subtype was predominant (52.9%), followed by the solid subtype (35.3%). MET immunohistochemistry demonstrated 100% sensitivity and 70.4% specificity. Multivariate analyses showed that patients with METex14 skipping had a higher recurrence rate than those with ALK fusion (versus METex14 skipping) (hazard ratio = 0.283, 95% confidence interval: 0.119-0.670) in stage I to IIIA disease; however, the differences in overall survival were not significant after adjustment for pathologic stage (p = 0.669). Meanwhile, siRNA decreased MET-driven signaling pathways in Hs746T cells, and combined treatment with siRNA and crizotinib inhibited cell proliferation in crizotinib-resistant H596 cells. The prevalence of METex14 skipping was quite high in East Asian patients without other driver mutations in lung adenocarcinomas. METex14 skipping was associated with old age, the acinar or solid histologic subtype, and high MET immunohistochemical expression. The prognosis of patients with METex14 skipping was similar to that of patients with major driver mutations. siRNA targeting the junction of METex14 skipping could inhibit MET-driven signaling pathways in cells with METex14 skipping. Copyright © 2017 International Association for the Study of Lung Cancer. Published by Elsevier Inc. All rights reserved.

  8. Double air-fuel ratio sensor system having double-skip function

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Katsuno, T.

    1988-01-26

    A method for controlling the air-fuel ratio in an internal combustion engine is described having a catalyst converter for removing pollutants in the exhaust gas thereof, and upstream-side and downstream-side air-fuel ratio sensors disposed upstream and downstream, respectively, of the catalyst converter for detecting a concentration of a specific component in an exhaust gas, comprising the steps of: comparing the output of the upstream-side air-fuel ratio sensor with a first predetermined value; gradually changing a first air-fuel ratio correction amount in accordance with a result of the comparison of the output of the upstream-side air-fuel ratio sensor with the predeterminedmore » value; shifting the first air-fuel ratio correction amount by a first skip amount during a predetermined time period after the result of the comparison of the upstream-side air-fuel ratio sensor is changed; shifting the first air-fuel ratio correction amount by a second skip amount smaller than the first skip amount after the predetermined time period has passed; comparing the output of the downstream-side air-fuel ratio with a second predetermined value, calculating a second air-fuel ratio correction amount in accordance with the comparison result of the output of the downstream-side air-fuel ratio sensor with the second predetermined value; and adjusting the actual air-fuel ratio in accordance with the first and second air-fuel ratio correction amounts; wherein the gradually-changing step comprises the steps of: gradually decreasing the first air-fuel ratio correction amount when the output of the upstream-side air-fuel sensor is on the rich side with respect to the first predetermined value; and gradually increasing the first air-fuel ratio correction amount when the output of the upstream-side air-fuel sensor is on the lean side with respect to the first predetermined value.« less

  9. Children's Perceptions of Parental Attitude Affecting Breakfast Skipping in Primary Sixth-Grade Students

    ERIC Educational Resources Information Center

    Cheng, Tereza Sy; Tse, Lap Ah; Yu, Ignatius Tak-Sun; Griffiths, Sian

    2008-01-01

    Background: Breakfast skipping is an international public health concern. This study investigated the prevalence of breakfast skipping among primary sixth-grade students in Hong Kong and the impact of students' perceptions of parental attitudes on breakfast skipping. Methods: A total of 426 students aged 10-14 years in 4 local schools participated…

  10. Metabolic and Cardiorespiratory Responses of Young Women to Skipping and Jogging.

    ERIC Educational Resources Information Center

    Allen, T. Earl; And Others

    1987-01-01

    Nine 18- to 29-year-old females were studied while jogging and skipping at treadmill speeds of 4.0, 4.8, and 5.4 miles per hour. Comparison of metabolic demand, musculoskeletal stress, and perceived exertion indicated skipping imposed significantly greater metabolic demands and caused higher heart rates than jogging. Skipping was also rated more…

  11. Reading Skill and Word Skipping: Implications for Visual and Linguistic Accounts of Word Skipping

    ERIC Educational Resources Information Center

    Eskenazi, Michael A.; Folk, Jocelyn R.

    2015-01-01

    We investigated whether high-skill readers skip more words than low-skill readers as a result of parafoveal processing differences based on reading skill. We manipulated foveal load and word length, two variables that strongly influence word skipping, and measured reading skill using the Nelson-Denny Reading Test. We found that reading skill did…

  12. Evidence for skipped spawning in a potamodromous cyprinid, humpback chub (Gila cypha), with implications for demographic parameter estimates

    USGS Publications Warehouse

    Pearson, Kristen Nicole; Kendall, William L.; Winkelman, Dana L.; Persons, William R.

    2015-01-01

    Our findings reveal evidence for skipped spawning in a potamodromous cyprinid, humpback chub (HBC; Gila cypha  ). Using closed robust design mark-recapture models, we found, on average, spawning HBC transition to the skipped spawning state () with a probability of 0.45 (95% CRI (i.e. credible interval): 0.10, 0.80) and skipped spawners remain in the skipped spawning state () with a probability of 0.60 (95% CRI: 0.26, 0.83), yielding an average spawning cycle of every 2.12 years, conditional on survival. As a result, migratory skipped spawners are unavailable for detection during annual sampling events. If availability is unaccounted for, survival and detection probability estimates will be biased. Therefore, we estimated annual adult survival probability (S), while accounting for skipped spawning, and found S remained reasonably stable throughout the study period, with an average of 0.75 ((95% CRI: 0.66, 0.82), process varianceσ2 = 0.005), while skipped spawning probability was highly dynamic (σ2 = 0.306). By improving understanding of HBC spawning strategies, conservation decisions can be based on less biased estimates of survival and a more informed population model structure.

  13. Risk of mental health problems in adolescents skipping meals: The Korean National Health and Nutrition Examination Survey 2010 to 2012.

    PubMed

    Lee, Gyungjoo; Han, Kyungdo; Kim, Hyunju

    Adolescents frequently skip meals, doing so even more than once per day. This is associated with more mental health problems. This study identified mental health problems' associations with skipping meals and the frequency thereof among adolescents. This cross-sectional population-based study used a data set of 1,413 adolescents from the 2010 to 2012 Korean National Health and Nutrition Examination Survey. Hierarchical multivariable logistic regression was conducted to determine the risk of mental health problems, including stress, depressive mood, and suicidal ideation in relation to skipping meals and the frequency thereof per day. Breakfast skipping significantly increased the risks of stress and depressive mood. Stress, depressive mood, and suicidal ideation were significantly prevalent as the daily frequency of skipping meals increased. Specific strategies should be developed at government or school level to decrease the frequency of skipping meals per day, associated with serious mental health problems in adolescents. Copyright © 2017 Elsevier Inc. All rights reserved.

  14. Dispelling the myth of "smart drugs": cannabis and alcohol use problems predict nonmedical use of prescription stimulants for studying.

    PubMed

    Arria, Amelia M; Wilcox, Holly C; Caldeira, Kimberly M; Vincent, Kathryn B; Garnier-Dykstra, Laura M; O'Grady, Kevin E

    2013-03-01

    This study tested the hypothesis that college students' substance use problems would predict increases in skipping classes and declining academic performance, and that nonmedical use of prescription stimulants (NPS) for studying would occur in association with this decline. A cohort of 984 students in the College Life Study at a large public university in the US participated in a longitudinal prospective study. Interviewers assessed NPS; Diagnostic and Statistical Manual of Mental Disorders, Fourth Edition (DSM-IV) cannabis and alcohol use disorders; and frequency of skipping class. Semester grade point average (GPA) was obtained from the university. Control variables were race, sex, family income, high school GPA, and self-reported attention deficit hyperactivity disorder diagnosis. Longitudinal growth curve modeling of four annual data waves estimated the associations among the rates of change of cannabis use disorder, percentage of classes skipped, and semester GPA. The associations between these trajectories and NPS for studying were then evaluated. A second structural model substituted alcohol use disorder for cannabis use disorder. More than one-third (38%) reported NPS for studying at least once by Year 4. Increases in skipping class were associated with both alcohol and cannabis use disorder, which were associated with declining GPA. The hypothesized relationships between these trajectories and NPS for studying were confirmed. These longitudinal findings suggest that escalation of substance use problems during college is related to increases in skipping class and to declining academic performance. NPS for studying is associated with academic difficulties. Although additional research is needed to investigate causal pathways, these results suggest that nonmedical users of prescription stimulants could benefit from a comprehensive drug and alcohol assessment to possibly mitigate future academic declines. Copyright © 2012 Elsevier Ltd. All rights reserved.

  15. Antisense oligonucleotide-induced alternative splicing of the APOB mRNA generates a novel isoform of APOB.

    PubMed

    Khoo, Bernard; Roca, Xavier; Chew, Shern L; Krainer, Adrian R

    2007-01-17

    Apolipoprotein B (APOB) is an integral part of the LDL, VLDL, IDL, Lp(a) and chylomicron lipoprotein particles. The APOB pre-mRNA consists of 29 constitutively-spliced exons. APOB exists as two natural isoforms: the full-length APOB100 isoform, assembled into LDL, VLDL, IDL and Lp(a) and secreted by the liver in humans; and the C-terminally truncated APOB48, assembled into chylomicrons and secreted by the intestine in humans. Down-regulation of APOB100 is a potential therapy to lower circulating LDL and cholesterol levels. We investigated the ability of 2'O-methyl RNA antisense oligonucleotides (ASOs) to induce the skipping of exon 27 in endogenous APOB mRNA in HepG2 cells. These ASOs are directed towards the 5' and 3' splice-sites of exon 27, the branch-point sequence (BPS) of intron 26-27 and several predicted exonic splicing enhancers within exon 27. ASOs targeting either the 5' or 3' splice-site, in combination with the BPS, are the most effective. The splicing of other alternatively spliced genes are not influenced by these ASOs, suggesting that the effects seen are not due to non-specific changes in alternative splicing. The skip 27 mRNA is translated into a truncated isoform, APOB87SKIP27. The induction of APOB87SKIP27 expression in vivo should lead to decreased LDL and cholesterol levels, by analogy to patients with hypobetalipoproteinemia. As intestinal APOB mRNA editing and APOB48 expression rely on sequences within exon 26, exon 27 skipping should not affect APOB48 expression unlike other methods of down-regulating APOB100 expression which also down-regulate APOB48.

  16. Water Surface Impact and Ricochet of Deformable Elastomeric Spheres

    NASA Astrophysics Data System (ADS)

    Hurd, Randy C.

    Soft and deformable silicone rubber spheres ricochet from a water surface when rigid spheres and disks (or skipping stones) cannot. This dissertation investigates why these objects are able to skip so successfully. High speed cameras allow us to see that these unique spheres deform significantly as they impact the water surface, flattening into pancake-like shapes with greater area. Though the water entry behavior of deformable spheres deviates from that of rigid spheres, our research shows that if this deformation is accounted for, their behavior can be predicted from previously established methods. Soft spheres skip more easily because they deform significantly when impacting the water surface. We present a diagram which enables the prediction of a ricochet from sphere impact conditions such as speed and angle. Experiments and mathematical representations of the sphere skipping both show that these deformable spheres skip more readily because deformation momentarily increases sphere area and produces an attack angle with the water which is favorable to skipping. Predictions from our mathematical representation of sphere skipping agree strongly with observations from experiments. Even when a sphere was allowed to skip multiple times in the laboratory, the mathematical predictions show good agreement with measured impact conditions through subsequent skipping events. While studying multiple impact events in an outdoor setting, we discovered a previously unidentified means of skipping, which is unique to deformable spheres. This new skipping occurs when a relatively soft sphere first hits the water at a high speed and low impact angle and the sphere begins to rotate very quickly. This quick rotation causes the sphere to stretch into a shape similar to an American football and maintain this shape while it spins. The sphere is observed to move nearly parallel with the water surface with the tips of this "football" dipping into the water as it rotates and the sides passing just over the surface. This sequence of rapid impact events give the impression that the sphere is walking across the water surface.

  17. Breakfast skipping is associated with cyberbullying and school bullying victimization. A school-based cross-sectional study.

    PubMed

    Sampasa-Kanyinga, Hugues; Roumeliotis, Paul; Farrow, Claire V; Shi, Yuanfeng F

    2014-08-01

    Breakfast skipping is a health concern that has well-known negative consequences physically and psychologically. It is therefore important to understand why children skip breakfast. The purpose of this study was to establish whether the experience of bullying and cyberbullying impacts upon breakfast skipping and to further evaluate whether the inability for youths to cope with bullying victimization affects their mental health (depression), and in turn predicts breakfast skipping. Data were obtained from the Eastern Ontario 2011 Youth Risk Behaviour Survey, a cross-sectional regional school-based survey of middle and high school students (11-20 years old) across the five counties of Eastern Ontario, Canada (N = 3035). Self-reported data about children's experiences of bullying victimization, breakfast eating habits, socio-economical status, depression, and other risk behaviours were analysed. Approximately half of the participants (50.4%) reported not eating breakfast on a regular basis: 26.3% and 24.1% reported often (usually eat breakfast three times or more per week) and frequent (usually eat breakfast twice a week or less) breakfast skipping behaviour, respectively. Victims of both cyberbullying and school bullying presented greater likelihood of often (adjusted relative risk ratio (RR) = 1.55; 95% confidence interval (CI) = 1.17-2.06) and frequent (RR = 1.97; 95% CI = 1.28-3.03) breakfast skipping. Mediation analysis further showed that depression fully mediated the relationship between school bullying victimization and frequent breakfast skipping. Moreover, depression partially mediated the associations between both cyberbullying and school bullying with frequent breakfast skipping. These findings highlight the potential interrelationships between cyberbullying, school bullying and depression in predicting unhealthy breakfast skipping behaviour in children. Copyright © 2014 Elsevier Ltd. All rights reserved.

  18. MET exon 14 skipping defines a unique molecular class of non-small cell lung cancer.

    PubMed

    Zheng, Difan; Wang, Rui; Ye, Ting; Yu, Su; Hu, Haichuan; Shen, Xuxia; Li, Yuan; Ji, Hongbin; Sun, Yihua; Chen, Haiquan

    2016-07-05

    Recurrent MET exon 14 splicing has been revealed in lung cancers and is a promising therapeutic target. Because we have limited knowledge about the natural history of MET mutant tumors, the current study was aiming to determine the clinical and pathological characteristics in non-small cell lung cancers (NSCLC). Twenty-three patients (1.3%) were positive for MET exon 14 skipping. Patients with MET exon 14 skipping displayed unique characteristics: female, non-smokers, earlier pathology stage and older age. MET exon 14 skipping indicated an early event as other drivers in lung cancer, while MET copy number gain was more likely a late event in lung cancer. Overall survival (OS) of patients harboring MET exon 14 skipping was longer than patients with KRAS mutation. Almost four-fifths of the lung tumors with MET exon 14 skipping had EGFR and/or HER2 gene copy number gains. EGFR inhibitor showed moderate antitumor activity in treatment of a patient harboring MET exon 14 skipping. From October 2007 to June 2013, we screened 1770 patients with NSCLC and correlated MET status with clinical pathologic characteristics and mutations in EGFR, KRAS, BRAF, HER2, and ALK. Quantitative Real-Time PCR was used to detect MET gene copy number gain. Immunohistochemistry (IHC) was also performed to screen MET exon 14 skipping. Clinicopathological characteristics and survival information were analyzed. MET exon 14 skipping was detected in 1.3% (23/1770) of the Chinese patients with NSCLC. MET exon 14 skipping defined a new molecular subset of NSCLC with identifiable clinical characteristics. The therapeutic EGFR inhibitors might be an alternative treatment for patients with MET mutant NSCLC.

  19. Rice cyclophilin OsCYP18-2 is translocated to the nucleus by an interaction with SKIP and enhances drought tolerance in rice and Arabidopsis.

    PubMed

    Lee, Sang Sook; Park, Hyun Ji; Yoon, Dae Hwa; Kim, Beom-Gi; Ahn, Jun Cheul; Luan, Sheng; Cho, Hye Sun

    2015-10-01

    Cyclophilin 18-2 (CYP18-2) genes, homologues of human peptidyl-prolyl isomerase-like 1 (PPiL1), are conserved across multicellular organisms and Schizosaccharomyces pombe. Although PPiL1 is known to interact with ski-interacting protein (SKIP), a transcriptional co-regulator and spliceosomal component, there have been no functional analyses of PPiL1 homologues in plants. Rice cyclophilin 18-2 (OsCYP18-2) bound directly to amino acids 56-95 of OsSKIP and its binding was independent of cyclosporin A, a cyclophilin-binding drug. Moreover, OsCYP18-2 exhibited PPIase activity regardless of its interaction with OsSKIP. Therefore, the binding site for OsCYP18-2's interaction with SKIP was distinct from the PPIase active site. OsCYP18-2's interaction with SKIP full-length protein enabled OsCYP18-2's translocation from the cytoplasm into the nucleus and AtSKIP interacted in planta with both AtCYP18-2 and OsCYP18-2. Drought and salt stress induced similar expression of OsCYP18-2 and OsSKIP. Overexpression of OsCYP18-2 in transgenic rice and Arabidopsis thaliana plants enhanced drought tolerance and altered expression and pre-mRNA splicing patterns of stress-related genes in Arabidopsis under drought conditions. Furthermore, OsCYP18-2 caused transcriptional activation with/without OsSKIP in the GAL4 system of yeast; thus the OsSKIP-OsCYP18-2 interaction has an important role in the transcriptional and post-transcriptional regulation of stress-related genes and increases tolerance to drought stress. © 2015 John Wiley & Sons Ltd.

  20. Associations between perceived friends' support of healthy eating and meal skipping in adolescence.

    PubMed

    Rosenrauch, Sharon; Ball, Kylie; Lamb, Karen E

    2017-12-01

    Meal skipping is a relatively common behaviour during adolescence. As peer influence increases during adolescence, friendship groups may play a role in determining eating patterns such as meal skipping. The current study examined cross-sectional and longitudinal associations between perceived friends' support of healthy eating and breakfast and lunch skipping among adolescents. Survey of intrapersonal, social and environmental factors that may influence eating patterns at baseline (2004/05) and follow-up (2006/07). Thirty-seven secondary schools in Victoria, Australia. Sample of 1785 students aged 12-15 years at baseline. Adolescents who reported that their friends sometimes or often ate healthy foods with them were less likely (adjusted OR; 95 % CI) to skip breakfast (sometimes: 0·71; 0·57, 0·90; often: 0·54; 0·38, 0·76) or lunch (sometimes: 0·61; 0·41, 0·89; often: 0·59; 0·37, 0·94) at baseline than those who reported their friends never or rarely displayed this behaviour. Although this variable was associated with lunch skipping at follow-up, there was no evidence of an association with breakfast skipping at follow-up. There was no evidence of an association between perceived encouragement of healthy eating, and an inconsistent relationship between perceived discouragement of junk food consumption, and meal skipping. Friends eating healthy foods together may serve to reduce meal skipping during early adolescence, possibly due to the influence of directly observable behaviour and shared beliefs held by those in the same friendship group. Verbal encouragement or discouragement from friends may be less impactful an influence on meal skipping (than directly observable behaviours) in adolescents.

  1. The combined unhealthy behaviors of breakfast skipping and smoking are associated with the prevalence of diabetes mellitus.

    PubMed

    Nishiyama, Midori; Muto, Takashi; Minakawa, Toshihiro; Shibata, Toshie

    2009-08-01

    Skipping breakfast has been considered a representative unhealthy behavior, but there is little information about the combined effects of breakfast skipping and other unhealthy health habits, especially smoking. First this cross-sectional study investigated unhealthy behaviors among breakfast skippers, and then examined the impact of the combined association of skipping breakfast and smoking on health. A total of 1,200 adults living in one Japanese community were sent questionnaires to elicit data on age, gender, breakfast-eating frequency, and other lifestyle habits. A total 603 of people returned their questionnaires (response rate: 50.3%), and 493 (230 men and 263 women) questionnaires were considered appropriate for analysis. Smoking rate in men (mean age, 53.7 years) and women (mean age, 50.4 years) was 41.3%, and 9.5%, respectively. Skipping breakfast was more prevalent in people under age 50 years (p < 0.001), and was related to other unhealthy behaviors. Binary logistic regression identified current smoking as the most significant factor related to breakfast skipping (3.10, 95%CI 1.50-6.39). Other factors included, age younger than 50 years (3.04, 95%CI 1.31-7.06) and poor sleeping quality (2.06, 95%CI 1.00-4.25). After examining the combined impact of skipping breakfast and smoking, the highest odds ratio for a diagnosis of diabetes mellitus was found among those who smoked and skipped breakfast (4.68, 95% CI: 1.46-15.05). Moreover, skipping breakfast among non-smokers showed a high association with perceived stress (2.83, 95% CI: 1.05-7.61). In conclusion, the combined unhealthy behaviors of skipping breakfast and smoking are associated with the prevalence of diabetes mellitus.

  2. The Estate Tax Enigma.

    ERIC Educational Resources Information Center

    Harrison, Ellen K.

    2001-01-01

    Discusses the implications for planned giving of the new Economic Growth and Tax Relief Reconciliation Act of 2001. Describes changes in income, estate, generation-skipping, and gift tax regulations and their consequences for estate planning. (EV)

  3. Word skipping: effects of word length, predictability, spelling and reading skill.

    PubMed

    Slattery, Timothy J; Yates, Mark

    2017-08-31

    Readers eyes often skip over words as they read. Skipping rates are largely determined by word length; short words are skipped more than long words. However, the predictability of a word in context also impacts skipping rates. Rayner, Slattery, Drieghe and Liversedge (2011) reported an effect of predictability on word skipping for even long words (10-13 characters) that extend beyond the word identification span. Recent research suggests that better readers and spellers have an enhanced perceptual span (Veldre & Andrews, 2014). We explored whether reading and spelling skill interact with word length and predictability to impact word skipping rates in a large sample (N=92) of average and poor adult readers. Participants read the items from Rayner et al. (2011) while their eye movements were recorded. Spelling skill (zSpell) was assessed using the dictation and recognition tasks developed by Sally Andrews and colleagues. Reading skill (zRead) was assessed from reading speed (words per minute) and accuracy of three 120 word passages each with 10 comprehension questions. We fit linear mixed models to the target gaze duration data and generalized linear mixed models to the target word skipping data. Target word gaze durations were significantly predicted by zRead while, the skipping likelihoods were significantly predicted by zSpell. Additionally, for gaze durations, zRead significantly interacted with word predictability as better readers relied less on context to support word processing. These effects are discussed in relation to the lexical quality hypothesis and eye movement models of reading.

  4. Academic performance, educational aspiration and birth outcomes among adolescent mothers: a national longitudinal study

    PubMed Central

    2014-01-01

    Background Maternal educational attainment has been associated with birth outcomes among adult mothers. However, limited research explores whether academic performance and educational aspiration influence birth outcomes among adolescent mothers. Methods Data from Waves I and IV of the National Longitudinal Study of Adolescent Health (Add Health) were used. Adolescent girls whose first pregnancy occurred after Wave I, during their adolescence, and ended with a singleton live birth were included. Adolescents’ grade point average (GPA), experience of ever skipping a grade and ever repeating a grade, and their aspiration to attend college were examined as predictors of birth outcomes (birthweight and gestational age; n = 763). Univariate statistics, bivariate analyses and multivariable models were run stratified on race using survey procedures. Results Among Black adolescents, those who ever skipped a grade had higher offspring’s birthweight. Among non-Black adolescents, ever skipping a grade and higher educational aspiration were associated with higher offspring’s birthweight; ever skipping a grade was also associated with higher gestational age. GPA was not statistically significantly associated with either birth outcome. The addition of smoking during pregnancy and prenatal care visit into the multivariable models did not change these associations. Conclusions Some indicators of higher academic performance and aspiration are associated with better birth outcomes among adolescents. Investing in improving educational opportunities may improve birth outcomes among teenage mothers. PMID:24422664

  5. Efficient exon skipping of SGCG mutations mediated by phosphorodiamidate morpholino oligomers.

    PubMed

    Wyatt, Eugene J; Demonbreun, Alexis R; Kim, Ellis Y; Puckelwartz, Megan J; Vo, Andy H; Dellefave-Castillo, Lisa M; Gao, Quan Q; Vainzof, Mariz; Pavanello, Rita C M; Zatz, Mayana; McNally, Elizabeth M

    2018-05-03

    Exon skipping uses chemically modified antisense oligonucleotides to modulate RNA splicing. Therapeutically, exon skipping can bypass mutations and restore reading frame disruption by generating internally truncated, functional proteins to rescue the loss of native gene expression. Limb-girdle muscular dystrophy type 2C is caused by autosomal recessive mutations in the SGCG gene, which encodes the dystrophin-associated protein γ-sarcoglycan. The most common SGCG mutations disrupt the transcript reading frame abrogating γ-sarcoglycan protein expression. In order to treat most SGCG gene mutations, it is necessary to skip 4 exons in order to restore the SGCG transcript reading frame, creating an internally truncated protein referred to as Mini-Gamma. Using direct reprogramming of human cells with MyoD, myogenic cells were tested with 2 antisense oligonucleotide chemistries, 2'-O-methyl phosphorothioate oligonucleotides and vivo-phosphorodiamidate morpholino oligomers, to induce exon skipping. Treatment with vivo-phosphorodiamidate morpholino oligomers demonstrated efficient skipping of the targeted exons and corrected the mutant reading frame, resulting in the expression of a functional Mini-Gamma protein. Antisense-induced exon skipping of SGCG occurred in normal cells and those with multiple distinct SGCG mutations, including the most common 521ΔT mutation. These findings demonstrate a multiexon-skipping strategy applicable to the majority of limb-girdle muscular dystrophy 2C patients.

  6. Naturally occurring deletions of hunchback binding sites in the even-skipped stripe 3+7 enhancer.

    PubMed

    Palsson, Arnar; Wesolowska, Natalia; Reynisdóttir, Sigrún; Ludwig, Michael Z; Kreitman, Martin

    2014-01-01

    Changes in regulatory DNA contribute to phenotypic differences within and between taxa. Comparative studies show that many transcription factor binding sites (TFBS) are conserved between species whereas functional studies reveal that some mutations segregating within species alter TFBS function. Consistently, in this analysis of 13 regulatory elements in Drosophila melanogaster populations, single base and insertion/deletion polymorphism are rare in characterized regulatory elements. Experimentally defined TFBS are nearly devoid of segregating mutations and, as has been shown before, are quite conserved. For instance 8 of 11 Hunchback binding sites in the stripe 3+7 enhancer of even-skipped are conserved between D. melanogaster and Drosophila virilis. Oddly, we found a 72 bp deletion that removes one of these binding sites (Hb8), segregating within D. melanogaster. Furthermore, a 45 bp deletion polymorphism in the spacer between the stripe 3+7 and stripe 2 enhancers, removes another predicted Hunchback site. These two deletions are separated by ∼250 bp, sit on distinct haplotypes, and segregate at appreciable frequency. The Hb8Δ is at 5 to 35% frequency in the new world, but also shows cosmopolitan distribution. There is depletion of sequence variation on the Hb8Δ-carrying haplotype. Quantitative genetic tests indicate that Hb8Δ affects developmental time, but not viability of offspring. The Eve expression pattern differs between inbred lines, but the stripe 3 and 7 boundaries seem unaffected by Hb8Δ. The data reveal segregating variation in regulatory elements, which may reflect evolutionary turnover of characterized TFBS due to drift or co-evolution.

  7. Self-Harm

    MedlinePlus

    ... value. Skipping classes to change bandages or avoiding social occasions to prevent people from seeing your scars is a sign that your habit is negatively affecting work and relationships. Why People Self-harm Self-harm is not a mental illness, but ...

  8. [Euthanasia and advanced dementia].

    PubMed

    Keizer, B

    2017-01-01

    Somewhere around 1975 there was a shift in our perception of suffering that is soon followed by death: it seemed a good idea to skip this unhappy stage of life. A complicated national debate arose, and continues to this day, about whether a life may be prematurely terminated in cases of insoluble misery. Legislation came into effect 2002, after 30 years of deliberation, and the rest of the world looked on in horror. England, in particular, liked to point out that the Dutch were on a very slippery slope.

  9. Skip residues modulate the structural properties of the myosin rod and guide thick filament assembly

    DOE PAGES

    Taylor, Keenan C.; Buvoli, Massimo; Korkmaz, Elif Nihal; ...

    2015-07-06

    The rod of sarcomeric myosins directs thick filament assembly and is characterized by the insertion of four skip residues that introduce discontinuities in the coiled-coil heptad repeats. We report in this paper that the regions surrounding the first three skip residues share high structural similarity despite their low sequence homology. Near each of these skip residues, the coiled-coil transitions to a nonclose-packed structure inducing local relaxation of the superhelical pitch. Moreover, molecular dynamics suggest that these distorted regions can assume different conformationally stable states. In contrast, the last skip residue region constitutes a true molecular hinge, providing C-terminal rod flexibility.more » Assembly of myosin with mutated skip residues in cardiomyocytes shows that the functional importance of each skip residue is associated with rod position and reveals the unique role of the molecular hinge in promoting myosin antiparallel packing. By defining the biophysical properties of the rod, the structures and molecular dynamic calculations presented here provide insight into thick filament formation, and highlight the structural differences occurring between the coiled-coils of myosin and the stereotypical tropomyosin. Finally, in addition to extending our knowledge into the conformational and biological properties of coiled-coil discontinuities, the molecular characterization of the four myosin skip residues also provides a guide to modeling the effects of rod mutations causing cardiac and skeletal myopathies.« less

  10. Mathematical modeling for optimizing skip-stop rail transit operation strategy using genetic algorithm.

    DOT National Transportation Integrated Search

    2012-03-01

    "With skip-stop rail transit operation, transit agencies can reduce their operating costs and fleet size, : and passengers can experience reduced in-transit travel times without extra track and technological : improvement. However, since skip-stop op...

  11. Helping Children Exposed to Domestic Violence

    MedlinePlus

    ... in adolescents include: Drug or alcohol abuse Skipping school Changes in peer groups New rebellious or oppositional behavior Declining grades Social withdrawal Depression or anxiety Loss of interest in school, friends or other things they enjoyed in the ...

  12. Characterization of porcine SKIP gene in skeletal muscle development: polymorphisms, association analysis, expression and regulation of cell growth in C2C12 cells.

    PubMed

    Xiong, Qi; Chai, Jin; Deng, Changyan; Jiang, Siwen; Liu, Yang; Huang, Tao; Suo, Xiaojun; Zhang, Nian; Li, Xiaofeng; Yang, Qianping; Chen, Mingxin; Zheng, Rong

    2012-12-01

    Skeletal muscle and kidney-enriched inositol phosphatase (SKIP) was identified as a 5'-inositol phosphatase that hydrolyzes phosphatidylinositol (3,4,5)-triphosphate (PI(3,4,5)P3) to PI(3,4)P2 and negatively regulates insulin-induced phosphatidylinositol 3-kinase signaling in skeletal muscle. In this study, two new single nucleotide polymorphisms (SNPs) in porcine SKIP introns 1 and 6 were detected. The C1092T locus in intron 1 showed significant associations with some meat traits, whereas the A17G locus in intron 6 showed significant associations with some carcass traits. Expression analysis showed that porcine SKIP is upregulated at d 65 of gestation and Meishan fetuses have higher and prolonged expression of SKIP compared to Large White at d 100 of gestation. Ectopic expression of porcine SKIP decreased insulin-induced cell proliferation and promoted serum starvation-induced cell cycle arrest in G0/G1 phase in C2C12. Our results suggest that SKIP plays a negative regulatory role in skeletal muscle development partly by preventing cell proliferation. Crown Copyright © 2012. Published by Elsevier Ltd. All rights reserved.

  13. Gait biomechanics of skipping are substantially different than those of running.

    PubMed

    McDonnell, Jessica; Willson, John D; Zwetsloot, Kevin A; Houmard, Joseph; DeVita, Paul

    2017-11-07

    The inherit injury risk associated with high-impact exercises calls for alternative ways to achieve the benefits of aerobic exercise while minimizing excessive stresses to body tissues. Skipping presents such an alternative, incorporating double support, flight, and single support phases. We used ground reaction forces (GRFs), lower extremity joint torques and powers to compare skipping and running in 20 healthy adults. The two consecutive skipping steps on each limb differed significantly from each other, and from running. Running had the longest step length, the highest peak vertical GRF, peak knee extensor torque, and peak knee negative and positive power and negative and positive work. Skipping had the greater cadence, peak horizontal GRF, peak hip and ankle extensor torques, peak ankle negative power and work, and peak ankle positive power. The second vs first skipping step had the shorter step length, higher cadence, peak horizontal GRF, peak ankle extensor torque, and peak ankle negative power, negative work, and positive power and positive work. The first skipping step utilized predominately net negative joint work (eccentric muscle action) while the second utilized predominately net positive joint work (concentric muscle action). The skipping data further highlight the persistence of net negative work performed at the knee and net positive work performed at the ankle across locomotion gaits. Evidence of step segregation was seen in distribution of the braking and propelling impulses and net work produced across the hip, knee, and ankle joints. Skipping was substantially different than running and was temporally and spatially asymmetrical with successive foot falls partitioned into a dominant function, either braking or propelling whereas running had a single, repeated step in which both braking and propelling actions were performed equally. Copyright © 2017 Elsevier Ltd. All rights reserved.

  14. The relationship between breakfast skipping, chronotype, and glycemic control in type 2 diabetes.

    PubMed

    Reutrakul, Sirimon; Hood, Megan M; Crowley, Stephanie J; Morgan, Mary K; Teodori, Marsha; Knutson, Kristen L

    2014-02-01

    Breakfast skipping is associated with obesity and an increased risk of type 2 diabetes. Later chronotypes, individuals who have a preference for later bed and wake times, often skip breakfast. The aim of the study was to explore the relationships among breakfast skipping, chronotype, and glycemic control in type 2 diabetes patients. We collected sleep timing and 24-h dietary recall from 194 non-shift-working type 2 diabetes patients who were being followed in outpatient clinics. Mid-sleep time on free days (MSF) was used as an indicator of chronotype. Hemoglobin A1C (HbA1C) values were obtained from medical records. Hierarchical linear regression analyses controlling for demographic, sleep, and dietary variables were computed to determine whether breakfast skipping was associated with HbA1C. Additional regression analyses were performed to test if this association was mediated by chronotype. There were 22 participants (11.3%) who self-reported missing breakfast. Breakfast skippers had significantly higher HbA1C levels, higher body mass indices (BMI), and later MSF than breakfast eaters. Breakfast skipping was significantly associated with higher HbA1C values (B = 0.108, p = 0.01), even after adjusting for age, sex, race, BMI, number of diabetes complications, insulin use, depressive symptoms, perceived sleep debt, and percentage of daily caloric intake at dinner. The relationship between breakfast skipping and HbA1C was partially mediated by chronotype. In summary, breakfast skipping is associated with a later chronotype. Later chronotype and breakfast skipping both contribute to poorer glycemic control, as indicated by higher HbA1C levels. Future studies are needed to confirm these findings and determine whether behavioral interventions targeting breakfast eating or sleep timing may improve glycemic control in patients with type 2 diabetes.

  15. 78 FR 42819 - Proposed Collection; Comment Request for Form 709

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-07-17

    ... 709, United States Gift (and Generation-Skipping Transfer) Tax Return. DATES: Written comments should....gov . SUPPLEMENTARY INFORMATION: Title: United States Gift (and Generation-Skipping Transfer) Tax... transfers subject to the gift and generation-skipping transfer taxes and to compute these taxes. The IRS...

  16. 75 FR 38179 - Proposed Collection; Comment Request for Form 709

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-07-01

    ... 709, United States Gift (and Generation-Skipping Transfer) Tax Return. DATES: Written comments should....gov . SUPPLEMENTARY INFORMATION: Title: United States Gift (and Generation-Skipping Transfer) Tax... transfers subject to the gift and generation-skipping transfer taxes and to compute these taxes. The IRS...

  17. 78 FR 46688 - Proposed Collection; Comment Request for Form 706

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-08-01

    ... 706, United States Estate (and Generation-Skipping Transfer) Tax Return. DATES: Written comments... INFORMATION: Title: United States Estate (and Generation-Skipping Transfer) Tax Return. OMB Number: 1545-0015... imposed by Internal Revenue Code section 2001 and the Federal generation-skipping transfer (GST) tax...

  18. Eye movements and word skipping during reading: Effects of word length and predictability

    PubMed Central

    Rayner, Keith; Slattery, Timothy J.; Drieghe, Denis; Liversedge, Simon P.

    2012-01-01

    The extent to which target words were predictable from prior context was varied: half of the target words were predictable and the other half were unpredictable. In addition, the length of the target word varied: the target words were short (4–6 letters), medium (7–9 letters), or long (10–12 letters). Length and predictability both yielded strong effects on the probability of skipping the target words and on the amount of time readers fixated the target words (when they were not skipped). However, there was no interaction in any of the measures examined for either skipping or fixation time. The results demonstrate that word predictability (due to contextual constraint) and word length have strong and independent influences on word skipping and fixation durations. Furthermore, since the long words extended beyond the word identification span, the data indicate that skipping can occur on the basis of partial information in relation to word identity. PMID:21463086

  19. The Association between Breakfast Skipping and Body Weight, Nutrient Intake, and Metabolic Measures among Participants with Metabolic Syndrome

    PubMed Central

    Zhang, Lijuan; Cordeiro, Lorraine S.; Liu, Jinghua; Ma, Yunsheng

    2017-01-01

    The effect of skipping breakfast on health, especially in adults, remains a controversial topic. A secondary data analysis was conducted to examine associations between breakfast eating patterns and weight loss, nutrient intake, and metabolic parameters among participants with metabolic syndrome (MetS) (n = 240). Three randomly selected 24-h dietary recalls were collected from each participant at baseline and at the one-year visit. Skipped breakfast was seen in 32.9% at baseline and in 17.4% at the one-year visit, respectively. At baseline, after adjustment for demographics and physical activity, participants who ate breakfast had a higher thiamin, niacin, and folate intake than did breakfast skippers (p < 0.05); other selected parameters including body weight, dietary quality scores, nutrient intake, and metabolic parameters showed no significant differences between the two groups (p ≥ 0.05). From baseline to one year, after adjustment for covariates, mean fat intake increased by 2.7% (95% confidence intervals (CI): −1.0, 6.5%) of total energy in breakfast skippers in comparison to the 1.2% decrease observed in breakfast eaters (95% CI: −3.4, 1.1%) (p = 0.02). Mean changes in other selected parameters showed no significant differences between breakfast skippers and eaters (p > 0.05). This study did not support the hypothesis that skipping breakfast has impact on body weight, nutrient intakes, and selected metabolic measures in participants with MetS. PMID:28420112

  20. Quiz: How Much do You Know about Taking Good Care of Yourself?

    MedlinePlus

    ... Illness & disability Drugs, alcohol & smoking Your feelings Relationships Bullying Safety Your future Environmental health Skip section navigation (navigation may have changed) Section navigation Illness & disability: Types of illnesses and disabilities Dealing with medical issues ...

  1. TU-AB-BRA-09: A Novel Method of Generating Ultrafast Volumetric Cine MRI (VC-MRI) Using Prior 4D-MRI and On-Board Phase-Skipped Encoding Acquisition for Radiotherapy Target Localization

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wang, C; Yin, F; Harris, W

    Purpose: To develop a technique generating ultrafast on-board VC-MRI using prior 4D-MRI and on-board phase-skipped encoding k-space acquisition for real-time 3D target tracking of liver and lung radiotherapy. Methods: The end-of-expiration (EOE) volume in 4D-MRI acquired during the simulation was selected as the prior volume. 3 major respiratory deformation patterns were extracted through the principal component analysis of the deformation field maps (DFMs) generated between EOE and all other phases. The on-board VC-MRI at each instant was considered as a deformation of the prior volume, and the deformation was modeled as a linear combination of the extracted 3 major deformationmore » patterns. To solve the weighting coefficients of the 3 major patterns, a 2D slice was extracted from VC-MRI volume to match with the 2D on-board sampling data, which was generated by 8-fold phase skipped-encoding k-space acquisition (i.e., sample 1 phase-encoding line out of every 8 lines) to achieve an ultrafast 16–24 volumes/s frame rate. The method was evaluated using XCAT digital phantom to simulate lung cancer patients. The 3D volume of end-ofinhalation (EOI) phase at the treatment day was used as ground-truth onboard VC-MRI with simulated changes in 1) breathing amplitude and 2) breathing amplitude/phase change from the simulation day. A liver cancer patient case was evaluated for in-vivo feasibility demonstration. Results: The comparison between ground truth and estimated on-board VC-MRI shows good agreements. In XCAT study with changed breathing amplitude, the volume-percent-difference(VPD) between ground-truth and estimated tumor volumes at EOI was 6.28% and the Center-of-Mass-Shift(COMS) was 0.82mm; with changed breathing amplitude and phase, the VPD was 8.50% and the COMS was 0.54mm. The study of liver patient case also demonstrated a promising in vivo feasibility of the proposed method Conclusion: Preliminary results suggest the feasibility to estimate ultrafast VC-MRI for on-board target localization with phase skipped-encoding k-space acquisition. Research grant from NIH R01-184173.« less

  2. 26 CFR 26.2612-1 - Definitions.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... GENERATION-SKIPPING TRANSFER TAX REGULATIONS UNDER THE TAX REFORM ACT OF 1986 § 26.2612-1 Definitions. (a... person. Only one direct skip occurs when a single transfer of property skips two or more generations. See... termination is a taxable termination with respect to the distributed property. (3) Simultaneous terminations...

  3. 26 CFR 26.2612-1 - Definitions.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... GENERATION-SKIPPING TRANSFER TAX REGULATIONS UNDER THE TAX REFORM ACT OF 1986 § 26.2612-1 Definitions. (a... person. Only one direct skip occurs when a single transfer of property skips two or more generations. See... termination is a taxable termination with respect to the distributed property. (3) Simultaneous terminations...

  4. The Timing of Grade Skipping

    ERIC Educational Resources Information Center

    Kuo, Yi-Lung; Lohman, David F.

    2011-01-01

    The purposes of this study were to investigate the following: (a) the impact of sex, ethnicity, socioeconomic status, and family income on the likelihood of whole-grade skipping between kindergarten and Grade 7 and (b) the effects of grade skipping during elementary or middle school on students' academic achievement in high school. The authors…

  5. 1999 Survey of Active Duty Personnel: Administration, Datasets, and Codebook. Appendix G: Frequency and Percentage Distributions for Variables in the Survey Analysis Files.

    DTIC Science & Technology

    2000-12-01

    A SKIP FLAG INDICATING THE RESULT OF CHECKING THE RESPONSE ON THE PARENT (SCREENING) ITEM AGAINST THE RESPONSE(S) ON THE ITEMS WITHIN THE SKIP...RESPONSE ON THE PARENT (SCREENING) ITEM AGAINST THE RESPONSE(S) ON THE ITEMS WITHIN THE SKIP PATTERN. SEE TABLE D-5, NOTE 2, IN APPENDIX D. G-52...RESULT OF CHECKING THE RESPONSE ON THE PARENT (SCREENING) ITEM AGAINST THE RESPONSE(S) ON THE ITEMS WITHIN THE SKIP PATTERN. SEE TABLE D-5

  6. Reengineering a transmembrane protein to treat muscular dystrophy using exon skipping.

    PubMed

    Gao, Quan Q; Wyatt, Eugene; Goldstein, Jeff A; LoPresti, Peter; Castillo, Lisa M; Gazda, Alec; Petrossian, Natalie; Earley, Judy U; Hadhazy, Michele; Barefield, David Y; Demonbreun, Alexis R; Bönnemann, Carsten; Wolf, Matthew; McNally, Elizabeth M

    2015-11-02

    Exon skipping uses antisense oligonucleotides as a treatment for genetic diseases. The antisense oligonucleotides used for exon skipping are designed to bypass premature stop codons in the target RNA and restore reading frame disruption. Exon skipping is currently being tested in humans with dystrophin gene mutations who have Duchenne muscular dystrophy. For Duchenne muscular dystrophy, the rationale for exon skipping derived from observations in patients with naturally occurring dystrophin gene mutations that generated internally deleted but partially functional dystrophin proteins. We have now expanded the potential for exon skipping by testing whether an internal, in-frame truncation of a transmembrane protein γ-sarcoglycan is functional. We generated an internally truncated γ-sarcoglycan protein that we have termed Mini-Gamma by deleting a large portion of the extracellular domain. Mini-Gamma provided functional and pathological benefits to correct the loss of γ-sarcoglycan in a Drosophila model, in heterologous cell expression studies, and in transgenic mice lacking γ-sarcoglycan. We generated a cellular model of human muscle disease and showed that multiple exon skipping could be induced in RNA that encodes a mutant human γ-sarcoglycan. Since Mini-Gamma represents removal of 4 of the 7 coding exons in γ-sarcoglycan, this approach provides a viable strategy to treat the majority of patients with γ-sarcoglycan gene mutations.

  7. Reengineering a transmembrane protein to treat muscular dystrophy using exon skipping

    PubMed Central

    Gao, Quan Q.; Wyatt, Eugene; Goldstein, Jeff A.; LoPresti, Peter; Castillo, Lisa M.; Gazda, Alec; Petrossian, Natalie; Earley, Judy U.; Hadhazy, Michele; Barefield, David Y.; Demonbreun, Alexis R.; Bönnemann, Carsten; Wolf, Matthew; McNally, Elizabeth M.

    2015-01-01

    Exon skipping uses antisense oligonucleotides as a treatment for genetic diseases. The antisense oligonucleotides used for exon skipping are designed to bypass premature stop codons in the target RNA and restore reading frame disruption. Exon skipping is currently being tested in humans with dystrophin gene mutations who have Duchenne muscular dystrophy. For Duchenne muscular dystrophy, the rationale for exon skipping derived from observations in patients with naturally occurring dystrophin gene mutations that generated internally deleted but partially functional dystrophin proteins. We have now expanded the potential for exon skipping by testing whether an internal, in-frame truncation of a transmembrane protein γ-sarcoglycan is functional. We generated an internally truncated γ-sarcoglycan protein that we have termed Mini-Gamma by deleting a large portion of the extracellular domain. Mini-Gamma provided functional and pathological benefits to correct the loss of γ-sarcoglycan in a Drosophila model, in heterologous cell expression studies, and in transgenic mice lacking γ-sarcoglycan. We generated a cellular model of human muscle disease and showed that multiple exon skipping could be induced in RNA that encodes a mutant human γ-sarcoglycan. Since Mini-Gamma represents removal of 4 of the 7 coding exons in γ-sarcoglycan, this approach provides a viable strategy to treat the majority of patients with γ-sarcoglycan gene mutations. PMID:26457733

  8. 75 FR 11213 - Self-Regulatory Organizations; The NASDAQ Stock Market LLC; Notice of Filing and Immediate...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-03-10

    ... of the Proposed Rule Change NASDAQ proposes to modify pricing for NASDAQ members using the NASDAQ... Statutory Basis for, the Proposed Rule Change 1. Purpose NASDAQ is making minor modifications to its pricing... the fee for members using the STGY, SCAN, SKNY, SKIP, or DOTI routing strategies.\\3\\ For orders using...

  9. 26 CFR 26.2632-1 - Allocation of GST exemption.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... AND GIFT TAXES GENERATION-SKIPPING TRANSFER TAX REGULATIONS UNDER THE TAX REFORM ACT OF 1986 § 26.2632... United States Gift (and Generation-Skipping Transfer) Tax Return (Form 709) the transfer and the extent... generation-skipping potential, the initial allocation under paragraph (b)(4)(ii)(A)(1)(i) of this section is...

  10. 26 CFR 26.2632-1 - Allocation of GST exemption.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... AND GIFT TAXES GENERATION-SKIPPING TRANSFER TAX REGULATIONS UNDER THE TAX REFORM ACT OF 1986 § 26.2632... United States Gift (and Generation-Skipping Transfer) Tax Return (Form 709) the transfer and the extent... generation-skipping potential, the initial allocation under paragraph (b)(4)(ii)(A)(1)(i) of this section is...

  11. 26 CFR 26.2632-1 - Allocation of GST exemption.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... AND GIFT TAXES GENERATION-SKIPPING TRANSFER TAX REGULATIONS UNDER THE TAX REFORM ACT OF 1986 § 26.2632... United States Gift (and Generation-Skipping Transfer) Tax Return (Form 709) the transfer and the extent... generation-skipping potential, the initial allocation under paragraph (b)(4)(ii)(A)(1)(i) of this section is...

  12. 26 CFR 26.2632-1 - Allocation of GST exemption.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... AND GIFT TAXES GENERATION-SKIPPING TRANSFER TAX REGULATIONS UNDER THE TAX REFORM ACT OF 1986 § 26.2632... United States Gift (and Generation-Skipping Transfer) Tax Return (Form 709) the transfer and the extent... generation-skipping potential, the initial allocation under paragraph (b)(4)(ii)(A)(1)(i) of this section is...

  13. 26 CFR 26.2653-1 - Taxation of multiple skips.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 26 Internal Revenue 14 2010-04-01 2010-04-01 false Taxation of multiple skips. 26.2653-1 Section 26.2653-1 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) ESTATE...-1 Taxation of multiple skips. (a) General rule. If property is held in trust immediately after a GST...

  14. 26 CFR 26.6081-1 - Automatic extension of time for filing generation-skipping transfer tax returns.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 26 Internal Revenue 14 2011-04-01 2010-04-01 true Automatic extension of time for filing generation-skipping transfer tax returns. 26.6081-1 Section 26.6081-1 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) ESTATE AND GIFT TAXES GENERATION-SKIPPING TRANSFER TAX...

  15. 26 CFR 26.6081-1 - Automatic extension of time for filing generation-skipping transfer tax returns.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 26 Internal Revenue 14 2010-04-01 2010-04-01 false Automatic extension of time for filing generation-skipping transfer tax returns. 26.6081-1 Section 26.6081-1 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) ESTATE AND GIFT TAXES GENERATION-SKIPPING TRANSFER TAX...

  16. 26 CFR 26.6081-1 - Automatic extension of time for filing generation-skipping transfer tax returns.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 26 Internal Revenue 14 2013-04-01 2013-04-01 false Automatic extension of time for filing generation-skipping transfer tax returns. 26.6081-1 Section 26.6081-1 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) ESTATE AND GIFT TAXES GENERATION-SKIPPING TRANSFER TAX...

