Isoform-level gene expression patterns in single-cell RNA-sequencing data.
Vu, Trung Nghia; Wills, Quin F; Kalari, Krishna R; Niu, Nifang; Wang, Liewei; Pawitan, Yudi; Rantalainen, Mattias
2018-02-27
RNA sequencing of single cells enables characterization of transcriptional heterogeneity in seemingly homogeneous cell populations. Single-cell sequencing has been applied in a wide range of researches fields. However, few studies have focus on characterization of isoform-level expression patterns at the single-cell level. In this study we propose and apply a novel method, ISOform-Patterns (ISOP), based on mixture modeling, to characterize the expression patterns of isoform pairs from the same gene in single-cell isoform-level expression data. We define six principal patterns of isoform expression relationships and describe a method for differential-pattern analysis. We demonstrate ISOP through analysis of single-cell RNA-sequencing data from a breast cancer cell line, with replication in three independent datasets. We assigned the pattern types to each of 16,562 isoform-pairs from 4,929 genes. Among those, 26% of the discovered patterns were significant (p<0.05), while remaining patterns are possibly effects of transcriptional bursting, drop-out and stochastic biological heterogeneity. Furthermore, 32% of genes discovered through differential-pattern analysis were not detected by differential-expression analysis. The effect of drop-out events, mean expression level, and properties of the expression distribution on the performances of ISOP were also investigated through simulated datasets. To conclude, ISOP provides a novel approach for characterization of isoformlevel preference, commitment and heterogeneity in single-cell RNA-sequencing data. The ISOP method has been implemented as a R package and is available at https://github.com/nghiavtr/ISOP under a GPL-3 license. mattias.rantalainen@ki.se. Supplementary data are available at Bioinformatics online.
Cheaib, Miriam; Dehghani Amirabad, Azim; Nordström, Karl J. V.; Schulz, Marcel H.; Simon, Martin
2015-01-01
Phenotypic variation of a single genotype is achieved by alterations in gene expression patterns. Regulation of such alterations depends on their time scale, where short-time adaptations differ from permanently established gene expression patterns maintained by epigenetic mechanisms. In the ciliate Paramecium, serotypes were described for an epigenetically controlled gene expression pattern of an individual multigene family. Paradoxically, individual serotypes can be triggered in Paramecium by alternating environments but are then stabilized by epigenetic mechanisms, thus raising the question to which extend their expression follows environmental stimuli. To characterize environmental adaptation in the context of epigenetically controlled serotype expression, we used RNA-seq to characterize transcriptomes of serotype pure cultures. The resulting vegetative transcriptome resource is first analysed for genes involved in the adaptive response to the altered environment. Secondly, we identified groups of genes that do not follow the adaptive response but show co-regulation with the epigenetically controlled serotype system, suggesting that their gene expression pattern becomes manifested by similar mechanisms. In our experimental set-up, serotype expression and the entire group of co-regulated genes were stable among environmental changes and only heat-shock genes altered expression of these gene groups. The data suggest that the maintenance of these gene expression patterns in a lineage represents epigenetically controlled robustness counteracting short-time adaptation processes. PMID:26231545
Cheaib, Miriam; Dehghani Amirabad, Azim; Nordström, Karl J V; Schulz, Marcel H; Simon, Martin
2015-08-01
Phenotypic variation of a single genotype is achieved by alterations in gene expression patterns. Regulation of such alterations depends on their time scale, where short-time adaptations differ from permanently established gene expression patterns maintained by epigenetic mechanisms. In the ciliate Paramecium, serotypes were described for an epigenetically controlled gene expression pattern of an individual multigene family. Paradoxically, individual serotypes can be triggered in Paramecium by alternating environments but are then stabilized by epigenetic mechanisms, thus raising the question to which extend their expression follows environmental stimuli. To characterize environmental adaptation in the context of epigenetically controlled serotype expression, we used RNA-seq to characterize transcriptomes of serotype pure cultures. The resulting vegetative transcriptome resource is first analysed for genes involved in the adaptive response to the altered environment. Secondly, we identified groups of genes that do not follow the adaptive response but show co-regulation with the epigenetically controlled serotype system, suggesting that their gene expression pattern becomes manifested by similar mechanisms. In our experimental set-up, serotype expression and the entire group of co-regulated genes were stable among environmental changes and only heat-shock genes altered expression of these gene groups. The data suggest that the maintenance of these gene expression patterns in a lineage represents epigenetically controlled robustness counteracting short-time adaptation processes. © The Author 2015. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.
Xu, Yuantao; Wu, Guizhi; Hao, Baohai; Chen, Lingling; Deng, Xiuxin; Xu, Qiang
2015-11-23
With the availability of rapidly increasing number of genome and transcriptome sequences, lineage-specific genes (LSGs) can be identified and characterized. Like other conserved functional genes, LSGs play important roles in biological evolution and functions. Two set of citrus LSGs, 296 citrus-specific genes (CSGs) and 1039 orphan genes specific to sweet orange, were identified by comparative analysis between the sweet orange genome sequences and 41 genomes and 273 transcriptomes. With the two sets of genes, gene structure and gene expression pattern were investigated. On average, both the CSGs and orphan genes have fewer exons, shorter gene length and higher GC content when compared with those evolutionarily conserved genes (ECs). Expression profiling indicated that most of the LSGs expressed in various tissues of sweet orange and some of them exhibited distinct temporal and spatial expression patterns. Particularly, the orphan genes were preferentially expressed in callus, which is an important pluripotent tissue of citrus. Besides, part of the CSGs and orphan genes expressed responsive to abiotic stress, indicating their potential functions during interaction with environment. This study identified and characterized two sets of LSGs in citrus, dissected their sequence features and expression patterns, and provided valuable clues for future functional analysis of the LSGs in sweet orange.
USDA-ARS?s Scientific Manuscript database
Macrophages express various pathogen-recognition receptors (PRRs) which recognize pathogen-associated molecular patterns (PAMPs) and activate genes responsible for host defense. The aim of this study was to characterize two porcine macrophage cell lines (Cdelta+ and Cdelta–) for the expression of P...
Characterization of GPR101 transcript structure and expression patterns
Trivellin, Giampaolo; Bjelobaba, Ivana; Daly, Adrian F.; Larco, Darwin O.; Palmeira, Leonor; Faucz, Fabio R.; Thiry, Albert; Leal, Letícia F.; Rostomyan, Liliya; Quezado, Martha; Schernthaner-Reiter, Marie Helene; Janjic, Marija M.; Villa, Chiara; Wu, T. John; Stojilkovic, Stanko S.; Beckers, Albert; Feldman, Benjamin; Stratakis, Constantine A.
2016-01-01
We recently showed that Xq26.3 microduplications cause X-linked acrogigantism (X-LAG). X-LAG patients mainly present with growth hormone and prolactin-secreting adenomas and share a minimal duplicated region containing at least four genes. GPR101 was the only gene highly expressed in their pituitary lesions, but little is known about its expression patterns. GPR101 transcripts were characterized in human tissues by 5’-RACE and RNAseq, while the putative promoter was bioinformatically predicted. We investigated GPR101 mRNA and protein expression by RT-qPCR, whole-mount in situ hybridization, and immunostaining, in human, rhesus monkey, rat, and zebrafish. We identified four GPR101 isoforms characterized by different 5’ untranslated regions (UTRs) and a common 6.1 kb-long 3’UTR. GPR101 expression was very low or absent in almost all adult human tissues examined, except for specific brain regions. Strong GPR101 staining was observed in human fetal pituitary and during adolescence, whereas very weak/absent expression was detected during childhood and adult life. In contrast to humans, adult pituitaries of monkey and rat expressed GPR101, but in different cell types. Gpr101 is expressed in the brain and pituitary during rat and zebrafish development; in rat pituitary Gpr101 is expressed only after birth and showed sexual dimorphism. This study shows that different GPR101 transcripts exist and that the brain is the major site of GPR101 expression across different species, although divergent species- and temporal-specific expression patterns are evident. These findings suggest an important role for GPR101 in brain and pituitary development and likely reflect the very different growth, development and maturation patterns among species. PMID:27282544
Zhang, Zhang; Liu, Jingxing; Wu, Jiayan; Yu, Jun
2013-01-01
The regulation of gene expression is essential for eukaryotes, as it drives the processes of cellular differentiation and morphogenesis, leading to the creation of different cell types in multicellular organisms. RNA-Sequencing (RNA-Seq) provides researchers with a powerful toolbox for characterization and quantification of transcriptome. Many different human tissue/cell transcriptome datasets coming from RNA-Seq technology are available on public data resource. The fundamental issue here is how to develop an effective analysis method to estimate expression pattern similarities between different tumor tissues and their corresponding normal tissues. We define the gene expression pattern from three directions: 1) expression breadth, which reflects gene expression on/off status, and mainly concerns ubiquitously expressed genes; 2) low/high or constant/variable expression genes, based on gene expression level and variation; and 3) the regulation of gene expression at the gene structure level. The cluster analysis indicates that gene expression pattern is higher related to physiological condition rather than tissue spatial distance. Two sets of human housekeeping (HK) genes are defined according to cell/tissue types, respectively. To characterize the gene expression pattern in gene expression level and variation, we firstly apply improved K-means algorithm and a gene expression variance model. We find that cancer-associated HK genes (a HK gene is specific in cancer group, while not in normal group) are expressed higher and more variable in cancer condition than in normal condition. Cancer-associated HK genes prefer to AT-rich genes, and they are enriched in cell cycle regulation related functions and constitute some cancer signatures. The expression of large genes is also avoided in cancer group. These studies will help us understand which cell type-specific patterns of gene expression differ among different cell types, and particularly for cancer. PMID:23382867
KIT gene mutations and patterns of protein expression in mucosal and acral melanoma.
Abu-Abed, Suzan; Pennell, Nancy; Petrella, Teresa; Wright, Frances; Seth, Arun; Hanna, Wedad
2012-01-01
Recently characterized KIT (CD117) gene mutations have revealed new pathways involved in melanoma pathogenesis. In particular, certain subtypes harbor mutations similar to those observed in gastrointestinal stromal tumors, which are sensitive to treatment with tyrosine kinase inhibitors. The purpose of this study was to characterize KIT gene mutations and patterns of protein expression in mucosal and acral melanoma. Formalin-fixed, paraffin-embedded tissues were retrieved from our archives. Histologic assessment included routine hematoxylin-eosin stains and immunohistochemical staining for KIT. Genomic DNA was used for polymerase chain reaction-based amplification of exons 11 and 13. We identified 59 acral and mucosal melanoma cases, of which 78% showed variable levels of KIT expression. Sequencing of exons 11 and 13 was completed on all cases, and 4 (6.8%) mutant cases were isolated. We successfully optimized conditions for the detection of KIT mutations and showed that 8.6% of mucosal and 4.2% of acral melanoma cases at our institution harbor KIT mutations; all mutant cases showed strong, diffuse KIT protein expression. Our case series represents the first Canadian study to characterize KIT gene mutations and patterns of protein expression in acral and mucosal melanoma.
Maissen-Villiger, Carla A; Schweighauser, Ariane; van Dorland, H Anette; Morel, Claudine; Bruckmaier, Rupert M; Zurbriggen, Andreas; Francey, Thierry
2016-01-01
Dogs with leptospirosis show similar organ manifestations and disease course as human patients, including acute kidney injury and pulmonary hemorrhage, making this naturally-occurring infection a good animal model for human leptospirosis. Expression patterns of cytokines and enzymes have been correlated with disease manifestations and clinical outcome in humans and animals. The aim of this study was to describe mRNA expression of pro- and anti-inflammatory mediators in canine leptospirosis and to compare it with other renal diseases to identify patterns characterizing the disease and especially its pulmonary form. The mRNA abundance of cytokines (IL-1α, IL-1β, IL-8, IL-10, TNF-α, TGF-β) and enzymes (5-LO, iNOS) was measured prospectively in blood leukocytes from 34 dogs with severe leptospirosis and acute kidney injury, including 22 dogs with leptospirosis-associated pulmonary hemorrhages. Dogs with leptospirosis were compared to 14 dogs with acute kidney injury of other origin than leptospirosis, 8 dogs with chronic kidney disease, and 10 healthy control dogs. Canine leptospirosis was characterized by high 5-LO and low TNF-α expression compared to other causes of acute kidney injury, although the decreased TNF-α expression was also seen in chronic kidney disease. Leptospirosis-associated pulmonary hemorrhage was not characterized by a specific pattern, with only mild changes noted, including increased IL-10 and decreased 5-LO expression on some days in affected dogs. Fatal outcome from pulmonary hemorrhages was associated with low TNF-α, high IL-1β, and high iNOS expression, a pattern possibly expressed also in dogs with other forms of acute kidney injury. The patterns of cytokine and enzyme expression observed in the present study indicate a complex pro- and anti-inflammatory response to the infection with leptospires. The recognition of these signatures may be of diagnostic and prognostic relevance for affected individuals and they may indicate options for newer therapies targeting the identified pathways.
Zhang, Bo; Peng, Yu; Zheng, Jincheng; Liang, Lina; Hoffmann, Ary A; Ma, Chun-Sen
2016-07-01
Heat shock protein gene (Hsp) families are thought to be important in thermal adaptation, but their expression patterns under various thermal stresses have still been poorly characterized outside of model systems. We have therefore characterized Hsp genes and their stress responses in the oriental fruit moth (OFM), Grapholita molesta, a widespread global orchard pest, and compared patterns of expression in this species to that of other insects. Genes from four Hsp families showed variable expression levels among tissues and developmental stages. Members of the Hsp40, 70, and 90 families were highly expressed under short exposures to heat and cold. Expression of Hsp40, 70, and Hsc70 family members increased in OFM undergoing diapause, while Hsp90 was downregulated. We found that there was strong sequence conservation of members of large Hsp families (Hsp40, Hsp60, Hsp70, Hsc70) across taxa, but this was not always matched by conservation of expression patterns. When the large Hsps as well as small Hsps from OFM were compared under acute and ramping heat stress, two groups of sHsps expression patterns were apparent, depending on whether expression increased or decreased immediately after stress exposure. These results highlight potential differences in conservation of function as opposed to sequence in this gene family and also point to Hsp genes potentially useful as bioindicators of diapause and thermal stress in OFM.
E2F4 is required for early eye patterning.
Ruzhynsky, Vladimir A; Furimsky, Marosh; Park, David S; Wallace, Valerie A; Slack, Ruth S
2009-01-01
Increasingly, studies reveal novel functions for cell cycle proteins during development. Here, we investigated the role of E2F4 in eye development. E2F4-deficient mouse embryos exhibit severe early eye patterning defects, which are evident from embryonic day 11.5 and characterized by aberrant shape of the optic cup, coloboma as well as abnormal eye pigmentation. Loss of E2F4 is associated with proximal-distal patterning defects in the optic vesicle. These defects are characterized by the expansion of optic stalk marker gene expression to the optic cup and reduced expression of ventral optic cup markers. These defects are associated with a split of Shh expression domain at the ventral midline of the forebrain and expansion of the Shh activity into the ventral optic cup. Despite these patterning defects, early neuronal differentiation and Shh expression in the retina are not affected by E2F4 deletion. Overall, the results of our studies show a novel role of E2F4 in the early eye development. 2009 S. Karger AG, Basel.
Erasure and reestablishment of random allelic expression imbalance after epigenetic reprogramming
Jeffries, Aaron Richard; Uwanogho, Dafe Aghogho; Cocks, Graham; Perfect, Leo William; Dempster, Emma; Mill, Jonathan; Price, Jack
2016-01-01
Clonal level random allelic expression imbalance and random monoallelic expression provides cellular heterogeneity within tissues by modulating allelic dosage. Although such expression patterns have been observed in multiple cell types, little is known about when in development these stochastic allelic choices are made. We examine allelic expression patterns in human neural progenitor cells before and after epigenetic reprogramming to induced pluripotency, observing that loci previously characterized by random allelic expression imbalance (0.63% of expressed genes) are generally reset to a biallelic state in induced pluripotent stem cells (iPSCs). We subsequently neuralized the iPSCs and profiled isolated clonal neural stem cells, observing that significant random allelic expression imbalance is reestablished at 0.65% of expressed genes, including novel loci not found to show allelic expression imbalance in the original parental neural progenitor cells. Allelic expression imbalance was associated with altered DNA methylation across promoter regulatory regions, with clones characterized by skewed allelic expression being hypermethylated compared to their biallelic sister clones. Our results suggest that random allelic expression imbalance is established during lineage commitment and is associated with increased DNA methylation at the gene promoter. PMID:27539784
Erasure and reestablishment of random allelic expression imbalance after epigenetic reprogramming.
Jeffries, Aaron Richard; Uwanogho, Dafe Aghogho; Cocks, Graham; Perfect, Leo William; Dempster, Emma; Mill, Jonathan; Price, Jack
2016-10-01
Clonal level random allelic expression imbalance and random monoallelic expression provides cellular heterogeneity within tissues by modulating allelic dosage. Although such expression patterns have been observed in multiple cell types, little is known about when in development these stochastic allelic choices are made. We examine allelic expression patterns in human neural progenitor cells before and after epigenetic reprogramming to induced pluripotency, observing that loci previously characterized by random allelic expression imbalance (0.63% of expressed genes) are generally reset to a biallelic state in induced pluripotent stem cells (iPSCs). We subsequently neuralized the iPSCs and profiled isolated clonal neural stem cells, observing that significant random allelic expression imbalance is reestablished at 0.65% of expressed genes, including novel loci not found to show allelic expression imbalance in the original parental neural progenitor cells. Allelic expression imbalance was associated with altered DNA methylation across promoter regulatory regions, with clones characterized by skewed allelic expression being hypermethylated compared to their biallelic sister clones. Our results suggest that random allelic expression imbalance is established during lineage commitment and is associated with increased DNA methylation at the gene promoter. © 2016 Jeffries et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.
Zeng, Fang; Li, Zicong; Cai, Gengyuan; Gao, Wenchao; Jiang, Gelong; Liu, Dewu; Urschitz, Johann; Moisyadi, Stefan; Wu, Zhenfang
2016-01-01
Previously we successfully produced a group of EGFP-expressing founder transgenic pigs by a newly developed efficient and simple pig transgenesis method based on cytoplasmic injection of piggyBac plasmids. In this study, we investigated the growth and reproduction performance, and characterized the transgene insertion, transmission and expression patterns in transgenic pigs generated by piggyBac transposition. Results showed that transgene has no injurious effect on the growth and reproduction of transgenic pigs. Multiple copies of monogenic EGFP transgene were inserted at noncoding sequences of host genome, and passed from founder transgenic pigs to their transgenic offspring in segregation or linkage manner. The EGFP transgene was ubiquitously expressed in transgenic pigs, and its expression intensity was associated with transgene copy number but not related to its promoter DNA methylation level. To the best of our knowledge, this is first study that fully described the growth and reproduction performance, transgene insertion, expression and transmission profiles in transgenic pigs produced by piggyBac system. It not only demonstrates that piggyBac transposition-mediated gene transfer is an effective and favourable approach for pig transgenesis, but also provides scientific information for understanding the transgene insertion, expression and transmission patterns in transgenic animals produced by piggyBac transposition. PMID:27565868
Function does not follow form in gene regulatory circuits.
Payne, Joshua L; Wagner, Andreas
2015-08-20
Gene regulatory circuits are to the cell what arithmetic logic units are to the chip: fundamental components of information processing that map an input onto an output. Gene regulatory circuits come in many different forms, distinct structural configurations that determine who regulates whom. Studies that have focused on the gene expression patterns (functions) of circuits with a given structure (form) have examined just a few structures or gene expression patterns. Here, we use a computational model to exhaustively characterize the gene expression patterns of nearly 17 million three-gene circuits in order to systematically explore the relationship between circuit form and function. Three main conclusions emerge. First, function does not follow form. A circuit of any one structure can have between twelve and nearly thirty thousand distinct gene expression patterns. Second, and conversely, form does not follow function. Most gene expression patterns can be realized by more than one circuit structure. And third, multifunctionality severely constrains circuit form. The number of circuit structures able to drive multiple gene expression patterns decreases rapidly with the number of these patterns. These results indicate that it is generally not possible to infer circuit function from circuit form, or vice versa.
Sun, Zhi-Hui; Wang, Yang; Lu, Wei-Jia; Li, Zhi; Liu, Xiao-Chun; Li, Shui-Sheng; Zhou, Li; Gui, Jian-Fang
2017-03-23
Multiple nanos genes have been characterized in several fishes, but the functional implications of their various expression patterns remain unclear. In this study, we identified and characterized four nanos genes from a hermaphroditic fish orange-spotted grouper, Epinephelus coioides . Ecnanos1a and Ecnanos1b show divergent expression patterns, and the dynamic expression change of Ecnanos1a in pituitaries during sex change is associated with testis differentiation and spermatogenesis. Ecnanos2 and Ecnanos3 might be germline stem cells (GSCs) and primordial germ cells (PGCs)-specific markers, respectively. Significantly, Ecnanos3 3'-untranslated region (UTR) is necessary for PGC specific expression, where a non-canonical "GCACGTTT" sequence is required for miR-430-mediated repression of Ecnanos3 RNA. Furthermore, grouper Dead end (Dnd) can relieve miR-430 repression in PGCs by associating with a 23 bp U-rich region (URR) in Ecnanos3 3'-UTR. The current study revealed the functional association of multiple nanos genes with PGC formation and germ cell development in orange-spotted grouper, and opened up new possibilities for developing biotechnologies through utilizing the associations between Ecnanos3 and PGCs or between Ecnanos2 and GSCs in the hermaphroditic fish.
Characterization of embryo-specific genes
DOE Office of Scientific and Technical Information (OSTI.GOV)
Not Available
1989-01-01
The objective of the proposed research is to characterize the structure and function of a set of genes whose expression is regulated in embryo development, and that is not expressed in mature tissues -- the embryonic genes. In the last two years, using cDNA clones, we have isolated 22 cDNA clones, and characterized the expression pattern of their corresponding RNA. At least 4 cDNA clones detect RNAs of embryonic genes. These cDNA clones detect RNAs expressed in somatic as well as zygotic embryos of carrot. Using the cDNA clones, we screened the genomic library of carrot embryo DNA, and isolatedmore » genomic clones for three genes. The structure and function of two genes DC 8 and DC 59 have been characterized and are reported in this paper.« less
Sääf, Annika M.; Halbleib, Jennifer M.; Chen, Xin; Yuen, Siu Tsan; Leung, Suet Yi
2007-01-01
Posttranslational mechanisms are implicated in the development of epithelial cell polarity, but little is known about the patterns of gene expression and transcriptional regulation during this process. We characterized temporal patterns of gene expression during cell–cell adhesion-initiated polarization of cultured human Caco-2 cells, which develop structural and functional polarity resembling enterocytes in vivo. A distinctive switch in gene expression patterns occurred upon formation of cell–cell contacts. Comparison to gene expression patterns in normal human colon and colon tumors revealed that the pattern in proliferating, nonpolarized Caco-2 cells paralleled patterns seen in human colon cancer in vivo, including expression of genes involved in cell proliferation. The pattern switched in polarized Caco-2 cells to one more closely resembling that in normal colon tissue, indicating that regulation of transcription underlying Caco-2 cell polarization is similar to that during enterocyte differentiation in vivo. Surprisingly, the temporal program of gene expression in polarizing Caco-2 cells involved changes in signaling pathways (e.g., Wnt, Hh, BMP, FGF) in patterns similar to those during migration and differentiation of intestinal epithelial cells in vivo, despite the absence of morphogen gradients and interactions with stromal cells characteristic of enterocyte differentiation in situ. The full data set is available at http://microarray-pubs.stanford.edu/CACO2. PMID:17699589
Choi, Wonseon; Miyamura, Yoshinori; Wolber, Rainer; Smuda, Christoph; Reinhold, William; Liu, Hongfang; Kolbe, Ludger; Hearing, Vincent J.
2012-01-01
Ultraviolet (UV) radiation is a major environmental factor that affects pigmentation in human skin and can eventually result in various types of UV-induced skin cancers. The effects of various wavelengths of UV on melanocytes and other types of skin cells in culture have been studied but little is known about gene expression patterns in situ following in situe exposure of human skin to different types of UV (UVA and/or UVB). Paracrine factors expressed by keratinocytes and/or fibroblasts that affect skin pigmentation might be regulated differently by UV, as might their corresponding receptors expressed on melanocytes. To test the hypothesis that different mechanisms are involved in the pigmentary responses of the skin to different types of UV, we used immunohistochemical and whole human genome microarray analyses to characterize human skin in situ to examine how melanocyte-specific proteins and paracrine melanogenic factors are regulated by repetitive exposure to different types of UV compared with unexposed skin as a control. The results show that gene expression patterns induced by UVA or UVB are distinct, UVB eliciting dramatic increases in a large number of genes involved in pigmentation as well as in other cellular functions, while UVA had little or no effect on those. The expression patterns characterize the distinct responses of the skin to UVA or UVB, and identify several potential previously unidentified factors involved in UV-induced responses of human skin. PMID:20147966
Hunter, Nina L; Hikasa, Hiroki; Dymecki, Susan M; Sokol, Sergei Y
2006-01-01
Frodo has been identified as a protein interacting with Dishevelled, an essential mediator of the Wnt signaling pathway, critical for the determination of cell fate and polarity in embryonic development. In this study, we use specific gene probes to characterize stage- and tissue-specific expression patterns of the mouse Frodo homologue and compare them with Frodo expression patterns in Xenopus embryos. In situ hybridization analysis of mouse Frodo transcripts demonstrates that, similar to Xenopus Frodo, mouse Frodo is expressed in primitive streak mesoderm, neuroectoderm, neural crest, presomitic mesoderm, and somites. In many cases, Frodo expression is confined to tissues undergoing extensive morphogenesis, suggesting that Frodo may be involved in the regulation of cell shape and motility. Highly conserved dynamic expression patterns of Frodo homologues indicate a similar function for these proteins in different vertebrates. 2005 Wiley-Liss, Inc.
Expression of VEGFR and PDGFR-α/-β in 187 canine nasal carcinomas.
Gramer, I; Killick, D; Scase, T; Chandry, D; Marrington, M; Blackwood, L
2017-09-01
Radiotherapy represents the standard of care for intranasal carcinomas. Responses to tyrosine kinase inhibitors (TKIs) have been reported but data on expression of target receptor tyrosine kinases (rTKs) is limited. This study characterizes the expression of vascular endothelial growth factor receptor (VEGFR), platelet-derived growth factor receptor (PDGFR)-α and PDGFR-β in canine intranasal carcinomas. Histological samples from 187 dogs were retrieved. Immunohistochemistry was performed using commercially available antibodies. Expression of rTKs was classified into weak, moderate or intense and additionally recorded as cytoplasmic, membranous, cytoplasmic-membranous, nuclear or stromal. VEGFR was expressed in 158 dogs with predominantly moderate expression (36.9%) and a cytoplasmic-membranous expression pattern (70.9%). PDGFR-α was detected in 133 with predominantly weak expression (57.9%) and cytoplasmic pattern (87.9%). PDGFR-β was identified in 74 patients with a predominantly moderate expression (17.6%) and cytoplasmic expression pattern (63.5%). Co-expression of rTKs was common. These results confirm expression of VEGFR, PDGFR-α and PDGFR-β in canine intranasal carcinomas and support the utility of TKIs. © 2016 John Wiley & Sons Ltd.
Göritz, M; Müller, K; Krastel, D; Staudacher, G; Schmidt, P; Kühn, M; Nickel, R; Schoon, H-A
2013-07-01
Splenic haemangiosarcomas (HSAs) from 122 dogs were characterized and classified according to their patterns of growth, survival time post splenectomy, metastases and chemotherapy. The most common pattern of growth was a mixture of cavernous, capillary and solid tumour tissue. Survival time post splenectomy was independent of the growth pattern; however, it was influenced by chemotherapy and metastases. Immunohistochemical assessment of the expression of angiogenic factors (fetal liver kinase-1, angiopoietin-2, angiopoietin receptor-2 and vascular endothelial growth factor A) and conventional endothelial markers (CD31, factor VIII-related antigen) revealed variable expression, particularly in undifferentiated HSAs. Therefore, a combination of endothelial markers should be used to confirm the endothelial origin of splenic tumours. Copyright © 2012 Elsevier Ltd. All rights reserved.
Sun, Zhi-Hui; Wang, Yang; Lu, Wei-Jia; Li, Zhi; Liu, Xiao-Chun; Li, Shui-Sheng; Zhou, Li; Gui, Jian-Fang
2017-01-01
Multiple nanos genes have been characterized in several fishes, but the functional implications of their various expression patterns remain unclear. In this study, we identified and characterized four nanos genes from a hermaphroditic fish orange-spotted grouper, Epinephelus coioides. Ecnanos1a and Ecnanos1b show divergent expression patterns, and the dynamic expression change of Ecnanos1a in pituitaries during sex change is associated with testis differentiation and spermatogenesis. Ecnanos2 and Ecnanos3 might be germline stem cells (GSCs) and primordial germ cells (PGCs)-specific markers, respectively. Significantly, Ecnanos3 3′-untranslated region (UTR) is necessary for PGC specific expression, where a non-canonical “GCACGTTT” sequence is required for miR-430-mediated repression of Ecnanos3 RNA. Furthermore, grouper Dead end (Dnd) can relieve miR-430 repression in PGCs by associating with a 23 bp U-rich region (URR) in Ecnanos3 3′-UTR. The current study revealed the functional association of multiple nanos genes with PGC formation and germ cell development in orange-spotted grouper, and opened up new possibilities for developing biotechnologies through utilizing the associations between Ecnanos3 and PGCs or between Ecnanos2 and GSCs in the hermaphroditic fish. PMID:28333083
Genome-wide characterization of the Pectate Lyase-like (PLL) genes in Brassica rapa.
Jiang, Jingjing; Yao, Lina; Miao, Ying; Cao, Jiashu
2013-11-01
Pectate lyases (PL) depolymerize demethylated pectin (pectate, EC 4.2.2.2) by catalyzing the eliminative cleavage of α-1,4-glycosidic linked galacturonan. Pectate Lyase-like (PLL) genes are one of the largest and most complex families in plants. However, studies on the phylogeny, gene structure, and expression of PLL genes are limited. To understand the potential functions of PLL genes in plants, we characterized their intron-exon structure, phylogenetic relationships, and protein structures, and measured their expression patterns in various tissues, specifically the reproductive tissues in Brassica rapa. Sequence alignments revealed two characteristic motifs in PLL genes. The chromosome location analysis indicated that 18 of the 46 PLL genes were located in the least fractionated sub-genome (LF) of B. rapa, while 16 were located in the medium fractionated sub-genome (MF1) and 12 in the more fractionated sub-genome (MF2). Quantitative RT-PCR analysis showed that BrPLL genes were expressed in various tissues, with most of them being expressed in flowers. Detailed qRT-PCR analysis identified 11 pollen specific PLL genes and several other genes with unique spatial expression patterns. In addition, some duplicated genes showed similar expression patterns. The phylogenetic analysis identified three PLL gene subfamilies in plants, among which subfamily II might have evolved from gene neofunctionalization or subfunctionalization. Therefore, this study opens the possibility for exploring the roles of PLL genes during plant development.
Functional analysis of chloroplast early light inducible proteins (ELIPs)
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wetzel, Carolyn M
The objectives of this project were to characterize gene expression patterns of early light inducible protein (ELIP) genes in Arabidopsis thaliana and in Lycopersicon esculentum, to identify knock mutants of the 2 ELIP genes in Arabidopsis, and to characterize the effects of the knockouts. Expression in Arabidopsis was studied in response to thylakoid electron transport chain (PETC) capacity, where it was found that there is a signal for expression associated with reduction of the PETC. Expression in response to salt was also studied, with different responses of the two gene copies. Knockout lines for ELIP1 and ELIP2 have been identifiedmore » and are being characterized. In tomato, it was found that the single-copy ELIP gene is highly expressed in ripening fruit during the chloroplast-to-chromoplast transition. Studies of expression in tomato ripening mutants are ongoing.« less
Nayidu, Naghabushana K.; Kagale, Sateesh; Taheri, Ali; Withana-Gamage, Thushan S.; Parkin, Isobel A. P.; Sharpe, Andrew G.; Gruber, Margaret Y.
2014-01-01
Coding sequences for major trichome regulatory genes, including the positive regulators GLABRA 1(GL1), GLABRA 2 (GL2), ENHANCER OF GLABRA 3 (EGL3), and TRANSPARENT TESTA GLABRA 1 (TTG1) and the negative regulator TRIPTYCHON (TRY), were cloned from wild Brassica villosa, which is characterized by dense trichome coverage over most of the plant. Transcript (FPKM) levels from RNA sequencing indicated much higher expression of the GL2 and TTG1 regulatory genes in B. villosa leaves compared with expression levels of GL1 and EGL3 genes in either B. villosa or the reference genome species, glabrous B. oleracea; however, cotyledon TTG1 expression was high in both species. RNA sequencing and Q-PCR also revealed an unusual expression pattern for the negative regulators TRY and CPC, which were much more highly expressed in trichome-rich B. villosa leaves than in glabrous B. oleracea leaves and in glabrous cotyledons from both species. The B. villosa TRY expression pattern also contrasted with TRY expression patterns in two diploid Brassica species, and with the Arabidopsis model for expression of negative regulators of trichome development. Further unique sequence polymorphisms, protein characteristics, and gene evolution studies highlighted specific amino acids in GL1 and GL2 coding sequences that distinguished glabrous species from hairy species and several variants that were specific for each B. villosa gene. Positive selection was observed for GL1 between hairy and non-hairy plants, and as expected the origin of the four expressed positive trichome regulatory genes in B. villosa was predicted to be from B. oleracea. In particular the unpredicted expression patterns for TRY and CPC in B. villosa suggest additional characterization is needed to determine the function of the expanded families of trichome regulatory genes in more complex polyploid species within the Brassicaceae. PMID:24755905
Holm, Karolina; Staaf, Johan; Lauss, Martin; Aine, Mattias; Lindgren, David; Bendahl, Pär-Ola; Vallon-Christersson, Johan; Barkardottir, Rosa Bjork; Höglund, Mattias; Borg, Åke; Jönsson, Göran; Ringnér, Markus
2016-02-29
Aberrant DNA methylation is frequently observed in breast cancer. However, the relationship between methylation patterns and the heterogeneity of breast cancer has not been comprehensively characterized. Whole-genome DNA methylation analysis using Illumina Infinium HumanMethylation450 BeadChip arrays was performed on 188 human breast tumors. Unsupervised bootstrap consensus clustering was performed to identify DNA methylation epigenetic subgroups (epitypes). The Cancer Genome Atlas data, including methylation profiles of 669 human breast tumors, was used for validation. The identified epitypes were characterized by integration with publicly available genome-wide data, including gene expression levels, DNA copy numbers, whole-exome sequencing data, and chromatin states. We identified seven breast cancer epitypes. One epitype was distinctly associated with basal-like tumors and with BRCA1 mutations, one epitype contained a subset of ERBB2-amplified tumors characterized by multiple additional amplifications and the most complex genomes, and one epitype displayed a methylation profile similar to normal epithelial cells. Luminal tumors were stratified into the remaining four epitypes, with differences in promoter hypermethylation, global hypomethylation, proliferative rates, and genomic instability. Specific hyper- and hypomethylation across the basal-like epitype was rare. However, we observed that the candidate genomic instability drivers BRCA1 and HORMAD1 displayed aberrant methylation linked to gene expression levels in some basal-like tumors. Hypomethylation in luminal tumors was associated with DNA repeats and subtelomeric regions. We observed two dominant patterns of aberrant methylation in breast cancer. One pattern, constitutively methylated in both basal-like and luminal breast cancer, was linked to genes with promoters in a Polycomb-repressed state in normal epithelial cells and displayed no correlation with gene expression levels. The second pattern correlated with gene expression levels and was associated with methylation in luminal tumors and genes with active promoters in normal epithelial cells. Our results suggest that hypermethylation patterns across basal-like breast cancer may have limited influence on tumor progression and instead reflect the repressed chromatin state of the tissue of origin. On the contrary, hypermethylation patterns specific to luminal breast cancer influence gene expression, may contribute to tumor progression, and may present an actionable epigenetic alteration in a subset of luminal breast cancers.
Bai, Wen-tao; Xu, Zhi-kai; Zhang, Fang-lin; Luo, Wen; Liu, Yong; Wu, Xing-an; Yan, Yan
2004-11-01
To transiently express an intracellular single chain Fv of monoclonal antibody 1A8 against nucleocapsid protein of Hantavirus and characterize the immunological activities of the expressed products. COS-7 cells were transfected with mammalian expression vector 1A8-scFv-Ckappa/pCI-neo via lipofectin. The expressed product was identified by indirect immunofluorescence and immunoprecipitation. A diffuse pattern fluorescence was observed in less than 1% cytoplasm of transfected COS-7 cells. The binding of intracellular antibody fragments to NP antigen was confirmed by immunoprecipitation analysis. Transiently expressed single chain intrabodies can effectively target NP antigen in the cytoplasm. The present study may provide a new approach for treatment of Hantavirus.
A transcriptome analysis of two grapevine populations segregating for tendril phyllotaxy
USDA-ARS?s Scientific Manuscript database
The shoot structure of cultivated grapevine Vitis vinifera L. typically exhibits a 3-node modular repetitive pattern, two sequential leaf-opposed tendrils followed by a tendril-free node. In this study, we investigated the molecular basis of this pattern by characterizing differentially expressed ge...
Comprehensive analysis and discovery of drought-related NAC transcription factors in common bean.
Wu, Jing; Wang, Lanfen; Wang, Shumin
2016-09-07
Common bean (Phaseolus vulgaris L.) is an important warm-season food legume. Drought is the most important environmental stress factor affecting large areas of common bean via plant death or reduced global production. The NAM, ATAF1/2 and CUC2 (NAC) domain protein family are classic transcription factors (TFs) involved in a variety of abiotic stresses, particularly drought stress. However, the NAC TFs in common bean have not been characterized. In the present study, 86 putative NAC TF proteins were identified from the common bean genome database and located on 11 common bean chromosomes. The proteins were phylogenetically clustered into 8 distinct subfamilies. The gene structure and motif composition of common bean NACs were similar in each subfamily. These results suggest that NACs in the same subfamily may possess conserved functions. The expression patterns of common bean NAC genes were also characterized. The majority of NACs exhibited specific temporal and spatial expression patterns. We identified 22 drought-related NAC TFs based on transcriptome data for drought-tolerant and drought-sensitive genotypes. Quantitative real-time PCR (qRT-PCR) was performed to confirm the expression patterns of the 20 drought-related NAC genes. Based on the common bean genome sequence, we analyzed the structural characteristics, genome distribution, and expression profiles of NAC gene family members and analyzed drought-responsive NAC genes. Our results provide useful information for the functional characterization of common bean NAC genes and rich resources and opportunities for understanding common bean drought stress tolerance mechanisms.
Kim, Wontae; Bae, Sungwoo; Kim, Ayoung; Park, Kwanho; Lee, Sangbeom; Choi, Youngcheol; Han, Sangmi; Park, Younghan; Koh, Youngho
2011-06-01
To investigate the molecular scavenging capabilities of the larvae of Hermetia illucens, two serine proteases (SPs) were cloned and characterized. Multiple sequence alignments and phylogenetic tree analysis of the deduced amino acid sequences of Hi-SP1 and Hi-SP2 were suggested that Hi-SP1 may be a chymotrypsin- and Hi-SP2 may be a trypsin-like protease. Hi-SP1 and Hi-SP2 3-D homology models revealed that a catalytic triad, three disulfide bonds, and a substrate-binding pocket were highly conserved, as would be expected of a SP. E. coli expressed Hi-SP1 and Hi-SP2 showed chymotrypsin or trypsin activities, respectively. Hi-SP2 mRNAs were consistently expressed during larval development. In contrast, the expression of Hi-SP1 mRNA fluctuated between feeding and molting stages and disappeared at the pupal stages. These expression pattern differences suggest that Hi-SP1 may be a larval specific chymotrypsin-like protease involved with food digestion, while Hi-SP2 may be a trypsin-like protease with diverse functions at different stages.
Lu, Yuan; Reyes, Jose; Walter, Sean; Gonzalez, Trevor; Medrano, Geraldo; Boswell, Mikki; Boswell, William; Savage, Markita; Walter, Ronald
2018-06-01
Evolutionarily conserved diurnal circadian mechanisms maintain oscillating patterns of gene expression based on the day-night cycle. Xiphophorus fish have been used to evaluate transcriptional responses after exposure to various light sources and it was determined that each source incites distinct genetic responses in skin tissue. However, basal expression levels of genes that show oscillating expression patterns in day-night cycle, may affect the outcomes of such experiments, since basal gene expression levels at each point in the circadian path may influence the profile of identified light responsive genes. Lack of knowledge regarding diurnal fluctuations in basal gene expression patterns may confound the understanding of genetic responses to external stimuli (e.g., light) since the dynamic nature of gene expression implies animals subjected to stimuli at different times may be at very different stages within the continuum of genetic homeostasis. We assessed basal gene expression changes over a 24-hour period in 200 select Xiphophorus gene targets known to transcriptionally respond to various types of light exposure. We identified 22 genes in skin, 36 genes in brain and 28 genes in liver that exhibit basal oscillation of expression patterns. These genes, including known circadian regulators, produced the expected expression patterns over a 24-hour cycle when compared to circadian regulatory genes identified in other species, especially human and other vertebrate animal models. Our results suggest the regulatory network governing diurnal oscillating gene expression is similar between Xiphophorus and other vertebrates for the three Xiphophorus organs tested. In addition, we were able to categorize light responsive gene sets in Xiphophorus that do, and do not, exhibit circadian based oscillating expression patterns. Copyright © 2017 Elsevier Inc. All rights reserved.
Yi, Xin; Qi, Jiangwei; Zhou, Xiaofan; Hu, Mei Ying; Zhong, Guo Hua
2017-03-22
While it has been well characterized that chemosensory receptors in guts of mammals have great influence on food preference, much remains elusive in insects. Insect chemosensory proteins (CSPs) are soluble proteins that could deliver chemicals to olfactory and gustatory receptors. Recent studies have identified a number of CSPs expressed in midgut in Lepidoptera insects, which started to reveal their roles in chemical recognition and stimulating appetite in midgut. In this study, we examined expression patterns in midgut of 21 Spodoptera litura CSPs (SlitCSPs) characterized from a previously reported transcriptome, and three CSPs were identified to be expressed highly in midgut. The orthologous relationships between midgut expressed CSPs in S. litura and those in Bombyx mori and Plutella xylostella also suggest a conserved pattern of CSP expression in midgut. We further demonstrated that the expression of midgut-CSPs may change in response to different host plants, and SlitCSPs could bind typical chemicals from host plant in vitro. Overall, our results suggested midgut expressed SlitCSPs may have functional roles, likely contributing to specialization and adaption to different ecosystems. Better knowledge of this critical component of the chemsensation signaling pathways in midguts may improve our understanding of food preference processes in a new perspective.
NASA Astrophysics Data System (ADS)
Arce, DP; Krsticevic, FJ; Ezpeleta, J.; Ponce, SD; Pratta, GR; Tapia, E.
2016-04-01
The small heat shock proteins (sHSPs) have been found to play a critical role in physiological stress conditions in protecting proteins from irreversible aggregation. To characterize the gene expression profile of four sHsps with a tandem gene structure arrangement in the domesticated Solanum lycopersicum (Heinz 1706) genome and its wild close relative Solanum pimpinellifolium (LA1589), differential gene expression analysis using RNA-Seq was conducted in three ripening stages in both cultivars fruits. Gene promoter analysis was performed to explain the heterogeneous pattern of gene expression found for these tandem duplicated sHsps. In silico analysis results contribute to refocus wet experiment analysis in tomato sHsp family proteins.
Characterization of TALE genes expression during the first lineage segregation in mammalian embryos.
Sonnet, Wendy; Rezsöhazy, Rene; Donnay, Isabelle
2012-11-01
Three amino acid loop extension (TALE) homeodomain-containing transcription factors are generally recognized for their role in organogenesis and differentiation during embryogenesis. However, very little is known about the expression and function of Meis, Pbx, and Prep genes during early development. In order to determine whether TALE proteins could contribute to the early cell fate decisions in mammalian development, this study aimed to characterize in a systematic manner the pattern of expression of all Meis, Pbx, and Prep genes from the precompaction to blastocyst stage corresponding to the first step of cell differentiation in mammals. To reveal to what extent TALE genes expression at these early stages is a conserved feature among mammals, this study was performed in parallel in the bovine and mouse models. We demonstrated the transcription and translation of TALE genes, before gastrulation in the two species. At least one member of Meis, Pbx, and Prep subfamilies was found expressed at the RNA and protein levels but different patterns of expression were observed between genes and between species, suggesting specific gene regulations. Taken together, these results suggest a previously unexpected involvement of these factors during the early development in mammals. Copyright © 2012 Wiley Periodicals, Inc.
A dehydration-inducible gene in the truffle Tuber borchii identifies a novel group of dehydrins
Abba', Simona; Ghignone, Stefano; Bonfante, Paola
2006-01-01
Background The expressed sequence tag M6G10 was originally isolated from a screening for differentially expressed transcripts during the reproductive stage of the white truffle Tuber borchii. mRNA levels for M6G10 increased dramatically during fruiting body maturation compared to the vegetative mycelial stage. Results Bioinformatics tools, phylogenetic analysis and expression studies were used to support the hypothesis that this sequence, named TbDHN1, is the first dehydrin (DHN)-like coding gene isolated in fungi. Homologs of this gene, all defined as "coding for hypothetical proteins" in public databases, were exclusively found in ascomycetous fungi and in plants. Although complete (or almost complete) fungal genomes and EST collections of some Basidiomycota and Glomeromycota are already available, DHN-like proteins appear to be represented only in Ascomycota. A new and previously uncharacterized conserved signature pattern was identified and proposed to Uniprot database as the main distinguishing feature of this new group of DHNs. Expression studies provide experimental evidence of a transcript induction of TbDHN1 during cellular dehydration. Conclusion Expression pattern and sequence similarities to known plant DHNs indicate that TbDHN1 is the first characterized DHN-like protein in fungi. The high similarity of TbDHN1 with homolog coding sequences implies the existence of a novel fungal/plant group of LEA Class II proteins characterized by a previously undescribed signature pattern. PMID:16512918
Geib, Scott M; Calla, Bernarda; Hall, Brian; Hou, Shaobin; Manoukis, Nicholas C
2014-10-28
The oriental fruit fly, Bactrocera dorsalis, is an important pest of fruit and vegetable crops throughout Asia, and is considered a high risk pest for establishment in the mainland United States. It is a member of the family Tephritidae, which are the most agriculturally important family of flies, and can be considered an out-group to well-studied members of the family Drosophilidae. Despite their importance as pests and their relatedness to Drosophila, little information is present on B. dorsalis transcripts and proteins. The objective of this paper is to comprehensively characterize the transcripts present throughout the life history of B. dorsalis and functionally annotate and analyse these transcripts relative to the presence, expression, and function of orthologous sequences present in Drosophila melanogaster. We present a detailed transcriptome assembly of B. dorsalis from egg through adult stages containing 20,666 transcripts across 10,799 unigene components. Utilizing data available through Flybase and the modENCODE project, we compared expression patterns of these transcripts to putative orthologs in D. melanogaster in terms of timing, abundance, and function. In addition, temporal expression patterns in B. dorsalis were characterized between stages, to establish the constitutive or stage-specific expression patterns of particular transcripts. A fully annotated transcriptome assembly is made available through NCBI, in addition to corresponding expression data. Through characterizing the transcriptome of B. dorsalis through its life history and comparing the transcriptome of B. dorsalis to the model organism D. melanogaster, a database has been developed that can be used as the foundation to functional genomic research in Bactrocera flies and help identify orthologous genes between B. dorsalis and D. melanogaster. This data provides the foundation for future functional genomic research that will focus on improving our understanding of the physiology and biology of this species at the molecular level. This knowledge can also be applied towards developing improved methods for control, survey, and eradication of this important pest.
NASA Astrophysics Data System (ADS)
Dai, Guohao; Kaazempur-Mofrad, Mohammad R.; Natarajan, Sripriya; Zhang, Yuzhi; Vaughn, Saran; Blackman, Brett R.; Kamm, Roger D.; García-Cardeña, Guillermo; Gimbrone, Michael A., Jr.
2004-10-01
Atherosclerotic lesion localization to regions of disturbed flow within certain arterial geometries, in humans and experimental animals, suggests an important role for local hemodynamic forces in atherogenesis. To explore how endothelial cells (EC) acquire functional/dysfunctional phenotypes in response to vascular region-specific flow patterns, we have used an in vitro dynamic flow system to accurately reproduce arterial shear stress waveforms on cultured human EC and have examined the effects on EC gene expression by using a high-throughput transcriptional profiling approach. The flow patterns in the carotid artery bifurcations of several normal human subjects were characterized by using 3D flow analysis based on actual vascular geometries and blood flow profiles. Two prototypic arterial waveforms, "athero-prone" and "athero-protective," were defined as representative of the wall shear stresses in two distinct regions of the carotid artery (carotid sinus and distal internal carotid artery) that are typically "susceptible" or "resistant," respectively, to atherosclerotic lesion development. These two waveforms were applied to cultured EC, and cDNA microarrays were used to analyze the differential patterns of EC gene expression. In addition, the differential effects of athero-prone vs. athero-protective waveforms were further characterized on several parameters of EC structure and function, including actin cytoskeletal organization, expression and localization of junctional proteins, activation of the NF-B transcriptional pathway, and expression of proinflammatory cytokines and adhesion molecules. These global gene expression patterns and functional data reveal a distinct phenotypic modulation in response to the wall shear stresses present in atherosclerosis-susceptible vs. atherosclerosis-resistant human arterial geometries.
Swinnen, Stephan P.; Wenderoth, Nicole
2016-01-01
Autism spectrum disorders (ASD) are far more prevalent in males than in females. Little is known however about the differential neural expression of ASD in males and females. We used a resting-state fMRI-dataset comprising 42 males/42 females with ASD and 75 male/75 female typical-controls to examine whether autism-related alterations in intrinsic functional connectivity are similar or different in males and females, and particularly whether alterations reflect ‘neural masculinization’, as predicted by the Extreme Male Brain theory. Males and females showed a differential neural expression of ASD, characterized by highly consistent patterns of hypo-connectivity in males with ASD (compared to typical males), and hyper-connectivity in females with ASD (compared to typical females). Interestingly, patterns of hyper-connectivity in females with ASD reflected a shift towards the (high) connectivity levels seen in typical males (neural masculinization), whereas patterns of hypo-connectivity observed in males with ASD reflected a shift towards the (low) typical feminine connectivity patterns (neural feminization). Our data support the notion that ASD is a disorder of sexual differentiation rather than a disorder characterized by masculinization in both genders. Future work is needed to identify underlying factors such as sex hormonal alterations that drive these sex-specific neural expressions of ASD. PMID:26989195
Cheng, Hongtao; Hao, Mengyu; Wang, Wenxiang; Mei, Desheng; Tong, Chaobo; Wang, Hui; Liu, Jia; Fu, Li; Hu, Qiong
2016-09-08
SBP-box genes belong to one of the largest families of transcription factors. Though members of this family have been characterized to be important regulators of diverse biological processes, information of SBP-box genes in the third most important oilseed crop Brassica napus is largely undefined. In the present study, by whole genome bioinformatics analysis and transcriptional profiling, 58 putative members of SBP-box gene family in oilseed rape (Brassica napus L.) were identified and their expression pattern in different tissues as well as possible interaction with miRNAs were analyzed. In addition, B. napus lines with contrasting branch angle were used for investigating the involvement of SBP-box genes in plant architecture regulation. Detailed gene information, including genomic organization, structural feature, conserved domain and phylogenetic relationship of the genes were systematically characterized. By phylogenetic analysis, BnaSBP proteins were classified into eight distinct groups representing the clear orthologous relationships to their family members in Arabidopsis and rice. Expression analysis in twelve tissues including vegetative and reproductive organs showed different expression patterns among the SBP-box genes and a number of the genes exhibit tissue specific expression, indicating their diverse functions involved in the developmental process. Forty-four SBP-box genes were ascertained to contain the putative miR156 binding site, with 30 and 14 of the genes targeted by miR156 at the coding and 3'UTR region, respectively. Relative expression level of miR156 is varied across tissues. Different expression pattern of some BnaSBP genes and the negative correlation of transcription levels between miR156 and its target BnaSBP gene were observed in lines with different branch angle. Taken together, this study represents the first systematic analysis of the SBP-box gene family in Brassica napus. The data presented here provides base foundation for understanding the crucial roles of BnaSBP genes in plant development and other biological processes.
Barth, Andreas S; Kumordzie, Ami; Frangakis, Constantine; Margulies, Kenneth B; Cappola, Thomas P; Tomaselli, Gordon F
2011-10-01
Systolic heart failure (HF) is a complex systemic syndrome that can result from a wide variety of clinical conditions and gene mutations. Despite phenotypic similarities, characterized by ventricular dilatation and reduced contractility, the extent of common and divergent gene expression between different forms of HF remains a matter of intense debate. Using a meta-analysis of 28 experimental (mouse, rat, dog) and human HF microarray studies, we demonstrate that gene expression changes are characterized by a coordinated and reciprocal regulation of major metabolic and signaling pathways. In response to a wide variety of stressors in animal models of HF, including ischemia, pressure overload, tachypacing, chronic isoproterenol infusion, Chagas disease, and transgenic mouse models, major metabolic pathways are invariably downregulated, whereas cell signaling pathways are upregulated. In contrast to this uniform transcriptional pattern that recapitulates a fetal gene expression program in experimental animal models of HF, human HF microarray studies displayed a greater heterogeneity, with some studies even showing upregulation of metabolic and downregulation of signaling pathways in end-stage human hearts. These discrepant results between animal and human studies are due to a number of factors, prominently cardiac disease and variable exposure to cold cardioplegic solution in nonfailing human samples, which can downregulate transcripts involved in oxidative phosphorylation (OXPHOS), thus mimicking gene expression patterns observed in failing samples. Additionally, β-blockers and ACE inhibitor use in end-stage human HF was associated with higher levels of myocardial OXPHOS transcripts, thus partially reversing the fetal gene expression pattern. In human failing samples, downregulation of metabolism was associated with hemodynamic markers of disease severity. Irrespective of the etiology, gene expression in failing myocardium is characterized by downregulation of metabolic transcripts and concomitant upregulation of cell signaling pathways. Gene expression changes along this metabolic-signaling axis in mammalian myocardium are a consistent feature in the heterogeneous transcriptional response observed in phenotypically similar models of HF.
