Thermal Diffusivity and Conductivity in Ceramic Matrix Fiber Composite Materials - Literature Study

DOE Office of Scientific and Technical Information (OSTI.GOV)

R.G. Quinn

A technical literature review was conducted to gain an understanding of the state of the art method, problems, results, and future of thermal diffusivity/conductivity of matrix-fiber composites for high temperature applications. This paper summarizes the results of test method development and theory. Results from testing on various sample types are discussed with concentration on the anisotropic characteristics of matrix-fiber composites, barriers to heat flow, and notable microstructure observations. The conclusion presents some observations from the technical literature, drawbacks of current information and discusses potential needs for future testing.

Characterization of poly(vinyl acetate) based floating matrix tablets.

PubMed

Strübing, Sandra; Metz, Hendrik; Mäder, Karsten

2008-03-03

Floating Kollidon SR matrix tablets containing Propranolol HCl were developed and characterized with respect to drug release characteristics and floating strength. Kollidon SR was able to delay Propranolol HCl release efficiently. Drug release kinetics was evaluated using the Korsmeyer-Peppas model and found to be governed by Fickian diffusion. Tablet floating started immediately and continued for 24 h. It was possible to monitor the floating strength of the matrix devices using a simple experimental setup. Floating strength was related to Kollidon SR level with improved floating characteristics for samples with a high polymer/drug ratio. Swelling characteristics of the tablets were analyzed by applying the equation according to Therien-Aubin et al. The influence of the polymer content on swelling characteristics was found to be only marginal. Furthermore, the new method of benchtop MRI was introduced to study the water diffusion and swelling behaviour non-invasively and continuously.

Matrix elements for type 1 unitary irreducible representations of the Lie superalgebra gl(m|n)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gould, Mark D.; Isaac, Phillip S.; Werry, Jason L.

Using our recent results on eigenvalues of invariants associated to the Lie superalgebra gl(m|n), we use characteristic identities to derive explicit matrix element formulae for all gl(m|n) generators, particularly non-elementary generators, on finite dimensional type 1 unitary irreducible representations. We compare our results with existing works that deal with only subsets of the class of type 1 unitary representations, all of which only present explicit matrix elements for elementary generators. Our work therefore provides an important extension to existing methods, and thus highlights the strength of our techniques which exploit the characteristic identities.

Graphene-Reinforced Aluminum Matrix Composites: A Review of Synthesis Methods and Properties

NASA Astrophysics Data System (ADS)

Chen, Fei; Gupta, Nikhil; Behera, Rakesh K.; Rohatgi, Pradeep K.

2018-06-01

Graphene-reinforced aluminum (Gr-Al) matrix nanocomposites (NCs) have attracted strong interest from both research and industry in high-performance weight-sensitive applications. Due to the vastly different bonding characteristics of the Al matrix (metallic) and graphene (in-plane covalent + inter-plane van der Waals), the graphene phase has a general tendency to agglomerate and phase separate in the metal matrix, which is detrimental for the mechanical and chemical properties of the composite. Thus, synthesis of Gr-Al NCs is extremely challenging. This review summarizes the different methods available to synthesize Gr-Al NCs and the resulting properties achieved in these NCs. Understanding the effect of processing parameters on the realized properties opens up the possibility of tailoring the synthesis methods to achieve the desired properties for a given application.

Graphene-Reinforced Aluminum Matrix Composites: A Review of Synthesis Methods and Properties

NASA Astrophysics Data System (ADS)

Chen, Fei; Gupta, Nikhil; Behera, Rakesh K.; Rohatgi, Pradeep K.

2018-03-01

Graphene-reinforced aluminum (Gr-Al) matrix nanocomposites (NCs) have attracted strong interest from both research and industry in high-performance weight-sensitive applications. Due to the vastly different bonding characteristics of the Al matrix (metallic) and graphene (in-plane covalent + inter-plane van der Waals), the graphene phase has a general tendency to agglomerate and phase separate in the metal matrix, which is detrimental for the mechanical and chemical properties of the composite. Thus, synthesis of Gr-Al NCs is extremely challenging. This review summarizes the different methods available to synthesize Gr-Al NCs and the resulting properties achieved in these NCs. Understanding the effect of processing parameters on the realized properties opens up the possibility of tailoring the synthesis methods to achieve the desired properties for a given application.

New Techniques in Computational Aerodynamics.

DTIC Science & Technology

1987-08-06

the nature of a continuous range of nearby flow fields is of fundmental significance in the design and performance of aircraft. To treat this...parameters. The resulting matrix of derivatives of flow quantities is referred to as the Jacobi matrix. The subsequent procedure is in principle now...employed here also results in a method which is closely related to the method of characteristics. Special account must be taken of the appearance of

Material identification based on electrostatic sensing technology

NASA Astrophysics Data System (ADS)

Liu, Kai; Chen, Xi; Li, Jingnan

2018-04-01

When the robot travels on the surface of different media, the uncertainty of the medium will seriously affect the autonomous action of the robot. In this paper, the distribution characteristics of multiple electrostatic charges on the surface of materials are detected, so as to improve the accuracy of the existing electrostatic signal material identification methods, which is of great significance to help the robot optimize the control algorithm. In this paper, based on the electrostatic signal material identification method proposed by predecessors, the multi-channel detection circuit is used to obtain the electrostatic charge distribution at different positions of the material surface, the weights are introduced into the eigenvalue matrix, and the weight distribution is optimized by the evolutionary algorithm, which makes the eigenvalue matrix more accurately reflect the surface charge distribution characteristics of the material. The matrix is used as the input of the k-Nearest Neighbor (kNN)classification algorithm to classify the dielectric materials. The experimental results show that the proposed method can significantly improve the recognition rate of the existing electrostatic signal material recognition methods.

Polymer-mediated tunneling transport between carbon nanotubes in nanocomposites.

PubMed

Derosa, Pedro A; Michalak, Tyler

2014-05-01

Electron transport in nanocomposites has attracted a good deal of attention for some time now; furthermore, the ability to control its characteristics is a necessary step in the design of multifunctional materials. When conductive nanostructures (for example carbon nanotubes) are inserted in a non-conductive matrix, electron transport below the percolation threshold is dominated by tunneling and thus the conductive characteristics of the composite depends heavily on the characteristics of the tunneling currents between nanoinserts. A parameter-free approach to study tunneling transport between carbon nanotubes across a polymer matrix is presented. The calculation is done with a combination of Density Functional Theory and Green functions (an approach heavily used in molecular electronics) which is shown here to be effective in this non-resonant transport condition. The results show that the method can effectively capture the effect of a dielectric layer in tunneling transport. The current is found to exponentially decrease with the size of the gap for both vacuum and polymer, and that the polymer layer lowers the tunneling barrier enhancing tunneling conduction. For a polyacrylonitrile matrix, a four-fold decrease in the tunneling constant, compared to tunneling in vacuum, is observed, a result that is consistent with available information. The method is very versatile as any DFT functional (or any other quantum mechanics method) can be used and thus the most accurate method for each particular system can be chosen. Furthermore as more methods become available, the calculations can be revised and improved. This approach can be used to design functional materials for fine-tunning the tunneling transport, for instance, the effect of modifying the nanoinsert-matrix interface (for example, by adding functional groups to carbon nanotubes) can be captured and the comparative performance of each interface predicted by simulation.

A comparison of matrix methods for calculating eigenvalues in acoustically lined ducts

NASA Technical Reports Server (NTRS)

Watson, W.; Lansing, D. L.

1976-01-01

Three approximate methods - finite differences, weighted residuals, and finite elements - were used to solve the eigenvalue problem which arises in finding the acoustic modes and propagation constants in an absorptively lined two-dimensional duct without airflow. The matrix equations derived for each of these methods were solved for the eigenvalues corresponding to various values of wall impedance. Two matrix orders, 20 x 20 and 40 x 40, were used. The cases considered included values of wall admittance for which exact eigenvalues were known and for which several nearly equal roots were present. Ten of the lower order eigenvalues obtained from the three approximate methods were compared with solutions calculated from the exact characteristic equation in order to make an assessment of the relative accuracy and reliability of the three methods. The best results were given by the finite element method using a cubic polynomial. Excellent accuracy was consistently obtained, even for nearly equal eigenvalues, by using a 20 x 20 order matrix.

Analysis of Spectral Features of Seawaterbiooptical Components Fluorescence from the Excitation-emission Matrix

NASA Astrophysics Data System (ADS)

Salyuk, P. A.; Nagorny, I. G.

The paper presents the method for processing of excitation-emission matrix of sea water and the allocation of the spectral characteristics of different types of colored dissolved organic matter (CDOM) and phytoplankton cells in seawater. The method consists of identification of regularly observed fluorescence peaks of CDOM in marine waters of different type and definition of the spectral ranges, where the predominant influence of these peaks are observed.

A Rapid Coordinate Transformation Method Applied in Industrial Robot Calibration Based on Characteristic Line Coincidence.

PubMed

Liu, Bailing; Zhang, Fumin; Qu, Xinghua; Shi, Xiaojia

2016-02-18

Coordinate transformation plays an indispensable role in industrial measurements, including photogrammetry, geodesy, laser 3-D measurement and robotics. The widely applied methods of coordinate transformation are generally based on solving the equations of point clouds. Despite the high accuracy, this might result in no solution due to the use of ill conditioned matrices. In this paper, a novel coordinate transformation method is proposed, not based on the equation solution but based on the geometric transformation. We construct characteristic lines to represent the coordinate systems. According to the space geometry relation, the characteristic line scan is made to coincide by a series of rotations and translations. The transformation matrix can be obtained using matrix transformation theory. Experiments are designed to compare the proposed method with other methods. The results show that the proposed method has the same high accuracy, but the operation is more convenient and flexible. A multi-sensor combined measurement system is also presented to improve the position accuracy of a robot with the calibration of the robot kinematic parameters. Experimental verification shows that the position accuracy of robot manipulator is improved by 45.8% with the proposed method and robot calibration.

A Rapid Coordinate Transformation Method Applied in Industrial Robot Calibration Based on Characteristic Line Coincidence

PubMed Central

Liu, Bailing; Zhang, Fumin; Qu, Xinghua; Shi, Xiaojia

2016-01-01

Coordinate transformation plays an indispensable role in industrial measurements, including photogrammetry, geodesy, laser 3-D measurement and robotics. The widely applied methods of coordinate transformation are generally based on solving the equations of point clouds. Despite the high accuracy, this might result in no solution due to the use of ill conditioned matrices. In this paper, a novel coordinate transformation method is proposed, not based on the equation solution but based on the geometric transformation. We construct characteristic lines to represent the coordinate systems. According to the space geometry relation, the characteristic line scan is made to coincide by a series of rotations and translations. The transformation matrix can be obtained using matrix transformation theory. Experiments are designed to compare the proposed method with other methods. The results show that the proposed method has the same high accuracy, but the operation is more convenient and flexible. A multi-sensor combined measurement system is also presented to improve the position accuracy of a robot with the calibration of the robot kinematic parameters. Experimental verification shows that the position accuracy of robot manipulator is improved by 45.8% with the proposed method and robot calibration. PMID:26901203

Conservative supra-characteristics method for splitting the hyperbolic systems of gasdynamics for real and perfect gases

NASA Technical Reports Server (NTRS)

Lombard, C. K.

1982-01-01

A conservative flux difference splitting is presented for the hyperbolic systems of gasdynamics. The stable robust method is suitable for wide application in a variety of schemes, explicit or implicit, iterative or direct, for marching in either time or space. The splitting is modeled on the local quasi one dimensional characteristics system for multi-dimensional flow similar to Chakravarthy's nonconservative split coefficient matrix method; but, as the result of maintaining global conservation, the method is able to capture sharp shocks correctly. The embedded characteristics formulation is cast in a primitive variable the volumetric internal energy (rather than the pressure) that is effective for treating real as well as perfect gases. Finally the relationship of the splitting to characteristics boundary conditions is discussed and the associated conservative matrix formulation for a computed blown wall boundary condition is developed as an example. The theoretical development employs and extends the notion of Roe of constructing stable upwind difference formulae by sending split simple one sided flux difference pieces to appropriate mesh sites. The developments are also believed to have the potential for aiding in the analysis of both existing and new conservative difference schemes.

Probabilistic homogenization of random composite with ellipsoidal particle reinforcement by the iterative stochastic finite element method

NASA Astrophysics Data System (ADS)

Sokołowski, Damian; Kamiński, Marcin

2018-01-01

This study proposes a framework for determination of basic probabilistic characteristics of the orthotropic homogenized elastic properties of the periodic composite reinforced with ellipsoidal particles and a high stiffness contrast between the reinforcement and the matrix. Homogenization problem, solved by the Iterative Stochastic Finite Element Method (ISFEM) is implemented according to the stochastic perturbation, Monte Carlo simulation and semi-analytical techniques with the use of cubic Representative Volume Element (RVE) of this composite containing single particle. The given input Gaussian random variable is Young modulus of the matrix, while 3D homogenization scheme is based on numerical determination of the strain energy of the RVE under uniform unit stretches carried out in the FEM system ABAQUS. The entire series of several deterministic solutions with varying Young modulus of the matrix serves for the Weighted Least Squares Method (WLSM) recovery of polynomial response functions finally used in stochastic Taylor expansions inherent for the ISFEM. A numerical example consists of the High Density Polyurethane (HDPU) reinforced with the Carbon Black particle. It is numerically investigated (1) if the resulting homogenized characteristics are also Gaussian and (2) how the uncertainty in matrix Young modulus affects the effective stiffness tensor components and their PDF (Probability Density Function).

Metal-matrix radiation-protective composite materials based on aluminum

NASA Astrophysics Data System (ADS)

Cherdyntsev, V. V.; Gorshenkov, M. V.; Danilov, V. D.; Kaloshkin, S. D.; Gul'bin, V. N.

2013-05-01

A method of mechanical activation providing a homogeneous distribution of reinforcing boron-bearing components and tungsten nanopowder in the matrix is recommended for making an aluminum-based radiation- protective material. Joint mechanical activation and subsequent extrusion are used to produce aluminum- based composites. The structure and the physical, mechanical and tribological characteristics of the composite materials are studied.

Spectral analysis of the UFBG-based acousto—optical modulator in V-I transmission matrix formalism

NASA Astrophysics Data System (ADS)

Wu, Liang-Ying; Pei, Li; Liu, Chao; Wang, Yi-Qun; Weng, Si-Jun; Wang, Jian-Shuai

2014-11-01

In this study, the V-I transmission matrix formalism (V-I method) is proposed to analyze the spectrum characteristics of the uniform fiber Bragg grating (FBG)-based acousto—optic modulators (UFBG-AOM). The simulation results demonstrate that both the amplitude of the acoustically induced strain and the frequency of the acoustic wave (AW) have an effect on the spectrum. Additionally, the wavelength spacing between the primary reflectivity peak and the secondary reflectivity peak is proportional to the acoustic frequency with the ratio 0.1425 nm/MHz. Meanwhile, we compare the amount of calculation. For the FBG whose period is M, the calculation of the V-I method is 4 × (2M-1) in addition/subtraction, 8 × (2M - 1) in multiply/division and 2M in exponent arithmetic, which is almost a quarter of the multi-film method and transfer matrix (TM) method. The detailed analysis indicates that, compared with the conventional multi-film method and transfer matrix (TM) method, the V-I method is faster and less complex.

Google matrix analysis of directed networks

NASA Astrophysics Data System (ADS)

Ermann, Leonardo; Frahm, Klaus M.; Shepelyansky, Dima L.

2015-10-01

In the past decade modern societies have developed enormous communication and social networks. Their classification and information retrieval processing has become a formidable task for the society. Because of the rapid growth of the World Wide Web, and social and communication networks, new mathematical methods have been invented to characterize the properties of these networks in a more detailed and precise way. Various search engines extensively use such methods. It is highly important to develop new tools to classify and rank a massive amount of network information in a way that is adapted to internal network structures and characteristics. This review describes the Google matrix analysis of directed complex networks demonstrating its efficiency using various examples including the World Wide Web, Wikipedia, software architectures, world trade, social and citation networks, brain neural networks, DNA sequences, and Ulam networks. The analytical and numerical matrix methods used in this analysis originate from the fields of Markov chains, quantum chaos, and random matrix theory.

Method of azimuthally stable Mueller-matrix diagnostics of blood plasma polycrystalline films in cancer diagnostics

NASA Astrophysics Data System (ADS)

Ushenko, Yu. A.; Prysyazhnyuk, V. P.; Gavrylyak, M. S.; Gorsky, M. P.; Bachinskiy, V. T.; Vanchuliak, O. Ya.

2015-02-01

A new information optical technique of diagnostics of the structure of polycrystalline films of blood plasma is proposed. The model of Mueller-matrix description of mechanisms of optical anisotropy of such objects as optical activity, birefringence, as well as linear and circular dichroism is suggested. The ensemble of informationally topical azimuthally stable Mueller-matrix invariants is determined. Within the statistical analysis of such parameters distributions the objective criteria of differentiation of films of blood plasma taken from healthy and patients with liver cirrhosis were determined. From the point of view of probative medicine the operational characteristics (sensitivity, specificity and accuracy) of the information-optical method of Mueller-matrix mapping of polycrystalline films of blood plasma were found and its efficiency in diagnostics of liver cirrhosis was demonstrated. Prospects of application of the method in experimental medicine to differentiate postmortem changes of the myocardial tissue was examined.

A contracting-interval program for the Danilewski method. Ph.D. Thesis - Va. Univ.

NASA Technical Reports Server (NTRS)

Harris, J. D.

1971-01-01

The concept of contracting-interval programs is applied to finding the eigenvalues of a matrix. The development is a three-step process in which (1) a program is developed for the reduction of a matrix to Hessenberg form, (2) a program is developed for the reduction of a Hessenberg matrix to colleague form, and (3) the characteristic polynomial with interval coefficients is readily obtained from the interval of colleague matrices. This interval polynomial is then factored into quadratic factors so that the eigenvalues may be obtained. To develop a contracting-interval program for factoring this polynomial with interval coefficients it is necessary to have an iteration method which converges even in the presence of controlled rounding errors. A theorem is stated giving sufficient conditions for the convergence of Newton's method when both the function and its Jacobian cannot be evaluated exactly but errors can be made proportional to the square of the norm of the difference between the previous two iterates. This theorem is applied to prove the convergence of the generalization of the Newton-Bairstow method that is used to obtain quadratic factors of the characteristic polynomial.

Detection of LSB+/-1 steganography based on co-occurrence matrix and bit plane clipping

NASA Astrophysics Data System (ADS)

Abolghasemi, Mojtaba; Aghaeinia, Hassan; Faez, Karim; Mehrabi, Mohammad Ali

2010-01-01

Spatial LSB+/-1 steganography changes smooth characteristics between adjoining pixels of the raw image. We present a novel steganalysis method for LSB+/-1 steganography based on feature vectors derived from the co-occurrence matrix in the spatial domain. We investigate how LSB+/-1 steganography affects the bit planes of an image and show that it changes more least significant bit (LSB) planes of it. The co-occurrence matrix is derived from an image in which some of its most significant bit planes are clipped. By this preprocessing, in addition to reducing the dimensions of the feature vector, the effects of embedding were also preserved. We compute the co-occurrence matrix in different directions and with different dependency and use the elements of the resulting co-occurrence matrix as features. This method is sensitive to the data embedding process. We use a Fisher linear discrimination (FLD) classifier and test our algorithm on different databases and embedding rates. We compare our scheme with the current LSB+/-1 steganalysis methods. It is shown that the proposed scheme outperforms the state-of-the-art methods in detecting the LSB+/-1 steganographic method for grayscale images.

An Illumination-Adaptive Colorimetric Measurement Using Color Image Sensor

NASA Astrophysics Data System (ADS)

Lee, Sung-Hak; Lee, Jong-Hyub; Sohng, Kyu-Ik

An image sensor for a use of colorimeter is characterized based on the CIE standard colorimetric observer. We use the method of least squares to derive a colorimetric characterization matrix between RGB output signals and CIE XYZ tristimulus values. This paper proposes an adaptive measuring method to obtain the chromaticity of colored scenes and illumination through a 3×3 camera transfer matrix under a certain illuminant. Camera RGB outputs, sensor status values, and photoelectric characteristic are used to obtain the chromaticity. Experimental results show that the proposed method is valid in the measuring performance.

Fire test method for graphite fiber reinforced plastics

NASA Technical Reports Server (NTRS)

Bowles, K. J.

1980-01-01

A potential problem in the use of graphite fiber reinforced resin matrix composites is the dispersal of graphite fibers during accidential fires. Airborne, electrically conductive fibers originating from the burning composites could enter and cause shorting in electrical equipment located in surrounding areas. A test method for assessing the burning characteristics of graphite fiber reinforced composites and the effectiveness of the composites in retaining the graphite fibers has been developed. The method utilizes a modified rate of heat release apparatus. The equipment and the testing procedure are described. The application of the test method to the assessment of composite materials is illustrated for two resin matrix/graphite composite systems.

A finite element formulation preserving symmetric and banded diffusion stiffness matrix characteristics for fractional differential equations

NASA Astrophysics Data System (ADS)

Lin, Zeng; Wang, Dongdong

2017-10-01

Due to the nonlocal property of the fractional derivative, the finite element analysis of fractional diffusion equation often leads to a dense and non-symmetric stiffness matrix, in contrast to the conventional finite element formulation with a particularly desirable symmetric and banded stiffness matrix structure for the typical diffusion equation. This work first proposes a finite element formulation that preserves the symmetry and banded stiffness matrix characteristics for the fractional diffusion equation. The key point of the proposed formulation is the symmetric weak form construction through introducing a fractional weight function. It turns out that the stiffness part of the present formulation is identical to its counterpart of the finite element method for the conventional diffusion equation and thus the stiffness matrix formulation becomes trivial. Meanwhile, the fractional derivative effect in the discrete formulation is completely transferred to the force vector, which is obviously much easier and efficient to compute than the dense fractional derivative stiffness matrix. Subsequently, it is further shown that for the general fractional advection-diffusion-reaction equation, the symmetric and banded structure can also be maintained for the diffusion stiffness matrix, although the total stiffness matrix is not symmetric in this case. More importantly, it is demonstrated that under certain conditions this symmetric diffusion stiffness matrix formulation is capable of producing very favorable numerical solutions in comparison with the conventional non-symmetric diffusion stiffness matrix finite element formulation. The effectiveness of the proposed methodology is illustrated through a series of numerical examples.

Three-dimensional ordered particulate structures: Method to retrieve characteristics from photonic band gap data

NASA Astrophysics Data System (ADS)

Miskevich, Alexander A.; Loiko, Valery A.

2015-01-01

A method to retrieve characteristics of ordered particulate structures, such as photonic crystals, is proposed. It is based on the solution of the inverse problem using data on the photonic band gap (PBG). The quasicrystalline approximation (QCA) of the theory of multiple scattering of waves and the transfer matrix method (TMM) are used. Retrieval of the refractive index of particles is demonstrated. Refractive indices of the artificial opal particles are estimated using the published experimental data.

Large-diameter carbon-composite monofilaments. [production method and characteristics of carbon composite monofilaments

NASA Technical Reports Server (NTRS)

Bradshaw, W. G.; Pinoli, P. C.; Karlak, R. F.

1974-01-01

Large-diameter carbon composite monofilaments with high strength and high modulus were produced by pregging multifiber carbon bundles with suitable organic resins and pyrolysing them together. Two approaches were developed to increase the utilization of fiber tensile strength by minimizing stress concentration defects induced by dissimilar shrinkage during pyrolysis. These were matrix modification to improve char yield and strain-to-failure and fiber-matrix copyrolysis to alleviate matrix cracking. Highest tensile strength and modulus were obtained by heat treatments to 2873 K to match fiber and matrix strain-to-failure and develop maximum monofilament tensile-strength and elastic modulus.

Analytical development of disturbed matrix eigenvalue problem applied to mixed convection stability analysis in Darcy media

NASA Astrophysics Data System (ADS)

Hamed, Haikel Ben; Bennacer, Rachid

2008-08-01

This work consists in evaluating algebraically and numerically the influence of a disturbance on the spectral values of a diagonalizable matrix. Thus, two approaches will be possible; to use the theorem of disturbances of a matrix depending on a parameter, due to Lidskii and primarily based on the structure of Jordan of the no disturbed matrix. The second approach consists in factorizing the matrix system, and then carrying out a numerical calculation of the roots of the disturbances matrix characteristic polynomial. This problem can be a standard model in the equations of the continuous media mechanics. During this work, we chose to use the second approach and in order to illustrate the application, we choose the Rayleigh-Bénard problem in Darcy media, disturbed by a filtering through flow. The matrix form of the problem is calculated starting from a linear stability analysis by a finite elements method. We show that it is possible to break up the general phenomenon into other elementary ones described respectively by a disturbed matrix and a disturbance. A good agreement between the two methods was seen. To cite this article: H.B. Hamed, R. Bennacer, C. R. Mecanique 336 (2008).

Jones matrix polarization-correlation mapping of biological crystals networks

NASA Astrophysics Data System (ADS)

Ushenko, O. G.; Ushenko, Yu. O.; Pidkamin, L. Y.; Sidor, M. I.; Vanchuliak, O.; Motrich, A. V.; Gorsky, M. P.; Meglinskiy, I.; Marchuk, Yu. F.

2017-08-01

It has been proposed the optical model of Jones-matrix description of mechanisms of optical anisotropy of polycrystalline films of human bile, namely optical activity and birefringence. The algorithm of reconstruction of distributions of parameters - optical rotation angles and phase shifts of the indicated anisotropy types has been elaborated. The objective criteria of differentiation of bile films taken from healthy donors and patients with cholelithiasis by means of statistic analysis of such distributions have been determined. The operational characteristics (sensitivity, specificity and accuracy) of Jones-matrix reconstruction method of optical anisotropy parameters were defined.

A nonlinear quality-related fault detection approach based on modified kernel partial least squares.

PubMed

Jiao, Jianfang; Zhao, Ning; Wang, Guang; Yin, Shen

2017-01-01

In this paper, a new nonlinear quality-related fault detection method is proposed based on kernel partial least squares (KPLS) model. To deal with the nonlinear characteristics among process variables, the proposed method maps these original variables into feature space in which the linear relationship between kernel matrix and output matrix is realized by means of KPLS. Then the kernel matrix is decomposed into two orthogonal parts by singular value decomposition (SVD) and the statistics for each part are determined appropriately for the purpose of quality-related fault detection. Compared with relevant existing nonlinear approaches, the proposed method has the advantages of simple diagnosis logic and stable performance. A widely used literature example and an industrial process are used for the performance evaluation for the proposed method. Copyright © 2016 ISA. Published by Elsevier Ltd. All rights reserved.

A revised version of the transfer matrix method to analyze one-dimensional structures

NASA Technical Reports Server (NTRS)

Nitzsche, F.

1983-01-01

A new and general method to analyze both free and forced vibration characteristics of one-dimensional structures is discussed in this paper. This scheme links for the first time the classical transfer matrix method with the recently developed integrating matrix technique to integrate systems of differential equations. Two alternative approaches to the problem are presented. The first is based upon the lumped parameter model to account for the inertia properties of the structure. The second releases that constraint allowing a more precise description of the physical system. The free vibration of a straight uniform beam under different support conditions is analyzed to test the accuracy of the two models. Finally some results for the free vibration of a 12th order system representing a curved, rotating beam prove that the present method is conveniently extended to more complicated structural dynamics problems.

Model correlation and damage location for large space truss structures: Secant method development and evaluation

NASA Technical Reports Server (NTRS)

Smith, Suzanne Weaver; Beattie, Christopher A.

1991-01-01

On-orbit testing of a large space structure will be required to complete the certification of any mathematical model for the structure dynamic response. The process of establishing a mathematical model that matches measured structure response is referred to as model correlation. Most model correlation approaches have an identification technique to determine structural characteristics from the measurements of the structure response. This problem is approached with one particular class of identification techniques - matrix adjustment methods - which use measured data to produce an optimal update of the structure property matrix, often the stiffness matrix. New methods were developed for identification to handle problems of the size and complexity expected for large space structures. Further development and refinement of these secant-method identification algorithms were undertaken. Also, evaluation of these techniques is an approach for model correlation and damage location was initiated.

Morphology and dispersion of FeCo alloy nanoparticles dispersed in a matrix of IR pyrolized polyvinyl alcohol

NASA Astrophysics Data System (ADS)

Vasilev, A. A.; Dzidziguri, E. L.; Muratov, D. G.; Zhilyaeva, N. A.; Efimov, M. N.; Karpacheva, G. P.

2018-04-01

Metal-carbon nanocomposites consisting of FeCo alloy nanoparticles dispersed in a carbon matrix were synthesized by the thermal decomposition method of a precursor based on polyvinyl alcohol and metals salts. The synthesized powders were investigated by X-ray diffraction (XRD), X-ray fluorescent spectrometry (XRFS), transmission electron microscopy (TEM) and scanning electron microscopy (SEM). Surface characteristics of materials were measured by BET-method. The morphology and dispersity of metal nanoparticles were studied depending on the metals ratio in the composite.

Photoluminescence from trivalent-cerium-doped silica glass prepared by sol-gel method with aluminum co-dopant

NASA Astrophysics Data System (ADS)

Tokumitsu, Seika; Murakami, Yukon; Oda, Hisaya; Kawabe, Yutaka

2018-01-01

Trivalent cerium is an important luminescent center giving light emission in short wavelength region depending on host materials. Sol-gel formed silica glass is an ideal matrix due to its high transparency, robustness, and low-temperature processability, but the emission from cerium in silica matrix is often mixed up with that from defects in the matrix, making it difficult to obtain well-determined characteristics. Bright emission from Ce ions peaking at about 400 nm was observed in sol-gel silica glasses synthesized with aluminum co-dopant. From luminescence decay time, the origin was confirmed to be d-f transition in trivalent Ce. From dependence of emission characteristics and UV absorbance on aluminum concentration, it was found that the co-dopant plays an important role to convert the optically inactive tetravalent ions to emissive trivalent state.

Combined micromechanical and fabrication process optimization for metal-matrix composites

NASA Technical Reports Server (NTRS)

Morel, M.; Saravanos, D. A.; Chamis, C. C.

1991-01-01

A method is presented to minimize the residual matrix stresses in metal matrix composites. Fabrication parameters such as temperature and consolidation pressure are optimized concurrently with the characteristics (i.e., modulus, coefficient of thermal expansion, strength, and interphase thickness) of a fiber-matrix interphase. By including the interphase properties in the fabrication process, lower residual stresses are achievable. Results for an ultra-high modulus graphite (P100)/copper composite show a reduction of 21 percent for the maximum matrix microstress when optimizing the fabrication process alone. Concurrent optimization of the fabrication process and interphase properties show a 41 percent decrease in the maximum microstress. Therefore, this optimization method demonstrates the capability of reducing residual microstresses by altering the temperature and consolidation pressure histories and tailoring the interphase properties for an improved composite material. In addition, the results indicate that the consolidation pressures are the most important fabrication parameters, and the coefficient of thermal expansion is the most critical interphase property.

Concurrent micromechanical tailoring and fabrication process optimization for metal-matrix composites

NASA Technical Reports Server (NTRS)

Morel, M.; Saravanos, D. A.; Chamis, Christos C.

1990-01-01

A method is presented to minimize the residual matrix stresses in metal matrix composites. Fabrication parameters such as temperature and consolidation pressure are optimized concurrently with the characteristics (i.e., modulus, coefficient of thermal expansion, strength, and interphase thickness) of a fiber-matrix interphase. By including the interphase properties in the fabrication process, lower residual stresses are achievable. Results for an ultra-high modulus graphite (P100)/copper composite show a reduction of 21 percent for the maximum matrix microstress when optimizing the fabrication process alone. Concurrent optimization of the fabrication process and interphase properties show a 41 percent decrease in the maximum microstress. Therefore, this optimization method demonstrates the capability of reducing residual microstresses by altering the temperature and consolidation pressure histories and tailoring the interphase properties for an improved composite material. In addition, the results indicate that the consolidation pressures are the most important fabrication parameters, and the coefficient of thermal expansion is the most critical interphase property.

Sequential design of discrete linear quadratic regulators via optimal root-locus techniques

NASA Technical Reports Server (NTRS)

Shieh, Leang S.; Yates, Robert E.; Ganesan, Sekar

1989-01-01

A sequential method employing classical root-locus techniques has been developed in order to determine the quadratic weighting matrices and discrete linear quadratic regulators of multivariable control systems. At each recursive step, an intermediate unity rank state-weighting matrix that contains some invariant eigenvectors of that open-loop matrix is assigned, and an intermediate characteristic equation of the closed-loop system containing the invariant eigenvalues is created.

Fire test method for graphite fiber reinforced plastics

NASA Technical Reports Server (NTRS)

Bowles, K. J.

1980-01-01

A potential problem in the use of graphite fiber reinforced resin matrix composites is the dispersal of graphite fibers during accidental fires. Airborne, electrically conductive fibers originating from the burning composites could enter and cause shorting in electrical equipment located in surrounding areas. A test method for assessing the burning characteristics of graphite fiber reinforced composites and the effectiveness of the composites in retaining the graphite fibers has been developed. The method utilizes a modified Ohio State University Rate of Heat Release apparatus. The equipment and the testing procedure are described. The application of the test method to the assessment of composite materials is illustrated for two resin matrix/graphite composite systems.

E-Beam Processing of Polymer Matrix Composites for Multifunctional Radiation Shielding

NASA Technical Reports Server (NTRS)

Hou, Tan-Hung; Wilson, John W.; Jensen, Brian J.; Thibeault, Sheila A.; Chang, Chie K.; Kiefer, Richard L.

2005-01-01

Aliphatic polymers were identified as optimum radiation shielding polymeric materials for building multifunctional structural elements for in-space habitats. Conceptual damage tolerant configurations of polyolefins have been proposed, but many manufacturing issues relied on methods and materials which have sub-optimal radiation shielding characteristics (for example, epoxy matrix and adhesives). In the present approach, we shall investigate e-beam processing technologies for inclusion of high-strength aliphatic polymer reinforcement structures into a highly cross-linked polyolefin matrix. This paper reports the baseline thermo-mechanical properties of low density polyethylene and highly crystallized polyethylene.

Modeling cometary photopolarimetric characteristics with Sh-matrix method

NASA Astrophysics Data System (ADS)

Kolokolova, L.; Petrov, D.

2017-12-01

Cometary dust is dominated by particles of complex shape and structure, which are often considered as fractal aggregates. Rigorous modeling of light scattering by such particles, even using parallelized codes and NASA supercomputer resources, is very computer time and memory consuming. We are presenting a new approach to modeling cometary dust that is based on the Sh-matrix technique (e.g., Petrov et al., JQSRT, 112, 2012). This method is based on the T-matrix technique (e.g., Mishchenko et al., JQSRT, 55, 1996) and was developed after it had been found that the shape-dependent factors could be separated from the size- and refractive-index-dependent factors and presented as a shape matrix, or Sh-matrix. Size and refractive index dependences are incorporated through analytical operations on the Sh-matrix to produce the elements of T-matrix. Sh-matrix method keeps all advantages of the T-matrix method, including analytical averaging over particle orientation. Moreover, the surface integrals describing the Sh-matrix elements themselves can be solvable analytically for particles of any shape. This makes Sh-matrix approach an effective technique to simulate light scattering by particles of complex shape and surface structure. In this paper, we present cometary dust as an ensemble of Gaussian random particles. The shape of these particles is described by a log-normal distribution of their radius length and direction (Muinonen, EMP, 72, 1996). Changing one of the parameters of this distribution, the correlation angle, from 0 to 90 deg., we can model a variety of particles from spheres to particles of a random complex shape. We survey the angular and spectral dependencies of intensity and polarization resulted from light scattering by such particles, studying how they depend on the particle shape, size, and composition (including porous particles to simulate aggregates) to find the best fit to the cometary observations.

Damping characterization in large structures

NASA Technical Reports Server (NTRS)

Eke, Fidelis O.; Eke, Estelle M.

1991-01-01

This research project has as its main goal the development of methods for selecting the damping characteristics of components of a large structure or multibody system, in such a way as to produce some desired system damping characteristics. The main need for such an analytical device is in the simulation of the dynamics of multibody systems consisting, at least partially, of flexible components. The reason for this need is that all existing simulation codes for multibody systems require component-by-component characterization of complex systems, whereas requirements (including damping) often appear at the overall system level. The main goal was met in large part by the development of a method that will in fact synthesize component damping matrices from a given system damping matrix. The restrictions to the method are that the desired system damping matrix must be diagonal (which is almost always the case) and that interbody connections must be by simple hinges. In addition to the technical outcome, this project contributed positively to the educational and research infrastructure of Tuskegee University - a Historically Black Institution.

An O(log sup 2 N) parallel algorithm for computing the eigenvalues of a symmetric tridiagonal matrix

NASA Technical Reports Server (NTRS)

Swarztrauber, Paul N.

1989-01-01

An O(log sup 2 N) parallel algorithm is presented for computing the eigenvalues of a symmetric tridiagonal matrix using a parallel algorithm for computing the zeros of the characteristic polynomial. The method is based on a quadratic recurrence in which the characteristic polynomial is constructed on a binary tree from polynomials whose degree doubles at each level. Intervals that contain exactly one zero are determined by the zeros of polynomials at the previous level which ensures that different processors compute different zeros. The exact behavior of the polynomials at the interval endpoints is used to eliminate the usual problems induced by finite precision arithmetic.

A new decentralised controller design method for a class of strongly interconnected systems

NASA Astrophysics Data System (ADS)

Duan, Zhisheng; Jiang, Zhong-Ping; Huang, Lin

2017-02-01

In this paper, two interconnected structures are first discussed, under which some closed-loop subsystems must be unstable to make the whole interconnected system stable, which can be viewed as a kind of strongly interconnected systems. Then, comparisons with small gain theorem are discussed and large gain interconnected characteristics are shown. A new approach for the design of decentralised controllers is presented by determining the Lyapunov function structure previously, which allows the existence of unstable subsystems. By fully utilising the orthogonal space information of input matrix, some new understandings are presented for the construction of Lyapunov matrix. This new method can deal with decentralised state feedback, static output feedback and dynamic output feedback controllers in a unified framework. Furthermore, in order to reduce the design conservativeness and deal with robustness, a new robust decentralised controller design method is given by combining with the parameter-dependent Lyapunov function method. Some basic rules are provided for the choice of initial variables in Lyapunov matrix or new introduced slack matrices. As byproducts, some linear matrix inequality based sufficient conditions are established for centralised static output feedback stabilisation. Effects of unstable subsystems in nonlinear Lur'e systems are further discussed. The corresponding decentralised controller design method is presented for absolute stability. The examples illustrate that the new method is significantly effective.

Simulation analysis of impulse characteristics of space debris irradiated by multi-pulse laser

NASA Astrophysics Data System (ADS)

Lin, Zhengguo; Jin, Xing; Chang, Hao; You, Xiangyu

2018-02-01

Cleaning space debris with laser is a hot topic in the field of space security research. Impulse characteristics are the basis of cleaning space debris with laser. In order to study the impulse characteristics of rotating irregular space debris irradiated by multi-pulse laser, the impulse calculation method of rotating space debris irradiated by multi-pulse laser is established based on the area matrix method. The calculation method of impulse and impulsive moment under multi-pulse irradiation is given. The calculation process of total impulse under multi-pulse irradiation is analyzed. With a typical non-planar space debris (cube) as example, the impulse characteristics of space debris irradiated by multi-pulse laser are simulated and analyzed. The effects of initial angular velocity, spot size and pulse frequency on impulse characteristics are investigated.

Rolling Element Bearing Stiffness Matrix Determination (Presentation)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Guo, Y.; Parker, R.

2014-01-01

Current theoretical bearing models differ in their stiffness estimates because of different model assumptions. In this study, a finite element/contact mechanics model is developed for rolling element bearings with the focus of obtaining accurate bearing stiffness for a wide range of bearing types and parameters. A combined surface integral and finite element method is used to solve for the contact mechanics between the rolling elements and races. This model captures the time-dependent characteristics of the bearing contact due to the orbital motion of the rolling elements. A numerical method is developed to determine the full bearing stiffness matrix corresponding tomore » two radial, one axial, and two angular coordinates; the rotation about the shaft axis is free by design. This proposed stiffness determination method is validated against experiments in the literature and compared to existing analytical models and widely used advanced computational methods. The fully-populated stiffness matrix demonstrates the coupling between bearing radial, axial, and tilting bearing deflections.« less

Linear and nonlinear dynamic analysis of redundant load path bearingless rotor systems

NASA Technical Reports Server (NTRS)

Murthy, V. R.

1985-01-01

The bearingless rotorcraft offers reduced weight, less complexity and superior flying qualities. Almost all the current industrial structural dynamic programs of conventional rotors which consist of single load path rotor blades employ the transfer matrix method to determine natural vibration characteristics because this method is ideally suited for one dimensional chain like structures. This method is extended to multiple load path rotor blades without resorting to an equivalent single load path approximation. Unlike the conventional blades, it isk necessary to introduce the axial-degree-of-freedom into the solution process to account for the differential axial displacements in the different load paths. With the present extension, the current rotor dynamic programs can be modified with relative ease to account for the multiple load paths without resorting to the equivalent single load path modeling. The results obtained by the transfer matrix method are validated by comparing with the finite element solutions. A differential stiffness matrix due to blade rotation is derived to facilitate the finite element solutions.

Method for preparing polyolefin composites containing a phase change material

DOEpatents

Salyer, Ival O.

1990-01-01

A composite useful in thermal energy storage, said composite being formed of a polyolefin matrix having a phase change material such as a crystalline alkyl hydrocarbon incorporated therein. The composite is useful in forming pellets, sheets or fibers having thermal energy storage characteristics; methods for forming the composite are also disclosed.

Distance learning in discriminative vector quantization.

PubMed

Schneider, Petra; Biehl, Michael; Hammer, Barbara

2009-10-01

Discriminative vector quantization schemes such as learning vector quantization (LVQ) and extensions thereof offer efficient and intuitive classifiers based on the representation of classes by prototypes. The original methods, however, rely on the Euclidean distance corresponding to the assumption that the data can be represented by isotropic clusters. For this reason, extensions of the methods to more general metric structures have been proposed, such as relevance adaptation in generalized LVQ (GLVQ) and matrix learning in GLVQ. In these approaches, metric parameters are learned based on the given classification task such that a data-driven distance measure is found. In this letter, we consider full matrix adaptation in advanced LVQ schemes. In particular, we introduce matrix learning to a recent statistical formalization of LVQ, robust soft LVQ, and we compare the results on several artificial and real-life data sets to matrix learning in GLVQ, a derivation of LVQ-like learning based on a (heuristic) cost function. In all cases, matrix adaptation allows a significant improvement of the classification accuracy. Interestingly, however, the principled behavior of the models with respect to prototype locations and extracted matrix dimensions shows several characteristic differences depending on the data sets.

General algebraic method applied to control analysis of complex engine types

NASA Technical Reports Server (NTRS)

Boksenbom, Aaron S; Hood, Richard

1950-01-01

A general algebraic method of attack on the problem of controlling gas-turbine engines having any number of independent variables was utilized employing operational functions to describe the assumed linear characteristics for the engine, the control, and the other units in the system. Matrices were used to describe the various units of the system, to form a combined system showing all effects, and to form a single condensed matrix showing the principal effects. This method directly led to the conditions on the control system for noninteraction so that any setting disturbance would affect only its corresponding controlled variable. The response-action characteristics were expressed in terms of the control system and the engine characteristics. The ideal control-system characteristics were explicitly determined in terms of any desired response action.

Method of determining lanthanidies in a transition element host

DOEpatents

De Kalb, Edward L.; Fassel, Velmer A.

1976-02-03

A phosphor composition contains a lanthanide activator element within a host matrix having a transition element as a major component. The host matrix is composed of certain rare earth phosphates or vanadates such as YPO.sub.4 with a portion of the rare earth replaced with one or more of the transition elements. On X-ray or other electromagnetic excitation, trace lanthanide impurities or additives within the phosphor are spectrometrically determined from their characteristic luminescence.

Addressable test matrix for measuring analog transfer characteristics of test elements used for integrated process control and device evaluation

NASA Technical Reports Server (NTRS)

Buehler, Martin G. (Inventor)

1988-01-01

A set of addressable test structures, each of which uses addressing schemes to access individual elements of the structure in a matrix, is used to test the quality of a wafer before integrated circuits produced thereon are diced, packaged and subjected to final testing. The electrical characteristic of each element is checked and compared to the electrical characteristic of all other like elements in the matrix. The effectiveness of the addressable test matrix is in readily analyzing the electrical characteristics of the test elements and in providing diagnostic information.

Effect of HPMC - E15 LV premium polymer on release profile and compression characteristics of chitosan/ pectin colon targeted mesalamine matrix tablets and in vitro study on effect of pH impact on the drug release profile.

PubMed

Newton, A M J; Lakshmanan, Prabakaran

2014-04-01

The study was designed to investigate the in vitro dissolution profile and compression characteristics of colon targeted matrix tablets prepared with HPMC E15 LV in combination with pectin and Chitosan. The matrix tablets were subjected to two dissolution models in various simulated fluids such as pH 1.2, 6, 6.8, 7.2, 5.5. The fluctuations in colonic pH conditions during IBD (inflammatory bowel disease) and the nature of less fluid content in the colon may limit the expected drug release in the polysaccharide-based matrices when used alone. The Hydrophilic hydroxyl propyl methylcellulose ether premium polymer (HPMC E15 LV) of low viscosity grade was used in the formulation design, which made an excellent modification in physical and compression characteristics of the granules. The release studies indicated that the prepared matrices could control the drug release until the dosage form reaches the colon and the addition HPMC E15 LV showed the desirable changes in the dissolution profile by its hydrophilic nature since the colon is known for its less fluid content. The hydrophilic HPMC E15 LV allowed the colonic fluids to enter into the matrix and confirmed the drug release at the target site from a poorly water soluble polymer such as Chitosan and also from water soluble Pectin. The dramatic changes occurred in the drug release profile and physicochemical characteristics of the Pectin, Chitosan matrix tablets when a premium polymer HPMC E15 LV added in the formulation design in the optimized concentration. Various drug release mechanisms used for the examination of drug release characteristics. Drug release followed the combined mechanism of diffusion, erosion, swelling and polymer entanglement. In recent decade, IBD attracts many patents in novel treatment methods by using novel drug delivery systems.

Critical speeds and forced response solutions for active magnetic bearing turbomachinery, part 2

NASA Technical Reports Server (NTRS)

Rawal, D.; Keesee, J.; Kirk, R. Gordon

1991-01-01

The need for better performance of turbomachinery with active magnetic bearings has necessitated a study of such systems for accurate prediction of their vibrational characteristics. A modification of existing transfer matrix methods for rotor analysis is presented to predict the response of rotor systems with active magnetic bearings. The position of the magnetic bearing sensors is taken into account and the effect of changing sensor position on the vibrational characteristics of the rotor system is studied. The modified algorithm is validated using a simpler Jeffcott model described previously. The effect of changing from a rotating unbalance excitation to a constant excitation in a single plane is also studied. A typical eight stage centrifugal compressor rotor is analyzed using the modified transfer matrix code. The results for a two mass Jeffcott model were presented previously. The results obtained by running this model with the transfer matrix method were compared with the results of the Jeffcott analysis for the purposes of verification. Also included are plots of amplitude versus frequency for the eight stage centrifugal compressor rotor. These plots demonstrate the significant influence that sensor location has on the amplitude and critical frequencies of the rotor system.

Multi-energy CT based on a prior rank, intensity and sparsity model (PRISM).

PubMed

Gao, Hao; Yu, Hengyong; Osher, Stanley; Wang, Ge

2011-11-01

We propose a compressive sensing approach for multi-energy computed tomography (CT), namely the prior rank, intensity and sparsity model (PRISM). To further compress the multi-energy image for allowing the reconstruction with fewer CT data and less radiation dose, the PRISM models a multi-energy image as the superposition of a low-rank matrix and a sparse matrix (with row dimension in space and column dimension in energy), where the low-rank matrix corresponds to the stationary background over energy that has a low matrix rank, and the sparse matrix represents the rest of distinct spectral features that are often sparse. Distinct from previous methods, the PRISM utilizes the generalized rank, e.g., the matrix rank of tight-frame transform of a multi-energy image, which offers a way to characterize the multi-level and multi-filtered image coherence across the energy spectrum. Besides, the energy-dependent intensity information can be incorporated into the PRISM in terms of the spectral curves for base materials, with which the restoration of the multi-energy image becomes the reconstruction of the energy-independent material composition matrix. In other words, the PRISM utilizes prior knowledge on the generalized rank and sparsity of a multi-energy image, and intensity/spectral characteristics of base materials. Furthermore, we develop an accurate and fast split Bregman method for the PRISM and demonstrate the superior performance of the PRISM relative to several competing methods in simulations.

Toward active-matrix lab-on-a-chip: programmable electrofluidic control enabled by arrayed oxide thin film transistors.

PubMed

Noh, Joo Hyon; Noh, Jiyong; Kreit, Eric; Heikenfeld, Jason; Rack, Philip D

2012-01-21

Agile micro- and nano-fluidic control is critical to numerous life science and chemical science synthesis as well as kinetic and thermodynamic studies. To this end, we have demonstrated the use of thin film transistor arrays as an active matrix addressing method to control an electrofluidic array. Because the active matrix method minimizes the number of control lines necessary (m + n lines for the m×n element array), the active matrix addressing method integrated with an electrofluidic platform can be a significant breakthrough for complex electrofluidic arrays (increased size or resolution) with enhanced function, agility and programmability. An amorphous indium gallium zinc oxide (a-IGZO) semiconductor active layer is used because of its high mobility of 1-15 cm(2) V(-1) s(-1), low-temperature processing and transparency for potential spectroscopy and imaging. Several electrofluidic functionalities are demonstrated using a simple 2 × 5 electrode array connected to a 2 × 5 IGZO thin film transistor array with the semiconductor channel width of 50 μm and mobility of 6.3 cm(2) V(-1) s(-1). Additionally, using the TFT device characteristics, active matrix addressing schemes are discussed as the geometry of the electrode array can be tailored to act as a storage capacitor element. Finally, requisite material and device parameters are discussed in context with a VGA scale active matrix addressed electrofluidic platform.

A Novel Hyperbolization Procedure for The Two-Phase Six-Equation Flow Model

DOE Office of Scientific and Technical Information (OSTI.GOV)

Samet Y. Kadioglu; Robert Nourgaliev; Nam Dinh

2011-10-01

We introduce a novel approach for the hyperbolization of the well-known two-phase six equation flow model. The six-equation model has been frequently used in many two-phase flow applications such as bubbly fluid flows in nuclear reactors. One major drawback of this model is that it can be arbitrarily non-hyperbolic resulting in difficulties such as numerical instability issues. Non-hyperbolic behavior can be associated with complex eigenvalues that correspond to characteristic matrix of the system. Complex eigenvalues are often due to certain flow parameter choices such as the definition of inter-facial pressure terms. In our method, we prevent the characteristic matrix receivingmore » complex eigenvalues by fine tuning the inter-facial pressure terms with an iterative procedure. In this way, the characteristic matrix possesses all real eigenvalues meaning that the characteristic wave speeds are all real therefore the overall two-phase flowmodel becomes hyperbolic. The main advantage of this is that one can apply less diffusive highly accurate high resolution numerical schemes that often rely on explicit calculations of real eigenvalues. We note that existing non-hyperbolic models are discretized mainly based on low order highly dissipative numerical techniques in order to avoid stability issues.« less

Polarization-correlation analysis of maps of optical anisotropy biological layers

NASA Astrophysics Data System (ADS)

Ushenko, Yu. A.; Dubolazov, A. V.; Prysyazhnyuk, V. S.; Marchuk, Y. F.; Pashkovskaya, N. V.; Motrich, A. V.; Novakovskaya, O. Y.

2014-08-01

A new information optical technique of diagnostics of the structure of polycrystalline films of bile is proposed. The model of Mueller-matrix description of mechanisms of optical anisotropy of such objects as optical activity, birefringence, as well as linear and circular dichroism is suggested. The ensemble of informationally topical azimuthally stable Mueller-matrix invariants is determined. Within the statistical analysis of such parameters distributions the objective criteria of differentiation of films of bile taken from healthy donors and diabetes of type 2 were determined. From the point of view of probative medicine the operational characteristics (sensitivity, specificity and accuracy) of the information-optical method of Mueller-matrix mapping of polycrystalline films of bile were found and its efficiency in diagnostics of diabetes extent of type 2 was demonstrated. Considered prospects of applying this method in the diagnosis of cirrhosis.

A quasi steady state method for solving transient Darcy flow in complex 3D fractured networks accounting for matrix to fracture flow

NASA Astrophysics Data System (ADS)

Nœtinger, B.

2015-02-01

Modeling natural Discrete Fracture Networks (DFN) receives more and more attention in applied geosciences, from oil and gas industry, to geothermal recovery and aquifer management. The fractures may be either natural, or artificial in case of well stimulation. Accounting for the flow inside the fracture network, and accounting for the transfers between the matrix and the fractures, with the same level of accuracy is an important issue for calibrating the well architecture and for setting up optimal resources recovery strategies. Recently, we proposed an original method allowing to model transient pressure diffusion in the fracture network only [1]. The matrix was assumed to be impervious. A systematic approximation scheme was built, allowing to model the initial DFN by a set of N unknowns located at each identified intersection between fractures. The higher N, the higher the accuracy of the model. The main assumption was using a quasi steady state hypothesis, that states that the characteristic diffusion time over one single fracture is negligible compared with the characteristic time of the macroscopic problem, e.g. change of boundary conditions. In that context, the lowest order approximation N = 1 has the form of solving a transient problem in a resistor/capacitor network, a so-called pipe network. Its topology is the same as the network of geometrical intersections between fractures. In this paper, we generalize this approach in order to account for fluxes from matrix to fractures. The quasi steady state hypothesis at the fracture level is still kept. Then, we show that in the case of well separated time scales between matrix and fractures, the preceding model needs only to be slightly modified in order to incorporate these fluxes. The additional knowledge of the so-called matrix to fracture transfer function allows to modify the mass matrix that becomes a time convolution operator. This is reminiscent of existing space averaged transient dual porosity models.

Activated phosphors having matrices of yttrium-transition metal compound

DOEpatents

De Kalb, E.L.; Fassel, V.A.

1975-07-01

A method is described for preparing a phosphor composition containing a lanthanide activator element with a host matrix having a transition element as a major component. The host matrix is composed of certain rare earth phosphates or vanadates such as YPO$sub 4$ with a portion of the rare earth replaced with one or more of the transition elements. On x-ray or other electromagnetic excitation, trace lanthanide impurities or additives within the phosphor are spectrometrically determined from their characteristic luminescence. (auth)

Pressure vessel with improved impact resistance and method of making the same

NASA Technical Reports Server (NTRS)

DeLay, Thomas K. (Inventor); Patterson, James E. (Inventor); Olson, Michael A. (Inventor)

2010-01-01

A composite overwrapped pressure vessel is provided which includes a composite overwrapping material including fibers disposed in a resin matrix. At least first and second kinds of fibers are used. These fibers typically have characteristics of high strength and high toughness to provide impact resistance with increased pressure handling capability and low weight. The fibers are applied to form a pressure vessel using wrapping or winding techniques with winding angles varied for specific performance characteristics. The fibers of different kinds are dispersed in a single layer of winding or wound in distinct separate layers. Layers of fabric comprised of such fibers are interspersed between windings for added strength or impact resistance. The weight percentages of the high toughness and high strength materials are varied to provide specified impact resistance characteristics. The resin matrix is formed with prepregnated fibers or through wet winding. The vessels are formed with or without liners.

Transmittance properties of one dimensional ternary nanocomposite photonic crystals

NASA Astrophysics Data System (ADS)

Elsayed, Hussein A.

2018-03-01

In the present work, we have theoretically investigated the transmittance characteristics of one dimensional ternary photonic crystals that containing a nanocomposite layer. The nanocomposite layer was designed from metallic nanoparticles of (Ag) in a transparent matrix of a dielectric material (MgF2). The numerical results are obtained based on the theoretical modeling of the characteristic matrix method and Maxwell-Garnett model. The investigated results demonstrate the significant effect of the volume fraction of the nanoparticles on the effective permittivity of the nanocomposite material as well as the transmission characteristics of our design. Moreover, the roles played by other parameters such as the thickness of the nanocomposite layer, the permittivity of the host dielectric material and the spherical radius of the nanoparticles are included her. The proposed structure could be promising for many applications such as THz optical filters, reflectors and optical switches.

A spectral tau algorithm based on Jacobi operational matrix for numerical solution of time fractional diffusion-wave equations

NASA Astrophysics Data System (ADS)

Bhrawy, A. H.; Doha, E. H.; Baleanu, D.; Ezz-Eldien, S. S.

2015-07-01

In this paper, an efficient and accurate spectral numerical method is presented for solving second-, fourth-order fractional diffusion-wave equations and fractional wave equations with damping. The proposed method is based on Jacobi tau spectral procedure together with the Jacobi operational matrix for fractional integrals, described in the Riemann-Liouville sense. The main characteristic behind this approach is to reduce such problems to those of solving systems of algebraic equations in the unknown expansion coefficients of the sought-for spectral approximations. The validity and effectiveness of the method are demonstrated by solving five numerical examples. Numerical examples are presented in the form of tables and graphs to make comparisons with the results obtained by other methods and with the exact solutions more easier.

Error analysis applied to several inversion techniques used for the retrieval of middle atmospheric constituents from limb-scanning MM-wave spectroscopic measurements

NASA Technical Reports Server (NTRS)

Puliafito, E.; Bevilacqua, R.; Olivero, J.; Degenhardt, W.

1992-01-01

The formal retrieval error analysis of Rodgers (1990) allows the quantitative determination of such retrieval properties as measurement error sensitivity, resolution, and inversion bias. This technique was applied to five numerical inversion techniques and two nonlinear iterative techniques used for the retrieval of middle atmospheric constituent concentrations from limb-scanning millimeter-wave spectroscopic measurements. It is found that the iterative methods have better vertical resolution, but are slightly more sensitive to measurement error than constrained matrix methods. The iterative methods converge to the exact solution, whereas two of the matrix methods under consideration have an explicit constraint, the sensitivity of the solution to the a priori profile. Tradeoffs of these retrieval characteristics are presented.

Driving Method for Compensating Reliability Problem of Hydrogenated Amorphous Silicon Thin Film Transistors and Image Sticking Phenomenon in Active Matrix Organic Light-Emitting Diode Displays

NASA Astrophysics Data System (ADS)

Shin, Min-Seok; Jo, Yun-Rae; Kwon, Oh-Kyong

2011-03-01

In this paper, we propose a driving method for compensating the electrical instability of hydrogenated amorphous silicon (a-Si:H) thin film transistors (TFTs) and the luminance degradation of organic light-emitting diode (OLED) devices for large active matrix OLED (AMOLED) displays. The proposed driving method senses the electrical characteristics of a-Si:H TFTs and OLEDs using current integrators and compensates them by an external compensation method. Threshold voltage shift is controlled a using negative bias voltage. After applying the proposed driving method, the measured error of the maximum emission current ranges from -1.23 to +1.59 least significant bit (LSB) of a 10-bit gray scale under the threshold voltage shift ranging from -0.16 to 0.17 V.

Texture Feature Analysis for Different Resolution Level of Kidney Ultrasound Images

NASA Astrophysics Data System (ADS)

Kairuddin, Wan Nur Hafsha Wan; Mahmud, Wan Mahani Hafizah Wan

2017-08-01

Image feature extraction is a technique to identify the characteristic of the image. The objective of this work is to discover the texture features that best describe a tissue characteristic of a healthy kidney from ultrasound (US) image. Three ultrasound machines that have different specifications are used in order to get a different quality (different resolution) of the image. Initially, the acquired images are pre-processed to de-noise the speckle to ensure the image preserve the pixels in a region of interest (ROI) for further extraction. Gaussian Low- pass Filter is chosen as the filtering method in this work. 150 of enhanced images then are segmented by creating a foreground and background of image where the mask is created to eliminate some unwanted intensity values. Statistical based texture features method is used namely Intensity Histogram (IH), Gray-Level Co-Occurance Matrix (GLCM) and Gray-level run-length matrix (GLRLM).This method is depends on the spatial distribution of intensity values or gray levels in the kidney region. By using One-Way ANOVA in SPSS, the result indicated that three features (Contrast, Difference Variance and Inverse Difference Moment Normalized) from GLCM are not statistically significant; this concludes that these three features describe a healthy kidney characteristics regardless of the ultrasound image quality.

Insight on agglomerates of gold nanoparticles in glass based on surface plasmon resonance spectrum: study by multi-spheres T-matrix method

NASA Astrophysics Data System (ADS)

Avakyan, L. A.; Heinz, M.; Skidanenko, A. V.; Yablunovski, K. A.; Ihlemann, J.; Meinertz, J.; Patzig, C.; Dubiel, M.; Bugaev, L. A.

2018-01-01

The formation of a localized surface plasmon resonance (SPR) spectrum of randomly distributed gold nanoparticles in the surface layer of silicate float glass, generated and implanted by UV ArF-excimer laser irradiation of a thin gold layer sputter-coated on the glass surface, was studied by the T-matrix method, which enables particle agglomeration to be taken into account. The experimental technique used is promising for the production of submicron patterns of plasmonic nanoparticles (given by laser masks or gratings) without damage to the glass surface. Analysis of the applicability of the multi-spheres T-matrix (MSTM) method to the studied material was performed through calculations of SPR characteristics for differently arranged and structured gold nanoparticles (gold nanoparticles in solution, particles pairs, and core-shell silver-gold nanoparticles) for which either experimental data or results of the modeling by other methods are available. For the studied gold nanoparticles in glass, it was revealed that the theoretical description of their SPR spectrum requires consideration of the plasmon coupling between particles, which can be done effectively by MSTM calculations. The obtained statistical distributions over particle sizes and over interparticle distances demonstrated the saturation behavior with respect to the number of particles under consideration, which enabled us to determine the effective aggregate of particles, sufficient to form the SPR spectrum. The suggested technique for the fitting of an experimental SPR spectrum of gold nanoparticles in glass by varying the geometrical parameters of the particles aggregate in the recurring calculations of spectrum by MSTM method enabled us to determine statistical characteristics of the aggregate: the average distance between particles, average size, and size distribution of the particles. The fitting strategy of the SPR spectrum presented here can be applied to nanoparticles of any nature and in various substances, and, in principle, can be extended for particles with non-spherical shapes, like ellipsoids, rod-like and other T-matrix-solvable shapes.

Optimization Algorithm for Kalman Filter Exploiting the Numerical Characteristics of SINS/GPS Integrated Navigation Systems.

PubMed

Hu, Shaoxing; Xu, Shike; Wang, Duhu; Zhang, Aiwu

2015-11-11

Aiming at addressing the problem of high computational cost of the traditional Kalman filter in SINS/GPS, a practical optimization algorithm with offline-derivation and parallel processing methods based on the numerical characteristics of the system is presented in this paper. The algorithm exploits the sparseness and/or symmetry of matrices to simplify the computational procedure. Thus plenty of invalid operations can be avoided by offline derivation using a block matrix technique. For enhanced efficiency, a new parallel computational mechanism is established by subdividing and restructuring calculation processes after analyzing the extracted "useful" data. As a result, the algorithm saves about 90% of the CPU processing time and 66% of the memory usage needed in a classical Kalman filter. Meanwhile, the method as a numerical approach needs no precise-loss transformation/approximation of system modules and the accuracy suffers little in comparison with the filter before computational optimization. Furthermore, since no complicated matrix theories are needed, the algorithm can be easily transplanted into other modified filters as a secondary optimization method to achieve further efficiency.

A matrix effect and accuracy evaluation for the determination of elements in milk powder LIBS and laser ablation/ICP-OES spectrometry.

PubMed

Gilon, N; El-Haddad, J; Stankova, A; Lei, W; Ma, Q; Motto-Ros, V; Yu, J

2011-11-01

Laser ablation coupled to inductively coupled plasma optical emission spectrometry (LA-ICP-OES) and laser-induced breakdown spectroscopy (LIBS) were investigated for the determination of Ca, Mg, Zn and Na in milk samples. The accuracy of both methods was evaluated by comparison of the concentration found using LA-ICP-OES and LIBS with classical wet digestion associated with ICP-OES determination. The results were not fully acceptable, with biases from less than 1% to more than 60%. Matrix effects were also investigated. The sample matrix can influence the temperature, electron number density (n (e)) and other excitation characteristics in the ICP. These ICP characteristics were studied and evaluated during ablation of eight milk samples. Differences in n (e) (from 8.9 to 13.8 × 10(14) cm(-3)) and rotational temperature (ranging from 3,400 to 4,400 K) occurred with no correlation with trueness. LIBS results obtained after classical external calibration procedure gave degraded accuracy, indicating a strong matrix effect. The LIBS measurements clearly showed that the major problem in LA-ICP was related to the ablation process and that LIBS spectroscopy is an excellent diagnostic tool for LA-ICP techniques.

Non-Rigid Structure Estimation in Trajectory Space from Monocular Vision

PubMed Central

Wang, Yaming; Tong, Lingling; Jiang, Mingfeng; Zheng, Junbao

2015-01-01

In this paper, the problem of non-rigid structure estimation in trajectory space from monocular vision is investigated. Similar to the Point Trajectory Approach (PTA), based on characteristic points’ trajectories described by a predefined Discrete Cosine Transform (DCT) basis, the structure matrix was also calculated by using a factorization method. To further optimize the non-rigid structure estimation from monocular vision, the rank minimization problem about structure matrix is proposed to implement the non-rigid structure estimation by introducing the basic low-rank condition. Moreover, the Accelerated Proximal Gradient (APG) algorithm is proposed to solve the rank minimization problem, and the initial structure matrix calculated by the PTA method is optimized. The APG algorithm can converge to efficient solutions quickly and lessen the reconstruction error obviously. The reconstruction results of real image sequences indicate that the proposed approach runs reliably, and effectively improves the accuracy of non-rigid structure estimation from monocular vision. PMID:26473863

A Planning Approach of Engineering Characteristics Based on QFD-TRIZ Integrated

NASA Astrophysics Data System (ADS)

Liu, Shang; Shi, Dongyan; Zhang, Ying

Traditional QFD planning method compromises contradictions between engineering characteristics to achieve higher customer satisfaction. However, this compromise trade-off can not eliminate the contradictions existing among the engineering characteristics which limited the overall customer satisfaction. QFD (Quality function deployment) integrated with TRIZ (the Russian acronym of the Theory of Inventive Problem Solving) becomes hot research recently for TRIZ can be used to solve contradictions between engineering characteristics which construct the roof of HOQ (House of quality). But, the traditional QFD planning approach is not suitable for QFD integrated with TRIZ for that TRIZ requires emphasizing the contradictions between engineering characteristics at problem definition stage instead of compromising trade-off. So, a new planning approach based on QFD / TRIZ integration is proposed in this paper, which based on the consideration of the correlation matrix of engineering characteristics and customer satisfaction on the basis of cost. The proposed approach suggests that TRIZ should be applied to solve contradictions at the first step, and the correlation matrix of engineering characteristics should be amended at the second step, and at next step IFR (ideal final result) must be validated, then planning execute. An example is used to illustrate the proposed approach. The application indicated that higher customer satisfaction can be met and the contradictions between the characteristic parameters are eliminated.