  17. 26 CFR 26.6081-1 - Automatic extension of time for filing generation-skipping transfer tax returns.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 26 Internal Revenue 14 2014-04-01 2013-04-01 true Automatic extension of time for filing generation-skipping transfer tax returns. 26.6081-1 Section 26.6081-1 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) ESTATE AND GIFT TAXES GENERATION-SKIPPING TRANSFER TAX...

  18. 26 CFR 26.6081-1 - Automatic extension of time for filing generation-skipping transfer tax returns.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 26 Internal Revenue 14 2012-04-01 2012-04-01 false Automatic extension of time for filing generation-skipping transfer tax returns. 26.6081-1 Section 26.6081-1 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) ESTATE AND GIFT TAXES GENERATION-SKIPPING TRANSFER TAX...

  19. 26 CFR 26.2653-1 - Taxation of multiple skips.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 26 Internal Revenue 14 2011-04-01 2010-04-01 true Taxation of multiple skips. 26.2653-1 Section 26.2653-1 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) ESTATE AND... Taxation of multiple skips. (a) General rule. If property is held in trust immediately after a GST, solely...

  20. One Way to Design a Valence-Skip Compound.

    PubMed

    Hase, I; Yanagisawa, T; Kawashima, K

    2017-12-01

    Valence-skip compound is a good candidate with high T c and low anisotropy because it has a large attractive interaction at the site of valence-skip atom. However, it is not easy to synthesize such compound because of (i) the instability of the skipping valence state, (ii) the competing charge order, and (iii) that formal valence may not be true in some compounds. In the present study, we show several examples of the valence-skip compounds and discuss how we can design them by first principles calculations. Furthermore, we calculated the electronic structure of a promising candidate of valence skipping compound RbTlCl 3 from first principles. We confirmed that the charge-density wave (CDW) is formed in this compound, and the Tl atoms in two crystallographic different sites take the valence Tl 1+ and Tl 3+ . Structure optimization study reveals that this CDW is stable at the ambient pressure, while this CDW gap can be collapsed when we apply pressure with several gigapascals. In this metallic phase, we can expect a large charge fluctuation and a large electron-phonon interaction.

  1. Is breakfast skipping associated with physical activity among U.S. adolescents? A cross-sectional study of adolescents aged 12-19 years, National Health and Nutrition Examination Survey (NHANES).

    PubMed

    Lyerly, Jordan E; Huber, Larissa R; Warren-Findlow, Jan; Racine, Elizabeth F; Dmochowski, Jacek

    2014-04-01

    To examine the association between breakfast skipping and physical activity among US adolescents aged 12-19 years. A cross-sectional study of nationally representative 2007-2008 National Health and Nutrition Examination Survey (NHANES) data. Breakfast skipping was assessed by two 24 h dietary recalls. Physical activity was self-reported by participants and classified based on meeting national recommendations for physical activity for the appropriate age group. Multiple logistic regression analysis was used to model the association between breakfast skipping and physical activity while controlling for confounders. A total of 936 adolescents aged 12-19 years in the USA. After adjusting for family income, there was no association between breakfast skipping and meeting physical activity guidelines for age among adolescents aged 12-19 years (OR = 0.95, 95% CI 0.56, 1.32). Findings from the study differ from previous research findings on breakfast skipping and physical activity. Therefore, further research that uses large, nationally representative US samples and national recommended guidelines for physical activity is needed.

  2. Accurate predictor-corrector skip entry guidance for low lift-to-drag ratio spacecraft

    NASA Astrophysics Data System (ADS)

    Enmi, Y.; Qian, W.; He, K.; Di, D.

    2018-06-01

    This paper develops numerical predictor-corrector skip en try guidance for vehicles with low lift-to-drag L/D ratio during the skip entry phase of a Moon return mission. The guidance method is composed of two parts: trajectory planning before entry and closed-loop gu idance during skip entry. The result of trajectory planning before entry is able to present an initial value for predictor-corrector algorithm in closed-loop guidance for fast convergence. The magnitude of bank angle, which is parameterized as a linear function of the range-to-go, is modulated to satisfy the downrange requirements. The sign of the bank ang le is determined by the bank-reversal logic. The predictor-corrector algorithm repeatedly applied onboard in each guidance cycle to realize closed-loop guidance in the skip entry phase. The effectivity of the proposed guidance is validated by simulations in nominal conditions, including skip entry, loft entry, and direct entry, as well as simulations in dispersion conditions considering the combination disturbance of the entry interface, the aerodynamic coefficients, the air density, and the mass of the vehicle.

  3. Breakfast Skipping, Extreme Commutes, and the Sex Composition at Birth.

    PubMed

    Mazumder, Bhashkar; Seeskin, Zachary

    2015-01-01

    A growing body of literature has shown that environmental exposures in the period around conception can affect the sex ratio at birth through selective attrition that favors the survival of female conceptuses. Glucose availability is considered a key indicator of the fetal environment, and its absence as a result of meal skipping may inhibit male survival. We hypothesize that breakfast skipping during pregnancy may lead to a reduction in the fraction of male births. Using time use data from the United States we show that women with commute times of 90 minutes or longer are 20 percentage points more likely to skip breakfast. Using U.S. census data we show that women with commute times of 90 minutes or longer are 1.2 percentage points less likely to have a male child under the age of 2. Under some assumptions, this implies that routinely skipping breakfast around the time of conception leads to a 6 percentage point reduction in the probability of a male child. Skipping breakfast during pregnancy may therefore constitute a poor environment for fetal health more generally.

  4. Systemic Delivery of Morpholinos to Skip Multiple Exons in a Dog Model of Duchenne Muscular Dystrophy.

    PubMed

    Maruyama, Rika; Echigoya, Yusuke; Caluseriu, Oana; Aoki, Yoshitsugu; Takeda, Shin'ichi; Yokota, Toshifumi

    2017-01-01

    Exon-skipping therapy is an emerging approach that uses synthetic DNA-like molecules called antisense oligonucleotides (AONs) to splice out frame-disrupting parts of mRNA, restore the reading frame, and produce truncated yet functional proteins. Multiple exon skipping utilizing a cocktail of AONs can theoretically treat 80-90% of patients with Duchenne muscular dystrophy (DMD). The success of multiple exon skipping by the systemic delivery of a cocktail of AONs called phosphorodiamidate morpholino oligomers (PMOs) in a DMD dog model has made a significant impact on the development of therapeutics for DMD, leading to clinical trials of PMO-based drugs. Here, we describe the systemic delivery of a cocktail of PMOs to skip multiple exons in dystrophic dogs and the evaluation of the efficacies and toxicity in vivo.

  5. The influence of the metastasis pattern of mediastinal lymph nodes on the postoperative radiotherapy’s efficacy for the IIIA-pN2 non-small-cell lung cancer: a retrospective analysis of 220 patients

    PubMed Central

    Zhang, Baozhong; Zhao, Lujun; Yuan, Zhiyong; Pang, Qingsong; Wang, Ping

    2016-01-01

    Objective The use of postoperative radiotherapy (PORT) remains controversial for Stage IIIA-N2 non-small-cell lung cancer (NSCLC) patients, a possible reason is that IIIA-pN2 NSCLC diseases are a heterogeneous group with different clinicopathologic features. The aim of this research was to prove whether the mediastinal lymph nodes’ (LNs) skipping status could indicate the necessity of the PORT for the pN2 NSCLC patients. Methods The skip metastasis was defined as pN0N2 (no N1 LN involved), and nonskip metastasis was pN1N2 (one or more N1 LNs involved). Patients were divided into two groups: LNs nonskip and LNs skip, and postoperative chemoradiotherapy (POCRT) and postoperative chemotherapy. Then, the LN nonskip and LN skip groups were further divided into subgroups: POCRT and point of care testing (POCT) for subgroup analysis. Results There were 220 cases included in the analysis, and 43 of them received PORT. On univariate analysis, the median 3-year progression-free survival (PFS) was, respectively, 16 months (27.7%) for the LN skip group and 11 months (15.3%) for the LN nonskip group (P=0.001). The median 3-year overall survival (OS) was, respectively, 35 months (47.0%) for the LN skip group and 27 months (38.7%) for the LN nonskip group (P=0.025). The median 3-year local recurrence-free survival (LRFS) was, respectively, 25 months (41.0%) for the LN skip group and19 months (29.9%) for the LN nonskip group (P=0.014). The median 3-year distant metastasis-free survival (DMFS) was, respectively, 22 months (32.5%) for the LN skip group and 15 months (20.4%) for the LN nonskip group (P=0.013). The median 3-year PFS was, respectively, 17 months (25.6%) for the POCRT group and 12 months (18.6%) for the POCT group (P=0.037). Although the POCRT group showed better OS, LRFS, and DMFS than the POCT group, the results showed no statistical significance. In subgroup analysis, there was no statistical significance in the Kaplan–Meier analysis between subgroups, but it showed that POCRT resulted in better PFS, OS, and DMFS in both LN skip and LN nonskip subgroups; this advantage was more obvious in the LN skip subgroup. Conclusion The LN skip status is closely related to the survival of the IIIA-N2 NSCLC disease, and the LN skip patients may get more benefit in PFS and LRFS than the LN nonskip patients from PORT. PMID:27785064

  6. Quantitative Antisense Screening and Optimization for Exon 51 Skipping in Duchenne Muscular Dystrophy.

    PubMed

    Echigoya, Yusuke; Lim, Kenji Rowel Q; Trieu, Nhu; Bao, Bo; Miskew Nichols, Bailey; Vila, Maria Candida; Novak, James S; Hara, Yuko; Lee, Joshua; Touznik, Aleksander; Mamchaoui, Kamel; Aoki, Yoshitsugu; Takeda, Shin'ichi; Nagaraju, Kanneboyina; Mouly, Vincent; Maruyama, Rika; Duddy, William; Yokota, Toshifumi

    2017-11-01

    Duchenne muscular dystrophy (DMD), the most common lethal genetic disorder, is caused by mutations in the dystrophin (DMD) gene. Exon skipping is a therapeutic approach that uses antisense oligonucleotides (AOs) to modulate splicing and restore the reading frame, leading to truncated, yet functional protein expression. In 2016, the US Food and Drug Administration (FDA) conditionally approved the first phosphorodiamidate morpholino oligomer (morpholino)-based AO drug, eteplirsen, developed for DMD exon 51 skipping. Eteplirsen remains controversial with insufficient evidence of its therapeutic effect in patients. We recently developed an in silico tool to design antisense morpholino sequences for exon skipping. Here, we designed morpholino AOs targeting DMD exon 51 using the in silico tool and quantitatively evaluated the effects in immortalized DMD muscle cells in vitro. To our surprise, most of the newly designed morpholinos induced exon 51 skipping more efficiently compared with the eteplirsen sequence. The efficacy of exon 51 skipping and rescue of dystrophin protein expression were increased by up to more than 12-fold and 7-fold, respectively, compared with the eteplirsen sequence. Significant in vivo efficacy of the most effective morpholino, determined in vitro, was confirmed in mice carrying the human DMD gene. These findings underscore the importance of AO sequence optimization for exon skipping. Copyright © 2017 The American Society of Gene and Cell Therapy. Published by Elsevier Inc. All rights reserved.

  7. Less Therapy Okay for Some with Wilms Tumor?

    Cancer.gov

    Some children with advanced Wilms tumor, a form of kidney cancer, may be able to skip radiation therapy, findings from an NCI-funded clinical trial show. It’s unclear if the finding will change clinical practice, as this Cancer Currents post reports.

  8. The Academic Consequences of Marijuana Use during College

    PubMed Central

    Arria, Amelia M.; Caldeira, Kimberly M.; Bugbee, Brittany A.; Vincent, Kathryn B.; O’Grady, Kevin E.

    2015-01-01

    Although several studies have shown that marijuana use can adversely affect academic achievement among adolescents, less research has focused on its impact on post-secondary educational outcomes. This study utilized data from a large longitudinal cohort study of college students to test the direct and indirect effects of marijuana use on college GPA and time to graduation, with skipping class as a mediator of these outcomes. A structural equation model was evaluated taking into account a variety of baseline risk and protective factors (i.e., demographics, college engagement, psychological functioning, alcohol and other drug use) thought to contribute to college academic outcomes. The results showed a significant path from baseline marijuana use frequency to skipping more classes at baseline to lower first-semester GPA to longer time to graduation. Baseline measures of other drug use and alcohol quantity exhibited similar indirect effects on GPA and graduation time. Over time, the rate of change in marijuana use was negatively associated with rate of change in GPA, but did not account for any additional variance in graduation time. Percentage of classes skipped was negatively associated with GPA at baseline and over time. Thus, even accounting for demographics and other factors, marijuana use adversely affected college academic outcomes, both directly and indirectly through poorer class attendance. Results extend prior research by showing that marijuana use during college can be a barrier to academic achievement. Prevention and early intervention might be important components of a comprehensive strategy for promoting post-secondary academic achievement. PMID:26237288

  9. Contrasting effects of climatic variability on the demography of a trans-equatorial migratory seabird.

    PubMed

    Genovart, Meritxell; Sanz-Aguilar, Ana; Fernández-Chacón, Albert; Igual, Jose M; Pradel, Roger; Forero, Manuela G; Oro, Daniel

    2013-01-01

    Large-scale seasonal climatic indices, such as the North Atlantic Oscillation (NAO) index or the Southern Oscillation Index (SOI), account for major variations in weather and climate around the world and may influence population dynamics in many organisms. However, assessing the extent of climate impacts on species and their life-history traits requires reliable quantitative statistical approaches. We used a new analytical tool in mark-recapture, the multi-event modelling, to simultaneously assess the influence of climatic variation on multiple demographic parameters (i.e. adult survival, transient probability, reproductive skipping and nest dispersal) at two Mediterranean colonies of the Cory's shearwater Calonectris diomedea, a trans-equatorial migratory long-lived seabird. We also analysed the impact of climate in the breeding success at the two colonies. We found a clear temporal variation of survival for Cory's shearwaters, strongly associated to the large-scale SOI especially in one of the colonies (up to 66% of variance explained). Atlantic hurricane season is modulated by the SOI and coincides with shearwater migration to their wintering areas, directly affecting survival probabilities. However, the SOI was a better predictor of survival probabilities than the frequency of hurricanes; thus, we cannot discard an indirect additive effect of SOI via food availability. Accordingly, the proportion of transients was also correlated with SOI values, indicating higher costs of first reproduction (resulting in either mortality or permanent dispersal) when bad environmental conditions occurred during winter before reproduction. Breeding success was also affected by climatic factors, the NAO explaining c. 41% of variance, probably as a result of its effect in the timing of peak abundance of squid and small pelagics, the main prey for shearwaters. No climatic effect was found either on reproductive skipping or on nest dispersal. Contrarily to what we expect for a long-lived organism, large-scale climatic indexes had a more pronounced effect on survival and transient probabilities than on less sensitive fitness parameters such reproductive skipping or nest dispersal probabilities. The potential increase in hurricane frequency because of global warming may interact with other global change agents (such as incidental bycatch and predation by alien species) nowadays impacting shearwaters, affecting future viability of populations. © 2012 The Authors. Journal of Animal Ecology © 2012 British Ecological Society.

  10. 26 CFR 26.2663-2 - Application of chapter 13 to transfers by nonresidents not citizens of the United States.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) ESTATE AND GIFT TAXES GENERATION-SKIPPING TRANSFER TAX... generation-skipping trust. Of the property transferred to the trust, property having a value of $200 is... exemption to the trust on a timely filed United States Gift (and Generation-Skipping Transfer) Tax Return...

  11. 26 CFR 26.2663-2 - Application of chapter 13 to transfers by nonresidents not citizens of the United States.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) ESTATE AND GIFT TAXES GENERATION-SKIPPING TRANSFER TAX... generation-skipping trust. Of the property transferred to the trust, property having a value of $200 is... exemption to the trust on a timely filed United States Gift (and Generation-Skipping Transfer) Tax Return...

  12. 26 CFR 26.2663-2 - Application of chapter 13 to transfers by nonresidents not citizens of the United States.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) ESTATE AND GIFT TAXES GENERATION-SKIPPING TRANSFER TAX... generation-skipping trust. Of the property transferred to the trust, property having a value of $200 is... exemption to the trust on a timely filed United States Gift (and Generation-Skipping Transfer) Tax Return...

  13. 26 CFR 26.2663-2 - Application of chapter 13 to transfers by nonresidents not citizens of the United States.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) ESTATE AND GIFT TAXES GENERATION-SKIPPING TRANSFER TAX... generation-skipping trust. Of the property transferred to the trust, property having a value of $200 is... exemption to the trust on a timely filed United States Gift (and Generation-Skipping Transfer) Tax Return...

  14. 26 CFR 26.2611-1 - Generation-skipping transfer defined.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... AND GIFT TAXES GENERATION-SKIPPING TRANSFER TAX REGULATIONS UNDER THE TAX REFORM ACT OF 1986 § 26.2611... either a direct skip, a taxable distribution, or a taxable termination. See § 26.2612-1 for the definition of these terms. The determination as to whether an event is a GST is made by reference to the most...

  15. 7 CFR 42.123 - Flow diagram for skip lot sampling and inspection.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 2 2014-01-01 2014-01-01 false Flow diagram for skip lot sampling and inspection. 42.123 Section 42.123 Agriculture Regulations of the Department of Agriculture AGRICULTURAL MARKETING... Procedures § 42.123 Flow diagram for skip lot sampling and inspection. EC02SE91.000 Notes: 1. Only normal...

  16. 7 CFR 42.123 - Flow diagram for skip lot sampling and inspection.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 2 2011-01-01 2011-01-01 false Flow diagram for skip lot sampling and inspection. 42.123 Section 42.123 Agriculture Regulations of the Department of Agriculture AGRICULTURAL MARKETING... Procedures § 42.123 Flow diagram for skip lot sampling and inspection. EC02SE91.000 Notes: 1. Only normal...

  17. 7 CFR 42.123 - Flow diagram for skip lot sampling and inspection.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 2 2013-01-01 2013-01-01 false Flow diagram for skip lot sampling and inspection. 42.123 Section 42.123 Agriculture Regulations of the Department of Agriculture AGRICULTURAL MARKETING... Procedures § 42.123 Flow diagram for skip lot sampling and inspection. EC02SE91.000 Notes: 1. Only normal...

  18. 7 CFR 42.123 - Flow diagram for skip lot sampling and inspection.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 2 2012-01-01 2012-01-01 false Flow diagram for skip lot sampling and inspection. 42.123 Section 42.123 Agriculture Regulations of the Department of Agriculture AGRICULTURAL MARKETING... Procedures § 42.123 Flow diagram for skip lot sampling and inspection. EC02SE91.000 Notes: 1. Only normal...

  19. Breakfast Skipping, Anxiety, Exercise, and Soda Consumption are Associated with Diet Quality in Mexican College Students.

    PubMed

    Hall, Laura; Tejada-Tayabas, Luz María; Monárrez-Espino, Joel

    2017-01-01

    ABSTEACT Despite the reported poor dietary habits and risk of weight gain in college students, they remain understudied in Mexico. Mexican college students are in a rapidly changing economic environment; a shift from a traditional, homemade cuisine to a diet more heavily influenced by an industrialized culture seems to be occurring, potentially affecting the quality of their dietary intake. A health and nutrition survey was conducted among 450 Mexican college students to study the relationship between sociodemographic factors and diet quality. Dietary data were used to build macro- and micronutrient scores, dichotomized as low and normal quality. Adjusted odds (OR [95% CI]) were computed to determine the probability of low dietary quality. Breakfast skipping (5.3 [1.2, 22.7]) and risk of anxiety (2.3 [1.3, 4.4]) were associated with a greater risk of low macronutrient quality, and caloric intake < 1,800 kcal (5.8 [3.5, 9.7]), breakfast skipping (3.7 [1.4, 10.3]), vigorous exercise ≤ 1 h/wk (2.6 [1.3, 5.2]), and soda consumption > 250 mL/d (2.0 [1.2, 3.3]) with low micronutrient quality.

  20. Analytic Guidance for the First Entry in a Skip Atmospheric Entry

    NASA Technical Reports Server (NTRS)

    Garcia-Llama, Eduardo

    2007-01-01

    This paper presents an analytic method to generate a reference drag trajectory for the first entry portion of a skip atmospheric entry. The drag reference, expressed as a polynomial function of the velocity, will meet the conditions necessary to fit the requirements of the complete entry phase. The generic method proposed to generate the drag reference profile is further simplified by thinking of the drag and the velocity as density and cumulative distribution functions respectively. With this notion it will be shown that the reference drag profile can be obtained by solving a linear algebraic system of equations. The resulting drag profile is flown using the feedback linearization method of differential geometric control as guidance law with the error dynamics of a second order homogeneous equation in the form of a damped oscillator. This approach was first proposed as a revisited version of the Space Shuttle Orbiter entry guidance. However, this paper will show that it can be used to fly the first entry in a skip entry trajectory. In doing so, the gains in the error dynamics will be changed at a certain point along the trajectory to improve the tracking performance.

  1. Sweets, snacking habits, and skipping meals in children and adolescents on intensive insulin treatment.

    PubMed

    Øverby, N C; Margeirsdottir, H D; Brunborg, C; Dahl-Jørgensen, K; Andersen, L F

    2008-08-01

    To examine the association between skipping meals and snacking events and dietary and clinical characteristics in children and adolescents using modern insulin treatment. Dietary intake was recorded for 4 d in food diaries in 655 young diabetic patients. Number of meals and snacking events was recorded in a separated questionnaire, while clinical data were obtained from case record forms. Skipping meals refer to consuming a main meal (e.g., breakfast) five times a week or less. Modern insulin treatment may favor a more flexible lifestyle. This study shows that there are fewer young diabetic patients who skip meals than non-diabetic controls (p < 0.001) even when using modern intensified insulin treatment. However, skipping meals among young diabetic patients was associated with negative characteristics such as having suboptimal hemoglobin A1c (HbA1c) (OR 4.7, p = 0.02), higher low-density lipoprotein (LDL) cholesterol levels (OR 4.0, p < 0.001), watching more TV (OR 3.6, p < 0.001), being overweight (OR 2.8, p = 0.03), as well as having a higher intake of added sugar (OR 2.1, p = 0.01) and lower intake of fiber (OR 0.2, p = 0.04) compared with those not skipping meals. Having more than two snacking events during the day was associated with higher HbA1c, higher intake of added sugar and sweets, and spending more hours in front of the TV or personal computer. In general, fewer children and adolescents with type 1 diabetes skip meals compared with healthy peers. Those who skip meals and have more snacking events have poorer glycemic control and less healthy dietary and leisure habits.

  2. Elastic spheres can walk on water.

    PubMed

    Belden, Jesse; Hurd, Randy C; Jandron, Michael A; Bower, Allan F; Truscott, Tadd T

    2016-02-04

    Incited by public fascination and engineering application, water-skipping of rigid stones and spheres has received considerable study. While these objects can be coaxed to ricochet, elastic spheres demonstrate superior water-skipping ability, but little is known about the effect of large material compliance on water impact physics. Here we show that upon water impact, very compliant spheres naturally assume a disk-like geometry and dynamic orientation that are favourable for water-skipping. Experiments and numerical modelling reveal that the initial spherical shape evolves as elastic waves propagate through the material. We find that the skipping dynamics are governed by the wave propagation speed and by the ratio of material shear modulus to hydrodynamic pressure. With these insights, we explain why softer spheres skip more easily than stiffer ones. Our results advance understanding of fluid-elastic body interaction during water impact, which could benefit inflatable craft modelling and, more playfully, design of elastic aquatic toys.

  3. Elastic spheres can walk on water

    PubMed Central

    Belden, Jesse; Hurd, Randy C.; Jandron, Michael A.; Bower, Allan F.; Truscott, Tadd T.

    2016-01-01

    Incited by public fascination and engineering application, water-skipping of rigid stones and spheres has received considerable study. While these objects can be coaxed to ricochet, elastic spheres demonstrate superior water-skipping ability, but little is known about the effect of large material compliance on water impact physics. Here we show that upon water impact, very compliant spheres naturally assume a disk-like geometry and dynamic orientation that are favourable for water-skipping. Experiments and numerical modelling reveal that the initial spherical shape evolves as elastic waves propagate through the material. We find that the skipping dynamics are governed by the wave propagation speed and by the ratio of material shear modulus to hydrodynamic pressure. With these insights, we explain why softer spheres skip more easily than stiffer ones. Our results advance understanding of fluid-elastic body interaction during water impact, which could benefit inflatable craft modelling and, more playfully, design of elastic aquatic toys. PMID:26842860

  4. The New Planned Giving Landscape.

    ERIC Educational Resources Information Center

    Moerschbaecher, Lynda

    1987-01-01

    The best way to support charitable causes after tax reform is planned giving. Seven changes in the new tax laws that may affect donors are identified: charitable deduction, fewer deductions, fewer itemizers, increased capital gains tax, alternative minimum tax, generation-skipping tax, and retirement plan restrictions. (MLW)

  5. 40 CFR 61.243-2 - Alternative standards for valves in VHAP service-skip period leak detection and repair.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... VHAP service-skip period leak detection and repair. 61.243-2 Section 61.243-2 Protection of Environment... AIR POLLUTANTS National Emission Standard for Equipment Leaks (Fugitive Emission Sources) § 61.243-2 Alternative standards for valves in VHAP service—skip period leak detection and repair. (a)(1) An owner or...

  6. 40 CFR 264.1062 - Alternative standards for valves in gas/vapor service or in light liquid service: skip period...

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... gas/vapor service or in light liquid service: skip period leak detection and repair. 264.1062 Section... Emission Standards for Equipment Leaks § 264.1062 Alternative standards for valves in gas/vapor service or in light liquid service: skip period leak detection and repair. (a) An owner or operator subject to...

  7. 40 CFR 264.1062 - Alternative standards for valves in gas/vapor service or in light liquid service: skip period...

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... gas/vapor service or in light liquid service: skip period leak detection and repair. 264.1062 Section... Emission Standards for Equipment Leaks § 264.1062 Alternative standards for valves in gas/vapor service or in light liquid service: skip period leak detection and repair. (a) An owner or operator subject to...

  8. 40 CFR 265.1062 - Alternative standards for valves in gas/vapor service or in light liquid service: skip period...

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... gas/vapor service or in light liquid service: skip period leak detection and repair. 265.1062 Section... FACILITIES Air Emission Standards for Equipment Leaks § 265.1062 Alternative standards for valves in gas/vapor service or in light liquid service: skip period leak detection and repair. (a) An owner or...

  9. 40 CFR 264.1062 - Alternative standards for valves in gas/vapor service or in light liquid service: skip period...

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... gas/vapor service or in light liquid service: skip period leak detection and repair. 264.1062 Section... Emission Standards for Equipment Leaks § 264.1062 Alternative standards for valves in gas/vapor service or in light liquid service: skip period leak detection and repair. (a) An owner or operator subject to...

  10. 40 CFR 265.1062 - Alternative standards for valves in gas/vapor service or in light liquid service: skip period...

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... gas/vapor service or in light liquid service: skip period leak detection and repair. 265.1062 Section... FACILITIES Air Emission Standards for Equipment Leaks § 265.1062 Alternative standards for valves in gas/vapor service or in light liquid service: skip period leak detection and repair. (a) An owner or...

  11. 40 CFR 265.1062 - Alternative standards for valves in gas/vapor service or in light liquid service: skip period...

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... gas/vapor service or in light liquid service: skip period leak detection and repair. 265.1062 Section... FACILITIES Air Emission Standards for Equipment Leaks § 265.1062 Alternative standards for valves in gas/vapor service or in light liquid service: skip period leak detection and repair. (a) An owner or...

  12. 40 CFR 264.1062 - Alternative standards for valves in gas/vapor service or in light liquid service: skip period...

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... gas/vapor service or in light liquid service: skip period leak detection and repair. 264.1062 Section... Emission Standards for Equipment Leaks § 264.1062 Alternative standards for valves in gas/vapor service or in light liquid service: skip period leak detection and repair. (a) An owner or operator subject to...

  13. 40 CFR 265.1062 - Alternative standards for valves in gas/vapor service or in light liquid service: skip period...

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... gas/vapor service or in light liquid service: skip period leak detection and repair. 265.1062 Section... FACILITIES Air Emission Standards for Equipment Leaks § 265.1062 Alternative standards for valves in gas/vapor service or in light liquid service: skip period leak detection and repair. (a) An owner or...

  14. 40 CFR 265.1062 - Alternative standards for valves in gas/vapor service or in light liquid service: skip period...

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... gas/vapor service or in light liquid service: skip period leak detection and repair. 265.1062 Section... FACILITIES Air Emission Standards for Equipment Leaks § 265.1062 Alternative standards for valves in gas/vapor service or in light liquid service: skip period leak detection and repair. (a) An owner or...

  15. 40 CFR 264.1062 - Alternative standards for valves in gas/vapor service or in light liquid service: skip period...

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... gas/vapor service or in light liquid service: skip period leak detection and repair. 264.1062 Section... Emission Standards for Equipment Leaks § 264.1062 Alternative standards for valves in gas/vapor service or in light liquid service: skip period leak detection and repair. (a) An owner or operator subject to...

  16. Water walking - an evolution of water surface skipping

    NASA Astrophysics Data System (ADS)

    Hurd, Randy; Belden, Jesse; Jandron, Michael; Bower, Allan; Holekamp, Sean; Truscott, Tadd

    2017-11-01

    Previous work has shown that elastomeric spheres skip more easily than disk-shaped stones. This is due to increased lift stemming from sphere deformation, which provides an increased cross-sectional area and favorable attack angle upon impact. We extend lift models developed for individual impacts to long-range multiple impact events and compare the estimates to experimental results, which show good agreement. Additionally, a surprising new mode of skipping is observed that resembles water-walking, wherein a quickly rotating sphere produces small successive impacts allowing it to move parallel to the water surface. The dynamics of this new multiple skip behavior are rationalized analytically and tested experimentally.

  17. Performance Analysis of Stop-Skipping Scheduling Plans in Rail Transit under Time-Dependent Demand

    PubMed Central

    Cao, Zhichao; Yuan, Zhenzhou; Zhang, Silin

    2016-01-01

    Stop-skipping is a key method for alleviating congestion in rail transit, where schedules are sometimes difficult to implement. Several mechanisms have been proposed and analyzed in the literature, but very few performance comparisons are available. This study formulated train choice behavior estimation into the model considering passengers’ perception. If a passenger’s train path can be identified, this information would be useful for improving the stop-skipping schedule service. Multi-performance is a key characteristic of our proposed five stop-skipping schedules, but quantified analysis can be used to illustrate the different effects of well-known deterministic and stochastic forms. Problems in the novel category of forms were justified in the context of a single line rather than transit network. We analyzed four deterministic forms based on the well-known A/B stop-skipping operating strategy. A stochastic form was innovatively modeled as a binary integer programming problem. We present a performance analysis of our proposed model to demonstrate that stop-skipping can feasibly be used to improve the service of passengers and enhance the elasticity of train operations under demand variations along with an explicit parametric discussion. PMID:27420087

  18. Performance Analysis of Stop-Skipping Scheduling Plans in Rail Transit under Time-Dependent Demand.

    PubMed

    Cao, Zhichao; Yuan, Zhenzhou; Zhang, Silin

    2016-07-13

    Stop-skipping is a key method for alleviating congestion in rail transit, where schedules are sometimes difficult to implement. Several mechanisms have been proposed and analyzed in the literature, but very few performance comparisons are available. This study formulated train choice behavior estimation into the model considering passengers' perception. If a passenger's train path can be identified, this information would be useful for improving the stop-skipping schedule service. Multi-performance is a key characteristic of our proposed five stop-skipping schedules, but quantified analysis can be used to illustrate the different effects of well-known deterministic and stochastic forms. Problems in the novel category of forms were justified in the context of a single line rather than transit network. We analyzed four deterministic forms based on the well-known A/B stop-skipping operating strategy. A stochastic form was innovatively modeled as a binary integer programming problem. We present a performance analysis of our proposed model to demonstrate that stop-skipping can feasibly be used to improve the service of passengers and enhance the elasticity of train operations under demand variations along with an explicit parametric discussion.

  19. Relationship between Breakfast Skipping and Obesity among Elderly: Cross-Sectional Analysis of the HEIJO-KYO Study.

    PubMed

    Otaki, N; Obayashi, K; Saeki, K; Kitagawa, M; Tone, N; Kurumatani, N

    2017-01-01

    Breakfast skipping is reported to be associated with obesity in children and younger populations; however, few studies report the association among elderly. The purpose of this study was to investigate the relationships between breakfast skipping and obesity prevalence among elderly. Cross-sectional study. Community-dwelling elderly in Nara, Japan. 1052 elderly participants (mean age: 71.6 years). Obesity and breakfast skipping were defined as body mass index of ≥25 kg/m2 and skipping breakfast one or more times per week, respectively. Two hundred and seventy-two participants (25.9%) were classified as obese and forty-one (3.9%) were as breakfast skippers. Obesity prevalence was significantly higher in breakfast skippers than in breakfast eaters (43.9% vs. 25.1%, P = 0.007). In multivariable logistic regression analysis adjusted for potential confounders (age, sex and alcohol consumption), breakfast skippers showed significantly higher odds ratio (OR) for obesity than breakfast eaters (OR, 2.23; 95% confidence interval, 1.17-4.27; P = 0.015), which continued to be significant after further adjustment for socioeconomic status. In addition, breakfast skippers showed significantly lower daily potassium (P <0.001) and dietary fibre intakes (P = 0.001) and lower subjective physical activity (P = 0.035) than breakfast eaters. Breakfast skipping was significantly associated with obesity among elderly. Poor diet quality and physical inactivity may be potential intermediators underlying the association between breakfast skipping and obesity.

  20. The relationship of breakfast skipping and type of breakfast consumption with nutrient intake and weight status in children and adolescents: the National Health and Nutrition Examination Survey 1999-2006

    USDA-ARS?s Scientific Manuscript database

    National data comparing nutrient intakes and anthropometric measures in children and adolescents in the United States who skip breakfast or consume different types of breakfasts are limited. The objective was to examine the relationship between breakfast skipping and type of breakfast consumed with ...

  1. Skip trajectory flight of a ramjet-powered hypersonic vehicle

    NASA Astrophysics Data System (ADS)

    Fomin, V. M.; Aulchenko, S. M.; Zvegintsev, V. I.

    2010-07-01

    Possible skip trajectories of a flying vehicle with a periodically actuated ramjet are numerically simulated. An optimal choice of ramjet actuation areas and duration is demonstrated to ensure the maximum flight range with a given amount of the fuel. The main advantage of skip trajectories is found to be a significant (by an order of magnitude) decrease in thermal loads on the flying vehicle.

  2. Modulating Calcium Signals to Boost AON Exon Skipping for DMD

    DTIC Science & Technology

    2016-10-01

    RNA Seq analysis to identify mechanisms of activity and specificity in order to guide discovery of second-generation skipping drugs or combinations...with greater activity. 15. SUBJECT TERMS Exon skipping, Dantrolene, Calcium, Duchenne, Dytrophy, Dystrophin, anti-sense-oligonucleatide, DMD, RNA ...for a subset of very rare mutations. Finally, we hypothesize that by combining chemical genomics with RNA Seq analysis we can begin to identify

  3. Media use as a reason for meal skipping and fast eating in secondary school children.

    PubMed

    Van den Bulck, J; Eggermont, S

    2006-04-01

    This study examined self-reported meal skipping and eating faster than usual with the goal of watching television or playing computer games. Respondents reported their media use and indicated how often they skipped a meal to watch a favourite television programme or to play a computer game, and how often they ate faster than usual in order to watch television or play a computer game. Respondents were 2546 adolescents of 13 (first year of secondary school) and 16 years (fourth year of secondary school) of age. About one respondent in 10 skipped at least one meal every week for either television viewing or computer game playing. Weekly meal skipping for television viewing occurs more regularly in boys and first-year students, but particularly in teenagers who view 5 h or more daily (15% of the sample). The category of teenagers who play computer games four times a week or more (25.3% of the sample) is at increased risk of meal skipping; those who play more than four times a week are 10 times more likely weekly to skip a meal. A quarter of the adolescents eat faster at least once a week to be able to watch television or play a computer game. Regardless of gender and school year, teenagers' risk of eating faster progressively increases with their use of the media. Those who watch 4 h or more daily are about seven times more likely to skip a meal for television and those who play computer games at least four times a week are nine times more likely weekly to skip a meal. Unhealthy eating habits can be a side effect of heavy or excessive media use. Teenagers' use of television or game computers during nonworking or out-of-school hours partly displaces the amount of time that needs to be spent at meals. Practitioners and educators may try to encourage or restore a pattern of healthful meal consumption habits by reducing the amount of media use, and by supporting parental rule-making regarding children's eating habits and media use.

  4. 76 FR 52879 - Changes in Flood Elevation Determinations

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-08-24

    ... Commerce City Commerce City, 7887 East Sentinel Express. 60th Avenue, Commerce City, CO 80022. Adams (FEMA... Sentinel. Civic Center Drive, Thornton, CO 80229. Adams (FEMA Docket No.: B- Unincorporated areas February...; ``Skip'' Fischer, 08-0748P). The Northglenn- Chairman, Adams County Thornton Sentinel. Board of...

  5. Optimized P2A for reporter gene insertion into Nipah virus results in efficient ribosomal skipping and wild-type lethality.

    PubMed

    Park, Arnold; Yun, Tatyana; Hill, Terence E; Ikegami, Tetsuro; Juelich, Terry L; Smith, Jennifer K; Zhang, Lihong; Freiberg, Alexander N; Lee, Benhur

    2016-04-01

    Incorporation of reporter genes within virus genomes is an indispensable tool for interrogation of virus biology and pathogenesis. In previous work, we incorporated a fluorophore into a viral ORF by attaching it to the viral gene via a P2A ribosomal skipping sequence. This recombinant Nipah virus, however, was attenuated in vitro relative to WT virus. In this work, we determined that inefficient ribosomal skipping was a major contributing factor to this attenuation. Inserting a GSG linker before the P2A sequence resulted in essentially complete skipping, significantly improved growth in vitro, and WT lethality in vivo. To the best of our knowledge, this represents the first time a recombinant virus of Mononegavirales with integration of a reporter into a viral ORF has been compared with the WT virus in vivo. Incorporating the GSG linker for improved skipping efficiency whenever functionally important is a critical consideration for recombinant virus design.

  6. A Large Scale Code Resolution Service Network in the Internet of Things

    PubMed Central

    Yu, Haining; Zhang, Hongli; Fang, Binxing; Yu, Xiangzhan

    2012-01-01

    In the Internet of Things a code resolution service provides a discovery mechanism for a requester to obtain the information resources associated with a particular product code immediately. In large scale application scenarios a code resolution service faces some serious issues involving heterogeneity, big data and data ownership. A code resolution service network is required to address these issues. Firstly, a list of requirements for the network architecture and code resolution services is proposed. Secondly, in order to eliminate code resolution conflicts and code resolution overloads, a code structure is presented to create a uniform namespace for code resolution records. Thirdly, we propose a loosely coupled distributed network consisting of heterogeneous, independent; collaborating code resolution services and a SkipNet based code resolution service named SkipNet-OCRS, which not only inherits DHT's advantages, but also supports administrative control and autonomy. For the external behaviors of SkipNet-OCRS, a novel external behavior mode named QRRA mode is proposed to enhance security and reduce requester complexity. For the internal behaviors of SkipNet-OCRS, an improved query algorithm is proposed to increase query efficiency. It is analyzed that integrating SkipNet-OCRS into our resolution service network can meet our proposed requirements. Finally, simulation experiments verify the excellent performance of SkipNet-OCRS. PMID:23202207

  7. Identification of Small Molecule and Genetic Modulators of AON-Induced Dystrophin Exon Skipping by High-Throughput Screening

    PubMed Central

    O'Leary, Debra A.; Sharif, Orzala; Anderson, Paul; Tu, Buu; Welch, Genevieve; Zhou, Yingyao; Caldwell, Jeremy S.; Engels, Ingo H.; Brinker, Achim

    2009-01-01

    One therapeutic approach to Duchenne Muscular Dystrophy (DMD) recently entering clinical trials aims to convert DMD phenotypes to that of a milder disease variant, Becker Muscular Dystrophy (BMD), by employing antisense oligonucleotides (AONs) targeting splice sites, to induce exon skipping and restore partial dystrophin function. In order to search for small molecule and genetic modulators of AON-dependent and independent exon skipping, we screened ∼10,000 known small molecule drugs, >17,000 cDNA clones, and >2,000 kinase- targeted siRNAs against a 5.6 kb luciferase minigene construct, encompassing exon 71 to exon 73 of human dystrophin. As a result, we identified several enhancers of exon skipping, acting on both the reporter construct as well as endogenous dystrophin in mdx cells. Multiple mechanisms of action were identified, including histone deacetylase inhibition, tubulin modulation and pre-mRNA processing. Among others, the nucleolar protein NOL8 and staufen RNA binding protein homolog 2 (Stau2) were found to induce endogenous exon skipping in mdx cells in an AON-dependent fashion. An unexpected but recurrent theme observed in our screening efforts was the apparent link between the inhibition of cell cycle progression and the induction of exon skipping. PMID:20020055

  8. Identification of small molecule and genetic modulators of AON-induced dystrophin exon skipping by high-throughput screening.

    PubMed

    O'Leary, Debra A; Sharif, Orzala; Anderson, Paul; Tu, Buu; Welch, Genevieve; Zhou, Yingyao; Caldwell, Jeremy S; Engels, Ingo H; Brinker, Achim

    2009-12-17

    One therapeutic approach to Duchenne Muscular Dystrophy (DMD) recently entering clinical trials aims to convert DMD phenotypes to that of a milder disease variant, Becker Muscular Dystrophy (BMD), by employing antisense oligonucleotides (AONs) targeting splice sites, to induce exon skipping and restore partial dystrophin function. In order to search for small molecule and genetic modulators of AON-dependent and independent exon skipping, we screened approximately 10,000 known small molecule drugs, >17,000 cDNA clones, and >2,000 kinase- targeted siRNAs against a 5.6 kb luciferase minigene construct, encompassing exon 71 to exon 73 of human dystrophin. As a result, we identified several enhancers of exon skipping, acting on both the reporter construct as well as endogenous dystrophin in mdx cells. Multiple mechanisms of action were identified, including histone deacetylase inhibition, tubulin modulation and pre-mRNA processing. Among others, the nucleolar protein NOL8 and staufen RNA binding protein homolog 2 (Stau2) were found to induce endogenous exon skipping in mdx cells in an AON-dependent fashion. An unexpected but recurrent theme observed in our screening efforts was the apparent link between the inhibition of cell cycle progression and the induction of exon skipping.

  9. A large scale code resolution service network in the Internet of Things.

    PubMed

    Yu, Haining; Zhang, Hongli; Fang, Binxing; Yu, Xiangzhan

    2012-11-07

    In the Internet of Things a code resolution service provides a discovery mechanism for a requester to obtain the information resources associated with a particular product code immediately. In large scale application scenarios a code resolution service faces some serious issues involving heterogeneity, big data and data ownership. A code resolution service network is required to address these issues. Firstly, a list of requirements for the network architecture and code resolution services is proposed. Secondly, in order to eliminate code resolution conflicts and code resolution overloads, a code structure is presented to create a uniform namespace for code resolution records. Thirdly, we propose a loosely coupled distributed network consisting of heterogeneous, independent; collaborating code resolution services and a SkipNet based code resolution service named SkipNet-OCRS, which not only inherits DHT’s advantages, but also supports administrative control and autonomy. For the external behaviors of SkipNet-OCRS, a novel external behavior mode named QRRA mode is proposed to enhance security and reduce requester complexity. For the internal behaviors of SkipNet-OCRS, an improved query algorithm is proposed to increase query efficiency. It is analyzed that integrating SkipNet-OCRS into our resolution service network can meet our proposed requirements. Finally, simulation experiments verify the excellent performance of SkipNet-OCRS.

  10. Skipped words and fixated words are processed differently during reading.

    PubMed

    Eskenazi, Michael A; Folk, Jocelyn R

    2015-04-01

    The purpose of this study was to investigate whether words are processed differently when they are fixated during silent reading than when they are skipped. According to a serial processing model of eye movement control (e.g., EZ Reader) skipped words are fully processed (Reichle, Rayner, Pollatsek, Behavioral and Brain Sciences, 26(04):445-476, 2003), whereas in a parallel processing model (e.g., SWIFT) skipped words do not need to be fully processed (Engbert, Nuthmann, Richter, Kliegl, Psychological Review, 112(4):777-813, 2005). Participants read 34 sentences with target words embedded in them while their eye movements were recorded. All target words were three-letter, low-frequency, and unpredictable nouns. After the reading session, participants completed a repetition priming lexical decision task with the target words from the reading session included as the repetition prime targets, with presentation of those same words during the reading task acting as the prime. When participants skipped a word during the reading session, their reaction times on the lexical decision task were significantly longer (M = 656.42 ms) than when they fixated the word (M = 614.43 ms). This result provides evidence that skipped words are sometimes not processed to the same degree as fixated words during reading.

  11. Factors associated with skipping breakfast among Inner Mongolia medical students in China.

    PubMed

    Sun, Juan; Yi, He; Liu, Zhiyue; Wu, Yan; Bian, Jiang; Wu, Yanyan; Eshita, Yuki; Li, Gaimei; Zhang, Qing; Yang, Ying

    2013-01-17

    Few studies on the breakfast consumption habits of medical students in China have been carried out. The aim of the present study was to determine the prevalence of skipping breakfast and factors associated with skipping breakfast among medical students in Inner Mongolia of China, and to assist in the design of interventions to improve breakfast consumption habits of medical college students in this region. From December 2010 to January 2011 a cross-sectional survey was conducted among medical students in the Inner Mongolia Medical College using a self-administered questionnaire. The prevalence of skipping breakfast in relation to lifestyle habits was described and factors associated with breakfast consumption were identified using multiple logistic regression analysis. The overall prevalence of skipping breakfast was 41.7% and 23.5% for males and females, respectively. The Faculty of Medicine Information Management had the highest breakfast skipping prevalence. Logistic regression models found that the main factors associated with breakfast consumption habits among medical students were gender, class years of education, monthly expenses, faculty, appetite, sleeping quality, and the learning process; monthly expenses, sleeping quality, and the learning process showed a dose-dependent relationship. Breakfast consumption was associated with many factors, most importantly monthly expenses, sleeping quality and the learning process. The prevalence of skipping breakfast is significantly higher compared recently reported figures for medical students in western countries and other areas of China. Improvement of breakfast education should be considered for students in which higher monthly expenses, poor sleeping quality, or a laborious learning process have been identified.

  12. Forecasting fluctuating outbreaks in seasonally driven epidemics

    NASA Astrophysics Data System (ADS)

    Stone, Lewi

    2009-03-01

    Seasonality is a driving force that has major impact on the spatio-temporal dynamics of natural systems and their populations. This is especially true for the transmission of common infectious diseases such as influenza, measles, chickenpox, and pertussis. Here we gain new insights into the nonlinear dynamics of recurrent diseases through the analysis of the classical seasonally forced SIR epidemic model. Despite many efforts over the last decades, it has been difficult to gain general analytical insights because of the complex synchronization effects that can evolve between the external forcing and the model's natural oscillations. The analysis advanced here attempts to make progress in this direction by focusing on the dynamics of ``skips'' where we identify and predict years in which the epidemic is absent rather than outbreak years. Skipping events are intrinsic to the forced SIR model when parameterised in the chaotic regime. In fact, it is difficult if not impossible to locate realistic chaotic parameter regimes in which outbreaks occur regularly each year. This contrasts with the well known Rossler oscillator whose outbreaks recur regularly but whose amplitude vary chaotically in time (Uniform Phase Chaotic Amplitude oscillations). The goal of the present study is to develop a ``language of skips'' that makes it possible to predict under what conditions the next outbreak is likely to occur, and how many ``skips'' might be expected after any given outbreak. We identify a new threshold effect and give clear analytical conditions that allow accurate predictions. Moreover, the time of occurrence (i.e., phase) of an outbreak proves to be a useful new parameter that carries important epidemiological information. In forced systems, seasonal changes can prevent late-initiating outbreaks (i.e., having high phase) from running to completion. These principles yield forecasting tools that should have relevance for the study of newly emerging and reemerging diseases.

  13. Transtheoretical Model Based Exercise Counseling Combined with Music Skipping Rope Exercise on Childhood Obesity.

    PubMed

    Ham, Ok Kyung; Sung, Kyung Mi; Lee, Bo Gyeong; Choi, Hee Won; Im, Eun-Ok

    2016-06-01

    The purpose was to evaluate the effects of a transtheoretical model (TTM) based exercise counseling offered with music skipping rope exercise on components of the TTM (stages of change, decisional balance, and self-efficacy), body mass index, glucose, and lipid profile of overweight/obese children in Korea. This study used a nonequivalent pretest and posttest experimental study design. A total of 75 overweight/obese children participated in the study. Eight sessions of exercise counseling combined with music skipping rope exercise for 12 weeks were offered for children in the experimental group, while one session of exercise counseling with music skipping rope exercise for 12 weeks was offered for children in the control group. Outcomes were measured at baseline, and 6 months after the intervention. After the intervention, self-efficacy significantly improved among children in the experimental group (p = .049), while these children maintained their baseline BMI at 6-month follow-up (p > .05). Among children in the control group, BMI significantly increased (p < .05). Fasting blood sugar significantly increased for both groups after the intervention (p < .05). However, a greater increase was observed for the control group. Our study partially supports the hypothesis that a TTM-based exercise intervention is effective in maintaining BMI and improving self-efficacy of overweight/obese children. The TTM-based counseling combined with exercise classes has potential to control weight among overweight/obese children, while involvement of parents and children in the development of the theory-based intervention may generate further benefits regarding health and well-being of overweight/obese children. Copyright © 2016. Published by Elsevier B.V.

  14. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Procarione, J.A.