Meng, Dong; Li, Yuanyuan; Bai, Yang; Li, Mingjun; Cheng, Lailiang
2016-06-01
As one of the largest transcriptional factor families in plants, WRKY genes play significant roles in various biotic and abiotic stress responses. Although the WRKY gene family has been characterized in a few plant species, the details remain largely unknown in the apple (Malus domestica Borkh.). In this study, we identified a total of 127 MdWRKYs from the apple genome, which were divided into four subgroups according to the WRKY domains and zinc finger motif. Most of them were mapped onto the apple's 17 chromosomes and were expressed in more than one tissue, including shoot tips, mature leaves, fruit and apple calli. We then contrasted WRKY expression patterns between calli grown in solid medium (control) and liquid medium (representing waterlogging stress) and found that 34 WRKY genes were differentially expressed between the two growing conditions. Finally, we determined the expression patterns of 10 selected WRKY genes in an apple rootstock, G41, in response to waterlogging and drought stress, which identified candidate genes involved in responses to water stress for functional analysis. Our data provide interesting candidate MdWRKYs for future functional analysis and demonstrate that apple callus is a useful system for characterizing gene expression and function in apple. Copyright © 2016 Elsevier Masson SAS. All rights reserved.
Arabidopsis gene expression patterns during spaceflight
NASA Astrophysics Data System (ADS)
Paul, A.-L.; Ferl, R. J.
The exposure of Arabidopsis thaliana (Arabidopsis) plants to spaceflight environments resulted in the differential expression of hundreds of genes. A 5 day mission on orbiter Columbia in 1999 (STS-93) carried transgenic Arabidopsis plants engineered with a transgene composed of the alcohol dehydrogenase (Adh) gene promoter linked to the β -Glucuronidase (GUS) reporter gene. The plants were used to evaluate the effects of spaceflight on two fronts. First, expression patterns visualized with the Adh/GUS transgene were used to address specifically the possibility that spaceflight induces a hypoxic stress response, and to assess whether any spaceflight response was similar to control terrestrial hypoxia-induced gene expression patterns. (Paul et al., Plant Physiol. 2001, 126:613). Second, genome-wide patterns of native gene expression were evaluated utilizing the Affymetrix ATH1 GeneChip? array of 8,000 Arabidopsis genes. As a control for the veracity of the array analyses, a selection of genes identified with the arrays was further characterized with quantitative Real-Time RT PCR (ABI - TaqmanTM). Comparison of the patterns of expression for arrays of hybridized with RNA isolated from plants exposed to spaceflight compared to the control arrays revealed hundreds of genes that were differentially expressed in response to spaceflight, yet most genes that are hallmarks of hypoxic stress were unaffected. These results will be discussed in light of current models for plant responses to the spaceflight environment, and with regard to potential future flight opportunities.
A Drosophila heat shock response represents an exception rather than a rule amongst Diptera species.
Zatsepina, O G; Przhiboro, A A; Yushenova, I A; Shilova, V; Zelentsova, E S; Shostak, N G; Evgen'ev, M B; Garbuz, D G
2016-08-01
Heat shock protein 70 (Hsp70) is the major player that underlies adaptive response to hyperthermia in all organisms studied to date. We investigated patterns of Hsp70 expression in larvae of dipteran species collected from natural populations of species belonging to four families from different evolutionary lineages of the order Diptera: Stratiomyidae, Tabanidae, Chironomidae and Ceratopogonidae. All investigated species showed a Hsp70 expression pattern that was different from the pattern in Drosophila. In contrast to Drosophila, all of the species in the families studied were characterized by high constitutive levels of Hsp70, which was more stable than that in Drosophila. When Stratiomyidae Hsp70 proteins were expressed in Drosophila cells, they became as short-lived as the endogenous Hsp70. Interestingly, three species of Ceratopogonidae and a cold-water species of Chironomidae exhibited high constitutive levels of Hsp70 mRNA and high basal levels of Hsp70. Furthermore, two species of Tabanidae were characterized by significant constitutive levels of Hsp70 and highly stable Hsp70 mRNA. In most cases, heat-resistant species were characterized by a higher basal level of Hsp70 than more thermosensitive species. These data suggest that different trends were realized during the evolution of the molecular mechanisms underlying the regulation of the responses of Hsp70 genes to temperature fluctuations in the studied families. © 2016 The Royal Entomological Society.
Shi, Dian; Chang, Joshua W; Choi, Jaimin; Connor, Bronwen; O'Carroll, Simon J; Nicholson, Louise F B; Kim, Joo Hyun
2018-06-01
Receptor for advanced glycation end products (RAGE) is a multi-ligand receptor involved in the pathology of several progressive neurodegenerative disorders including Huntington's disease (HD). We previously showed that the expression of RAGE and its colocalization with ligands were increased in the striatum of HD patients, increasing with grade severity, and that the pattern of RAGE expression coincided with the medio-lateral pattern of neurodegeneration. However, the exact role of RAGE in HD remains elusive. In order to address the necessity for a direct functional study, we aimed to characterize the pattern of RAGE expression in the transgenic rat model of HD (tgHD rats). Our results showed that RAGE expression was expanded laterally in tgHD rat caudate-putamen (CPu) compared to wildtype littermates, but the expression was unchanged by disease severity. The rostro-caudal location did not affect RAGE expression. RAGE was predominantly expressed in the medium spiny neurons (MSN) where it colocalized most extensively with N-carboxymethyllysine (CML), which largely contradicts with observations from human HD brains. Overall, the tgHD rat model only partially recapitulated the pattern in striatal RAGE expression in human brains, raising a question about its reliability as an animal model for future functional studies. Copyright © 2018 IBRO. Published by Elsevier Ltd. All rights reserved.
Expression and distribution of voltage-gated ion channels in ferret sinoatrial node.
Brahmajothi, Mulugu V; Morales, Michael J; Campbell, Donald L; Steenbergen, Charles; Strauss, Harold C
2010-10-01
Spontaneous diastolic depolarization in the sinoatrial (SA) node enables it to serve as pacemaker of the heart. The variable cell morphology within the SA node predicts that ion channel expression would be heterogeneous and different from that in the atrium. To evaluate ion channel heterogeneity within the SA node, we used fluorescent in situ hybridization to examine ion channel expression in the ferret SA node region and atrial appendage. SA nodal cells were distinguished from surrounding cardiac myocytes by expression of the slow (SA node) and cardiac (surrounding tissue) forms of troponin I. Nerve cells in the sections were identified by detection of GAP-43 and cytoskeletal middle neurofilament. Transcript expression was characterized for the 4 hyperpolarization-activated cation channels, 6 voltage-gated Na(+) channels, 3 voltage-gated Ca(2+) channels, 24 voltage-gated K(+) channel α-subunits, and 3 ancillary subunits. To ensure that transcript expression was representative of protein expression, immunofluorescence was used to verify localization patterns of voltage-dependent K(+) channels. Colocalizations were performed to observe any preferential patterns. Some overlapping and nonoverlapping binding patterns were observed. Measurement of different cation channel transcripts showed heterogeneous expression with many different patterns of expression, attesting to the complexity of electrical activity in the SA node. This study provides insight into the possible role ion channel heterogeneity plays in SA node pacemaker activity.
JAK/Stat signaling regulates heart precursor diversification in Drosophila
Johnson, Aaron N.; Mokalled, Mayssa H.; Haden, Tom N.; Olson, Eric N.
2011-01-01
Intercellular signal transduction pathways regulate the NK-2 family of transcription factors in a conserved gene regulatory network that directs cardiogenesis in both flies and mammals. The Drosophila NK-2 protein Tinman (Tin) was recently shown to regulate Stat92E, the Janus kinase (JAK) and Signal transducer and activator of transcription (Stat) pathway effector, in the developing mesoderm. To understand whether the JAK/Stat pathway also regulates cardiogenesis, we performed a systematic characterization of JAK/Stat signaling during mesoderm development. Drosophila embryos with mutations in the JAK/Stat ligand upd or in Stat92E have non-functional hearts with luminal defects and inappropriate cell aggregations. Using strong Stat92E loss-of-function alleles, we show that the JAK/Stat pathway regulates tin expression prior to heart precursor cell diversification. tin expression can be subdivided into four phases and, in Stat92E mutant embryos, the broad phase 2 expression pattern in the dorsal mesoderm does not restrict to the constrained phase 3 pattern. These embryos also have an expanded pericardial cell domain. We show the E(spl)-C gene HLHm5 is expressed in a pattern complementary to tin during phase 3 and that this expression is JAK/Stat dependent. In addition, E(spl)-C mutant embryos phenocopy the cardiac defects of Stat92E embryos. Mechanistically, JAK/Stat signals activate E(spl)-C genes to restrict Tin expression and the subsequent expression of the T-box transcription factor H15 to direct heart precursor diversification. This study is the first to characterize a role for the JAK/Stat pathway during cardiogenesis and identifies an autoregulatory circuit in which tin limits its own expression domain. PMID:21965617
Reynier, Frédéric; Petit, Fabien; Paye, Malick; Turrel-Davin, Fanny; Imbert, Pierre-Emmanuel; Hot, Arnaud; Mougin, Bruno; Miossec, Pierre
2011-01-01
The analysis of gene expression data shows that many genes display similarity in their expression profiles suggesting some co-regulation. Here, we investigated the co-expression patterns in gene expression data and proposed a correlation-based research method to stratify individuals. Using blood from rheumatoid arthritis (RA) patients, we investigated the gene expression profiles from whole blood using Affymetrix microarray technology. Co-expressed genes were analyzed by a biclustering method, followed by gene ontology analysis of the relevant biclusters. Taking the type I interferon (IFN) pathway as an example, a classification algorithm was developed from the 102 RA patients and extended to 10 systemic lupus erythematosus (SLE) patients and 100 healthy volunteers to further characterize individuals. We developed a correlation-based algorithm referred to as Classification Algorithm Based on a Biological Signature (CABS), an alternative to other approaches focused specifically on the expression levels. This algorithm applied to the expression of 35 IFN-related genes showed that the IFN signature presented a heterogeneous expression between RA, SLE and healthy controls which could reflect the level of global IFN signature activation. Moreover, the monitoring of the IFN-related genes during the anti-TNF treatment identified changes in type I IFN gene activity induced in RA patients. In conclusion, we have proposed an original method to analyze genes sharing an expression pattern and a biological function showing that the activation levels of a biological signature could be characterized by its overall state of correlation.
NASA Astrophysics Data System (ADS)
Song, Xiaoming; Duan, Weike; Huang, Zhinan; Liu, Gaofeng; Wu, Peng; Liu, Tongkun; Li, Ying; Hou, Xilin
2015-09-01
In plants, flowering is the most important transition from vegetative to reproductive growth. The flowering patterns of monocots and eudicots are distinctly different, but few studies have described the evolutionary patterns of the flowering genes in them. In this study, we analysed the evolutionary pattern, duplication and expression level of these genes. The main results were as follows: (i) characterization of flowering genes in monocots and eudicots, including the identification of family-specific, orthologous and collinear genes; (ii) full characterization of CONSTANS-like genes in Brassica rapa (BraCOL genes), the key flowering genes; (iii) exploration of the evolution of COL genes in plant kingdom and construction of the evolutionary pattern of COL genes; (iv) comparative analysis of CO and FT genes between Brassicaceae and Grass, which identified several family-specific amino acids, and revealed that CO and FT protein structures were similar in B. rapa and Arabidopsis but different in rice; and (v) expression analysis of photoperiod pathway-related genes in B. rapa under different photoperiod treatments by RT-qPCR. This analysis will provide resources for understanding the flowering mechanisms and evolutionary pattern of COL genes. In addition, this genome-wide comparative study of COL genes may also provide clues for evolution of other flowering genes.
Molecular characterization of ferulate 5-hydroxylase gene from kenaf (Hibiscus cannabinus L.)
USDA-ARS?s Scientific Manuscript database
The purpose of this research was to clone and characterize the expression pattern of a kenaf (Hibiscus cannabinus L.) F5H gene that encodes ferulate 5-hydroxylase in the phenylpropanoid pathway. Kenaf is well known as a fast growing dicotyledonous plant, which makes it a valuable biomass plant. The ...
Buchner, Peter; Hawkesford, Malcolm J.
2014-01-01
NPF (formerly referred to as low-affinity NRT1) and ‘high-affinity’ NRT2 nitrate transporter genes are involved in nitrate uptake by the root, and transport and distribution of nitrate within the plant. The NPF gene family consists of 53 members in Arabidopsis thaliana, however only 11 of these have been functionally characterized. Although homologous genes have been identified in genomes of different plant species including some cereals, there is little information available for wheat (Triticum aestivum). Sixteen genes were identified in wheat homologous to characterized Arabidopsis low-affinity nitrate transporter NPF genes, suggesting a complex wheat NPF gene family. The regulation of wheat NFP genes by plant N-status indicated involvement of these transporters in substrate transport in relation to N-metabolism. The complex expression pattern in relation to tissue specificity, nitrate availability and senescence may be associated with the complex growth patterns of wheat depending on sink/source demands, as well as remobilization during grain filling. PMID:24913625
Tanaka, Nobuaki K.; Dye, Louis; Stopfer, Mark
2010-01-01
Light and electron microscopy (LM and EM) both offer important advantages for characterizing neuronal circuitry in intact brains: LM can reveal the general patterns neurons trace between brain areas, and EM can confirm synaptic connections between identified neurons within a small area. In a few species, genetic labeling with fluorescent proteins has been used with LM to visualize many kinds of neurons and to analyze their morphologies and projection patterns. However, combining these large-scale patterns with the fine detail available in EM analysis has been a technical challenge. To analyze the synaptic connectivity of neurons expressing fluorescent markers with EM, we developed a dual-labeling method for use with pre-embedded brains. In Drosophila expressing genetic labels and also injected with markers we visualized synaptic connections among two populations of neurons in the AL, one of which has been shown to mediate a specific function, odor evoked neural oscillation. PMID:21074556
Happiness and the patterns of life: a study of geolocated tweets.
Frank, Morgan R; Mitchell, Lewis; Dodds, Peter Sheridan; Danforth, Christopher M
2013-01-01
The patterns of life exhibited by large populations have been described and modeled both as a basic science exercise and for a range of applied goals such as reducing automotive congestion, improving disaster response, and even predicting the location of individuals. However, these studies have had limited access to conversation content, rendering changes in expression as a function of movement invisible. In addition, they typically use the communication between a mobile phone and its nearest antenna tower to infer position, limiting the spatial resolution of the data to the geographical region serviced by each cellphone tower. We use a collection of 37 million geolocated tweets to characterize the movement patterns of 180,000 individuals, taking advantage of several orders of magnitude of increased spatial accuracy relative to previous work. Employing the recently developed sentiment analysis instrument known as the hedonometer, we characterize changes in word usage as a function of movement, and find that expressed happiness increases logarithmically with distance from an individual's average location.
Hayward, David C.; Hetherington, Suzannah; Behm, Carolyn A.; Grasso, Lauretta C.; Forêt, Sylvain; Miller, David J.; Ball, Eldon E.
2011-01-01
Background A successful metamorphosis from a planktonic larva to a settled polyp, which under favorable conditions will establish a future colony, is critical for the survival of corals. However, in contrast to the situation in other animals, e.g., frogs and insects, little is known about the molecular basis of coral metamorphosis. We have begun to redress this situation with previous microarray studies, but there is still a great deal to learn. In the present paper we have utilized a different technology, subtractive hybridization, to characterize genes differentially expressed across this developmental transition and to compare the success of this method to microarray. Methodology/Principal Findings Suppressive subtractive hybridization (SSH) was used to identify two pools of transcripts from the coral, Acropora millepora. One is enriched for transcripts expressed at higher levels at the pre-settlement stage, and the other for transcripts expressed at higher levels at the post-settlement stage. Virtual northern blots were used to demonstrate the efficacy of the subtractive hybridization technique. Both pools contain transcripts coding for proteins in various functional classes but transcriptional regulatory proteins were represented more frequently in the post-settlement pool. Approximately 18% of the transcripts showed no significant similarity to any other sequence on the public databases. Transcripts of particular interest were further characterized by in situ hybridization, which showed that many are regulated spatially as well as temporally. Notably, many transcripts exhibit axially restricted expression patterns that correlate with the pool from which they were isolated. Several transcripts are expressed in patterns consistent with a role in calcification. Conclusions We have characterized over 200 transcripts that are differentially expressed between the planula larva and post-settlement polyp of the coral, Acropora millepora. Sequence, putative function, and in some cases temporal and spatial expression are reported. PMID:22065994
A combinatorial code for pattern formation in Drosophila oogenesis.
Yakoby, Nir; Bristow, Christopher A; Gong, Danielle; Schafer, Xenia; Lembong, Jessica; Zartman, Jeremiah J; Halfon, Marc S; Schüpbach, Trudi; Shvartsman, Stanislav Y
2008-11-01
Two-dimensional patterning of the follicular epithelium in Drosophila oogenesis is required for the formation of three-dimensional eggshell structures. Our analysis of a large number of published gene expression patterns in the follicle cells suggests that they follow a simple combinatorial code based on six spatial building blocks and the operations of union, difference, intersection, and addition. The building blocks are related to the distribution of inductive signals, provided by the highly conserved epidermal growth factor receptor and bone morphogenetic protein signaling pathways. We demonstrate the validity of the code by testing it against a set of patterns obtained in a large-scale transcriptional profiling experiment. Using the proposed code, we distinguish 36 distinct patterns for 81 genes expressed in the follicular epithelium and characterize their joint dynamics over four stages of oogenesis. The proposed combinatorial framework allows systematic analysis of the diversity and dynamics of two-dimensional transcriptional patterns and guides future studies of gene regulation.
Gibbons, Taylor C; Metzger, David C H; Healy, Timothy M; Schulte, Patricia M
2017-05-01
Phenotypic plasticity is thought to facilitate the colonization of novel environments and shape the direction of evolution in colonizing populations. However, the relative prevalence of various predicted patterns of changes in phenotypic plasticity following colonization remains unclear. Here, we use a whole-transcriptome approach to characterize patterns of gene expression plasticity in the gills of a freshwater-adapted and a saltwater-adapted ecotype of threespine stickleback (Gasterosteus aculeatus) exposed to a range of salinities. The response of the gill transcriptome to environmental salinity had a large shared component common to both ecotypes (2159 genes) with significant enrichment of genes involved in transmembrane ion transport and the restructuring of the gill epithelium. This transcriptional response to freshwater acclimation is induced at salinities below two parts per thousand. There was also differentiation in gene expression patterns between ecotypes (2515 genes), particularly in processes important for changes in the gill structure and permeability. Only 508 genes that differed between ecotypes also responded to salinity and no specific processes were enriched among this gene set, and an even smaller number (87 genes) showed evidence of changes in the extent of the response to salinity acclimation between ecotypes. No pattern of relative expression dominated among these genes, suggesting that neither gains nor losses of plasticity dominated the changes in expression patterns between the ecotypes. These data demonstrate that multiple patterns of changes in gene expression plasticity can occur following colonization of novel habitats. © 2017 John Wiley & Sons Ltd.
Transcription Factors Expressed in Lateral Organ Boundaries: Identification of Downstream Targets
DOE Office of Scientific and Technical Information (OSTI.GOV)
Springer, Patricia S
2010-07-12
The processes of lateral organ initiation and patterning are central to the generation of mature plant form. Characterization of the molecular mechanisms underlying these processes is essential to our understanding of plant development. Communication between the shoot apical meristem and initiating organ primordia is important both for functioning of the meristem and for proper organ patterning, and very little is known about this process. In particular, the boundary between meristem and leaf is emerging as a critical region that is important for SAM maintenance and regulation of organogenesis. The goal of this project was to characterize three boundary-expressed genes thatmore » encode predicted transcription factors. Specifically, we have studied LATERAL ORGAN BOUNDARIES (LOB), LATERAL ORGAN FUSION1 (LOF1), and LATERAL ORGAN FUSION2 (LOF2). LOB encodes the founding member of the LOB-DOMAIN (LBD) plant-specific DNA binding transcription factor family and LOF1 and LOF2 encode paralogous MYB-domain transcription factors. We characterized the genetic relationship between these three genes and other boundary and meristem genes. We also used an ectopic inducible expression system to identify direct targets of LOB.« less
Gene expression characterizes different nutritional strategies among three mixotrophic protists.
Liu, Zhenfeng; Campbell, Victoria; Heidelberg, Karla B; Caron, David A
2016-07-01
Mixotrophic protists, i.e. protists that can carry out both phototrophy and heterotrophy, are a group of organisms with a wide range of nutritional strategies. The ecological and biogeochemical importance of these species has recently been recognized. In this study, we investigated and compared the gene expression of three mixotrophic protists, Prymnesium parvum, Dinobyron sp. and Ochromonas sp. under light and dark conditions in the presence of prey using RNA-Seq. Gene expression of the obligately phototrophic P. parvum and Dinobryon sp. changed significantly between light and dark treatments, while that of primarily heterotrophic Ochromonas sp. was largely unchanged. Gene expression of P. parvum and Dinobryon sp. shared many similarities, especially in the expression patterns of genes related to reproduction. However, key genes involved in central carbon metabolism and phagotrophy had different expression patterns between these two species, suggesting differences in prey consumption and heterotrophic nutrition in the dark. Transcriptomic data also offered clues to other physiological traits of these organisms such as preference of nitrogen sources and photo-oxidative stress. These results provide potential target genes for further exploration of the mechanisms of mixotrophic physiology and demonstrate the potential usefulness of molecular approaches in characterizing the nutritional modes of mixotrophic protists. © FEMS 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
NASA Technical Reports Server (NTRS)
Romano, Laura A.; Wray, Gregory A.
2003-01-01
Evolutionary changes in transcriptional regulation undoubtedly play an important role in creating morphological diversity. However, there is little information about the evolutionary dynamics of cis-regulatory sequences. This study examines the functional consequence of evolutionary changes in the Endo16 promoter of sea urchins. The Endo16 gene encodes a large extracellular protein that is expressed in the endoderm and may play a role in cell adhesion. Its promoter has been characterized in exceptional detail in the purple sea urchin, Strongylocentrotus purpuratus. We have characterized the structure and function of the Endo16 promoter from a second sea urchin species, Lytechinus variegatus. The Endo16 promoter sequences have evolved in a strongly mosaic manner since these species diverged approximately 35 million years ago: the most proximal region (module A) is conserved, but the remaining modules (B-G) are unalignable. Despite extensive divergence in promoter sequences, the pattern of Endo16 transcription is largely conserved during embryonic and larval development. Transient expression assays demonstrate that 2.2 kb of upstream sequence in either species is sufficient to drive GFP reporter expression that correctly mimics this pattern of Endo16 transcription. Reciprocal cross-species transient expression assays imply that changes have also evolved in the set of transcription factors that interact with the Endo16 promoter. Taken together, these results suggest that stabilizing selection on the transcriptional output may have operated to maintain a similar pattern of Endo16 expression in S. purpuratus and L. variegatus, despite dramatic divergence in promoter sequence and mechanisms of transcriptional regulation.
Hall, S G; Bieber, A J
1997-03-01
We have identified and characterized three embryonic lethal mutations that alter or abolish expression of Drosophila Neuroglian and have used these mutations to analyze Neuroglian function during development. Neuroglian is a member of the immunoglobulin superfamily. It is expressed by a variety of cell types during embryonic development, including expression on motoneurons and the muscle cells that they innervate. Examination of the nervous systems of neuroglian mutant embryos reveals that motoneurons have altered pathfinding trajectories. Additionally, the sensory cell bodies of the peripheral nervous system display altered morphology and patterning. Using a temperature-sensitive mutation, the phenocritical period for Neuroglian function was determined to occur during late embryogenesis, an interval which coincides with the period during which neuromuscular connections and the peripheral nervous system pattern are established.
A review of the immune molecules in the sea cucumber.
Xue, Zhuang; Li, Hui; Wang, Xiuli; Li, Xia; Liu, Yang; Sun, Jing; Liu, Cenjie
2015-05-01
It is very important to identify and characterize the immune-related genes that respond to pathogens. Until recently, only some of the immune-related genes in sea cucumbers had been characterized. Their expression patterns after pathogen challenges have been analyzed via expressed sequence tag libraries, microarray studies and proteomic approaches. These genes include lectins, antimicrobial peptides, lysozyme, enzymes, clotting protein, pattern recognition proteins, Toll receptors, complement C3 and other humoral factors that might participate in the innate immune system of sea cucumbers. Although the participation of some of these immune molecules in the sea cucumber's innate immune defense against invading pathogens has been demonstrated, the functions of many of the molecules remain unclear. This review focuses on the discovery and functional characterization of the immune-related molecules from the sea cucumber for the first time and provides new insights into the immune mechanisms of the sea cucumber, which opens new possibilities for developing drugs for novel anti-bacterial and antiviral applications in fisheries. Copyright © 2015 Elsevier Ltd. All rights reserved.
Genetic effects on gene expression across human tissues
2017-01-01
Characterization of the molecular function of the human genome and its variation across individuals is essential for identifying the cellular mechanisms that underlie human genetic traits and diseases. The Genotype-Tissue Expression (GTEx) project aims to characterize variation in gene expression levels across individuals and diverse tissues of the human body, many of which are not easily accessible. Here we describe genetic effects on gene expression levels across 44 human tissues. We find that local genetic variation affects gene expression levels for the majority of genes, and we further identify inter-chromosomal genetic effects for 93 genes and 112 loci. On the basis of the identified genetic effects, we characterize patterns of tissue specificity, compare local and distal effects, and evaluate the functional properties of the genetic effects. We also demonstrate that multi-tissue, multi-individual data can be used to identify genes and pathways affected by human disease-associated variation, enabling a mechanistic interpretation of gene regulation and the genetic basis of disease. PMID:29022597
Genetic effects on gene expression across human tissues.
Battle, Alexis; Brown, Christopher D; Engelhardt, Barbara E; Montgomery, Stephen B
2017-10-11
Characterization of the molecular function of the human genome and its variation across individuals is essential for identifying the cellular mechanisms that underlie human genetic traits and diseases. The Genotype-Tissue Expression (GTEx) project aims to characterize variation in gene expression levels across individuals and diverse tissues of the human body, many of which are not easily accessible. Here we describe genetic effects on gene expression levels across 44 human tissues. We find that local genetic variation affects gene expression levels for the majority of genes, and we further identify inter-chromosomal genetic effects for 93 genes and 112 loci. On the basis of the identified genetic effects, we characterize patterns of tissue specificity, compare local and distal effects, and evaluate the functional properties of the genetic effects. We also demonstrate that multi-tissue, multi-individual data can be used to identify genes and pathways affected by human disease-associated variation, enabling a mechanistic interpretation of gene regulation and the genetic basis of disease.
Alaerts, Kaat; Swinnen, Stephan P; Wenderoth, Nicole
2016-06-01
Autism spectrum disorders (ASD) are far more prevalent in males than in females. Little is known however about the differential neural expression of ASD in males and females. We used a resting-state fMRI-dataset comprising 42 males/42 females with ASD and 75 male/75 female typical-controls to examine whether autism-related alterations in intrinsic functional connectivity are similar or different in males and females, and particularly whether alterations reflect 'neural masculinization', as predicted by the Extreme Male Brain theory. Males and females showed a differential neural expression of ASD, characterized by highly consistent patterns of hypo-connectivity in males with ASD (compared to typical males), and hyper-connectivity in females with ASD (compared to typical females). Interestingly, patterns of hyper-connectivity in females with ASD reflected a shift towards the (high) connectivity levels seen in typical males (neural masculinization), whereas patterns of hypo-connectivity observed in males with ASD reflected a shift towards the (low) typical feminine connectivity patterns (neural feminization). Our data support the notion that ASD is a disorder of sexual differentiation rather than a disorder characterized by masculinization in both genders. Future work is needed to identify underlying factors such as sex hormonal alterations that drive these sex-specific neural expressions of ASD. © The Author (2016). Published by Oxford University Press. For Permissions, please email: journals.permissions@oup.com.
Characterization of NvLWamide-like neurons reveals stereotypy in Nematostella nerve net development.
Havrilak, Jamie A; Faltine-Gonzalez, Dylan; Wen, Yiling; Fodera, Daniella; Simpson, Ayanna C; Magie, Craig R; Layden, Michael J
2017-11-15
The organization of cnidarian nerve nets is traditionally described as diffuse with randomly arranged neurites that show minimal reproducibility between animals. However, most observations of nerve nets are conducted using cross-reactive antibodies that broadly label neurons, which potentially masks stereotyped patterns produced by individual neuronal subtypes. Additionally, many cnidarians species have overt structures such as a nerve ring, suggesting higher levels of organization and stereotypy exist, but mechanisms that generated that stereotypy are unknown. We previously demonstrated that NvLWamide-like is expressed in a small subset of the Nematostella nerve net and speculated that observing a few neurons within the developing nerve net would provide a better indication of potential stereotypy. Here we document NvLWamide-like expression more systematically. NvLWamide-like is initially expressed in the typical neurogenic salt and pepper pattern within the ectoderm at the gastrula stage, and expression expands to include endodermal salt and pepper expression at the planula larval stage. Expression persists in both ectoderm and endoderm in adults. We characterized our NvLWamide-like::mCherry transgenic reporter line to visualize neural architecture and found that NvLWamide-like is expressed in six neural subtypes identifiable by neural morphology and location. Upon completing development the numbers of neurons in each neural subtype are minimally variable between animals and the projection patterns of each subtype are consistent. Furthermore, between the juvenile polyp and adult stages the number of neurons for each subtype increases. We conclude that development of the Nematostella nerve net is stereotyped between individuals. Our data also imply that one aspect of generating adult cnidarian nervous systems is to modify the basic structural architecture generated in the juvenile by increasing neural number proportionally with size. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.
Ibarra-Laclette, Enrique; Méndez-Bravo, Alfonso; Pérez-Torres, Claudia Anahí; Albert, Victor A; Mockaitis, Keithanne; Kilaru, Aruna; López-Gómez, Rodolfo; Cervantes-Luevano, Jacob Israel; Herrera-Estrella, Luis
2015-08-13
Avocado (Persea americana) is an economically important tropical fruit considered to be a good source of fatty acids. Despite its importance, the molecular and cellular characterization of biochemical and developmental processes in avocado is limited due to the lack of transcriptome and genomic information. The transcriptomes of seeds, roots, stems, leaves, aerial buds and flowers were determined using different sequencing platforms. Additionally, the transcriptomes of three different stages of fruit ripening (pre-climacteric, climacteric and post-climacteric) were also analyzed. The analysis of the RNAseqatlas presented here reveals strong differences in gene expression patterns between different organs, especially between root and flower, but also reveals similarities among the gene expression patterns in other organs, such as stem, leaves and aerial buds (vegetative organs) or seed and fruit (storage organs). Important regulators, functional categories, and differentially expressed genes involved in avocado fruit ripening were identified. Additionally, to demonstrate the utility of the avocado gene expression atlas, we investigated the expression patterns of genes implicated in fatty acid metabolism and fruit ripening. A description of transcriptomic changes occurring during fruit ripening was obtained in Mexican avocado, contributing to a dynamic view of the expression patterns of genes involved in fatty acid biosynthesis and the fruit ripening process.
Winterhoff, Boris J; Maile, Makayla; Mitra, Amit Kumar; Sebe, Attila; Bazzaro, Martina; Geller, Melissa A; Abrahante, Juan E; Klein, Molly; Hellweg, Raffaele; Mullany, Sally A; Beckman, Kenneth; Daniel, Jerry; Starr, Timothy K
2017-03-01
The purpose of this study was to determine the level of heterogeneity in high grade serous ovarian cancer (HGSOC) by analyzing RNA expression in single epithelial and cancer associated stromal cells. In addition, we explored the possibility of identifying subgroups based on pathway activation and pre-defined signatures from cancer stem cells and chemo-resistant cells. A fresh, HGSOC tumor specimen derived from ovary was enzymatically digested and depleted of immune infiltrating cells. RNA sequencing was performed on 92 single cells and 66 of these single cell datasets passed quality control checks. Sequences were analyzed using multiple bioinformatics tools, including clustering, principle components analysis, and geneset enrichment analysis to identify subgroups and activated pathways. Immunohistochemistry for ovarian cancer, stem cell and stromal markers was performed on adjacent tumor sections. Analysis of the gene expression patterns identified two major subsets of cells characterized by epithelial and stromal gene expression patterns. The epithelial group was characterized by proliferative genes including genes associated with oxidative phosphorylation and MYC activity, while the stromal group was characterized by increased expression of extracellular matrix (ECM) genes and genes associated with epithelial-to-mesenchymal transition (EMT). Neither group expressed a signature correlating with published chemo-resistant gene signatures, but many cells, predominantly in the stromal subgroup, expressed markers associated with cancer stem cells. Single cell sequencing provides a means of identifying subpopulations of cancer cells within a single patient. Single cell sequence analysis may prove to be critical for understanding the etiology, progression and drug resistance in ovarian cancer. Copyright © 2017 Elsevier Inc. All rights reserved.
Asperger Syndrome (For Parents)
... Happens in AS? AS is characterized by poor social interactions, obsessions, odd speech patterns, few facial expressions, and ... AS have trouble showing empathy for others, and social interactions continue to be difficult. Experts say that AS ...
G-protein coupled receptor expression patterns delineate medulloblastoma subgroups
2013-01-01
Background Medulloblastoma is the most common malignant brain tumor in children. Genetic profiling has identified four principle tumor subgroups; each subgroup is characterized by different initiating mutations, genetic and clinical profiles, and prognoses. The two most well-defined subgroups are caused by overactive signaling in the WNT and SHH mitogenic pathways; less is understood about Groups 3 and 4 medulloblastoma. Identification of tumor subgroup using molecular classification is set to become an important component of medulloblastoma diagnosis and staging, and will likely guide therapeutic options. However, thus far, few druggable targets have emerged. G-protein coupled receptors (GPCRs) possess characteristics that make them ideal targets for molecular imaging and therapeutics; drugs targeting GPCRs account for 30-40% of all current pharmaceuticals. While expression patterns of many proteins in human medulloblastoma subgroups have been discerned, the expression pattern of GPCRs in medulloblastoma has not been investigated. We hypothesized that analysis of GPCR expression would identify clear subsets of medulloblastoma and suggest distinct GPCRs that might serve as molecular targets for both imaging and therapy. Results Our study found that medulloblastoma tumors fall into distinct clusters based solely on GPCR expression patterns. Normal cerebellum clustered separately from the tumor samples. Further, two of the tumor clusters correspond with high fidelity to the WNT and SHH subgroups of medulloblastoma. Distinct over-expressed GPCRs emerge; for example, LGR5 and GPR64 are significantly and uniquely over-expressed in the WNT subgroup of tumors, while PTGER4 is over-expressed in the SHH subgroup. Uniquely under-expressed GPCRs were also observed. Our key findings were independently validated using a large international dataset. Conclusions Our results identify GPCRs with potential to act as imaging and therapeutic targets. Elucidating tumorigenic pathways is a secondary benefit to identifying differential GPCR expression patterns in medulloblastoma tumors. PMID:24252460
HLA-C expression pattern is spatially different between psoriasis and eczema skin lesions.
Carlén, Lina; Sakuraba, Kazuko; Ståhle, Mona; Sánchez, Fabio
2007-02-01
Interactions between genetic and environmental factors underlie the immune dysregulation and keratinocyte abnormalities that characterize psoriasis. Among known psoriasis susceptibility loci (PSORS), PSORS1 on chromosome 6 has the strongest association to disease. Altered expression of some PSORS1 candidate genes has been reported but little is known about HLA-C expression in psoriasis. This study compared expression of major histocompatibility complex class Ia and HLA-C in psoriasis, allergic contact eczema, and normal skin. Although HLA-C was abundant in protein extracts from both eczema and psoriasis, a consistent and intriguing difference in the expression pattern was observed; strong immunoreactivity in the basal cell layer, polarized towards the basement membrane in psoriasis, whereas in eczema lesions HLA-C immunostaining was present mostly in suprabasal cells. Inflammatory cells in the dermis were strongly stained in both diseases. Normal skin epithelium showed less intense but similar HLA-C staining as eczema lesions. HLA class Ia expression overall resembled that of HLA-C in all samples. The distinct HLA-C expression patterns in psoriasis and eczema suggest a functional role in the specific psoriasis immune response and not only a general feature of inflammation.
Villar-Cerviño, Verona; Rocancourt, Claire; Menuet, Arnaud; Da Silva, Corinne; Wincker, Patrick; Anadón, Ramón; Mazan, Sylvie; Rodicio, Maria Celina
2010-09-01
Vesicular glutamate transporters (VGLUTs) accumulate glutamate into synaptic vesicles of glutamatergic neurons, and thus are considered to define the phenotype of these neurons. Glutamate also appears to play a role in the development of the nervous system of vertebrates. Here we report the characterization of a vesicular glutamate transporter of lamprey (lVGluT), a novel member of the VGluT gene family. Phylogenetic analysis indicates that lVGLUT cannot be assigned to any of the three VGLUT isoforms characterized in teleosts and mammals, suggesting that these classes may have been fixed after the splitting between cyclostomes and gnathostomes. Expression pattern analysis during lamprey embryogenesis and prolarval stages shows that lVGluT expression is restricted to the nervous system. The first structure to express lVGluT was the olfactory epithelium of late embryos. In the brain of early prolarvae, lVGluT was expressed in most of the neuronal populations that generate the early axonal scaffold. lVGluT expression was also observed in neuronal populations of the rhombencephalon and spinal cord and in ganglia of the branchiomeric, octaval and posterior lateral line nerves. In the rhombencephalon, lVGluT expression appears to be spatially restricted in dorsal and ventral longitudinal domains. Comparison of the early expression of VGluT genes between the lamprey and some anamniotan gnathostomes (frog, zebrafish) reveals a conserved expression pattern, likely to reflect ancestral vertebrate characteristics. 2010 Elsevier B.V. All rights reserved.
Characterization of the replication cycle of the Lymantria dispar nuclear polyhedrosis virus
Christopher I. Riegel; James M. Slavicek
1997-01-01
The life cycle of the Lymantria dispar nuclear polyhedrosis virus (LdMNPV) was characterized through analysis of budded virus (BV) release, the temporal formation of polyhedra, the temporal transcription pattern of representative early, late, and hyper-expressed late genes, and the onset of DNA replication in the Ld652Y cell line. Transcripts from...
Günthner, Roman; Kumar, Vankayala Ramaiah Santhosh; Lorenz, Georg; Anders, Hans-Joachim; Lech, Maciej
2013-01-01
The cell type-, organ-, and species-specific expression of the pattern-recognition receptors (PRRs) are well described but little is known about the respective expression profiles of their negative regulators. We therefore determined the mRNA expression levels of A20, CYLD, DUBA, ST2, CD180, SIGIRR, TANK, SOCS1, SOCS3, SHIP, IRAK-M, DOK1, DOK2, SHP1, SHP2, TOLLIP, IRF4, SIKE, NLRX1, ERBIN, CENTB1, and Clec4a2 in human and mouse solid organs. Humans and mice displayed significant differences between their respective mRNA expression patterns of these factors. Additionally, we characterized their expression profiles in mononuclear blood cells upon bacterial endotoxin, which showed a consistent induction of A20, SOCS3, IRAK-M, and Clec4a2 in human and murine cells. Furthermore, we studied the expression pattern in transient kidney ischemia-reperfusion injury versus post-ischemic atrophy and fibrosis in mice. A20, CD180, ST2, SOCS1, SOCS3, SHIP, IRAK-M, DOK1, DOK2, IRF4, CENTB1, and Clec4a2 were all induced, albeit at different times of injury and repair. Progressive fibrosis was associated with a persistent induction of these factors. Thus, the organ- and species-specific expression patterns need to be considered in the design and interpretation of studies related to PRR-mediated innate immunity, which seems to be involved in tissue injury, tissue regeneration and in progressive tissue scarring. PMID:24009023
Chiou, Chung-Yi; Wu, Keqiang; Yeh, Kai-Wun
2008-10-01
Tissue-specific promoters are required for plant molecular breeding to drive a target gene in the appropriate location in plants. A chromoplast-specific, carotenoid-associated gene (OgCHRC) and its promoter (Pchrc) were isolated from Oncidium orchid and characterized. Northern blot analysis revealed that OgCHRC is specifically expressed in flowers, not in roots and leaves. Transient expression assay of Pchrc by bombardment transformation confirmed its differential expression pattern in floral tissues of different horticulture plants and cell-type location in conical papillate cells of adaxial epidermis of flower. These results suggest that Pchrc could serve as a useful tool in ornamental plant biotechnology to modify flower color.
Proteomic Characterization of Host Response to Yersinia pestis
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chromy, B; Perkins, J; Heidbrink, J
Host-pathogen interactions result in protein expression changes within both the host and the pathogen. Here, results from proteomic characterization of host response following exposure to Yersinia pestis, the causative agent of plague, and to two near neighbors, Y. pseudotuberculosis and Y. enterocolitica, are reported. Human monocyte-like cells were chosen as a model for macrophage immune response to pathogen exposure. Two-dimensional electrophoresis followed by mass spectrometry was used to identify host proteins with differential expression following exposure to these three closely related Yersinia species. This comparative proteomic characterization of host response clearly shows that host protein expression patterns are distinct formore » the different pathogen exposures, and contributes to further understanding of Y. pestis virulence and host defense mechanisms. This work also lays the foundation for future studies aimed at defining biomarkers for presymptomatic detection of plague.« less
Complex genomic rearrangement in CCS-LacZ transgenic mice.
Stroud, Dina Myers; Darrow, Bruce J; Kim, Sang Do; Zhang, Jie; Jongbloed, Monique R M; Rentschler, Stacey; Moskowitz, Ivan P G; Seidman, Jonathan; Fishman, Glenn I
2007-02-01
The cardiac conduction system (CCS)-lacZ insertional mouse mutant strain genetically labels the developing and mature CCS. This pattern of expression is presumed to reflect the site of transgene integration rather than regulatory elements within the transgene proper. We sought to characterize the genomic structure of the integration locus and identify nearby gene(s) that might potentially confer the observed CCS-specific transcription. We found rearrangement of chromosome 7 between regions D1 and E1 with altered transcription of multiple genes in the D1 region. Several lines of evidence suggested that regulatory elements from at least one gene, Slco3A1, influenced CCS-restricted reporter gene expression. In embryonic hearts, Slco3A1 was expressed in a spatial pattern similar to the CCS-lacZ transgene and was similarly neuregulin-responsive. At later stages, however, expression patterns of the transgene and Slco3A1 diverged, suggesting that the Slco3A1 locus may be necessary, but not sufficient to confer CCS-specific transgene expression in the CCS-lacZ line. (c) 2007 Wiley-Liss, Inc.
Zhang, Dapeng; Xiong, Huiling; Mennigen, Jan A; Popesku, Jason T; Marlatt, Vicki L; Martyniuk, Christopher J; Crump, Kate; Cossins, Andrew R; Xia, Xuhua; Trudeau, Vance L
2009-06-05
Many vertebrates, including the goldfish, exhibit seasonal reproductive rhythms, which are a result of interactions between external environmental stimuli and internal endocrine systems in the hypothalamo-pituitary-gonadal axis. While it is long believed that differential expression of neuroendocrine genes contributes to establishing seasonal reproductive rhythms, no systems-level investigation has yet been conducted. In the present study, by analyzing multiple female goldfish brain microarray datasets, we have characterized global gene expression patterns for a seasonal cycle. A core set of genes (873 genes) in the hypothalamus were identified to be differentially expressed between May, August and December, which correspond to physiologically distinct stages that are sexually mature (prespawning), sexual regression, and early gonadal redevelopment, respectively. Expression changes of these genes are also shared by another brain region, the telencephalon, as revealed by multivariate analysis. More importantly, by examining one dataset obtained from fish in October who were kept under long-daylength photoperiod (16 h) typical of the springtime breeding season (May), we observed that the expression of identified genes appears regulated by photoperiod, a major factor controlling vertebrate reproductive cyclicity. Gene ontology analysis revealed that hormone genes and genes functionally involved in G-protein coupled receptor signaling pathway and transmission of nerve impulses are significantly enriched in an expression pattern, whose transition is located between prespawning and sexually regressed stages. The existence of seasonal expression patterns was verified for several genes including isotocin, ependymin II, GABA(A) gamma2 receptor, calmodulin, and aromatase b by independent samplings of goldfish brains from six seasonal time points and real-time PCR assays. Using both theoretical and experimental strategies, we report for the first time global gene expression patterns throughout a breeding season which may account for dynamic neuroendocrine regulation of seasonal reproductive development.
Mennigen, Jan A.; Popesku, Jason T.; Marlatt, Vicki L.; Martyniuk, Christopher J.; Crump, Kate; Cossins, Andrew R.; Xia, Xuhua; Trudeau, Vance L.
2009-01-01
Background Many vertebrates, including the goldfish, exhibit seasonal reproductive rhythms, which are a result of interactions between external environmental stimuli and internal endocrine systems in the hypothalamo-pituitary-gonadal axis. While it is long believed that differential expression of neuroendocrine genes contributes to establishing seasonal reproductive rhythms, no systems-level investigation has yet been conducted. Methodology/Principal Findings In the present study, by analyzing multiple female goldfish brain microarray datasets, we have characterized global gene expression patterns for a seasonal cycle. A core set of genes (873 genes) in the hypothalamus were identified to be differentially expressed between May, August and December, which correspond to physiologically distinct stages that are sexually mature (prespawning), sexual regression, and early gonadal redevelopment, respectively. Expression changes of these genes are also shared by another brain region, the telencephalon, as revealed by multivariate analysis. More importantly, by examining one dataset obtained from fish in October who were kept under long-daylength photoperiod (16 h) typical of the springtime breeding season (May), we observed that the expression of identified genes appears regulated by photoperiod, a major factor controlling vertebrate reproductive cyclicity. Gene ontology analysis revealed that hormone genes and genes functionally involved in G-protein coupled receptor signaling pathway and transmission of nerve impulses are significantly enriched in an expression pattern, whose transition is located between prespawning and sexually regressed stages. The existence of seasonal expression patterns was verified for several genes including isotocin, ependymin II, GABAA gamma2 receptor, calmodulin, and aromatase b by independent samplings of goldfish brains from six seasonal time points and real-time PCR assays. Conclusions/Significance Using both theoretical and experimental strategies, we report for the first time global gene expression patterns throughout a breeding season which may account for dynamic neuroendocrine regulation of seasonal reproductive development. PMID:19503831
Ray, Sumanta; Hossain, Sk Md Mosaddek; Khatun, Lutfunnesa; Mukhopadhyay, Anirban
2017-12-20
Alzheimer's disease (AD) is a chronic neuro-degenerative disruption of the brain which involves in large scale transcriptomic variation. The disease does not impact every regions of the brain at the same time, instead it progresses slowly involving somewhat sequential interaction with different regions. Analysis of the expression patterns of the genes in different regions of the brain influenced in AD surely contribute for a enhanced comprehension of AD pathogenesis and shed light on the early characterization of the disease. Here, we have proposed a framework to identify perturbation and preservation characteristics of gene expression patterns across six distinct regions of the brain ("EC", "HIP", "PC", "MTG", "SFG", and "VCX") affected in AD. Co-expression modules were discovered considering a couple of regions at once. These are then analyzed to know the preservation and perturbation characteristics. Different module preservation statistics and a rank aggregation mechanism have been adopted to detect the changes of expression patterns across brain regions. Gene ontology (GO) and pathway based analysis were also carried out to know the biological meaning of preserved and perturbed modules. In this article, we have extensively studied the preservation patterns of co-expressed modules in six distinct brain regions affected in AD. Some modules are emerged as the most preserved while some others are detected as perturbed between a pair of brain regions. Further investigation on the topological properties of preserved and non-preserved modules reveals a substantial association amongst "betweenness centrality" and "degree" of the involved genes. Our findings may render a deeper realization of the preservation characteristics of gene expression patterns in discrete brain regions affected by AD.
NASA Technical Reports Server (NTRS)
Story, Michael; Stivers, David N.
2004-01-01
This project was funded as a pilot project to determine the feasibility of using gene expression profiles to characterize the response of human cells to exposure to particulate radiations such as those encountered in the spaceflight environment. We proposed to use microarray technology to examine the gene expression patterns of a bank of well-characterized human fibroblast cell cultures. These fibroblast cultures were derived from breast or head and neck cancer patients who exhibited normal, minimal, or severe normal tissue reactions following low LET radiation exposure via radiotherapy. Furthermore, determination of SF2 values from fibroblasts cultured from these individuals were predictive of risk for severe late reactions. We hypothesized that by determining the expression of thousands of genes we could identify gene expression patterns that reflect how normal tissues respond to high Z and energy (HZE) particles, that is, that there are molecular signatures for HZE exposures. We also hypothesized that individuals who are intrinsically radiosensitive may elicit a unique response. Because this was funded as a pilot project we focused our initial studies on logistics and appropriate experimental design, and then to test our hypothesis that there is a unique molecular response to specific particles, in this case C and Fe, for primary human skin fibroblasts.
Chemokine and Chemokine Receptor Profiles in Metastatic Salivary Adenoid Cystic Carcinoma.
Mays, Ashley C; Feng, Xin; Browne, James D; Sullivan, Christopher A
2016-08-01
To characterize the chemokine pattern in metastatic salivary adenoid cystic carcinoma (SACC). Real-time polymerase chain reaction (RT-PCR) was used to compare chemokine and chemokine receptor gene expression in two SACC cell lines: SACC-83 and SACC-LM (lung metastasis). Chemokines and receptor genes were then screened and their expression pattern characterized in human tissue samples of non-recurrent SACC and recurrent SACC with perineural invasion. Expression of chemokine receptors C5AR1, CCR1, CCR3, CCR6, CCR7, CCR9, CCR10, CXCR4, CXCR6, CXCR7, CCRL1 and CCRL2 were higher in SACC-83 compared to SACC-LM. CCRL1, CCBP2, CMKLR1, XCR1 and CXCR2 and 6 chemokine genes (CCL13, CCL27, CXCL14, CMTM1, CMTM2, CKLF) were more highly expressed in tissues of patients without tumor recurrence/perineural invasion compared to those with tumor recurrence. CCRL1 (receptor), CCL27, CMTM1, CMTM2, and CKLF (chemokine) genes were more highly expressed in SACC-83 and human tissues of patients without tumor recurrence/perineural invasion. CCRL1, CCL27, CMTM1, CMTM2 and CKLF may play important roles in the development of tumor metastases in SACC. Copyright© 2016 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.
USDA-ARS?s Scientific Manuscript database
The main aim of this study was to improve the detection of Babesia (B.) spp. in naturally infected cattle in Egypt. In addition, we analyzed the pattern of expression of selected cytokine genes in response to infection of bovines with B. bovis and B. bigemina. Infections were detected using both, tr...
Dynamic expression patterns of ECM molecules in the developing mouse olfactory pathway
Shay, Elaine L.; Greer, Charles A.; Treloar, Helen B.
2009-01-01
Olfactory sensory neuron (OSN) axons follow stereotypic spatio-temporal paths in the establishment of the olfactory pathway. Extracellular matrix (ECM) molecules are expressed early in the developing pathway and are proposed to have a role in its initial establishment. During later embryonic development, OSNs sort out and target specific glomeruli to form precise, complex topographic projections. We hypothesized that ECM cues may help to establish this complex topography. The aim of this study was to characterize expression of ECM molecules during the period of glomerulogenesis, when synaptic contacts are forming. We examined expression of laminin-1, perlecan, tenascin-C and CSPGs and found a coordinated pattern of expression of these cues in the pathway. These appear to restrict axons to the pathway while promoting axon outgrowth within. Thus, ECM molecules are present in dynamic spatio-temporal positions to affect OSN axons as they navigate to the olfactory bulb and establish synapses. PMID:18570250
A regulatory toolbox of MiniPromoters to drive selective expression in the brain.
Portales-Casamar, Elodie; Swanson, Douglas J; Liu, Li; de Leeuw, Charles N; Banks, Kathleen G; Ho Sui, Shannan J; Fulton, Debra L; Ali, Johar; Amirabbasi, Mahsa; Arenillas, David J; Babyak, Nazar; Black, Sonia F; Bonaguro, Russell J; Brauer, Erich; Candido, Tara R; Castellarin, Mauro; Chen, Jing; Chen, Ying; Cheng, Jason C Y; Chopra, Vik; Docking, T Roderick; Dreolini, Lisa; D'Souza, Cletus A; Flynn, Erin K; Glenn, Randy; Hatakka, Kristi; Hearty, Taryn G; Imanian, Behzad; Jiang, Steven; Khorasan-zadeh, Shadi; Komljenovic, Ivana; Laprise, Stéphanie; Liao, Nancy Y; Lim, Jonathan S; Lithwick, Stuart; Liu, Flora; Liu, Jun; Lu, Meifen; McConechy, Melissa; McLeod, Andrea J; Milisavljevic, Marko; Mis, Jacek; O'Connor, Katie; Palma, Betty; Palmquist, Diana L; Schmouth, Jean-François; Swanson, Magdalena I; Tam, Bonny; Ticoll, Amy; Turner, Jenna L; Varhol, Richard; Vermeulen, Jenny; Watkins, Russell F; Wilson, Gary; Wong, Bibiana K Y; Wong, Siaw H; Wong, Tony Y T; Yang, George S; Ypsilanti, Athena R; Jones, Steven J M; Holt, Robert A; Goldowitz, Daniel; Wasserman, Wyeth W; Simpson, Elizabeth M
2010-09-21
The Pleiades Promoter Project integrates genomewide bioinformatics with large-scale knockin mouse production and histological examination of expression patterns to develop MiniPromoters and related tools designed to study and treat the brain by directed gene expression. Genes with brain expression patterns of interest are subjected to bioinformatic analysis to delineate candidate regulatory regions, which are then incorporated into a panel of compact human MiniPromoters to drive expression to brain regions and cell types of interest. Using single-copy, homologous-recombination "knockins" in embryonic stem cells, each MiniPromoter reporter is integrated immediately 5' of the Hprt locus in the mouse genome. MiniPromoter expression profiles are characterized in differentiation assays of the transgenic cells or in mouse brains following transgenic mouse production. Histological examination of adult brains, eyes, and spinal cords for reporter gene activity is coupled to costaining with cell-type-specific markers to define expression. The publicly available Pleiades MiniPromoter Project is a key resource to facilitate research on brain development and therapies.
Sánchez, Joaquín; Medina, Gerardo; Buhse, Thomas; Holmgren, Jan; Soberón-Chavez, Gloria
2004-03-01
The regulatory systems controlling expression of the ctxAB genes encoding cholera toxin (CT) in the classical and El Tor biotypes of pathogenic Vibrio cholerae have been characterized and found to be almost identical. Notwithstanding this, special in vitro conditions, called AKI conditions, are required for El Tor bacteria to produce CT. The AKI conditions involve biphasic cultures. In phase 1 the organism is grown in a still tube for 4 h. In phase 2 the medium is poured into a flask to continue growth with shaking. Virtually no expression of CT occurs if this protocol is not followed. Here we demonstrated that CT expression takes place in single-phase still cultures if the volume-to-surface-area ratio is decreased, both under air and under an inert atmosphere. The expression of key genes involved in the regulation of CT production was analyzed, and we found that the expression pattern closely resembles the in vivo expression pattern.