Advances in mechanistic understanding of release rate control mechanisms of extended-release hydrophilic matrix tablets.

PubMed

Timmins, Peter; Desai, Divyakant; Chen, Wei; Wray, Patrick; Brown, Jonathan; Hanley, Sarah

2016-08-01

Approaches to characterizing and developing understanding around the mechanisms that control the release of drugs from hydrophilic matrix tablets are reviewed. While historical context is provided and direct physical characterization methods are described, recent advances including the role of percolation thresholds, the application on magnetic resonance and other spectroscopic imaging techniques are considered. The influence of polymer and dosage form characteristics are reviewed. The utility of mathematical modeling is described. Finally, how all the information derived from applying the developed mechanistic understanding from all of these tools can be brought together to develop a robust and reliable hydrophilic matrix extended-release tablet formulation is proposed.

Mueller-matrix mapping of biological tissues in differential diagnosis of optical anisotropy mechanisms of protein networks

NASA Astrophysics Data System (ADS)

Ushenko, V. A.; Sidor, M. I.; Marchuk, Yu F.; Pashkovskaya, N. V.; Andreichuk, D. R.

2015-03-01

We report a model of Mueller-matrix description of optical anisotropy of protein networks in biological tissues with allowance for the linear birefringence and dichroism. The model is used to construct the reconstruction algorithms of coordinate distributions of phase shifts and the linear dichroism coefficient. In the statistical analysis of such distributions, we have found the objective criteria of differentiation between benign and malignant tissues of the female reproductive system. From the standpoint of evidence-based medicine, we have determined the operating characteristics (sensitivity, specificity and accuracy) of the Mueller-matrix reconstruction method of optical anisotropy parameters and demonstrated its effectiveness in the differentiation of benign and malignant tumours.

Azimuth-invariant mueller-matrix differentiation of the optical anisotropy of biological tissues

NASA Astrophysics Data System (ADS)

Ushenko, V. A.; Sidor, M. I.; Marchuk, Yu. F.; Pashkovskaya, N. V.; Andreichuk, D. R.

2014-07-01

A Mueller-matrix model is proposed for analysis of the optical anisotropy of protein networks of optically thin nondepolarizing layers of biological tissues with allowance for birefringence and dichroism. The model is used to construct algorithms for reconstruction of coordinate distributions of phase shifts and coefficient of linear dichroism. Objective criteria for differentiation of benign and malignant tissues of female genitals are formulated in the framework of the statistical analysis of such distributions. Approaches of evidence-based medicine are used to determine the working characteristics (sensitivity, specificity, and accuracy) of the Mueller-matrix method for the reconstruction of the parameters of optical anisotropy and show its efficiency in the differentiation of benign and malignant tumors.

Simple Pixel Structure Using Video Data Correction Method for Nonuniform Electrical Characteristics of Polycrystalline Silicon Thin-Film Transistors and Differential Aging Phenomenon of Organic Light-Emitting Diodes

NASA Astrophysics Data System (ADS)

Hai-Jung In,; Oh-Kyong Kwon,

2010-03-01

A simple pixel structure using a video data correction method is proposed to compensate for electrical characteristic variations of driving thin-film transistors (TFTs) and the degradation of organic light-emitting diodes (OLEDs) in active-matrix OLED (AMOLED) displays. The proposed method senses the electrical characteristic variations of TFTs and OLEDs and stores them in external memory. The nonuniform emission current of TFTs and the aging of OLEDs are corrected by modulating video data using the stored data. Experimental results show that the emission current error due to electrical characteristic variation of driving TFTs is in the range from -63.1 to 61.4% without compensation, but is decreased to the range from -1.9 to 1.9% with the proposed correction method. The luminance error due to the degradation of an OLED is less than 1.8% when the proposed correction method is used for a 50% degraded OLED.

[Rapid detection of caffeine in blood by freeze-out extraction].

PubMed

Bekhterev, V N; Gavrilova, S N; Kozina, E P; Maslakov, I V

2010-01-01

A new method for the detection of caffeine in blood has been proposed based on the combination of extraction and freezing-out to eliminate the influence of sample matrix. Metrological characteristics of the method are presented. Selectivity of detection is achieved by optimal conditions of analysis by high performance liquid chromatography. The method is technically simple and cost-efficient, it ensures rapid performance of the studies.

Moving Sound Source Localization Based on Sequential Subspace Estimation in Actual Room Environments

NASA Astrophysics Data System (ADS)

Tsuji, Daisuke; Suyama, Kenji

This paper presents a novel method for moving sound source localization and its performance evaluation in actual room environments. The method is based on the MUSIC (MUltiple SIgnal Classification) which is one of the most high resolution localization methods. When using the MUSIC, a computation of eigenvectors of correlation matrix is required for the estimation. It needs often a high computational costs. Especially, in the situation of moving source, it becomes a crucial drawback because the estimation must be conducted at every the observation time. Moreover, since the correlation matrix varies its characteristics due to the spatial-temporal non-stationarity, the matrix have to be estimated using only a few observed samples. It makes the estimation accuracy degraded. In this paper, the PAST (Projection Approximation Subspace Tracking) is applied for sequentially estimating the eigenvectors spanning the subspace. In the PAST, the eigen-decomposition is not required, and therefore it is possible to reduce the computational costs. Several experimental results in the actual room environments are shown to present the superior performance of the proposed method.

Estimation technique of corrective effects for forecasting of reliability of the designed and operated objects of the generating systems

NASA Astrophysics Data System (ADS)

Truhanov, V. N.; Sultanov, M. M.

2017-11-01

In the present article researches of statistical material on the refusals and malfunctions influencing operability of heat power installations have been conducted. In this article the mathematical model of change of output characteristics of the turbine depending on number of the refusals revealed in use has been presented. The mathematical model is based on methods of mathematical statistics, probability theory and methods of matrix calculation. The novelty of this model is that it allows to predict the change of the output characteristic in time, and the operating influences have been presented in an explicit form. As desirable dynamics of change of the output characteristic (function, reliability) the law of distribution of Veybull which is universal is adopted since at various values of parameters it turns into other types of distributions (for example, exponential, normal, etc.) It should be noted that the choice of the desirable law of management allows to determine the necessary management parameters with use of the saved-up change of the output characteristic in general. The output characteristic can be changed both on the speed of change of management parameters, and on acceleration of change of management parameters. In this article the technique of an assessment of the pseudo-return matrix has been stated in detail by the method of the smallest squares and the standard Microsoft Excel functions. Also the technique of finding of the operating effects when finding restrictions both for the output characteristic, and on management parameters has been considered. In the article the order and the sequence of finding of management parameters has been stated. A concrete example of finding of the operating effects in the course of long-term operation of turbines has been shown.

A new estimation of equivalent matrix block sizes in fractured media with two-phase flow applications in dual porosity models

NASA Astrophysics Data System (ADS)

Jerbi, Chahir; Fourno, André; Noetinger, Benoit; Delay, Frederick

2017-05-01

Single and multiphase flows in fractured porous media at the scale of natural reservoirs are often handled by resorting to homogenized models that avoid the heavy computations associated with a complete discretization of both fractures and matrix blocks. For example, the two overlapping continua (fractures and matrix) of a dual porosity system are coupled by way of fluid flux exchanges that deeply condition flow at the large scale. This characteristic is a key to realistic flow simulations, especially for multiphase flow as capillary forces and contrasts of fluid mobility compete in the extraction of a fluid from a capacitive matrix then conveyed through the fractures. The exchange rate between fractures and matrix is conditioned by the so-called mean matrix block size which can be viewed as the size of a single matrix block neighboring a single fracture within a mesh of a dual porosity model. We propose a new evaluation of this matrix block size based on the analysis of discrete fracture networks. The fundaments rely upon establishing at the scale of a fractured block the equivalence between the actual fracture network and a Warren and Root network only made of three regularly spaced fracture families parallel to the facets of the fractured block. The resulting matrix block sizes are then compared via geometrical considerations and two-phase flow simulations to the few other available methods. It is shown that the new method is stable in the sense it provides accurate sizes irrespective of the type of fracture network investigated. The method also results in two-phase flow simulations from dual porosity models very close to that from references calculated in finely discretized networks. Finally, calculations of matrix block sizes by this new technique reveal very rapid, which opens the way to cumbersome applications such as preconditioning a dual porosity approach applied to regional fractured reservoirs.

TIMEDELN: A programme for the detection and parametrization of overlapping resonances using the time-delay method

NASA Astrophysics Data System (ADS)

Little, Duncan A.; Tennyson, Jonathan; Plummer, Martin; Noble, Clifford J.; Sunderland, Andrew G.

2017-06-01

TIMEDELN implements the time-delay method of determining resonance parameters from the characteristic Lorentzian form displayed by the largest eigenvalues of the time-delay matrix. TIMEDELN constructs the time-delay matrix from input K-matrices and analyses its eigenvalues. This new version implements multi-resonance fitting and may be run serially or as a high performance parallel code with three levels of parallelism. TIMEDELN takes K-matrices from a scattering calculation, either read from a file or calculated on a dynamically adjusted grid, and calculates the time-delay matrix. This is then diagonalized, with the largest eigenvalue representing the longest time-delay experienced by the scattering particle. A resonance shows up as a characteristic Lorentzian form in the time-delay: the programme searches the time-delay eigenvalues for maxima and traces resonances when they pass through different eigenvalues, separating overlapping resonances. It also performs the fitting of the calculated data to the Lorentzian form and outputs resonance positions and widths. Any remaining overlapping resonances can be fitted jointly. The branching ratios of decay into the open channels can also be found. The programme may be run serially or in parallel with three levels of parallelism. The parallel code modules are abstracted from the main physics code and can be used independently.

NIR spectrometer using a Schottky photodetector enhanced by grating-based SPR.

PubMed

Chen, Wenjing; Kan, Tetsuo; Ajiki, Yoshiharu; Matsumoto, Kiyoshi; Shimoyama, Isao

2016-10-31

We present a near-infrared (NIR) spectrum measurement method using a Schottky photodetector enhanced by surface plasmon resonance (SPR). An Au grating was fabricated on an n-type silicon wafer to form a Schottky barrier and act as an SPR coupler. The resulting photodetector provides wavelength-selective photodetection depending on the SPR coupling angle. A matrix was pre-calculated to describe this characteristic. The spectrum was obtained from this matrix and the measured photocurrents at various SPR coupling angles. Light with single and multiple wavelengths was tested. Comparative measurements showed that our method is able to detect spectra with a wavelength resolution comparable to that of a commercial spectrometer.

Colorimetric characterization models based on colorimetric characteristics evaluation for active matrix organic light emitting diode panels.

PubMed

Gong, Rui; Xu, Haisong; Tong, Qingfen

2012-10-20

The colorimetric characterization of active matrix organic light emitting diode (AMOLED) panels suffers from their poor channel independence. Based on the colorimetric characteristics evaluation of channel independence and chromaticity constancy, an accurate colorimetric characterization method, namely, the polynomial compensation model (PC model) considering channel interactions was proposed for AMOLED panels. In this model, polynomial expressions are employed to calculate the relationship between the prediction errors of XYZ tristimulus values and the digital inputs to compensate the XYZ prediction errors of the conventional piecewise linear interpolation assuming the variable chromaticity coordinates (PLVC) model. The experimental results indicated that the proposed PC model outperformed other typical characterization models for the two tested AMOLED smart-phone displays and for the professional liquid crystal display monitor as well.

Research and Analysis on the Localization of a 3-D Single Source in Lossy Medium Using Uniform Circular Array

PubMed Central

Xue, Bing; Qu, Xiaodong; Fang, Guangyou; Ji, Yicai

2017-01-01

In this paper, the methods and analysis for estimating the location of a three-dimensional (3-D) single source buried in lossy medium are presented with uniform circular array (UCA). The mathematical model of the signal in the lossy medium is proposed. Using information in the covariance matrix obtained by the sensors’ outputs, equations of the source location (azimuth angle, elevation angle, and range) are obtained. Then, the phase and amplitude of the covariance matrix function are used to process the source localization in the lossy medium. By analyzing the characteristics of the proposed methods and the multiple signal classification (MUSIC) method, the computational complexity and the valid scope of these methods are given. From the results, whether the loss is known or not, we can choose the best method for processing the issues (localization in lossless medium or lossy medium). PMID:28574467

A Two-Time Scale Decentralized Model Predictive Controller Based on Input and Output Model

PubMed Central

Niu, Jian; Zhao, Jun; Xu, Zuhua; Qian, Jixin

2009-01-01

A decentralized model predictive controller applicable for some systems which exhibit different dynamic characteristics in different channels was presented in this paper. These systems can be regarded as combinations of a fast model and a slow model, the response speeds of which are in two-time scale. Because most practical models used for control are obtained in the form of transfer function matrix by plant tests, a singular perturbation method was firstly used to separate the original transfer function matrix into two models in two-time scale. Then a decentralized model predictive controller was designed based on the two models derived from the original system. And the stability of the control method was proved. Simulations showed that the method was effective. PMID:19834542

Factorial Design Based Multivariate Modeling and Optimization of Tunable Bioresponsive Arginine Grafted Poly(cystaminebis(acrylamide)-diaminohexane) Polymeric Matrix Based Nanocarriers.

PubMed

Yang, Rongbing; Nam, Kihoon; Kim, Sung Wan; Turkson, James; Zou, Ye; Zuo, Yi Y; Haware, Rahul V; Chougule, Mahavir B

2017-01-03

Desired characteristics of nanocarriers are crucial to explore its therapeutic potential. This investigation aimed to develop tunable bioresponsive newly synthesized unique arginine grafted poly(cystaminebis(acrylamide)-diaminohexane) [ABP] polymeric matrix based nanocarriers by using L9 Taguchi factorial design, desirability function, and multivariate method. The selected formulation and process parameters were ABP concentration, acetone concentration, the volume ratio of acetone to ABP solution, and drug concentration. The measured nanocarrier characteristics were particle size, polydispersity index, zeta potential, and percentage drug loading. Experimental validation of nanocarrier characteristics computed from initially developed predictive model showed nonsignificant differences (p > 0.05). The multivariate modeling based optimized cationic nanocarrier formulation of <100 nm loaded with hydrophilic acetaminophen was readapted for a hydrophobic etoposide loading without significant changes (p > 0.05) except for improved loading percentage. This is the first study focusing on ABP polymeric matrix based nanocarrier development. Nanocarrier particle size was stable in PBS 7.4 for 48 h. The increase of zeta potential at lower pH 6.4, compared to the physiological pH, showed possible endosomal escape capability. The glutathione triggered release at the physiological conditions indicated the competence of cytosolic targeting delivery of the loaded drug from bioresponsive nanocarriers. In conclusion, this unique systematic approach provides rational evaluation and prediction of a tunable bioresponsive ABP based matrix nanocarrier, which was built on selected limited number of smart experimentation.

Superconducting wire with improved strain characteristics

DOEpatents

Luhman, Thomas; Klamut, Carl J.; Suenaga, Masaki; Welch, David

1982-01-01

A superconducting wire comprising a superconducting filament and a beryllium strengthened bronze matrix in which the addition of beryllium to the matrix permits a low volume matrix to exhibit reduced elastic deformation after heat treating which increases the compression of the superconducting filament on cooling and thereby improve the strain characteristics of the wire.

Superconducting wire with improved strain characteristics

DOEpatents

Luhman, Thomas; Klamut, Carl J.; Suenaga, Masaki; Welch, David

1982-01-01

A superconducting wire comprising a superconducting filament and a beryllium strengthened bronze matrix in which the addition of beryllium to the matrix permits a low volume matrix to exhibit reduced elastic deformation after heat treating which increases the compression of the superconducting filament on cooling and thereby improves the strain characteristics of the wire.

Superconducting wire with improved strain characteristics

DOEpatents

Luhman, T.; Klamut, C.J.; Suenaga, M.; Welch, D.

1979-12-19

A superconducting wire comprising a superconducting filament and a beryllium strengthened bronze matrix in which the addition of beryllium to the matrix permits a low volume matrix to exhibit reduced elastic deformation after heat treating which increases the compression of the superconducting filament on cooling and thereby improve the strain characteristics of the wire.

A physiologically motivated sparse, compact, and smooth (SCS) approach to EEG source localization.

PubMed

Cao, Cheng; Akalin Acar, Zeynep; Kreutz-Delgado, Kenneth; Makeig, Scott

2012-01-01

Here, we introduce a novel approach to the EEG inverse problem based on the assumption that principal cortical sources of multi-channel EEG recordings may be assumed to be spatially sparse, compact, and smooth (SCS). To enforce these characteristics of solutions to the EEG inverse problem, we propose a correlation-variance model which factors a cortical source space covariance matrix into the multiplication of a pre-given correlation coefficient matrix and the square root of the diagonal variance matrix learned from the data under a Bayesian learning framework. We tested the SCS method using simulated EEG data with various SNR and applied it to a real ECOG data set. We compare the results of SCS to those of an established SBL algorithm.

Azimuthally invariant Mueller-matrix mapping of optically anisotropic layers of biological networks of blood plasma in the diagnosis of liver disease

NASA Astrophysics Data System (ADS)

Ushenko, A. G.; Dubolazov, A. V.; Ushenko, V. A.; Ushenko, Yu. A.; Sakhnovskiy, M. Y.; Pavlyukovich, O.; Pavlyukovich, N.; Novakovskaya, O.; Gorsky, M. P.

2016-09-01

The model of Mueller-matrix description of mechanisms of optical anisotropy that typical for polycrystalline layers of the histological sections of biological tissues and fluids - optical activity, birefringence, as well as linear and circular dichroism - is suggested. Within the statistical analysis distributions quantities of linear and circular birefringence and dichroism the objective criteria of differentiation of myocardium histological sections (determining the cause of death); films of blood plasma (liver pathology); peritoneal fluid (endometriosis of tissues of women reproductive sphere); urine (kidney disease) were determined. From the point of view of probative medicine the operational characteristics (sensitivity, specificity and accuracy) of the method of Mueller-matrix reconstruction of optical anisotropy parameters were found.

Comprehensive Deployment Method for Technical Characteristics Base on Multi-failure Modes Correlation Analysis

NASA Astrophysics Data System (ADS)

Zheng, W.; Gao, J. M.; Wang, R. X.; Chen, K.; Jiang, Y.

2017-12-01

This paper put forward a new method of technical characteristics deployment based on Reliability Function Deployment (RFD) by analysing the advantages and shortages of related research works on mechanical reliability design. The matrix decomposition structure of RFD was used to describe the correlative relation between failure mechanisms, soft failures and hard failures. By considering the correlation of multiple failure modes, the reliability loss of one failure mode to the whole part was defined, and a calculation and analysis model for reliability loss was presented. According to the reliability loss, the reliability index value of the whole part was allocated to each failure mode. On the basis of the deployment of reliability index value, the inverse reliability method was employed to acquire the values of technology characteristics. The feasibility and validity of proposed method were illustrated by a development case of machining centre’s transmission system.

Effect of electronic coupling of Watson-Crick hopping in DNA poly(dA)-poly(dT)

NASA Astrophysics Data System (ADS)

Risqi, A. M.; Yudiarsah, E.

2017-07-01

Charge transport properties of poly(dA)-poly(dT) DNA has been studied by using thigh binding Hamiltonian approach. Molecule DNA that we use consist of 32 base pair of adenine (A) and thymine (T) and backbone is consist of phosphate and sugar. The molecule DNA is contacted electrode at both ends. Charge transport in molecule DNA depend on the environment, we studied the effect of electronic coupling of Watson-Crick hopping in poly(dA)-poly(dT) DNA to transmission probability and characteristic I-V. The electronic coupling constant influence charge transport between adenine-thymine base pairs at the same site. Transmission probability is studied by using transfer matrix and scattering matrix method, and the result of transmission probability is used to calculate the characteristic I-V by using formula Landauer Buttiker. The result shows that when the electronic coupling increase then transmission probability and characteristic I-V increase slightly.

Dermis, acellular dermal matrix, and fibroblasts from different layers of pig skin exhibit different profibrotic characteristics: evidence from in vivo study

PubMed Central

Zuo, Yanhai; Lu, Shuliang

2017-01-01

To explore the profibrotic characteristics of the autografted dermis, acellular dermal matrix, and dermal fibroblasts from superficial/deep layers of pig skin, 93 wounds were established on the dorsa of 7 pigs. 72 wounds autografted with the superficial/deep dermis and acellular dermal matrix served as the superficial/deep dermis and acellular dermal matrix group, respectively, and were sampled at 2, 4, and 8 weeks post-wounding. 21 wounds autografted with/without superficial/deep dermal fibroblasts served as the superficial/deep dermal fibroblast group and the control group, respectively, and were sampled at 2 weeks post-wounding. The hematoxylin and eosin staining showed that the wounded skin thicknesses in the deep dermis group (superficial acellular dermal matrix group) were significantly greater than those in the superficial dermis group (deep acellular dermal matrix group) at each time point, the thickness of the cutting plane in the deep dermal fibroblast group was significantly greater than that in the superficial dermal fibroblast group and the control group. The western blots showed that the α-smooth muscle actin expression in the deep dermis group (superficial acellular dermal matrix group) was significantly greater than that in the superficial dermis group (deep acellular dermal matrix group) at each time point. In summary, the deep dermis and dermal fibroblasts exhibited more profibrotic characteristics than the superficial ones, on the contrary, the deep acellular dermal matrix exhibited less profibrotic characteristics than the superficial one. PMID:28423561

Matrix precipitation: a general strategy to eliminate matrix interference for pharmaceutical toxic impurities analysis.

PubMed

Yang, Xiaojing; Xiong, Xuewu; Cao, Ji; Luan, Baolei; Liu, Yongjun; Liu, Guozhu; Zhang, Lei

2015-01-30

Matrix interference, which can lead to false positive/negative results, contamination of injector or separation column, incompatibility between sample solution and the selected analytical instrument, and response inhibition or even quenching, is commonly suffered for the analysis of trace level toxic impurities in drug substance. In this study, a simple matrix precipitation strategy is proposed to eliminate or minimize the above stated matrix interference problems. Generally, a sample of active pharmaceutical ingredients (APIs) is dissolved in an appropriate solvent to achieve the desired high concentration and then an anti-solvent is added to precipitate the matrix substance. As a result, the target analyte is extracted into the mixed solution with very less residual of APIs. This strategy has the characteristics of simple manipulation, high recovery and excellent anti-interference capability. It was found that the precipitation ratio (R, representing the ability to remove matrix substance) and the proportion of solvent (the one used to dissolve APIs) in final solution (P, affecting R and also affecting the method sensitivity) are two important factors of the precipitation process. The correlation between R and P was investigated by performing precipitation with various APIs in different solvent/anti-solvent systems. After a detailed mathematical reasoning process, P=20% was proved to be an effective and robust condition to perform the precipitation strategy. The precipitation method with P=20% can be used as a general strategy for toxic impurity analysis in APIs. Finally, several typical examples are described in this article, where the challenging matrix interference issues have been resolved successfully. Copyright © 2014 Elsevier B.V. All rights reserved.

Evaluation and prevention of the negative matrix effect of terpenoids on pesticides in apples quantification by gas chromatography-tandem mass spectrometry.

PubMed

Giacinti, Géraldine; Raynaud, Christine; Capblancq, Sophie; Simon, Valérie

2016-12-21

The sample matrix can enhance the gas chromatography signal of pesticide residues relative to that obtained with the same concentration of pesticide in solvent. This paper is related to negative matrix effects observed in coupled gas chromatography-mass spectrometry ion trap (GC/MS 2 ) quantification of pesticides in concentrated extracts of apple peel prepared by the Quick Easy Cheap Effective Rugged and Safe (QuEChERS) method. It is focused on the pesticides most frequently used on the apple varieties studied, throughout the crop cycle, right up to harvest, to combat pests and diseases and to improve fruit storage properties. Extracts from the fleshy receptacle (flesh), the epiderm (peel) and fruit of three apple varieties were studied by high-performance thin-layer chromatography hyphenated with UV-vis light detection (HPTLC/UV visible). The peel extracts had high concentrations of triterpenic acids (oleanolic and ursolic acids), reaching 25mgkg -1 , whereas these compounds were not detected in the flesh extracts (<0.05mgkg -1 ). A significant relationship has been found between the levels of these molecules and negative matrix effects in GC/MS 2 . The differences in the behavior of pesticides with respect to matrix effects can be accounted for by the physicochemical characteristics of the molecules (lone pairs, labile hydrogen, conjugation). The HPTLC/UV visible method developed here for the characterization of QuEChERS extracts acts as a complementary clean-up method, aimed to decrease the negative matrix effects of such extracts. Copyright © 2016 Elsevier B.V. All rights reserved.

Evaluation and prevention of the negative matrix effect of terpenoids on pesticides in apples quantification by gas chromatography-tandem mass spectrometry.

PubMed

Giacinti, Géraldine; Raynaud, Christine; Capblancq, Sophie; Simon, Valérie

2017-02-03

The sample matrix can enhance the gas chromatography signal of pesticide residues relative to that obtained with the same concentration of pesticide in solvent. This paper is related to negative matrix effects observed in coupled gas chromatography-mass spectrometry ion trap (GC/MS 2 ) quantification of pesticides in concentrated extracts of apple peel prepared by the Quick Easy Cheap Effective Rugged and Safe (QuEChERS) method. It is focused on the pesticides most frequently used on the apple varieties studied, throughout the crop cycle, right up to harvest, to combat pests and diseases and to improve fruit storage properties. Extracts from the fleshy receptacle (flesh), the epiderm (peel) and fruit of three apple varieties were studied by high-performance thin-layer chromatography hyphenated with UV-vis light detection (HPTLC/UV visible). The peel extracts had high concentrations of triterpenic acids (oleanolic and ursolic acids), reaching 25mgkg -1 , whereas these compounds were not detected in the flesh extracts (<0.05mgkg -1 ). A significant relationship has been found between the levels of these molecules and negative matrix effects in GC/MS 2 . The differences in the behavior of pesticides with respect to matrix effects can be accounted for by the physicochemical characteristics of the molecules (lone pairs, labile hydrogen, conjugation). The HPTLC/UV visible method developed here for the characterization of QuEChERS extracts acts as a complementary clean-up method, aimed to decrease the negative matrix effects of such extracts. Copyright © 2016 Elsevier B.V. All rights reserved.

Transfer matrix method for dynamics modeling and independent modal space vibration control design of linear hybrid multibody system

NASA Astrophysics Data System (ADS)

Rong, Bao; Rui, Xiaoting; Lu, Kun; Tao, Ling; Wang, Guoping; Ni, Xiaojun

2018-05-01

In this paper, an efficient method of dynamics modeling and vibration control design of a linear hybrid multibody system (MS) is studied based on the transfer matrix method. The natural vibration characteristics of a linear hybrid MS are solved by using low-order transfer equations. Then, by constructing the brand-new body dynamics equation, augmented operator and augmented eigenvector, the orthogonality of augmented eigenvector of a linear hybrid MS is satisfied, and its state space model expressed in each independent model space is obtained easily. According to this dynamics model, a robust independent modal space-fuzzy controller is designed for vibration control of a general MS, and the genetic optimization of some critical control parameters of fuzzy tuners is also presented. Two illustrative examples are performed, which results show that this method is computationally efficient and with perfect control performance.

Driving technology for improving motion quality of active-matrix organic light-emitting diode display

NASA Astrophysics Data System (ADS)

Kim, Jongbin; Kim, Minkoo; Kim, Jong-Man; Kim, Seung-Ryeol; Lee, Seung-Woo

2014-09-01

This paper reports transient response characteristics of active-matrix organic light emitting diode (AMOLED) displays for mobile applications. This work reports that the rising responses look like saw-tooth waveform and are not always faster than those of liquid crystal displays. Thus, a driving technology is proposed to improve the rising transient responses of AMOLED based on the overdrive (OD) technology. We modified the OD technology by combining it with a dithering method because the conventional OD method cannot successfully enhance all the rising responses. Our method can improve all the transitions of AMOLED without modifying the conventional gamma architecture of drivers. A new artifact is found when OD is applied to certain transitions. We propose an optimum OD selection method to mitigate the artifact. The implementation results show the proposed technology can successfully improve motion quality of scrolling texts as well as moving pictures in AMOLED displays.

Forecasts of non-Gaussian parameter spaces using Box-Cox transformations

NASA Astrophysics Data System (ADS)

Joachimi, B.; Taylor, A. N.

2011-09-01

Forecasts of statistical constraints on model parameters using the Fisher matrix abound in many fields of astrophysics. The Fisher matrix formalism involves the assumption of Gaussianity in parameter space and hence fails to predict complex features of posterior probability distributions. Combining the standard Fisher matrix with Box-Cox transformations, we propose a novel method that accurately predicts arbitrary posterior shapes. The Box-Cox transformations are applied to parameter space to render it approximately multivariate Gaussian, performing the Fisher matrix calculation on the transformed parameters. We demonstrate that, after the Box-Cox parameters have been determined from an initial likelihood evaluation, the method correctly predicts changes in the posterior when varying various parameters of the experimental setup and the data analysis, with marginally higher computational cost than a standard Fisher matrix calculation. We apply the Box-Cox-Fisher formalism to forecast cosmological parameter constraints by future weak gravitational lensing surveys. The characteristic non-linear degeneracy between matter density parameter and normalization of matter density fluctuations is reproduced for several cases, and the capabilities of breaking this degeneracy by weak-lensing three-point statistics is investigated. Possible applications of Box-Cox transformations of posterior distributions are discussed, including the prospects for performing statistical data analysis steps in the transformed Gaussianized parameter space.

Pixel-level multisensor image fusion based on matrix completion and robust principal component analysis

NASA Astrophysics Data System (ADS)

Wang, Zhuozheng; Deller, J. R.; Fleet, Blair D.

2016-01-01

Acquired digital images are often corrupted by a lack of camera focus, faulty illumination, or missing data. An algorithm is presented for fusion of multiple corrupted images of a scene using the lifting wavelet transform. The method employs adaptive fusion arithmetic based on matrix completion and self-adaptive regional variance estimation. Characteristics of the wavelet coefficients are used to adaptively select fusion rules. Robust principal component analysis is applied to low-frequency image components, and regional variance estimation is applied to high-frequency components. Experiments reveal that the method is effective for multifocus, visible-light, and infrared image fusion. Compared with traditional algorithms, the new algorithm not only increases the amount of preserved information and clarity but also improves robustness.

Interfacial characteristics of diamond/aluminum composites with high thermal conductivity fabricated by squeeze-casting method

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jiang, Longtao, E-mail: longtaojiang@163.com; Wang, Pingping; Xiu, Ziyang

2015-08-15

In this work, aluminum matrix composites reinforced with diamond particles (diamond/aluminum composites) were fabricated by squeeze casting method. The material exhibited a thermal conductivity as high as 613 W / (m · K). The obtained composites were investigated by scanning electron microscope and transmission electron microscope in terms of the (100) and (111) facets of diamond particles. The diamond particles were observed to be homogeneously distributed in the aluminum matrix. The diamond{sub (111)}/Al interface was found to be devoid of reaction products. While at the diamond{sub (100)}/Al interface, large-sized aluminum carbides (Al{sub 4}C{sub 3}) with twin-crystal structure were identified. Themore » interfacial characteristics were believed to be responsible for the excellent thermal conductivity of the material. - Graphical abstract: Display Omitted - Highlights: • Squeeze casting method was introduced to fabricate diamond/Al composite. • Sound interfacial bonding with excellent thermal conductivity was produced. • Diamond{sub (111)}/ aluminum interface was firstly characterized by TEM/HRTEM. • Physical combination was the controlling bonding for diamond{sub (111)}/aluminum. • The growth mechanism of Al{sub 4}C{sub 3} was analyzed by crystallography theory.« less

Linear and nonlinear dynamic analysis of redundant load path bearingless rotor systems

NASA Technical Reports Server (NTRS)

Murthy, V. R.; Shultz, Louis A.

1994-01-01

The goal of this research is to develop the transfer matrix method to treat nonlinear autonomous boundary value problems with multiple branches. The application is the complete nonlinear aeroelastic analysis of multiple-branched rotor blades. Once the development is complete, it can be incorporated into the existing transfer matrix analyses. There are several difficulties to be overcome in reaching this objective. The conventional transfer matrix method is limited in that it is applicable only to linear branch chain-like structures, but consideration of multiple branch modeling is important for bearingless rotors. Also, hingeless and bearingless rotor blade dynamic characteristics (particularly their aeroelasticity problems) are inherently nonlinear. The nonlinear equations of motion and the multiple-branched boundary value problem are treated together using a direct transfer matrix method. First, the formulation is applied to a nonlinear single-branch blade to validate the nonlinear portion of the formulation. The nonlinear system of equations is iteratively solved using a form of Newton-Raphson iteration scheme developed for differential equations of continuous systems. The formulation is then applied to determine the nonlinear steady state trim and aeroelastic stability of a rotor blade in hover with two branches at the root. A comprehensive computer program is developed and is used to obtain numerical results for the (1) free vibration, (2) nonlinearly deformed steady state, (3) free vibration about the nonlinearly deformed steady state, and (4) aeroelastic stability tasks. The numerical results obtained by the present method agree with results from other methods.

Low-dose cerebral perfusion computed tomography image restoration via low-rank and total variation regularizations

PubMed Central

Niu, Shanzhou; Zhang, Shanli; Huang, Jing; Bian, Zhaoying; Chen, Wufan; Yu, Gaohang; Liang, Zhengrong; Ma, Jianhua

2016-01-01

Cerebral perfusion x-ray computed tomography (PCT) is an important functional imaging modality for evaluating cerebrovascular diseases and has been widely used in clinics over the past decades. However, due to the protocol of PCT imaging with repeated dynamic sequential scans, the associative radiation dose unavoidably increases as compared with that used in conventional CT examinations. Minimizing the radiation exposure in PCT examination is a major task in the CT field. In this paper, considering the rich similarity redundancy information among enhanced sequential PCT images, we propose a low-dose PCT image restoration model by incorporating the low-rank and sparse matrix characteristic of sequential PCT images. Specifically, the sequential PCT images were first stacked into a matrix (i.e., low-rank matrix), and then a non-convex spectral norm/regularization and a spatio-temporal total variation norm/regularization were then built on the low-rank matrix to describe the low rank and sparsity of the sequential PCT images, respectively. Subsequently, an improved split Bregman method was adopted to minimize the associative objective function with a reasonable convergence rate. Both qualitative and quantitative studies were conducted using a digital phantom and clinical cerebral PCT datasets to evaluate the present method. Experimental results show that the presented method can achieve images with several noticeable advantages over the existing methods in terms of noise reduction and universal quality index. More importantly, the present method can produce more accurate kinetic enhanced details and diagnostic hemodynamic parameter maps. PMID:27440948

Predicting drug-target interactions by dual-network integrated logistic matrix factorization

NASA Astrophysics Data System (ADS)

Hao, Ming; Bryant, Stephen H.; Wang, Yanli

2017-01-01

In this work, we propose a dual-network integrated logistic matrix factorization (DNILMF) algorithm to predict potential drug-target interactions (DTI). The prediction procedure consists of four steps: (1) inferring new drug/target profiles and constructing profile kernel matrix; (2) diffusing drug profile kernel matrix with drug structure kernel matrix; (3) diffusing target profile kernel matrix with target sequence kernel matrix; and (4) building DNILMF model and smoothing new drug/target predictions based on their neighbors. We compare our algorithm with the state-of-the-art method based on the benchmark dataset. Results indicate that the DNILMF algorithm outperforms the previously reported approaches in terms of AUPR (area under precision-recall curve) and AUC (area under curve of receiver operating characteristic) based on the 5 trials of 10-fold cross-validation. We conclude that the performance improvement depends on not only the proposed objective function, but also the used nonlinear diffusion technique which is important but under studied in the DTI prediction field. In addition, we also compile a new DTI dataset for increasing the diversity of currently available benchmark datasets. The top prediction results for the new dataset are confirmed by experimental studies or supported by other computational research.

Kinetics and mechanism of release from glyceryl monostearate-based implants: evaluation of release in a gel simulating in vivo implantation.

PubMed

Allababidi, S; Shah, J C

1998-06-01

The overall objective of the study was to design an implantable delivery system based on glyceryl monostearate (GMS) for the site-specific delivery of antibiotics for the prevention of surgical wound infection. To design the implant, a release method had to be developed that simulate the in vivo implantation conditions to be able to predict the release characteristics from the implants when they are actually used in vivo. Also, identifying the release kinetics and mechanism and evaluating the factors that influence the release of drugs from the GMS-based matrix were necessary to allow further design of implants that could yield a desired release rate. The release of cefazolin was monitored from GMS matrixes implanted into agar gel, simulating subcutaneous tissues with respect to viscosity and water content. The gel method resulted in observation of spatial and temporal concentration profiles in the immediate vicinity of the implants, indicating the benefits of local drug delivery; however, there was no significant difference between the cumulative release profiles by the gel method or the vial release method. The release of cefazolin from the GMS-based matrix with the vial method followed Higuchi's square root of time kinetics. The release rate was found to be directly proportional to cefazolin load (A) and the surface area (SA) of the matrix as expressed by the following equation: = 0.24ASA. On the basis of this equation, one can design a variety of GMS matrixes that would result in a desired release rate or release duration. This also indicated that cefazolin release followed the release kinetics of a freely soluble drug from an insoluble matrix and hence it is a diffusion-controlled process. The effect of drug solubility on the release kinetics was determined by comparing the release kinetics of the poorly water soluble ciprofloxacin (0.16 mg/mL) to that of the highly water soluble cefazolin (325 mg/mL). The release duration of ciprofloxacin (80 h) was longer than that of cefazolin (25 h) from identical GMS matrixes. Although ciprofloxacin release was initially controlled by the matrix, agitation accelerated disintegration of the matrix and release due to its poor solubility, and ciprofloxacin release appeared to be a dissolution-controlled process following zero-order release kinetics.

Multi-class multi-residue analysis of veterinary drugs in meat using enhanced matrix removal lipid cleanup and liquid chromatography-tandem mass spectrometry.

PubMed

Zhao, Limian; Lucas, Derick; Long, David; Richter, Bruce; Stevens, Joan

2018-05-11

This study presents the development and validation of a quantitation method for the analysis of multi-class, multi-residue veterinary drugs using lipid removal cleanup cartridges, enhanced matrix removal lipid (EMR-Lipid), for different meat matrices by liquid chromatography tandem mass spectrometry detection. Meat samples were extracted using a two-step solid-liquid extraction followed by pass-through sample cleanup. The method was optimized based on the buffer and solvent composition, solvent additive additions, and EMR-Lipid cartridge cleanup. The developed method was then validated in five meat matrices, porcine muscle, bovine muscle, bovine liver, bovine kidney and chicken liver to evaluate the method performance characteristics, such as absolute recoveries and precision at three spiking levels, calibration curve linearity, limit of quantitation (LOQ) and matrix effect. The results showed that >90% of veterinary drug analytes achieved satisfactory recovery results of 60-120%. Over 97% analytes achieved excellent reproducibility results (relative standard deviation (RSD) < 20%), and the LOQs were 1-5 μg/kg in the evaluated meat matrices. The matrix co-extractive removal efficiency by weight provided by EMR-lipid cartridge cleanup was 42-58% in samples. The post column infusion study showed that the matrix ion suppression was reduced for samples with the EMR-Lipid cartridge cleanup. The reduced matrix ion suppression effect was also confirmed with <15% frequency of compounds with significant quantitative ion suppression (>30%) for all tested veterinary drugs in all of meat matrices. The results showed that the two-step solid-liquid extraction provides efficient extraction for the entire spectrum of veterinary drugs, including the difficult classes such as tetracyclines, beta-lactams etc. EMR-Lipid cartridges after extraction provided efficient sample cleanup with easy streamlined protocol and minimal impacts on analytes recovery, improving method reliability and consistency. Copyright © 2018 Elsevier B.V. All rights reserved.

Tailored porous silicon microparticles: fabrication and properties

PubMed Central

Chiappini, Ciro; Tasciotti, Ennio; Fakhoury, Jean R.; Fine, Daniel; Pullan, Lee; Wang, Young-Chung; Fu, Lianfeng

2010-01-01

The use of mesoporous silicon particles for drug delivery has been widely explored thanks to their biodegradability and biocompatibility. The ability to tailor the physicochemical properties of porous silicon at the micro and nano scale confers versatility to this material. We present a method for the fabrication of highly reproducible, monodisperse mesoporous silicon particles with controlled physical characteristics through electrochemical etch of patterned silicon trenches. We tailored particle size in the micrometer range and pore size in the nanometer range, shape from tubular to discoidal to hemispherical, and porosity from 46% to over 80%. In addition, we correlated the properties of the porous matrix with the loading of model nanoparticles (Q-dots) and observed their three-dimensional arrangement within the matrix by transmission electron microscopy tomography. The methods developed in this study provide effective means to fabricate mesoporous silicon particles according to the principles of rational design for therapeutic vectors and to characterize the distribution of nanoparticles within the porous matrix PMID:20162656

Rolling Bearing Fault Diagnosis Based on an Improved HTT Transform

PubMed Central

Tang, Guiji; Tian, Tian; Zhou, Chong

2018-01-01

When rolling bearing failure occurs, vibration signals generally contain different signal components, such as impulsive fault feature signals, background noise and harmonic interference signals. One of the most challenging aspects of rolling bearing fault diagnosis is how to inhibit noise and harmonic interference signals, while enhancing impulsive fault feature signals. This paper presents a novel bearing fault diagnosis method, namely an improved Hilbert time–time (IHTT) transform, by combining a Hilbert time–time (HTT) transform with principal component analysis (PCA). Firstly, the HTT transform was performed on vibration signals to derive a HTT transform matrix. Then, PCA was employed to de-noise the HTT transform matrix in order to improve the robustness of the HTT transform. Finally, the diagonal time series of the de-noised HTT transform matrix was extracted as the enhanced impulsive fault feature signal and the contained fault characteristic information was identified through further analyses of amplitude and envelope spectrums. Both simulated and experimental analyses validated the superiority of the presented method for detecting bearing failures. PMID:29662013

A new model for simulating spring discharge recession and estimating effective porosity of karst aquifers

NASA Astrophysics Data System (ADS)

Xu, Bin; Ye, Ming; Dong, Shuning; Dai, Zhenxue; Pei, Yongzhen

2018-07-01

Quantitative analysis of recession curves of karst spring hydrographs is a vital tool for understanding karst hydrology and inferring hydraulic properties of karst aquifers. This paper presents a new model for simulating karst spring recession curves. The new model has the following characteristics: (1) the model considers two separate but hydraulically connected reservoirs: matrix reservoir and conduit reservoir; (2) the model separates karst spring hydrograph recession into three stages: conduit-drainage stage, mixed-drainage stage (with both conduit drainage and matrix drainage), and matrix-drainage stage; and (3) in the mixed-drainage stage, the model uses multiple conduit layers to present different levels of conduit development. The new model outperforms the classical Mangin model and the recently developed Fiorillo model for simulating observed discharge at the Madison Blue Spring located in northern Florida. This is attributed to the latter two characteristics of the new model. Based on the new model, a method is developed for estimating effective porosity of the matrix and conduit reservoirs for the three drainage stages. The estimated porosity values are consistent with measured matrix porosity at the study site and with estimated conduit porosity reported in literature. The new model for simulating karst spring hydrograph recession is mathematically general, and can be applied to a wide range of karst spring hydrographs to understand groundwater flow in karst aquifers. The limitations of the model are discussed at the end of this paper.

Electrically conductive, black thermal control coatings for space craft application. II - Silicone matrix formulation

NASA Technical Reports Server (NTRS)

Hribar, V. F.; Bauer, J. L.; O'Donnell, T. P.

1986-01-01

Five black electrically conductive thermal-control coatings have been formulated and tested for application on the Galileo spacecraft. The coatings consisted of organic and inorganic systems applied on titanium and aluminum surfaces. The coatings were tested under simulated space environment conditions. Coated specimens were subjected to thermal radiation and convective and conductive heating from -196 to 538 C. Mechanical, physical, thermal, electrical, and optical characteristics, formulation, mixing, application, surface preparation of substrates, and a method of determining electrical resistance are presented for the silicone matrix formulation designated as GF-580.

Iron oxide nanomatrix facilitating metal ionization in matrix-assisted laser desorption/ionization mass spectrometry.

PubMed

Obena, Rofeamor P; Lin, Po-Chiao; Lu, Ying-Wei; Li, I-Che; del Mundo, Florian; Arco, Susan dR; Nuesca, Guillermo M; Lin, Chung-Chen; Chen, Yu-Ju

2011-12-15

The significance and epidemiological effects of metals to life necessitate the development of direct, efficient, and rapid method of analysis. Taking advantage of its simple, fast, and high-throughput features, we present a novel approach to metal ion detection by matrix-functionalized magnetic nanoparticle (matrix@MNP)-assisted MALDI-MS. Utilizing 21 biologically and environmentally relevant metal ion solutions, the performance of core and matrix@MNP against conventional matrixes in MALDI-MS and laser desorption ionization (LDI) MS were systemically tested to evaluate the versatility of matrix@MNP as ionization element. The matrix@MNPs provided 20- to >100-fold enhancement on detection sensitivity of metal ions and unambiguous identification through characteristic isotope patterns and accurate mass (<5 ppm), which may be attributed to its multifunctional role as metal chelator, preconcentrator, absorber, and reservoir of energy. Together with the comparison on the ionization behaviors of various metals having different ionization potentials (IP), we formulated a metal ionization mechanism model, alluding to the role of exciton pooling in matrix@MNP-assisted MALDI-MS. Moreover, the detection of Cu in spiked tap water demonstrated the practicability of this new approach as an efficient and direct alternative tool for fast, sensitive, and accurate determination of trace metal ions in real samples.

Flapping response characteristics of hingeless rotor blades by a gereralized harmonic balance method

NASA Technical Reports Server (NTRS)

Peters, D. A.; Ormiston, R. A.

1975-01-01

Linearized equations of motion for the flapping response of flexible rotor blades in forward flight are derived in terms of generalized coordinates. The equations are solved using a matrix form of the method of linear harmonic balance, yielding response derivatives for each harmonic of the blade deformations and of the hub forces and moments. Numerical results and approximate closed-form expressions for rotor derivatives are used to illustrate the relationships between rotor parameters, modeling assumptions, and rotor response characteristics. Finally, basic hingeless rotor response derivatives are presented in tabular and graphical form for a wide range of configuration parameters and operating conditions.

Modeling and design of a pre-stressed piezoelectric stack actuator

NASA Astrophysics Data System (ADS)

Jiang, Shiping; Cheng, Lei

2017-07-01

To provide a method for designing a pre-stressed PSA with high-performance, it is very meaningful to model the dynamic characteristics of the pre-stressed PSA accurately. A novel model, which considers both the electric side and the mechanical side of the PSA as distributed systems, is put forward to describe the dynamics characteristics of the PSA and the pre-stressed PSA. The role of the pre-stressed mechanism is derived and analyzed by extended transfer matrix method, and then the principle of design of the pre-stressed mechanism is obtained. The theoretical analysis is in accordance with the experimental results.

Spectral Analysis of Rich Network Topology in Social Networks

ERIC Educational Resources Information Center

Wu, Leting

2013-01-01

Social networks have received much attention these days. Researchers have developed different methods to study the structure and characteristics of the network topology. Our focus is on spectral analysis of the adjacency matrix of the underlying network. Recent work showed good properties in the adjacency spectral space but there are few…

Texture analysis of tissues in Gleason grading of prostate cancer

NASA Astrophysics Data System (ADS)

Alexandratou, Eleni; Yova, Dido; Gorpas, Dimitris; Maragos, Petros; Agrogiannis, George; Kavantzas, Nikolaos

2008-02-01

Prostate cancer is a common malignancy among maturing men and the second leading cause of cancer death in USA. Histopathological grading of prostate cancer is based on tissue structural abnormalities. Gleason grading system is the gold standard and is based on the organization features of prostatic glands. Although Gleason score has contributed on cancer prognosis and on treatment planning, its accuracy is about 58%, with this percentage to be lower in GG2, GG3 and GG5 grading. On the other hand it is strongly affected by "inter- and intra observer variations", making the whole process very subjective. Therefore, there is need for the development of grading tools based on imaging and computer vision techniques for a more accurate prostate cancer prognosis. The aim of this paper is the development of a novel method for objective grading of biopsy specimen in order to support histopathological prognosis of the tumor. This new method is based on texture analysis techniques, and particularly on Gray Level Co-occurrence Matrix (GLCM) that estimates image properties related to second order statistics. Histopathological images of prostate cancer, from Gleason grade2 to Gleason grade 5, were acquired and subjected to image texture analysis. Thirteen texture characteristics were calculated from this matrix as they were proposed by Haralick. Using stepwise variable selection, a subset of four characteristics were selected and used for the description and classification of each image field. The selected characteristics profile was used for grading the specimen with the multiparameter statistical method of multiple logistic discrimination analysis. The subset of these characteristics provided 87% correct grading of the specimens. The addition of any of the remaining characteristics did not improve significantly the diagnostic ability of the method. This study demonstrated that texture analysis techniques could provide valuable grading decision support to the pathologists, concerning prostate cancer prognosis.

A fast efficient implicit scheme for the gasdynamic equations using a matrix reduction technique

NASA Technical Reports Server (NTRS)

Barth, T. J.; Steger, J. L.

1985-01-01

An efficient implicit finite-difference algorithm for the gasdynamic equations utilizing matrix reduction techniques is presented. A significant reduction in arithmetic operations is achieved without loss of the stability characteristics generality found in the Beam and Warming approximate factorization algorithm. Steady-state solutions to the conservative Euler equations in generalized coordinates are obtained for transonic flows and used to show that the method offers computational advantages over the conventional Beam and Warming scheme. Existing Beam and Warming codes can be retrofit with minimal effort. The theoretical extension of the matrix reduction technique to the full Navier-Stokes equations in Cartesian coordinates is presented in detail. Linear stability, using a Fourier stability analysis, is demonstrated and discussed for the one-dimensional Euler equations.

Development and characterization of polyethersulfone/TiO2 mixed matrix membranes for CO2/CH4 separation

NASA Astrophysics Data System (ADS)

Galaleldin, S.; Mannan, H. A.; Mukhtar, H.

2017-12-01

In this study, mixed matrix membranes comprised of polyethersulfone as the bulk polymer phase and titanium dioxide (TiO2) nanoparticles as the inorganic discontinuous phase were prepared for CO2/CH4 separation. Membranes were synthesized at filler loading of 0, 5, 10 and 15 wt % via dry phase inversion method. Morphology, chemical bonding and thermal characteristics of membranes were scrutinized utilizing different techniques, namely: Field Emission Scanning Electron Microscopy (FESEM), Fourier Transform InfraRed (FTIR) spectra and Thermogravimetric analysis (TGA) respectively. Membranes gas separation performance was evaluated for CO2 and CH4 gases at 4 bar feed pressure. The highest separation performance was achieved by mixed matrix membrane (MMM) at 5 % loading of TiO2.

Autofluorescent polarimetry of bile films in the liver pathology differentiation

NASA Astrophysics Data System (ADS)

Prysyazhnyuk, V. P.; Ushenko, Yu. O.; Dubolazov, O. V.; Ushenko, A. G.; Savich, V. O.; Karachevtsev, A. O.

2015-09-01

A new information optical technique of diagnostics of the structure of the polycrystalline bile films is proposed. The model of Mueller-matrix description of mechanisms of optical anisotropy of such objects as optical activity, birefringence, as well as linear and circular dichroism is suggested. The ensemble of informationally topical azimuthally stable Mueller-matrix invariants is determined. Within the statistical analysis of such parameters distributions the objective criteria of differentiation of the polycrystalline bile films taken from patients with fatty degeneration (group 1) chronic hepatitis (group 2) of the liver were determined. From the point of view of probative medicine the operational characteristics (sensitivity, specificity and accuracy) of the information-optical method of Mueller-matrix mapping of polycrystalline films of bile were found and its efficiency in diagnostics of pathological changes was demonstrated.

[Study on the determination of trace gallium in molybdenum-coated pyrolytic graphite tube by electrothermal absorption spectrometry].

PubMed

Huang, Yu-an; Zhou, Fang-qin; Long, Si-hua; Yang, Liu

2004-02-01

The effects on gallium atomization in the pyrolytic graphite tube imposed by different matrix modifiers and different coatings were discussed detailedly in this paper. In the presence of matrix modifier of Ni(NO3)2 the matrix interference was eliminated efficiently. The pyrolytic graphite tubes were coated differently with lanthanum, zirconium, and molybdenum to avoid producing gallium carbide. Results showed that the tube with molybdenum coating was the best. On this basis, the mechanism of gallium atomization in the molybdenum-coated pyrolytic graphite tube using Ni(NO3)2 as a matrix modifier was studied furthermore; in addition, the parameters of the operation were optimized. As a result, a new method improved in many aspects was developed to detect trace gallium in complicated sample of gangue. The outcomes of practical applications indicated that the method could satisfy the requests of analysis and that the manipulations were simple to achieve. The characteristic content, the detection limit, and the adding recoveries were 2.12 x 10(-11) g, 1.4 x 10(-10) g and 97.4%-102.7% respectively, and the relative standard deviation was less than or equal to 3.6% (n = 11).

A METHOD FOR IN-SITU CHARACTERIZATION OF RF HEATING IN PARALLEL TRANSMIT MRI

PubMed Central

Alon, Leeor; Deniz, Cem Murat; Brown, Ryan; Sodickson, Daniel K.; Zhu, Yudong

2012-01-01

In ultra high field magnetic resonance imaging, parallel radio-frequency (RF) transmission presents both opportunities and challenges for specific absorption rate (SAR) management. On one hand, parallel transmission provides flexibility in tailoring electric fields in the body while facilitating magnetization profile control. On the other hand, it increases the complexity of energy deposition as well as possibly exacerbating local SAR by improper design or delivery of RF pulses. This study shows that the information needed to characterize RF heating in parallel transmission is contained within a local power correlation matrix. Building upon a calibration scheme involving a finite number of magnetic resonance thermometry measurements, the present work establishes a way of estimating the local power correlation matrix. Determination of this matrix allows prediction of temperature change for an arbitrary parallel transmit RF pulse. In the case of a three transmit coil MR experiment in a phantom, determination and validation of the power correlation matrix was conducted in less than 200 minutes with induced temperature changes of <4 degrees C. Further optimization and adaptation are possible, and simulations evaluating potential feasibility for in vivo use are presented. The method allows general characteristics indicative of RF coil/pulse safety determined in situ. PMID:22714806

Fuzzy Reasoning to More Accurately Determine Void Areas on Optical Micrographs of Composite Structures

NASA Technical Reports Server (NTRS)

Dominquez, Jesus A.; Tate, Lanetra C.; Wright, M. Clara; Caraccio, Anne

2013-01-01

Accomplishing the best-performing composite matrix (resin) requires that not only the processing method but also the cure cycle generate low-void-content structures. If voids are present, the performance of the composite matrix will be significantly reduced. This is usually noticed by significant reductions in matrix-dominated properties, such as compression and shear strength. Voids in composite materials are areas that are absent of the composite components: matrix and fibers. The characteristics of the voids and their accurate estimation are critical to determine for high performance composite structures. One widely used method of performing void analysis on a composite structure sample is acquiring optical micrographs or Scanning Electron Microscope (SEM) images of lateral sides of the sample and retrieving the void areas within the micrographs/images using an image analysis technique. Segmentation for the retrieval and subsequent computation of void areas within the micrographs/images is challenging as the gray-scaled values of the void areas are close to the gray-scaled values of the matrix leading to the need of manually performing the segmentation based on the histogram of the micrographs/images to retrieve the void areas. The use of an algorithm developed by NASA and based on Fuzzy Reasoning (FR) proved to overcome the difficulty of suitably differentiate void and matrix image areas with similar gray-scaled values leading not only to a more accurate estimation of void areas on composite matrix micrographs but also to a faster void analysis process as the algorithm is fully autonomous.

Scattering Matrix for Typical Urban Anthropogenic Origin Cement Dust and Discrimination of Representative Atmospheric Particulates

NASA Astrophysics Data System (ADS)

Liu, Jia; Zhang, Yongming; Zhang, Qixing; Wang, Jinjun

2018-03-01

The complete scattering matrix for cement dust was measured as a function of scattering angle from 5° to 160° at a wavelength of 532 nm, as a representative of mineral dust of anthropogenic origin in urban areas. Other related characteristics of cement dust, such as particle size distribution, chemical composition, refractive index, and micromorphology, were also analyzed. For this objective, a newly improved apparatus was built and calibrated using water droplets. Measurements of water droplets were in good agreement with Lorenz-Mie calculations. To facilitate the direct applicability of measurements for cement dust in radiative transfer calculation, the synthetic scattering matrix was computed and defined over the full scattering angle range from 0° to 180°. The scattering matrices for cement dust and typical natural mineral dusts were found to be similar in trends and angular behaviors. Angular distributions of all matrix elements were confined to rather limited domains. To promote the application of light-scattering matrix in atmospheric observation and remote sensing, discrimination methods for various atmospheric particulates (cement dust, soot, smolder smoke, and water droplets) based on the angular distributions of their scattering matrix elements are discussed. The ratio -F12/F11 proved to be the most effective discrimination method when a single matrix element is employed; aerosol identification can be achieved based on -F12/F11 values at 90° and 160°. Meanwhile, the combinations of -F12/F11 with F22/F11 (or (F11 - F22)/(F11 + F22)) or -F12/F11 with F44/F11 at 160° can be used when multiple matrix elements at the same scattering angle are selected.

An EMG-Based Control for an Upper-Limb Power-Assist Exoskeleton Robot.

PubMed

Kiguchi, K; Hayashi, Y

2012-08-01

Many kinds of power-assist robots have been developed in order to assist self-rehabilitation and/or daily life motions of physically weak persons. Several kinds of control methods have been proposed to control the power-assist robots according to user's motion intention. In this paper, an electromyogram (EMG)-based impedance control method for an upper-limb power-assist exoskeleton robot is proposed to control the robot in accordance with the user's motion intention. The proposed method is simple, easy to design, humanlike, and adaptable to any user. A neurofuzzy matrix modifier is applied to make the controller adaptable to any users. Not only the characteristics of EMG signals but also the characteristics of human body are taken into account in the proposed method. The effectiveness of the proposed method was evaluated by the experiments.

Research on the development efficiency of regional high-end talent in China: A complex network approach

PubMed Central

Zhang, Wenbin

2017-01-01

In this paper, based on the panel data of 31 provinces and cities in China from 1991 to 2016, the regional development efficiency matrix of high-end talent is obtained by DEA method, and the matrix is converted into a continuous change of complex networks through the construction of sliding window. Using a series of continuous changes in the complex network topology statistics, the characteristics of regional high-end talent development efficiency system are analyzed. And the results show that the average development efficiency of high-end talent in the western region is at a low level. After 2005, the national regional high-end talent development efficiency network has both short-range relevance and long-range relevance in the evolution process. The central region plays an important intermediary role in the national regional high-end talent development system. And the western region has high clustering characteristics. With the implementation of the high-end talent policies with regional characteristics by different provinces and cities, the relevance of high-end talent development efficiency in various provinces and cities presents a weakening trend, and the geographical characteristics of high-end talent are more and more obvious. PMID:29272286

In vitro testing of curcumin based composites coatings as antitumoral systems against osteosarcoma cells

NASA Astrophysics Data System (ADS)

Tirca, I.; Mitran, V.; Marascu, V.; Brajnicov, S.; Ion, V.; Stokker-Cheregi, F.; Popovici, I. A.; Cimpean, A.; Dinca, V.; Dinescu, M.

2017-12-01

In this work, we propose a new design for biodegradable composite coatings obtained by laser methods, which are aimed at evaluating the effects of active antitumoral elements on osteosarcoma cells. Our approach relies on embedding curcumin, which is a natural polyphenol having antitumoral properties, within biodegradable copolymer coatings (i.e. polyvinyl alcohol-polyethylene glycol - PVA-PEG) by using matrix assisted pulsed laser evaporation (MAPLE). The structural and morphological characteristics of the coatings were tailored by using different solvents (water, ethanol, benzene, dimethylsufoxide) as deposition matrix. The morphological characteristics of the resulting films were investigated by atomic force microscopy (AFM), whereas their chemical composition was characterized by Fourier transform infrared spectroscopy (FTIR). These characteristics were correlated with the degradation behavior by using ellipsometry (SE) and AFM measurements data. The in vitro study of the MG-63 osteosarcoma cell behavior indicates that the developed hybrid coatings significantly decreased osteosarcoma cell viability and proliferation potential. The physico-chemical characteristics of the thin films, along with the preliminary in vitro analyses, suggest that our developed polymeric hybrid coatings represent an efficient way to tackle the design of antitumoral surfaces, with applications in biomedicine.

Methods for an investigation of the effect of material components on the mechanical characteristics of glass-fiber-reinforced plastics

NASA Technical Reports Server (NTRS)

Willax, H. O.

1980-01-01

The materials used in the production of glass reinforced plastics are discussed. Specific emphasis is given to matrix polyester materials, the reinforcing glass materials, and aspects of specimen preparation. Various methods of investigation are described, giving attention to optical impregnation and wetting measurements and the gravimetric determination of the angle of contact. Deformation measurements and approaches utilizing a piezoelectric device are also considered.

Some characteristics of matrix-assisted UV laser desorption/ionization mass spectrometric analysis of large proteins

NASA Astrophysics Data System (ADS)

Perera, I. K.; Kantartzoglou, S.; Dyer, P. E.

1996-12-01

We have performed experiments to explore the characteristics of the matrix-assisted laser desorption/ionization (MALDI) process and to ascertain optimal operational conditions for observing intact molecular ions of large proteins. In this study, several methods have been adopted for the preparation of analyte samples. Of these, the samples prepared with the simple dried-droplet method were found to be the most suitable for the generation of the large molecular clusters, while the near-uniform spin-coated samples were observed to produce highly reproducible molecular ion signals of relatively high mass resolutions. A resulting mass spectrum which illustrates the formation of cluster ions up to the 26-mer [26M+H]+ of bovine insulin corresponding to a mass of about 150,000 Da, is presented. The effect of fluence on the extent of clustering of protein molecules has been studied, the results revealing the existence of an optimum fluence for detecting the large cluster ions. Investigations have also indicated that the use of polyethylene-coated metallic substrates as sample supports can considerably reduce the fragmentation of the matrix/analyte molecular ions and the desorption of "neat" MALDI matrices deposited on these polyethylene-coated sample probes enhance their aggregation, forming up to the heptamer [7M+H]+ of the matrix, ferulic acid. The dependence of the mass resolution on the applied acceleration voltage and the desorption fluence has been examined and the results obtained are discussed in terms of a simple analysis of the linear time-of-flight mass spectrometer. A spectrum of chicken egg lysozyme (M~14,306) displaying the high mass resolutions (M/[Delta]M~690) that can be attained when the mass spectrometer is operated in the reflectron mode is also presented.

The concentration parameter thermal microstresses as the thermophysical characteristics of two-phase materials

NASA Astrophysics Data System (ADS)

Kuanishev, V. T.; Sachkov, I. N.; Sorogin, I. G.; Sorogina, T. I.

2017-11-01

Thermal strength is one of the main thermophysical characteristics of structural materials. For homogeneous systems it is determined by the strength characteristics of the material. While for inhomogeneous systems, in particular, multiphase ones, it is necessary to consider the nature of the microstructure. Heat resistant real materials such as steels are known to be multi-phase systems. One of the mechanisms of their destruction is associated with the presence of propagating heat fluxes that generate thermal stresses. The aim of this paper is to evaluate the patterns of the formation of spatial distributions of thermal stresses in matrix systems of round inclusions characterized by different mutual disposition. The spatial distributions of thermal stresses in a two-phase material characterized by a matrix structure with round inclusions are investigated. For the numerical solution of the problem of stationary thermal conductivity the finite element method with discretization of the medium by triangular elements is used. It was found that at certain points in the medium the values of thermal stresses are ten times higher than the average for the material. It is shown that the spatial distribution and the local magnitude of the temperature gradient depend on the shape of the particles of the phase components and the values of their thermal conductivities. It is considered that the elastic moduli of inclusion and matrix differ little from each other.

Transplantation of neurons derived from human iPS cells cultured on collagen matrix into guinea-pig cochleae.

PubMed

Ishikawa, Masaaki; Ohnishi, Hiroe; Skerleva, Desislava; Sakamoto, Tatsunori; Yamamoto, Norio; Hotta, Akitsu; Ito, Juichi; Nakagawa, Takayuki

2017-06-01

The present study examined the efficacy of a neural induction method for human induced pluripotent stem (iPS) cells to eliminate undifferentiated cells and to determine the feasibility of transplanting neurally induced cells into guinea-pig cochleae for replacement of spiral ganglion neurons (SGNs). A stepwise method for differentiation of human iPS cells into neurons was used. First, a neural induction method was established on Matrigel-coated plates; characteristics of cell populations at each differentiation step were assessed. Second, neural stem cells were differentiated into neurons on a three-dimensional (3D) collagen matrix, using the same protocol of culture on Matrigel-coated plates; neuron subtypes in differentiated cells on a 3D collagen matrix were examined. Then, human iPS cell-derived neurons cultured on a 3D collagen matrix were transplanted into intact guinea-pig cochleae, followed by histological analysis. In vitro analyses revealed successful induction of neural stem cells from human iPS cells, with no retention of undifferentiated cells expressing OCT3/4. After the neural differentiation of neural stem cells, approximately 70% of cells expressed a neuronal marker, 90% of which were positive for vesicular glutamate transporter 1 (VGLUT1). The expression pattern of neuron subtypes in differentiated cells on a 3D collagen matrix was identical to that of the differentiated cells on Matrigel-coated plates. In addition, the survival of transplant-derived neurons was achieved when inflammatory responses were appropriately controlled. Our preparation method for human iPS cell-derived neurons efficiently eliminated undifferentiated cells and contributed to the settlement of transplant-derived neurons expressing VGLUT1 in guinea-pig cochleae. Copyright © 2015 John Wiley & Sons, Ltd. Copyright © 2015 John Wiley & Sons, Ltd.

Determination of dissolved bromate in drinking water by ion chromatography and post column reaction: interlaboratory study.

PubMed

Cordeiro, Fernando; Robouch, Piotr; de la Calle, Maria Beatriz; Emteborg, Håkan; Charoud-Got, Jean; Schmitz, Franz

2011-01-01

A collaborative study, International Evaluation Measurement Programme-25a, was conducted in accordance with international protocols to determine the performance characteristics of an analytical method for the determination of dissolved bromate in drinking water. The method should fulfill the analytical requirements of Council Directive 98/83/EC (referred to in this work as the Drinking Water Directive; DWD). The new draft standard method under investigation is based on ion chromatography followed by post-column reaction and UV detection. The collaborating laboratories used the Draft International Organization for Standardization (ISO)/Draft International Standard (DIS) 11206 document. The existing standard method (ISO 15061:2001) is based on ion chromatography using suppressed conductivity detection, in which a preconcentration step may be required for the determination of bromate concentrations as low as 3 to 5 microg/L. The new method includes a dilution step that reduces the matrix effects, thus allowing the determination of bromate concentrations down to 0.5 microg/L. Furthermore, the method aims to minimize any potential interference of chlorite ions. The collaborative study investigated different types of drinking water, such as soft, hard, and mineral water. Other types of water, such as raw water (untreated), swimming pool water, a blank (named river water), and a bromate standard solution, were included as test samples. All test matrixes except the swimming pool water were spiked with high-purity potassium bromate to obtain bromate concentrations ranging from 1.67 to 10.0 microg/L. Swimming pool water was not spiked, as this water was incurred with bromate. Test samples were dispatched to 17 laboratories from nine different countries. Sixteen participants reported results. The repeatability RSD (RSD(r)) ranged from 1.2 to 4.1%, while the reproducibility RSD (RSDR) ranged from 2.3 to 5.9%. These precision characteristics compare favorably with those of ISO 15601. A thorough comparison of the performance characteristics is presented in this report. All method performance characteristics obtained in the frame of this collaborative study indicate that the draft ISO/DIS 11206 standard method meets the requirements set down by the DWD. It can, therefore, be considered to fit its intended analytical purpose.