    This research concerns the development of two models - a mine and a haulage shaft for ventilation studies. The model mine for instructional study of pressures and quantities was designed and built of 12-inch diameter furnace duct. It consists of a north and south sections in the hallway ceiling space in the third floor of the W.C. Browning Building. A fan section, consisting of three fans in Room 314, is attached to it. Both fan and duct sections may be operated singly, in parallel, and in series with each other. A blowing or exhausting mode allows a total of thirty-twomore » combinations. Through a system of air flow measurement stations, solenoid valves, and relays, pressures and velocities may be determined with a micromanometer or a pressure transducer whose output is processed by a computer. A control panel, made up of switches, permits the selection of the various fan-duct combinations and measurements. The 120 foot model shaft is for the study of shock losses when two skips are moving in an airflow within its confines. Air is directed from a fan downward through the 10 inch diameter aluminum shaft installed inside the former rubbish chute of the Browning Building. For data collection from which shock losses may be determined, sixteen strategically located measuring stations connect to pressure transducers. Voltage outputs from the transducers are sampled and processed by the computer in Room 314. In addition to the pressure readings, the skip speed and the air temperature in the model are also recorded by the computer system for later use in data reduction. Provisions are made for changing skip sizes and speeds as well as shaft wall roughness. With one skip size and speed and with smooth shaft walls, data was collected and processed to prove proper operation of the complete system.« less

  15. Children's Emotion and Behavior In Painting Activities

    ERIC Educational Resources Information Center

    Chen, I-Ju

    2013-01-01

    This study adopted various methods such as qualitative research, observation, interviews, and document collection to examine the emotional responses, behavior changes, and counseling effects on a single-parent child in a skipped-generation family before or after a series of painting activities. The participant was asked to take part in 50-minute…

  16. The effectiveness of breakfast recommendations on weight loss: a randomized controlled trial123

    PubMed Central

    Dhurandhar, Emily J; Dawson, John; Alcorn, Amy; Larsen, Lesli H; Thomas, Elizabeth A; Cardel, Michelle; Bourland, Ashley C; Astrup, Arne; St-Onge, Marie-Pierre; Hill, James O; Apovian, Caroline M; Shikany, James M; Allison, David B

    2014-01-01

    Background: Breakfast is associated with lower body weight in observational studies. Public health authorities commonly recommend breakfast consumption to reduce obesity, but the effectiveness of adopting these recommendations for reducing body weight is unknown. Objective: We tested the relative effectiveness of a recommendation to eat or skip breakfast on weight loss in adults trying to lose weight in a free-living setting. Design: We conducted a multisite, 16-wk, 3-parallel-arm randomized controlled trial in otherwise healthy overweight and obese adults [body mass index (in kg/m2) between 25 and 40] aged 20–65 y. Our primary outcome was weight change. We compared weight change in a control group with weight loss in experimental groups told to eat breakfast or to skip breakfast [no breakfast (NB)]. Randomization was stratified by prerandomization breakfast eating habits. A total of 309 participants were randomly assigned. Results: A total of 283 of the 309 participants who were randomly assigned completed the intervention. Treatment assignment did not have a significant effect on weight loss, and there was no interaction between initial breakfast eating status and treatment. Among skippers, mean (±SD) baseline weight-, age-, sex-, site-, and race-adjusted weight changes were −0.71 ± 1.16, −0.76 ± 1.26, and −0.61 ± 1.18 kg for the control, breakfast, and NB groups, respectively. Among breakfast consumers, mean (±SD) baseline weight-, age-, sex-, site-, and race-adjusted weight changes were −0.53 ± 1.16, −0.59 ± 1.06, and −0.71 ± 1.17 kg for the control, breakfast, and NB groups, respectively. Self-reported compliance with the recommendation was 93.6% for the breakfast group and 92.4% for the NB group. Conclusions: A recommendation to eat or skip breakfast for weight loss was effective at changing self-reported breakfast eating habits, but contrary to widely espoused views this had no discernable effect on weight loss in free-living adults who were attempting to lose weight. This trial was registered at clinicaltrails.gov as NCT01781780. PMID:24898236

  17. Live-cell imaging visualizes frequent mitotic skipping during senescence-like growth arrest in mammary carcinoma cells exposed to ionizing radiation.

    PubMed

    Suzuki, Masatoshi; Yamauchi, Motohiro; Oka, Yasuyoshi; Suzuki, Keiji; Yamashita, Shunichi

    2012-06-01

    Senescence-like growth arrest in human solid carcinomas is now recognized as the major outcome of radiotherapy. This study was designed to analyze cell cycle during the process of senescence-like growth arrest in mammary carcinoma cells exposed to X-rays. Fluorescent ubiquitination-based cell cycle indicators were introduced into the human mammary carcinoma cell line MCF-7. Cell cycle was sequentially monitored by live-cell imaging for up to 5 days after exposure to 10 Gy of X-rays. Live-cell imaging revealed that cell cycle transition from G2 to G1 phase without mitosis, so-called mitotic skipping, was observed in 17.1% and 69.8% of G1- and G2-irradiated cells, respectively. Entry to G1 phase was confirmed by the nuclear accumulation of mKO(2)-hCdt1 as well as cyclin E, which was inversely correlated to the accumulation of G2-specific markers such as mAG-hGeminin and CENP-F. More than 90% of cells skipping mitosis were persistently arrested in G1 phase and showed positive staining for the senescent biochemical marker, which is senescence-associated ß-galactosidase, indicating induction of senescence-like growth arrest accompanied by mitotic skipping. While G2 irradiation with higher doses of X-rays induced mitotic skipping in approximately 80% of cells, transduction of short hairpin RNA (shRNA) for p53 significantly suppressed mitotic skipping, suggesting that ionizing radiation-induced mitotic skipping is associated with p53 function. The present study found the pathway of senescence-like growth arrest in G1 phase without mitotic entry following G2-irradiation. Copyright © 2012 Elsevier Inc. All rights reserved.

  18. Precursor processes of human self-initiated action.

    PubMed

    Khalighinejad, Nima; Schurger, Aaron; Desantis, Andrea; Zmigrod, Leor; Haggard, Patrick

    2018-01-15

    A gradual buildup of electrical potential over motor areas precedes self-initiated movements. Recently, such "readiness potentials" (RPs) were attributed to stochastic fluctuations in neural activity. We developed a new experimental paradigm that operationalized self-initiated actions as endogenous 'skip' responses while waiting for target stimuli in a perceptual decision task. We compared these to a block of trials where participants could not choose when to skip, but were instead instructed to skip. Frequency and timing of motor action were therefore balanced across blocks, so that conditions differed only in how the timing of skip decisions was generated. We reasoned that across-trial variability of EEG could carry as much information about the source of skip decisions as the mean RP. EEG variability decreased more markedly prior to self-initiated compared to externally-triggered skip actions. This convergence suggests a consistent preparatory process prior to self-initiated action. A leaky stochastic accumulator model could reproduce this convergence given the additional assumption of a systematic decrease in input noise prior to self-initiated actions. Our results may provide a novel neurophysiological perspective on the topical debate regarding whether self-initiated actions arise from a deterministic neurocognitive process, or from neural stochasticity. We suggest that the key precursor of self-initiated action may manifest as a reduction in neural noise. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  19. Effect of innovative building design on physical activity.

    PubMed

    Nicoll, Gayle; Zimring, Craig

    2009-01-01

    Stair climbing can be a low-cost and relatively accessible way to add everyday physical activity, but many building stairwells are inaccessible or unpleasant and elevators are far more convenient. This study explores the use of and attitude toward stairs in an innovative office building where the main elevators for able-bodied users stop only at every third floor ("skip-stop" elevators). These users are expected to walk up or down nearby stairs that have been made open and appealing ("skip-stop" stairs). The study takes advantage of a natural experiment. Some workers' offices were clustered around the skip-stop elevator and the stairs, whereas others had access to a traditional elevator core, that is, an elevator that stopped at each floor with nearby fire exit stairs. Stair use on the open skip-stop stairs and enclosed fire stairs was measured using infrared monitors and card-reader activity logs. An online survey of employees (N=299, a 17.4% response rate) gathered information on stair use and attitudes and behaviors toward physical activity; interviews with key personnel identified major implementation issues. The skip-stop stair was used 33 times more than the enclosed stair of the traditional elevator core, with 72% of survey participants reporting daily stair use. Although implementation issues related to organizational objectives, costs, security, barrier-free accessibility, and building codes exist, the skip-stop feature offers a successful strategy for increasing stair use in workplaces.

  20. Immortalized Muscle Cell Model to Test the Exon Skipping Efficacy for Duchenne Muscular Dystrophy

    PubMed Central

    Nguyen, Quynh

    2017-01-01

    Duchenne muscular dystrophy (DMD) is a lethal genetic disorder that most commonly results from mutations disrupting the reading frame of the dystrophin (DMD) gene. Among the therapeutic approaches employed, exon skipping using antisense oligonucleotides (AOs) is one of the most promising strategies. This strategy aims to restore the reading frame, thus producing a truncated, yet functioning dystrophin protein. In 2016, the Food and Drug Administration (FDA) conditionally approved the first AO-based drug, eteplirsen (Exondys 51), developed for DMD exon 51 skipping. An accurate and reproducible method to quantify exon skipping efficacy is essential for evaluating the therapeutic potential of different AOs sequences. However, previous in vitro screening studies have been hampered by the limited proliferative capacity and insufficient amounts of dystrophin expressed by primary muscle cell lines that have been the main system used to evaluate AOs sequences. In this paper, we illustrate the challenges associated with primary muscle cell lines and describe a novel approach that utilizes immortalized cell lines to quantitatively evaluate the exon skipping efficacy in in vitro studies. PMID:29035327

  1. Fire Safety

    MedlinePlus

    ... mode Turn off more accessible mode Skip Ribbon Commands Skip to main content Turn off Animations Turn ... able to reliably rescue themselves. Know What to Do in a Fire Test any closed doors with ...

  2. Precession and circularization of elliptical space-tether motion

    NASA Technical Reports Server (NTRS)

    Chapel, Jim D.; Grosserode, Patrick

    1993-01-01

    In this paper, we present a simplified analytic model for predicting motion of long space tethers. The perturbation model developed here addresses skip rope motion, where each end of the tether is held in place and the middle of the tether swings with a motion similar to that of a child's skip rope. If the motion of the tether midpoint is elliptical rather than circular, precession of the ellipse complicates the procedures required to damp this motion. The simplified analytic model developed in this paper parametrically predicts the precession of elliptical skip rope motion. Furthermore, the model shows that elliptic skip rope motion will circularize when damping is present in the longitudinal direction. Compared with high-fidelity simulation results, this simplified model provides excellent predictions of these phenomena.

  3. U.S. Northern Command > Newsroom > Press Releases

    Science.gov Websites

    Skip to main content (Press Enter). Toggle navigation U.S. Northern Command Search Search USNORTHCOM: Search Search USNORTHCOM: Search U.S. Northern Command U.S. Northern Command Home Leadership , 2018 NORAD and USNORTHCOM to host change of command ceremony Nov. 30, 2017 United States, Mexico to

  4. Foundations

    NASA Astrophysics Data System (ADS)

    Harteveld, Casper

    A building will more likely collapse if it does not have any proper foundations. Similarly, the design philosophy of Triadic Game Design (TGD) needs to reside on solid building blocks, otherwise the concept will collapse as well. In this level I will elaborate on these building blocks. First I will explain what the general idea of TGD is. It is a design philosophy, for sure, but one which stresses that an “optimum” needs to be found in a design space constituted by three different worlds: Reality, Meaning, and Play. Additionally, these worlds need to be considered simultaneously and be treated equally. The latter requires balancing the worlds which may result in different tensions, within and between two or three of the worlds. I continue by discussing each of the worlds and showing their perspective on the field of games with a meaningful purpose. From this, we clearly see that it is feasible to think of each world and that the idea makes sense. I substantiate this further by relating the notion of player and similar approaches to this framework. This level is quite a tough pill to swallow yet essential for finishing the other levels. Do not cheat or simply skip this level, but just take a big cup of coffee or tea and start reading it.

  5. Improving Family Communications

    MedlinePlus

    ... mode Turn off more accessible mode Skip Ribbon Commands Skip to main content Turn off Animations Turn ... do the same. More Tips To Improve Communication Do Give clear, age-appropriate directions such as, "When ...

  6. Sleep Apnea Detection

    MedlinePlus

    ... mode Turn off more accessible mode Skip Ribbon Commands Skip to main content Turn off Animations Turn ... the night Sleepiness during the day Difficulty paying attention Behavior problems If you notice any of these ...

  7. Histone hyperacetylation and exon skipping: a calcium-mediated dynamic regulation in cardiomyocytes

    PubMed Central

    Sharma, Alok; Nguyen, Hieu; Cai, Lu; Lou, Hua

    2015-01-01

    In contrast to cell type-specific pre-mRNA alternative splicing, mechanisms controlling activity-dependent alternative splicing is under-studied and not well understood. In a recent study, we conducted a comprehensive analysis of calcium-mediated mechanism that regulates alternative exon skipping in mouse cardiomyocytes. Our results reveal a strong link between histone hyperacetylation and skipping of cassette exons, and provide support to the kinetic coupling model of the epigenetic regulation of alternative splicing at the chromatin level. PMID:26325491

  8. What Is a Neonatologist?

    MedlinePlus

    ... mode Turn off more accessible mode Skip Ribbon Commands Skip to main content Turn off Animations Turn ... care during your pregnancy. What Kind of Training Do Neonatologists Have? Neonatologists are medical doctors who have ...

  9. What Is a Pediatric Endocrinologist?

    MedlinePlus

    ... mode Turn off more accessible mode Skip Ribbon Commands Skip to main content Turn off Animations Turn ... and the teen years. What Kind of Training Do Pediatric Endocrinologists Have? Pediatric endocrinologists are medical doctors ...

  10. What Is a Pediatric Urologist?

    MedlinePlus

    ... mode Turn off more accessible mode Skip Ribbon Commands Skip to main content Turn off Animations Turn ... to treat your child. What Kind of Training Do Pediatric Urologists Have? Pediatric urologists are medical doctors ...

  11. Emotional Development: 1 Year Olds

    MedlinePlus

    ... mode Turn off more accessible mode Skip Ribbon Commands Skip to main content Turn off Animations Turn ... her regain her composure is to give her attention and reassurance when she needs it. Snapping at ...

  12. What Is a Pediatric Infectious Diseases Specialist?

    MedlinePlus

    ... mode Turn off more accessible mode Skip Ribbon Commands Skip to main content Turn off Animations Turn ... through the teen years. What Kind of Training Do Pediatric Infectious Diseases Specialists Have? Pediatric infectious diseases ...

  13. How to Keep Your Sleeping Baby Safe

    MedlinePlus

    ... mode Turn off more accessible mode Skip Ribbon Commands Skip to main content Turn off Animations Turn ... any of the recommendations listed. What You Can Do: Recommendations for Infant Sleep Safety Until their first ...

  14. What Is a Pediatric Critical Care Specialist?

    MedlinePlus

    ... mode Turn off more accessible mode Skip Ribbon Commands Skip to main content Turn off Animations Turn ... offered in the PICU. What Kind of Training Do Pediatric Critical Care Specialists Have? Pediatric critical care ...

  15. SKIP Is a Component of the Spliceosome Linking Alternative Splicing and the Circadian Clock in Arabidopsis[W

    PubMed Central

    Wang, Xiaoxue; Wu, Fangming; Xie, Qiguang; Wang, Huamei; Wang, Ying; Yue, Yanling; Gahura, Ondrej; Ma, Shuangshuang; Liu, Lei; Cao, Ying; Jiao, Yuling; Puta, Frantisek; McClung, C. Robertson; Xu, Xiaodong; Ma, Ligeng

    2012-01-01

    Circadian clocks generate endogenous rhythms in most organisms from cyanobacteria to humans and facilitate entrainment to environmental diurnal cycles, thus conferring a fitness advantage. Both transcriptional and posttranslational mechanisms are prominent in the basic network architecture of circadian systems. Posttranscriptional regulation, including mRNA processing, is emerging as a critical step for clock function. However, little is known about the molecular mechanisms linking RNA metabolism to the circadian clock network. Here, we report that a conserved SNW/Ski-interacting protein (SKIP) domain protein, SKIP, a splicing factor and component of the spliceosome, is involved in posttranscriptional regulation of circadian clock genes in Arabidopsis thaliana. Mutation in SKIP lengthens the circadian period in a temperature-sensitive manner and affects light input and the sensitivity of the clock to light resetting. SKIP physically interacts with the spliceosomal splicing factor Ser/Arg-rich protein45 and associates with the pre-mRNA of clock genes, such as PSEUDORESPONSE REGULATOR7 (PRR7) and PRR9, and is necessary for the regulation of their alternative splicing and mRNA maturation. Genome-wide investigations reveal that SKIP functions in regulating alternative splicing of many genes, presumably through modulating recognition or cleavage of 5′ and 3′ splice donor and acceptor sites. Our study addresses a fundamental question on how the mRNA splicing machinery contributes to circadian clock function at a posttranscriptional level. PMID:22942380

  16. Skipping meals and alcohol consumption. The regulation of energy intake and expenditure among weight loss participants.

    PubMed

    Carels, Robert A; Young, Kathleen M; Coit, Carissa; Clayton, Anna Marie; Spencer, Alexis; Wagner, Marissa

    2008-11-01

    Research suggests that specific eating patterns (e.g., eating breakfast) may be related to favorable weight status. This investigation examined the relationship between eating patterns (i.e., skipping meals; consuming alcohol) and weight loss treatment outcomes (weight loss, energy intake, energy expenditure, and duration of exercise). Fifty-four overweight or obese adults (BMI> or =27 kg/m(2)) participated in a self-help or therapist-assisted weight loss program. Daily energy intake from breakfast, lunch, dinner, and alcoholic beverages, total daily energy intake, total daily energy expenditure, physical activity, and weekly weight loss were assessed. On days that breakfast or dinner was skipped, or alcoholic beverages were not consumed, less total daily energy was consumed compared to days that breakfast, dinner, or alcoholic beverages were consumed. On days that breakfast or alcohol was consumed, daily energy expenditure (breakfast only) and duration of exercise were higher compared to days that breakfast or alcohol was not consumed. Individuals who skipped dinner or lunch more often had lower energy expenditure and exercise duration than individuals who skipped dinner or lunch less often. Individuals who consumed alcohol more often had high daily energy expenditure than individuals who consumed alcohol less often. Skipping meals or consuming alcoholic beverages was not associated with weekly weight loss. In this investigation, weight loss program participants may have compensated for excess energy intake from alcoholic beverages and meals with greater daily energy expenditure and longer exercise duration.

  17. Skip the trip: air travelers' behavioral responses to pandemic influenza.

    PubMed

    Fenichel, Eli P; Kuminoff, Nicolai V; Chowell, Gerardo

    2013-01-01

    Theory suggests that human behavior has implications for disease spread. We examine the hypothesis that individuals engage in voluntary defensive behavior during an epidemic. We estimate the number of passengers missing previously purchased flights as a function of concern for swine flu or A/H1N1 influenza using 1.7 million detailed flight records, Google Trends, and the World Health Organization's FluNet data. We estimate that concern over "swine flu," as measured by Google Trends, accounted for 0.34% of missed flights during the epidemic. The Google Trends data correlates strongly with media attention, but poorly (at times negatively) with reported cases in FluNet. Passengers show no response to reported cases. Passengers skipping their purchased trips forwent at least $50 M in travel related benefits. Responding to actual cases would have cut this estimate in half. Thus, people appear to respond to an epidemic by voluntarily engaging in self-protection behavior, but this behavior may not be responsive to objective measures of risk. Clearer risk communication could substantially reduce epidemic costs. People undertaking costly risk reduction behavior, for example, forgoing nonrefundable flights, suggests they may also make less costly behavior adjustments to avoid infection. Accounting for defensive behaviors may be important for forecasting epidemics, but linking behavior with epidemics likely requires consideration of risk communication.

  18. Antisense Oligonucleotide-mediated Exon Skipping as a Systemic Therapeutic Approach for Recessive Dystrophic Epidermolysis Bullosa.

    PubMed

    Bremer, Jeroen; Bornert, Olivier; Nyström, Alexander; Gostynski, Antoni; Jonkman, Marcel F; Aartsma-Rus, Annemieke; van den Akker, Peter C; Pasmooij, Anna Mg

    2016-10-18

    The "generalized severe" form of recessive dystrophic epidermolysis bullosa (RDEB-gen sev) is caused by bi-allelic null mutations in COL7A1, encoding type VII collagen. The absence of type VII collagen leads to blistering of the skin and mucous membranes upon the slightest trauma. Because most patients carry exonic point mutations or small insertions/deletions, most exons of COL7A1 are in-frame, and low levels of type VII collagen already drastically improve the disease phenotype, this gene seems a perfect candidate for antisense oligonucleotide (AON)-mediated exon skipping. In this study, we examined the feasibility of AON-mediated exon skipping in vitro in primary cultured keratinocytes and fibroblasts, and systemically in vivo using a human skin-graft mouse model. We show that treatment with AONs designed against exon 105 leads to in-frame exon 105 skipping at the RNA level and restores type VII collagen protein production in vitro. Moreover, we demonstrate that systemic delivery in vivo induces de novo expression of type VII collagen in skin grafts generated from patient cells. Our data demonstrate strong proof-of-concept for AON-mediated exon skipping as a systemic therapeutic strategy for RDEB.

  19. Skimming and Skipping Stones

    ERIC Educational Resources Information Center

    Humble, Steve

    2007-01-01

    This article presents an example of skimming and skipping stone motion in mathematical terms available to students studying A-level mathematics. The theory developed in the article postulates a possible mathematical model that is verified by experimental results.

  20. What is the Best Way to Treat Diarrhea?

    MedlinePlus

    ... mode Turn off more accessible mode Skip Ribbon Commands Skip to main content Turn off Animations Turn ... starts making normal amounts of urine again. Reminder–Do's and Don'ts Do Watch for signs of ...

  1. Safety for Your Child: Birth to 6 Months

    MedlinePlus

    ... mode Turn off more accessible mode Skip Ribbon Commands Skip to main content Turn off Animations Turn ... seat, will behave better, so you can pay attention to your driving. Make your newborn’s first ride ...

  2. Dietary change mediates relationships between stress during pregnancy and infant head circumference measures: the QF2011 study.

    PubMed

    Dancause, Kelsey N; Mutran, Dima; Elgbeili, Guillaume; Laplante, David P; Kildea, Sue; Stapleton, Helen; McIntyre, David; King, Suzanne

    2017-07-01

    Prenatal maternal stress can adversely affect birth outcomes, likely reflecting effects of maternal stress hormones on fetal development. Maternal stress might also induce behavioural changes, such as dietary change, that might influence fetal development. Few studies have documented relationships between stress and dietary change in pregnancy. We analysed stress and dietary change among 222 pregnant women exposed to the 2011 Queensland Floods. We assessed women's objective hardship, subjective distress and cognitive appraisal of the disaster; changes in their diets and their associations with infants' gestational age, weight, length and head circumference at birth, head circumference to birth length ratio (HC/BL) and ponderal index. Greater objective hardship was correlated with more negative dietary change, skipped meals and skipped multivitamins. There were no direct effects of stress or dietary change on birth outcomes. However, we observed an interactive effect of dietary change and exposure timing on head circumference for gestational age (HC for GA) (p = 0.010) and a similar trend for HC/BL (p = 0.064). HC for GA and HC/BL were larger among children whose mothers experienced negative changes to their diet in early pregnancy compared with later pregnancy, consistent with a 'head-sparing' response with early gestation exposure. Further analyses indicated that dietary change mediates the relationship between objective hardship because of the floods and these outcomes. This is the first report of relationships among an independent stressor, dietary change and birth outcomes. It highlights another possible mechanism in the relationship between prenatal maternal stress and child development that could guide future research and interventions. © 2016 John Wiley & Sons Ltd.

  3. 75 FR 28082 - Self-Regulatory Organizations; The NASDAQ Stock Market LLC; Notice of Filing and Immediate...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-05-19

    ... Change NASDAQ proposes to modify pricing for NASDAQ members using the NASDAQ Market Center. NASDAQ will... Exchange (``NYSE''), NASDAQ is making minor modifications to its pricing schedule for the routing of orders... using the STGY, SCAN, SKNY, SKIP, or DOTI routing strategies to either add liquidity or execute at the...

  4. DARPA ADAMS Project

    DTIC Science & Technology

    2015-05-11

    it means that Mary distrusts John. We showed that it is possible to analyze such trust- distrust relationships within signed social networks in... relationship problems) − Professional Problems (negative changes at workplace, interpersonal conflicts) Furthermore, we encode in 2nd degree variables...a social media forum data. • Processed initial set of Vegas metrics data (clustering coefficient, # similar users, # skip levels) through time

  5. Catalyst-free synthesis of skipped dienes from phosphorus ylides, allylic carbonates, and aldehydes via a one-pot SN2' allylation-Wittig strategy.

    PubMed

    Xu, Silong; Zhu, Shaoying; Shang, Jian; Zhang, Junjie; Tang, Yuhai; Dou, Jianwei

    2014-04-18

    A catalyst-free allylic alkylation of stabilized phosphorus ylides with allylic carbonates via a regioselective SN2' process is presented. Subsequent one-pot Wittig reaction with both aliphatic and aromatic aldehydes as well as ketenes provides structurally diverse skipped dienes (1,4-dienes) in generally high yields and moderate to excellent stereoselectivity with flexible substituent patterns. This one-pot SN2' allylation-Wittig strategy constitutes a convenient and efficient synthetic method for highly functionalized skipped dienes from readily available starting materials.

  6. In Silico Screening Based on Predictive Algorithms as a Design Tool for Exon Skipping Oligonucleotides in Duchenne Muscular Dystrophy

    PubMed Central

    Echigoya, Yusuke; Mouly, Vincent; Garcia, Luis; Yokota, Toshifumi; Duddy, William

    2015-01-01

    The use of antisense ‘splice-switching’ oligonucleotides to induce exon skipping represents a potential therapeutic approach to various human genetic diseases. It has achieved greatest maturity in exon skipping of the dystrophin transcript in Duchenne muscular dystrophy (DMD), for which several clinical trials are completed or ongoing, and a large body of data exists describing tested oligonucleotides and their efficacy. The rational design of an exon skipping oligonucleotide involves the choice of an antisense sequence, usually between 15 and 32 nucleotides, targeting the exon that is to be skipped. Although parameters describing the target site can be computationally estimated and several have been identified to correlate with efficacy, methods to predict efficacy are limited. Here, an in silico pre-screening approach is proposed, based on predictive statistical modelling. Previous DMD data were compiled together and, for each oligonucleotide, some 60 descriptors were considered. Statistical modelling approaches were applied to derive algorithms that predict exon skipping for a given target site. We confirmed (1) the binding energetics of the oligonucleotide to the RNA, and (2) the distance in bases of the target site from the splice acceptor site, as the two most predictive parameters, and we included these and several other parameters (while discounting many) into an in silico screening process, based on their capacity to predict high or low efficacy in either phosphorodiamidate morpholino oligomers (89% correctly predicted) and/or 2’O Methyl RNA oligonucleotides (76% correctly predicted). Predictions correlated strongly with in vitro testing for sixteen de novo PMO sequences targeting various positions on DMD exons 44 (R2 0.89) and 53 (R2 0.89), one of which represents a potential novel candidate for clinical trials. We provide these algorithms together with a computational tool that facilitates screening to predict exon skipping efficacy at each position of a target exon. PMID:25816009

  7. In vivo effects on intron retention and exon skipping by the U2AF large subunit and SF1/BBP in the nematode Caenorhabditis elegans

    PubMed Central

    Ma, Long; Tan, Zhiping; Teng, Yanling; Hoersch, Sebastian; Horvitz, H. Robert

    2011-01-01

    The in vivo analysis of the roles of splicing factors in regulating alternative splicing in animals remains a challenge. Using a microarray-based screen, we identified a Caenorhabditis elegans gene, tos-1, that exhibited three of the four major types of alternative splicing: intron retention, exon skipping, and, in the presence of U2AF large subunit mutations, the use of alternative 3′ splice sites. Mutations in the splicing factors U2AF large subunit and SF1/BBP altered the splicing of tos-1. 3′ splice sites of the retained intron or before the skipped exon regulate the splicing pattern of tos-1. Our study provides in vivo evidence that intron retention and exon skipping can be regulated largely by the identities of 3′ splice sites. PMID:22033331

  8. Power inverter implementing phase skipping control

    DOEpatents

    Somani, Utsav; Amirahmadi, Ahmadreza; Jourdan, Charles; Batarseh, Issa

    2016-10-18

    A power inverter includes a DC/AC inverter having first, second and third phase circuitry coupled to receive power from a power source. A controller is coupled to a driver for each of the first, second and third phase circuitry (control input drivers). The controller includes an associated memory storing a phase skipping control algorithm, wherein the controller is coupled to receive updating information including a power level generated by the power source. The drivers are coupled to control inputs of the first, second and third phase circuitry, where the drivers are configured for receiving phase skipping control signals from the controller and outputting mode selection signals configured to dynamically select an operating mode for the DC/AC inverter from a Normal Control operation and a Phase Skipping Control operation which have different power injection patterns through the first, second and third phase circuitry depending upon the power level.

  9. World, environment, Umwelt, and innerworld: a biological perspective on visual awareness

    NASA Astrophysics Data System (ADS)

    Koenderink, Jan J.

    2013-03-01

    The world is all physical reality (Higgs bosons, and so forth), the "environment" is a geographical locality (your city, …), the "Umwelt" is the totality of possible actions of the environment on the sensitive body surface of an agent (you, your dog, …) and the possible actions of the agent on the environment (mechanical, chemical, …), whereas the "innerworld" is what it is for the agent to be, that is awareness. Awareness is pre-personal, proto-conscious, and (perhaps) proto-rational. The various "worlds" described above are on distinct ontological levels. The world, and the environment are studied in the exact sciences, the Umwelt is studied by physiology and ethology. Ethology is like behavioristic psychology, with the difference that it applies to all animals. It skips the innerworld, e.g., it considers speech to be a movement of air molecules.The innerworld can only be known through first person reports, thus is intrinsically subjective. It can only be approached through "experimental phenomenology", which is based on intersubjectivity among humans. In this setting speech may mean something in addition to the movements of molecules. These views lead to a model of vision as an "optical user interface". It has consequences for many applications.

  10. A Comparison of Two Skip Entry Guidance Algorithms

    NASA Technical Reports Server (NTRS)

    Rea, Jeremy R.; Putnam, Zachary R.

    2007-01-01

    The Orion capsule vehicle will have a Lift-to-Drag ratio (L/D) of 0.3-0.35. For an Apollo-like direct entry into the Earth's atmosphere from a lunar return trajectory, this L/D will give the vehicle a maximum range of about 2500 nm and a maximum crossrange of 216 nm. In order to y longer ranges, the vehicle lift must be used to loft the trajectory such that the aerodynamic forces are decreased. A Skip-Trajectory results if the vehicle leaves the sensible atmosphere and a second entry occurs downrange of the atmospheric exit point. The Orion capsule is required to have landing site access (either on land or in water) inside the Continental United States (CONUS) for lunar returns anytime during the lunar month. This requirement means the vehicle must be capable of flying ranges of at least 5500 nm. For the L/D of the vehicle, this is only possible with the use of a guided Skip-Trajectory. A skip entry guidance algorithm is necessary to achieve this requirement. Two skip entry guidance algorithms have been developed: the Numerical Skip Entry Guidance (NSEG) algorithm was developed at NASA/JSC and PredGuid was developed at Draper Laboratory. A comparison of these two algorithms will be presented in this paper. Each algorithm has been implemented in a high-fidelity, 6 degree-of-freedom simulation called the Advanced NASA Technology Architecture for Exploration Studies (ANTARES). NASA and Draper engineers have completed several monte carlo analyses in order to compare the performance of each algorithm in various stress states. Each algorithm has been tested for entry-to-target ranges to include direct entries and skip entries of varying length. Dispersions have been included on the initial entry interface state, vehicle mass properties, vehicle aerodynamics, atmosphere, and Reaction Control System (RCS). Performance criteria include miss distance to the target, RCS fuel usage, maximum g-loads and heat rates for the first and second entry, total heat load, and control system saturation. The comparison of the performance criteria has led to a down select and guidance merger that will take the best ideas from each algorithm to create one skip entry guidance algorithm for the Orion vehicle.

  11. Do Vaccines Cause Autism? Is it OK to Skip Certain Vaccines? Get the facts

    MedlinePlus

    ... Lifestyle Infant and toddler health Do vaccines cause autism? Is it OK to skip certain vaccines? Get ... their potentially serious complications. Vaccines do not cause autism. Despite much controversy on the topic, researchers haven' ...

  12. Quick Guide to Health Literacy and Older Adults

    MedlinePlus

    ... starter tips Resources Additional Resources Cultural Competence Health Literacy Older Adults Plain Language Visual Impairment Web sites Content last updated: October 30, 2007 skip to navigation | skip to content ACCESSIBILITY | FREEDOM OF INFORMATION ACT | PRIVACY POLICY | CONTACT US Office of Disease ...

  13. Atmospheric guidance law for planar skip trajectories

    NASA Technical Reports Server (NTRS)

    Mease, K. D.; Mccreary, F. A.

    1985-01-01

    The applicability of an approximate, closed-form, analytical solution to the equations of motion, as a basis for a deterministic guidance law for controlling the in-plane motion during a skip trajectory, is investigated. The derivation of the solution by the method of matched asymptotic expansions is discussed. Specific issues that arise in the application of the solution to skip trajectories are addressed. Based on the solution, an explicit formula for the approximate energy loss due to an atmospheric pass is derived. A guidance strategy is proposed that illustrates the use of the approximate solution. A numerical example shows encouraging performance.

  14. 7 CFR 42.123 - Flow diagram for skip lot sampling and inspection.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ....123 Section 42.123 Agriculture Regulations of the Department of Agriculture AGRICULTURAL MARKETING SERVICE (Standards, Inspections, Marketing Practices), DEPARTMENT OF AGRICULTURE COMMODITY STANDARDS AND STANDARD CONTAINER REGULATIONS STANDARDS FOR CONDITION OF FOOD CONTAINERS Skip Lot Sampling and Inspection...

  15. 75 FR 32989 - Proposed Collection; Comment Request for Form 706

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-06-10

    ... [email protected] . SUPPLEMENTARY INFORMATION: Title: United States Estate (and Generation-Skipping... proposed and/or continuing information collections, as required by the Paperwork Reduction Act of 1995... 706, United States Estate (and Generation-Skipping Transfer) Tax Return. DATES: Written comments...

  16. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Suzuki, Masatoshi, E-mail: msuzuki@nagasaki-u.ac.jp; Yamauchi, Motohiro; Oka, Yasuyoshi

    Purpose: Senescence-like growth arrest in human solid carcinomas is now recognized as the major outcome of radiotherapy. This study was designed to analyze cell cycle during the process of senescence-like growth arrest in mammary carcinoma cells exposed to X-rays. Methods and Materials: Fluorescent ubiquitination-based cell cycle indicators were introduced into the human mammary carcinoma cell line MCF-7. Cell cycle was sequentially monitored by live-cell imaging for up to 5 days after exposure to 10 Gy of X-rays. Results: Live-cell imaging revealed that cell cycle transition from G2 to G1 phase without mitosis, so-called mitotic skipping, was observed in 17.1% andmore » 69.8% of G1- and G2-irradiated cells, respectively. Entry to G1 phase was confirmed by the nuclear accumulation of mKO{sub 2}-hCdt1 as well as cyclin E, which was inversely correlated to the accumulation of G2-specific markers such as mAG-hGeminin and CENP-F. More than 90% of cells skipping mitosis were persistently arrested in G1 phase and showed positive staining for the senescent biochemical marker, which is senescence-associated ss-galactosidase, indicating induction of senescence-like growth arrest accompanied by mitotic skipping. While G2 irradiation with higher doses of X-rays induced mitotic skipping in approximately 80% of cells, transduction of short hairpin RNA (shRNA) for p53 significantly suppressed mitotic skipping, suggesting that ionizing radiation-induced mitotic skipping is associated with p53 function. Conclusions: The present study found the pathway of senescence-like growth arrest in G1 phase without mitotic entry following G2-irradiation.« less

  17. The effects of larval habitat quality on Aedes albopictus skip oviposition

    USDA-ARS?s Scientific Manuscript database

    Aedes albopictus, an invasive mosquito species that transmits disease-causing pathogens, oviposits in containers in resource-limited habitats. To mitigate larval competition, Ae. albopictus females may choose to distribute eggs from a single gonotrophic cycle among multiple containers through skip o...

  18. 7 CFR 42.141 - Obtaining Operating Characteristic (OC) curve information for skip lot sampling and inspection.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ..., and read the new Percent of Lots Expected to be Accepted, Pas, which results when using these skip lot... point, proceed vertically to the curve and then horizontally to the left to the vertical axis. From this...

  19. 7 CFR 42.141 - Obtaining Operating Characteristic (OC) curve information for skip lot sampling and inspection.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ..., and read the new Percent of Lots Expected to be Accepted, Pas, which results when using these skip lot... point, proceed vertically to the curve and then horizontally to the left to the vertical axis. From this...

  20. Development of Exon Skipping Therapies for Duchenne Muscular Dystrophy: A Critical Review and a Perspective on the Outstanding Issues

    PubMed Central

    Aartsma-Rus, Annemieke; Straub, Volker; Hemmings, Robert; Haas, Manuel; Schlosser-Weber, Gabriele; Stoyanova-Beninska, Violeta; Mercuri, Eugenio; Muntoni, Francesco; Sepodes, Bruno; Vroom, Elizabeth

    2017-01-01

    Duchenne muscular dystrophy (DMD) is a rare, severe, progressive muscle-wasting disease leading to disability and premature death. Patients lack the muscle membrane-stabilizing protein dystrophin. Antisense oligonucleotide (AON)-mediated exon skipping is a therapeutic approach that aims to induce production of partially functional dystrophins. Recently, an AON targeting exon 51 became the first of its class to be approved by the United States regulators [Food and Drug Administration (FDA)] for the treatment of DMD. A unique aspect of the exon-skipping approach for DMD is that, depending on the size and location of the mutation, different exons need to be skipped. This challenge raises a number of questions regarding the development and regulatory approval of those individual compounds. In this study, we present a perspective on those questions, following a European stakeholder meeting involving academics, regulators, and representatives from industry and patient organizations, and in the light of the most recent scientific and regulatory experience. PMID:28796573

  1. Genetic variation affecting exon skipping contributes to brain structural atrophy in Alzheimer's disease.

    PubMed

    Lee, Younghee; Han, Seonggyun; Kim, Dongwook; Kim, Dokyoon; Horgousluoglu, Emrin; Risacher, Shannon L; Saykin, Andrew J; Nho, Kwangsik

    2018-01-01

    Genetic variation in cis-regulatory elements related to splicing machinery and splicing regulatory elements (SREs) results in exon skipping and undesired protein products. We developed a splicing decision model to identify actionable loci among common SNPs for gene regulation. The splicing decision model identified SNPs affecting exon skipping by analyzing sequence-driven alternative splicing (AS) models and by scanning the genome for the regions with putative SRE motifs. We used non-Hispanic Caucasians with neuroimaging, and fluid biomarkers for Alzheimer's disease (AD) and identified 17,088 common exonic SNPs affecting exon skipping. GWAS identified one SNP (rs1140317) in HLA-DQB1 as significantly associated with entorhinal cortical thickness, AD neuroimaging biomarker, after controlling for multiple testing. Further analysis revealed that rs1140317 was significantly associated with brain amyloid-f deposition (PET and CSF). HLA-DQB1 is an essential immune gene and may regulate AS, thereby contributing to AD pathology. SRE may hold potential as novel therapeutic targets for AD.

  2. 7 CFR 42.121 - Sampling and inspection procedures.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 2 2011-01-01 2011-01-01 false Sampling and inspection procedures. 42.121 Section 42... REGULATIONS STANDARDS FOR CONDITION OF FOOD CONTAINERS Skip Lot Sampling and Inspection Procedures § 42.121 Sampling and inspection procedures. (a) Following skip lot procedure authorization, inspect every lot...

  3. 7 CFR 42.121 - Sampling and inspection procedures.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false Sampling and inspection procedures. 42.121 Section 42... REGULATIONS STANDARDS FOR CONDITION OF FOOD CONTAINERS Skip Lot Sampling and Inspection Procedures § 42.121 Sampling and inspection procedures. (a) Following skip lot procedure authorization, inspect every lot...

  4. Immunization: Department of Health

    Science.gov Websites

    State of Rhode Island: Department of Health State of Rhode Island: Department of Health Rhode Island Department of Health State of Rhode Island Department of Health Skip to content | Skip to Health & Wellness Food, Water & Environment Birth, Death & Marriage Records Laboratory

  5. Tuberculosis: Department of Health

    Science.gov Websites

    State of Rhode Island: Department of Health State of Rhode Island: Department of Health Rhode Island Department of Health State of Rhode Island Department of Health Skip to content | Skip to Health & Wellness Food, Water & Environment Birth, Death & Marriage Records Laboratory

  6. 78 FR 10001 - Proposed Collection; Comment Request for Form 706-GS(D)

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-02-12

    ... Form 706-GS(D), Generation-Skipping Transfer Tax Return for Distributions. DATES: Written comments should be received on or before April 15, 2013 to be assured of consideration. ADDRESSES: Direct all... [email protected] . SUPPLEMENTARY INFORMATION: Title: Generation-Skipping Transfer Tax Return for...

  7. Skipping Syntactically Illegal "the" Previews: The Role of Predictability

    ERIC Educational Resources Information Center

    Abbott, Matthew J.; Angele, Bernhard; Ahn, Y. Danbi; Rayner, Keith

    2015-01-01

    Readers tend to skip words, particularly when they are short, frequent, or predictable. Angele and Rayner (2013) recently reported that readers are often unable to detect syntactic anomalies in parafoveal vision. In the present study, we manipulated target word predictability to assess whether contextual constraint modulates…

  8. Therapeutic NOTCH3 cysteine correction in CADASIL using exon skipping: in vitro proof of concept.

    PubMed

    Rutten, Julie W; Dauwerse, Hans G; Peters, Dorien J M; Goldfarb, Andrew; Venselaar, Hanka; Haffner, Christof; van Ommen, Gert-Jan B; Aartsma-Rus, Annemieke M; Lesnik Oberstein, Saskia A J

    2016-04-01

    Cerebral autosomal dominant arteriopathy with subcortical infarcts and leukoencephalopathy, or CADASIL, is a hereditary cerebral small vessel disease caused by characteristic cysteine altering missense mutations in the NOTCH3 gene. NOTCH3 mutations in CADASIL result in an uneven number of cysteine residues in one of the 34 epidermal growth factor like-repeat (EGFr) domains of the NOTCH3 protein. The consequence of an unpaired cysteine residue in an EGFr domain is an increased multimerization tendency of mutant NOTCH3, leading to toxic accumulation of the protein in the (cerebro)vasculature, and ultimately reduced cerebral blood flow, recurrent stroke and vascular dementia. There is no therapy to delay or alleviate symptoms in CADASIL. We hypothesized that exclusion of the mutant EGFr domain from NOTCH3 would abolish the detrimental effect of the unpaired cysteine and thus prevent toxic NOTCH3 accumulation and the negative cascade of events leading to CADASIL. To accomplish this NOTCH3 cysteine correction by EGFr domain exclusion, we used pre-mRNA antisense-mediated skipping of specific NOTCH3 exons. Selection of these exons was achieved using in silico studies and based on the criterion that skipping of a particular exon or exon pair would modulate the protein in such a way that the mutant EGFr domain is eliminated, without otherwise corrupting NOTCH3 structure and function. Remarkably, we found that this strategy closely mimics evolutionary events, where the elimination and fusion of NOTCH EGFr domains led to the generation of four functional NOTCH homologues. We modelled a selection of exon skip strategies using cDNA constructs and show that the skip proteins retain normal protein processing, can bind ligand and be activated by ligand. We then determined the technical feasibility of targeted NOTCH3 exon skipping, by designing antisense oligonucleotides targeting exons 2-3, 4-5 and 6, which together harbour the majority of distinct CADASIL-causing mutations. Transfection of these antisense oligonucleotides into CADASIL patient-derived cerebral vascular smooth muscle cells resulted in successful exon skipping, without abrogating NOTCH3 signalling. Combined, these data provide proof of concept for this novel application of exon skipping, and are a first step towards the development of a rational therapeutic approach applicable to up to 94% of CADASIL-causing mutations. © The Author (2016). Published by Oxford University Press on behalf of the Guarantors of Brain. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  9. Effect of skipping breakfast on subsequent energy intake.

    PubMed

    Levitsky, David A; Pacanowski, Carly R

    2013-07-02

    The objective was to examine the effect of consuming breakfast on subsequent energy intake. Participants who habitually ate breakfast and those who skipped breakfast were recruited for two studies. Using a randomized crossover design, the first study examined the effect of having participants consume either (a) no breakfast, (b) a high carbohydrate breakfast (335 kcals), or (c) a high fiber breakfast (360 kcals) on three occasions and measured ad libitum intake at lunch. The second study again used a randomized crossover design but with a larger, normal carbohydrate breakfast consumed ad libtum. Intake averaged 624 kcals and subsequent food intake was measured throughout the day. Participants ate only foods served from the Cornell Human Metabolic Research Unit where all foods were weighed before and after consumption. In the first study, neither eating breakfast nor the kind of breakfast consumed had an effect on the amount consumed at lunch despite a reduction in hunger ratings. In the second study, intake at lunch as well as hunger ratings were significantly increased after skipping breakfast (by 144 kcal), leaving a net caloric deficit of 408 kcal by the end of the day. These data are consistent with published literature demonstrating that skipping a meal does not result in accurate energy compensation at subsequent meals and suggests that skipping breakfast may be an effective means to reduce daily energy intake in some adults. Copyright © 2013 Elsevier Inc. All rights reserved.

  10. Skip the Trip: Air Travelers' Behavioral Responses to Pandemic Influenza

    PubMed Central

    Fenichel, Eli P.; Kuminoff, Nicolai V.; Chowell, Gerardo

    2013-01-01

    Theory suggests that human behavior has implications for disease spread. We examine the hypothesis that individuals engage in voluntary defensive behavior during an epidemic. We estimate the number of passengers missing previously purchased flights as a function of concern for swine flu or A/H1N1 influenza using 1.7 million detailed flight records, Google Trends, and the World Health Organization's FluNet data. We estimate that concern over “swine flu,” as measured by Google Trends, accounted for 0.34% of missed flights during the epidemic. The Google Trends data correlates strongly with media attention, but poorly (at times negatively) with reported cases in FluNet. Passengers show no response to reported cases. Passengers skipping their purchased trips forwent at least $50 M in travel related benefits. Responding to actual cases would have cut this estimate in half. Thus, people appear to respond to an epidemic by voluntarily engaging in self-protection behavior, but this behavior may not be responsive to objective measures of risk. Clearer risk communication could substantially reduce epidemic costs. People undertaking costly risk reduction behavior, for example, forgoing nonrefundable flights, suggests they may also make less costly behavior adjustments to avoid infection. Accounting for defensive behaviors may be important for forecasting epidemics, but linking behavior with epidemics likely requires consideration of risk communication. PMID:23526970

  11. The Prospect of Responsive Spacecraft Using Aeroassisted, Trans-Atmospheric Maneuvers

    DTIC Science & Technology

    2014-06-19

    skip entry aeroassisted maneuvers. By overflying a geographically diverse set of sample ground targets, comparative analysis indicates a significant... analysis . Depending on the chosen re- circularization altitude, the coupled optimal design can achieve an inclination change of 19.91 deg with 50-85...third phase also introduces the “Maneuver Performance Number” as a dimensionless means of comparative effectiveness analysis for both exo- and trans

  12. Skipping toward Seniority: One Queer Scholar's Romp through the Weeds of Academe

    ERIC Educational Resources Information Center

    Lugg, Catherine A.

    2017-01-01

    This reflective essay, which is both autobiographical and historical in nature, is framed by answering the questions posed by the editors regarding my work: What values inform it, how I actually do it, and why do I do it? Quite simply, I am writing to encourage social change for all queer people, be it merely the little corner of my own social…

  13. 26 CFR 26.2653-1 - Taxation of multiple skips.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... AND GIFT TAXES GENERATION-SKIPPING TRANSFER TAX REGULATIONS UNDER THE TAX REFORM ACT OF 1986 § 26.2653... thereafter deemed to occupy the generation immediately above the highest generation of any person holding an... immediately after the GST, the transferor is treated as occupying the generation above the highest generation...

  14. 26 CFR 26.2653-1 - Taxation of multiple skips.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... AND GIFT TAXES GENERATION-SKIPPING TRANSFER TAX REGULATIONS UNDER THE TAX REFORM ACT OF 1986 § 26.2653... thereafter deemed to occupy the generation immediately above the highest generation of any person holding an... immediately after the GST, the transferor is treated as occupying the generation above the highest generation...

  15. 26 CFR 26.2653-1 - Taxation of multiple skips.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... GIFT TAXES GENERATION-SKIPPING TRANSFER TAX REGULATIONS UNDER THE TAX REFORM ACT OF 1986 § 26.2653-1... deemed to occupy the generation immediately above the highest generation of any person holding an... immediately after the GST, the transferor is treated as occupying the generation above the highest generation...

  16. Quiz Today: Should I Skip Class?

    ERIC Educational Resources Information Center

    Zizler, Peter

    2013-01-01

    How does selective assessment, wherein one counts only the best "k" out of "n" quizzes set, impact grade inflation? Based on our analysis, a specific quantitative answer can be given to a student who plans to skip a quiz, depending, of course, on the student's quiz writing consistency or inconsistency.

  17. 26 CFR 26.2642-5 - Finality of inclusion ratio.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 26 Internal Revenue 14 2014-04-01 2013-04-01 true Finality of inclusion ratio. 26.2642-5 Section...-5 Finality of inclusion ratio. (a) Direct skips. The inclusion ratio applicable to a direct skip...) Other GSTs. With respect to taxable distributions and taxable terminations, the inclusion ratio for a...

  18. 26 CFR 26.2642-5 - Finality of inclusion ratio.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 26 Internal Revenue 14 2012-04-01 2012-04-01 false Finality of inclusion ratio. 26.2642-5 Section...-5 Finality of inclusion ratio. (a) Direct skips. The inclusion ratio applicable to a direct skip...) Other GSTs. With respect to taxable distributions and taxable terminations, the inclusion ratio for a...