Tang, Xin; Liu, Huawei; Chen, Quanmei; Wang, Xin; Xiong, Ying; Zhao, Ping
2016-01-01
The solute carrier 6 (SLC6) gene family, initially known as the neurotransmitter transporters, plays vital roles in the regulation of neurotransmitter signaling, nutrient absorption and motor behavior. In this study, a total of 16 candidate genes were identified as SLC6 family gene homologs in the silkworm (Bombyx mori) genome. Spatio-temporal expression patterns of silkworm SLC6 gene transcripts indicated that these genes were highly and specifically expressed in midgut, brain and gonads; moreover, these genes were expressed primarily at the feeding stage or adult stage. Levels of expression for most midgut-specific and midgut-enriched gene transcripts were down-regulated after starvation but up-regulated after re-feeding. In addition, we observed that expression levels of these genes except for BmSLC6-15 and BmGT1 were markedly up-regulated by a juvenile hormone analog. Moreover, brain-enriched genes showed differential expression patterns during wandering and mating processes, suggesting that these genes may be involved in modulating wandering and mating behaviors. Our results improve our understanding of the expression patterns and potential physiological functions of the SLC6 gene family, and provide valuable information for the comprehensive functional analysis of the SLC6 gene family. PMID:27706106
Tang, Xin; Liu, Huawei; Chen, Quanmei; Wang, Xin; Xiong, Ying; Zhao, Ping
2016-10-03
The solute carrier 6 (SLC6) gene family, initially known as the neurotransmitter transporters, plays vital roles in the regulation of neurotransmitter signaling, nutrient absorption and motor behavior. In this study, a total of 16 candidate genes were identified as SLC6 family gene homologs in the silkworm (Bombyx mori) genome. Spatio-temporal expression patterns of silkworm SLC6 gene transcripts indicated that these genes were highly and specifically expressed in midgut, brain and gonads; moreover, these genes were expressed primarily at the feeding stage or adult stage. Levels of expression for most midgut-specific and midgut-enriched gene transcripts were down-regulated after starvation but up-regulated after re-feeding. In addition, we observed that expression levels of these genes except for BmSLC6-15 and BmGT1 were markedly up-regulated by a juvenile hormone analog. Moreover, brain-enriched genes showed differential expression patterns during wandering and mating processes, suggesting that these genes may be involved in modulating wandering and mating behaviors. Our results improve our understanding of the expression patterns and potential physiological functions of the SLC6 gene family, and provide valuable information for the comprehensive functional analysis of the SLC6 gene family.
Saito, Yasuhiko; Zhang, Yue; Yanagawa, Yuchio
2015-04-01
Although it has been proposed that neurons that contain both acetylcholine (ACh) and γ-aminobutyric acid (GABA) are present in the prepositus hypoglossi nucleus (PHN), these neurons have not been characterized because of the difficulty in identifying them. In the present study, PHN neurons that express both choline acetyltransferase and the vesicular GABA transporter (VGAT) were identified using double-transgenic rats, in which the cholinergic and inhibitory neurons express the fluorescent proteins tdTomato and Venus, respectively. To characterize the neurons that express both tdTomato and Venus (D+ neurons), the afterhyperpolarization (AHP) profiles and firing patterns of these neurons were investigated via whole-cell recordings of brainstem slice preparations. Regarding the three AHP profiles and four firing patterns that the D+ neurons exhibited, an AHP with an afterdepolarization and a firing pattern that exhibited a delay in the generation of the first spike were the preferential properties of these neurons. In the three morphological types classified, the multipolar type that exhibited radiating dendrites was predominant among the D+ neurons. Immunocytochemical analysis revealed that the VGAT-immunopositive axonal boutons that expressed tdTomato were primarily located in the dorsal cap of inferior olive (IO) and the PHN. Although the PHN receives cholinergic inputs from the pedunculopontine tegmental nucleus and laterodorsal tegmental nucleus, D+ neurons were absent from these brain areas. Together, these results suggest that PHN neurons that co-express ACh and GABA exhibit specific electrophysiological and morphological properties, and innervate the dorsal cap of the IO and the PHN. © 2015 Federation of European Neuroscience Societies and John Wiley & Sons Ltd.
Dobyns, Abigail E.; Goyal, Ravi; Carpenter, Lauren Grisham; Freeman, Tom C.; Longo, Lawrence D.; Yellon, Steven M.
2015-01-01
As the critical gatekeeper for birth, prepartum remodeling of the cervix is associated with increased resident macrophages (Mφ), proinflammatory processes, and extracellular matrix degradation. This study tested the hypothesis that expression of genes unique to Mφs characterizes the prepartum from unremodeled nonpregnant cervix. Perfused cervix from prepartum day 21 postbreeding (D21) or nonpregnant (NP) rats, with or without Mφs, had RNA extracted and whole genome microarray analysis performed. By subtractive analyses, expression of 194 and 120 genes related to Mφs in the cervix from D21 rats were increased and decreased, respectively. In both D21 and NP groups, 158 and 57 Mφ genes were also more or less up- or down-regulated, respectively. Mφ gene expression patterns were most strongly correlated within groups and in 5 major clustering patterns. In the cervix from D21 rats, functional categories and canonical pathways of increased expression by Mφ gene related to extracellular matrix, cell proliferation, differentiation, as well as cell signaling. Pathways were characteristic of inflammation and wound healing, e.g., CD163, CD206, and CCR2. Signatures of only inflammation pathways, e.g., CSF1R, EMR1, and MMP12 were common to both D21 and NP groups. Thus, a novel and complex balance of Mφ genes and clusters differentiated the degraded extracellular matrix and cellular genomic activities in the cervix before birth from the unremodeled state. Predicted Mφ activities, pathways, and networks raise the possibility that expression patterns of specific genes characterize and promote prepartum remodeling of the cervix for parturition at term and with preterm labor. PMID:25811906
USDA-ARS?s Scientific Manuscript database
Matrix metalloproteinase-13 (MMP-13), referred to as collagenase-3, is a proteolytic enzyme that plays a key role in degradation and remodelling of host extracellularmatrix proteins. The objective of this study was to characterize the MMP-13 gene in channel catfish, and to determine its pattern of e...
Platre, Matthieu Pierre; Barberon, Marie; Caillieux, Erwann; Colot, Vincent
2016-01-01
Summary Multicellular organisms are composed of many cell types that acquire their specific fate through a precisely controlled pattern of gene expression in time and space dictated in part by cell type-specific promoter activity. Understanding the contribution of highly specialized cell types in the development of a whole organism requires the ability to isolate or analyze different cell types separately. We have characterized and validated a large collection of root cell type-specific promoters and have generated cell type-specific marker lines. These benchmarked promoters can be readily used to evaluate cell type-specific complementation of mutant phenotypes, or to knockdown gene expression using targeted expression of artificial miRNA. We also generated vectors and characterized transgenic lines for cell type-specific induction of gene expression and cell type-specific isolation of nuclei for RNA and chromatin profiling. Vectors and seeds from transgenic Arabidopsis plants will be freely available, and will promote rapid progress in cell type-specific functional genomics. We demonstrate the power of this promoter set for analysis of complex biological processes by investigating the contribution of root cell types in the IRT1-dependent root iron uptake. Our findings revealed the complex spatial expression pattern of IRT1 in both root epidermis and phloem companion cells and the requirement for IRT1 to be expressed in both cell types for proper iron homeostasis. PMID:26662936
Pescatori, Mario; Broccolini, Aldobrando; Minetti, Carlo; Bertini, Enrico; Bruno, Claudio; D'amico, Adele; Bernardini, Camilla; Mirabella, Massimiliano; Silvestri, Gabriella; Giglio, Vincenzo; Modoni, Anna; Pedemonte, Marina; Tasca, Giorgio; Galluzzi, Giuliana; Mercuri, Eugenio; Tonali, Pietro A; Ricci, Enzo
2007-04-01
Genome-wide gene expression profiling of skeletal muscle from Duchenne muscular dystrophy (DMD) patients has been used to describe muscle tissue alterations in DMD children older than 5 years. By studying the expression profile of 19 patients younger than 2 years, we describe with high resolution the gene expression signature that characterizes DMD muscle during the initial or "presymptomatic" phase of the disease. We show that in the first 2 years of the disease, DMD muscle is already set to express a distinctive gene expression pattern considerably different from the one expressed by normal, age-matched muscle. This "dystrophic" molecular signature is characterized by a coordinate induction of genes involved in the inflammatory response, extracellular matrix (ECM) remodeling and muscle regeneration, and the reduced transcription of those involved in energy metabolism. Despite the lower degree of muscle dysfunction experienced, our younger patients showed abnormal expression of most of the genes reported as differentially expressed in more advanced stages of the disease. By analyzing our patients as a time series, we provide evidence that some genes, including members of three pathways involved in morphogenetic signaling-Wnt, Notch, and BMP-are progressively induced or repressed in the natural history of DMD.
Arabidopsis gene expression patterns are altered during spaceflight
NASA Astrophysics Data System (ADS)
Paul, Anna-Lisa; Popp, Michael P.; Gurley, William B.; Guy, Charles; Norwood, Kelly L.; Ferl, Robert J.
The exposure of Arabidopsis thaliana (Arabidopsis) plants to spaceflight environments results in differential gene expression. A 5-day mission on orbiter Columbia in 1999 (STS-93) carried transgenic Arabidopsis plants engineered with a transgene composed of the alcohol dehydrogenase (Adh) gene promoter linked to the β-Glucuronidase (GUS) reporter gene. The plants were used to evaluate the effects of spaceflight on gene expression patterns initially by using the Adh/GUS transgene to address specifically the possibility that spaceflight induces a hypoxic stress response (Paul, A.L., Daugherty, C.J., Bihn, E.A., Chapman, D.K., Norwood, K.L., Ferl, R.J., 2001. Transgene expression patterns indicate that spaceflight affects stress signal perception and transduction in arabidopsis, Plant Physiol. 126, 613-621). As a follow-on to the reporter gene analysis, we report here the evaluation of genome-wide patterns of native gene expression within Arabidopsis shoots utilizing the Agilent DNA array of 21,000 Arabidopsis genes. As a control for the veracity of the array analyses, a selection of genes was further characterized with quantitative Real-Time RT PCR (ABI - Taqman®). Comparison of the patterns of expression for arrays probed with RNA isolated from plants exposed to spaceflight compared to RNA isolated from ground control plants revealed 182 genes that were differentially expressed in response to the spaceflight mission by more than 4-fold, and of those only 50 genes were expressed at levels chosen to support a conservative change call. None of the genes that are hallmarks of hypoxic stress were induced to this level. However, genes related to heat shock were dramatically induced - but in a pattern and under growth conditions that are not easily explained by elevated temperatures. These gene expression data are discussed in light of current models for plant responses to the spaceflight environment and with regard to potential future spaceflight experiment opportunities.
Molecular and Functional Characterization of Broccoli EMBRYONIC FLOWER 2 Genes
Chen, Long-Fang O.; Lin, Chun-Hung; Lai, Ying-Mi; Huang, Jia-Yuan; Sung, Zinmay Renee
2012-01-01
Polycomb group (PcG) proteins regulate major developmental processes in Arabidopsis. EMBRYONIC FLOWER 2 (EMF2), the VEFS domain-containing PcG gene, regulates diverse genetic pathways and is required for vegetative development and plant survival. Despite widespread EMF2-like sequences in plants, little is known about their function other than in Arabidopsis and rice. To study the role of EMF2 in broccoli (Brassica oleracea var. italica cv. Elegance) development, we identified two broccoli EMF2 (BoEMF2) genes with sequence homology to and a similar gene expression pattern to that in Arabidopsis (AtEMF2). Reducing their expression in broccoli resulted in aberrant phenotypes and gene expression patterns. BoEMF2 regulates genes involved in diverse developmental and stress programs similar to AtEMF2 in Arabidopsis. However, BoEMF2 differs from AtEMF2 in the regulation of flower organ identity, cell proliferation and elongation, and death-related genes, which may explain the distinct phenotypes. The expression of BoEMF2.1 in the Arabidopsis emf2 mutant (Rescued emf2) partially rescued the mutant phenotype and restored the gene expression pattern to that of the wild type. Many EMF2-mediated molecular and developmental functions are conserved in broccoli and Arabidopsis. Furthermore, the restored gene expression pattern in Rescued emf2 provides insights into the molecular basis of PcG-mediated growth and development. PMID:22537758
Li, Yan-Jun; Zhu, Shou-Hong; Zhang, Xin-Yu; Liu, Yong-Chang; Xue, Fei; Zhao, Lan-Jie; Sun, Jie
2017-06-12
Cotton fiber, a natural fiber widely used in the textile industry, is differentiated from single cell of ovule epidermis. A large number of genes are believed to be involved in fiber formation, but so far only a few fiber genes have been isolated and functionally characterized in this developmental process. The Kinesin13 subfamily was found to play key roles during cell division and cell elongation, and was considered to be involved in the regulation of cotton fiber development. The full length of coding sequence of GhKIS13A1 was cloned using cDNA from cotton fiber for functional characterization. Expression pattern analysis showed that GhKIS13A1 maintained a lower expression level during cotton fiber development. Biochemical assay showed that GhKIS13A1 has microtubule binding activity and basal ATPase activity that can be activated significantly by the presence of microtubules. Overexpression of GhKIS13A1 in Arabidopsis reduced leaf trichomes and the percentage of three-branch trichomes, and increased two-branch and shriveled trichomes compared to wild-type. Additionally, the expression of GhKIS13A1 in the Arabidopsis Kinesin-13a-1 mutant rescued the defective trichome branching pattern of the mutant, making its overall trichome branching pattern back to normal. Our results suggested that GhKIS13A1 is functionally compatible with AtKinesin-13A regarding their role in regulating the number and branching pattern of leaf trichomes. Given the developmental similarities between cotton fibers and Arabidopsis trichomes, it is speculated that GhKIS13A1 may also be involved in the regulation of cotton fiber development.
Chen, Lin; Yang, Yang; Liu, Can; Zheng, Yanyan; Xu, Mingshuang; Wu, Na; Sheng, Jiping; Shen, Lin
2015-08-28
WRKY transcription factors play an important role in cold defense of plants. However, little information is available about the cold-responsive WRKYs in tomato (Solanum lycopersicum). In the present study, a complete characterization of this gene family was described. Eighty WRKY genes in the tomato genome were identified. Almost all WRKY genes contain putative stress-responsive cis-elements in their promoter regions. Segmental duplications contributed significantly to the expansion of the SlWRKY gene family. Transcriptional analysis revealed notable differential expression in tomato tissues and expression patterns under cold stress, which indicated wide functional divergence in this family. Ten WRKYs in tomato were strongly induced more than 2-fold during cold stress. These genes represented candidate genes for future functional analysis of WRKYs involved in the cold-related signal pathways. Our data provide valuable information about tomato WRKY proteins and form a foundation for future studies of these proteins, especially for those that play an important role in response to cold stress. Copyright © 2015 Elsevier Inc. All rights reserved.
Physiological role of ghrelin as revealed by the ghrelin and GOAT knockout mice.
Kang, Kihwa; Zmuda, Erik; Sleeman, Mark W
2011-11-01
Ghrelin is a gastric hormone that has been shown to regulate food intake and energy metabolism. One unique feature of ghrelin is that its activity is regulated post transcriptionally by ghrelin O-acyltransferase (GOAT) through the addition of fatty acid to the serine residue in the N terminal region. Despite much biochemical characterization, to date no other proteins have been shown to be specifically octonylated by GOAT, suggesting a unique matching of the acyl transferase for a single ligand, ghrelin. If this is indeed correct, then genetic deletion of ghrelin or GOAT should produce near identical phenotypes and there should be extensive overlap in expression patterns. This review summarizes the similarities and differences in the phenotypes with the genetic deletion of ghrelin and GOAT in the various knockout mouse lines reported to date. While there is considerable overlap in expression pattern between ghrelin and GOAT, the latter does exhibit some unique tissue expression that could suggest that additional peptides may be acylated and await discovery and characterization. Copyright © 2011 Elsevier Inc. All rights reserved.
The expression patterns of pro-apoptotic and anti-apoptotic factors in human fetal and adult ovary.
Poljicanin, Ana; Vukusic Pusic, Tanja; Vukojevic, Katarina; Caric, Ana; Vilovic, Katarina; Tomic, Snjezana; Soljic, Violeta; Saraga-Babic, Mirna
2013-07-01
The influence of pro-apoptotic Bax and anti-apoptotic Bcl-2 proteins on the cell death (caspase-3, TUNEL) of different ovarian cell lineages was immunohistochemically analyzed in six fetal and five adult human ovaries in order to disclose possible mechanisms of cell number control. Mild to moderate expression of Bcl-2 characterized ovarian surface epithelium, follicular cells and oocytes of 15 and 22 week human ovaries, while expression of Bax and caspase-3 gradually increased in all ovarian cell populations, except caspase-3 in the ovarian surface epithelium. Different levels of Bax and Bcl-2 proteins co-expression characterized fetal ovarian cells, while TUNEL and caspase-3 co-expression was found only in some of them. In adult ovaries, Bcl-2 was moderately and Bax strongly expressed in the surface ovarian epithelium and stroma. Bcl-2 and Bax expression in granulosa and theca interna cells varied depending on the stage of follicular atresia. Caspase-3 apoptotic cells characterized granulosa cells of adult atretic follicles. Our results indicate that intracellular levels of Bcl-2 and Bax protein might regulate the final destiny of developing germ cells. Caspase-3 dependent apoptosis seems to be the most important, but not the only cell death pathway in ovaries. In adult ovaries, caspase-dependent cell death characterized granulosa cells, but not the germ cells. Copyright © 2012 Elsevier GmbH. All rights reserved.
Kim, Sabrina Y; Renihan, Maia K; Boulianne, Gabrielle L
2006-06-01
PDZ (PSD-95, Discs-large, ZO-1) domain proteins often function as scaffolding proteins and have been shown to play important roles in diverse cellular processes such as the establishment and maintenance of cell polarity, and signal transduction. Here, we report the identification and cloning of a novel Drosophila melanogaster gene that is predicted to produce several different PDZ domain-containing proteins through alternative promoter usage and alternative splicing. This gene, that we have named big bang (bbg), was first identified as C96-GAL4, a GAL4 enhancer trap line that was generated in our lab. To further characterize bbg, its expression pattern was examined in ovaries, embryos, and late third instar larvae using UAS reporter gene constructs, in situ hybridization, or immunocytochemistry. In addition, the expression of alternatively spliced transcripts was examined in more detail using in situ hybridization. We find that during embryogenesis bbg is predominantly expressed in the developing gut, but it is also expressed in external sensory organs found in the epidermis. In the late third instar larva, bbg is expressed along the presumptive wing margin in the wing disc, broadly in the eye disc, and in other imaginal discs as well as in the brain. The expression patterns observed are dynamic and specific during development, suggesting that like other genes that encode for several different PDZ domain protein isoforms, bbg likely plays important roles in multiple developmental processes.
Profile of new green fluorescent protein transgenic Jinhua pigs as an imaging source
NASA Astrophysics Data System (ADS)
Kawarasaki, Tatsuo; Uchiyama, Kazuhiko; Hirao, Atsushi; Azuma, Sadahiro; Otake, Masayoshi; Shibata, Masatoshi; Tsuchiya, Seiko; Enosawa, Shin; Takeuchi, Koichi; Konno, Kenjiro; Hakamata, Yoji; Yoshino, Hiroyuki; Wakai, Takuya; Ookawara, Shigeo; Tanaka, Hozumi; Kobayashi, Eiji; Murakami, Takashi
2009-09-01
Animal imaging sources have become an indispensable material for biological sciences. Specifically, gene-encoded biological probes serve as stable and high-performance tools to visualize cellular fate in living animals. We use a somatic cell cloning technique to create new green fluorescent protein (GFP)-expressing Jinhua pigs with a miniature body size, and characterized the expression profile in various tissues/organs and ex vivo culture conditions. The born GFP-transgenic pig demonstrate an organ/tissue-dependent expression pattern. Strong GFP expression is observed in the skeletal muscle, pancreas, heart, and kidney. Regarding cellular levels, bone-marrow-derived mesenchymal stromal cells, hepatocytes, and islet cells of the pancreas also show sufficient expression with the unique pattern. Moreover, the cloned pigs demonstrate normal growth and fertility, and the introduced GFP gene is stably transmitted to pigs in subsequent generations. The new GFP-expressing Jinhua pigs may be used as new cellular/tissue light resources for biological imaging in preclinical research fields such as tissue engineering, experimental regenerative medicine, and transplantation.
Joshi, Sandeep S; Tandukar, Bishal; Castaneda, Maira; Jiang, Shunlin; Diwakar, Ganesh; Hertzano, Ronna P; Hornyak, Thomas J
2018-01-01
Melanocytes are neural crest-derived cells that are responsible for mammalian hair follicle (HF) pigmentation. The Dct-LacZ transgenic mouse is extensively used to study melanocyte biology but lacks conditionally-inducible labelling and fluorescent labelling, enabling specific, viable isolation of melanocytes using fluorescence-activated cell sorting (FACS). Here, we have generated a Tet-off bitransgenic mouse model, Dct-H2BGFP, containing Dct-tTA and TRE-H2BGFP transgenes. Characterization of Dct-H2BGFP mice confirmed a pattern of Dct-H2BGFP expression in melanoblasts, melanocyte stem cells (McSCs), and terminally differentiated melanocytes similar to the expression pattern of previously published mouse models Dct-LacZ and iDct-GFP. GFP expression is regulated by doxycycline. GFP is shown to co-localize with melanocyte label-retaining cells (LRCs) identified through BrdU retention. The GFP-expressing cells identified in vivo in the bulge and the secondary hair germ of telogen HFs of Dct-H2BGFP mice express the melanocyte and melanocyte stem cell markers Dct and Kit. Using Dct-H2BGFP mice, we separated GFP-expressing cells from the telogen HF based on FACS and showed that GFP-expressing cells express high levels of Kit and Dct, and lower levels of HF epithelial keratin genes. We also show that GFP-expressing cells express high levels of the melanocyte differentiation genes Tyr, Tyrp1, and Pmel17, further substantiating their identity within the melanocyte lineage. Thus, Dct-H2BGFP mice are not only useful for the in vivo identification of melanocytic cells, but also for isolating them viably and studying their molecular and biological properties. Published by Elsevier B.V.
Balachandar, Arjun; Prescott, Steven A
2018-05-01
Distinct spiking patterns may arise from qualitative differences in ion channel expression (i.e. when different neurons express distinct ion channels) and/or when quantitative differences in expression levels qualitatively alter the spike generation process. We hypothesized that spiking patterns in neurons of the superficial dorsal horn (SDH) of spinal cord reflect both mechanisms. We reproduced SDH neuron spiking patterns by varying densities of K V 1- and A-type potassium conductances. Plotting the spiking patterns that emerge from different density combinations revealed spiking-pattern regions separated by boundaries (bifurcations). This map suggests that certain spiking pattern combinations occur when the distribution of potassium channel densities straddle boundaries, whereas other spiking patterns reflect distinct patterns of ion channel expression. The former mechanism may explain why certain spiking patterns co-occur in genetically identified neuron types. We also present algorithms to predict spiking pattern proportions from ion channel density distributions, and vice versa. Neurons are often classified by spiking pattern. Yet, some neurons exhibit distinct patterns under subtly different test conditions, which suggests that they operate near an abrupt transition, or bifurcation. A set of such neurons may exhibit heterogeneous spiking patterns not because of qualitative differences in which ion channels they express, but rather because quantitative differences in expression levels cause neurons to operate on opposite sides of a bifurcation. Neurons in the spinal dorsal horn, for example, respond to somatic current injection with patterns that include tonic, single, gap, delayed and reluctant spiking. It is unclear whether these patterns reflect five cell populations (defined by distinct ion channel expression patterns), heterogeneity within a single population, or some combination thereof. We reproduced all five spiking patterns in a computational model by varying the densities of a low-threshold (K V 1-type) potassium conductance and an inactivating (A-type) potassium conductance and found that single, gap, delayed and reluctant spiking arise when the joint probability distribution of those channel densities spans two intersecting bifurcations that divide the parameter space into quadrants, each associated with a different spiking pattern. Tonic spiking likely arises from a separate distribution of potassium channel densities. These results argue in favour of two cell populations, one characterized by tonic spiking and the other by heterogeneous spiking patterns. We present algorithms to predict spiking pattern proportions based on ion channel density distributions and, conversely, to estimate ion channel density distributions based on spiking pattern proportions. The implications for classifying cells based on spiking pattern are discussed. © 2018 The Authors. The Journal of Physiology published by John Wiley & Sons Ltd on behalf of The Physiological Society.
Luo, Jie; Xu, Pei; Cao, Peijian; Wan, Hongjian; Lv, Xiaonan; Xu, Shengchun; Wang, Gangjun; Cook, Melloni N.; Jones, Byron C.; Lu, Lu; Wang, Xusheng
2018-01-01
Although the link between stress and alcohol is well recognized, the underlying mechanisms of how they interplay at the molecular level remain unclear. The purpose of this study is to identify molecular networks underlying the effects of alcohol and stress responses, as well as their interaction on anxiety behaviors in the hippocampus of mice using a systems genetics approach. Here, we applied a gene co-expression network approach to transcriptomes of 41 BXD mouse strains under four conditions: stress, alcohol, stress-induced alcohol and control. The co-expression analysis identified 14 modules and characterized four expression patterns across the four conditions. The four expression patterns include up-regulation in no restraint stress and given an ethanol injection (NOE) but restoration in restraint stress followed by an ethanol injection (RSE; pattern 1), down-regulation in NOE but rescue in RSE (pattern 2), up-regulation in both restraint stress followed by a saline injection (RSS) and NOE, and further amplification in RSE (pattern 3), and up-regulation in RSS but reduction in both NOE and RSE (pattern 4). We further identified four functional subnetworks by superimposing protein-protein interactions (PPIs) to the 14 co-expression modules, including γ-aminobutyric acid receptor (GABA) signaling, glutamate signaling, neuropeptide signaling, cAMP-dependent signaling. We further performed module specificity analysis to identify modules that are specific to stress, alcohol, or stress-induced alcohol responses. Finally, we conducted causality analysis to link genetic variation to these identified modules, and anxiety behaviors after stress and alcohol treatments. This study underscores the importance of integrative analysis and offers new insights into the molecular networks underlying stress and alcohol responses. PMID:29674951
Suksuwan, Worramin; Cai, Xiaoli; Ngernsiri, Lertluk; Baumgartner, Stefan
2017-01-01
The oriental fruit fly, Bactrocera dorsalis, is regarded as a severe pest of fruit production in Asia. Despite its economic importance, only limited information regarding the molecular and developmental biology of this insect is known to date. We provide a detailed analysis of B. dorsalis embryology, as well as the expression patterns of a number of segmentation genes known to act during patterning of Drosophila and compare these to the patterns of other insect families. An anterior shift of the expression of gap genes was detected when compared to Drosophila. This shift was largely restored during the step where the gap genes control expression of the pair-rule genes. We analyzed and compared the shapes of the embryos of insects of different families, B. dorsalis and the blow fly Lucilia sericata with that of the well-characterized Drosophila melanogaster. We found distinct shapes as well as differences in the ratios of the length of the anterior-posterior axis and the dorsal-ventral axis. These features were integrated into a profile of how the expression patterns of the gap gene Krüppel and the pair-rule gene even-skipped were observed along the A-P axis in three insects families. Since significant differences were observed, we discuss how Krüppel controls the even-skipped stripes. Furthermore, we discuss how the position and angles of the segmentation gene stripes differed from other insects. Finally, we analyzed the outcome of the expression patterns of the late acting segment polarity genes in relation to the anlagen of the naked-cuticle and denticle belt area of the B. dorsalis larva.
Multiple Pesticides Detoxification Function of Maize (Zea mays) GST34.
Li, Dongzhi; Xu, Li; Pang, Sen; Liu, Zhiqian; Zhao, Weisong; Wang, Chengju
2017-03-08
ZmGST34 is a maize Tau class GST gene and was found to be differently expressed between two maize cultivars differing in tolerance to herbicide metolachlor. To explore the possible role of ZmGST34 in maize development, the expression pattern and substrate specificity of ZmGST34 were characterized by quantitative RT-PCR and heterologous expression system, respectively. The results indicated that the expression level of ZmGST34 was increased ∼2-5-fold per day during the second-leaf stage of maize seedling. Chloroacetanilide herbicides or phytohormone treatments had no influence on the expression level of ZmGST34, suggesting that ZmGST34 is a constitutively expressed gene in maize seedling. Heterologous expression in Escherichia coli and in Arabidopsis thaliana proved that ZmGST34 can metabolize most chloroacetanilide herbicides and increase tolerance to these herbicides in transgenic Arabidopsis thaliana. The constitutive expression pattern and broad substrate activity of ZmGST34 suggested that this gene may play an important role in maize development in addition to the detoxification of pesticides.
Molecular anatomy of the developing limb in the coquí frog, Eleutherodactylus coqui.
Gross, Joshua B; Kerney, Ryan; Hanken, James; Tabin, Clifford J
2011-01-01
The vertebrate limb demonstrates remarkable similarity in basic organization across phylogenetically disparate groups. To gain further insight into how this morphological similarity is maintained in different developmental contexts, we explored the molecular anatomy of size-reduced embryos of the Puerto Rican coquí frog, Eleutherodactylus coqui. This animal demonstrates direct development, a life-history strategy marked by rapid progression from egg to adult and absence of a free-living, aquatic larva. Nonetheless, coquí exhibits a basal anuran limb structure, with four toes on the forelimb and five toes on the hind limb. We investigated the extent to which coquí limb bud development conforms to the model of limb development derived from amniote studies. Toward this end, we characterized dynamic patterns of expression for 13 critical patterning genes across three principle stages of limb development. As expected, most genes demonstrate expression patterns that are essentially unchanged compared to amniote species. For example, we identified an EcFgf8-expression domain within the apical ectodermal ridge (AER). This expression pattern defines a putatively functional AER signaling domain, despite the absence of a morphological ridge in coquí embryos. However, two genes, EcMeis2 and EcAlx4, demonstrate altered domains of expression, which imply a potential shift in gene function between coquí frogs and amniote model systems. Unexpectedly, several genes thought to be critical for limb patterning in other systems, including EcFgf4, EcWnt3a, EcWnt7a, and EcGremlin, demonstrated no evident expression pattern in the limb at the three stages we analyzed. The absence of EcFgf4 and EcWnt3a expression during limb patterning is perhaps not surprising, given that neither gene is critical for proper limb development in the mouse, based on knockout and expression analyses. In contrast, absence of EcWnt7a and EcGremlin is surprising, given that expression of these molecules appears to be absolutely essential in all other model systems so far examined. Although this analysis substantiates the existence of a core set of ancient limb-patterning molecules, which likely mediate identical functions across highly diverse vertebrate forms, it also reveals remarkable evolutionary flexibility in the genetic control of a conserved morphological pattern across evolutionary time. © 2011 Wiley Periodicals, Inc.
Battelle, Barbara-Anne; Kempler, Karen E.; Saraf, Spencer R.; Marten, Catherine E.; Dugger, Donald R.; Speiser, Daniel I.; Oakley, Todd H.
2015-01-01
The eyes of the horseshoe crab Limulus polyphemus have long been used for studies of basic mechanisms of vision, and the structure and physiology of Limulus photoreceptors have been examined in detail. Less is known about the opsins Limulus photoreceptors express. We previously characterized a UV opsin (LpUVOps1) that is expressed in all three types of Limulus eyes (lateral compound eyes, median ocelli and larval eyes) and three visible light-sensitive rhabdomeric opsins (LpOps1, -2 and -5) that are expressed in Limulus lateral compound and larval eyes. Physiological studies showed that visible light-sensitive photoreceptors are also present in median ocelli, but the visible light-sensitive opsins they express were unknown. In the current study we characterize three newly identified, visible light-sensitive rhabdomeric opsins (LpOps6, -7 and -8) that are expressed in median ocelli. We show that they are ocellar specific and that all three are co-expressed in photoreceptors distinct from those expressing LpUVOps1. Our current findings show that the pattern of opsin expression in Limulus eyes is much more complex than previously thought and extend our previous observations of opsin co-expression in visible light-sensitive Limulus photoreceptors. We also characterize a Limulus peropsin/RGR (LpPerOps1). We examine the phylogenetic relationship of LpPerOps1 with other peropsins and RGRs, demonstrate that LpPerOps1 transcripts are expressed in each of the three types of Limulus eyes and show that the encoded protein is expressed in membranes of cells closely associated with photoreceptors in each eye type. These finding suggest that peropsin was in the opsin repertoire of euchelicerates. PMID:25524988
Cal, Laura; MegÍas, Manuel; Cerdá-Reverter, José Miguel; Postlethwait, John H; Braasch, Ingo; Rotllant, Josep
2017-11-01
Dorsoventral pigment patterning, characterized by a light ventrum and a dark dorsum, is one of the most widespread chromatic adaptations in vertebrate body coloration. In mammals, this countershading depends on differential expression of agouti-signaling protein (ASIP), which drives a switch of synthesis of one type of melanin to another within melanocytes. Teleost fish share countershading, but the pattern results from a differential distribution of multiple types of chromatophores, with black-brown melanophores most abundant in the dorsal body and reflective iridophores most abundant in the ventral body. We previously showed that Asip1 (a fish ortholog of mammalian ASIP) plays a role in patterning melanophores. This observation leads to the surprising hypothesis that agouti may control an evolutionarily conserved pigment pattern by regulating different mechanisms in mammals and fish. To test this hypothesis, we compared two ray-finned fishes: the teleost zebrafish and the nonteleost spotted gar (Lepisosteus oculatus). By examining the endogenous pattern of asip1 expression in gar, we demonstrate a dorsoventral-graded distribution of asip1 expression that is highest ventrally, similar to teleosts. Additionally, in the first reported experiments to generate zebrafish transgenic lines carrying a bacterial artificial chromosome (BAC) from spotted gar, we show that both transgenic zebrafish lines embryos replicate the endogenous asip1 expression pattern in adult zebrafish, showing that BAC transgenes from both species contain all of the regulatory elements required for regular asip1 expression within adult ray-finned fishes. These experiments provide evidence that the mechanism leading to an environmentally important pigment pattern was likely in place before the origin of teleosts. © 2017 Wiley Periodicals, Inc.
Characterization of choline transporters in the human placenta over gestation.
Baumgartner, Heidi K; Trinder, Kinsey M; Galimanis, Carly E; Post, Annalisa; Phang, Tzu; Ross, Randal G; Winn, Virginia D
2015-12-01
The developing fetus relies on the maternal blood supply to provide the choline it requires for making membrane lipids, synthesizing acetylcholine, and performing important methylation reactions. It is vital, therefore, that the placenta is efficient at transporting choline from the maternal to the fetal circulation. Although choline transporters have been found in term placenta samples, little is known about what cell types express specific choline transporters and how expression of the transporters may change over gestation. The objective of this study was to characterize choline transporter expression levels and localization in the human placenta throughout placental development. We analyzed CTL1 and -2 expression over gestation in human placental biopsies from 6 to 40 weeks gestation (n = 6-10 per gestational window) by immunoblot analysis. To determine the cellular expression pattern of the choline transporters throughout gestation, immunofluorescence analysis was then performed. Both CTL1 and CTL2 were expressed in the chorionic villi from 6 weeks gestation to term. Labor did not alter expression levels of either transporter. CTL1 localized to the syncytial trophoblasts and the endothelium of the fetal vasculature within the chorionic villous structure. CTL2 localized mainly to the stroma early in gestation and by the second trimester co-localized with CTL1 at the fetal vasculature. The differential expression pattern of CTL1 and CTL2 suggests that CTL1 is the key transporter involved in choline transport from maternal circulation and both transporters are likely involved in stromal and endothelial cell choline transport. Copyright © 2015 Elsevier Ltd. All rights reserved.
Su, Lina; Zhou, Fengjuan; Ding, Zhujin; Gao, Zexia; Wen, Jiufu; Wei, Wei; Wang, Qijun; Wang, Weimin; Liu, Hong
2015-12-01
Doublesex and Mab3 related transcription factor (DMRT), characterized by a conserved DM domain, function as sex-related transcription factors and also play critical roles in ontogenesis. In this study, 4 Dmrt genes in the blunt snout bream, Megalobrama amblycephala, were identified, characterized and their mRNA expression in different adult organs, during embryogenesis and gonadal development in larvae were determined by quantitative real time PCR. There are 4 Dmrt1 isoforms in the M. amblycephala genome, which were expressed highly in the testis and weakly in the ovary. The complete cDNAs of the M. amblycephala Dmrt2a, Dmrt2b and Dmrt3 were predicted to encode 510, 328 and 449 amino acids, respectively. The M. amblycephala Dmrt2a mRNA peaked at 11hpf (hour post fertilizing) during early embryonic stages, while Dmrt2b was highly expressed during late embryonic stages. Both the M. amblycephala Dmrt2a and Dmrt2b were expressed highly in the gill and exhibited a sexually dimorphic expression pattern. The M. amblycephala Dmrt3 was expressed highly in the gill, muscle and brain, at 40dph (day post hatching) during early development and at stage V in the testis during gonadal development. All fish Dmrts except Dmrt5 were found in the M. amblycephala genome. The observed expression patterns of these Dmrts in developing embryos and larvae, as well as different adult organs indicate conserved sexual or extragonadal functions of the Dmrts through evolution. Copyright © 2015 Elsevier B.V. All rights reserved.
Characterization of Choline Transporters in the Human Placenta over Gestation
Baumgartner, Heidi K.; Trinder, Kinsey M.; Galimanis, Carly E.; Post, Annalisa; Phang, Tzu; Ross, Randal G.; Winn, Virginia D.
2015-01-01
INTRODUCTION The developing fetus relies on the maternal blood supply to provide the choline it requires for making membrane lipids, synthesizing acetylcholine, and performing important methylation reactions. It is vital, therefore, that the placenta is efficient at transporting choline from maternal to fetal circulation. Although choline transporters have been found in term placenta samples, little is known about what cell types express specific choline transporters and how expression of the transporters may change over gestation. The objective of this study was to characterize choline transporter expression levels and localization in the human placenta throughout placental development. METHODS We analyzed CTL1 and −2 expression over gestation in human placental biopsies from 6 to 40 weeks gestation (n=6–10 per gestational window) by immunoblot analysis. To determine the cellular expression pattern of the choline transporters throughout gestation, immunofluorescence analysis was then performed. RESULTS Both CTL1 and CTL2 were expressed in the chorionic villi from 6 weeks gestation to term. Labor did not alter expression levels of either transporter. CTL1 localized to the syncytial trophoblasts and the endothelium of the fetal vasculature within the chorionic villous structure. CTL2 localized mainly to the stroma early in gestation and by the second trimester co-localized with CTL1 at the fetal vasculature. DISCUSSION The differential expression pattern of CTL1 and CTL2 suggests that CTL1 is the key transporter involved in choline transport from maternal circulation and both transporters are likely involved in stromal and endothelial cell choline transport. PMID:26601765
Differential expression of neuroligin genes in the nervous system of zebrafish.
Davey, Crystal; Tallafuss, Alexandra; Washbourne, Philip
2010-02-01
The establishment and maturation of appropriate synaptic connections is crucial in the development of neuronal circuits. Cellular adhesion is believed to play a central role in this process. Neuroligins are neuronal cell adhesion molecules that are hypothesized to act in the initial formation and maturation of synaptic connections. In order to establish the zebrafish as a model to investigate the in vivo role of Neuroligin proteins in nervous system development, we identified the zebrafish orthologs of neuroligin family members and characterized their expression. Zebrafish possess seven neuroligin genes. Synteny analysis and sequence comparisons show that NLGN2, NLGN3, and NLGN4X are duplicated in zebrafish, but NLGN1 has a single zebrafish ortholog. All seven zebrafish neuroligins are expressed in complex patterns in the developing nervous system and in the adult brain. The spatial and temporal expression patterns of these genes suggest that they occupy a role in nervous system development and maintenance.
ImpulseDE: detection of differentially expressed genes in time series data using impulse models.
Sander, Jil; Schultze, Joachim L; Yosef, Nir
2017-03-01
Perturbations in the environment lead to distinctive gene expression changes within a cell. Observed over time, those variations can be characterized by single impulse-like progression patterns. ImpulseDE is an R package suited to capture these patterns in high throughput time series datasets. By fitting a representative impulse model to each gene, it reports differentially expressed genes across time points from a single or between two time courses from two experiments. To optimize running time, the code uses clustering and multi-threading. By applying ImpulseDE , we demonstrate its power to represent underlying biology of gene expression in microarray and RNA-Seq data. ImpulseDE is available on Bioconductor ( https://bioconductor.org/packages/ImpulseDE/ ). niryosef@berkeley.edu. Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com
Patterns of expression of position-dependent integrated transgenes in mouse embryo.
Bonnerot, C; Grimber, G; Briand, P; Nicolas, J F
1990-01-01
The abilities to introduce foreign DNA into the genome of mice and to visualize gene expression at the single-cell level underlie a method for defining individual elements of a genetic program. We describe the use of an Escherichia coli lacZ reporter gene fused to the promoter of the gene for hypoxanthine phosphoribosyl transferase that is expressed in all tissues. Most transgenic mice (six of seven) obtained with this construct express the lacZ gene from the hypoxanthine phosphoribosyltransferase promoter. Unexpectedly, however, the expression is temporally and spatially regulated. Each transgenic line is characterized by a specific, highly reproducible pattern of lacZ expression. These results show that, for expression, the integrated construct must be complemented by elements of the genome. These elements exert dominant developmental control on the hypoxanthine phosphoribosyltransferase promoter. The expression patterns in some transgenic mice conform to a typological marker and in others to a subtle combination of typology and topography. These observations define discrete heterogeneities of cell types and of certain structures, particularly in the nervous system and in the mesoderm. This system opens opportunities for developmental studies by providing cellular, molecular, and genetic markers of cell types, cell states, and cells from developmental compartments. Finally this method illustrates that genes transduced or transposed to a different position in the genome acquire different spatiotemporal specificities, a result that has implications for evolution. Images PMID:1696727
Lambret-Frotté, Julia; Artico, Sinara; Muniz Nardeli, Sarah; Fonseca, Fernando; Brilhante Oliveira-Neto, Osmundo; Grossi-de-Sá, Maria Fatima; Alves-Ferreira, Marcio
2016-01-01
Cotton is one of the most economically important cultivated crops. It is the major source of natural fiber for the textile industry and an important target for genetic modification for both biotic stress and herbicide tolerance. Therefore, the characterization of genes and regulatory regions that might be useful for genetic transformation is indispensable. The isolation and characterization of new regulatory regions is of great importance to drive transgene expression in genetically modified crops. One of the major drawbacks in cotton production is pest damage; therefore, the most promising, cost-effective, and sustainable method for pest control is the development of genetically resistant cotton lines. Considering this scenario, our group isolated and characterized the promoter region of a MCO (multicopper oxidase) from Gossypium hirsutum, named GhAO-like1 (ascorbate oxidase-like1). The quantitative expression, together with the in vivo characterization of the promoter region reveals that GhAO-like1 has a flower- and fruit-specific expression pattern. The GUS activity is mainly observed in stamens, as expected considering that the GhAO-like1 regulatory sequence is enriched in cis elements, which have been characterized as a target of reproductive tissue specific transcription factors. Both histological and quantitative analyses in Arabidopsis thaliana have confirmed flower (mainly in stamens) and fruit expression of GhAO-like1. In the present paper, we isolated and characterized both in silico and in vivo the promoter region of the GhAO-like1 gene. The regulatory region of GhAO-like1 might be useful to confer tissue-specific expression in genetically modified plants.
Qi, Xiwu; Yu, Xu; Xu, Daohua; Fang, Hailing; Dong, Ke; Li, Weilin; Liang, Chengyuan
2017-01-01
Lonicera japonica is an important medicinal plant that has been widely used in traditional Chinese medicine for thousands of years. The pharmacological activities of L. japonica are mainly due to its rich natural active ingredients, most of which are secondary metabolites. CYP450s are a large, complex, and widespread superfamily of proteins that participate in many endogenous and exogenous metabolic reactions, especially secondary metabolism. Here, we identified CYP450s in L. japonica transcriptome and analyzed CYP450s that may be involved in chlorogenic acid (CGA) biosynthesis. The recent availability of L. japonica transcriptome provided opportunity to identify CYP450s in this herb. BLAST based method and HMM based method were used to identify CYP450s in L. japonica transcriptome. Then, phylogenetic analysis, conserved motifs analysis, GO annotation, and KEGG annotation analyses were conducted to characterize the identified CYP450s. qRT-PCR was used to explore expression patterns of five CGA biosynthesis related CYP450s. In this study, 151 putative CYP450s with complete cytochrome P450 domain, which belonged to 10 clans, 45 families and 76 subfamilies, were identified in L. japonica transcriptome. Phylogenetic analysis classified these CYP450s into two major branches, A-type (47%) and non-A type (53%). Both types of CYP450s had conserved motifs in L. japonica . The differences of typical motif sequences between A-type and non-A type CYP450s in L. japonica were similar with other plants. GO classification indicated that non-A type CYP450s participated in more molecular functions and biological processes than A-type. KEGG pathway annotation totally assigned 47 CYP450s to 25 KEGG pathways. From these data, we cloned two LjC3Hs (CYP98A subfamily) and three LjC4Hs (CYP73A subfamily) that may be involved in biosynthesis of CGA, the major ingredient for pharmacological activities of L. japonica . qRT-PCR results indicated that two LjC3Hs exhibited oppositing expression patterns during the flower development and LjC3H2 exhibited a similar expression pattern with CGA concentration measured by HPLC. The expression patterns of three LjC4Hs were quite different and the expression pattern of LjC4H3 was quite similar with that of LjC3H1 . Our results provide a comprehensive identification and characterization of CYP450s in L. japonica . Five CGA biosynthesis related CYP450s were cloned and their expression patterns were explored. The different expression patterns of two LjC3Hs and three LjC4Hs may be due to functional divergence of both substrate and catalytic specificity during plant evolution. The co-expression pattern of LjC3H1 and LjC4H3 strongly suggested that they were under coordinated regulation by the same transcription factors due to same cis elements in their promoters. In conclusion, this study provides insight into CYP450s and will effectively facilitate the research of biosynthesis of CGA in L. japonica .
Genome-wide identification of the SWEET gene family in wheat.
Gao, Yue; Wang, Zi Yuan; Kumar, Vikranth; Xu, Xiao Feng; Yuan, De Peng; Zhu, Xiao Feng; Li, Tian Ya; Jia, Baolei; Xuan, Yuan Hu
2018-02-05
The SWEET (sugars will eventually be exported transporter) family is a newly characterized group of sugar transporters. In plants, the key roles of SWEETs in phloem transport, nectar secretion, pollen nutrition, stress tolerance, and plant-pathogen interactions have been identified. SWEET family genes have been characterized in many plant species, but a comprehensive analysis of SWEET members has not yet been performed in wheat. Here, 59 wheat SWEETs (hereafter TaSWEETs) were identified through homology searches. Analyses of phylogenetic relationships, numbers of transmembrane helices (TMHs), gene structures, and motifs showed that TaSWEETs carrying 3-7 TMHs could be classified into four clades with 10 different types of motifs. Examination of the expression patterns of 18 SWEET genes revealed that a few are tissue-specific while most are ubiquitously expressed. In addition, the stem rust-mediated expression patterns of SWEET genes were monitored using a stem rust-susceptible cultivar, 'Little Club' (LC). The resulting data showed that the expression of five out of the 18 SWEETs tested was induced following inoculation. In conclusion, we provide the first comprehensive analysis of the wheat SWEET gene family. Information regarding the phylogenetic relationships, gene structures, and expression profiles of SWEET genes in different tissues and following stem rust disease inoculation will be useful in identifying the potential roles of SWEETs in specific developmental and pathogenic processes. Copyright © 2017 Elsevier B.V. All rights reserved.
Wnt signaling underlies evolution and development of the butterfly wing pattern symmetry systems.
Martin, Arnaud; Reed, Robert D
2014-11-15
Most butterfly wing patterns are proposed to be derived from a set of conserved pattern elements known as symmetry systems. Symmetry systems are so-named because they are often associated with parallel color stripes mirrored around linear organizing centers that run between the anterior and posterior wing margins. Even though the symmetry systems are the most prominent and diverse wing pattern elements, their study has been confounded by a lack of knowledge regarding the molecular basis of their development, as well as the difficulty of drawing pattern homologies across species with highly derived wing patterns. Here we present the first molecular characterization of symmetry system development by showing that WntA expression is consistently associated with the major basal, discal, central, and external symmetry system patterns of nymphalid butterflies. Pharmacological manipulations of signaling gradients using heparin and dextran sulfate showed that pattern organizing centers correspond precisely with WntA, wingless, Wnt6, and Wnt10 expression patterns, thus suggesting a role for Wnt signaling in color pattern induction. Importantly, this model is supported by recent genetic and population genomic work identifying WntA as the causative locus underlying wing pattern variation within several butterfly species. By comparing the expression of WntA between nymphalid butterflies representing a range of prototypical symmetry systems, slightly deviated symmetry systems, and highly derived wing patterns, we were able to infer symmetry system homologies in several challenging cases. Our work illustrates how highly divergent morphologies can be derived from modifications to a common ground plan across both micro- and macro-evolutionary time scales. Copyright © 2014 Elsevier Inc. All rights reserved.
Cutillas, C; German, P; Arias, P; Guevara, D
1996-10-01
Morphological and biometric studies were performed in Trichuris skrjabini (Baskakov, 1924) collected from the caecum of Capra hircus. The LDH (EC 1.1.1.27.), G6PD (EC 1.1.1.49.), GPI (EC 5.3.1.9.), MDH (EC 1.1.1.37) and malic enzyme (ME) (EC 1.1.1.40) isoenzymatic patterns of T. skrjabini were determined by starch gel electrophoresis. The G6PD and GPI isoenzymatic patterns of T. skrjabini displayed two anodic bands for both enzymes: one fast migration band and one band near the origin. This isoenzymatic pattern was interpreted as two gene loci encoding both enzymes. The LDH isoenzymatic pattern of T. skrjabini was characterized by the presence of a cathodically migrating band, while the MDH isoenzymatic pattern showed a very slow cathodic band. These two phenotypes were interpreted as the expression of a homozygous state of a gene locus for LDH and MDH in T. skrjabini. The ME isoenzymatic pattern was characterized by the presence of a single anodic band. Further, comparative isoenzymatic studies were carried out between T. skrjabini and T. ovis. The different G6PD, GPI, LDH, MDH and ME isoenzymatic patterns observed for both species allowed us to distinguish them and therefore to use isoenzymatic patterns as a diagnostic tool to differentiate species of Trichuris.
Celedon, Jose M; Yuen, Macaire M S; Chiang, Angela; Henderson, Hannah; Reid, Karen E; Bohlmann, Jörg
2017-11-01
Plant defenses often involve specialized cells and tissues. In conifers, specialized cells of the bark are important for defense against insects and pathogens. Using laser microdissection, we characterized the transcriptomes of cortical resin duct cells, phenolic cells and phloem of white spruce (Picea glauca) bark under constitutive and methyl jasmonate (MeJa)-induced conditions, and we compared these transcriptomes with the transcriptome of the bark tissue complex. Overall, ~3700 bark transcripts were differentially expressed in response to MeJa. Approximately 25% of transcripts were expressed in only one cell type, revealing cell specialization at the transcriptome level. MeJa caused cell-type-specific transcriptome responses and changed the overall patterns of cell-type-specific transcript accumulation. Comparison of transcriptomes of the conifer bark tissue complex and specialized cells resolved a masking effect inherent to transcriptome analysis of complex tissues, and showed the actual cell-type-specific transcriptome signatures. Characterization of cell-type-specific transcriptomes is critical to reveal the dynamic patterns of spatial and temporal display of constitutive and induced defense systems in a complex plant tissue or organ. This was demonstrated with the improved resolution of spatially restricted expression of sets of genes of secondary metabolism in the specialized cell types. © 2017 The Authors The Plant Journal published by John Wiley & Sons Ltd and Society for Experimental Biology.
NASA Astrophysics Data System (ADS)
Gibbs, Holly C.; Dodson, Colin R.; Bai, Yuqiang; Lekven, Arne C.; Yeh, Alvin T.
2014-12-01
During embryogenesis, presumptive brain compartments are patterned by dynamic networks of gene expression. The spatiotemporal dynamics of these networks, however, have not been characterized with sufficient resolution for us to understand the regulatory logic resulting in morphogenetic cellular behaviors that give the brain its shape. We have developed a new, integrated approach using ultrashort pulse microscopy [a high-resolution, two-photon fluorescence (2PF)-optical coherence microscopy (OCM) platform using 10-fs pulses] and image registration to study brain patterning and morphogenesis in zebrafish embryos. As a demonstration, we used time-lapse 2PF to capture midbrain-hindbrain boundary morphogenesis and a wnt1 lineage map from embryos during brain segmentation. We then performed in situ hybridization to deposit NBT/BCIP, where wnt1 remained actively expressed, and reimaged the embryos with combined 2PF-OCM. When we merged these datasets using morphological landmark registration, we found that the mechanism of boundary formation differs along the dorsoventral axis. Dorsally, boundary sharpening is dominated by changes in gene expression, while ventrally, sharpening may be accomplished by lineage sorting. We conclude that the integrated visualization of lineage reporter and gene expression domains simultaneously with brain morphology will be useful for understanding how changes in gene expression give rise to proper brain compartmentalization and structure.
Gibbs, Holly C; Dodson, Colin R; Bai, Yuqiang; Lekven, Arne C; Yeh, Alvin T
2014-12-01
During embryogenesis, presumptive brain compartments are patterned by dynamic networks of gene expression. The spatiotemporal dynamics of these networks, however, have not been characterized with sufficient resolution for us to understand the regulatory logic resulting in morphogenetic cellular behaviors that give the brain its shape. We have developed a new, integrated approach using ultrashort pulse microscopy [a high-resolution, two-photon fluorescence (2PF)-optical coherence microscopy (OCM) platform using 10-fs pulses] and image registration to study brain patterning and morphogenesis in zebrafish embryos. As a demonstration, we used time-lapse 2PF to capture midbrain-hindbrain boundary morphogenesis and a wnt1 lineage map from embryos during brain segmentation. We then performed in situ hybridization to deposit NBT/BCIP, where wnt1 remained actively expressed, and reimaged the embryos with combined 2PF-OCM. When we merged these datasets using morphological landmark registration, we found that the mechanism of boundary formation differs along the dorsoventral axis. Dorsally, boundary sharpening is dominated by changes in gene expression, while ventrally, sharpening may be accomplished by lineage sorting. We conclude that the integrated visualization of lineage reporter and gene expression domains simultaneously with brain morphology will be useful for understanding how changes in gene expression give rise to proper brain compartmentalization and structure.