First order coupled dynamic model of flexible space structures with time-varying configurations

NASA Astrophysics Data System (ADS)

Wang, Jie; Li, Dongxu; Jiang, Jianping

2017-03-01

This paper proposes a first order coupled dynamic modeling method for flexible space structures with time-varying configurations for the purpose of deriving the characteristics of the system. The model considers the first time derivative of the coordinate transformation matrix between the platform's body frame and the appendage's floating frame. As a result it can accurately predict characteristics of the system even if flexible appendages rotate with complex trajectory relative to the rigid part. In general, flexible appendages are fixed on the rigid platform or forced to rotate with a slow angular velocity. So only the zero order of the transformation matrix is considered in conventional models. However, due to neglecting of time-varying terms of the transformation matrix, these models introduce severe error when appendages, like antennas, for example, rotate with a fast speed relative to the platform. The first order coupled dynamic model for flexible space structures proposed in this paper resolve this problem by introducing the first time derivative of the transformation matrix. As a numerical example, a central core with a rotating solar panel is considered and the results are compared with those given by the conventional model. It has been shown that the first order terms are of great importance on the attitude of the rigid body and dynamic response of the flexible appendage.

Matrix effect on the performance of headspace solid phase microextraction method for the analysis of target volatile organic compounds (VOCs) in environmental samples.

PubMed

Higashikawa, Fábio S; Cayuela, Maria Luz; Roig, Asunción; Silva, Carlos A; Sánchez-Monedero, Miguel A

2013-11-01

Solid phase microextraction (SPME) is a fast, cheap and solvent free methodology widely used for environmental analysis. A SPME methodology has been optimized for the analysis of VOCs in a range of matrices covering different soils of varying textures, organic matrices from manures and composts from different origins, and biochars. The performance of the technique was compared for the different matrices spiked with a multicomponent VOC mixture, selected to cover different VOC groups of environmental relevance (ketone, terpene, alcohol, aliphatic hydrocarbons and alkylbenzenes). VOC recovery was dependent on the nature itself of the VOC and the matrix characteristics. The SPME analysis of non-polar compounds, such as alkylbenzenes, terpenes and aliphatic hydrocarbons, was markedly affected by the type of matrix as a consequence of the competition for the adsorption sites in the SPME fiber. These non-polar compounds were strongly retained in the biochar surfaces limiting the use of SPME for this type of matrices. However, this adsorption capacity was not evident when biochar had undergone a weathering/aging process through composting. Polar compounds (alcohol and ketone) showed a similar behavior in all matrices, as a consequence of the hydrophilic characteristics, affected by water content in the matrix. SPME showed a good performance for soils and organic matrices especially for non-polar compounds, achieving a limit of detection (LD) and limit of quantification (LQ) of 0.02 and 0.03 ng g(-1) for non-polar compounds and poor extraction for more hydrophilic and polar compounds (LD and LQ higher 310 and 490 ng g(-1)). The characteristics of the matrix, especially pH and organic matter, had a marked impact on SPME, due to the competition of the analytes for active sites in the fiber, but VOC biodegradation should not be discarded in matrices with active microbial biomass. Copyright © 2013 Elsevier Ltd. All rights reserved.

Polyolefin composites containing a phase change material

DOEpatents

Salyer, Ival O.

1991-01-01

A composite useful in thermal energy storage, said composite being formed of a polyolefin matrix having a phase change material such as a crystalline alkyl hydrocarbon incorporated therein, said polyolefin being thermally form stable; the composite is useful in forming pellets, sheets or fibers having thermal energy storage characteristics; methods for forming the composite are also disclosed.

Maintenance of a bone collagen phenotype by osteoblast-like cells in 3D periodic porous titanium (Ti-6Al-4 V) structures fabricated by selective electron beam melting

PubMed Central

Hrabe, Nikolas W.; Heinl, Peter; Bordia, Rajendra K.; Körner, Carolin; Fernandes, Russell J.

2013-01-01

Regular 3D periodic porous Ti-6Al-4 V structures were fabricated by the selective electron beam melting method (EBM) over a range of relative densities (0.17–0.40) and pore sizes (500–1500 μm). Structures were seeded with human osteoblast-like cells (SAOS-2) and cultured for four weeks. Cells multiplied within these structures and extracellular matrix collagen content increased. Type I and type V collagens typically synthesized by osteoblasts were deposited in the newly formed matrix with time in culture. High magnification scanning electron microscopy revealed cells attached to surfaces on the interior of the structures with an increasingly fibrous matrix. The in-vitro results demonstrate that the novel EBM-processed porous structures, designed to address the effect of stress-shielding, are conducive to osteoblast attachment, proliferation and deposition of a collagenous matrix characteristic of bone. PMID:23869614

Mueller-matrix invariants of optical anisotropy of the bile polycrystalline films in the diagnosis of human liver pathologies

NASA Astrophysics Data System (ADS)

Ushenko, V. O.; Prysyazhnyuk, V. P.; Dubolazov, O. V.; Savich, O. V.; Novakovska, O. Y.; Olar, O. V.

2015-09-01

The model of Mueller-matrix description of mechanisms of optical anisotropy typical for polycrystalline films of bile - optical activity, birefringence, as well as linear and circular dichroism - is suggested. Within the statistical analysis of such distributions the objective criteria of differentiation of films of bile from the dead you people different times were determined. From the point of view of probative medicine the operational characteristics (sensitivity, specificity and accuracy) of the method of Muellermatrix reconstruction of optical anisotropy parameters were found and its efficiency in another task - diagnostics of diseases of internal organs of rats was demonstrated.

Determining entire mean first-passage time for Cayley networks

NASA Astrophysics Data System (ADS)

Wang, Xiaoqian; Dai, Meifeng; Chen, Yufei; Zong, Yue; Sun, Yu; Su, Weiyi

In this paper, we consider the entire mean first-passage time (EMFPT) with random walks for Cayley networks. We use Laplacian spectra to calculate the EMFPT. Firstly, we calculate the constant term and monomial coefficient of characteristic polynomial. By using the Vieta theorem, we then obtain the sum of reciprocals of all nonzero eigenvalues of Laplacian matrix. Finally, we obtain the scaling of the EMFPT for Cayley networks by using the relationship between the sum of reciprocals of all nonzero eigenvalues of Laplacian matrix and the EMFPT. We expect that our method can be adapted to other types of self-similar networks, such as vicsek networks, polymer networks.

Does the performance of wet granulation and tablet hardness affect the drug dissolution profile of carvedilol in matrix tablets?

PubMed

Košir, Darjan; Ojsteršek, Tadej; Vrečer, Franc

2018-06-14

Wet granulation is mostly used process for manufacturing matrix tablets. Compared to the direct compression method, it allows for a better flow and compressibility properties of compression mixtures. Granulation, including process parameters and tableting, can influence critical quality attributes (CQAs) of hydrophilic matrix tablets. One of the most important CQAs is the drug release profile. We studied the influence of granulation process parameters (type of nozzle and water quantity used as granulation liquid) and tablet hardness on the drug release profile. Matrix tablets contained HPMC K4M hydrophilic matrix former and carvedilol as a model drug. The influence of selected HPMC characteristics on the drug release profile was also evaluated using two additional HPMC batches. For statistical evaluation, partial least square (PLS) models were generated for each time point of the drug release profile using the same number of latent factors. In this way, it was possible to evaluate how the importance of factors influencing drug dissolution changes in dependence on time throughout the drug release profile. The results of statistical evaluation show that the granulation process parameters (granulation liquid quantity and type of nozzle) and tablet hardness significantly influence the release profile. On the other hand, the influence of HPMC characteristics is negligible in comparison to the other factors studied. Using a higher granulation liquid quantity and the standard nozzle type results in larger granules with a higher density and lower porosity, which leads to a slower drug release profile. Lower tablet hardness also slows down the release profile.

Influence of different crosslinking treatments on the physical properties of collagen membranes.

PubMed

Charulatha, V; Rajaram, A

2003-02-01

The physical properties of collagen-based biomaterials are profoundly influenced by the method and extent of crosslinking. In this study, the influence of various crosslinking treatments on the physical properties of reconstituted collagen membranes was assessed. Five crosslinking agents viz., GTA, DMS, DTBP, a combination of DMS and GTA and acyl azide method were used to stabilize collagen matrices. Crosslinking density, swelling ratio, thermo-mechanical properties, stress-strain characteristics and resistance to collagenase digestion were determined to evaluate the physical properties of crosslinked matrices. GTA treatment induced the maximum number of crosslinks (13) while DMS treatment induced the minimum (7). Of the two diimidoesters (DMS and DTBP), DTBP was a more effective crosslinking agent due to the presence of disulphide bonds in the DTBP crosslinks. T(s) for DTBP and DMS crosslinked collagen were 80 degrees C and 70 degrees C, and their HIT values were 5.4 and 2.85MN/m(2), respectively. Low concentration of GTA (0.01%) increased the crosslinking density of an already crosslinked matrix (DMS treated matrix) from 7 to 12. Lowest fracture energy was observed for the acyl azide treated matrix (0.61MJ/m(3)) while the highest was observed for the GTA treated matrix (1.97MJ/m(3)). The tensile strength of GTA treated matrix was maximum (12.4MPa) and that of acyl azide treated matrix was minimum (7.2MPa). GTA, DTBP and acyl azide treated matrices were equally resistant to collagenase degradation with approximately 6% solubilization after 5h while the DMS treated was least stable with 52.4% solubilization after the same time period. The spatial orientation of amino acid side chain residues on collagen plays an important role in determining the crosslinking density and consequent physical properties of the collagen matrix.

Transport synthetic acceleration for long-characteristics assembly-level transport problems

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zika, M.R.; Adams, M.L.

2000-02-01

The authors apply the transport synthetic acceleration (TSA) scheme to the long-characteristics spatial discretization for the two-dimensional assembly-level transport problem. This synthetic method employs a simplified transport operator as its low-order approximation. Thus, in the acceleration step, the authors take advantage of features of the long-characteristics discretization that make it particularly well suited to assembly-level transport problems. The main contribution is to address difficulties unique to the long-characteristics discretization and produce a computationally efficient acceleration scheme. The combination of the long-characteristics discretization, opposing reflecting boundary conditions (which are present in assembly-level transport problems), and TSA presents several challenges. The authorsmore » devise methods for overcoming each of them in a computationally efficient way. Since the boundary angular data exist on different grids in the high- and low-order problems, they define restriction and prolongation operations specific to the method of long characteristics to map between the two grids. They implement the conjugate gradient (CG) method in the presence of opposing reflection boundary conditions to solve the TSA low-order equations. The CG iteration may be applied only to symmetric positive definite (SPD) matrices; they prove that the long-characteristics discretization yields an SPD matrix. They present results of the acceleration scheme on a simple test problem, a typical pressurized water reactor assembly, and a typical boiling water reactor assembly.« less

A parallel algorithm for computing the eigenvalues of a symmetric tridiagonal matrix

NASA Technical Reports Server (NTRS)

Swarztrauber, Paul N.

1993-01-01

A parallel algorithm, called polysection, is presented for computing the eigenvalues of a symmetric tridiagonal matrix. The method is based on a quadratic recurrence in which the characteristic polynomial is constructed on a binary tree from polynomials whose degree doubles at each level. Intervals that contain exactly one zero are determined by the zeros of polynomials at the previous level which ensures that different processors compute different zeros. The signs of the polynomials at the interval endpoints are determined a priori and used to guarantee that all zeros are found. The use of finite-precision arithmetic may result in multiple zeros; however, in this case, the intervals coalesce and their number determines exactly the multiplicity of the zero. For an N x N matrix the eigenvalues can be determined in O(log-squared N) time with N-squared processors and O(N) time with N processors. The method is compared with a parallel variant of bisection that requires O(N-squared) time on a single processor, O(N) time with N processors, and O(log N) time with N-squared processors.

Prediction of high temperature metal matrix composite ply properties

NASA Technical Reports Server (NTRS)

Caruso, J. J.; Chamis, C. C.

1988-01-01

The application of the finite element method (superelement technique) in conjunction with basic concepts from mechanics of materials theory is demonstrated to predict the thermomechanical behavior of high temperature metal matrix composites (HTMMC). The simulated behavior is used as a basis to establish characteristic properties of a unidirectional composite idealized an as equivalent homogeneous material. The ply properties predicted include: thermal properties (thermal conductivities and thermal expansion coefficients) and mechanical properties (moduli and Poisson's ratio). These properties are compared with those predicted by a simplified, analytical composite micromechanics model. The predictive capabilities of the finite element method and the simplified model are illustrated through the simulation of the thermomechanical behavior of a P100-graphite/copper unidirectional composite at room temperature and near matrix melting temperature. The advantage of the finite element analysis approach is its ability to more precisely represent the composite local geometry and hence capture the subtle effects that are dependent on this. The closed form micromechanics model does a good job at representing the average behavior of the constituents to predict composite behavior.

A hybrid method for determination of the acoustic impedance of an unflanged cylindrical duct for multimode wave

NASA Astrophysics Data System (ADS)

Snakowska, Anna; Jurkiewicz, Jerzy; Gorazd, Łukasz

2017-05-01

The paper presents derivation of the impedance matrix based on the rigorous solution of the wave equation obtained by the Wiener-Hopf technique for a semi-infinite unflanged cylindrical duct. The impedance matrix allows, in turn, calculate the acoustic impedance along the duct and, as a special case, the radiation impedance. The analysis is carried out for a multimode incident wave accounting for modes coupling on the duct outlet not only qualitatively but also quantitatively for a selected source operating inside. The quantitative evaluation of the acoustic impedance requires setting of modes amplitudes which has been obtained applying the mode decomposition method to the far-field pressure radiation measurements and theoretical formulae for single mode directivity characteristics for an unflanged duct. Calculation of the acoustic impedance for a non-uniform distribution of the sound pressure and the sound velocity on a duct cross section requires determination of the acoustic power transmitted along/radiated from a duct. In the paper, the impedance matrix, the power, and the acoustic impedance were derived as functions of Helmholtz number and distance from the outlet.

Investigation of Aspergillus fumigatus biofilm formation by various “omics” approaches

PubMed Central

Muszkieta, Laetitia; Beauvais, Anne; Pähtz, Vera; Gibbons, John G.; Anton Leberre, Véronique; Beau, Rémi; Shibuya, Kazutoshi; Rokas, Antonis; Francois, Jean M.; Kniemeyer, Olaf; Brakhage, Axel A.; Latgé, Jean P.

2013-01-01

In the lung, Aspergillus fumigatus usually forms a dense colony of filaments embedded in a polymeric extracellular matrix called biofilm (BF). This extracellular matrix embeds and glues hyphae together and protects the fungus from an outside hostile environment. This extracellular matrix is absent in fungal colonies grown under classical liquid shake conditions (PL), which were historically used to understand A. fumigatus pathobiology. Recent works have shown that the fungus in this aerial grown BF-like state exhibits reduced susceptibility to antifungal drugs and undergoes major metabolic changes that are thought to be associated to virulence. These differences in pathological and physiological characteristics between BF and liquid shake conditions suggest that the PL condition is a poor in vitro disease model. In the laboratory, A. fumigatus mycelium embedded by the extracellular matrix can be produced in vitro in aerial condition using an agar-based medium. To provide a global and accurate understanding of A. fumigatus in vitro BF growth, we utilized microarray, RNA-sequencing, and proteomic analysis to compare the global gene and protein expression profiles of A. fumigatus grown under BF and PL conditions. In this review, we will present the different signatures obtained with these three “omics” methods. We will discuss the advantages and limitations of each method and their complementarity. PMID:23407341

Simplified LCA and matrix methods in identifying the environmental aspects of a product system.

PubMed

Hur, Tak; Lee, Jiyong; Ryu, Jiyeon; Kwon, Eunsun

2005-05-01

In order to effectively integrate environmental attributes into the product design and development processes, it is crucial to identify the significant environmental aspects related to a product system within a relatively short period of time. In this study, the usefulness of life cycle assessment (LCA) and a matrix method as tools for identifying the key environmental issues of a product system were examined. For this, a simplified LCA (SLCA) method that can be applied to Electrical and Electronic Equipment (EEE) was developed to efficiently identify their significant environmental aspects for eco-design, since a full scale LCA study is usually very detailed, expensive and time-consuming. The environmentally responsible product assessment (ERPA) method, which is one of the matrix methods, was also analyzed. Then, the usefulness of each method in eco-design processes was evaluated and compared using the case studies of the cellular phone and vacuum cleaner systems. It was found that the SLCA and the ERPA methods provided different information but they complemented each other to some extent. The SLCA method generated more information on the inherent environmental characteristics of a product system so that it might be useful for new design/eco-innovation when developing a completely new product or method where environmental considerations play a major role from the beginning. On the other hand, the ERPA method gave more information on the potential for improving a product so that it could be effectively used in eco-redesign which intends to alleviate environmental impacts of an existing product or process.

Drainage basin characteristics from ERTS data

NASA Technical Reports Server (NTRS)

Hollyday, E. F. (Principal Investigator)

1975-01-01

The author has identified the following significant results. ERTS-derived measurements of forests, riparian vegetation, open water, and combined agricultural and urban land use were added to an available matrix of map-derived basin characteristics. The matrix of basin characteristics was correlated with 40 stream flow characteristics by multiple regression techniques. Fifteen out of the 40 equations were improved. If the technique can be transferred to other physiographic regions in the nation, the opportunity exists for a potential annual savings in operations of about $250,000.

Quasi-stationary states of an electron with linearly dependent effective mass in an open nanostructure within transmission coefficient and S-matrix methods

NASA Astrophysics Data System (ADS)

Seti, Julia; Tkach, Mykola; Voitsekhivska, Oxana

2018-03-01

The exact solutions of the Schrödinger equation for a double-barrier open semiconductor plane nanostructure are obtained by using two different approaches, within the model of the rectangular potential profile and the continuous position-dependent effective mass of the electron. The transmission coefficient and scattering matrix are calculated for the double-barrier nanostructure. The resonance energies and resonance widths of the electron quasi-stationary states are analyzed as a function of the size of the near-interface region between wells and barriers, where the effective mass linearly depends on the coordinate. It is established that, in both methods, the increasing size affects in a qualitatively similar way the spectral characteristics of the states, shifting the resonance energies into the low- or high-energy region and increasing the resonance widths. It is shown that the relative difference of resonance energies and widths of a certain state, obtained in the model of position-dependent effective mass and in the widespread abrupt model in physically correct range of near-interface sizes, does not exceed 0.5% and 5%, respectively, independently of the other geometrical characteristics of the structure.

An analytics of electricity consumption characteristics based on principal component analysis

NASA Astrophysics Data System (ADS)

Feng, Junshu

2018-02-01

Abstract . More detailed analysis of the electricity consumption characteristics can make demand side management (DSM) much more targeted. In this paper, an analytics of electricity consumption characteristics based on principal component analysis (PCA) is given, which the PCA method can be used in to extract the main typical characteristics of electricity consumers. Then, electricity consumption characteristics matrix is designed, which can make a comparison of different typical electricity consumption characteristics between different types of consumers, such as industrial consumers, commercial consumers and residents. In our case study, the electricity consumption has been mainly divided into four characteristics: extreme peak using, peak using, peak-shifting using and others. Moreover, it has been found that industrial consumers shift their peak load often, meanwhile commercial and residential consumers have more peak-time consumption. The conclusions can provide decision support of DSM for the government and power providers.

Stabilization of computational procedures for constrained dynamical systems

NASA Technical Reports Server (NTRS)

Park, K. C.; Chiou, J. C.

1988-01-01

A new stabilization method of treating constraints in multibody dynamical systems is presented. By tailoring a penalty form of the constraint equations, the method achieves stabilization without artificial damping and yields a companion matrix differential equation for the constraint forces; hence, the constraint forces are obtained by integrating the companion differential equation for the constraint forces in time. A principal feature of the method is that the errors committed in each constraint condition decay with its corresponding characteristic time scale associated with its constraint force. Numerical experiments indicate that the method yields a marked improvement over existing techniques.

Transient excitation and mechanical admittance test techniques for prediction of payload vibration environments

NASA Technical Reports Server (NTRS)

Kana, D. D.; Vargas, L. M.

1977-01-01

Transient excitation forces were applied separately to simple beam-and-mass launch vehicle and payload models to develop complex admittance functions for the interface and other appropriate points on the structures. These measured admittances were then analytically combined by a matrix representation to obtain a description of the coupled system dynamic characteristics. Response of the payload model to excitation of the launch vehicle model was predicted and compared with results measured on the combined models. These results are also compared with results of earlier work in which a similar procedure was employed except that steady-state sinusoidal excitation techniques were included. It is found that the method employing transient tests produces results that are better overall than the steady state methods. Furthermore, the transient method requires far less time to implement, and provides far better resolution in the data. However, the data acquisition and handling problem is more complex for this method. It is concluded that the transient test and admittance matrix prediction method can be a valuable tool for development of payload vibration tests.

Critical review of methods for risk ranking of food-related hazards, based on risks for human health.

PubMed

Van der Fels-Klerx, H J; Van Asselt, E D; Raley, M; Poulsen, M; Korsgaard, H; Bredsdorff, L; Nauta, M; D'agostino, M; Coles, D; Marvin, H J P; Frewer, L J

2018-01-22

This study aimed to critically review methods for ranking risks related to food safety and dietary hazards on the basis of their anticipated human health impacts. A literature review was performed to identify and characterize methods for risk ranking from the fields of food, environmental science and socio-economic sciences. The review used a predefined search protocol, and covered the bibliographic databases Scopus, CAB Abstracts, Web of Sciences, and PubMed over the period 1993-2013. All references deemed relevant, on the basis of predefined evaluation criteria, were included in the review, and the risk ranking method characterized. The methods were then clustered-based on their characteristics-into eleven method categories. These categories included: risk assessment, comparative risk assessment, risk ratio method, scoring method, cost of illness, health adjusted life years (HALY), multi-criteria decision analysis, risk matrix, flow charts/decision trees, stated preference techniques and expert synthesis. Method categories were described by their characteristics, weaknesses and strengths, data resources, and fields of applications. It was concluded there is no single best method for risk ranking. The method to be used should be selected on the basis of risk manager/assessor requirements, data availability, and the characteristics of the method. Recommendations for future use and application are provided.

Procollagen III N-terminal Propeptide and Desmosine are Released by Matrix Destruction in Pulmonary Tuberculosis

PubMed Central

Seddon, Jo; Kasprowicz, Victoria; Walker, Naomi F.; Yuen, Ho Ming; Sunpath, Henry; Tezera, Liku; Meintjes, Graeme; Wilkinson, Robert J.; Bishai, William R.; Friedland, Jon S.; Elkington, Paul T.

2013-01-01

Background. Tuberculosis is transmitted by patients with pulmonary disease. Matrix metalloproteinases (MMPs) drive lung destruction in tuberculosis but the resulting matrix degradation products (MDPs) have not been studied. We investigate the hypothesis that MMP activity generates matrix turnover products as correlates of lung pathology. Methods. Induced sputum and plasma were collected prospectively from human immunodeficiency virus (HIV) positive and negative patients with pulmonary tuberculosis and controls. Concentrations of MDPs and MMPs were analyzed by ELISA and Luminex array in 2 patient cohorts. Results. Procollagen III N-terminal propeptide (PIIINP) was 3.8-fold higher in induced sputum of HIV-uninfected tuberculosis patients compared to controls and desmosine, released during elastin degradation, was 2.4-fold higher. PIIINP was elevated in plasma of tuberculosis patients. Plasma PIIINP correlated with induced sputum MMP-1 concentrations and radiological scores, demonstrating that circulating MDPs reflect lung destruction. In a second patient cohort of mixed HIV seroprevalence, plasma PIIINP concentration was increased 3.0-fold above controls (P < .001). Plasma matrix metalloproteinase-8 concentrations were also higher in tuberculosis patients (P = .001). Receiver operating characteristic analysis utilizing these 2 variables demonstrated an area under the curve of 0.832 (P < .001). Conclusions. In pulmonary tuberculosis, MMP-driven immunopathology generates matrix degradation products. PMID:23922364

In Situ Thermal Generation of Silver Nanoparticles in 3D Printed Polymeric Structures.

PubMed

Fantino, Erika; Chiappone, Annalisa; Calignano, Flaviana; Fontana, Marco; Pirri, Fabrizio; Roppolo, Ignazio

2016-07-19

Polymer nanocomposites have always attracted the interest of researchers and industry because of their potential combination of properties from both the nanofillers and the hosting matrix. Gathering nanomaterials and 3D printing could offer clear advantages and numerous new opportunities in several application fields. Embedding nanofillers in a polymeric matrix could improve the final material properties but usually the printing process gets more difficult. Considering this drawback, in this paper we propose a method to obtain polymer nanocomposites by in situ generation of nanoparticles after the printing process. 3D structures were fabricated through a Digital Light Processing (DLP) system by disolving metal salts in the starting liquid formulation. The 3D fabrication is followed by a thermal treatment in order to induce in situ generation of metal nanoparticles (NPs) in the polymer matrix. Comprehensive studies were systematically performed on the thermo-mechanical characteristics, morphology and electrical properties of the 3D printed nanocomposites.

Two decades of prairie restoration at Fermilab, Batavia, Illinois

DOE Office of Scientific and Technical Information (OSTI.GOV)

Betz, R.F.; Lootens, R.J.; Becker, M.K.

1996-12-31

Successional Restoration is the method being used to restore the prairie at Fermilab on the former agricultural fields. This involves an initial planting, using aggressive species that have wide ecological tolerances which will grow well on abandoned agricultural fields. Collectively, these species are designated as the prairie matrix. The species used for this prairie matrix compete with and eventually eliminate most weedy species. They also provide an adequate fuel load capable of sustaining a fire within a few years after a site has been initially planted. Associated changes in the biological and physical structure of the soil help prepare themore » way for the successful introduction of plants of the later successional species. Only after the species of the prairie matrix are well established, is the species diversity increased by introducing species with narrower ecological tolerances. These species are thus characteristic of the later successional stages.« less

Comparative investigation on magnetic capture selectivity between single wires and a real matrix

NASA Astrophysics Data System (ADS)

Ren, Peng; Chen, Luzheng; Liu, Wenbo; Shao, Yanhai; Zeng, Jianwu

2018-03-01

High gradient magnetic separation (HGMS) achieves the effective separation to fine weakly magnetic minerals through a magnetic matrix. In practice, the matrix is made of numerous magnetic wires, so that an insight into the magnetic capture characteristics of single wires to magnetic minerals would provide a basic foundation for the optimum design and choice of real matrix. The magnetic capture selectivity of cylindrical and rectangular single wires in concentrating ilmenite minerals were investigated through a cyclic pulsating HGMS separator with its key operating parameters (magnetic induction, feed velocity and pulsating frequency) varied, and their capture selectivity characteristics were parallelly compared with that of a real 3.0 mm cylindrical matrix. It was found that the cylindrical single wires have superior capture selectivity to the rectangular one; and, the single wires and the real matrix have basically the same capture trend with changes in the key operating parameters, but the single wires have a much higher capture selectivity than that of real matrix.

Characteristics of Matrix Metals in Which Fast Diffusion of Foreign Metallic Elements Occurs

NASA Astrophysics Data System (ADS)

Mae, Yoshiharu

2018-04-01

A few foreign elements are known to diffuse faster than the self-diffusion of the matrix metal. However, the characteristics of the matrix metal, which contribute to such fast diffusion remain unknown. In this study, the diffusion coefficients of various elements were plotted on a TC-YM diagram. The matrix metals that show fast diffusion are located in the low thermal conductivity range of the TC-YM diagram, while diffuser elements that undergo fast diffusion are mainly gulf elements such as Fe, Ni, Co, Cr, and Cu. The gulf elements are those that show the largest combination of thermal conductivity and Young's modulus. The great difference in the electron mobility between the matrix metal and diffuser elements generates a repulsive force between them, and the repulsive force—acting between the soft and large atoms of the matrix metal and the hard and small atoms of the diffuser elements—deforms the atoms of the matrix metal to open passageways for fast diffusion of diffuser elements.

Complete polarization characterization of single plasmonic nanoparticle enabled by a novel Dark-field Mueller matrix spectroscopy system

PubMed Central

Chandel, Shubham; Soni, Jalpa; Ray, Subir kumar; Das, Anwesh; Ghosh, Anirudha; Raj, Satyabrata; Ghosh, Nirmalya

2016-01-01

Information on the polarization properties of scattered light from plasmonic systems are of paramount importance due to fundamental interest and potential applications. However, such studies are severely compromised due to the experimental difficulties in recording full polarization response of plasmonic nanostructures. Here, we report on a novel Mueller matrix spectroscopic system capable of acquiring complete polarization information from single isolated plasmonic nanoparticle/nanostructure. The outstanding issues pertaining to reliable measurements of full 4 × 4 spectroscopic scattering Mueller matrices from single nanoparticle/nanostructures are overcome by integrating an efficient Mueller matrix measurement scheme and a robust eigenvalue calibration method with a dark-field microscopic spectroscopy arrangement. Feasibility of quantitative Mueller matrix polarimetry and its potential utility is illustrated on a simple plasmonic system, that of gold nanorods. The demonstrated ability to record full polarization information over a broad wavelength range and to quantify the intrinsic plasmon polarimetry characteristics via Mueller matrix inverse analysis should lead to a novel route towards quantitative understanding, analysis/interpretation of a number of intricate plasmonic effects and may also prove useful towards development of polarization-controlled novel sensing schemes. PMID:27212687

A joint tracking method for NSCC based on WLS algorithm

NASA Astrophysics Data System (ADS)

Luo, Ruidan; Xu, Ying; Yuan, Hong

2017-12-01

Navigation signal based on compound carrier (NSCC), has the flexible multi-carrier scheme and various scheme parameters configuration, which enables it to possess significant efficiency of navigation augmentation in terms of spectral efficiency, tracking accuracy, multipath mitigation capability and anti-jamming reduction compared with legacy navigation signals. Meanwhile, the typical scheme characteristics can provide auxiliary information for signal synchronism algorithm design. This paper, based on the characteristics of NSCC, proposed a kind of joint tracking method utilizing Weighted Least Square (WLS) algorithm. In this method, the LS algorithm is employed to jointly estimate each sub-carrier frequency shift with the frequency-Doppler linear relationship, by utilizing the known sub-carrier frequency. Besides, the weighting matrix is set adaptively according to the sub-carrier power to ensure the estimation accuracy. Both the theory analysis and simulation results illustrate that the tracking accuracy and sensitivity of this method outperforms the single-carrier algorithm with lower SNR.

Wideband characterization of the complex wave number and characteristic impedance of sound absorbers.

PubMed

Salissou, Yacoubou; Panneton, Raymond

2010-11-01

Several methods for measuring the complex wave number and the characteristic impedance of sound absorbers have been proposed in the literature. These methods can be classified into single frequency and wideband methods. In this paper, the main existing methods are revisited and discussed. An alternative method which is not well known or discussed in the literature while exhibiting great potential is also discussed. This method is essentially an improvement of the wideband method described by Iwase et al., rewritten so that the setup is more ISO 10534-2 standard-compliant. Glass wool, melamine foam and acoustical/thermal insulator wool are used to compare the main existing wideband non-iterative methods with this alternative method. It is found that, in the middle and high frequency ranges the alternative method yields results that are comparable in accuracy to the classical two-cavity method and the four-microphone transfer-matrix method. However, in the low frequency range, the alternative method appears to be more accurate than the other methods, especially when measuring the complex wave number.

Metal-matrix composites: Status and prospects

NASA Technical Reports Server (NTRS)

1974-01-01

Applications of metal matrix composites for air frames and jet engine components are discussed. The current state of the art in primary and secondary fabrication is presented. The present and projected costs were analyzed to determine the cost effectiveness of metal matrix composites. The various types of metal matrix composites and their characteristics are described.

A study of autonomous satellite navigation methods using the global positioning satellite system

NASA Technical Reports Server (NTRS)

Tapley, B. D.

1980-01-01

Special orbit determination algorithms were developed to accommodate the size and speed limitations of on-board computer systems of the NAVSTAR Global Positioning System. The algorithms use square root sequential filtering methods. A new method for the time update of the square root covariance matrix was also developed. In addition, the time update method was compared with another square root convariance propagation method to determine relative performance characteristics. Comparisions were based on the results of computer simulations of the LANDSAT-D satellite processing pseudo range and pseudo range-rate measurements from the phase one GPS. A summary of the comparison results is presented.

Radio-physical properties of radiotransparent thermal protection materials in ablation mode

NASA Astrophysics Data System (ADS)

Petrovskiy, V. P.; Pakhomov, E. P.; Politiko, A. A.; Semenenko, V. N.; Chistyaev, V. A.; Balakirev, B. A.; Pervov, A. Yu; Kamalov, A. D.; Sotskova, L. P.

2018-01-01

Experimental method for assessing the impact of the effects of high-temperature ablation processes on the radio physical characteristics of radiotransparent thermal protection materials (RTPM) is developed. Researches for the following RTPM with various structures of glass fillers are completed: press material (radiotransparent thermal protection press material or RTP-200); glass-fiber laminate (glass-fiber radiotransparent organic ceramic matrix or GFR-CM); reinforced composite material of class SiO2-SiO2 (high-temperature radiotransparent ceramic organic matrix or HTRC-OM). The influence of physicochemical transformations in the surface layer of RTPM on transmission and reflection coefficients of electromagnetic waves of RTPM samples and on the value of their complex permittivity is determined.

Low-rank matrix decomposition and spatio-temporal sparse recovery for STAP radar

DOE PAGES

Sen, Satyabrata

2015-08-04

We develop space-time adaptive processing (STAP) methods by leveraging the advantages of sparse signal processing techniques in order to detect a slowly-moving target. We observe that the inherent sparse characteristics of a STAP problem can be formulated as the low-rankness of clutter covariance matrix when compared to the total adaptive degrees-of-freedom, and also as the sparse interference spectrum on the spatio-temporal domain. By exploiting these sparse properties, we propose two approaches for estimating the interference covariance matrix. In the first approach, we consider a constrained matrix rank minimization problem (RMP) to decompose the sample covariance matrix into a low-rank positivemore » semidefinite and a diagonal matrix. The solution of RMP is obtained by applying the trace minimization technique and the singular value decomposition with matrix shrinkage operator. Our second approach deals with the atomic norm minimization problem to recover the clutter response-vector that has a sparse support on the spatio-temporal plane. We use convex relaxation based standard sparse-recovery techniques to find the solutions. With extensive numerical examples, we demonstrate the performances of proposed STAP approaches with respect to both the ideal and practical scenarios, involving Doppler-ambiguous clutter ridges, spatial and temporal decorrelation effects. As a result, the low-rank matrix decomposition based solution requires secondary measurements as many as twice the clutter rank to attain a near-ideal STAP performance; whereas the spatio-temporal sparsity based approach needs a considerably small number of secondary data.« less

A review of modern instrumental techniques for measurements of ice cream characteristics.

PubMed

Bahram-Parvar, Maryam

2015-12-01

There is an increasing demand of the food industries and research institutes to have means of measurement allowing the characterization of foods. Ice cream, as a complex food system, consists of a frozen matrix containing air bubbles, fat globules, ice crystals, and an unfrozen serum phase. Some deficiencies in conventional methods for testing this product encourage the use of alternative techniques such as rheometry, spectroscopy, X-ray, electro-analytical techniques, ultrasound, and laser. Despite the development of novel instrumental applications in food science, use of some of them in ice cream testing is few, but has shown promising results. Developing the novel methods should increase our understanding of characteristics of ice cream and may allow online testing of the product. This review article discusses the potential of destructive and non-destructive methodologies in determining the quality and characteristics of ice cream and similar products. Copyright © 2015. Published by Elsevier Ltd.

Rule Extracting based on MCG with its Application in Helicopter Power Train Fault Diagnosis

NASA Astrophysics Data System (ADS)

Wang, M.; Hu, N. Q.; Qin, G. J.

2011-07-01

In order to extract decision rules for fault diagnosis from incomplete historical test records for knowledge-based damage assessment of helicopter power train structure. A method that can directly extract the optimal generalized decision rules from incomplete information based on GrC was proposed. Based on semantic analysis of unknown attribute value, the granule was extended to handle incomplete information. Maximum characteristic granule (MCG) was defined based on characteristic relation, and MCG was used to construct the resolution function matrix. The optimal general decision rule was introduced, with the basic equivalent forms of propositional logic, the rules were extracted and reduction from incomplete information table. Combined with a fault diagnosis example of power train, the application approach of the method was present, and the validity of this method in knowledge acquisition was proved.

Quantitative evaluation of polymer concentration profile during swelling of hydrophilic matrix tablets using 1H NMR and MRI methods.

PubMed

Baumgartner, Sasa; Lahajnar, Gojmir; Sepe, Ana; Kristl, Julijana

2005-02-01

Many pharmaceutical tablets are based on hydrophilic polymers, which, after exposure to water, form a gel layer around the tablet that limits the dissolution and diffusion of the drug and provides a mechanism for controlled drug release. Our aim was to determine the thickness of the swollen gel layer of matrix tablets and to develop a method for calculating the polymer concentration profile across the gel layer. MR imaging has been used to investigate the in situ swelling behaviour of cellulose ether matrix tablets and NMR spectroscopy experiments were performed on homogeneous hydrogels with known polymer concentration. The MRI results show that the thickest gel layer was observed for hydroxyethylcellulose tablets, followed by definitely thinner but almost equal gel layer for hydroxypropylcellulose and hydroxypropylmethylcellulose of both molecular weights. The water proton NMR relaxation parameters were combined with the MRI data to obtain a quantitative description of the swelling process on the basis of the concentrations and mobilities of water and polymer as functions of time and distance. The different concentration profiles observed after the same swelling time are the consequence of the different polymer characteristics. The procedure developed here could be used as a general method for calculating polymer concentration profiles on other similar polymeric systems.

Rotordynamic analysis using the Complex Transfer Matrix: An application to elastomer supports using the viscoelastic correspondence principle

NASA Astrophysics Data System (ADS)

Varney, Philip; Green, Itzhak

2014-11-01

Numerous methods are available to calculate rotordynamic whirl frequencies, including analytic methods, finite element analysis, and the transfer matrix method. The typical real-valued transfer matrix (RTM) suffers from several deficiencies, including lengthy computation times and the inability to distinguish forward and backward whirl. Though application of complex coordinates in rotordynamic analysis is not novel per se, specific advantages gained from using such coordinates in a transfer matrix analysis have yet to be elucidated. The present work employs a complex coordinate redefinition of the transfer matrix to obtain reduced forms of the elemental transfer matrices in inertial and rotating reference frames, including external stiffness and damping. Application of the complex-valued state variable redefinition results in a reduction of the 8×8 RTM to the 4×4 Complex Transfer Matrix (CTM). The CTM is advantageous in that it intrinsically separates forward and backward whirl, eases symbolic manipulation by halving the transfer matrices’ dimension, and provides significant improvement in computation time. A symbolic analysis is performed on a simple overhung rotor to demonstrate the mathematical motivation for whirl frequency separation. The CTM's utility is further shown by analyzing a rotordynamic system supported by viscoelastic elastomer rings. Viscoelastic elastomer ring supports can provide significant damping while reducing the cost and complexity associated with conventional components such as squeeze film dampers. The stiffness and damping of a viscoelastic damper ring are determined herein as a function of whirl frequency using the viscoelastic correspondence principle and a constitutive fractional calculus viscoelasticity model. The CTM is then employed to obtain the characteristic equation, where the whirl frequency dependent stiffness and damping of the elastomer supports are included. The Campbell diagram is shown, demonstrating the CTM's ability to intrinsically separate synchronous whirl direction for a non-trivial rotordynamic system. Good agreement is found between the CTM results and previously obtained analytic and experimental results for the elastomer ring supported rotordynamic system.

Stiffness modeling of compliant parallel mechanisms and applications in the performance analysis of a decoupled parallel compliant stage

NASA Astrophysics Data System (ADS)

Jiang, Yao; Li, Tie-Min; Wang, Li-Ping

2015-09-01

This paper investigates the stiffness modeling of compliant parallel mechanism (CPM) based on the matrix method. First, the general compliance matrix of a serial flexure chain is derived. The stiffness modeling of CPMs is next discussed in detail, considering the relative positions of the applied load and the selected displacement output point. The derived stiffness models have simple and explicit forms, and the input, output, and coupling stiffness matrices of the CPM can easily be obtained. The proposed analytical model is applied to the stiffness modeling and performance analysis of an XY parallel compliant stage with input and output decoupling characteristics. Then, the key geometrical parameters of the stage are optimized to obtain the minimum input decoupling degree. Finally, a prototype of the compliant stage is developed and its input axial stiffness, coupling characteristics, positioning resolution, and circular contouring performance are tested. The results demonstrate the excellent performance of the compliant stage and verify the effectiveness of the proposed theoretical model. The general stiffness models provided in this paper will be helpful for performance analysis, especially in determining coupling characteristics, and the structure optimization of the CPM.

Coal-cleaning plant refuse characterization

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cavalet, J.R.; Torak, E.R.

1985-06-01

This report describes a study performed for the Electric Power Research Institute's Coal Cleaning Test Facility in Homer City, Pennsylvania. The purpose of the study was to design a standard methods for chemically and physically classifying refuse generated by physical coal cleaning and to construct a matrix that will accurately predict how a particular refuse will react to particular disposal methods - based solely on raw-coal characteristics and the process used to clean the coal. The value of such a classification system (which has not existed to this point) is the ability to design efficient and economical systems for disposingmore » of specific coal cleaning refuse. The report describes the project's literature search and a four-tier classification system. It also provides designs for test piles, sampling procedures, and guidelines for a series of experiments to test the classfication system and create an accurate, reliable predictive matrix. 38 refs., 39 figs., 35 tabs.« less

Improvement in Brightness Uniformity by Compensating for the Threshold Voltages of Both the Driving Thin-Film Transistor and the Organic Light-Emitting Diode for Active-Matrix Organic Light-Emitting Diode Displays

NASA Astrophysics Data System (ADS)

Ching-Lin Fan,; Hui-Lung Lai,; Jyu-Yu Chang,

2010-05-01

In this paper, we propose a novel pixel design and driving method for active-matrix organic light-emitting diode (AM-OLED) displays using low-temperature polycrystalline silicon thin-film transistors (LTPS-TFTs). The proposed threshold voltage compensation circuit, which comprised five transistors and two capacitors, has been verified to supply uniform output current by simulation work using the automatic integrated circuit modeling simulation program with integrated circuit emphasis (AIM-SPICE) simulator. The driving scheme of this voltage programming method includes four periods: precharging, compensation, data input, and emission. The simulated results demonstrate excellent properties such as low error rate of OLED anode voltage variation (<1%) and high output current. The proposed pixel circuit shows high immunity to the threshold voltage deviation characteristics of both the driving poly-Si TFT and the OLED.

A New Low Temperature Polycrystalline Silicon Thin Film Transistor Pixel Circuit for Active Matrix Organic Light Emitting Diode

NASA Astrophysics Data System (ADS)

Ching-Lin Fan,; Yi-Yan Lin,; Jyu-Yu Chang,; Bo-Jhang Sun,; Yan-Wei Liu,

2010-06-01

This study presents one novel compensation pixel design and driving method for active matrix organic light-emitting diode (AMOLED) displays that use low-temperature polycrystalline silicon thin-film transistors (LTPS-TFTs) with a voltage feed-back method and the simulation results are proposed and verified by SPICE simulator. The measurement and simulation of LTPS TFT characteristics demonstrate the good fitting result. The proposed circuit consists of four TFTs and two capacitors with an additional signal line. The error rates of OLED anode voltage variation are below 0.3% under the threshold voltage deviation of driving TFT (Δ VTH = ± 0.33 V). The simulation results show that the pixel design can improve the display image non-uniformity by compensating the threshold voltage deviation of driving TFT and the degradation of OLED threshold voltage at the same time.

A New Low Temperature Polycrystalline Silicon Thin Film Transistor Pixel Circuit for Active Matrix Organic Light Emitting Diode

NASA Astrophysics Data System (ADS)

Fan, Ching-Lin; Lin, Yi-Yan; Chang, Jyu-Yu; Sun, Bo-Jhang; Liu, Yan-Wei

2010-06-01

This study presents one novel compensation pixel design and driving method for active matrix organic light-emitting diode (AMOLED) displays that use low-temperature polycrystalline silicon thin-film transistors (LTPS-TFTs) with a voltage feed-back method and the simulation results are proposed and verified by SPICE simulator. The measurement and simulation of LTPS TFT characteristics demonstrate the good fitting result. The proposed circuit consists of four TFTs and two capacitors with an additional signal line. The error rates of OLED anode voltage variation are below 0.3% under the threshold voltage deviation of driving TFT (ΔVTH = ±0.33 V). The simulation results show that the pixel design can improve the display image non-uniformity by compensating the threshold voltage deviation of driving TFT and the degradation of OLED threshold voltage at the same time.

Snapshot Mueller polarimetry for biomedical diagnostic related to human liver fibrosis: evaluation of the method for biomedical assessments

NASA Astrophysics Data System (ADS)

Babilotte, P.; Dubreuil, M.; Rivet, S.; Lijour, Y.; Sevrain, D.; Martin, L.; Le Brun, G.; Le Grand, Y.; Le Jeune, B.

2011-10-01

Human liver biopsy samples, consisting into a 16 μm thickness biomaterial chemically fixed into a formaldehyde matrix, and stained by red picrosirius dye, are analysed for different states of fibrosis degeneration. Polarimetric methods, and specially Mueller polarimetry based on wavelength coding, have been qualified as an efficient tool to describe many different biological aspects. The polarimetric characteristics of the media, extracted from a Lu and Chipman decomposition1, 2 of their Mueller Matrix (MM), are correlated with the degeneracy level of tissue. Different works and results linked to the clinical analysis will be presented and compared to previous performed works.3 Polarimetric imaging will be presented and compared with SHG measurements. A statistical analysis of the distribution of polarimetric parameters (such as the retardance R and depolarisation Pd) will be presented too, in order to characterise the liver fibrosis level into the biomaterial under study.

Multi-criteria decision making development of ion chromatographic method for determination of inorganic anions in oilfield waters based on artificial neural networks retention model.

PubMed

Stefanović, Stefica Cerjan; Bolanča, Tomislav; Luša, Melita; Ukić, Sime; Rogošić, Marko

2012-02-24

This paper describes the development of ad hoc methodology for determination of inorganic anions in oilfield water, since their composition often significantly differs from the average (concentration of components and/or matrix). Therefore, fast and reliable method development has to be performed in order to ensure the monitoring of desired properties under new conditions. The method development was based on computer assisted multi-criteria decision making strategy. The used criteria were: maximal value of objective functions used, maximal robustness of the separation method, minimal analysis time, and maximal retention distance between two nearest components. Artificial neural networks were used for modeling of anion retention. The reliability of developed method was extensively tested by the validation of performance characteristics. Based on validation results, the developed method shows satisfactory performance characteristics, proving the successful application of computer assisted methodology in the described case study. Copyright © 2011 Elsevier B.V. All rights reserved.

Method for thermal processing alumina-enriched spinel single crystals

DOEpatents

Jantzen, Carol M.

1995-01-01

A process for age-hardening alumina-rich magnesium aluminum spinel to obtain the desired combination of characteristics of hardness, clarity, flexural strength and toughness comprises selection of the time-temperature pair for isothermal heating followed by quenching. The time-temperature pair is selected from the region wherein the precipitate groups have the characteristics sought. The single crystal spinel is isothermally heated and will, if heated long enough pass from its single phase through two pre-precipitates and two metastable precipitates to a stable secondary phase precipitate within the spinel matrix. Quenching is done slowly at first to avoid thermal shock, then rapidly.

Diagonally Implicit Runge-Kutta Methods for Ordinary Differential Equations. A Review

NASA Technical Reports Server (NTRS)

Kennedy, Christopher A.; Carpenter, Mark H.

2016-01-01

A review of diagonally implicit Runge-Kutta (DIRK) methods applied to rst-order ordinary di erential equations (ODEs) is undertaken. The goal of this review is to summarize the characteristics, assess the potential, and then design several nearly optimal, general purpose, DIRK-type methods. Over 20 important aspects of DIRKtype methods are reviewed. A design study is then conducted on DIRK-type methods having from two to seven implicit stages. From this, 15 schemes are selected for general purpose application. Testing of the 15 chosen methods is done on three singular perturbation problems. Based on the review of method characteristics, these methods focus on having a stage order of two, sti accuracy, L-stability, high quality embedded and dense-output methods, small magnitudes of the algebraic stability matrix eigenvalues, small values of aii, and small or vanishing values of the internal stability function for large eigenvalues of the Jacobian. Among the 15 new methods, ESDIRK4(3)6L[2]SA is recommended as a good default method for solving sti problems at moderate error tolerances.

Design and Analyze a New Measuring Lift Device for Fin Stabilizers Using Stiffness Matrix of Euler-Bernoulli Beam

PubMed Central

Liang, Lihua; Sun, Mingxiao; Shi, Hongyu; Luan, Tiantian

2017-01-01

Fin-angle feedback control is usually used in conventional fin stabilizers, and its actual anti-rolling effect is difficult to reach theoretical design requirements. Primarily, lift of control torque is a theoretical value calculated by static hydrodynamic characteristics of fin. However, hydrodynamic characteristics of fin are dynamic while fin is moving in waves. As a result, there is a large deviation between actual value and theoretical value of lift. Firstly, the reasons of deviation are analyzed theoretically, which could avoid a variety of interference factors and complex theoretical derivations. Secondly, a new device is designed for direct measurement of actual lift, which is composed of fin-shaft combined mechanism and sensors. This new device can make fin-shaft not only be the basic function of rotating fin, but also detect actual lift. Through analysis using stiffness matrix of Euler-Bernoulli beam, displacement of shaft-core end is measured instead of lift which is difficult to measure. Then quantitative relationship between lift and displacement is defined. Three main factors are analyzed with quantitative relationship. What is more, two installation modes of sensors and a removable shaft-end cover are proposed according to hydrodynamic characteristics of fin. Thus the new device contributes to maintenance and measurement. Lastly, the effectiveness and accuracy of device are verified by contrasting calculation and simulation on the basis of actual design parameters. And the new measuring lift method can be proved to be effective through experiments. The new device is achieved from conventional fin stabilizers. Accordingly, the reliability of original equipment is inherited. The alteration of fin stabilizers is minor, which is suitable for engineering application. In addition, the flexural properties of fin-shaft are digitized with analysis of stiffness matrix. This method provides theoretical support for engineering application by carrying out finite element analysis with computers. PMID:28046122

Deterministic and stochastic methods of calculation of polarization characteristics of radiation in natural environment

NASA Astrophysics Data System (ADS)

Strelkov, S. A.; Sushkevich, T. A.; Maksakova, S. V.

2017-11-01

We are talking about russian achievements of the world level in the theory of radiation transfer, taking into account its polarization in natural media and the current scientific potential developing in Russia, which adequately provides the methodological basis for theoretically-calculated research of radiation processes and radiation fields in natural media using supercomputers and mass parallelism. A new version of the matrix transfer operator is proposed for solving problems of polarized radiation transfer in heterogeneous media by the method of influence functions, when deterministic and stochastic methods can be combined.

Near-infrared fluorescence image quality test methods for standardized performance evaluation

NASA Astrophysics Data System (ADS)

Kanniyappan, Udayakumar; Wang, Bohan; Yang, Charles; Ghassemi, Pejhman; Wang, Quanzeng; Chen, Yu; Pfefer, Joshua

2017-03-01

Near-infrared fluorescence (NIRF) imaging has gained much attention as a clinical method for enhancing visualization of cancers, perfusion and biological structures in surgical applications where a fluorescent dye is monitored by an imaging system. In order to address the emerging need for standardization of this innovative technology, it is necessary to develop and validate test methods suitable for objective, quantitative assessment of device performance. Towards this goal, we develop target-based test methods and investigate best practices for key NIRF imaging system performance characteristics including spatial resolution, depth of field and sensitivity. Characterization of fluorescence properties was performed by generating excitation-emission matrix properties of indocyanine green and quantum dots in biological solutions and matrix materials. A turbid, fluorophore-doped target was used, along with a resolution target for assessing image sharpness. Multi-well plates filled with either liquid or solid targets were generated to explore best practices for evaluating detection sensitivity. Overall, our results demonstrate the utility of objective, quantitative, target-based testing approaches as well as the need to consider a wide range of factors in establishing standardized approaches for NIRF imaging system performance.

The analysis of composite properties reinforced with particles from palm oil industry waste produced by casting methods

NASA Astrophysics Data System (ADS)

Tugiman; Ariani, F.; Taher, F.; Hasibuan, M. S.; Suprianto

2017-12-01

Palm oil processing industries are very attractive because they offer plenty products with high economic value. The CPO factory processes not only produces crude palm oil but also generates fly ash (FA) particles waste in its final process. The purpose of this investigation to analyze and increase the benefits of particles as reinforcement materials for fabricating aluminum matrix composites (AMC’s) by different casting route. Stirring, centrifugal and squeeze casting method was conducted in this study. Further, the chemical composition of FA particles, densities and mechanical properties have been analyzed. The characteristics of composite material were investigated using an Optical microscope, scanning electron microscope (SEM), hardness (Brinell), impact strength (Charpy). The pin on disc method was used to measure the wear rate. The results show that SiO2, Fe2O3, and Al2O3 are the main compounds of fly ash particles. These particles enhanced the hardness and reduce wear resistance of aluminum matrix composites. The squeeze method gives better results than stir and centrifugal casting.

Derivatives of random matrix characteristic polynomials with applications to elliptic curves

NASA Astrophysics Data System (ADS)

Snaith, N. C.

2005-12-01

The value distribution of derivatives of characteristic polynomials of matrices from SO(N) is calculated at the point 1, the symmetry point on the unit circle of the eigenvalues of these matrices. We consider subsets of matrices from SO(N) that are constrained to have at least n eigenvalues equal to 1 and investigate the first non-zero derivative of the characteristic polynomial at that point. The connection between the values of random matrix characteristic polynomials and values of L-functions in families has been well established. The motivation for this work is the expectation that through this connection with L-functions derived from families of elliptic curves, and using the Birch and Swinnerton-Dyer conjecture to relate values of the L-functions to the rank of elliptic curves, random matrix theory will be useful in probing important questions concerning these ranks.

Design of distributed PID-type dynamic matrix controller for fractional-order systems

NASA Astrophysics Data System (ADS)

Wang, Dawei; Zhang, Ridong

2018-01-01

With the continuous requirements for product quality and safety operation in industrial production, it is difficult to describe the complex large-scale processes with integer-order differential equations. However, the fractional differential equations may precisely represent the intrinsic characteristics of such systems. In this paper, a distributed PID-type dynamic matrix control method based on fractional-order systems is proposed. First, the high-order approximate model of integer order is obtained by utilising the Oustaloup method. Then, the step response model vectors of the plant is obtained on the basis of the high-order model, and the online optimisation for multivariable processes is transformed into the optimisation of each small-scale subsystem that is regarded as a sub-plant controlled in the distributed framework. Furthermore, the PID operator is introduced into the performance index of each subsystem and the fractional-order PID-type dynamic matrix controller is designed based on Nash optimisation strategy. The information exchange among the subsystems is realised through the distributed control structure so as to complete the optimisation task of the whole large-scale system. Finally, the control performance of the designed controller in this paper is verified by an example.

Magnetization measurements reveal the local shear stiffness of hydrogels probed by ferromagnetic nanorods

NASA Astrophysics Data System (ADS)

Bender, P.; Tschöpe, A.; Birringer, R.

2014-12-01

The local mechanical coupling of ferromagnetic nanorods in hydrogels was characterized by magnetization measurements. Nickel nanorods were synthesized by the AAO-template method and embedded in gelatine hydrogels with mechanically soft or hard matrix properties determined by the gelatine weight fraction. By applying a homogeneous magnetic field during gelation the nanorods were aligned along the field resulting in uniaxially textured ferrogels. The magnetization curves of the soft ferrogel exhibited not only important similarities but also characteristic differences as compared to the hard ferrogel. The hystereses measured in a field parallel to the texture axis were almost identical for both samples indicating effective coupling of the nanorods with the polymer network. By contrast, measurements in a magnetic field perpendicular to the texture axis revealed a much higher initial susceptibility of the soft as compared to the hard ferrogel. This difference was attributed to the additional rotation of the nanorods allowed by the reduced shear modulus in the soft ferrogel matrix. Two methods for data analysis were presented which enabled us to determine the shear modulus of the gelatine matrix which was interpreted as a local rather than macroscopic quantity in consideration of the nanoscale of the probe particles.

Matrix and fine-grained rims in the unequilibrated CO3 chondrite, ALHA77307 - Origins and evidence for diverse, primitive nebular dust components

NASA Technical Reports Server (NTRS)

Brearley, Adrian J.

1993-01-01

SEM, TEM, and electron microprobe analysis were used to investigate in detail the mineralogical and chemical characteristics of dark matrix and fine-grained rims in the unequilibrated CO3 chondrite ALHA77307. Data obtained revealed that there was a remarkable diversity of distinct mineralogical components, which can be identified using their chemical and textural characteristics. The matrix and rim components in ALHA77307 formed by disequilibrium condensation process as fine-grained amorphous dust that is represented by the abundant amorphous component in the matrix. Subsequent thermal processing of this condensate material, in a variety of environments in the nebula, caused partial or complete recrystallization of the fine-grained dust.

Identification and modification of dominant noise sources in diesel engines

NASA Astrophysics Data System (ADS)

Hayward, Michael D.

Determination of dominant noise sources in diesel engines is an integral step in the creation of quiet engines, but is a process which can involve an extensive series of expensive, time-consuming fired and motored tests. The goal of this research is to determine dominant noise source characteristics of a diesel engine in the near and far-fields with data from fewer tests than is currently required. Pre-conditioning and use of numerically robust methods to solve a set of cross-spectral density equations results in accurate calculation of the transfer paths between the near- and far-field measurement points. Application of singular value decomposition to an input cross-spectral matrix determines the spectral characteristics of a set of independent virtual sources, that, when scaled and added, result in the input cross spectral matrix. Each virtual source power spectral density is a singular value resulting from the decomposition performed over a range of frequencies. The complex relationship between virtual and physical sources is estimated through determination of virtual source contributions to each input measurement power spectral density. The method is made more user-friendly through use of a percentage contribution color plotting technique, where different normalizations can be used to help determine the presence of sources and the strengths of their contributions. Convolution of input measurements with the estimated path impulse responses results in a set of far-field components, to which the same singular value contribution plotting technique can be applied, thus allowing dominant noise source characteristics in the far-field to also be examined. Application of the methods presented results in determination of the spectral characteristics of dominant noise sources both in the near- and far-fields from one fired test, which significantly reduces the need for extensive fired and motored testing. Finally, it is shown that the far-field noise time history of a physically altered engine can be simulated through modification of singular values and recalculation of transfer paths between input and output measurements of previously recorded data.

[Characteristics, advantages, and limits of matrix tests].

PubMed

Brand, T; Wagener, K C

2017-03-01

Deterioration of communication abilities due to hearing problems is particularly relevant in listening situations with noise. Therefore, speech intelligibility tests in noise are required for audiological diagnostics and evaluation of hearing rehabilitation. This study analyzed the characteristics of matrix tests assessing the 50 % speech recognition threshold in noise. What are their advantages and limitations? Matrix tests are based on a matrix of 50 words (10 five-word sentences with same grammatical structure). In the standard setting, 20 sentences are presented using an adaptive procedure estimating the individual 50 % speech recognition threshold in noise. At present, matrix tests in 17 different languages are available. A high international comparability of matrix tests exists. The German language matrix test (OLSA, male speaker) has a reference 50 % speech recognition threshold of -7.1 (± 1.1) dB SNR. Before using a matrix test for the first time, the test person has to become familiar with the basic speech material using two training lists. Hereafter, matrix tests produce constant results even if repeated many times. Matrix tests are suitable for users of hearing aids and cochlear implants, particularly for assessment of benefit during the fitting process. Matrix tests can be performed in closed form and consequently with non-native listeners, even if the experimenter does not speak the test person's native language. Short versions of matrix tests are available for listeners with a shorter memory span, e.g., children.

New Synthesis Of High-Performance Bismaleimides

NASA Technical Reports Server (NTRS)

Pater, Ruth H.; Lowther, Sharon; Cannon, Michelle; Smith, Janice; Whitely, Karen

1991-01-01

New general synthesis of tough and easy-to-process high-performance bismaleimides (BMI's) developed. Involves reaction of acetylene-terminated compounds with BMI's or biscitraconimides. Offers matrix resins and adhesives having combined advantages of toughness characteristic of thermoplastics and easy processability characteristic of thermosetting materials. Scheme has potential for providing high-performance matrix resins surviving well at high temperatures and absorb little moisture.

Application of fractal and grey level co-occurrence matrix analysis in evaluation of brain corpus callosum and cingulum architecture.

PubMed

Pantic, Igor; Dacic, Sanja; Brkic, Predrag; Lavrnja, Irena; Pantic, Senka; Jovanovic, Tomislav; Pekovic, Sanja

2014-10-01

This aim of this study was to assess the discriminatory value of fractal and grey level co-occurrence matrix (GLCM) analysis methods in standard microscopy analysis of two histologically similar brain white mass regions that have different nerve fiber orientation. A total of 160 digital micrographs of thionine-stained rat brain white mass were acquired using a Pro-MicroScan DEM-200 instrument. Eighty micrographs from the anterior corpus callosum and eighty from the anterior cingulum areas of the brain were analyzed. The micrographs were evaluated using the National Institutes of Health ImageJ software and its plugins. For each micrograph, seven parameters were calculated: angular second moment, inverse difference moment, GLCM contrast, GLCM correlation, GLCM variance, fractal dimension, and lacunarity. Using the Receiver operating characteristic analysis, the highest discriminatory value was determined for inverse difference moment (IDM) (area under the receiver operating characteristic (ROC) curve equaled 0.925, and for the criterion IDM≤0.610 the sensitivity and specificity were 82.5 and 87.5%, respectively). Most of the other parameters also showed good sensitivity and specificity. The results indicate that GLCM and fractal analysis methods, when applied together in brain histology analysis, are highly capable of discriminating white mass structures that have different axonal orientation.

Use of residence time distribution for evaluation of gaseous pollutant volatilization from stored swine manure.

PubMed

Liao, C M

1997-01-01

A quantification analysis for evaluation of gaseous pollutant volatilization as a result of mass transfer from stored swine manure is presented from the viewpoint of residence time distribution. The method is based on evaluating the moments of concentration vs. time curves of both air and gaseous pollutants. The concept of moments of concentration histories is applicable to characterize the dispersal of the supplied air or gaseous pollutant in a ventilated system. The mean age or residence time of airflow can be calculated from an inverse system state matrix [B]-1 of a linear dynamic equation describing the dynamics of gaseous pollutant in a ventilated airspace. The sum elements in an arbitrary row i in matrix [B]-1 is equal to the mean age of airflow in airspace i. The mean age of gaseous pollutant in airspace i can be obtained from the area under the concentration profile divided by the equilibrium concentration reading in that space caused by gaseous pollutant sources. Matrix [B]-1 can also be represented in terms of the inverse local airflow rate matrix ([W]-1), transition probability matrix ([P]), and air volume matrix ([V]) as, [B]-1 = [W]-1[P][V]. Finally the mean age of airflow in a ventilated airspace can be interpreted by the physical characteristics of matrices [W] and [P]. The practical use of the concepts is also applied in a typical pig unit.

Mapping the coupled role of structure and materials in mechanics of platelet-matrix composites

NASA Astrophysics Data System (ADS)

Farzanian, Shafee; Shahsavari, Rouzbeh

2018-03-01

Despite significant progresses on understanding and mimicking the delicate nano/microstructure of biomaterials such as nacre, decoding the indistinguishable merger of materials and structures in controlling the tradeoff in mechanical properties has been long an engineering pursuit. Herein, we focus on an archetype platelet-matrix composite and perform ∼400 nonlinear finite element simulations to decode the complex interplay between various structural features and material characteristics in conferring the balance of mechanical properties. We study various combinatorial models expressed by four key dimensionless parameters, i.e. characteristic platelet length, matrix plasticity, platelet dissimilarity, and overlap offset, whose effects are all condensed in a new unifying parameter, defined as the multiplication of strength, toughness, and stiffness over composite volume. This parameter, which maximizes at a critical characteristic length, controls the transition from intrinsic toughening (matrix plasticity driven without crack growths) to extrinsic toughening phenomena involving progressive crack propagations. This finding, combined with various abstract volumetric and radar plots, will not only shed light on decoupling the complex role of structure and materials on mechanical performance and their trends, but provides important guidelines for designing lightweight staggered platelet-matrix composites while ensuring the best (balance) of their mechanical properties.

Spectral simulation of unsteady compressible flow past a circular cylinder

NASA Technical Reports Server (NTRS)

Don, Wai-Sun; Gottlieb, David

1990-01-01

An unsteady compressible viscous wake flow past a circular cylinder was successfully simulated using spectral methods. A new approach in using the Chebyshev collocation method for periodic problems is introduced. It was further proved that the eigenvalues associated with the differentiation matrix are purely imaginary, reflecting the periodicity of the problem. It was been shown that the solution of a model problem has exponential growth in time if improper boundary conditions are used. A characteristic boundary condition, which is based on the characteristics of the Euler equations of gas dynamics, was derived for the spectral code. The primary vortex shedding frequency computed agrees well with the results in the literature for Mach = 0.4, Re = 80. No secondary frequency is observed in the power spectrum analysis of the pressure data.

Estimation of the POD function and the LOD of a qualitative microbiological measurement method.

PubMed

Wilrich, Cordula; Wilrich, Peter-Theodor

2009-01-01

Qualitative microbiological measurement methods in which the measurement results are either 0 (microorganism not detected) or 1 (microorganism detected) are discussed. The performance of such a measurement method is described by its probability of detection as a function of the contamination (CFU/g or CFU/mL) of the test material, or by the LOD(p), i.e., the contamination that is detected (measurement result 1) with a specified probability p. A complementary log-log model was used to statistically estimate these performance characteristics. An intralaboratory experiment for the detection of Listeria monocytogenes in various food matrixes illustrates the method. The estimate of LOD50% is compared with the Spearman-Kaerber method.