  19. 26 CFR 26.2642-5 - Finality of inclusion ratio.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 26 Internal Revenue 14 2013-04-01 2013-04-01 false Finality of inclusion ratio. 26.2642-5 Section...-5 Finality of inclusion ratio. (a) Direct skips. The inclusion ratio applicable to a direct skip...) Other GSTs. With respect to taxable distributions and taxable terminations, the inclusion ratio for a...

  20. 26 CFR 25.2518-1 - Qualified disclaimers of property; in general.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ...-2, for purposes of the Federal estate, gift, and generation-skipping transfer tax provisions, the... estate, gift, and generation-skipping transfer tax provisions, the disclaimer is disregarded and the... State Y on June 17, 1978. G and H are beneficiaries under the will. The will provides that any...

  1. 29 CFR 1926.702 - Requirements for equipment and tools.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ..., DEPARTMENT OF LABOR (CONTINUED) SAFETY AND HEALTH REGULATIONS FOR CONSTRUCTION Concrete and Masonry... the ejection system is not to be operated. (b) Concrete mixers. Concrete mixers with one cubic yard... the skip of materials; and (2) Guardrails installed on each side of the skip. (c) Power concrete...

  2. 75 FR 36480 - Proposed Collection; Comment Request for Regulation Project

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-06-25

    ... required by the Paperwork Reduction Act of 1995, Public Law 104-13 (44 U.S.C. 3506(c)(2)(A)). Currently..., Qualified Severance of a Trust for Generation-Skipping Transfer (GST) Tax Purposes. DATES: Written [email protected] . SUPPLEMENTARY INFORMATION: Title: Qualified Severance of a Trust for Generation-Skipping...

  3. 75 FR 38869 - Proposed Collection; Comment Request for Regulation Project

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-07-06

    ...-73-88 (TD 8644), Generation-Skipping Transfer Tax (Sec. Sec. 26.2601-1, 26.2632- 1, 26.2642-1, 26... or before September 7, 2010 to be assured of consideration. ADDRESSES: Direct all written comments to... [email protected] . SUPPLEMENTARY INFORMATION: Title: Generation-Skipping Transfer Tax. OMB...

  4. 26 CFR 26.2642-5 - Finality of inclusion ratio.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 26 Internal Revenue 14 2010-04-01 2010-04-01 false Finality of inclusion ratio. 26.2642-5 Section...-5 Finality of inclusion ratio. (a) Direct skips. The inclusion ratio applicable to a direct skip...) Other GSTs. With respect to taxable distributions and taxable terminations, the inclusion ratio for a...

  5. 26 CFR 26.2642-5 - Finality of inclusion ratio.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 26 Internal Revenue 14 2011-04-01 2010-04-01 true Finality of inclusion ratio. 26.2642-5 Section...-5 Finality of inclusion ratio. (a) Direct skips. The inclusion ratio applicable to a direct skip...) Other GSTs. With respect to taxable distributions and taxable terminations, the inclusion ratio for a...

  6. 75 FR 38874 - Proposed Collection; Comment Request for Form 706-NA

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-07-06

    ... INFORMATION: Title: United States Estate (and Generation-Skipping Transfer) Tax Return, Estate of nonresident... Form 706-NA, United States Estate (and Generation-Skipping Transfer) Tax Return, Estate of nonresident not a citizen of the United States. DATES: Written comments should be received on or before September...

  7. Skipping breakfast, overconsumption of soft drinks and screen media: longitudinal analysis of the combined influence on weight development in primary schoolchildren.

    PubMed

    Traub, Meike; Lauer, Romy; Kesztyüs, Tibor; Wartha, Olivia; Steinacker, Jürgen Michael; Kesztyüs, Dorothea

    2018-03-16

    Regular breakfast and well-balanced soft drink, and screen media consumption are associated with a lower risk of overweight and obesity in schoolchildren. The aim of this research is the combined examination of these three parameters as influencing factors for longitudinal weight development in schoolchildren in order to adapt targeted preventive measures. In the course of the Baden-Württemberg Study, Germany, data from direct measurements (baseline (2010) and follow-up (2011)) at schools was available for 1733 primary schoolchildren aged 7.08 ± 0.6 years (50.8% boys). Anthropometric measurements of the children were taken according to ISAK-standards (International Standard for Anthropometric Assessment) by trained staff. Health and lifestyle characteristics of the children and their parents were assessed in questionnaires. A linear mixed effects regression analysis was conducted to examine influences on changes in waist-to-height-ratio (WHtR), weight, and body mass index (BMI) measures. A generalised linear mixed effects regression analysis was performed to identify the relationship between breakfast, soft drink and screen media consumption with the prevalence of overweight, obesity and abdominal obesity at follow-up. According to the regression analyses, skipping breakfast led to increased changes in WHtR, weight and BMI measures. Skipping breakfast and the overconsumption of screen media at baseline led to higher odds of abdominal obesity and overweight at follow-up. No significant association between soft drink consumption and weight development was found. Targeted prevention for healthy weight status and development in primary schoolchildren should aim towards promoting balanced breakfast habits and a reduction in screen media consumption. Future research on soft drink consumption is needed. Health promoting interventions should synergistically involve children, parents, and schools. The Baden-Württemberg Study is registered at the German Clinical Trials Register (DRKS) under the DRKS-ID: DRKS00000494 .

  8. Online and In-Person Nutrition Education Improves Breakfast Knowledge, Attitudes, and Behaviors: A Randomized Trial of Participants in the Special Supplemental Nutrition Program for Women, Infants, and Children.

    PubMed

    Au, Lauren E; Whaley, Shannon; Rosen, Nila J; Meza, Martha; Ritchie, Lorrene D

    2016-03-01

    Although in-person education is expected to remain central to the Special Supplemental Nutrition Program for Women, Infants, and Children (WIC) service delivery, effective online nutrition education has the potential for increased exposure to quality education and a positive influence on nutrition behaviors in WIC participants. Education focused on promoting healthy breakfast behaviors is an important topic for WIC participants because breakfast eating compared with breakfast skipping has been associated with a higher-quality diet and decreased risk for obesity. To examine the influences of online and in-person group nutrition education on changes in knowledge, attitudes, and behaviors related to breakfast eating. Randomized-controlled trial comparing the effectiveness of online and in-person nutrition education between March and September 2014. Five hundred ninety WIC participants from two Los Angeles, CA, WIC clinics were randomly assigned to receive in-person group education (n=359) or online education (n=231). Education focused on ways to reduce breakfast skipping and promoted healthy options at breakfast for parents and their 1- to 5-year-old children participating in WIC. Questionnaires assessing breakfast-related knowledge, attitudes, and behaviors were administered before and after education, and at a 2- to 4-month follow-up. Changes within and between in-person and online groups were compared using t tests and χ(2) tests. Analysis of covariance and generalized estimating equations were used to assess differences in change between groups. Changes in knowledge between pretest and follow-up at 2 to 4 months were similar between groups. Both groups reported reductions in barriers to eating breakfast due to time constraints, not having enough foods at home, and difficulty with preparation. Increases in the frequency of eating breakfast were greater for both the parent (P=0.0007) and child (P=0.01) in the online group compared with the in-person group during the same time points. Overall, this study demonstrates that both in-person and online nutrition education were effective in increasing breakfast-related knowledge in WIC participants, reducing breakfast skipping, and improving other breakfast-related behaviors, showing the potential usefulness for online education modalities for future WIC services. Copyright © 2016 Academy of Nutrition and Dietetics. Published by Elsevier Inc. All rights reserved.

  9. A Case Study on Organizational Culture and Its Role in the Creation of Organizational Change Efforts Within a Government Agency

    DTIC Science & Technology

    2010-03-01

    celebration often results in the unintentional reversion back to “old ways” as the meaningful changes have yet to be engrained within the organization’s...skip over stages often resulting in the need to go back to address the prior stages. In the following paragraphs, each of the eight stages is briefly...Another mistake made is having a team of individuals whose members have low credibility in the organization—although there may be the CEO in that

  10. Breakfast Blitz: An Innovative Nutrition Education Program

    ERIC Educational Resources Information Center

    Towery, Pamela C.; Nix, Elizabeth S.; Norman, Bilinda

    2014-01-01

    Childhood overweight and obesity are major problems in the United States, with important consequences for our nation's health and economy. Breakfast is considered the most important meal of the day, yet children, adolescents, and adults skip breakfast on a routine basis. This habit of breakfast skipping is related to weight gain, higher body…

  11. The Influence of Mathematical Ability and Morning Nutrition on Mental Arithmetic in Preadolescents: An ERP study.

    USDA-ARS?s Scientific Manuscript database

    The effects of eating or skipping breakfast on ERP correlates of mental arithmetic were studied in preadolescents differing in experience (age) and mathematical skills. Participants, randomly assigned to treatment [eat (B) or skip (SB) breakfast (each, n = 41)], were sub-grouped by age [8.8 yrs (B: ...

  12. Examining Predictors of Breakfast Skipping and Breakfast Program Use among Secondary School Students in the Compass Study

    ERIC Educational Resources Information Center

    Godin, Katelyn M.; Patte, Karen A.; Leatherdale, Scott T.

    2018-01-01

    Background: Many Canadian schools offer breakfast programs; however, students' engagement in these programs is low, while breakfast skipping is highly prevalent among youth. This study examined whether the availability of breakfast programs supports adolescents' regular breakfast eating, and identified characteristics of breakfast skippers who are…

  13. SKIPing with Head Start Teachers: Influence of T-SKIP on Object-Control Skills

    ERIC Educational Resources Information Center

    Brian, Ali; Goodway, Jacqueline D.; Logan, Jessica A.; Sutherland, Sue

    2017-01-01

    Purpose: Children from disadvantaged settings are at risk for delays in their object-control (OC) skills. Fundamental motor skill interventions, such as the Successful Kinesthetic Instruction for Preschoolers (SKIP) Program, are highly successful when led by motor development experts. However, few preschools employ such experts. This study…

  14. Skip-row Planting Patterns Stabilize Corn Grain Yields in the Central Great Plains

    USDA-ARS?s Scientific Manuscript database

    The highly variable climate of the Central Great Plains makes dryland corn (Zea mays) production a risky enterprise. Twenty-three field trials were conducted across the Central Great Plains from 2004 through 2006 to quantify the effect of various skip-row planting patterns and plant populations on g...

  15. Helping Struggling Students: The Impact of Three Instructional Interventions on College Students' Exam Scores and Exam-Skipping Behavior

    ERIC Educational Resources Information Center

    Thomas, Nichole Gibbs; Thomas, Antonio Lamar

    2018-01-01

    Whether instructional-communication feedback sent to struggling students and succeeding students following course exams would significantly increase their exam scores and significantly decrease their exam-skipping behavior relative to students in the control group was investigated. An experimenter-blind study utilizing feedback and the…

  16. Skipping on uneven ground: trailing leg adjustments simplify control and enhance robustness.

    PubMed

    Müller, Roy; Andrada, Emanuel

    2018-01-01

    It is known that humans intentionally choose skipping in special situations, e.g. when descending stairs or when moving in environments with lower gravity than on Earth. Although those situations involve uneven locomotion, the dynamics of human skipping on uneven ground have not yet been addressed. To find the reasons that may motivate this gait, we combined experimental data on humans with numerical simulations on a bipedal spring-loaded inverted pendulum model (BSLIP). To drive the model, the following parameters were estimated from nine subjects skipping across a single drop in ground level: leg lengths at touchdown, leg stiffness of both legs, aperture angle between legs, trailing leg angle at touchdown (leg landing first after flight phase), and trailing leg retraction speed. We found that leg adjustments in humans occur mostly in the trailing leg (low to moderate leg retraction during swing phase, reduced trailing leg stiffness, and flatter trailing leg angle at lowered touchdown). When transferring these leg adjustments to the BSLIP model, the capacity of the model to cope with sudden-drop perturbations increased.

  17. Effects of social determinants on food choice and skipping meals among Turkish adolescents.

    PubMed

    Soyer, Meral Turk; Ergin, Isil; Gursoy, Safak Taner

    2008-01-01

    To present data that contributes to understanding factors that influence food choice and skipping meals in adolescents. A cross sectional study is carried in selected high schools in Bornova. Study sample compromises of 527 students chosen randomly by class from a population of 2410 first year in high school students. Self-administered questionnaires containing sociodemographic determinants, self reported weight and height, food choices and meal patterns were used. A psychosocial factor that affects almost all of the students is the "taste and sensory perception of food". The second noticable factor is the "health and nutritious value of food". The time conserved and the convenience in the preparation of food is one of the lifestyle factors that affect more than half of the students. The cost of the food was also found to have an effect. Among the third group of factors categorized as "media", the leading factor is advertisement, effective in one third of the students. Among boys and girls, there was no statistical difference in the type of meal skipped. Living in Izmir for more than 10 years compared to less than ten years, being in a nuclear family to extended family, and belonging to the "owner" social class to "wage laborer" class also do not statistically differ with regard to skipping meals. However, the mother's and father's education level and having a working mother are associated with skipping meals. These results provide important evidence to support opportunities to positively influence the adoption of healthful eating.

  18. Identification of a novel exonic mutation at -13 from 5' splice site causing exon skipping in a girl with mitochondrial acetoacetyl-coenzyme A thiolase deficiency.

    PubMed Central

    Fukao, T; Yamaguchi, S; Wakazono, A; Orii, T; Hoganson, G; Hashimoto, T

    1994-01-01

    We identified a novel exonic mutation which causes exon skipping in the mitochondrial acetoacetyl-CoA thiolase (T2) gene from a girl with T2 deficiency (GK07). GK07 is a compound heterozygote; the maternal allele has a novel G to T transversion at position 1136 causing Gly379 to Val substitution (G379V) of the T2 precursor. In case of in vivo expression analysis, cells transfected with this mutant cDNA showed no evidence of restored T2 activity. The paternal allele was associated with exon 8 skipping at the cDNA level. At the gene level, a C to T transition causing Gln272 to termination codon (Q272STOP) was identified within exon 8, 13 bp from the 5' splice site of intron 8 in the paternal allele. The mRNA with Q272STOP could not be detected in GK07 fibroblasts, presumably because pre-mRNA with Q272STOP was unstable because of the premature termination. In vivo splicing experiments revealed that the exonic mutation caused partial skipping of exon 8. This substitution was thought to alter the secondary structure of T2 pre-mRNA around exon 8 and thus impede normal splicing. The role of exon sequences in the splicing mechanism is indicated by the exon skipping which occurred with an exonic mutation. Images PMID:7907600

  19. HnRNP C, YB-1 and hnRNP L coordinately enhance skipping of human MUSK exon 10 to generate a Wnt-insensitive MuSK isoform

    PubMed Central

    Nasrin, Farhana; Rahman, Mohammad Alinoor; Masuda, Akio; Ohe, Kenji; Takeda, Jun-ichi; Ohno, Kinji

    2014-01-01

    Muscle specific receptor tyrosine kinase (MuSK) is an essential postsynaptic transmembrane molecule that mediates clustering of acetylcholine receptors (AChR). MUSK exon 10 is alternatively skipped in human, but not in mouse. Skipping of this exon disrupts a cysteine-rich region (Fz-CRD), which is essential for Wnt-mediated AChR clustering. To investigate the underlying mechanisms of alternative splicing, we exploited block-scanning mutagenesis with human minigene and identified a 20-nucleotide block that contained exonic splicing silencers. Using RNA-affinity purification, mass spectrometry, and Western blotting, we identified that hnRNP C, YB-1 and hnRNP L are bound to MUSK exon 10. siRNA-mediated knockdown and cDNA overexpression confirmed the additive, as well as the independent, splicing suppressing effects of hnRNP C, YB-1 and hnRNP L. Antibody-mediated in vitro protein depletion and scanning mutagenesis additionally revealed that binding of hnRNP C to RNA subsequently promotes binding of YB-1 and hnRNP L to the immediate downstream sites and enhances exon skipping. Simultaneous tethering of two splicing trans-factors to the target confirmed the cooperative effect of YB-1 and hnRNP L on hnRNP C-mediated exon skipping. Search for a similar motif in the human genome revealed nine alternative exons that were individually or coordinately regulated by hnRNP C and YB-1. PMID:25354590

  20. Health, behavioral, cognitive, and social correlates of breakfast skipping among women living in socioeconomically disadvantaged neighborhoods.

    PubMed

    Smith, Kylie J; McNaughton, Sarah A; Cleland, Verity J; Crawford, David; Ball, Kylie

    2013-11-01

    Breakfast skipping is a potentially modifiable behavior that has negative effects on health and is socioeconomically patterned. This study aimed to examine the intrapersonal (health, behavioral, and cognitive) and social factors associated with breakfast skipping. Nonpregnant women (n = 4123) aged 18-45 y from socioeconomically disadvantaged neighborhoods throughout Victoria, Australia, completed a postal questionnaire. Sociodemographic characteristics, diet, physical activity, sedentary behaviors, and cognitive and social factors were assessed by self-report. Breakfast skipping was defined in 2 ways: 1) "rarely/never" eating breakfast (n = 498) and 2) eating breakfast ≤2 d/wk (includes those who rarely/never ate breakfast; n = 865). Poisson regression was used to calculate prevalence ratios and linear trends, adjusting for covariates. The P values for linear trends are reported below. Compared with breakfast consumers, women who reported rarely/never eating breakfast tended to have poorer self-rated health (P-trend < 0.001), be current smokers (P-trend < 0.001), pay less attention to health (P-trend < 0.001), not prioritize their own healthy eating when busy looking after their family (P-trend < 0.001), have less nutrition knowledge (P-trend < 0.001), and a lower proportion were trying to control their weight (P-trend < 0.020). When breakfast skipping was defined as eating breakfast ≤2 d/wk, additional associations were found for having lower leisure-time physical activity (P-trend = 0.012) and less self-efficacy for eating a healthy diet (P-trend < 0.043). In conclusion, a range of intrapersonal and social factors were significantly associated with breakfast skipping among women living in socioeconomically disadvantaged areas. Acknowledging the cross-sectional design and need for causal confirmation, programs that aim to promote breakfast consumption in this population group should consider targeting family-related barriers to healthy eating and nutrition knowledge.

  1. Cwf16p Associating with the Nineteen Complex Ensures Ordered Exon Joining in Constitutive Pre-mRNA Splicing in Fission Yeast

    PubMed Central

    Sasaki-Haraguchi, Noriko; Ikuyama, Takeshi; Yoshii, Shogo; Takeuchi-Andoh, Tomoko; Frendewey, David; Tani, Tokio

    2015-01-01

    Exons are ligated in an ordered manner without the skipping of exons in the constitutive splicing of pre-mRNAs with multiple introns. To identify factors ensuring ordered exon joining in constitutive pre-mRNA splicing, we previously screened for exon skipping mutants in Schizosaccharomyces pombe using a reporter plasmid, and characterized three exon skipping mutants named ods1 (ordered splicing 1), ods2, and ods3, the responsible genes of which encode Prp2/U2AF59, U2AF23, and SF1, respectively. They form an SF1-U2AF59-U2AF23 complex involved in recognition of the branch and 3′ splice sites in pre-mRNA. In the present study, we identified a fourth ods mutant, ods4, which was isolated in an exon-skipping screen. The ods4 + gene encodes Cwf16p, which interacts with the NineTeen Complex (NTC), a complex thought to be involved in the first catalytic step of the splicing reaction. We isolated two multi-copy suppressors for the ods4-1 mutation, Srp2p, an SR protein essential for pre-mRNA splicing, and Tif213p, a translation initiation factor, in S. pombe. The overexpression of Srp2p suppressed the exon-skipping phenotype of all ods mutants, whereas Tif213p suppressed only ods4-1, which has a mutation in the translational start codon of the cwf16 gene. We also showed that the decrease in the transcriptional elongation rate induced by drug treatment suppressed exon skipping in ods4-1. We propose that Cwf16p/NTC participates in the early recognition of the branch and 3′ splice sites and cooperates with the SF1-U2AF59-U2AF23 complex to maintain ordered exon joining. PMID:26302002

  2. Orion Entry Handling Qualities Assessments

    NASA Technical Reports Server (NTRS)

    Bihari, B.; Tiggers, M.; Strahan, A.; Gonzalez, R.; Sullivan, K.; Stephens, J. P.; Hart, J.; Law, H., III; Bilimoria, K.; Bailey, R.

    2011-01-01

    The Orion Command Module (CM) is a capsule designed to bring crew back from the International Space Station (ISS), the moon and beyond. The atmospheric entry portion of the flight is deigned to be flown in autopilot mode for nominal situations. However, there exists the possibility for the crew to take over manual control in off-nominal situations. In these instances, the spacecraft must meet specific handling qualities criteria. To address these criteria two separate assessments of the Orion CM s entry Handling Qualities (HQ) were conducted at NASA s Johnson Space Center (JSC) using the Cooper-Harper scale (Cooper & Harper, 1969). These assessments were conducted in the summers of 2008 and 2010 using the Advanced NASA Technology Architecture for Exploration Studies (ANTARES) six degree of freedom, high fidelity Guidance, Navigation, and Control (GN&C) simulation. This paper will address the specifics of the handling qualities criteria, the vehicle configuration, the scenarios flown, the simulation background and setup, crew interfaces and displays, piloting techniques, ratings and crew comments, pre- and post-fight briefings, lessons learned and changes made to improve the overall system performance. The data collection tools, methods, data reduction and output reports will also be discussed. The objective of the 2008 entry HQ assessment was to evaluate the handling qualities of the CM during a lunar skip return. A lunar skip entry case was selected because it was considered the most demanding of all bank control scenarios. Even though skip entry is not planned to be flown manually, it was hypothesized that if a pilot could fly the harder skip entry case, then they could also fly a simpler loads managed or ballistic (constant bank rate command) entry scenario. In addition, with the evaluation set-up of multiple tasks within the entry case, handling qualities ratings collected in the evaluation could be used to assess other scenarios such as the constant bank angle maintenance case. The 2008 entry assessment was divided into two sections (see Figure 1). Entry I was the first, high speed portion of a lunar return and Entry II was the second, lower speed portion of a lunar return, which is similar (but not identical) to a typical ISS return.

  3. Chronic Stress Is Associated with Indicators of Diet Quality in Habitual Breakfast Skippers.

    PubMed

    Widaman, Adrianne M; Witbracht, Megan G; Forester, Shavawn M; Laugero, Kevin D; Keim, Nancy L

    2016-11-01

    Previous studies suggest skipping breakfast is associated with lower diet quality, but possible reasons underlying this relationship are not clear. Our aim was to determine the relationship between chronic stress and variations in diet quality in the context of breakfast eating or breakfast skipping. Based on morning eating habits, 40 breakfast eaters and 35 breakfast skippers participated in a cross-sectional study. Diet assessment was based on unannounced 24-hour recalls. Women, ages 18 to 45 years, with a body mass index (calculated as kg/m 2 ) <40 were recruited in the greater Sacramento, CA, area between 2009 and 2013. Only women who consistently ate or skipped breakfast were enrolled. Compliance with the 2010 Dietary Guidelines for Americans was measured using the Healthy Eating Index 2010 (HEI-2010). Stress and executive function were evaluated with validated questionnaires and a computer-based task, respectively. Diet characteristics of breakfast eating and breakfast skipping were evaluated as nutrient densities (amounts per 1,000 kcal) and compared using a one-way analysis of covariance, with body mass index as covariate. Diet and stress variable associations were assessed using Pearson correlations. Despite no observed differences in daily energy intake between breakfast skipping and breakfast eating, overall diet quality (P=0.001), whole grains (P=0.002), fruit (P=0.002), empty calories (P=0.050), fiber (P=0.001), calcium (P=0.001), potassium (P=0.033), and folate (P=0.013) intakes were higher in breakfast eating. In the evening, breakfast skipping consumed more added sugars (P=0.012) and saturated fat (P=0.006). In breakfast skipping, reported stress was associated with empty calories (r=-0.39; P=0.027) and evening intake of added sugars (r=0.501; P=0.005). These relationships were not observed in breakfast eating. Breakfast skippers were less likely to meet the Dietary Guidelines for Americans and consumed more empty calories at night. Chronic stress was related to evening eating choices and overall empty calories in the diet of breakfast skippers, whereas breakfast eaters' dietary intake did not appear to be affected by chronic stress. Copyright © 2016 Academy of Nutrition and Dietetics. Published by Elsevier Inc. All rights reserved.

  4. Pedometer Accuracy in Elementary School Children while Walking, Skipping, Galloping, and Sliding

    ERIC Educational Resources Information Center

    Smith, John Damien; Schroeder, Cynthia Ann

    2010-01-01

    The purpose of this study was to examine the accuracy of the SW-701 (Yamax Corporation, Tokyo, Japan) and NL-800 (New-Lifestyles, Inc., Lee's Summit, Missouri, USA) pedometer in fifth-grade students while walking, skipping, galloping, sliding, and hopping. Counts registered by both pedometer models were significantly lower than actual counts while…

  5. The Relationships of Balance and Bilateral Coordination to Skipping in Kindergarten Children.

    ERIC Educational Resources Information Center

    Hockersmith, Mary R.; Folsom-Meek, Sherry L.

    The purpose of this study was to examine the relationship of balance and bilateral coordination to the fundamental locomotor pattern of skipping in 5- and 6-year old children. Subjects were kindergarten students (N=30) who were attending an elementary school in the suburban Kansas City area. The investigators used items from the…

  6. Effect of skip row planting configuration on grain sorghum water use

    USDA-ARS?s Scientific Manuscript database

    Grain sorghum (Sorghum bicolor L. [Moench]) is grown as a dryland crop in the semi-arid Central Great Plains. Growing the crop in a skip row configuration has been proposed as a means of delaying water use during the vegetative stage such that more water will be available to be used during the more ...

  7. 75 FR 5866 - Proposed Collection; Comment Request for Form 4768

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-02-04

    ...: Application for Extension of Time To File a Return and/or Pay U.S. Estate (and Generation-Skipping Transfer... 4768, Application for Extension of Time To File a Return and/or Pay U.S. Estate (and Generation-Skipping Transfer) Taxes. DATES: Written comments should be received on or before April 5, 2010 to be...

  8. Development and evaluation of an attractive self-marking ovitrap to measure dispersal and determine skip oviposition in Aedes albopictus(Diptera:Culicidae) field populations

    USDA-ARS?s Scientific Manuscript database

    Aedes albopictus (Skuse) is a container-breeding mosquito of public health importance. Its oviposition behavior has been assessed in outdoor conditions, but only with laboratory-reared specimens. We used an attractive self-marking oviposition device to assess Ae. albopictus skip oviposition behavi...

  9. Modeling Skipped and Not-Reached Items Using IRTrees

    ERIC Educational Resources Information Center

    Debeer, Dries; Janssen, Rianne; De Boeck, Paul

    2017-01-01

    When dealing with missing responses, two types of omissions can be discerned: items can be skipped or not reached by the test taker. When the occurrence of these omissions is related to the proficiency process the missingness is nonignorable. The purpose of this article is to present a tree-based IRT framework for modeling responses and omissions…

  10. Word Skipping During Sentence Reading: Effects of Lexicality on Parafoveal Processing

    PubMed Central

    Choi, Wonil; Gordon, Peter C.

    2013-01-01

    Two experiments examined how lexical status affects the targeting of saccades during reading by using the boundary technique to vary independently the content of a letter string when seen in parafoveal preview and when directly fixated. Experiment 1 measured the skipping rate for a target word embedded in a sentence under three parafoveal preview conditions: full preview (e.g. brain-brain), pseudohomophone preview (e.g. brane-brain), and orthographic nonword control preview (e.g. brant-brain); in the first condition the preview string was always an English word while in the second and third conditions it was always a nonword. Experiment 2 investigated three conditions where the preview string was always a word: full preview (e.g. beach-beach), homophone preview (e.g. beech-beach), and orthographic control preview (e.g. bench-beach). None of the letter string manipulations used to create the preview conditions in the experiments disrupted sub-lexical orthographic or phonological patterns. In Experiment 1 higher skipping rates were observed for the full (lexical) preview condition, which consisted of a word, compared to the nonword preview conditions (pseudohomophone and orthographic-control). In contrast Experiment 2 showed no difference in skipping rates across the three types of lexical preview conditions (full, homophone and orthographic control), though preview type did influence reading times. This pattern indicates that skipping depends not only on the presence of disrupted sub-lexical patterns of orthography or phonology but is also critically dependent on processes that are sensitive to the lexical status of letter strings in the parafovea. PMID:24170376

  11. Oxidative Stress Triggers Body-Wide Skipping of Multiple Exons of the Spinal Muscular Atrophy Gene

    PubMed Central

    Seo, Joonbae; Singh, Natalia N.; Ottesen, Eric W.; Sivanesan, Senthilkumar; Shishimorova, Maria; Singh, Ravindra N.

    2016-01-01

    Humans carry two nearly identical copies of Survival Motor Neuron gene: SMN1 and SMN2. Loss of SMN1 leads to spinal muscular atrophy (SMA), the most frequent genetic cause of infant mortality. While SMN2 cannot compensate for the loss of SMN1 due to predominant skipping of exon 7, correction of SMN2 exon 7 splicing holds the promise of a cure for SMA. Previously, we used cell-based models coupled with a multi-exon-skipping detection assay (MESDA) to demonstrate the vulnerability of SMN2 exons to aberrant splicing under the conditions of oxidative stress (OS). Here we employ a transgenic mouse model and MESDA to examine the OS-induced splicing regulation of SMN2 exons. We induced OS using paraquat that is known to trigger production of reactive oxygen species and cause mitochondrial dysfunction. We show an overwhelming co-skipping of SMN2 exon 5 and exon 7 under OS in all tissues except testis. We also show that OS increases skipping of SMN2 exon 3 in all tissues except testis. We uncover several new SMN2 splice isoforms expressed at elevated levels under the conditions of OS. We analyze cis-elements and transacting factors to demonstrate the diversity of mechanisms for splicing misregulation under OS. Our results of proteome analysis reveal downregulation of hnRNP H as one of the potential consequences of OS in brain. Our findings suggest SMN2 as a sensor of OS with implications to SMA and other diseases impacted by low levels of SMN protein. PMID:27111068

  12. Clinical characterisation of Becker muscular dystrophy patients predicts favourable outcome in exon-skipping therapy.

    PubMed

    van den Bergen, J C; Schade van Westrum, S M; Dekker, L; van der Kooi, A J; de Visser, M; Wokke, B H A; Straathof, C S; Hulsker, M A; Aartsma-Rus, A; Verschuuren, J J; Ginjaar, H B

    2014-01-01

    Duchenne and Becker muscular dystrophy (DMD/BMD) are both caused by mutations in the DMD gene. Out-of-frame mutations in DMD lead to absence of the dystrophin protein, while in-frame BMD mutations cause production of internally deleted dystrophin. Clinically, patients with DMD loose ambulance around the age of 12, need ventilatory support at their late teens and die in their third or fourth decade due to pulmonary or cardiac failure. BMD has a more variable disease course. The disease course of patients with BMD with specific mutations could be very informative to predict the outcome of the exon-skipping therapy, aiming to restore the reading-frame in patients with DMD. Patients with BMD with a mutation equalling a DMD mutation after successful exon skipping were selected from the Dutch Dystrophinopathy Database. Information about disease course was gathered through a standardised questionnaire. Cardiac data were collected from medical correspondence and a previous study on cardiac function in BMD. Forty-eight patients were included, representing 11 different mutations. Median age of patients was 43 years (range 6-67). Nine patients were wheelchair users (26-56 years). Dilated cardiomyopathy was present in 7/36 patients. Only one patient used ventilatory support. Three patients had died at the age of 45, 50 and 76 years, respectively. This study provides mutation specific data on the course of disease in patients with BMD. It shows that the disease course of patients with BMD, with a mutation equalling a 'skipped' DMD mutation is relatively mild. This finding strongly supports the potential benefit of exon skipping in patients with DMD.

  13. New architecture for dynamic frame-skipping transcoder.

    PubMed

    Fung, Kai-Tat; Chan, Yui-Lam; Siu, Wan-Chi

    2002-01-01

    Transcoding is a key technique for reducing the bit rate of a previously compressed video signal. A high transcoding ratio may result in an unacceptable picture quality when the full frame rate of the incoming video bitstream is used. Frame skipping is often used as an efficient scheme to allocate more bits to the representative frames, so that an acceptable quality for each frame can be maintained. However, the skipped frame must be decompressed completely, which might act as a reference frame to nonskipped frames for reconstruction. The newly quantized discrete cosine transform (DCT) coefficients of the prediction errors need to be re-computed for the nonskipped frame with reference to the previous nonskipped frame; this can create undesirable complexity as well as introduce re-encoding errors. In this paper, we propose new algorithms and a novel architecture for frame-rate reduction to improve picture quality and to reduce complexity. The proposed architecture is mainly performed on the DCT domain to achieve a transcoder with low complexity. With the direct addition of DCT coefficients and an error compensation feedback loop, re-encoding errors are reduced significantly. Furthermore, we propose a frame-rate control scheme which can dynamically adjust the number of skipped frames according to the incoming motion vectors and re-encoding errors due to transcoding such that the decoded sequence can have a smooth motion as well as better transcoded pictures. Experimental results show that, as compared to the conventional transcoder, the new architecture for frame-skipping transcoder is more robust, produces fewer requantization errors, and has reduced computational complexity.

  14. Nonparametric Multiple Imputation for Questionnaires with Individual Skip Patterns and Constraints: The Case of Income Imputation in The National Educational Panel Study

    ERIC Educational Resources Information Center

    Aßmann, Christian; Würbach, Ariane; Goßmann, Solange; Geissler, Ferdinand; Bela, Anika

    2017-01-01

    Large-scale surveys typically exhibit data structures characterized by rich mutual dependencies between surveyed variables and individual-specific skip patterns. Despite high efforts in fieldwork and questionnaire design, missing values inevitably occur. One approach for handling missing values is to provide multiply imputed data sets, thus…

  15. Do breakfast skipping and breakfast type affect energy intake, nutrient intake, nutrient adequacy, and diet quality in young adults? NHANES 1999-2002

    USDA-ARS?s Scientific Manuscript database

    The objective of this study was to assess the impact of breakfast skipping and type of breakfast consumed on energy/nutrient intake, nutrient adequacy, and diet quality using a cross-sectional design. The setting was The National Health and Nutrition Examination Survey (NHANES), 1999-2002. The sub...

  16. The relationship of breakfast skipping and type of breakfast consumed with overweight/obesity, abdominal obesity, other cardiometabolic risk factors and the metabolic syndrome in young adults. NHANES 1999-2006

    USDA-ARS?s Scientific Manuscript database

    The goal of this study was to examine the association between breakfast skipping and type of breakfast consumed with overweight /obesity, abdominal obesity, other cardiometabolic risk factors and the metabolic syndrome. Three breakfast groups were identified (breakfast skippers, ready-to-eat-cereal ...

  17. Variation in Student Skipping: A Study of Six High Schools. Final Report.

    ERIC Educational Resources Information Center

    Duckworth, Kenneth; deJung, John

    Data were obtained from six high schools in the Northwest during 1984 and 1985 to determine the variation in students' reports of the frequency with which they skip school and cut classes. The study was guided by the advice of school administrators and a theoretical model of the influences or levels of participation in work organizations. Evidence…

  18. The Indirect Effect of Alcohol Use on GPA in First-Semester College Students: The Mediating Role of Academic Effort

    ERIC Educational Resources Information Center

    Conway, James M.; DiPlacido, Joanne

    2015-01-01

    This study focused on first-semester college students, investigating (a) indirect effects of aggregate alcohol use on grade point average (GPA) through academic effort (skipping class and time on schoolwork) and (b) daily effects of alcohol use on reduced effort. Eighty students reported daily alcohol use and academic effort (skipping class and…

  19. Cal OES Internet Home Cal OES Home

    Science.gov Websites

    Sign In You may be trying to access this site from a secured browser on the server. Please enable scripts and reload this page. Turn on more accessible mode Turn off more accessible mode Skip Ribbon Commands Skip to main content Turn off Animations Turn on Animations image of CA.gov logo image of Cal OES

  20. Translational and regulatory challenges for exon skipping therapies.

    PubMed

    Aartsma-Rus, Annemieke; Ferlini, Alessandra; Goemans, Nathalie; Pasmooij, Anna M G; Wells, Dominic J; Bushby, Katerine; Vroom, Elizabeth; Balabanov, Pavel

    2014-10-01

    Several translational challenges are currently impeding the therapeutic development of antisense-mediated exon skipping approaches for rare diseases. Some of these are inherent to developing therapies for rare diseases, such as small patient numbers and limited information on natural history and interpretation of appropriate clinical outcome measures. Others are inherent to the antisense oligonucleotide (AON)-mediated exon skipping approach, which employs small modified DNA or RNA molecules to manipulate the splicing process. This is a new approach and only limited information is available on long-term safety and toxicity for most AON chemistries. Furthermore, AONs often act in a mutation-specific manner, in which case multiple AONs have to be developed for a single disease. A workshop focusing on preclinical development, trial design, outcome measures, and different forms of marketing authorization was organized by the regulatory models and biochemical outcome measures working groups of Cooperation of Science and Technology Action: "Networking towards clinical application of antisense-mediated exon skipping for rare diseases." The workshop included participants from patient organizations, academia, and members of staff from the European Medicine Agency and Medicine Evaluation Board (the Netherlands). This statement article contains the key outcomes of this meeting.

  1. Kinematic analysis of rope skipper's stability

    NASA Astrophysics Data System (ADS)

    Ab Ghani, Nor Atikah; Rambely, Azmin Sham

    2014-06-01

    There are various kinds of jumping that can be done while performing rope skipping activity. This activity was always associated with injury. But, if the rope skipper can perform the activity in a right way, it is believed that the injury might be reduced. The main purpose of this paper is to observe the stability of rope skipper from a biomechanics perspective, which are the centre of mass, angle at the ankle, knee and hip joints and also the trajectory for the ipsilateral leg between the two types of skip which is one leg and two legs. Six healthy, physically active subject, two males and four females (age: 8.00±1.25 years, weight: 17.90±6.85 kg and height: 1.22±0.08 m) participated in this study. Kinematic data of repeated five cycles of rope skipping activity was captured by using Vicon Nexus system. Based on the data collected, skipping with two legs shows more stable behavior during preparation, flight and landing phases. It is concluded that landing on the balls of the feet, lowering the trajectory positions of the feet from the ground as well as flexion of each joint which would reduce the injury while landing.

  2. Design and reliability of a MEMS thermal rotary actuator.

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Baker, Michael Sean; Corwin, Alex David

    2007-09-01

    A new rotary MEMS actuator has been developed and tested at Sandia National Laboratories that utilizes a linear thermal actuator as the drive mechanism. This actuator was designed to be a low-voltage, high-force alternative to the existing electrostatic torsional ratcheting actuator (TRA) [1]. The new actuator, called the Thermal Rotary Actuator (ThRA), is conceptually much simpler than the TRA and consists of a gear on a hub that is turned by a linear thermal actuator [2] positioned outside of the gear. As seen in Figure 1, the gear is turned through a ratcheting pawl, with anti-reverse pawls positioned around themore » gear for unidirectional motion (see Figure 1). A primary consideration in the design of the ThRA was the device reliability and in particular, the required one-to-one relationship between the ratcheting output motion and the electrical input signal. The electrostatic TRA design has been shown to both over-drive and under-drive relative to the number of input pulses [3]. Two different ThRA designs were cycle tested to measure the skip rate. This was done in an automated test setup by using pattern matching to measure the angle of rotation of the output gear after a defined number of actuation pulses. By measuring this gear angle over time, the number of skips can be determined. Figure 2 shows a picture of the ThRA during testing, with the pattern-matching features highlighted. In the first design tested, it was found that creep in the thermal actuator limited the number of skip-free cycles, as the rest position of the actuator would creep forward enough to prevent the counter-rotation pawls from fully engaging (Figure 3). Even with this limitation, devices were measured with up to 100 million cycles with no skipping. A design modification was made to reduce the operating temperature of the thermal actuator which has been shown in a previous study [2] to reduce the creep rate. In addition, changes were made to the drive ratchet design and actuation direction to increase the available output force. This new design was tested and shown to operate in one case out to greater than 360 million cycles without any skipping, after which the test was stopped without failure. The output force was also measured as a function of input voltage (Figure 4), and shown to be higher than the previous design. The maximum force shown in the figure is a limit of the gauge used, not the actuator itself. Continued work for this design will focus on understanding the actuator performance while driving a load, as all current tests were performed with no load on the output gear.« less

  3. Deep learning meets ontologies: experiments to anchor the cardiovascular disease ontology in the biomedical literature.

    PubMed

    Arguello Casteleiro, Mercedes; Demetriou, George; Read, Warren; Fernandez Prieto, Maria Jesus; Maroto, Nava; Maseda Fernandez, Diego; Nenadic, Goran; Klein, Julie; Keane, John; Stevens, Robert

    2018-04-12

    Automatic identification of term variants or acceptable alternative free-text terms for gene and protein names from the millions of biomedical publications is a challenging task. Ontologies, such as the Cardiovascular Disease Ontology (CVDO), capture domain knowledge in a computational form and can provide context for gene/protein names as written in the literature. This study investigates: 1) if word embeddings from Deep Learning algorithms can provide a list of term variants for a given gene/protein of interest; and 2) if biological knowledge from the CVDO can improve such a list without modifying the word embeddings created. We have manually annotated 105 gene/protein names from 25 PubMed titles/abstracts and mapped them to 79 unique UniProtKB entries corresponding to gene and protein classes from the CVDO. Using more than 14 M PubMed articles (titles and available abstracts), word embeddings were generated with CBOW and Skip-gram. We setup two experiments for a synonym detection task, each with four raters, and 3672 pairs of terms (target term and candidate term) from the word embeddings created. For Experiment I, the target terms for 64 UniProtKB entries were those that appear in the titles/abstracts; Experiment II involves 63 UniProtKB entries and the target terms are a combination of terms from PubMed titles/abstracts with terms (i.e. increased context) from the CVDO protein class expressions and labels. In Experiment I, Skip-gram finds term variants (full and/or partial) for 89% of the 64 UniProtKB entries, while CBOW finds term variants for 67%. In Experiment II (with the aid of the CVDO), Skip-gram finds term variants for 95% of the 63 UniProtKB entries, while CBOW finds term variants for 78%. Combining the results of both experiments, Skip-gram finds term variants for 97% of the 79 UniProtKB entries, while CBOW finds term variants for 81%. This study shows performance improvements for both CBOW and Skip-gram on a gene/protein synonym detection task by adding knowledge formalised in the CVDO and without modifying the word embeddings created. Hence, the CVDO supplies context that is effective in inducing term variability for both CBOW and Skip-gram while reducing ambiguity. Skip-gram outperforms CBOW and finds more pertinent term variants for gene/protein names annotated from the scientific literature.

  4. Effect of Bearing Defects

    DTIC Science & Technology

    1974-12-01

    defect types were tested at various levels: Comet- Tail, Dig-Nick, Dirt Brinell, Grind-Skip Lines, Impingement, Orange Peel , Pit, Scratch and "Liney...Shallow irregular indentation of surface. <.0015 max. dim. -(<.0008)*’ Otange Peel Pebbly appearance of raceway surface. Small ** Comet Tail Pit...scratch; dig-nick; impingement; grind-skip lines; and orange peel . The data obtained indicated that these defects in most cases, affected bearing

  5. 40 CFR 60.483-2a - Alternative standards for valves-skip period leak detection and repair.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    .../vapor and light liquid service. (4) If the percent of valves leaking is greater than 2.0, the owner or... Industry for Which Construction, Reconstruction, or Modification Commenced After November 7, 2006 § 60.483... percent of valves leaking equal to or less than 2.0, an owner or operator may begin to skip 1 of the...

  6. 40 CFR 60.483-2a - Alternative standards for valves-skip period leak detection and repair.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    .../vapor and light liquid service. (4) If the percent of valves leaking is greater than 2.0, the owner or... Industry for Which Construction, Reconstruction, or Modification Commenced After November 7, 2006 § 60.483... percent of valves leaking equal to or less than 2.0, an owner or operator may begin to skip 1 of the...

  7. 40 CFR 60.483-2a - Alternative standards for valves-skip period leak detection and repair.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    .../vapor and light liquid service. (4) If the percent of valves leaking is greater than 2.0, the owner or... Industry for Which Construction, Reconstruction, or Modification Commenced After November 7, 2006 § 60.483... percent of valves leaking equal to or less than 2.0, an owner or operator may begin to skip 1 of the...

  8. 40 CFR 60.483-2a - Alternative standards for valves-skip period leak detection and repair.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    .../vapor and light liquid service. (4) If the percent of valves leaking is greater than 2.0, the owner or... Industry for Which Construction, Reconstruction, or Modification Commenced After November 7, 2006 § 60.483... percent of valves leaking equal to or less than 2.0, an owner or operator may begin to skip 1 of the...

  9. 40 CFR 60.483-2a - Alternative standards for valves-skip period leak detection and repair.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    .../vapor and light liquid service. (4) If the percent of valves leaking is greater than 2.0, the owner or... Industry for Which Construction, Reconstruction, or Modification Commenced After November 7, 2006 § 60.483... percent of valves leaking equal to or less than 2.0, an owner or operator may begin to skip 1 of the...

  10. The Effect of High- and Low-Frequency Previews and Sentential Fit on Word Skipping during Reading

    ERIC Educational Resources Information Center

    Angele, Bernhard; Laishley, Abby E.; Rayner, Keith; Liversedge, Simon P.

    2014-01-01

    In a previous gaze-contingent boundary experiment, Angele and Rayner (2013) found that readers are likely to skip a word that appears to be the definite article "the" even when syntactic constraints do not allow for articles to occur in that position. In the present study, we investigated whether the word frequency of the preview of a…

  11. Dystrophin quantification and clinical correlations in Becker muscular dystrophy: implications for clinical trials.

    PubMed

    Anthony, Karen; Cirak, Sebahattin; Torelli, Silvia; Tasca, Giorgio; Feng, Lucy; Arechavala-Gomeza, Virginia; Armaroli, Annarita; Guglieri, Michela; Straathof, Chiara S; Verschuuren, Jan J; Aartsma-Rus, Annemieke; Helderman-van den Enden, Paula; Bushby, Katherine; Straub, Volker; Sewry, Caroline; Ferlini, Alessandra; Ricci, Enzo; Morgan, Jennifer E; Muntoni, Francesco

    2011-12-01

    Duchenne muscular dystrophy is caused by mutations in the DMD gene that disrupt the open reading frame and prevent the full translation of its protein product, dystrophin. Restoration of the open reading frame and dystrophin production can be achieved by exon skipping using antisense oligonucleotides targeted to splicing elements. This approach aims to transform the Duchenne muscular dystrophy phenotype to that of the milder disorder, Becker muscular dystrophy, typically caused by in-frame dystrophin deletions that allow the production of an internally deleted but partially functional dystrophin. There is ongoing debate regarding the functional properties of the different internally deleted dystrophins produced by exon skipping for different mutations; more insight would be valuable to improve and better predict the outcome of exon skipping clinical trials. To this end, we have characterized the clinical phenotype of 17 patients with Becker muscular dystrophy harbouring in-frame deletions relevant to on-going or planned exon skipping clinical trials for Duchenne muscular dystrophy and correlated it to the levels of dystrophin, and dystrophin-associated protein expression. The cohort of 17 patients, selected exclusively on the basis of their genotype, included 4 asymptomatic, 12 mild and 1 severe patient. All patients had dystrophin levels of >40% of control and significantly higher dystrophin (P = 0.013), β-dystroglycan (P = 0.025) and neuronal nitric oxide synthase (P = 0.034) expression was observed in asymptomatic individuals versus symptomatic patients with Becker muscular dystrophy. Furthermore, grouping the patients by deletion, patients with Becker muscular dystrophy with deletions with an end-point of exon 51 (the skipping of which could rescue the largest group of Duchenne muscular dystrophy deletions) showed significantly higher dystrophin levels (P = 0.034) than those with deletions ending with exon 53. This is the first quantitative study on both dystrophin and dystrophin-associated protein expression in patients with Becker muscular dystrophy with deletions relevant for on-going exon skipping trials in Duchenne muscular dystrophy. Taken together, our results indicate that all varieties of internally deleted dystrophin assessed in this study have the functional capability to provide a substantial clinical benefit to patients with Duchenne muscular dystrophy.

  12. Dystrophin quantification and clinical correlations in Becker muscular dystrophy: implications for clinical trials

    PubMed Central

    Anthony, Karen; Cirak, Sebahattin; Torelli, Silvia; Tasca, Giorgio; Feng, Lucy; Arechavala-Gomeza, Virginia; Armaroli, Annarita; Guglieri, Michela; Straathof, Chiara S.; Verschuuren, Jan J.; Aartsma-Rus, Annemieke; Helderman-van den Enden, Paula; Bushby, Katherine; Straub, Volker; Sewry, Caroline; Ferlini, Alessandra; Ricci, Enzo; Morgan, Jennifer E.

    2011-01-01

    Duchenne muscular dystrophy is caused by mutations in the DMD gene that disrupt the open reading frame and prevent the full translation of its protein product, dystrophin. Restoration of the open reading frame and dystrophin production can be achieved by exon skipping using antisense oligonucleotides targeted to splicing elements. This approach aims to transform the Duchenne muscular dystrophy phenotype to that of the milder disorder, Becker muscular dystrophy, typically caused by in-frame dystrophin deletions that allow the production of an internally deleted but partially functional dystrophin. There is ongoing debate regarding the functional properties of the different internally deleted dystrophins produced by exon skipping for different mutations; more insight would be valuable to improve and better predict the outcome of exon skipping clinical trials. To this end, we have characterized the clinical phenotype of 17 patients with Becker muscular dystrophy harbouring in-frame deletions relevant to on-going or planned exon skipping clinical trials for Duchenne muscular dystrophy and correlated it to the levels of dystrophin, and dystrophin-associated protein expression. The cohort of 17 patients, selected exclusively on the basis of their genotype, included 4 asymptomatic, 12 mild and 1 severe patient. All patients had dystrophin levels of >40% of control and significantly higher dystrophin (P = 0.013), β-dystroglycan (P = 0.025) and neuronal nitric oxide synthase (P = 0.034) expression was observed in asymptomatic individuals versus symptomatic patients with Becker muscular dystrophy. Furthermore, grouping the patients by deletion, patients with Becker muscular dystrophy with deletions with an end-point of exon 51 (the skipping of which could rescue the largest group of Duchenne muscular dystrophy deletions) showed significantly higher dystrophin levels (P = 0.034) than those with deletions ending with exon 53. This is the first quantitative study on both dystrophin and dystrophin-associated protein expression in patients with Becker muscular dystrophy with deletions relevant for on-going exon skipping trials in Duchenne muscular dystrophy. Taken together, our results indicate that all varieties of internally deleted dystrophin assessed in this study have the functional capability to provide a substantial clinical benefit to patients with Duchenne muscular dystrophy. PMID:22102647

  13. Effect of Midmorning Puree Snacks on Subjective Appetite, Food Intake, and Glycemic and Insulin Responses in Healthy Adults.