A regulatory toolbox of MiniPromoters to drive selective expression in the brain
Portales-Casamar, Elodie; Swanson, Douglas J.; Liu, Li; de Leeuw, Charles N.; Banks, Kathleen G.; Ho Sui, Shannan J.; Fulton, Debra L.; Ali, Johar; Amirabbasi, Mahsa; Arenillas, David J.; Babyak, Nazar; Black, Sonia F.; Bonaguro, Russell J.; Brauer, Erich; Candido, Tara R.; Castellarin, Mauro; Chen, Jing; Chen, Ying; Cheng, Jason C. Y.; Chopra, Vik; Docking, T. Roderick; Dreolini, Lisa; D'Souza, Cletus A.; Flynn, Erin K.; Glenn, Randy; Hatakka, Kristi; Hearty, Taryn G.; Imanian, Behzad; Jiang, Steven; Khorasan-zadeh, Shadi; Komljenovic, Ivana; Laprise, Stéphanie; Liao, Nancy Y.; Lim, Jonathan S.; Lithwick, Stuart; Liu, Flora; Liu, Jun; Lu, Meifen; McConechy, Melissa; McLeod, Andrea J.; Milisavljevic, Marko; Mis, Jacek; O'Connor, Katie; Palma, Betty; Palmquist, Diana L.; Schmouth, Jean-François; Swanson, Magdalena I.; Tam, Bonny; Ticoll, Amy; Turner, Jenna L.; Varhol, Richard; Vermeulen, Jenny; Watkins, Russell F.; Wilson, Gary; Wong, Bibiana K. Y.; Wong, Siaw H.; Wong, Tony Y. T.; Yang, George S.; Ypsilanti, Athena R.; Jones, Steven J. M.; Holt, Robert A.; Goldowitz, Daniel; Wasserman, Wyeth W.; Simpson, Elizabeth M.
2010-01-01
The Pleiades Promoter Project integrates genomewide bioinformatics with large-scale knockin mouse production and histological examination of expression patterns to develop MiniPromoters and related tools designed to study and treat the brain by directed gene expression. Genes with brain expression patterns of interest are subjected to bioinformatic analysis to delineate candidate regulatory regions, which are then incorporated into a panel of compact human MiniPromoters to drive expression to brain regions and cell types of interest. Using single-copy, homologous-recombination “knockins” in embryonic stem cells, each MiniPromoter reporter is integrated immediately 5′ of the Hprt locus in the mouse genome. MiniPromoter expression profiles are characterized in differentiation assays of the transgenic cells or in mouse brains following transgenic mouse production. Histological examination of adult brains, eyes, and spinal cords for reporter gene activity is coupled to costaining with cell-type–specific markers to define expression. The publicly available Pleiades MiniPromoter Project is a key resource to facilitate research on brain development and therapies. PMID:20807748
Pattern of somatostatin receptors expression in normal and bladder cancer tissue samples.
Karavitakis, Markos; Msaouel, Pavlos; Michalopoulos, Vassilis; Koutsilieris, Michael
2014-06-01
Known risks factors for bladder cancer progression and recurrence are limited regarding their prognostic ability. Therefore identification of molecular determinants of disease progression could provide with more specific prognostic information and could be translated into new approaches for biomarker development. In the present study we evaluated, the expression patterns of somatostatin receptors 1-5 (SSTRs) in normal and tumor bladder tissues. The expression of SSTR1-5 was characterized in 45 normal and bladder cancer tissue samples using reverse transcriptase-polymerase chain reaction (RT-PCR). SSTR1 was expressed in 24 samples, SSTR2 in 15, SSTR3 in 23, SSTR4 in 16 and SSTR5 in all but one sample. Bladder cancer tissue samples expressed lower levels of SSTR3. Co-expression of SSTRs was associated with superficial disease. Our results demonstrate, for the first time, that there is expression of SSTR in normal and bladder cancer urothelium. Further studies are required to evaluate the prognostic and therapeutic significance of these findings. Copyright© 2014 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.
Pang, Alan Lap-Yin; Peacock, Stephanie; Johnson, Warren; Bear, Deborah H.; Rennert, Owen M.; Chan, Wai-Yee
2009-01-01
N-alpha-terminal acetylation is a modification process that occurs cotranslationally on most eukaryotic proteins. The major enzyme responsible for this process, N-alpha-terminal acetyltransferase, is composed of the catalytic subunit ARD1A and the auxiliary subunit NAT1. We cloned, characterized, and studied the expression pattern of Ard1b (also known as Ard2), a novel homolog of the mouse Ard1a. Comparison of the genomic structures suggests that the autosomal Ard1b is a retroposed copy of the X-linked Ard1a. Expression analyses demonstrated a testis predominance of Ard1b. A reciprocal expression pattern between Ard1a and Ard1b is also observed during spermatogenesis, suggesting that Ard1b is expressed to compensate for the loss of Ard1a starting from meiosis. Both ARD1A and ARD1B can interact with NAT1 to constitute a functional N-alpha-terminal acetyltransferase in vitro. The expression of ARD1B protein can be detected in mouse testes but is delayed until the first appearance of round spermatids. In a cell culture model, the inclusion of the long 3′ untranslated region of Ard1b leads to reduction of luciferase reporter activity, which implicates its role in translational repression of Ard1b during spermatogenesis. Our results suggest that ARD1B may have an important role in the later course of the spermatogenic process. PMID:19246321
Pang, Alan Lap-Yin; Peacock, Stephanie; Johnson, Warren; Bear, Deborah H; Rennert, Owen M; Chan, Wai-Yee
2009-08-01
N-alpha-terminal acetylation is a modification process that occurs cotranslationally on most eukaryotic proteins. The major enzyme responsible for this process, N-alpha-terminal acetyltransferase, is composed of the catalytic subunit ARD1A and the auxiliary subunit NAT1. We cloned, characterized, and studied the expression pattern of Ard1b (also known as Ard2), a novel homolog of the mouse Ard1a. Comparison of the genomic structures suggests that the autosomal Ard1b is a retroposed copy of the X-linked Ard1a. Expression analyses demonstrated a testis predominance of Ard1b. A reciprocal expression pattern between Ard1a and Ard1b is also observed during spermatogenesis, suggesting that Ard1b is expressed to compensate for the loss of Ard1a starting from meiosis. Both ARD1A and ARD1B can interact with NAT1 to constitute a functional N-alpha-terminal acetyltransferase in vitro. The expression of ARD1B protein can be detected in mouse testes but is delayed until the first appearance of round spermatids. In a cell culture model, the inclusion of the long 3' untranslated region of Ard1b leads to reduction of luciferase reporter activity, which implicates its role in translational repression of Ard1b during spermatogenesis. Our results suggest that ARD1B may have an important role in the later course of the spermatogenic process.
NASA Technical Reports Server (NTRS)
Murashov, A. K.; Talebian, S.; Wolgemuth, D. J.
1998-01-01
Although expression of the small heat shock protein family member Hsp25 has been previously observed in the central nervous system (CNS), both constitutively and upon induction, its function in the CNS remains far from clear. In the present study we have characterized the spatial pattern of expression of Hsp25 in the normal adult mouse brain as well as the changes in expression patterns induced by subjecting mice to experimental hyperthermia or hypoxia. Immunohistochemical analysis revealed a surprisingly restricted pattern of constitutive expression of Hsp25 in the brain, limited to the facial, trigeminal, ambiguus, hypoglossal and vagal motor nuclei of the brainstem. After hyperthermia or hypoxia treatment, significant increases in the levels of Hsp25 were observed in these same areas and also in fibers of the facial and trigeminal nerve tracts. Immunoblot analysis of protein lysates from brainstem also showed the same pattern of induction of Hsp25. Surprisingly, no other area in the brain showed expression of Hsp25, in either control or stressed animals. The highly restricted expression of Hsp25 implies that this protein may have a specific physiological role in the orofacial motor nuclei, which govern precise coordination between muscles of mastication and the pharynx, larynx, and face. Its rapid induction after stress further suggests that Hsp25 may serve as a specific molecular chaperone in the lower cholinergic motor neurons and along their fibers under conditions of stress or injury. Copyright 1998 Elsevier Science B.V.
Automating Network Node Behavior Characterization by Mining Communication Patterns
DOE Office of Scientific and Technical Information (OSTI.GOV)
Carroll, Thomas E.; Chikkagoudar, Satish; Arthur-Durett, Kristine M.
Enterprise networks of scale are complex, dynamic computing environments that respond to evolv- ing business objectives and requirements. Characteriz- ing system behaviors in these environments is essential for network management and cyber security operations. Characterization of system’s communication is typical and is supported using network flow information (NetFlow). Related work has characterized behavior using theoretical graph metrics; results are often difficult to interpret by enterprise staff. We propose a different approach, where flow information is mapped to sets of tags that contextualize the data in terms of network principals and enterprise concepts. Frequent patterns are then extracted and are expressedmore » as behaviors. Behaviors can be com- pared, identifying systems expressing similar behaviors. We evaluate the approach using flow information collected by a third party.« less
Fan, Wei; Xu, Jia-Meng; Lou, He-Qiang; Xiao, Chuan; Chen, Wei-Wei; Yang, Jian-Li
2016-01-01
Grain amaranth (Amaranthus hypochondriacus L.) is abundant in oxalate and can secrete oxalate under aluminium (Al) stress. However, the features of Al-induced secretion of organic acid anions (OA) and potential genes responsible for OA secretion are poorly understood. Here, Al-induced OA secretion in grain amaranth roots was characterized by ion charomatography and enzymology methods, and suppression subtractive hybridization (SSH) together with quantitative real-time PCR (qRT-PCR) was used to identify up-regulated genes that are potentially involved in OA secretion. The results showed that grain amaranth roots secrete both oxalate and citrate in response to Al stress. The secretion pattern, however, differs between oxalate and citrate. Neither lanthanum chloride (La) nor cadmium chloride (Cd) induced OA secretion. A total of 84 genes were identified as up-regulated by Al, in which six genes were considered as being potentially involved in OA secretion. The expression pattern of a gene belonging to multidrug and toxic compound extrusion (MATE) family, AhMATE1, was in close agreement with that of citrate secretion. The expression of a gene encoding tonoplast dicarboxylate transporter and four genes encoding ATP-binding cassette transporters was differentially regulated by Al stress, but the expression pattern was not correlated well with that of oxalate secretion. Our results not only reveal the secretion pattern of oxalate and citrate from grain amaranth roots under Al stress, but also provide some genetic information that will be useful for further characterization of genes involved in Al toxicity and tolerance mechanisms. PMID:27144562
Fan, Wei; Xu, Jia-Meng; Lou, He-Qiang; Xiao, Chuan; Chen, Wei-Wei; Yang, Jian-Li
2016-04-30
Grain amaranth (Amaranthus hypochondriacus L.) is abundant in oxalate and can secrete oxalate under aluminium (Al) stress. However, the features of Al-induced secretion of organic acid anions (OA) and potential genes responsible for OA secretion are poorly understood. Here, Al-induced OA secretion in grain amaranth roots was characterized by ion charomatography and enzymology methods, and suppression subtractive hybridization (SSH) together with quantitative real-time PCR (qRT-PCR) was used to identify up-regulated genes that are potentially involved in OA secretion. The results showed that grain amaranth roots secrete both oxalate and citrate in response to Al stress. The secretion pattern, however, differs between oxalate and citrate. Neither lanthanum chloride (La) nor cadmium chloride (Cd) induced OA secretion. A total of 84 genes were identified as up-regulated by Al, in which six genes were considered as being potentially involved in OA secretion. The expression pattern of a gene belonging to multidrug and toxic compound extrusion (MATE) family, AhMATE1, was in close agreement with that of citrate secretion. The expression of a gene encoding tonoplast dicarboxylate transporter and four genes encoding ATP-binding cassette transporters was differentially regulated by Al stress, but the expression pattern was not correlated well with that of oxalate secretion. Our results not only reveal the secretion pattern of oxalate and citrate from grain amaranth roots under Al stress, but also provide some genetic information that will be useful for further characterization of genes involved in Al toxicity and tolerance mechanisms.
Zuriaga, Maria A; Fuster, Jose J; Gokce, Noyan; Walsh, Kenneth
2017-01-01
Visceral adiposity is much more strongly associated with cardiometabolic disease in humans than subcutaneous adiposity. Browning, the appearance of brown-like adipocytes in the white adipose tissue (WAT), has been shown to protect mice against metabolic dysfunction, suggesting the possibility of new therapeutic approaches to treat obesity and type 2 diabetes. In mice, subcutaneous WAT depots express higher levels of browning genes when compared with visceral WAT, further suggesting that differences in WAT browning could contribute to the differences in the pathogenicity of the two depots. However, the expression of browning genes in different WAT depots of human has not been characterized. Here, it is shown that the expression of browning genes is higher in visceral than in subcutaneous WAT in humans, a pattern that is opposite to what is observed in mice. These results suggest that caution should be applied in extrapolating the results of murine browning gene expression studies to human pathophysiology.
Orozco, Carlos A; Acevedo, Andrés; Cortina, Lazaro; Cuellar, Gina E; Duarte, Mónica; Martín, Liliana; Mesa, Néstor M; Muñoz, Javier; Portilla, Carlos A; Quijano, Sandra M; Quintero, Guillermo; Rodriguez, Miriam; Saavedra, Carlos E; Groot, Helena; Torres, María M; López-Segura, Valeriano
2013-01-01
A variety of genetic alterations are considered hallmarks of cancer development and progression. The Ikaros gene family, encoding for key transcription factors in hematopoietic development, provides several examples as genetic defects in these genes are associated with the development of different types of leukemia. However, the complex patterns of expression of isoforms in Ikaros family genes has prevented their use as clinical markers. In this study, we propose the use of the expression profiles of the Ikaros isoforms to classify various hematological tumor diseases. We have standardized a quantitative PCR protocol to estimate the expression levels of the Ikaros gene exons. Our analysis reveals that these levels are associated with specific types of leukemia and we have found differences in the levels of expression relative to five interexonic Ikaros regions for all diseases studied. In conclusion, our method has allowed us to precisely discriminate between B-ALL, CLL and MM cases. Differences between the groups of lymphoid and myeloid pathologies were also identified in the same way.
Identification and expression analysis of zebrafish glypicans during embryonic development.
Gupta, Mansi; Brand, Michael
2013-01-01
Heparan sulfate Proteoglycans (HSPG) are ubiquitous molecules with indispensable functions in various biological processes. Glypicans are a family of HSPG's, characterized by a Gpi-anchor which directs them to the cell surface and/or extracellular matrix where they regulate growth factor signaling during development and disease. We report the identification and expression pattern of glypican genes from zebrafish. The zebrafish genome contains 10 glypican homologs, as opposed to six in mammals, which are highly conserved and are phylogenetically related to the mammalian genes. Some of the fish glypicans like Gpc1a, Gpc3, Gpc4, Gpc6a and Gpc6b show conserved synteny with their mammalian cognate genes. Many glypicans are expressed during the gastrulation stage, but their expression becomes more tissue specific and defined during somitogenesis stages, particularly in the developing central nervous system. Existence of multiple glypican orthologs in fish with diverse expression pattern suggests highly specialized and/or redundant function of these genes during embryonic development.
Ji, Chang Yoon; Kim, Yun-Hee; Kim, Ho Soo; Ke, Qingbo; Kim, Gun-Woo; Park, Sung-Chul; Lee, Haeng-Soon; Jeong, Jae Cheol; Kwak, Sang-Soo
2016-09-01
Tocopherol (vitamin E) is a chloroplast lipid that is presumed to be involved in the plant response to oxidative stress. In this study, we isolated and characterized five tocopherol biosynthetic genes from sweetpotato (Ipomoea batatas [L.] Lam) plants, including genes encoding 4-hydroxyphenylpyruvate dioxygenase (IbHPPD), homogentisate phytyltransferase (IbHPT), 2-methyl-6-phytylbenzoquinol methyltransferase (IbMPBQ MT), tocopherol cyclase (IbTC) and γ-tocopherol methyltransferase (IbTMT). Fluorescence microscope analysis indicated that four proteins localized into the chloroplast, whereas IbHPPD observed in the nuclear. Quantitative RT-PCR analysis revealed that the expression patterns of the five tocopherol biosynthetic genes varied in different plant tissues and under different stress conditions. All five genes were highly expressed in leaf tissues, whereas IbHPPD and IbHPT were highly expressed in the thick roots. The expression patterns of these five genes significantly differed in response to PEG, NaCl and H2O2-mediated oxidative stress. IbHPPD was strongly induced following PEG and H2O2 treatment and IbHPT was strongly induced following PEG treatment, whereas IbMPBQ MT and IbTC were highly expressed following NaCl treatment. Upon infection of the bacterial pathogen Pectobacterium chrysanthemi, the expression of IbHPPD increased sharply in sweetpotato leaves, whereas the expression of the other genes was reduced or unchanged. Additionally, transient expression of the five tocopherol biosynthetic genes in tobacco (Nicotiana bentamiana) leaves resulted in increased transcript levels of the transgenes expressions and tocopherol production. Therefore, our results suggested that the five tocopherol biosynthetic genes of sweetpotato play roles in the stress defense response as transcriptional regulators of the tocopherol production. Copyright © 2016 Elsevier Masson SAS. All rights reserved.
Byrum, M L; Pondenis, H C; Fredrickson, R L; Wycislo, K L; Fan, T M
2016-07-01
The establishment and progression of metastases remains the life-limiting factor for dogs diagnosed with osteosarcoma (OS). The pattern of metastases is likely regulated through interactions between chemokine receptors and chemokines, and perturbations in these signaling cascades responsible for cytoskeletal organization and directional migration have the potential to alter metastatic cell trafficking behaviors. Zoledronate will impair directional migration of OS cells through downregulation of chemokine (C-X-C motif) receptor 4 (CXCR4) expression and functionality. Nineteen archived tumor specimens and plasma from 20 dogs with OS. Prospectively, the expressions of CXCR4 were studied in OS cell lines and spontaneous tumor samples. The effect of zoledronate on CXCR4 expression and functionality was investigated by characterizing responses in 3 OS cell lines. In 19 OS specimens and 20 dogs with OS, changes in CXCR4 expression and circulating CXCR4 concentrations were characterized in response to zoledronate therapy respectively. All canine OS cells express CXCR4, and zoledronate reduces CXCR4 expression and functionality by 27.7% (P < .0001), through augmented proteasome degradation and reduced prenylation of heterotrimeric G-proteins in 33% of tumor cell lines evaluated. In OS-bearing dogs, zoledronate reduces CXCR4 expressions by 40% within the primary tumor compared to untreated controls (P = .03) and also decreases the circulating concentrations of CXCR4 in 18 of 20 dogs with OS. Zoledronate can alter CXCR4 expression and functionality in OS cells, and consequent perturbations in CXCR4 intracellular signaling cascades might influence patterns of metastases. Copyright © 2016 The Authors. Journal of Veterinary Internal Medicine published by Wiley Periodicals, Inc. on behalf of the American College of Veterinary Internal Medicine.
Kangaroo – A pattern-matching program for biological sequences
2002-01-01
Background Biologists are often interested in performing a simple database search to identify proteins or genes that contain a well-defined sequence pattern. Many databases do not provide straightforward or readily available query tools to perform simple searches, such as identifying transcription binding sites, protein motifs, or repetitive DNA sequences. However, in many cases simple pattern-matching searches can reveal a wealth of information. We present in this paper a regular expression pattern-matching tool that was used to identify short repetitive DNA sequences in human coding regions for the purpose of identifying potential mutation sites in mismatch repair deficient cells. Results Kangaroo is a web-based regular expression pattern-matching program that can search for patterns in DNA, protein, or coding region sequences in ten different organisms. The program is implemented to facilitate a wide range of queries with no restriction on the length or complexity of the query expression. The program is accessible on the web at http://bioinfo.mshri.on.ca/kangaroo/ and the source code is freely distributed at http://sourceforge.net/projects/slritools/. Conclusion A low-level simple pattern-matching application can prove to be a useful tool in many research settings. For example, Kangaroo was used to identify potential genetic targets in a human colorectal cancer variant that is characterized by a high frequency of mutations in coding regions containing mononucleotide repeats. PMID:12150718
Na, Kiyong; Sung, Ji-Youn; Kim, Hyun-Soo
2017-12-01
Diffuse and strong nuclear p53 immunoreactivity and a complete lack of p53 expression are regarded as indicative of missense and nonsense mutations, respectively, of the TP53 gene. Tubo-ovarian and peritoneal high-grade serous carcinoma (HGSC) is characterized by aberrant p53 expression induced by a TP53 mutation. However, our experience with some HGSC cases with a wild-type p53 immunostaining pattern led us to comprehensively review previous cases and investigate the TP53 mutational status of the exceptional cases. We analyzed the immunophenotype of 153 cases of HGSC and performed TP53 gene sequencing analysis in those with a wild-type p53 immunostaining pattern. Immunostaining revealed that 109 (71.3%) cases displayed diffuse and strong p53 expression (missense mutation pattern), while 39 (25.5%) had no p53 expression (nonsense mutation pattern). The remaining five cases of HGSC showed a wild-type p53 immunostaining pattern. Direct sequencing analysis revealed that three of these cases harbored nonsense TP53 mutations and two had novel splice site deletions. TP53 mutation is almost invariably present in HGSC, and p53 immunostaining can be used as a surrogate marker of TP53 mutation. In cases with a wild-type p53 immunostaining pattern, direct sequencing for TP53 mutational status can be helpful to confirm the presence of a TP53 mutation. Copyright© 2017, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.
Santos, Efrén; Remy, Serge; Thiry, Els; Windelinckx, Saskia; Swennen, Rony; Sági, László
2009-06-24
Next-generation transgenic plants will require a more precise regulation of transgene expression, preferably under the control of native promoters. A genome-wide T-DNA tagging strategy was therefore performed for the identification and characterization of novel banana promoters. Embryogenic cell suspensions of a plantain-type banana were transformed with a promoterless, codon-optimized luciferase (luc+) gene and low temperature-responsive luciferase activation was monitored in real time. Around 16,000 transgenic cell colonies were screened for baseline luciferase activity at room temperature 2 months after transformation. After discarding positive colonies, cultures were re-screened in real-time at 26 degrees C followed by a gradual decrease to 8 degrees C. The baseline activation frequency was 0.98%, while the frequency of low temperature-responsive luciferase activity was 0.61% in the same population of cell cultures. Transgenic colonies with luciferase activity responsive to low temperature were regenerated to plantlets and luciferase expression patterns monitored during different regeneration stages. Twenty four banana DNA sequences flanking the right T-DNA borders in seven independent lines were cloned via PCR walking. RT-PCR analysis in one line containing five inserts allowed the identification of the sequence that had activated luciferase expression under low temperature stress in a developmentally regulated manner. This activating sequence was fused to the uidA reporter gene and back-transformed into a commercial dessert banana cultivar, in which its original expression pattern was confirmed. This promoter tagging and real-time screening platform proved valuable for the identification of novel promoters and genes in banana and for monitoring expression patterns throughout in vitro development and low temperature treatment. Combination of PCR walking techniques was efficient for the isolation of candidate promoters even in a multicopy T-DNA line. Qualitative and quantitative GUS expression analyses of one tagged promoter in a commercial cultivar demonstrated a reproducible promoter activity pattern during in vitro culture. Thus, this promoter could be used during in vitro selection and generation of commercial transgenic plants.
Hopp, Lydia; Lembcke, Kathrin; Binder, Hans; Wirth, Henry
2013-01-01
We present an analytic framework based on Self-Organizing Map (SOM) machine learning to study large scale patient data sets. The potency of the approach is demonstrated in a case study using gene expression data of more than 200 mature aggressive B-cell lymphoma patients. The method portrays each sample with individual resolution, characterizes the subtypes, disentangles the expression patterns into distinct modules, extracts their functional context using enrichment techniques and enables investigation of the similarity relations between the samples. The method also allows to detect and to correct outliers caused by contaminations. Based on our analysis, we propose a refined classification of B-cell Lymphoma into four molecular subtypes which are characterized by differential functional and clinical characteristics. PMID:24833231
Proteogenomic characterization of human colon and rectal cancer
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhang, Bing; Wang, Jing; Wang, Xiaojing
2014-09-18
We analyzed proteomes of colon and rectal tumors previously characterized by the Cancer Genome Atlas (TCGA) and performed integrated proteogenomic analyses. Protein sequence variants encoded by somatic genomic variations displayed reduced expression compared to protein variants encoded by germline variations. mRNA transcript abundance did not reliably predict protein expression differences between tumors. Proteomics identified five protein expression subtypes, two of which were associated with the TCGA "MSI/CIMP" transcriptional subtype, but had distinct mutation and methylation patterns and associated with different clinical outcomes. Although CNAs showed strong cis- and trans-effects on mRNA expression, relatively few of these extend to the proteinmore » level. Thus, proteomics data enabled prioritization of candidate driver genes. Our analyses identified HNF4A, a novel candidate driver gene in tumors with chromosome 20q amplifications. Integrated proteogenomic analysis provides functional context to interpret genomic abnormalities and affords novel insights into cancer biology.« less
Katagiri, Fumiaki; Glazebrook, Jane
2003-01-01
A major task in computational analysis of mRNA expression profiles is definition of relationships among profiles on the basis of similarities among them. This is generally achieved by pattern recognition in the distribution of data points representing each profile in a high-dimensional space. Some drawbacks of commonly used pattern recognition algorithms stem from their use of a globally linear space and/or limited degrees of freedom. A pattern recognition method called Local Context Finder (LCF) is described here. LCF uses nonlinear dimensionality reduction for pattern recognition. Then it builds a network of profiles based on the nonlinear dimensionality reduction results. LCF was used to analyze mRNA expression profiles of the plant host Arabidopsis interacting with the bacterial pathogen Pseudomonas syringae. In one case, LCF revealed two dimensions essential to explain the effects of the NahG transgene and the ndr1 mutation on resistant and susceptible responses. In another case, plant mutants deficient in responses to pathogen infection were classified on the basis of LCF analysis of their profiles. The classification by LCF was consistent with the results of biological characterization of the mutants. Thus, LCF is a powerful method for extracting information from expression profile data. PMID:12960373
Gong, Yiwen; Feng, Shuaisheng; Li, Shangqi; Zhang, Yan; Zhao, Zixia; Hu, Mou; Xu, Peng; Jiang, Yanliang
2017-12-01
The Toll-like receptor (TLR) gene family is a class of conserved pattern recognition receptors, which play an essential role in innate immunity providing efficient defense against invading microbial pathogens. Although TLRs have been extensively characterized in both invertebrates and vertebrates, a comprehensive analysis of TLRs in common carp is lacking. In the present study, we have conducted the first genome-wide systematic analysis of common carp (Cyprinus carpio) TLR genes. A set of 27 common carp TLR genes were identified and characterized. Sequence similarity analysis, functional domain prediction and phylogenetic analysis supported their annotation and orthologies. By examining the gene copy number of TLR genes across several vertebrates, gene duplications and losses were observed. The expression patterns of TLR genes were examined during early developmental stages and in various healthy tissues, and the results showed that TLR genes were ubiquitously expressed, indicating a likely role in maintaining homeostasis. Moreover, the differential expression of TLRs was examined after Aeromons hydrophila infection, and showed that most TLR genes were induced, with diverse patterns. TLR1, TLR4-2, TLR4-3, TLR22-2, TLR22-3 were significantly up-regulated at minimum one timepoint, whereas TLR2-1, TLR4-1, TLR7-1 and TLR7-2 were significantly down-regulated. Our results suggested that TLR genes play critical roles in the common carp immune response. Collectively, our findings provide fundamental genomic resources for future studies on fish disease management and disease-resistance selective breeding strategy development. Copyright © 2017 Elsevier Inc. All rights reserved.
Guzmán-López, José Alfredo; Abraham-Juárez, María Jazmín; Lozano-Sotomayor, Paulina; de Folter, Stefan; Simpson, June
2016-05-01
Observation of a differential expression pattern, including strong expression in meristematic tissue of an Agave tequilana GlsA/ZRF ortholog suggested an important role for this gene during bulbil formation and developmental changes in this species. In order to better understand this role, the two GlsA/ZFR orthologs present in the genome of Arabidopsis thaliana were functionally characterized by analyzing expression patterns, double mutant phenotypes, promoter-GUS fusions and expression of hormone related or meristem marker genes. Patterns of expression for A. thaliana show that GlsA/ZFR genes are strongly expressed in SAMs and RAMs in mature plants and developing embryos and double mutants showed multiple changes in morphology related to both SAM and RAM tissues. Typical double mutants showed stunted growth of aerial and root tissue, formation of multiple ectopic meristems and effects on cotyledons, leaves and flowers. The KNOX genes STM and BP were overexpressed in double mutants whereas CLV3, WUSCHEL and AS1 were repressed and lack of AtGlsA expression was also associated with changes in localization of auxin and cytokinin. These results suggest that GlsA/ZFR is an essential component of the machinery that maintains the integrity of SAM and RAM tissue and underline the potential to identify new genes or gene functions based on observations in non-model plants.
Toward the human cellular microRNAome.
McCall, Matthew N; Kim, Min-Sik; Adil, Mohammed; Patil, Arun H; Lu, Yin; Mitchell, Christopher J; Leal-Rojas, Pamela; Xu, Jinchong; Kumar, Manoj; Dawson, Valina L; Dawson, Ted M; Baras, Alexander S; Rosenberg, Avi Z; Arking, Dan E; Burns, Kathleen H; Pandey, Akhilesh; Halushka, Marc K
2017-10-01
MicroRNAs are short RNAs that serve as regulators of gene expression and are essential components of normal development as well as modulators of disease. MicroRNAs generally act cell-autonomously, and thus their localization to specific cell types is needed to guide our understanding of microRNA activity. Current tissue-level data have caused considerable confusion, and comprehensive cell-level data do not yet exist. Here, we establish the landscape of human cell-specific microRNA expression. This project evaluated 8 billion small RNA-seq reads from 46 primary cell types, 42 cancer or immortalized cell lines, and 26 tissues. It identified both specific and ubiquitous patterns of expression that strongly correlate with adjacent superenhancer activity. Analysis of unaligned RNA reads uncovered 207 unknown minor strand (passenger) microRNAs of known microRNA loci and 495 novel putative microRNA loci. Although cancer cell lines generally recapitulated the expression patterns of matched primary cells, their isomiR sequence families exhibited increased disorder, suggesting DROSHA- and DICER1-dependent microRNA processing variability. Cell-specific patterns of microRNA expression were used to de-convolute variable cellular composition of colon and adipose tissue samples, highlighting one use of these cell-specific microRNA expression data. Characterization of cellular microRNA expression across a wide variety of cell types provides a new understanding of this critical regulatory RNA species. © 2017 McCall et al.; Published by Cold Spring Harbor Laboratory Press.
McIntosh, B J
1989-01-01
People often speak of children as being "spoiled" and many parents worry about the possibility of spoiling their infants and children. Many pediatricians, however, are uncomfortable with this term because it is a poorly defined and derogatory expression. Some would even deny that infants and children can be spoiled. Avoiding the use of the expression spoiled can create difficulties in communicating with parents concerned about their children's behavior. In this article, the spoiled child syndrome will be defined and those patterns of behavior that characterize it will be distinguished from other patterns of difficult behavior which may be confused with it. The spoiled child syndrome is characterized by excessive self-centered and immature behavior, resulting from the failure of parents to enforce consistent, age-appropriate limits. Many of the problem behaviors that cause parental concern are unrelated to spoiling as properly understood. Such behaviors are often age-related normal behaviors, reactions to family stresses, or patterns of behavior determined by factors inherent in the child. Pediatricians can provide counseling and reassurance for such behaviors and, by helping parents understand the etiology of true spoiling, can encourage the use of behavior modification techniques for its prevention and treatment.
Song, Qiuming; Li, Dayong; Dai, Yi; Liu, Shixia; Huang, Lei; Hong, Yongbo; Zhang, Huijuan; Song, Fengming
2015-12-23
Mitogen-activated protein kinase (MAPK) cascades, which consist of three functionally associated protein kinases, namely MEKKs, MKKs and MPKs, are universal signaling modules in all eukaryotes and have been shown to play critical roles in many physiological and biochemical processes in plants. However, little or nothing is known about the MPK and MKK families in watermelon. In the present study, we performed a systematic characterization of the ClMPK and ClMKK families including the identification and nomenclature, chromosomal localization, phylogenetic relationships, ClMPK-ClMKK interactions, expression patterns in different tissues and in response to abiotic and biotic stress and transient expression-based functional analysis for their roles in disease resistance. Genome-wide survey identified fifteen ClMPK and six ClMKK genes in watermelon genome and phylogenetic analysis revealed that both of the ClMPK and ClMKK families can be classified into four distinct groups. Yeast two-hybrid assays demonstrated significant interactions between members of the ClMPK and ClMKK families, defining putative ClMKK2-1/ClMKK6-ClMPK4-1/ClMPK4-2/ClMPK13 and ClMKK5-ClMPK6 cascades. Most of the members in the ClMPK and ClMKK families showed differential expression patterns in different tissues and in response to abiotic (e.g. drought, salt, cold and heat treatments) and biotic (e.g. infection of Fusarium oxysporum f. sp. niveum) stresses. Transient expression of ClMPK1, ClMPK4-2 and ClMPK7 in Nicotiana benthamiana resulted in enhanced resistance to Botrytis cinerea and upregulated expression of defense genes while transient expression of ClMPK6 and ClMKK2-2 led to increased susceptibility to B. cinerea. Furthermore, transient expression of ClMPK7 also led to hypersensitive response (HR)-like cell death and significant accumulation of H2O2 in N. benthamiana. We identified fifteen ClMPK and six ClMKK genes from watermelon and analyzed their phylogenetic relationships, expression patterns and protein-protein interactions and functions in disease resistance. Our results demonstrate that ClMPK1, ClMPK4-2 and ClMPK7 positively but ClMPK6 and ClMKK2-2 negatively regulate the resistance to B. cinerea when transiently expressed in N. benthamiana and that ClMPK7 functions as a regulator of HR-like cell death through modulating the generation of H2O2.
Hale, Matthew D; Galligan, Thomas M; Rainwater, Thomas R; Moore, Brandon C; Wilkinson, Philip M; Guillette, Louis J; Parrott, Benjamin B
2017-11-01
The aryl hydrocarbon receptor (AHR) is a ligand-activated transcription factor that initiates a transcriptional pathway responsible for the expression of CYP1A subfamily members, key to the metabolism of xenobiotic compounds. Toxic planar halogenated aromatic hydrocarbons, including dioxin and PCBs, are capable of activating the AHR, and while dioxin and PCB inputs into the environment have been dramatically curbed following strict regulatory efforts in the United States, they persist in the environment and exposures remain relevant today. Little is known regarding the effects that long-term chronic exposures to dioxin or dioxin-like compounds might have on the development and subsequent health of offspring from exposed individuals, nor is much known regarding AHR expression in reptilians. Here, we characterize AHR and CYP1A gene expression in embryonic and juvenile specimen of a long-lived, apex predator, the American alligator (Alligator mississippiensis), and investigate variation in gene expression profiles in offspring collected from sites conveying differential exposures to environmental contaminants. Both age- and tissue-dependent patterning of AHR isoform expression are detected. We characterize two downstream transcriptional targets of the AHR, CYP1A1 and CYP1A2, and describe conserved elements of their genomic architecture. When comparisons across different sites are made, hepatic expression of CYP1A2, a direct target of the AHR, appears elevated in embryos from a site associated with a dioxin point source and previously characterized PCB contamination. Elevated CYP1A2 expression is not persistent, as site-specific variation was absent in juveniles originating from field-collected eggs but reared under lab conditions. Our results illustrate the patterning of AHR gene expression in a long-lived environmental model species, and indicate a potential contemporary influence of historical contamination. This research presents a novel opportunity to link contamination events to critical genetic pathways during embryonic development, and carries significant potential to inform our understanding of potential health effects in wildlife and humans. Copyright © 2017 Elsevier Ltd. All rights reserved.
Heterogeneous conservation of Dlx paralog co-expression in jawed vertebrates.
Debiais-Thibaud, Mélanie; Metcalfe, Cushla J; Pollack, Jacob; Germon, Isabelle; Ekker, Marc; Depew, Michael; Laurenti, Patrick; Borday-Birraux, Véronique; Casane, Didier
2013-01-01
The Dlx gene family encodes transcription factors involved in the development of a wide variety of morphological innovations that first evolved at the origins of vertebrates or of the jawed vertebrates. This gene family expanded with the two rounds of genome duplications that occurred before jawed vertebrates diversified. It includes at least three bigene pairs sharing conserved regulatory sequences in tetrapods and teleost fish, but has been only partially characterized in chondrichthyans, the third major group of jawed vertebrates. Here we take advantage of developmental and molecular tools applied to the shark Scyliorhinus canicula to fill in the gap and provide an overview of the evolution of the Dlx family in the jawed vertebrates. These results are analyzed in the theoretical framework of the DDC (Duplication-Degeneration-Complementation) model. The genomic organisation of the catshark Dlx genes is similar to that previously described for tetrapods. Conserved non-coding elements identified in bony fish were also identified in catshark Dlx clusters and showed regulatory activity in transgenic zebrafish. Gene expression patterns in the catshark showed that there are some expression sites with high conservation of the expressed paralog(s) and other expression sites with events of paralog sub-functionalization during jawed vertebrate diversification, resulting in a wide variety of evolutionary scenarios within this gene family. Dlx gene expression patterns in the catshark show that there has been little neo-functionalization in Dlx genes over gnathostome evolution. In most cases, one tandem duplication and two rounds of vertebrate genome duplication have led to at least six Dlx coding sequences with redundant expression patterns followed by some instances of paralog sub-functionalization. Regulatory constraints such as shared enhancers, and functional constraints including gene pleiotropy, may have contributed to the evolutionary inertia leading to high redundancy between gene expression patterns.
Disgust, Fear, and the Anxiety Disorders: A Critical Review
Cisler, Josh M.; Olatunji, Bunmi O.; Lohr, Jeffrey M.
2010-01-01
Anxiety disorders have traditionally been conceptualized as reflecting the emotions of fear and anxiety. A developing program of research demonstrates a relation between disgust and three specific anxiety disorders: blood-injection-injury (BII) phobia, spider phobia, and contamination-related obsessive-compulsive disorder (OCD). This review serves three purposes. First, the authors review the response patterns predicted to be observed if the emotional response in these disorders involved disgust versus fear. The review suggests specific response patterns that characterize disgust and fear in the domains of heart rate, facial expression, neural activity, and cognitive processes. Second, the authors review extant research employing measures of these domains in spider phobia, BII phobia, and contamination-related OCD. The evidence suggests that both fear and disgust characterize each of these disorders, but the magnitude at which the emotions characterize the disorders may depend on the response domain measured. For example, disgust may be more involved in spider phobia in appraisals and facial expression, but less involved in neural correlates or heart rate domains. Third, the authors suggest guidelines for future research, including concurrent use of specific measures as well as examining whether the different emotions in different response domains respond to similar interventions (e.g., exposure). PMID:18977061
Liu, Kaidong; Yuan, Changchun; Li, Haili; Lin, Wanhuang; Yang, Yanjun; Shen, Chenjia; Zheng, Xiaolin
2015-11-05
Auxin and auxin signaling are involved in a series of developmental processes in plants. Auxin Response Factors (ARFs) is reported to modulate the expression of target genes by binding to auxin response elements (AuxREs) and influence the transcriptional activation of down-stream target genes. However, how ARF genes function in flower development and fruit ripening of papaya (Carica papaya L.) is largely unknown. In this study, a comprehensive characterization and expression profiling analysis of 11 C. papaya ARF (CpARF) genes was performed using the newly updated papaya reference genome data. We analyzed CpARF expression patterns at different developmental stages. CpARF1, CpARF2, CpARF4, CpARF5, and CpARF10 showed the highest expression at the initial stage of flower development, but decreased during the following developmental stages. CpARF6 expression increased during the developmental process and reached its peak level at the final stage of flower development. The expression of CpARF1 increased significantly during the fruit ripening stages. Many AuxREs were included in the promoters of two ethylene signaling genes (CpETR1 and CpETR2) and three ethylene-synthesis-related genes (CpACS1, CpACS2, and CpACO1), suggesting that CpARFs might be involved in fruit ripening via the regulation of ethylene signaling. Our study provided comprehensive information on ARF family in papaya, including gene structures, chromosome locations, phylogenetic relationships, and expression patterns. The involvement of CpARF gene expression changes in flower and fruit development allowed us to understand the role of ARF-mediated auxin signaling in the maturation of reproductive organs in papaya.
Expression pattern of RAGE and IGF-1 in the human fetal ovary and ovarian serous carcinoma.
Poljicanin, Ana; Filipovic, Natalija; Vukusic Pusic, Tanja; Soljic, Violeta; Caric, Ana; Saraga-Babic, Mirna; Vukojevic, Katarina
2015-01-01
The expression pattern of RAGE and IGF-1 proteins in different ovarian cell lineages was histologically analyzed in six fetal, nine adult human ovaries, and nine serous ovarian carcinomas (OSC) using immunohistochemical methods. Mild expression of IGF-1 in ovarian surface epithelium (Ose) and oocytes in the 15-week human ovaries increased to moderate or strong in the stromal cells, oocytes and follicular cells in week 22. Occasional mild RAGE expression was observed in Ose during week 15, while strong expression characterized primordial follicles in week 22. In the reproductive human ovary, IGF-1 was mildly to moderately expressed in all ovarian cell lineages except in theca cells of the tertiary follicle where IGF-1 was negative. RAGE was strongly positive in the granulosa cells and some theca cells of the tertiary follicle, while negative to mildly positive in all cells of the secondary follicle. In the postmenopausal human ovary IGF-1 and RAGE were mildly expressed in Ose and stroma. In OSC, cells were strongly positive to IGF-1 and RAGE, except for some negative stromal cells. Different levels of IGF-1 and RAGE co-expression characterized fetal ovarian cells during development. In reproductive ovaries, IGF-1 and RAGE were co-localized in the granulosa and theca interna cells of tertiary follicles, while in postmenopausal ovaries and OSC, IGF-1 and RAGE were co-localized in Ose and OSC cells respectively. Our results indicate that intracellular levels of IGF-1 and RAGE protein might regulate the final destiny of the ovarian cell populations prior and during folliculogenesis, possibly controlling the metastatic potential of OSC as well. Copyright © 2015. Published by Elsevier GmbH.
Evolution and inheritance of early embryonic patterning in D. simulans and D. sechellia
Lott, Susan E.; Ludwig, Michael Z.; Kreitman, Martin
2010-01-01
Pattern formation in Drosophila is a widely studied example of a robust developmental system. Such robust systems pose a challenge to adaptive evolution, as they mask variation which selection may otherwise act upon. Yet we find variation in the localization of expression domains (henceforth ‘stripe allometry’) in the pattern formation pathway. Specifically, we characterize differences in the gap genes giant and Kruppel, and the pair-rule gene even-skipped, which differ between the sibling species D. simulans and D. sechellia. In a double-backcross experiment, stripe allometry is consistent with maternal inheritance of stripe positioning and multiple genetic factors, with a distinct genetic basis from embryo length. Embryos produced by F1 and F2 backcross mothers exhibit novel spatial patterns of gene expression relative to the parental species, with no measurable increase in positional variance among individuals. Buffering of novel spatial patterns in the backcross genotypes suggests that robustness need not be disrupted in order for the trait to evolve, and perhaps the system is incapable of evolving to prevent the expression of all genetic variation. This limitation, and the ability of natural selection to act on minute genetic differences that are within the “margin of error” for the buffering mechanism, indicates that developmentally buffered traits can evolve without disruption of robustness PMID:21121913
Ye, P; Yu, H; Simonian, M; Hunter, N
2014-04-01
Previously we demonstrated uniformly strong expression of CD24 in the epithelial attachment to the tooth and in the migrating epithelium of the periodontitis lesion. Titers of serum antibodies autoreactive with CD24 peptide correlated with reduced severity of periodontal disease. Ligation of CD24 expressed by oral epithelial cells induced formation of tight junctions that limited paracellular diffusion. In this study, we aimed to reveal that the lack of uniform expression of tight junction components in the pocket epithelium of periodontitis lesions is likely to contribute to increased paracellular permeability to bacterial products. This is proposed as a potential driver of the immunopathology of periodontitis. An epithelial culture model with close correspondence for expression patterns for tight junction components in periodontal epithelia was used. Immunohistochemical staining and confocal laser scanning microscopy were used to analyse patterns of expression of gingival epithelial tight junction components. The minimally inflamed gingival attachment was characterized by uniformly strong staining at cell contacts for the tight junction components zona occludens-1, zona occludens-2, occludin, junction adhesion molecule-A, claudin-4 and claudin-15. In contrast, the pocket epithelium of the periodontal lesion showed scattered, uneven staining for these components. This pattern correlated closely with that of unstimulated oral epithelial cells in culture. Following ligation of CD24 expressed by these cells, the pattern of tight junction component expression of the minimally inflamed gingival attachment developed rapidly. There was evidence for non-uniform and focal expression only of tight junction components in the pocket epithelium. In the cell-culture model, ligation of CD24 induced a tight junction expression profile equivalent to that observed for the minimally inflamed gingival attachment. Ligation of CD24 expressed by gingival epithelial cells by lectin-like receptors of commensal oral streptococci could mediate the phenotype of health, whereas pathogenic organisms associated with periodontal disease might not signal effectively through CD24. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Rooprai, Harcharan K; Martin, Andrew J; King, Andrew; Appadu, Usha D; Jones, Huw; Selway, Richard P; Gullan, Richard W; Pilkington, Geoffrey J
2016-12-01
MMPs (matrix metalloproteinases), ADAMs (a disintegrin and metalloproteinase) and TIMPs (tissue inhibitors of metalloproteinases) are implicated in invasion and angiogenesis: both are tissue remodeling processes involving regulated proteolysis of the extracellular matrix, growth factors and their receptors. The expression of these three groups and their correlations with clinical behaviour has been reported in gliomas but a similar comprehensive study in meningiomas is lacking. In this study, we aimed to evaluate the patterns of expression of 23 MMPs, 4 TIMPs, 8 ADAMs, selective growth factors and their receptors in 17 benign meningiomas using a quantitative real-time polymerase chain reaction (qPCR). Results indicated very high gene expression of 13 proteases, inhibitors and growth factors studied: MMP2 and MMP14, TIMP-1, -2 and -3, ADAM9, 10, 12, 15 and 17, EGF-R, EMMPRIN and VEGF-A, in almost every meningioma. Expression pattern analysis showed several positive correlations between MMPs, ADAMs, TIMPs and growth factors. Furthermore, our findings suggest that expression of MMP14, ADAM9, 10, 12, 15 and 17, TIMP-2, EGF-R and EMMPRIN reflects histological subtype of meningioma such that fibroblastic subtype had the highest mRNA expression, transitional subtype was intermediate and meningothelial type had the lowest expression. In conclusion, this is the first comprehensive study characterizing gene expression of 8 ADAMs in meningiomas. These neoplasms, although by histological definition benign, have invasive potential. Taken together, the selected elevated gene expression pattern may serve to identify targets for therapeutic intervention or indicators of biological progression and recurrence.
Structure and transcriptional regulation of the major intrinsic protein gene family in grapevine.
Wong, Darren Chern Jan; Zhang, Li; Merlin, Isabelle; Castellarin, Simone D; Gambetta, Gregory A
2018-04-11
The major intrinsic protein (MIP) family is a family of proteins, including aquaporins, which facilitate water and small molecule transport across plasma membranes. In plants, MIPs function in a huge variety of processes including water transport, growth, stress response, and fruit development. In this study, we characterize the structure and transcriptional regulation of the MIP family in grapevine, describing the putative genome duplication events leading to the family structure and characterizing the family's tissue and developmental specific expression patterns across numerous preexisting microarray and RNAseq datasets. Gene co-expression network (GCN) analyses were carried out across these datasets and the promoters of each family member were analyzed for cis-regulatory element structure in order to provide insight into their transcriptional regulation. A total of 29 Vitis vinifera MIP family members (excluding putative pseudogenes) were identified of which all but two were mapped onto Vitis vinifera chromosomes. In this study, segmental duplication events were identified for five plasma membrane intrinsic protein (PIP) and four tonoplast intrinsic protein (TIP) genes, contributing to the expansion of PIPs and TIPs in grapevine. Grapevine MIP family members have distinct tissue and developmental expression patterns and hierarchical clustering revealed two primary groups regardless of the datasets analyzed. Composite microarray and RNA-seq gene co-expression networks (GCNs) highlighted the relationships between MIP genes and functional categories involved in cell wall modification and transport, as well as with other MIPs revealing a strong co-regulation within the family itself. Some duplicated MIP family members have undergone sub-functionalization and exhibit distinct expression patterns and GCNs. Cis-regulatory element (CRE) analyses of the MIP promoters and their associated GCN members revealed enrichment for numerous CREs including AP2/ERFs and NACs. Combining phylogenetic analyses, gene expression profiling, gene co-expression network analyses, and cis-regulatory element enrichment, this study provides a comprehensive overview of the structure and transcriptional regulation of the grapevine MIP family. The study highlights the duplication and sub-functionalization of the family, its strong coordinated expression with genes involved in growth and transport, and the putative classes of TFs responsible for its regulation.
A Recommendation for Naming Transcription Factor Proteins in the Grasses
USDA-ARS?s Scientific Manuscript database
Transcription factors are central for the exquisite temporal and spatial expression patterns of many genes. These proteins are characterized by their ability to be tethered to particular regulatory sequences in the genes that they control. While many other proteins participate in the regulation of g...
Brodsky, Leonid; Leontovich, Andrei; Shtutman, Michael; Feinstein, Elena
2004-01-01
Mathematical methods of analysis of microarray hybridizations deal with gene expression profiles as elementary units. However, some of these profiles do not reflect a biologically relevant transcriptional response, but rather stem from technical artifacts. Here, we describe two technically independent but rationally interconnected methods for identification of such artifactual profiles. Our diagnostics are based on detection of deviations from uniformity, which is assumed as the main underlying principle of microarray design. Method 1 is based on detection of non-uniformity of microarray distribution of printed genes that are clustered based on the similarity of their expression profiles. Method 2 is based on evaluation of the presence of gene-specific microarray spots within the slides’ areas characterized by an abnormal concentration of low/high differential expression values, which we define as ‘patterns of differentials’. Applying two novel algorithms, for nested clustering (method 1) and for pattern detection (method 2), we can make a dual estimation of the profile’s quality for almost every printed gene. Genes with artifactual profiles detected by method 1 may then be removed from further analysis. Suspicious differential expression values detected by method 2 may be either removed or weighted according to the probabilities of patterns that cover them, thus diminishing their input in any further data analysis. PMID:14999086
Circadian Rhythms Regulate Amelogenesis
Zheng, Li; Seon, Yoon Ji; Mourão, Marcio A.; Schnell, Santiago; Kim, Doohak; Harada, Hidemitsu; Papagerakis, Silvana; Papagerakis, Petros
2013-01-01
Ameloblasts, the cells responsible for making enamel, modify their morphological features in response to specialized functions necessary for synchronized ameloblast differentiation and enamel formation. Secretory and maturation ameloblasts are characterized by the expression of stage-specific genes which follows strictly controlled repetitive patterns. Circadian rhythms are recognized as key regulators of development and diseases of many tissues including bone. Our aim was to gain novel insights on the role of clock genes in enamel formation and to explore the potential links between circadian rhythms and amelogenesis. Our data shows definitive evidence that the main clock genes (Bmal1, Clock, Per1 and Per2) oscillate in ameloblasts at regular circadian (24h) intervals both at RNA and protein levels. This study also reveals that two markers of ameloblast differentiation i.e. amelogenin (Amelx; a marker of secretory ameloblasts) and kallikrein-related peptidase 4 (Klk4, a marker of maturation ameloblasts) are downstream targets of clock genes. Both, Amelx and Klk4 show 24h oscillatory expression patterns and their expression levels are up-regulated after Bmal1 over-expression in HAT-7 ameloblast cells. Taken together, these data suggest that both the secretory and the maturation stage of amelogenesis might be under circadian control. Changes in clock genes expression patterns might result in significant alterations of enamel apposition and mineralization. PMID:23486183
Arza, Elvira; Alvarez-Barrientos, Alberto; Fabregat, Isabel; Garcia-Bravo, Maria; Meza, Nestor W.; Segovia, Jose C.
2012-01-01
The fusion of bone marrow (BM) hematopoietic cells with hepatocytes to generate BM derived hepatocytes (BMDH) is a natural process, which is enhanced in damaged tissues. However, the reprogramming needed to generate BMDH and the identity of the resultant cells is essentially unknown. In a mouse model of chronic liver damage, here we identify a modification in the chromatin structure of the hematopoietic nucleus during BMDH formation, accompanied by the loss of the key hematopoietic transcription factor PU.1/Sfpi1 (SFFV proviral integration 1) and gain of the key hepatic transcriptional regulator HNF-1A homeobox A (HNF-1A/Hnf1a). Through genome-wide expression analysis of laser captured BMDH, a differential gene expression pattern was detected and the chromatin changes observed were confirmed at the level of chromatin regulator genes. Similarly, Tranforming Growth Factor-β1 (TGF-β1) and neurotransmitter (e.g. Prostaglandin E Receptor 4 [Ptger4]) pathway genes were over-expressed. In summary, in vivo BMDH generation is a process in which the hematopoietic cell nucleus changes its identity and acquires hepatic features. These BMDHs have their own cell identity characterized by an expression pattern different from hematopoietic cells or hepatocytes. The role of these BMDHs in the liver requires further investigation. PMID:22457803
Zhao, Xuejun; Xiu, Jiangfan; Li, Yan; Ma, Huiling; Wu, Jianwei; Wang, Bo; Guo, Guo
2017-07-01
Chaperonins, belonging to the T-complex protein-1 (TCP-1) family, assist in the correct folding of nascent and misfolded proteins. It is well-known that in mammals, the zeta subunit of the TCP-1 complex (TCP-1ζ) plays a vital role in the folding and assembly of cytoskeleta proteins. This study reported for the first time the cloning, characterization and expression pattern analysis of the TCP-1ζ from Musca domestica, which was named as MdTCP-1ζ. The MdTCP-1ζ cDNA is 1,803 bp long with a 1,596 bp open reading frame that encodes a protein with 531 bp amino acids. The analysis of the transcriptional profile of MdTCP-1ζ using qRT-PCR revealed relatively high expression in the salivary glands and trachea at the tissues while among the developmental stages. The highest expression was observed only in the eggs suggesting that the MdTCP-1ζ may play a role in embryonic development. The expression of MdTCP-1ζ was also significantly induced after exposure to short-term heat shock and infection by Escherichia coli, Staphylococcus aureus, or Candida albicans. This suggested that MdTCP-1ζ may take part in the immune responses of housefly and perhaps contribute to the protection against cellular injury. © The Authors 2017. Published by Oxford University Press on behalf of Entomological Society of America.