Compressive Sensing of Roller Bearing Faults via Harmonic Detection from Under-Sampled Vibration Signals

PubMed Central

Tang, Gang; Hou, Wei; Wang, Huaqing; Luo, Ganggang; Ma, Jianwei

2015-01-01

The Shannon sampling principle requires substantial amounts of data to ensure the accuracy of on-line monitoring of roller bearing fault signals. Challenges are often encountered as a result of the cumbersome data monitoring, thus a novel method focused on compressed vibration signals for detecting roller bearing faults is developed in this study. Considering that harmonics often represent the fault characteristic frequencies in vibration signals, a compressive sensing frame of characteristic harmonics is proposed to detect bearing faults. A compressed vibration signal is first acquired from a sensing matrix with information preserved through a well-designed sampling strategy. A reconstruction process of the under-sampled vibration signal is then pursued as attempts are conducted to detect the characteristic harmonics from sparse measurements through a compressive matching pursuit strategy. In the proposed method bearing fault features depend on the existence of characteristic harmonics, as typically detected directly from compressed data far before reconstruction completion. The process of sampling and detection may then be performed simultaneously without complete recovery of the under-sampled signals. The effectiveness of the proposed method is validated by simulations and experiments. PMID:26473858

Critical factors determining the quantification capability of matrix-assisted laser desorption/ionization– time-of-flight mass spectrometry

PubMed Central

Wang, Chia-Chen; Lai, Yin-Hung; Ou, Yu-Meng; Chang, Huan-Tsung; Wang, Yi-Sheng

2016-01-01

Quantitative analysis with mass spectrometry (MS) is important but challenging. Matrix-assisted laser desorption/ionization (MALDI) coupled with time-of-flight (TOF) MS offers superior sensitivity, resolution and speed, but such techniques have numerous disadvantages that hinder quantitative analyses. This review summarizes essential obstacles to analyte quantification with MALDI-TOF MS, including the complex ionization mechanism of MALDI, sensitive characteristics of the applied electric fields and the mass-dependent detection efficiency of ion detectors. General quantitative ionization and desorption interpretations of ion production are described. Important instrument parameters and available methods of MALDI-TOF MS used for quantitative analysis are also reviewed. This article is part of the themed issue ‘Quantitative mass spectrometry’. PMID:27644968

The breast reconstruction evaluation of acellular dermal matrix as a sling trial (BREASTrial): design and methods of a prospective randomized trial.

PubMed

Agarwal, Jayant P; Mendenhall, Shaun D; Anderson, Layla A; Ying, Jian; Boucher, Kenneth M; Liu, Ting; Neumayer, Leigh A

2015-01-01

Recent literature has focused on the advantages and disadvantages of using acellular dermal matrix in breast reconstruction. Many of the reported data are from low level-of-evidence studies, leaving many questions incompletely answered. The present randomized trial provides high-level data on the incidence and severity of complications in acellular dermal matrix breast reconstruction between two commonly used types of acellular dermal matrix. A prospective randomized trial was conducted to compare outcomes of immediate staged tissue expander breast reconstruction using either AlloDerm or DermaMatrix. The impact of body mass index, smoking, diabetes, mastectomy type, radiation therapy, and chemotherapy on outcomes was analyzed. Acellular dermal matrix biointegration was analyzed clinically and histologically. Patient satisfaction was assessed by means of preoperative and postoperative surveys. Logistic regression models were used to identify predictors of complications. This article reports on the study design, surgical technique, patient characteristics, and preoperative survey results, with outcomes data in a separate report. After 2.5 years, we successfully enrolled and randomized 128 patients (199 breasts). The majority of patients were healthy nonsmokers, with 41 percent of patients receiving radiation therapy and 49 percent receiving chemotherapy. Half of the mastectomies were prophylactic, with nipple-sparing mastectomy common in both cancer and prophylactic cases. Preoperative survey results indicate that patients were satisfied with their premastectomy breast reconstruction education. Results from the Breast Reconstruction Evaluation Using Acellular Dermal Matrix as a Sling Trial will assist plastic surgeons in making evidence-based decisions regarding acellular dermal matrix-assisted tissue expander breast reconstruction. Therapeutic, II.

Formation of multicomponent matrix metal oxide films in anodic alumina matrixes by chemical deposition

NASA Astrophysics Data System (ADS)

Gorokh, G. G.; Zakhlebayeva, A. I.; Metla, A. I.; Zhilinskiy, V. V.; Murashkevich, A. N.; Bogomazova, N. V.

2017-11-01

The metal oxide films of SnxZnyOz and SnxMoyOz systems deposited onto anodic alumina matrixes by chemical and ion layering from an aqueous solutions were characterized by scanning electron microscopy, Raman spectroscopy, electron probe X-ray microanalysis and IR spectroscopy. The obtained matrix films had reproducible composition and structure and possessed certain morphological characteristics and properties.

Elucidation of release characteristics of highly soluble drug trimetazidine hydrochloride from chitosan-carrageenan matrix tablets.

PubMed

Li, Liang; Wang, Linlin; Shao, Yang; Tian, Ye; Li, Conghao; Li, Ying; Mao, Shirui

2013-08-01

The aim of this study was to better understand the underlying drug release characteristics from matrix tablets based on the combination of chitosan (CS) and different types of carrageenans [kappa (κ)-CG, iota (ι)-CG, and lambda (λ)-CG]. Highly soluble trimetazidine hydrochloride (TH) was used as a model drug. First, characteristics of drug release from different formulations were investigated, and then in situ complexation capacity of CG with TH and CS was studied by differential scanning calorimetry and Fourier transform infrared spectroscopy. Erosion and swelling of matrix were also characterized to better understand the drug-release mechanisms. Effects of pH and ionic strength on drug release were also studied. It was found that not only ι-CG and λ-CG could reduce the burst release of TH by the effect of TH-CG interaction, CS-ι-CG- and CS-λ-CG-based polyelectrolyte film could further modify the controlled-release behavior, but not CS-κ-CG. High pH and high ionic strength resulted in faster drug release from CS-κ-CG- and CS-ι-CG-based matrix, but drug release from CS-λ-CG-based matrix was less sensitive to pH and ionic strength. In conclusion, CS-λ-CG-based matrix tablets are quite promising as controlled-release drug carrier based on multiple mechanisms. Copyright © 2013 Wiley Periodicals, Inc.

Hybrid Weighted Minimum Norm Method A new method based LORETA to solve EEG inverse problem.

PubMed

Song, C; Zhuang, T; Wu, Q

2005-01-01

This Paper brings forward a new method to solve EEG inverse problem. Based on following physiological characteristic of neural electrical activity source: first, the neighboring neurons are prone to active synchronously; second, the distribution of source space is sparse; third, the active intensity of the sources are high centralized, we take these prior knowledge as prerequisite condition to develop the inverse solution of EEG, and not assume other characteristic of inverse solution to realize the most commonly 3D EEG reconstruction map. The proposed algorithm takes advantage of LORETA's low resolution method which emphasizes particularly on 'localization' and FOCUSS's high resolution method which emphasizes particularly on 'separability'. The method is still under the frame of the weighted minimum norm method. The keystone is to construct a weighted matrix which takes reference from the existing smoothness operator, competition mechanism and study algorithm. The basic processing is to obtain an initial solution's estimation firstly, then construct a new estimation using the initial solution's information, repeat this process until the solutions under last two estimate processing is keeping unchanged.

Hierarchical modeling of professional skills in the field of castings manufacture engineering

NASA Astrophysics Data System (ADS)

Samuilă, V.; Soporan, V. F.; Conțiu, G.; Pădurețu, S.; Lehene, T. R.; Vescan, M. M.

2017-06-01

The paper presents a method of hierarchizing professional skills in the manufacturing of molded parts (castings) by using and adapting the FAHP algorithm (Fuzzy Analitical Hierarchy Process). Assessments are made regarding the peculiarities of the professional training process, specifying the activities to be carried out and the competences necessary for their development. The contribution of the design of the method extends to the design of the hierarchy system architecture, the linguistic determination of the importance of each characteristic, the construction of the fuzzy ordering matrices for each stage of the process, the determination of the share of the characteristics for each hierarchy step and establishing the hierarchy of the characteristics taking into account the influences of the others, grouped at the level of the steps and within the global matrix. The research carried out represents the support for generating an instrument of hierarchy of professional competencies that can be used in various professional and institutional contexts. Case study on the hierarchy of professional skills in the manufacturing of molded parts engineering. Keywords: Materials engineering, castings manufacture professional skills, hierarchy, AHP method, standard occupational curriculum.

The characteristics of grating structure in magnetic field measurements based on polarization properties of fiber gratings

NASA Astrophysics Data System (ADS)

Su, Yang; Peng, Hui; Feng, Kui; Li, Yu-quan

2009-11-01

In this paper the characteristics of grating structure in magnetic field measurements based on differential group delay of fiber gratings are analyzed. Theoretical simulations are realized using the coupled-mode theory and transfer matrix method. The effects of grating parameters of uniform Bragg grating on measurement range and sensitivity are analyzed. The impacts of chirped, phase-shifted and apodized gratings on DGD peak values are also monitored. FBG transmitted spectrums and DGD spectrums are recorded by means of an optical vector analyzer (OVA). Both the simulations and experiments demonstrate that the phase-shifted gratings can obviously improve the sensitivity.

Method for thermal processing alumina-enriched spinel single crystals

DOEpatents

Jantzen, C.M.

1995-05-09

A process for age-hardening alumina-rich magnesium aluminum spinel to obtain the desired combination of characteristics of hardness, clarity, flexural strength and toughness comprises selection of the time-temperature pair for isothermal heating followed by quenching. The time-temperature pair is selected from the region wherein the precipitate groups have the characteristics sought. The single crystal spinel is isothermally heated and will, if heated long enough pass from its single phase through two pre-precipitates and two metastable precipitates to a stable secondary phase precipitate within the spinel matrix. Quenching is done slowly at first to avoid thermal shock, then rapidly. 12 figs.

Precise identification of Dirac-like point through a finite photonic crystal square matrix

PubMed Central

Dong, Guoyan; Zhou, Ji; Yang, Xiulun; Meng, Xiangfeng

2016-01-01

The phenomena of the minimum transmittance spectrum or the maximum reflection spectrum located around the Dirac frequency have been observed to demonstrate the 1/L scaling law near the Dirac-like point through the finite ribbon structure. However, so far there is no effective way to identify the Dirac-like point accurately. In this work we provide an effective measurement method to identify the Dirac-like point accurately through a finite photonic crystal square matrix. Based on the Dirac-like dispersion achieved by the accidental degeneracy at the centre of the Brillouin zone of dielectric photonic crystal, both the simulated and experimental results demonstrate that the transmittance spectra through a finite photonic crystal square matrix not only provide the clear evidence for the existence of Dirac-like point but also can be used to identify the precise location of Dirac-like point by the characteristics of sharp cusps embedded in the extremum spectra surrounding the conical singularity. PMID:27857145

In Situ Thermal Generation of Silver Nanoparticles in 3D Printed Polymeric Structures

PubMed Central

Fantino, Erika; Chiappone, Annalisa; Calignano, Flaviana; Fontana, Marco; Pirri, Fabrizio; Roppolo, Ignazio

2016-01-01

Polymer nanocomposites have always attracted the interest of researchers and industry because of their potential combination of properties from both the nanofillers and the hosting matrix. Gathering nanomaterials and 3D printing could offer clear advantages and numerous new opportunities in several application fields. Embedding nanofillers in a polymeric matrix could improve the final material properties but usually the printing process gets more difficult. Considering this drawback, in this paper we propose a method to obtain polymer nanocomposites by in situ generation of nanoparticles after the printing process. 3D structures were fabricated through a Digital Light Processing (DLP) system by disolving metal salts in the starting liquid formulation. The 3D fabrication is followed by a thermal treatment in order to induce in situ generation of metal nanoparticles (NPs) in the polymer matrix. Comprehensive studies were systematically performed on the thermo-mechanical characteristics, morphology and electrical properties of the 3D printed nanocomposites. PMID:28773716

Understanding the Relationship between Red Wine Matrix, Tannin Activity, and Sensory Properties.

PubMed

Watrelot, Aude A; Byrnes, Nadia K; Heymann, Hildegarde; Kennedy, James A

2016-11-30

One major red wine mouthfeel characteristic, astringency, is derived from grape-extracted tannins and is considered to be a result of interaction with salivary proteins and the oral mucosa. To improve our understanding of the role that the enthalpy of interaction of tannin with a hydrophobic surface (tannin activity) has in astringency perception, a chromatographic method was used to determine the tannin concentration and activity of 34 Cabernet Sauvignon wines, as well as sensory analysis done on 13 of those wines. In addition, astringency-relevant matrix parameters (pH, titratable acidity, ethanol, glucose, and fructose) were measured across all wines. Tannin activity was not significantly correlated with any matrix variables, and the perception of drying and grippy was not correlated with tannin concentration and activity. However, ethanol content was well related to mouthfeel attributes and appeared to drive perceived drying. Although fructose and glucose content were well correlated, they did not drive the perception of sweetness, which is explained by the well-known mixture suppression effect.

Google matrix of business process management

NASA Astrophysics Data System (ADS)

Abel, M. W.; Shepelyansky, D. L.

2011-12-01

Development of efficient business process models and determination of their characteristic properties are subject of intense interdisciplinary research. Here, we consider a business process model as a directed graph. Its nodes correspond to the units identified by the modeler and the link direction indicates the causal dependencies between units. It is of primary interest to obtain the stationary flow on such a directed graph, which corresponds to the steady-state of a firm during the business process. Following the ideas developed recently for the World Wide Web, we construct the Google matrix for our business process model and analyze its spectral properties. The importance of nodes is characterized by PageRank and recently proposed CheiRank and 2DRank, respectively. The results show that this two-dimensional ranking gives a significant information about the influence and communication properties of business model units. We argue that the Google matrix method, described here, provides a new efficient tool helping companies to make their decisions on how to evolve in the exceedingly dynamic global market.

The food matrix and sterol characteristics affect the plasma cholesterol lowering of phytosterol/phytostanol.

PubMed

Cusack, Laura Kells; Fernandez, Maria Luz; Volek, Jeff S

2013-11-01

Foods with added phytosterols/phytostanols (PS) are recommended to lower LDL cholesterol (LDL-c) concentrations. Manufacturers have incorporated PS into a variety of common foods. Understanding the cholesterol-lowering impact of the food matrix and the PS characteristics would maximize their success and increase the benefit to consumers. This review systematically examines whether the PS characteristics and the fatty acid composition of foods with added PS affects serum LDL-c. A total of 33 studies published between the years 1998 and 2011 inclusive of 66 individual primary variables (strata) were evaluated. The functional food matrices included margarine, mayonnaise, yogurt, milk, cheese, meat, grain, juice, and chocolate. Consistently, ≥10% reductions in LDL-c were reported when the characteristics of the food matrix included poly- and monounsaturated fatty acids known to lower LDL-c. Also, >10% mean reductions in LDL-c were reported when β-sitostanol and campestanol as well as stanol esters were used. These characteristics allow both low-fat and high-fat foods to successfully incorporate PS and significantly lower LDL-c.

Development of a quantitative method for the analysis of cocaine analogue impregnated into textiles by Raman spectroscopy.

PubMed

Xiao, Linda; Alder, Rhiannon; Mehta, Megha; Krayem, Nadine; Cavasinni, Bianca; Laracy, Sean; Cameron, Shane; Fu, Shanlin

2018-04-01

Cocaine trafficking in the form of textile impregnation is routinely encountered as a concealment method. Raman spectroscopy has been a popular and successful testing method used for in situ screening of cocaine in textiles and other matrices. Quantitative analysis of cocaine in these matrices using Raman spectroscopy has not been reported to date. This study aimed to develop a simple Raman method for quantifying cocaine using atropine as the model analogue in various types of textiles. Textiles were impregnated with solutions of atropine in methanol. The impregnated atropine was extracted using less hazardous acidified water with the addition of potassium thiocyanate (KSCN) as an internal standard for Raman analysis. Despite the presence of background matrix signals arising from the textiles, the cocaine analogue could easily be identified by its characteristic Raman bands. The successful use of KSCN normalised the analyte signal response due to different textile matrix background interferences and thus removed the need for a matrix-matched calibration. The method was linear over a concentration range of 6.25-37.5 mg/cm 2 with a coefficient of determination (R 2 ) at 0.975 and acceptable precision and accuracy. A simple and accurate Raman spectroscopy method for the analysis and quantification of a cocaine analogue impregnated in textiles has been developed and validated for the first time. This proof-of-concept study has demonstrated that atropine can act as an ideal model compound to study the problem of cocaine impregnation in textile. The method has the potential to be further developed and implemented in real world forensic cases. Copyright © 2017 John Wiley & Sons, Ltd.

Aortic Wall Extracellular Matrix Proteins Correlate with Syntax Score in Patients Undergoing Coronary Artery Bypass Surgery

PubMed Central

Chiong, Terri; Cheow, Esther S. H.; Woo, Chin C.; Lin, Xiao Y.; Khin, Lay W.; Lee, Chuen N.; Hartman, Mikael; Sze, Siu K.; Sorokin, Vitaly A.

2016-01-01

Aims: The SYNTAX score correlate with major cardiovascular events post-revascularization, although the histopathological basis is unclear. We aim to evaluate the association between syntax score and extracellular matrix histological characteristics of aortic punch tissue obtained during coronary artery bypass surgery (CABG). This analysis compares coronary artery bypass surgery patients with High and Low syntax score which were followed up for one year period. Methods and Results: Patients with High (score ≥ 33, (n=77)) and Low Syntax Scores (score ≤ 22, (n=71)) undergoing elective CABG were recruited prospectively. Baseline clinical characteristics and surgical risks were well matched. At 1 year, EMACCE (Sum of cardiovascular death, stroke, congestive cardiac failure, and limb, gut and myocardial ischemia) was significantly elevated in the High syntax group (P=0.022). Mass spectrometry (MS)-based quantitative iTRAQ proteomic results validated on independent cohort by immunohistochemistry (IHC) revealed that the High syntax group had significantly upraised Collagen I (P<0.0001) and Elastin (P<0.0001) content in ascending aortic wall. Conclusion: This study shows that aortic extracellular matrix (ECM) differ between High and Low syntax groups with up-regulation of Collagen I and Elastin level in High Syntax Score group. This identifies aortic punches collected during CABG as another biomarker source related with atherosclerosis severity and possible clinical outcome. PMID:27347220

Method and Apparatus for Detecting and Quantifying Bacterial Spores on a Surface

NASA Technical Reports Server (NTRS)

Ponce, Adrian (Inventor)

2017-01-01

A method and an apparatus for detecting and quantifying bacterial spores on a surface. In accordance with the method: a matrix including lanthanide ions is provided on the surface containing the bacterial spores; functionalized aromatic molecules are released from the bacterial spores on the surface; a complex of the lanthanide ion and the aromatic molecule is formed on the surface; the complex of the lanthanide ion and the aromatic molecule is excited to generate a characteristic luminescence of the complex on the surface; and the bacterial spores exhibiting the luminescence of the complex on the surface are detected and quantified.

Method and apparatus for detecting and quantifying bacterial spores on a surface

NASA Technical Reports Server (NTRS)

Ponce, Adrian (Inventor)

2009-01-01

A method and an apparatus for detecting and quantifying bacterial spores on a surface. In accordance with the method: a matrix including lanthanide ions is provided on the surface containing the bacterial spores; functionalized aromatic molecules are released from the bacterial spores on the surface; a complex of the lanthanide ion and the aromatic molecule is formed on the surface; the complex of the lanthanide ion and the aromatic molecule is excited to generate a characteristic luminescence of the complex on the surface; and the bacterial spores exhibiting the luminescence of the complex on the surface are detected and quantified.

A robust LC-MS/MS method for the determination of pidotimod in different biological matrixes and its application to in vivo and in vitro pharmacokinetic studies.

PubMed

Wang, Guangji; Wang, Qian; Rao, Tai; Shen, Boyu; Kang, Dian; Shao, Yuhao; Xiao, Jingcheng; Chen, Huimin; Liang, Yan

2016-06-15

Pidotimod, (R)-3-[(S)-(5-oxo-2-pyrrolidinyl) carbonyl]-thiazolidine-4-carboxylic acid, was frequently used to treat children with recurrent respiratory infections. Preclinical pharmacokinetics of pidotimod was still rarely reported to date. Herein, a liquid chromatography-tandem mass spectrometry (LC-MS/MS) method was developed and validated to determine pidotimod in rat plasma, tissue homogenate and Caco-2 cells. In this process, phenacetin was chosen as the internal standard due to its similarity in chromatographic and mass spectrographic characteristics with pidotimod. The plasma calibration curves were established within the concentration range of 0.01-10.00μg/mL, and similar linear curves were built using tissue homogenate and Caco-2 cells. The calibration curves for all biological samples showed good linearity (r>0.99) over the concentration ranges tested. The intra- and inter-day precision (RSD, %) values were below 15% and accuracy (RE, %) was ranged from -15% to 15% at all quality control levels. For plasma, tissue homogenate and Caco-2 cells, no obvious matrix effect was found, and the average recoveries were all above 75%. Thus, the method demonstrated excellent accuracy, precision and robustness for high throughput applications, and was then successfully applied to the studies of absorption in rat plasma, distribution in rat tissues and intracellular uptake characteristics in Caco-2 cells for pidotimod. Copyright © 2016 Elsevier B.V. All rights reserved.

A review of the matrix-exponential formalism in radiative transfer

NASA Astrophysics Data System (ADS)

Efremenko, Dmitry S.; Molina García, Víctor; Gimeno García, Sebastián; Doicu, Adrian

2017-07-01

This paper outlines the matrix exponential description of radiative transfer. The eigendecomposition method which serves as a basis for computing the matrix exponential and for representing the solution in a discrete ordinate setting is considered. The mathematical equivalence of the discrete ordinate method, the matrix operator method, and the matrix Riccati equations method is proved rigorously by means of the matrix exponential formalism. For optically thin layers, approximate solution methods relying on the Padé and Taylor series approximations to the matrix exponential, as well as on the matrix Riccati equations, are presented. For optically thick layers, the asymptotic theory with higher-order corrections is derived, and parameterizations of the asymptotic functions and constants for a water-cloud model with a Gamma size distribution are obtained.

Sensitivity Analysis of Nuclide Importance to One-Group Neutron Cross Sections

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sekimoto, Hiroshi; Nemoto, Atsushi; Yoshimura, Yoshikane

The importance of nuclides is useful when investigating nuclide characteristics in a given neutron spectrum. However, it is derived using one-group microscopic cross sections, which may contain large errors or uncertainties. The sensitivity coefficient shows the effect of these errors or uncertainties on the importance.The equations for calculating sensitivity coefficients of importance to one-group nuclear constants are derived using the perturbation method. Numerical values are also evaluated for some important cases for fast and thermal reactor systems.Many characteristics of the sensitivity coefficients are derived from the derived equations and numerical results. The matrix of sensitivity coefficients seems diagonally dominant. However,more » it is not always satisfied in a detailed structure. The detailed structure of the matrix and the characteristics of coefficients are given.By using the obtained sensitivity coefficients, some demonstration calculations have been performed. The effects of error and uncertainty of nuclear data and of the change of one-group cross-section input caused by fuel design changes through the neutron spectrum are investigated. These calculations show that the sensitivity coefficient is useful when evaluating error or uncertainty of nuclide importance caused by the cross-section data error or uncertainty and when checking effectiveness of fuel cell or core design change for improving neutron economy.« less

Propagation of SH waves in an infinite/semi-infinite piezoelectric/piezomagnetic periodically layered structure.

PubMed

Pang, Yu; Liu, Yu-Shan; Liu, Jin-Xi; Feng, Wen-Jie

2016-04-01

In this paper, SH bulk/surface waves propagating in the corresponding infinite/semi-infinite piezoelectric (PE)/piezomagnetic (PM) and PM/PE periodically layered composites are investigated by two methods, the stiffness matrix method and the transfer matrix method. For a semi-infinite PE/PM or PM/PE medium, the free surface is parallel to the layer interface. Both PE and PM materials are assumed to be transversely isotropic solids. Dispersion equations are derived by the stiffness/transfer matrix methods, respectively. The effects of electric-magnetic (ME) boundary conditions at the free surface and the layer thickness ratios on dispersion curves are considered in detail. Numerical examples show that the results calculated by the two methods are the same. The dispersion curves of SH surface waves are below the bulk bands or inside the frequency gaps. The ratio of the layer thickness has an important effect not only on the bulk bands but also on the dispersion curves of SH surface waves. Electric and magnetic boundary conditions, respectively, determine the dispersion curves of SH surface waves for the PE/PM and PM/PE semi-infinite structures. The band structures of SH bulk waves are consistent for the PE/PM and PM/PE structures, however, the dispersive behaviors of SH surface waves are indeed different for the two composites. The realization of the above-mentioned characteristics of SH waves will make it possible to design PE/PM acoustic wave devices with periodical structures and achieve the better performance. Copyright © 2016 Elsevier B.V. All rights reserved.

Physical, Spatial, and Molecular Aspects of Extracellular Matrix of In Vivo Niches and Artificial Scaffolds Relevant to Stem Cells Research

PubMed Central

Akhmanova, Maria; Osidak, Egor; Domogatsky, Sergey; Rodin, Sergey; Domogatskaya, Anna

2015-01-01

Extracellular matrix can influence stem cell choices, such as self-renewal, quiescence, migration, proliferation, phenotype maintenance, differentiation, or apoptosis. Three aspects of extracellular matrix were extensively studied during the last decade: physical properties, spatial presentation of adhesive epitopes, and molecular complexity. Over 15 different parameters have been shown to influence stem cell choices. Physical aspects include stiffness (or elasticity), viscoelasticity, pore size, porosity, amplitude and frequency of static and dynamic deformations applied to the matrix. Spatial aspects include scaffold dimensionality (2D or 3D) and thickness; cell polarity; area, shape, and microscale topography of cell adhesion surface; epitope concentration, epitope clustering characteristics (number of epitopes per cluster, spacing between epitopes within cluster, spacing between separate clusters, cluster patterns, and level of disorder in epitope arrangement), and nanotopography. Biochemical characteristics of natural extracellular matrix molecules regard diversity and structural complexity of matrix molecules, affinity and specificity of epitope interaction with cell receptors, role of non-affinity domains, complexity of supramolecular organization, and co-signaling by growth factors or matrix epitopes. Synergy between several matrix aspects enables stem cells to retain their function in vivo and may be a key to generation of long-term, robust, and effective in vitro stem cell culture systems. PMID:26351461

Study and analysis of filtering characteristics of 1D photonic crystal

NASA Astrophysics Data System (ADS)

Juyal, Rohan; Suthar, Bhuvneshwer; Kumar, Arun

2018-05-01

Propagation of electromagnetic wave have been studied and analyzed through 1D photonic crystal. 1D photonic band gap material with low and high refractive index material has been chosen for this study. Band structure and reflectivity of this 1D structure has been calculated using transmission matrix method (TMM). Study and analysis of the band structure and reflectivity of this structure shows that this structure may work as an optical filter.

Dual optimization method of radiofrequency and quasistatic field simulations for reduction of eddy currents generated on 7T radiofrequency coil shielding.

PubMed

Zhao, Yujuan; Zhao, Tiejun; Raval, Shailesh B; Krishnamurthy, Narayanan; Zheng, Hai; Harris, Chad T; Handler, William B; Chronik, Blaine A; Ibrahim, Tamer S

2015-11-01

To optimize the design of radiofrequency (RF) shielding of transmit coils at 7T and reduce eddy currents generated on the RF shielding when imaging with rapid gradient waveforms. One set of a four-element, 2 × 2 Tic-Tac-Toe head coil structure was selected and constructed to study eddy currents on the RF coil shielding. The generated eddy currents were quantitatively studied in the time and frequency domains. The RF characteristics were studied using the finite difference time domain method. Five different kinds of RF shielding were tested on a 7T MRI scanner with phantoms and in vivo human subjects. The eddy current simulation method was verified by the measurement results. Eddy currents induced by solid/intact and simple-structured slotted RF shielding significantly distorted the gradient fields. Echo-planar images, B1+ maps, and S matrix measurements verified that the proposed slot pattern suppressed the eddy currents while maintaining the RF characteristics of the transmit coil. The presented dual-optimization method could be used to design RF shielding and reduce the gradient field-induced eddy currents while maintaining the RF characteristics of the transmit coil. © 2014 Wiley Periodicals, Inc.

Analysis of mechanical properties anisotropy of nanomodified carbon fibre-reinforced woven composites

NASA Astrophysics Data System (ADS)

Ruslantsev, A. N.; Portnova, Ya M.; Tairova, L. P.; Dumansky, A. M.

2016-10-01

The polymer binder cracking problem arises while designing and maintaining polymer composite-based aircraft load-bearing members. Some technological methods are used to solve this problem. In particular the injection of nanoagents can block the initiation and growth of microscopic cracks. Crack propagation can also be blocked if the strain energy release is not related with fracturing. One of the possible ways for such energy release is creep. Testing of the anisotropy of the woven carbon fibre reinforced plastic elastic characteristics and creep have been conducted. The samples with different layouts have been made of woven carbon fibre laminate BMI-3/3692 with nanomodified bismaleimide matrix. This matrix has a higher glass transition temperature and improved mechanical properties. The deformation regularities have been analyzed, layer elastic characteristics have been determined. The constitutive equations describing composite material creep have been obtained and its parameters have been defined. Experimental and calculated creep curves have been plotted. It was found that the effects of rheology arise as the direction of load does not match the direction of reinforcing fibres of the material.

Advances in organic-inorganic hybrid sorbents for the extraction of organic and inorganic pollutants in different types of food and environmental samples.

PubMed

Ng, Nyuk-Ting; Kamaruddin, Amirah Farhan; Wan Ibrahim, Wan Aini; Sanagi, Mohd Marsin; Abdul Keyon, Aemi S

2018-01-01

The efficiency of the extraction and removal of pollutants from food and the environment has been an important issue in analytical science. By incorporating inorganic species into an organic matrix, a new material known as an organic-inorganic hybrid material is formed. As it possesses high selectivity, permeability, and mechanical and chemical stabilities, organic-inorganic hybrid materials constitute an emerging research field and have become popular to serve as sorbents in various separaton science methods. Here, we review recent significant advances in analytical solid-phase extraction employing organic-inorganic composite/nanocomposite sorbents for the extraction of organic and inorganic pollutants from various types of food and environmental matrices. The physicochemical characteristics, extraction properties, and analytical performances of sorbents are discussed; including morphology and surface characteristics, types of functional groups, interaction mechanism, selectivity and sensitivity, accuracy, and regeneration abilities. Organic-inorganic hybrid sorbents combined with extraction techniques are highly promising for sample preparation of various food and environmental matrixes with analytes at trace levels. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Multiresidue method for pesticide residue analysis in food of animal and plant origin based on GC or LC and MS or MS/MS.

PubMed

Muñoz, Eva; Muñoz, Gloria; Pineda, Laura; Serrahima, Eulalia; Centrich, Francesc

2012-01-01

A multiresidue method based on GC or LC and MS or MS/MS for the determination of 204 pesticides in diverse food matrixes of animal and plant origin is described. The method can include different stages of cleanup according to the chemical characteristics of each sample. Samples were extracted using accelerated solvent extraction. Those with a high fat content or that contained chlorophyll required further purification by gel permeation chromatography and/or SPE (ENVI-Carb). The methodology developed here was fully validated; the LOQs for the 204 pesticides are presented. The LOQ values lie between 0.01 to 0.02 mg/kg. However, in some cases, mainly in baby food, they were as low as 0.003 mg/kg, thereby meeting European Union requirements on maximum residue levels for pesticides, as outlined in European regulation 396/2005 and the Commission Directive 2003/13/EC. The procedure has been accredited for a wide scope of pesticides and matrixes by the Spanish Accreditation Body (ENAC) following ISO/IEC 17025:2005, as outlined in ENAC technical note NT-19.

Microstructural parameters and high third order nonlinear absorption characteristics of Mn-doped PbS/PVA nanocomposite films

NASA Astrophysics Data System (ADS)

Ramezanpour, B.; Mahmoudi Chenari, Hossein; Sadigh, M. Khadem

2017-11-01

In this work, undoped and Mn-doped PbS/PVA nanocomposite films have been successfully fabricated using the simple solution-casting method. Their crystalline structure was examined by X-ray powder diffraction (XRD). XRD pattern show the formation of cubic structure of PbS for Mn-doped PbS in PVA matrix. Microstructure parameters of Mn-doped PbS/PVA nanocomposite films were obtained through the size-strain plot (SSP) method. The thermal stability of the nanocomposite film was determined using Thermogravimetric analysis (TGA). Furthermore, Z-scan technique was used to investigate the optical nonlinearity of nanocomposite films by a continuous-wave laser irradiation at the wavelength of 655 nm. This experimental results show that undoped PbS/PVA nanocomposite films indicate high nonlinear absorption characteristics. Moreover, the nanocomposite films with easy preparation characteristics, high thermal stability and nonlinear absorption properties can be used as an active element in optics and photonic devices.

Engineered cartilage using primary chondrocytes cultured in a porous cartilage-derived matrix

PubMed Central

Cheng, Nai-Chen; Estes, Bradley T; Young, Tai-Horng; Guilak, Farshid

2011-01-01

Aim To investigate the cell growth, matrix accumulation and mechanical properties of neocartilage formed by human or porcine articular chondrocytes on a porous, porcine cartilage-derived matrix (CDM) for use in cartilage tissue engineering. Materials & methods We examined the physical properties, cell infiltration and matrix accumulation in different formulations of CDM and selected a CDM made of homogenized cartilage slurry as an appropriate scaffold for long-term culture of human and porcine articular chondrocytes. Results The CDM scaffold supported growth and proliferation of both human and porcine chondrocytes. Histology and immunohistochemistry showed abundant cartilage-specific macromolecule deposition at day 28. Human chondrocytes migrated throughout the CDM, showing a relatively homogeneous distribution of new tissue accumulation, whereas porcine chondrocytes tended to form a proteoglycan-rich layer primarily on the surfaces of the scaffold. Human chondrocyte-seeded scaffolds had a significantly lower aggregate modulus and hydraulic permeability at day 28. Conclusions These data show that a scaffold derived from native porcine articular cartilage can support neocartilage formation in the absence of exogenous growth factors. The overall characteristics and properties of the constructs depend on factors such as the concentration of CDM used, the porosity of the scaffold, and the species of chondrocytes. PMID:21175289

Photoimages and the release characteristics of lipophilic matrix tablets containing highly water-soluble potassium citrate with high drug loadings.

PubMed

Cao, Qing-Ri; Kim, Tae-Wan; Lee, Beom-Jin

2007-07-18

Two types of the carnauba wax-based lipophilic matrix tablet using spray-dried granules (SDT) or directly compressible powdered mixtures (DCT) were prepared for sustained release. The model drug was a highly water-soluble potassium citrate and loaded about 74% of the total tablet weight. The SDT slowly eroded and disintegrated during the release study without showing sustained release when the hydrophilic excipients were added. In contrast, the DCT was more efficient for sustained release. The release rate decreased with increasing carnauba wax concentration. In particular, the sustained release rate was markedly pronounced when the lipophilic stearyl alcohol and stearic acid were combined with the carnauba wax. The surface of the intact DCT appeared to be smooth and rusty. The DCT rose to the surface from the bottom of the vessel during the release test, and numerous pores and cracks with no signs of disintegration were also observed after the release test. The release profile was dependent on the formulation composition and preparation method of the matrix tablet. Diffusion-controlled leaching through the channels of the pores and cracks of the lipophilic matrix tablet (DCT) is a key to the sustained release.

Efficient sparse matrix-matrix multiplication for computing periodic responses by shooting method on Intel Xeon Phi

NASA Astrophysics Data System (ADS)

Stoykov, S.; Atanassov, E.; Margenov, S.

2016-10-01

Many of the scientific applications involve sparse or dense matrix operations, such as solving linear systems, matrix-matrix products, eigensolvers, etc. In what concerns structural nonlinear dynamics, the computations of periodic responses and the determination of stability of the solution are of primary interest. Shooting method iswidely used for obtaining periodic responses of nonlinear systems. The method involves simultaneously operations with sparse and dense matrices. One of the computationally expensive operations in the method is multiplication of sparse by dense matrices. In the current work, a new algorithm for sparse matrix by dense matrix products is presented. The algorithm takes into account the structure of the sparse matrix, which is obtained by space discretization of the nonlinear Mindlin's plate equation of motion by the finite element method. The algorithm is developed to use the vector engine of Intel Xeon Phi coprocessors. It is compared with the standard sparse matrix by dense matrix algorithm and the one developed by Intel MKL and it is shown that by considering the properties of the sparse matrix better algorithms can be developed.

Method of forming a ceramic matrix composite and a ceramic matrix component

DOE Office of Scientific and Technical Information (OSTI.GOV)

de Diego, Peter; Zhang, James

A method of forming a ceramic matrix composite component includes providing a formed ceramic member having a cavity, filling at least a portion of the cavity with a ceramic foam. The ceramic foam is deposited on a barrier layer covering at least one internal passage of the cavity. The method includes processing the formed ceramic member and ceramic foam to obtain a ceramic matrix composite component. Also provided is a method of forming a ceramic matrix composite blade and a ceramic matrix composite component.

Epileptic Seizure Detection Based on Time-Frequency Images of EEG Signals using Gaussian Mixture Model and Gray Level Co-Occurrence Matrix Features.

PubMed

Li, Yang; Cui, Weigang; Luo, Meilin; Li, Ke; Wang, Lina

2018-01-25

The electroencephalogram (EEG) signal analysis is a valuable tool in the evaluation of neurological disorders, which is commonly used for the diagnosis of epileptic seizures. This paper presents a novel automatic EEG signal classification method for epileptic seizure detection. The proposed method first employs a continuous wavelet transform (CWT) method for obtaining the time-frequency images (TFI) of EEG signals. The processed EEG signals are then decomposed into five sub-band frequency components of clinical interest since these sub-band frequency components indicate much better discriminative characteristics. Both Gaussian Mixture Model (GMM) features and Gray Level Co-occurrence Matrix (GLCM) descriptors are then extracted from these sub-band TFI. Additionally, in order to improve classification accuracy, a compact feature selection method by combining the ReliefF and the support vector machine-based recursive feature elimination (RFE-SVM) algorithm is adopted to select the most discriminative feature subset, which is an input to the SVM with the radial basis function (RBF) for classifying epileptic seizure EEG signals. The experimental results from a publicly available benchmark database demonstrate that the proposed approach provides better classification accuracy than the recently proposed methods in the literature, indicating the effectiveness of the proposed method in the detection of epileptic seizures.

Assessing the performance of regional landslide early warning models: the EDuMaP method

NASA Astrophysics Data System (ADS)

Calvello, M.; Piciullo, L.

2016-01-01

A schematic of the components of regional early warning systems for rainfall-induced landslides is herein proposed, based on a clear distinction between warning models and warning systems. According to this framework an early warning system comprises a warning model as well as a monitoring and warning strategy, a communication strategy and an emergency plan. The paper proposes the evaluation of regional landslide warning models by means of an original approach, called the "event, duration matrix, performance" (EDuMaP) method, comprising three successive steps: identification and analysis of the events, i.e., landslide events and warning events derived from available landslides and warnings databases; definition and computation of a duration matrix, whose elements report the time associated with the occurrence of landslide events in relation to the occurrence of warning events, in their respective classes; evaluation of the early warning model performance by means of performance criteria and indicators applied to the duration matrix. During the first step the analyst identifies and classifies the landslide and warning events, according to their spatial and temporal characteristics, by means of a number of model parameters. In the second step, the analyst computes a time-based duration matrix with a number of rows and columns equal to the number of classes defined for the warning and landslide events, respectively. In the third step, the analyst computes a series of model performance indicators derived from a set of performance criteria, which need to be defined by considering, once again, the features of the warning model. The applicability, potentialities and limitations of the EDuMaP method are tested and discussed using real landslides and warning data from the municipal early warning system operating in Rio de Janeiro (Brazil).

Optical fiber-based full Mueller polarimeter for endoscopic imaging using a two-wavelength simultaneous measurement method

NASA Astrophysics Data System (ADS)

Vizet, Jérémy; Manhas, Sandeep; Tran, Jacqueline; Validire, Pierre; Benali, Abdelali; Garcia-Caurel, Enric; Pierangelo, Angelo; Martino, Antonello De; Pagnoux, Dominique

2016-07-01

This paper reports a technique based on spectrally differential measurement for determining the full Mueller matrix of a biological sample through an optical fiber. In this technique, two close wavelengths were used simultaneously, one for characterizing the fiber and the other for characterizing the assembly of fiber and sample. The characteristics of the fiber measured at one wavelength were used to decouple its contribution from the measurement on the assembly of fiber and sample and then to extract sample Mueller matrix at the second wavelength. The proof of concept was experimentally validated by measuring polarimetric parameters of various calibrated optical components through the optical fiber. Then, polarimetric images of histological cuts of human colon tissues were measured, and retardance, diattenuation, and orientation of the main axes of fibrillar regions were displayed. Finally, these images were successfully compared with images obtained by a free space Mueller microscope. As the reported method does not use any moving component, it offers attractive integration possibilities with an endoscopic probe.

Characteristics of ADC12/nano Al2O3composites with Addition of Ti Produced By Stir Casting Method

NASA Astrophysics Data System (ADS)

Zulfia, A.; Krisiphala; Ferdian, D.; Utomo, B. W.; Dhaneswara, D.

2018-03-01

The mechanical properties and microstructure of ADC12/nano Al2O3 matrix composites have been studied in this work. The composites were produced by stir casting method. ADC 12 as matrix composites was combined by Mg and Ti. The addition of Ti was varied from 0.02 to 0.08 wt-% as grain refinement wetting to improve mechanical properties such as tensile strength, hardness and wear resistance, while Mg addition was to promote wetting between ADC 12 and nano Al2O3. The optimum tensile strength was found at 0.04 wt-% addition of Ti with value of 132.5 MPa, further adding more Ti cause a poisoning mechanism that will hindered the grain refining process and reduce the tensile strength. The hardness and wear resistance of composites would also increase because of the refinement process. and the added Magnesium in the material that will form Mg2Si primary phases who have a high hardness value.

Nondestructive evaluation and characterization of damage and repair to continuous-fiber ceramic composite panels.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sun, J. G.; Petrak, D. R.; Pillai, T. A. K.

1998-04-01

Continuous fiber ceramic matrix composites are currently being developed for a variety of high-temperature applications. Because of the high costs of making these components, minor damage incurred during manufacturing or operation must be rewired in order to extend the life of the components. In this study, five ceramic-grade Nicalon{trademark} fiber/SiNC-matrix composite panels were intentionally damaged with a pendulum-type impactor during an impact test. The damaged panels were then repaired at Dow Corning Corporation. Three nondestructive evaluation (NDE) methods were used to study the characteristics of the panels after the damage and again after the panels were repaired. The NDE methodsmore » were X-ray radiography, infrared thermal imaging, and air-coupled ultrasound. The results showed that the impact test induced various types of damage in the panels. The NDE data that were obtained by the three NDE methods were correlated with each other.« less

Optical fiber-based full Mueller polarimeter for endoscopic imaging using a two-wavelength simultaneous measurement method.

PubMed

Vizet, Jérémy; Manhas, Sandeep; Tran, Jacqueline; Validire, Pierre; Benali, Abdelali; Garcia-Caurel, Enric; Pierangelo, Angelo; De Martino, Antonello; Pagnoux, Dominique

2016-07-01

This paper reports a technique based on spectrally differential measurement for determining the full Mueller matrix of a biological sample through an optical fiber. In this technique, two close wavelengths were used simultaneously, one for characterizing the fiber and the other for characterizing the assembly of fiber and sample. The characteristics of the fiber measured at one wavelength were used to decouple its contribution from the measurement on the assembly of fiber and sample and then to extract sample Mueller matrix at the second wavelength. The proof of concept was experimentally validated by measuring polarimetric parameters of various calibrated optical components through the optical fiber. Then, polarimetric images of histological cuts of human colon tissues were measured, and retardance, diattenuation, and orientation of the main axes of fibrillar regions were displayed. Finally, these images were successfully compared with images obtained by a free space Mueller microscope. As the reported method does not use any moving component, it offers attractive integration possibilities with an endoscopic probe.

Controlled Breast Cancer Microarrays for the Deconvolution of Cellular Multilayering and Density Effects upon Drug Responses

PubMed Central

Håkanson, Maria; Kobel, Stefan; Lutolf, Matthias P.; Textor, Marcus; Cukierman, Edna; Charnley, Mirren

2012-01-01

Background Increasing evidence shows that the cancer microenvironment affects both tumorigenesis and the response of cancer to drug treatment. Therefore in vitro models that selectively reflect characteristics of the in vivo environment are greatly needed. Current methods allow us to screen the effect of extrinsic parameters such as matrix composition and to model the complex and three-dimensional (3D) cancer environment. However, 3D models that reflect characteristics of the in vivo environment are typically too complex and do not allow the separation of discrete extrinsic parameters. Methodology/Principal Findings In this study we used a poly(ethylene glycol) (PEG) hydrogel-based microwell array to model breast cancer cell behavior in multilayer cell clusters that allows a rigorous control of the environment. The innovative array fabrication enables different matrix proteins to be integrated into the bottom surface of microwells. Thereby, extrinsic parameters including dimensionality, type of matrix coating and the extent of cell-cell adhesion could be independently studied. Our results suggest that cell to matrix interactions and increased cell-cell adhesion, at high cell density, induce independent effects on the response to Taxol in multilayer breast cancer cell clusters. In addition, comparing the levels of apoptosis and proliferation revealed that drug resistance mediated by cell-cell adhesion can be related to altered cell cycle regulation. Conversely, the matrix-dependent response to Taxol did not correlate with proliferation changes suggesting that cell death inhibition may be responsible for this effect. Conclusions/Significance The application of the PEG hydrogel platform provided novel insight into the independent role of extrinsic parameters controlling drug response. The presented platform may not only become a useful tool for basic research related to the role of the cancer microenvironment but could also serve as a complementary platform for in vitro drug development. PMID:22792141

The comparison of antimicrobial packaging properties with different applications incorporation method of active material

NASA Astrophysics Data System (ADS)

Anwar, R. W.; Sugiarto; Warsiki, E.

2018-03-01

Contamination after the processing of products during storage, distribution and marketing is one of the main causes of food safety issues. Handling of food products after processing can be done during the packaging process. Antimicrobial (AM) active packaging is one of the concept of packaging product development by utilize the interaction between the product and the packaging environment that can delay the bacterial damage by killing or reducing bacterial growth. The active system is formed by incorporating an antimicrobial agent against a packaging matrix that will function as a carrier. Many incorporation methods have been developed in this packaging-making concept which were direct mixing, polishing, and encapsulation. The aims of this research were to examine the different of the AM packaging performances including its stability and effectiveness of its function that would be produced by three different methods. The stability of the packaging function was analyzed by looking at the diffusivity of the active ingredient to the matrix using SEM. The effectiveness was analyzed by the ability of the packaging to prevent the growing of the microbial. The results showed that different incorporation methods resulted on different characteristics of the AM packaging.

Fluorescence Intrinsic Characterization of Excitation-Emission Matrix Using Multi-Dimensional Ensemble Empirical Mode Decomposition

PubMed Central

Chang, Chi-Ying; Chang, Chia-Chi; Hsiao, Tzu-Chien

2013-01-01

Excitation-emission matrix (EEM) fluorescence spectroscopy is a noninvasive method for tissue diagnosis and has become important in clinical use. However, the intrinsic characterization of EEM fluorescence remains unclear. Photobleaching and the complexity of the chemical compounds make it difficult to distinguish individual compounds due to overlapping features. Conventional studies use principal component analysis (PCA) for EEM fluorescence analysis, and the relationship between the EEM features extracted by PCA and diseases has been examined. The spectral features of different tissue constituents are not fully separable or clearly defined. Recently, a non-stationary method called multi-dimensional ensemble empirical mode decomposition (MEEMD) was introduced; this method can extract the intrinsic oscillations on multiple spatial scales without loss of information. The aim of this study was to propose a fluorescence spectroscopy system for EEM measurements and to describe a method for extracting the intrinsic characteristics of EEM by MEEMD. The results indicate that, although PCA provides the principal factor for the spectral features associated with chemical compounds, MEEMD can provide additional intrinsic features with more reliable mapping of the chemical compounds. MEEMD has the potential to extract intrinsic fluorescence features and improve the detection of biochemical changes. PMID:24240806

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kumar, Sumit; Srivastava, Subodh; Agrawal, Shweta

The composite membranes of multi-walled carbon nanotube (MWCNT) and polymethylmethacrylate (PMMA) were prepared by solution cast method. The MWCNT was dispersing a very low concentration (0.1 wt %) in PMMA matrix. Alignment of MWCNT in PMMA matrix has been performed by inducing a DC electric field at different voltage parameter varying from 350 V/cm to 1250 V/cm. The MWCNT/PMMA composites were characterized by gas permeation and electrical measurement before and after electric field alignment. The effect of electric field alignment has been studied on gas permeation measurements for gas purification applications. These measurements indicate the enhancement in gas permeability duemore » to the aligned of MWCNT in PMMA matix as compare to randomly dispersed MWCNT. I-V characteristics measurement also indicates that aligned MWCNT/PMMA composite membrane exhibits electron tunneling conductivity.« less

Application of the trigonal curve to the Blaszak-Marciniak lattice hierarchy

NASA Astrophysics Data System (ADS)

Geng, Xianguo; Zeng, Xin

2017-01-01

We develop a method for constructing algebro-geometric solutions of the Blaszak-Marciniak ( BM) lattice hierarchy based on the theory of trigonal curves. We first derive the BM lattice hierarchy associated with a discrete (3×3)- matrix spectral problem using Lenard recurrence relations. Using the characteristic polynomial of the Lax matrix for the BM lattice hierarchy, we introduce a trigonal curve with two infinite points, which we use to establish the associated Dubrovin-type equations. We then study the asymptotic properties of the algebraic function carrying the data of the divisor and the Baker-Akhiezer function near the two infinite points on the trigonal curve. We finally obtain algebro-geometric solutions of the entire BM lattice hierarchy in terms of the Riemann theta function.

Preparation and crystalline studies of PVDF hybrid composites

NASA Astrophysics Data System (ADS)

Chethan P., B.; Renukappa, N. M.; Sanjeev, Ganesh

2018-04-01

The conducting polymer composites have become increasingly important for electrical and electronic applications due to their flexibility, easy of processing, high strength and low cost. A flexible conducting polymer hybrid composite was prepared by melt mixing of nickel coated multi-walled carbon nanotubes (Ni-MWNT) and graphitized carbon nanofibres (GCNF) in Polyvinylidene fluoride (PVDF) matrix. The crystalline structures of the nano composites were studied by X-ray diffraction (XRD) method and showed characteristic peaks at 17.7°, 18.5°, 20° and 26.7° of 2θ. The β phase crystalline nature of the composite films, degree of crystallinity, melting temperature and crystallization behavior of the hybrid composites were studied using appropriate characterization techniques. The filler in the insulating polymer matrix plays crucial role to improve the crystallinity of the composites.

Tailorable Dielectric Material with Complex Permittivity Characteristics

NASA Technical Reports Server (NTRS)

Smith, Joseph G. (Inventor); Watson, Kent A. (Inventor); Elliott, Holly A (Inventor); Delozier, Donavon Mark (Inventor); Connell, John W. (Inventor); Ghose, Sayata (Inventor); Dudley, Kenneth L. (Inventor)

2014-01-01

A dielectric material includes a network of nanosubstrates, such as but not limited to nanotubes, nanosheets, or other nanomaterials or nanostructures, a polymer base material or matrix, and nanoparticles constructed at least partially of an elemental metal. The network has a predetermined nanosubstrate loading percentage by weight with respect to a total weight of the dielectric material, and a preferential or predetermined longitudinal alignment with respect to an orientation of an incident electrical field. A method of forming the dielectric material includes depositing the metal-based nanoparticles onto the nanosubstrates and subsequently mixing these with a polymer matrix. Once mixed, alignment can be achieved by melt extrusion or a similar mechanical shearing process. Alignment of the nanosubstrate may be in horizontal or vertical direction with respect to the orientation of an incident electrical field.

Propagation characteristics of electromagnetic waves in dusty plasma with full ionization

NASA Astrophysics Data System (ADS)

Dan, Li; Guo, Li-Xin; Li, Jiang-Ting

2018-01-01

This study investigates the propagation characteristics of electromagnetic (EM) waves in fully ionized dusty plasmas. The propagation characteristics of fully ionized plasma with and without dust under the Fokker-Planck-Landau (FPL) and Bhatnagar-Gross-Krook (BGK) models are compared to those of weakly ionized plasmas by using the propagation matrix method. It is shown that the FPL model is suitable for the analysis of the propagation characteristics of weakly collisional and fully ionized dusty plasmas, as is the BGK model. The influence of varying the dust parameters on the propagation properties of EM waves in the fully ionized dusty plasma was analyzed using the FPL model. The simulation results indicated that the densities and average radii of dust grains influence the reflection and transmission coefficients of fully ionized dusty plasma slabs. These results may be utilized to analyze the effects of interaction between EM waves and dusty plasmas, such as those associated with hypersonic vehicles.

The Effects of Q-Matrix Design on Classification Accuracy in the Log-Linear Cognitive Diagnosis Model.

PubMed

Madison, Matthew J; Bradshaw, Laine P

2015-06-01

Diagnostic classification models are psychometric models that aim to classify examinees according to their mastery or non-mastery of specified latent characteristics. These models are well-suited for providing diagnostic feedback on educational assessments because of their practical efficiency and increased reliability when compared with other multidimensional measurement models. A priori specifications of which latent characteristics or attributes are measured by each item are a core element of the diagnostic assessment design. This item-attribute alignment, expressed in a Q-matrix, precedes and supports any inference resulting from the application of the diagnostic classification model. This study investigates the effects of Q-matrix design on classification accuracy for the log-linear cognitive diagnosis model. Results indicate that classification accuracy, reliability, and convergence rates improve when the Q-matrix contains isolated information from each measured attribute.

Immobilized lipid-bilayer materials

DOEpatents

Sasaki, Darryl Y.; Loy, Douglas A.; Yamanaka, Stacey A.

2000-01-01

A method for preparing encapsulated lipid-bilayer materials in a silica matrix comprising preparing a silica sol, mixing a lipid-bilayer material in the silica sol and allowing the mixture to gel to form the encapsulated lipid-bilayer material. The mild processing conditions allow quantitative entrapment of pre-formed lipid-bilayer materials without modification to the material's spectral characteristics. The method allows for the immobilization of lipid membranes to surfaces. The encapsulated lipid-bilayer materials perform as sensitive optical sensors for the detection of analytes such as heavy metal ions and can be used as drug delivery systems and as separation devices.

Matrix completion by deep matrix factorization.

PubMed

Fan, Jicong; Cheng, Jieyu

2018-02-01

Conventional methods of matrix completion are linear methods that are not effective in handling data of nonlinear structures. Recently a few researchers attempted to incorporate nonlinear techniques into matrix completion but there still exists considerable limitations. In this paper, a novel method called deep matrix factorization (DMF) is proposed for nonlinear matrix completion. Different from conventional matrix completion methods that are based on linear latent variable models, DMF is on the basis of a nonlinear latent variable model. DMF is formulated as a deep-structure neural network, in which the inputs are the low-dimensional unknown latent variables and the outputs are the partially observed variables. In DMF, the inputs and the parameters of the multilayer neural network are simultaneously optimized to minimize the reconstruction errors for the observed entries. Then the missing entries can be readily recovered by propagating the latent variables to the output layer. DMF is compared with state-of-the-art methods of linear and nonlinear matrix completion in the tasks of toy matrix completion, image inpainting and collaborative filtering. The experimental results verify that DMF is able to provide higher matrix completion accuracy than existing methods do and DMF is applicable to large matrices. Copyright © 2017 Elsevier Ltd. All rights reserved.

Numerical analysis for the stick-slip vibration of a transversely moving beam in contact with a frictional wall

NASA Astrophysics Data System (ADS)

Won, Hong-In; Chung, Jintai

2018-04-01

This paper presents a numerical analysis for the stick-slip vibration of a transversely moving beam, considering both stick-slip transition and friction force discontinuity. The dynamic state of the beam was separated into the stick state and the slip state, and boundary conditions were defined for both. By applying the finite element method, two matrix-vector equations were derived: one for stick state and the other for slip state. However, the equations have different degrees of freedom depending on whether the end of a beam sticks or slips, so we encountered difficulties in time integration. To overcome the difficulties, we proposed a new numerical technique to alternatively use the matrix-vector equations with different matrix sizes. In addition, to eliminate spurious high-frequency responses, we applied the generalized-α time integration method with appropriate value of high-frequency numerical dissipation. Finally, the dynamic responses of stick-slip vibration were analyzed in time and frequency domains: the dynamic behavior of the beam was explained to facilitate understanding of the stick-slip motion, and frequency characteristics of the stick-slip vibration were investigated in relation to the natural frequencies of the beam. The effects of the axial load and the moving speed upon the dynamic response were also examined.

A Bayesian method for detecting pairwise associations in compositional data

PubMed Central

Ventz, Steffen; Huttenhower, Curtis

2017-01-01

Compositional data consist of vectors of proportions normalized to a constant sum from a basis of unobserved counts. The sum constraint makes inference on correlations between unconstrained features challenging due to the information loss from normalization. However, such correlations are of long-standing interest in fields including ecology. We propose a novel Bayesian framework (BAnOCC: Bayesian Analysis of Compositional Covariance) to estimate a sparse precision matrix through a LASSO prior. The resulting posterior, generated by MCMC sampling, allows uncertainty quantification of any function of the precision matrix, including the correlation matrix. We also use a first-order Taylor expansion to approximate the transformation from the unobserved counts to the composition in order to investigate what characteristics of the unobserved counts can make the correlations more or less difficult to infer. On simulated datasets, we show that BAnOCC infers the true network as well as previous methods while offering the advantage of posterior inference. Larger and more realistic simulated datasets further showed that BAnOCC performs well as measured by type I and type II error rates. Finally, we apply BAnOCC to a microbial ecology dataset from the Human Microbiome Project, which in addition to reproducing established ecological results revealed unique, competition-based roles for Proteobacteria in multiple distinct habitats. PMID:29140991

The New Multi-HAzard and MulTi-RIsK Assessment MethodS for Europe (MATRIX) Project - An overview of its major findings

NASA Astrophysics Data System (ADS)

Fleming, Kevin; Zschau, Jochen; Gasparini, Paolo

2014-05-01

Recent major natural disasters, such as the 2011 Tōhoku earthquake, tsunami and subsequent Fukushima nuclear accident, have raised awareness of the frequent and potentially far-reaching interconnections between natural hazards. Such interactions occur at the hazard level, where an initial hazard may trigger other events (e.g., an earthquake triggering a tsunami) or several events may occur concurrently (or nearly so), e.g., severe weather around the same time as an earthquake. Interactions also occur at the vulnerability level, where the initial event may make the affected community more susceptible to the negative consequences of another event (e.g., an earthquake weakens buildings, which are then damaged further by windstorms). There is also a temporal element involved, where changes in exposure may alter the total risk to a given area. In short, there is the likelihood that the total risk estimated when considering multiple hazard and risks and their interactions is greater than the sum of their individual parts. It is with these issues in mind that the European Commission, under their FP7 program, supported the New Multi-HAzard and MulTi-RIsK Assessment MethodS for Europe or MATRIX project (10.2010 to 12.2013). MATRIX set out to tackle multiple natural hazards (i.e., those of concern to Europe, namely earthquakes, landslides, volcanos, tsunamis, wild fires, storms and fluvial and coastal flooding) and risks within a common theoretical framework. The MATRIX work plan proceeded from an assessment of single-type risk methodologies (including how uncertainties should be treated), cascade effects within a multi-hazard environment, time-dependent vulnerability, decision making and support for multi-hazard mitigation and adaption, and an assessment of how the multi-hazard and risk viewpoint may be integrated into current decision making and risk mitigation programs, considering the existing single-hazard and risk focus. Three test sites were considered during the project: Naples, Cologne, and the French West Indies. In addition, a software platform, the MATRIX-Common IT sYstem (MATRIX-CITY), was developed to allow the evaluation of characteristic multi-hazard and risk scenarios in comparison to single-type analyses. This presentation therefore outlines the more significant outcomes of the project, in particular those dealing with the harmonization of single-type hazards, cascade event analysis, time-dependent vulnerability changes and the response of the disaster management community to the MATRIX point of view.

Key-Generation Algorithms for Linear Piece In Hand Matrix Method

NASA Astrophysics Data System (ADS)

Tadaki, Kohtaro; Tsujii, Shigeo

The linear Piece In Hand (PH, for short) matrix method with random variables was proposed in our former work. It is a general prescription which can be applicable to any type of multivariate public-key cryptosystems for the purpose of enhancing their security. Actually, we showed, in an experimental manner, that the linear PH matrix method with random variables can certainly enhance the security of HFE against the Gröbner basis attack, where HFE is one of the major variants of multivariate public-key cryptosystems. In 1998 Patarin, Goubin, and Courtois introduced the plus method as a general prescription which aims to enhance the security of any given MPKC, just like the linear PH matrix method with random variables. In this paper we prove the equivalence between the plus method and the primitive linear PH matrix method, which is introduced by our previous work to explain the notion of the PH matrix method in general in an illustrative manner and not for a practical use to enhance the security of any given MPKC. Based on this equivalence, we show that the linear PH matrix method with random variables has the substantial advantage over the plus method with respect to the security enhancement. In the linear PH matrix method with random variables, the three matrices, including the PH matrix, play a central role in the secret-key and public-key. In this paper, we clarify how to generate these matrices and thus present two probabilistic polynomial-time algorithms to generate these matrices. In particular, the second one has a concise form, and is obtained as a byproduct of the proof of the equivalence between the plus method and the primitive linear PH matrix method.

Sparse subspace clustering for data with missing entries and high-rank matrix completion.

PubMed

Fan, Jicong; Chow, Tommy W S

2017-09-01

Many methods have recently been proposed for subspace clustering, but they are often unable to handle incomplete data because of missing entries. Using matrix completion methods to recover missing entries is a common way to solve the problem. Conventional matrix completion methods require that the matrix should be of low-rank intrinsically, but most matrices are of high-rank or even full-rank in practice, especially when the number of subspaces is large. In this paper, a new method called Sparse Representation with Missing Entries and Matrix Completion is proposed to solve the problems of incomplete-data subspace clustering and high-rank matrix completion. The proposed algorithm alternately computes the matrix of sparse representation coefficients and recovers the missing entries of a data matrix. The proposed algorithm recovers missing entries through minimizing the representation coefficients, representation errors, and matrix rank. Thorough experimental study and comparative analysis based on synthetic data and natural images were conducted. The presented results demonstrate that the proposed algorithm is more effective in subspace clustering and matrix completion compared with other existing methods. Copyright © 2017 Elsevier Ltd. All rights reserved.

Chondrocytes provide a model for in-situ confocal microscopy and 3D reconstructions

NASA Astrophysics Data System (ADS)

Hirsch, Michelle S.; Svoboda, Kathy K. H.

1994-04-01

Hyaline cartilage is composed of chondrocytes that reside in lacunae surrounded by extracellular matrix molecules. Microscopic and histochemical features of cartilage have been studied with many techniques. Many of these techniques can be time consuming and may alter natural cartilage characteristics. In addition, the orientation and order of sectioned tissue must be maintained to create 3D reconstructions. We show that confocal laser scanning microscopy may replace traditional methods for studying cartilage.

Fire and Flammability Characteristics of Materials Used in Rail Passenger Cars. A Literature Survey.

DTIC Science & Technology

1980-04-01

Charac- teristics of Fiber -Reinforced Organic-Matrix Composites ," Report No. MAT-77-21, David W. Taylor Naval Ship R&D Center, Annapolis, MD 21402, June...were limited to poly- vinyl chloride, urethanes, wool, and Nomex fiber ;and gas analysis was limited to carbon monoxide, hydrogen cyanide, and...liberation, smoke emission, combustion products, toxicity, pyrolysis, plastics, polymers, synthetic fibers , flammability test methods. 20, A MT’NACT (mftM m

Simulation of Optical Resonators for Vertical-Cavity Surface-Emitting Lasers (vcsel)

NASA Astrophysics Data System (ADS)

Mansour, Mohy S.; Hassen, Mahmoud F. M.; El-Nozahey, Adel M.; Hafez, Alaa S.; Metry, Samer F.

2010-04-01

Simulation and modeling of the reflectivity and transmissivity of the multilayer DBR of VCSEL, as well as inside the active region quantum well are analyzed using the characteristic matrix method. The electric field intensity distributions inside such vertical-cavity structure are calculated. A software program under MATLAB environment is constructed for the simulation. This study was performed for two specific Bragg wavelengths 980 nm and 370 nm for achieving a resonant periodic gain (RPG)

Generalized Eigenvalues for pairs on heritian matrices

NASA Technical Reports Server (NTRS)

Rublein, George

1988-01-01

A study was made of certain special cases of a generalized eigenvalue problem. Let A and B be nxn matrics. One may construct a certain polynomial, P(A,B, lambda) which specializes to the characteristic polynomial of B when A equals I. In particular, when B is hermitian, that characteristic polynomial, P(I,B, lambda) has real roots, and one can ask: are the roots of P(A,B, lambda) real when B is hermitian. We consider the case where A is positive definite and show that when N equals 3, the roots are indeed real. The basic tools needed in the proof are Shur's theorem on majorization for eigenvalues of hermitian matrices and the interlacing theorem for the eigenvalues of a positive definite hermitian matrix and one of its principal (n-1)x(n-1) minors. The method of proof first reduces the general problem to one where the diagonal of B has a certain structure: either diag (B) = diag (1,1,1) or diag (1,1,-1), or else the 2 x 2 principal minors of B are all 1. According as B has one of these three structures, we use an appropriate method to replace A by a positive diagonal matrix. Since it can be easily verified that P(D,B, lambda) has real roots, the result follows. For other configurations of B, a scaling and a continuity argument are used to prove the result in general.

Normal response function method for mass and stiffness matrix updating using complex FRFs

NASA Astrophysics Data System (ADS)

Pradhan, S.; Modak, S. V.

2012-10-01

Quite often a structural dynamic finite element model is required to be updated so as to accurately predict the dynamic characteristics like natural frequencies and the mode shapes. Since in many situations undamped natural frequencies and mode shapes need to be predicted, it has generally been the practice in these situations to seek updating of only mass and stiffness matrix so as to obtain a reliable prediction model. Updating using frequency response functions (FRFs) has been one of the widely used approaches for updating, including updating of mass and stiffness matrices. However, the problem with FRF based methods, for updating mass and stiffness matrices, is that these methods are based on use of complex FRFs. Use of complex FRFs to update mass and stiffness matrices is not theoretically correct as complex FRFs are not only affected by these two matrices but also by the damping matrix. Therefore, in situations where updating of only mass and stiffness matrices using FRFs is required, the use of complex FRFs based updating formulation is not fully justified and would lead to inaccurate updated models. This paper addresses this difficulty and proposes an improved FRF based finite element model updating procedure using the concept of normal FRFs. The proposed method is a modified version of the existing response function method that is based on the complex FRFs. The effectiveness of the proposed method is validated through a numerical study of a simple but representative beam structure. The effect of coordinate incompleteness and robustness of method under presence of noise is investigated. The results of updating obtained by the improved method are compared with the existing response function method. The performance of the two approaches is compared for cases of light, medium and heavily damped structures. It is found that the proposed improved method is effective in updating of mass and stiffness matrices in all the cases of complete and incomplete data and with all levels and types of damping.