    PubMed

    Guo, Qing; Totosy de Zepetnek, Julia; Chang, Jennifer; Hayden, Julia; Crozier, Stephen J; Mongia, Gagan; Rousseau, Dérick; Bellissimo, Nick

    2018-04-27

    Dietary pattern changes, as a part of a healthy lifestyle, may improve weight management. The objective of this study was to examine the effect of midmorning puree snacks varying in macronutrient composition and energy content on subjective appetite, food intake, and glycemic and insulin responses in healthy adults. In a randomized, repeated measures crossover design, 6 treatments (snack skipping and purees: control [186 kcal], maltodextrin [272 kcal], whey protein [201 kcal], oat [276 kcal], and coconut oil [276 kcal]) were administered to 23 normal weight adults (n = 14 males, n = 9 females). Subjective appetite, blood glucose, and insulin responses were measured at regular intervals for 2 hours immediately followed by an ad libitum pizza lunch. In vitro digestion experiments were conducted to corroborate results of the human trial. Compared to snack skipping, all snack treatments similarly reduced subjective average appetite (net area under the curve), but only oat (p < 0.032) and coconut oil (p < 0.031) purees significantly decreased test meal food intake. However, caloric compensation did not differ among snack treatments (p < 0.73). Both blood glucose (incremental area under the curve [iAUC]; p < 0.0001) and serum insulin (iAUC; p < 0.0001) were affected by treatment. A positive correlation was found between blood glucose iAUC and in vitro glucose release (r = 0.993, p < 0.0001). The release of free fatty acids (FFAs) was sustained, and oats were difficult to disintegrate during in vitro digestion. Compared with snack skipping, coconut oil and oat puree snacks suppressed short-term food intake, which was likely due to the sustained release of FFA and slowly digestible oats, respectively. Our in vitro digestion model predicted the relative differences in the glycemic response in vivo.

  14. Coordination of Word Recognition and Oculomotor Control During Reading: The Role of Implicit Lexical Decisions

    PubMed Central

    Choi, Wonil; Gordon, Peter C.

    2013-01-01

    The coordination of word-recognition and oculomotor processes during reading was evaluated in two eye-tracking experiments that examined how word skipping, where a word is not fixated during first-pass reading, is affected by the lexical status of a letter string in the parafovea and ease of recognizing that string. Ease of lexical recognition was manipulated through target-word frequency (Experiment 1) and through repetition priming between prime-target pairs embedded in a sentence (Experiment 2). Using the gaze-contingent boundary technique the target word appeared in the parafovea either with full preview or with transposed-letter (TL) preview. The TL preview strings were nonwords in Experiment 1 (e.g., bilnk created from the target blink), but were words in Experiment 2 (e.g., sacred created from the target scared). Experiment 1 showed greater skipping for high-frequency than low-frequency target words in the full preview condition but not in the TL preview (nonword) condition. Experiment 2 showed greater skipping for target words that repeated an earlier prime word than for those that did not, with this repetition priming occurring both with preview of the full target and with preview of the target’s TL neighbor word. However, time to progress from the word after the target was greater following skips of the TL preview word, whose meaning was anomalous in the sentence context, than following skips of the full preview word whose meaning fit sensibly into the sentence context. Together, the results support the idea that coordination between word-recognition and oculomotor processes occurs at the level of implicit lexical decisions. PMID:23106372

  15. Ultrasonic multi-skip tomography for pipe inspection

    NASA Astrophysics Data System (ADS)

    Volker, Arno; Vos, Rik; Hunter, Alan; Lorenz, Maarten

    2012-05-01

    The inspection of wall loss corrosion is difficult at pipe support locations due to limited accessibility. However, the recently developed ultrasonic Multi-Skip screening technique is suitable for this problem. The method employs ultrasonic transducers in a pitch-catch geometry positioned on opposite sides of the pipe support. Shear waves are transmitted in the axial direction within the pipe wall, reflecting multiple times between the inner and outer surfaces before reaching the receivers. Along this path, the signals accumulate information on the integral wall thickness (e.g., via variations in travel time). The method is very sensitive in detecting the presence of wall loss, but it is difficult to quantify both the extent and depth of the loss. If the extent is unknown, then only a conservative estimate of the depth can be made due to the cumulative nature of the travel time variations. Multi-Skip tomography is an extension of Multi-Skip screening and has shown promise as a complimentary follow-up inspection technique. In recent work, we have developed the technique and demonstrated its use for reconstructing high-resolution estimates of pipe wall thickness profiles. The method operates via a model-based full wave field inversion; this consists of a forward model for predicting the measured wave field and an iterative process that compares the predicted and measured wave fields and minimizes the differences with respect to the model parameters (i.e., the wall thickness profile). This paper presents our recent developments in Multi-Skip tomographic inversion, focusing on the initial localization of corrosion regions for efficient parameterization of the surface profile model and utilization of the signal phase information for improving resolution.

  16. Basal exon skipping and nonsense-associated altered splicing allows bypassing complete CEP290 loss-of-function in individuals with unusually mild retinal disease.

    PubMed

    Barny, Iris; Perrault, Isabelle; Michel, Christel; Soussan, Mickael; Goudin, Nicolas; Rio, Marlène; Thomas, Sophie; Attié-Bitach, Tania; Hamel, Christian; Dollfus, Hélène; Kaplan, Josseline; Rozet, Jean-Michel; Gerard, Xavier

    2018-05-16

    CEP290 mutations cause a spectrum of ciliopathies from Leber congenital amaurosis type 10 (LCA10) to embryo-lethal Meckel syndrome (MKS). Using panel-based molecular diagnosis testing for inherited retinal diseases, we identified two individuals with some preserved vision despite biallelism for presumably truncating CEP290 mutations. The first one carried a homozygous 1 base-pair deletion in exon 17, introducing a premature termination codon (PTC) in exon 18 (c.1666del; p.Ile556Phefs*17). mRNA analysis revealed a basal exon skipping (BES) of exon 18, providing mutant cells with the ability to escape protein truncation, while disrupting the reading frame in controls. The second individual harbored compound heterozygous nonsense mutations in exon 8 (c.508A>T, p.Lys170*) and exon 32 (c.4090G>T, p.Glu1364*), respectively. Some CEP290 lacking exon 8 were detected in mutant fibroblasts but not in controls whereas some skipping of exon 32 occurred in both lines, but with higher amplitude in the mutant. Considering that the deletion of either exon maintains the reading frame in either line, skipping in mutant cells likely involves nonsense-associated altered splicing (NAS) alone (exon 8), or with BES (exon 32). Skipping of PTC-containing exons in mutant cells allowed production of CEP290 isoforms with preserved ability to assemble into a high molecular weight complex and to interact efficiently with proteins important for cilia formation and intraflagellar trafficking. In contrast, studying LCA10 and MKS fibroblasts we show moderate to severe cilia alterations, providing support for a correlation between disease severity and the ability of cells to express shortened, yet functional, CEP290 isoforms.

  17. Validation Experiments for Spent-Fuel Dry-Cask In-Basket Convection

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Smith, Barton L.

    2016-08-16

    This work consisted of the following major efforts; 1. Literature survey on validation of external natural convection; 2. Design the experiment; 3. Build the experiment; 4. Run the experiment; 5. Collect results; 6. Disseminate results; and 7. Perform a CFD validation study using the results. We note that while all tasks are complete, some deviations from the original plan were made. Specifically, geometrical changes in the parameter space were skipped in favor of flow condition changes, which were found to be much more practical to implement. Changing the geometry required new as-built measurements, which proved extremely costly and impractical givenmore » the time and funds available« less

  18. Sounds like a Narcissist: Behavioral Manifestations of Narcissism in Everyday Life

    PubMed Central

    Holtzman, Nicholas S.; Vazire, Simine; Mehl, Matthias R.

    2010-01-01

    Little is known about narcissists’ everyday behavior. The goal of this study was to describe how narcissism is manifested in everyday life. Using the Electronically Activated Recorder (EAR), we obtained naturalistic behavior from participants’ everyday lives. The results suggest that the defining characteristics of narcissism that have been established from questionnaire and laboratory-based studies are borne out in narcissists’ day-to-day behaviors. Narcissists do indeed behave in more extraverted and less agreeable ways than non-narcissists, skip class more (among narcissists high in exploitativeness/entitlement only), and use more sexual language. Furthermore, we found that the link between narcissism and disagreeable behavior is strengthened when controlling for self-esteem, thus extending prior questionnaire-based findings (Paulhus, Robins, Trzesniewski, & Tracy, 2004) to observed, real-world behavior. PMID:20711512

  19. Influence of Skip Patterns on Item Non-Response in a Substance Use Survey of 7th to 12th Grade Students

    ERIC Educational Resources Information Center

    Ding, Kele; Olds, R. Scott; Thombs, Dennis L.

    2009-01-01

    This retrospective case study assessed the influence of item non-response error on subsequent response to questionnaire items assessing adolescent alcohol and marijuana use. Post-hoc analyses were conducted on survey results obtained from 4,371 7th to 12th grade students in Ohio in 2005. A skip pattern design in a conventional questionnaire…

  20. Simultaneous Production of Anabaenopeptins and Namalides by the Cyanobacterium Nostoc sp. CENA543.

    PubMed

    Shishido, Tânia K; Jokela, Jouni; Fewer, David P; Wahlsten, Matti; Fiore, Marli F; Sivonen, Kaarina

    2017-11-17

    Anabaenopeptins are a diverse group of cyclic peptides, which contain an unusual ureido linkage. Namalides are shorter structural homologues of anabaenopeptins, which also contain an ureido linkage. The biosynthetic origins of namalides are unknown despite a strong resemblance to anabaenopeptins. Here, we show the cyanobacterium Nostoc sp. CENA543 strain producing new (nostamide B-E (2, 4, 5, and 6)) and known variants of anabaenopeptins (schizopeptin 791 (1) and anabaenopeptin 807 (3)). Surprisingly, Nostoc sp. CENA543 also produced namalide B (8) and the new namalides D (7), E (9), and F (10) in similar amounts to anabaenopeptins. Analysis of the complete Nostoc sp. CENA543 genome sequence indicates that both anabaenopeptins and namalides are produced by the same biosynthetic pathway through module skipping during biosynthesis. This unique process involves the skipping of two modules present in different nonribosomal peptide synthetases during the namalide biosynthesis. This skipping is an efficient mechanism since both anabaenopeptins and namalides are synthesized in similar amounts by Nostoc sp. CENA543. Consequently, gene skipping may be used to increase and possibly broaden the chemical diversity of related peptides produced by a single biosynthetic gene cluster. Genome mining demonstrated that the anabaenopeptin gene clusters are widespread in cyanobacteria and can also be found in tectomicrobia bacteria.

  1. Distinct subsets of Eve-positive pericardial cells stabilise cardiac outflow and contribute to Hox gene-triggered heart morphogenesis in Drosophila.

    PubMed

    Zmojdzian, Monika; de Joussineau, Svetlana; Da Ponte, Jean Philippe; Jagla, Krzysztof

    2018-01-17

    The Drosophila heart, composed of discrete subsets of cardioblasts and pericardial cells, undergoes Hox-triggered anterior-posterior morphogenesis, leading to a functional subdivision into heart proper and aorta, with its most anterior part forming a funnel-shaped cardiac outflow. Cardioblasts differentiate into Tin-positive 'working myocytes' and Svp-expressing ostial cells. However, developmental fates and functions of heart-associated pericardial cells remain elusive. Here, we show that the pericardial cells that express the transcription factor Even Skipped adopt distinct fates along the anterior-posterior axis. Among them, the most anterior Antp-Ubx-AbdA - negative cells form a novel cardiac outflow component we call the outflow hanging structure, whereas the Antp-expressing cells differentiate into wing heart precursors. Interestingly, Hox gene expression in the Even Skipped-positive cells not only underlies their antero-posterior diversification, but also influences heart morphogenesis in a non-cell-autonomous way. In brief, we identify a new cardiac outflow component derived from a subset of Even Skipped-expressing cells that stabilises the anterior heart tip, and demonstrate non-cell-autonomous effects of Hox gene expression in the Even Skipped-positive cells on heart morphogenesis. © 2018. Published by The Company of Biologists Ltd.

  2. Intron self-complementarity enforces exon inclusion in a yeast pre-mRNA

    PubMed Central

    Howe, Kenneth James; Ares, Manuel

    1997-01-01

    Skipping of internal exons during removal of introns from pre-mRNA must be avoided for proper expression of most eukaryotic genes. Despite significant understanding of the mechanics of intron removal, mechanisms that ensure inclusion of internal exons in multi-intron pre-mRNAs remain mysterious. Using a natural two-intron yeast gene, we have identified distinct RNA–RNA complementarities within each intron that prevent exon skipping and ensure inclusion of internal exons. We show that these complementarities are positioned to act as intron identity elements, bringing together only the appropriate 5′ splice sites and branchpoints. Destroying either intron self-complementarity allows exon skipping to occur, and restoring the complementarity using compensatory mutations rescues exon inclusion, indicating that the elements act through formation of RNA secondary structure. Introducing new pairing potential between regions near the 5′ splice site of intron 1 and the branchpoint of intron 2 dramatically enhances exon skipping. Similar elements identified in single intron yeast genes contribute to splicing efficiency. Our results illustrate how intron secondary structure serves to coordinate splice site pairing and enforce exon inclusion. We suggest that similar elements in vertebrate genes could assist in the splicing of very large introns and in the evolution of alternative splicing. PMID:9356473

  3. AirLand Battle-Future--A Hop, Skip, or Jump?

    DTIC Science & Technology

    1990-12-15

    degradations to accuracy. Certain families of munitions will become smart and others will become brilliant in terms of their capability to kill a target... WORK UNIT ELEMENT NO. NO. NO. ACCESSION NO. 11. TITLE (Include Security Classification) AirLand Battle Future--A Hop, Skip, or Jump? 12. PERSONAL AUTHOR...leve.. Military tactics have traditionally been, first and foremost, a contest of wills . Any battle, past, present, or future will reveal that moral

  4. A composite step conjugate gradients squared algorithm for solving nonsymmetric linear systems

    NASA Astrophysics Data System (ADS)

    Chan, Tony; Szeto, Tedd

    1994-03-01

    We propose a new and more stable variant of the CGS method [27] for solving nonsymmetric linear systems. The method is based on squaring the Composite Step BCG method, introduced recently by Bank and Chan [1,2], which itself is a stabilized variant of BCG in that it skips over steps for which the BCG iterate is not defined and causes one kind of breakdown in BCG. By doing this, we obtain a method (Composite Step CGS or CSCGS) which not only handles the breakdowns described above, but does so with the advantages of CGS, namely, no multiplications by the transpose matrix and a faster convergence rate than BCG. Our strategy for deciding whether to skip a step does not involve any machine dependent parameters and is designed to skip near breakdowns as well as produce smoother iterates. Numerical experiments show that the new method does produce improved performance over CGS on practical problems.

  5. Dynamics of Leading-strand Lesion Skipping by the Replisome

    PubMed Central

    Yeeles, Joseph T.P.; Marians, Kenneth J.

    2013-01-01

    SUMMARY The E. coli replisome stalls transiently when it encounters a lesion in the leading-strand template, skipping over the damage by reinitiating replication at a new primer synthesized downstream by the primase. We report here that template unwinding and lagging-strand synthesis continue downstream of the lesion at a reduced rate after replisome stalling, that one replisome is capable of skipping multiple lesions, and that the rate limiting steps of replication restart involve the synthesis and activation of the new primer downstream. We also find little support for the concept that polymerase uncoupling, where extensive lagging-strand synthesis proceeds downstream in the absence of leading-strand synthesis, involves physical separation of the leading-strand polymerase from the replisome. Instead, our data indicate that extensive uncoupled replication likely results from a failure of the leading-strand polymerase still associated with the DNA helicase and the lagging-strand polymerase that are proceeding downstream to reinitiate synthesis. PMID:24268579

  6. Evaluation of genetic and metabolic role of SKIP11 in Arabidopsis thaliana

    NASA Astrophysics Data System (ADS)

    Hassan, Muhammad Naeem ul; Ismail, Ismanizan

    2015-09-01

    Most of the regulatory proteins are degraded by 26S proteasome complex, only when they are tagged by Ubiquitin. A complex of four proteins, SKP1-Cullin-Ring box-F box (SCF) catalyses the final step to link the Ubiquitin tag with the target proteins. SCF complex interacts with the target proteins through F-box proteins, which confer the overall substrate specificity to the complex. F-box proteins, one of the largest family of proteins in plants have an N-terminal F-box domain and variable C-terminal domains, like leucine-rich repeat, WD-40 repeat and the kelch-repeat domains. In this study, we analysed the role of SKIP11, a kelch containing F-box protein (KFB) from Arabidopsis thaliana, by using reverse genetics strategy. The results show that SKIP11 is involved in the down-regulation of oxylipin pathway, possibly through the degradation of enzymes or/ and the regulatory factors of the pathway.

  7. Longitudinal development of object permanence in mentally retarded children: an exploratory study.

    PubMed

    Wohlhueter, M J; Sindberg, R M

    1975-03-01

    Monthly testing on a series of Piaget object tasks was carried out on 1- to 6-year-old profoundly, severly, and moderately retarded children. Forty nine subjects were followed for 1 to 1.5 years or to criterion; 18 subjects were followed for shorter periods. Three general patterns occurred among the noncriterion subjects with approximately equeal frequency: (a) little or no change, (b) marked variability, and (c) relatively steady upward change from month to month. Criterion and upward subjects skipped certain substages about one-half of the time. Degree of retardation, CA, and diagnostic concomitants of these observations were discussed.

  8. Emerging genetic therapies to treat Duchenne muscular dystrophy

    PubMed Central

    Nelson, Stanley F.; Crosbie, Rachelle H.; Miceli, M. Carrie; Spencer, Melissa J.

    2010-01-01

    Purpose of review Duchenne muscular dystrophy is a progressive muscle degenerative disease caused by dystrophin mutations. The purpose of this review is to highlight two emerging therapies designed to repair the primary genetic defect, called `exon skipping' and `nonsense codon suppression'. Recent findings A drug, PTC124, was identified that suppresses nonsense codon translation termination. PTC124 can lead to restoration of some dystrophin expression in human Duchenne muscular dystrophy muscles with mutations resulting in premature stops. Two drugs developed for exon skipping, PRO051 and AVI-4658, result in the exclusion of exon 51 from mature mRNA. They can restore the translational reading frame to dystrophin transcripts from patients with a particular subset of dystrophin gene deletions and lead to some restoration of dystrophin expression in affected boys' muscle in vivo. Both approaches have concluded phase I trials with no serious adverse events. Summary These novel therapies that act to correct the primary genetic defect of dystrophin deficiency are among the first generation of therapies tailored to correct specific mutations in humans. Thus, they represent paradigm forming approaches to personalized medicine with the potential to lead to life changing treatment for those affected by Duchenne muscular dystrophy. PMID:19745732

  9. Accountability: The Most Underappreciated Aspect of Command

    DTIC Science & Technology

    2012-02-15

    1994). Webster, John. "Air Force Hush Job Skips Accountability." The Spokesman-Review. May 25, 1995. http://www.spokesman.com/stories/1995/may/25...air-force- hush -job-skips- accountability/ (accessed December 9, 2011). Wynne, Michael W., Secretary of the Air Force. "Resignation Letter." June 6...used against you in a trial by court-martial except…for perjury, false swearing, or for a false official statement.” 79 John Webster, “Air Force Hush

  10. Effectiveness and Acceptability of Nutrient Solutions in Enhancing Fluid Intake in the Heat

    DTIC Science & Technology

    1988-11-18

    water Placebo - colored, flavored, artificially sweetened solution TEST BEVERAGE - NBC Nutrient Solution Water Other fluids 2.5% fructose...Q) •H fa ACCEPTABILITY OF TEST BEVERAGES control (no natural or artificial sweetener added) with subjects exercised at 400 watts in a climatic...ever drunk beverages with "Nutrasweet" Sweetener in them? ) Yes )No (skip to question 27) |Don’t know (skip to question 27) Page 4 196 o 5590

  11. Defeating Hard and Deeply Buried Targets in 2035

    DTIC Science & Technology

    2012-02-15

    Hafnium Carbide 12.2 33 722 120 3000 Tantalum 16.4 24 680 113 3017 Tantalum Carbide 14.3 28 746 124 3880 Tungsten 19.3 21 550 92 3422 Tungsten ...lethality. Concepts for employing the weapon included “vertical delivery with the bomb detonated at or just outside portal, skip bomb with short fuse (first...or second contact), skip bomb with long fuse (penetrate door, maximize distance down adits [underground facility entrances or passages]), and

  12. An examination of the demographic predictors of adolescent breakfast consumption, content, and context

    PubMed Central

    2014-01-01

    Background Breakfast consumption is important to health; however, adolescents often skip breakfast, and an increased understanding of the breakfast consumption patterns of adolescents is needed. The purpose of this study was to identify the predictors of breakfast eating, including the content and context, in an adolescent sample from Australia and England. Methods Four-hundred and eighty-one students completed an online questionnaire measuring breakfast skipping, and breakfast content (what was eaten) and context (who they ate with, involvement in preparation). Logistic regression was conducted to investigate the predictors of skipping breakfast, breakfast context, and consumption of the ten most commonly consumed foods. Chi-square analyses were used to examine differences in breakfast content according to context. Results Most students (88%) had consumed breakfast on the day of the survey; breakfast skipping was more common in England (18%) than in Australia (8%). Country, gender, socioeconomic status, and body mass index (BMI) were all predictors of breakfast content and context. Whether adolescents ate with others and/or were involved in breakfast preparation predicted the content of breakfast consumed. Conclusions This study provides a comprehensive examination of the factors underlying breakfast consumption (content and context) and has important implications for the development of evidence-based interventions to improve rates of breakfast consumption and the quality of food consumed amongst adolescents. PMID:24645936

  13. Analysis of the functional consequences of targeted exon deletion in COL7A1 reveals prospects for dystrophic epidermolysis bullosa therapy

    PubMed Central

    Bornert, Olivier; Kühl, Tobias; Bremer, Jeroen; van den Akker, Peter C; Pasmooij, Anna MG; Nyström, Alexander

    2016-01-01

    Genetically evoked deficiency of collagen VII causes dystrophic epidermolysis bullosa (DEB)—a debilitating disease characterized by chronic skin fragility and progressive fibrosis. Removal of exons carrying frame-disrupting mutations can reinstate protein expression in genetic diseases. The therapeutic potential of this approach is critically dependent on gene, protein, and disease intrinsic factors. Naturally occurring exon skipping in COL7A1, translating collagen VII, suggests that skipping of exons containing disease-causing mutations may be feasible for the treatment of DEB. However, despite a primarily in-frame arrangement of exons in the COL7A1 gene, no general conclusion of the aptitude of exon skipping for DEB can be drawn, since regulation of collagen VII functionality is complex involving folding, intra- and intermolecular interactions. To directly address this, we deleted two conceptually important exons located at both ends of COL7A1, exon 13, containing recurrent mutations, and exon 105, predicted to impact folding. The resulting recombinantly expressed proteins showed conserved functionality in biochemical and in vitro assays. Injected into DEB mice, the proteins promoted skin stability. By demonstrating functionality of internally deleted collagen VII variants, our study provides support of targeted exon deletion or skipping as a potential therapy to treat a large number of individuals with DEB. PMID:27157667

  14. Potential applications of skip SMV with thrust engine

    NASA Astrophysics Data System (ADS)

    Wang, Weilin; Savvaris, Al

    2016-11-01

    This paper investigates the potential applications of Space Maneuver Vehicles (SMV) with skip trajectory. Due to soaring space operations over the past decades, the risk of space debris has considerably increased such as collision risks with space asset, human property on ground and even aviation. Many active debris removal methods have been investigated and in this paper, a debris remediation method is first proposed based on skip SMV. The key point is to perform controlled re-entry. These vehicles are expected to achieve a trans-atmospheric maneuver with thrust engine. If debris is released at altitude below 80 km, debris could be captured by the atmosphere drag force and re-entry interface prediction accuracy is improved. Moreover if the debris is released in a cargo at a much lower altitude, this technique protects high value space asset from break up by the atmosphere and improves landing accuracy. To demonstrate the feasibility of this concept, the present paper presents the simulation results for two specific mission profiles: (1) descent to predetermined altitude; (2) descent to predetermined point (altitude, longitude and latitude). The evolutionary collocation method is adopted for skip trajectory optimization due to its global optimality and high-accuracy. This method is actually a two-step optimization approach based on the heuristic algorithm and the collocation method. The optimal-control problem is transformed into a nonlinear programming problem (NLP) which can be efficiently and accurately solved by the sequential quadratic programming (SQP) procedure. However, such a method is sensitive to initial values. To reduce the sensitivity problem, genetic algorithm (GA) is adopted to refine the grids and provide near optimum initial values. By comparing the simulation data from different scenarios, it is found that skip SMV is feasible in active debris removal and the evolutionary collocation method gives a truthful re-entry trajectory that satisfies the path and boundary constraints.

  15. Effects of broiler breeder management on pullet body weight and carcass uniformity.

    PubMed

    Zuidhof, M J; Holm, D E; Renema, R A; Jalal, M A; Robinson, F E

    2015-06-01

    An experiment was conducted to study the effect of broiler breeder feeding management practices on pullet performance, BW uniformity, and carcass traits during rearing (to 22 wk of age). At 3 wk of age, 1,200 Ross 308 breeder pullets were assigned to one of 5 treatments: 1) control: standard mash diet, fed daily; 2) high fiber: mash diet containing 25% lower nutrient density, fed daily; 3) scatter: standard diet in pellet form scattered on litter, fed daily; 4) skip-a-day: standard mash diet, fed on alternate days; or 5) grading: standard mash diet, fed daily (birds sorted into low, average, and high BW groups every 4 wk). Birds on the high fiber treatment consumed more feed (P<0.0001) and had the highest feed conversion ratio (FCR; P<0.004) but the lowest ME to gain and CP to gain ratios (P≤0.002). Skip-a-day treatment pullets consumed more ME and CP than birds in any other treatment (P<0.001). Grading yielded the highest BW uniformity at 22 wk of age (CV=6.2%), while control and high fiber treatment groups were least uniform (CV>15%; P<0.0001). Skip-a-day feed restriction produced birds with the significantly lowest breast muscle and highest liver weight compared to all other treatments (P<0.05). Variation in shank length, chest width, and breast muscle was lowest in the grading treatment, whereas the CV for fat pad and liver was lowest in the skip-a-day treatment. In this trial, broiler breeder target BW profiles were achieved using combinations of quantitative and qualitative feed restriction, or preemptive management practices. Qualitative diet dilution and skip-a-day management did little to increase flock uniformity relative to the control during the most intense period of feed restriction (7 to 19 wk). Scatter feeding increased flock uniformity to a small degree, whereas grading yielded the highest increase in BW and carcass trait uniformity. © 2015 Poultry Science Association Inc.

  16. Intron-mediated alternative splicing of Arabidopsis P5CS1 and its association with natural variation in proline and climate adaptation

    PubMed Central

    Kesari, Ravi; Lasky, Jesse R.; Villamor, Joji Grace; Des Marais, David L.; Chen, Ying-Jiun C.; Liu, Tzu-Wen; Juenger, Thomas E.; Verslues, Paul E.

    2012-01-01

    Drought-induced proline accumulation is widely observed in plants but its regulation and adaptive value are not as well understood. Proline accumulation of the Arabidopsis accession Shakdara (Sha) was threefold less than that of Landsberg erecta (Ler) and quantitative trait loci mapping identified a reduced function allele of the proline synthesis enzyme Δ1-pyrroline-5-carboxylate synthetase1 (P5CS1) as a basis for the lower proline of Sha. Sha P5CS1 had additional TA repeats in intron 2 and a G-to-T transversion in intron 3 that were sufficient to promote alternative splicing and production of a nonfunctional transcript lacking exon 3 (exon 3-skip P5CS1). In Sha, and additional accessions with the same intron polymorphisms, the nonfunctional exon 3-skip P5CS1 splice variant constituted as much as half of the total P5CS1 transcript. In a larger panel of Arabidopsis accessions, low water potential-induced proline accumulation varied by 10-fold and variable production of exon 3-skip P5CS1 among accessions was an important, but not the sole, factor underlying variation in proline accumulation. Population genetic analyses suggest that P5CS1 may have evolved under positive selection, and more extensive correlation of exon 3-skip P5CS1 production than proline abundance with climate conditions of natural accessions also suggest a role of P5CS1 in local adaptation to the environment. These data identify a unique source of alternative splicing in plants, demonstrate a role of exon 3-skip P5CS1 in natural variation of proline metabolism, and suggest an association of P5CS1 and its alternative splicing with environmental adaptation. PMID:22615385

  17. Comparable clinical and radiological outcomes between skipped-level and all-level plating for open-door laminoplasty.

    PubMed

    Cheung, Jason Pui Yin; Cheung, Prudence Wing Hang; Cheung, Amy Yim Ling; Lui, Darren; Cheung, Kenneth M C

    2018-06-01

    To compare the clinical and radiological outcomes between skipped-level and all-level plating for cervical laminoplasty. Patients with cervical spondylotic myelopathy (CSM) treated by open-door laminoplasty with minimum 2-year postoperative follow-up were included. All patients had opening from C3-6 or C3-7 and were divided into skipped-level or all-level plating groups. Japanese Orthopaedic Association (JOA) scores and canal measurements were obtained preoperatively, immediate (within 1 week) postoperatively, and at 2, 6 weeks, 3, 6 and 12 months postoperatively. Paired t test was used for comparative analysis. Receiver operating characteristic analysis was used to determine the canal expansion cutoff for spring-back closure. A total of 74 subjects were included with mean age of 66.1 ± 11.3 years at surgery. Of these, 32 underwent skipped-level plating and 42 underwent all-level plating. No significant differences were noted between the two groups at baseline and follow-up. Spring-back closure was observed in up to 50% of the non-plated levels within 3 months postoperatively. The cutoff for developing spring-back closure was 7 mm canal expansion for C3-6. No differences were observed in JOA scores and recovery rates between the two groups. None of the patients with spring-back required reoperation. There were no significant differences between skipped-level and all-level plating in terms of JOA or recovery rate, and canal diameter differences. This has tremendous impact on saving costs in CSM management as up to two plates per patient undergoing a standard C3-6 laminoplasty may be omitted instead of four plates to every level to achieve similar clinical and radiological outcomes. III. These slides can be retrieved under Electronic Supplementary Material.

  18. The addition of a protein-rich breakfast and its effects on acute appetite control and food intake in 'breakfast-skipping' adolescents.

    PubMed

    Leidy, H J; Racki, E M

    2010-07-01

    Breakfast skipping (BS) is closely associated with overeating (in the evening), weight gain and obesity. It is unclear whether the addition of breakfast, with emphasis on dietary protein, leads to better appetite and energy intake regulation in adolescents. The purpose of the study was to examine the impact of addition of a normal-protein (PN) breakfast vs protein-rich (PR) breakfast on appetite and food intake in 'breakfast-skipping' adolescents. A total of 13 adolescents (age 14.3+/-0.3 years; body mass index percentile 79+/-4 percentile; skipped breakfast 5+/-1 x per week) randomly completed 3 testing days that included a PN (18+/-1 g protein), PR (48+/-2 g protein) or BS. Breakfast was 24% of estimated daily energy needs. Appetite, satiety and hormonal responses were collected over 5 h followed by an ad libitum lunch and 24-h food intake assessments. Perceived appetite was not different following PN vs BS; PR led to greater reductions vs BS (P<0.01) and PN (P<0.001). Fullness was greater following both breakfast meals vs BS (P<0.01) but was not different between meals. Ghrelin was not different among treatments. Greater PYY concentrations were observed following both breakfast meals vs BS (P<0.01) but was not different between meals. Lunch energy intake was not different following PN vs BS; PR led to fewer kcal consumed vs BS (P<0.01) and PN (P<0.005). Daily food intake was not different among treatments. Breakfast led to increased satiety through increased fullness and PYY concentrations in 'breakfast skipping' adolescents. A breakfast rich in dietary protein provides additional benefits through reductions in appetite and energy intake. These findings suggest that the addition of a protein-rich breakfast might be an effective strategy to improve appetite control in young people.

  19. A Duchenne Muscular Dystrophy Gene Hot Spot Mutation in Dystrophin-Deficient Cavalier King Charles Spaniels Is Amenable to Exon 51 Skipping

    PubMed Central

    Walmsley, Gemma L.; Arechavala-Gomeza, Virginia; Fernandez-Fuente, Marta; Burke, Margaret M.; Nagel, Nicole; Holder, Angela; Stanley, Rachael; Chandler, Kate; Marks, Stanley L.; Muntoni, Francesco; Shelton, G. Diane; Piercy, Richard J.

    2010-01-01

    Background Duchenne muscular dystrophy (DMD), which afflicts 1 in 3500 boys, is one of the most common genetic disorders of children. This fatal degenerative condition is caused by an absence or deficiency of dystrophin in striated muscle. Most affected patients have inherited or spontaneous deletions in the dystrophin gene that disrupt the reading frame resulting in unstable truncated products. For these patients, restoration of the reading frame via antisense oligonucleotide-mediated exon skipping is a promising therapeutic approach. The major DMD deletion “hot spot” is found between exons 45 and 53, and skipping exon 51 in particular is predicted to ameliorate the dystrophic phenotype in the greatest number of patients. Currently the mdx mouse is the most widely used animal model of DMD, although its mild phenotype limits its suitability in clinical trials. The Golden Retriever muscular dystrophy (GRMD) model has a severe phenotype, but due to its large size, is expensive to use. Both these models have mutations in regions of the dystrophin gene distant from the commonly mutated DMD “hot spot”. Methodology/Principal Findings Here we describe the severe phenotype, histopathological findings, and molecular analysis of Cavalier King Charles Spaniels with dystrophin-deficient muscular dystrophy (CKCS-MD). The dogs harbour a missense mutation in the 5′ donor splice site of exon 50 that results in deletion of exon 50 in mRNA transcripts and a predicted premature truncation of the translated protein. Antisense oligonucleotide-mediated skipping of exon 51 in cultured myoblasts from an affected dog restored the reading frame and protein expression. Conclusions/Significance Given the small size of the breed, the amiable temperament and the nature of the mutation, we propose that CKCS-MD is a valuable new model for clinical trials of antisense oligonucleotide-induced exon skipping and other therapeutic approaches for DMD. PMID:20072625

  20. Fast DCNN based on FWT, intelligent dropout and layer skipping for image retrieval.

    PubMed

    ElAdel, Asma; Zaied, Mourad; Amar, Chokri Ben

    2017-11-01

    Deep Convolutional Neural Network (DCNN) can be marked as a powerful tool for object and image classification and retrieval. However, the training stage of such networks is highly consuming in terms of storage space and time. Also, the optimization is still a challenging subject. In this paper, we propose a fast DCNN based on Fast Wavelet Transform (FWT), intelligent dropout and layer skipping. The proposed approach led to improve the image retrieval accuracy as well as the searching time. This was possible thanks to three key advantages: First, the rapid way to compute the features using FWT. Second, the proposed intelligent dropout method is based on whether or not a unit is efficiently and not randomly selected. Third, it is possible to classify the image using efficient units of earlier layer(s) and skipping all the subsequent hidden layers directly to the output layer. Our experiments were performed on CIFAR-10 and MNIST datasets and the obtained results are very promising. Copyright © 2017 Elsevier Ltd. All rights reserved.

  1. Dynamic ASXL1 Exon Skipping and Alternative Circular Splicing in Single Human Cells

    PubMed Central

    Natarajan, Sivaraman; Carter, Robert; Brown, Patrick O.

    2016-01-01

    Circular RNAs comprise a poorly understood new class of noncoding RNA. In this study, we used a combination of targeted deletion, high-resolution splicing detection, and single-cell sequencing to deeply probe ASXL1 circular splicing. We found that efficient circular splicing required the canonical transcriptional start site and inverted AluSx elements. Sequencing-based interrogation of isoforms after ASXL1 overexpression identified promiscuous linear splicing between all exons, with the two most abundant non-canonical linear products skipping the exons that produced the circular isoforms. Single-cell sequencing revealed a strong preference for either the linear or circular ASXL1 isoforms in each cell, and found the predominant exon skipping product is frequently co-expressed with its reciprocal circular isoform. Finally, absolute quantification of ASXL1 isoforms confirmed our findings and suggests that standard methods overestimate circRNA abundance. Taken together, these data reveal a dynamic new view of circRNA genesis, providing additional framework for studying their roles in cellular biology. PMID:27736885

  2. Analogy motor learning by young children: a study of rope skipping.

    PubMed

    Tse, Andy C Y; Fong, Shirley S M; Wong, Thomson W L; Masters, Rich

    2017-03-01

    Research in psychology suggests that provision of an instruction by analogy can enhance acquisition and understanding of knowledge. Limited research has been conducted to test this proposition in motor learning by children. The purpose of the present study was to examine the feasibility of analogy instructions in motor skill acquisition by children. Thirty-two children were randomly assigned to one of the two instruction protocols: analogy and explicit instruction protocols for a two-week rope skipping training. Each participant completed a pretest (Lesson 1), three practice sessions (Lesson 2-4), a posttest and a secondary task test (Lesson 5). Children in the analogy protocol displayed better rope skip performance than those in the explicit instruction protocol (p < .001). Moreover, a cognitive secondary task test indicated that children in the analogy protocol performed more effectively, whereas children in the explicit protocol displayed decrements in performance. Analogy learning may aid children to acquire complex motor skills, and have potential benefits related to reduced cognitive processing requirements.

  3. Ameliorating pathogenesis by removing an exon containing a missense mutation: a potential exon-skipping therapy for laminopathies.

    PubMed

    Scharner, J; Figeac, N; Ellis, J A; Zammit, P S

    2015-06-01

    Exon skipping, as a therapy to restore a reading frame or switch protein isoforms, is under clinical trial. We hypothesised that removing an in-frame exon containing a mutation could also improve pathogenic phenotypes. Our model is laminopathies: incurable tissue-specific degenerative diseases associated with LMNA mutations. LMNA encodes A-type lamins, that together with B-type lamins, form the nuclear lamina. Lamins contain an alpha-helical central rod domain composed of multiple heptad repeats. Eliminating LMNA exon 3 or 5 removes six heptad repeats, so shortens, but should not otherwise significantly alter, the alpha-helix. Human Lamin A or Lamin C with a deletion corresponding to amino acids encoded by exon 5 (Lamin A/C-Δ5) localised normally in murine lmna-null cells, rescuing both nuclear shape and endogenous Lamin B1/emerin distribution. However, Lamin A carrying pathogenic mutations in exon 3 or 5, or Lamin A/C-Δ3, did not. Furthermore, Lamin A/C-Δ5 was not deleterious to wild-type cells, unlike the other Lamin A mutants including Lamin A/C-Δ3. Thus Lamin A/C-Δ5 function as effectively as wild-type Lamin A/C and better than mutant versions. Antisense oligonucleotides skipped LMNA exon 5 in human cells, demonstrating the possibility of treating certain laminopathies with this approach. This proof-of-concept is the first to report the therapeutic potential of exon skipping for diseases arising from missense mutations.

  4. Tradeoffs between physical captures and PIT tag antenna array detections: A case study for the Lower Colorado River Basin population of humpback chub (Gila cypha)

    USGS Publications Warehouse

    Pearson, Kristen Nicole; Kendall, William L.; Winkelman, Dana L.; Persons, William R.

    2016-01-01

    A key component of many monitoring programs for special status species involves capture and handling of individuals as part of capture-recapture efforts for tracking population health and demography. Minimizing negative impacts from sampling, such as through reduced handling, aids prevention of negative impacts on species from monitoring efforts. Using simulation analyses, we found that long-term population monitoring techniques, requiring physical capture (i.e. hoop-net sampling), can be reduced and supplemented with passive detections (i.e. PIT tag antenna array detections) without negatively affecting estimates of adult humpback chub (HBC; Gila cypha) survival (S) and skipped spawning probabilities (γ' = spawner transitions to a skipped spawner, γ′ = skipped spawner remains a skipped spawner). Based on our findings of the array’s in situ detection efficiency (0.42), estimability of such demographic parameters would improve over hoop-netting alone. In addition, the array provides insight into HBC population dynamics and movement patterns outside of traditional sampling periods. However, given current timing of sampling efforts, spawner abundance estimates were negatively biased when hoop-netting was reduced, suggesting not all spawning HBC are present during the current sampling events. Despite this, our findings demonstrate that PIT tag antenna arrays, even with moderate potential detectability, may allow for reduced handling of special status species while also offering potentially more efficient monitoring strategies, especially if ideal timing of sampling can be determined.

  5. The CCTC Quick-Reacting General War Gaming System (QUICK) Program Maintenance Manual. Volume 3. Weapon Allocation Subsystem

    DTIC Science & Technology

    1978-04-15

    12. (Part 2 of 2) 70 B1 Calculate Revised I! Allocation Error [: Estimates For Each Attribute Category] Skip Change of tltipliers - No _ D-Do For All A...passing Onl to tilt next target , thlt current Value Of the target weight is revised . Altecr every two to four targets , the Laigrange multipliers art...delete a weapon, a new set of variables is delivered by WADOUT, and STALL uses this revised in- formation to decide whether more weapons should be added

  6. Dietary behaviors, physical activity and sedentary lifestyle associated with overweight and obesity, and their socio-demographic correlates, among Pakistani primary school children

    PubMed Central

    2011-01-01

    Background There is no data on diet- and activity-related behaviors associated with overweight and obesity among Pakistani school-aged children. The study aimed to explore dietary behaviors, physical activity and sedentary lifestyle associated with overweight and obesity, and their socio-demographic correlates, among Pakistani primary school children. Methods A population-based cross-sectional study was conducted with a representative multistage random cluster sample of 1860 children aged five to twelve years in Lahore, Pakistan. Overweight (> +1 SD) and obesity (> +2 SD) were defined using the World Health Organization reference 2007. Chi-square test was used as the test of trend. Linear regression was used to examine the predictive power of independent variables in relation to body mass index (BMI). Logistic regression was used to quantify the independent predictors and adjusted odds ratios (aOR) with 95% confidence intervals (CI) were obtained. Statistical significance was considered at P < 0.05. Results Children skipping breakfast (8%), eating fast food and snacks ≥ once a week (43%) and being involved in sedentary lifestyle > one hour a day (49%) were significantly more likely to be overweight and obese while those participating in physical activity > twice a week (53%) were significantly less likely to be overweight and obese (all P < 0.01). Skipping breakfast (P < 0.001), eating fast food and snacks (P = 0.001) and sedentary lifestyle (P < 0.001) showed an independent positive association with BMI while physical activity showed an independent inverse association (P = 0.001). Skipping breakfast (aOR 1.82, 95% CI 1.22-2.71), eating fast food and snacks ≥ once a week (OR 1.41, 95% CI 1.07-1.86), physical activity > twice a week (aOR 0.49, 95% CI 0.34-0.70) and sedentary lifestyle > one hour a day (aOR 1.56, 95% CI 1.19-2.03) were independent predictors of being overweight. Skipping breakfast had independent inverse association with physical activity (aOR 0.63, 95% CI 0.45-0.89) and eating fast food and snacks had independent positive association with sedentary lifestyle (aOR 1.79, 95% CI 1.49-2.16). Female gender was independently associated with skipping breakfast (aOR 1.50, 95% CI 1.04-2.16). Male gender (aOR 1.64, 95% CI 1.33-2.02), urban area with high SES (aOR 5.09, 95% CI 3.02-8.60) and higher parental education (aOR 1.74, 95% CI 1.12-2.68) were significant independent predictors of eating fast food and snacks ≥ once a week. Living in the rural area was independently associated (aOR 2.51, 95% CI 1.71-3.68) with physical activity > twice a week. Male gender (aOR 1.60, 95% CI 1.31-1.95), urban area with low SES (aOR 1.46, 95% CI 1.02-2.09), high-income neighborhoods (aOR 1.52, 95% CI 1.02-2.25), higher parental education (aOR 1.55, 95% CI 1.03-2.34) and fewer siblings (aOR 1.38, 95% CI 1.10-1.73) were independent predictors of sedentary lifestyle > one hour a day. Conclusions Dietary behaviors, physical activity and sedentary lifestyle are independent predictors of overweight and higher BMI among Pakistani primary school children, and are significantly affected by the child's socio-demographic characteristics. These findings support the urgent need to develop a National strategy for diet and physical activity and to implement culturally relevant behavioral interventions in the resource-poor developing country settings. PMID:22117626

  7. Dietary behaviors, physical activity and sedentary lifestyle associated with overweight and obesity, and their socio-demographic correlates, among Pakistani primary school children.

    PubMed

    Mushtaq, Muhammad Umair; Gull, Sibgha; Mushtaq, Komal; Shahid, Ubeera; Shad, Mushtaq Ahmad; Akram, Javed

    2011-11-25

    There is no data on diet- and activity-related behaviors associated with overweight and obesity among Pakistani school-aged children. The study aimed to explore dietary behaviors, physical activity and sedentary lifestyle associated with overweight and obesity, and their socio-demographic correlates, among Pakistani primary school children. A population-based cross-sectional study was conducted with a representative multistage random cluster sample of 1860 children aged five to twelve years in Lahore, Pakistan. Overweight (>+1 SD) and obesity (>+2 SD) were defined using the World Health Organization reference 2007. Chi-square test was used as the test of trend. Linear regression was used to examine the predictive power of independent variables in relation to body mass index (BMI). Logistic regression was used to quantify the independent predictors and adjusted odds ratios (aOR) with 95% confidence intervals (CI) were obtained. Statistical significance was considered at P<0.05. Children skipping breakfast (8%), eating fast food and snacks≥once a week (43%) and being involved in sedentary lifestyle>one hour a day (49%) were significantly more likely to be overweight and obese while those participating in physical activity>twice a week (53%) were significantly less likely to be overweight and obese (all P<0.01). Skipping breakfast (P<0.001), eating fast food and snacks (P=0.001) and sedentary lifestyle (P<0.001) showed an independent positive association with BMI while physical activity showed an independent inverse association (P=0.001). Skipping breakfast (aOR 1.82, 95% CI 1.22-2.71), eating fast food and snacks≥once a week (OR 1.41, 95% CI 1.07-1.86), physical activity>twice a week (aOR 0.49, 95% CI 0.34-0.70) and sedentary lifestyle>one hour a day (aOR 1.56, 95% CI 1.19-2.03) were independent predictors of being overweight. Skipping breakfast had independent inverse association with physical activity (aOR 0.63, 95% CI 0.45-0.89) and eating fast food and snacks had independent positive association with sedentary lifestyle (aOR 1.79, 95% CI 1.49-2.16). Female gender was independently associated with skipping breakfast (aOR 1.50, 95% CI 1.04-2.16). Male gender (aOR 1.64, 95% CI 1.33-2.02), urban area with high SES (aOR 5.09, 95% CI 3.02-8.60) and higher parental education (aOR 1.74, 95% CI 1.12-2.68) were significant independent predictors of eating fast food and snacks≥once a week. Living in the rural area was independently associated (aOR 2.51, 95% CI 1.71-3.68) with physical activity>twice a week. Male gender (aOR 1.60, 95% CI 1.31-1.95), urban area with low SES (aOR 1.46, 95% CI 1.02-2.09), high-income neighborhoods (aOR 1.52, 95% CI 1.02-2.25), higher parental education (aOR 1.55, 95% CI 1.03-2.34) and fewer siblings (aOR 1.38, 95% CI 1.10-1.73) were independent predictors of sedentary lifestyle>one hour a day. Dietary behaviors, physical activity and sedentary lifestyle are independent predictors of overweight and higher BMI among Pakistani primary school children, and are significantly affected by the child's socio-demographic characteristics. These findings support the urgent need to develop a National strategy for diet and physical activity and to implement culturally relevant behavioral interventions in the resource-poor developing country settings.

  8. Skipping Strategy (SS) for Initial Population of Job-Shop Scheduling Problem

    NASA Astrophysics Data System (ADS)

    Abdolrazzagh-Nezhad, M.; Nababan, E. B.; Sarim, H. M.

    2018-03-01

    Initial population in job-shop scheduling problem (JSSP) is an essential step to obtain near optimal solution. Techniques used to solve JSSP are computationally demanding. Skipping strategy (SS) is employed to acquire initial population after sequence of job on machine and sequence of operations (expressed in Plates-jobs and mPlates-jobs) are determined. The proposed technique is applied to benchmark datasets and the results are compared to that of other initialization techniques. It is shown that the initial population obtained from the SS approach could generate optimal solution.

  9. Parental functional health literacy relates to skip pattern questionnaire error and to child oral health.

    PubMed

    Garrett, Gail M; Citi, Alicia M; Gansky, Stuart A

    2012-05-01

    The study's purpose was to determine if parental dental functional health literacy related to child oral health. A secondary aim was to assess if errors in completing the questionnaire related to FHL and child oral health. Parents of pediatric clinic children (N = 101) completed questionnaires and dental caries indices were recorded. Higher FHL was negatively correlated with worse child caries (r = -0.23), but not subjective oral health. Mean FHL seemed to differ by skip pattern (p = 0.087), indicating it may be a potential FHL proxy.

  10. Proceedings of the Workshop on the Assessment of Crew Workload Measurement Methods, Techniques and Procedures. Volume 2. Library References.