Delgado Sandoval, Silvia del Carmen; Abraham Juárez, María Jazmín; Simpson, June
2012-03-01
Agave tequilana is a monocarpic perennial species that flowers after 5-8 years of vegetative growth signaling the end of the plant's life cycle. When fertilization is unsuccessful, vegetative bulbils are induced on the umbels of the inflorescence near the bracteoles from newly formed meristems. Although the regulation of inflorescence and flower development has been described in detail for monocarpic annuals and polycarpic species, little is known at the molecular level for these processes in monocarpic perennials, and few studies have been carried out on bulbils. Histological samples revealed the early induction of umbel meristems soon after the initiation of the vegetative to inflorescence transition in A. tequilana. To identify candidate genes involved in the regulation of floral induction, a search for MADS-box transcription factor ESTs was conducted using an A. tequilana transcriptome database. Seven different MIKC MADS genes classified into 6 different types were identified based on previously characterized A. thaliana and O. sativa MADS genes and sequences from non-grass monocotyledons. Quantitative real-time PCR analysis of the seven candidate MADS genes in vegetative, inflorescence, bulbil and floral tissues uncovered novel patterns of expression for some of the genes in comparison with orthologous genes characterized in other species. In situ hybridization studies using two different genes showed expression in specific tissues of vegetative meristems and floral buds. Distinct MADS gene regulatory patterns in A. tequilana may be related to the specific reproductive strategies employed by this species.
Urushihara, Hideko; Kuwayama, Hidekazu; Fukuhara, Kensuke; Itoh, Takehiko; Kagoshima, Hiroshi; Shin-I, Tadasu; Toyoda, Atsushi; Ohishi, Kazuyo; Taniguchi, Tateaki; Noguchi, Hideki; Kuroki, Yoko; Hata, Takashi; Uchi, Kyoko; Mohri, Kurato; King, Jason S; Insall, Robert H; Kohara, Yuji; Fujiyama, Asao
2015-02-14
Social amoebae are lower eukaryotes that inhabit the soil. They are characterized by the construction of a starvation-induced multicellular fruiting body with a spore ball and supportive stalk. In most species, the stalk is filled with motile stalk cells, as represented by the model organism Dictyostelium discoideum, whose developmental mechanisms have been well characterized. However, in the genus Acytostelium, the stalk is acellular and all aggregated cells become spores. Phylogenetic analyses have shown that it is not an ancestral genus but has lost the ability to undergo cell differentiation. We performed genome and transcriptome analyses of Acytostelium subglobosum and compared our findings to other available dictyostelid genome data. Although A. subglobosum adopts a qualitatively different developmental program from other dictyostelids, its gene repertoire was largely conserved. Yet, families of polyketide synthase and extracellular matrix proteins have not expanded and a serine protease and ABC transporter B family gene, tagA, and a few other developmental genes are missing in the A. subglobosum lineage. Temporal gene expression patterns are astonishingly dissimilar from those of D. discoideum, and only a limited fraction of the ortholog pairs shared the same expression patterns, so that some signaling cascades for development seem to be disabled in A. subglobosum. The absence of the ability to undergo cell differentiation in Acytostelium is accompanied by a small change in coding potential and extensive alterations in gene expression patterns.
2014-01-01
Background To gain insight into what differences might restrict the capacity for limb regeneration in Xenopus froglets, we used High Performance Liquid Chromatography (HPLC)/double mass spectrometry to characterize protein expression during fibroblastema formation in the amputated froglet hindlimb, and compared the results to those obtained previously for blastema formation in the axolotl limb. Results Comparison of the Xenopus fibroblastema and axolotl blastema revealed several similarities and significant differences in proteomic profiles. The most significant similarity was the strong parallel down regulation of muscle proteins and enzymes involved in carbohydrate metabolism. Regenerating Xenopus limbs differed significantly from axolotl regenerating limbs in several ways: deficiency in the inositol phosphate/diacylglycerol signaling pathway, down regulation of Wnt signaling, up regulation of extracellular matrix (ECM) proteins and proteins involved in chondrocyte differentiation, lack of expression of a key cell cycle protein, ecotropic viral integration site 5 (EVI5), that blocks mitosis in the axolotl, and the expression of several patterning proteins not seen in the axolotl that may dorsalize the fibroblastema. Conclusions We have characterized global protein expression during fibroblastema formation after amputation of the Xenopus froglet hindlimb and identified several differences that lead to signaling deficiency, failure to retard mitosis, premature chondrocyte differentiation, and failure of dorsoventral axial asymmetry. These differences point to possible interventions to improve blastema formation and pattern formation in the froglet limb. PMID:25063185
Characterisation of monoclonal antibodies specific for hamster leukocyte differentiation molecules.
Rees, Jennifer; Haig, David; Mack, Victoria; Davis, William C
2017-01-01
Flow cytometry was used to identify mAbs that recognize conserved epitopes on hamster leukocyte differentiation molecules (hLDM) and also to characterize mAbs developed against hLDM. Initial screening of mAbs developed against LDMs in other species yielded mAbs specific for the major histocompatibility (MHC) II molecule, CD4 and CD18. Screening of sets of mAbs developed against hLDM yielded 22 new mAbs, including additional mAbs to MHC II molecules and mAbs that recognize LDMs expressed on all leukocytes, granulocytes, all lymphocytes, all T cells, a subset of T cells, or on all B cells. Based on comparison of the pattern of expression of LDMs expressed on all hamster leukocytes with the patterns of expression of known LDMs in other species, as detected by flow cytometry (FC), four mAbs are predicted to recognize CD11a, CD44, and CD45. Cross comparison of mAbs specific for a subset of hamster T cells with a cross reactive mAb known to recognize CD4 in mice and one recognising CD8 revealed they recognize CD4. The characterization of these mAbs expands opportunities to use hamsters as an additional model species to investigate the mechanisms of immunopathogenesis of infectious diseases. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.
Silva, Francisco Goes da; Iandolino, Alberto; Al-Kayal, Fadi; Bohlmann, Marlene C.; Cushman, Mary Ann; Lim, Hyunju; Ergul, Ali; Figueroa, Rubi; Kabuloglu, Elif K.; Osborne, Craig; Rowe, Joan; Tattersall, Elizabeth; Leslie, Anna; Xu, Jane; Baek, JongMin; Cramer, Grant R.; Cushman, John C.; Cook, Douglas R.
2005-01-01
We report the analysis and annotation of 146,075 expressed sequence tags from Vitis species. The majority of these sequences were derived from different cultivars of Vitis vinifera, comprising an estimated 25,746 unique contig and singleton sequences that survey transcription in various tissues and developmental stages and during biotic and abiotic stress. Putatively homologous proteins were identified for over 17,752 of the transcripts, with 1,962 transcripts further subdivided into one or more Gene Ontology categories. A simple structured vocabulary, with modules for plant genotype, plant development, and stress, was developed to describe the relationship between individual expressed sequence tags and cDNA libraries; the resulting vocabulary provides query terms to facilitate data mining within the context of a relational database. As a measure of the extent to which characterized metabolic pathways were encompassed by the data set, we searched for homologs of the enzymes leading from glycolysis, through the oxidative/nonoxidative pentose phosphate pathway, and into the general phenylpropanoid pathway. Homologs were identified for 65 of these 77 enzymes, with 86% of enzymatic steps represented by paralogous genes. Differentially expressed transcripts were identified by means of a stringent believability index cutoff of ≥98.4%. Correlation analysis and two-dimensional hierarchical clustering grouped these transcripts according to similarity of expression. In the broadest analysis, 665 differentially expressed transcripts were identified across 29 cDNA libraries, representing a range of developmental and stress conditions. The groupings revealed expected associations between plant developmental stages and tissue types, with the notable exception of abiotic stress treatments. A more focused analysis of flower and berry development identified 87 differentially expressed transcripts and provides the basis for a compendium that relates gene expression and annotation to previously characterized aspects of berry development and physiology. Comparison with published results for select genes, as well as correlation analysis between independent data sets, suggests that the inferred in silico patterns of expression are likely to be an accurate representation of transcript abundance for the conditions surveyed. Thus, the combined data set reveals the in silico expression patterns for hundreds of genes in V. vinifera, the majority of which have not been previously studied within this species. PMID:16219919
Lee, Sang Yoon; Nam, Yoon Kwon
2016-11-01
A novel metallothionein (MT) gene from the Pacific abalone H. discus hannai was characterized and its mRNA expression patterns (tissue distribution, developmental expression and differential expression in responsive to various in vivo stimulatory treatments) were examined. Abalone MT shares conserved structural features with previously known gastropod orthologs at both genomic (i.e., tripartite organization) and amino acid (conserved Cys motifs) levels. The 5'-flanking regulatory region of abalone MT gene displayed various transcription factor binding motifs particularly including ones related with metal regulation and stress/immune responses. Tissue distribution and basal expression patterns of MT mRNAs indicated a potential association between ovarian MT expression and sexual maturation. Developmental expression pattern suggested the maternal contribution of MT mRNAs to embryonic and early larval developments. Abalone MT mRNAs could be significantly induced by various heavy metals in different tissues (gill, hepatopancreas, muscle and hemocyte) in a tissue- and/or metal-dependent fashion. In addition, the abalone MT gene was highly modulated in responsive to other non-metal, stimulatory treatments such as immune challenge (LPS, polyI:C and bacterial injections), hypoxia (decrease from normoxia 8 ppm-2 ppm), thermal elevation (increase from 20 °C to 30 °C), and xenobiotic exposure (250 ppb of 17α-ethynylestradiol and 0.25 ppb of 2,3,7,8-tetrachlorodibenzodioxin) where differential expression patterns were toward either up- or down-regulation depending on types of stimulations and tissues examined. Taken together, our results highlight that MT is a multifunctional effector playing in wide criteria of cellular pathways especially associated with development and stress responses in this abalone species. Copyright © 2016 Elsevier Ltd. All rights reserved.
A novel, tissue-specific, Drosophila homeobox gene.
Barad, M; Jack, T; Chadwick, R; McGinnis, W
1988-07-01
The homeobox gene family of Drosophila appears to control a variety of position-specific patterning decisions during embryonic and imaginal development. Most of these patterning decisions determine groups of cells on the anterior-posterior axis of the Drosophila germ band. We have isolated a novel homeobox gene from Drosophila, designated H2.0. H2.0 has the most diverged homeobox so far characterized in metazoa, and, in contrast to all previously isolated homeobox genes, H2.0 exhibits a tissue-specific pattern of expression. The cells that accumulate transcripts for this novel gene correspond to the visceral musculature and its anlagen.
Ben-Moshe, Zohar; Vatine, Gad; Alon, Shahar; Tovin, Adi; Mracek, Philipp; Foulkes, Nicholas S; Gothilf, Yoav
2010-09-01
Circadian rhythms of physiology and behavior are generated by an autonomous circadian oscillator that is synchronized daily with the environment, mainly by light input. The PAR subfamily of transcriptional activators and the related E4BP4 repressor belonging to the basic leucine zipper (bZIP) family are clock-controlled genes that are suggested to mediate downstream circadian clock processes and to feedback onto the core oscillator. Here, the authors report the characterization of these genes in the zebrafish, an increasingly important model in the field of chronobiology. Five novel PAR and six novel e4bp4 zebrafish homolog genes were identified using bioinformatic tools and their coding sequences were cloned. Based on their evolutionary relationships, these genes were annotated as ztef2, zhlf1 and zhlf2, zdbp1 and zdbp2, and ze4bp4-1 to -6. The spatial and temporal mRNA expression pattern of each of these factors was characterized in zebrafish embryos in the context of a functional circadian clock and regulation by light. Nine of the factors exhibited augmented and rhythmic expression in the pineal gland, a central clock organ in zebrafish. Moreover, these genes were found to be regulated, to variable extents, by the circadian clock and/or by light. Differential expression patterns of multiple paralogs in zebrafish suggest multiple roles for these factors within the vertebrate circadian clock. This study, in the genetically accessible zebrafish model, lays the foundation for further research regarding the involvement and specific roles of PAR and E4BP4 transcription factors in the vertebrate circadian clock mechanism.
Pieragostino, Damiana; Bucci, Sonia; Agnifili, Luca; Fasanella, Vincenzo; D'Aguanno, Simona; Mastropasqua, Alessandra; Ciancaglini, Marco; Mastropasqua, Leonardo; Di Ilio, Carmine; Sacchetta, Paolo; Urbani, Andrea; Del Boccio, Piero
2012-04-01
Primary open angle (POAG) and pseudoexfoliative glaucoma (PXG) are the most common primary and secondary forms of glaucoma, respectively. Even though the patho-physiology, aqueous humor composition, risk factors, clinical features, therapy and drug induced ocular surface changes in POAG and PXG have been widely studied, to date information concerning tear protein characterization is lacking. Tears are a source of nourishment for ocular surface tissues and a vehicle to remove local waste products, metabolized drugs and inflammatory mediators produced in several ophthalmic diseases. In glaucoma, the proteomic definition of tears may provide insights concerning patho-physiology of the disease and ocular surface modifications induced by topical therapy. Our study aimed at characterizing protein patterns in tears of patients with medically controlled POAG and PXG. A comparative tears proteomic analysis by label-free LC-MS(E) highlighted differences in the expression of several proteins in the two glaucoma sub-types and control subjects, highlighting inflammation pathways expressed in both diseases. Results were independently reconfirmed by SDS-PAGE and linear MALDI-TOF MS, validating altered levels of Lysozyme C, Lipocalin-1, Protein S100, Immunoglobulins and Prolactin Inducible Protein. Moreover, we found a differential pattern of phosphorylated Cystatin-S that distinguishes the two pathologies. The most relevant results suggest that in both pathologies there may be active inflammation pathways related to the disease and/or induced by therapy. We show, for the first time, tear protein patterns expressed under controlled intraocular pressure conditions in POAG and PXG subjects. These findings could help in the understanding of molecular machinery underlying these ophthalmologic diseases, resulting in early diagnosis and more specific therapy.
Characterization of Conserved and Nonconserved Imprinted Genes in Swine
USDA-ARS?s Scientific Manuscript database
Genomic imprinting results in the silencing of a subset of mammalian alleles due to parent-of-origin inheritance. Due to the nature of their expression patterns they play a critical role in placental and early embryonic development. In order to increase our understanding of imprinted genes specifi...
Cultured Neuronal Networks Express Complex Patterns of Activity and Morphological Memory
NASA Astrophysics Data System (ADS)
Raichman, Nadav; Rubinsky, Liel; Shein, Mark; Baruchi, Itay; Volman, Vladislav; Ben-Jacob, Eshel
The following sections are included: * Cultured Neuronal Networks * Recording the Network Activity * Network Engineering * The Formation of Synchronized Bursting Events * The Characterization of the SBEs * Highly-Active Neurons * Function-Form Relations in Cultured Networks * Analyzing the SBEs Motifs * Network Repertoire * Network under Hypothermia * Summary * Acknowledgments * References
Environmental Stress and Biobehavioral Antecedents of Coronary Heart Disease.
ERIC Educational Resources Information Center
Krantz, David S.; And Others
1988-01-01
Provides an overview of research on the biobehavioral antecedents of coronary heart disease, including stressful occupational settings characterized by high demands and little control over the job, and the Type A pattern, particularly hostility and mode of anger expression (anger-in). Discusses research on physiologic responsiveness (reactivity)…
Haga, Yutaka; Dominique, Vincent J; Du, Shao Jun
2009-10-01
To characterize the process of vertebral segmentation and disc formation in living animals, we analyzed tiggy-winkle hedgehog (twhh):green fluorescent protein (gfp) and sonic hedgehog (shh):gfp transgenic zebrafish models that display notochord-specific GFP expression. We found that they showed distinct patterns of expression in the intervertebral discs of late stage fish larvae and adult zebrafish. A segmented pattern of GFP expression was detected in the intervertebral disc of twhh:gfp transgenic fish. In contrast, little GFP expression was found in the intervertebral disc of shh:gfp transgenic fish. Treating twhh:gfp transgenic zebrafish larvae with exogenous retinoic acid (RA), a teratogenic factor on normal development, resulted in disruption of notochord segmentation and formation of oversized vertebrae. Histological analysis revealed that the oversized vertebrae are likely due to vertebral fusion. These studies demonstrate that the twhh:gfp transgenic zebrafish is a useful model for studying vertebral segmentation and disc formation, and moreover, that RA signaling may play a role in this process.
Huang, Jianyan; Zhao, Xiaobo; Weng, Xiaoyu; Wang, Lei; Xie, Weibo
2012-01-01
Background The B-box (BBX) -containing proteins are a class of zinc finger proteins that contain one or two B-box domains and play important roles in plant growth and development. The Arabidopsis BBX gene family has recently been re-identified and renamed. However, there has not been a genome-wide survey of the rice BBX (OsBBX) gene family until now. Methodology/Principal Findings In this study, we identified 30 rice BBX genes through a comprehensive bioinformatics analysis. Each gene was assigned a uniform nomenclature. We described the chromosome localizations, gene structures, protein domains, phylogenetic relationship, whole life-cycle expression profile and diurnal expression patterns of the OsBBX family members. Based on the phylogeny and domain constitution, the OsBBX gene family was classified into five subfamilies. The gene duplication analysis revealed that only chromosomal segmental duplication contributed to the expansion of the OsBBX gene family. The expression profile of the OsBBX genes was analyzed by Affymetrix GeneChip microarrays throughout the entire life-cycle of rice cultivar Zhenshan 97 (ZS97). In addition, microarray analysis was performed to obtain the expression patterns of these genes under light/dark conditions and after three phytohormone treatments. This analysis revealed that the expression patterns of the OsBBX genes could be classified into eight groups. Eight genes were regulated under the light/dark treatments, and eleven genes showed differential expression under at least one phytohormone treatment. Moreover, we verified the diurnal expression of the OsBBX genes using the data obtained from the Diurnal Project and qPCR analysis, and the results indicated that many of these genes had a diurnal expression pattern. Conclusions/Significance The combination of the genome-wide identification and the expression and diurnal analysis of the OsBBX gene family should facilitate additional functional studies of the OsBBX genes. PMID:23118960
Coba de la Peña, Teodoro; Cárcamo, Claudia B; Díaz, María I; Brokordt, Katherina B; Winkler, Federico M
2016-08-01
Ferritin is involved in several iron homoeostasis processes in molluscs. We characterized two ferritin homologues and their expression patterns in association with early development, growth rate and immune response in the scallop Argopecten purpuratus, a species of economic importance for Chile and Peru. Two ferritin subunits (Apfer1 and Apfer2) were cloned. Apfer1 cDNA is a 792bp clone containing a 516bp open reading frame (ORF) that corresponds to a novel ferritin subunit in A. purpuratus. Apfer2 cDNA is a 681bp clone containing a 522bp ORF that corresponds to a previously sequenced EST. A putative iron responsive element (IRE) was identified in the 5'-untranslated region of both genes. The deduced protein sequences of both cDNAs possessed the motifs and domains characteristic of functional ferritin subunits. Both genes showed differential expression patterns at tissue-specific and early development stage levels. Apfer1 expression level increased 40-fold along larval developmental stages, decreasing markedly after larval settlement. Apfer1 expression in mantle tissue was 2.8-fold higher in fast-growing than in slow-growing scallops. Apfer1 increased 8-fold in haemocytes 24h post-challenge with the bacterium Vibrio splendidus. Apfer2 expression did not differ between fast- and slow-growing scallops or in response to bacterial challenge. These results suggest that Apfer1 and Apfer2 may be involved in iron storage, larval development and shell formation. Apfer1 expression may additionally be involved in immune response against bacterial infections and also in growth; and thus would be a potential marker for immune capacity and for fast growth in A. purpuratus. Copyright © 2016 Elsevier Inc. All rights reserved.
The Oncoprotein BRD4-NUT Generates Aberrant Histone Modification Patterns.
Zee, Barry M; Dibona, Amy B; Alekseyenko, Artyom A; French, Christopher A; Kuroda, Mitzi I
2016-01-01
Defects in chromatin proteins frequently manifest in diseases. A striking case of a chromatin-centric disease is NUT-midline carcinoma (NMC), which is characterized by expression of NUT as a fusion partner most frequently with BRD4. ChIP-sequencing studies from NMC patients revealed that BRD4-NUT (B4N) covers large genomic regions and elevates transcription within these domains. To investigate how B4N modulates chromatin, we performed affinity purification of B4N when ectopically expressed in 293-TREx cells and quantified the associated histone posttranslational modifications (PTM) using proteomics. We observed significant enrichment of acetylation particularly on H3 K18 and of combinatorial patterns such as H3 K27 acetylation paired with K36 methylation. We postulate that B4N complexes override the preexisting histone code with new PTM patterns that reflect aberrant transcription and that epigenetically modulate the nucleosome environment toward the NMC state.
The Oncoprotein BRD4-NUT Generates Aberrant Histone Modification Patterns
Zee, Barry M.; Dibona, Amy B.; Alekseyenko, Artyom A.; French, Christopher A.; Kuroda, Mitzi I.
2016-01-01
Defects in chromatin proteins frequently manifest in diseases. A striking case of a chromatin-centric disease is NUT-midline carcinoma (NMC), which is characterized by expression of NUT as a fusion partner most frequently with BRD4. ChIP-sequencing studies from NMC patients revealed that BRD4-NUT (B4N) covers large genomic regions and elevates transcription within these domains. To investigate how B4N modulates chromatin, we performed affinity purification of B4N when ectopically expressed in 293-TREx cells and quantified the associated histone posttranslational modifications (PTM) using proteomics. We observed significant enrichment of acetylation particularly on H3 K18 and of combinatorial patterns such as H3 K27 acetylation paired with K36 methylation. We postulate that B4N complexes override the preexisting histone code with new PTM patterns that reflect aberrant transcription and that epigenetically modulate the nucleosome environment toward the NMC state. PMID:27698495
Expression Patterns of CREBs in Oocyte Growth and Maturation of Fish
Wang, De-Shou; Sudhakumari, Cheni-Chery; Kobayashi, Tohru; Nagahama, Yoshitaka
2015-01-01
In fish, oocyte meiotic maturation is regulated by 17α, 20β-dihydroxy-progesterone through cAMP. To study the role of cAMP response element binding protein (CREB) in meiotic maturation, we cloned and characterized the expression pattern of CREBs from two fish models, the Nile tilapia and catfish. In the Nile tilapia three different CREBs were identified where in CREB1 was found in many tissues including gonads with abundant expression in testis. CREB2, few amino acids shorter than CREB1, was expressed in several tissues with abundant expression in ovary. In addition, a 3’UTR variant form, CREB3 was exclusively found in ovary. During natural 14-day ovarian cycle of the Nile tilapia, CREB1 expression was stable throughout vitellogenesis with a sharp decrease on the day of spawning. In contrast, CREB2 remain unchanged throughout the ovarian cycle, however elevated in 11-day full-grown immature ovarian follicle and after hCG-induction. Interestingly, CREB3 expression was induced three folds on the day of spawning as well as during hCG-induced oocyte maturation. Based on the synergistic expression pattern, CREB1 is likely to control oocyte growth, whereas CREB 2 and 3 contribute to oocyte maturation in tilapia and the latter seems to be critical. In catfish, a single form of CREB showed a maximum expression during spawning phase and hCG-induced maturation both in vivo and in vitro augmented CREB expression. These results suggest that spatial and temporal expression of CREBs seems to be important for final oocyte maturation and may also regulate oocyte growth in fish. PMID:26700177
Mo, Delin; Zhu, Zhengmao; te Pas, Marinus F W; Li, Xinyun; Yang, Shulin; Wang, Heng; Wang, Huanling; Li, Kui
2008-06-30
In a previous screen to identify differentially expressed genes associated with embryonic development, the porcine PNAS-4 gene had been found. Considering differentially expressed genes in early stages of muscle development are potential candidate genes to improve meat quality and production efficiency, we determined how porcine PNAS-4 gene regulates meat production. Therefore, this gene has been sequenced, expression analyzed and associated with meat production traits. We cloned the full-length cDNA of porcine PNAS-4 gene encoding a protein of 194 amino acids which was expressed in the Golgi complex. This gene was mapped to chromosome 10, q11-16, in a region of conserved synteny with human chromosome 1 where the human homologous gene was localized. Real-time PCR revealed that PNAS-4 mRNA was widely expressed with highest expression levels in skeletal muscle followed by lymph, liver and other tissues, and showed a down-regulated expression pattern during prenatal development while a up-regulated expression pattern after weaning. Association analysis revealed that allele C of SNP A1813C was prevalent in Chinese indigenous breeds whereas A was dominant allele in Landrace and Large White, and the pigs with homozygous CC had a higher fat content than those of the pigs with other genotypes (P < 0.05). Porcine PNAS-4 protein tagged with green fluorescent protein accumulated in the Golgi complex, and its mRNA showed a widespread expression across many tissues and organs in pigs. It may be an important factor affecting the meat production efficiency, because its down-regulated expression pattern during early embryogenesis suggests involvement in increase of muscle fiber number. In addition, the SNP A1813C associated with fat traits might be a genetic marker for molecular-assisted selection in animal breeding.
Transcript and protein environmental biomarkers in fish--a review.
Tom, Moshe; Auslander, Meirav
2005-04-01
The levels of contaminant-affected gene products (transcripts and proteins) are increasingly utilized as environmental biomarkers, and their appropriate implementation as diagnostic tools is discussed. The required characteristics of a gene product biomarker are accurate evaluation using properly normalized absolute units, aiming at long-term comparability of biomarker levels over a wide geographical range and among many laboratories. Quantitative RT-PCR and competitive ELISA are suggested as preferred evaluation methods for transcript and protein, respectively. Constitutively expressed RNAs or proteins which are part of the examined homogenate are suggested as normalizing agents, compensating for variable processing efficiency. Essential characterization of expression patterns is suggested, providing reference values to be compared to the monitored levels. This comparison would enable estimation of the intensity of biological effects of contaminants. Contaminant-independent reference expression patterns should include natural fluctuations of the biomarker level. Contaminant-dependent patterns should include dose response to model contaminants chronically administered in two environmentally-realistic routes, reaching extreme sub-lethal affected levels. Recent studies using fish as environmental sentinel species, applying gene products as environmental biomarkers, and implementing at least part of the depicted methodologies are reviewed.
Barad, Shiri; Sela, Noa; Kumar, Dilip; Kumar-Dubey, Amit; Glam-Matana, Nofar; Sherman, Amir; Prusky, Dov
2016-05-04
Penicillium expansum is a destructive phytopathogen that causes decay in deciduous fruits during postharvest handling and storage. During colonization the fungus secretes D-gluconic acid (GLA), which modulates environmental pH and regulates mycotoxin accumulation in colonized tissue. Till now no transcriptomic analysis has addressed the specific contribution of the pathogen's pH regulation to the P. expansum colonization process. For this purpose total RNA from the leading edge of P. expansum-colonized apple tissue of cv. 'Golden Delicious' and from fungal cultures grown under pH 4 or 7 were sequenced and their gene expression patterns were compared. We present a large-scale analysis of the transcriptome data of P. expansum and apple response to fungal colonization. The fungal analysis revealed nine different clusters of gene expression patterns that were divided among three major groups in which the colonized tissue showed, respectively: (i) differing transcript expression patterns between mycelial growth at pH 4 and pH 7; (ii) similar transcript expression patterns of mycelial growth at pH 4; and (iii) similar transcript expression patterns of mycelial growth at pH 7. Each group was functionally characterized in order to decipher genes that are important for pH regulation and also for colonization of apple fruits by Penicillium. Furthermore, comparison of gene expression of healthy apple tissue with that of colonized tissue showed that differentially expressed genes revealed up-regulation of the jasmonic acid and mevalonate pathways, and also down-regulation of the glycogen and starch biosynthesis pathways. Overall, we identified important genes and functionalities of P. expansum that were controlled by the environmental pH. Differential expression patterns of genes belonging to the same gene family suggest that genes were selectively activated according to their optimal environmental conditions (pH, in vitro or in vivo) to enable the fungus to cope with varying conditions and to make optimal use of available enzymes. Comparison between the activation of the colonized host's gene responses by alkalizing Colletotrichum gloeosporioides and acidifying P. expansum pathogens indicated similar gene response patterns, but stronger responses to P. expansum, suggesting the importance of acidification by P. expansum as a factor in its increased aggressiveness.
Holographic interferometry of oil films and droplets in water with a single-beam mirror-type scheme.
Kukhtarev, Nickolai; Kukhtareva, Tatiana; Gallegos, Sonia C
2011-03-01
Application of single-beam reflective laser optical interferometry for oil films and droplets in water detection and characterization is discussed. Oil films can be detected by the appearance of characteristic interference patterns. Analytical expressions describing intensity distribution in these interference patterns allow determination of oil film thickness, size of oil droplets, and distance to the oil film from the observation plane. Results from these analyses indicate that oil spill aging and breakup can be monitored in real time by analyzing time-dependent holographic fringe patterns. Interferometric methods of oil spill detection and characterization can be automated using digital holography with three-dimensional reconstruction of the time-changing oil spill topography. In this effort, the interferometric methods were applied to samples from Chevron oil and British Petroleum MC252 oil obtained during the Deep Water Horizon oil spill in the Gulf of Mexico. © 2011 Optical Society of America
A MS-lesion pattern discrimination plot based on geostatistics.
Marschallinger, Robert; Schmidt, Paul; Hofmann, Peter; Zimmer, Claus; Atkinson, Peter M; Sellner, Johann; Trinka, Eugen; Mühlau, Mark
2016-03-01
A geostatistical approach to characterize MS-lesion patterns based on their geometrical properties is presented. A dataset of 259 binary MS-lesion masks in MNI space was subjected to directional variography. A model function was fit to express the observed spatial variability in x, y, z directions by the geostatistical parameters Range and Sill. Parameters Range and Sill correlate with MS-lesion pattern surface complexity and total lesion volume. A scatter plot of ln(Range) versus ln(Sill), classified by pattern anisotropy, enables a consistent and clearly arranged presentation of MS-lesion patterns based on geometry: the so-called MS-Lesion Pattern Discrimination Plot. The geostatistical approach and the graphical representation of results are considered efficient exploratory data analysis tools for cross-sectional, follow-up, and medication impact analysis.
LateBiclustering: Efficient Heuristic Algorithm for Time-Lagged Bicluster Identification.
Gonçalves, Joana P; Madeira, Sara C
2014-01-01
Identifying patterns in temporal data is key to uncover meaningful relationships in diverse domains, from stock trading to social interactions. Also of great interest are clinical and biological applications, namely monitoring patient response to treatment or characterizing activity at the molecular level. In biology, researchers seek to gain insight into gene functions and dynamics of biological processes, as well as potential perturbations of these leading to disease, through the study of patterns emerging from gene expression time series. Clustering can group genes exhibiting similar expression profiles, but focuses on global patterns denoting rather broad, unspecific responses. Biclustering reveals local patterns, which more naturally capture the intricate collaboration between biological players, particularly under a temporal setting. Despite the general biclustering formulation being NP-hard, considering specific properties of time series has led to efficient solutions for the discovery of temporally aligned patterns. Notably, the identification of biclusters with time-lagged patterns, suggestive of transcriptional cascades, remains a challenge due to the combinatorial explosion of delayed occurrences. Herein, we propose LateBiclustering, a sensible heuristic algorithm enabling a polynomial rather than exponential time solution for the problem. We show that it identifies meaningful time-lagged biclusters relevant to the response of Saccharomyces cerevisiae to heat stress.
NASA Technical Reports Server (NTRS)
Seaver, E. C.; Paulson, D. A.; Irvine, S. Q.; Martindale, M. Q.
2001-01-01
We are interested in understanding whether the annelids and arthropods shared a common segmented ancestor and have approached this question by characterizing the expression pattern of the segment polarity gene engrailed (en) in a basal annelid, the polychaete Chaetopterus. We have isolated an en gene, Ch-en, from a Chaetopterus cDNA library. Genomic Southern blotting suggests that this is the only en class gene in this animal. The predicted protein sequence of the 1.2-kb cDNA clone contains all five domains characteristic of en proteins in other taxa, including the en class homeobox. Whole-mount in situ hybridization reveals that Ch-en is expressed throughout larval life in a complex spatial and temporal pattern. The Ch-en transcript is initially detected in a small number of neurons associated with the apical organ and in the posterior portion of the prototrochophore. At later stages, Ch-en is expressed in distinct patterns in the three segmented body regions (A, B, and C) of Chaetopterus. In all segments, Ch-en is expressed in a small set of segmentally iterated cells in the CNS. In the A region, Ch-en is also expressed in a small group of mesodermal cells at the base of the chaetal sacs. In the B region, Ch-en is initially expressed broadly in the mesoderm that then resolves into one band/segment coincident with morphological segmentation. The mesodermal expression in the B region is located in the anterior region of each segment, as defined by the position of ganglia in the ventral nerve cord, and is involved in the morphogenesis of segment-specific feeding structures late in larval life. We observe banded mesodermal and ectodermal staining in an anterior-posterior sequence in the C region. We do not observe a segment polarity pattern of expression of Ch-en in the ectoderm, as is observed in arthropods. Copyright 2001 Academic Press.
The centrality of RNA for engineering gene expression
Chappell, James; Takahashi, Melissa K; Meyer, Sarai; Loughrey, David; Watters, Kyle E; Lucks, Julius
2013-01-01
Synthetic biology holds promise as both a framework for rationally engineering biological systems and a way to revolutionize how we fundamentally understand them. Essential to realizing this promise is the development of strategies and tools to reliably and predictably control and characterize sophisticated patterns of gene expression. Here we review the role that RNA can play towards this goal and make a case for why this versatile, designable, and increasingly characterizable molecule is one of the most powerful substrates for engineering gene expression at our disposal. We discuss current natural and synthetic RNA regulators of gene expression acting at key points of control – transcription, mRNA degradation, and translation. We also consider RNA structural probing and computational RNA structure predication tools as a way to study RNA structure and ultimately function. Finally, we discuss how next-generation sequencing methods are being applied to the study of RNA and to the characterization of RNA's many properties throughout the cell. PMID:24124015
Martins, Carlo de Oliveira; Demarchi, Lea; Ferreira, Frederico Moraes; Pomerantzeff, Pablo Maria Alberto; Brandao, Carlos; Sampaio, Roney Orismar; Spina, Guilherme Sobreira; Kalil, Jorge; Cunha-Neto, Edecio; Guilherme, Luiza
2017-01-01
Autoimmune inflammatory reactions leading to rheumatic fever (RF) and rheumatic heart disease (RHD) result from untreated Streptococcus pyogenes throat infections in individuals who exhibit genetic susceptibility. Immune effector mechanisms have been described that lead to heart tissue damage culminating in mitral and aortic valve dysfunctions. In myxomatous valve degeneration (MXD), the mitral valve is also damaged due to non-inflammatory mechanisms. Both diseases are characterized by structural valve disarray and a previous proteomic analysis of them has disclosed a distinct profile of matrix/structural proteins differentially expressed. Given their relevance in organizing valve tissue, we quantitatively evaluated the expression of vimentin, collagen VI, lumican, and vitronectin as well as performed immunohistochemical analysis of their distribution in valve tissue lesions of patients in both diseases. We identified abundant expression of two isoforms of vimentin (45 kDa, 42 kDa) with reduced expression of the full-size protein (54 kDa) in RHD valves. We also found increased vitronectin expression, reduced collagen VI expression and similar lumican expression between RHD and MXD valves. Immunohistochemical analysis indicated disrupted patterns of these proteins in myxomatous degeneration valves and disorganized distribution in rheumatic heart disease valves that correlated with clinical manifestations such as valve regurgitation or stenosis. Confocal microscopy analysis revealed a diverse pattern of distribution of collagen VI and lumican into RHD and MXD valves. Altogether, these results demonstrated distinct patterns of altered valve expression and tissue distribution/organization of structural/matrix proteins that play important pathophysiological roles in both valve diseases.
Zhu, Xin; Li, Yu-Long; Liu, Li; Wang, Jian-Hua; Li, Hong-Hui; Wu, Ping; Chu, Wu-Ying; Zhang, Jian-She
2016-01-01
Myogenic regulatory factors (MRFs) are muscle-specific basic helix-loop-helix (bHLH) transcription factor that plays an essential role in regulating skeletal muscle development and growth. To investigate molecular characterization of Myf5 and compare the expressional patterns of the four MRFs, we cloned the Myf5 cDNA sequence and analyzed the MRFs expressional patterns using quantitative real-time polymerase chain reaction in Chinese perch (Siniperca chuatsi). Sequence analysis indicated that Chinese perch Myf5 and other MRFs shared a highly conserved bHLH domain with those of other vertebrates. Sequence alignment and phylogenetic tree showed that Chinese perch MRFs had the highest identity with the MRFs of Epinephelus coioides. Spatio-temporal expressional patterns revealed that the MRFs were primarily expressed in muscle, especially in white muscle. During embryonic development period, Myf5, MyoD and MyoG mRNAs had a steep increase at neurula stage, and their highest expressional level was predominantly observed at hatching period. Whereas the highest expressional level of the MRF4 was observed at the muscular effect stage. The expressional patterns of post-embryonic development showed that the Myf5, MyoD and MyoG mRNAs were highest at 90 days post-hatching (dph). Furthermore, starvation and refeeding results showed that the transcription of the MRFs in the fast skeletal muscle of Chinese perch responded quickly to a single meal after 7 days of fasting. It indicated that the MRFs might contribute to muscle recovery after refeeding in Chinese perch. Copyright © 2015 Elsevier B.V. All rights reserved.
Liu, Juan; Franks, Robert G.; Feng, Chun-Miao; Liu, Xiang; Fu, Cheng-Xin; (Jenny) Xiang, Qiu-Yun
2013-01-01
Background and Aims LFY homologues encode transcription factors that regulate the transition from vegetative to reproductive growth in flowering plants and have been shown to control inflorescence patterning in model species. This study investigated the expression patterns of LFY homologues within the diverse inflorescence types (head-like, umbel-like and inflorescences with elongated internodes) in closely related lineages in the dogwood genus (Cornus s.l.). The study sought to determine whether LFY homologues in Cornus species are expressed during floral and inflorescence development and if the pattern of expression is consistent with a function in regulating floral development and inflorescence architectures in the genus. Methods Total RNAs were extracted using the CTAB method and the first-strand cDNA was synthesized using the SuperScript III first-strand synthesis system kit (Invitrogen). Expression of CorLFY was investigated by RT–PCR and RNA in situ hybridization. Phylogenetic analyses were conducted using the maximum likelihood methods implemented in RAxML-HPC v7.2.8. Key Results cDNA clones of LFY homologues (designated CorLFY) were isolated from six Cornus species bearing different types of inflorescence. CorLFY cDNAs were predicted to encode proteins of approximately 375 amino acids. The detection of CorLFY expression patterns using in situ RNA hybridization demonstrated the expression of CorLFY within the inflorescence meristems, inflorescence branch meristems, floral meristems and developing floral organ primordia. PCR analyses for cDNA libraries derived from reverse transcription of total RNAs showed that CorLFY was also expressed during the late-stage development of flowers and inflorescences, as well as in bracts and developing leaves. Consistent differences in the CorLFY expression patterns were not detected among the distinct inflorescence types. Conclusions The results suggest a role for CorLFY genes during floral and inflorescence development in dogwoods. However, the failure to detect expression differences between the inflorescence types in the Cornus species analysed suggests that the evolutionary shift between major inflorescence types in the genus is not controlled by dramatic alterations in the levels of CorLFY gene transcript accumulation. However, due to spatial, temporal and quantitative limitations of the expression data, it cannot be ruled out that subtle differences in the level or location of CorLFY transcripts may underlie the different inflorescence architectures that are observed across these species. Alternatively, differences in CorLFY protein function or the expression or function of other regulators (e.g. TFL1 and UFO homologues) may support the divergent developmental trajectories. PMID:24052556
Liu, Juan; Franks, Robert G; Feng, Chun-Miao; Liu, Xiang; Fu, Cheng-Xin; Jenny Xiang, Qiu-Yun
2013-11-01
LFY homologues encode transcription factors that regulate the transition from vegetative to reproductive growth in flowering plants and have been shown to control inflorescence patterning in model species. This study investigated the expression patterns of LFY homologues within the diverse inflorescence types (head-like, umbel-like and inflorescences with elongated internodes) in closely related lineages in the dogwood genus (Cornus s.l.). The study sought to determine whether LFY homologues in Cornus species are expressed during floral and inflorescence development and if the pattern of expression is consistent with a function in regulating floral development and inflorescence architectures in the genus. Total RNAs were extracted using the CTAB method and the first-strand cDNA was synthesized using the SuperScript III first-strand synthesis system kit (Invitrogen). Expression of CorLFY was investigated by RT-PCR and RNA in situ hybridization. Phylogenetic analyses were conducted using the maximum likelihood methods implemented in RAxML-HPC v7.2.8. cDNA clones of LFY homologues (designated CorLFY) were isolated from six Cornus species bearing different types of inflorescence. CorLFY cDNAs were predicted to encode proteins of approximately 375 amino acids. The detection of CorLFY expression patterns using in situ RNA hybridization demonstrated the expression of CorLFY within the inflorescence meristems, inflorescence branch meristems, floral meristems and developing floral organ primordia. PCR analyses for cDNA libraries derived from reverse transcription of total RNAs showed that CorLFY was also expressed during the late-stage development of flowers and inflorescences, as well as in bracts and developing leaves. Consistent differences in the CorLFY expression patterns were not detected among the distinct inflorescence types. The results suggest a role for CorLFY genes during floral and inflorescence development in dogwoods. However, the failure to detect expression differences between the inflorescence types in the Cornus species analysed suggests that the evolutionary shift between major inflorescence types in the genus is not controlled by dramatic alterations in the levels of CorLFY gene transcript accumulation. However, due to spatial, temporal and quantitative limitations of the expression data, it cannot be ruled out that subtle differences in the level or location of CorLFY transcripts may underlie the different inflorescence architectures that are observed across these species. Alternatively, differences in CorLFY protein function or the expression or function of other regulators (e.g. TFL1 and UFO homologues) may support the divergent developmental trajectories.
Testin (TES) as a candidate tumour suppressor and prognostic marker in human astrocytoma.
Steponaitis, Giedrius; Kazlauskas, Arunas; Skiriute, Daina; Valiulyte, Indre; Skauminas, Kestutis; Tamasauskas, Arimantas; Vaitkiene, Paulina
2016-11-01
Astrocytomas are one of the most common brain tumours; however, the current methods used to characterize these tumours are inadequate. The establishment of molecular markers may identify variables required to improve tumour characterization and subtyping, and may aid to specify targets for improved treatment with essential prognostic value for patient survival. One such candidate is testin (TES), which was reported to have prognostic value for glioblastoma patients. However, the role of TES protein in gliomagenesis is currently unknown. In the present study, the methylation status of the TES promoter was investigated in post-operative astrocytoma tumours of different malignancy grade, and its association with the survival of astrocytoma patients was evaluated. In addition, the expression of TES protein was investigated in the same set of astrocytoma tumours tissue, and the association of protein expression with glioma patients survival was evaluated. The methylation status of TES was assessed by methylation-specific polymerase chain reaction in 138 different grade astrocytoma samples. Western blot analysis was used to characterize the expression pattern of TES in 86 different grade astrocytoma specimens: 13 of pathological grade I, 31 of pathological grade II, 17 of pathological grade III and 25 of pathological grade IV (glioblastoma). Statistical analyses were conducted to investigate the association between tumour molecular pattern, patient clinical variables and overall survival. The methylation analysis of the TES promoter exhibited a distinct profile between astrocytomas of different malignancy grade (P<0.001). Furthermore, gene promoter methylation was significantly associated with patients' age, survival and pathological grade (P<0.001). The protein expression level of TES was significantly lower in glioblastoma (grade IV astrocytoma) than in lower grade (II-III) astrocytoma tissue (P=0.028 and P=0.04, respectively). Additionally, short overall survival of patients was markedly associated with low TES protein expression (P=0.007). However, no association between TES methylation and TES protein expression was noticed. The present study demonstrated that decreased expression of TES may be important in tumour progression and prognosis in human astrocytomas. TES may be a useful marker for predicting the clinical outcome of astrocytoma patients.
Testin (TES) as a candidate tumour suppressor and prognostic marker in human astrocytoma
Steponaitis, Giedrius; Kazlauskas, Arunas; Skiriute, Daina; Valiulyte, Indre; Skauminas, Kestutis; Tamasauskas, Arimantas; Vaitkiene, Paulina
2016-01-01
Astrocytomas are one of the most common brain tumours; however, the current methods used to characterize these tumours are inadequate. The establishment of molecular markers may identify variables required to improve tumour characterization and subtyping, and may aid to specify targets for improved treatment with essential prognostic value for patient survival. One such candidate is testin (TES), which was reported to have prognostic value for glioblastoma patients. However, the role of TES protein in gliomagenesis is currently unknown. In the present study, the methylation status of the TES promoter was investigated in post-operative astrocytoma tumours of different malignancy grade, and its association with the survival of astrocytoma patients was evaluated. In addition, the expression of TES protein was investigated in the same set of astrocytoma tumours tissue, and the association of protein expression with glioma patients survival was evaluated. The methylation status of TES was assessed by methylation-specific polymerase chain reaction in 138 different grade astrocytoma samples. Western blot analysis was used to characterize the expression pattern of TES in 86 different grade astrocytoma specimens: 13 of pathological grade I, 31 of pathological grade II, 17 of pathological grade III and 25 of pathological grade IV (glioblastoma). Statistical analyses were conducted to investigate the association between tumour molecular pattern, patient clinical variables and overall survival. The methylation analysis of the TES promoter exhibited a distinct profile between astrocytomas of different malignancy grade (P<0.001). Furthermore, gene promoter methylation was significantly associated with patients' age, survival and pathological grade (P<0.001). The protein expression level of TES was significantly lower in glioblastoma (grade IV astrocytoma) than in lower grade (II–III) astrocytoma tissue (P=0.028 and P=0.04, respectively). Additionally, short overall survival of patients was markedly associated with low TES protein expression (P=0.007). However, no association between TES methylation and TES protein expression was noticed. The present study demonstrated that decreased expression of TES may be important in tumour progression and prognosis in human astrocytomas. TES may be a useful marker for predicting the clinical outcome of astrocytoma patients. PMID:27899997
2010-01-01
Background The necrogenic enterobacterium, Erwinia amylovora is the causal agent of the fire blight (FB) disease in many Rosaceaespecies, including apple and pear. During the infection process, the bacteria induce an oxidative stress response with kinetics similar to those induced in an incompatible bacteria-plant interaction. No resistance mechanism to E. amylovora in host plants has yet been characterized, recent work has identified some molecular events which occur in resistant and/or susceptible host interaction with E. amylovora: In order to understand the mechanisms that characterize responses to FB, differentially expressed genes were identified by cDNA-AFLP analysis in resistant and susceptible apple genotypes after inoculation with E. amylovora. Results cDNA were isolated from M.26 (susceptible) and G.41 (resistant) apple tissues collected 2 h and 48 h after challenge with a virulent E. amylovora strain or mock (buffer) inoculated. To identify differentially expressed transcripts, electrophoretic banding patterns were obtained from cDNAs. In the AFLP experiments, M.26 and G.41 showed different patterns of expression, including genes specifically induced, not induced, or repressed by E. amylovora. In total, 190 ESTs differentially expressed between M.26 and G.41 were identified using 42 pairs of AFLP primers. cDNA-AFLP analysis of global EST expression in a resistant and a susceptible apple genotype identified different major classes of genes. EST sequencing data showed that genes linked to resistance, encoding proteins involved in recognition, signaling, defense and apoptosis, were modulated by E. amylovora in its host plant. The expression time course of some of these ESTs selected via a bioinformatic analysis has been characterized. Conclusion These data are being used to develop hypotheses of resistance or susceptibility mechanisms in Malus to E. amylovora and provide an initial categorization of genes possibly involved in recognition events, early signaling responses the subsequent development of resistance or susceptibility. These data also provided potential candidates for improving apple resistance to fire blight either by marker-assisted selection or genetic engineering. PMID:20047654
Tanigaki, Yusuke; Higashi, Takanobu; Takayama, Kotaro; Nagano, Atsushi J; Honjo, Mie N; Fukuda, Hirokazu
2015-01-01
In plant factories, measurements of plant conditions are necessary at an early stage of growth to predict harvest times of high value-added crops. Moreover, harvest qualities depend largely on environmental stresses that elicit plant hormone responses. However, the complexities of plant hormone networks have not been characterized under nonstress conditions. In the present study, we determined temporal expression profiles of all genes and then focused on plant hormone pathways using RNA-Seq analyses of gene expression in tomato leaves every 2 h for 48 h. In these experiments, temporally expressed genes were found in the hormone synthesis pathways for salicylic acid, abscisic acid, ethylene, and jasmonic acid. The timing of CAB expression 1 (TOC1) and abscisic acid insensitive 1 (ABA1) and open stomata 1 (OST1) control gating stomata. In this study, compare with tomato and Arabidopsis thaliana, expression patterns of TOC1 have similarity. In contrast, expression patterns of tomato ABI1 and OST1 had expression peak at different time. These findings suggest that the regulation of gating stomata does not depend predominantly on TOC1 and significantly reflects the extracellular environment. The present data provide new insights into relationships between temporally expressed plant hormone-related genes and clock genes under normal sunlight conditions.
Tanigaki, Yusuke; Higashi, Takanobu; Takayama, Kotaro; Nagano, Atsushi J.; Honjo, Mie N.; Fukuda, Hirokazu
2015-01-01
In plant factories, measurements of plant conditions are necessary at an early stage of growth to predict harvest times of high value-added crops. Moreover, harvest qualities depend largely on environmental stresses that elicit plant hormone responses. However, the complexities of plant hormone networks have not been characterized under nonstress conditions. In the present study, we determined temporal expression profiles of all genes and then focused on plant hormone pathways using RNA-Seq analyses of gene expression in tomato leaves every 2 h for 48 h. In these experiments, temporally expressed genes were found in the hormone synthesis pathways for salicylic acid, abscisic acid, ethylene, and jasmonic acid. The timing of CAB expression 1 (TOC1) and abscisic acid insensitive 1 (ABA1) and open stomata 1 (OST1) control gating stomata. In this study, compare with tomato and Arabidopsis thaliana, expression patterns of TOC1 have similarity. In contrast, expression patterns of tomato ABI1 and OST1 had expression peak at different time. These findings suggest that the regulation of gating stomata does not depend predominantly on TOC1 and significantly reflects the extracellular environment. The present data provide new insights into relationships between temporally expressed plant hormone-related genes and clock genes under normal sunlight conditions. PMID:26624004
Ahmed, Ikhlak; Karedath, Thasni; Andrews, Simeon S; Al-Azwani, Iman K; Mohamoud, Yasmin Ali; Querleu, Denis; Rafii, Arash; Malek, Joel A
2016-06-14
Recently, a class of endogenous species of RNA called circular RNA (circRNA) has been shown to regulate gene expression in mammals and their role in cellular function is just beginning to be understood. To investigate the role of circRNAs in ovarian cancer, we performed paired-end RNA sequencing of primary sites, peritoneal and lymph node metastases from three patients with stage IIIC ovarian cancer. We developed an in-house computational pipeline to identify and characterize the circRNA expression from paired-end RNA-Seq libraries. This pipeline revealed thousands of circular isoforms in Epithelial Ovarian Carcinoma (EOC). These circRNAs are enriched for potentially effective miRNA seed matches. A significantly larger number of circRNAs are differentially expressed between tumor sites than mRNAs. Circular and linear expression exhibits an inverse trend for many cancer related pathways and signaling pathways like NFkB, PI3k/AKT and TGF-β typically activated for mRNA in metastases are inhibited for circRNA expression. Further, circRNAs show a more robust expression pattern across patients than mRNA forms indicating their suitability as biomarkers in highly heterogeneous cancer transcriptomes. The consistency of circular RNA expression may offer new candidates for cancer treatment and prognosis.
Ahmed, Ikhlak; Karedath, Thasni; Andrews, Simeon S.; Al, Iman K.; Mohamoud, Yasmin Ali; Querleu, Denis; Rafii, Arash; Malek, Joel A.
2016-01-01
Recently, a class of endogenous species of RNA called circular RNA (circRNA) has been shown to regulate gene expression in mammals and their role in cellular function is just beginning to be understood. To investigate the role of circRNAs in ovarian cancer, we performed paired-end RNA sequencing of primary sites, peritoneal and lymph node metastases from three patients with stage IIIC ovarian cancer. We developed an in-house computational pipeline to identify and characterize the circRNA expression from paired-end RNA-Seq libraries. This pipeline revealed thousands of circular isoforms in Epithelial Ovarian Carcinoma (EOC). These circRNAs are enriched for potentially effective miRNA seed matches. A significantly larger number of circRNAs are differentially expressed between tumor sites than mRNAs. Circular and linear expression exhibits an inverse trend for many cancer related pathways and signaling pathways like NFkB, PI3k/AKT and TGF-β typically activated for mRNA in metastases are inhibited for circRNA expression. Further, circRNAs show a more robust expression pattern across patients than mRNA forms indicating their suitability as biomarkers in highly heterogeneous cancer transcriptomes. The consistency of circular RNA expression may offer new candidates for cancer treatment and prognosis. PMID:27119352
Munday, J; Kerr, S; Ni, J; Cornish, A L; Zhang, J Q; Nicoll, G; Floyd, H; Mattei, M G; Moore, P; Liu, D; Crocker, P R
2001-01-01
Here we characterize Siglec-10 as a new member of the Siglec family of sialic acid-binding Ig-like lectins. A full-length cDNA was isolated from a human spleen library and the corresponding gene identified. Siglec-10 is predicted to contain five extracellular Ig-like domains and a cytoplasmic tail containing three putative tyrosine-based signalling motifs. Siglec-10 exhibited a high degree of sequence similarity to CD33-related Siglecs and mapped to the same region, on chromosome 19q13.3. The expressed protein was able to mediate sialic acid-dependent binding to human erythrocytes and soluble sialoglycoconjugates. Using specific antibodies, Siglec-10 was detected on subsets of human leucocytes including eosinophils, monocytes and a minor population of natural killer-like cells. The molecular properties and expression pattern suggest that Siglec-10 may function as an inhibitory receptor within the innate immune system. PMID:11284738
Transgenic mouse models enabling photolabeling of individual neurons in vivo.