Cardiovascular disease testing on the Dimension Vista system: biomarkers of acute coronary syndromes.

PubMed

Kelley, Walter E; Lockwood, Christina M; Cervelli, Denise R; Sterner, Jamie; Scott, Mitchell G; Duh, Show-Hong; Christenson, Robert H

2009-09-01

Performance characteristics of the LOCI cTnI, CK-MB, MYO, NTproBNP and hsCRP methods on the Dimension Vista System were evaluated. Imprecision (following CLSI EP05-A2 guidelines), limit of quantitation (cTnI), limit of blank, linearity on dilution, serum versus plasma matrix studies (cTnI), and method comparison studies were conducted. Method imprecision of 1.8 to 9.7% (cTnI), 1.8 to 5.7% (CK-MB), 2.1 to 2.2% (MYO), 1.6 to 3.3% (NTproBNP), and 3.5 to 4.2% (hsCRP) were demonstrated. The manufacturer's claimed imprecision, detection limits and upper measurement limits were met. Limit of Quantitation was 0.040 ng/mL for the cTnI assay. Agreement of serum and plasma values for cTnI (r=0.99) was shown. Method comparison study results were acceptable. The Dimension Vista cTnI, CK-MB, MYO, NTproBNP, and hsCRP methods demonstrate acceptable performance characteristics for use as an aid in the diagnosis and risk assessment of patients presenting with suspected acute coronary syndromes.

Creep of Heat-Resistant Composites of an Oxide-Fiber/Ni-Matrix Family

NASA Astrophysics Data System (ADS)

Mileiko, S. T.

2001-09-01

A creep model of a composite with a creeping matrix and initially continuous elastic brittle fibers is developed. The model accounts for the fiber fragmentation in the stage of unsteady creep of the composite, which ends with a steady-state creep, where a minimum possible average length of the fiber is achieved. The model makes it possible to analyze the creep rate of the composite in relation to such parameters of its structure as the statistic characteristics of the fiber strength, the creep characteristics of the matrix, and the strength of the fiber-matrix interface, the latter being of fundamental importance. A comparison between the calculation results and the experimental ones obtained on composites with a Ni-matrix and monocrystalline and eutectic oxide fibers as well as on sapphire fiber/TiAl-matrix composites shows that the model is applicable to the computer simulation of the creep behavior of heat-resistant composites and to the optimization of the structure of such composites. By combining the experimental data with calculation results, it is possible to evaluate the heat resistance of composites and the potential of oxide-fiber/Ni-matrix composites. The composite specimens obtained and tested to date reveal their high creep resistance up to a temperature of 1150°C. The maximum operating temperature of the composites can be considerably raised by strengthening the fiber-matrix interface.

Generation of gas-phase ions from charged clusters: an important ionization step causing suppression of matrix and analyte ions in matrix-assisted laser desorption/ionization mass spectrometry.

PubMed

Lou, Xianwen; van Dongen, Joost L J; Milroy, Lech-Gustav; Meijer, E W

2016-12-30

Ionization in matrix-assisted laser desorption/ionization mass spectrometry (MALDI-MS) is a very complicated process. It has been reported that quaternary ammonium salts show extremely strong matrix and analyte suppression effects which cannot satisfactorily be explained by charge transfer reactions. Further investigation of the reasons causing these effects can be useful to improve our understanding of the MALDI process. The dried-droplet and modified thin-layer methods were used as sample preparation methods. In the dried-droplet method, analytes were co-crystallized with matrix, whereas in the modified thin-layer method analytes were deposited on the surface of matrix crystals. Model compounds, tetrabutylammonium iodide ([N(Bu) 4 ]I), cesium iodide (CsI), trihexylamine (THA) and polyethylene glycol 600 (PEG 600), were selected as the test analytes given their ability to generate exclusively pre-formed ions, protonated ions and metal ion adducts respectively in MALDI. The strong matrix suppression effect (MSE) observed using the dried-droplet method might disappear using the modified thin-layer method, which suggests that the incorporation of analytes in matrix crystals contributes to the MSE. By depositing analytes on the matrix surface instead of incorporating in the matrix crystals, the competition for evaporation/ionization from charged matrix/analyte clusters could be weakened resulting in reduced MSE. Further supporting evidence for this inference was found by studying the analyte suppression effect using the same two sample deposition methods. By comparing differences between the mass spectra obtained via the two sample preparation methods, we present evidence suggesting that the generation of gas-phase ions from charged matrix/analyte clusters may induce significant suppression of matrix and analyte ions. The results suggest that the generation of gas-phase ions from charged matrix/analyte clusters is an important ionization step in MALDI-MS. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

Differentiating characteristic microstructural features of cancerous tissues using Mueller matrix microscope.

PubMed

Wang, Ye; He, Honghui; Chang, Jintao; Zeng, Nan; Liu, Shaoxiong; Li, Migao; Ma, Hui

2015-12-01

Polarized light imaging can provide rich microstructural information of samples, and has been applied to the detections of various abnormal tissues. In this paper, we report a polarized light microscope based on Mueller matrix imaging by adding the polarization state generator and analyzer (PSG and PSA) to a commercial transmission optical microscope. The maximum errors for the absolute values of Mueller matrix elements are reduced to 0.01 after calibration. This Mueller matrix microscope has been used to examine human cervical and liver cancerous tissues with fibrosis. Images of the transformed Mueller matrix parameters provide quantitative assessment on the characteristic features of the pathological tissues. Contrast mechanism of the experimental results are backed up by Monte Carlo simulations based on the sphere-cylinder birefringence model, which reveal the relationship between the pathological features in the cancerous tissues at the cellular level and the polarization parameters. Both the experimental and simulated data indicate that the microscopic transformed Mueller matrix parameters can distinguish the breaking down of birefringent normal tissues for cervical cancer, or the formation of birefringent surrounding structures accompanying the inflammatory reaction for liver cancer. With its simple structure, fast measurement and high precision, polarized light microscope based on Mueller matrix shows a good diagnosis application prospect. Copyright © 2015 Elsevier Ltd. All rights reserved.

Matrix elements and duality for type 2 unitary representations of the Lie superalgebra gl(m|n)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Werry, Jason L.; Gould, Mark D.; Isaac, Phillip S.

The characteristic identity formalism discussed in our recent articles is further utilized to derive matrix elements of type 2 unitary irreducible gl(m|n) modules. In particular, we give matrix element formulae for all gl(m|n) generators, including the non-elementary generators, together with their phases on finite dimensional type 2 unitary irreducible representations which include the contravariant tensor representations and an additional class of essentially typical representations. Remarkably, we find that the type 2 unitary matrix element equations coincide with the type 1 unitary matrix element equations for non-vanishing matrix elements up to a phase.

On Connected Diagrams and Cumulants of Erdős-Rényi Matrix Models

NASA Astrophysics Data System (ADS)

Khorunzhiy, O.

2008-08-01

Regarding the adjacency matrices of n-vertex graphs and related graph Laplacian we introduce two families of discrete matrix models constructed both with the help of the Erdős-Rényi ensemble of random graphs. Corresponding matrix sums represent the characteristic functions of the average number of walks and closed walks over the random graph. These sums can be considered as discrete analogues of the matrix integrals of random matrix theory. We study the diagram structure of the cumulant expansions of logarithms of these matrix sums and analyze the limiting expressions as n → ∞ in the cases of constant and vanishing edge probabilities.

Collagen in the spicule organic matrix of the gorgonian Leptogorgia virgulata

NASA Technical Reports Server (NTRS)

Kingsley, R. J.; Tsuzaki, M.; Watabe, N.; Mechanic, G. L.

1990-01-01

Decalcification of the calcareous spicules from the gorgonian Leptogorgia virgulata reveals an organic matrix that may be divided into water insoluble and soluble fractions. The insoluble fraction displays characteristics typical of collagen, which is an unusual component of an invertebrate calcium carbonate structure. This matrix fraction exhibits a collagenous amino acid profile and behavior upon SDS-PAGE. Furthermore, the reducible crosslink, dihydroxylysinonorleucine (DHLNL), is detected in this fraction. The composition of the matrix varies seasonally; i.e., the collagenous composition is most prevalent in the summer. These results indicate that the insoluble matrix is a dynamic structure. Potential roles of this matrix in spicule calcification are discussed.

A robust method of computing finite difference coefficients based on Vandermonde matrix

NASA Astrophysics Data System (ADS)

Zhang, Yijie; Gao, Jinghuai; Peng, Jigen; Han, Weimin

2018-05-01

When the finite difference (FD) method is employed to simulate the wave propagation, high-order FD method is preferred in order to achieve better accuracy. However, if the order of FD scheme is high enough, the coefficient matrix of the formula for calculating finite difference coefficients is close to be singular. In this case, when the FD coefficients are computed by matrix inverse operator of MATLAB, inaccuracy can be produced. In order to overcome this problem, we have suggested an algorithm based on Vandermonde matrix in this paper. After specified mathematical transformation, the coefficient matrix is transformed into a Vandermonde matrix. Then the FD coefficients of high-order FD method can be computed by the algorithm of Vandermonde matrix, which prevents the inverse of the singular matrix. The dispersion analysis and numerical results of a homogeneous elastic model and a geophysical model of oil and gas reservoir demonstrate that the algorithm based on Vandermonde matrix has better accuracy compared with matrix inverse operator of MATLAB.

The dependence of the tunneling characteristic on the electronic energy bands and the carrier’s states of Graphene superlattice

NASA Astrophysics Data System (ADS)

Yang, C. H.; Shen, G. Z.; Ao, Z. M.; Xu, Y. W.

2016-09-01

Using the transfer matrix method, the carrier tunneling properties in graphene superlattice generated by the Thue-Morse sequence and Kolakoski sequence are investigated. The positions and strength of the transmission can be modulated by the barrier structures, the incident energy and angle, the height and width of the potential. These carriers tunneling characteristic can be understood from the energy band structures in the corresponding superlattice systems and the carrier’s states in well/barriers. The transmission peaks above the critical incident angle rely on the carrier’s resonance in the well regions. The structural diversity can modulate the electronic and transport properties, thus expanding its applications.

A Method for Incorporating Changing Structural Characteristics Due to Propellant Mass Usage in a Launch Vehicle Ascent Simulation

NASA Technical Reports Server (NTRS)

McGhee, D. S.

2004-01-01

Launch vehicles consume large quantities of propellant quickly, causing the mass properties and structural dynamics of the vehicle to change dramatically. Currently, structural load assessments account for this change with a large collection of structural models representing various propellant fill levels. This creates a large database of models complicating the delivery of reduced models and requiring extensive work for model changes. Presented here is a method to account for these mass changes in a more efficient manner. The method allows for the subtraction of propellant mass as the propellant is used in the simulation. This subtraction is done in the modal domain of the vehicle generalized model. Additional computation required is primarily for constructing the used propellant mass matrix from an initial propellant model and further matrix multiplications and subtractions. An additional eigenvalue solution is required to uncouple the new equations of motion; however, this is a much simplier calculation starting from a system that is already substantially uncoupled. The method was successfully tested in a simulation of Saturn V loads. Results from the method are compared to results from separate structural models for several propellant levels, showing excellent agreement. Further development to encompass more complicated propellant models, including slosh dynamics, is possible.

Quark Physics without Quarks: A Review of Recent Developments in S-Matrix Theory.

ERIC Educational Resources Information Center

Capra, Fritjof

1979-01-01

Reviews the developments in S-matrix theory over the past five years which have made it possible to derive results characteristic of quark models without any need to postulate the existence of physical quarks. In the new approach, the quark patterns emerge as a consequence of combining the general S-matrix principles with the concept of order.…

Methods and codes for neutronic calculations of the MARIA research reactor.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Andrzejewski, K.; Kulikowska, T.; Bretscher, M. M.

2002-02-18

The core of the MARIA high flux multipurpose research reactor is highly heterogeneous. It consists of beryllium blocks arranged in 6 x 8 matrix, tubular fuel assemblies, control rods and irradiation channels. The reflector is also heterogeneous and consists of graphite blocks clad with aluminum. Its structure is perturbed by the experimental beam tubes. This paper presents methods and codes used to calculate the MARIA reactor neutronics characteristics and experience gained thus far at IAE and ANL. At ANL the methods of MARIA calculations were developed in connection with the RERTR program. At IAE the package of programs was developedmore » to help its operator in optimization of fuel utilization.« less

Transient analysis of 1D inhomogeneous media by dynamic inhomogeneous finite element method

NASA Astrophysics Data System (ADS)

Yang, Zailin; Wang, Yao; Hei, Baoping

2013-12-01

The dynamic inhomogeneous finite element method is studied for use in the transient analysis of onedimensional inhomogeneous media. The general formula of the inhomogeneous consistent mass matrix is established based on the shape function. In order to research the advantages of this method, it is compared with the general finite element method. A linear bar element is chosen for the discretization tests of material parameters with two fictitious distributions. And, a numerical example is solved to observe the differences in the results between these two methods. Some characteristics of the dynamic inhomogeneous finite element method that demonstrate its advantages are obtained through comparison with the general finite element method. It is found that the method can be used to solve elastic wave motion problems with a large element scale and a large number of iteration steps.

Comparison of two Galerkin quadrature methods

DOE PAGES

Morel, Jim E.; Warsa, James; Franke, Brian C.; ...

2017-02-21

Here, we compare two methods for generating Galerkin quadratures. In method 1, the standard S N method is used to generate the moment-to-discrete matrix and the discrete-to-moment matrix is generated by inverting the moment-to-discrete matrix. This is a particular form of the original Galerkin quadrature method. In method 2, which we introduce here, the standard S N method is used to generate the discrete-to-moment matrix and the moment-to-discrete matrix is generated by inverting the discrete-to-moment matrix. With an N-point quadrature, method 1 has the advantage that it preserves N eigenvalues and N eigenvectors of the scattering operator in a pointwisemore » sense. With an N-point quadrature, method 2 has the advantage that it generates consistent angular moment equations from the corresponding S N equations while preserving N eigenvalues of the scattering operator. Our computational results indicate that these two methods are quite comparable for the test problem considered.« less

Comparison of two Galerkin quadrature methods

DOE Office of Scientific and Technical Information (OSTI.GOV)

Morel, Jim E.; Warsa, James; Franke, Brian C.

Here, we compare two methods for generating Galerkin quadratures. In method 1, the standard S N method is used to generate the moment-to-discrete matrix and the discrete-to-moment matrix is generated by inverting the moment-to-discrete matrix. This is a particular form of the original Galerkin quadrature method. In method 2, which we introduce here, the standard S N method is used to generate the discrete-to-moment matrix and the moment-to-discrete matrix is generated by inverting the discrete-to-moment matrix. With an N-point quadrature, method 1 has the advantage that it preserves N eigenvalues and N eigenvectors of the scattering operator in a pointwisemore » sense. With an N-point quadrature, method 2 has the advantage that it generates consistent angular moment equations from the corresponding S N equations while preserving N eigenvalues of the scattering operator. Our computational results indicate that these two methods are quite comparable for the test problem considered.« less

Determination of perchlorate in drinking water by ion chromatography using macrocycle-based concentration and separation methods.

PubMed

Lamb, John D; Simpson, David; Jensen, Bryce D; Gardner, Joseph S; Peterson, Quinn P

2006-06-16

Macrocycle-based ion chromatography provides a convenient, reliable method for the determination of perchlorate ion, which is currently of great interest to the environmental community. This study shows that effective perchlorate determinations can be made using standard conductimetric detection by combining an 18-crown-6-based mobile phase with an underivatized reversed-phase mobile phase ion chromatography (MPIC) column. One unique feature of this method is the flexibility in column capacity that is achieved through simple variations in eluent concentrations of 18-crown-6 and KOH, facilitating the separation of target analyte anions such as perchlorate. Using a standard anion exchange column as concentrator makes possible the determination of perchlorate as low as 0.2 ug/L in low ionic strength matrices. Determination of perchlorate at the sub-ug/L level in pure water and in spiked local city hard water samples with high background ion concentrations can be achieved this way. However, like other IC techniques, this method is challenged to achieve analyses at the ug/L level in the demanding high ionic strength matrix described by the United States Environmental Protection Agency (EPA) (1,000 mg/L chloride, sulfate and carbonate). We approached this challenge by use of the Cryptand C1 concentrator column, provided by Dionex Corporation, to effectively preconcentrate perchlorate while reducing background ion concentrations in the high ionic strength matrix. The retention characteristics of the concentrator column were studied in order to maximize its effectiveness for perchlorate determinations. The method makes possible the determination of perchlorate at the 5 ug/L level in the highest ionic strength matrix described by the EPA.

Method of producing a hybrid matrix fiber composite

DOEpatents

Deteresa, Steven J [Livermore, CA; Lyon, Richard E [Absecon, NJ; Groves, Scott E [Brentwood, CA

2006-03-28

Hybrid matrix fiber composites having enhanced compressive performance as well as enhanced stiffness, toughness and durability suitable for compression-critical applications. The methods for producing the fiber composites using matrix hybridization. The hybrid matrix fiber composites comprised of two chemically or physically bonded matrix materials, whereas the first matrix materials are used to impregnate multi-filament fibers formed into ribbons and the second matrix material is placed around and between the fiber ribbons that are impregnated with the first matrix material and both matrix materials are cured and solidified.

Effect of Nanofiller Characteristics on Nanocomposite Properties

NASA Technical Reports Server (NTRS)

Working, Dennis C.; Lillehei, Peter T.; Lowther, Sharon E.; Siochi, Emilie J.; Kim, Jae-Woo; Sauti, Godfrey; Wise, Kristopher E.; Park, Cheol

2016-01-01

This report surveys the effect of nanofiller characteristics on nanocomposites fabricated with two polyimide matrices. Mechanical and electrical properties were determined. Microscopy results showed that matrix chemistry, nanofiller characteristics and processing conditions had significant impact on nanocomposite quality.

Modeling and parameter identification of impulse response matrix of mechanical systems

NASA Astrophysics Data System (ADS)

Bordatchev, Evgueni V.

1998-12-01

A method for studying the problem of modeling, identification and analysis of mechanical system dynamic characteristic in view of the impulse response matrix for the purpose of adaptive control is developed here. Two types of the impulse response matrices are considered: (i) on displacement, which describes the space-coupled relationship between vectors of the force and simulated displacement, which describes the space-coupled relationship between vectors of the force and simulated displacement and (ii) on acceleration, which also describes the space-coupled relationship between the vectors of the force and measured acceleration. The idea of identification consists of: (a) the practical obtaining of the impulse response matrix on acceleration by 'impact-response' technique; (b) the modeling and parameter estimation of the each impulse response function on acceleration through the fundamental representation of the impulse response function on displacement as a sum of the damped sine curves applying linear and non-linear least square methods; (c) simulating the impulse provides the additional possibility to calculate masses, damper and spring constants. The damped natural frequencies are used as a priori information and are found through the standard FFT analysis. The problem of double numerical integration is avoided by taking two derivations of the fundamental dynamic model of a mechanical system as linear combination of the mass-damper-spring subsystems. The identified impulse response matrix on displacement represents the dynamic properties of the mechanical system. From the engineering point of view, this matrix can be also understood as a 'dynamic passport' of the mechanical system and can be used for dynamic certification and analysis of the dynamic quality. In addition, the suggested approach mathematically reproduces amplitude-frequency response matrix in a low-frequency band and on zero frequency. This allows the possibility of determining the matrix of the static stiffness due to dynamic testing over the time of 10- 15 minutes. As a practical example, the dynamic properties in view of the impulse and frequency response matrices of the lathe spindle are obtained, identified and investigated. The developed approach for modeling and parameter identification appears promising for a wide range o industrial applications; for example, rotary systems.

Approximate method of variational Bayesian matrix factorization/completion with sparse prior

NASA Astrophysics Data System (ADS)

Kawasumi, Ryota; Takeda, Koujin

2018-05-01

We derive the analytical expression of a matrix factorization/completion solution by the variational Bayes method, under the assumption that the observed matrix is originally the product of low-rank, dense and sparse matrices with additive noise. We assume the prior of a sparse matrix is a Laplace distribution by taking matrix sparsity into consideration. Then we use several approximations for the derivation of a matrix factorization/completion solution. By our solution, we also numerically evaluate the performance of a sparse matrix reconstruction in matrix factorization, and completion of a missing matrix element in matrix completion.

The fast algorithm of spark in compressive sensing

NASA Astrophysics Data System (ADS)

Xie, Meihua; Yan, Fengxia

2017-01-01

Compressed Sensing (CS) is an advanced theory on signal sampling and reconstruction. In CS theory, the reconstruction condition of signal is an important theory problem, and spark is a good index to study this problem. But the computation of spark is NP hard. In this paper, we study the problem of computing spark. For some special matrixes, for example, the Gaussian random matrix and 0-1 random matrix, we obtain some conclusions. Furthermore, for Gaussian random matrix with fewer rows than columns, we prove that its spark equals to the number of its rows plus one with probability 1. For general matrix, two methods are given to compute its spark. One is the method of directly searching and the other is the method of dual-tree searching. By simulating 24 Gaussian random matrixes and 18 0-1 random matrixes, we tested the computation time of these two methods. Numerical results showed that the dual-tree searching method had higher efficiency than directly searching, especially for those matrixes which has as much as rows and columns.

A sparse matrix-vector multiplication based algorithm for accurate density matrix computations on systems of millions of atoms

NASA Astrophysics Data System (ADS)

Ghale, Purnima; Johnson, Harley T.

2018-06-01

We present an efficient sparse matrix-vector (SpMV) based method to compute the density matrix P from a given Hamiltonian in electronic structure computations. Our method is a hybrid approach based on Chebyshev-Jackson approximation theory and matrix purification methods like the second order spectral projection purification (SP2). Recent methods to compute the density matrix scale as O(N) in the number of floating point operations but are accompanied by large memory and communication overhead, and they are based on iterative use of the sparse matrix-matrix multiplication kernel (SpGEMM), which is known to be computationally irregular. In addition to irregularity in the sparse Hamiltonian H, the nonzero structure of intermediate estimates of P depends on products of H and evolves over the course of computation. On the other hand, an expansion of the density matrix P in terms of Chebyshev polynomials is straightforward and SpMV based; however, the resulting density matrix may not satisfy the required constraints exactly. In this paper, we analyze the strengths and weaknesses of the Chebyshev-Jackson polynomials and the second order spectral projection purification (SP2) method, and propose to combine them so that the accurate density matrix can be computed using the SpMV computational kernel only, and without having to store the density matrix P. Our method accomplishes these objectives by using the Chebyshev polynomial estimate as the initial guess for SP2, which is followed by using sparse matrix-vector multiplications (SpMVs) to replicate the behavior of the SP2 algorithm for purification. We demonstrate the method on a tight-binding model system of an oxide material containing more than 3 million atoms. In addition, we also present the predicted behavior of our method when applied to near-metallic Hamiltonians with a wide energy spectrum.

Study of the bending vibration characteristic of phononic crystals beam-foundation structures by Timoshenko beam theory

NASA Astrophysics Data System (ADS)

Zhang, Yan; Ni, Zhi-Qiang; Jiang, Lin-Hua; Han, Lin; Kang, Xue-Wei

2015-07-01

Vibration problems wildly exist in beam-foundation structures. In this paper, finite periodic composites inspired by the concept of ideal phononic crystals (PCs), as well as Timoshenko beam theory (TBT), are proposed to the beam anchored on Winkler foundation. The bending vibration band structure of the PCs Timoshenko beam-foundation structure is derived from the modified transfer matrix method (MTMM) and Bloch's theorem. Then, the frequency response of the finite periodic composite Timoshenko beam-foundation structure by the finite element method (FEM) is performed to verify the above theoretical deduction. Study shows that the Timoshenko beam-foundation structure with periodic composites has wider attenuation zones compared with homogeneous ones. It is concluded that TBT is more available than Euler beam theory (EBT) in the study of the bending vibration characteristic of PCs beam-foundation structures with different length-to-height ratios.

Establishing Quantitative Software Metrics in Department of the Navy Programs

DTIC Science & Technology

2016-04-01

13 Quality to Metrics Dependency Matrix...11 7. Quality characteristics to metrics dependecy matrix...In accomplishing this goal, a need exists for a formalized set of software quality metrics . This document establishes the validity of those necessary

Optimized Projection Matrix for Compressive Sensing

NASA Astrophysics Data System (ADS)

Xu, Jianping; Pi, Yiming; Cao, Zongjie

2010-12-01

Compressive sensing (CS) is mainly concerned with low-coherence pairs, since the number of samples needed to recover the signal is proportional to the mutual coherence between projection matrix and sparsifying matrix. Until now, papers on CS always assume the projection matrix to be a random matrix. In this paper, aiming at minimizing the mutual coherence, a method is proposed to optimize the projection matrix. This method is based on equiangular tight frame (ETF) design because an ETF has minimum coherence. It is impossible to solve the problem exactly because of the complexity. Therefore, an alternating minimization type method is used to find a feasible solution. The optimally designed projection matrix can further reduce the necessary number of samples for recovery or improve the recovery accuracy. The proposed method demonstrates better performance than conventional optimization methods, which brings benefits to both basis pursuit and orthogonal matching pursuit.

Voltage dependency of transmission probability of aperiodic DNA molecule

NASA Astrophysics Data System (ADS)

Wiliyanti, V.; Yudiarsah, E.

2017-07-01

Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

Development of a method for fabricating metallic matrix composite shapes by a continuous mechanical process

NASA Technical Reports Server (NTRS)

Divecha, A. P.

1974-01-01

Attempts made to develop processes capable of producing metal composites in structural shapes and sizes suitable for space applications are described. The processes must be continuous and promise to lower fabrication costs. Special attention was given to the aluminum boride (Al/b) composite system. Results show that despite adequate temperature control, the consolidation characteristics did not improve as expected. Inadequate binder removal was identified as the cause responsible. An Al/c (aluminum-graphite) composite was also examined.

Infrared spectra of free radicals and protonated species produced in para-hydrogen matrices.

PubMed

Bahou, Mohammed; Das, Prasanta; Lee, Yu-Fang; Wu, Yu-Jong; Lee, Yuan-Pern

2014-02-14

The quantum solid para-hydrogen (p-H2) has emerged as a new host for matrix isolation experiments. Among several unique characteristics, the diminished cage effect enables the possibility of producing free radicals via either photolysis in situ or bimolecular reactions of molecules with atoms or free radicals that are produced in situ from their precursors upon photo-irradiation. Many free radicals that are unlikely to be produced in noble-gas matrices can be produced readily in solid p-H2. In addition, protonated species can be produced upon electron bombardment of p-H2 containing a small proportion of the precursor during deposition. The application of this novel technique to generate protonated polycyclic aromatic hydrocarbons (PAH) and their neutral counterparts demonstrates its superiority over other methods. The technique of using p-H2 as a matrix host has opened up many possibilities for the preparation of free radicals and unstable species and their spectral characterization. Many new areas of applications and fundamental understanding concerning the p-H2 matrix await further exploration.

Improved prediction of MHC class I and class II epitopes using a novel Gibbs sampling approach.

PubMed

Nielsen, Morten; Lundegaard, Claus; Worning, Peder; Hvid, Christina Sylvester; Lamberth, Kasper; Buus, Søren; Brunak, Søren; Lund, Ole

2004-06-12

Prediction of which peptides will bind a specific major histocompatibility complex (MHC) constitutes an important step in identifying potential T-cell epitopes suitable as vaccine candidates. MHC class II binding peptides have a broad length distribution complicating such predictions. Thus, identifying the correct alignment is a crucial part of identifying the core of an MHC class II binding motif. In this context, we wish to describe a novel Gibbs motif sampler method ideally suited for recognizing such weak sequence motifs. The method is based on the Gibbs sampling method, and it incorporates novel features optimized for the task of recognizing the binding motif of MHC classes I and II. The method locates the binding motif in a set of sequences and characterizes the motif in terms of a weight-matrix. Subsequently, the weight-matrix can be applied to identifying effectively potential MHC binding peptides and to guiding the process of rational vaccine design. We apply the motif sampler method to the complex problem of MHC class II binding. The input to the method is amino acid peptide sequences extracted from the public databases of SYFPEITHI and MHCPEP and known to bind to the MHC class II complex HLA-DR4(B1*0401). Prior identification of information-rich (anchor) positions in the binding motif is shown to improve the predictive performance of the Gibbs sampler. Similarly, a consensus solution obtained from an ensemble average over suboptimal solutions is shown to outperform the use of a single optimal solution. In a large-scale benchmark calculation, the performance is quantified using relative operating characteristics curve (ROC) plots and we make a detailed comparison of the performance with that of both the TEPITOPE method and a weight-matrix derived using the conventional alignment algorithm of ClustalW. The calculation demonstrates that the predictive performance of the Gibbs sampler is higher than that of ClustalW and in most cases also higher than that of the TEPITOPE method.

Determination of pharmaceutical compounds in surface- and ground-water samples by solid-phase extraction and high-performance liquid chromatography-electrospray ionization mass spectrometry

USGS Publications Warehouse

Cahill, J.D.; Furlong, E.T.; Burkhardt, M.R.; Kolpin, D.; Anderson, L.G.

2004-01-01

Commonly used prescription and over-the-counter pharmaceuticals are possibly present in surface- and ground-water samples at ambient concentrations less than 1 μg/L. In this report, the performance characteristics of a combined solid-phase extraction isolation and high-performance liquid chromatography–electrospray ionization mass spectrometry (HPLC–ESI-MS) analytical procedure for routine determination of the presence and concentration of human-health pharmaceuticals are described. This method was developed and used in a recent national reconnaissance of pharmaceuticals in USA surface waters. The selection of pharmaceuticals evaluated for this method was based on usage estimates, resulting in a method that contains compounds from diverse chemical classes, which presents challenges and compromises when applied as a single routine analysis. The method performed well for the majority of the 22 pharmaceuticals evaluated, with recoveries greater than 60% for 12 pharmaceuticals. The recoveries of angiotensin-converting enzyme inhibitors, a histamine (H2) receptor antagonist, and antihypoglycemic compound classes were less than 50%, but were retained in the method to provide information describing the potential presence of these compounds in environmental samples and to indicate evidence of possible matrix enhancing effects. Long-term recoveries, evaluated from reagent-water fortifications processed over 2 years, were similar to initial method performance. Method detection limits averaged 0.022 μg/L, sufficient for expected ambient concentrations. Compound-dependent matrix effects on HPLC/ESI-MS analysis, including enhancement and suppression of ionization, were observed as a 20–30% increase in measured concentrations for three compounds and greater than 50% increase for two compounds. Changing internal standard and more frequent ESI source maintenance minimized matrix effects. Application of the method in the national survey demonstrates that several pharmaceuticals are routinely detected at 0.010–0.100 μg/L concentrations.

Error due to unresolved scales in estimation problems for atmospheric data assimilation

NASA Astrophysics Data System (ADS)

Janjic, Tijana

The error arising due to unresolved scales in data assimilation procedures is examined. The problem of estimating the projection of the state of a passive scalar undergoing advection at a sequence of times is considered. The projection belongs to a finite- dimensional function space and is defined on the continuum. Using the continuum projection of the state of a passive scalar, a mathematical definition is obtained for the error arising due to the presence, in the continuum system, of scales unresolved by the discrete dynamical model. This error affects the estimation procedure through point observations that include the unresolved scales. In this work, two approximate methods for taking into account the error due to unresolved scales and the resulting correlations are developed and employed in the estimation procedure. The resulting formulas resemble the Schmidt-Kalman filter and the usual discrete Kalman filter, respectively. For this reason, the newly developed filters are called the Schmidt-Kalman filter and the traditional filter. In order to test the assimilation methods, a two- dimensional advection model with nonstationary spectrum was developed for passive scalar transport in the atmosphere. An analytical solution on the sphere was found depicting the model dynamics evolution. Using this analytical solution the model error is avoided, and the error due to unresolved scales is the only error left in the estimation problem. It is demonstrated that the traditional and the Schmidt- Kalman filter work well provided the exact covariance function of the unresolved scales is known. However, this requirement is not satisfied in practice, and the covariance function must be modeled. The Schmidt-Kalman filter cannot be computed in practice without further approximations. Therefore, the traditional filter is better suited for practical use. Also, the traditional filter does not require modeling of the full covariance function of the unresolved scales, but only modeling of the covariance matrix obtained by evaluating the covariance function at the observation points. We first assumed that this covariance matrix is stationary and that the unresolved scales are not correlated between the observation points, i.e., the matrix is diagonal, and that the values along the diagonal are constant. Tests with these assumptions were unsuccessful, indicating that a more sophisticated model of the covariance is needed for assimilation of data with nonstationary spectrum. A new method for modeling the covariance matrix based on an extended set of modeling assumptions is proposed. First, it is assumed that the covariance matrix is diagonal, that is, that the unresolved scales are not correlated between the observation points. It is postulated that the values on the diagonal depend on a wavenumber that is characteristic for the unresolved part of the spectrum. It is further postulated that this characteristic wavenumber can be diagnosed from the observations and from the estimate of the projection of the state that is being estimated. It is demonstrated that the new method successfully overcomes previously encountered difficulties.

Comparison of matrix effects in HPLC-MS/MS and UPLC-MS/MS analysis of nine basic pharmaceuticals in surface waters.

PubMed

Van De Steene, Jet C; Lambert, Willy E

2008-05-01

When developing an LC-MS/MS-method matrix effects are a major issue. The effect of co-eluting compounds arising from the matrix can result in signal enhancement or suppression. During method development much attention should be paid to diminishing matrix effects as much as possible. The present work evaluates matrix effects from aqueous environmental samples in the simultaneous analysis of a group of 9 specific pharmaceuticals with HPLC-ESI/MS/MS and UPLC-ESI/MS/MS: flubendazole, propiconazole, pipamperone, cinnarizine, ketoconazole, miconazole, rabeprazole, itraconazole and domperidone. When HPLC-MS/MS is used, matrix effects are substantial and can not be compensated for with analogue internal standards. For different surface water samples different matrix effects are found. For accurate quantification the standard addition approach is necessary. Due to the better resolution and more narrow peaks in UPLC, analytes will co-elute less with interferences during ionisation, so matrix effects could be lower, or even eliminated. If matrix effects are eliminated with this technique, the standard addition method for quantification can be omitted and the overall method will be simplified. Results show that matrix effects are almost eliminated if internal standards (structural analogues) are used. Instead of the time-consuming and labour-intensive standard addition method, with UPLC the internal standardization can be used for quantification and the overall method is substantially simplified.

Cell cycle of matrix cells in the mouse embryo during histogenesis of telencephalon

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hoshino, K.; Matsuzawa, T.; Murakami, U.

1973-01-01

Pregnant female mice were injected intraperitoneally with 5 mu Ci/g body weight of /sup 3/H-thymidine (spec. act. 12 mu Ci/mM) at 1:30 p.m. on day 10, 13, or 17 of gestation and were put to death at 1 or 2 hr intervals per group. Embryos were removed quickly from mothers and fixed in Bouin's solution. The prepared slides were observed microscopically. The duration of the cell cycle of the matrix cells of the telencephalon was determined by direct graphic measurement, plotting the percentage of labeled mitosis against the time after / sup 3/H-thymidine injection according to the method of Quastlermore » and Sherman. The total cell cycle times in day 10, 13, and 17 groups were 7.0, 15.5, and 26.0 hr, respectively. It was characteristic in the alteration of cell cycle of matrix cells in the telencephalon during mouse embryonic life that not only G/sub 1/ but also S phase lengthened linearly with embryonic age, and both G/sub 2/ and M phases remained constant. According to these facts, the matrix cells seemed to change cytogenetically with increase of age so as to produce different neurons that would progressively make up different layers in the neocortex. (JA)« less

Polymer-based metal nano-coated disposable target for matrix-assisted and matrix-free laser desorption/ionization mass spectrometry.

PubMed

Bugovsky, Stefan; Winkler, Wolfgang; Balika, Werner; Koranda, Manfred; Allmaier, Günter

2016-07-15

The ideal MALDI/LDI mass spectrometry sample target for an axial TOF instrument possesses a variety of properties. Primarily, it should be chemically inert to the sample, i.e. analyte, matrix and solvents, highly planar across the whole target, without any previous chemical contact and provide a uniform surface to facilitate reproducible measurements without artifacts from previous sample or matrix compounds. This can be hard to achieve with a metal target, which has to be extensively cleaned every time after use. Any cleaning step may leave residues behind, may change the surface properties due to the type of cleaning method used or even cause microscopic scratches over time hence altering matrix crystallization behavior. Alternatively, use of disposable targets avoids these problems. As each possesses the same surface they therefore have the potential to replace the conventional full metal targets so commonly employed. Furthermore, low cost single-use targets with high planarity promise an easier compliance with GLP guidelines as they alleviate the problem of low reproducibility due to inconsistent sample/matrix crystallization and changes to the target surface properties. In our tests, polymeric metal nano-coated targets were compared to a stainless steel reference. The polymeric metal nano-coated targets exhibited all the performance characteristics for a MALDI MS sample support, and even surpassed the - in our lab commonly used - reference in some aspects like limit of detection. The target exhibits all necessary features such as electrical conductivity, vacuum, laser and solvent compatibility. Copyright © 2016 Elsevier Inc. All rights reserved.

Effects of Prior Aging at 288 deg C in Argon Environment on Creep Response of Carbon Fiber Reinforced PMR-15 Composite with + or - 45 deg Fiber Orientation at 288 deg C

DTIC Science & Technology

2009-06-01

typically consists of a thermoset or thermoplastic polymer matrix reinforced with fibers that are much stronger and stiffer than the matrix. The PMCs are...high thermal or electrical conductivity, stealth characteristics , the ability to self-heal, communication, and sensor capabilities. The multi...have factual evidence of limitations and characteristics so as to utilize the material in a manner consistent with its strengths and weaknesses

Fast Low-Rank Bayesian Matrix Completion With Hierarchical Gaussian Prior Models

NASA Astrophysics Data System (ADS)

Yang, Linxiao; Fang, Jun; Duan, Huiping; Li, Hongbin; Zeng, Bing

2018-06-01

The problem of low rank matrix completion is considered in this paper. To exploit the underlying low-rank structure of the data matrix, we propose a hierarchical Gaussian prior model, where columns of the low-rank matrix are assumed to follow a Gaussian distribution with zero mean and a common precision matrix, and a Wishart distribution is specified as a hyperprior over the precision matrix. We show that such a hierarchical Gaussian prior has the potential to encourage a low-rank solution. Based on the proposed hierarchical prior model, a variational Bayesian method is developed for matrix completion, where the generalized approximate massage passing (GAMP) technique is embedded into the variational Bayesian inference in order to circumvent cumbersome matrix inverse operations. Simulation results show that our proposed method demonstrates superiority over existing state-of-the-art matrix completion methods.

Principle component analysis (PCA) for investigation of relationship between population dynamics of microbial pathogenesis, chemical and sensory characteristics in beef slices containing Tarragon essential oil.

PubMed

Alizadeh Behbahani, Behrooz; Tabatabaei Yazdi, Farideh; Shahidi, Fakhri; Mortazavi, Seyed Ali; Mohebbi, Mohebbat

2017-04-01

Principle component analysis (PCA) was employed to examine the effect of the exerted treatments on the beef shelf life as well as discovering the correlations between the studied responses. Considering the variability of the dimensions of the responses, correlation coefficients were applied to form the matrix and extract the eigenvalue. Antimicrobial effect was evaluated on 10 pathogenic microorganisms through the methods of hole-plate diffusion method, disk diffusion method, pour plate method, minimum inhibitory concentration and minimum bactericidal/fungicidal concentration. Antioxidant potential and total phenolic content were examined through the method of 2,2-diphenyl-1-picrylhydrazyl (DPPH) and Folin-Ciocalteu method, respectively. The components were identified through gas chromatography and gas chromatography/mass spectrometry. Barhang seed mucilage (BSM) based edible coating containing 0, 0.5, 1 and 1.5% (w/w) Tarragon (T) essential oil mix were applied on beef slices to control the growth of pathogenic microorganisms. Microbiological (total viable count, psychrotrophic count, Escherichia coli, Staphylococcus aureus and fungi), chemical (thiobarbituric acid, peroxide value and pH) and sensory characteristics (odor, color and overall acceptability) analysis measurements were made during the storage periodically. PCA was employed to examine the effect of the exerted treatments on the beef shelf life as well as discovering the correlations between the studied responses. Considering the variability of the dimensions of the responses, correlation coefficients were applied to form the matrix and extract the eigenvalue. The PCA showed that the properties of the uncoated meat samples on the 9th, 12th, 15th and 18th days of storage are continuously changing independent of the exerted treatments on the other samples. This reveals the effect of the exerted treatments on the samples. Copyright © 2017 Elsevier Ltd. All rights reserved.

A precise and accurate acupoint location obtained on the face using consistency matrix pointwise fusion method.

PubMed

Yanq, Xuming; Ye, Yijun; Xia, Yong; Wei, Xuanzhong; Wang, Zheyu; Ni, Hongmei; Zhu, Ying; Xu, Lingyu

2015-02-01

To develop a more precise and accurate method, and identified a procedure to measure whether an acupoint had been correctly located. On the face, we used an acupoint location from different acupuncture experts and obtained the most precise and accurate values of acupoint location based on the consistency information fusion algorithm, through a virtual simulation of the facial orientation coordinate system. Because of inconsistencies in each acupuncture expert's original data, the system error the general weight calculation. First, we corrected each expert of acupoint location system error itself, to obtain a rational quantification for each expert of acupuncture and moxibustion acupoint location consistent support degree, to obtain pointwise variable precision fusion results, to put every expert's acupuncture acupoint location fusion error enhanced to pointwise variable precision. Then, we more effectively used the measured characteristics of different acupuncture expert's acupoint location, to improve the measurement information utilization efficiency and acupuncture acupoint location precision and accuracy. Based on using the consistency matrix pointwise fusion method on the acupuncture experts' acupoint location values, each expert's acupoint location information could be calculated, and the most precise and accurate values of each expert's acupoint location could be obtained.

Continuous fiber ceramic matrix composites for heat engine components

NASA Technical Reports Server (NTRS)

Tripp, David E.

1988-01-01

High strength at elevated temperatures, low density, resistance to wear, and abundance of nonstrategic raw materials make structural ceramics attractive for advanced heat engine applications. Unfortunately, ceramics have a low fracture toughness and fail catastrophically because of overload, impact, and contact stresses. Ceramic matrix composites provide the means to achieve improved fracture toughness while retaining desirable characteristics, such as high strength and low density. Materials scientists and engineers are trying to develop the ideal fibers and matrices to achieve the optimum ceramic matrix composite properties. A need exists for the development of failure models for the design of ceramic matrix composite heat engine components. Phenomenological failure models are currently the most frequently used in industry, but they are deterministic and do not adequately describe ceramic matrix composite behavior. Semi-empirical models were proposed, which relate the failure of notched composite laminates to the stress a characteristic distance away from the notch. Shear lag models describe composite failure modes at the micromechanics level. The enhanced matrix cracking stress occurs at the same applied stress level predicted by the two models of steady state cracking. Finally, statistical models take into consideration the distribution in composite failure strength. The intent is to develop these models into computer algorithms for the failure analysis of ceramic matrix composites under monotonically increasing loads. The algorithms will be included in a postprocessor to general purpose finite element programs.

A Truncated Nuclear Norm Regularization Method Based on Weighted Residual Error for Matrix Completion.

PubMed

Qing Liu; Zhihui Lai; Zongwei Zhou; Fangjun Kuang; Zhong Jin

2016-01-01

Low-rank matrix completion aims to recover a matrix from a small subset of its entries and has received much attention in the field of computer vision. Most existing methods formulate the task as a low-rank matrix approximation problem. A truncated nuclear norm has recently been proposed as a better approximation to the rank of matrix than a nuclear norm. The corresponding optimization method, truncated nuclear norm regularization (TNNR), converges better than the nuclear norm minimization-based methods. However, it is not robust to the number of subtracted singular values and requires a large number of iterations to converge. In this paper, a TNNR method based on weighted residual error (TNNR-WRE) for matrix completion and its extension model (ETNNR-WRE) are proposed. TNNR-WRE assigns different weights to the rows of the residual error matrix in an augmented Lagrange function to accelerate the convergence of the TNNR method. The ETNNR-WRE is much more robust to the number of subtracted singular values than the TNNR-WRE, TNNR alternating direction method of multipliers, and TNNR accelerated proximal gradient with Line search methods. Experimental results using both synthetic and real visual data sets show that the proposed TNNR-WRE and ETNNR-WRE methods perform better than TNNR and Iteratively Reweighted Nuclear Norm (IRNN) methods.

Matrix method for acoustic levitation simulation.

PubMed

Andrade, Marco A B; Perez, Nicolas; Buiochi, Flavio; Adamowski, Julio C

2011-08-01

A matrix method is presented for simulating acoustic levitators. A typical acoustic levitator consists of an ultrasonic transducer and a reflector. The matrix method is used to determine the potential for acoustic radiation force that acts on a small sphere in the standing wave field produced by the levitator. The method is based on the Rayleigh integral and it takes into account the multiple reflections that occur between the transducer and the reflector. The potential for acoustic radiation force obtained by the matrix method is validated by comparing the matrix method results with those obtained by the finite element method when using an axisymmetric model of a single-axis acoustic levitator. After validation, the method is applied in the simulation of a noncontact manipulation system consisting of two 37.9-kHz Langevin-type transducers and a plane reflector. The manipulation system allows control of the horizontal position of a small levitated sphere from -6 mm to 6 mm, which is done by changing the phase difference between the two transducers. The horizontal position of the sphere predicted by the matrix method agrees with the horizontal positions measured experimentally with a charge-coupled device camera. The main advantage of the matrix method is that it allows simulation of non-symmetric acoustic levitators without requiring much computational effort.

Optical matrix-matrix multiplication method demonstrated by the use of a multifocus hololens

NASA Technical Reports Server (NTRS)

Liu, H. K.; Liang, Y.-Z.

1984-01-01

A method of optical matrix-matrix multiplication is presented. The feasibility of the method is also experimentally demonstrated by the use of a dichromated-gelatin multifocus holographic lens (hololens). With the specific values of matrices chosen, the average percentage error between the theoretical and experimental data of the elements of the output matrix of the multiplication of some specific pairs of 3 x 3 matrices is 0.4 percent, which corresponds to an 8-bit accuracy.

Key principles of community-based natural resource management: a synthesis and interpretation of identified effective approaches for managing the commons.

PubMed

Gruber, James S

2010-01-01

This article examines recent research on approaches to community-based environmental and natural resource management and reviews the commonalities and differences between these interdisciplinary and multistakeholder initiatives. To identify the most effective characteristics of Community-based natural resource management (CBNRM), I collected a multiplicity of perspectives from research teams and then grouped findings into a matrix of organizational principles and key characteristics. The matrix was initially vetted (or "field tested") by applying numerous case studies that were previously submitted to the World Bank International Workshop on CBNRM. These practitioner case studies were then compared and contrasted with the findings of the research teams. It is hoped that the developed matrix may be useful to researchers in further focusing research, understanding core characteristics of effective and sustainable CBNRM, providing practitioners with a framework for developing new CBNRM initiatives for managing the commons, and providing a potential resource for academic institutions during their evaluation of their practitioner-focused environmental management and leadership curriculum.

A Robust Self-Alignment Method for Ship's Strapdown INS Under Mooring Conditions

PubMed Central

Sun, Feng; Lan, Haiyu; Yu, Chunyang; El-Sheimy, Naser; Zhou, Guangtao; Cao, Tong; Liu, Hang

2013-01-01

Strapdown inertial navigation systems (INS) need an alignment process to determine the initial attitude matrix between the body frame and the navigation frame. The conventional alignment process is to compute the initial attitude matrix using the gravity and Earth rotational rate measurements. However, under mooring conditions, the inertial measurement unit (IMU) employed in a ship's strapdown INS often suffers from both the intrinsic sensor noise components and the external disturbance components caused by the motions of the sea waves and wind waves, so a rapid and precise alignment of a ship's strapdown INS without any auxiliary information is hard to achieve. A robust solution is given in this paper to solve this problem. The inertial frame based alignment method is utilized to adapt the mooring condition, most of the periodical low-frequency external disturbance components could be removed by the mathematical integration and averaging characteristic of this method. A novel prefilter named hidden Markov model based Kalman filter (HMM-KF) is proposed to remove the relatively high-frequency error components. Different from the digital filters, the HMM-KF barely cause time-delay problem. The turntable, mooring and sea experiments favorably validate the rapidness and accuracy of the proposed self-alignment method and the good de-noising performance of HMM-KF. PMID:23799492

Comparative proteomics of matrix fractions between pimpled and normal chicken eggshells.

PubMed

Liu, Zhangguo; Song, Lingzi; Lu, Lizhi; Zhang, Xianfu; Zhang, Fuming; Wang, Kehua; Linhardt, Robert J

2017-09-07

Eggshell matrix can be dissociated into three matrix fractions: acid-insoluble matrix (M1), water-insoluble matrix (M2) and acid-water facultative-soluble matrix (M3). Matrix fractions from pimpled and normal eggshells were compared using label-free proteomic method to understand the differences among three matrix fractions and the proteins involved with eggshell quality. A total of 738 and 600 proteins were identified in the pimpled and normal calcified eggshells, respectively. Both eggshells showed a combined proteomic inventory of 769 proteins. In the same type of eggshell, a high similarity was present in the proteomes of three matrix fractions. These triply overlapped common proteins formed the predominant contributor to proteomic abundance in the matrix fractions. In each matrix fraction and between both eggshell models, normal and pimpled eggshells, a majority of the proteomes of the fractions were commonly observed. Forty-two common major proteins (iBAQ-derived abundance ≥0.095% of proteomic abundance) were identified throughout the three matrix fractions and these proteins might act as backbone constituents in chicken eggshell matrix. Finally, using 1.75-fold as up-regulated and using 0.57-fold as down-regulated cutoff values, twenty-five differential major proteins were screened and they all negatively influence and none showed any effect on eggshell quality. Overall, we uncovered the characteristics of proteomics of three eggshell matrix fractions and identified candidate proteins influencing eggshell quality. The next research on differential proteins will uncover the potential mechanisms underlying how proteins affect eggshell quality. It was reported that the proteins in an eggshell can be divided into insoluble and soluble proteins. The insoluble proteins are thought to be an inter-mineral matrix and acts as a structural framework, while the soluble proteins are thought as intra-mineral matrix that are embedded within the crystal during calcification. However, the difference between matrix fractions is unknown. Cross-analysis of proteomic data of three matrix fractions from the same type of eggshell, uncovered triply overlapped common proteins formed the predominant contributor to proteomic abundance of any matrix fraction, and we suggested that abundance variance of some common proteins between the three matrix fractions might be an important cause of their solubility differences. Moreover, eggshell is formed in hen's uterus, and uterus tend to be considered as unique organ determining eggshell quality. By cross-analysis on proteomic data of three matrix fractions between two eggshell models, normal and pimpled eggshells, the differential proteins were screened as candidates influencing eggshell quality. And we suggested that the liver and spleen or lymphocytes might be the major organs influencing eggshell quality, because the most promising candidates are almost blood and non-collagenous proteins, and originated from above organs. Copyright © 2017 Elsevier B.V. All rights reserved.

The Bioactivity of Cartilage Extracellular Matrix in Articular Cartilage Regeneration

PubMed Central

Sutherland, Amanda J.; Converse, Gabriel L.; Hopkins, Richard A.; Detamore, Michael S.

2014-01-01

Cartilage matrix is a particularly promising acellular material for cartilage regeneration given the evidence supporting its chondroinductive character. The ‘raw materials’ of cartilage matrix can serve as building blocks and signals for enhanced tissue regeneration. These matrices can be created by chemical or physical methods: physical methods disrupt cellular membranes and nuclei but may not fully remove all cell components and DNA, whereas chemical methods when combined with physical methods are particularly effective in fully decellularizing such materials. Critical endpoints include no detectable residual DNA or immunogenic antigens. It is important to first delineate between the sources of the cartilage matrix, i.e., derived from matrix produced by cells in vitro or from native tissue, and then to further characterize the cartilage matrix based on the processing method, i.e., decellularization or devitalization. With these distinctions, four types of cartilage matrices exist: decellularized native cartilage (DCC), devitalized native cartilage (DVC), decellularized cell derived matrix (DCCM), and devitalized cell derived matrix (DVCM). Delivery of cartilage matrix may be a straightforward approach without the need for additional cells or growth factors. Without additional biological additives, cartilage matrix may be attractive from a regulatory and commercialization standpoint. Source and delivery method are important considerations for clinical translation. Only one currently marketed cartilage matrix medical device is decellularized, although trends in filed patents suggest additional decellularized products may be available in the future. To choose the most relevant source and processing for cartilage matrix, qualifying testing needs to include targeting the desired application, optimizing delivery of the material, identify relevant FDA regulations, assess availability of raw materials, and immunogenic properties of the product. PMID:25044502

Novel image analysis methods for quantification of in situ 3-D tendon cell and matrix strain.

PubMed

Fung, Ashley K; Paredes, J J; Andarawis-Puri, Nelly

2018-01-23

Macroscopic tendon loads modulate the cellular microenvironment leading to biological outcomes such as degeneration or repair. Previous studies have shown that damage accumulation and the phases of tendon healing are marked by significant changes in the extracellular matrix, but it remains unknown how mechanical forces of the extracellular matrix are translated to mechanotransduction pathways that ultimately drive the biological response. Our overarching hypothesis is that the unique relationship between extracellular matrix strain and cell deformation will dictate biological outcomes, prompting the need for quantitative methods to characterize the local strain environment. While 2-D methods have successfully calculated matrix strain and cell deformation, 3-D methods are necessary to capture the increased complexity that can arise due to high levels of anisotropy and out-of-plane motion, particularly in the disorganized, highly cellular, injured state. In this study, we validated the use of digital volume correlation methods to quantify 3-D matrix strain using images of naïve tendon cells, the collagen fiber matrix, and injured tendon cells. Additionally, naïve tendon cell images were used to develop novel methods for 3-D cell deformation and 3-D cell-matrix strain, which is defined as a quantitative measure of the relationship between matrix strain and cell deformation. The results support that these methods can be used to detect strains with high accuracy and can be further extended to an in vivo setting for observing temporal changes in cell and matrix mechanics during degeneration and healing. Copyright © 2017. Published by Elsevier Ltd.

Maximum entropy formalism for the analytic continuation of matrix-valued Green's functions

NASA Astrophysics Data System (ADS)

Kraberger, Gernot J.; Triebl, Robert; Zingl, Manuel; Aichhorn, Markus

2017-10-01

We present a generalization of the maximum entropy method to the analytic continuation of matrix-valued Green's functions. To treat off-diagonal elements correctly based on Bayesian probability theory, the entropy term has to be extended for spectral functions that are possibly negative in some frequency ranges. In that way, all matrix elements of the Green's function matrix can be analytically continued; we introduce a computationally cheap element-wise method for this purpose. However, this method cannot ensure important constraints on the mathematical properties of the resulting spectral functions, namely positive semidefiniteness and Hermiticity. To improve on this, we present a full matrix formalism, where all matrix elements are treated simultaneously. We show the capabilities of these methods using insulating and metallic dynamical mean-field theory (DMFT) Green's functions as test cases. Finally, we apply the methods to realistic material calculations for LaTiO3, where off-diagonal matrix elements in the Green's function appear due to the distorted crystal structure.

Permeation characteristics of hypericin across Caco-2 monolayers in the presence of single flavonoids, defined flavonoid mixtures or Hypericum extract matrix.

PubMed

Verjee, Sheela; Kelber, Olaf; Kolb, Christiane; Abdel-Aziz, Heba; Butterweck, Veronika

2017-03-12

The major aim of this study was to get a detailed understanding of the exposure and fate of hypericin in the Caco-2 cell system when combined with various flavonoids, mixtures of flavonoids or Hypericum perforatum extract matrix (STW3-VI). The permeation characteristics of hypericin in the absence or presence of quercetin, quercitrin, isoquercitrin, hyperoside and rutin were tested. Hypericin (5 μm) was mixed with single flavonoids (20 μm) or with different flavonoid combinations (each flavonoid 4 or 10 μm, total flavonoid concentration: 20 μm). Further, the uptake of hypericin (5 μm) in the presence of H. perforatum extract matrix (7.25, 29 and 58 μg/ml) was studied. Following application of hypericin to the apical side of the monolayer, only negligible amounts of the compound were found in the basolateral compartment. From all tested flavonoids, only quercitrin increased the basolateral amount of hypericin. Dual flavonoid combinations were not superior compared to the single combinations. The amount of hypericin in the basolateral compartment increased concentration-dependently in the presence of extract matrix (from 0 to 7.5%). Comparing the effects of various flavonoid mixtures vs the extract matrix, it can be concluded that, besides flavonoids, the extract seems to contain further compounds (e.g. phenolic acids or proanthocyanidins) which substantially improve the permeation characteristics of hypericin. © 2017 Royal Pharmaceutical Society.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vu-khanh, T.; Denault, J.

The effects of the conditions of the processing of PEEK/carbon prepregs and comingled fabric on the microstructure and mechanical characteristics of the resulting composites were investigated. Results showed that, in the comingled fabric system, the fiber/matrix adhesion depends on the molding temperature, the residence time at the melt temperature, and the cooling rate. Too high molding temperature resulted in degradation of the PEEK matrix, which affected the crystallization behavior of the composites, the fiber/matrix adhesion, and the matrix properties. This effect was most important in the case of comingled systems containing sized carbon fibers. 17 refs.

Theory and implementation of H-matrix based iterative and direct solvers for Helmholtz and elastodynamic oscillatory kernels

NASA Astrophysics Data System (ADS)

Chaillat, Stéphanie; Desiderio, Luca; Ciarlet, Patrick

2017-12-01

In this work, we study the accuracy and efficiency of hierarchical matrix (H-matrix) based fast methods for solving dense linear systems arising from the discretization of the 3D elastodynamic Green's tensors. It is well known in the literature that standard H-matrix based methods, although very efficient tools for asymptotically smooth kernels, are not optimal for oscillatory kernels. H2-matrix and directional approaches have been proposed to overcome this problem. However the implementation of such methods is much more involved than the standard H-matrix representation. The central questions we address are twofold. (i) What is the frequency-range in which the H-matrix format is an efficient representation for 3D elastodynamic problems? (ii) What can be expected of such an approach to model problems in mechanical engineering? We show that even though the method is not optimal (in the sense that more involved representations can lead to faster algorithms) an efficient solver can be easily developed. The capabilities of the method are illustrated on numerical examples using the Boundary Element Method.

Collision effects on propagation characteristics of electromagnetic waves in a sub-wavelength plasma slab of partially ionized dense plasmas

NASA Astrophysics Data System (ADS)

Bowen, LI; Zhibin, WANG; Qiuyue, NIE; Xiaogang, WANG; Fanrong, KONG; Zhenyu, WANG

2018-01-01

Intensive collisions between electrons and neutral particles in partially ionized plasmas generated in atmospheric/sub-atmospheric pressure environments can sufficiently affect the propagation characteristics of electromagnetic waves, particularly in the sub-wavelength regime. To investigate the collisional effect in such plasmas, we introduce a simplified plasma slab model with a thickness on the order of the wavelength of the incident electromagnetic wave. The scattering matrix method (SMM) is applied to solve the wave equation in the plasma slab with significant nonuniformity. Results show that the collisions between the electrons and the neutral particles, as well as the incident angle and the plasma thickness, can disturb the transmission and reduce reflection significantly.

Analytical quality assurance in veterinary drug residue analysis methods: matrix effects determination and monitoring for sulfonamides analysis.

PubMed

Hoff, Rodrigo Barcellos; Rübensam, Gabriel; Jank, Louise; Barreto, Fabiano; Peralba, Maria do Carmo Ruaro; Pizzolato, Tânia Mara; Silvia Díaz-Cruz, M; Barceló, Damià

2015-01-01

In residue analysis of veterinary drugs in foodstuff, matrix effects are one of the most critical points. This work present a discuss considering approaches used to estimate, minimize and monitoring matrix effects in bioanalytical methods. Qualitative and quantitative methods for estimation of matrix effects such as post-column infusion, slopes ratios analysis, calibration curves (mathematical and statistical analysis) and control chart monitoring are discussed using real data. Matrix effects varying in a wide range depending of the analyte and the sample preparation method: pressurized liquid extraction for liver samples show matrix effects from 15.5 to 59.2% while a ultrasound-assisted extraction provide values from 21.7 to 64.3%. The matrix influence was also evaluated: for sulfamethazine analysis, losses of signal were varying from -37 to -96% for fish and eggs, respectively. Advantages and drawbacks are also discussed considering a workflow for matrix effects assessment proposed and applied to real data from sulfonamides residues analysis. Copyright © 2014 Elsevier B.V. All rights reserved.

Spectrum recovery method based on sparse representation for segmented multi-Gaussian model

NASA Astrophysics Data System (ADS)

Teng, Yidan; Zhang, Ye; Ti, Chunli; Su, Nan

2016-09-01

Hyperspectral images can realize crackajack features discriminability for supplying diagnostic characteristics with high spectral resolution. However, various degradations may generate negative influence on the spectral information, including water absorption, bands-continuous noise. On the other hand, the huge data volume and strong redundancy among spectrums produced intense demand on compressing HSIs in spectral dimension, which also leads to the loss of spectral information. The reconstruction of spectral diagnostic characteristics has irreplaceable significance for the subsequent application of HSIs. This paper introduces a spectrum restoration method for HSIs making use of segmented multi-Gaussian model (SMGM) and sparse representation. A SMGM is established to indicating the unsymmetrical spectral absorption and reflection characteristics, meanwhile, its rationality and sparse property are discussed. With the application of compressed sensing (CS) theory, we implement sparse representation to the SMGM. Then, the degraded and compressed HSIs can be reconstructed utilizing the uninjured or key bands. Finally, we take low rank matrix recovery (LRMR) algorithm for post processing to restore the spatial details. The proposed method was tested on the spectral data captured on the ground with artificial water absorption condition and an AVIRIS-HSI data set. The experimental results in terms of qualitative and quantitative assessments demonstrate that the effectiveness on recovering the spectral information from both degradations and loss compression. The spectral diagnostic characteristics and the spatial geometry feature are well preserved.

Rapid Identification of Mycobacterial Whole Cells in Solid and Liquid Culture Media by Matrix-Assisted Laser Desorption Ionization-Time of Flight Mass Spectrometry ▿

PubMed Central

Lotz, Aurélie; Ferroni, Agnès; Beretti, Jean-Luc; Dauphin, Brunhilde; Carbonnelle, Etienne; Guet-Revillet, Hélène; Veziris, Nicolas; Heym, Béate; Jarlier, Vincent; Gaillard, Jean-Louis; Pierre-Audigier, Catherine; Frapy, Eric; Berche, Patrick; Nassif, Xavier; Bille, Emmanuelle

2010-01-01

Mycobacterial identification is based on several methods: conventional biochemical tests that require several weeks for accurate identification, and molecular tools that are now routinely used. However, these techniques are expensive and time-consuming. In this study, an alternative method was developed using matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS). This approach allows a characteristic mass spectral fingerprint to be obtained from whole inactivated mycobacterial cells. We engineered a strategy based on specific profiles in order to identify the most clinically relevant species of mycobacteria. To validate the mycobacterial database, a total of 311 strains belonging to 31 distinct species and 4 species complexes grown in Löwenstein-Jensen (LJ) and liquid (mycobacterium growth indicator tube [MGIT]) media were analyzed. No extraction step was required. Correct identifications were obtained for 97% of strains from LJ and 77% from MGIT media. No misidentification was noted. Our results, based on a very simple protocol, suggest that this system may represent a serious alternative for clinical laboratories to identify mycobacterial species. PMID:20943874

An automatic search of Alzheimer patterns using a nonnegative matrix factorization

NASA Astrophysics Data System (ADS)

Giraldo, Diana L.; García-Arteaga, Juan D.; Romero, Eduardo

2013-11-01

This paper presents a fully automatic method that condenses relevant morphometric information from a database of magnetic resonance images (MR) labeled as either normal (NC) or Alzheimer's disease (AD). The proposed method generates class templates using Nonnegative Matrix Factorization (NMF) which will be used to develop an NC/AD classi cator. It then nds regions of interest (ROI) with discerning inter-class properties. by inspecting the di erence volume of the two class templates. From these templates local probability distribution functions associated to low level features such as intensities, orientation and edges within the found ROI are calculated. A sample brain volume can then be characterized by a similarity measure in the ROI to both the normal and the pathological templates. These characteristics feed a simple binary SVM classi er which, when tested with an experimental group extracted from a public brain MR dataset (OASIS), reveals an equal error rate measure which is better than the state-of-the-art tested on the same dataset (0:9 in the former and 0:8 in the latter).

Assessing the performance of regional landslide early warning models: the EDuMaP method

NASA Astrophysics Data System (ADS)

Calvello, M.; Piciullo, L.

2015-10-01

The paper proposes the evaluation of the technical performance of a regional landslide early warning system by means of an original approach, called EDuMaP method, comprising three successive steps: identification and analysis of the Events (E), i.e. landslide events and warning events derived from available landslides and warnings databases; definition and computation of a Duration Matrix (DuMa), whose elements report the time associated with the occurrence of landslide events in relation to the occurrence of warning events, in their respective classes; evaluation of the early warning model Performance (P) by means of performance criteria and indicators applied to the duration matrix. During the first step, the analyst takes into account the features of the warning model by means of ten input parameters, which are used to identify and classify landslide and warning events according to their spatial and temporal characteristics. In the second step, the analyst computes a time-based duration matrix having a number of rows and columns equal to the number of classes defined for the warning and landslide events, respectively. In the third step, the analyst computes a series of model performance indicators derived from a set of performance criteria, which need to be defined by considering, once again, the features of the warning model. The proposed method is based on a framework clearly distinguishing between local and regional landslide early warning systems as well as among correlation laws, warning models and warning systems. The applicability, potentialities and limitations of the EDuMaP method are tested and discussed using real landslides and warnings data from the municipal early warning system operating in Rio de Janeiro (Brazil).

Thermodynamic characterization of networks using graph polynomials

NASA Astrophysics Data System (ADS)

Ye, Cheng; Comin, César H.; Peron, Thomas K. DM.; Silva, Filipi N.; Rodrigues, Francisco A.; Costa, Luciano da F.; Torsello, Andrea; Hancock, Edwin R.

2015-09-01

In this paper, we present a method for characterizing the evolution of time-varying complex networks by adopting a thermodynamic representation of network structure computed from a polynomial (or algebraic) characterization of graph structure. Commencing from a representation of graph structure based on a characteristic polynomial computed from the normalized Laplacian matrix, we show how the polynomial is linked to the Boltzmann partition function of a network. This allows us to compute a number of thermodynamic quantities for the network, including the average energy and entropy. Assuming that the system does not change volume, we can also compute the temperature, defined as the rate of change of entropy with energy. All three thermodynamic variables can be approximated using low-order Taylor series that can be computed using the traces of powers of the Laplacian matrix, avoiding explicit computation of the normalized Laplacian spectrum. These polynomial approximations allow a smoothed representation of the evolution of networks to be constructed in the thermodynamic space spanned by entropy, energy, and temperature. We show how these thermodynamic variables can be computed in terms of simple network characteristics, e.g., the total number of nodes and node degree statistics for nodes connected by edges. We apply the resulting thermodynamic characterization to real-world time-varying networks representing complex systems in the financial and biological domains. The study demonstrates that the method provides an efficient tool for detecting abrupt changes and characterizing different stages in network evolution.