    DTIC Science & Technology

    1987-06-01

    OHIO 45433-6553 0. % NOTICE When Government drawings, specifications, or other data are used for any purpose other than in connection with a definitely...have formulated or in any way supplied the said drawings, specifications, or other data , is not to be regarded by implication, or otherwise in any...Formal Review 2= Informal Review 3= No Reviewer C. Quality of Data (If not 1-3 QUIT) 1= Experiment(s) 2= Case Study(s) 3= Theory/Review (Skip to F.) (Skip

  11. P-Tether-Mediated, Iterative SN2'-Cuprate Alkylation Strategy to Skipped Polyol Stereotetrads: Utility of an Oxidative "Function Switch" with Phosphite-Borane Tethers.

    PubMed

    Markley, Jana L; Hanson, Paul R

    2017-05-19

    The development of a P-tether-mediated, iterative S N 2'-cuprate alkylation protocol for the formation of 1,3-skipped polyol stereotetrads is reported. This two-directional synthetic strategy builds molecular complexity from simple, readily prepared C 2 -symmetric dienediols and unites the chemistry of both temporary phosphite-borane tethers and temporary phosphate tethers-through an oxidative "function switch" of the P-tether itself-to generate intermediates that were previously inaccessible via either method alone.

  12. Tethered satellite system dynamics and control review panel and related activities, phase 3

    NASA Technical Reports Server (NTRS)

    1991-01-01

    Two major tests of the Tethered Satellite System (TSS) engineering and flight units were conducted to demonstrate the functionality of the hardware and software. Deficiencies in the hardware/software integration tests (HSIT) led to a recommendation for more testing to be performed. Selected problem areas of tether dynamics were analyzed, including verification of the severity of skip rope oscillations, verification or comparison runs to explore dynamic phenomena observed in other simulations, and data generation runs to explore the performance of the time domain and frequency domain skip rope observers.

  13. The Right to Education for Children in Domestic Labour: Empirical Evidence from Kenya

    NASA Astrophysics Data System (ADS)

    Munene, Ishmael I.; Ruto, Sara J.

    2010-02-01

    Since 1948, various UN conventions have recognised basic education as a human right. Yet this right continues to be denied to many child labourers across the world. This articles draws on the results of a study examining how children in domestic labour in Kenya access and participate in education. Three issues were explored: (1) the correlates of child domestic labourers; (2) their working conditions and contexts; and (3) the right to education. Interviews and group discussions held in one city and two rural districts elicited data from 91 child domestic labourers and 84 adults. The results indicated that child labour was both poverty-induced and adult-initiated, and that children worked in hazardous environments characterised by economic exploitation. Most did not attend school; those who did had to contend with a rigid school structure and an authoritarian class environment. Children in domestic labour often skipped school, and their participation in classes was low.

  14. Association of Depressive Symptoms with Lapses in Antiretroviral Medication Adherence Among People Living with HIV: A Test of an Indirect Pathway.

    PubMed

    Babowitch, Jacklyn D; Sheinfil, Alan Z; Woolf-King, Sarah E; Vanable, Peter A; Sweeney, Shannon M

    2018-03-23

    Viral suppression, a critical component of HIV care, is more likely when individuals initiate antiretroviral therapy (ART) early in disease progression and maintain optimal levels of adherence to ART regimens. Although several studies have documented the negative association of depressive symptoms with ART adherence, less is known about how depressed mood relates to intentional versus unintentional lapses in adherence as well as the mechanisms underlying this association. The purpose of the current study was to examine the association of depressive symptoms with ART adherence, assessed as a multidimensional construct. Secondarily, this study conducted preliminary indirect path models to determine if medication self-efficacy could explain the depressed mood-adherence relationship. Depressive symptoms were not associated with 95% ART taken, self-reported viral load, deliberate adjustments to ART regimens or skipped ART doses. However, the indirect association of depressive symptoms via decrements in medication self-efficacy was significant for 95% ART taken, self-reported viral load and skipped ART doses, but not deliberate changes to ART regimens. In this sample of HIV-positive outpatients, there is evidence to support medication self-efficacy as a potential mechanism underlying the association between depressive symptoms and ART adherence. Additional longitudinal studies are needed to formally examine medication taking self-efficacy as a mediator.

  15. Caffeine Reduces Reaction Time and Improves Performance in Simulated-Contest of Taekwondo

    PubMed Central

    Santos, Victor G. F.; Santos, Vander R. F.; Felippe, Leandro J. C.; Almeida, Jose W.; Bertuzzi, Rômulo; Kiss, Maria A. P. D. M.; Lima-Silva, Adriano E.

    2014-01-01

    The aim of this study was to investigate the effects of caffeine on reaction time during a specific taekwondo task and athletic performance during a simulated taekwondo contest. Ten taekwondo athletes ingested either 5 mg·kg−1 body mass caffeine or placebo and performed two combats (spaced apart by 20 min). The reaction-time test (five kicks “Bandal Tchagui”) was performed immediately prior to the first combat and immediately after the first and second combats. Caffeine improved reaction time (from 0.42 ± 0.05 to 0.37 ± 0.07 s) only prior to the first combat (P = 0.004). During the first combat, break times during the first two rounds were shorter in caffeine ingestion, followed by higher plasma lactate concentrations compared with placebo (P = 0.029 and 0.014, respectively). During the second combat, skipping-time was reduced, and relative attack times and attack/skipping ratio was increased following ingestion of caffeine during the first two rounds (all P < 0.05). Caffeine resulted in no change in combat intensity parameters between the first and second combat (all P > 0.05), but combat intensity was decreased following placebo (all P < 0.05). In conclusion, caffeine reduced reaction time in non-fatigued conditions and delayed fatigue during successive taekwondo combats. PMID:24518826

  16. Meal types as sources for intakes of fruits, vegetables, fish and whole grains among Norwegian adults.

    PubMed

    Myhre, Jannicke B; Løken, Elin B; Wandel, Margareta; Andersen, Lene F

    2015-08-01

    To study how different meals contribute to intakes of fruits, vegetables, fish and whole grains in a group of Norwegian adults and in subgroups of this population. Moreover, to investigate the consequences of skipping the meal contributing most to the intake of each food group (main contributing meal). Cross-sectional dietary survey in Norwegian adults. Dietary data were collected using two non-consecutive telephone-administered 24 h recalls. The recorded meal types were breakfast, lunch, dinner, supper/evening meal and snacks. Nationwide, Norway (2010-2011). Adults aged 18-70 years (n 1787). Dinner was the main contributing meal for fish and vegetables, while snacks were the main contributing meal for fruit intake. For whole grains, breakfast was the main contributing meal. The main contributing meal did not change for any of the food groups when studying subgroups of the participants according to intake of each food group, educational level or age. A substantially lower intake of the food groups in question was found on days when the main contributing meal was skipped. Intakes of fruits, vegetables, fish and whole grains largely depend on one meal type. Inclusion of these foods in other meals in addition to the main contributing meal, preferably replacing energy-dense nutrient-poor foods, should be promoted.

  17. Breakfast habits among school children in selected communities in the eastern region of Ghana.

    PubMed

    Intiful, F D; Lartey, A

    2014-06-01

    Breakfast is considered the most important meal of the day, yet many people skip breakfast. Studies indicate that school age children who regularly skip breakfast are not likely to concentrate in class, thus affecting school performance. This study determined the breakfast habits and nutrient contributions of the breakfast meal to the days' nutrient intake. A cross sectional study was conducted among school children (n=359) between the ages of 6-19 years in Manya Krobo in the Eastern Region of Ghana. Questionnaires were used to collect information on background characteristics and breakfast consumption habits. The 24-hour dietary recall method was used to obtain information on the children's food intake. T-test was used to compare differences between means of variables of breakfast consumers and skippers. About 85.5% of the children had breakfast on the day of interview. More boys (87.8%) consumed breakfast compared to the girls (83.1%). For those who skipped breakfast, lack of food at home or lack of no money (36.5%) was the main reason. Breakfast consumers had significantly higher energy and nutrient intakes than those who skipped breakfast (energy 2259 verses 1360 kcal, p-0.039; vitamin A 1534 verses 662 ug/RE, p=0.001; iron 22.9 verses 13.9 mg, p=0.017, zinc 9.9 verses 5.6 mg, p=0.034). The breakfast meal contributed between 32-41% of the day's energy intake, and between 30-47% of micronutrient intake. Encouraging breakfast consumption among school children is a way to ensure that they meet their daily nutrient and energy intakes.

  18. Meal pattern among Norwegian primary-school children and longitudinal associations between meal skipping and weight status.

    PubMed

    Stea, Tonje H; Vik, Frøydis N; Bere, Elling; Svendsen, Martin V; Oellingrath, Inger M

    2015-02-01

    To investigate meal pattern longitudinally and explore whether meal skipping was associated with overweight among Norwegian children and adolescents. Longitudinal study. Children's meal frequencies were reported by their parents using a retrospective FFQ. Weight and height were measured by public health nurses. Descriptive data comparing 4th and 7th grade were analysed by paired-sample t tests for continuous variables and χ 2 tests for categorical variables. Odds ratio estimates, including confidence intervals, with BMI category (normal/overweight) as the dependent variable, were determined through logistic regression analyses. Primary schools, Telemark County, Norway. A cohort of 428 Norwegian boys and girls; 4th graders in 2007, 7th graders in 2010. The number of children eating four main meals per day (regular meal frequency) decreased from 4th grade (47 %) to 7th grade (38 %; P = 0·001). Those who ate regular meals in 4th grade but not in 7th grade had higher odds (OR = 3·1; 95 % CI 1·1, 9·0) of being overweight in 7th grade after adjusting for gender, maternal education and physical activity, but the odds ratio was not statistically significant after adjusting for overweight in 4th grade (OR = 2·8; 95 % CI 0·7, 11·6). The present study showed significant increases in overall meal skipping among children between 4th and 7th grade. The results indicate an association between overweight and meal skipping, but additional prospective and longitudinal analyses and intervention trials are warranted to confirm this relationship.

  19. Predictive simulation of gait at low gravity reveals skipping as the preferred locomotion strategy

    PubMed Central

    Ackermann, Marko; van den Bogert, Antonie J.

    2012-01-01

    The investigation of gait strategies at low gravity environments gained momentum recently as manned missions to the Moon and to Mars are reconsidered. Although reports by astronauts of the Apollo missions indicate alternative gait strategies might be favored on the Moon, computational simulations and experimental investigations have been almost exclusively limited to the study of either walking or running, the locomotion modes preferred under Earth's gravity. In order to investigate the gait strategies likely to be favored at low gravity a series of predictive, computational simulations of gait are performed using a physiological model of the musculoskeletal system, without assuming any particular type of gait. A computationally efficient optimization strategy is utilized allowing for multiple simulations. The results reveal skipping as more efficient and less fatiguing than walking or running and suggest the existence of a walk-skip rather than a walk-run transition at low gravity. The results are expected to serve as a background to the design of experimental investigations of gait under simulated low gravity. PMID:22365845

  20. Predictive simulation of gait at low gravity reveals skipping as the preferred locomotion strategy.

    PubMed

    Ackermann, Marko; van den Bogert, Antonie J

    2012-04-30

    The investigation of gait strategies at low gravity environments gained momentum recently as manned missions to the Moon and to Mars are reconsidered. Although reports by astronauts of the Apollo missions indicate alternative gait strategies might be favored on the Moon, computational simulations and experimental investigations have been almost exclusively limited to the study of either walking or running, the locomotion modes preferred under Earth's gravity. In order to investigate the gait strategies likely to be favored at low gravity a series of predictive, computational simulations of gait are performed using a physiological model of the musculoskeletal system, without assuming any particular type of gait. A computationally efficient optimization strategy is utilized allowing for multiple simulations. The results reveal skipping as more efficient and less fatiguing than walking or running and suggest the existence of a walk-skip rather than a walk-run transition at low gravity. The results are expected to serve as a background to the design of experimental investigations of gait under simulated low gravity. Copyright © 2012 Elsevier Ltd. All rights reserved.

  1. A compatible exon-exon junction database for the identification of exon skipping events using tandem mass spectrum data.

    PubMed

    Mo, Fan; Hong, Xu; Gao, Feng; Du, Lin; Wang, Jun; Omenn, Gilbert S; Lin, Biaoyang

    2008-12-16

    Alternative splicing is an important gene regulation mechanism. It is estimated that about 74% of multi-exon human genes have alternative splicing. High throughput tandem (MS/MS) mass spectrometry provides valuable information for rapidly identifying potentially novel alternatively-spliced protein products from experimental datasets. However, the ability to identify alternative splicing events through tandem mass spectrometry depends on the database against which the spectra are searched. We wrote scripts in perl, Bioperl, mysql and Ensembl API and built a theoretical exon-exon junction protein database to account for all possible combinations of exons for a gene while keeping the frame of translation (i.e., keeping only in-phase exon-exon combinations) from the Ensembl Core Database. Using our liver cancer MS/MS dataset, we identified a total of 488 non-redundant peptides that represent putative exon skipping events. Our exon-exon junction database provides the scientific community with an efficient means to identify novel alternatively spliced (exon skipping) protein isoforms using mass spectrometry data. This database will be useful in annotating genome structures using rapidly accumulating proteomics data.

  2. Subsurface-channeling-like energy loss structure of the skipping motion on an ionic crystal.

    PubMed

    Villette, J; Borisov, A G; Khemliche, H; Momeni, A; Roncin, P

    2000-10-09

    The skipping motion of Ne+ ions in grazing scattering from the LiF(001) surface is studied for velocity below 0.1 a.u. with a time-of-flight technique. It is demonstrated that suppression of electronic excitation and dominance of optical phonon excitation in the projectile stopping results in an odd 1,3,5,... progression of the energy loss peaks, a feature usually ascribed to subsurface channeling. The experimental findings are well reproduced by parameter-free model calculations where thermal vibrations are the dominant cause for the ion trapping and detrapping.

  3. Parental Functional Health Literacy Relates to Skip Pattern Questionnaire Error and to Child Oral Health

    PubMed Central

    Garrett, Gail M.; Citi, Alicia M.; Gansky, Stuart A.

    2012-01-01

    The study's purpose was to determine if parental dental functional-health-literacy (FHL) related to child oral health; a secondary aim was to assess if errors in completing the questionnaire related to FHL and child oral health. Parents of pediatric clinic children (N=101) completed questionnaires; dental caries indices were recorded. Higher FHL was negatively correlated with worse child caries (r=-0.23), but not subjective oral health. Mean FHL seemed to differ by skip pattern (p=0.087), indicating it may be a potential FHL proxy. PMID:22685950

  4. 2005 Service Academies: Sexual Assault Survey: Administration, Datasets and Codebook

    DTIC Science & Technology

    2005-10-01

    sex w/you-Uned 326 SB026SK* [26sk] Situation w/ greatest eff -Skip 204 SB027* 27. [27---] In which semester did this occur 205 SB027U* [27...Tab recode SB038CR: Commis Officer COC 669 SB038CU* [38c] Retal by officer in chain o c-Uned 370 SB038D* 38d. [38d] Retal by other academy...sex w/you 203 SB026SK [26sk] Situation w/ greatest eff -Skip 204 SB027 27. [27---] In which semester did this occur 205 SB028 28. [28---] Where

  5. Integrated Planning for Telepresence with Time Delays

    NASA Technical Reports Server (NTRS)

    Johnston, Mark D.; Rabe, Kenneth J.

    2006-01-01

    Integrated planning and execution of teleoperations in space with time delays is shown. The topics include: 1) The Problem; 2) Future Robot Surgery? 3) Approach Overview; 4) Robonaut; 5) Normal Planning and Execution; 6) Planner Context; 7) Implementation; 8) Use of JSHOP2; 9) Monitoring and Testing GUI; 10) Normal sequence: first the supervisor acts; 11) then the robot; 12) Robot might be late; 13) Supervisor can work ahead; 14) Deviations from Plan; 15) Robot State Change Example; 16) Accomplished goals skipped in replan; 17) Planning continuity; 18) Supervisor Deviation From Plan; 19) Intentional Deviation; and 20) Infeasible states.

  6. Melanocortin-1 receptor, skin cancer and phenotypic characteristics (M-SKIP) project: study design and methods for pooling results of genetic epidemiological studies

    PubMed Central

    2012-01-01

    Background For complex diseases like cancer, pooled-analysis of individual data represents a powerful tool to investigate the joint contribution of genetic, phenotypic and environmental factors to the development of a disease. Pooled-analysis of epidemiological studies has many advantages over meta-analysis, and preliminary results may be obtained faster and with lower costs than with prospective consortia. Design and methods Based on our experience with the study design of the Melanocortin-1 receptor (MC1R) gene, SKin cancer and Phenotypic characteristics (M-SKIP) project, we describe the most important steps in planning and conducting a pooled-analysis of genetic epidemiological studies. We then present the statistical analysis plan that we are going to apply, giving particular attention to methods of analysis recently proposed to account for between-study heterogeneity and to explore the joint contribution of genetic, phenotypic and environmental factors in the development of a disease. Within the M-SKIP project, data on 10,959 skin cancer cases and 14,785 controls from 31 international investigators were checked for quality and recoded for standardization. We first proposed to fit the aggregated data with random-effects logistic regression models. However, for the M-SKIP project, a two-stage analysis will be preferred to overcome the problem regarding the availability of different study covariates. The joint contribution of MC1R variants and phenotypic characteristics to skin cancer development will be studied via logic regression modeling. Discussion Methodological guidelines to correctly design and conduct pooled-analyses are needed to facilitate application of such methods, thus providing a better summary of the actual findings on specific fields. PMID:22862891

  7. Endoscopic Skipping of the Terminal Ileum in Pediatric Crohn Disease.

    PubMed

    Mansuri, Ishrat; Fletcher, Joel G; Bruining, David H; Kolbe, Amy B; Fidler, Jeff L; Samuel, Sunil; Tung, Jeanne

    2017-06-01

    Pediatric small-bowel (SB) Crohn disease (CD) may be missed if the terminal ileum (TI) appears normal at endoscopy and SB imaging is not performed. We sought to estimate the prevalence and clinical characteristics of pediatric patients with CD and endoscopic skipping of the TI-that is, pediatric patients with active SB or upper gut inflammation and an endoscopically normal TI. This retrospective study included pediatric patients with CD who underwent both CT enterography (CTE) or MR enterography (MRE) and ileocolonoscopy within a 30-day period between July 2004 and April 2014. The physician global assessment was used as the reference standard for SB CD activity. Radiologists reviewed the CTE and MRE studies for inflammatory parameters; severity, length, and multifocality of SB inflammation; and the presence of penetrating complications. Of 170 patients who underwent ileal intubation, the TI was macroscopically normal or showed nonspecific inflammation in 73 patients (43%). Nearly half (36/73, 49%) of the patients with normal or nonspecific findings at ileocolonoscopy had radiologically active disease with a median length of SB involvement of 20 cm (range, 1 to > 100 cm). Seventeen (47%) of these patients had multifocal SB involvement and five (14%) had penetrating complications. Overall, endoscopic TI skipping was present in 43 (59%) patients with normal or nonspecific ileocolonoscopic findings: 20 with histologic inflammation (17 with positive imaging findings), 14 with inflammation at imaging only, and nine with proximal disease (upper gut, jejunum, or proximal ileum). There were no significant differences in the clinical parameters of the patients with and those without endoscopic TI skipping. Ileocolonoscopy may miss SB CD in pediatric patients that is due to isolated histologic, intramural, or proximal inflammation. Enterography is complementary to ileocolonoscopy in the evaluation of pediatric CD.

  8. Fast-food outlets and grocery stores near school and adolescents' eating habits and overweight in Finland.

    PubMed

    Virtanen, Marianna; Kivimäki, Hanne; Ervasti, Jenni; Oksanen, Tuula; Pentti, Jaana; Kouvonen, Anne; Halonen, Jaana I; Kivimäki, Mika; Vahtera, Jussi

    2015-08-01

    Environmental factors may affect adolescents' eating habits and thereby body weight. However, the contribution of school neighbourhood environment is poorly understood. This study examined the association between proximity of a fast-food outlet or grocery store to school and adolescents' eating habits and overweight. Participants were 23 182 adolescents (mean age 15 years) who responded to a classroom survey in 181 lower secondary schools in Finland (2008-09). School location was linked to data on distance from school to the nearest fast-food outlet or grocery store (≤100 m, 101-500 m, >500 m) using global positioning system-coordinate databases. Outcomes were irregular eating habits (skipping breakfast, skipping free school lunch, skipping free school-provided snacks and not having family dinners), the accumulation of these habits and overweight, including obesity (body mass index ≥ 25 kg/m(2)). Thirteen percentage of the participants were overweight. Having a fast-food outlet or grocery store near school was associated with skipping often breakfast and free school lunch, and the accumulation of irregular eating habits. The proximity of a fast-food outlet or grocery store was associated with a 1.25-fold (95% confidence interval 1.03-1.52) risk of overweight among adolescent with a low socioeconomic status but not among those with higher socioeconomic status. This association was partly (12%) explained by the accumulation of irregular eating habits. Among adolescents from low socioeconomic background, the presence of fast-food retailers near schools is associated with accumulation of irregular eating habits and greater overweight. These findings suggest that obesogenic school neighbourhoods may contribute to social inequalities in overweight. © The Author 2015. Published by Oxford University Press on behalf of the European Public Health Association. All rights reserved.

  9. Meal skipping relates to food choice, understanding of nutrition labeling, and prevalence of obesity in Korean fifth grade children.

    PubMed

    Kim, Hye-Young; Lee, Na-Rae; Lee, Jung-Sug; Choi, Young-Sun; Kwak, Tong-Kyung; Chung, Hae Rang; Kwon, Sehyug; Choi, Youn-Ju; Lee, Soon-Kyu; Kang, Myung-Hee

    2012-08-01

    This study was performed to investigate the differences in food choice, nutrition labeling perceptions, and prevalence of obesity due to meal skipping in Korean elementary school children. A national survey was performed in 2010 to collect data on food intake frequency, understanding of nutrition labeling, and body mass index from 2,335 fifth grade students in 118 elementary schools selected from 16 metropolitan local governments by stratified cluster sampling. The data were analyzed using the SAS 9.1 and SUDAAN 10.0 packages. Students who consumed three meals for 6-7 days during the past week were classified into the regular meal eating (RM) group (n = 1,476) and those who did not were placed into the meal skipping (MS) group (n = 859). The daily intake frequency of fruits, vegetables, kimchi, and milk was significantly lower in the MS group compared to that in the RM group (P < 0.001), whereas the daily intake frequency of soft drinks and instant noodles (ramyeon) was significantly higher in the MS group than that in the RM group (P < 0.05). The MS group demonstrated a significantly lower degree of understanding with regard to nutrition labeling and high calorie foods containing low nutritional value than that in the RM group. The distribution of obesity based on the percentile criteria using the Korean growth chart was different between the MS and RM groups. The MS group (8.97%) had a higher percentage of obese subjects than that in the RM group (5.38%). In conclusion, meal skipping was related to poor food choice, low perception of nutrition labeling, and a high prevalence of obesity in Korean fifth grade children.

  10. Meal skipping relates to food choice, understanding of nutrition labeling, and prevalence of obesity in Korean fifth grade children

    PubMed Central

    Kim, Hye-Young; Lee, Na-Rae; Lee, Jung-Sug; Choi, Young-Sun; Kwak, Tong-Kyung; Chung, Hae Rang; Kwon, Sehyug; Choi, Youn-Ju; Lee, Soon-Kyu

    2012-01-01

    This study was performed to investigate the differences in food choice, nutrition labeling perceptions, and prevalence of obesity due to meal skipping in Korean elementary school children. A national survey was performed in 2010 to collect data on food intake frequency, understanding of nutrition labeling, and body mass index from 2,335 fifth grade students in 118 elementary schools selected from 16 metropolitan local governments by stratified cluster sampling. The data were analyzed using the SAS 9.1 and SUDAAN 10.0 packages. Students who consumed three meals for 6-7 days during the past week were classified into the regular meal eating (RM) group (n = 1,476) and those who did not were placed into the meal skipping (MS) group (n = 859). The daily intake frequency of fruits, vegetables, kimchi, and milk was significantly lower in the MS group compared to that in the RM group (P < 0.001), whereas the daily intake frequency of soft drinks and instant noodles (ramyeon) was significantly higher in the MS group than that in the RM group (P < 0.05). The MS group demonstrated a significantly lower degree of understanding with regard to nutrition labeling and high calorie foods containing low nutritional value than that in the RM group. The distribution of obesity based on the percentile criteria using the Korean growth chart was different between the MS and RM groups. The MS group (8.97%) had a higher percentage of obese subjects than that in the RM group (5.38%). In conclusion, meal skipping was related to poor food choice, low perception of nutrition labeling, and a high prevalence of obesity in Korean fifth grade children. PMID:22977687

  11. Breakfast skipping and breakfast type are associated with daily nutrient intakes and metabolic syndrome in Korean adults

    PubMed Central

    Chung, Sang-Jin; Lee, Yoonna; Lee, Seokhwa

    2015-01-01

    BACKGROUND/OBJECTIVES Emerging evidence shows that eating breakfast and breakfast types may be associated with health outcomes and dietary intakes in various populations. The aim of this study was to investigate the association between breakfast types in Korean adults with their daily nutrient intakes and health outcomes. SUBJECTS/METHODS A total of 11,801 20- to 64-year-old adults (age 42.9 ± 11.8 yrs [mean ± standard error of the mean]; male 41.1%, female 58.9%) in 2007-2009 Korean National Health and Nutrition Survey data were divided into 5 groups based on breakfast types in a 24-hr dietary recall: rice with 3 or more side dishes (Rice3+, 35.3%), rice with 0-2 side dishes (Rice0-2, 34.73%), noodles (1.56%), bread and cereal (6.56%), and breakfast skipping (21.63%). Daily nutrient intakes and the risk of metabolic syndrome were compared among five groups. RESULTS Compared with Korean Recommended Nutrient Intake levels, the breakfast-skipping group showed the lowest intake level in most nutrients, whereas the Rice3+ group showed the highest. Fat intake was higher in the bread and noodle groups than in the other groups. When compared with the Rice3+ group, the odds ratios for the risk of obesity and metabolic syndrome were increased in the breakfast skipping, Rice0-2, and noodle groups after controlling for confounding variables. CONCLUSIONS The rice-based breakfast group showed better nutritional status and health outcomes when eating with 3 or more side dishes. Nutrition education is needed to emphasize both the potential advantage of the rice-based, traditional Korean diet in terms of nutritional content and the importance of food diversity. PMID:26060541

  12. Effects of systemic multiexon skipping with peptide-conjugated morpholinos in the heart of a dog model of Duchenne muscular dystrophy

    PubMed Central

    Echigoya, Yusuke; Nakamura, Akinori; Nagata, Tetsuya; Urasawa, Nobuyuki; Trieu, Nhu; Panesar, Dharminder; Kuraoka, Mutsuki; Moulton, Hong M.; Saito, Takashi; Aoki, Yoshitsugu; Iversen, Patrick; Sazani, Peter; Kole, Ryszard; Maruyama, Rika; Partridge, Terry; Takeda, Shin’ichi; Yokota, Toshifumi

    2017-01-01

    Duchenne muscular dystrophy (DMD) is a lethal genetic disorder caused by an absence of the dystrophin protein in bodywide muscles, including the heart. Cardiomyopathy is a leading cause of death in DMD. Exon skipping via synthetic phosphorodiamidate morpholino oligomers (PMOs) represents one of the most promising therapeutic options, yet PMOs have shown very little efficacy in cardiac muscle. To increase therapeutic potency in cardiac muscle, we tested a next-generation morpholino: arginine-rich, cell-penetrating peptide-conjugated PMOs (PPMOs) in the canine X-linked muscular dystrophy in Japan (CXMDJ) dog model of DMD. A PPMO cocktail designed to skip dystrophin exons 6 and 8 was injected intramuscularly, intracoronarily, or intravenously into CXMDJ dogs. Intravenous injections with PPMOs restored dystrophin expression in the myocardium and cardiac Purkinje fibers, as well as skeletal muscles. Vacuole degeneration of cardiac Purkinje fibers, as seen in DMD patients, was ameliorated in PPMO-treated dogs. Although symptoms and functions in skeletal muscle were not ameliorated by i.v. treatment, electrocardiogram abnormalities (increased Q-amplitude and Q/R ratio) were improved in CXMDJ dogs after intracoronary or i.v. administration. No obvious evidence of toxicity was found in blood tests throughout the monitoring period of one or four systemic treatments with the PPMO cocktail (12 mg/kg/injection). The present study reports the rescue of dystrophin expression and recovery of the conduction system in the heart of dystrophic dogs by PPMO-mediated multiexon skipping. We demonstrate that rescued dystrophin expression in the Purkinje fibers leads to the improvement/prevention of cardiac conduction abnormalities in the dystrophic heart. PMID:28373570

  13. Effects of systemic multiexon skipping with peptide-conjugated morpholinos in the heart of a dog model of Duchenne muscular dystrophy.

    PubMed

    Echigoya, Yusuke; Nakamura, Akinori; Nagata, Tetsuya; Urasawa, Nobuyuki; Lim, Kenji Rowel Q; Trieu, Nhu; Panesar, Dharminder; Kuraoka, Mutsuki; Moulton, Hong M; Saito, Takashi; Aoki, Yoshitsugu; Iversen, Patrick; Sazani, Peter; Kole, Ryszard; Maruyama, Rika; Partridge, Terry; Takeda, Shin'ichi; Yokota, Toshifumi

    2017-04-18

    Duchenne muscular dystrophy (DMD) is a lethal genetic disorder caused by an absence of the dystrophin protein in bodywide muscles, including the heart. Cardiomyopathy is a leading cause of death in DMD. Exon skipping via synthetic phosphorodiamidate morpholino oligomers (PMOs) represents one of the most promising therapeutic options, yet PMOs have shown very little efficacy in cardiac muscle. To increase therapeutic potency in cardiac muscle, we tested a next-generation morpholino: arginine-rich, cell-penetrating peptide-conjugated PMOs (PPMOs) in the canine X-linked muscular dystrophy in Japan (CXMD J ) dog model of DMD. A PPMO cocktail designed to skip dystrophin exons 6 and 8 was injected intramuscularly, intracoronarily, or intravenously into CXMD J dogs. Intravenous injections with PPMOs restored dystrophin expression in the myocardium and cardiac Purkinje fibers, as well as skeletal muscles. Vacuole degeneration of cardiac Purkinje fibers, as seen in DMD patients, was ameliorated in PPMO-treated dogs. Although symptoms and functions in skeletal muscle were not ameliorated by i.v. treatment, electrocardiogram abnormalities (increased Q-amplitude and Q/R ratio) were improved in CXMD J dogs after intracoronary or i.v. administration. No obvious evidence of toxicity was found in blood tests throughout the monitoring period of one or four systemic treatments with the PPMO cocktail (12 mg/kg/injection). The present study reports the rescue of dystrophin expression and recovery of the conduction system in the heart of dystrophic dogs by PPMO-mediated multiexon skipping. We demonstrate that rescued dystrophin expression in the Purkinje fibers leads to the improvement/prevention of cardiac conduction abnormalities in the dystrophic heart.

  14. TDRS-L Tribute Decal to Arthur "Skip" Mackey, Jr.

    NASA Image and Video Library

    2014-01-22

    CAPE CANAVERAL, Fla. – This memorial message was added to the Atlas V rocket for NASA's Tracking and Data Relay Satellite, or TDRS-L, spacecraft being prepared for launch from Cape Canaveral Air Force Station's Launch Complex 41. Arthur J. "Skip" Mackey Jr. was the “Voice of NASA” during the 1960s, 1970s and early 1980s for flight commentary after liftoff for expendable vehicles launched from Cape Canaveral. Mackey served as branch chief for Telemetry and Communications at Hangar AE in the agency’s Expendable Launch Vehicle Program and then the Launch Services Program for 39 years. He died in Fort Lauderdale, Fla., on Nov. 19, 2013. The TDRS-L spacecraft is the second of three new satellites designed to ensure vital operational continuity for NASA by expanding the lifespan of the Tracking and Data Relay Satellite System TDRSS fleet, which consists of eight satellites in geosynchronous orbit. The spacecraft provide tracking, telemetry, command and high bandwidth data return services for numerous science and human exploration missions orbiting Earth. These include NASA's Hubble Space Telescope and the International Space Station. TDRS-L has a high-performance solar panel designed for more spacecraft power to meet the growing S-band communications requirements. TDRSS is one of NASA Space Communication and Navigation’s SCaN three networks providing space communications to NASA’s missions. For more information more about TDRS-L, visit: http://www.nasa.gov/tdrs To learn more about SCaN, visit: www.nasa.gov/scan For more on "Skip" Mackey go to: http://www.nasa.gov/content/skip-mackey-remembered-by-colleagues-as-voice-of-nasa/ Image credit: United Launch Alliance

  15. Benchmark eye movement effects during natural reading in autism spectrum disorder.

    PubMed

    Howard, Philippa L; Liversedge, Simon P; Benson, Valerie

    2017-01-01

    In 2 experiments, eye tracking methodology was used to assess on-line lexical, syntactic and semantic processing in autism spectrum disorder (ASD). In Experiment 1, lexical identification was examined by manipulating the frequency of target words. Both typically developed (TD) and ASD readers showed normal frequency effects, suggesting that the processes TD and ASD readers engage in to identify words are comparable. In Experiment 2, syntactic parsing and semantic interpretation requiring the on-line use of world knowledge were examined, by having participants read garden path sentences containing an ambiguous prepositional phrase. Both groups showed normal garden path effects when reading low-attached sentences and the time course of reading disruption was comparable between groups. This suggests that not only do ASD readers hold similar syntactic preferences to TD readers, but also that they use world knowledge on-line during reading. Together, these experiments demonstrate that the initial construction of sentence interpretation appears to be intact in ASD. However, the finding that ASD readers skip target words less often in Experiment 2, and take longer to read sentences during second pass for both experiments, suggests that they adopt a more cautious reading strategy and take longer to evaluate their sentence interpretation prior to making a manual response. (PsycINFO Database Record (c) 2017 APA, all rights reserved).

  16. Adaptive Phase Delay Generator

    NASA Technical Reports Server (NTRS)

    Greer, Lawrence

    2013-01-01

    There are several experimental setups involving rotating machinery that require some form of synchronization. The adaptive phase delay generator (APDG) the Bencic-1000 is a flexible instrument that allows the user to generate pulses synchronized to the rising edge of a tachometer signal from any piece of rotating machinery. These synchronized pulses can vary by the delay angle, pulse width, number of pulses per period, number of skipped pulses, and total number of pulses. Due to the design of the pulse generator, any and all of these parameters can be changed independently, yielding an unparalleled level of versatility. There are two user interfaces to the APDG. The first is a LabVIEW program that has the advantage of displaying all of the pulse parameters and input signal data within one neatly organized window on the PC monitor. Furthermore, the LabVIEW interface plots the rpm of the two input signal channels in real time. The second user interface is a handheld portable device that goes anywhere a computer is not accessible. It consists of a liquid-crystal display and keypad, which enable the user to control the unit by scrolling through a host of command menus and parameter listings. The APDG combines all of the desired synchronization control into one unit. The experimenter can adjust the delay, pulse width, pulse count, number of skipped pulses, and produce a specified number of pulses per revolution. Each of these parameters can be changed independently, providing an unparalleled level of versatility when synchronizing hardware to a host of rotating machinery. The APDG allows experimenters to set up quickly and generate a host of synchronizing configurations using a simple user interface, which hopefully leads to faster results.

  17. Behavioural factors related with successful weight loss 15 months post-enrolment in a commercial web-based weight-loss programme.

    PubMed

    Neve, Melinda J; Morgan, Philip J; Collins, Clare E

    2012-07-01

    As further understanding is required of what behavioural factors are associated with long-term weight-loss success, the aim of the present study was to determine the prevalence of successful weight loss 15 months post-enrolment in a commercial web-based weight-loss programme and which behavioural factors were associated with success. An online survey was completed 15 months post-enrolment in a commercial web-based weight-loss programme to assess weight-related behaviours and current weight. Participants were classified as successful if they had lost ≥5 % of their starting weight after 15 months. Commercial users of a web-based weight-loss programme. Participants enrolled in the commercial programme between August 2007 and May 2008. Six hundred and seventy-seven participants completed the survey. The median (interquartile range) weight change was -2·7 (-8·2, 1·6) % of enrolment weight, with 37 % achieving ≥5 % weight loss. Multivariate logistic regression analysis found success was associated with frequency of weight self-monitoring, higher dietary restraint score, lower emotional eating score, not skipping meals, not keeping snack foods in the house and eating takeaway foods less frequently. The findings suggest that individuals trying to achieve or maintain ≥5 % weight loss should be advised to regularly weigh themselves, avoid skipping meals or keeping snack foods in the house, limit the frequency of takeaway food consumption, manage emotional eating and strengthen dietary restraint. Strategies to assist individuals make these changes to behaviour should be incorporated within obesity treatments to improve the likelihood of successful weight loss in the long term.

  18. Manned geosynchronous mission requirements and systems analysis study. Volume 1: Executive summary

    NASA Technical Reports Server (NTRS)

    Boyland, R. E.; Sherman, S. W.; Morfin, H. W.

    1979-01-01

    The crew capsule of the MOTV was studied with emphasis on crew accommodations, crew capsule functional requirements, subsystem interface definition between crew module and propulsion module, and man rating requirements. Competing mission modes were studied covering a wide range of propulsion concepts. These included one stage, one and one half stage, and two stage concepts using either the standard STS or an augmented STS. Several deorbit concepts were considered, including all propulsive modes, direct re-entry, and aeromaneuvering skip in skip out in the upper reaches of Earth's atmosphere. A five year plan covering costs, schedules, and critical technology issues is discussed.

  19. Exon skipping and gene transfer restore dystrophin expression in human induced pluripotent stem cells-cardiomyocytes harboring DMD mutations.

    PubMed

    Dick, Emily; Kalra, Spandan; Anderson, David; George, Vinoj; Ritso, Morten; Laval, Steven H; Barresi, Rita; Aartsma-Rus, Annemieke; Lochmüller, Hanns; Denning, Chris

    2013-10-15

    With an incidence of ∼1:3,500 to 5,000 in male children, Duchenne muscular dystrophy (DMD) is an X-linked disorder in which progressive muscle degeneration occurs and affected boys usually die in their twenties or thirties. Cardiac involvement occurs in 90% of patients and heart failure accounts for up to 40% of deaths. To enable new therapeutics such as gene therapy and exon skipping to be tested in human cardiomyocytes, we produced human induced pluripotent stem cells (hiPSC) from seven patients harboring mutations across the DMD gene. Mutations were retained during differentiation and analysis indicated the cardiomyocytes showed a dystrophic gene expression profile. Antisense oligonucleotide-mediated skipping of exon 51 restored dystrophin expression to ∼30% of normal levels in hiPSC-cardiomyocytes carrying exon 47-50 or 48-50 deletions. Alternatively, delivery of a dystrophin minigene to cardiomyocytes with a deletion in exon 35 or a point mutation in exon 70 allowed expression levels similar to those seen in healthy cells. This demonstrates that DMD hiPSC-cardiomyocytes provide a novel tool to evaluate whether new therapeutics can restore dystrophin expression in the heart.

  20. Nanoparticle Delivery of Antisense Oligonucleotides and Their Application in the Exon Skipping Strategy for Duchenne Muscular Dystrophy

    PubMed Central

    Falzarano, Maria Sofia; Passarelli, Chiara

    2014-01-01

    Antisense therapy is a powerful tool for inducing post-transcriptional modifications and thereby regulating target genes associated with disease. There are several classes of antisense oligonucleotides (AONs) with therapeutic use, such as double-stranded RNAs (interfering RNAs, utilized for gene silencing, and single-stranded AONs with various chemistries, which are useful for antisense targeting of micro-RNAs and mRNAs. In particular, the use of AONs for exon skipping, by targeting pre-mRNA, is proving to be a highly promising therapy for some genetic disorders like Duchenne muscular dystrophy and spinal muscular atrophy. However, AONs are unable to cross the plasma membrane unaided, and several other obstacles still remain to be overcome, in particular their instability due to their nuclease sensitivity and their lack of tissue specificity. Various drug delivery systems have been explored to improve the bioavailability of nucleic acids, and nanoparticles (NPs) have been suggested as potential vectors for DNA/RNA. This review describes the recent progress in AON conjugation with natural and synthetic delivery systems, and provides an overview of the efficacy of NP-AON complexes as an exon-skipping treatment for Duchenne muscular dystrophy. PMID:24506782

  1. Exon Skipping and Gene Transfer Restore Dystrophin Expression in Human Induced Pluripotent Stem Cells-Cardiomyocytes Harboring DMD Mutations

    PubMed Central

    Dick, Emily; Kalra, Spandan; Anderson, David; George, Vinoj; Ritso, Morten; Laval, Steven H.; Barresi, Rita; Aartsma-Rus, Annemieke; Lochmüller, Hanns

    2013-01-01

    With an incidence of ∼1:3,500 to 5,000 in male children, Duchenne muscular dystrophy (DMD) is an X-linked disorder in which progressive muscle degeneration occurs and affected boys usually die in their twenties or thirties. Cardiac involvement occurs in 90% of patients and heart failure accounts for up to 40% of deaths. To enable new therapeutics such as gene therapy and exon skipping to be tested in human cardiomyocytes, we produced human induced pluripotent stem cells (hiPSC) from seven patients harboring mutations across the DMD gene. Mutations were retained during differentiation and analysis indicated the cardiomyocytes showed a dystrophic gene expression profile. Antisense oligonucleotide-mediated skipping of exon 51 restored dystrophin expression to ∼30% of normal levels in hiPSC-cardiomyocytes carrying exon 47–50 or 48–50 deletions. Alternatively, delivery of a dystrophin minigene to cardiomyocytes with a deletion in exon 35 or a point mutation in exon 70 allowed expression levels similar to those seen in healthy cells. This demonstrates that DMD hiPSC-cardiomyocytes provide a novel tool to evaluate whether new therapeutics can restore dystrophin expression in the heart. PMID:23829870

  2. A mechanism for exon skipping caused by nonsense or missense mutations in BRCA1 and other genes.

    PubMed

    Liu, H X; Cartegni, L; Zhang, M Q; Krainer, A R

    2001-01-01

    Point mutations can generate defective and sometimes harmful proteins. The nonsense-mediated mRNA decay (NMD) pathway minimizes the potential damage caused by nonsense mutations. In-frame nonsense codons located at a minimum distance upstream of the last exon-exon junction are recognized as premature termination codons (PTCs), targeting the mRNA for degradation. Some nonsense mutations cause skipping of one or more exons, presumably during pre-mRNA splicing in the nucleus; this phenomenon is termed nonsense-mediated altered splicing (NAS), and its underlying mechanism is unclear. By analyzing NAS in BRCA1, we show here that inappropriate exon skipping can be reproduced in vitro, and results from disruption of a splicing enhancer in the coding sequence. Enhancers can be disrupted by single nonsense, missense and translationally silent point mutations, without recognition of an open reading frame as such. These results argue against a nuclear reading-frame scanning mechanism for NAS. Coding-region single-nucleotide polymorphisms (cSNPs) within exonic splicing enhancers or silencers may affect the patterns or efficiency of mRNA splicing, which may in turn cause phenotypic variability and variable penetrance of mutations elsewhere in a gene.

  3. Functional analysis of a large set of BRCA2 exon 7 variants highlights the predictive value of hexamer scores in detecting alterations of exonic splicing regulatory elements.

    PubMed

    Di Giacomo, Daniela; Gaildrat, Pascaline; Abuli, Anna; Abdat, Julie; Frébourg, Thierry; Tosi, Mario; Martins, Alexandra

    2013-11-01

    Exonic variants can alter pre-mRNA splicing either by changing splice sites or by modifying splicing regulatory elements. Often these effects are difficult to predict and are only detected by performing RNA analyses. Here, we analyzed, in a minigene assay, 26 variants identified in the exon 7 of BRCA2, a cancer predisposition gene. Our results revealed eight new exon skipping mutations in this exon: one directly altering the 5' splice site and seven affecting potential regulatory elements. This brings the number of splicing regulatory mutations detected in BRCA2 exon 7 to a total of 11, a remarkably high number considering the total number of variants reported in this exon (n = 36), all tested in our minigene assay. We then exploited this large set of splicing data to test the predictive value of splicing regulator hexamers' scores recently established by Ke et al. (). Comparisons of hexamer-based predictions with our experimental data revealed high sensitivity in detecting variants that increased exon skipping, an important feature for prescreening variants before RNA analysis. In conclusion, hexamer scores represent a promising tool for predicting the biological consequences of exonic variants and may have important applications for the interpretation of variants detected by high-throughput sequencing. © 2013 WILEY PERIODICALS, INC.

  4. Histopathological analysis of aggressive renal cell carcinoma harboring a unique germline mutation in fumarate hydratase.

    PubMed

    Matsumoto, Kana; Udaka, Naoko; Hasumi, Hisashi; Nakaigawa, Noboru; Nagashima, Yoji; Tanaka, Reiko; Kato, Ikuma; Yao, Masahiro; Furuya, Mitsuko

    2018-05-24

    Hereditary leiomyomatosis and renal cell cancer (HLRCC) is a rare genetic disorder characterized by cutaneous and uterine leiomyomatosis with RCC. This disorder is caused by a germline mutation in the fumarate hydratase (FH) gene, which encodes an important enzyme of the tricarboxylic acid (TCA) cycle. This mutation distinguishes HLRCC from sporadic RCCs. Herein, we investigated a case of HLRCC in a 32-year-old man who underwent nephrectomy for treatment of a solid-cystic tumor in the left kidney. Histopathology demonstrated a variegated architecture of papillary, tubulocystic and cribriform patterns composed of high-grade tumor cells with enlarged nuclei and eosinophilic nucleoli. Immunostaining and western blotting revealed no FH expression in the tumor. Genomic DNA sequencing identified a heterozygous mutation involving deletion of the 3' end of exon 2 and intron 2 of the FH gene (c.251_267+7delTGACAGAACGCATGCCAGTAAGTG), and RT-PCR confirmed exon 2 skipping in FH mRNA. The somatic FH gene status of the tumor showed only the mutated allele, indicating loss of heterozygosity as the "second hit" of tumor suppressor gene inactivation. These data support that an FH mutation involving the splice site causes exon skipping, changing the conformation of the protein and accelerating carcinogenic cascades under impaired FH functioning in the TCA cycle. © 2018 Japanese Society of Pathology and John Wiley & Sons Australia, Ltd.

  5. A typical working-day breakfast among children, adolescents and adults belonging to the middle and upper socio-economic classes in Mumbai, India - challenges and implications for dietary change.

    PubMed

    Sivaramakrishnan, Malathi; Kamath, Vidya

    2012-11-01

    Breakfast has been linked to several aspects of health, yet breakfast skipping is rampant across the globe. Studies in India have focused mostly on children. Hence the present study examined breakfast behaviour across different age and gender groups. Cross-sectional sample, purposive sampling. Nutrient intakes of the participants derived from 24 h dietary recall and 3 d breakfast record data were compared with RDA values prescribed by the Indian Council of Medical Research using Student's t test, with P < 0·05 taken to indicate significance. Mumbai, India. Participants (n 1027) aged 8 years and above. Nutritional adequacy of the breakfast meal and that of the day's diet were the main outcome measures. Eighty-one per cent of the participants had a nutritionally inadequate breakfast. Intakes of Fe and dietary fibre were notably low. Consumption of just milk or milk plus a milk food-based drink among schoolchildren (49 %) and increased breakfast skipping among adolescents (37 %) were seen. The study identifies both irregularities and/or nutritional inadequacies with respect to the breakfast meal. Age- and gender-specific challenges in breakfast behaviour need to be addressed. Development of 'nutrient-dense' breakfast foods that can be prepared easily, school breakfast programmes and education on the importance of breakfast are the needs of the hour.

  6. Functional changes in Becker muscular dystrophy: implications for clinical trials in dystrophinopathies.

    PubMed

    Bello, Luca; Campadello, Paola; Barp, Andrea; Fanin, Marina; Semplicini, Claudio; Sorarù, Gianni; Caumo, Luca; Calore, Chiara; Angelini, Corrado; Pegoraro, Elena

    2016-09-01

    We performed a 1-year longitudinal study of Six Minute Walk Test (6MWT), North Star Ambulatory Assessment (NSAA), and timed function tests in Becker muscular dystrophy (BMD). Skeletal muscle dystrophin was quantified by immunoblot. We grouped deletions ending on exon 45 ("del 45-x", n = 28) or 51 ("del x-51", n = 10); isolated exon 48 deletion ("del 48", n = 10); and other mutations (n = 21). Only patients in the "del 45-x" or "other" groups became non-ambulatory (n = 5, log-rank p = n.s.) or unable to run (n = 22, p < 0.001). All measures correlated positively with dystrophin quantity and negatively with age, and were significantly more impaired in the "del 45-x" and "other" groups. After one year, NSAA score decreased significantly (-0.9 ± 1.6, p < 0.001); in the "del 45-x" group, both NSAA (-1.3 ± 1.7, p = 0.001) and 6MWT (-12 ± 31 m, p = 0.059) decreased. We conclude that patients with "del x-51" or "del 48" mutations have mild or asymptomatic BMD, while "del 45-x" mutations cause comparatively severe weakness, and functional deterioration in 1 year. Furthermore, exon 51 skipping could be more effective than exon 45 skipping in Duchenne muscular dystrophy.

  7. Maternal work hours and adolescents' school outcomes among low-income families in four urban counties.

    PubMed

    Gennetian, Lisaa A; Lopoo, Leonard M; London, Andrew S

    2008-02-01

    We examine how changes in maternal work hours affect adolescent children's school participation and performance outcomes using data from interviews in 1998 and 2001 with approximately 1700 women who, in May 1995, were welfare-reliant, single mothers of adolescents living in neighborhoods of concentrated poverty in Cuyahoga (Cleveland), Los Angeles, Miami-Dade, and Philadelphia counties. Analyses control for a broad array of mothers' characteristics, including their psychological and physical health, experiences with domestic violence and substance abuse, as well as unobserved time-invariant characteristics. In fixed-effects models, we find unfavorable effects of increased maternal work hours on three of six outcomes: skipping school, performing above average, and parental contact about behavior problems. Adolescent-aged sons seem to be particularly sensitive to changes in mothers' hours of work.