Peter, Manuel; Bathellier, Brice; Fontinha, Bruno; Pliota, Pinelopi; Haubensak, Wulf; Rumpel, Simon
2013-01-01
One of the biggest tasks in neuroscience is to explain activity patterns of individual neurons during behavior by their cellular characteristics and their connectivity within the neuronal network. To greatly facilitate linking in vivo experiments with a more detailed molecular or physiological analysis in vitro, we have generated and characterized genetically modified mice expressing photoactivatable GFP (PA-GFP) that allow conditional photolabeling of individual neurons. Repeated photolabeling at the soma reveals basic morphological features due to diffusion of activated PA-GFP into the dendrites. Neurons photolabeled in vivo can be re-identified in acute brain slices and targeted for electrophysiological recordings. We demonstrate the advantages of PA-GFP expressing mice by the correlation of in vivo firing rates of individual neurons with their expression levels of the immediate early gene c-fos. Generally, the mouse models described in this study enable the combination of various analytical approaches to characterize living cells, also beyond the neurosciences.
Evolution and inheritance of early embryonic patterning in Drosophila simulans and D. sechellia.
Lott, Susan E; Ludwig, Michael Z; Kreitman, Martin
2011-05-01
Pattern formation in Drosophila is a widely studied example of a robust developmental system. Such robust systems pose a challenge to adaptive evolution, as they mask variation that selection may otherwise act upon. Yet we find variation in the localization of expression domains (henceforth "stripe allometry") in the pattern formation pathway. Specifically, we characterize differences in the gap genes giant and Kruppel, and the pair-rule gene even-skipped, which differ between the sibling species Drosophila simulans and D. sechellia. In a double-backcross experiment, stripe allometry is consistent with maternal inheritance of stripe positioning and multiple genetic factors, with a distinct genetic basis from embryo length. Embryos produced by F1 and F2 backcross mothers exhibit novel spatial patterns of gene expression relative to the parental species, with no measurable increase in positional variance among individuals. Buffering of novel spatial patterns in the backcross genotypes suggests that robustness need not be disrupted in order for the trait to evolve, and perhaps the system is incapable of evolving to prevent the expression of all genetic variation. This limitation, and the ability of natural selection to act on minute genetic differences that are within the "margin of error" for the buffering mechanism, indicates that developmentally buffered traits can evolve without disruption of robustness. © 2010 The Author(s). Evolution© 2010 The Society for the Study of Evolution.
Laskowska-Macios, Karolina; Zapasnik, Monika; Hu, Tjing-Tjing; Kossut, Malgorzata; Arckens, Lutgarde; Burnat, Kalina
2015-10-01
Pattern vision deprivation (BD) can induce permanent deficits in global motion perception. The impact of timing and duration of BD on the maturation of the central and peripheral visual field representations in cat primary visual areas 17 and 18 remains unknown. We compared early BD, from eye opening for 2, 4, or 6 months, with late onset BD, after 2 months of normal vision, using the expression pattern of the visually driven activity reporter gene zif268 as readout. Decreasing zif268 mRNA levels between months 2 and 4 characterized the normal maturation of the (supra)granular layers of the central and peripheral visual field representations in areas 17 and 18. In general, all BD conditions had higher than normal zif268 levels. In area 17, early BD induced a delayed decrease, beginning later in peripheral than in central area 17. In contrast, the decrease occurred between months 2 and 4 throughout area 18. Lack of pattern vision stimulation during the first 4 months of life therefore has a different impact on the development of areas 17 and 18. A high zif268 expression level at a time when normal vision is restored seems to predict the capacity of a visual area to compensate for BD. © The Author 2014. Published by Oxford University Press.
Computational Micromodel for Epigenetic Mechanisms
Raghavan, Karthika; Ruskin, Heather J.; Perrin, Dimitri; Goasmat, Francois; Burns, John
2010-01-01
Characterization of the epigenetic profile of humans since the initial breakthrough on the human genome project has strongly established the key role of histone modifications and DNA methylation. These dynamic elements interact to determine the normal level of expression or methylation status of the constituent genes in the genome. Recently, considerable evidence has been put forward to demonstrate that environmental stress implicitly alters epigenetic patterns causing imbalance that can lead to cancer initiation. This chain of consequences has motivated attempts to computationally model the influence of histone modification and DNA methylation in gene expression and investigate their intrinsic interdependency. In this paper, we explore the relation between DNA methylation and transcription and characterize in detail the histone modifications for specific DNA methylation levels using a stochastic approach. PMID:21152421
USDA-ARS?s Scientific Manuscript database
To better understand water uptake patterns in root systems of woody perennial crops, we detailed the developmental anatomy and hydraulic physiology along the length of grapevine fine roots- from the tip to secondary growth zones. Our characterization included localization of suberized structures an...
Gender Differences in Same-Sex Friendships and Romantic Relationships.
ERIC Educational Resources Information Center
Mosley, Norman R.; And Others
An investigation of differences in the friendship patterns of men and of women reported that women appeared to be expressive in their friendship styles while men's same-sex friendships were best characterized as being instrumental. To examine these differences further, a study was conducted which investigated the relationship of friendship and…
Ostberg, Carl O.; Chase, Dorothy M.; Hauser, Lorenz
2015-01-01
Hybridization creates novel gene combinations that may generate important evolutionary novelty, but may also reduce existing adaptation by interrupting inherent biological processes, such as genotype-environment interactions. Hybridization often causes substantial change in patterns of gene expression, which, in turn, may cause phenotypic change. Rainbow trout (Oncorhynchus mykiss) and cutthroat trout (O. clarkii) produce viable hybrids in the wild, and introgressive hybridization with introduced rainbow trout is a major conservation concern for native cutthroat trout. The two species differ in body shape, which is likely an evolutionary adaptation to their native environments, and their hybrids tend to show intermediate morphology. The characterization of gene expression patterns may provide insights on the genetic basis of hybrid and parental morphologies, as well as on the ecological performance of hybrids in the wild. Here, we evaluated the expression of eight growth-related genes (MSTN-1a, MSTN-1b, MyoD1a, MyoD1b, MRF-4, IGF-1, IGF-2, and CAST-L) and the relationship of these genes with growth traits (length, weight, and condition factor) in six line crosses: both parental species, both reciprocal F1 hybrids, and both first-generation backcrosses (F1 x rainbow trout and F1 x cutthroat trout). Four of these genes were differentially expressed among rainbow, cutthroat, and their hybrids. Transcript abundance was significantly correlated with growth traits across the parent species, but not across hybrids. Our findings suggest that rainbow and cutthroat trout exhibit differences in muscle growth regulation, that transcriptional networks may be modified by hybridization, and that hybridization disrupts intrinsic relationships between gene expression and growth patterns that may be functionally important for phenotypic adaptations.
Chun, Lauren E.; Hinds, Laura R.; Spencer, Robert L.
2016-01-01
Mood disorders are associated with dysregulation of prefrontal cortex (PFC) function, circadian rhythms, and diurnal glucocorticoid (corticosterone [CORT]) circulation. Entrainment of clock gene expression in some peripheral tissues depends on CORT. In this study, we characterized over the course of the day the mRNA expression pattern of the core clock genes Per1, Per2, and Bmal1 in the male rat PFC and suprachiasmatic nucleus (SCN) under different diurnal CORT conditions. In experiment 1, rats were left adrenal-intact (sham) or were adrenalectomized (ADX) followed by 10 daily antiphasic (opposite time of day of the endogenous CORT peak) ip injections of either vehicle or 2.5 mg/kg CORT. In experiment 2, all rats received ADX surgery followed by 13 daily injections of vehicle or CORT either antiphasic or in-phase with the endogenous CORT peak. In sham rats clock gene mRNA levels displayed a diurnal pattern of expression in the PFC and the SCN, but the phase differed between the 2 structures. ADX substantially altered clock gene expression patterns in the PFC. This alteration was normalized by in-phase CORT treatment, whereas antiphasic CORT treatment appears to have eliminated a diurnal pattern (Per1 and Bmal1) or dampened/inverted its phase (Per2). There was very little effect of CORT condition on clock gene expression in the SCN. These experiments suggest that an important component of glucocorticoid circadian physiology entails CORT regulation of the molecular clock in the PFC. Consequently, they also point to a possible mechanism that contributes to PFC disrupted function in disorders associated with abnormal CORT circulation. PMID:26901093
2011-01-01
Background Paraquat (1, 1-dimethyl-4, 4-bipyridium dichloride; PQ) causes neurotoxicity, especially dopaminergic neurotoxicity, and is a supposed risk factor for Parkinson's disease (PD). However, the cellular and molecular mechanisms of PQ-induced neurodegeneration are far from clear. Previous studies have shown that PQ induces neuroinflammation and dopaminergic cell loss, but the prime cause of those events is still in debate. Methods We examined the neuropathological effects of PQ not only in substantia nigra (SN) but also in frontal cortex (FC) and hippocampus of the progressive mouse (adult Swiss albino) model of PD-like neurodegeneration, using immunohistochemistry, western blots, and histological and biochemical analyses. Results PQ caused differential patterns of changes in cellular morphology and expression of proteins related to PD and neuroinflammation in the three regions examined (SN, FC and hippocampus). Coincident with behavioral impairment and brain-specific ROS generation, there was differential immunolocalization and decreased expression levels of tyrosine hydroxylase (TH) in the three regions, whereas α-synuclein immunopositivity increased in hippocampus, increased in FC and decreased in SN. PQ-induced neuroinflammation was characterized by area-specific changes in localization and appearances of microglial cells with or without activation and increment in expression patterns of tumor necrosis factor-α in the three regions of mouse brain. Expression of interleukin-1β was increased in FC and hippocampus but not significantly changed in SN. Conclusion The present study demonstrates that PQ induces ROS production and differential α-synuclein expression that promotes neuroinflammation in microglia-dependent or -independent manners, and produces different patterns of dopaminergic neurotoxicity in three different regions of mouse brain. PMID:22112368
Sun, Tao; Zhang, Lei; Yang, Yanjun; Qi, Jianshuang; Yan, Shufeng; Han, Xiaohua; Wang, Huizhong; Shen, Chenjia
2015-01-01
The auxin influx carriers auxin resistant 1/like aux 1 (AUX/LAX), efflux carriers pin-formed (PIN) (together with PIN-like proteins) and efflux/conditional P-glycoprotein (ABCB) are major protein families involved in auxin polar transport. However, how they function in responses to exogenous auxin and abiotic stresses in maize is largely unknown. In this work, the latest updated maize (Zea mays L.) reference genome sequence was used to characterize and analyze the ZmLAX, ZmPIN, ZmPILS and ZmABCB family genes from maize. The results showed that five ZmLAXs, fifteen ZmPINs, nine ZmPILSs and thirty-five ZmABCBs were mapped on all ten maize chromosomes. Highly diversified gene structures, nonconservative transmembrane helices and tissue-specific expression patterns suggested the possibility of function diversification for these genes. Quantitative real-time polymerase chain reaction (qRT-PCR) was used to analyze the expression patterns of ZmLAX, ZmPIN, ZmPILS and ZmABCB genes under exogenous auxin and different environmental stresses. The expression levels of most ZmPIN, ZmPILS, ZmLAX and ZmABCB genes were induced in shoots and were reduced in roots by various abiotic stresses (drought, salt and cold stresses). The opposite expression response patterns indicated the dynamic auxin transport between shoots and roots under abiotic stresses. Analysis of the expression patterns of ZmPIN, ZmPILS, ZmLAX and ZmABCB genes under drought, salt and cold treatment may help us to understand the possible roles of maize auxin transporter genes in responses and tolerance to environmental stresses. PMID:25742625
Hart, M. C.; Wang, L.; Coulter, D. E.
1996-01-01
The odd-skipped (odd) gene, which was identified on the basis of a pair-rule segmentation phenotype in mutant embryos, is initially expressed in the Drosophila embryo in seven pair-rule stripes, but later exhibits a segment polarity-like pattern for which no phenotypic correlate is apparent. We have molecularly characterized two embryonically expressed odd-cognate genes, sob and bowel (bowl), that encode proteins with highly conserved C(2)H(2) zinc fingers. While the Sob and Bowl proteins each contain five tandem fingers, the Odd protein lacks a fifth (C-terminal) finger and is also less conserved among the four common fingers. Reminiscent of many segmentation gene paralogues, the closely linked odd and sob genes are expressed during embryogenesis in similar striped patterns; in contrast, the less-tightly linked bowl gene is expressed in a distinctly different pattern at the termini of the early embryo. Although our results indicate that odd and sob are more likely than bowl to share overlapping developmental roles, some functional divergence between the Odd and Sob proteins is suggested by the absence of homology outside the zinc fingers, and also by amino acid substitutions in the Odd zinc fingers at positions that appear to be constrained in Sob and Bowl. PMID:8878683
Circadian rhythms regulate amelogenesis.
Zheng, Li; Seon, Yoon Ji; Mourão, Marcio A; Schnell, Santiago; Kim, Doohak; Harada, Hidemitsu; Papagerakis, Silvana; Papagerakis, Petros
2013-07-01
Ameloblasts, the cells responsible for making enamel, modify their morphological features in response to specialized functions necessary for synchronized ameloblast differentiation and enamel formation. Secretory and maturation ameloblasts are characterized by the expression of stage-specific genes which follows strictly controlled repetitive patterns. Circadian rhythms are recognized as key regulators of the development and diseases of many tissues including bone. Our aim was to gain novel insights on the role of clock genes in enamel formation and to explore the potential links between circadian rhythms and amelogenesis. Our data shows definitive evidence that the main clock genes (Bmal1, Clock, Per1 and Per2) oscillate in ameloblasts at regular circadian (24 h) intervals both at RNA and protein levels. This study also reveals that the two markers of ameloblast differentiation i.e. amelogenin (Amelx; a marker of secretory stage ameloblasts) and kallikrein-related peptidase 4 (Klk4, a marker of maturation stage ameloblasts) are downstream targets of clock genes. Both, Amelx and Klk4 show 24h oscillatory expression patterns and their expression levels are up-regulated after Bmal1 over-expression in HAT-7 ameloblast cells. Taken together, these data suggest that both the secretory and the maturation stages of amelogenesis might be under circadian control. Changes in clock gene expression patterns might result in significant alterations of enamel apposition and mineralization. Copyright © 2013 Elsevier Inc. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Aluru, Neelakanteswar, E-mail: naluru@whoi.edu; Kuo, Elaine; Stanford University, 450 Serra Mall, Stanford, CA 94305
2015-04-15
DNA methylation is one of the most important epigenetic modifications involved in the regulation of gene expression. The DNA methylation reaction is catalyzed by DNA methyltransferases (DNMTs). Recent studies have demonstrated that toxicants can affect normal development by altering DNA methylation patterns, but the mechanisms of action are poorly understood. Hence, we tested the hypothesis that developmental exposure to TCDD affects dnmt gene expression patterns. Zebrafish embryos were exposed to 5 nM TCDD for 1 h from 4 to 5 h post-fertilization (hpf) and sampled at 12, 24, 48, 72, and 96 hpf to determine dnmt gene expression and DNAmore » methylation patterns. We performed a detailed analysis of zebrafish dnmt gene expression during development and in adult tissues. Our results demonstrate that dnmt3b genes are highly expressed in early stages of development, and dnmt3a genes are more abundant in later stages. TCDD exposure upregulated dnmt1 and dnmt3b2 expression, whereas dnmt3a1, 3b1, and 3b4 are downregulated following exposure. We did not observe any TCDD-induced differences in global methylation or hydroxymethylation levels, but the promoter methylation of aryl hydrocarbon receptor (AHR) target genes was altered. In TCDD-exposed embryos, AHR repressor a (ahrra) and c-fos promoters were differentially methylated. To characterize the TCDD effects on DNMTs, we cloned the dnmt promoters with xenobiotic response elements and conducted AHR transactivation assays using a luciferase reporter system. Our results suggest that ahr2 can regulate dnmt3a1, dnmt3a2, and dnmt3b2 expression. Overall, we demonstrate that developmental exposure to TCDD alters dnmt expression and DNA methylation patterns. - Highlights: • TCDD altered the dnmt expression in a gene and developmental time-specific manner. • TCDD hypermethylated ahrra and hypomethylated c-fos proximal promoter regions. • Functional analysis suggests that ahr2 can regulate dnmt3a1, 3a2, and 3b2 expression. • Dnmt3b genes are expressed early whereas dnmt3a are abundant later in development.« less
Ma, Ming-San; Kannan, Vishnu; de Vries, Anneriek E; Czepiel, Marcin; Wesseling, Evelyn M; Balasubramaniyan, Veerakumar; Kuijer, Roel; Vissink, Arjan; Copray, Sjef C V M; Raghoebar, Gerry M
2017-01-01
New developments in stem cell biology offer alternatives for the reconstruction of critical-sized bone defects. One of these developments is the use of induced pluripotent stem (iPS) cells. These stem cells are similar to embryonic stem (ES) cells, but can be generated from adult somatic cells and therefore do not raise ethical concerns. Proper characterization of iPS-derived osteoblasts is important for future development of safe clinical applications of these cells. For this reason, we differentiated mouse ES and iPS cells toward osteoblasts using osteogenic medium and compared their functionality. Immunocytochemical analysis showed significant expression of bone markers (osteocalcin and collagen type I) in osteoblasts differentiated from ES and iPS cells on days 7 and 30. An in vitro mineralization assay confirmed the functionality of osteogenically differentiated ES and iPS cells. Gene expression arrays focusing on osteogenic differentiation were performed in order to compare the gene expression pattern in both differentiated and undifferentiated ES cells and iPS cells. We observed a significant upregulation of osteogenesis-related genes such as Runx2, osteopontin, collagen type I, Tnfsf11, Csf1, and alkaline phosphatase upon osteogenic differentiation of the ES and iPS cells. We further validated the expression of key osteogenic genes Runx2, osteopontin, osteocalcin, collagen type I, and osterix in both differentiated and undifferentiated ES and iPS cells by means of quantified real-time polymerase chain reaction. We conclude that ES and iPS cells are similar in their osteogenic differentiation capacities, as well as in their gene expression patterns.
Liu, H-W; Wang, L-L; Meng, Z; Tang, X; Li, Y-S; Xia, Q-Y; Zhao, P
2017-10-01
Clip domain serine proteases (CLIPs), characterized by one or more conserved clip domains, are essential components of extracellular signalling cascades in various biological processes, especially in innate immunity and the embryonic development of insects. Additionally, CLIPs may have additional non-immune functions in insect development. In the present study, the clip domain serine protease gene Bombyx mori serine protease 95 (BmSP95), which encodes a 527-residue protein, was cloned from the integument of B. mori. Bioinformatics analysis indicated that BmSP95 is a typical CLIP of the subfamily D and possesses a clip domain at the N terminus, a trypsin-like serine protease (tryp_spc) domain at the C terminus and a conserved proline-rich motif between these two domains. At the transcriptional level, BmSP95 is expressed in the integument during moulting and metamorphosis, and the expression pattern is consistent with the fluctuating 20-hydroxyecdysone (20E) titre in B. mori. At the translational level, BmSP95 protein is synthesized in the epidermal cells, secreted as a zymogen and activated in the moulting fluid. Immunofluorescence revealed that BmSP95 is distributed into the old endocuticle in the moulting stage. The expression of BmSP95 was upregulated by 20E. Moreover, expression of BmSP95 was downregulated by pathogen infection. RNA interference-mediated silencing of BmSP95 led to delayed moulting from pupa to moth. These results suggest that BmSP95 is involved in integument remodelling during moulting and metamorphosis. © 2017 The Royal Entomological Society.
Baskar, Venkidasamy; Park, Se Won
2015-07-01
Glucosinolates (GSL) are one of the major secondary metabolites of the Brassicaceae family. In the present study, we aim at characterizing the multiple paralogs of aliphatic GSL regulators, such as BrMYB28 and BrMYB29 genes in Brassica rapa ssp. pekinensis, by quantitative real-time PCR (qRT-PCR) analysis in different tissues and at various developmental stages. An overlapping gene expression pattern between the BrMYBs as well as their downstream genes (DSGs) was found at different developmental stages. Among the BrMYB28 and BrMYB29 paralogous genes, the BrMYB28.3 and BrMYB29.1 genes were dominantly expressed in most of the developmental stages, compared to the other paralogs of the BrMYB genes. Furthermore, the differential expression pattern of the BrMYBs was observed under various stress treatments. Interestingly, BrMYB28.2 showed the least expression in most developmental stages, while its expression was remarkably high in different stress conditions. More specifically, the BrMYB28.2, BrMYB28.3, and BrMYB29.1 genes were highly responsive to various abiotic and biotic stresses, further indicating their possible role in stress tolerance. Moreover, the in silico cis motif analysis in the upstream regulatory regions of BrMYBs showed the presence of various putative stress-specific motifs, which further indicated their responsiveness to biotic and abiotic stresses. These observations suggest that the dominantly expressed BrMYBs, both in different developmental stages and under various stress treatments (BrMYB28.3 and BrMYB29.1), may be potential candidate genes for altering the GSL level through genetic modification studies in B. rapa ssp. pekinensis. Copyright © 2015. Published by Elsevier SAS.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cheng, Xiaoxia; University of Chinese Academy of Sciences, Beijing; Chen, Xiaowen
The glycoprotein subunit α (gsuα) gene encodes the shared α subunit of the three pituitary heterodimeric glycoprotein hormones: follicle-stimulating hormone β (Fshβ), luteinizing hormone β (Lhβ) and thyroid stimulating hormone β (Tshβ). In our current study, we identified and characterized the promoter region of zebrafish gsuα and generated a stable gsuα:EGFP transgenic line, which recapitulated the endogenous gsuα expression in the early developing pituitary gland. A relatively conserved regulatory element set is presented in the promoter regions of zebrafish and three other known mammalian gsuα promoters. Our results also demonstrated that the expression patterns of the gsuα:EGFP transgene were allmore » identical to those expression patterns of the endogenous gsuα expression in the pituitary tissue when our transgenic fish were treated with various endocrine chemicals, including forskolin (FSK), SP600125, trichostatin A (TSA), KClO{sub 4}, dexamethasone (Dex), β-estradiol and progesterone. Thus, this gsuα:EGFP transgenic fish reporter line provides another valuable tool for investigating the lineage development of gsuα-expressing gonadotrophins and the coordinated regulation of various glycoprotein hormone subunit genes. These reporter fish can serve as a novel platform to perform screenings of endocrine-disrupting chemicals (EDCs) in vivo as well. - Highlights: • Identification of the promoter of zebrafish glycoprotein subunit α (gsuα) gene • Generation of stable transmission gsuα:EGFP transgenic zebrafish reporter • Demonstration of the recapitulation of the gsuα:EGFP and endogenous gsuα expression • Suggestion of the gsuα:EGFP transgenic zebrafish as a novel platform for EDC study.« less
Radulović, Željko; Porter, Lindsay M.; Kim, Tae K.; Mulenga, Albert
2015-01-01
Organic anion-transporting polypeptides (Oatps) are an integral part of the detoxification mechanism in vertebrates and invertebrates. These cell surface proteins are involved in mediating the sodium-independent uptake and/or distribution of a broad array of organic amphipathic compounds and xenobiotic drugs. This study describes bioinformatics and biological characterization of 9 Oatp sequences in the Ixodes scapularis genome. These sequences have been annotated on the basis of 12 transmembrane domains, consensus motif D-X-RW-(I,V)-GAWW-X-G-(F,L)-L, and 11 conserved cysteine amino acid residues in the large extracellular loop 5 that characterize the Oatp superfamily. Ixodes scapularis Oatps may regulate non-redundant cross-tick species conserved functions in that they did not cluster as a monolithic group on the phylogeny tree and that they have orthologs in other ticks. Phylogeny clustering patterns also suggest that some tick Oatp sequences transport substrates that are similar to those of body louse, mosquito, eye worm, and filarial worm Oatps. Semi-quantitative RT-PCR analysis demonstrated that all 9 I. scapularis Oatp sequences were expressed during tick feeding. Ixodes scapularis Oatp genes potentially regulate functions during early and/or late-stage tick feeding as revealed by normalized mRNA profiles. Normalized transcript abundance indicates that I. scapularis Oatp genes are strongly expressed in unfed ticks during the first 24 h of feeding and/or at the end of the tick feeding process. Except for 2 I. scapularis Oatps, which were expressed in the salivary glands and ovaries, all other genes were expressed in all tested organs, suggesting the significance of I. scapularis Oatps in maintaining tick homeostasis. Different I. scapularis Oatp mRNA expression patterns were detected and discussed with reference to different physiological states of unfed and feeding ticks. PMID:24582512
Widiez, Thomas; Hartman, Thomas G; Dudai, Nativ; Yan, Qing; Lawton, Michael; Havkin-Frenkel, Daphna; Belanger, Faith C
2011-08-01
Caffeoyl CoA O-methyltransferases (OMTs) have been characterized from numerous plant species and have been demonstrated to be involved in lignin biosynthesis. Higher plant species are known to have additional caffeoyl CoA OMT-like genes, which have not been well characterized. Here, we identified two new caffeoyl CoA OMT-like genes by screening a cDNA library from specialized hair cells of pods of the orchid Vanilla planifolia. Characterization of the corresponding two enzymes, designated Vp-OMT4 and Vp-OMT5, revealed that in vitro both enzymes preferred as a substrate the flavone tricetin, yet their sequences and phylogenetic relationships to other enzymes are distinct from each other. Quantitative analysis of gene expression indicated a dramatic tissue-specific expression pattern for Vp-OMT4, which was highly expressed in the hair cells of the developing pod, the likely location of vanillin biosynthesis. Although Vp-OMT4 had a lower activity with the proposed vanillin precursor, 3,4-dihydroxybenzaldehyde, than with tricetin, the tissue specificity of expression suggests it may be a candidate for an enzyme involved in vanillin biosynthesis. In contrast, the Vp-OMT5 gene was mainly expressed in leaf tissue and only marginally expressed in pod hair cells. Phylogenetic analysis suggests Vp-OMT5 evolved from a cyanobacterial enzyme and it clustered within a clade in which the sequences from eukaryotic species had predicted chloroplast transit peptides. Transient expression of a GFP-fusion in tobacco demonstrated that Vp-OMT5 was localized in the plastids. This is the first flavonoid OMT demonstrated to be targeted to the plastids.
Mihm, Bernhard; Bergmann, Markus; Brück, Wolfgang; Probst-Cousin, Stefan
2014-06-01
To determine if the pattern of macrophage activation reflects differences in the pathogenesis and clinical presentation of giant cell arteritis and primary angiitis of the central nervous system, specimens of 10 patients with giant cell arteritis and five with primary angiitis of the central nervous system were immunohistochemically studied and the expression of the macrophage activation markers 27E10, MRP14, MRP8 and 25F9 was determined in the vasculitic infiltrates. Thus, a partly different expression pattern of macrophage activation markers in giant cell arteritis and primary angiitis of the central nervous system was observed. The group comparison revealed that giant cell arteritis cases had significantly higher numbers of acute activated MRP14-positive macrophages, whereas primary angiitis of the central nervous system is characterized by a tendency toward more MRP8-positive intermediate/late activated macrophages. Furthermore, in giant cell arteritis comparably fewer CD8-positive lymphocytes were observed. These observations suggest, that despite their histopathological similarities, giant cell arteritis and primary angiitis of the central nervous system appear to represent either distinct entities within the spectrum of granulomatous vasculitides or different stages of similar disease processes. Their discrete clinical presentation is reflected by different activation patterns of macrophages, which may characterize giant cell arteritis as a more acute process and primary angiitis of the central nervous system as a more advanced inflammatory process. © 2013 Japanese Society of Neuropathology.
Falavigna, Vítor da Silveira; Miotto, Yohanna Evelyn; Porto, Diogo Denardi; Anzanello, Rafael; Santos, Henrique Pessoa dos; Fialho, Flávio Bello; Margis-Pinheiro, Márcia; Pasquali, Giancarlo; Revers, Luís Fernando
2015-11-01
Dehydrins (DHN) are proteins involved in plant adaptive responses to abiotic stresses, mainly dehydration. Several studies in perennial crops have linked bud dormancy progression, a process characterized by the inability to initiate growth from meristems under favorable conditions, with DHN gene expression. However, an in-depth characterization of DHNs during bud dormancy progression is still missing. An extensive in silico characterization of the apple DHN gene family was performed. Additionally, we used five different experiments that generated samples with different dormancy status, including genotypes with contrasting dormancy traits, to analyze how DHN genes are being regulated during bud dormancy progression in apple by real-time quantitative polymerase chain reaction (RT-qPCR). Duplication events took place in the diversification of apple DHN family. Additionally, MdDHN genes presented tissue- and bud dormant-specific expression patterns. Our results indicate that MdDHN genes are highly divergent in function, with overlapping levels, and that their expressions are fine-tuned by the environment during the dormancy process in apple. © 2015 Scandinavian Plant Physiology Society.
Shakhbazau, Antos; Shcharbin, Dzmitry; Seviaryn, Ihar; Goncharova, Natalya; Kosmacheva, Svetlana; Potapnev, Mihail; Bryszewska, Maria; Kumar, Ranjan; Biernaskie, Jeffrey; Midha, Rajiv
2012-05-07
This study reports the use of a nonviral expression system based on polyamidoamine dendrimers for time-restricted neurotrophin overproduction in mesenchymal stem cells and skin precursor-derived Schwann cells. The dendrimers were used to deliver plasmids for brain-derived neurotrophic factor (BDNF) or neurotrophin-3 (NT-3) expression in both rodent and human stem cells, and the timelines of expression were studied. We have found that, despite the fact that transfection efficiencies and protein expression levels were comparable, dendrimer-driven expression in human mesenchymal stem cells was characterized by a more rapid decline compared to rodent cells. Transient expression systems can be beneficial for some neurotrophins, which were earlier reported to cause unwanted side effects in virus-based long-term expression models. Nonviral neurotrophin expression is a biologically safe and accessible alternative to increase the therapeutic potential of autologous adult stem cells and stem cell-derived functional differentiated cells.
Imprinted expression in cystic embryoid bodies shows an embryonic and not an extra-embryonic pattern
Kulinski, Tomasz M.; Casari, M. Rita T.; Guenzl, Philipp M.; Wenzel, Daniel; Andergassen, Daniel; Hladik, Anastasiya; Datlinger, Paul; Farlik, Matthias; Theussl, H. -Christian; Penninger, Josef M.; Knapp, Sylvia; Bock, Christoph; Barlow, Denise P.; Hudson, Quanah J.
2015-01-01
A large subset of mammalian imprinted genes show extra-embryonic lineage (EXEL) specific imprinted expression that is restricted to placental trophectoderm lineages and to visceral yolk sac endoderm (ysE). Isolated ysE provides a homogenous in vivo model of a mid-gestation extra-embryonic tissue to examine the mechanism of EXEL-specific imprinted gene silencing, but an in vitro model of ysE to facilitate more rapid and cost-effective experiments is not available. Reports indicate that ES cells differentiated into cystic embryoid bodies (EBs) contain ysE, so here we investigate if cystic EBs model ysE imprinted expression. The imprinted expression pattern of cystic EBs is shown to resemble fetal liver and not ysE. To investigate the reason for this we characterized the methylome and transcriptome of cystic EBs in comparison to fetal liver and ysE, by whole genome bisulphite sequencing and RNA-seq. Cystic EBs show a fetal liver pattern of global hypermethylation and low expression of repeats, while ysE shows global hypomethylation and high expression of IAPEz retroviral repeats, as reported for placenta. Transcriptome analysis confirmed that cystic EBs are more similar to fetal liver than ysE and express markers of early embryonic endoderm. Genome-wide analysis shows that ysE shares epigenetic and repeat expression features with placenta. Contrary to previous reports, we show that cystic EBs do not contain ysE, but are more similar to the embryonic endoderm of fetal liver. This explains why cystic EBs reproduce the imprinted expression seen in the embryo but not that seen in the ysE. PMID:25912690
Palovaara, Joakim; Hallberg, Henrik; Stasolla, Claudio; Luit, Bert; Hakman, Inger
2010-04-01
In seed plants, the body organization is established during embryogenesis and is uniform across gymnosperms and angiosperms, despite differences during early embryogeny. Evidence from angiosperms implicates the plant hormone auxin and its polar transport, mainly established by the PIN family of auxin efflux transporters, in the patterning of embryos. Here, PaPIN1 from Norway spruce (Picea abies [L.] Karst.), a gene widely expressed in conifer tissues and organs, was characterized and its expression and localization patterns were determined with reverse transcription polymerase chain reaction and in situ hybridization during somatic embryo development and in seedlings. PaPIN1 shares the predicted structure of other PIN proteins, but its central hydrophilic loop is longer than most PINs. In phylogenetic analyses, PaPIN1 clusters with Arabidopsis thaliana (L.) Heynh. PIN3, PIN4 and PIN7, but its expression pattern also suggests similarity to PIN1. The PaPIN1 expression signal was high in the protoderm of pre-cotyledonary embryos, but not if embryos were pre-treated with the auxin transport inhibitor N-1-naphthylphthalamic acid (NPA). This, together with a high auxin immunolocalization signal in this cell layer, suggests a role of PaPIN1 during cotyledon formation. At later stages, high PaPIN1 expression was observed in differentiating procambium, running from the tip of incipient cotyledons down through the embryo axis and to the root apical meristem (RAM), although the mode of RAM specification in conifer embryos differs from that of most angiosperms. Also, the PaPIN1 in situ signal was high in seedling root tips including root cap columella cells. The results thus suggest that PaPIN1 provides an ancient function associated with auxin transport and embryo pattern formation prior to the separation of angiosperms and gymnosperms, in spite of some morphological differences.
Rettig, Eleni M; Bishop, Justin A; Agrawal, Nishant; Chung, Christine H; Sharma, Rajni; Zamuner, Fernando; Li, Ryan J; Koch, Wayne M; Califano, Joseph A; Guo, Theresa; Gaykalova, Daria A; Fakhry, Carole
2018-07-01
Notch signaling is frequently altered in head and neck squamous cell carcinoma (HNSCC). However, the nature and clinical implications of this dysregulation are not well understood. We previously described an association of transcriptionally active NOTCH1 Intracellular Domain (NICD1) immunohistochemical (IHC) expression pattern with high-risk pathologic characteristics. Here we further characterize Notch signaling in HNSCC. IHC expression patterns and clinicopathologic associations of Notch pathway molecules were evaluated among 78 tumors with known NOTCH1 mutation status. IHC was performed for JAG1, a NOTCH1 activating ligand, and HEY1, an NICD1 transcriptional target and Notch pathway activation marker. IHC pattern and H-score (% staining × intensity) were recorded and compared to clinicopathologic characteristics and survival. Survival was analyzed using Kaplan Meier method and Cox proportional hazards models (HR). JAG1 and NICD1 expression patterns were highly concordant among tumors without truncating NOTCH1 mutations (p < 0.001), but were dissimilar among tumors with truncating NOTCH1 mutations (p = 0.24). There was evidence for JAG1-independent NOTCH1 activation among seven tumors, all with wild-type NOTCH1. HEY1 expression was associated with neither JAG1 nor NICD1 expression, but was associated with NOTCH1 mutation status (p = 0.03). Twelve (16%) tumors expressed HEY1 but not NICD1. Higher HEY1 H-score was significantly associated with worse overall (adjusted hazard ratio [aHR] 2.0, 95% CI = 1.0-4.2) and disease-specific (aHR = 3.3, 95% CI = 1.4-7.9) survival, whereas JAG1 and NICD1 expression were not associated with survival. These findings suggest both NOTCH1-dependent and -independent HEY1 regulation, and imply a previously unrecognized prognostic role for HEY1 in HNSCC. Copyright © 2018 Elsevier Ltd. All rights reserved.
Beyond age at first sex: Patterns of emerging sexual behavior in adolescence and young adulthood
Haydon, Abigail A.; Herring, Amy H.; Prinstein, Mitchell J.; Halpern, Carolyn Tucker
2011-01-01
Purpose Although the emergence of sexual expression during adolescence and early adulthood is nearly universal, little is known about patterns of initiation. Methods We used latent class analysis to group 12,194 respondents from Waves I and IV of the National Longitudinal Study of Adolescent Health (Add Health) into one of five classes based on variety, timing, spacing, and sequencing of oral-genital, anal, and vaginal sex. Multinomial logistic regression models, stratified by biological sex, examined associations between sociodemographic characteristics and class membership. Results Approximately half of respondents followed a pattern characterized predominately by initiation of vaginal sex first, average age of initiation of approximately 16 years, and spacing of one year or more between initiation of the first and second behaviors; almost one third initiated sexual activity slightly later but reported first experiences of oral-genital and vaginal sex within the same year. Classes characterized by postponement of sexual activity, initiation of only one type of behavior, or adolescent initiation of anal sex were substantially less common. Compared to White respondents, Black respondents were more likely to appear in classes characterized by initiation of vaginal sex first. Respondents from lower socioeconomic backgrounds were more likely to be in classes distinguished by early/atypical patterns of initiation. Conclusions A small number of typical and atypical patterns capture the emergence of sexual behavior during adolescence, but these patterns reveal complex associations among different elements of emerging sexuality that should be considered in future research. PMID:22525108
Master, V A; Kourakis, M J; Martindale, M Q
1996-12-01
The msx gene family is one of the most highly conserved of the nonclustered homeobox-containing genes. We have isolated an msx homolog (Le-msx) from the glossiphoniid leech, Helobdella robusta, and characterized its pattern of expression by whole mount in situ hybridization. In situ expression and reverse transcription polymerase chain reaction (RT-PCR) data results show that Le-msx is a maternal transcript initially uniformly distributed in the cortex of immature oocytes that becomes asymmetrically localized to the polar regions of the uncleaved zygote. This is the earliest reported expression for the msx gene family and the first maternally expressed homeodomain-containing transcription factor reported in annelids. During embryonic development, Le-msx is expressed in all 10 embryonic stem cells and their segmental founder cell descendants. At midembryonic stages, Le-msx is expressed in the expanding germinal plate. Le-msx is confined to the central nervous system and nephridia at late (stage 9) stages and subsequently disappears from nephridia. In addition, we present a phylogenetic hypothesis for the evolution of the msx gene family, including the identification of a putative C. elegans msx homolog and the realignment of the sponge msx homolog to the NK class of homeodomain genes.
Karanja, Bernard Kinuthia; Fan, Lianxue; Xu, Liang; Wang, Yan; Zhu, Xianwen; Tang, Mingjia; Wang, Ronghua; Zhang, Fei; Muleke, Everlyne M'mbone; Liu, Liwang
2017-11-01
The radish WRKY gene family was genome-widely identified and played critical roles in response to multiple abiotic stresses. The WRKY is among the largest transcription factors (TFs) associated with multiple biological activities for plant survival, including control response mechanisms against abiotic stresses such as heat, salinity, and heavy metals. Radish is an important root vegetable crop and therefore characterization and expression pattern investigation of WRKY transcription factors in radish is imperative. In the present study, 126 putative WRKY genes were retrieved from radish genome database. Protein sequence and annotation scrutiny confirmed that RsWRKY proteins possessed highly conserved domains and zinc finger motif. Based on phylogenetic analysis results, RsWRKYs candidate genes were divided into three groups (Group I, II and III) with the number 31, 74, and 20, respectively. Additionally, gene structure analysis revealed that intron-exon patterns of the WRKY genes are highly conserved in radish. Linkage map analysis indicated that RsWRKY genes were distributed with varying densities over nine linkage groups. Further, RT-qPCR analysis illustrated the significant variation of 36 RsWRKY genes under one or more abiotic stress treatments, implicating that they might be stress-responsive genes. In total, 126 WRKY TFs were identified from the R. sativus genome wherein, 35 of them showed abiotic stress-induced expression patterns. These results provide a genome-wide characterization of RsWRKY TFs and baseline for further functional dissection and molecular evolution investigation, specifically for improving abiotic stress resistances with an ultimate goal of increasing yield and quality of radish.
Cannon, Matthew V.; Buchner, David A.; Hester, James; Miller, Hadley; Sehayek, Ephraim; Nadeau, Joseph H.; Serre, David
2014-01-01
Aims Epidemiological and animal studies have shown that maternal diet can influence metabolism in adult offspring. However, the molecular mechanisms underlying these changes remain poorly understood. Here, we characterize the phenotypes induced by maternal obesity in a mouse model and examine gene expression and epigenetic changes induced by maternal diet in adult offspring. Methods We analyzed genetically identical male mice born from dams fed a high- or low-fat diet throughout pregnancy and until day 21 postpartum. After weaning, half of the males of each group were fed a high-fat diet, the other half a low-fat diet. We first characterized the genome-wide gene expression patterns of six tissues of adult offspring - liver, pancreas, white adipose, brain, muscle and heart. We then measured DNA methylation patterns in liver at selected loci and throughout the genome. Results Maternal diet had a significant effect on the body weight of the offspring when they were fed an obesogenic diet after weaning. Our analyses showed that maternal diet had a pervasive effect on gene expression, with a pronounced effect in liver where it affected many genes involved in inflammation, cholesterol synthesis and RXR activation. We did not detect any effect of the maternal diet on DNA methylation in the liver. Conclusions Overall, our findings highlighted the persistent influence of maternal diet on adult tissue regulation and suggested that the transcriptional changes were unlikely to be caused by DNA methylation differences in adult liver. PMID:24594983
Vitorino, Marta; Cunha, Nídia; Conceição, Natércia; Cancela, M Leonor
2018-05-11
Atypical Rett syndrome is a child neurodevelopmental disorder induced by mutations in CDKL5 gene and characterized by a progressive regression in development with loss of purposeful use of the hands, slowed brain and head growth, problems with walking, seizures, and intellectual disability. At the moment, there is no cure for this pathology and little information is available concerning animal models capable of mimicking its phenotypes, thus the development of additional animal models should be of interest to gain more knowledge about the disease. Zebrafish has been used successfully as model organism for many human genetic diseases; however, no information is available concerning the spatial and temporal expression of cdkl5 orthologous in this organism. In the present study, we identified the developmental expression patterns of cdkl5 in zebrafish by quantitative PCR and whole-mount in situ hybridization. cdkl5 is expressed maternally at low levels during the first 24 h of development. After that the expression of the gene increases significantly and it starts to be expressed mainly in the nervous system and in several brain structures, such as telencephalon, mesencephalon and diencephalon. The expression patterns of cdkl5 in zebrafish is in accordance with the tissues known to be affected in humans and associated to symptoms and deficits observed in Rett syndrome patients thus providing the first evidence that zebrafish could be an alternative model to study the molecular pathways of this disease as well as to test possible therapeutic approaches capable of rescuing the phenotype.
Zhang, Bin; Liu, Xia; Zhao, Guangyao; Mao, Xinguo; Li, Ang; Jing, Ruilian
2014-06-01
Wheat (Triticum aestivum L.) is one of the most important crops in the world. Squamosa-promoter binding protein (SBP)-box genes play a critical role in regulating flower and fruit development. In this study, 10 novel SBP-box genes (TaSPL genes) were isolated from wheat ((Triticum aestivum L.) cultivar Yanzhan 4110). Phylogenetic analysis classified the TaSPL genes into five groups (G1-G5). The motif combinations and expression patterns of the TaSPL genes varied among the five groups with each having own distinctive characteristics: TaSPL20/21 in G1 and TaSPL17 in G2 mainly expressed in the shoot apical meristem and the young ear, and their expression levels responded to development of the ear; TaSPL6/15 belonging to G3 were upregulated and TaSPL1/23 in G4 were downregulated during grain development; the gene in G5 (TaSPL3) expressed constitutively. Thus, the consistency of the phylogenetic analysis, motif compositions, and expression patterns of the TaSPL genes revealed specific gene structures and functions. On the other hand, the diverse gene structures and different expression patterns suggested that wheat SBP-box genes have a wide range of functions. The results also suggest a potential role for wheat SBP-box genes in ear development. This study provides a significant beginning of functional analysis of SBP-box genes in wheat. © 2014 The Authors. Journal of Integrative Plant Biology Published by Wiley Publishing Asia Pty Ltd on behalf of Institute of Botany, Chinese Academy of Sciences.
2013-01-01
Background Multicellular organisms consist of cells of many different types that are established during development. Each type of cell is characterized by the unique combination of expressed gene products as a result of spatiotemporal gene regulation. Currently, a fundamental challenge in regulatory biology is to elucidate the gene expression controls that generate the complex body plans during development. Recent advances in high-throughput biotechnologies have generated spatiotemporal expression patterns for thousands of genes in the model organism fruit fly Drosophila melanogaster. Existing qualitative methods enhanced by a quantitative analysis based on computational tools we present in this paper would provide promising ways for addressing key scientific questions. Results We develop a set of computational methods and open source tools for identifying co-expressed embryonic domains and the associated genes simultaneously. To map the expression patterns of many genes into the same coordinate space and account for the embryonic shape variations, we develop a mesh generation method to deform a meshed generic ellipse to each individual embryo. We then develop a co-clustering formulation to cluster the genes and the mesh elements, thereby identifying co-expressed embryonic domains and the associated genes simultaneously. Experimental results indicate that the gene and mesh co-clusters can be correlated to key developmental events during the stages of embryogenesis we study. The open source software tool has been made available at http://compbio.cs.odu.edu/fly/. Conclusions Our mesh generation and machine learning methods and tools improve upon the flexibility, ease-of-use and accuracy of existing methods. PMID:24373308
Altered procollagen gene expression in mid-gestational mouse excisional wounds.
Goldberg, Stephanie R; Quirk, Gerald L; Sykes, Virginia W; Kordula, Tomasz; Lanning, David A
2007-11-01
Many pathologic conditions are characterized by excessive tissue contraction and scar formation. Previously, we developed a murine model of excisional wound healing in which mid-gestational wounds heal scarlessly compared with late-gestational wounds. We theorized that variations in procollagen gene expression may contribute to the scarless and rapid closure. Time-dated pregnant FVB strain mice underwent laparotomy and hysterotomy on embryonic days 15 (E15) and 18 (E18). Full-thickness, excisional wounds (3 mm) were made on each of 4 fetuses per doe and then harvested at 32, 48, or 72 h. Control tissue consisted of age-matched normal fetal skin. Procollagen types 1alpha1, 1alpha2, and 3 gene expressions were measured by real-time polymerase chain reaction and normalized to glyceraldehyde-3-phosphate dehydrogenase. Trichrome staining was also performed. Procollagen 1alpha1 expression was decreased in E15 wounds at 32 h compared with their normal skin groups. Procollagen types 1alpha2 and 3 expressions were both increased in the E15 groups compared with the E18 groups at 48 h. At 72 h, the E15 wounds had a collagen density similar to the surrounding normal skin while E18 wounds exhibited increased collagen deposition in a disorganized pattern. This study demonstrates that the pattern of gene expression for types 1 and 3 collagen varies between mid- and late-gestational mouse excisional wounds. These alterations in procollagen expression may contribute to a pattern of collagen deposition in the mid-gestational fetuses that is more favorable for scarless healing with less type 1 and more type 3 collagen.
Carlson, Kimberly A.; Gardner, Kylee; Pashaj, Anjeza; Carlson, Darby J.; Yu, Fang; Eudy, James D.; Zhang, Chi; Harshman, Lawrence G.
2015-01-01
Aging is a complex process characterized by a steady decline in an organism's ability to perform life-sustaining tasks. In the present study, two cages of approximately 12,000 mated Drosophila melanogaster females were used as a source of RNA from individuals sampled frequently as a function of age. A linear model for microarray data method was used for the microarray analysis to adjust for the box effect; it identified 1,581 candidate aging genes. Cluster analyses using a self-organizing map algorithm on the 1,581 significant genes identified gene expression patterns across different ages. Genes involved in immune system function and regulation, chorion assembly and function, and metabolism were all significantly differentially expressed as a function of age. The temporal pattern of data indicated that gene expression related to aging is affected relatively early in life span. In addition, the temporal variance in gene expression in immune function genes was compared to a random set of genes. There was an increase in the variance of gene expression within each cohort, which was not observed in the set of random genes. This observation is compatible with the hypothesis that D. melanogaster immune function genes lose control of gene expression as flies age. PMID:26090231
Vascular Gene Expression in Nonneoplastic and Malignant Brain
Madden, Stephen L.; Cook, Brian P.; Nacht, Mariana; Weber, William D.; Callahan, Michelle R.; Jiang, Yide; Dufault, Michael R.; Zhang, Xiaoming; Zhang, Wen; Walter-Yohrling, Jennifer; Rouleau, Cecile; Akmaev, Viatcheslav R.; Wang, Clarence J.; Cao, Xiaohong; St. Martin, Thia B.; Roberts, Bruce L.; Teicher, Beverly A.; Klinger, Katherine W.; Stan, Radu-Virgil; Lucey, Brenden; Carson-Walter, Eleanor B.; Laterra, John; Walter, Kevin A.
2004-01-01
Malignant gliomas are uniformly lethal tumors whose morbidity is mediated in large part by the angiogenic response of the brain to the invading tumor. This profound angiogenic response leads to aggressive tumor invasion and destruction of surrounding brain tissue as well as blood-brain barrier breakdown and life-threatening cerebral edema. To investigate the molecular mechanisms governing the proliferation of abnormal microvasculature in malignant brain tumor patients, we have undertaken a cell-specific transcriptome analysis from surgically harvested nonneoplastic and tumor-associated endothelial cells. SAGE-derived endothelial cell gene expression patterns from glioma and nonneoplastic brain tissue reveal distinct gene expression patterns and consistent up-regulation of certain glioma endothelial marker genes across patient samples. We define the G-protein-coupled receptor RDC1 as a tumor endothelial marker whose expression is distinctly induced in tumor endothelial cells of both brain and peripheral vasculature. Further, we demonstrate that the glioma-induced gene, PV1, shows expression both restricted to endothelial cells and coincident with endothelial cell tube formation. As PV1 provides a framework for endothelial cell caveolar diaphragms, this protein may serve to enhance glioma-induced disruption of the blood-brain barrier and transendothelial exchange. Additional characterization of this extensive brain endothelial cell gene expression database will provide unique molecular insights into vascular gene expression. PMID:15277233
Halbleib, Jennifer M.; Sääf, Annika M.
2007-01-01
Although there is considerable evidence implicating posttranslational mechanisms in the development of epithelial cell polarity, little is known about the patterns of gene expression and transcriptional regulation during this process. We characterized the temporal program of gene expression during cell–cell adhesion–initiated polarization of human Caco-2 cells in tissue culture, which develop structural and functional polarity similar to that of enterocytes in vivo. A distinctive switch in gene expression patterns occurred upon formation of cell–cell contacts between neighboring cells. Expression of genes involved in cell proliferation was down-regulated concomitant with induction of genes necessary for functional specialization of polarized epithelial cells. Transcriptional up-regulation of these latter genes correlated with formation of important structural and functional features in enterocyte differentiation and establishment of structural and functional cell polarity; components of the apical microvilli were induced as the brush border formed during polarization; as barrier function was established, expression of tight junction transmembrane proteins peaked; transcripts encoding components of the apical, but not the basal-lateral trafficking machinery were increased during polarization. Coordinated expression of genes encoding components of functional cell structures were often observed indicating temporal control of expression and assembly of multiprotein complexes. PMID:17699590
Identification of Reference Genes for RT-qPCR Data Normalization in Cannabis sativa Stem Tissues.
Mangeot-Peter, Lauralie; Legay, Sylvain; Hausman, Jean-Francois; Esposito, Sergio; Guerriero, Gea
2016-09-15
Gene expression profiling via quantitative real-time PCR is a robust technique widely used in the life sciences to compare gene expression patterns in, e.g., different tissues, growth conditions, or after specific treatments. In the field of plant science, real-time PCR is the gold standard to study the dynamics of gene expression and is used to validate the results generated with high throughput techniques, e.g., RNA-Seq. An accurate relative quantification of gene expression relies on the identification of appropriate reference genes, that need to be determined for each experimental set-up used and plant tissue studied. Here, we identify suitable reference genes for expression profiling in stems of textile hemp (Cannabis sativa L.), whose tissues (isolated bast fibres and core) are characterized by remarkable differences in cell wall composition. We additionally validate the reference genes by analysing the expression of putative candidates involved in the non-oxidative phase of the pentose phosphate pathway and in the first step of the shikimate pathway. The goal is to describe the possible regulation pattern of some genes involved in the provision of the precursors needed for lignin biosynthesis in the different hemp stem tissues. The results here shown are useful to design future studies focused on gene expression analyses in hemp.
Videos of conspecifics elicit interactive looking patterns and facial expressions in monkeys
Mosher, Clayton P.; Zimmerman, Prisca E.; Gothard, Katalin M.
2014-01-01
A broader understanding of the neural basis of social behavior in primates requires the use of species-specific stimuli that elicit spontaneous, but reproducible and tractable behaviors. In this context of natural behaviors, individual variation can further inform about the factors that influence social interactions. To approximate natural social interactions similar to those documented by field studies, we used unedited video footage to induce in viewer monkeys spontaneous facial expressions and looking patterns in the laboratory setting. Three adult male monkeys, previously behaviorally and genetically (5-HTTLPR) characterized (Gibboni et al., 2009), were monitored while they watched 10 s video segments depicting unfamiliar monkeys (movie monkeys) displaying affiliative, neutral, and aggressive behaviors. The gaze and head orientation of the movie monkeys alternated between ‘averted’ and ‘directed’ at the viewer. The viewers were not reinforced for watching the movies, thus their looking patterns indicated their interest and social engagement with the stimuli. The behavior of the movie monkey accounted for differences in the looking patterns and facial expressions displayed by the viewers. We also found multiple significant differences in the behavior of the viewers that correlated with their interest in these stimuli. These socially relevant dynamic stimuli elicited spontaneous social behaviors, such as eye-contact induced reciprocation of facial expression, gaze aversion, and gaze following, that were previously not observed in response to static images. This approach opens a unique opportunity to understanding the mechanisms that trigger spontaneous social behaviors in humans and non-human primates. PMID:21688888
Intra- and interregional coregulation of opioid genes: broken symmetry in spinal circuits
Kononenko, Olga; Galatenko, Vladimir; Andersson, Malin; Bazov, Igor; Watanabe, Hiroyuki; Zhou, Xing Wu; Iatsyshyna, Anna; Mityakina, Irina; Yakovleva, Tatiana; Sarkisyan, Daniil; Ponomarev, Igor; Krishtal, Oleg; Marklund, Niklas; Tonevitsky, Alex; Adkins, DeAnna L.; Bakalkin, Georgy
2017-01-01
Regulation of the formation and rewiring of neural circuits by neuropeptides may require coordinated production of these signaling molecules and their receptors that may be established at the transcriptional level. Here, we address this hypothesis by comparing absolute expression levels of opioid peptides with their receptors, the largest neuropeptide family, and by characterizing coexpression (transcriptionally coordinated) patterns of these genes. We demonstrated that expression patterns of opioid genes highly correlate within and across functionally and anatomically different areas. Opioid peptide genes, compared with their receptor genes, are transcribed at much greater absolute levels, which suggests formation of a neuropeptide cloud that covers the receptor-expressed circuits. Surprisingly, we found that both expression levels and the proportion of opioid receptors are strongly lateralized in the spinal cord, interregional coexpression patterns are side specific, and intraregional coexpression profiles are affected differently by left- and right-side unilateral body injury. We propose that opioid genes are regulated as interconnected components of the same molecular system distributed between distinct anatomic regions. The striking feature of this system is its asymmetric coexpression patterns, which suggest side-specific regulation of selective neural circuits by opioid neurohormones.—Kononenko, O., Galatenko, V., Andersson, M., Bazov, I., Watanabe, H., Zhou, X. W., Iatsyshyna, A., Mityakina, I., Yakovleva, T., Sarkisyan, D., Ponomarev, I., Krishtal, O., Marklund, N., Tonevitsky, A., Adkins, D. L., Bakalkin, G. Intra- and interregional coregulation of opioid genes: broken symmetry in spinal circuits. PMID:28122917
Xu, Jiajia; Bräutigam, Andrea; Weber, Andreas P. M.; Zhu, Xin-Guang
2016-01-01
Identification of potential cis-regulatory motifs controlling the development of C4 photosynthesis is a major focus of current research. In this study, we used time-series RNA-seq data collected from etiolated maize and rice leaf tissues sampled during a de-etiolation process to systematically characterize the expression patterns of C4-related genes and to further identify potential cis elements in five different genomic regions (i.e. promoter, 5′UTR, 3′UTR, intron, and coding sequence) of C4 orthologous genes. The results demonstrate that although most of the C4 genes show similar expression patterns, a number of them, including chloroplast dicarboxylate transporter 1, aspartate aminotransferase, and triose phosphate transporter, show shifted expression patterns compared with their C3 counterparts. A number of conserved short DNA motifs between maize C4 genes and their rice orthologous genes were identified not only in the promoter, 5′UTR, 3′UTR, and coding sequences, but also in the introns of core C4 genes. We also identified cis-regulatory motifs that exist in maize C4 genes and also in genes showing similar expression patterns as maize C4 genes but that do not exist in rice C3 orthologs, suggesting a possible recruitment of pre-existing cis-elements from genes unrelated to C4 photosynthesis into C4 photosynthesis genes during C4 evolution. PMID:27436282
Pizzo, Astrid; Mazzone, Fabio; Palestrini, Claudia
2015-01-01
Among beetles, thousands of species develop horns, the size of which is often extraordinarily disproportionate with respect to body size. The Scarabaeidae is the family in which horned species are most predominant, but other families, such as the Geotrupidae (dor beetles), also show remarkable horns, although in a more limited number of species. Horn expression mechanisms are well documented in Scarabaeidae but, despite the wealth of studies on this family, the horn morphological pattern of the Geotrupidae, to our knowledge, has never been investigated. In this paper, we describe for the first time the horn expression pattern in a dor beetle. As a study species, we chose Ceratophyus rossii, an Italian endemic dor beetle of the protected Mediterranean maquis in Tuscany, which shows remarkable head and pronotal horns in males and a notable cephalic horn in females. We identified and modeled shape and size horn patterns combining traditional and geometric morphometric approaches. We discuss the results in the wider landscape of developmental models described for other, more well-characterized, scarab beetles.