Structure and performance of polymer-derived bulk ceramics determined by method of filler incorporation

NASA Astrophysics Data System (ADS)

Konegger, T.; Schneider, P.; Bauer, V.; Amsüss, A.; Liersch, A.

2013-12-01

The effect of four distinct methods of incorporating fillers into a preceramic polymer matrix was investigated with respect to the structural and mechanical properties of the resulting materials. Investigations were conducted with a polysiloxane/Al2O3/ZrO2 model system used as a precursor for mullite/ZrO2 composites. A quantitative evaluation of the uniformity of filler distribution was obtained by employing a novel image analysis. While solvent-free mixing led to a heterogeneous distribution of constituents resulting in limited mechanical property values, a strong improvement of material homogeneity and properties was obtained by using solvent-assisted methods. The results demonstrate the importance of the processing route on final characteristics of polymer-derived ceramics.

Compressive Properties of Metal Matrix Syntactic Foams in Free and Constrained Compression

NASA Astrophysics Data System (ADS)

Orbulov, Imre Norbert; Májlinger, Kornél

2014-06-01

Metal matrix syntactic foam (MMSF) blocks were produced by an inert gas-assisted pressure infiltration technique. MMSFs are advanced hollow sphere reinforced-composite materials having promising application in the fields of aviation, transport, and automotive engineering, as well as in civil engineering. The produced blocks were investigated in free and constrained compression modes, and besides the characteristic mechanical properties, their deformation mechanisms and failure modes were studied. In the tests, the chemical composition of the matrix material, the size of the reinforcing ceramic hollow spheres, the applied heat treatment, and the compression mode were considered as investigation parameters. The monitored mechanical properties were the compressive strength, the fracture strain, the structural stiffness, the fracture energy, and the overall absorbed energy. These characteristics were strongly influenced by the test parameters. By the proper selection of the matrix and the reinforcement and by proper design, the mechanical properties of the MMSFs can be effectively tailored for specific and given applications.

Performance analysis of landslide early warning systems at regional scale: the EDuMaP method

NASA Astrophysics Data System (ADS)

Piciullo, Luca; Calvello, Michele

2016-04-01

Landslide early warning systems (LEWSs) reduce landslide risk by disseminating timely and meaningful warnings when the level of risk is judged intolerably high. Two categories of LEWSs, can be defined on the basis of their scale of analysis: "local" systems and "regional" systems. LEWSs at regional scale (ReLEWSs) are used to assess the probability of occurrence of landslides over appropriately-defined homogeneous warning zones of relevant extension, typically through the prediction and monitoring of meteorological variables, in order to give generalized warnings to the public. Despite many studies on ReLEWSs, no standard requirements exist for assessing their performance. Empirical evaluations are often carried out by simply analysing the time frames during which significant high-consequence landslides occurred in the test area. Alternatively, the performance evaluation is based on 2x2 contingency tables computed for the joint frequency distribution of landslides and alerts, both considered as dichotomous variables. In all these cases, model performance is assessed neglecting some important aspects which are peculiar to ReLEWSs, among which: the possible occurrence of multiple landslides in the warning zone; the duration of the warnings in relation to the time of occurrence of the landslides; the level of the warning issued in relation to the landslide spatial density in the warning zone; the relative importance system managers attribute to different types of errors. An original approach, called EDuMaP method, is proposed to assess the performance of landslide early warning models operating at regional scale. The method is composed by three main phases: Events analysis, Duration Matrix, Performance analysis. The events analysis phase focuses on the definition of landslide (LEs) and warning events (WEs), which are derived from available landslides and warnings databases according to their spatial and temporal characteristics by means of ten input parameters. The evaluation of time associated with the occurrence of landslide events (LE) in relation to the occurrence of warning events (WE) in their respective classes is a fundamental step to determine the duration matrix elements. On the other hand the classification of LEs and WEs establishes the structure of the duration matrix. Indeed, the number of rows and columns of the matrix is equal to the number of classes defined for the warning and landslide events, respectively. Thus the matrix is not expressed as a 2x2 contingency and LEs and WEs are not expressed as dichotomous variables. The final phase of the method is the evaluation of the duration matrix based on a set of performance criteria assigning a performance meaning to the element of the matrix. To this aim different criteria can be defined, for instance employing an alert classification scheme derived from 2x2 contingency tables or assigning a colour code to the elements of the matrix in relation to their grade of correctness. Finally, performance indicators can be derived from the performance criteria to quantify successes and errors of the early warning models. EDuMaP has been already applied to different real case studies, highlighting the adaptability of the method to analyse the performance of structurally different ReLEWSs.

Relationships Between Abrasive Wear, Hardness, and Surface Grinding Characteristics of Titanium-Based Metal Matrix Composites

DOE Office of Scientific and Technical Information (OSTI.GOV)

Blau, Peter Julian; Jolly, Brian C

2009-01-01

The objective of this work was to support the development of grinding models for titanium metal-matrix composites (MMCs) by investigating possible relationships between their indentation hardness, low-stress belt abrasion, high-stress belt abrasion, and the surface grinding characteristics. Three Ti-based particulate composites were tested and compared with the popular titanium alloy Ti-6Al-4V. The three composites were a Ti-6Al-4V-based MMC with 5% TiB{sub 2} particles, a Ti-6Al-4V MMC with 10% TiC particles, and a Ti-6Al-4V/Ti-7.5%W binary alloy matrix that contained 7.5% TiC particles. Two types of belt abrasion tests were used: (a) a modified ASTM G164 low-stress loop abrasion test, and (b)more » a higher-stress test developed to quantify the grindability of ceramics. Results were correlated with G-ratios (ratio of stock removed to abrasives consumed) obtained from an instrumented surface grinder. Brinell hardness correlated better with abrasion characteristics than microindentation or scratch hardness. Wear volumes from low-stress and high-stress abrasive belt tests were related by a second-degree polynomial. Grindability numbers correlated with hard particle content but were also matrix-dependent.« less

Multi-threaded Sparse Matrix Sparse Matrix Multiplication for Many-Core and GPU Architectures.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Deveci, Mehmet; Trott, Christian Robert; Rajamanickam, Sivasankaran

Sparse Matrix-Matrix multiplication is a key kernel that has applications in several domains such as scientific computing and graph analysis. Several algorithms have been studied in the past for this foundational kernel. In this paper, we develop parallel algorithms for sparse matrix- matrix multiplication with a focus on performance portability across different high performance computing architectures. The performance of these algorithms depend on the data structures used in them. We compare different types of accumulators in these algorithms and demonstrate the performance difference between these data structures. Furthermore, we develop a meta-algorithm, kkSpGEMM, to choose the right algorithm and datamore » structure based on the characteristics of the problem. We show performance comparisons on three architectures and demonstrate the need for the community to develop two phase sparse matrix-matrix multiplication implementations for efficient reuse of the data structures involved.« less

Multi-threaded Sparse Matrix-Matrix Multiplication for Many-Core and GPU Architectures.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Deveci, Mehmet; Rajamanickam, Sivasankaran; Trott, Christian Robert

Sparse Matrix-Matrix multiplication is a key kernel that has applications in several domains such as scienti c computing and graph analysis. Several algorithms have been studied in the past for this foundational kernel. In this paper, we develop parallel algorithms for sparse matrix-matrix multiplication with a focus on performance portability across different high performance computing architectures. The performance of these algorithms depend on the data structures used in them. We compare different types of accumulators in these algorithms and demonstrate the performance difference between these data structures. Furthermore, we develop a meta-algorithm, kkSpGEMM, to choose the right algorithm and datamore » structure based on the characteristics of the problem. We show performance comparisons on three architectures and demonstrate the need for the community to develop two phase sparse matrix-matrix multiplication implementations for efficient reuse of the data structures involved.« less

Fast Minimum Variance Beamforming Based on Legendre Polynomials.

PubMed

Bae, MooHo; Park, Sung Bae; Kwon, Sung Jae

2016-09-01

Currently, minimum variance beamforming (MV) is actively investigated as a method that can improve the performance of an ultrasound beamformer, in terms of the lateral and contrast resolution. However, this method has the disadvantage of excessive computational complexity since the inverse spatial covariance matrix must be calculated. Some noteworthy methods among various attempts to solve this problem include beam space adaptive beamforming methods and the fast MV method based on principal component analysis, which are similar in that the original signal in the element space is transformed to another domain using an orthonormal basis matrix and the dimension of the covariance matrix is reduced by approximating the matrix only with important components of the matrix, hence making the inversion of the matrix very simple. Recently, we proposed a new method with further reduced computational demand that uses Legendre polynomials as the basis matrix for such a transformation. In this paper, we verify the efficacy of the proposed method through Field II simulations as well as in vitro and in vivo experiments. The results show that the approximation error of this method is less than or similar to those of the above-mentioned methods and that the lateral response of point targets and the contrast-to-speckle noise in anechoic cysts are also better than or similar to those methods when the dimensionality of the covariance matrices is reduced to the same dimension.

Solidification processing of monotectic alloy matrix composites

NASA Technical Reports Server (NTRS)

Frier, Nancy L.; Shiohara, Yuh; Russell, Kenneth C.

1989-01-01

Directionally solidified aluminum-indium alloys of the monotectic composition were found to form an in situ rod composite which obeys a lambda exp 2 R = constant relation. The experimental data shows good agreement with previously reported results. A theoretical boundary between cellular and dendritic growth conditions was derived and compared with experiments. The unique wetting characteristics of the monotectic alloys can be utilized to tailor the interface structure in metal matrix composites. Metal matrix composites with monotectic and hypermonotectic Al-In matrices were made by pressure infiltration, remelted and directionally solidified to observe the wetting characteristics of the alloys as well as the effect on structure of solidification in the constrained field of the fiber interstices. Models for monotectic growth are modified to take into account solidification in these constrained fields.

Investigation of Structures of Microwave Microelectromechanical-System Switches by Taguchi Method

NASA Astrophysics Data System (ADS)

Lai, Yeong-Lin; Lin, Chien-Hung

2007-10-01

The optimal design of microwave microelectromechanical-system (MEMS) switches by the Taguchi method is presented. The structures of the switches are analyzed and optimized in terms of the effective stiffness constant, the maximum von Mises stress, and the natural frequency in order to improve the reliability and the performance of the MEMS switches. There are four factors, each of which has three levels in the Taguchi method for the MEMS switches. An L9(34) orthogonal array is used for the matrix experiments. The characteristics of the experiments are studied by the finite-element method and the analytical method. The responses of the signal-to-noise (S/N) ratios of the characteristics of the switches are investigated. The statistical analysis of variance (ANOVA) is used to interpret the experimental results and decide the significant factors. The final optimum setting, A1B3C1D2, predicts that the effective stiffness constant is 1.06 N/m, the maximum von Mises stress is 76.9 MPa, and the natural frequency is 29.331 kHz. The corresponding switching time is 34 μs, and the pull-down voltage is 9.8 V.

Printing method for organic light emitting device lighting

NASA Astrophysics Data System (ADS)

Ki, Hyun Chul; Kim, Seon Hoon; Kim, Doo-Gun; Kim, Tae-Un; Kim, Snag-Gi; Hong, Kyung-Jin; So, Soon-Yeol

2013-03-01

Organic Light Emitting Device (OLED) has a characteristic to change the electric energy into the light when the electric field is applied to the organic material. OLED is currently employed as a light source for the lighting tools because research has extensively progressed in the improvement of luminance, efficiency, and life time. OLED is widely used in the plate display device because of a simple manufacture process and high emitting efficiency. But most of OLED lighting projects were used the vacuum evaporator (thermal evaporator) with low molecular. Although printing method has lower efficiency and life time of OLED than vacuum evaporator method, projects of printing OLED actively are progressed because was possible to combine with flexible substrate and printing technology. Printing technology is ink-jet, screen printing and slot coating. This printing method allows for low cost and mass production techniques and large substrates. In this research, we have proposed inkjet printing for organic light-emitting devices has the dominant method of thick film deposition because of its low cost and simple processing. In this research, the fabrication of the passive matrix OLED is achieved by inkjet printing, using a polymer phosphorescent ink. We are measured optical and electrical characteristics of OLED.

Antioxidant Capacity Determination in Plants and Plant-Derived Products: A Review

PubMed Central

Pop, Aneta; Cimpeanu, Carmen; Predoi, Gabriel

2016-01-01

The present paper aims at reviewing and commenting on the analytical methods applied to antioxidant and antioxidant capacity assessment in plant-derived products. Aspects related to oxidative stress, reactive oxidative species' influence on key biomolecules, and antioxidant benefits and modalities of action are discussed. Also, the oxidant-antioxidant balance is critically discussed. The conventional and nonconventional extraction procedures applied prior to analysis are also presented, as the extraction step is of pivotal importance for isolation and concentration of the compound(s) of interest before analysis. Then, the chromatographic, spectrometric, and electrochemical methods for antioxidant and antioxidant capacity determination in plant-derived products are detailed with respect to their principles, characteristics, and specific applications. Peculiarities related to the matrix characteristics and other factors influencing the method's performances are discussed. Health benefits of plants and derived products are described, as indicated in the original source. Finally, critical and conclusive aspects are given when it comes to the choice of a particular extraction procedure and detection method, which should consider the nature of the sample, prevalent antioxidant/antioxidant class, and the mechanism underlying each technique. Advantages and disadvantages are discussed for each method. PMID:28044094

Convergence analysis of modulus-based matrix splitting iterative methods for implicit complementarity problems.

PubMed

Wang, An; Cao, Yang; Shi, Quan

2018-01-01

In this paper, we demonstrate a complete version of the convergence theory of the modulus-based matrix splitting iteration methods for solving a class of implicit complementarity problems proposed by Hong and Li (Numer. Linear Algebra Appl. 23:629-641, 2016). New convergence conditions are presented when the system matrix is a positive-definite matrix and an [Formula: see text]-matrix, respectively.

Algorithms for Solvents and Spectral Factors of Matrix Polynomials

DTIC Science & Technology

1981-01-01

spectral factors of matrix polynomials LEANG S. SHIEHt, YIH T. TSAYt and NORMAN P. COLEMANt A generalized Newton method , based on the contracted gradient...of a matrix poly- nomial, is derived for solving the right (left) solvents and spectral factors of matrix polynomials. Two methods of selecting initial...estimates for rapid convergence of the newly developed numerical method are proposed. Also, new algorithms for solving complete sets of the right

Evaluation of the resistance of a geopolymer-based drug delivery system to tampering.

PubMed

Cai, Bing; Engqvist, Håkan; Bredenberg, Susanne

2014-04-25

Tamper-resistance is an important property of controlled-release formulations of opioid drugs. Tamper-resistant formulations aim to increase the degree of effort required to override the controlled release of the drug molecules from extended-release formulations for the purpose of non-medical use. In this study, the resistance of a geopolymer-based formulation to tampering was evaluated by comparing it with a commercial controlled-release tablet using several methods commonly used by drug abusers. Because of its high compressive strength and resistance to heat, much more effort and time was required to extract the drug from the geopolymer-based formulation. Moreover, in the drug-release test, the geopolymer-based formulation maintained its controlled-release characteristics after milling, while the drug was released immediately from the milled commercial tablets, potentially resulting in dose dumping. Although the tampering methods used in this study does not cover all methods that abuser could access, the results obtained by the described methods showed that the geopolymer matrix increased the degree of effort required to override the controlled release of the drug, suggesting that the formulation has improved resistance to some common drug-abuse tampering methods. The geopolymer matrix has the potential to make the opioid product less accessible and attractive to non-medical users. Copyright © 2014 Elsevier B.V. All rights reserved.

Physical and Hydrological Meaning of the Spectral Information from Hydrodynamic Signals at Karst Springs

NASA Astrophysics Data System (ADS)

Dufoyer, A.; Lecoq, N.; Massei, N.; Marechal, J. C.

2017-12-01

Physics-based modeling of karst systems remains almost impossible without enough accurate information about the inner physical characteristics. Usually, the only available hydrodynamic information is the flow rate at the karst outlet. Numerous works in the past decades have used and proven the usefulness of time-series analysis and spectral techniques applied to spring flow, precipitations or even physico-chemical parameters, for interpreting karst hydrological functioning. However, identifying or interpreting the karst systems physical features that control statistical or spectral characteristics of spring flow variations is still challenging, not to say sometimes controversial. The main objective of this work is to determine how the statistical and spectral characteristics of the hydrodynamic signal at karst springs can be related to inner physical and hydraulic properties. In order to address this issue, we undertake an empirical approach based on the use of both distributed and physics-based models, and on synthetic systems responses. The first step of the research is to conduct a sensitivity analysis of time-series/spectral methods to karst hydraulic and physical properties. For this purpose, forward modeling of flow through several simple, constrained and synthetic cases in response to precipitations is undertaken. It allows us to quantify how the statistical and spectral characteristics of flow at the outlet are sensitive to changes (i) in conduit geometries, and (ii) in hydraulic parameters of the system (matrix/conduit exchange rate, matrix hydraulic conductivity and storativity). The flow differential equations resolved by MARTHE, a computer code developed by the BRGM, allows karst conduits modeling. From signal processing on simulated spring responses, we hope to determine if specific frequencies are always modified, thanks to Fourier series and multi-resolution analysis. We also hope to quantify which parameters are the most variable with auto-correlation analysis: first results seem to show higher variations due to conduit conductivity than the ones due to matrix/conduit exchange rate. Future steps will be using another computer code, based on double-continuum approach and allowing turbulent conduit flow, and modeling a natural system.

A sample preparation method for recovering suppressed analyte ions in MALDI TOF MS.

PubMed

Lou, Xianwen; de Waal, Bas F M; Milroy, Lech-Gustav; van Dongen, Joost L J

2015-05-01

In matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI TOF MS), analyte signals can be substantially suppressed by other compounds in the sample. In this technical note, we describe a modified thin-layer sample preparation method that significantly reduces the analyte suppression effect (ASE). In our method, analytes are deposited on top of the surface of matrix preloaded on the MALDI plate. To prevent embedding of analyte into the matrix crystals, the sample solution were prepared without matrix and efforts were taken not to re-dissolve the preloaded matrix. The results with model mixtures of peptides, synthetic polymers and lipids show that detection of analyte ions, which were completely suppressed using the conventional dried-droplet method, could be effectively recovered by using our method. Our findings suggest that the incorporation of analytes in the matrix crystals has an important contributory effect on ASE. By reducing ASE, our method should be useful for the direct MALDI MS analysis of multicomponent mixtures. Copyright © 2015 John Wiley & Sons, Ltd.

Learning object correspondences with the observed transport shape measure.

PubMed

Pitiot, Alain; Delingette, Hervé; Toga, Arthur W; Thompson, Paul M

2003-07-01

We propose a learning method which introduces explicit knowledge to the object correspondence problem. Our approach uses an a priori learning set to compute a dense correspondence field between two objects, where the characteristics of the field bear close resemblance to those in the learning set. We introduce a new local shape measure we call the "observed transport measure", whose properties make it particularly amenable to the matching problem. From the values of our measure obtained at every point of the objects to be matched, we compute a distance matrix which embeds the correspondence problem in a highly expressive and redundant construct and facilitates its manipulation. We present two learning strategies that rely on the distance matrix and discuss their applications to the matching of a variety of 1-D, 2-D and 3-D objects, including the corpus callosum and ventricular surfaces.

The effect of mechano-chemical treatment on structural properties of the drawn TiNi-based alloy wire

NASA Astrophysics Data System (ADS)

Anikeev, Sergey; Hodorenko, Valentina; Gunther, Victor; Chekalkin, Timofey; Kang, Ji-hoon; Kang, Seung-baik

2018-01-01

The rapid development of biomedical materials with the advanced functional characteristics is a challenging task because of the growing demands for better material properties in-clinically employed. Modern medical devices that can be implanted into humans have evolved steadily by replacing TiNi-based alloys for titanium and stainless steel. In this study, the effect of the mechano-chemical treatment on structural properties of the matrix and surface layer of the drawn TiNi-based alloy wire was assessed. A range of samples have been prepared using different drawing and etching procedures. It is clear from the results obtained that the fabricated samples show a composite structure comprising the complex matrix and textured oxycarbonitride spitted surface layer. The suggested method of surface treatment is a concept to increase the surface roughness for the enhanced bio-performance and better in vivo integration.

Retrievals of Aerosol and Cloud Particle Microphysics Using Polarization and Depolarization Techniques

NASA Technical Reports Server (NTRS)

Mishchenko, Michael; Hansen, James E. (Technical Monitor)

2001-01-01

The recent availability of theoretical techniques for computing single and multiple scattering of light by realistic polydispersions of spherical and nonspherical particles and the strong dependence of the Stokes scattering matrix on particle size, shape, and refractive index make polarization and depolarization measurements a powerful particle characterization tool. In this presentation I will describe recent applications of photopolarimetric and lidar depolarization measurements to remote sensing characterization of tropospheric aerosols, polar stratospheric clouds (PSCs), and contrails. The talk will include (1) a short theoretical overview of the effects of particle microphysics on particle single-scattering characteristics; (2) the use of multi-angle multi-spectral photopolarimetry to retrieve the optical thickness, size distribution, refractive index, and number concentration of tropospheric aerosols over the ocean surface; and (3) the application of the T-matrix method to constraining the PSC and contrail particle microphysics using multi-spectral measurements of lidar backscatter and depolarization.

Quantitative evaluation of the matrix effect in bioanalytical methods based on LC-MS: A comparison of two approaches.

PubMed

Rudzki, Piotr J; Gniazdowska, Elżbieta; Buś-Kwaśnik, Katarzyna

2018-06-05

Liquid chromatography coupled to mass spectrometry (LC-MS) is a powerful tool for studying pharmacokinetics and toxicokinetics. Reliable bioanalysis requires the characterization of the matrix effect, i.e. influence of the endogenous or exogenous compounds on the analyte signal intensity. We have compared two methods for the quantitation of matrix effect. The CVs(%) of internal standard normalized matrix factors recommended by the European Medicines Agency were evaluated against internal standard normalized relative matrix effects derived from Matuszewski et al. (2003). Both methods use post-extraction spiked samples, but matrix factors require also neat solutions. We have tested both approaches using analytes of diverse chemical structures. The study did not reveal relevant differences in the results obtained with both calculation methods. After normalization with the internal standard, the CV(%) of the matrix factor was on average 0.5% higher than the corresponding relative matrix effect. The method adopted by the European Medicines Agency seems to be slightly more conservative in the analyzed datasets. Nine analytes of different structures enabled a general overview of the problem, still, further studies are encouraged to confirm our observations. Copyright © 2018 Elsevier B.V. All rights reserved.

Non-Muscle Myosin II Isoforms Have Different Functions in Matrix Rearrangement by MDA-MB-231 Cells

PubMed Central

Hindman, Bridget; Goeckeler, Zoe; Sierros, Kostas; Wysolmerski, Robert

2015-01-01

The role of a stiffening extra-cellular matrix (ECM) in cancer progression is documented but poorly understood. Here we use a conditioning protocol to test the role of nonmuscle myosin II isoforms in cell mediated ECM arrangement using collagen constructs seeded with breast cancer cells expressing shRNA targeted to either the IIA or IIB heavy chain isoform. While there are several methods available to measure changes in the biophysical characteristics of the ECM, we wanted to use a method which allows for the measurement of global stiffness changes as well as a dynamic response from the sample over time. The conditioning protocol used allows the direct measurement of ECM stiffness. Using various treatments, it is possible to determine the contribution of various construct and cellular components to the overall construct stiffness. Using this assay, we show that both the IIA and IIB isoforms are necessary for efficient matrix remodeling by MDA-MB-231 breast cancer cells, as loss of either isoform changes the stiffness of the collagen constructs as measured using our conditioning protocol. Constructs containing only collagen had an elastic modulus of 0.40 Pascals (Pa), parental MDA-MB-231 constructs had an elastic modulus of 9.22 Pa, while IIA and IIB KD constructs had moduli of 3.42 and 7.20 Pa, respectively. We also calculated the cell and matrix contributions to the overall sample elastic modulus. Loss of either myosin isoform resulted in decreased cell stiffness, as well as a decrease in the stiffness of the cell-altered collagen matrices. While the total construct modulus for the IIB KD cells was lower than that of the parental cells, the IIB KD cell-altered matrices actually had a higher elastic modulus than the parental cell-altered matrices (4.73 versus 4.38 Pa). These results indicate that the IIA and IIB heavy chains play distinct and non-redundant roles in matrix remodeling. PMID:26136073

Direct Iterative Nonlinear Inversion by Multi-frequency T-matrix Completion

NASA Astrophysics Data System (ADS)

Jakobsen, M.; Wu, R. S.

2016-12-01

Researchers in the mathematical physics community have recently proposed a conceptually new method for solving nonlinear inverse scattering problems (like FWI) which is inspired by the theory of nonlocality of physical interactions. The conceptually new method, which may be referred to as the T-matrix completion method, is very interesting since it is not based on linearization at any stage. Also, there are no gradient vectors or (inverse) Hessian matrices to calculate. However, the convergence radius of this promising T-matrix completion method is seriously restricted by it's use of single-frequency scattering data only. In this study, we have developed a modified version of the T-matrix completion method which we believe is more suitable for applications to nonlinear inverse scattering problems in (exploration) seismology, because it makes use of multi-frequency data. Essentially, we have simplified the single-frequency T-matrix completion method of Levinson and Markel and combined it with the standard sequential frequency inversion (multi-scale regularization) method. For each frequency, we first estimate the experimental T-matrix by using the Moore-Penrose pseudo inverse concept. Then this experimental T-matrix is used to initiate an iterative procedure for successive estimation of the scattering potential and the T-matrix using the Lippmann-Schwinger for the nonlinear relation between these two quantities. The main physical requirements in the basic iterative cycle is that the T-matrix should be data-compatible and the scattering potential operator should be dominantly local; although a non-local scattering potential operator is allowed in the intermediate iterations. In our simplified T-matrix completion strategy, we ensure that the T-matrix updates are always data compatible simply by adding a suitable correction term in the real space coordinate representation. The use of singular-value decomposition representations are not required in our formulation since we have developed an efficient domain decomposition method. The results of several numerical experiments for the SEG/EAGE salt model illustrate the importance of using multi-frequency data when performing frequency domain full waveform inversion in strongly scattering media via the new concept of T-matrix completion.

Insolubilized enzymes for food synthesis

NASA Technical Reports Server (NTRS)

Marshall, D. L.

1972-01-01

Cellulose matrix with numerous enzyme-coated silica particles of colloidal size permanently bound at various sites within matrix was produced that has high activity and possesses requisite physical characteristics for filtration or column operations. Product also allows coupling step in synthesis of edible food to proceed under mild conditions.

Comparison of experimental methods for estimating matrix diffusion coefficients for contaminant transport modeling

NASA Astrophysics Data System (ADS)

Telfeyan, Katherine; Ware, S. Doug; Reimus, Paul W.; Birdsell, Kay H.

2018-02-01

Diffusion cell and diffusion wafer experiments were conducted to compare methods for estimating effective matrix diffusion coefficients in rock core samples from Pahute Mesa at the Nevada Nuclear Security Site (NNSS). A diffusion wafer method, in which a solute diffuses out of a rock matrix that is pre-saturated with water containing the solute, is presented as a simpler alternative to the traditional through-diffusion (diffusion cell) method. Both methods yielded estimates of effective matrix diffusion coefficients that were within the range of values previously reported for NNSS volcanic rocks. The difference between the estimates of the two methods ranged from 14 to 30%, and there was no systematic high or low bias of one method relative to the other. From a transport modeling perspective, these differences are relatively minor when one considers that other variables (e.g., fracture apertures, fracture spacings) influence matrix diffusion to a greater degree and tend to have greater uncertainty than effective matrix diffusion coefficients. For the same relative random errors in concentration measurements, the diffusion cell method yields effective matrix diffusion coefficient estimates that have less uncertainty than the wafer method. However, the wafer method is easier and less costly to implement and yields estimates more quickly, thus allowing a greater number of samples to be analyzed for the same cost and time. Given the relatively good agreement between the methods, and the lack of any apparent bias between the methods, the diffusion wafer method appears to offer advantages over the diffusion cell method if better statistical representation of a given set of rock samples is desired.

Application of Matrix Projection Exposure Using a Liquid Crystal Display Panel to Fabricate Thick Resist Molds

NASA Astrophysics Data System (ADS)

Fukasawa, Hirotoshi; Horiuchi, Toshiyuki

2009-08-01

The patterning characteristics of matrix projection exposure using an analog liquid crystal display (LCD) panel in place of a reticle were investigated, in particular for oblique patterns. In addition, a new method for fabricating practical thick resist molds was developed. At first, an exposure system fabricated in past research was reconstructed. Changes in the illumination optics and the projection lens were the main improvements. Using fly's eye lenses, the illumination light intensity distribution was homogenized. The projection lens was changed from a common camera lens to a higher-grade telecentric lens. In addition, although the same metal halide lamp was used as an exposure light source, the central exposure wavelength was slightly shortened from 480 to 450 nm to obtain higher resist sensitivity while maintaining almost equivalent contrast between black and white. Circular and radial patterns with linewidths of approximately 6 µm were uniformly printed in all directions throughout the exposure field owing to these improvements. The patterns were smoothly printed without accompanying stepwise roughness caused by the cell matrix array. On the bases of these results, a new method of fabricating thick resist molds for electroplating was investigated. It is known that thick resist molds fabricated using the negative resist SU-8 (Micro Chem) are useful because very high aspect patterns are printable and the side walls are perpendicular to the substrate surfaces. However, the most suitable exposure wavelength of SU-8 is 365 nm, and SU-8 is insensitive to light of 450 nm wavelength, which is most appropriate for LCD matrix exposure. For this reason, a novel multilayer resist process was proposed, and micromolds of SU-8 of 50 µm thickness were successfully obtained. As a result, feasibility for fabricating complex resist molds including oblique patterns was demonstrated.

Remodeling characteristics and collagen distribution in synthetic mesh materials explanted from human subjects after abdominal wall reconstruction: an analysis of remodeling characteristics by patient risk factors and surgical site classifications

PubMed Central

Cavallo, Jaime A.; Roma, Andres A.; Jasielec, Mateusz S.; Ousley, Jenny; Creamer, Jennifer; Pichert, Matthew D.; Baalman, Sara; Frisella, Margaret M.; Matthews, Brent D.

2014-01-01

Background The purpose of this study was to evaluate the associations between patient characteristics or surgical site classifications and the histologic remodeling scores of synthetic meshes biopsied from their abdominal wall repair sites in the first attempt to generate a multivariable risk prediction model of non-constructive remodeling. Methods Biopsies of the synthetic meshes were obtained from the abdominal wall repair sites of 51 patients during a subsequent abdominal re-exploration. Biopsies were stained with hematoxylin and eosin, and evaluated according to a semi-quantitative scoring system for remodeling characteristics (cell infiltration, cell types, extracellular matrix deposition, inflammation, fibrous encapsulation, and neovascularization) and a mean composite score (CR). Biopsies were also stained with Sirius Red and Fast Green, and analyzed to determine the collagen I:III ratio. Based on univariate analyses between subject clinical characteristics or surgical site classification and the histologic remodeling scores, cohort variables were selected for multivariable regression models using a threshold p value of ≤0.200. Results The model selection process for the extracellular matrix score yielded two variables: subject age at time of mesh implantation, and mesh classification (c-statistic = 0.842). For CR score, the model selection process yielded two variables: subject age at time of mesh implantation and mesh classification (r2 = 0.464). The model selection process for the collagen III area yielded a model with two variables: subject body mass index at time of mesh explantation and pack-year history (r2 = 0.244). Conclusion Host characteristics and surgical site assessments may predict degree of remodeling for synthetic meshes used to reinforce abdominal wall repair sites. These preliminary results constitute the first steps in generating a risk prediction model that predicts the patients and clinical circumstances for which non-constructive remodeling of an abdominal wall repair site with synthetic mesh reinforcement is most likely to occur. PMID:24442681

Efficient Algorithms for Estimating the Absorption Spectrum within Linear Response TDDFT

DOE Office of Scientific and Technical Information (OSTI.GOV)

Brabec, Jiri; Lin, Lin; Shao, Meiyue

We present two iterative algorithms for approximating the absorption spectrum of molecules within linear response of time-dependent density functional theory (TDDFT) framework. These methods do not attempt to compute eigenvalues or eigenvectors of the linear response matrix. They are designed to approximate the absorption spectrum as a function directly. They take advantage of the special structure of the linear response matrix. Neither method requires the linear response matrix to be constructed explicitly. They only require a procedure that performs the multiplication of the linear response matrix with a vector. These methods can also be easily modified to efficiently estimate themore » density of states (DOS) of the linear response matrix without computing the eigenvalues of this matrix. We show by computational experiments that the methods proposed in this paper can be much more efficient than methods that are based on the exact diagonalization of the linear response matrix. We show that they can also be more efficient than real-time TDDFT simulations. We compare the pros and cons of these methods in terms of their accuracy as well as their computational and storage cost.« less

Matrix Stiffness Corresponding to Strictured Bowel Induces a Fibrogenic Response in Human Colonic Fibroblasts

PubMed Central

Johnson, Laura A.; Rodansky, Eva S.; Sauder, Kay L.; Horowitz, Jeffrey C.; Mih, Justin D.; Tschumperlin, Daniel J.; Higgins, Peter D.

2013-01-01

Background Crohn’s disease is characterized by repeated cycles of inflammation and mucosal healing which ultimately progress to intestinal fibrosis. This inexorable progression towards fibrosis suggests that fibrosis becomes inflammation-independent and auto-propagative. We hypothesized that matrix stiffness regulates this auto-propagation of intestinal fibrosis. Methods The stiffness of fresh ex vivo samples from normal human small intestine, Crohn’s disease strictures, and the unaffected margin were measured with a microelastometer. Normal human colonic fibroblasts were cultured on physiologically normal or pathologically stiff matrices corresponding to the physiological stiffness of normal or fibrotic bowel. Cellular response was assayed for changes in cell morphology, α-smooth muscle actin (αSMA) staining, and gene expression. Results Microelastometer measurements revealed a significant increase in colonic tissue stiffness between normal human colon and Crohn’s strictures as well as between the stricture and adjacent tissue margin. In Ccd-18co cells grown on stiff matrices corresponding to Crohn’s strictures, cellular proliferation increased. Pathologic stiffness induced a marked change in cell morphology and increased αSMA protein expression. Growth on a stiff matrix induced fibrogenic gene expression, decreased matrix metalloproteinase and pro-inflammatory gene expression, and was associated with nuclear localization of the transcriptional cofactor MRTF-A. Conclusions Matrix stiffness, representative of the pathological stiffness of Crohn’s strictures, activates human colonic fibroblasts to a fibrogenic phenotype. Matrix stiffness affects multiple pathways suggesting the mechanical properties of the cellular environment are critical to fibroblast function and may contribute to autopropagation of intestinal fibrosis in the absence of inflammation, thereby contributing to the intractable intestinal fibrosis characteristic of Crohn’s disease. PMID:23502354

A Conceptual Framework for Representing Human Behavior Characteristics in a System of Systems Agent-Based Survivability Simulation

DTIC Science & Technology

2010-11-22

fuzzy matrix converges to a “zero-one” matrix. The values of “0” and “1” simply means that two edges of the network with “1” have a crisp ...fuzzy matrix converges to a “zero-one” matrix. The values of “0” and “1” simply means that two edges of the network with “1” have a crisp connectivity...converges to a “zero-one” matrix. The values of “0” and “1” simply means that two edges of the network with “1” have a crisp connectivity (and

Concurrent tailoring of fabrication process and interphase layer to reduce residual stresses in metal matrix composites

NASA Technical Reports Server (NTRS)

Saravanos, D. A.; Chamis, C. C.; Morel, M.

1991-01-01

A methodology is presented to reduce the residual matrix stresses in continuous fiber metal matrix composites (MMC) by optimizing the fabrication process and interphase layer characteristics. The response of the fabricated MMC was simulated based on nonlinear micromechanics. Application cases include fabrication tailoring, interphase tailoring, and concurrent fabrication-interphase optimization. Two composite systems, silicon carbide/titanium and graphite/copper, are considered. Results illustrate the merits of each approach, indicate that concurrent fabrication/interphase optimization produces significant reductions in the matrix residual stresses and demonstrate the strong coupling between fabrication and interphase tailoring.

Interphase layer optimization for metal matrix composites with fabrication considerations

NASA Technical Reports Server (NTRS)

Morel, M.; Saravanos, D. A.; Chamis, C. C.

1991-01-01

A methodology is presented to reduce the final matrix microstresses for metal matrix composites by concurrently optimizing the interphase characteristics and fabrication process. Application cases include interphase tailoring with and without fabrication considerations for two material systems, graphite/copper and silicon carbide/titanium. Results indicate that concurrent interphase/fabrication optimization produces significant reductions in the matrix residual stresses and strong coupling between interphase and fabrication tailoring. The interphase coefficient of thermal expansion and the fabrication consolidation pressure are the most important design parameters and must be concurrently optimized to further reduce the microstresses to more desirable magnitudes.

Can Laws Be a Potential PET Image Texture Analysis Approach for Evaluation of Tumor Heterogeneity and Histopathological Characteristics in NSCLC?

PubMed

Karacavus, Seyhan; Yılmaz, Bülent; Tasdemir, Arzu; Kayaaltı, Ömer; Kaya, Eser; İçer, Semra; Ayyıldız, Oguzhan

2018-04-01

We investigated the association between the textural features obtained from 18 F-FDG images, metabolic parameters (SUVmax , SUVmean, MTV, TLG), and tumor histopathological characteristics (stage and Ki-67 proliferation index) in non-small cell lung cancer (NSCLC). The FDG-PET images of 67 patients with NSCLC were evaluated. MATLAB technical computing language was employed in the extraction of 137 features by using first order statistics (FOS), gray-level co-occurrence matrix (GLCM), gray-level run length matrix (GLRLM), and Laws' texture filters. Textural features and metabolic parameters were statistically analyzed in terms of good discrimination power between tumor stages, and selected features/parameters were used in the automatic classification by k-nearest neighbors (k-NN) and support vector machines (SVM). We showed that one textural feature (gray-level nonuniformity, GLN) obtained using GLRLM approach and nine textural features using Laws' approach were successful in discriminating all tumor stages, unlike metabolic parameters. There were significant correlations between Ki-67 index and some of the textural features computed using Laws' method (r = 0.6, p = 0.013). In terms of automatic classification of tumor stage, the accuracy was approximately 84% with k-NN classifier (k = 3) and SVM, using selected five features. Texture analysis of FDG-PET images has a potential to be an objective tool to assess tumor histopathological characteristics. The textural features obtained using Laws' approach could be useful in the discrimination of tumor stage.

Compatibility of pedigree-based and marker-based relationship matrices for single-step genetic evaluation.

PubMed

Christensen, Ole F

2012-12-03

Single-step methods provide a coherent and conceptually simple approach to incorporate genomic information into genetic evaluations. An issue with single-step methods is compatibility between the marker-based relationship matrix for genotyped animals and the pedigree-based relationship matrix. Therefore, it is necessary to adjust the marker-based relationship matrix to the pedigree-based relationship matrix. Moreover, with data from routine evaluations, this adjustment should in principle be based on both observed marker genotypes and observed phenotypes, but until now this has been overlooked. In this paper, I propose a new method to address this issue by 1) adjusting the pedigree-based relationship matrix to be compatible with the marker-based relationship matrix instead of the reverse and 2) extending the single-step genetic evaluation using a joint likelihood of observed phenotypes and observed marker genotypes. The performance of this method is then evaluated using two simulated datasets. The method derived here is a single-step method in which the marker-based relationship matrix is constructed assuming all allele frequencies equal to 0.5 and the pedigree-based relationship matrix is constructed using the unusual assumption that animals in the base population are related and inbred with a relationship coefficient γ and an inbreeding coefficient γ / 2. Taken together, this γ parameter and a parameter that scales the marker-based relationship matrix can handle the issue of compatibility between marker-based and pedigree-based relationship matrices. The full log-likelihood function used for parameter inference contains two terms. The first term is the REML-log-likelihood for the phenotypes conditional on the observed marker genotypes, whereas the second term is the log-likelihood for the observed marker genotypes. Analyses of the two simulated datasets with this new method showed that 1) the parameters involved in adjusting marker-based and pedigree-based relationship matrices can depend on both observed phenotypes and observed marker genotypes and 2) a strong association between these two parameters exists. Finally, this method performed at least as well as a method based on adjusting the marker-based relationship matrix. Using the full log-likelihood and adjusting the pedigree-based relationship matrix to be compatible with the marker-based relationship matrix provides a new and interesting approach to handle the issue of compatibility between the two matrices in single-step genetic evaluation.

A theory for modeling ground-water flow in heterogeneous media

USGS Publications Warehouse

Cooley, Richard L.

2004-01-01

Construction of a ground-water model for a field area is not a straightforward process. Data are virtually never complete or detailed enough to allow substitution into the model equations and direct computation of the results of interest. Formal model calibration through optimization, statistical, and geostatistical methods is being applied to an increasing extent to deal with this problem and provide for quantitative evaluation and uncertainty analysis of the model. However, these approaches are hampered by two pervasive problems: 1) nonlinearity of the solution of the model equations with respect to some of the model (or hydrogeologic) input variables (termed in this report system characteristics) and 2) detailed and generally unknown spatial variability (heterogeneity) of some of the system characteristics such as log hydraulic conductivity, specific storage, recharge and discharge, and boundary conditions. A theory is developed in this report to address these problems. The theory allows construction and analysis of a ground-water model of flow (and, by extension, transport) in heterogeneous media using a small number of lumped or smoothed system characteristics (termed parameters). The theory fully addresses both nonlinearity and heterogeneity in such a way that the parameters are not assumed to be effective values. The ground-water flow system is assumed to be adequately characterized by a set of spatially and temporally distributed discrete values, ?, of the system characteristics. This set contains both small-scale variability that cannot be described in a model and large-scale variability that can. The spatial and temporal variability in ? are accounted for by imagining ? to be generated by a stochastic process wherein ? is normally distributed, although normality is not essential. Because ? has too large a dimension to be estimated using the data normally available, for modeling purposes ? is replaced by a smoothed or lumped approximation y?. (where y is a spatial and temporal interpolation matrix). Set y?. has the same form as the expected value of ?, y 'line' ? , where 'line' ? is the set of drift parameters of the stochastic process; ?. is a best-fit vector to ?. A model function f(?), such as a computed hydraulic head or flux, is assumed to accurately represent an actual field quantity, but the same function written using y?., f(y?.), contains error from lumping or smoothing of ? using y?.. Thus, the replacement of ? by y?. yields nonzero mean model errors of the form E(f(?)-f(y?.)) throughout the model and covariances between model errors at points throughout the model. These nonzero means and covariances are evaluated through third and fifth-order accuracy, respectively, using Taylor series expansions. They can have a significant effect on construction and interpretation of a model that is calibrated by estimating ?.. Vector ?.. is estimated as 'hat' ? using weighted nonlinear least squares techniques to fit a set of model functions f(y'hat' ?) to a. corresponding set of observations of f(?), Y. These observations are assumed to be corrupted by zero-mean, normally distributed observation errors, although, as for ?, normality is not essential. An analytical approximation of the nonlinear least squares solution is obtained using Taylor series expansions and perturbation techniques that assume model and observation errors to be small. This solution is used to evaluate biases and other results to second-order accuracy in the errors. The correct weight matrix to use in the analysis is shown to be the inverse of the second-moment matrix E(Y-f(y?.))(Y-f(y?.))', but the weight matrix is assumed to be arbitrary in most developments. The best diagonal approximation is the inverse of the matrix of diagonal elements of E(Y-f(y?.))(Y-f(y?.))', and a method of estimating this diagonal matrix when it is unknown is developed using a special objective function to compute 'hat' ?. When considered to be an estimate of f

Effect of the Parameters of Gas-Powder Laser Surfacing on the Structural Characteristics of Reconditioned Surface Layer of Corrosion-Resistant Steels

NASA Astrophysics Data System (ADS)

Krylova, S. E.; Oplesnin, S. P.; Manakov, N. A.; Yasakov, A. S.; Strizhov, A. O.

2018-01-01

Results of the developed commercial process for reconditioning the surface of corrosion-resistant steels by the method of laser surfacing are presented. A comparative analysis of the microstructures of the deposited wear-resistant layer, of the zone of fusion with the matrix material and of the diffusion zone after different variants of surfacing is performed. The hardness of the deposited layer is measured and a nondestructive inspection of the latter for the presence of flaws is performed.

[Monitoring of Crack Propagation in Repaired Structures Based on Characteristics of FBG Sensors Reflecting Spectra].

PubMed

Yuan, Shen-fang; Jin, Xin; Qiu, Lei; Huang, Hong-mei

2015-03-01

In order to improve the security of aircraft repaired structures, a method of crack propagation monitoring in repaired structures is put forward basing on characteristics of Fiber Bragg Grating (FBG) reflecting spectra in this article. With the cyclic loading effecting on repaired structure, cracks propagate, while non-uniform strain field appears nearby the tip of crack which leads to the FBG sensors' reflecting spectra deformations. The crack propagating can be monitored by extracting the characteristics of FBG sensors' reflecting spectral deformations. A finite element model (FEM) of the specimen is established. Meanwhile, the distributions of strains which are under the action of cracks of different angles and lengths are obtained. The characteristics, such as main peak wavelength shift, area of reflecting spectra, second and third peak value and so on, are extracted from the FBGs' reflecting spectral which are calculated by transfer matrix algorithm. An artificial neural network is built to act as the model between the characteristics of the reflecting spectral and the propagation of crack. As a result, the crack propagation of repaired structures is monitored accurately and the error of crack length is less than 0.5 mm, the error of crack angle is less than 5 degree. The accurately monitoring problem of crack propagation of repaired structures is solved by taking use of this method. It has important significance in aircrafts safety improvement and maintenance cost reducing.

A Partial Least Squares Based Procedure for Upstream Sequence Classification in Prokaryotes.

PubMed

Mehmood, Tahir; Bohlin, Jon; Snipen, Lars

2015-01-01

The upstream region of coding genes is important for several reasons, for instance locating transcription factor, binding sites, and start site initiation in genomic DNA. Motivated by a recently conducted study, where multivariate approach was successfully applied to coding sequence modeling, we have introduced a partial least squares (PLS) based procedure for the classification of true upstream prokaryotic sequence from background upstream sequence. The upstream sequences of conserved coding genes over genomes were considered in analysis, where conserved coding genes were found by using pan-genomics concept for each considered prokaryotic species. PLS uses position specific scoring matrix (PSSM) to study the characteristics of upstream region. Results obtained by PLS based method were compared with Gini importance of random forest (RF) and support vector machine (SVM), which is much used method for sequence classification. The upstream sequence classification performance was evaluated by using cross validation, and suggested approach identifies prokaryotic upstream region significantly better to RF (p-value < 0.01) and SVM (p-value < 0.01). Further, the proposed method also produced results that concurred with known biological characteristics of the upstream region.

Polyethylene composites containing a phase change material having a C14 straight chain hydrocarbon

DOEpatents

Salyer, Ival O.

1987-01-01

A composite useful in thermal energy storage, said composite being formed of a polyethylene matrix having a straight chain alkyl hydrocarbon incorporated therein, said polyethylene being crosslinked to such a degree that said polyethylene matrix is form stable and said polyethylene matrix is capable of absorbing at least 10% by weight of said straight chain alkyl hydrocarbon; the composite is useful in forming pellets or sheets having thermal energy storage characteristics.

Integrated approach to estimate the ocean's time variable dynamic topography including its covariance matrix

NASA Astrophysics Data System (ADS)

Müller, Silvia; Brockmann, Jan Martin; Schuh, Wolf-Dieter

2015-04-01

The ocean's dynamic topography as the difference between the sea surface and the geoid reflects many characteristics of the general ocean circulation. Consequently, it provides valuable information for evaluating or tuning ocean circulation models. The sea surface is directly observed by satellite radar altimetry while the geoid cannot be observed directly. The satellite-based gravity field determination requires different measurement principles (satellite-to-satellite tracking (e.g. GRACE), satellite-gravity-gradiometry (GOCE)). In addition, hydrographic measurements (salinity, temperature and pressure; near-surface velocities) provide information on the dynamic topography. The observation types have different representations and spatial as well as temporal resolutions. Therefore, the determination of the dynamic topography is not straightforward. Furthermore, the integration of the dynamic topography into ocean circulation models requires not only the dynamic topography itself but also its inverse covariance matrix on the ocean model grid. We developed a rigorous combination method in which the dynamic topography is parameterized in space as well as in time. The altimetric sea surface heights are expressed as a sum of geoid heights represented in terms of spherical harmonics and the dynamic topography parameterized by a finite element method which can be directly related to the particular ocean model grid. Besides the difficult task of combining altimetry data with a gravity field model, a major aspect is the consistent combination of satellite data and in-situ observations. The particular characteristics and the signal content of the different observations must be adequately considered requiring the introduction of auxiliary parameters. Within our model the individual observation groups are combined in terms of normal equations considering their full covariance information; i.e. a rigorous variance/covariance propagation from the original measurements to the final product is accomplished. In conclusion, the developed integrated approach allows for estimating the dynamic topography and its inverse covariance matrix on arbitrary grids in space and time. The inverse covariance matrix contains the appropriate weights for model-data misfits in least-squares ocean model inversions. The focus of this study is on the North Atlantic Ocean. We will present the conceptual design and dynamic topography estimates based on time variable data from seven satellite altimeter missions (Jason-1, Jason-2, Topex/Poseidon, Envisat, ERS-2, GFO, Cryosat2) in combination with the latest GOCE gravity field model and in-situ data from the Argo floats and near-surface drifting buoys.

Multifunctional layered magnetic composites

PubMed Central

Siglreitmeier, Maria; Wu, Baohu; Kollmann, Tina; Neubauer, Martin; Nagy, Gergely; Schwahn, Dietmar; Pipich, Vitaliy; Faivre, Damien; Zahn, Dirk; Fery, Andreas

2015-01-01

Summary A fabrication method of a multifunctional hybrid material is achieved by using the insoluble organic nacre matrix of the Haliotis laevigata shell infiltrated with gelatin as a confined reaction environment. Inside this organic scaffold magnetite nanoparticles (MNPs) are synthesized. The amount of MNPs can be controlled through the synthesis protocol therefore mineral loadings starting from 15 wt % up to 65 wt % can be realized. The demineralized organic nacre matrix is characterized by small-angle and very-small-angle neutron scattering (SANS and VSANS) showing an unchanged organic matrix structure after demineralization compared to the original mineralized nacre reference. Light microscopy and confocal laser scanning microscopy studies of stained samples show the presence of insoluble proteins at the chitin surface but not between the chitin layers. Successful and homogeneous gelatin infiltration in between the chitin layers can be shown. The hybrid material is characterized by TEM and shows a layered structure filled with MNPs with a size of around 10 nm. Magnetic analysis of the material demonstrates superparamagnetic behavior as characteristic for the particle size. Simulation studies show the potential of collagen and chitin to act as nucleators, where there is a slight preference of chitin over collagen as a nucleator for magnetite. Colloidal-probe AFM measurements demonstrate that introduction of a ferrogel into the chitin matrix leads to a certain increase in the stiffness of the composite material. PMID:25671158

Quantification of sulphur amino acids by ultra-high performance liquid chromatography in aquatic invertebrates.

PubMed

Thera, Jennifer C; Kidd, Karen A; Dodge-Lynch, M Elaine; Bertolo, Robert F

2017-12-15

We examined the performance of an ultra-high performance liquid chromatography method to quantify protein-bound sulphur amino acids in zooplankton. Both cysteic acid and methionine sulfone were linear from 5 to 250 pmol (r 2  = 0.99), with a method detection limit of 13 pmol and 9 pmol, respectively. Although there was no matrix effect on linearity, adjacent peaks and co-eluting noise from the invertebrate proteins increased the detection limits when compared to common standards. Overall, performance characteristics were reproducible and accurate, and provide a means for quantifying sulphur amino acids in aquatic invertebrates, an understudied group. Copyright © 2017 Elsevier Inc. All rights reserved.

Analysis of band structure, transmission properties, and dispersion behavior of THz wave in one-dimensional parabolic plasma photonic crystal

DOE Office of Scientific and Technical Information (OSTI.GOV)

Askari, Nasim; Eslami, Esmaeil, E-mail: eeslami@iust.ac.ir; Mirzaie, Reza

2015-11-15

The photonic band gap of obliquely incident terahertz electromagnetic waves in a one-dimensional plasma photonic crystal is studied. The periodic structure consists of lossless dielectric and inhomogeneous plasma with a parabolic density profile. The dispersion relation and the THz wave transmittance are analyzed based on the electromagnetic equations and transfer matrix method. The dependence of effective plasma frequency and photonic band gap characteristics on dielectric and plasma thickness, plasma density, and incident angle are discussed in detail. A theoretical calculation for effective plasma frequency is presented and compared with numerical results. Results of these two methods are in good agreement.

Instability of the cored barotropic disc: the linear eigenvalue formulation

NASA Astrophysics Data System (ADS)

Polyachenko, E. V.

2018-05-01

Gaseous rotating razor-thin discs are a testing ground for theories of spiral structure that try to explain appearance and diversity of disc galaxy patterns. These patterns are believed to arise spontaneously under the action of gravitational instability, but calculations of its characteristics in the gas are mostly obscured. The paper suggests a new method for finding the spiral patterns based on an expansion of small amplitude perturbations over Lagrange polynomials in small radial elements. The final matrix equation is extracted from the original hydrodynamical equations without the use of an approximate theory and has a form of the linear algebraic eigenvalue problem. The method is applied to a galactic model with the cored exponential density profile.

Matrix effects in pesticide multi-residue analysis by liquid chromatography-mass spectrometry.

PubMed

Kruve, Anneli; Künnapas, Allan; Herodes, Koit; Leito, Ivo

2008-04-11

Three sample preparation methods: Luke method (AOAC 985.22), QuEChERS (quick, easy, cheap, effective, rugged and safe) and matrix solid-phase dispersion (MSPD) were applied to different fruits and vegetables for analysis of 14 pesticide residues by high-performance liquid chromatography with electrospray ionization-mass spectrometry (HPLC/ESI/MS). Matrix effect, recovery and process efficiency of the sample preparation methods applied to different fruits and vegetables were compared. The Luke method was found to produce least matrix effect. On an average the best recoveries were obtained with the QuEChERS method. MSPD gave unsatisfactory recoveries for some basic pesticide residues. Comparison of matrix effects for different apple varieties showed high variability for some residues. It was demonstrated that the amount of co-extracting compounds that cause ionization suppression of aldicarb depends on the apple variety as well as on the sample preparation method employed.

Band selection method based on spectrum difference in targets of interest in hyperspectral imagery

NASA Astrophysics Data System (ADS)

Zhang, Xiaohan; Yang, Guang; Yang, Yongbo; Huang, Junhua

2016-10-01

While hyperspectral data shares rich spectrum information, it has numbers of bands with high correlation coefficients, causing great data redundancy. A reasonable band selection is important for subsequent processing. Bands with large amount of information and low correlation should be selected. On this basis, according to the needs of target detection applications, the spectral characteristics of the objects of interest are taken into consideration in this paper, and a new method based on spectrum difference is proposed. Firstly, according to the spectrum differences of targets of interest, a difference matrix which represents the different spectral reflectance of different targets in different bands is structured. By setting a threshold, the bands satisfying the conditions would be left, constituting a subset of bands. Then, the correlation coefficients between bands are calculated and correlation matrix is given. According to the size of the correlation coefficient, the bands can be set into several groups. At last, the conception of normalized variance is used on behalf of the information content of each band. The bands are sorted by the value of its normalized variance. Set needing number of bands, and the optimum band combination solution can be get by these three steps. This method retains the greatest degree of difference between the target of interest and is easy to achieve by computer automatically. Besides, false color image synthesis experiment is carried out using the bands selected by this method as well as other 3 methods to show the performance of method in this paper.

Comparison of experimental methods for estimating matrix diffusion coefficients for contaminant transport modeling

DOE PAGES

Telfeyan, Katherine Christina; Ware, Stuart Doug; Reimus, Paul William; ...

2018-01-31

Here, diffusion cell and diffusion wafer experiments were conducted to compare methods for estimating effective matrix diffusion coefficients in rock core samples from Pahute Mesa at the Nevada Nuclear Security Site (NNSS). A diffusion wafer method, in which a solute diffuses out of a rock matrix that is pre-saturated with water containing the solute, is presented as a simpler alternative to the traditional through-diffusion (diffusion cell) method. Both methods yielded estimates of effective matrix diffusion coefficients that were within the range of values previously reported for NNSS volcanic rocks. The difference between the estimates of the two methods ranged frommore » 14 to 30%, and there was no systematic high or low bias of one method relative to the other. From a transport modeling perspective, these differences are relatively minor when one considers that other variables (e.g., fracture apertures, fracture spacings) influence matrix diffusion to a greater degree and tend to have greater uncertainty than effective matrix diffusion coefficients. For the same relative random errors in concentration measurements, the diffusion cell method yields effective matrix diffusion coefficient estimates that have less uncertainty than the wafer method. However, the wafer method is easier and less costly to implement and yields estimates more quickly, thus allowing a greater number of samples to be analyzed for the same cost and time. Given the relatively good agreement between the methods, and the lack of any apparent bias between the methods, the diffusion wafer method appears to offer advantages over the diffusion cell method if better statistical representation of a given set of rock samples is desired.« less

Comparison of experimental methods for estimating matrix diffusion coefficients for contaminant transport modeling

DOE Office of Scientific and Technical Information (OSTI.GOV)

Telfeyan, Katherine Christina; Ware, Stuart Doug; Reimus, Paul William

Here, diffusion cell and diffusion wafer experiments were conducted to compare methods for estimating effective matrix diffusion coefficients in rock core samples from Pahute Mesa at the Nevada Nuclear Security Site (NNSS). A diffusion wafer method, in which a solute diffuses out of a rock matrix that is pre-saturated with water containing the solute, is presented as a simpler alternative to the traditional through-diffusion (diffusion cell) method. Both methods yielded estimates of effective matrix diffusion coefficients that were within the range of values previously reported for NNSS volcanic rocks. The difference between the estimates of the two methods ranged frommore » 14 to 30%, and there was no systematic high or low bias of one method relative to the other. From a transport modeling perspective, these differences are relatively minor when one considers that other variables (e.g., fracture apertures, fracture spacings) influence matrix diffusion to a greater degree and tend to have greater uncertainty than effective matrix diffusion coefficients. For the same relative random errors in concentration measurements, the diffusion cell method yields effective matrix diffusion coefficient estimates that have less uncertainty than the wafer method. However, the wafer method is easier and less costly to implement and yields estimates more quickly, thus allowing a greater number of samples to be analyzed for the same cost and time. Given the relatively good agreement between the methods, and the lack of any apparent bias between the methods, the diffusion wafer method appears to offer advantages over the diffusion cell method if better statistical representation of a given set of rock samples is desired.« less

Automated MALDI matrix deposition method with inkjet printing for imaging mass spectrometry.

PubMed

Baluya, Dodge L; Garrett, Timothy J; Yost, Richard A

2007-09-01

Careful matrix deposition on tissue samples for matrix-assisted laser desorption/ionization (MALDI) is critical for producing reproducible analyte ion signals. Traditional methods for matrix deposition are often considered an art rather than a science, with significant sample-to-sample variability. Here we report an automated method for matrix deposition, employing a desktop inkjet printer (<$200) with 5760 x 1440 dpi resolution and a six-channel piezoelectric head that delivers 3 pL/drop. The inkjet printer tray, designed to hold CDs and DVDs, was modified to hold microscope slides. Empty ink cartridges were filled with MALDI matrix solutions, including DHB in methanol/water (70:30) at concentrations up to 40 mg/mL. Various samples (including rat brain tissue sections and standards of small drug molecules) were prepared using three deposition methods (electrospray, airbrush, inkjet). A linear ion trap equipped with an intermediate-pressure MALDI source was used for analyses. Optical microscopic examination showed that matrix crystals were formed evenly across the sample. There was minimal background signal after storing the matrix in the cartridges over a 6-month period. Overall, the mass spectral images gathered from inkjet-printed tissue specimens were of better quality and more reproducible than from specimens prepared by the electrospray and airbrush methods.

Information matrix estimation procedures for cognitive diagnostic models.

PubMed

Liu, Yanlou; Xin, Tao; Andersson, Björn; Tian, Wei

2018-03-06

Two new methods to estimate the asymptotic covariance matrix for marginal maximum likelihood estimation of cognitive diagnosis models (CDMs), the inverse of the observed information matrix and the sandwich-type estimator, are introduced. Unlike several previous covariance matrix estimators, the new methods take into account both the item and structural parameters. The relationships between the observed information matrix, the empirical cross-product information matrix, the sandwich-type covariance matrix and the two approaches proposed by de la Torre (2009, J. Educ. Behav. Stat., 34, 115) are discussed. Simulation results show that, for a correctly specified CDM and Q-matrix or with a slightly misspecified probability model, the observed information matrix and the sandwich-type covariance matrix exhibit good performance with respect to providing consistent standard errors of item parameter estimates. However, with substantial model misspecification only the sandwich-type covariance matrix exhibits robust performance. © 2018 The British Psychological Society.

Structural properties of the intrinsically disordered, multiple calcium ion-binding otolith matrix macromolecule-64 (OMM-64).

PubMed

Poznar, Monika; Hołubowicz, Rafał; Wojtas, Magdalena; Gapiński, Jacek; Banachowicz, Ewa; Patkowski, Adam; Ożyhar, Andrzej; Dobryszycki, Piotr

2017-11-01

Fish otoliths are calcium carbonate biominerals that are involved in hearing and balance sensing. An organic matrix plays a crucial role in their formation. Otolith matrix macromolecule-64 (OMM-64) is a highly acidic, calcium-binding protein (CBP) found in rainbow trout otoliths. It is a component of high-molecular-weight aggregates, which influence the size, shape and polymorph of calcium carbonate in vitro. In this study, a protocol for the efficient expression and purification of OMM-64 was developed. For the first time, the complete structural characteristics of OMM-64 were described. Various biophysical methods were combined to show that OMM-64 occurs as an intrinsically disordered monomer. Under denaturing conditions (pH, temperature) OMM-64 exhibits folding propensity. It was determined that OMM-64 binds approximately 61 calcium ions with millimolar affinity. The folding-unfolding experiments showed that calcium ions induced the collapse of OMM-64. The effect of other counter ions present in trout endolymph on OMM-64 conformational changes was studied. The significance of disordered properties of OMM-64 and the possible function of this protein is discussed. Copyright © 2017 Elsevier B.V. All rights reserved.

Pulsed field gradients in simulations of one- and two-dimensional NMR spectra.

PubMed

Meresi, G H; Cuperlovic, M; Palke, W E; Gerig, J T

1999-03-01

A method for the inclusion of the effects of z-axis pulsed field gradients in computer simulations of an arbitrary pulsed NMR experiment with spin (1/2) nuclei is described. Recognizing that the phase acquired by a coherence following the application of a z-axis pulsed field gradient bears a fixed relation to its order and the spatial position of the spins in the sample tube, the sample is regarded as a collection of volume elements, each phase-encoded by a characteristic, spatially dependent precession frequency. The evolution of the sample's density matrix is thus obtained by computing the evolution of the density matrix for each volume element. Following the last gradient pulse, these density matrices are combined to form a composite density matrix which evolves through the rest of the experiment to yield the observable signal. This approach is implemented in a program which includes capabilities for rigorous inclusion of spin relaxation by dipole-dipole, chemical shift anisotropy, and random field mechanisms, plus the effects of arbitrary RF fields. Mathematical procedures for accelerating these calculations are described. The approach is illustrated by simulations of representative one- and two-dimensional NMR experiments. Copyright 1999 Academic Press.

Effect of particle morphology of Ni on the mechanical behavior of AZ91E-Ni coated nano Al2O3 composites

NASA Astrophysics Data System (ADS)

Sameer Kumar, D.; Suman, K. N. S.; Poddar, Palash

2017-06-01

The properties of any composite always depend on the bonding between the matrix and reinforcement phases. One way of improving the wettability of reinforcement in a matrix is to apply a layer of coating on reinforcing particles. The present study aims at developing Ni coating on nano Al2O3 ceramic particles and dispersing them in AZ91E magnesium matrix material. The electroless plating method has been employed to coat the particles and semi solid stir casting technique was adopted to prepare the composites. Several weight fractions of dispersed phase are considered to analyze the behavior of the fabricated composites. Field emission scanning electron microscopy (FESEM) and x-ray diffraction analysis has been carried out to investigate the distribution of particles and phase characteristics of the proposed material. The physical and mechanical behavior of the material was examined through density measurements, hardness, elastic modulus, ductility and tensile strength calculations. The metal coating on reinforcement aids to promote metal-metal bonding interface reactions which result in improved properties of the composite. Tensile fractography was carried out under FESEM and presented.

Cervical collagen imaging for determining preterm labor risks using a colposcope with full Mueller matrix capability

NASA Astrophysics Data System (ADS)

Stoff, Susan; Chue-Sang, Joseph; Holness, Nola A.; Gandjbakhche, Amir; Chernomordik, Viktor; Ramella-Roman, Jessica

2016-02-01

Preterm birth is a worldwide health issue, as the number one cause of infant mortality and neurological disorders. Although affecting nearly 10% of all births, an accurate, reliable diagnostic method for preterm birth has, yet, to be developed. The primary constituent of the cervix, collagen, provides the structural support and mechanical strength to maintain cervical closure, through specific organization, during fetal gestation. As pregnancy progresses, the disorganization of the cervical collagen occurs to allow eventual cervical pliability so the baby can be birthed through the cervical opening. This disorganization of collagen affects the mechanical properties of the cervix and, if the changes occur prematurely, may be a significant factor leading to preterm birth. The organization of collagen can be analyzed through the use of Mueller Matrix Polarimetric imaging of the characteristic birefringence of collagen. In this research, we have built a full Mueller Matrix Polarimetry attachment to a standard colposcope to enable imaging of human cervixes during standard prenatal exams at various stages of fetal gestation. Analysis of the polarimetric images provides information of quantity and organization of cervical collagen at specific gestational stages of pregnancy. This quantitative information may provide an indication of risk of preterm birth.

Optoelectronics of inverted type-I CdS/CdSe core/crown quantum ring

NASA Astrophysics Data System (ADS)

Bose, Sumanta; Fan, Weijun; Zhang, Dao Hua

2017-10-01

Inverted type-I heterostructure core/crown quantum rings (QRs) are quantum-efficient luminophores, whose spectral characteristics are highly tunable. Here, we study the optoelectronic properties of type-I core/crown CdS/CdSe QRs in the zincblende phase—over contrasting lateral size and crown width. For this, we inspect their strain profiles, transition energies, transition matrix elements, spatial charge densities, electronic bandstructures, band-mixing probabilities, optical gain spectra, maximum optical gains, and differential optical gains. Our framework uses an effective-mass envelope function theory based on the 8-band k ṡ p method employing the valence force field model for calculating the atomic strain distributions. The gain calculations are based on the density-matrix equation and take into consideration the excitonic effects with intraband scattering. Variations in the QR lateral size and relative widths of core and crown (ergo the composition) affect their energy levels, band-mixing probabilities, optical transition matrix elements, emission wavelengths/intensities, etc. The optical gain of QRs is also strongly dimension and composition dependent with further dependency on the injection carrier density causing the band-filling effect. They also affect the maximum and differential gain at varying dimensions and compositions.