  8. Modeling human decision making behavior in supervisory control

    NASA Technical Reports Server (NTRS)

    Tulga, M. K.; Sheridan, T. B.

    1977-01-01

    An optimal decision control model was developed, which is based primarily on a dynamic programming algorithm which looks at all the available task possibilities, charts an optimal trajectory, and commits itself to do the first step (i.e., follow the optimal trajectory during the next time period), and then iterates the calculation. A Bayesian estimator was included which estimates the tasks which might occur in the immediate future and provides this information to the dynamic programming routine. Preliminary trials comparing the human subject's performance to that of the optimal model show a great similarity, but indicate that the human skips certain movements which require quick change in strategy.

  9. Performance analysis of visual tracking algorithms for motion-based user interfaces on mobile devices

    NASA Astrophysics Data System (ADS)

    Winkler, Stefan; Rangaswamy, Karthik; Tedjokusumo, Jefry; Zhou, ZhiYing

    2008-02-01

    Determining the self-motion of a camera is useful for many applications. A number of visual motion-tracking algorithms have been developed till date, each with their own advantages and restrictions. Some of them have also made their foray into the mobile world, powering augmented reality-based applications on phones with inbuilt cameras. In this paper, we compare the performances of three feature or landmark-guided motion tracking algorithms, namely marker-based tracking with MXRToolkit, face tracking based on CamShift, and MonoSLAM. We analyze and compare the complexity, accuracy, sensitivity, robustness and restrictions of each of the above methods. Our performance tests are conducted over two stages: The first stage of testing uses video sequences created with simulated camera movements along the six degrees of freedom in order to compare accuracy in tracking, while the second stage analyzes the robustness of the algorithms by testing for manipulative factors like image scaling and frame-skipping.

  10. Growth, the Mediterranean diet and the buying power of adolescents in Greece.

    PubMed

    Grammatikopoulou, Maria G; Gkiouras, Konstantinos; Daskalou, Efstratia; Apostolidou, Eirini; Theodoridis, Xenophon; Stylianou, Charilaos; Galli-Tsinopoulou, Assimina; Tsigga, Maria; Dardavessis, Theodore; Chourdakis, Michael

    2018-06-01

    The aim of the present cross-sectional study was to evaluate associations between pocket money, Mediterranean diet (MD) adherence and growth among Greek adolescents. A total of 319 (157 boys and 162 girls) Greek adolescents, aged 10-18 years participated in the study. Pocket money was recorded, MD adherence was assessed with the KIDMED score and growth was evaluated using the World Health Organization (WHO) growth charts. Participants receiving pocket money exceeding 6.0€ daily demonstrated increased fast-food consumption and breakfast skipping. Overall, a negative relationship was revealed between pocket money and obesity. However, lower allowance receivers were less likely to be obese, consume fruit per day and more likely to consume breakfast and sweets, compared to average pocket money receivers. Increased MD adherence was associated with a lower risk of overweight and as expected, unhealthy eating habits were observed among obese adolescents. Interrelationships tend to exist between MD adherence, pocket money and growth among adolescents.

  11. Skipped Beats

    MedlinePlus

    ... Certification (MOC) Scientific Sessions Certified Education Courses & Online Learning Co-Sponsored & Endorsed Events Educational Resources Career Resources Job Board Fellowships & Program Directors IBHRE Exam Jobs at ...

  12. Kidney adysplasia and variable hydronephrosis, a new mutation affecting the odd-skipped related 1 gene in the mouse, causes variable defects in kidney development and hydronephrosis

    PubMed Central

    Davisson, Muriel T.; Cook, Susan A.; Akeson, Ellen C.; Liu, Don; Heffner, Caleb; Gudis, Polyxeni; Fairfield, Heather

    2015-01-01

    Many genes, including odd-skipped related 1 (Osr1), are involved in regulation of mammalian kidney development. We describe here a new recessive mutation (kidney adysplasia and variable hydronephrosis, kavh) in the mouse that leads to downregulation of Osr1 transcript, causing several kidney defects: agenesis, hypoplasia, and hydronephrosis with variable age of onset. The mutation is closely associated with a reciprocal translocation, T(12;17)4Rk, whose Chromosome 12 breakpoint is upstream from Osr1. The kavh/kavh mutant provides a model to study kidney development and test therapies for hydronephrosis. PMID:25834070

  13. Kidney adysplasia and variable hydronephrosis, a new mutation affecting the odd-skipped related 1 gene in the mouse, causes variable defects in kidney development and hydronephrosis.

    PubMed

    Davisson, Muriel T; Cook, Susan A; Akeson, Ellen C; Liu, Don; Heffner, Caleb; Gudis, Polyxeni; Fairfield, Heather; Murray, Stephen A

    2015-06-15

    Many genes, including odd-skipped related 1 (Osr1), are involved in regulation of mammalian kidney development. We describe here a new recessive mutation (kidney adysplasia and variable hydronephrosis, kavh) in the mouse that leads to downregulation of Osr1 transcript, causing several kidney defects: agenesis, hypoplasia, and hydronephrosis with variable age of onset. The mutation is closely associated with a reciprocal translocation, T(12;17)4Rk, whose Chromosome 12 breakpoint is upstream from Osr1. The kavh/kavh mutant provides a model to study kidney development and test therapies for hydronephrosis. Copyright © 2015 the American Physiological Society.

  14. On the relation among the solar activity, the quasi-biennial oscillation in the equatorial stratosphere and El Nino.

    NASA Astrophysics Data System (ADS)

    Gul, Zhennian

    The possibility of a relation among Quasi-Biennial Oscillation (QBO) of zonal winds in the equatorial stratosphere, sunspot Wolf number and SST's in the eastern Pacific during the same interval are analyzed. The band filter and the wavelet method which are capable of finding local periods and amplitudes are used in the data processing. It is shown that the coherence estimates between the series of QBO in Wolf and in lower tropical stratosphere are of order of -0.6. A possible dynamical explanation for skip a beat of QBO linked El Nino suggested by Angel and Gray is presented. Solar activity is a hypothetical mechanism of this skip.

  15. Microcomputer-Assisted Flow-Through ASV System.

    DTIC Science & Technology

    1979-09-01

    89 03 A ADCA #$03 0037 7A 0300 D DEC SAVz1 0042 26 F6 003A DN! THOULP 0044 39 XITBIN RTS * XDTF BCDBIN 19 or iko. 302 SCUE j CD To BINARY CONVERSION...TIMFLG 0006 BD 0330 A SKIP75 JSR CLOCK GET TINE AND DIPLAY 0009 B6 0300 A LDAA P5BC CHECK IF "GO" PUSHED OOOC 2B 02 0013 BMI SKIP75 YES- RTS 000E 20 F6 ...405 RESET STACK PT 0003 B7 0002 D STAA TP 0006 F7 0083 D STAB TP+1 0009 B6 0018 D LDAA IPHI CALCULATE (IP-IV) FOR OSOC F6 0319 D LDAB IPLO CD 000F FO

  16. Computer aided field editing in the DHS context: the Turkey experiment.

    PubMed

    Cushing, J; Loaiza, E

    1994-01-01

    "In this study two types of field editing used during the Turkey Demographic and Health Survey are compared. These two types of editing are computer aided field editing and manual editing. It is known that manual editing by field editors is a tedious job in which errors especially on skip questions can be missed; however, with the aid of computers field editors could quickly find all occasions on which an interviewer incorrectly followed a skip instruction. At the end of the experiment it has been found...that the field editing done with the aid of a notebook computer was consistently better than that done in the standard manual manner." (SUMMARY IN TUR) excerpt

  17. Mass drug administration for trachoma: how long is not long enough?

    PubMed

    Jimenez, Violeta; Gelderblom, Huub C; Mann Flueckiger, Rebecca; Emerson, Paul M; Haddad, Danny

    2015-03-01

    Blinding trachoma is targeted for elimination by 2020 using the SAFE strategy (Surgery, Antibiotics, Facial cleanliness, and Environmental improvements). Annual mass drug administration (MDA) with azithromycin is a cornerstone of this strategy. If baseline prevalence of clinical signs of trachomatous inflammation - follicular among 1-9 year-olds (TF1-9) is ≥ 10% but <30%, the World Health Organization guidelines are for at least 3 annual MDAs; if ≥ 30%, 5. We assessed the likelihood of achieving the global elimination target of TF1-9 <5% at 3 and 5 year evaluations using program reports. We used the International Trachoma Initiative's prevalence and treatment database. Of 283 cross-sectional survey pairs with baseline and follow-up data, MDA was conducted in 170 districts. Linear and logistic regression modeling was applied to these to investigate the effect of MDA on baseline prevalence. Reduction to <5% was less likely, though not impossible, at higher baseline TF1-9 prevalences. Increased number of annual MDAs, as well as no skipped MDAs, were significant predictors of reduced TF1-9 at follow-up. The probability of achieving the <5% target was <50% for areas with ≥ 30% TF1-9 prevalence at baseline, even with 7 or more continuous annual MDAs. Number of annual MDAs alone appears insufficient to predict program progress; more information on the effects of baseline prevalence, coverage, and underlying environmental and hygienic conditions is needed. Programs should not skip MDAs, and at prevalences >30%, 7 or more annual MDAs may be required to achieve the target. There are five years left before the 2020 deadline to eliminate blinding trachoma. Low endemic settings are poised to succeed in their elimination goals. However, newly-identified high prevalence districts warrant immediate inclusion in the global program. Intensified application of the SAFE strategy is needed in order to guarantee blinding trachoma elimination by 2020.

  18. Mass Drug Administration for Trachoma: How Long Is Not Long Enough?

    PubMed Central

    Jimenez, Violeta; Gelderblom, Huub C.; Mann Flueckiger, Rebecca; Emerson, Paul M.; Haddad, Danny

    2015-01-01

    Background Blinding trachoma is targeted for elimination by 2020 using the SAFE strategy (Surgery, Antibiotics, Facial cleanliness, and Environmental improvements). Annual mass drug administration (MDA) with azithromycin is a cornerstone of this strategy. If baseline prevalence of clinical signs of trachomatous inflammation – follicular among 1-9 year-olds (TF1-9) is ≥10% but <30%, the World Health Organization guidelines are for at least 3 annual MDAs; if ≥30%, 5. We assessed the likelihood of achieving the global elimination target of TF1-9 <5% at 3 and 5 year evaluations using program reports. Methodology/Principal Findings We used the International Trachoma Initiative’s prevalence and treatment database. Of 283 cross-sectional survey pairs with baseline and follow-up data, MDA was conducted in 170 districts. Linear and logistic regression modeling was applied to these to investigate the effect of MDA on baseline prevalence. Reduction to <5% was less likely, though not impossible, at higher baseline TF1-9 prevalences. Increased number of annual MDAs, as well as no skipped MDAs, were significant predictors of reduced TF1-9 at follow-up. The probability of achieving the <5% target was <50% for areas with ≥30% TF1-9 prevalence at baseline, even with 7 or more continuous annual MDAs. Conclusions Number of annual MDAs alone appears insufficient to predict program progress; more information on the effects of baseline prevalence, coverage, and underlying environmental and hygienic conditions is needed. Programs should not skip MDAs, and at prevalences >30%, 7 or more annual MDAs may be required to achieve the target. There are five years left before the 2020 deadline to eliminate blinding trachoma. Low endemic settings are poised to succeed in their elimination goals. However, newly-identified high prevalence districts warrant immediate inclusion in the global program. Intensified application of the SAFE strategy is needed in order to guarantee blinding trachoma elimination by 2020. PMID:25799168

  19. Scarlet Fever (For Parents)

    MedlinePlus

    [Skip to Content] for Parents Parents site Sitio para padres General Health Growth & Development Infections Diseases & Conditions Pregnancy & Baby Nutrition & Fitness Emotions & Behavior School & Family ...

  20. Strep Throat (For Parents)

    MedlinePlus

    [Skip to Content] for Parents Parents site Sitio para padres General Health Growth & Development Infections Diseases & Conditions Pregnancy & Baby Nutrition & Fitness Emotions & Behavior School & Family ...

  1. Accelerating non-contrast-enhanced MR angiography with inflow inversion recovery imaging by skipped phase encoding and edge deghosting (SPEED).

    PubMed

    Chang, Zheng; Xiang, Qing-San; Shen, Hao; Yin, Fang-Fang

    2010-03-01

    To accelerate non-contrast-enhanced MR angiography (MRA) with inflow inversion recovery (IFIR) with a fast imaging method, Skipped Phase Encoding and Edge Deghosting (SPEED). IFIR imaging uses a preparatory inversion pulse to reduce signals from static tissue, while leaving inflow arterial blood unaffected, resulting in sparse arterial vasculature on modest tissue background. By taking advantage of vascular sparsity, SPEED can be simplified with a single-layer model to achieve higher efficiency in both scan time reduction and image reconstruction. SPEED can also make use of information available in multiple coils for further acceleration. The techniques are demonstrated with a three-dimensional renal non-contrast-enhanced IFIR MRA study. Images are reconstructed by SPEED based on a single-layer model to achieve an undersampling factor of up to 2.5 using one skipped phase encoding direction. By making use of information available in multiple coils, SPEED can achieve an undersampling factor of up to 8.3 with four receiver coils. The reconstructed images generally have comparable quality as that of the reference images reconstructed from full k-space data. As demonstrated with a three-dimensional renal IFIR scan, SPEED based on a single-layer model is able to reduce scan time further and achieve higher computational efficiency than the original SPEED.

  2. The Stratospheric Kinetic Inductance Polarimeter (SKIP)

    NASA Astrophysics Data System (ADS)

    Flanigan, Daniel; Ade, P.; Araujo, D.; Bradford, K. J.; Chapman, D.; Che, G.; Day, P.; Didier, J.; Doyle, S.; Eriksen, H.; Groppi, C. E.; Hillbrand, S. N.; Johnson, B.; Jones, G.; Limon, M.; Mauskopf, P.; McCarrick, H.; Miller, A. D.; Mroczkowski, T.; Reichborn-Kjennerud, B.; Smiley, B.; Sobrin, J.; Wehus, I. K.; Zmuidzinas, J.

    2014-01-01

    We discuss the Stratospheric Kinetic Inductance Polarimeter (SKIP). SKIP is a proposed balloon-borne experiment designed to study the cosmic microwave background, the cosmic infrared background, and Galactic dust emission by observing 1100 square degrees of sky in the Northern Hemisphere with launches from Kiruna, Sweden. The instrument contains 2317 single-polarization, horn-coupled, aluminum lumped-element kinetic inductance detectors (LEKIDs), which will be maintained at 100 mK by an adiabatic demagnetization refrigerator. The polarimeter will operate in two configurations, one sensitive to a spectral band centered on 150 GHz and the other sensitive to 260 and 350 GHz bands. The detector readout system is based on the ROACH-1 board, and the detectors will be biased below 300 MHz. The detector array is fed by an F/2.4 crossed-Dragone telescope with a 500 mm aperture yielding a 15 arcminute full-width half-maximum beam at 150 GHz. To minimize detector loading and maximize sensitivity, the entire optical system will be cooled to 1 K. Linearly polarized sky signals will be modulated with a metal-mesh half-wave plate that is mounted at the telescope aperture and is rotated on a superconducting magnetic bearing. The observation program consists of two or more five-day flights, and 150 GHz observations are planned to begin in 2017.

  3. Basal exon skipping and genetic pleiotropy: A predictive model of disease pathogenesis.

    PubMed

    Drivas, Theodore G; Wojno, Adam P; Tucker, Budd A; Stone, Edwin M; Bennett, Jean

    2015-06-10

    Genetic pleiotropy, the phenomenon by which mutations in the same gene result in markedly different disease phenotypes, has proven difficult to explain with traditional models of disease pathogenesis. We have developed a model of pleiotropic disease that explains, through the process of basal exon skipping, how different mutations in the same gene can differentially affect protein production, with the total amount of protein produced correlating with disease severity. Mutations in the centrosomal protein of 290 kDa (CEP290) gene are associated with a spectrum of phenotypically distinct human diseases (the ciliopathies). Molecular biologic examination of CEP290 transcript and protein expression in cells from patients carrying CEP290 mutations, measured by quantitative polymerase chain reaction and Western blotting, correlated with disease severity and corroborated our model. We show that basal exon skipping may be the mechanism underlying the disease pleiotropy caused by CEP290 mutations. Applying our model to a different disease gene, CC2D2A (coiled-coil and C2 domains-containing protein 2A), we found that the same correlations held true. Our model explains the phenotypic diversity of two different inherited ciliopathies and may establish a new model for the pathogenesis of other pleiotropic human diseases. Copyright © 2015, American Association for the Advancement of Science.

  4. Sleep variability and fatigue in adolescents: Associations with school-related features.

    PubMed

    Matos, M G; Gaspar, T; Tomé, G; Paiva, T

    2016-10-01

    This study aims to evaluate the influences of sleep duration and sleep variability (SleepV), upon adolescents' school-related situations. The Health Behaviour in School-Aged Children (HBSC) survey is based on a self-completed questionnaire. The participants were 3164 pupils (53.7% girls), attending the 8th and 10th grades, 14.9 years old, and were inquired about subjective sleep duration during the week and weekends, SleepV, fatigue, difficulties in sleep initiation, school achievement, feelings towards schools, pressure with school work and skipping classes. Multiple regression models used, as dependent variables: (a) school achievement, (b) disliking school, (c) pressure with school work and (d) skipping classes, using as independent variables, each of the remaining school-related variables, fatigue, total sleep duration and difficulties in sleep initiation. The average sleep duration in the week and during weekdays was lower than recommended for these age groups, and almost half of students had high SleepV between weekdays and weekends. A logistic model revealed that the absence of SleepV was associated with lower perception of school work pressure, less frequent skipping classes, more infrequent fatigue and more infrequent difficulties in sleep initiation. Poor sleep quality, SleepV and insufficient sleep duration affected negatively school-related variables. © 2015 International Union of Psychological Science.

  5. Breakfast habits, nutritional status, body weight, and academic performance in children and adolescents.

    PubMed

    Rampersaud, Gail C; Pereira, Mark A; Girard, Beverly L; Adams, Judi; Metzl, Jordan D

    2005-05-01

    Breakfast has been labeled the most important meal of the day, but are there data to support this claim? We summarized the results of 47 studies examining the association of breakfast consumption with nutritional adequacy (nine studies), body weight (16 studies), and academic performance (22 studies) in children and adolescents. Breakfast skipping is highly prevalent in the United States and Europe (10% to 30%), depending on age group, population, and definition. Although the quality of breakfast was variable within and between studies, children who reported eating breakfast on a consistent basis tended to have superior nutritional profiles than their breakfast-skipping peers. Breakfast eaters generally consumed more daily calories yet were less likely to be overweight, although not all studies associated breakfast skipping with overweight. Evidence suggests that breakfast consumption may improve cognitive function related to memory, test grades, and school attendance. Breakfast as part of a healthful diet and lifestyle can positively impact children's health and well-being. Parents should be encouraged to provide breakfast for their children or explore the availability of a school breakfast program. We advocate consumption of a healthful breakfast on a daily basis consisting of a variety of foods, especially high-fiber and nutrient-rich whole grains, fruits, and dairy products.

  6. Combination Antisense Treatment for Destructive Exon Skipping of Myostatin and Open Reading Frame Rescue of Dystrophin in Neonatal mdx Mice.

    PubMed

    Lu-Nguyen, Ngoc B; Jarmin, Susan A; Saleh, Amer F; Popplewell, Linda; Gait, Michael J; Dickson, George

    2015-08-01

    The fatal X-linked Duchenne muscular dystrophy (DMD), characterized by progressive muscle wasting and muscle weakness, is caused by mutations within the DMD gene. The use of antisense oligonucleotides (AOs) modulating pre-mRNA splicing to restore the disrupted dystrophin reading frame, subsequently generating a shortened but functional protein has emerged as a potential strategy in DMD treatment. AO therapy has recently been applied to induce out-of-frame exon skipping of myostatin pre-mRNA, knocking-down expression of myostatin protein, and such an approach is suggested to enhance muscle hypertrophy/hyperplasia and to reduce muscle necrosis. Within this study, we investigated dual exon skipping of dystrophin and myostatin pre-mRNAs using phosphorodiamidate morpholino oligomers conjugated with an arginine-rich peptide (B-PMOs). Intraperitoneal administration of B-PMOs was performed in neonatal mdx males on the day of birth, and at weeks 3 and 6. At week 9, we observed in treated mice (as compared to age-matched, saline-injected controls) normalization of muscle mass, a recovery in dystrophin expression, and a decrease in muscle necrosis, particularly in the diaphragm. Our data provide a proof of concept for antisense therapy combining dystrophin restoration and myostatin inhibition for the treatment of DMD.

  7. RNAV STAR Procedural Adherence

    NASA Technical Reports Server (NTRS)

    Stewart, Michael J.; Matthews, Bryan L.

    2017-01-01

    In this exploratory archival study we mined the performance of 24 major US airports area navigation standard terminal arrival routes (RNAV STARs) over the preceding three years. Overlaying radar track data on top of RNAV STAR routes provided a comparison between aircraft flight paths and the waypoint positions and altitude restrictions. NASA Ames Supercomputing resources were utilized to perform the data mining and processing. We investigated STARs by lateral transition path (full-lateral), vertical restrictions (full-lateral/full-vertical), and skipped waypoints (skips). In addition, we graphed altitudes and their frequencies of occurrence for altitude restrictions. Full-lateral compliance was generally greater than Full-lateral/full-vertical, but the delta between the rates was not always consistent. Full-lateral/full-vertical usage medians of the 2016 procedures ranged from 0 in KDEN (Denver) to 21 in KMEM (Memphis). Waypoint skips ranged from 0 to nearly 100 for specific waypoints. Altitudes restrictions were sometimes missed by systemic amounts in 1000 ft. increments from the restriction, creating multi-modal distributions. Other times, altitude misses looked to be more normally distributed around the restriction. This work is a preliminary investigation into the objective performance of instrument procedures and provides a framework to track how procedural concepts and design intervention function. In addition, this tool may aid in providing acceptability metrics as well as risk assessment information.

  8. Effects of word predictability and preview lexicality on eye movements during reading: A comparison between young and older adults.

    PubMed

    Choi, Wonil; Lowder, Matthew W; Ferreira, Fernanda; Swaab, Tamara Y; Henderson, John M

    2017-05-01

    Previous eye-tracking research has characterized older adults' reading patterns as "risky," arguing that compared to young adults, older adults skip more words, have longer saccades, and are more likely to regress to previous portions of the text. In the present eye-tracking study, we reexamined the claim that older adults adopt a risky reading strategy, utilizing the boundary paradigm to manipulate parafoveal preview and contextual predictability of a target word. Results showed that older adults had longer fixation durations compared to young adults; however, there were no age differences in skipping rates, saccade length, or proportion of regressions. In addition, readers showed higher skipping rates of the target word if the preview string was a word than if it was a nonword, regardless of age. Finally, the effect of predictability in reading times on the target word was larger for older adults than for young adults. These results suggest that older adults' reading strategies are not as risky as was previously claimed. Instead, we propose that older adults can effectively combine top-down information from the sentence context with bottom-up information from the parafovea to optimize their reading strategies. (PsycINFO Database Record (c) 2017 APA, all rights reserved).

  9. Hopping locomotion at different gravity: metabolism and mechanics in humans.

    PubMed

    Pavei, Gaspare; Minetti, Alberto E

    2016-05-15

    Previous literature on the effects of low gravity on the mechanics and energetics of human locomotion already dealt with walking, running, and skipping. The aim of the present study is to obtain a comprehensive view on that subject by including measurements of human hopping in simulated low gravity, a gait often adopted in many Apollo Missions and documented in NASA footage. Six subjects hopped at different speeds at terrestrial, Martian, and Lunar gravity on a treadmill while oxygen consumption and 3D body kinematic were sampled. Results clearly indicate that hopping is too metabolically expensive to be a sustainable locomotion on Earth but, similarly to skipping (and running), its economy greatly (more than ×10) increases at lower gravity. On the Moon, the metabolic cost of hopping becomes even lower than that of walking, skipping, and running, but the general finding is that gaits with very different economy on Earth share almost the same economy on the Moon. The mechanical reasons for such a decrease in cost are discussed in the paper. The present data, together with previous findings, will allow also to predict the aerobic traverse range/duration of astronauts when getting far from their base station on low gravity planets. Copyright © 2016 the American Physiological Society.

  10. Older people as resources in South Africa: Mpumalanga households.

    PubMed

    Kimuna, Sitawa R; Makiwane, Monde

    2007-01-01

    The extended family used to be relied upon to provide subsistence and care for older people in sub-Saharan Africa. However, recently South Africa has seen a reversal of roles, where older people now provide subsistence and care to younger generations; this role reversal is being accelerated by HIV/AIDS deaths among young adults. In most rural households, the non-contributory old age pension (OAP) that is means-tested is an important factor in making older people breadwinners. Using data from the 2004 Mpumalanga Older People's Survey, we examined the changing role of older people, which has been influenced mainly by changes in household structure and old age pension. Findings show that in 63% of matrifocal, multigenerational households, 76% of older people are the sole providers of household necessities, caring for the sick and grandchildren in increasingly skip-generation households.

  11. von Willebrand Disease (For Parents)

    MedlinePlus

    [Skip to Content] for Parents Parents site Sitio para padres General Health Growth & Development Infections Diseases & Conditions Pregnancy & Baby Nutrition & Fitness Emotions & Behavior School & Family ...

  12. Skipping meals or carbohydrate-free meals in order to determine Basal insulin requirements in subjects with type 1 diabetes mellitus?

    PubMed

    Uthoff, H; Lehmann, R; Sprenger, M; Wiesli, P

    2010-05-01

    Basal insulin dose requirements in patients with type 1 diabetes may be derived from the course of glucose concentrations in the fasting state; i. e. by skipping meals. The present study examined whether fasting tests could be replaced by carbohydrate-free meals. 16 adult patients with type 1 diabetes (10 male) on intensive insulin therapy participated in this prospective intervention study. Mean age (+/-SD) was 44+/-12 years, BMI 24+/-3 kg/m (2), mean HbA1c was 7.5+/-0.6% and duration of diabetes 15+/-12 years. All participants skipped dinner and plasma glucose concentrations were hourly monitored from 7 p.m. to 11 p.m. This blood glucose profile was compared with three test meals given at 7 p.m. at day 2-4, consumed either in the hospital (meal 1) or at home (meal 2 and 3). No insulin injection (except to basal insulin) was allowed. Test meals consisted of 2.5 g carbohydrate, 32.4 g protein, 52.0 g fat (according to 612 kcal). During 16 fasting tests plasma glucose concentration remained stable between 7.2+/-2.4 mmol/l at 7 p.m. and 6.8+/-2.8 mmol/l at 11 p.m. (p=0.461). Following the intake of near carbohydrate-free meals (48 tests), plasma glucose concentrations rose within 4 h from 6.7+/-2.0 at 7 p.m. to 9.8+/-3.4 mmol/l at 11 p.m. (p<0.0001). The increase in plasma glucose concentrations was similar in all three different meals tested. Plasma glucose concentrations significantly increase in patients with type 1 diabetes following the intake of carbohydrate-free meals. Carbohydrate-free meal-tests cannot replace skipping meal tests to determine the basal insulin requirement in patients with type 1 diabetes.

  13. Acute Effect of Upper and Lower Body Postactivation Exercises on Shot Put Performance.

    PubMed

    Kontou, Eleni I; Berberidou, Fani T; Pilianidis, Theophilos C; Mantzouranis, Nikolaos I; Methenitis, Spyridon K

    2018-04-01

    Kontou, EI, Berberidou, FT, Pilianidis, TC, Mantzouranis, NI, and Methenitis, SK. Acute effect of upper and lower body postactivation exercises on shot put performance. J Strength Cond Res 32(4): 970-982, 2018-The purpose of this study was to investigate the effect of different types of upper and lower' extremities exercises on acute increase of shot put performance, in moderate experienced throwers. Eight (n = 8) males and 9 (n = 9) female throwers participated in this study. Their bench press and squat maximum strength were measured while their shot put performance from power position was evaluated before and after 4 interventions: (a) plyometric push-ups (Plyo), (b) 6 s isometric push-ups (Iso), (c) 3 countermovement jumps (CMJs) and (d) 10 reps. of skipping (Skip). Interventions were performed in counterbalanced order with a 48-hour interval. Significant increase (p < 0.05) of shot put performances was observed after Plyo, Iso, and CMJ (range: 2.30 ± 1.82%-5.72 ± 4.32%). In addition, Iso induced the highest increase while Skip did not induce any improvement of throwing performance. The highest increases were recorded in men's performance after CMJ (5.72 ± 4.32%) while in women's performance after Iso (3.59 ± 2.7%). Javelin and discus throwers increase higher their performance after CMJs while shot putters after Iso. Significant correlations were found between training experience, maximum/relative strength, shot put performance and increase of throwing performance (%) after the interventions (r: 0.519-0.991, p < 0.05). Percentage increase of performance between Iso and Plyo have negative correlations (r: -0.569, p < 0.05) in contrast of those between Skip and CMJ (r: 0.710, p < 0.05). These results suggest that upper or lower body postactivation interventions may acutely increase the throwing performance. However, experience and strength are significant determinant of this increase.

  14. Context Dependent Effects of Chimeric Peptide Morpholino Conjugates Contribute to Dystrophin Exon-skipping Efficiency.

    PubMed

    Yin, Haifang; Boisguerin, Prisca; Moulton, Hong M; Betts, Corinne; Seow, Yiqi; Boutilier, Jordan; Wang, Qingsong; Walsh, Anthony; Lebleu, Bernard; Wood, Matthew Ja

    2013-09-24

    We have recently reported that cell-penetrating peptides (CPPs) and novel chimeric peptides containing CPP (referred as B peptide) and muscle-targeting peptide (referred as MSP) motifs significantly improve the systemic exon-skipping activity of morpholino phosphorodiamidate oligomers (PMOs) in dystrophin-deficient mdx mice. In the present study, the general mechanistic significance of the chimeric peptide configuration on the activity and tissue uptake of peptide conjugated PMOs in vivo was investigated. Four additional chimeric peptide-PMO conjugates including newly identified peptide 9 (B-9-PMO and 9-B-PMO) and control peptide 3 (B-3-PMO and 3-B-PMO) were tested in mdx mice. Immunohistochemical staining, RT-PCR and western blot results indicated that B-9-PMO induced significantly higher level of exon skipping and dystrophin restoration than its counterpart (9-B-PMO), further corroborating the notion that the activity of chimeric peptide-PMO conjugates is dependent on relative position of the tissue-targeting peptide motif within the chimeric peptide with respect to PMOs. Subsequent mechanistic studies showed that enhanced cellular uptake of B-MSP-PMO into muscle cells leads to increased exon-skipping activity in comparison with MSP-B-PMO. Surprisingly, further evidence showed that the uptake of chimeric peptide-PMO conjugates of both orientations (B-MSP-PMO and MSP-B-PMO) was ATP- and temperature-dependent and also partially mediated by heparan sulfate proteoglycans (HSPG), indicating that endocytosis is likely the main uptake pathway for both chimeric peptide-PMO conjugates. Collectively, our data demonstrate that peptide orientation in chimeric peptides is an important parameter that determines cellular uptake and activity when conjugated directly to oligonucleotides. These observations provide insight into the design of improved cell targeting compounds for future therapeutics studies.Molecular Therapy-Nucleic Acids (2013) 2, e124; doi:10.1038/mtna.2013.51; published online 24 September 2013.

  15. Personnel reliability impact on petrochemical facilities monitoring system's failure skipping probability

    NASA Astrophysics Data System (ADS)

    Kostyukov, V. N.; Naumenko, A. P.

    2017-08-01

    The paper dwells upon urgent issues of evaluating impact of actions conducted by complex technological systems operators on their safe operation considering application of condition monitoring systems for elements and sub-systems of petrochemical production facilities. The main task for the research is to distinguish factors and criteria of monitoring system properties description, which would allow to evaluate impact of errors made by personnel on operation of real-time condition monitoring and diagnostic systems for machinery of petrochemical facilities, and find and objective criteria for monitoring system class, considering a human factor. On the basis of real-time condition monitoring concepts of sudden failure skipping risk, static and dynamic error, monitoring systems, one may solve a task of evaluation of impact that personnel's qualification has on monitoring system operation in terms of error in personnel or operators' actions while receiving information from monitoring systems and operating a technological system. Operator is considered as a part of the technological system. Although, personnel's behavior is usually a combination of the following parameters: input signal - information perceiving, reaction - decision making, response - decision implementing. Based on several researches on behavior of nuclear powers station operators in USA, Italy and other countries, as well as on researches conducted by Russian scientists, required data on operator's reliability were selected for analysis of operator's behavior at technological facilities diagnostics and monitoring systems. The calculations revealed that for the monitoring system selected as an example, the failure skipping risk for the set values of static (less than 0.01) and dynamic (less than 0.001) errors considering all related factors of data on reliability of information perception, decision-making, and reaction fulfilled is 0.037, in case when all the facilities and error probability are under control - not more than 0.027. In case when only pump and compressor units are under control, the failure skipping risk is not more than 0.022, when the probability of error in operator's action is not more than 0.011. The work output shows that on the basis of the researches results an assessment of operators' reliability can be made in terms of almost any kind of production, but considering only technological capabilities, since operators' psychological and general training considerable vary in different production industries. Using latest technologies of engineering psychology and design of data support systems, situation assessment systems, decision-making and responding system, as well as achievement in condition monitoring in various production industries one can evaluate hazardous condition skipping risk probability considering static, dynamic errors and human factor.

  16. DiGeorge Syndrome (DGS)

    MedlinePlus

    American Academy of Allergy Asthma & Immunology Menu Search Main navigation Skip to content Conditions & Treatments Allergies Asthma Primary Immunodeficiency Disease Related Conditions Drug Guide Conditions Dictionary Just ...

  17. Asthma, Allergies and Pregnancy

    MedlinePlus

    ... Menu Search Main navigation Skip to content Conditions & Treatments Allergies Asthma Primary Immunodeficiency Disease Related Conditions Drug Guide Conditions Dictionary Just for Kids Library School Tools Videos Virtual ...

  18. Symptoms and Treatment of Depression

    MedlinePlus Videos and Cool Tools

    Skip to content Home Health Information Health Information Home Mental Health Information Statistics Consumer Health Publications Help for Mental Illnesses Clinical Trials Outreach Outreach Home Stakeholder Engagement ...

  19. Development of the Young Brain

    MedlinePlus Videos and Cool Tools

    Skip to content Home Health Information Health Information Home Mental Health Information Statistics Consumer Health Publications Help for Mental Illnesses Clinical Trials Outreach Outreach Home Stakeholder Engagement ...

  20. Learning about Familial Hypercholesterolemia

    MedlinePlus

    Skip to main content Learning About Familial Hypercholesterolemia Enter Search Term(s): Español Research Funding An Overview Bioinformatics Current Grants Education and Training Funding Extramural Research ...

  1. Migraine

    MedlinePlus

    ... Skipping meals or fasting also can trigger attacks. Food additives. The sweetener aspartame and the preservative monosodium glutamate (MSG), found in many foods, may trigger migraines. Drinks. Alcohol, especially wine, and ...

  2. Energy conservation for pasteurizer apparatus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Huling, J.K.

    In the pasteurizing of beverages in closed containers, the containers arrive generally in a chilled state and are progressively raised in temperature approaching the pasteurizing temperature and, after being pasteurized for an appropriate time, are progressively cooled down. Apparatus of this type is provided with a source of chilled water which is available for use when skips occur in the supply of the containers, the chilled water being accumulated from the incoming containers and from common outside sources. The accumulated water in its chilled state saves substantial amounts of energy by eliminating mechanical or other means to produce the chillmore » effect, and such source of water is constantly available under control which senses the presence of a skip in the supply of containers.« less

  3. Hydraulic hoisting and backfilling

    NASA Astrophysics Data System (ADS)

    Sauermann, H. B.

    In a country such as South Africa, with its large deep level mining industry, improvements in mining and hoisting techniques could result in substantial savings. Hoisting techniques, for example, may be improved by the introduction of hydraulic hoisting. The following are some of the advantages of hydraulic hoisting as against conventional skip hoisting: (1) smaller shafts are required because the pipes to hoist the same quantity of ore hydraulically require less space in the shaft than does skip hoisting equipment; (2) the hoisting capacity of a mine can easily be increased without the necessity of sinking new shafts. Large savings in capital costs can thus be made; (3) fully automatic control is possible with hydraulic hoisting and therefore less manpower is required; and (4) health and safety conditions will be improved.

  4. Effects of Anesthesia

    MedlinePlus

    Skip to content Menu Anesthesia 101 Pain Management Preparing for Surgery Stories Resources About Policymakers Media ASA Member Toolkit Anesthesia 101 Effects of Anesthesia Explore this page: Effects of Anesthesia ...

  5. Personalizing the Approach to Childhood Asthma

    MedlinePlus

    American Academy of Allergy Asthma & Immunology Menu Search Main navigation Skip to content Conditions & Treatments Allergies Asthma Primary Immunodeficiency Disease Related Conditions Drug Guide Conditions Dictionary Just ...

  6. Drug Facts: Anabolic Steroids

    MedlinePlus

    Skip to main content En español Researchers Medical & Health Professionals Patients & ... Medicines Prescription Medicines Steroids (Anabolic) Synthetic Cannabinoids (K2/Spice) Synthetic Cathinones (Bath Salts) Tobacco/Nicotine ...

  7. What about Breastfeeding?

    MedlinePlus

    ... Fundraising Ideas Vehicle Donation Volunteer Efforts What about Breastfeeding? skip to submenu What We Do Cleft & Craniofacial Educational Materials What about Breastfeeding? To download the PDF version of this factsheet, ...

  8. Thrombocytopenia

    MedlinePlus

    Skip to main content U.S. Department of Health & Human Services Health Topics Health Topics A-Z Clinical Trials Publications and Resources Health Education and Awareness The Science Science Home Blood Disorders and ...

  9. User account | National Agricultural Library

    Science.gov Websites

    Skip to main content Home National Agricultural Library United States Department of Agriculture Ag | Agricultural Research Service | Plain Language | FOIA | Accessibility Statement | Information Quality | Privacy

  10. Why Do I Fight with My Parents So Much?

    MedlinePlus

    [Skip to Content] for Parents Parents site Sitio para padres General Health Growth & Development Infections Diseases & Conditions Pregnancy & Baby Nutrition & Fitness Emotions & Behavior School & Family ...

  11. About Face

    MedlinePlus Videos and Cool Tools

    Skip to Content Menu Closed (Tap to Open) Home Interviews Our Stories Search All Videos PTSD Basics PTSD Treatment What is AboutFace? Resources for Professionals Get Help Home Watch Interviews Our ...

  12. Health Consequences of Drug Misuse

    MedlinePlus

    Skip to main content En español Researchers Medical & Health Professionals Patients & ... Medicines Prescription Medicines Steroids (Anabolic) Synthetic Cannabinoids (K2/Spice) Synthetic Cathinones (Bath Salts) Tobacco/Nicotine ...

  13. Gene Variants Reduce Opioid Risks

    MedlinePlus

    Skip to main content En español Researchers Medical & Health Professionals Patients & ... Medicines Prescription Medicines Steroids (Anabolic) Synthetic Cannabinoids (K2/Spice) Synthetic Cathinones (Bath Salts) Tobacco/Nicotine ...

  14. Cigarettes and Other Tobacco Products

    MedlinePlus

    Skip to main content En español Researchers Medical & Health Professionals Patients & ... Medicines Prescription Medicines Steroids (Anabolic) Synthetic Cannabinoids (K2/Spice) Synthetic Cathinones (Bath Salts) Tobacco/Nicotine ...

  15. Drugs + HIV, Learn the Link

    MedlinePlus

    Skip to main content En español Researchers Medical & Health Professionals Patients & ... Medicines Prescription Medicines Steroids (Anabolic) Synthetic Cannabinoids (K2/Spice) Synthetic Cathinones (Bath Salts) Tobacco/Nicotine ...

  16. Analytic Development of a Reference Profile for the First Entry in a Skip Atmospheric Entry

    NASA Technical Reports Server (NTRS)

    Garcia-Llama, Eduardo

    2010-01-01

    This note shows that a feasible reference drag profile for the first entry portion of a skip entry can be generated as a polynomial expression of the velocity. The coefficients of that polynomial are found through the resolution of a system composed of m + 1 equations, where m is the degree of the drag polynomial. It has been shown that a minimum of five equations (m = 4) are required to establish the range and the initial and final conditions on velocity and flight path angle. It has been shown that at least one constraint on the trajectory can be imposed through the addition of one extra equation in the system, which must be accompanied by the increase in the degree of the drag polynomial. In order to simplify the resolution of the system of equations, the drag was considered as being a probability density function of the velocity, with the velocity as a distribution function of the drag. Combining this notion with the introduction of empirically derived constants, it has been shown that the system of equations required to generate the drag profile can be successfully reduced to a system of linear algebraic equations. For completeness, the resulting drag profiles have been flown using the feedback linearization method of differential geometric control as a guidance law with the error dynamics of a second order homogeneous equation in the form of a damped oscillator. Satisfactory results were achieved when the gains in the error dynamics were changed at a certain point along the trajectory that is dependent on the velocity and the curvature of the drag as a function of the velocity. Future work should study the capacity to update the drag profile in flight when dispersions are introduced. Also, future studies should attempt to link the first entry, as presented and controlled in this note, with a more standard control concept for the second entry, such as the Apollo entry guidance, to try to assess the overall skip entry performance. A guidance law that includes an integral feedback term, as is the case in the actual Space Shuttle entry guidance and as is proposed in Ref 29, could be tried in future studies to assess whether its use results in an improvement of the tracking performance, and to evaluate the design needs when determining the control gains.

  17. Two-Exon Skipping within MLPH Is Associated with Coat Color Dilution in Rabbits

    PubMed Central

    Lehner, Stefanie; Gähle, Marion; Dierks, Claudia; Stelter, Ricarda; Gerber, Jonathan; Brehm, Ralph; Distl, Ottmar

    2013-01-01

    Coat color dilution turns black coat color to blue and red color to cream and is a characteristic in many mammalian species. Matings among Netherland Dwarf, Loh, and Lionhead Dwarf rabbits over two generations gave evidence for a monogenic autosomal recessive inheritance of coat colour dilution. Histological analyses showed non-uniformly distributed, large, agglomerating melanin granules in the hair bulbs of coat color diluted rabbits. We sequenced the cDNA of MLPH in two dilute and one black rabbit for polymorphism detection. In both color diluted rabbits, skipping of exons 3 and 4 was present resulting in altered amino acids at p.QGL[37-39]QWA and a premature stop codon at p.K40*. Sequencing of genomic DNA revealed a c.111-5C>A splice acceptor mutation within the polypyrimidine tract of intron 2 within MLPH. This mutation presumably causes skipping of exons 3 and 4. In 14/15 dilute rabbits, the c.111-5C>A mutation was homozygous and in a further dilute rabbit, heterozygous and in combination with a homozygous frame shift mutation within exon 6 (c.585delG). In conclusion, our results demonstrated a colour dilution associated MLPH splice variant causing a strongly truncated protein (p.Q37QfsX4). An involvement of further MLPH-associated mutations needs further investigations. PMID:24376820

  18. Ultrasonic multi-skip tomography for pipe inspection

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Volker, Arno; Zon, Tim van

    The inspection of wall loss corrosion is difficult at pipe supports due to limited accessibility. The recently developed ultrasonic Multi-Skip screening technique is suitable for this problem. The method employs ultrasonic transducers in a pitch-catch geometry positioned on opposite sides of the pipe support. Shear waves are transmitted in the axial direction within the pipe wall, reflecting multiple times between the inner and outer surfaces before reaching the receivers. Along this path, the signals accumulate information on the integral wall thickness (e.g., via variations in travel time). The method is very sensitive in detecting the presence of wall loss, butmore » it is difficult to quantify both the extent and depth of the loss. Multi-skip tomography has been developed to reconstruct the wall thickness profile along the axial direction of the pipe. The method uses model-based full wave field inversion; this consists of a forward model for predicting the measured wave field and an iterative process that compares the predicted and measured wave fields and minimizes the differences with respect to the model parameters (i.e., the wall thickness profile). Experimental results are very encouraging. Various defects (slot and flat bottom hole) are reconstructed using the tomographic inversion. The general shape and width are well recovered. The current sizing accuracy is in the order of 1 mm.« less

  19. A Healthy Eating Identity is Associated with Healthier Food Choice Behaviors Among U.S. Army Soldiers.

    PubMed

    Jayne, Julianna M; Frongillo, Edward A; Torres-McGehee, Toni M; Emerson, Dawn M; Glover, Saundra H; Blake, Christine E

    2018-04-04

    Promoting healthy eating among Soldiers is a priority to the Army due to the link between nutrition and performance. The Army typically uses nutrition education to encourage Soldiers to make healthier food choices with low emphasis on other psychosocial determinants of food choice behaviors. Drill Sergeant Candidates (n = 575) completed surveys assessing nutrition knowledge, eating identity type, and food choice behaviors including fruit and vegetable intake, skipping meals, and eating out frequency. In multiple linear regression models using full-information maximum likelihood estimation while controlling for race/ethnicity, education, and marital status, we examined relationships between nutrition knowledge, a healthy eating identity, and Soldiers' food choice behaviors. The study was approved by the Department of Defense and University of South Carolina's Institutional Review Boards. A healthy eating identity was positively associated with greater fruit and vegetable consumption (p < 0.05), and negatively associated with skipping meals and eating out frequency (p < 0.05). Nutrition knowledge was negatively associated with skipping meals (p < 0.05). Findings suggest that fostering a healthy eating identity may be more effective for promoting healthy food choice behaviors than nutrition education alone. Determining if various points in a Soldier's career could be leveraged to influence a healthy eating identity and behaviors could be an important strategy to improve compliance with health promotion programs.

  20. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Asai, Hirohide; Hirano, Makito; Kiriyama, Takao

    Intranuclear events due to mutations in the Parkin gene remain elusive in autosomal recessive juvenile parkinsonism (ARJP). We identified a mutant PARKIN protein in fibroblast cultures from a pair of siblings with ARJP who were homozygous for the exon 4-deleted Parkin gene. Disease was mild in one patient and debilitating in the other. The detected mutant, encoded by a transcript lacking exon 3 as well as exon 4, is an in-frame deletion that removes 121 aa, resulting in a 344-aa protein (PaDel3,4). Cell culture and transfection studies revealed negative correlations between expression levels of PaDel3,4 and those of cell cyclemore » proteins, including cyclin E, CDK2, ppRb, and E2F-1, and demonstrated that GFP-PaDel3,4 entered nucleus and ubiquitinated cyclin E as a part of SCF{sup hSel-10} ligase complex in the patient cells. In addition, nuclear localization signal-tagged PaDel3,4 expressed in the transfected patient cells most effectively ubiquitinated cyclin E and reduced DNA damage, protecting cells from oxidative stress. Antisense-oligonucleotide treatment promoted skipping of exon 3 and thus generated PaDel3,4, increasing cell survival. Collectively, we propose that naturally- and experimentally-induced exon skipping at least partly restores the mutant Parkin gene deficit, providing a molecular basis for the development of therapeutic exon skipping.« less

  1. Impact of Breakfast Skipping and Breakfast Choice on the Nutrient Intake and Body Mass Index of Australian Children

    PubMed Central

    Fayet-Moore, Flavia; Kim, Jean; Sritharan, Nilani; Petocz, Peter

    2016-01-01

    Recent data on breakfast consumption among Australian children are limited. This study examined the impact of breakfast skipping and breakfast type (cereal or non-cereal) on nutrient intakes, likelihood of meeting nutrient targets and anthropometric measures. A secondary analysis of two 24-h recall data from the 2007 Australian National Children’s Nutrition and Physical Activity Survey was conducted (2–16 years; n = 4487) to identify (a) breakfast skippers and (b) breakfast consumers, with breakfast consumers further sub-divided into (i) non-cereal and (ii) cereal consumers. Only 4% skipped breakfast and 59% of skippers were 14–16 years. Breakfast consumers had significantly higher intakes of calcium and folate, and significantly lower intakes of total fat than breakfast skippers. Cereal consumers were more likely to meet targets and consume significantly higher fibre, calcium, iron, had significantly higher intakes of folate, total sugars and carbohydrate, and significantly lower intakes of total fat and sodium than non-cereal consumers. The prevalence of overweight was lower among breakfast consumers compared to skippers, and among cereal consumers compared to-cereal consumers (p < 0.001), while no significant differences were observed for mean body mass index (BMI), BMI z-score, waist circumference and physical activity level across the categories. Breakfast and particularly breakfast cereal consumption contributes important nutrients to children’s diets. PMID:27517957

  2. Violence

    MedlinePlus

    ... Illness & disability Drugs, alcohol & smoking Your feelings Relationships Bullying Safety Your future Environmental health Skip section navigation ( ... Robbery Using a weapon Sexual assault and rape Bullying Effects of youth violence top Every year, thousands ...

  3. Learning about Autism

    MedlinePlus

    Skip to main content Learning About Autism Enter Search Term(s): Español Research Funding An Overview Bioinformatics Current Grants Education and Training Funding Extramural Research News Features Funding Divisions Funding ...

  4. Impact of Food Allergy on Asthma in Children

    MedlinePlus

    American Academy of Allergy Asthma & Immunology Menu Search Main navigation Skip to content Conditions & Treatments Allergies Asthma Primary Immunodeficiency Disease Related Conditions Drug Guide Conditions Dictionary Just ...

  5. Simplifying Effective Treatment of Chronic Hives in Children

    MedlinePlus

    American Academy of Allergy Asthma & Immunology Menu Search Main navigation Skip to content Conditions & Treatments Allergies Asthma Primary Immunodeficiency Disease Related Conditions Drug Guide Conditions Dictionary Just ...

  6. Learning about Thalassemia

    MedlinePlus

    Skip to main content Learning About Thalassemia Enter Search Term(s): Español Research Funding An Overview Bioinformatics Current Grants Education and Training Funding Extramural Research News Features Funding Divisions Funding ...

  7. DNA Microarray Technology

    MedlinePlus

    Skip to main content DNA Microarray Technology Enter Search Term(s): Español Research Funding An Overview Bioinformatics Current Grants Education and Training Funding Extramural Research News Features Funding Divisions Funding ...