Gene Profiling in Experimental Models of Eye Growth: Clues to Myopia Pathogenesis
Stone, Richard A.; Khurana, Tejvir S.
2010-01-01
To understand the complex regulatory pathways that underlie the development of refractive errors, expression profiling has evaluated gene expression in ocular tissues of well-characterized experimental models that alter postnatal eye growth and induce refractive errors. Derived from a variety of platforms (e.g. differential display, spotted microarrays or Affymetrix GeneChips), gene expression patterns are now being identified in species that include chicken, mouse and primate. Reconciling available results is hindered by varied experimental designs and analytical/statistical features. Continued application of these methods offers promise to provide the much-needed mechanistic framework to develop therapies to normalize refractive development in children. PMID:20363242
Parallel human genome analysis: microarray-based expression monitoring of 1000 genes.
Schena, M; Shalon, D; Heller, R; Chai, A; Brown, P O; Davis, R W
1996-01-01
Microarrays containing 1046 human cDNAs of unknown sequence were printed on glass with high-speed robotics. These 1.0-cm2 DNA "chips" were used to quantitatively monitor differential expression of the cognate human genes using a highly sensitive two-color hybridization assay. Array elements that displayed differential expression patterns under given experimental conditions were characterized by sequencing. The identification of known and novel heat shock and phorbol ester-regulated genes in human T cells demonstrates the sensitivity of the assay. Parallel gene analysis with microarrays provides a rapid and efficient method for large-scale human gene discovery. Images Fig. 1 Fig. 2 Fig. 3 PMID:8855227
Rotival, Maxime; Zeller, Tanja; Wild, Philipp S; Maouche, Seraya; Szymczak, Silke; Schillert, Arne; Castagné, Raphaele; Deiseroth, Arne; Proust, Carole; Brocheton, Jessy; Godefroy, Tiphaine; Perret, Claire; Germain, Marine; Eleftheriadis, Medea; Sinning, Christoph R; Schnabel, Renate B; Lubos, Edith; Lackner, Karl J; Rossmann, Heidi; Münzel, Thomas; Rendon, Augusto; Erdmann, Jeanette; Deloukas, Panos; Hengstenberg, Christian; Diemert, Patrick; Montalescot, Gilles; Ouwehand, Willem H; Samani, Nilesh J; Schunkert, Heribert; Tregouet, David-Alexandre; Ziegler, Andreas; Goodall, Alison H; Cambien, François; Tiret, Laurence; Blankenberg, Stefan
2011-12-01
One major expectation from the transcriptome in humans is to characterize the biological basis of associations identified by genome-wide association studies. So far, few cis expression quantitative trait loci (eQTLs) have been reliably related to disease susceptibility. Trans-regulating mechanisms may play a more prominent role in disease susceptibility. We analyzed 12,808 genes detected in at least 5% of circulating monocyte samples from a population-based sample of 1,490 European unrelated subjects. We applied a method of extraction of expression patterns-independent component analysis-to identify sets of co-regulated genes. These patterns were then related to 675,350 SNPs to identify major trans-acting regulators. We detected three genomic regions significantly associated with co-regulated gene modules. Association of these loci with multiple expression traits was replicated in Cardiogenics, an independent study in which expression profiles of monocytes were available in 758 subjects. The locus 12q13 (lead SNP rs11171739), previously identified as a type 1 diabetes locus, was associated with a pattern including two cis eQTLs, RPS26 and SUOX, and 5 trans eQTLs, one of which (MADCAM1) is a potential candidate for mediating T1D susceptibility. The locus 12q24 (lead SNP rs653178), which has demonstrated extensive disease pleiotropy, including type 1 diabetes, hypertension, and celiac disease, was associated to a pattern strongly correlating to blood pressure level. The strongest trans eQTL in this pattern was CRIP1, a known marker of cellular proliferation in cancer. The locus 12q15 (lead SNP rs11177644) was associated with a pattern driven by two cis eQTLs, LYZ and YEATS4, and including 34 trans eQTLs, several of them tumor-related genes. This study shows that a method exploiting the structure of co-expressions among genes can help identify genomic regions involved in trans regulation of sets of genes and can provide clues for understanding the mechanisms linking genome-wide association loci to disease.
Wang, Meng; Xu, Zongchang; Ding, Anming; Kong, Yingzhen
2018-05-24
Xyloglucan endotransglucosylase/hydrolase genes ( XTHs ) encode enzymes required for the reconstruction and modification of xyloglucan backbones, which will result in changes of cell wall extensibility during growth. A total of 56 NtXTH genes were identified from common tobacco, and 50 cDNA fragments were verified by PCR amplification. The 56 NtXTH genes could be classified into two subfamilies: Group I/II and Group III according to their phylogenetic relationships. The gene structure, chromosomal localization, conserved protein domains prediction, sub-cellular localization of NtXTH proteins and evolutionary relationships among Nicotiana tabacum , Nicotiana sylvestrisis , Nicotiana tomentosiformis , Arabidopsis , and rice were also analyzed. The NtXTHs expression profiles analyzed by the TobEA database and qRT-PCR revealed that NtXTHs display different expression patterns in different tissues. Notably, the expression patterns of 12 NtXTHs responding to environment stresses, including salinity, alkali, heat, chilling, and plant hormones, including IAA and brassinolide, were characterized. All the results would be useful for the function study of NtXTHs during different growth cycles and stresses.
Romero-Soriano, Valèria; Garcia Guerreiro, Maria Pilar
2016-01-01
Transposable elements (TEs), repeated mobile sequences, are ubiquitous in the eukaryotic kingdom. Their mobilizing capacity confers on them a high mutagenic potential, which must be strongly regulated to guarantee genome stability. In the Drosophila germline, a small RNA-mediated silencing system, the piRNA (Piwi-interacting RNA) pathway, is the main responsible TE regulating mechanism, but some stressful conditions can destabilize it. For instance, during interspecific hybridization, genomic stress caused by the shock of two different genomes can lead, in both animals and plants, to higher transposition rates. A recent study in D. buzatii—D. koepferae hybrids detected mobilization of 28 TEs, yet little is known about the molecular mechanisms explaining this transposition release. We have characterized one of the mobilized TEs, the retrotransposon Helena, and used quantitative expression to assess whether its high transposition rates in hybrids are preceded by increased expression. We have also localized Helena expression in the gonads to see if cellular expression patterns have changed in the hybrids. To give more insight into changes in TE regulation in hybrids, we analysed Helena-specific piRNA populations of hybrids and parental species. Helena expression is not globally altered in somatic tissues, but male and female gonads have different patterns of deregulation. In testes, Helena is repressed in F1, increasing then its expression up to parental values. This is linked with a mislocation of Helena transcripts along with an increase of their specific piRNA levels. Ovaries have additive levels of Helena expression, but the ping-pong cycle efficiency seems to be reduced in F1 hybrids. This could be at the origin of new Helena insertions in hybrids, which would be transmitted to F1 hybrid female progeny. PMID:26812285
Ritchey, Eric R.; Bongini, Rachel E.; Code, Kimberly A.; Zelinka, Christopher; Petersen-Jones, Simon; Fischer, Andy J.
2010-01-01
Guanine nucleotide-binding protein β3 (GNB3) is an isoform of the β subunit of the heterotrimeric G protein second messenger complex that is commonly associated with transmembrane receptors. The presence of GNB3 in photoreceptors, and possibly bipolar cells, has been confirmed in murine, bovine and primate retinas (Lee et al., 1992, Peng et al., 1992, Huang et al., 2003). Studies have indicated that a mutation in the GNB3 gene causes progressive retinopathy and globe enlargement (RGE) in chickens. The goals of this study were to 1) examine the expression pattern of GNB3 in wild-type and RGE mutant chickens, 2) characterize the types of bipolar cells that express GNB3 and 3) examine whether the expression of GNB3 in the retina is conserved across vertebrate species. We find that chickens homozygous for the RGE allele completely lack GNB3 protein. We find that the pattern of expression of GNB3 in the retina is highly conserved across vertebrate species, including teleost fish (Carassius auratus), frogs (Xenopus laevis), chickens (Gallus domesticus), mice (Mus musculata), guinea pigs (Cavia porcellus), dogs (Canis familiaris) and non-human primates (Macaca fasicularis). Regardless of the species, we find that GNB3 is expressed by Islet1-positive cone ON-bipolar cells and by cone photoreceptors. In some vertebrates, GNB3-immunoreactivity was observed in both rod and cone photoreceptors. A protein-protein alignment of GNB3 across different vertebrates, from fish to humans, indicates a high degree (>92%) of sequence conservation. Given that analogous types of retinal neurons express GNB3 in different species, we propose that the functions and the mechanisms that regulate the expression of GNB3 are highly conserved. PMID:20538044
Batagov, Arsen O; Yarmishyn, Aliaksandr A; Jenjaroenpun, Piroon; Tan, Jovina Z; Nishida, Yuichiro; Kurochkin, Igor V
2013-10-16
Mammalian genomes are extensively transcribed producing thousands of long non-protein-coding RNAs (lncRNAs). The biological significance and function of the vast majority of lncRNAs remain unclear. Recent studies have implicated several lncRNAs as playing important roles in embryonic development and cancer progression. LncRNAs are characterized with different genomic architectures in relationship with their associated protein-coding genes. Our study aimed at bridging lncRNA architecture with dynamical patterns of their expression using differentiating human neuroblastoma cells model. LncRNA expression was studied in a 120-hours timecourse of differentiation of human neuroblastoma SH-SY5Y cells into neurons upon treatment with retinoic acid (RA), the compound used for the treatment of neuroblastoma. A custom microarray chip was utilized to interrogate expression levels of 9,267 lncRNAs in the course of differentiation. We categorized lncRNAs into 19 architecture classes according to their position relatively to protein-coding genes. For each architecture class, dynamics of expression of lncRNAs was studied in association with their protein-coding partners. It allowed us to demonstrate positive correlation of lncRNAs with their associated protein-coding genes at bidirectional promoters and for sense-antisense transcript pairs. In contrast, lncRNAs located in the introns and downstream of the protein-coding genes were characterized with negative correlation modes. We further classified the lncRNAs by the temporal patterns of their expression dynamics. We found that intronic and bidirectional promoter architectures are associated with rapid RA-dependent induction or repression of the corresponding lncRNAs, followed by their constant expression. At the same time, lncRNAs expressed downstream of protein-coding genes are characterized by rapid induction, followed by transcriptional repression. Quantitative RT-PCR analysis confirmed the discovered functional modes for several selected lncRNAs associated with proteins involved in cancer and embryonic development. This is the first report detailing dynamical changes of multiple lncRNAs during RA-induced neuroblastoma differentiation. Integration of genomic and transcriptomic levels of information allowed us to demonstrate specific behavior of lncRNAs organized in different genomic architectures. This study also provides a list of lncRNAs with possible roles in neuroblastoma.
ERIC Educational Resources Information Center
Knapska, Ewelina; Maren, Stephen
2009-01-01
After extinction of conditioned fear, memory for the conditioning and extinction experiences becomes context dependent. Fear is suppressed in the extinction context, but renews in other contexts. This study characterizes the neural circuitry underlying the context-dependent retrieval of extinguished fear memories using c-Fos immunohistochemistry.…
USDA-ARS?s Scientific Manuscript database
In the natural environment, the longhorned beetle, Batocera horsfieldi (Hope) (Coleoptera: Cerambycidae), finds it’s maturation-feeding and host plants by using chemical cues. In this study, we described the identification and characterization of four new cDNAs that encode Minus-C odorant binding pr...
USDA-ARS?s Scientific Manuscript database
Induction of innate immune pathways is critical for early host defense but there is limited understanding of how teleost fish recognize pathogen molecules and activate these pathways. In mammals, cells of the innate immune system detect pathogenic molecular structures using pattern recognition rece...
ECoG Gamma Activity during a Language Task: Differentiating Expressive and Receptive Speech Areas
ERIC Educational Resources Information Center
Towle, Vernon L.; Yoon, Hyun-Ah; Castelle, Michael; Edgar, J. Christopher; Biassou, Nadia M.; Frim, David M.; Spire, Jean-Paul; Kohrman, Michael H.
2008-01-01
Electrocorticographic (ECoG) spectral patterns obtained during language tasks from 12 epilepsy patients (age: 12-44 years) were analyzed in order to identify and characterize cortical language areas. ECoG from 63 subdural electrodes (500 Hz/channel) chronically implanted over frontal, parietal and temporal lobes were examined. Two language tasks…
USDA-ARS?s Scientific Manuscript database
A regulatory sequence from a serine proteinase inhibitor gene (BvSTIpro) shown to be up-regulated in resistant interactions with a root pest of sugar beet, the sugar beet root maggot, was fused to the ß-glucuronidase (GUS) reporter gene to characterize its expression patterns in transgenic Nicotiana...
USDA-ARS?s Scientific Manuscript database
A partial-thickness epidermal explant model was colonized with GFP-expressing S. aureus and the pattern of S. aureus biofilm growth was characterized using electron and confocal laser scanning microscopy. Oxygen concentration in explants and H2O2 in media was quantified using microelectrodes. The re...
The Pax gene family: Highlights from cephalopods
Baratte, Sébastien; Andouche, Aude; Bonnaud-Ponticelli, Laure
2017-01-01
Pax genes play important roles in Metazoan development. Their evolution has been extensively studied but Lophotrochozoa are usually omitted. We addressed the question of Pax paralog diversity in Lophotrochozoa by a thorough review of available databases. The existence of six Pax families (Pax1/9, Pax2/5/8, Pax3/7, Pax4/6, Paxβ, PoxNeuro) was confirmed and the lophotrochozoan Paxβ subfamily was further characterized. Contrary to the pattern reported in chordates, the Pax2/5/8 family is devoid of homeodomain in Lophotrochozoa. Expression patterns of the three main pax classes (pax2/5/8, pax3/7, pax4/6) during Sepia officinalis development showed that Pax roles taken as ancestral and common in metazoans are modified in S. officinalis, most likely due to either the morphological specificities of cephalopods or to their direct development. Some expected expression patterns were missing (e.g. pax6 in the developing retina), and some expressions in unexpected tissues have been found (e.g. pax2/5/8 in dermal tissue and in gills). This study underlines the diversity and functional plasticity of Pax genes and illustrates the difficulty of using probable gene homology as strict indicator of homology between biological structures. PMID:28253300
Zhu, Kaikai; Wang, Xiaolong; Liu, Jinyi; Tang, Jun; Cheng, Qunkang; Chen, Jin-Gui; Cheng, Zong-Ming Max
2018-01-01
Protein kinases (PKs) have evolved as the largest family of molecular switches that regulate protein activities associated with almost all essential cellular functions. Only a fraction of plant PKs, however, have been functionally characterized even in model plant species. In the present study, the entire grapevine kinome was identified and annotated using the most recent version of the grapevine genome. A total of 1168 PK-encoding genes were identified and classified into 20 groups and 121 families, with the RLK-Pelle group being the largest, with 872 members. The 1168 kinase genes were unevenly distributed over all 19 chromosomes, and both tandem and segmental duplications contributed to the expansion of the grapevine kinome, especially of the RLK-Pelle group. Ka/Ks values indicated that most of the tandem and segmental duplication events were under purifying selection. The grapevine kinome families exhibited different expression patterns during plant development and in response to various stress treatments, with many being coexpressed. The comprehensive annotation of grapevine kinase genes, their patterns of expression and coexpression, and the related information facilitate a more complete understanding of the roles of various grapevine kinases in growth and development, responses to abiotic stress, and evolutionary history.
Huang, Yi; Tao, Zhangsheng; Liu, Qiong; Wang, Xinfa; Yu, Jingyin; Liu, Guihua; Wang, Hanzhong
2014-07-01
Inflorescence architecture, pedicel length and stomata patterning in Arabidopsis thaliana are specified by inter-tissue communication mediated by ERECTA and its signaling ligands in the EPIDERMAL PATTERNING FACTOR-LIKE (EPFL) family of secreted cysteine-rich peptides. Here, we identified and characterized BnEPFL6 from Brassica napus. Heterologous expression of this gene under the double enhanced CaMV promoter (D35S) in Arabidopsis resulted in shortened stamen filaments, filaments degradation, and reduced filament cell size that displayed down-regulated expression of AHK2, in which phenotypic variation of ahk2-1 mutant presented highly consistent with that of BnEPFL6 transgenic lines. Especially, the expression level of BnEPFL6 in the shortened filaments of four B. napus male sterile lines (98A, 86A, SA, and Z11A) was similar to that of BnEPFL6 in the transgenic Arabidopsis lines. The activity of pBnEPFL6.2::GUS was intensive in the filaments of transgenic lines. These observations reveal that BnEPFL6 plays an important role in filament elongation and may also affect organ morphology and floral organ specification via a BnEPFL6-mediated cascade.
Takahashi, Yu; Yasuhiko, Yukuto; Takahashi, Jun; Takada, Shinji; Johnson, Randy L; Saga, Yumiko; Kanno, Jun
2013-08-15
The vertebrae are derived from the sclerotome of somites. Formation of the vertebral body involves a process called resegmentation, by which the caudal half of a sclerotome is combined with the rostral half of the next sclerotome. To elucidate the relationship between resegmentation and rostro-caudal patterning of somite, we used the Uncx4.1-LacZ transgene to characterize the resegmentation process. Our observations suggested that in the thoracic and lumbar vertebrae, the Uncx4.1-expressing caudal sclerotome gave rise to the intervertebral disc (IVD) and rostral portion of the vertebral body (VB). In the cervical vertebrae, the Uncx4.1-expressing caudal sclerotome appeared to contribute to the IVD and both caudal and rostral ends of the VB. This finding suggests that the rostro-caudal gene expression boundary does not necessarily coincide with the resegmentation boundary. This conclusion was supported by analyses of Mesp2 KO and Ripply1/2 double KO embryos lacking rostral and caudal properties, respectively. Resegmentation was not observed in Mesp2 KO embryos, but both the IVD and whole VB were formed from the caudalized sclerotome. Expression analysis of IVD marker genes including Pax1 in the wild-type, Mesp2 KO, and Ripply1/2 DKO embryos also supported the idea that a metameric pattern of IVD/VB is generated independently of Mesp2/Ripply-mediated rostro-caudal patterning of somite. However, in the lumbar region, IVD differentiation appeared to be stimulated by the caudal property and suppressed by the rostral property. Therefore, we propose that rostro-caudal patterning of somites is not a prerequisite for metameric patterning of the IVD and VB, but instead required to stimulate IVD differentiation in the caudal half of the sclerotome. Copyright © 2013 Elsevier Inc. All rights reserved.
Kim, Na Na; Jin, Deuk-Hee; Lee, Jehee; Kil, Gyung-Suk; Choi, Cheol Young
2010-10-01
In the present study, we investigated the expression pattern of estrogen receptors (esr) and vitellogenin (vtg) mRNA in the gonads and liver during sex change in cinnamon clownfish by using quantitative polymerase chain reaction. We divided gonadal development during the sex change from male to female into 3 stages (mature male, male at 90days after removing female, and mature female) and investigated esr and vtg mRNA expressions during the sex change. With female, the esr and vtg mRNA expressions increased. In western blot analysis, Esr1 protein was detected only in the ovaries of female cinnamon clownfish. Also, to understand the effect of 17beta-estradiol (E(2)), we investigated the esr and vtg mRNA expression patterns in the gonads and liver, and the changes in plasma E(2) level after E(2) injection. E(2) treatment increased both mRNA expression levels of esr and vtg and plasma E(2) levels. The present study describes the molecular characterization of esr subtypes and the interactions between esr and vtg after E(2) treatment in cinnamon clownfish. 2010 Elsevier Inc. All rights reserved.
Candidate genes for cooperation and aggression in the social wasp Polistes dominula.
Manfredini, Fabio; Brown, Mark J F; Toth, Amy L
2018-05-01
Cooperation and aggression are ubiquitous in social groups, and the genetic mechanisms underlying these behaviours are of great interest for understanding how social group formation is regulated and how it evolves. In this study, we used a candidate gene approach to investigate the patterns of expression of key genes for cooperation and aggression in the brain of a primitively eusocial wasp, Polistes dominula, during colony founding, when multiple foundresses can join the same nest and establish subtle hierarchies of dominance. We used a comparative approach to select candidate genes for cooperation and aggression looking at two previously published studies on global gene expression in wasps and ants. We tested the expression of these genes in P. dominula wasps that were either displaying aggressive behaviour (dominant and single foundresses) or cooperation (subordinate foundresses and workers) towards nestmates. One gene in particular, the egg yolk protein vitellogenin, known for its reproductive role in insects, displayed patterns of expression that strongly matched wasp social rank. We characterize the genomic context of vitellogenin by building a head co-expression gene network for P. dominula, and we discuss a potential role for vitellogenin as a mediator of social interactions in wasps.
Characterization and expression patterns of small RNAs in synthesized Brassica hexaploids.
Shen, Yanyue; Zhao, Qin; Zou, Jun; Wang, Wenliang; Gao, Yi; Meng, Jinling; Wang, Jianbo
2014-06-01
Polyploidy has played an important role in promoting plant evolution through genomic merging and doubling. We used high-throughput sequencing to compare miRNA expression profiles between Brassica hexaploid and its parents. A total of 613, 784 and 742 known miRNAs were identified in Brassica rapa, Brassica carinata, and Brassica hexaploid, respectively. We detected 618 miRNAs were differentially expressed (log(2)Ratio ≥ 1, P ≤ 0.05) between Brassica hexaploid and its parents, and 425 miRNAs were non-additively expressed in Brassica hexaploid, which suggest a trend of non-additive miRNA regulation following hybridization and polyploidization. Remarkably, majority of the non-additively expressed miRNAs in the Brassica hexaploid are repressed, and there was a bias toward repression of B. rapa miRNAs, which is consistent with the progenitor-biased gene repression in the synthetic allopolyploids. In addition, we identified 653 novel mature miRNAs in Brassica hexaploid and its parents. Finally, we found that almost all the non-additive accumulation of siRNA clusters exhibited a low-parent pattern in Brassica hexaploid. Non-additive small RNA regulation is involved in a range of biological pathways, probably providing a driving force for variation and adaptation in allopolyploids.
NASA Technical Reports Server (NTRS)
Takezawa, D.; Liu, Z. H.; An, G.; Poovaiah, B. W.
1995-01-01
Eight genomic clones of potato calmodulin (PCM1 to 8) were isolated and characterized. Sequence comparisons of different genes revealed that the deduced amino acid sequence of PCM1 had several unique substitutions, especially in the fourth Ca(2+)-binding area. The expression patterns of different genes were studied by northern analysis using the 3'-untranslated regions as probes. The expression of PCM1, 5, and 8 was highest in the stolon tip and it decreased during tuber development. The expression of PCM6 did not vary much in the tissues tested, except in the leaves, where the expression was lower; whereas, the expression of PCM4 was very low in all the tissues. The expression of PCM2 and PCM3 was not detected in any of the tissues tested. Among these genes, only PCM1 showed increased expression following touch stimulation. To study the regulation of PCM1, transgenic potato plants carrying the PCM1 promoter fused to the beta-glucuronidase (GUS) reporter gene were produced. GUS expression was found to be developmentally regulated and touch-responsive, indicating a positive correlation between the expression of PCM1 and GUS mRNAs. These results suggest that the 5'-flanking region of PCM1 controls developmental and touch-induced expression. X-Gluc staining patterns revealed that GUS localization is high in meristematic tissues such as the stem apex, stolon tip, and vascular regions.
Viera-Vera, Jorge; García-Arrarás, José E
2018-05-15
Retinoic acid receptors (RAR) and retinoid X receptors (RXR) are ligand-mediated transcription factors that synchronize intricate signaling networks in metazoans. Dimer formation between these two nuclear receptors mediates the recruitment of co-regulatory complexes coordinating the progression of signaling cascades during developmental and regenerative events. In the present study we identified and characterized the receptors for retinoic acid in the sea cucumber Holothuria glaberrima; a model system capable of regenerative organogenesis during adulthood. Molecular characterizations revealed the presence of three isoforms of RAR and two of RXR as a consequence of alternative splicing events. Various analyses including: primary structure sequencing, phylogenetic analysis, protein domain prediction, and multiple sequence alignment further confirmed their identity. Semiquantitative reverse transcription PCR analysis of each receptor isoform herein identified showed that the retinoid receptors are expressed in all tissues sampled: the mesenteries, respiratory trees, muscles, gonads, and the digestive tract. During regenerative organogenesis two of the receptors (RAR-L and RXR-T) showed differential expression in the posterior segment while RAR-S is differentially expressed in the anterior segment of the intestine. This work presents the first description of the components relaying the signaling for retinoic acid within this model system. Copyright © 2018 Elsevier B.V. All rights reserved.
Prescott, Joseph B; Hall, Pamela R; Bondu-Hawkins, Virginie S; Ye, Chunyan; Hjelle, Brian
2007-08-01
Sin Nombre virus (SNV) is a highly pathogenic New World virus and etiologic agent of hantavirus cardiopulmonary syndrome. We have previously shown that replication-defective virus particles are able to induce a strong IFN-stimulated gene (ISG) response in human primary cells. RNA viruses often stimulate the innate immune response by interactions between viral nucleic acids, acting as a pathogen-associated molecular pattern, and cellular pattern-recognition receptors (PRRs). Ligand binding to PRRs activates transcription factors which regulate the expression of antiviral genes, and in all systems examined thus far, IFN regulatory factor 3 (IRF3) has been described as an essential intermediate for induction of ISG expression. However, we now describe a model in which IRF3 is dispensable for the induction of ISG transcription in response to viral particles. IRF3-independent ISG transcription in human hepatoma cell lines is initiated early after exposure to SNV virus particles in an entry- and replication-independent fashion. Furthermore, using gene knockdown, we discovered that this activation is independent of the best-characterized RNA- and protein-sensing PRRs including the cytoplasmic caspase recruitment domain-containing RNA helicases and the TLRs. SNV particles engage a heretofore unrecognized PRR, likely located at the cell surface, and engage a novel IRF3-independent pathway that activates the innate immune response.
Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya
2002-12-01
The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.
Transcription Factor Binding Site Enrichment Analysis in Co-Expression Modules in Celiac Disease
Romero-Garmendia, Irati; Jauregi-Miguel, Amaia; Plaza-Izurieta, Leticia; Cros, Marie-Pierre; Legarda, Maria; Irastorza, Iñaki; Herceg, Zdenko; Fernandez-Jimenez, Nora
2018-01-01
The aim of this study was to construct celiac co-expression patterns at a whole genome level and to identify transcription factors (TFs) that could drive the gliadin-related changes in coordination of gene expression observed in celiac disease (CD). Differential co-expression modules were identified in the acute and chronic responses to gliadin using expression data from a previous microarray study in duodenal biopsies. Transcription factor binding site (TFBS) and Gene Ontology (GO) annotation enrichment analyses were performed in differentially co-expressed genes (DCGs) and selection of candidate regulators was performed. Expression of candidates was measured in clinical samples and the activation of the TFs was further characterized in C2BBe1 cells upon gliadin challenge. Enrichment analyses of the DCGs identified 10 TFs and five were selected for further investigation. Expression changes related to active CD were detected in four TFs, as well as in several of their in silico predicted targets. The activation of TFs was further characterized in C2BBe1 cells upon gliadin challenge, and an increase in nuclear translocation of CAMP Responsive Element Binding Protein 1 (CREB1) and IFN regulatory factor-1 (IRF1) in response to gliadin was observed. Using transcriptome-wide co-expression analyses we are able to propose novel genes involved in CD pathogenesis that respond upon gliadin stimulation, also in non-celiac models. PMID:29748492
Transcription Factor Binding Site Enrichment Analysis in Co-Expression Modules in Celiac Disease.
Romero-Garmendia, Irati; Garcia-Etxebarria, Koldo; Hernandez-Vargas, Hector; Santin, Izortze; Jauregi-Miguel, Amaia; Plaza-Izurieta, Leticia; Cros, Marie-Pierre; Legarda, Maria; Irastorza, Iñaki; Herceg, Zdenko; Fernandez-Jimenez, Nora; Bilbao, Jose Ramon
2018-05-10
The aim of this study was to construct celiac co-expression patterns at a whole genome level and to identify transcription factors (TFs) that could drive the gliadin-related changes in coordination of gene expression observed in celiac disease (CD). Differential co-expression modules were identified in the acute and chronic responses to gliadin using expression data from a previous microarray study in duodenal biopsies. Transcription factor binding site (TFBS) and Gene Ontology (GO) annotation enrichment analyses were performed in differentially co-expressed genes (DCGs) and selection of candidate regulators was performed. Expression of candidates was measured in clinical samples and the activation of the TFs was further characterized in C2BBe1 cells upon gliadin challenge. Enrichment analyses of the DCGs identified 10 TFs and five were selected for further investigation. Expression changes related to active CD were detected in four TFs, as well as in several of their in silico predicted targets. The activation of TFs was further characterized in C2BBe1 cells upon gliadin challenge, and an increase in nuclear translocation of CAMP Responsive Element Binding Protein 1 (CREB1) and IFN regulatory factor-1 (IRF1) in response to gliadin was observed. Using transcriptome-wide co-expression analyses we are able to propose novel genes involved in CD pathogenesis that respond upon gliadin stimulation, also in non-celiac models.
The Prx1 limb enhancers: targeted gene expression in developing zebrafish pectoral fins.
Hernández-Vega, Amayra; Minguillón, Carolina
2011-08-01
Limbs represent an excellent model to study the induction, growth, and patterning of several organs. A breakthrough to study gene function in various tissues has been the characterization of regulatory elements that allow tissue-specific interference of gene function. The mouse Prx1 promoter has been used to generate limb-specific mutants and overexpress genes in tetrapod limbs. Although zebrafish possess advantages that favor their use to study limb morphogenesis, there is no driver described suitable for specifically interfering with gene function in developing fins. We report the generation of zebrafish lines that express enhanced green fluorescent protein (EGFP) driven by the mouse Prx1 enhancer in developing pectoral fins. We also describe the expression pattern of the zebrafish prrx1 genes and identify three conserved non-coding elements (CNEs) that we use to generate fin-specific EGFP reporter lines. Finally, we show that the mouse and zebrafish regulatory elements may be used to modify gene function in pectoral fins. Copyright © 2011 Wiley-Liss, Inc.
Ingram, G C; Goodrich, J; Wilkinson, M D; Simon, R; Haughn, G W; Coen, E S
1995-09-01
The unusual floral organs (ufo) mutant of Arabidopsis has flowers with variable homeotic organ transformations and inflorescence-like characteristics. To determine the relationship between UFO and previously characterized meristem and organ identity genes, we cloned UFO and determined its expression pattern. The UFO gene shows extensive homology with FIMBRIATA (FIM), a gene mediating between meristem and organ identity genes in Antirrhinum. All three UFO mutant alleles that we sequenced are predicted to produce truncated proteins. UFO transcripts were first detected in early floral meristems, before organ identity genes had been activated. At later developmental stages, UFO expression is restricted to the junction between sepal and petal primordia. Phenotypic, genetic, and expression pattern comparisons between UFO and FIM suggest that they are cognate homologs and play a similar role in mediating between meristem and organ identity genes. However, some differences in the functions and genetic interactions of UFO and FIM were apparent, indicating that changes in partially redundant pathways have occurred during the evolutionary divergence of Arabidopsis and Antirrhinum.
Pombo, Marina A; Zheng, Yi; Fernandez-Pozo, Noe; Dunham, Diane M; Fei, Zhangjun; Martin, Gregory B
2014-01-01
Plants have two related immune systems to defend themselves against pathogen attack. Initially,pattern-triggered immunity is activated upon recognition of microbe-associated molecular patterns by pattern recognition receptors. Pathogenic bacteria deliver effector proteins into the plant cell that interfere with this immune response and promote disease. However, some plants express resistance proteins that detect the presence of specific effectors leading to a robust defense response referred to as effector-triggered immunity. The interaction of tomato with Pseudomonas syringae pv. tomato is an established model system for understanding the molecular basis of these plant immune responses. We apply high-throughput RNA sequencing to this pathosystem to identify genes whose expression changes specifically during pattern-triggered or effector-triggered immunity. We then develop reporter genes for each of these responses that will enable characterization of the host response to the large collection of P. s. pv. tomato strains that express different combinations of effectors. Virus-induced gene silencing of 30 of the effector-triggered immunity-specific genes identifies Epk1 which encodes a predicted protein kinase from a family previously unknown to be involved in immunity. Knocked-down expression of Epk1 compromises effector-triggered immunity triggered by three bacterial effectors but not by effectors from non-bacterial pathogens. Epistasis experiments indicate that Epk1 acts upstream of effector-triggered immunity-associated MAP kinase signaling. Using RNA-seq technology we identify genes involved in specific immune responses. A functional genomics screen led to the discovery of Epk1, a novel predicted protein kinase required for plant defense activation upon recognition of three different bacterial effectors.
Aldous, Sophia H.; Weise, Sean E.; Sharkey, Thomas D.; Waldera-Lupa, Daniel M.; Stühler, Kai; Mallmann, Julia; Groth, Georg; Gowik, Udo; Westhoff, Peter; Arsova, Borjana
2014-01-01
The key enzyme for C4 photosynthesis, Phosphoenolpyruvate Carboxylase (PEPC), evolved from nonphotosynthetic PEPC found in C3 ancestors. In all plants, PEPC is phosphorylated by Phosphoenolpyruvate Carboxylase Protein Kinase (PPCK). However, differences in the phosphorylation pattern exist among plants with these photosynthetic types, and it is still not clear if they are due to interspecies differences or depend on photosynthetic type. The genus Flaveria contains closely related C3, C3-C4 intermediate, and C4 species, which are evolutionarily young and thus well suited for comparative analysis. To characterize the evolutionary differences in PPCK between plants with C3 and C4 photosynthesis, transcriptome libraries from nine Flaveria spp. were used, and a two-member PPCK family (PPCKA and PPCKB) was identified. Sequence analysis identified a number of C3- and C4-specific residues with various occurrences in the intermediates. Quantitative analysis of transcriptome data revealed that PPCKA and PPCKB exhibit inverse diel expression patterns and that C3 and C4 Flaveria spp. differ in the expression levels of these genes. PPCKA has maximal expression levels during the day, whereas PPCKB has maximal expression during the night. Phosphorylation patterns of PEPC varied among C3 and C4 Flaveria spp. too, with PEPC from the C4 species being predominantly phosphorylated throughout the day, while in the C3 species the phosphorylation level was maintained during the entire 24 h. Since C4 Flaveria spp. evolved from C3 ancestors, this work links the evolutionary changes in sequence, PPCK expression, and phosphorylation pattern to an evolutionary phase shift of kinase activity from a C3 to a C4 mode. PMID:24850859
Englund, Marie; Carlsbecker, Annelie; Engström, Peter; Vergara-Silva, Francisco
2011-01-01
The morphological variation among reproductive organs of extant gymnosperms is remarkable, especially among conifers. Several hypotheses concerning morphological homology between various conifer reproductive organs have been put forward, in particular in relation to the pine ovuliferous scale. Here, we use the expression patterns of orthologs of the ABC-model MADS-box gene AGAMOUS (AG) for testing morphological homology hypotheses related to organs of the conifer female cone. To this end, we first developed a tailored 3'RACE procedure that allows reliable amplification of partial sequences highly similar to gymnosperm-derived members of the AG-subfamily of MADS-box genes. Expression patterns of two novel conifer AG orthologs cloned with this procedure-namely PodAG and TgAG, obtained from the podocarp Podocarpus reichei and the yew Taxus globosa, respectively-are then further characterized in the morphologically divergent female cones of these species. The expression patterns of PodAG and TgAG are compared with those of DAL2, a previously discovered Picea abies (Pinaceae) AG ortholog. By treating the expression patterns of DAL2, PodAG, and TgAG as character states mapped onto currently accepted cladogram topologies, we suggest that the epimatium-that is, the podocarp female cone organ previously postulated as a "modified" ovuliferous scale-and the canonical Pinaceae ovuliferous scale can be legitimally conceptualized as "primary homologs." Character state mapping for TgAG suggests in turn that the aril of Taxaceae should be considered as a different type of organ. This work demonstrates how the interaction between developmental-genetic data and formal cladistic theory could fruitfully contribute to gymnosperm systematics. © 2011 Wiley Periodicals, Inc.
Expression of adhesion molecules and cytokeratin 20 in merkel cell carcinomas.
Tanaka, Yasushi; Sano, Toshiaki; Qian, Zhi Rong; Hirokawa, Mitsuyoshi
2004-01-01
Merkel cell carcinoma (MCC) is an aggressive neuroendocrine carcinoma of the skin. MCCs often show characteristic paranuclear dot-like immunopositivity for cytokeratin 20 (CK20), a globular aggregation of CK20 intermediate filaments. These aggregates typically form rhabdoid features and fibrous bodies and may be associated with a down-regulation in adhesion molecules (AMs). To date, the relationship between the expression of AMs and CK20 and clinicopathological findings in MCC has not been well examined. In this immunohistochemical study, we assessed the expression of AMs, CK20, and chromogranin A (CgA) on MCCs in 8 men and 23 women with this disease, and also characterized their clinicopathological features. This study is the largest of its kind that has been undertaken to date in Japanese patients. Compared to normal tissue, E-cadherin and alpha- and beta-catenins showed reduced membranous expression in 95.7%, 46.7%, and 45.2% of MCCs, respectively. Nuclear E-cadherin localization was seen in four tumors, all of which predominantly showed a CK20 dot pattern. However, there was no significant relationship between the membranous expression of AMs and a CK20 dot pattern. E-cadherin expression was significantly lower in tumors of > or =2 cm, and tumors negative for E-cadherin more frequently developed outside of the head and neck than within those regions. CgA was more intensely expressed in tumors with uniform nuclei and a dense lymphocytic infiltrate than in those that showed pleomorphisms and that had few, if any, infiltrating lymphocytes. These findings suggest that MCCs have a reduced expression of AMs and that down-regulation of E-cadherin expression may correlate with increased tumor aggressiveness. The fact that no significant relationship was demonstrable between the membranous expression of AMs and the CK20 expression pattern suggests that the mechanism of aggregation of intermediate filaments may be different in different types of tumors.
Jia, Changkai; Zhang, Feng; Zhu, Ying; Qi, Xia; Wang, Yiqiang
2017-10-20
Matrix-remodeling associated 7 (MXRA7) gene was first reported in 2002 and named so for its co-expression with several genes known to relate with matrix-remodeling. However, not any studies had been intentionally performed to characterize this gene. We started defining the functions of MXRA7 by integrating bioinformatics analysis and experimental study. Data mining of MXRA7 expression in BioGPS, Gene Expression Omnibus and EurExpress platforms highlighted high level expression of Mxra7 in murine ocular tissues. Real-time PCR was employed to measure Mxra7 mRNA in tissues of adult C57BL/6 mice and demonstrated that Mxra7 was preferentially expressed at higher level in retina, corneas and lens than in other tissues. Then the inflammatory corneal neovascularization (CorNV) model and fungal corneal infections were induced in Balb/c mice, and mRNA levels of Mxra7 as well as several matrix-remodeling related genes (Mmp3, Mmp13, Ecm1, Timp1) were monitored with RT-PCR. The results demonstrated a time-dependent Mxra7 under-expression pattern (U-shape curve along timeline), while all other matrix-remodeling related genes manifested an opposite changes pattern (dome-shape curve). When limited data from BioGPS concerning human MXRA7 gene expression in human tissues were looked at, it was found that ocular tissue was also the one expressing highest level of MXRA7. To conclude, integrative assay of MXRA7 gene expression in public databank as well as domestic animal models revealed a selective high expression MXRA7 in murine and human ocular tissues, and its change patterns in two corneal disease models implied that MXRA7 might play a role in pathological processes or diseases involving injury, neovascularization and would healing. Copyright © 2017 Elsevier B.V. All rights reserved.
Schneider, Sven; Kadletz, Lorenz; Wiebringhaus, Robert; Kenner, Lukas; Selzer, Edgar; Füreder, Thorsten; Rajky, Orsolya; Berghoff, Anna S; Preusser, Matthias; Heiduschka, Gregor
2018-05-09
Expression profiles and clinical impact of programmed cell death ligand 1 (PD-L1) and programmed cell death 1 (PD-1) expressing tumour infiltrating lymphocytes (TILs) in head and neck squamous cell carcinoma (HNSCC) are not fully elucidated. This study evaluates expression patterns in primary HNSCC and related lymph node metastasis and impact on patients' clinical outcome. Immunohistochemical staining patterns of PD-L1 and PD-1 were evaluated in 129 specimens of primary HNSCC and 77 lymph node metastases. Results were correlated to patients' clinical data. PD-L1 expression was observed in 36% of primary carcinoma and 33% of lymph node metastasis and significantly correlates with decreased overall survival (OS) (p=0.01) and disease free survival (DFS) (p=0.001) in oral cavity squamous cell carcinoma patients. PD-L1 expression was associated with presence of lymph node metastasis (p=0.0223). Infiltration of PD-1 expressing lymphocytes significantly correlates with favorable OS (p=0.001) and DFS (p=0.001) in oropharyngeal cancer and hypopharyngeal cancer patients OS (p=0.007) and DFS (p=0.001). Presence of PD-1 TILs significantly correlates with better OS (p=0.005) and DFS (p=0) also in the HPV negative cohort. Cox regression multivariate analysis revealed PD-1 TIL expression as an independent prognostic marker for OS (p=0.004) and DFS (p=0.001) and T stage was validated as negative prognostic marker for OS (p=0.011). PD-1 expressing lymphocytes (p=0.0412) and PD-L1 expression (p=0.0022) patterns correlate significantly in primary cancers and matched lymph node metastases. Our results characterize the expression profiles of PD-1 axis proteins in HNSCC which might serve as possible clinical prognostic markers. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.
Characterization of mitochondrial dicarboxylate/tricarboxylate transporters from grape berries.
Regalado, Ana; Pierri, Ciro Leonardo; Bitetto, Maria; Laera, Valentina Liliana; Pimentel, Catarina; Francisco, Rita; Passarinho, José; Chaves, Maria M; Agrimi, Gennaro
2013-03-01
Grape berries (Vitis vinifera L fruit) exhibit a double-sigmoid pattern of development that results from two successive periods of vacuolar swelling during which the nature of accumulated solutes changes significantly. Throughout the first period, called green or herbaceous stage, berries accumulate high levels of organic acids, mainly malate and tartrate. At the cellular level fruit acidity comprises both metabolism and vacuolar storage. Malic acid compartmentation is critical for optimal functioning of cytosolic enzymes. Therefore, the identification and characterization of the carriers involved in malate transport across sub-cellular compartments is of great importance. The decrease in acid content during grape berry ripening has been mainly associated to mitochondrial malate oxidation. However, no Vitis vinifera mitochondrial carrier involved in malate transport has been reported to date. Here we describe the identification of three V. vinifera mitochondrial dicarboxylate/tricarboxylate carriers (VvDTC1-3) putatively involved in mitochondrial malate, citrate and other di/tricarboxylates transport. The three VvDTCs are very similar, sharing a percentage of identical residues of at least 83 %. Expression analysis of the encoding VvDTC genes in grape berries shows that they are differentially regulated exhibiting a developmental pattern of expression. The simultaneous high expression of both VvDTC2 and VvDTC3 in grape berry mesocarp close to the onset of ripening suggests that these carriers might be involved in the transport of malate into mitochondria.
Petricevic, Josko; Forempoher, Gea; Ostojic, Ljerka; Mardesic-Brakus, Snjezana; Andjelinovic, Simun; Vukojevic, Katarina; Saraga-Babic, Mirna
2011-11-01
The spatial and temporal pattern of appearance of nestin, epithelial membrane antigen (EMA) and mesothelin proteins was immunohistochemically determined in the cells of normal developing and adult human meninges and meningiomas. Human meninges developed as two mesenchymal condensations in the head region. The simple squamous epithelium on the surface of leptomeninges developed during mesenchymal to epithelial transformation. Nestin appeared for the first time in week 7, EMA in week 8, while mesothelin appeared in week 22 of development. In the late fetal period and after birth, nestin expression decreased, whereas expression of EMA and mesothelin increased. EMA appeared in all surface epithelial cells and nodules, while mesothelin was found only in some of them. In adult meninges, all three proteins were predominantly localized in the surface epithelium and meningeal nodules. In meningothelial meningiomas (WHO grade I), EMA was detected in all tumor cells except in the endothelial cells, mesothelin characterized nests of tumor cells, while nestin was found predominantly in the walls of blood vessels. The distribution pattern of those proteins in normal meningeal and tumor cells indicates that nestin might characterize immature cells, while EMA and mesothelin appeared in maturing epithelial cells. Neoplastic transformation of these specific cell lineages contributes to the cell population in meningiomas. Copyright © 2010 Elsevier GmbH. All rights reserved.
Michelutti, Alessandro; Gremese, Elisa; Morassi, Francesca; Petricca, Luca; Arena, Vincenzo; Tolusso, Barbara; Alivernini, Stefano; Peluso, Giusy; Bosello, Silvia Laura; Ferraccioli, Gianfranco
2011-01-01
The aim of the present study was to determine whether different subsets of B cells characterize synovial fluid (SF) or synovial tissue (ST) of seropositive or seronegative rheumatoid arthritis (RA) with respect to the peripheral blood (PB). PB, SF and ST of 14 autoantibody (AB)-positive (rheumatoid factor [RF]-IgM, RF-IgA, anti-citrullinated peptide [CCP]), 13 negative RA and 13 no-RA chronic arthritides were examined for B-cell subsets (Bm1-Bm5 and IgD-CD27 classifications), zeta-associated protein kinase-70 (ZAP70) expression on B cells and cytokine levels (interleukin [IL]-1β, tumor necrosis factor [TNF]-α, IL-6, IL-8 and monocyte chemotactic protein [MCP]-1). Synovial tissues were classified as aggregate and diffuse patterns. No differences were found in B-cell percentages or in subsets in PB and SF between AB(+) and AB(-) RA and no-RA. In both AB(+) and AB(-) RA (and no-RA), the percentage of CD19(+)/ZAP70(+) was higher in SF than in PB (AB(+): P = 0.03; AB(-): P = 0.01; no-RA: P = 0.01). Moreover, SF of both AB(+) and AB(-) RA (and no-RA) patients was characterized by a higher percentage of IgD-CD27(+) and IgD-CD27(-) B cells and lower percentage of IgD(+)CD27(-) (P < 0.05) B cells compared to PB. In SF, ZAP70 positivity is more represented in B cell CD27(+)/IgD(-)/CD38(-). The aggregate synovitis pattern was characterized by higher percentages of Bm5 cells in SF compared with the diffuse pattern (P = 0.05). These data suggest that no difference exists between AB(+) and AB(-) in B-cell subset compartmentalization. CD27(+)/IgD(-)/ZAP70(+) memory B cells accumulate preferentially in the joints of RA, suggesting a dynamic maturation of the B cells in this compartment.
Zhu, Bao-Jian; Yu, Hao; Tian, Sen; Dai, Li-Shang; Sun, Yu; Liu, Chao-Liang
2016-01-01
The receptor for activated C kinase (RACK) is an important scaffold protein with regulatory functions in cells. However, its role in the immune response of Antheraea pernyi to pathogen challenge remains unclear. To investigate the biological functions of RACK in the wild silkworm A. pernyi, cloning was performed and the expression patterns of the RACK gene were analyzed. Sequence analysis revealed that the RACK gene was 1120 bp containing a 960-bp open reading frame. The deduced RACK protein sequence reveals the higher identity with its homologs from other insects. SDS-PAGE and western blot analysis demonstrated successful expression of a 36-kDa recombinant RACK protein in Escherichia coli. The titer of a rabbit-raised antibody against recombinant RACK protein was about 1: 20000, determined by ELISA. Real-time PCR analysis showed that RACK expression was higher in fat bodies than in other examined A. pernyi tissues. The expression of RACK mRNA in fat bodies of fifth larvae of A. pernyi was obviously induced after nucleopolyhedrovirus, E. coli or Beauveria bassiana challenge. However, the expression patterns of RACK were different in response to these pathogens. Our data suggest that RACK may play a role in the innate immune responses of A. pernyi.
Schatton, Adriana; Mendoza, Ezequiel; Grube, Kathrin; Scharff, Constance
2018-06-15
Mutations in the transcription factors FOXP1, FOXP2, and FOXP4 affect human cognition, including language. The FoxP gene locus is evolutionarily ancient and highly conserved in its DNA-binding domain. In Drosophila melanogaster FoxP has been implicated in courtship behavior, decision making, and specific types of motor-learning. Because honeybees (Apis mellifera, Am) excel at navigation and symbolic dance communication, they are a particularly suitable insect species to investigate a potential link between neural FoxP expression and cognition. We characterized two AmFoxP isoforms and mapped their expression in the brain during development and in adult foragers. Using a custom-made antiserum and in situ hybridization, we describe 11 AmFoxP expressing neuron populations. FoxP was expressed in equivalent patterns in two other representatives of Apidae; a closely related dwarf bee and a bumblebee species. Neural tracing revealed that the largest FoxP expressing neuron cluster in honeybees projects into a posterior tract that connects the optic lobe to the posterior lateral protocerebrum, predicting a function in visual processing. Our data provide an entry point for future experiments assessing the function of FoxP in eusocial Hymenoptera. © 2018 Wiley Periodicals, Inc.
Characterization of Cer-1 cis-regulatory region during early Xenopus development.
Silva, Ana Cristina; Filipe, Mário; Steinbeisser, Herbert; Belo, José António
2011-05-01
Cerberus-related molecules are well-known Wnt, Nodal, and BMP inhibitors that have been implicated in different processes including anterior–posterior patterning and left–right asymmetry. In both mouse and frog, two Cerberus-related genes have been isolated, mCer-1 and mCer-2, and Xcer and Xcoco, respectively. Until now, little is known about the mechanisms involved in their transcriptional regulation. Here, we report a heterologous analysis of the mouse Cerberus-1 gene upstream regulatory regions, responsible for its expression in the visceral endodermal cells. Our analysis showed that the consensus sequences for a TATA, CAAT, or GC boxes were absent but a TGTGG sequence was present at position -172 to -168 bp, relative to the ATG. Using a series of deletion constructs and transient expression in Xenopus embryos, we found that a fragment of 1.4 kb of Cer-1 promoter sequence could reproduce the endogenous expression pattern of Xenopus cerberus. A 0.7-kb mcer-1 upstream region was able to drive reporter expression to the involuting mesendodermal cells, while further deletions abolished reporter gene expression. Our results suggest that although no sequence similarity was found between mouse and Xenopus cerberus cis-regulatory regions, the signaling cascades regulating cerberus expression, during gastrulation, is conserved.
Handisurya, Alessandra; Day, Patricia M.; Thompson, Cynthia D.; Buck, Christopher B.; Pang, Yuk-Ying S.; Lowy, Douglas R.