Identification and Quantification of Carbon Phases in Conversion Fuel for the Transient Reactor Test Facility

DOE Office of Scientific and Technical Information (OSTI.GOV)

Steele, Robert; Mata, Angelica; Dunzik-Gougar, Mary Lou

2016-06-01

As part of an overall effort to convert US research reactors to low-enriched uranium (LEU) fuel use, a LEU conversion fuel is being designed for the Transient Reactor Test Facility (TREAT) at the Idaho National Laboratory. TREAT fuel compacts are comprised of UO2 fuel particles in a graphitic matrix material. In order to refine heat transfer modeling, as well as determine other physical and nuclear characteristics of the fuel, the amount and type of graphite and non-graphite phases within the fuel matrix must be known. In this study, we performed a series of complementary analyses, designed to allow detailed characterizationmore » of the graphite and phenolic resin based fuel matrix. Methods included Scanning Electron and Transmission Electron Microscopies, Raman spectroscopy, X-ray Diffraction, and Dual-Beam Focused Ion Beam Tomography. Our results indicate that no single characterization technique will yield all of the desired information; however, through the use of statistical and empirical data analysis, such as curve fitting, partial least squares regression, volume extrapolation and spectra peak ratios, a degree of certainty for the quantity of each phase can be obtained.« less

Cross-linked κ-carrageenan polymer/zinc nanoporous composite matrix for expanded bed application: Fabrication and hydrodynamic characterization.

PubMed

Mohsenkhani, Sadaf; Jahanshahi, Mohsen; Rahimpour, Ahmad

2015-08-21

Expanded bed adsorption (EBA) is a reliable separation technique for the purification of bioproducts from complex feedstocks. The specifically designed adsorbent is necessary to form a stable expanded bed. In the present work, a novel custom-designed composite matrix has been prepared through the method of water-in-oil emulsification. In order to develop an adsorbent with desirable qualities and reduce the costs, κ-carrageenan and zinc powder were used as the polymeric skeleton and the densifier, respectively. The prepared composite matrix was named as KC-Zn. Optical microscope (OM) and scanning electron microscope (SEM) were applied to characterize the morphology and structure of prepared composite matrix. These analyses approved good spherical shape and porous structure with nano-scale pores in the range of about 60-180nm. The results from the particle size analyzer (PSA) revealed that all the KC-Zn beads followed logarithmic normal size distribution with the range of 50-350μm and average diameter of 160-230μm, respectively. Main physical properties of KC-Zn matrices were measured as a function of zinc powder ratio to κ-carrageenan slurry, which showed an appropriate wet density in the range of 1.39-2.27g/ml, water content of 72.67-36.41% and porosity of 98.07-80.24%, respectively. The effects of matrix density and liquid phase viscosity on hydrodynamic behavior of prepared matrix have been investigated by residence time distribution (RTD) experiments in an expanded bed. The results indicated that in a constant liquid velocity as the matrix density was increased, the expansion factor of bed decreased and the axial mixing coefficient increased. Moreover, an enhancement in the fluid viscosity led to an increase in the bed expansion and a decrease in the stability of expanded bed. Therefore using a matrix with higher density seems necessary to face viscous feedstocks. All the results demonstrated that proper physical properties and hydrodynamic characteristics of KC-Zn matrix confirm good potential for possible use in high flow rate expanded bed operations. Copyright © 2015 Elsevier B.V. All rights reserved.

Lyophilic matrix method for dissolution and release studies of nanoscale particles.

PubMed

Pessi, Jenni; Svanbäck, Sami; Lassila, Ilkka; Hæggström, Edward; Yliruusi, Jouko

2017-10-25

We introduce a system with a lyophilic matrix to aid dissolution studies of powders and particulate systems. This lyophilic matrix method (LM method) is based on the ability to discriminate between non-dissolved particles and the dissolved species. In the LM method the test substance is embedded in a thin lyophilic core-shell matrix. This permits rapid contact with the dissolution medium while minimizing dispersion of non-dissolved particles without presenting a substantial diffusion barrier. The method produces realistic dissolution and release results for particulate systems, especially those featuring nanoscale particles. By minimizing method-induced effects on the dissolution profile of nanopowders, the LM method overcomes shortcomings associated with current dissolution tests. Copyright © 2017 Elsevier B.V. All rights reserved.

Chosen interval methods for solving linear interval systems with special type of matrix

NASA Astrophysics Data System (ADS)

Szyszka, Barbara

2013-10-01

The paper is devoted to chosen direct interval methods for solving linear interval systems with special type of matrix. This kind of matrix: band matrix with a parameter, from finite difference problem is obtained. Such linear systems occur while solving one dimensional wave equation (Partial Differential Equations of hyperbolic type) by using the central difference interval method of the second order. Interval methods are constructed so as the errors of method are enclosed in obtained results, therefore presented linear interval systems contain elements that determining the errors of difference method. The chosen direct algorithms have been applied for solving linear systems because they have no errors of method. All calculations were performed in floating-point interval arithmetic.

Non-negative matrix factorization in texture feature for classification of dementia with MRI data

NASA Astrophysics Data System (ADS)

Sarwinda, D.; Bustamam, A.; Ardaneswari, G.

2017-07-01

This paper investigates applications of non-negative matrix factorization as feature selection method to select the features from gray level co-occurrence matrix. The proposed approach is used to classify dementia using MRI data. In this study, texture analysis using gray level co-occurrence matrix is done to feature extraction. In the feature extraction process of MRI data, we found seven features from gray level co-occurrence matrix. Non-negative matrix factorization selected three features that influence of all features produced by feature extractions. A Naïve Bayes classifier is adapted to classify dementia, i.e. Alzheimer's disease, Mild Cognitive Impairment (MCI) and normal control. The experimental results show that non-negative factorization as feature selection method able to achieve an accuracy of 96.4% for classification of Alzheimer's and normal control. The proposed method also compared with other features selection methods i.e. Principal Component Analysis (PCA).

Matrix effect and recovery terminology issues in regulated drug bioanalysis.

PubMed

Huang, Yong; Shi, Robert; Gee, Winnie; Bonderud, Richard

2012-02-01

Understanding the meaning of the terms used in the bioanalytical method validation guidance is essential for practitioners to implement best practice. However, terms that have several meanings or that have different interpretations exist within bioanalysis, and this may give rise to differing practices. In this perspective we discuss an important but often confusing term - 'matrix effect (ME)' - in regulated drug bioanalysis. The ME can be interpreted as either the ionization change or the measurement bias of the method caused by the nonanalyte matrix. The ME definition dilemma makes its evaluation challenging. The matrix factor is currently used as a standard method for evaluation of ionization changes caused by the matrix in MS-based methods. Standard additions to pre-extraction samples have been suggested to evaluate the overall effects of a matrix from different sources on the analytical system, because it covers ionization variation and extraction recovery variation. We also provide our personal views on the term 'recovery'.

Optical Analog to Electromagnetically Induced Transparency in Cascaded Ring-Resonator Systems.

PubMed

Wang, Yonghua; Zheng, Hua; Xue, Chenyang; Zhang, Wendong

2016-07-25

The analogue of electromagnetically induced transparency in optical methods has shown great potential in slow light and sensing applications. Here, we experimentally demonstrated a coupled resonator induced transparency system with three cascaded ring coupled resonators in a silicon chip. The structure was modeled by using the transfer matrix method. Influences of various parameters including coupling ratio of couplers, waveguide loss and additional loss of couplers on transmission characteristic and group index have been investigated theoretically and numerically in detail. The transmission character of the system was measured by the vertical grating coupling method. The enhanced quality factor reached 1.22 × 10⁵. In addition, we further test the temperature performance of the device. The results provide a new method for the manipulation of light in highly integrated optical circuits and sensing applications.

Recognition of Roasted Coffee Bean Levels using Image Processing and Neural Network

NASA Astrophysics Data System (ADS)

Nasution, T. H.; Andayani, U.

2017-03-01

The coffee beans roast levels have some characteristics. However, some people cannot recognize the coffee beans roast level. In this research, we propose to design a method to recognize the coffee beans roast level of images digital by processing the image and classifying with backpropagation neural network. The steps consist of how to collect the images data with image acquisition, pre-processing, feature extraction using Gray Level Co-occurrence Matrix (GLCM) method and finally normalization of data extraction using decimal scaling features. The values of decimal scaling features become an input of classifying in backpropagation neural network. We use the method of backpropagation to recognize the coffee beans roast levels. The results showed that the proposed method is able to identify the coffee roasts beans level with an accuracy of 97.5%.

Three-Dimensional ISAR Imaging Method for High-Speed Targets in Short-Range Using Impulse Radar Based on SIMO Array.

PubMed

Zhou, Xinpeng; Wei, Guohua; Wu, Siliang; Wang, Dawei

2016-03-11

This paper proposes a three-dimensional inverse synthetic aperture radar (ISAR) imaging method for high-speed targets in short-range using an impulse radar. According to the requirements for high-speed target measurement in short-range, this paper establishes the single-input multiple-output (SIMO) antenna array, and further proposes a missile motion parameter estimation method based on impulse radar. By analyzing the motion geometry relationship of the warhead scattering center after translational compensation, this paper derives the receiving antenna position and the time delay after translational compensation, and thus overcomes the shortcomings of conventional translational compensation methods. By analyzing the motion characteristics of the missile, this paper estimates the missile's rotation angle and the rotation matrix by establishing a new coordinate system. Simulation results validate the performance of the proposed algorithm.

Integrated and global pseudotargeted metabolomics strategy applied to screening for quality control markers of Citrus TCMs.

PubMed

Shu, Yisong; Liu, Zhenli; Zhao, Siyu; Song, Zhiqian; He, Dan; Wang, Menglei; Zeng, Honglian; Lu, Cheng; Lu, Aiping; Liu, Yuanyan

2017-08-01

Traditional Chinese medicine (TCM) exerts its therapeutic effect in a holistic fashion with the synergistic function of multiple characteristic constituents. The holism philosophy of TCM is coincident with global and systematic theories of metabolomics. The proposed pseudotargeted metabolomics methodologies were employed for the establishment of reliable quality control markers for use in the screening strategy of TCMs. Pseudotargeted metabolomics integrates the advantages of both targeted and untargeted methods. In the present study, targeted metabolomics equipped with the gold standard RRLC-QqQ-MS method was employed for in vivo quantitative plasma pharmacochemistry study of characteristic prototypic constituents. Meanwhile, untargeted metabolomics using UHPLC-QE Orbitrap HRMS with better specificity and selectivity was employed for identification of untargeted metabolites in the complex plasma matrix. In all, 32 prototypic metabolites were quantitatively determined, and 66 biotransformed metabolites were convincingly identified after being orally administered with standard extracts of four labeled Citrus TCMs. The global absorption and metabolism process of complex TCMs was depicted in a systematic manner.

Investigation of terahertz waves propagating through far infrared/CO2 laser stealth-compatible coating based on one-dimensional photonic crystal

NASA Astrophysics Data System (ADS)

Wang, Qichao; Wang, Jiachun; Zhao, Dapeng; Zhang, Jikui; Li, Zhigang; Chen, Zongsheng; Zeng, Jie; Miao, Lei; Shi, Jiaming

2016-11-01

We propose a new method to disclose the camouflaged targets coated with far infrared/CO2 laser stealth-compatible coating by utilizing terahertz (THz) radar. A coating based on one-dimensional photonic crystal (1DPC) with a defect mode is specially designed and successfully prepared, which possesses a high reflectivity in 8-14 μm waveband and a low reflectivity at 10.6 μm, by alternating thin films of Ge, ZnSe and Si. The propagation characteristic of 0.3-2 THz wave at incident angle from 0° to 80° in such PC coating is investigated theoretically based on characteristic matrix method. The maximal transmittance is up to 92%, and the absorptivity keeps lower than 0.5% over the whole band. The results are verified by experiments, which demonstrate the feasibility of using THz radar to detect the targets covered with such stealth-compatible coatings.

Mesenchymal stem cells: biological characteristics and potential clinical applications.

PubMed

Kassem, Moustapha

2004-01-01

Mesenchymal stem cells (MSC) are clonogenic, non-hematpoietic stem cells present in the bone marrow and are able to differentiate into multiple mesoderm-type cell lineages, for example, osteoblasts, chondrocytes, endothelial-cells and also non-mesoderm-type lineages, for example, neuronal-like cells. Several methods are currently available for isolation of the MSC based on their physical and physico-chemical characteristics, for example, adherence to plastics or other extracellular matrix components. Because of the ease of their isolation and their extensive differentiation potential, MSC are among the first stem cell types to be introduced in the clinic. Several studies have demonstrated the possible use of MSC in systemic transplantation for systemic diseases, local implantation for local tissue defects, as a vehicle for genes in gene therapy protocols or to generate transplantable tissues and organs in tissue engineering protocols. Before their widespread use in therapy, methods allowing the generation of large number of cells without affecting their differentiation potential as well as technologies that overcome immunological rejection (in case allogenic transplantation) must be developed.

Current density characteristics in the studies of electromagnetically induced transparency in a GaAs/GaAlAs quantum well

NASA Astrophysics Data System (ADS)

Jayarubi, J.; Peter, A. John

2017-05-01

Confinement potential profiles due to conduction and valence bands are obtained in a Ga0.7Al0.3As/ GaAs/ Ga0.7Al0.3As using variation formulism. The free electron distribution is carried out. The confined energy eigenvalue and its corresponding wavefunctions of charge carriers are found using self-consistent method. The confined energies with the geometrical confinement are computed. The potentials due to charges are done by Poisson equation. The effects of dielectric mismatch between the GaAs and GaAlAs semiconductors are introduced in the effective potential expressions. Transfer matrix method is employed to obtain the respective energies. The transmission probability is obtained for a constant well size. The high current density characteristics as a function of applied voltage is investigated. This investigation on the electromagnetically induced transparency in the photonic material will exploit in fabricating novel nonlinear optical devices in future.

[Quantitative Analysis of Heavy Metals in Water with LIBS Based on Signal-to-Background Ratio].

PubMed

Hu, Li; Zhao, Nan-jing; Liu, Wen-qing; Fang, Li; Zhang, Da-hai; Wang, Yin; Meng, De Shuo; Yu, Yang; Ma, Ming-jun

2015-07-01

There are many influence factors in the precision and accuracy of the quantitative analysis with LIBS technology. According to approximately the same characteristics trend of background spectrum and characteristic spectrum along with the change of temperature through in-depth analysis, signal-to-background ratio (S/B) measurement and regression analysis could compensate the spectral line intensity changes caused by system parameters such as laser power, spectral efficiency of receiving. Because the measurement dates were limited and nonlinear, we used support vector machine (SVM) for regression algorithm. The experimental results showed that the method could improve the stability and the accuracy of quantitative analysis of LIBS, and the relative standard deviation and average relative error of test set respectively were 4.7% and 9.5%. Data fitting method based on signal-to-background ratio(S/B) is Less susceptible to matrix elements and background spectrum etc, and provides data processing reference for real-time online LIBS quantitative analysis technology.

Automated MALDI Matrix Coating System for Multiple Tissue Samples for Imaging Mass Spectrometry

NASA Astrophysics Data System (ADS)

Mounfield, William P.; Garrett, Timothy J.

2012-03-01

Uniform matrix deposition on tissue samples for matrix-assisted laser desorption/ionization (MALDI) is key for reproducible analyte ion signals. Current methods often result in nonhomogenous matrix deposition, and take time and effort to produce acceptable ion signals. Here we describe a fully-automated method for matrix deposition using an enclosed spray chamber and spray nozzle for matrix solution delivery. A commercial air-atomizing spray nozzle was modified and combined with solenoid controlled valves and a Programmable Logic Controller (PLC) to control and deliver the matrix solution. A spray chamber was employed to contain the nozzle, sample, and atomized matrix solution stream, and to prevent any interference from outside conditions as well as allow complete control of the sample environment. A gravity cup was filled with MALDI matrix solutions, including DHB in chloroform/methanol (50:50) at concentrations up to 60 mg/mL. Various samples (including rat brain tissue sections) were prepared using two deposition methods (spray chamber, inkjet). A linear ion trap equipped with an intermediate-pressure MALDI source was used for analyses. Optical microscopic examination showed a uniform coating of matrix crystals across the sample. Overall, the mass spectral images gathered from tissues coated using the spray chamber system were of better quality and more reproducible than from tissue specimens prepared by the inkjet deposition method.

Automated MALDI matrix coating system for multiple tissue samples for imaging mass spectrometry.

PubMed

Mounfield, William P; Garrett, Timothy J

2012-03-01

Uniform matrix deposition on tissue samples for matrix-assisted laser desorption/ionization (MALDI) is key for reproducible analyte ion signals. Current methods often result in nonhomogenous matrix deposition, and take time and effort to produce acceptable ion signals. Here we describe a fully-automated method for matrix deposition using an enclosed spray chamber and spray nozzle for matrix solution delivery. A commercial air-atomizing spray nozzle was modified and combined with solenoid controlled valves and a Programmable Logic Controller (PLC) to control and deliver the matrix solution. A spray chamber was employed to contain the nozzle, sample, and atomized matrix solution stream, and to prevent any interference from outside conditions as well as allow complete control of the sample environment. A gravity cup was filled with MALDI matrix solutions, including DHB in chloroform/methanol (50:50) at concentrations up to 60 mg/mL. Various samples (including rat brain tissue sections) were prepared using two deposition methods (spray chamber, inkjet). A linear ion trap equipped with an intermediate-pressure MALDI source was used for analyses. Optical microscopic examination showed a uniform coating of matrix crystals across the sample. Overall, the mass spectral images gathered from tissues coated using the spray chamber system were of better quality and more reproducible than from tissue specimens prepared by the inkjet deposition method.

Compensation of matrix effects in gas chromatography-mass spectrometry analysis of pesticides using a combination of matrix matching and multiple isotopically labeled internal standards.

PubMed

Tsuchiyama, Tomoyuki; Katsuhara, Miki; Nakajima, Masahiro

2017-11-17

In the multi-residue analysis of pesticides using GC-MS, the quantitative results are adversely affected by a phenomenon known as the matrix effect. Although the use of matrix-matched standards is considered to be one of the most practical solutions to this problem, complete removal of the matrix effect is difficult in complex food matrices owing to their inconsistency. As a result, residual matrix effects can introduce analytical errors. To compensate for residual matrix effects, we have developed a novel method that employs multiple isotopically labeled internal standards (ILIS). The matrix effects of ILIS and pesticides were evaluated in spiked matrix extracts of various agricultural commodities, and the obtained data were subjected to simple statistical analysis. Based on the similarities between the patterns of variation in the analytical response, a total of 32 isotopically labeled compounds were assigned to 338 pesticides as internal standards. It was found that by utilizing multiple ILIS, residual matrix effects could be effectively compensated. The developed method exhibited superior quantitative performance compared with the common single-internal-standard method. The proposed method is more feasible for regulatory purposes than that using only predetermined correction factors and is considered to be promising for practical applications. Copyright © 2017 Elsevier B.V. All rights reserved.

Monte Carlo study of a new I‐125 brachytherapy prototype seed with a ceramic radionuclide carrier and radiographic marker

PubMed Central

Paixão, Lucas; Santos, Ana Maria M.; dos Santos, Adriano Márcio; Grynberg, Suely Epsztein

2012-01-01

In prostate cancer treatment, there is an increasing interest in the permanent radioactive seeds implant technique. Currently, in Brazil, the seeds are imported with high prices, which prohibit their use in public hospitals. A ceramic matrix that can be used as a radioisotope carrier and radiographic marker was developed at our institution. The ceramic matrix is distinguished by the characteristic of maintaining the radioactive material uniformly distributed in its surface. In this work, Monte Carlo simulations were performed in order to assess the dose distributions generated by this prototype seed model, with the ceramic matrix encapsulated in titanium, in the same way as the commercial 6711 seed. The obtained data was assessed, as described in the TG‐43U1 report by the American Association of Physicists in Medicine, for two seed models: (1) the most used model 6711 source — for validation and comparison, and (2) for the prototype model with the ceramic matrix. The dosimetric parameters dose rate constant, Λ, radial dose function, gL(r), and anisotropy function, F(r,θ), were derived from simulations by the Monte Carlo method using the MCNP5 code. A Λ 0.992 (±2.33%) cGyh−1U−1 was found for the prototype model. In comparison with the 6711 model, a lower dose fall‐off on transverse axis was found, as well as a lower dose anisotropy for the radius r= 0.25 cm. In general, for all distances, the prototype seed model presents a slightly larger anisotropy between 0° ≤ Θ < 50° and anisotropy similar to the 6711 model for Θ ≥ 50°. The dosimetric characteristics of the prototype model presented in this study suggest that its use is feasible. Because of the model's characteristics, seeds of lower specific activity iodine might be necessary which, on the other hand, would help to reduce costs. However, it has to be emphasized that the proposed source is a prototype, and the required (AAPM prerequisites) experimental study and tolerance manufacturer values are pending for future studies. PACS numbers: 87.53.Jw, 87.55.K PMID:22584172

Use of sol-gels as solid matrixes for simultaneous multielement determination by radio frequency glow discharge optical emission spectrometry: determinations of suspended particulate matter.

PubMed

Davis, W Clay; Knippel, Brad C; Cooper, Julia E; Spraul, Bryan K; Rice, Jeanette K; Smith, Dennis W; Marcus, R Kenneth

2003-05-15

A new approach for the analysis of particulate matter by radio frequency glow discharge optical emission spectrometry (rf-GD-OES) is described. Dispersion of the particles in a sol-gel sample matrix provides a convenient means of generating a thin film suitable for sputter-sampling into the discharge. Acid-catalyzed sol-gel glasses synthesized from tetramethyl orthosilicate were prepared and spun-cast on glass substrates. The resultant thin films on glass substrates were analyzed to determine the discharge operating conditions and resultant sputtering characteristics while a number of optical emission lines of the film components were monitored. Slurries of powdered standard reference materials NIST SRM 1884a (Portland Cement) and NIST SRM 2690 (Coal Fly Ash) dispersed in the sols were cast into films in the same manner. Use of the sol-gels as sample matrixes allows for background subtraction through the use of analytical blanks and may facilitate the generation of calibration curves via readily synthesized, matrix-matched analytical standards in solids analysis. Detection limits were determined for minor elements via the RSDB method to be in the range of 1-10 microg/g in Portland Cement and Coal Fly Ash samples for the elements Al, Fe, Mg, S, and Si. Values for Ca were in the range of 15-35 microg/g. This preliminary study demonstrates the possibility of incorporating various insoluble species, including ceramics and geological specimens in powder form, into a solid matrix for further analysis by either rf-GD-OES or MS.

Feature Extraction from Subband Brain Signals and Its Classification

NASA Astrophysics Data System (ADS)

Mukul, Manoj Kumar; Matsuno, Fumitoshi

This paper considers both the non-stationarity as well as independence/uncorrelated criteria along with the asymmetry ratio over the electroencephalogram (EEG) signals and proposes a hybrid approach of the signal preprocessing methods before the feature extraction. A filter bank approach of the discrete wavelet transform (DWT) is used to exploit the non-stationary characteristics of the EEG signals and it decomposes the raw EEG signals into the subbands of different center frequencies called as rhythm. A post processing of the selected subband by the AMUSE algorithm (a second order statistics based ICA/BSS algorithm) provides the separating matrix for each class of the movement imagery. In the subband domain the orthogonality as well as orthonormality criteria over the whitening matrix and separating matrix do not come respectively. The human brain has an asymmetrical structure. It has been observed that the ratio between the norms of the left and right class separating matrices should be different for better discrimination between these two classes. The alpha/beta band asymmetry ratio between the separating matrices of the left and right classes will provide the condition to select an appropriate multiplier. So we modify the estimated separating matrix by an appropriate multiplier in order to get the required asymmetry and extend the AMUSE algorithm in the subband domain. The desired subband is further subjected to the updated separating matrix to extract subband sub-components from each class. The extracted subband sub-components sources are further subjected to the feature extraction (power spectral density) step followed by the linear discriminant analysis (LDA).

Centered Kernel Alignment Enhancing Neural Network Pretraining for MRI-Based Dementia Diagnosis

PubMed Central

Cárdenas-Peña, David; Collazos-Huertas, Diego; Castellanos-Dominguez, German

2016-01-01

Dementia is a growing problem that affects elderly people worldwide. More accurate evaluation of dementia diagnosis can help during the medical examination. Several methods for computer-aided dementia diagnosis have been proposed using resonance imaging scans to discriminate between patients with Alzheimer's disease (AD) or mild cognitive impairment (MCI) and healthy controls (NC). Nonetheless, the computer-aided diagnosis is especially challenging because of the heterogeneous and intermediate nature of MCI. We address the automated dementia diagnosis by introducing a novel supervised pretraining approach that takes advantage of the artificial neural network (ANN) for complex classification tasks. The proposal initializes an ANN based on linear projections to achieve more discriminating spaces. Such projections are estimated by maximizing the centered kernel alignment criterion that assesses the affinity between the resonance imaging data kernel matrix and the label target matrix. As a result, the performed linear embedding allows accounting for features that contribute the most to the MCI class discrimination. We compare the supervised pretraining approach to two unsupervised initialization methods (autoencoders and Principal Component Analysis) and against the best four performing classification methods of the 2014 CADDementia challenge. As a result, our proposal outperforms all the baselines (7% of classification accuracy and area under the receiver-operating-characteristic curve) at the time it reduces the class biasing. PMID:27148392

Algebraic solution for the forward displacement analysis of the general 6-6 stewart mechanism

NASA Astrophysics Data System (ADS)

Wei, Feng; Wei, Shimin; Zhang, Ying; Liao, Qizheng

2016-01-01

The solution for the forward displacement analysis(FDA) of the general 6-6 Stewart mechanism(i.e., the connection points of the moving and fixed platforms are not restricted to lying in a plane) has been extensively studied, but the efficiency of the solution remains to be effectively addressed. To this end, an algebraic elimination method is proposed for the FDA of the general 6-6 Stewart mechanism. The kinematic constraint equations are built using conformal geometric algebra(CGA). The kinematic constraint equations are transformed by a substitution of variables into seven equations with seven unknown variables. According to the characteristic of anti-symmetric matrices, the aforementioned seven equations can be further transformed into seven equations with four unknown variables by a substitution of variables using the Gröbner basis. Its elimination weight is increased through changing the degree of one variable, and sixteen equations with four unknown variables can be obtained using the Gröbner basis. A 40th-degree univariate polynomial equation is derived by constructing a relatively small-sized 9´9 Sylvester resultant matrix. Finally, two numerical examples are employed to verify the proposed method. The results indicate that the proposed method can effectively improve the efficiency of solution and reduce the computational burden because of the small-sized resultant matrix.

Pre-form ceramic matrix composite cavity and method of forming and method of forming a ceramic matrix composite component

DOEpatents

Monaghan, Philip Harold; Delvaux, John McConnell; Taxacher, Glenn Curtis

2015-06-09

A pre-form CMC cavity and method of forming pre-form CMC cavity for a ceramic matrix component includes providing a mandrel, applying a base ply to the mandrel, laying-up at least one CMC ply on the base ply, removing the mandrel, and densifying the base ply and the at least one CMC ply. The remaining densified base ply and at least one CMC ply form a ceramic matrix component having a desired geometry and a cavity formed therein. Also provided is a method of forming a CMC component.

MATRIX DISCRIMINANT ANALYSIS WITH APPLICATION TO COLORIMETRIC SENSOR ARRAY DATA

PubMed Central

Suslick, Kenneth S.

2014-01-01

With the rapid development of nano-technology, a “colorimetric sensor array” (CSA) which is referred to as an optical electronic nose has been developed for the identification of toxicants. Unlike traditional sensors which rely on a single chemical interaction, CSA can measure multiple chemical interactions by using chemo-responsive dyes. The color changes of the chemo-responsive dyes are recorded before and after exposure to toxicants and serve as a template for classification. The color changes are digitalized in the form of a matrix with rows representing dye effects and columns representing the spectrum of colors. Thus, matrix-classification methods are highly desirable. In this article, we develop a novel classification method, matrix discriminant analysis (MDA), which is a generalization of linear discriminant analysis (LDA) for the data in matrix form. By incorporating the intrinsic matrix-structure of the data in discriminant analysis, the proposed method can improve CSA’s sensitivity and more importantly, specificity. A penalized MDA method, PMDA, is also introduced to further incorporate sparsity structure in discriminant function. Numerical studies suggest that the proposed MDA and PMDA methods outperform LDA and other competing discriminant methods for matrix predictors. The asymptotic consistency of MDA is also established. R code and data are available online as supplementary material. PMID:26783371

Bioprosthetic Tissue Matrices in Complex Abdominal Wall Reconstruction

PubMed Central

Broyles, Justin M.; Abt, Nicholas B.; Sacks, Justin M.

2013-01-01

Background: Complex abdominal defects are difficult problems encountered by surgeons in multiple specialties. Although current evidence supports the primary repair of these defects with mesh reinforcement, it is unclear which mesh is superior for any given clinical scenario. The purpose of this review was to explore the characteristics of and clinical relevance behind bioprosthetic tissue matrices in an effort to better clarify their role in abdominal wall reconstruction. Methods: We reviewed the peer-reviewed literature on the use of bioprosthetic mesh in human subjects. Basic science articles and large retrospective and prospective reviews were included in author’s analysis. The clinical performance and characteristics of 13 bioprosthetic tissue matrices were evaluated. Results: The majority of the products evaluated perform well in contaminated fields, where the risk of wound-healing difficulties is high. Clinical outcomes, which included infection, reherniation, and bulge formation, were variable, and the majority of the studies had a mean follow-up of less than 24 months. Conclusions: Although bioprosthetic matrix has a multitude of indications within the growing field of abdominal wall reconstruction, the functionality, regenerative capacity, and long-term fate of these products have yet to be fully established. Furthermore, the clinical performance, indications, and contraindications for each type of matrix need to be fully evaluated in long-term outcome studies. PMID:25289285

Multivariate analysis of scale-dependent associations between bats and landscape structure

USGS Publications Warehouse

Gorresen, P.M.; Willig, M.R.; Strauss, R.E.

2005-01-01

The assessment of biotic responses to habitat disturbance and fragmentation generally has been limited to analyses at a single spatial scale. Furthermore, methods to compare responses between scales have lacked the ability to discriminate among patterns related to the identity, strength, or direction of associations of biotic variables with landscape attributes. We present an examination of the relationship of population- and community-level characteristics of phyllostomid bats with habitat features that were measured at multiple spatial scales in Atlantic rain forest of eastern Paraguay. We used a matrix of partial correlations between each biotic response variable (i.e., species abundance, species richness, and evenness) and a suite of landscape characteristics to represent the multifaceted associations of bats with spatial structure. Correlation matrices can correspond based on either the strength (i.e., magnitude) or direction (i.e., sign) of association. Therefore, a simulation model independently evaluated correspondence in the magnitude and sign of correlations among scales, and results were combined via a meta-analysis to provide an overall test of significance. Our approach detected both species-specific differences in response to landscape structure and scale dependence in those responses. This matrix-simulation approach has broad applicability to ecological situations in which multiple intercorrelated factors contribute to patterns in space or time. ?? 2005 by the Ecological Society of America.

Investigating the effect of landfill leachates on the characteristics of dissolved organic matter in groundwater using excitation-emission matrix fluorescence spectra coupled with fluorescence regional integration and self-organizing map.

PubMed

He, Xiao-Song; Fan, Qin-Dong

2016-11-01

For the purpose of investigating the effect of landfill leachate on the characteristics of organic matter in groundwater, groundwater samples were collected near and in a landfill site, and dissolved organic matter (DOM) was extracted from the groundwater samples and characterized by excitation-emission matrix (EEM) fluorescence spectra combined with fluorescence regional integration (FRI) and self-organizing map (SOM). The results showed that the groundwater DOM comprised humic-, fulvic-, and protein-like substances. The concentration of humic-like matter showed no obvious variation for all groundwater except the sample collected in the landfill site. Fulvic-like substance content decreased when the groundwater was polluted by landfill leachates. There were two kinds of protein-like matter in the groundwater. One kind was bound to humic-like substances, and its content did not change along with groundwater pollution. However, the other kind was present as "free" molecules or else bound in proteins, and its concentration increased significantly when the groundwater was polluted by landfill leachates. The FRI and SOM methods both can characterize the composition and evolution of DOM in the groundwater. However, the SOM analysis can identify whether protein-like moieties was bound to humic-like matter.

Wear behavior of AA 5083/SiC nano-particle metal matrix composite: Statistical analysis

NASA Astrophysics Data System (ADS)

Hussain Idrisi, Amir; Ismail Mourad, Abdel-Hamid; Thekkuden, Dinu Thomas; Christy, John Victor

2018-03-01

This paper reports study on statistical analysis of the wear characteristics of AA5083/SiC nanocomposite. The aluminum matrix composites with different wt % (0%, 1% and 2%) of SiC nanoparticles were fabricated by using stir casting route. The developed composites were used in the manufacturing of spur gears on which the study was conducted. A specially designed test rig was used in testing the wear performance of the gears. The wear was investigated under different conditions of applied load (10N, 20N, and 30N) and operation time (30 mins, 60 mins, 90 mins, and 120mins). The analysis carried out at room temperature under constant speed of 1450 rpm. The wear parameters were optimized by using Taguchi’s method. During this statistical approach, L27 Orthogonal array was selected for the analysis of output. Furthermore, analysis of variance (ANOVA) was used to investigate the influence of applied load, operation time and SiC wt. % on wear behaviour. The wear resistance was analyzed by selecting “smaller is better” characteristics as the objective of the model. From this research, it is observed that experiment time and SiC wt % have the most significant effect on the wear performance followed by the applied load.

A novel approach for the fabrication of all-inorganic nanocrystal solids: Semiconductor matrix encapsulated nanocrystal arrays

NASA Astrophysics Data System (ADS)

Moroz, Pavel

Growing fossil fuels consumption compels researchers to find new alternative pathways to produce energy. Along with new materials for the conversion of different types of energy into electricity innovative methods for efficient processing of energy sources are also introduced. The main criteria for the success of such materials and methods are the low cost and compelling performance. Among different types of materials semiconductor nanocrystals are considered as promising candidates for the role of the efficient and cheap absorbers for solar energy applications. In addition to the anticipated cost reduction, the integration of nanocrystals (NC) into device architectures is inspired by the possibility of tuning the energy of electrical charges in NCs via nanoparticle size. However, the stability of nanocrystals in photovoltaic devices is limited by the stability of organic ligands which passivate the surface of semiconductors to preserve quantum confinement. The present work introduces a new strategy for low-temperature processing of colloidal nanocrystals into all-inorganic films: semiconductor matrix encapsulated nanocrystal arrays (SMENA). This methodology goes beyond the traditional ligand-interlinking scheme and relies on the encapsulation of morphologically-defined nanocrystal arrays into a matrix of a wide-band gap semiconductor, which preserves optoelectronic properties of individual nanoparticles. Fabricated solids exhibit excellent thermal stability, which is attributed to the heteroepitaxial structure of nanocrystal-matrix interfaces. The main characteristics and properties of these solids were investigated and compared with ones of traditionally fabricated nanocrystal films using standard spectroscopic, optoelectronic and electronic techniques. As a proof of concept, we. We also characterized electron transport phenomena in different types of nanocrystal films using all-optical approach. By measuring excited carrier lifetimes in either ligand-linked or matrix-encapsulated PbS nanocrystal films containing a tunable fraction of insulating ZnS domains, we uniquely distinguish the dynamics of charge scattering on defects from other processes of exciton dissociation. The measured times are subsequently used to estimate the diffusion length and the carrier mobility for each film type within hopping transport regime. It is demonstrated that nanocrystal films encapsulated into semiconductor matrices exhibit a lower probability of charge scattering than nanocrystal solids cross-linked with either 3-mercaptopropionic acid or 1,2-ethanedithiol molecular linkers. The suppression of carrier scattering in matrix-encapsulated nanocrystal films is attributed to a relatively low density of surface defects at nanocrystal/matrix interfaces. High stability and low density of defects made it possible to fabricate infrared-emitting nanocrystal solids. Presently, an important challenge facing the development of nanocrystal infrared emitters concerns the fact that both the emission quantum yield and the stability of colloidal nanoparticles become compromised when nanoparticle solutions are processed into solids. Here, we address this issue by developing an assembly technique that encapsulates infrared-emitting PbS NCs into crystalline CdS matrices, designed to preserve NC emission characteristics upon film processing. Here, the morphology of these matrices was designed to suppress the nonradiative carrier decay, whereby increasing the exciton lifetime up to 1 mus, and boosting the emission quantum yield to an unprecedented 3.7% for inorganically encapsulated PbS NC solids.

Statistical analysis and machine learning algorithms for optical biopsy

NASA Astrophysics Data System (ADS)

Wu, Binlin; Liu, Cheng-hui; Boydston-White, Susie; Beckman, Hugh; Sriramoju, Vidyasagar; Sordillo, Laura; Zhang, Chunyuan; Zhang, Lin; Shi, Lingyan; Smith, Jason; Bailin, Jacob; Alfano, Robert R.

2018-02-01

Analyzing spectral or imaging data collected with various optical biopsy methods is often times difficult due to the complexity of the biological basis. Robust methods that can utilize the spectral or imaging data and detect the characteristic spectral or spatial signatures for different types of tissue is challenging but highly desired. In this study, we used various machine learning algorithms to analyze a spectral dataset acquired from human skin normal and cancerous tissue samples using resonance Raman spectroscopy with 532nm excitation. The algorithms including principal component analysis, nonnegative matrix factorization, and autoencoder artificial neural network are used to reduce dimension of the dataset and detect features. A support vector machine with a linear kernel is used to classify the normal tissue and cancerous tissue samples. The efficacies of the methods are compared.

A Comparison of Methods for Estimating the Determinant of High-Dimensional Covariance Matrix.

PubMed

Hu, Zongliang; Dong, Kai; Dai, Wenlin; Tong, Tiejun

2017-09-21

The determinant of the covariance matrix for high-dimensional data plays an important role in statistical inference and decision. It has many real applications including statistical tests and information theory. Due to the statistical and computational challenges with high dimensionality, little work has been proposed in the literature for estimating the determinant of high-dimensional covariance matrix. In this paper, we estimate the determinant of the covariance matrix using some recent proposals for estimating high-dimensional covariance matrix. Specifically, we consider a total of eight covariance matrix estimation methods for comparison. Through extensive simulation studies, we explore and summarize some interesting comparison results among all compared methods. We also provide practical guidelines based on the sample size, the dimension, and the correlation of the data set for estimating the determinant of high-dimensional covariance matrix. Finally, from a perspective of the loss function, the comparison study in this paper may also serve as a proxy to assess the performance of the covariance matrix estimation.

Recognition and defect detection of dot-matrix text via variation-model based learning

NASA Astrophysics Data System (ADS)

Ohyama, Wataru; Suzuki, Koushi; Wakabayashi, Tetsushi

2017-03-01

An algorithm for recognition and defect detection of dot-matrix text printed on products is proposed. Extraction and recognition of dot-matrix text contains several difficulties, which are not involved in standard camera-based OCR, that the appearance of dot-matrix characters is corrupted and broken by illumination, complex texture in the background and other standard characters printed on product packages. We propose a dot-matrix text extraction and recognition method which does not require any user interaction. The method employs detected location of corner points and classification score. The result of evaluation experiment using 250 images shows that recall and precision of extraction are 78.60% and 76.03%, respectively. Recognition accuracy of correctly extracted characters is 94.43%. Detecting printing defect of dot-matrix text is also important in the production scene to avoid illegal productions. We also propose a detection method for printing defect of dot-matrix characters. The method constructs a feature vector of which elements are classification scores of each character class and employs support vector machine to classify four types of printing defect. The detection accuracy of the proposed method is 96.68 %.

Biomimetic Mineralization on a Macroporous Cellulose-Based Matrix for Bone Regeneration

PubMed Central

Petrauskaite, Odeta; Gomes, Pedro de Sousa; Fernandes, Maria Helena; Juodzbalys, Gintaras; Maminskas, Julius

2013-01-01

The aim of this study is to investigate the biomimetic mineralization on a cellulose-based porous matrix with an improved biological profile. The cellulose matrix was precalcified using three methods: (i) cellulose samples were treated with a solution of calcium chloride and diammonium hydrogen phosphate; (ii) the carboxymethylated cellulose matrix was stored in a saturated calcium hydroxide solution; (iii) the cellulose matrix was mixed with a calcium silicate solution in order to introduce silanol groups and to combine them with calcium ions. All the methods resulted in a mineralization of the cellulose surfaces after immersion in a simulated body fluid solution. Over a period of 14 days, the matrix was completely covered with hydroxyapatite crystals. Hydroxyapatite formation depended on functional groups on the matrix surface as well as on the precalcification method. The largest hydroxyapatite crystals were obtained on the carboxymethylated cellulose matrix treated with calcium hydroxide solution. The porous cellulose matrix was not cytotoxic, allowing the adhesion and proliferation of human osteoblastic cells. Comparatively, improved cell adhesion and growth rate were achieved on the mineralized cellulose matrices. PMID:24163816

Enhancing interacting residue prediction with integrated contact matrix prediction in protein-protein interaction.

PubMed

Du, Tianchuan; Liao, Li; Wu, Cathy H

2016-12-01

Identifying the residues in a protein that are involved in protein-protein interaction and identifying the contact matrix for a pair of interacting proteins are two computational tasks at different levels of an in-depth analysis of protein-protein interaction. Various methods for solving these two problems have been reported in the literature. However, the interacting residue prediction and contact matrix prediction were handled by and large independently in those existing methods, though intuitively good prediction of interacting residues will help with predicting the contact matrix. In this work, we developed a novel protein interacting residue prediction system, contact matrix-interaction profile hidden Markov model (CM-ipHMM), with the integration of contact matrix prediction and the ipHMM interaction residue prediction. We propose to leverage what is learned from the contact matrix prediction and utilize the predicted contact matrix as "feedback" to enhance the interaction residue prediction. The CM-ipHMM model showed significant improvement over the previous method that uses the ipHMM for predicting interaction residues only. It indicates that the downstream contact matrix prediction could help the interaction site prediction.

Dependent scattering and absorption by densely packed discrete spherical particles: Effects of complex refractive index

NASA Astrophysics Data System (ADS)

Ma, L. X.; Tan, J. Y.; Zhao, J. M.; Wang, F. Q.; Wang, C. A.; Wang, Y. Y.

2017-07-01

Due to the dependent scattering and absorption effects, the radiative transfer equation (RTE) may not be suitable for dealing with radiative transfer in dense discrete random media. This paper continues previous research on multiple and dependent scattering in densely packed discrete particle systems, and puts emphasis on the effects of particle complex refractive index. The Mueller matrix elements of the scattering system with different complex refractive indexes are obtained by both electromagnetic method and radiative transfer method. The Maxwell equations are directly solved based on the superposition T-matrix method, while the RTE is solved by the Monte Carlo method combined with the hard sphere model in the Percus-Yevick approximation (HSPYA) to consider the dependent scattering effects. The results show that for densely packed discrete random media composed of medium size parameter particles (equals 6.964 in this study), the demarcation line between independent and dependent scattering has remarkable connections with the particle complex refractive index. With the particle volume fraction increase to a certain value, densely packed discrete particles with higher refractive index contrasts between the particles and host medium and higher particle absorption indexes are more likely to show stronger dependent characteristics. Due to the failure of the extended Rayleigh-Debye scattering condition, the HSPYA has weak effect on the dependent scattering correction at large phase shift parameters.

A DEIM Induced CUR Factorization

DTIC Science & Technology

2015-09-18

CUR approximate matrix factorization based on the Discrete Empirical Interpolation Method (DEIM). For a given matrix A, such a factorization provides a...CUR approximations based on leverage scores. 1 Introduction This work presents a new CUR matrix factorization based upon the Discrete Empirical...SUPPLEMENTARY NOTES 14. ABSTRACT We derive a CUR approximate matrix factorization based on the Discrete Empirical Interpolation Method (DEIM). For a given

Phase matrix induced symmetrics for multiple scattering using the matrix operator method

NASA Technical Reports Server (NTRS)

Hitzfelder, S. J.; Kattawar, G. W.

1973-01-01

Entirely rigorous proofs of the symmetries induced by the phase matrix into the reflection and transmission operators used in the matrix operator theory are given. Results are obtained for multiple scattering in both homogeneous and inhomogeneous atmospheres. These results will be useful to researchers using the method since large savings in computer time and storage are obtainable.

Joint spatial-spectral hyperspectral image clustering using block-diagonal amplified affinity matrix

NASA Astrophysics Data System (ADS)

Fan, Lei; Messinger, David W.

2018-03-01

The large number of spectral channels in a hyperspectral image (HSI) produces a fine spectral resolution to differentiate between materials in a scene. However, difficult classes that have similar spectral signatures are often confused while merely exploiting information in the spectral domain. Therefore, in addition to spectral characteristics, the spatial relationships inherent in HSIs should also be considered for incorporation into classifiers. The growing availability of high spectral and spatial resolution of remote sensors provides rich information for image clustering. Besides the discriminating power in the rich spectrum, contextual information can be extracted from the spatial domain, such as the size and the shape of the structure to which one pixel belongs. In recent years, spectral clustering has gained popularity compared to other clustering methods due to the difficulty of accurate statistical modeling of data in high dimensional space. The joint spatial-spectral information could be effectively incorporated into the proximity graph for spectral clustering approach, which provides a better data representation by discovering the inherent lower dimensionality from the input space. We embedded both spectral and spatial information into our proposed local density adaptive affinity matrix, which is able to handle multiscale data by automatically selecting the scale of analysis for every pixel according to its neighborhood of the correlated pixels. Furthermore, we explored the "conductivity method," which aims at amplifying the block diagonal structure of the affinity matrix to further improve the performance of spectral clustering on HSI datasets.

Computerized Classification of Pneumoconiosis on Digital Chest Radiography Artificial Neural Network with Three Stages.

PubMed

Okumura, Eiichiro; Kawashita, Ikuo; Ishida, Takayuki

2017-08-01

It is difficult for radiologists to classify pneumoconiosis from category 0 to category 3 on chest radiographs. Therefore, we have developed a computer-aided diagnosis (CAD) system based on a three-stage artificial neural network (ANN) method for classification based on four texture features. The image database consists of 36 chest radiographs classified as category 0 to category 3. Regions of interest (ROIs) with a matrix size of 32 × 32 were selected from chest radiographs. We obtained a gray-level histogram, histogram of gray-level difference, gray-level run-length matrix (GLRLM) feature image, and gray-level co-occurrence matrix (GLCOM) feature image in each ROI. For ROI-based classification, the first ANN was trained with each texture feature. Next, the second ANN was trained with output patterns obtained from the first ANN. Finally, we obtained a case-based classification for distinguishing among four categories with the third ANN method. We determined the performance of the third ANN by receiver operating characteristic (ROC) analysis. The areas under the ROC curve (AUC) of the highest category (severe pneumoconiosis) case and the lowest category (early pneumoconiosis) case were 0.89 ± 0.09 and 0.84 ± 0.12, respectively. The three-stage ANN with four texture features showed the highest performance for classification among the four categories. Our CAD system would be useful for assisting radiologists in classification of pneumoconiosis from category 0 to category 3.

Modeling the Role of Bulk and Surface Characteristics of Carbon Fiber on Thermal Conductance across the Carbon Fiber/Matrix Interface (Postprint)

DTIC Science & Technology

2015-11-09

Osguthorpe, D. J.; Wolff, J.; Genest, M.; Hagler, A. T. Structure and Energetics of Ligand Binding to Proteins: Escherichia Coli Dihydrofolate...available at DOI: 10.1021/acsami.5b08591 14. ABSTRACT (Maximum 200 words) The rapid heating of carbon-fiber-reinforced polymer matrix composites leads ...polymer matrix composites leads to complex thermophysical interactions which not only are dependent on the thermal properties of the constituents and

Local-global analysis of crack growth in continuously reinfoced ceramic matrix composites

NASA Technical Reports Server (NTRS)

Ballarini, Roberto; Ahmed, Shamim

1989-01-01

This paper describes the development of a mathematical model for predicting the strength and micromechanical failure characteristics of continuously reinforced ceramic matrix composites. The local-global analysis models the vicinity of a propagating crack tip as a local heterogeneous region (LHR) consisting of spring-like representation of the matrix, fibers and interfaces. Parametric studies are conducted to investigate the effects of LHR size, component properties, and interface conditions on the strength and sequence of the failure processes in the unidirectional composite system.

Shear damage mechanisms in a woven, Nicalon-reinforced ceramic-matrix composite

DOE Office of Scientific and Technical Information (OSTI.GOV)

Keith, W.P.; Kedward, K.T.

The shear response of a Nicalon-reinforced ceramic-matrix composite was investigated using Iosipescu tests. Damage was characterized by X-ray, optical, and SEM techniques. The large inelastic strains which were observed were attributed to rigid body sliding of longitudinal blocks of material. These blocks are created by the development and extension of intralaminar cracks and ply delaminations. This research reveals that the debonding and sliding characteristics of the fiber-matrix interface control the shear strength, strain softening, and cyclic degradation of the material.

The Battle of the Printers.

ERIC Educational Resources Information Center

Muller, Douglas; Pettibone, Timothy

This paper compares the characteristics of dot-matrix and daisy wheel printers using a two-column format. In the first section, the left column is used to point out the advantages of dot-matrix printers, while the daisy wheel printer is praised in the right-hand column. Examples of various capabilities are included. Advantages of the dot-matrix…

Evidence of low molecular weight components in the organic matrix of the reef building coral, Stylophora pistillata.

PubMed

Puverel, S; Houlbrèque, F; Tambutté, E; Zoccola, D; Payan, P; Caminiti, N; Tambutté, S; Allemand, D

2007-08-01

Biominerals contain both inorganic and organic components. Organic components are collectively termed the organic matrix, and this matrix has been reported to play a crucial role in mineralization. Several matrix proteins have been characterized in vertebrates, but only a few in invertebrates, primarily in Molluscs and Echinoderms. Methods classically used to extract organic matrix proteins eliminate potential low molecular weight matrix components, since cut-offs ranging from 3.5 to 10 kDa are used to desalt matrix extracts. Consequently, the presence of such components remains unknown and these are never subjected to further analyses. In the present study, we have used microcolonies from the Scleractinian coral Stylophora pistillata to study newly synthesized matrix components by labelling them with 14C-labelled amino acids. Radioactive matrix components were investigated by a method in which both total organic matrix and fractions of matrix below and above 5 kDa were analyzed. Using this method and SDS-PAGE analyses, we were able to detect the presence of low molecular mass matrix components (<3.5 kDa), but no free amino acids in the skeletal organic matrix. Since more than 98% of the 14C-labelled amino acids were incorporated into low molecular weight molecules, these probably form the bulk of newly synthesized organic matrix components. Our results suggest that these low molecular weight components may be peptides, which can be involved in the regulation of coral skeleton mineralization.

Method of making molten carbonate fuel cell ceramic matrix tape

DOEpatents

Maricle, Donald L.; Putnam, Gary C.; Stewart, Jr., Robert C.

1984-10-23

A method of making a thin, flexible, pliable matrix material for a molten carbonate fuel cell is described. The method comprises admixing particles inert in the molten carbonate environment with an organic polymer binder and ceramic particle. The composition is applied to a mold surface and dried, and the formed compliant matrix material removed.

Modeling State-Space Aeroelastic Systems Using a Simple Matrix Polynomial Approach for the Unsteady Aerodynamics

NASA Technical Reports Server (NTRS)

Pototzky, Anthony S.

2008-01-01

A simple matrix polynomial approach is introduced for approximating unsteady aerodynamics in the s-plane and ultimately, after combining matrix polynomial coefficients with matrices defining the structure, a matrix polynomial of the flutter equations of motion (EOM) is formed. A technique of recasting the matrix-polynomial form of the flutter EOM into a first order form is also presented that can be used to determine the eigenvalues near the origin and everywhere on the complex plane. An aeroservoelastic (ASE) EOM have been generalized to include the gust terms on the right-hand side. The reasons for developing the new matrix polynomial approach are also presented, which are the following: first, the "workhorse" methods such as the NASTRAN flutter analysis lack the capability to consistently find roots near the origin, along the real axis or accurately find roots farther away from the imaginary axis of the complex plane; and, second, the existing s-plane methods, such as the Roger s s-plane approximation method as implemented in ISAC, do not always give suitable fits of some tabular data of the unsteady aerodynamics. A method available in MATLAB is introduced that will accurately fit generalized aerodynamic force (GAF) coefficients in a tabular data form into the coefficients of a matrix polynomial form. The root-locus results from the NASTRAN pknl flutter analysis, the ISAC-Roger's s-plane method and the present matrix polynomial method are presented and compared for accuracy and for the number and locations of roots.

Surrogate matrix and surrogate analyte approaches for definitive quantitation of endogenous biomolecules.

PubMed

Jones, Barry R; Schultz, Gary A; Eckstein, James A; Ackermann, Bradley L

2012-10-01

Quantitation of biomarkers by LC-MS/MS is complicated by the presence of endogenous analytes. This challenge is most commonly overcome by calibration using an authentic standard spiked into a surrogate matrix devoid of the target analyte. A second approach involves use of a stable-isotope-labeled standard as a surrogate analyte to allow calibration in the actual biological matrix. For both methods, parallelism between calibration standards and the target analyte in biological matrix must be demonstrated in order to ensure accurate quantitation. In this communication, the surrogate matrix and surrogate analyte approaches are compared for the analysis of five amino acids in human plasma: alanine, valine, methionine, leucine and isoleucine. In addition, methodology based on standard addition is introduced, which enables a robust examination of parallelism in both surrogate analyte and surrogate matrix methods prior to formal validation. Results from additional assays are presented to introduce the standard-addition methodology and to highlight the strengths and weaknesses of each approach. For the analysis of amino acids in human plasma, comparable precision and accuracy were obtained by the surrogate matrix and surrogate analyte methods. Both assays were well within tolerances prescribed by regulatory guidance for validation of xenobiotic assays. When stable-isotope-labeled standards are readily available, the surrogate analyte approach allows for facile method development. By comparison, the surrogate matrix method requires greater up-front method development; however, this deficit is offset by the long-term advantage of simplified sample analysis.

Systems and methods for deactivating a matrix converter

DOEpatents

Ransom, Ray M.

2013-04-02

Systems and methods are provided for deactivating a matrix conversion module. An electrical system comprises an alternating current (AC) interface, a matrix conversion module coupled to the AC interface, an inductive element coupled between the AC interface and the matrix conversion module, and a control module. The control module is coupled to the matrix conversion module, and in response to a shutdown condition, the control module is configured to operate the matrix conversion module to deactivate the first conversion module when a magnitude of a current through the inductive element is less than a threshold value.

Fission matrix-based Monte Carlo criticality analysis of fuel storage pools

DOE Office of Scientific and Technical Information (OSTI.GOV)

Farlotti, M.; Ecole Polytechnique, Palaiseau, F 91128; Larsen, E. W.

2013-07-01

Standard Monte Carlo transport procedures experience difficulties in solving criticality problems in fuel storage pools. Because of the strong neutron absorption between fuel assemblies, source convergence can be very slow, leading to incorrect estimates of the eigenvalue and the eigenfunction. This study examines an alternative fission matrix-based Monte Carlo transport method that takes advantage of the geometry of a storage pool to overcome this difficulty. The method uses Monte Carlo transport to build (essentially) a fission matrix, which is then used to calculate the criticality and the critical flux. This method was tested using a test code on a simplemore » problem containing 8 assemblies in a square pool. The standard Monte Carlo method gave the expected eigenfunction in 5 cases out of 10, while the fission matrix method gave the expected eigenfunction in all 10 cases. In addition, the fission matrix method provides an estimate of the error in the eigenvalue and the eigenfunction, and it allows the user to control this error by running an adequate number of cycles. Because of these advantages, the fission matrix method yields a higher confidence in the results than standard Monte Carlo. We also discuss potential improvements of the method, including the potential for variance reduction techniques. (authors)« less

Fatigue loading history reconstruction based on the rain-flow technique

NASA Technical Reports Server (NTRS)

Khosrovaneh, A. K.; Dowling, N. E.

1989-01-01

Methods are considered for reducing a non-random fatigue loading history to a concise description and then for reconstructing a time history similar to the original. In particular, three methods of reconstruction based on a rain-flow cycle counting matrix are presented. A rain-flow matrix consists of the numbers of cycles at various peak and valley combinations. Two methods are based on a two dimensional rain-flow matrix, and the third on a three dimensional rain-flow matrix. Histories reconstructed by any of these methods produce a rain-flow matrix identical to that of the original history, and as a result the resulting time history is expected to produce a fatigue life similar to that for the original. The procedures described allow lengthy loading histories to be stored in compact form.

On the equivalence of dynamically orthogonal and bi-orthogonal methods: Theory and numerical simulations

DOE Office of Scientific and Technical Information (OSTI.GOV)

Choi, Minseok; Sapsis, Themistoklis P.; Karniadakis, George Em, E-mail: george_karniadakis@brown.edu

2014-08-01

The Karhunen–Lòeve (KL) decomposition provides a low-dimensional representation for random fields as it is optimal in the mean square sense. Although for many stochastic systems of practical interest, described by stochastic partial differential equations (SPDEs), solutions possess this low-dimensional character, they also have a strongly time-dependent form and to this end a fixed-in-time basis may not describe the solution in an efficient way. Motivated by this limitation of standard KL expansion, Sapsis and Lermusiaux (2009) [26] developed the dynamically orthogonal (DO) field equations which allow for the simultaneous evolution of both the spatial basis where uncertainty ‘lives’ but also themore » stochastic characteristics of uncertainty. Recently, Cheng et al. (2013) [28] introduced an alternative approach, the bi-orthogonal (BO) method, which performs the exact same tasks, i.e. it evolves the spatial basis and the stochastic characteristics of uncertainty. In the current work we examine the relation of the two approaches and we prove theoretically and illustrate numerically their equivalence, in the sense that one method is an exact reformulation of the other. We show this by deriving a linear and invertible transformation matrix described by a matrix differential equation that connects the BO and the DO solutions. We also examine a pathology of the BO equations that occurs when two eigenvalues of the solution cross, resulting in an instantaneous, infinite-speed, internal rotation of the computed spatial basis. We demonstrate that despite the instantaneous duration of the singularity this has important implications on the numerical performance of the BO approach. On the other hand, it is observed that the BO is more stable in nonlinear problems involving a relatively large number of modes. Several examples, linear and nonlinear, are presented to illustrate the DO and BO methods as well as their equivalence.« less

Characterization and N-terminal sequencing of a calcium binding protein from the calcareous concretion organic matrix of the terrestrial crustacean Orchestia cavimana.

PubMed

Luquet, G; Testenière, O; Graf, F

1996-04-16

We extracted proteins from the organic matrix of calcareous concretions, which represents the calcium storage form in a terrestrial crustacean. Electrophoretic analyses of water-soluble organic-matrix proteinaceous components revealed 11 polypeptides, 6 of which are probably glycosylated. Among the unglycosylated proteins, we characterized a 23 kDa polypeptide, with an isoelectric point of 5.5, which is able to bind calcium. Its N-terminal sequence is rich in acidic amino acids (essentially aspartic acid). All these characteristics suggest its involvement in the calcium precipitation process within the successive layers of the organic matrix.

Mechanical Properties of Oxide Films on Electrolytic In-process Dressing (ELID) Copper-based Grinding Wheel

NASA Astrophysics Data System (ADS)

Kuai, J. C.; Wang, J. W.; Jiang, C. R.; Zhang, H. L.; Yang, Z. B.

2018-05-01

The mechanical properties of oxide films on copper based grinding wheel were studied by nanoindentation technique. The analysis of load displacement shows that the creep phenomenon occurs during the loading stage. Results show that the oxide film and the matrix have different characteristics, and the rigidity of the copper based grinding wheel is 0.6-1.3mN/nm, which is weaker than that of the matrix; the hardness of the oxide film is 2000-2300MPa, which is higher than the matrix; and the elastic modulus of the oxide film is 100-120GPa, also higher than the matrix.

Solving large sparse eigenvalue problems on supercomputers

NASA Technical Reports Server (NTRS)

Philippe, Bernard; Saad, Youcef

1988-01-01

An important problem in scientific computing consists in finding a few eigenvalues and corresponding eigenvectors of a very large and sparse matrix. The most popular methods to solve these problems are based on projection techniques on appropriate subspaces. The main attraction of these methods is that they only require the use of the matrix in the form of matrix by vector multiplications. The implementations on supercomputers of two such methods for symmetric matrices, namely Lanczos' method and Davidson's method are compared. Since one of the most important operations in these two methods is the multiplication of vectors by the sparse matrix, methods of performing this operation efficiently are discussed. The advantages and the disadvantages of each method are compared and implementation aspects are discussed. Numerical experiments on a one processor CRAY 2 and CRAY X-MP are reported. Possible parallel implementations are also discussed.

Organic salt NEDC (N-naphthylethylenediamine dihydrochloride) assisted laser desorption ionization mass spectrometry for identification of metal ions in real samples.

PubMed

Hou, Jian; Chen, Suming; Zhang, Ning; Liu, Huihui; Wang, Jianing; He, Qing; Wang, Jiyun; Xiong, Shaoxiang; Nie, Zongxiu

2014-07-07

The significance of metals in life and their epidemiological effects necessitate the development of a direct, efficient, and rapid method of analysis. The matrix assisted laser desorption/ionization technique is on the horns of a dilemma of metal analysis as the conventional matrixes have high background in the low mass range. An organic salt, NEDC (N-naphthylethylenediamine dihydrochloride), is applied as a matrix for identification of metal ions in the negative ion mode in the present work. Sixteen metal ions, Ba(2+), Ca(2+), Cd(2+), Ce(3+), Co(2+), Cu(2+), Fe(3+), Hg(2+), K(+), Mg(2+), Mn(2+), Na(+), Ni(2+), Pb(2+), Sn(2+) and Zn(2+), in the form of their chloride-adducted clusters were systematically tested. Mass spectra can provide unambiguous identification through accurate mass-to-charge ratios and characteristic isotope patterns. Compared to ruthenium ICP standard solution, tris(2,2'-bipyridyl)dichlororuthenium(ii) (C30H24N6Cl2Ru) can form organometallic chloride adducts to discriminate from the inorganic ruthenium by this method. After evaluating the sensitivity for Ca, Cu, Mg, Mn, Pb and Zn and plotting their quantitation curves of signal intensity versus concentration, we determined magnesium concentration in lake water quantitatively to be 5.42 mg L(-1) using the standard addition method. There is no significant difference from the result obtained with ICP-OES, 5.8 mg L(-1). Human urine and blood were also detected to ascertain the multi-metal analysis ability of this strategy in complex samples. At last, we explored its applicability to tissue slice and visualized sodium and potassium distribution by mass spectrometry imaging in the normal Kunming mouse brain.

Silica Coating of Nonsilicate Nanoparticles for Resin-Based Composite Materials

PubMed Central

Kaizer, M.R.; Almeida, J.R.; Gonçalves, A.P.R.; Zhang, Y.; Cava, S.S.; Moraes, R.R.

2016-01-01

This study was designed to develop and characterize a silica-coating method for crystalline nonsilicate ceramic nanoparticles (Al2O3, TiO2, and ZrO2). The hypothesis was that the coated nonsilicate nanoparticles would stably reinforce a polymeric matrix due to effective silanation. Silica coating was applied via a sol-gel method, with tetraethyl orthosilicate as a silica precursor, followed by heat treatment. The chemical and microstructural characteristics of the nanopowders were evaluated before and after silica coating through x-ray diffraction, BET (Brunauer-Emmett-Teller), energy-dispersive x-ray spectroscopy, field emission scanning electron microscopy, and transmission electron microscopy analyses. Coated and noncoated nanoparticles were silanated before preparation of hybrid composites, which contained glass microparticles in addition to the nanoparticles. The composites were mechanically tested in 4-point bending mode after aging (10,000 thermal cycles). Results of all chemical and microstructural analyses confirmed the successful obtaining of silica-coated nanoparticles. Two distinct aspects were observed depending on the type of nanoparticle tested: 1) formation of a silica shell on the surface of the particles and 2) nanoparticle clusters embedded into a silica matrix. The aged hybrid composites formulated with the coated nanoparticles showed improved flexural strength (10% to 30% higher) and work of fracture (35% to 40% higher) as compared with composites formulated with noncoated nanoparticles. The tested hypothesis was confirmed: silanated silica-coated nonsilicate nanoparticles yielded stable reinforcement of dimethacrylate polymeric matrix due to effective silanation. The silica-coating method presented here is a versatile and promising novel strategy for the use of crystalline nonsilicate ceramics as a reinforcing phase of polymeric composite biomaterials. PMID:27470069

Method of making silicon carbide-silicon composite having improved oxidation resistance

NASA Technical Reports Server (NTRS)

Wang, Hongyu (Inventor); Luthra, Krishan Lal (Inventor)

2002-01-01

A Silicon carbide-silicon matrix composite having improved oxidation resistance at high temperatures in dry or water-containing environments is provided. A method is given for sealing matrix cracks in situ in melt infiltrated silicon carbide-silicon matrix composites. The composite cracks are sealed by the addition of various additives, such as boron compounds, into the melt infiltrated silicon carbide-silicon matrix.

Silicon carbide-silicon composite having improved oxidation resistance and method of making

NASA Technical Reports Server (NTRS)

Wang, Hongyu (Inventor); Luthra, Krishan Lal (Inventor)

1999-01-01

A Silicon carbide-silicon matrix composite having improved oxidation resistance at high temperatures in dry or water-containing environments is provided. A method is given for sealing matrix cracks in situ in melt infiltrated silicon carbide-silicon matrix composites. The composite cracks are sealed by the addition of various additives, such as boron compounds, into the melt infiltrated silicon carbide-silicon matrix.

Fatigue Lifetime of Ceramic Matrix Composites at Intermediate Temperature by Acoustic Emission

PubMed Central

Racle, Elie; Godin, Nathalie; Reynaud, Pascal; Fantozzi, Gilbert

2017-01-01

The fatigue behavior of a Ceramic Matrix Composite (CMC) at intermediate temperature under air is investigated. Because of the low density and the high tensile strength of CMC, they offer a good technical solution to design aeronautical structural components. The aim of the present study is to compare the behavior of this composite under static and cyclic loading. Comparison between incremental static and cyclic tests shows that cyclic loading with an amplitude higher than 30% of the ultimate tensile strength has significant effects on damage and material lifetimes. In order to evaluate the remaining lifetime, several damage indicators, mainly based on the investigation of the liberated energy, are introduced. These indicators highlight critical times or characteristic times, allowing an evaluation of the remaining lifetime. A link is established with the characteristic time around 25% of the total test duration and the beginning of the matrix cracking during cyclic fatigue. PMID:28773019

A comparative study on the tensile and impact properties of Kevlar, carbon, and S-glass/epoxy composites reinforced with SiC particles

NASA Astrophysics Data System (ADS)

Bulut, Mehmet; Alsaadi, Mohamad; Erkliğ, Ahmet

2018-02-01

Present study compares the tensile and impact characteristics of Kevlar, carbon and glass fiber reinforced composites with addition of microscale silicon carbide (SiC) within the common matrix of epoxy. The variation of tensile and impact strength values was explored for different content of SiC in the epoxy resin by weight (0, 5, 10, 15 and 20 wt%). Resulting failure characteristics were identified by assisting Charpy impact tests. The influence of interfacial adhesion between particle and fiber/matrix on failure and tensile properties was discussed from obtained results and scanning electron microscopy (SEM) figures. It is concluded from results that the content of SiC particles, and fiber types used as reinforcement are major parameters those effecting on tensile and impact resistance of composites as a result of different interface strength properties between particle-matrix and particle-fiber.