  8. Fuel-optimal trajectories of aeroassisted orbital transfer with plane change

    NASA Technical Reports Server (NTRS)

    Naidu, Desineni Subbaramaiah; Hibey, Joseph L.

    1989-01-01

    The problem of minimization of fuel consumption during the atmospheric portion of an aeroassisted, orbital transfer with plane change is addressed. The complete mission has required three characteristic velocities, a deorbit impulse at high earth orbit (HEO), a boost impulse at the atmospheric exit, and a reorbit impulse at low earth orbit (LEO). A performance index has been formulated as the sum of these three impulses. Application of optimal control principles has led to a nonlinear, two-point, boundary value problem which was solved by using a multiple shooting algorithm. The strategy for the atmospheric portion of the minimum-fuel transfer is to start initially with the maximum positive lift in order to recover from the downward plunge, and then to fly with a gradually decreasing lift such that the vehicle skips out of the atmosphere with a flight path angle near zero degrees.

  9. What I have changed my mind about and why: public health and technology perspectives in the field of trauma studies.

    PubMed

    Schnurr, Paula P; Bryant, Richard; Berliner, Lucy; Kilpatrick, Dean G; Rizzo, Albert; Ruzek, Josef I

    2017-01-01

    Background : This paper is based on a panel discussion at the 32nd annual meeting of the International Society for Traumatic Stress Studies in Dallas, Texas, in November 2016. Objective : Paula Schnurr convened a panel of experts in the fields of public health and technology to address the topic: 'What I have changed my mind about and why.' Method : The panel included Richard Bryant, Lucy Berliner, Dean Kilpatrick, Albert ('Skip') Rizzo, and Josef Ruzek. Results : Panellists discussed innovative strategies for the dissemination of scientific knowledge and evidence-based treatment. Conclusions : Although there are effective treatments, there is a need to enhance the effectiveness of these treatments. There also is a need to develop simpler, low-cost strategies to disseminate effective treatments. However, technology approaches also offer pathways to increased dissemination. Researchers must communicate scientific findings more effectively to impact public opinion and public policy.

  10. Implementing team huddles in small rural hospitals: How does the Kotter model of change apply?

    PubMed

    Baloh, Jure; Zhu, Xi; Ward, Marcia M

    2017-12-17

    To examine how the process of change prescribed in Kotter's change model applies in implementing team huddles, and to assess the impact of the execution of early change phases on change success in later phases. Kotter's model can help to guide hospital leaders to implement change and potentially to improve success rates. However, the model is under studied, particularly in health care. We followed eight hospitals implementing team huddles for 2 years, interviewing the change teams quarterly to inquire about implementation progress. We assessed how the hospitals performed in the three overarching phases of the Kotter model, and examined whether performance in the initial phase influenced subsequent performance. In half of the hospitals, change processes were congruent with Kotter's model, where performance in the initial phase influenced their success in subsequent phases. In other hospitals, change processes were incongruent with the model, and their success depended on implementation scope and the strategies employed. We found mixed support for the Kotter model. It better fits implementation that aims to spread to multiple hospital units. When the scope is limited, changes can be successful even when steps are skipped. Kotter's model can be a useful guide for nurse managers implementing changes. © 2017 John Wiley & Sons Ltd.

  11. Balancing Acts

    MedlinePlus

    ... frames were skipping. It was disorienting," the Pittsburgh accountant recalls. The dizziness didn't go away. Finally ... treatment. "Happy to make a small contribution to public health," he agreed to participate in a clinical ...

  12. Anesthesia Awareness (Waking Up) During Surgery

    MedlinePlus

    Skip to content Menu Anesthesia 101 Pain Management Preparing for Surgery Stories Resources About Policymakers Media ASA Member Toolkit Risks Anesthesia Awareness (Waking Up) During Surgery Explore this page: Anesthesia ...

  13. Outpatient Surgery

    MedlinePlus

    Skip to content Menu Anesthesia 101 Pain Management Preparing for Surgery Stories Resources About Policymakers Media ASA Member Toolkit Preparation Outpatient Surgery Explore this page: Outpatient Surgery What types of anesthesia are available? How ...

  14. What Is Narcolepsy?

    MedlinePlus

    Skip to main content U.S. Department of Health & Human Services Health Topics Health Topics A-Z Clinical Trials Publications and Resources Health Education and Awareness The Science Science Home Blood Disorders and ...

  15. Botanical Dietary Supplements: Background Information

    MedlinePlus

    Skip navigation links U.S. Department of Health & Human Services HHS.gov National Institutes of Health NIH.gov Font Size Decrease Font Size Increase Font Size Strengthening Knowledge and Understanding of ...

  16. Predicting Asthma in Preschool Children with Asthma-Like Symptoms

    MedlinePlus

    American Academy of Allergy Asthma & Immunology Menu Search Main navigation Skip to content Conditions & Treatments Allergies Asthma Primary Immunodeficiency Disease Related Conditions Drug Guide Conditions Dictionary Just ...

  17. The Science of Drug Use: Discussion Points

    MedlinePlus

    Skip to main content En español Researchers Medical & Health Professionals Patients & ... Medicines Prescription Medicines Steroids (Anabolic) Synthetic Cannabinoids (K2/Spice) Synthetic Cathinones (Bath Salts) Tobacco/Nicotine ...

  18. Drug Use and Viral Infections (HIV, Hepatitis)

    MedlinePlus

    Skip to main content En español Researchers Medical & Health Professionals Patients & ... Medicines Prescription Medicines Steroids (Anabolic) Synthetic Cannabinoids (K2/Spice) Synthetic Cathinones (Bath Salts) Tobacco/Nicotine ...

  19. Feeling Stressed

    MedlinePlus

    ... Illness & disability Drugs, alcohol & smoking Your feelings Relationships Bullying Safety Your future Environmental health Skip section navigation ( ... weight Problems with friends or other relationships Being bullied Living in a dangerous neighborhood Peer pressure to ...

  20. Exon 11 skipping of SCN10A coding for voltage-gated sodium channels in dorsal root ganglia

    PubMed Central

    Schirmeyer, Jana; Szafranski, Karol; Leipold, Enrico; Mawrin, Christian; Platzer, Matthias; Heinemann, Stefan H

    2014-01-01

    The voltage-gated sodium channel NaV1.8 (encoded by SCN10A) is predominantly expressed in dorsal root ganglia (DRG) and plays a critical role in pain perception. We analyzed SCN10A transcripts isolated from human DRGs using deep sequencing and found a novel splice variant lacking exon 11, which codes for 98 amino acids of the domain I/II linker. Quantitative PCR analysis revealed an abundance of this variant of up to 5–10% in human, while no such variants were detected in mouse or rat. Since no obvious functional differences between channels with and without the exon-11 sequence were detected, it is suggested that SCN10A exon 11 skipping in humans is a tolerated event. PMID:24763188

  1. Modeling the human MTM1 p.R69C mutation in murine Mtm1 results in exon 4 skipping and a less severe myotubular myopathy phenotype

    PubMed Central

    Pierson, Christopher R.; Dulin-Smith, Ashley N.; Durban, Ashley N.; Marshall, Morgan L.; Marshall, Jordan T.; Snyder, Andrew D.; Naiyer, Nada; Gladman, Jordan T.; Chandler, Dawn S.; Lawlor, Michael W.; Buj-Bello, Anna; Dowling, James J.; Beggs, Alan H.

    2012-01-01

    X-linked myotubular myopathy (MTM) is a severe neuromuscular disease of infancy caused by mutations of MTM1, which encodes the phosphoinositide lipid phosphatase, myotubularin. The Mtm1 knockout (KO) mouse has a severe phenotype and its short lifespan (8 weeks) makes it a challenge to use as a model in the testing of certain preclinical therapeutics. Many MTM patients succumb early in life, but some have a more favorable prognosis. We used human genotype–phenotype correlation data to develop a myotubularin-deficient mouse model with a less severe phenotype than is seen in Mtm1 KO mice. We modeled the human c.205C>T point mutation in Mtm1 exon 4, which is predicted to introduce the p.R69C missense change in myotubularin. Hemizygous male Mtm1 p.R69C mice develop early muscle atrophy prior to the onset of weakness at 2 months. The median survival period is 66 weeks. Histopathology shows small myofibers with centrally placed nuclei. Myotubularin protein is undetectably low because the introduced c.205C>T base change induced exon 4 skipping in most mRNAs, leading to premature termination of myotubularin translation. Some full-length Mtm1 mRNA bearing the mutation is present, which provides enough myotubularin activity to account for the relatively mild phenotype, as Mtm1 KO and Mtm1 p.R69C mice have similar muscle phosphatidylinositol 3-phosphate levels. These data explain the basis for phenotypic variability among human patients with MTM1 p.R69C mutations and establish the Mtm1 p.R69C mouse as a valuable model for the disease, as its less severe phenotype will expand the scope of testable preclinical therapies. PMID:22068590

  2. Indoor Air Quality

    MedlinePlus

    ... policy . Skip to main content ABOUT US OUR INITIATIVES LUNG HEALTH & DISEASES SUPPORT & COMMUNITY STOP SMOKING GET ... Supporters Careers Contact Us Corporate Ethics Reporting OUR INITIATIVES LUNG FORCE Saved By The Scan Research Healthy ...

  3. What Is Aplastic Anemia?

    MedlinePlus

    Skip to main content U.S. Department of Health & Human Services Health Topics Health Topics A-Z Clinical Trials Publications and Resources Health Education and Awareness The Science Science Home Blood Disorders and ...

  4. What Causes POI?

    MedlinePlus

    Skip to main content US Department of Health and Human Services National Institutes of Health Directory Follow follow us on Facebook follow us on Twitter follow us on Pinterest follow us on YouTube ...

  5. User account | National Agricultural Library

    Science.gov Websites

    Skip to main content Home National Agricultural Library United States Department of Agriculture Ag registered trademark of Dries Buytaert. NAL Home | USDA.gov | Agricultural Research Service | Plain Language

  6. National Agricultural Library | United States Department of Agriculture

    Science.gov Websites

    Skip to main content Home National Agricultural Library United States Department of Agriculture Ag | USDA.gov | Agricultural Research Service | Plain Language | FOIA | Accessibility Statement | Information

  7. Sleep Quiz

    MedlinePlus

    Skip Navigation Bar Home Current Issue Past Issues Sleep Quiz Past Issues / Summer 2007 Table of Contents ... on. Photo: iStock Take the National Center on Sleep Disorders Research Sleep Quiz TRUE OR FALSE ? _____1. ...

  8. Vaccines Stop Illness

    MedlinePlus

    Skip Navigation Bar Home Current Issue Past Issues Vaccines Stop Illness Past Issues / Spring 2008 Table of ... meningitis won't infect, cripple, or kill children. Vaccine Safety In light of recent questions about vaccine ...

  9. American Macular Degeneration Foundation

    MedlinePlus

    ... 3) non-profit, publicly supported organization. Contributions are tax deductible to the extent allowed by law. Skip ... supported organization (Charity ID #04-3274007). Contributions are tax deductible to the extent allowed by law.

  10. Getting Your Period

    MedlinePlus

    ... of your period What happens during your menstrual cycle Premenstrual syndrome (PMS) Problem periods Getting enough sleep ... can skip to our pages on your menstrual cycle , PMS , how to take care of your period , ...

  11. Digital rectal exam

    MedlinePlus

    Skip navigation U.S. National Library of Medicine The navigation menu has been collapsed. Menu ... exam URL of this page: //medlineplus.gov/ency/article/007069.htm Digital rectal exam To use the sharing features ...

  12. Genetics, Disease Prevention and Treatment

    MedlinePlus

    Skip to main content FAQ About Genetics, Disease Prevention and Treatment Enter Search Term(s): Español Research Funding An Overview Bioinformatics Current Grants Education and Training Funding Extramural Research News ...

  13. HIV Infection Accelerates Hepatitis C-Related Liver Fibrosis

    MedlinePlus

    Skip to main content En español Researchers Medical & Health Professionals Patients & ... Medicines Prescription Medicines Steroids (Anabolic) Synthetic Cannabinoids (K2/Spice) Synthetic Cathinones (Bath Salts) Tobacco/Nicotine ...

  14. HIV Medication Adherence

    MedlinePlus

    ... AIDS Drugs Clinical Trials Apps skip to content HIV Treatment Home Understanding HIV/AIDS Fact Sheets HIV ... 4 p.m. ET) Send us an email HIV Medication Adherence Last Reviewed: January 17, 2018 Key ...

  15. Asthma Patients in US Overuse Quick-Relief Inhalers, Underuse Control Medications

    MedlinePlus

    American Academy of Allergy Asthma & Immunology Menu Search Main navigation Skip to content Conditions & Treatments Allergies Asthma Primary Immunodeficiency Disease Related Conditions Drug Guide Conditions Dictionary Just ...

  16. Frequently Asked Questions about Genetic Counseling

    MedlinePlus

    Skip to main content FAQ About Genetic Counseling Enter Search Term(s): Español Research Funding An Overview Bioinformatics Current Grants Education and Training Funding Extramural Research News Features Funding Divisions ...

  17. Frequently Asked Questions about Genetic Testing

    MedlinePlus

    Skip to main content FAQ About Genetic Testing Enter Search Term(s): Español Research Funding An Overview Bioinformatics Current Grants Education and Training Funding Extramural Research News Features Funding Divisions ...

  18. HIV and Hepatitis C

    MedlinePlus

    ... AIDS Drugs Clinical Trials Apps skip to content HIV and Opportunistic Infections, Coinfections, and Conditions Home Understanding ... 4 p.m. ET) Send us an email HIV and Hepatitis C Last Reviewed: June 25, 2018 ...

  19. HIV Treatment: The Basics

    MedlinePlus

    ... AIDS Drugs Clinical Trials Apps skip to content HIV Treatment Home Understanding HIV/AIDS Fact Sheets HIV ... 4 p.m. ET) Send us an email HIV Treatment: The Basics Last Reviewed: March 22, 2018 ...

  20. HIV and Hepatitis B

    MedlinePlus

    ... AIDS Drugs Clinical Trials Apps skip to content HIV and Opportunistic Infections, Coinfections, and Conditions Home Understanding ... 4 p.m. ET) Send us an email HIV and Hepatitis B Last Reviewed: July 24, 2017 ...

  1. Federal Emergency Management Agency

    MedlinePlus

    ... Preparedness Goal National Preparedness System Blog Careers FEMA Earthquake Contacts Center for Faith-Based & Neighborhood Partnerships Grant ... hazard categories including riverine flood, hurricane surge, wind, earthquake, and Wildland-Urban Interface Fire. Skip footer content. ...

  2. Effects of Victimization and Violence on Suicidal Ideation and Behaviors Among Sexual Minority and Heterosexual Adolescents

    PubMed Central

    Everett, Bethany G.; Heath, Ryan D.; Elsaesser, Caitlin E.; Neilands, Torsten B.

    2016-01-01

    Abstract Purpose: Sexual minority youth (SMY) are at higher risk for victimization and suicide than are heterosexual youth (HY). Relatively little research has examined which types of victimization are most closely linked to suicide, which is necessary to develop targeted prevention interventions. The present study was conducted to address this deficit. Methods: The data come from the 2011 Chicago Youth Risk Behavior Survey (n = 1,907). Structural equation modeling (SEM) in Mplus evaluated the direct, indirect, and total effects of sexual orientation on a latent indicator of suicidal ideation and behaviors via seven types of victimization. Four indicators of victimization were school-specific (e.g., harassment due to sexual orientation or gender identity (SO/GID), bullying, threatened or injured with a weapon, and skipping school due to safety concerns), and three indicators assessed other types of victimization (e.g., electronic bullying, intimate partner violence, and sexual abuse). Results: Thirteen percent of youth were classified as SMY. Significantly more SMY than HY reported suicidal ideation (27.95% vs. 13.64%), a suicide plan (22.78% vs. 12.36%), and at least one suicide attempt (29.92% vs. 12.43%) in the past year (all P < .001). A greater percentage of SMY reported SO/GID-related harassment, skipping school, electronic bullying, and sexual abuse. Sexual orientation was not directly related to suicidal ideation and behaviors in SEM. Rather, SMY's elevated risk of suicidality functioned indirectly through two forms of school-based victimization: being threatened or injured with a weapon (B = .19, SE = .09, P ≤ .05) and experiencing SO/GID-specific harassment (B = .40, SE = .15, P ≤ .01). There also was a trend for SMY to skip school as a strategy to reduce suicide risk. Conclusion: Although SMY experience higher rates of victimization than do HY, school-based victimization that involves weapons or is due to one's SO/GID appear to be the most deleterious. That SMY may skip school to reduce their risk of suicidal ideation and behaviors is problematic, and schools should be encouraged to enact and enforce policies that explicitly protect SMY from victimization. PMID:26789401

  3. Breakfast Skipping is Positively Associated With Incidence of Type 2 Diabetes Mellitus: Evidence From the Aichi Workers’ Cohort Study

    PubMed Central

    Uemura, Mayu; Yatsuya, Hiroshi; Hilawe, Esayas Haregot; Li, Yuanying; Wang, Chaochen; Chiang, Chifa; Otsuka, Rei; Toyoshima, Hideaki; Tamakoshi, Koji; Aoyama, Atsuko

    2015-01-01

    Background Skipping breakfast has been suspected as a risk factor for type 2 diabetes (T2DM), but the associations are not entirely consistent across ethnicities or sexes, and the issue has not been adequately addressed in the Japanese population. Methods We followed 4631 participants (3600 men and 1031 women) in a work-site cohort of participants aged 35–66 years in 2002 through 2011 for T2DM development. Frequency of eating breakfast was self-reported and was subsequently dichotomized to breakfast skippers, who eat breakfast 3–5 times/week or less, and to eaters. Cox proportional hazards models were used to adjust for potential confounding factors, including dietary factors, smoking and other lifestyles, body mass index (BMI), and fasting blood glucose (FBG) at baseline. Results During 8.9 years of follow-up, 285 T2DM cases (231 men and 54 women) developed. Compared to participants who reported eating breakfast every day, maximally-adjusted hazard ratios and 95% confidence intervals (CI) of those with the frequency of almost every day and 3–5, 1–2, and 0 days/week were: 1.06 (95% CI, 0.73–1.53), 2.07 (95% CI, 1.20–3.56), 1.37 (95% CI, 0.82–2.29), and 2.12 (95% CI, 1.19–3.76), respectively. In a dichotomized analysis, breakfast skipping was positively associated with T2DM incidence (maximally-adjusted hazard ratio 1.73; 95% CI, 1.24–2.42). The positive associations were found in both men and women, current and non-current smokers, normal weight and overweight (BMI ≥25 kg/m2), and normal glycemic status and impaired fasting glycemic status (FBG 110 to <126 mg/dL) individuals at baseline (Ps for interaction all >0.05). Conclusions The present study in middle-aged Japanese men and women suggests that skipping breakfast may increase the risk of T2DM independent of lifestyles and baseline levels of BMI and FBG. PMID:25787236

  4. Data inversion immune to cycle-skipping using AWI

    NASA Astrophysics Data System (ADS)

    Guasch, L.; Warner, M.; Umpleby, A.; Yao, G.; Morgan, J. V.

    2014-12-01

    Over the last decade, 3D Full Waveform Inversion (FWI) has become a standard model-building tool in exploration seismology, especially in oil and gas applications -thanks to the high quality (spatial density of sources and receivers) datasets acquired by the industry. FWI provides superior quantitative images than its travel-time counterparts (travel-time based inversion methods) because it aims to match all the information in the observations instead of a severely restricted subset of them, namely picked arrivals.The downside is that the solution space explored by FWI has a high number of local minima, and since the solution is restricted to local optimization methods (due to the objective function evaluation cost), the success of the inversion is subject to starting within the basin of attraction of the global minimum.Local minima can exist for a wide variety of reasons, and it seems unlikely that a formulation of the problem that can eliminate all of them -by defining the optimization problem in a form that results in a monotonic objective function- exist. However, a significant amount of local minima are created by the definition of data misfit. In its standard formulation FWI compares observed data (field data) with predicted data (generated with a synthetic model) by subtracting one from the other, and the objective function is defined as some norm of this difference. The combination of this criteria and the fact that seismic data is oscillatory produces the well-known phenomenon of cycle-skipping, where model updates try to match nearest cycles from one dataset to the other.In order to avoid cycle-skipping we propose a different comparison between observed and predicted data, based on Wiener filters, which exploits the fact that the "identity" Wiener filter is a spike at zero lag. This gives rise to a new objective function without cycle-skipped related local minima, and therefore suppress the need of accurate starting models or low frequencies in the data. This new technique, called Adaptive Waveform Inversion (AWI) appears always superior to conventional FWI.

  5. Effects of Victimization and Violence on Suicidal Ideation and Behaviors Among Sexual Minority and Heterosexual Adolescents.

    PubMed

    Bouris, Alida; Everett, Bethany G; Heath, Ryan D; Elsaesser, Caitlin E; Neilands, Torsten B

    2016-04-01

    Sexual minority youth (SMY) are at higher risk for victimization and suicide than are heterosexual youth (HY). Relatively little research has examined which types of victimization are most closely linked to suicide, which is necessary to develop targeted prevention interventions. The present study was conducted to address this deficit. The data come from the 2011 Chicago Youth Risk Behavior Survey (n = 1,907). Structural equation modeling (SEM) in Mplus evaluated the direct, indirect, and total effects of sexual orientation on a latent indicator of suicidal ideation and behaviors via seven types of victimization. Four indicators of victimization were school-specific (e.g., harassment due to sexual orientation or gender identity (SO/GID), bullying, threatened or injured with a weapon, and skipping school due to safety concerns), and three indicators assessed other types of victimization (e.g., electronic bullying, intimate partner violence, and sexual abuse). Thirteen percent of youth were classified as SMY. Significantly more SMY than HY reported suicidal ideation (27.95% vs. 13.64%), a suicide plan (22.78% vs. 12.36%), and at least one suicide attempt (29.92% vs. 12.43%) in the past year (all P < .001). A greater percentage of SMY reported SO/GID-related harassment, skipping school, electronic bullying, and sexual abuse. Sexual orientation was not directly related to suicidal ideation and behaviors in SEM. Rather, SMY's elevated risk of suicidality functioned indirectly through two forms of school-based victimization: being threatened or injured with a weapon (B = .19, SE = .09, P ≤ .05) and experiencing SO/GID-specific harassment (B = .40, SE = .15, P ≤ .01). There also was a trend for SMY to skip school as a strategy to reduce suicide risk. Although SMY experience higher rates of victimization than do HY, school-based victimization that involves weapons or is due to one's SO/GID appear to be the most deleterious. That SMY may skip school to reduce their risk of suicidal ideation and behaviors is problematic, and schools should be encouraged to enact and enforce policies that explicitly protect SMY from victimization.

  6. Beneficial effects of a higher-protein breakfast on the appetitive, hormonal, and neural signals controlling energy intake regulation in overweight/obese, “breakfast-skipping,” late-adolescent girls123

    PubMed Central

    Ortinau, Laura C; Douglas, Steve M; Hoertel, Heather A

    2013-01-01

    Background: Breakfast skipping is a common dietary habit practiced among adolescents and is strongly associated with obesity. Objective: The objective was to examine whether a high-protein (HP) compared with a normal-protein (NP) breakfast leads to daily improvements in appetite, satiety, food motivation and reward, and evening snacking in overweight or obese breakfast-skipping girls. Design: A randomized crossover design was incorporated in which 20 girls [mean ± SEM age: 19 ± 1 y; body mass index (in kg/m2): 28.6 ± 0.7] consumed 350-kcal NP (13 g protein) cereal-based breakfasts, consumed 350-kcal HP egg- and beef-rich (35 g protein) breakfasts, or continued breakfast skipping (BS) for 6 d. On day 7, a 10-h testing day was completed that included appetite and satiety questionnaires, blood sampling, predinner food cue–stimulated functional magnetic resonance imaging brain scans, ad libitum dinner, and evening snacking. Results: The consumption of breakfast reduced daily hunger compared with BS with no differences between meals. Breakfast increased daily fullness compared with BS, with the HP breakfast eliciting greater increases than did the NP breakfast. HP, but not NP, reduced daily ghrelin and increased daily peptide YY concentrations compared with BS. Both meals reduced predinner amygdala, hippocampal, and midfrontal corticolimbic activation compared with BS. HP led to additional reductions in hippocampal and parahippocampal activation compared with NP. HP, but not NP, reduced evening snacking of high-fat foods compared with BS. Conclusions: Breakfast led to beneficial alterations in the appetitive, hormonal, and neural signals that control food intake regulation. Only the HP breakfast led to further alterations in these signals and reduced evening snacking compared with BS, although no differences in daily energy intake were observed. These data suggest that the addition of breakfast, particularly one rich in protein, might be a useful strategy to improve satiety, reduce food motivation and reward, and improve diet quality in overweight or obese teenage girls. This trial was registered at clinicaltrials.gov as NCT01192100. PMID:23446906

  7. Eating patterns and leisure-time exercise among active duty military personnel: comparison to the Healthy People objectives.

    PubMed

    Smith, Tracey J; Dotson, Laura E; Young, Andrew J; White, Alan; Hadden, Louise; Bathalon, Gaston P; Funderburk, LesLee; Marriott, Bernadette P

    2013-07-01

    To assess whether active duty military personnel meet Healthy People 2010 objectives for physical activity and fruit, vegetable, and whole-grain intake; the relationship of select demographic characteristics, lifestyle factors (eg, smoking), and eating patterns (eg, frequency and location of meals) on achieving diet and exercise-related Healthy People 2010 objectives; and the relationship of eating patterns to self-reported weight gain. Secondary data from 15,747 participants in the 2005 Department of Defense Health Related Behaviors Survey was analyzed. More than 57% of respondents met the Healthy People 2010 guidelines for moderate or vigorous leisure exercise but only 3% reported eating fruit (once), vegetables (3 times), and whole grains (3 times) daily. Individuals who reported gaining weight during the previous year were more likely to skip breakfast and eat at, or from, a restaurant ≥2 times per week compared with those who did not gain weight (P<0.001). Regression analysis indicated that women were more likely to eat fruits (odds ratio [OR] 1.25) and vegetables (OR 1.20) and less likely than men to eat whole grains (OR 0.76) or engage in moderate or vigorous exercise (OR 0.71). Military personnel who skipped breakfast ≥2 times per week (OR 0.45) or ate at a restaurant/takeout food (OR 0.54) ≥2 times per week were significantly less likely to meet Healthy People 2010 guidelines for food intake (defined as achieving a daily intake of one or more fruits, three or more vegetables, and three or more servings of whole grains) and exercise (OR 0.88 and 0.82, respectively). Although the majority of military personnel met guidelines for physical activity, their intake of fruits, vegetables, and whole grains was suboptimal. Skipping breakfast and eating at, or from, restaurants were risk factors for poor nutrient intake and associated with weight gain. These data suggest that skipping breakfast and eating out deter achieving Healthy People 2010 objectives and provide targets for military programs to promote achieving these objectives. Copyright © 2013 Academy of Nutrition and Dietetics. Published by Elsevier Inc. All rights reserved.

  8. Nutrition-Related Practices and Attitudes of Kansas Skipped-Generation(s) Caregivers and Their Grandchildren

    PubMed Central

    Higgins, Mary Meck; Murray, Bethany J.

    2010-01-01

    Despite growing numbers, the nutrition practices and attitudes of skipped–generation(s) kinship caregivers regarding feeding the dependent children in their care have not been examined. In this qualitative study, transcriptions of semi-structured interviews with 19 female and four male skipped-generation(s) Kansas caregivers (ages 47 to 80, 92% non-Hispanic whites, 83% female, 78% grandparents and 22% great-aunt or great–grandparent caregivers; caring for a range of one to four children, ages three to 18, for an average of nine years) were content analyzed for how their nutrition-related practices and attitudes had changed since parenting the first time. Sub-themes regarding practices included: being more nutrition and food safety conscious now, and shifting their child feeding style. The children seemed to be adversely affected by an on-the-go lifestyle and the use of more electronics. Caregivers described their sources for child feeding advice as being based mostly on information from their mothers, physicians, and their past parenting experiences. Sub-themes for attitudes included opinions that nutrition and safe food handling are important and that nutritious food is expensive. They preferred printed or video nutrition education materials and wanted to receive information through organizations they trusted. This population could benefit from education on: infant, child, adolescent, and sports nutrition; feeding “picky eaters”; healthful recipes, “fast foods” and packaged foods; quick, inexpensive meals and snacks low in fat, sugar, and salt; limiting sedentary time; family meals; using food thermometers; and intergenerational gardening and cooking. PMID:22254004

  9. A G-to-A mutation in IVS-3 of the human gamma fibrinogen gene causing afibrinogenemia due to abnormal RNA splicing.

    PubMed

    Margaglione, M; Santacroce, R; Colaizzo, D; Seripa, D; Vecchione, G; Lupone, M R; De Lucia, D; Fortina, P; Grandone, E; Perricone, C; Di Minno, G

    2000-10-01

    Congenital afibrinogenemia is a rare autosomal recessive disorder characterized by a hemorrhagic diathesis of variable severity. Although more than 100 families with this disorder have been described, genetic defects have been characterized in few cases. An investigation of a young propositus, offspring of a consanguineous marriage, with undetectable levels of functional and quantitative fibrinogen, was conducted. Sequence analysis of the fibrinogen genes showed a homozygous G-to-A mutation at the fifth nucleotide (nt 2395) of the third intervening sequence (IVS) of the gamma-chain gene. Her first-degree relatives, who had approximately half the normal fibrinogen values and showed concordance between functional and immunologic levels, were heterozygtes. The G-to-A change predicts the disappearance of a donor splice site. After transfection with a construct, containing either the wild-type or the mutated sequence, cells with the mutant construct showed an aberrant messenger RNA (mRNA), consistent with skipping of exon 3, but not the expected mRNA. Sequencing of the abnormal mRNA showed the complete absence of exon 3. Skipping of exon 3 predicts the deletion of amino acid sequence from residue 16 to residue 75 and shifting of reading frame at amino acid 76 with a premature stop codon within exon 4 at position 77. Thus, the truncated gamma-chain gene product would not interact with other chains to form the mature fibrinogen molecule. The current findings show that mutations within highly conserved IVS regions of fibrinogen genes could affect the efficiency of normal splicing, giving rise to congenital afibrinogenemia.

  10. Mutation in Pyrroline-5-Carboxylate Reductase 1 Gene in Families with Cutis Laxa Type 2

    PubMed Central

    Guernsey, Duane L.; Jiang, Haiyan; Evans, Susan C.; Ferguson, Meghan; Matsuoka, Makoto; Nightingale, Mathew; Rideout, Andrea L.; Provost, Sylvie; Bedard, Karen; Orr, Andrew; Dubé, Marie-Pierre; Ludman, Mark; Samuels, Mark E.

    2009-01-01

    Autosomal-recessive cutis laxa type 2 (ARCL2) is a multisystem disorder characterized by the appearance of premature aging, wrinkled and lax skin, joint laxity, and a general developmental delay. Cutis laxa includes a family of clinically overlapping conditions with confusing nomenclature, generally requiring molecular analyses for definitive diagnosis. Six genes are currently known to mutate to yield one of these related conditions. We ascertained a cohort of typical ARCL2 patients from a subpopulation isolate within eastern Canada. Homozygosity mapping with high-density SNP genotyping excluded all six known genes, and instead identified a single homozygous region near the telomere of chromosome 17, shared identically by state by all genotyped affected individuals from the families. A putative pathogenic variant was identified by direct DNA sequencing of genes within the region. The single nucleotide change leads to a missense mutation adjacent to a splice junction in the gene encoding pyrroline-5-carboxylate reductase 1 (PYCR1). Bioinformatic analysis predicted a pathogenic effect of the variant on splice donor site function. Skipping of the associated exon was confirmed in RNA from blood lymphocytes of affected homozygotes and heterozygous mutation carriers. Exon skipping leads to deletion of the reductase functional domain-coding region and an obligatory downstream frameshift. PYCR1 plays a critical role in proline biosynthesis. Pathogenicity of the genetic variant in PYCR1 is likely, given that a similar clinical phenotype has been documented for mutation carriers of another proline biosynthetic enzyme, pyrroline-5-carboxylate synthase. Our results support a significant role for proline in normal development. PMID:19576563

  11. Simple Simulation Algorithms and Sample Applications

    NASA Astrophysics Data System (ADS)

    Kröger, Martin

    This section offers basic recipes and sample applications which allow the reader to immediately start his/her own simulation project on topics we dealt with in this book. Concerning molecular dynamics and Monte Carlo simulation there are, of course, several useful books already available which describe the ‘art of simulation‘ [141, 156, 256] in an exhaustive way. The reason we print some simple codes is that we skipped algorithmic details in the foregoing chapters. Simulations are always performed using dimensionless numbers, and all dimensional quantities can be expressed in terms of reduced units, cf. Sect. 4.3 for conventional Lennard Jones units. In this chapter, we concentrate on the necessary, and skip anything more sophisticated. Codes have been used in classrooms, they are obviously open for modifications and extensions, and offer not only an executable, but all necessary formulas for doing simulations in the correct (which is often essential) order. The overall spirit is as follows: codes are short, run without changes, demonstrate the main principle in a modular fashion, and are thus in particular open regarding efficiency issues and extensions. Algorithms are presented in the MatlabTM language, which is mostly directly portable to programming languages like fortran, c, or MathematicaTM. For an introduction we refer to [423]. Additional commands needed to visualize the results are given in the figure title for each application. Simulation codes, in a less modular fashion, are also available online at www.complexfluids.ethz.ch. Functions are shared over sections, for that reason we begin with an alphabetic list of all (nonbuiltin) functions in this chapter.

  12. The demise of Oregon's Medically Needy program: effects of losing prescription drug coverage.

    PubMed

    Zerzan, Judy; Edlund, Tina; Krois, Lisa; Smith, Jeanene

    2007-06-01

    In January 2003, people covered by Oregon's Medically Needy program lost benefits owing to state budget shortfalls. The Medically Needy program is a federally matched optional Medicaid program. In Oregon, this program mainly provided prescription drug benefits. To describe the Medically Needy population and determine how benefit loss affected this population's health and prescription use. A 49-question telephone survey instrument created by the research team and administered by a research contractor. A random sample of 1,269 eligible enrollees in Oregon's Medically Needy Program. Response rate was 35% with 439 individuals, ages 21-91 and 64% women, completing the survey. Demographics, health information, and medication use at the time of the survey obtained from the interview. Medication use during the program obtained from administrative data. In the 6 months after the Medically Needy program ended, 75% had skipped or stopped medications. Sixty percent of the respondents had cut back on their food budget, 47% had borrowed money, and 49% had skipped paying other bills to pay for medications. By self-report, there was no significant difference in emergency department visits, but a significant decrease in hospitalizations comparing 6 months before and after losing the program. Two-thirds of respondents rated their current health as poor or fair. The Medically Needy program provided coverage for a low-income, chronically ill population. Since its termination, enrollees have decreased prescription drug use and increased financial burden. As states make program changes and Medicare Part D evolves, effects on vulnerable populations must be considered.

  13. Technologies for the fabrication of the E-ELT mirrors within the T-REX project

    NASA Astrophysics Data System (ADS)

    Pareschi, G.; Aliverti, M.; Bianco, A.; Basso, S.; Citterio, O.; Civitani, M.; Ghigo, M.; Pariani, G.; Sironi, G.; Riva, M.; Vecchi, G.; Zerbi, F.

    With its primary mirror with 39 m of diameter, the E-ELT will be the largest optical/near-infrared telescope in the world and will gather 13 times more light than the largest optical telescopes existing today. The different optical sub-systems of E-ELT, including the primary mirror based on hundreds of reflecting tiles assembled together, represent key components for the implementation of the telescopes. A huge amount of aspherical reflecting elements have to be produced with "state of the art" figuring and polishing technologies and measured with proper metrological equipments. In the past couple of years, in the context of the T-REX project, a specific development program was carried out at the Brera Astronomical Observatory-INAF in order to address a numbers of technology aspects related to the fabrication of the E-ELT mirrors. In this paper we give a short overview of the activities that have been carried out. Other papers in this volume report on specific activities that have pursed within such a development program. skip=8pt

  14. eBenefits: My Gateway to Benefits Information

    MedlinePlus

    ... of the Department of Veterans Affairs and the Department of Defense A Service of the Department of Veterans Affairs and the Department of Defense Log in Register Skip Navigation Main Menu Apply ...

  15. Anaphylaxis

    MedlinePlus

    ... Menu Search Main navigation Skip to content Conditions & Treatments Allergies Asthma Primary Immunodeficiency Disease Related Conditions Drug Guide ... Expert Search Search AAAAI Breadcrumb navigation Home ▸ Conditions & Treatments ▸ Allergies ▸ Anaphylaxis ... Anaphylaxis Overview Symptoms & Diagnosis Treatment & Management ...

  16. Fire Ant Allergy

    MedlinePlus

    ... Menu Search Main navigation Skip to content Conditions & Treatments Allergies Asthma Primary Immunodeficiency Disease Related Conditions Drug Guide ... your condition and determine the best form of treatment. Allergy shots (immunotherapy) may be effective long-term treatment ...

  17. Working Parents

    MedlinePlus

    ... Ribbon Commands Skip to main content Turn off Animations Turn on Animations Our Sponsors Log in | Register Menu Log in | ... or go to the gym. Do some recreational reading. While family time is important and certain chores ...

  18. Pediatric Ophthalmologist

    MedlinePlus

    ... Ribbon Commands Skip to main content Turn off Animations Turn on Animations Our Sponsors Log in | Register Menu Log in | ... with a vision screening exam or has difficulty reading or learning, or needs surgery or medical treatment ...

  19. Finding Reliable Health Information Online

    MedlinePlus

    Skip to main content Finding Reliable Health Information Online Enter Search Term(s): Español Research Funding An Overview Bioinformatics Current Grants Education and Training Funding Extramural Research News Features Funding Divisions Funding ...

  20. Patient's Guide to Arrhythmogenic Right Ventricular Dysplasia/Cardiomyopathy

    MedlinePlus

    Skip to main content American Heart Association Science Volunteer Warning Signs Search for this keyword Search Advanced Search Donate Home About this Journal Editorial Board General Statistics Circulation Doodle Doodle Gallery ...

  1. Aplastic Anemia and Myelodysplastic Syndromes

    MedlinePlus

    Skip to main content U.S. Department of Health and Human Services Follow us: Search Menu Search for Information from NIDDK Entire Site Research & Funding Health Information About NIDDK News Search Research & Funding Current ...

  2. 3/29/2018: Making Data Machine-Readable Webinar | National Agricultural

    Science.gov Websites

    Library Skip to main content Home National Agricultural Library United States Department of | USDA.gov | Agricultural Research Service | Plain Language | FOIA | Accessibility Statement | Information

  3. HIV Medicines and Side Effects

    MedlinePlus

    ... Apps skip to content Side Effects of HIV Medicines Home Understanding HIV/AIDS Fact Sheets HIV Medicines ... p.m. ET) Send us an email HIV Medicines and Side Effects Last Reviewed: October 9, 2017 ...

  4. ARC-1973-A73-9044-2

    NASA Image and Video Library

    1973-11-21

    Pioneer 10; Mission to Jupiter Project Manager Charlie Hall (center) leads the Pioneer staff through his efficient (and infamous) stand-up meeting (also shown (L-foreground) Skip Nunamaker and (R-foreground) Richard Fimmel

  5. Guidelines for Better Heart Health

    MedlinePlus

    Skip Navigation Bar Home Current Issue Past Issues Guidelines for Better Heart Health Past Issues / Winter 2007 ... women either had or did not have CVD. Guidelines at a Glance: Prevention should be tailored to ...

  6. Structural manipulation of the graphene/metal interface with Ar+ irradiation

    NASA Astrophysics Data System (ADS)

    Åhlgren, E. H.; Hämäläinen, S. K.; Lehtinen, O.; Liljeroth, P.; Kotakoski, J.

    2013-10-01

    Controlled defect creation is a prerequisite for the detailed study of disorder effects in materials. Here, we irradiate a graphene/Ir(111) interface with low-energy Ar+ to study the induced structural changes. Combining computer simulations and scanning-probe microscopy, we show that the resulting disorder manifests mainly in the forms of intercalated metal adatoms and vacancy-type defects in graphene. One prominent feature at higher irradiation energies (from 1 keV up) is the formation of linelike depressions, which consist of sequential graphene defects created by the ion channeling within the interface, much like a stone skipping on water. Lower energies result in simpler defects, down to 100 eV, where more than one defect in every three is a graphene single vacancy.

  7. 26 CFR 20.2053-6 - Deduction for taxes.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... (3) effect distribution. Excise taxes incurred in distributing property of the estate in kind are.... If D's estate had claimed a deduction of $50x on D's United States Estate (and Generation-Skipping...

  8. 26 CFR 20.2053-6 - Deduction for taxes.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... (3) effect distribution. Excise taxes incurred in distributing property of the estate in kind are.... If D's estate had claimed a deduction of $50x on D's United States Estate (and Generation-Skipping...

  9. 26 CFR 20.2053-6 - Deduction for taxes.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... (3) effect distribution. Excise taxes incurred in distributing property of the estate in kind are.... If D's estate had claimed a deduction of $50x on D's United States Estate (and Generation-Skipping...

  10. 26 CFR 20.2053-6 - Deduction for taxes.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... (3) effect distribution. Excise taxes incurred in distributing property of the estate in kind are.... If D's estate had claimed a deduction of $50x on D's United States Estate (and Generation-Skipping...

  11. Allergy-Friendly Gardening

    MedlinePlus

    ... Menu Search Main navigation Skip to content Conditions & Treatments Allergies Asthma Primary Immunodeficiency Disease Related Conditions Drug Guide ... Expert Search Search AAAAI Breadcrumb navigation Home ▸ Conditions & Treatments ▸ ... Library ▸ Allergy-friendly gardening Share | Allergy-Friendly Gardening ...

  12. Rhinitis Overview

    MedlinePlus

    ... Menu Search Main navigation Skip to content Conditions & Treatments Allergies Asthma Primary Immunodeficiency Disease Related Conditions Drug Guide ... Expert Search Search AAAAI Breadcrumb navigation Home ▸ Conditions & Treatments ▸ Allergies ▸ Rhinitis Share | Rhinitis (Hay Fever) Overview Symptoms & Diagnosis ...

  13. ACHP | News

    Science.gov Websites

    Search skip specific nav links Home arrow News Internal Revenue Service Wins Chairman's Award for Federal Redstone Castle WASHINGTON, DC-The Internal Revenue Service (IRS) received the Advisory Council on Historic

  14. Friend or Foe?

    MedlinePlus

    ... Ribbon Commands Skip to main content Turn off Animations Turn on Animations Our Sponsors Log in | Register Menu Log in | ... best in him, rather than the worst. By reading up on the subject, discussing it with my ...

  15. Disruptive Behavior Disorders

    MedlinePlus

    ... Ribbon Commands Skip to main content Turn off Animations Turn on Animations Our Sponsors Log in | Register Menu Log in | ... greater chance of experiencing learning disabilities such as reading disorders and verbal impairment. But what distinguishes children ...

  16. Deployment and Children

    MedlinePlus

    ... Ribbon Commands Skip to main content Turn off Animations Turn on Animations Our Sponsors Log in | Register Menu Log in | ... to talk with teenagers about what they’re reading in the newspaper, discussing in school, or seeing ...

  17. Health Screenings at School

    MedlinePlus

    ... Ribbon Commands Skip to main content Turn off Animations Turn on Animations Our Sponsors Log in | Register Menu Log in | ... others develop later. A child who has difficulty reading the blackboard may not know that she is ...

  18. Stresses of Single Parenting

    MedlinePlus

    ... Ribbon Commands Skip to main content Turn off Animations Turn on Animations Our Sponsors Log in | Register Menu Log in | ... to enjoy your children. Spend quiet time playing, reading, working on arts-and-crafts projects, or just ...

  19. Importance of Family Routines

    MedlinePlus

    ... Ribbon Commands Skip to main content Turn off Animations Turn on Animations Our Sponsors Log in | Register Menu Log in | ... child to sleep. These rituals can include storytelling, reading aloud, conversation, and songs. Try to avoid exciting ...

  20. Preparing for Twins

    MedlinePlus

    ... Ribbon Commands Skip to main content Turn off Animations Turn on Animations Our Sponsors Log in | Register Menu Log in | ... challenges with twins. He also can suggest helpful reading material or refer you to organizations that help ...

  1. Parkinson's Disease: The Newest Advances

    MedlinePlus

    Skip Navigation Bar Home Current Issue Past Issues Parkinson's Disease: The Newest Advances Past Issues / Summer 2006 Table ... number of genes that cause or contribute to Parkinson's disease (PD), as well as potential environmental risk factors. ...

  2. Health Effects of Ozone and Particle Pollution

    MedlinePlus

    ... policy . Skip to main content ABOUT US OUR INITIATIVES LUNG HEALTH & DISEASES SUPPORT & COMMUNITY STOP SMOKING GET ... Supporters Careers Contact Us Corporate Ethics Reporting OUR INITIATIVES LUNG FORCE Saved By The Scan Research Healthy ...

  3. National Institute of Dental and Craniofacial Research

    MedlinePlus

    ... In Skip to Main Content National Institute of Dental and Craniofacial Research (NIDCR) Improving the Nation's Oral ... Researchers NIDCR Strategic Plan The National Institute of Dental and Craniofacial Research remains committed to improving the ...

  4. ACHP | News | ACHP Spring Business Meeting May 5

    Science.gov Websites

    Search skip specific nav links Home arrow News arrow ACHP Chairman Wayne Donaldson Celebrates with LA Preserve America Neighborhoods ACHP Chairman Wayne Donaldson Celebrates with LA Preserve America

  5. 4/4/2018: The Ag Data Commons Metrics | National Agricultural Library

    Science.gov Websites

    Skip to main content Home National Agricultural Library United States Department of Agriculture Ag | Agricultural Research Service | Plain Language | FOIA | Accessibility Statement | Information Quality | Privacy

  6. National Agricultural Library | United States Department of Agriculture

    Science.gov Websites

    Skip to main content Home National Agricultural Library United States Department of Agriculture Ag Policy Drupal is a registered trademark of Dries Buytaert. NAL Home | USDA.gov | Agricultural Research

  7. Measuring Physical Activity Intensity

    MedlinePlus Videos and Cool Tools

    ... Skip directly to site content Start of Search Controls Search Form Controls Cancel Submit Search the CDC CDC A-Z ... V W X Y Z # Start of Search Controls Search Form Controls Search The CDC Cancel Submit ...

  8. ACHP | ACHP Native American Program: Guidance for Federal Agencies

    Science.gov Websites

    Working with Section 106 Federal, State, & Tribal Programs Training & Education Publications Search skip specific nav links Home arrow Working with Section 106 arrow ACHP Native American Program

  9. 76 FR 4686 - Product Cancellation Order for Certain Pesticide Registrations

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-01-26

    ... Duty Bird Paradichlorobenze Guard. ne. 002517-00049 Sergeant's Pump Soap Bioallethrin MGK for Dogs. 264 Phenothrin. 002517-00059 Sergeant's Skip-Flea MGK 264 Soap (with D- Phenothrin. Phenothrin). 002517-00067...

  10. Combating HIV/AIDS | NIH MedlinePlus the Magazine

    MedlinePlus

    Skip to main content NIH MedlinePlus the Magazine NIH MedlinePlus Salud Download the Current Issue PDF [3.1 mb] Trusted Health Information from the National Institutes of Health Home Current Issue ...

  11. Why You Shouldn't Use Cotton Swabs to Clean Your Ears

    MedlinePlus

    Skip to main Content U.S. Department of Health & Human Services National Institutes of Health National Institute on Deafness and Other Communication Disorders You are here Home > Have You Heard? > ...

  12. 15 CFR 732.1 - Steps overview.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ..., Iran, North Korea, and Syria. For these countries, you may skip Steps 7 through 11 and go directly to...., Cuba, Iran, North Korea and Syria), prohibited activities of U.S. persons in support of proliferation...

  13. 15 CFR 732.1 - Steps overview.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ..., Iran, North Korea, and Syria. For these countries, you may skip Steps 7 through 11 and go directly to...., Cuba, Iran, North Korea and Syria), prohibited activities of U.S. persons in support of proliferation...

  14. How Much Exercise Do I Need?

    MedlinePlus

    ... Aerobic activities include walking fast, jogging, swimming, and biking Exercise at a moderate intensity. One way to ... skipping, playing on the playground, playing basketball, and biking Also, try to get each of these at ...

  15. 12. Exterior detail view of roof structure at eave, showing ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    12. Exterior detail view of roof structure at eave, showing exposed rafter tails, skip sheathing and gutter - American Railway Express Company Freight Building, 1060 Northeast Division Street, Bend, Deschutes County, OR

  16. What is a Therapeutic HIV Vaccine?

    MedlinePlus

    ... AIDS Drugs Clinical Trials Apps skip to content HIV Overview Home Understanding HIV/AIDS Fact Sheets What ... Send us an email What is a Therapeutic HIV Vaccine? Last Reviewed: August 16, 2017 Key Points ...

  17. HIV, AIDS, and the Future

    MedlinePlus

    Skip Navigation Bar Home Current Issue Past Issues HIV / AIDS HIV, AIDS, and the Future Past Issues / Summer 2009 ... turn Javascript on. Photo: The NAMES Project Foundation HIV and AIDS are a global catastrophe. While advances ...

  18. What is an Investigational HIV Drug?

    MedlinePlus

    ... AIDS Drugs Clinical Trials Apps skip to content HIV Overview Home Understanding HIV/AIDS Fact Sheets What ... Send us an email What is an Investigational HIV Drug? Last Reviewed: August 25, 2017 Key Points ...

  19. What is a Preventive HIV Vaccine?

    MedlinePlus

    ... AIDS Drugs Clinical Trials Apps skip to content HIV Overview Home Understanding HIV/AIDS Fact Sheets What ... Send us an email What is a Preventive HIV Vaccine? Last Reviewed: August 16, 2017 Key Points ...

  20. How to Find HIV Treatment Services

    MedlinePlus

    ... Clinical Trials Apps skip to content Living with HIV Home Understanding HIV/AIDS Fact Sheets How to ... ET) Send us an email How to Find HIV Treatment Services Last Reviewed: December 6, 2017 Key ...

Top