Mechanistic understanding of nanoparticles' interactions with extracellular matrix: the cell and immune system.

PubMed

Engin, Ayse Basak; Nikitovic, Dragana; Neagu, Monica; Henrich-Noack, Petra; Docea, Anca Oana; Shtilman, Mikhail I; Golokhvast, Kirill; Tsatsakis, Aristidis M

2017-06-24

Extracellular matrix (ECM) is an extraordinarily complex and unique meshwork composed of structural proteins and glycosaminoglycans. The ECM provides essential physical scaffolding for the cellular constituents, as well as contributes to crucial biochemical signaling. Importantly, ECM is an indispensable part of all biological barriers and substantially modulates the interchange of the nanotechnology products through these barriers. The interactions of the ECM with nanoparticles (NPs) depend on the morphological characteristics of intercellular matrix and on the physical characteristics of the NPs and may be either deleterious or beneficial. Importantly, an altered expression of ECM molecules ultimately affects all biological processes including inflammation. This review critically discusses the specific behavior of NPs that are within the ECM domain, and passing through the biological barriers. Furthermore, regenerative and toxicological aspects of nanomaterials are debated in terms of the immune cells-NPs interactions.

A matrix-inversion method for gamma-source mapping from gamma-count data

DOE Office of Scientific and Technical Information (OSTI.GOV)

Adsley, Ian; Burgess, Claire; Bull, Richard K

In a previous paper it was proposed that a simple matrix inversion method could be used to extract source distributions from gamma-count maps, using simple models to calculate the response matrix. The method was tested using numerically generated count maps. In the present work a 100 kBq Co{sup 60} source has been placed on a gridded surface and the count rate measured using a NaI scintillation detector. The resulting map of gamma counts was used as input to the matrix inversion procedure and the source position recovered. A multi-source array was simulated by superposition of several single-source count maps andmore » the source distribution was again recovered using matrix inversion. The measurements were performed for several detector heights. The effects of uncertainties in source-detector distances on the matrix inversion method are also examined. The results from this work give confidence in the application of the method to practical applications, such as the segregation of highly active objects amongst fuel-element debris. (authors)« less

Exact simulation of polarized light reflectance by particle deposits

NASA Astrophysics Data System (ADS)

Ramezan Pour, B.; Mackowski, D. W.

2015-12-01

The use of polarimetric light reflection measurements as a means of identifying the physical and chemical characteristics of particulate materials obviously relies on an accurate model of predicting the effects of particle size, shape, concentration, and refractive index on polarized reflection. The research examines two methods for prediction of reflection from plane parallel layers of wavelength—sized particles. The first method is based on an exact superposition solution to Maxwell's time harmonic wave equations for a deposit of spherical particles that are exposed to a plane incident wave. We use a FORTRAN-90 implementation of this solution (the Multiple Sphere T Matrix (MSTM) code), coupled with parallel computational platforms, to directly simulate the reflection from particle layers. The second method examined is based upon the vector radiative transport equation (RTE). Mie theory is used in our RTE model to predict the extinction coefficient, albedo, and scattering phase function of the particles, and the solution of the RTE is obtained from adding—doubling method applied to a plane—parallel configuration. Our results show that the MSTM and RTE predictions of the Mueller matrix elements converge when particle volume fraction in the particle layer decreases below around five percent. At higher volume fractions the RTE can yield results that, depending on the particle size and refractive index, significantly depart from the exact predictions. The particle regimes which lead to dependent scattering effects, and the application of methods to correct the vector RTE for particle interaction, will be discussed.

[Application of precursor ion scanning method in rapid screening of illegally added phosphodiesterase-5 inhibitors and their unknown derivatives in Chinese traditional patent medicines and health foods].

PubMed

Sun, Jing; Cao, Ling; Feng, Youlong; Tan, Li

2014-11-01

The compounds with similar structure often have similar pharmacological activities. So it is a trend for illegal addition that new derivatives of effective drugs are synthesized to avoid the statutory test. This bring challenges to crack down on illegal addition behavior, however, modified derivatives usually have similar product ions, which allow for precursor ion scanning. In this work, precursor ion scanning mode of a triple quadrupole mass spectrometer was first applied to screen illegally added drugs in complex matrix such as Chinese traditional patent medicines and healthy foods. Phosphodiesterase-5 inhibitors were used as experimental examples. Through the analysis of the structure and mass spectrum characteristics of the compounds, phosphodiesterase-5 inhibitors were classified, and their common product ions were screened by full scan of product ions of typical compounds. Then high performance liquid chromatography-tandem mass spectrometry (HPLC-MS/MS) method with precursor ion scanning mode was established based on the optimization of MS parameters. The effect of mass parameters and the choice of fragment ions were also studied. The method was applied to determine actual samples and further refined. The results demonstrated that this method can meet the need of rapid screening of unknown derivatives of phosphodiesterase-5 inhibitors in complex matrix, and prevent unknown derivatives undetected. This method shows advantages in sensitivity, specificity and efficiency, and is worth to be further investigated.

The generalised Sylvester matrix equations over the generalised bisymmetric and skew-symmetric matrices

NASA Astrophysics Data System (ADS)

Dehghan, Mehdi; Hajarian, Masoud

2012-08-01

A matrix P is called a symmetric orthogonal if P = P T = P -1. A matrix X is said to be a generalised bisymmetric with respect to P if X = X T = PXP. It is obvious that any symmetric matrix is also a generalised bisymmetric matrix with respect to I (identity matrix). By extending the idea of the Jacobi and the Gauss-Seidel iterations, this article proposes two new iterative methods, respectively, for computing the generalised bisymmetric (containing symmetric solution as a special case) and skew-symmetric solutions of the generalised Sylvester matrix equation ? (including Sylvester and Lyapunov matrix equations as special cases) which is encountered in many systems and control applications. When the generalised Sylvester matrix equation has a unique generalised bisymmetric (skew-symmetric) solution, the first (second) iterative method converges to the generalised bisymmetric (skew-symmetric) solution of this matrix equation for any initial generalised bisymmetric (skew-symmetric) matrix. Finally, some numerical results are given to illustrate the effect of the theoretical results.

Attitude determination using vector observations: A fast optimal matrix algorithm

NASA Technical Reports Server (NTRS)

Markley, F. Landis

1993-01-01

The attitude matrix minimizing Wahba's loss function is computed directly by a method that is competitive with the fastest known algorithm for finding this optimal estimate. The method also provides an estimate of the attitude error covariance matrix. Analysis of the special case of two vector observations identifies those cases for which the TRIAD or algebraic method minimizes Wahba's loss function.

A Chebyshev matrix method for spatial modes of the Orr-Sommerfeld equation

NASA Technical Reports Server (NTRS)

Danabasoglu, G.; Biringen, S.

1989-01-01

The Chebyshev matrix collocation method is applied to obtain the spatial modes of the Orr-Sommerfeld equation for Poiseuille flow and the Blausius boundary layer. The problem is linearized by the companion matrix technique for semi-infinite domain using a mapping transformation. The method can be easily adapted to problems with different boundary conditions requiring different transformations.

Matrix form of Legendre polynomials for solving linear integro-differential equations of high order

NASA Astrophysics Data System (ADS)

Kammuji, M.; Eshkuvatov, Z. K.; Yunus, Arif A. M.

2017-04-01

This paper presents an effective approximate solution of high order of Fredholm-Volterra integro-differential equations (FVIDEs) with boundary condition. Legendre truncated series is used as a basis functions to estimate the unknown function. Matrix operation of Legendre polynomials is used to transform FVIDEs with boundary conditions into matrix equation of Fredholm-Volterra type. Gauss Legendre quadrature formula and collocation method are applied to transfer the matrix equation into system of linear algebraic equations. The latter equation is solved by Gauss elimination method. The accuracy and validity of this method are discussed by solving two numerical examples and comparisons with wavelet and methods.

Acoustic 3D modeling by the method of integral equations

NASA Astrophysics Data System (ADS)

Malovichko, M.; Khokhlov, N.; Yavich, N.; Zhdanov, M.

2018-02-01

This paper presents a parallel algorithm for frequency-domain acoustic modeling by the method of integral equations (IE). The algorithm is applied to seismic simulation. The IE method reduces the size of the problem but leads to a dense system matrix. A tolerable memory consumption and numerical complexity were achieved by applying an iterative solver, accompanied by an effective matrix-vector multiplication operation, based on the fast Fourier transform (FFT). We demonstrate that, the IE system matrix is better conditioned than that of the finite-difference (FD) method, and discuss its relation to a specially preconditioned FD matrix. We considered several methods of matrix-vector multiplication for the free-space and layered host models. The developed algorithm and computer code were benchmarked against the FD time-domain solution. It was demonstrated that, the method could accurately calculate the seismic field for the models with sharp material boundaries and a point source and receiver located close to the free surface. We used OpenMP to speed up the matrix-vector multiplication, while MPI was used to speed up the solution of the system equations, and also for parallelizing across multiple sources. The practical examples and efficiency tests are presented as well.

Adapting Covariance Propagation to Account for the Presence of Modeled and Unmodeled Maneuvers

NASA Technical Reports Server (NTRS)

Schiff, Conrad

2006-01-01

This paper explores techniques that can be used to adapt the standard linearized propagation of an orbital covariance matrix to the case where there is a maneuver and an associated execution uncertainty. A Monte Carlo technique is used to construct a final orbital covariance matrix for a 'prop-burn-prop' process that takes into account initial state uncertainty and execution uncertainties in the maneuver magnitude. This final orbital covariance matrix is regarded as 'truth' and comparisons are made with three methods using modified linearized covariance propagation. The first method accounts for the maneuver by modeling its nominal effect within the state transition matrix but excludes the execution uncertainty by omitting a process noise matrix from the computation. The second method does not model the maneuver but includes a process noise matrix to account for the uncertainty in its magnitude. The third method, which is essentially a hybrid of the first two, includes the nominal portion of the maneuver via the state transition matrix and uses a process noise matrix to account for the magnitude uncertainty. The first method is unable to produce the final orbit covariance except in the case of zero maneuver uncertainty. The second method yields good accuracy for the final covariance matrix but fails to model the final orbital state accurately. Agreement between the simulated covariance data produced by this method and the Monte Carlo truth data fell within 0.5-2.5 percent over a range of maneuver sizes that span two orders of magnitude (0.1-20 m/s). The third method, which yields a combination of good accuracy in the computation of the final covariance matrix and correct accounting for the presence of the maneuver in the nominal orbit, is the best method for applications involving the computation of times of closest approach and the corresponding probability of collision, PC. However, applications for the two other methods exist and are briefly discussed. Although the process model ("prop-burn-prop") that was studied is very simple - point-mass gravitational effects due to the Earth combined with an impulsive delta-V in the velocity direction for the maneuver - generalizations to more complex scenarios, including high fidelity force models, finite duration maneuvers, and maneuver pointing errors, are straightforward and are discussed in the conclusion.

Convergence of Transition Probability Matrix in CLVMarkov Models

NASA Astrophysics Data System (ADS)

Permana, D.; Pasaribu, U. S.; Indratno, S. W.; Suprayogi, S.

2018-04-01

A transition probability matrix is an arrangement of transition probability from one states to another in a Markov chain model (MCM). One of interesting study on the MCM is its behavior for a long time in the future. The behavior is derived from one property of transition probabilty matrix for n steps. This term is called the convergence of the n-step transition matrix for n move to infinity. Mathematically, the convergence of the transition probability matrix is finding the limit of the transition matrix which is powered by n where n moves to infinity. The convergence form of the transition probability matrix is very interesting as it will bring the matrix to its stationary form. This form is useful for predicting the probability of transitions between states in the future. The method usually used to find the convergence of transition probability matrix is through the process of limiting the distribution. In this paper, the convergence of the transition probability matrix is searched using a simple concept of linear algebra that is by diagonalizing the matrix.This method has a higher level of complexity because it has to perform the process of diagonalization in its matrix. But this way has the advantage of obtaining a common form of power n of the transition probability matrix. This form is useful to see transition matrix before stationary. For example cases are taken from CLV model using MCM called Model of CLV-Markov. There are several models taken by its transition probability matrix to find its convergence form. The result is that the convergence of the matrix of transition probability through diagonalization has similarity with convergence with commonly used distribution of probability limiting method.

A new formulation of curcumin using poly (lactic-co-glycolic acid)—polyethylene glycol diblock copolymer as carrier material

NASA Astrophysics Data System (ADS)

Phuong Tuyen Dao, Thi; Hoai Nguyen, To; To, Van Vinh; Ho, Thanh Ha; Nguyen, Tuan Anh; Chien Dang, Mau

2014-09-01

The aim of this study is to fabricate a nanoparticle formulation of curcumin using a relatively new vehicle as the matrix polymer: poly(lactic-co-glycolic acid) (PLGA)- polyethylene glycol (PEG) diblock copolymer, and to investigate the effects of the various processing parameters on the characteristics of nanoparticles (NPs). We successfully synthesized the matrix polymer of PLGA-PEG by conjugation of PLGA copolymer with a carboxylate end group to a heterobifunctional amine-PEG-methoxy using N-(3-dimethylaminopropyl)-N’-ethylcarbodiimide hydrochloride and N-hydroxysuccinimide as conjugation crosslinkers. The composition of the formed product (PLGA-PEG) was characterized with 500 MHz 1H nuclear magnetic resonance (NMR). The conjugation of PLGA-PEG was confirmed using Fourier transform infrared (FTIR) spectrum study. This diblock copolymer was then used to prepare the curcumin-loaded NPs through nanoprecipitation technique. With this method, we found that the size distribution depends on the type of solvent, the concentration of polymer and the concentration of surfactant. The particle size and size distribution were measured by dynamic light scattering (DLS). Transmission electron microscope (TEM) and scanning electron microscope (SEM) were used to confirm the size, structure and morphology of the successfully prepared NPs. All of our results showed that they are spherical and quite homologous with mean diameter around of 100-300 nm. Further, we evaluated encapsulation efficiency and some characteristics of NPs through high performance liquid chromatography (HPLC) analyses, zeta-potential measurements and x-ray diffraction studies. The HPLC analyses were performed to determine the amount of curcumin entrapped in NPs. The zeta-potential measurements confirmed the stability of NPs and the successful encapsulation of curcumin within NPs and the x-ray diffraction patterns showed the disordered-crystalline phase of curcumin inside the polymeric matrix.

Efficient Implementation of the Invariant Imbedding T-Matrix Method and the Separation of Variables Method Applied to Large Nonspherical Inhomogeneous Particles

NASA Technical Reports Server (NTRS)

Bi, Lei; Yang, Ping; Kattawar, George W.; Mishchenko, Michael I.

2012-01-01

Three terms, ''Waterman's T-matrix method'', ''extended boundary condition method (EBCM)'', and ''null field method'', have been interchangeable in the literature to indicate a method based on surface integral equations to calculate the T-matrix. Unlike the previous method, the invariant imbedding method (IIM) calculates the T-matrix by the use of a volume integral equation. In addition, the standard separation of variables method (SOV) can be applied to compute the T-matrix of a sphere centered at the origin of the coordinate system and having a maximal radius such that the sphere remains inscribed within a nonspherical particle. This study explores the feasibility of a numerical combination of the IIM and the SOV, hereafter referred to as the IIMþSOV method, for computing the single-scattering properties of nonspherical dielectric particles, which are, in general, inhomogeneous. The IIMþSOV method is shown to be capable of solving light-scattering problems for large nonspherical particles where the standard EBCM fails to converge. The IIMþSOV method is flexible and applicable to inhomogeneous particles and aggregated nonspherical particles (overlapped circumscribed spheres) representing a challenge to the standard superposition T-matrix method. The IIMþSOV computational program, developed in this study, is validated against EBCM simulated spheroid and cylinder cases with excellent numerical agreement (up to four decimal places). In addition, solutions for cylinders with large aspect ratios, inhomogeneous particles, and two-particle systems are compared with results from discrete dipole approximation (DDA) computations, and comparisons with the improved geometric-optics method (IGOM) are found to be quite encouraging.

Preoperative easily misdiagnosed telangiectatic osteosarcoma: clinical–radiologic–pathologic correlations

PubMed Central

Gao, Zhen-Hua; Yin, Jun-Qiang; Liu, Da-Wei; Meng, Quan-Fei

2013-01-01

Abstract Purpose: To describe the clinical, imaging, and pathologic characteristics and diagnostic methods of telangiectatic osteosarcoma (TOS) for improving the diagnostic level. Materials and methods: The authors retrospectively reviewed patient demographics, serum alkaline phosphatase (AKP) levels, preoperative biopsy pathologic reports, pathologic materials, imaging findings, and treatment outcomes from 26 patients with TOS. Patient images from radiography (26 cases) and magnetic resonance (MR) imaging (22 cases) were evaluated by 3 authors in consensus for intrinsic characteristics. There were 15 male and 11 female patients in the study, with an age of 9–32 years (mean age 15.9 years). Results: Eighteen of 26 patients died of lung metastases within 5 years of follow-up. The distal femur was affected more commonly (14 cases, 53.8%). Regarding serum AKP, normal (8 cases) or mildly elevated (18 cases) levels were found before preoperative chemotherapy. Radiographs showed geographic bone lysis without sclerotic margin (26 cases), cortical destruction (26 cases), periosteal new bone formation (24 cases), soft-tissue mass (23 cases), and matrix mineralization (4 cases). The aggressive radiographic features of TOS simulated the appearance of conventional high-grade intramedullary osteosarcoma, though different from aneurysmal bone cyst. MR images demonstrated multiple big (16 cases) or small (6 cases) cystic spaces, fluid-fluid levels (14 cases), soft-tissue mass (22 cases), and thick peripheral and septal enhancement (22 cases). Nine of 26 cases were misdiagnosed as aneurysmal bone cysts by preoperative core-needle biopsy, owing to the absence of viable high-grade sarcomatous cells in the small tissue samples. Conclusion: The aggressive growth pattern with occasional matrix mineralization, and multiple big or small fluid-filled cavities with thick peripheral, septal, and nodular tissue surrounding the fluid-filled cavities are characteristic imaging features of TOS, and these features are helpful in making the correct preoperative diagnosis of TOS. PMID:24334494

A survey of clearing techniques for 3D imaging of tissues with special reference to connective tissue.

PubMed

Azaripour, Adriano; Lagerweij, Tonny; Scharfbillig, Christina; Jadczak, Anna Elisabeth; Willershausen, Brita; Van Noorden, Cornelis J F

2016-08-01

For 3-dimensional (3D) imaging of a tissue, 3 methodological steps are essential and their successful application depends on specific characteristics of the type of tissue. The steps are 1° clearing of the opaque tissue to render it transparent for microscopy, 2° fluorescence labeling of the tissues and 3° 3D imaging. In the past decades, new methodologies were introduced for the clearing steps with their specific advantages and disadvantages. Most clearing techniques have been applied to the central nervous system and other organs that contain relatively low amounts of connective tissue including extracellular matrix. However, tissues that contain large amounts of extracellular matrix such as dermis in skin or gingiva are difficult to clear. The present survey lists methodologies that are available for clearing of tissues for 3D imaging. We report here that the BABB method using a mixture of benzyl alcohol and benzyl benzoate and iDISCO using dibenzylether (DBE) are the most successful methods for clearing connective tissue-rich gingiva and dermis of skin for 3D histochemistry and imaging of fluorescence using light-sheet microscopy. Copyright © 2016 The Authors. Published by Elsevier GmbH.. All rights reserved.

Application of excitation and emission matrix fluorescence (EEM) and UV-vis absorption to monitor the characteristics of Alizarin Red S (ARS) during electro-Fenton degradation process.

PubMed

Lai, Bo; Zhou, Yuexi; Wang, Juling; Yang, Zhishan; Chen, Zhiqiang

2013-11-01

Oxidative degradation of Alizarin Red S (ARS) in aqueous solutions by using electro-Fenton was studied. At first, effect of operating parameters such as current density, aeration rate and initial pH on the degradation of ARS were studied by using UV-vis spectrum, respectively. Then, under the optimal operating conditions (current density: 10.0mAcm(-2), aeration rate: 1000mLmin(-1), initial pH: 2.8), the identification of degradation products of ARS was carried out by using GC-MS and HPLC, meanwhile its degradation pathway was proposed according to the intermediates. Considering the location, intensity and intensity ratio of fluorescence center peak of the ARS in aqueous solution, a convenient and quick monitoring method by using excitation-emission matrix fluorescence spectrum technology was developed to monitor the degradation degree of ARS through electro-Fenton process. Furthermore, it is suggested that the developed method would be promising for the quick analysis and evaluation of the degradation degree of the pollutants with π-conjugated system. Copyright © 2013 Elsevier Ltd. All rights reserved.

ECM-Based Biohybrid Materials for Engineering Compliant, Matrix-Dense Tissues

PubMed Central

Bracaglia, Laura G.; Fisher, John P.

2015-01-01

An ideal tissue engineering scaffold should not only promote, but take an active role in, constructive remodeling and formation of site appropriate tissue. ECM-derived proteins provide unmatched cellular recognition, and therefore influence cellular response towards predicted remodeling behaviors. Materials built with only these proteins, however, can degrade rapidly or begin too weak to substitute for compliant, matrix-dense tissues. The focus of this review is on biohybrid materials that incorporate polymer components with ECM-derived proteins, to produce a substrate with desired mechanical and degradation properties, as well as actively guide tissue remodeling. Materials are described through four fabrication methods: (1) polymer and ECM-protein fibers woven together, (2) polymer and ECM proteins combined in a bilayer, (3) cell-built ECM on polymer scaffold, and (4) ECM proteins and polymers combined in a single hydrogel. Scaffolds from each fabrication method can achieve characteristics suitable for different types of tissue. In vivo testing has shown progressive remodeling in injury models, and suggests ECM-based biohybrid materials promote a prohealing immune response over single component alternatives. The prohealing immune response is associated with lasting success and long term host maintenance of the implant. PMID:26227679

Tensile Properties and Fracture Characteristics of Nanostructured Copper and Cu-SiC Nanocomposite Produced by Mechanical Milling and Spark Plasma Sintering Process

NASA Astrophysics Data System (ADS)

Akbarpour, M. R.

2018-03-01

The presence of large grains within nanometric and ultrafine grain matrix is an effective method in order to enhance strength while keeping the high ductility of metals. For this purpose, in this research, spark plasma sintering (SPS) was used to consolidate milled Cu and Cu-SiC powders. In SPS process, local sparks with high temperature between particles take place and locally lead to intense grain growth, and therefore, this method has the ability to produce bimodal grain structures in copper and copper-based composites. Microstructural and mechanical studies showed ≈ 185 and ≈ 437 nm matrix grain sizes, high tensile yield strength values of ≈ 188.4 and ≈ 296.9 MPa, and fracture strain values of 15.1 and 6.7% for sintered Cu and Cu-4 vol.% SiC nanocomposite materials, respectively. The presence of nanoparticles promoted the occurrence of static recrystallization and decreased the fraction of coarse grains in microstructure. The high tensile properties of the produced materials are attributed to fine grain size, homogenous dispersion of nanoparticles and retarded grain boundary migration during sintering.

Habitat or matrix: which is more relevant to predict road-kill of vertebrates?

PubMed

Bueno, C; Sousa, C O M; Freitas, S R

2015-11-01

We believe that in tropics we need a community approach to evaluate road impacts on wildlife, and thus, suggest mitigation measures for groups of species instead a focal-species approach. Understanding which landscape characteristics indicate road-kill events may also provide models that can be applied in other regions. We intend to evaluate if habitat or matrix is more relevant to predict road-kill events for a group of species. Our hypothesis is: more permeable matrix is the most relevant factor to explain road-kill events. To test this hypothesis, we chose vertebrates as the studied assemblage and a highway crossing in an Atlantic Forest region in southeastern Brazil as the study site. Logistic regression models were designed using presence/absence of road-kill events as dependent variables and landscape characteristics as independent variables, which were selected by Akaike's Information Criterion. We considered a set of candidate models containing four types of simple regression models: Habitat effect model; Matrix types effect models; Highway effect model; and, Reference models (intercept and buffer distance). Almost three hundred road-kills and 70 species were recorded. River proximity and herbaceous vegetation cover, both matrix effect models, were associated to most road-killed vertebrate groups. Matrix was more relevant than habitat to predict road-kill of vertebrates. The association between river proximity and road-kill indicates that rivers may be a preferential route for most species. We discuss multi-species mitigation measures and implications to movement ecology and conservation strategies.

Structured Matrix Completion with Applications to Genomic Data Integration.

PubMed

Cai, Tianxi; Cai, T Tony; Zhang, Anru

2016-01-01

Matrix completion has attracted significant recent attention in many fields including statistics, applied mathematics and electrical engineering. Current literature on matrix completion focuses primarily on independent sampling models under which the individual observed entries are sampled independently. Motivated by applications in genomic data integration, we propose a new framework of structured matrix completion (SMC) to treat structured missingness by design. Specifically, our proposed method aims at efficient matrix recovery when a subset of the rows and columns of an approximately low-rank matrix are observed. We provide theoretical justification for the proposed SMC method and derive lower bound for the estimation errors, which together establish the optimal rate of recovery over certain classes of approximately low-rank matrices. Simulation studies show that the method performs well in finite sample under a variety of configurations. The method is applied to integrate several ovarian cancer genomic studies with different extent of genomic measurements, which enables us to construct more accurate prediction rules for ovarian cancer survival.

METCAN-PC - METAL MATRIX COMPOSITE ANALYZER

NASA Technical Reports Server (NTRS)

Murthy, P. L.

1994-01-01

High temperature metal matrix composites offer great potential for use in advanced aerospace structural applications. The realization of this potential however, requires concurrent developments in (1) a technology base for fabricating high temperature metal matrix composite structural components, (2) experimental techniques for measuring their thermal and mechanical characteristics, and (3) computational methods to predict their behavior. METCAN (METal matrix Composite ANalyzer) is a computer program developed to predict this behavior. METCAN can be used to computationally simulate the non-linear behavior of high temperature metal matrix composites (HT-MMC), thus allowing the potential payoff for the specific application to be assessed. It provides a comprehensive analysis of composite thermal and mechanical performance. METCAN treats material nonlinearity at the constituent (fiber, matrix, and interphase) level, where the behavior of each constituent is modeled accounting for time-temperature-stress dependence. The composite properties are synthesized from the constituent instantaneous properties by making use of composite micromechanics and macromechanics. Factors which affect the behavior of the composite properties include the fabrication process variables, the fiber and matrix properties, the bonding between the fiber and matrix and/or the properties of the interphase between the fiber and matrix. The METCAN simulation is performed as point-wise analysis and produces composite properties which are readily incorporated into a finite element code to perform a global structural analysis. After the global structural analysis is performed, METCAN decomposes the composite properties back into the localized response at the various levels of the simulation. At this point the constituent properties are updated and the next iteration in the analysis is initiated. This cyclic procedure is referred to as the integrated approach to metal matrix composite analysis. METCAN-PC is written in FORTRAN 77 for IBM PC series and compatible computers running MS-DOS. An 80286 machine with an 80287 math co-processor is required for execution. The executable requires at least 640K of RAM and DOS 3.1 or higher. The package includes sample executables which were compiled under Microsoft FORTRAN v. 5.1. The standard distribution medium for this program is one 5.25 inch 360K MS-DOS format diskette. The contents of the diskette are compressed using the PKWARE archiving tools. The utility to unarchive the files, PKUNZIP.EXE, is included. METCAN-PC was developed in 1992.

MRL and SuperFine+MRL: new supertree methods

PubMed Central

2012-01-01

Background Supertree methods combine trees on subsets of the full taxon set together to produce a tree on the entire set of taxa. Of the many supertree methods, the most popular is MRP (Matrix Representation with Parsimony), a method that operates by first encoding the input set of source trees by a large matrix (the "MRP matrix") over {0,1, ?}, and then running maximum parsimony heuristics on the MRP matrix. Experimental studies evaluating MRP in comparison to other supertree methods have established that for large datasets, MRP generally produces trees of equal or greater accuracy than other methods, and can run on larger datasets. A recent development in supertree methods is SuperFine+MRP, a method that combines MRP with a divide-and-conquer approach, and produces more accurate trees in less time than MRP. In this paper we consider a new approach for supertree estimation, called MRL (Matrix Representation with Likelihood). MRL begins with the same MRP matrix, but then analyzes the MRP matrix using heuristics (such as RAxML) for 2-state Maximum Likelihood. Results We compared MRP and SuperFine+MRP with MRL and SuperFine+MRL on simulated and biological datasets. We examined the MRP and MRL scores of each method on a wide range of datasets, as well as the resulting topological accuracy of the trees. Our experimental results show that MRL, coupled with a very good ML heuristic such as RAxML, produced more accurate trees than MRP, and MRL scores were more strongly correlated with topological accuracy than MRP scores. Conclusions SuperFine+MRP, when based upon a good MP heuristic, such as TNT, produces among the best scores for both MRP and MRL, and is generally faster and more topologically accurate than other supertree methods we tested. PMID:22280525

[Identification of green tea brand based on hyperspectra imaging technology].

PubMed

Zhang, Hai-Liang; Liu, Xiao-Li; Zhu, Feng-Le; He, Yong

2014-05-01

Hyperspectral imaging technology was developed to identify different brand famous green tea based on PCA information and image information fusion. First 512 spectral images of six brands of famous green tea in the 380 approximately 1 023 nm wavelength range were collected and principal component analysis (PCA) was performed with the goal of selecting two characteristic bands (545 and 611 nm) that could potentially be used for classification system. Then, 12 gray level co-occurrence matrix (GLCM) features (i. e., mean, covariance, homogeneity, energy, contrast, correlation, entropy, inverse gap, contrast, difference from the second-order and autocorrelation) based on the statistical moment were extracted from each characteristic band image. Finally, integration of the 12 texture features and three PCA spectral characteristics for each green tea sample were extracted as the input of LS-SVM. Experimental results showed that discriminating rate was 100% in the prediction set. The receiver operating characteristic curve (ROC) assessment methods were used to evaluate the LS-SVM classification algorithm. Overall results sufficiently demonstrate that hyperspectral imaging technology can be used to perform classification of green tea.

Application of the R-matrix method to photoionization of molecules.

PubMed

Tashiro, Motomichi

2010-04-07

The R-matrix method has been used for theoretical calculation of electron collision with atoms and molecules for long years. The method was also formulated to treat photoionization process, however, its application has been mostly limited to photoionization of atoms. In this work, we implement the R-matrix method to treat molecular photoionization problem based on the UK R-matrix codes. This method can be used for diatomic as well as polyatomic molecules, with multiconfigurational description for electronic states of both target neutral molecule and product molecular ion. Test calculations were performed for valence electron photoionization of nitrogen (N(2)) as well as nitric oxide (NO) molecules. Calculated photoionization cross sections and asymmetry parameters agree reasonably well with the available experimental results, suggesting usefulness of the method for molecular photoionization.

Method of multivariate spectral analysis

DOEpatents

Keenan, Michael R.; Kotula, Paul G.

2004-01-06

A method of determining the properties of a sample from measured spectral data collected from the sample by performing a multivariate spectral analysis. The method can include: generating a two-dimensional matrix A containing measured spectral data; providing a weighted spectral data matrix D by performing a weighting operation on matrix A; factoring D into the product of two matrices, C and S.sup.T, by performing a constrained alternating least-squares analysis of D=CS.sup.T, where C is a concentration intensity matrix and S is a spectral shapes matrix; unweighting C and S by applying the inverse of the weighting used previously; and determining the properties of the sample by inspecting C and S. This method can be used to analyze X-ray spectral data generated by operating a Scanning Electron Microscope (SEM) with an attached Energy Dispersive Spectrometer (EDS).

Method of waste stabilization with dewatered chemically bonded phosphate ceramics

DOEpatents

Wagh, Arun; Maloney, Martin D.

2010-06-29

A method of stabilizing a waste in a chemically bonded phosphate ceramic (CBPC). The method consists of preparing a slurry including the waste, water, an oxide binder, and a phosphate binder. The slurry is then allowed to cure to a solid, hydrated CBPC matrix. Next, bound water within the solid, hydrated CBPC matrix is removed. Typically, the bound water is removed by applying heat to the cured CBPC matrix. Preferably, the quantity of heat applied to the cured CBPC matrix is sufficient to drive off water bound within the hydrated CBPC matrix, but not to volatalize other non-water components of the matrix, such as metals and radioactive components. Typically, a temperature range of between 100.degree. C.-200.degree. C. will be sufficient. In another embodiment of the invention wherein the waste and water have been mixed prior to the preparation of the slurry, a select amount of water may be evaporated from the waste and water mixture prior to preparation of the slurry. Another aspect of the invention is a direct anyhydrous CBPC fabrication method wherein water is removed from the slurry by heating and mixing the slurry while allowing the slurry to cure. Additional aspects of the invention are ceramic matrix waste forms prepared by the methods disclosed above.

Linking Student Retention Model with Institutional Planning: The Benefits and Limitations of a Student Matrix Model.

ERIC Educational Resources Information Center

Schartman, Laura; Rhee, Byung-Shik

This study explored the possibility of linking the Luna (1999) student flow matrix model with institutional planning at a comprehensive state institution, investigating how student flow environments were associated with student characteristics such as race, gender, citizenship, class level, entry type, and cumulative grade point average. The study…

Damping Characteristics of Metal Matrix Composites

DTIC Science & Technology

1989-05-25

DAMPING OF METAL MATRIX COMPOSITES - -.......... 7-1 7.1 EPERIMENTAL PROCEDURE .............................................................. 7-1 7.2 M...space structures (LSS). A critical design concern for LSS is suppression of vibrations, caused by onboard and hostile threat-related disturbances during...acquisi- tion pointing and tracing (APT) phases of maneuvering. Various active and passive control mea- sures can be incorporated in the designs of

Structuring Word Problems for Diagnostic Teaching: Helping Teachers Meet the Needs of Children with Mild Disabilities.

ERIC Educational Resources Information Center

Parmar, Rene S.; Cawley, John F.

1994-01-01

Matrix organization can be used to construct math word problems for children with mild disabilities. Matrix organization specifies the characteristics of problems, such as problem theme or setting, operations, level of computation complexity, reading vocabulary level, and need for classification. A sample scope and sequence and 16 sample word…

Drawing a different picture with pencil lead as matrix-assisted laser desorption/ionization matrix for fullerene derivatives.

PubMed

Nye, Leanne C; Hungerbühler, Hartmut; Drewello, Thomas

2018-02-01

Inspired by reports on the use of pencil lead as a matrix-assisted laser desorption/ionization matrix, paving the way towards matrix-free matrix-assisted laser desorption/ionization, the present investigation evaluates its usage with organic fullerene derivatives. Currently, this class of compounds is best analysed using the electron transfer matrix trans-2-[3-(4-tert-butylphenyl)-2-methyl-2-propenylidene] malononitrile (DCTB), which was employed as the standard here. The suitability of pencil lead was additionally compared to direct (i.e. no matrix) laser desorption/ionization-mass spectrometry. The use of (DCTB) was identified as the by far gentler method, producing spectra with abundant molecular ion signals and much reduced fragmentation. Analytically, pencil lead was found to be ineffective as a matrix, however, appears to be an extremely easy and inexpensive method for producing sodium and potassium adducts.

Solution of matrix equations using sparse techniques

NASA Technical Reports Server (NTRS)

Baddourah, Majdi

1994-01-01

The solution of large systems of matrix equations is key to the solution of a large number of scientific and engineering problems. This talk describes the sparse matrix solver developed at Langley which can routinely solve in excess of 263,000 equations in 40 seconds on one Cray C-90 processor. It appears that for large scale structural analysis applications, sparse matrix methods have a significant performance advantage over other methods.

Background recovery via motion-based robust principal component analysis with matrix factorization

NASA Astrophysics Data System (ADS)

Pan, Peng; Wang, Yongli; Zhou, Mingyuan; Sun, Zhipeng; He, Guoping

2018-03-01

Background recovery is a key technique in video analysis, but it still suffers from many challenges, such as camouflage, lighting changes, and diverse types of image noise. Robust principal component analysis (RPCA), which aims to recover a low-rank matrix and a sparse matrix, is a general framework for background recovery. The nuclear norm is widely used as a convex surrogate for the rank function in RPCA, which requires computing the singular value decomposition (SVD), a task that is increasingly costly as matrix sizes and ranks increase. However, matrix factorization greatly reduces the dimension of the matrix for which the SVD must be computed. Motion information has been shown to improve low-rank matrix recovery in RPCA, but this method still finds it difficult to handle original video data sets because of its batch-mode formulation and implementation. Hence, in this paper, we propose a motion-assisted RPCA model with matrix factorization (FM-RPCA) for background recovery. Moreover, an efficient linear alternating direction method of multipliers with a matrix factorization (FL-ADM) algorithm is designed for solving the proposed FM-RPCA model. Experimental results illustrate that the method provides stable results and is more efficient than the current state-of-the-art algorithms.

Multi-residue analysis of pharmaceuticals in aqueous environmental samples by online solid-phase extraction-ultra-high-performance liquid chromatography-tandem mass spectrometry: optimisation and matrix effects reduction by quick, easy, cheap, effective, rugged and safe extraction.

PubMed

Bourdat-Deschamps, Marjolaine; Leang, Sokha; Bernet, Nathalie; Daudin, Jean-Jacques; Nélieu, Sylvie

2014-07-04

The aim of this study was to develop and optimise an analytical method for the quantification of a bactericide and 13 pharmaceutical products, including 8 antibiotics (fluoroquinolones, tetracyclines, sulfonamides, macrolide), in various aqueous environmental samples: soil water and aqueous fractions of pig slurry, digested pig slurry and sewage sludge. The analysis was performed by online solid-phase extraction coupled to ultra-high performance liquid chromatography with tandem mass spectrometry (online SPE-UHPLC-MS-MS). The main challenge was to minimize the matrix effects observed in mass spectrometry, mostly due to ion suppression. They depended on the dissolved organic carbon (DOC) content and its origin, and ranged between -22% and +20% and between -38% and -93% of the signal obtained without matrix, in soil water and slurry supernatant, respectively. The very variable levels of these matrix effects suggested DOC content cut-offs above which sample purification was required. These cut-offs depended on compounds, with concentrations ranging from 30 to 290mgC/L for antibiotics (except tylosine) up to 600-6400mgC/L for the most apolar compounds. A modified Quick, Easy, Cheap, Effective, Rugged and Safe (QuEChERS) extraction procedure was therefore optimised using an experimental design methodology, in order to purify samples with high DOC contents. Its performance led to a compromise, allowing fluoroquinolone and tetracycline analysis. The QuEChERS extraction salts consisted therefore of sodium acetate, sodium sulfate instead of magnesium sulfate, and sodium ethylenediaminetetraacetate (EDTA) as a ligand of divalent cations. The modified QuEChERS procedure employed for the extraction of pharmaceuticals in slurry and digested slurry liquid phases reduced the matrix effects for almost all the compounds, with extraction recoveries generally above 75%. The performance characteristics of the method were evaluated in terms of linearity, intra-day and inter-day precision, accuracy and limits of quantification, which reached concentration ranges of 5-270ng/L in soil water and sludge supernatant, and 31-2400ng/L in slurry and digested slurry supernatants, depending on the compounds. The new method was then successfully applied for the determination of the target compounds in environmental samples. Copyright © 2014 Elsevier B.V. All rights reserved.

The performance evaluation model of mining project founded on the weight optimization entropy value method

NASA Astrophysics Data System (ADS)

Mao, Chao; Chen, Shou

2017-01-01

According to the traditional entropy value method still have low evaluation accuracy when evaluating the performance of mining projects, a performance evaluation model of mineral project founded on improved entropy is proposed. First establish a new weight assignment model founded on compatible matrix analysis of analytic hierarchy process (AHP) and entropy value method, when the compatibility matrix analysis to achieve consistency requirements, if it has differences between subjective weights and objective weights, moderately adjust both proportions, then on this basis, the fuzzy evaluation matrix for performance evaluation. The simulation experiments show that, compared with traditional entropy and compatible matrix analysis method, the proposed performance evaluation model of mining project based on improved entropy value method has higher accuracy assessment.

M-matrices with prescribed elementary divisors

NASA Astrophysics Data System (ADS)

Soto, Ricardo L.; Díaz, Roberto C.; Salas, Mario; Rojo, Oscar

2017-09-01

A real matrix A is said to be an M-matrix if it is of the form A=α I-B, where B is a nonnegative matrix with Perron eigenvalue ρ (B), and α ≥slant ρ (B) . This paper provides sufficient conditions for the existence and construction of an M-matrix A with prescribed elementary divisors, which are the characteristic polynomials of the Jordan blocks of the Jordan canonical form of A. This inverse problem on M-matrices has not been treated until now. We solve the inverse elementary divisors problem for diagonalizable M-matrices and the symmetric generalized doubly stochastic inverse M-matrix problem for lists of real numbers and for lists of complex numbers of the form Λ =\\{λ 1, a+/- bi, \\ldots, a+/- bi\\} . The constructive nature of our results allows for the computation of a solution matrix. The paper also discusses an application of M-matrices to a capacity problem in wireless communications.

Stereological analysis of the epiphyseal growth cartilage in the brachymorphic (bm/bm) mouse, with special reference to the distribution of matrix vesicles.

PubMed

Wikström, B; Hjerpe, A; Hultenby, K; Reinholt, F P; Engfeldt, B

1984-01-01

The brachymorphic (bm/bm) mutation in the mouse leads to disproportional dwarfism due to a disturbance of endochondral bone formation. The morphological characteristics of bm/bm epiphyseal growth cartilage are signs of cellular degeneration and disintegration and alteration of the composition of the extracellular matrix, with an abnormal mineralization pattern. The present stereological study of the bm/bm growth plate revealed a clearly altered distribution of matrix vesicles as compared with the controls. It was also demonstrated that the bm/bm matrix vesicles have an abnormal size distribution, with an increased mean caliper diameter. The biological significance of these findings is discussed in relation to the different hypotheses on the origin of matrix vesicles and their possible role in the mineralization process. The results support the opinion that extracellular matrix vesicles, at least partly, constitute cellular debris.

Tensor-GMRES method for large sparse systems of nonlinear equations

NASA Technical Reports Server (NTRS)

Feng, Dan; Pulliam, Thomas H.

1994-01-01

This paper introduces a tensor-Krylov method, the tensor-GMRES method, for large sparse systems of nonlinear equations. This method is a coupling of tensor model formation and solution techniques for nonlinear equations with Krylov subspace projection techniques for unsymmetric systems of linear equations. Traditional tensor methods for nonlinear equations are based on a quadratic model of the nonlinear function, a standard linear model augmented by a simple second order term. These methods are shown to be significantly more efficient than standard methods both on nonsingular problems and on problems where the Jacobian matrix at the solution is singular. A major disadvantage of the traditional tensor methods is that the solution of the tensor model requires the factorization of the Jacobian matrix, which may not be suitable for problems where the Jacobian matrix is large and has a 'bad' sparsity structure for an efficient factorization. We overcome this difficulty by forming and solving the tensor model using an extension of a Newton-GMRES scheme. Like traditional tensor methods, we show that the new tensor method has significant computational advantages over the analogous Newton counterpart. Consistent with Krylov subspace based methods, the new tensor method does not depend on the factorization of the Jacobian matrix. As a matter of fact, the Jacobian matrix is never needed explicitly.

A three dimensional point cloud registration method based on rotation matrix eigenvalue

NASA Astrophysics Data System (ADS)

Wang, Chao; Zhou, Xiang; Fei, Zixuan; Gao, Xiaofei; Jin, Rui

2017-09-01

We usually need to measure an object at multiple angles in the traditional optical three-dimensional measurement method, due to the reasons for the block, and then use point cloud registration methods to obtain a complete threedimensional shape of the object. The point cloud registration based on a turntable is essential to calculate the coordinate transformation matrix between the camera coordinate system and the turntable coordinate system. We usually calculate the transformation matrix by fitting the rotation center and the rotation axis normal of the turntable in the traditional method, which is limited by measuring the field of view. The range of exact feature points used for fitting the rotation center and the rotation axis normal is approximately distributed within an arc less than 120 degrees, resulting in a low fit accuracy. In this paper, we proposes a better method, based on the invariant eigenvalue principle of rotation matrix in the turntable coordinate system and the coordinate transformation matrix of the corresponding coordinate points. First of all, we control the rotation angle of the calibration plate with the turntable to calibrate the coordinate transformation matrix of the corresponding coordinate points by using the least squares method. And then we use the feature decomposition to calculate the coordinate transformation matrix of the camera coordinate system and the turntable coordinate system. Compared with the traditional previous method, it has a higher accuracy, better robustness and it is not affected by the camera field of view. In this method, the coincidence error of the corresponding points on the calibration plate after registration is less than 0.1mm.

Sparse Matrix for ECG Identification with Two-Lead Features.

PubMed

Tseng, Kuo-Kun; Luo, Jiao; Hegarty, Robert; Wang, Wenmin; Haiting, Dong

2015-01-01

Electrocardiograph (ECG) human identification has the potential to improve biometric security. However, improvements in ECG identification and feature extraction are required. Previous work has focused on single lead ECG signals. Our work proposes a new algorithm for human identification by mapping two-lead ECG signals onto a two-dimensional matrix then employing a sparse matrix method to process the matrix. And that is the first application of sparse matrix techniques for ECG identification. Moreover, the results of our experiments demonstrate the benefits of our approach over existing methods.

Efficient l1 -norm-based low-rank matrix approximations for large-scale problems using alternating rectified gradient method.

PubMed

Kim, Eunwoo; Lee, Minsik; Choi, Chong-Ho; Kwak, Nojun; Oh, Songhwai

2015-02-01

Low-rank matrix approximation plays an important role in the area of computer vision and image processing. Most of the conventional low-rank matrix approximation methods are based on the l2 -norm (Frobenius norm) with principal component analysis (PCA) being the most popular among them. However, this can give a poor approximation for data contaminated by outliers (including missing data), because the l2 -norm exaggerates the negative effect of outliers. Recently, to overcome this problem, various methods based on the l1 -norm, such as robust PCA methods, have been proposed for low-rank matrix approximation. Despite the robustness of the methods, they require heavy computational effort and substantial memory for high-dimensional data, which is impractical for real-world problems. In this paper, we propose two efficient low-rank factorization methods based on the l1 -norm that find proper projection and coefficient matrices using the alternating rectified gradient method. The proposed methods are applied to a number of low-rank matrix approximation problems to demonstrate their efficiency and robustness. The experimental results show that our proposals are efficient in both execution time and reconstruction performance unlike other state-of-the-art methods.

[Correlation of substrate structure and hydraulic characteristics in subsurface flow constructed wetlands].

PubMed

Bai, Shao-Yuan; Song, Zhi-Xin; Ding, Yan-Li; You, Shao-Hong; He, Shan

2014-02-01

The correlation of substrate structure and hydraulic characteristics was studied by numerical simulation combined with experimental method. The numerical simulation results showed that the permeability coefficient of matrix had a great influence on hydraulic efficiency in subsurface flow constructed wetlands. The filler with a high permeability coefficient had a worse flow field distribution in the constructed wetland with single layer structure. The layered substrate structure with the filler permeability coefficient increased from surface to bottom could avoid the short-circuited flow and dead-zones, and thus, increased the hydraulic efficiency. Two parallel pilot-scale constructed wetlands were built according to the numerical simulation results, and tracer experiments were conducted to validate the simulation results. The tracer experiment result showed that hydraulic characteristics in the layered constructed wetland were obviously better than that in the single layer system, and the substrate effective utilization rates were 0.87 and 0.49, respectively. It was appeared that numerical simulation would be favorable for substrate structure optimization in subsurface flow constructed wetlands.

DOE Waste Treatability Group Guidance

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kirkpatrick, T.D.

1995-01-01

This guidance presents a method and definitions for aggregating U.S. Department of Energy (DOE) waste into streams and treatability groups based on characteristic parameters that influence waste management technology needs. Adaptable to all DOE waste types (i.e., radioactive waste, hazardous waste, mixed waste, sanitary waste), the guidance establishes categories and definitions that reflect variations within the radiological, matrix (e.g., bulk physical/chemical form), and regulated contaminant characteristics of DOE waste. Beginning at the waste container level, the guidance presents a logical approach to implementing the characteristic parameter categories as part of the basis for defining waste streams and as the solemore » basis for assigning streams to treatability groups. Implementation of this guidance at each DOE site will facilitate the development of technically defined, site-specific waste stream data sets to support waste management planning and reporting activities. Consistent implementation at all of the sites will enable aggregation of the site-specific waste stream data sets into comparable national data sets to support these activities at a DOE complex-wide level.« less

Finding a Hadamard matrix by simulated annealing of spin vectors

NASA Astrophysics Data System (ADS)

Bayu Suksmono, Andriyan

2017-05-01

Reformulation of a combinatorial problem into optimization of a statistical-mechanics system enables finding a better solution using heuristics derived from a physical process, such as by the simulated annealing (SA). In this paper, we present a Hadamard matrix (H-matrix) searching method based on the SA on an Ising model. By equivalence, an H-matrix can be converted into a seminormalized Hadamard (SH) matrix, whose first column is unit vector and the rest ones are vectors with equal number of -1 and +1 called SH-vectors. We define SH spin vectors as representation of the SH vectors, which play a similar role as the spins on Ising model. The topology of the lattice is generalized into a graph, whose edges represent orthogonality relationship among the SH spin vectors. Starting from a randomly generated quasi H-matrix Q, which is a matrix similar to the SH-matrix without imposing orthogonality, we perform the SA. The transitions of Q are conducted by random exchange of {+, -} spin-pair within the SH-spin vectors that follow the Metropolis update rule. Upon transition toward zeroth energy, the Q-matrix is evolved following a Markov chain toward an orthogonal matrix, at which the H-matrix is said to be found. We demonstrate the capability of the proposed method to find some low-order H-matrices, including the ones that cannot trivially be constructed by the Sylvester method.

Mueller matrix imaging study to detect the dental demineralization

NASA Astrophysics Data System (ADS)

Chen, Qingguang; Shen, Huanbo; Wang, Binqiang

2018-01-01

Mueller matrix is an optical parameter invasively to reveal the structure information of anisotropic material. Dental tissue has the ordered structure including dental enamel prism and dentinal tubule. The ordered structure of teeth surface will be destroyed by demineralization. The structure information has the possibility to reflect the dental demineralization. In the paper, the experiment setup was built to obtain the Mueller matrix images based on the dual- wave plate rotation method. Two linear polarizer and two quarter-wave plate were rotated by electric control revolving stage respectively to capture 16 images at different group of polarization states. Therefore, Mueller matrix image can be calculated from the 16 images. On this basis, depolarization index, the diattenuation index and retardance index of the Mueller matrix were analyzed by Lu-Chipman polarization decomposition method. Mueller matrix images of artificial demineralized enamels at different stages were analyzed and the results show the possibility to detect the dental demineralization using Mueller matrix imaging method.

Flexible multiply towpreg and method of production therefor

NASA Technical Reports Server (NTRS)

Muzzy, John D. (Inventor); Varughese, Babu (Inventor)

1992-01-01

This invention relates to an improved flexible towpreg and a method of production therefor. The improved flexible towpreg comprises a plurality of towpreg plies which comprise reinforcing filaments and matrix forming material; the reinforcing filaments being substantially wetout by the matrix forming material such that the towpreg plies are substantially void-free composite articles, and the towpreg plies having an average thickness less than about 100 microns. The method of production for the improved flexible towpreg comprises the steps of spreading the reinforcing filaments to expose individually substantially all of the reinforcing filaments; coating the reinforcing filaments with the matrix forming material in a manner causing interfacial adhesion of the matrix forming material to the reinforcing filaments; forming the towpreg plies by heating the matrix forming material contacting the reinforcing filaments until the matrix forming material liquefies and coats the reinforcing filaments; and cooling the towpreg plies in a manner such that substantial cohesion between neighboring towpreg plies is prevented until the matrix forming material solidifies.

A two-dimensional matrix image based feature extraction method for classification of sEMG: A comparative analysis based on SVM, KNN and RBF-NN.

PubMed

Wen, Tingxi; Zhang, Zhongnan; Qiu, Ming; Zeng, Ming; Luo, Weizhen

2017-01-01

The computer mouse is an important human-computer interaction device. But patients with physical finger disability are unable to operate this device. Surface EMG (sEMG) can be monitored by electrodes on the skin surface and is a reflection of the neuromuscular activities. Therefore, we can control limbs auxiliary equipment by utilizing sEMG classification in order to help the physically disabled patients to operate the mouse. To develop a new a method to extract sEMG generated by finger motion and apply novel features to classify sEMG. A window-based data acquisition method was presented to extract signal samples from sEMG electordes. Afterwards, a two-dimensional matrix image based feature extraction method, which differs from the classical methods based on time domain or frequency domain, was employed to transform signal samples to feature maps used for classification. In the experiments, sEMG data samples produced by the index and middle fingers at the click of a mouse button were separately acquired. Then, characteristics of the samples were analyzed to generate a feature map for each sample. Finally, the machine learning classification algorithms (SVM, KNN, RBF-NN) were employed to classify these feature maps on a GPU. The study demonstrated that all classifiers can identify and classify sEMG samples effectively. In particular, the accuracy of the SVM classifier reached up to 100%. The signal separation method is a convenient, efficient and quick method, which can effectively extract the sEMG samples produced by fingers. In addition, unlike the classical methods, the new method enables to extract features by enlarging sample signals' energy appropriately. The classical machine learning classifiers all performed well by using these features.

Experiences on p-Version Time-Discontinuous Galerkin's Method for Nonlinear Heat Transfer Analysis and Sensitivity Analysis

NASA Technical Reports Server (NTRS)

Hou, Gene

2004-01-01

The focus of this research is on the development of analysis and sensitivity analysis equations for nonlinear, transient heat transfer problems modeled by p-version, time discontinuous finite element approximation. The resulting matrix equation of the state equation is simply in the form ofA(x)x = c, representing a single step, time marching scheme. The Newton-Raphson's method is used to solve the nonlinear equation. Examples are first provided to demonstrate the accuracy characteristics of the resultant finite element approximation. A direct differentiation approach is then used to compute the thermal sensitivities of a nonlinear heat transfer problem. The report shows that only minimal coding effort is required to enhance the analysis code with the sensitivity analysis capability.

A finite element-boundary integral method for scattering and radiation by two- and three-dimensional structures

NASA Technical Reports Server (NTRS)

Jin, Jian-Ming; Volakis, John L.; Collins, Jeffery D.

1991-01-01

A review of a hybrid finite element-boundary integral formulation for scattering and radiation by two- and three-composite structures is presented. In contrast to other hybrid techniques involving the finite element method, the proposed one is in principle exac, and can be implemented using a low O(N) storage. This is of particular importance for large scale applications and is a characteristic of the boundary chosen to terminate the finite-element mesh, usually as close to the structure as possible. A certain class of these boundaries lead to convolutional boundary integrals which can be evaluated via the fast Fourier transform (FFT) without a need to generate a matrix; thus, retaining the O(N) storage requirement.

Dynamical mechanism in aero-engine gas path system using minimum spanning tree and detrended cross-correlation analysis

NASA Astrophysics Data System (ADS)

Dong, Keqiang; Zhang, Hong; Gao, You

2017-01-01

Identifying the mutual interaction in aero-engine gas path system is a crucial problem that facilitates the understanding of emerging structures in complex system. By employing the multiscale multifractal detrended cross-correlation analysis method to aero-engine gas path system, the cross-correlation characteristics between gas path system parameters are established. Further, we apply multiscale multifractal detrended cross-correlation distance matrix and minimum spanning tree to investigate the mutual interactions of gas path variables. The results can infer that the low-spool rotor speed (N1) and engine pressure ratio (EPR) are main gas path parameters. The application of proposed method contributes to promote our understanding of the internal mechanisms and structures of aero-engine dynamics.

Genetic Relationships Between Chondrules, Rims and Matrix

NASA Technical Reports Server (NTRS)

Huss, G. R.; Alexander, C. M. OD.; Palme, H.; Bland, P. A.; Wasson, J. T.

2004-01-01

The most primitive chondrites are composed of chondrules and chondrule fragments, various types of inclusions, discrete mineral grains, metal, sulfides, and fine-grained materials that occur as interchondrule matrix and as chondrule/inclusion rims. Understanding how these components are related is essential for understanding how chondrites and their constituents formed and were processed in the solar nebula. For example, were the first generations of chondrules formed by melting of matrix or matrix precursors? Did chondrule formation result in appreciable transfer of chondrule material into the matrix? Here, we consider three types of data: 1) compositional data for bulk chondrites and matrix, 2) mineralogical and textural information, and 3) the abundances and characteristics of presolar materials that reside in the matrix and rims. We use these data to evaluate the roles of evaporation and condensation, chondrule formation, mixing of different nebular components, and secondary processing both in the nebula and on the parent bodies. Our goal is to identify the things that are reasonably well established and to point out the areas that need additional work.

A finite element-boundary integral method for scattering and radiation by two- and three-dimensional structures

NASA Technical Reports Server (NTRS)

Jin, Jian-Ming; Volakis, John L.; Collins, Jeffery D.

1991-01-01

A review of a hybrid finite element-boundary integral formulation for scattering and radiation by two- and three-dimensional composite structures is presented. In contrast to other hybrid techniques involving the finite element method, the proposed one is in principle exact and can be implemented using a low O(N) storage. This is of particular importance for large scale applications and is a characteristic of the boundary chosen to terminate the finite element mesh, usually as close to the structure as possible. A certain class of these boundaries lead to convolutional boundary integrals which can be evaluated via the fast Fourier transform (FFT) without a need to generate a matrix; thus, retaining the O(N) storage requirement. The paper begins with a general description of the method. A number of two- and three-dimensional applications are then given, including numerical computations which demonstrate the method's accuracy, efficiency, and capability.

Three-Dimensional ISAR Imaging Method for High-Speed Targets in Short-Range Using Impulse Radar Based on SIMO Array

PubMed Central

Zhou, Xinpeng; Wei, Guohua; Wu, Siliang; Wang, Dawei

2016-01-01

This paper proposes a three-dimensional inverse synthetic aperture radar (ISAR) imaging method for high-speed targets in short-range using an impulse radar. According to the requirements for high-speed target measurement in short-range, this paper establishes the single-input multiple-output (SIMO) antenna array, and further proposes a missile motion parameter estimation method based on impulse radar. By analyzing the motion geometry relationship of the warhead scattering center after translational compensation, this paper derives the receiving antenna position and the time delay after translational compensation, and thus overcomes the shortcomings of conventional translational compensation methods. By analyzing the motion characteristics of the missile, this paper estimates the missile’s rotation angle and the rotation matrix by establishing a new coordinate system. Simulation results validate the performance of the proposed algorithm. PMID:26978372

Hydrodynamic Characteristics and Strength Analysis of a Novel Dot-matrix Oscillating Wave Energy Converter

NASA Astrophysics Data System (ADS)

Shao, Meng; Xiao, Chengsi; Sun, Jinwei; Shao, Zhuxiao; Zheng, Qiuhong

2017-12-01

The paper analyzes hydrodynamic characteristics and the strength of a novel dot-matrix oscillating wave energy converter, which is in accordance with nowadays’ research tendency: high power, high efficiency, high reliability and low cost. Based on three-dimensional potential flow theory, the paper establishes motion control equations of the wave energy converter unit and calculates wave loads and motions. On this basis, a three-dimensional finite element model of the device is built to check its strength. Through the analysis, it can be confirmed that the WEC is feasible and the research results could be a reference for wave energy’s exploration and utilization.

Regenerator matrix physical property data

NASA Technical Reports Server (NTRS)

Fucinari, C. A.

1980-01-01

Among several cellular ceramic structures manufactured by various suppliers for regenerator application in a gas turbine engine, three have the best potential for achieving durability and performance objectives for use in gas turbines, Stirling engines, and waste heat recovery systems: (1) an aluminum-silicate sinusoidal flow passage made from a corrugated wate paper process; (2) an extruded isosceles triangle flow passage; and (3) a second generation matrix incorporating a square flow passage formed by an embossing process. Key physical and thermal property data for these configurations presented include: heat transfer and pressure drop characteristics, compressive strength, tensile strength and elasticity, thermal expansion characteristics, chanical attack, and thermal stability.

Fibronectin alters the rate of formation and structure of the fibrin matrix.

PubMed

Ramanathan, Anand; Karuri, Nancy

2014-01-10

Plasma fibronectin is a vital component of the fibrin clot; however its role on clot structure is not clearly understood. The goal of this study was to examine the influence of fibronectin on the kinetics of formation, structural characteristics and composition of reconstituted fibrin clots or fibrin matrices. Fibrin matrices were formed by adding thrombin to 1, 2 or 4 mg/ml fibrinogen supplemented with 0-0.4 mg/ml fibronectin. The rate of fibrin matrix formation was then monitored by measuring light absorbance properties at different time points. Confocal microscopy of fluorescein conjugated fibrinogen was used to visualize the structural characteristics of fibrin matrices. The amount of fibronectin in fibrin matrices was determined through electrophoresis and immunoblotting of solubilized matrices. Fibronectin concentration positively correlated with the initial rate of fibrin matrix formation and with steady state light absorbance values of fibrin matrices. An increase in fibronectin concentration resulted in thinner and denser fibers in the fibrin matrices. Electrophoresis and immunoblotting showed that fibronectin was covalently and non-covalently bound to fibrin matrices and in the form of high molecular weight multimers. The formation of fibronectin multimers was attributed to cross-linking of fibronectin by trace amounts Factor XIIIa. These findings are novel because they link results from light absorbance studies to microcopy analyses and demonstrate an influence of fibronectin on fibrin matrix structural characteristics. This data is important in developing therapies that destabilize fibrin clots. Copyright © 2014. Published by Elsevier Inc.

Effect of the cellular structure on thermal conductivity of rigid closed-cell foam polymers during long-term aging

NASA Astrophysics Data System (ADS)

Dementyev, A. G.; Dementyev, M. A.; Zinger, P. A.; Metlyakova, I. R.

1999-03-01

The thermal conductivity of rigid closed-cell polyurethane foams during long-term aging has been studied. The similarity between the kinetics of changes in the physical and mechanical characteristics of PU foams on progressive aging is established, which is attributed to the effect of matrix destruction. It is found that rigid foams have cell walls of various strength, whose impact on the kinetics of changes in the physical characteristics of the foams during long-term aging is ascertained. The results of predicting the thermal conductivity of PU foams by the method of temperature-time analogy and establishing the limits of its application are discussed. The research presented is of interest both in determining the foam durability and in replacing freons by alternative, ecologically less harmful blowing agents.

Finite-difference time-domain analysis of photonic nanojets from liquid-crystal-containing microcylinder

NASA Astrophysics Data System (ADS)

Matsui, Tatsunosuke; Okajima, Akiko

2014-01-01

The photonic nanojet (PNJ) from a microcylinder with liquid crystals (LCs) showing tangential molecular alignment inside the microcylinder has been numerically analyzed on the basis of the finite-difference time-domain method. By introducing a small degree of birefringence, the characteristics of the PNJ, such as propagation length and polarization state, can be drastically changed. The azimuth angle and the ellipticity of the elliptically polarized PNJ obtained from the LC microcylinder changes within the propagation lengths in the micrometer range even in the isotropic matrix, which might be attributed to the jet like spatial profile of the PNJ. By using LC microcylinders or microspheres, we may obtain a rich variety of PNJs with unique polarization characteristics, which might open a new avenue for the development of novel optical devices with electrical tunability.

A finite element simulation of sound attenuation in a finite duct with a peripherally variable liner

NASA Technical Reports Server (NTRS)

Watson, W. R.

1977-01-01

Using multimodal analysis, a variational finite element method is presented for analyzing sound attenuation in a three-dimensional finite duct with a peripherally variable liner in the absence of flow. A rectangular element, with cubic shaped functions, is employed. Once a small portion of a peripheral liner is removed, the attenuation rate near the frequency where maximum attenuation occurs drops significantly. The positioning of the liner segments affects the attenuation characteristics of the liner. Effects of the duct termination are important in the low frequency ranges. The main effect of peripheral variation of the liner is a broadening of the attenuation characteristics in the midfrequency range. Because of matrix size limitations of the presently available computer program, the eigenvalue equations should be solved out of core in order to handle realistic sources.

Analysis of photonic band gap in novel piezoelectric photonic crystal

NASA Astrophysics Data System (ADS)

Malar Kodi, A.; Doni Pon, V.; Joseph Wilson, K. S.

2018-03-01

The transmission properties of one-dimensional novel photonic crystal having silver-doped novel piezoelectric superlattice and air as the two constituent layers have been investigated by means of transfer matrix method. By changing the appropriate thickness of the layers and filling factor of nanocomposite system, the variation in the photonic band gap can be studied. It is found that the photonic band gap increases with the filling factor of the metal nanocomposite and with the thickness of the layer. These structures possess unique characteristics enabling one to operate as optical waveguides, selective filters, optical switches, integrated piezoelectric microactuators, etc.

Atmospheric pressure laser desorption/ionization using a 6-7 µm-band mid-infrared tunable laser and liquid water matrix.

PubMed

Hiraguchi, Ryuji; Hazama, Hisanao; Masuda, Katsuyoshi; Awazu, Kunio

2015-01-01

Due to the characteristic absorption peaks in the IR region, various molecules can be used as a matrix for infrared matrix-assisted laser desorption/ionization (IR-MALDI). Especially in the 6-7 µm-band IR region, solvents used as the mobile phase for liquid chromatography have absorption peaks that correspond to their functional groups, such as O-H, C=O, and CH3. Additionally, atmospheric pressure (AP) IR-MALDI, which is applicable to liquid-state samples, is a promising technique to directly analyze untreated samples. Herein we perform AP-IR-MALDI mass spectrometry of a peptide, angiotensin II, using a mid-IR tunable laser with a tunable wavelength range of 5.50-10.00 µm and several different matrices. The wavelength dependences of the ion signal intensity of [M + H](+) of the peptide are measured using a conventional solid matrix, α-cyano-4-hydroxycinnamic acid (CHCA) and a liquid matrix composed of CHCA and 3-aminoquinoline. Other than the O-H stretching and bending vibration modes, the characteristic absorption peaks are useful for AP-IR-MALDI. Peptide ions are also observed from an aqueous solution of the peptide without an additional matrix, and the highest peak intensity of [M + H](+) is at 6.00 µm, which is somewhat shorter than the absorption peak wavelength of liquid water corresponding to the O-H bending vibration mode. Moreover, long-lasting and stable ion signals are obtained from the aqueous solution. AP-IR-MALDI using a 6-7 µm-band IR tunable laser and solvents as the matrix may provide a novel on-line interface between liquid chromatography and mass spectrometry. Copyright © 2015 John Wiley & Sons, Ltd.