2013-01-01
Full-length genomic DNA of the recently identified laboratory mouse papillomavirus 1 (MusPV1) was synthesized in vitro and was used to establish and characterize a mouse model of papillomavirus pathobiology. MusPV1 DNA, whether naked or encapsidated by MusPV1 or human papillomavirus 16 (HPV 16) capsids, efficiently induced the outgrowth of papillomas as early as 3 weeks after application to abraded skin on the muzzles and tails of athymic NCr nude mice. High concentrations of virions were extracted from homogenized papillomatous tissues and were serially passaged for >10 generations. Neutralization by L1 antisera confirmed that infectious transmission was capsid mediated. Unexpectedly, the skin of the murine back was much less susceptible to virion-induced papillomas than the muzzle or tail. Although reporter pseudovirions readily transduced the skin of the back, infection with native MusPV1 resulted in less viral genome amplification and gene expression on the back, including reduced expression of the L1 protein and very low expression of the L2 protein, results that imply skin region-specific control of postentry aspects of the viral life cycle. Unexpectedly, L1 protein on the back was predominantly cytoplasmic, while on the tail the abundant L1 was cytoplasmic in the lower epithelial layers and nuclear in the upper layers. Nuclear localization of L1 occurred only in cells that coexpressed the minor capsid protein, L2. The pattern of L1 protein staining in the infected epithelium suggests that L1 expression occurs earlier in the MusPV1 life cycle than in the life cycle of high-risk HPV and that virion assembly is regulated by a previously undescribed mechanism. PMID:24067981
Bachir, Daoura Goudia; Saeed, Iqbal; Song, Quanhao; Linn, Tay Zar; Chen, Liang; Hu, Yin-Gang
2017-06-01
Wheat is a C 3 plant with relatively low photosynthetic efficiency and is a potential target for C 4 photosynthetic pathway engineering. Here we reported the characterization of four key C 4 pathway genes and assessed their expression patterns and enzymatic activities at three growth stages in flag leaves of 59 bread wheat genotypes. The C 4 -like genes homologous to PEPC, NADP-ME, MDH, and PPDK in maize were identified in the A, B, and D sub-genomes of bread wheat, located on the long arms of chromosomes 3 and 5 (TaPEPC), short arms of chromosomes 1 and 3 (TaNADP-ME), long arms of chromosomes 1 and 7 (TaMDH), and long arms of chromosome 1 (TaPPDK), respectively. All the four C 4 -like genes were expressed in the flag leaves at the three growth stages with considerable variations among the 59 bread wheat genotypes. Significant differences were observed between the photosynthesis rates (A) of wheat genotypes with higher expressions of TaPEPC_5, TaNADP-ME_1, and TaMDH_7 at heading and middle grain-filling stages and those with intermediate and low expressions. Our results also indicated that the four C 4 enzymes showed activity in the flag leaves and were obviously different among the 59 wheat genotypes. The activities of PEPcase and PPDK decreased at anthesis and slightly increased at grain-filling stage, while NADP-ME and MDH exhibited a decreasing trend at the three stages. The results of the current study could be very valuable and useful for wheat researchers in improving photosynthetic capacity of wheat. Copyright © 2017 Elsevier GmbH. All rights reserved.
Molecular basis of floral petaloidy: insights from androecia of Canna indica
Fu, Qian; Liu, Huanfang; Almeida, Ana M. R.; Kuang, Yanfeng; Zou, Pu; Liao, Jingping
2014-01-01
Floral organs that take on the characteristics of petals can occur in all whorls of the monocot order Zingiberales. In Canna indica, the most ornamental or ‘petaloid’ parts of the flowers are of androecial origin and are considered staminodes. However, the precise nature of these petaloid organs is yet to be determined. In order to gain a better understanding of the genetic basis of androecial identity, a molecular investigation of B- and C-class genes was carried out. Two MADS-box genes GLOBOSA (GLO) and AGAMOUS (AG) were isolated from young inflorescences of C. indica by 3′ rapid amplification of cDNA ends polymerase chain reaction (3′-RACE PCR). Sequence characterization and phylogenetic analyses show that CiGLO and CiAG belong to the B- and C-class MADS-box gene family, respectively. CiAG is expressed in petaloid staminodes, the labellum, the fertile stamen and carpels. CiGLO is expressed in petals, petaloid staminodes, the labellum, the fertile stamen and carpels. Expression patterns in mature tissues of CiGLO and CiAG suggest that petaloid staminodes and the labellum are of androecial identity, in agreement with their position within the flower and with described Arabidopsis thaliana expression patterns. Although B- and C-class genes are important components of androecial determination, their expression patterns are not sufficient to explain the distinct morphology observed in staminodes and the fertile stamen in C. indica. PMID:24876297
Exogenous plant hormones and cyclotide expression in Viola uliginosa (Violaceae).
Slazak, Blazej; Jacobsson, Erik; Kuta, Elżbieta; Göransson, Ulf
2015-09-01
Plants from Violaceae produce cyclotides, peptides characterized by a circular peptide backbone and a cystine knot. This signature motif gives stability that can harness a wide spectrum of biological activities, with implications in plant defense and with applications in medicine and biotechnology. In the current work, cyclotide expressing in vitro cultures were established from Viola uliginosa. These cultures are useful models for studying biosynthesis of cyclotides and can also be used in their production. The cyclotide expression pattern is shown to be dependent on exogenous plant growth regulators, both on peptide and gene expression levels. The highest yields of cyclotides were obtained on media containing only a cytokinin and were correlated with storage material accumulation. Exposure to auxins decreased cyclotide production and caused shifting of the biosynthesis pattern to root specific cyclotides. The response to stimuli in terms of cyclotide expression pattern appears to be developmental, and related to polar auxin transportation and the auxin/cytokinin ratio regulating tissue differentiation. By the use of whole transcriptome shotgun sequencing (WTSS) and peptidomics, 20 cyclotide sequences from V. uliginosa (including 12 new) and 12 complete precursor proteins could be identified. The most abundant cyclotides were cycloviolacin O3 (CyO3), CyO8 and CyO13. A suspension culture was obtained that grew exponentially with a doubling time of approximately 3 days. After ten days of growth, the culture provided a yield of more than 4 mg CyO13 per gram dry mass. Copyright © 2015 Elsevier Ltd. All rights reserved.
Ortega-Amaro, María A.; Rodríguez-Hernández, Aída A.; Rodríguez-Kessler, Margarita; Hernández-Lucero, Eloísa; Rosales-Mendoza, Sergio; Ibáñez-Salazar, Alejandro; Delgado-Sánchez, Pablo; Jiménez-Bremont, Juan F.
2015-01-01
Proteins with glycine-rich signatures have been reported in a wide variety of organisms including plants, mammalians, fungi, and bacteria. Plant glycine-rich protein genes exhibit developmental and tissue-specific expression patterns. Herein, we present the characterization of the AtGRDP2 gene using Arabidopsis null and knockdown mutants and, Arabidopsis and lettuce over-expression lines. AtGRDP2 encodes a short glycine-rich domain protein, containing a DUF1399 domain and a putative RNA recognition motif (RRM). AtGRDP2 transcript is mainly expressed in Arabidopsis floral organs, and its deregulation in Arabidopsis Atgrdp2 mutants and 35S::AtGRDP2 over-expression lines produces alterations in development. The 35S::AtGRDP2 over-expression lines grow faster than the WT, while the Atgrdp2 mutants have a delay in growth and development. The over-expression lines accumulate higher levels of indole-3-acetic acid and, have alterations in the expression pattern of ARF6, ARF8, and miR167 regulators of floral development and auxin signaling. Under salt stress conditions, 35S::AtGRDP2 over-expression lines displayed higher tolerance and increased expression of stress marker genes. Likewise, transgenic lettuce plants over-expressing the AtGRDP2 gene manifest increased growth rate and early flowering time. Our data reveal an important role for AtGRDP2 in Arabidopsis development and stress response, and suggest a connection between AtGRDP2 and auxin signaling. PMID:25653657
Sequencing of mRNA identifies re-expression of fetal splice variants in cardiac hypertrophy
Ames, EG; Lawson, MJ; Mackey, AJ; Holmes, JW
2013-01-01
Cardiac hypertrophy has been well-characterized at the level of transcription. During cardiac hypertrophy, genes normally expressed primarily during fetal heart development are reexpressed, and this fetal gene program is believed to be a critical component of the hypertrophic process. Recently, alternative splicing of mRNA transcripts has been shown to be temporally regulated during heart development, leading us to consider whether fetal patterns of splicing also reappear during hypertrophy. We hypothesized that patterns of alternative splicing occurring during heart development are recapitulated during cardiac hypertrophy. Here we present a study of isoform expression during pressure-overload cardiac hypertrophy induced by 10 days of transverse aortic constriction (TAC) in rats and in developing fetal rat hearts compared to sham-operated adult rat hearts, using high-throughput sequencing of poly(A) tail mRNA. We find a striking degree of overlap between the isoforms expressed differentially in fetal and pressure-overloaded hearts compared to control: forty-four percent of the isoforms with significantly altered expression in TAC hearts are also expressed at significantly different levels in fetal hearts compared to control (P < 0.001). The isoforms that are shared between hypertrophy and fetal heart development are significantly enriched for genes involved in cytoskeletal organization, RNA processing, developmental processes, and metabolic enzymes. Our data strongly support the concept that mRNA splicing patterns normally associated with heart development recur as part of the hypertrophic response to pressure overload. These findings suggest that cardiac hypertrophy shares post-transcriptional as well as transcriptional regulatory mechanisms with fetal heart development. PMID:23688780
Niu, Jun; Bi, Quanxin; Deng, Shuya; Chen, Huiping; Yu, Haiyan; Wang, Libing; Lin, Shanzhi
2018-01-24
Auxin response factors (ARFs) in auxin signaling pathway are an important component that can regulate the transcription of auxin-responsive genes involved in almost all aspects of plant growth and development. To our knowledge, the comprehensive and systematic characterization of ARF genes has never been reported in Prunus sibirica, a novel woody biodiesel feedstock in China. In this study, we identified 14 PsARF genes with a perfect open reading frame (ORF) in P. sibirica by using its previous transcriptomic data. Conserved motif analysis showed that all identified PsARF proteins had typical DNA-binding and ARF domain, but 5 members (PsARF3, 8 10, 16 and 17) lacked the dimerization domain. Phylogenetic analysis of the ARF proteins generated from various plant species indicated that ARFs could be categorized into 4 major groups (Class I, II, III and IV), in which all identified ARFs from P. sibirica showed a closest relationship with those from P. mume. Comparison of the expression profiles of 14 PsARF genes in different developmental stages of Siberian apricot mesocarp (SAM) and kernel (SAK) reflected distinct temporal or spatial expression patterns for PsARF genes. Additionally, based on the expressed data from fruit and seed development of multiple plant species, we identified 1514 ARF-correlated genes using weighted gene co-expression network analysis (WGCNA). And the major portion of ARF-correlated gene was characterized to be involved in protein, nucleic acid and carbohydrate metabolic, transport and regulatory processes. In summary, we systematically and comprehensively analyzed the structure, expression pattern and co-expression network of ARF gene family in P. sibirica. All our findings provide theoretical foundation for the PsARF gene family and will pave the way for elucidating the precise role of PsARF genes in SAM and SAK development.
2013-01-01
Background Several β-galactosidases of the Glycosyl Hydrolase 35 (GH35) family have been characterized, and many of these modify cell wall components, including pectins, xyloglucans, and arabinogalactan proteins. The phloem fibres of flax (Linum usitatissimum) have gelatinous-type cell walls that are rich in crystalline cellulose and depend on β-galactosidase activity for their normal development. In this study, we investigate the transcript expression patterns and inferred evolutionary relationships of the complete set of flax GH35 genes, to better understand the functions of these genes in flax and other species. Results Using the recently published flax genome assembly, we identified 43 β-galactosidase-like (BGAL) genes, based on the presence of a GH35 domain. Phylogenetic analyses of their protein sequences clustered them into eight sub-families. Sub-family B, whose members in other species were known to be expressed in developing flowers and pollen, was greatly under represented in flax (p-value < 0.01). Sub-family A5, whose sole member from arabidopsis has been described as its primary xyloglucan BGAL, was greatly expanded in flax (p-value < 0.01). A number of flax BGALs were also observed to contain non-consensus GH35 active sites. Expression patterns of the flax BGALs were investigated using qRT-PCR and publicly available microarray data. All predicted flax BGALs showed evidence of expression in at least one tissue. Conclusion Flax has a large number of BGAL genes, which display a distinct distribution among the BGAL sub-families, in comparison to other closely related species with available whole genome assemblies. Almost every flax BGAL was expressed in fibres, the majority of which expressed predominately in fibres as compared to other tissues, suggesting an important role for the expansion of this gene family in the development of this species as a fibre crop. Variations displayed in the canonical GH35 active site suggest a variety of roles unique to flax, which will require further characterization. PMID:23701735
Hobson, Neil; Deyholos, Michael K
2013-05-23
Several β-galactosidases of the Glycosyl Hydrolase 35 (GH35) family have been characterized, and many of these modify cell wall components, including pectins, xyloglucans, and arabinogalactan proteins. The phloem fibres of flax (Linum usitatissimum) have gelatinous-type cell walls that are rich in crystalline cellulose and depend on β-galactosidase activity for their normal development. In this study, we investigate the transcript expression patterns and inferred evolutionary relationships of the complete set of flax GH35 genes, to better understand the functions of these genes in flax and other species. Using the recently published flax genome assembly, we identified 43 β-galactosidase-like (BGAL) genes, based on the presence of a GH35 domain. Phylogenetic analyses of their protein sequences clustered them into eight sub-families. Sub-family B, whose members in other species were known to be expressed in developing flowers and pollen, was greatly under represented in flax (p-value < 0.01). Sub-family A5, whose sole member from arabidopsis has been described as its primary xyloglucan BGAL, was greatly expanded in flax (p-value < 0.01). A number of flax BGALs were also observed to contain non-consensus GH35 active sites. Expression patterns of the flax BGALs were investigated using qRT-PCR and publicly available microarray data. All predicted flax BGALs showed evidence of expression in at least one tissue. Flax has a large number of BGAL genes, which display a distinct distribution among the BGAL sub-families, in comparison to other closely related species with available whole genome assemblies. Almost every flax BGAL was expressed in fibres, the majority of which expressed predominately in fibres as compared to other tissues, suggesting an important role for the expansion of this gene family in the development of this species as a fibre crop. Variations displayed in the canonical GH35 active site suggest a variety of roles unique to flax, which will require further characterization.
Functional characterization of liver-associated lymphocytes in patients with liver metastasis.
Winnock, M; Garcia-Barcina, M; Huet, S; Bernard, P; Saric, J; Bioulac-Sage, P; Gualde, N; Balabaud, C
1993-10-01
The liver-associated lymphocytes (LAL) population is mainly composed of cells with natural killer (NK) activity expressing the CD3+/-CD56+ phenotype. No evident difference has been found in the phenotypic data between patients with benign or malignant liver disease. In this study, the cytotoxic pattern of this population has been characterized from patients who underwent an operation for benign or metastatic liver disease. LAL were isolated by sinusoidal high-pressure lavage from partial hepatectomies. Phenotype was characterized by flow cytometry, and cytotoxicity was evaluated by standard 4-hour 51Cr release assays against NK and lymphokine-activated killer (LAK)-sensitive targets. In patients with benign liver disease, LAL showed spontaneous high levels of NK activity and LAK activity compared with peripheral blood lymphocytes. In patients with metastatic liver disease, no difference was observed in the levels of NK activity between LAL and peripheral blood, and the level of LAK activity was far lower than that expressed in patients with benign liver disease. These results show that the cytotoxic pattern of peripheral blood lymphocytes does not mirror that of LAL. In patients with benign liver disease, LAL are in a state of activation, whereas the decreased level of LAL cytotoxicity in patients with metastatic liver disease suggests that the cytotoxic activity of these cells could be inhibited by the presence of suppressive factors.
Dynamic Tumor Growth Patterns in a Novel Murine Model of Colorectal Cancer
Olson, Terrah J. Paul; Hadac, Jamie N.; Sievers, Chelsie K.; Leystra, Alyssa A.; Deming, Dustin A.; Zahm, Christopher D.; Albrecht, Dawn M.; Nomura, Alice; Nettekoven, Laura A.; Plesh, Lauren K.; Clipson, Linda; Sullivan, Ruth; Newton, Michael A.; Schelman, William R.; Halberg, Richard B.
2014-01-01
Colorectal cancer (CRC) often arises from adenomatous colonic polyps. Polyps can grow and progress to cancer, but may also remain static in size, regress, or resolve. Predicting which progress and which remain benign is difficult. We developed a novel long-lived murine model of CRC with tumors that can be followed by colonoscopy. Our aim was to assess whether these tumors have similar growth patterns and histologic fates to human colorectal polyps to identify features to aid in risk-stratification of colonic tumors. Long-lived ApcMin/+ mice were treated with dextran sodium sulfate to promote colonic tumorigenesis. Tumor growth patterns were characterized by serial colonoscopy with biopsies obtained for immunohistochemistry and gene expression profiling. Tumors grew, remained static, regressed, or resolved over time with different relative frequencies. Newly developed tumors demonstrated higher rates of growth and resolution than more established tumors that tended to remain static in size. Colonic tumors were hyperplastic lesions (3%), adenomas (73%), intramucosal carcinomas (20%), or adenocarcinomas (3%). Interestingly, the level of β-catenin was higher in adenomas that became intratumoral carcinomas as compared to those that failed to progress. In addition, differentially expressed genes between adenomas and intramucosal carcinomas were identified. This novel murine model of intestinal tumorigenesis develops colonic tumors that can be monitored by serial colonoscopy, mirror growth patterns seen in human colorectal polyps, and progress to CRC. Further characterization of cellular and molecular features are needed to determine which features can be used to risk-stratify polyps for progression to CRC and potentially guide prevention strategies. PMID:24196829
Ou, Xiufang; Long, Likun; Zhang, Yunhong; Xue, Yiqun; Liu, Jingchun; Lin, Xiuyun; Liu, Bao
2009-03-09
Spaceflight represents a complex environmental condition in which several interacting factors such as cosmic radiation, microgravity and space magnetic fields are involved, which may provoke stress responses and jeopardize genome integrity. Given the inherent property of epigenetic modifications to respond to intrinsic as well as external perturbations, it is conceivable that epigenetic markers like DNA methylation may undergo alterations in response to spaceflight. We report here that extensive alteration in both DNA methylation and gene expression occurred in rice plants subjected to a spaceflight, as revealed by a set of characterized sequences including 6 transposable elements (TEs) and 11 cellular genes. We found that several features characterize the alterations: (1) All detected alterations are hypermethylation events; (2) whereas alteration in both CG and CNG methylation occurred in the TEs, only alteration in CNG methylation occurred in the cellular genes; (3) alteration in expression includes both up- and down-regulations, which did not show a general correlation with alteration in methylation; (4) altered methylation patterns in both TEs and cellular genes are heritable to progenies at variable frequencies; however, stochastic reversion to wild-type patterns and further de novo changes in progenies are also apparent; and (5) the altered expression states in both TEs and cellular genes are also heritable to selfed progenies but with markedly lower transmission frequencies than altered DNA methylation states. Furthermore, we found that a set of genes encoding for the various putative DNA methyltransferases, 5-methylcytosine DNA glycosylases, the SWI/SNF chromatin remodeller (DDM1) and siRNA-related proteins are extremely sensitive to perturbation by spaceflight, which might be an underlying cause for the altered methylation patterns in the space-flown plants. We discuss implications of spaceflight-induced epigenetic variations with regard to health safety issues of spaceship crews and potentiality of spaceflight as a means for mutagenesis in crop breeding.
Zhang, Luning; Zhang, Huaiyuan; Song, Yuanda
2018-01-24
Acyl-CoA:diacylglycerol acyltransferase (DGAT) is a pivotal regulator of triacylglycerol (TAG) synthesis. The oleaginous fungus Mucor circinelloides has four putative DGATs: McDGAT1A, McDGAT1B, McDGAT2A, and McDGAT2B, classified into the DGAT1 and DGAT2 subfamilies, respectively. To identify and characterize DGATs in M. circinelloides, these four genes were expressed in Saccharomyces cerevisiae H1246 (TAG-deficient quadruple mutant), individually. TAG biosynthesis was restored only by the expression of McDGAT2B, and TAG content was significantly higher in the mutants with McDGAT2B expression than in a S. cerevisiae mutant with endogenous DGA1 expression. McDGAT2B prefers saturated fatty acids to monounsaturated fatty acids and has an obvious preference for C18:3 (ω-6) according to the results of substrate preference experiments. Furthermore, only the mRNA expression pattern of McDGAT2B correlated with TAG biosynthesis during a fermentation process. Our experiments strongly indicate that McDGAT2B is crucial for TAG accumulation, suggesting that it may be an essential target for metabolic engineering aimed at increasing lipid content of M. circinelloides.
Dang, Ran; Zhu, Jun-Quan; Tan, Fu-Qing; Wang, Wei; Zhou, Hong; Yang, Wan-Xi
2012-05-01
KIF3B is known for maintaining and assembling cilia and flagellum. To date, the function of KIF3B and its relationship with KIF3A during spermiogenesis in the cephalopod Octopus tankahkeei remains unknown. In the present study, we characterized a gene encoding a homologue of rat KIF3B in the O. tankahkeei testis and examined its temporal and spatial expression pattern during spermiogenesis. The cDNA of KIF3B was obtained with degenerate and RACE PCR and the distribution pattern of ot-kif3b were observed with RT-PCR. The morphological development during spermiogenesis was illustrated by histological and transmission electron microscopy and mRNA expression of ot-kif3b was observed by in situ hybridization. The 2,365 nucleotides cDNA consisted of a 102 bp 5' untranslated region (UTR), a 2,208 bp open reading frame (ORF) encoding a protein of 736 amino acids, and a 55 bp 3' UTR. Multiple alignments revealed that the putative Ot-KIF3B shared 68, 68, 69, 68, and 67% identity with that of Homo sapiens, Mus musculus, Gallus gallus, Danio rerio, and Xenopus laevis, respectively, along with high identities with Ot-KIF3A in fundamental structures. Ot-kif3b transcripts appeared gradually in early spermatids, increased in intermediate spermatids and maximized in drastically remodeled and final spermatids. The kif3b gene is identified and its expression pattern is demonstrated for the first time in O. tankahkeei. Compared to ot-kif3a reported by our laboratory before, our data suggested that the putative heterodimeric motor proteins Ot-KIF3A/B may be involved in intraspermatic transport and might contribute to structural changes during spermiogenesis.
Patterns of expression and normalized levels of the five Arabidopsis phytochromes.
Sharrock, Robert A; Clack, Ted
2002-09-01
Using monoclonal antibodies specific for each apoprotein and full-length purified apoprotein standards, the levels of the five Arabidopsis phytochromes and their patterns of expression in seedlings and mature plants and under different light conditions have been characterized. Phytochrome levels are normalized to the DNA content of the various tissue extracts to approximate normalization to the number of cells in the tissue. One phytochrome, phytochrome A, is highly light labile. The other four phytochromes are much more light stable, although among these, phytochromes B and C are reduced 4- to 5-fold in red- or white-light-grown seedlings compared with dark-grown seedlings. The total amount of extractable phytochrome is 23-fold lower in light-grown than dark-grown tissues, and the percent ratios of the five phytochromes, A:B:C:D:E, are measured as 85:10:2:1.5:1.5 in etiolated seedlings and 5:40:15:15:25 in seedlings grown in continuous white light. The four light-stable phytochromes are present at nearly unchanging levels throughout the course of development of mature rosette and reproductive-stage plants and are present in leaves, stems, roots, and flowers. Phytochrome protein expression patterns over the course of seed germination and under diurnal and circadian light cycles are also characterized. Little cycling in response to photoperiod is observed, and this very low amplitude cycling of some phytochrome proteins is out of phase with previously reported cycling of PHY mRNA levels. These studies indicate that, with the exception of phytochrome A, the family of phytochrome photoreceptors in Arabidopsis constitutes a quite stable and very broadly distributed array of sensory molecules.
Martins, Marina Angela; Silva, Maria Luiza; Elói-Santos, Silvana Maria; Ribeiro, José Geraldo Leite; Peruhype-Magalhães, Vanessa; Marciano, Ana Paula Vieira; Homma, Akira; Kroon, Erna Geessien; Teixeira-Carvalho, Andréa; Martins-Filho, Olindo Assis
2008-02-26
Detailed multiparametric phenotypic investigation aiming to characterize the kinetics of the innate immune response in the peripheral blood following 17DD yellow fever (17DD-YF) first-time vaccination was performed. Results showed increased frequency of monocytes and NK cell subpopulations besides unexpected up-regulation of granulocytes activation status (CD28+/CD23+ and CD28+/HLA-DR+, respectively). Up-regulation of Fcgamma-R and IL-10-R expression emerge as putative events underlying the mixed pattern of phenotypic features triggered by the 17DD yellow fever (17DD-YF) vaccination. Mixed pattern of chemokine receptors expression further support our hypothesis that a parallel establishment of activation/modulation microenvironment plays a pivotal role in the protective immunity triggered by the 17DD-YF vaccine.
Neural Cognition and Affective Computing on Cyber Language.
Huang, Shuang; Zhou, Xuan; Xue, Ke; Wan, Xiqiong; Yang, Zhenyi; Xu, Duo; Ivanović, Mirjana; Yu, Xueer
2015-01-01
Characterized by its customary symbol system and simple and vivid expression patterns, cyber language acts as not only a tool for convenient communication but also a carrier of abundant emotions and causes high attention in public opinion analysis, internet marketing, service feedback monitoring, and social emergency management. Based on our multidisciplinary research, this paper presents a classification of the emotional symbols in cyber language, analyzes the cognitive characteristics of different symbols, and puts forward a mechanism model to show the dominant neural activities in that process. Through the comparative study of Chinese, English, and Spanish, which are used by the largest population in the world, this paper discusses the expressive patterns of emotions in international cyber languages and proposes an intelligent method for affective computing on cyber language in a unified PAD (Pleasure-Arousal-Dominance) emotional space.
Neural Cognition and Affective Computing on Cyber Language
Huang, Shuang; Zhou, Xuan; Xue, Ke; Wan, Xiqiong; Yang, Zhenyi; Xu, Duo; Ivanović, Mirjana
2015-01-01
Characterized by its customary symbol system and simple and vivid expression patterns, cyber language acts as not only a tool for convenient communication but also a carrier of abundant emotions and causes high attention in public opinion analysis, internet marketing, service feedback monitoring, and social emergency management. Based on our multidisciplinary research, this paper presents a classification of the emotional symbols in cyber language, analyzes the cognitive characteristics of different symbols, and puts forward a mechanism model to show the dominant neural activities in that process. Through the comparative study of Chinese, English, and Spanish, which are used by the largest population in the world, this paper discusses the expressive patterns of emotions in international cyber languages and proposes an intelligent method for affective computing on cyber language in a unified PAD (Pleasure-Arousal-Dominance) emotional space. PMID:26491431
NASA Technical Reports Server (NTRS)
Uzawa, K.; Grzesik, W. J.; Nishiura, T.; Kuznetsov, S. A.; Robey, P. G.; Brenner, D. A.; Yamauchi, M.
1999-01-01
The pattern of lysyl hydroxylation in the nontriple helical domains of collagen is critical in determining the cross-linking pathways that are tissue specific. We hypothesized that the tissue specificity of type I collagen cross-linking is, in part, due to the differential expression of lysyl hydroxylase genes (Procollagen-lysine,2-oxyglutarate,5-dioxygenase 1, 2, and 3 [PLOD1, PLOD2, and PLOD3]). In this study, we have examined the expression patterns of these three genes during the course of in vitro differentiation of human osteoprogenitor cells (bone marrow stromal cells [BMSCs]) and normal skin fibroblasts (NSFs). In addition, using the medium and cell layer/matrix fractions in these cultures, lysine hydroxylation of type I collagen alpha chains and collagen cross-linking chemistries have been characterized. High levels of PLOD1 and PLOD3 genes were expressed in both BMSCs and NSFs, and the expression levels did not change in the course of differentiation. In contrast to the PLOD1 and PLOD3 genes, both cell types showed low PLOD2 gene expression in undifferentiated and early differentiated conditions. However, fully differentiated BMSCs, but not NSFs, exhibited a significantly elevated level (6-fold increase) of PLOD2 mRNA. This increase coincided with the onset of matrix mineralization and with the increase in lysyl hydroxylation in the nontriple helical domains of alpha chains of type I collagen molecule. Furthermore, the collagen cross-links that are derived from the nontriple helical hydroxylysine-aldehyde were found only in fully differentiated BMSC cultures. The data suggests that PLOD2 expression is associated with lysine hydroxylation in the nontriple helical domains of collagen and, thus, could be partially responsible for the tissue-specific collagen cross-linking pattern.
Hu, Yan; Liu, Hongxiang; Shan, Yanju; Ji, Gaige; Xu, Wenjuan; Shu, Jingting; Li, Huifang
2015-08-10
Genetic selection is a powerful tool for modifying poultry muscle yield. Insulin-like growth factor I (IGF-I) and myostatin (MSTN) are important regulators of muscle growth, especially in the myogenesis stage. This study compared the developmental pattern of the pectoralis major (PM) and lateral gastrocnemius (LM) muscles, mRNA expression characterization of IGF-I and MSTN-A and their correlation between 14 days in ovo and 1 week post-hatch in two Chinese local duck breeds. During early development, the growth of duck PM and LM followed an asynchronous pattern. Variations in PM growth rate observed with development followed the relative variations of MSTN and IGF-I expression; however, the same behavior was not observed in LM. Moreover, the profile of IGF-I expression in duck skeletal muscles indicated that genetic selection for high meat-yield poultry has altered the temporal expression of IGF-I and affected cellular characteristics and mass by hatch in a PM-specific manner. The MSTN-A expression profile showed synchronization with the growth of skeletal muscle and peaks of myofiber proliferation. The expression patterns of IGF-I and MSTN suggest that duck pectoralis fibers are prioritized for proliferation in embryogenesis. The IGF-1/MSTN-A mRNA ratios in PM and LM presented very similar trends in the changes of myofiber characteristics, and differences in the IGF-1/MSTN-A mRNA ratio in PM between the two breeds corresponded to the timing of differences in PM mass between the varieties. Our results support the hypothesis that relative levels of IGF-I and MSTN mRNA may participate in ordering muscle growth rates with selected development. Copyright © 2015 Elsevier B.V. All rights reserved.
Parkinson's disease: increased motor network activity in the absence of movement.
Ko, Ji Hyun; Mure, Hideo; Tang, Chris C; Ma, Yilong; Dhawan, Vijay; Spetsieris, Phoebe; Eidelberg, David
2013-03-06
We used a network approach to assess systems-level abnormalities in motor activation in humans with Parkinson's disease (PD). This was done by measuring the expression of the normal movement-related activation pattern (NMRP), a previously validated activation network deployed by healthy subjects during motor performance. In this study, NMRP expression was prospectively quantified in (15)O-water PET scans from a PD patient cohort comprised of a longitudinal early-stage group (n = 12) scanned at baseline and at two or three follow-up visits two years apart, and a moderately advanced group scanned on and off treatment with either subthalamic nucleus deep brain stimulation (n = 14) or intravenous levodopa infusion (n = 14). For each subject and condition, we measured NMRP expression during both movement and rest. Resting expression of the abnormal PD-related metabolic covariance pattern was likewise determined in the same subjects. NMRP expression was abnormally elevated (p < 0.001) in PD patients scanned in the nonmovement rest state. By contrast, network activity measured during movement did not differ from normal (p = 0.34). In the longitudinal cohort, abnormal increases in resting NMRP expression were evident at the earliest clinical stages (p < 0.05), which progressed significantly over time (p = 0.003). Analogous network changes were present at baseline in the treatment cohort (p = 0.001). These abnormalities improved with subthalamic nucleus stimulation (p < 0.005) but not levodopa (p = 0.25). In both cohorts, the changes in NMRP expression that were observed did not correlate with concurrent PD-related metabolic covariance pattern measurements (p > 0.22). Thus, the resting state in PD is characterized by changes in the activity of normal as well as pathological brain networks.
Comparative transcriptomics of 5 high-altitude vertebrates and their low-altitude relatives.
Tang, Qianzi; Gu, Yiren; Zhou, Xuming; Jin, Long; Guan, Jiuqiang; Liu, Rui; Li, Jing; Long, Kereng; Tian, Shilin; Che, Tiandong; Hu, Silu; Liang, Yan; Yang, Xuemei; Tao, Xuan; Zhong, Zhijun; Wang, Guosong; Chen, Xiaohui; Li, Diyan; Ma, Jideng; Wang, Xun; Mai, Miaomiao; Jiang, An'an; Luo, Xiaolin; Lv, Xuebin; Gladyshev, Vadim N; Li, Xuewei; Li, Mingzhou
2017-12-01
Species living at high altitude are subject to strong selective pressures due to inhospitable environments (e.g., hypoxia, low temperature, high solar radiation, and lack of biological production), making these species valuable models for comparative analyses of local adaptation. Studies that have examined high-altitude adaptation have identified a vast array of rapidly evolving genes that characterize the dramatic phenotypic changes in high-altitude animals. However, how high-altitude environment shapes gene expression programs remains largely unknown. We generated a total of 910 Gb of high-quality RNA-seq data for 180 samples derived from 6 tissues of 5 agriculturally important high-altitude vertebrates (Tibetan chicken, Tibetan pig, Tibetan sheep, Tibetan goat, and yak) and their cross-fertile relatives living in geographically neighboring low-altitude regions. Of these, ∼75% reads could be aligned to their respective reference genomes, and on average ∼60% of annotated protein coding genes in each organism showed FPKM expression values greater than 0.5. We observed a general concordance in topological relationships between the nucleotide alignments and gene expression-based trees. Tissue and species accounted for markedly more variance than altitude based on either the expression or the alternative splicing patterns. Cross-species clustering analyses showed a tissue-dominated pattern of gene expression and a species-dominated pattern for alternative splicing. We also identified numerous differentially expressed genes that could potentially be involved in phenotypic divergence shaped by high-altitude adaptation. These data serve as a valuable resource for examining the convergence and divergence of gene expression changes between species as they adapt or acclimatize to high-altitude environments. © The Authors 2017. Published by Oxford University Press.
Vázquez-Lobo, Alejandra; Carlsbecker, Annelie; Vergara-Silva, Francisco; Alvarez-Buylla, Elena R; Piñero, Daniel; Engström, Peter
2007-01-01
The identity of genes causally implicated in the development and evolutionary origin of reproductive characters in gymnosperms is largely unknown. Working within the framework of plant evolutionary developmental biology, here we have cloned, sequenced, performed phylogenetic analyses upon and tested the expression patterns of LEAFY/FLORICAULA and NEEDLY orthologs in reproductive structures from selected species of the conifer genera Picea, Podocarpus, and Taxus. Contrary to expectations based on previous assessments, expression of LFY/FLO and NLY in cones of these taxa was found to occur simultaneously in a single reproductive axis, initially overlapping but later in mutually exclusive primordia and/or groups of developing cells in both female and male structures. These observations directly affect the status of the "mostly male theory" for the origin of the angiosperm flower. On the other hand, comparative spatiotemporal patterns of the expression of these genes suggest a complex genetic regulatory network of cone development, as well as a scheme of functional divergence for LFY/FLO with respect to NLY homologs in gymnosperms, both with clear heterochronic aspects. Results presented in this study contribute to the understanding of the molecular-genetic basis of morphological evolution in conifer cones, and may aid in establishing a foundation for gymnosperm-specific, testable evo-devo hypotheses.
Rasool, Khawaja Ghulam; Khan, Muhammad Altaf; Aldawood, Abdulrahman Saad; Tufail, Muhammad; Mukhtar, Muhammad; Takeda, Makio
2015-01-01
A state of the art proteomic methodology using Matrix Assisted Laser Desorption/Ionization-Time of Flight (MALDI TOF) has been employed to characterize peptides modulated in the date palm stem subsequent to infestation with red palm weevil (RPW). Our analyses revealed 32 differentially expressed peptides associated with RPW infestation in date palm stem. To identify RPW infestation associated peptides (I), artificially wounded plants (W) were used as additional control beside uninfested plants, a conventional control (C). A constant unique pattern of differential expression in infested (I), wounded (W) stem samples compared to control (C) was observed. The upregulated proteins showed relative fold intensity in order of I > W and downregulated spots trend as W > I, a quite interesting pattern. This study also reveals that artificially wounding of date palm stem affects almost the same proteins as infestation; however, relative intensity is quite lower than in infested samples both in up and downregulated spots. All 32 differentially expressed spots were subjected to MALDI-TOF analysis for their identification and we were able to match 21 proteins in the already existing databases. Relatively significant modulated expression pattern of a number of peptides in infested plants predicts the possibility of developing a quick and reliable molecular methodology for detecting plants infested with date palm. PMID:26287180
Rasool, Khawaja Ghulam; Khan, Muhammad Altaf; Aldawood, Abdulrahman Saad; Tufail, Muhammad; Mukhtar, Muhammad; Takeda, Makio
2015-08-17
A state of the art proteomic methodology using Matrix Assisted Laser Desorption/Ionization-Time of Flight (MALDI TOF) has been employed to characterize peptides modulated in the date palm stem subsequent to infestation with red palm weevil (RPW). Our analyses revealed 32 differentially expressed peptides associated with RPW infestation in date palm stem. To identify RPW infestation associated peptides (I), artificially wounded plants (W) were used as additional control beside uninfested plants, a conventional control (C). A constant unique pattern of differential expression in infested (I), wounded (W) stem samples compared to control (C) was observed. The upregulated proteins showed relative fold intensity in order of I > W and downregulated spots trend as W > I, a quite interesting pattern. This study also reveals that artificially wounding of date palm stem affects almost the same proteins as infestation; however, relative intensity is quite lower than in infested samples both in up and downregulated spots. All 32 differentially expressed spots were subjected to MALDI-TOF analysis for their identification and we were able to match 21 proteins in the already existing databases. Relatively significant modulated expression pattern of a number of peptides in infested plants predicts the possibility of developing a quick and reliable molecular methodology for detecting plants infested with date palm.
USDA-ARS?s Scientific Manuscript database
Pecan nuts and other tree nuts can be a nutrient rich part of a healthy diet full of beneficial fatty acids and antioxidants, but can also cause allergic reactions in people suffering from food allergy to the nuts. We characterized the transcriptome of a developing pecan nut to identify the gene ex...
Condie, Brian G; Urbanski, William M
2014-01-01
Effective tools for searching the biomedical literature are essential for identifying reagents or mouse strains as well as for effective experimental design and informed interpretation of experimental results. We have built the Textpresso Site Specific Recombinases (Textpresso SSR) Web server to enable researchers who use mice to perform in-depth searches of a rapidly growing and complex part of the mouse literature. Our Textpresso Web server provides an interface for searching the full text of most of the peer-reviewed publications that report the characterization or use of mouse strains that express Cre or Flp recombinase. The database also contains most of the publications that describe the characterization or analysis of strains carrying conditional alleles or transgenes that can be inactivated or activated by site-specific recombinases such as Cre or Flp. Textpresso SSR complements the existing online databases that catalog Cre and Flp expression patterns by providing a unique online interface for the in-depth text mining of the site specific recombinase literature.
Tang, Guiying; Xu, Pingli; Liu, Wei; Liu, Zhanji; Shan, Lei
2015-01-01
LEAFY COTYLEDON1 (LEC1) is a B subunit of Nuclear Factor Y (NF-YB) transcription factor that mainly accumulates during embryo development. We cloned the 5′ flanking regulatory sequence of AhLEC1B gene, a homolog of Arabidopsis LEC1, and analyzed its regulatory elements using online software. To identify the crucial regulatory region, we generated a series of GUS expression frameworks driven by different length promoters with 5′ terminal and/or 3′ terminal deletion. We further characterized the GUS expression patterns in the transgenic Arabidopsis lines. Our results show that both the 65bp proximal promoter region and the 52bp 5′ UTR of AhLEC1B contain the key motifs required for the essential promoting activity. Moreover, AhLEC1B is preferentially expressed in the embryo and is co-regulated by binding of its upstream genes with both positive and negative corresponding cis-regulatory elements. PMID:26426444
Guo, Yong; Qiu, Li-Juan
2013-01-01
The Dof domain protein family is a classic plant-specific zinc-finger transcription factor family involved in a variety of biological processes. There is great diversity in the number of Dof genes in different plants. However, there are only very limited reports on the characterization of Dof transcription factors in soybean (Glycine max). In the present study, 78 putative Dof genes were identified from the whole-genome sequence of soybean. The predicted GmDof genes were non-randomly distributed within and across 19 out of 20 chromosomes and 97.4% (38 pairs) were preferentially retained duplicate paralogous genes located in duplicated regions of the genome. Soybean-specific segmental duplications contributed significantly to the expansion of the soybean Dof gene family. These Dof proteins were phylogenetically clustered into nine distinct subgroups among which the gene structure and motif compositions were considerably conserved. Comparative phylogenetic analysis of these Dof proteins revealed four major groups, similar to those reported for Arabidopsis and rice. Most of the GmDofs showed specific expression patterns based on RNA-seq data analyses. The expression patterns of some duplicate genes were partially redundant while others showed functional diversity, suggesting the occurrence of sub-functionalization during subsequent evolution. Comprehensive expression profile analysis also provided insights into the soybean-specific functional divergence among members of the Dof gene family. Cis-regulatory element analysis of these GmDof genes suggested diverse functions associated with different processes. Taken together, our results provide useful information for the functional characterization of soybean Dof genes by combining phylogenetic analysis with global gene-expression profiling.
A Comparative Review of microRNA Expression Patterns in Autism Spectrum Disorder.
Hicks, Steven D; Middleton, Frank A
2016-01-01
Autism spectrum disorder (ASD) is a neurodevelopmental disorder characterized by a wide spectrum of deficits in social interaction, communication, and behavior. There is a significant genetic component to ASD, yet no single gene variant accounts for >1% of incidence. Posttranscriptional mechanisms such as microRNAs (miRNAs) regulate gene expression without altering the genetic code. They are abundant in the developing brain and are dysregulated in children with ASD. Patterns of miRNA expression are altered in the brain, blood, saliva, and olfactory precursor cells of ASD subjects. The ability of miRNAs to regulate broad molecular pathways in response to environmental stimuli makes them an intriguing player in ASD, a disorder characterized by genetic predisposition with ill-defined environmental triggers. In addition, the availability and extracellular stability of miRNAs make them an ideal candidate for biomarker discovery. Here, we discuss 27 miRNAs with overlap across ASD studies, including 3 miRNAs identified in 3 or more studies (miR-23a, miR-146a, and miR-106b). Together, these 27 miRNAs have 1245 high-confidence mRNA targets, a significant number of which are expressed in the brain. Furthermore, these mRNA targets demonstrate over-representation of autism-related genes with enrichment of neurotrophic signaling molecules. Brain-derived neurotrophic factor, a molecule involved in hippocampal neurogenesis and altered in ASD, is targeted by 6 of the 27 miRNAs of interest. This neurotrophic pathway represents one intriguing mechanism by which perturbations in miRNA signaling might influence central nervous system development in children with ASD.
Nugent, B M; Stiver, K A; Alonzo, S H; Hofmann, H A
2016-10-01
The molecular mechanisms underlying phenotypic plasticity are not well understood. Identifying mechanisms underlying alternative reproductive tactics (ARTs) in species for which the behavioural and fitness consequences of this variation are well characterized provides an opportunity to integrate evolutionary and mechanistic understanding of the maintenance of variation within populations. In the ocellated wrasse Symphodus ocellatus, the behavioural phenotypes of three distinct male morphs (sneakers, satellites and nesting males), which arise from a single genome, have been thoroughly characterized. To determine the neuroendocrine and genomic mechanisms associated with discrete phenotypic variation and ARTs in S. ocellatus in their natural environment, we constructed a whole-brain de novo transcriptome and compared global patterns of gene expression between sexes and male morphs. Next, we quantified circulating cortisol and 11-ketotestosterone (11-kt), mediators of male reproductive behaviours, as well as stress and gonadal steroid hormone receptor expression in the preoptic area, ventral subpallial division of the telencephalon and dorsolateral telencephalon, critical brain regions for social and reproductive behaviours. We found higher levels of 11-kt in nesting males and higher levels of cortisol in sneaker males relative to other male morphs and females. We also identified distinct patterns of brain region-specific hormone receptor expression between males such that most hormone receptors are more highly expressed in satellites and nesting males relative to sneakers and females. Our results establish the neuroendocrine and molecular mechanisms that underlie ARTs in the wild and provide a foundation for experimentally testing hypotheses about the relationship between neuromolecular processes and reproductive success. © 2016 John Wiley & Sons Ltd.
Xu, Jiajia; Bräutigam, Andrea; Weber, Andreas P M; Zhu, Xin-Guang
2016-09-01
Identification of potential cis-regulatory motifs controlling the development of C4 photosynthesis is a major focus of current research. In this study, we used time-series RNA-seq data collected from etiolated maize and rice leaf tissues sampled during a de-etiolation process to systematically characterize the expression patterns of C4-related genes and to further identify potential cis elements in five different genomic regions (i.e. promoter, 5'UTR, 3'UTR, intron, and coding sequence) of C4 orthologous genes. The results demonstrate that although most of the C4 genes show similar expression patterns, a number of them, including chloroplast dicarboxylate transporter 1, aspartate aminotransferase, and triose phosphate transporter, show shifted expression patterns compared with their C3 counterparts. A number of conserved short DNA motifs between maize C4 genes and their rice orthologous genes were identified not only in the promoter, 5'UTR, 3'UTR, and coding sequences, but also in the introns of core C4 genes. We also identified cis-regulatory motifs that exist in maize C4 genes and also in genes showing similar expression patterns as maize C4 genes but that do not exist in rice C3 orthologs, suggesting a possible recruitment of pre-existing cis-elements from genes unrelated to C4 photosynthesis into C4 photosynthesis genes during C4 evolution. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology.
Videos of conspecifics elicit interactive looking patterns and facial expressions in monkeys.
Mosher, Clayton P; Zimmerman, Prisca E; Gothard, Katalin M
2011-08-01
A broader understanding of the neural basis of social behavior in primates requires the use of species-specific stimuli that elicit spontaneous, but reproducible and tractable behaviors. In this context of natural behaviors, individual variation can further inform about the factors that influence social interactions. To approximate natural social interactions similar to those documented by field studies, we used unedited video footage to induce in viewer monkeys spontaneous facial expressions and looking patterns in the laboratory setting. Three adult male monkeys (Macaca mulatta), previously behaviorally and genetically (5-HTTLPR) characterized, were monitored while they watched 10 s video segments depicting unfamiliar monkeys (movie monkeys) displaying affiliative, neutral, and aggressive behaviors. The gaze and head orientation of the movie monkeys alternated between "averted" and "directed" at the viewer. The viewers were not reinforced for watching the movies, thus their looking patterns indicated their interest and social engagement with the stimuli. The behavior of the movie monkey accounted for differences in the looking patterns and facial expressions displayed by the viewers. We also found multiple significant differences in the behavior of the viewers that correlated with their interest in these stimuli. These socially relevant dynamic stimuli elicited spontaneous social behaviors, such as eye-contact induced reciprocation of facial expression, gaze aversion, and gaze following, that were previously not observed in response to static images. This approach opens a unique opportunity to understanding the mechanisms that trigger spontaneous social behaviors in humans and nonhuman primates. (PsycINFO Database Record (c) 2011 APA, all rights reserved).
Jiang, Beiqi; Hua, Jing; Wang, Yijing; Fu, Yun; Zhuang, Zhigang; Zhu, Liping
2015-10-20
Breast milk expression (breast pumping) has become prevalent as an important dimension of breastfeeding behavior. It is, however, not clear whether increasing breast milk expression contributes to extend the duration of breastfeeding. The objective of the present study was to evaluate the impact of breast milk expression in early postpartum period on breastfeeding duration amongst mothers of healthy term infants. A prospective cohort study had been conducted from March to June 2010. Mothers who gave birth to healthy, full-term and singleton babies were enrolled at discharge. These women were interviewed at 6 weeks postpartum about their breastfeeding behaviors. According to expressing patterns at 6 week postpartum, women were divided into three groups: direct breastfeeding (group 1), combining direct breastfeeding with expressing (group 2), exclusive expressing (group 3). The investigators followed up the women by telephone thereafter at a bimonthly basis and documented breastfeeding duration. Survival analysis was conducted to explore the association between expressing patterns at 6 weeks postpartum and breastfeeding duration. Associated factors of exclusive expressing at 6 weeks postpartum were characterized by logistic regression analysis. Four hundred one eligible women were enrolled at discharge. Among the 389 women who attended the face-to-face interview at 6 weeks postpartum, 345 women continued breastfeeding. They were divided into 3 groups by their expressing patterns. According to survival analysis, women who exclusively expressed breast milk at 6 months postpartum (group 3) were 1.77 times as likely to stop breastfeeding as those who did not (group 1 and 2) (95% confidence interval: 1.25-2.48; P <0.001). There is, however, no significant difference of breastfeeding duration between group 1 and group 2. Subgroup analysis showed that exclusive expressing women who were exclusively breastfeeding at 6 weeks postpartum had the shortest breastfeeding duration. Mother's high education level, short maternity leave, breast milk expression in hospital and bottle-feeding in hospital were associated factors to exclusive expressing at 6 weeks postpartum. Exclusive expressing in the early postpartum period may not help women to achieve long-term breastfeeding duration, especially in women who were exclusively breastfeeding.
Simion, Viorel; Sobilo, Julien; Clemoncon, Rudy; Natkunarajah, Sharuja; Ezzine, Safia; Abdallah, Florence; Lerondel, Stephanie; Pichon, Chantal
2017-01-01
MicroRNAs (miRNAs) are key players in many biological processes and are considered as an emerging class of pharmacology drugs for diagnosis and therapy. However to fully exploit the therapeutic potential of miRNAs, it is becoming crucial to monitor their expression pattern using medical imaging modalities. Recently, we developed a method called RILES, for RNAi-Inducible Luciferase Expression System that relies on an engineered regulatable expression system to switch-ON the expression of the luciferase gene when a miRNA of interest is expressed in cells. Here we investigated whether replacing the luciferase reporter gene with the human sodium iodide symporter (hNIS) reporter gene will be also suited to monitor the expression of miRNAs in a clinical setting context. We provide evidence that radionuclide imaging of miRNA expression using hNIS is feasible although it is not as robust as when the luciferase reporter gene is used. However, under appropriate conditions, we monitored the expression of several miRNAs in cells, in the liver and in the tibialis anterior muscle of mice undergoing muscular atrophy. We demonstrated that radiotracer accumulation in transfected cells correlated with the induction of hNIS and with the expression of miRNAs detected by real time PCR. We established the kinetic of miRNA-23a expression in mice and demonstrated that this miRNA follows a biphasic expression pattern characterized by a loss of expression at a late time point of muscular atrophy. At autopsy, we found an opposite expression pattern between miRNA-23a and one of the main transcriptional target of this miRNA, APAF-1, and as downstream target, Caspase 9. Our results report the first positive monitoring of endogenously expressed miRNAs in a nuclear medicine imaging context and support the development of additional work to establish the potential therapeutic value of miRNA-23 to prevent the damaging effects of muscular atrophy. PMID:28493972
Simion, Viorel; Sobilo, Julien; Clemoncon, Rudy; Natkunarajah, Sharuja; Ezzine, Safia; Abdallah, Florence; Lerondel, Stephanie; Pichon, Chantal; Baril, Patrick
2017-01-01
MicroRNAs (miRNAs) are key players in many biological processes and are considered as an emerging class of pharmacology drugs for diagnosis and therapy. However to fully exploit the therapeutic potential of miRNAs, it is becoming crucial to monitor their expression pattern using medical imaging modalities. Recently, we developed a method called RILES, for RNAi-Inducible Luciferase Expression System that relies on an engineered regulatable expression system to switch-ON the expression of the luciferase gene when a miRNA of interest is expressed in cells. Here we investigated whether replacing the luciferase reporter gene with the human sodium iodide symporter (hNIS) reporter gene will be also suited to monitor the expression of miRNAs in a clinical setting context. We provide evidence that radionuclide imaging of miRNA expression using hNIS is feasible although it is not as robust as when the luciferase reporter gene is used. However, under appropriate conditions, we monitored the expression of several miRNAs in cells, in the liver and in the tibialis anterior muscle of mice undergoing muscular atrophy. We demonstrated that radiotracer accumulation in transfected cells correlated with the induction of hNIS and with the expression of miRNAs detected by real time PCR. We established the kinetic of miRNA-23a expression in mice and demonstrated that this miRNA follows a biphasic expression pattern characterized by a loss of expression at a late time point of muscular atrophy. At autopsy, we found an opposite expression pattern between miRNA-23a and one of the main transcriptional target of this miRNA, APAF-1, and as downstream target, Caspase 9. Our results report the first positive monitoring of endogenously expressed miRNAs in a nuclear medicine imaging context and support the development of additional work to establish the potential therapeutic value of miRNA-23 to prevent the damaging effects of muscular atrophy.
Citerne, Hélène L.; Reyes, Elisabeth; Le Guilloux, Martine; Delannoy, Etienne; Simonnet, Franck; Sauquet, Hervé; Weston, Peter H.; Nadot, Sophie; Damerval, Catherine
2017-01-01
Background and Aims The basal eudicot family Proteaceae (approx. 1700 species) shows considerable variation in floral symmetry but has received little attention in studies of evolutionary development at the genetic level. A framework for understanding the shifts in floral symmetry in Proteaceae is provided by reconstructing ancestral states on an upated phylogeny of the family, and homologues of CYCLOIDEA (CYC), a key gene for the control of floral symmetry in both monocots and eudicots, are characterized. Methods Perianth symmetry transitions were reconstructed on a new species-level tree using parsimony and maximum likelihood. CYC-like genes in 35 species (31 genera) of Proteaceae were sequenced and their phylogeny was reconstructed. Shifts in selection pressure following gene duplication were investigated using nested branch-site models of sequence evolution. Expression patterns of CYC homologues were characterized in three species of Grevillea with different types of floral symmetry. Key Results Zygomorphy has evolved 10–18 times independently in Proteaceae from actinomorphic ancestors, with at least four reversals to actinomorphy. A single duplication of CYC-like genes occurred prior to the diversification of Proteaceae, with putative loss or divergence of the ProtCYC1 paralogue in more than half of the species sampled. No shifts in selection pressure were detected in the branches subtending the two ProtCYC paralogues. However, the amino acid sequence preceding the TCP domain is strongly divergent in Grevillea ProtCYC1 compared with other species. ProtCYC genes were expressed in developing flowers of both actinomorphic and zygomorphic Grevillea species, with late asymmetric expression in the perianth of the latter. Conclusion Proteaceae is a remarkable family in terms of the number of transitions in floral symmetry. Furthermore, although CYC-like genes in Grevillea have unusual sequence characteristics, they display patterns of expression that make them good candidates for playing a role in the establishment of floral symmetry. PMID:28025288
Caminos, Elena; Vaquero, Cecilia F; García-Olmo, Dolores C
2014-12-01
Characterization of retinal cells, cell transplants and gene therapies may be helped by pre-labeled retinal cells, such as those transfected with vectors for green fluorescent protein expression. The aim of this study was to analyze retinal cells and optic nerve components from transgenic green mice (GM) with the 'enhanced' green fluorescent protein (EGFP) gene under the control of the CAG promoter (a chicken β-actin promoter and a cytomegalovirus enhancer). The structural analysis and electroretinography recordings showed a normal, healthy retina. Surprisingly, EGFP expression was not ubiquitously located in the retina and optic nerve. Epithelial cells, photoreceptors and bipolar cells presented high green fluorescence levels. In contrast, horizontal cells, specific amacrine cells and ganglion cells exhibited a null EGFP expression level. The synaptic terminals of rod bipolar cells displayed a high green fluorescence level when animals were kept in the dark. Immature retinas exhibited different EGFP expression patterns to those noted in adults. Axons and glial cells in the optic nerve revealed a specific regional EGFP expression pattern, which correlated with the presence of myelin. These results suggest that EGFP expression might be related to the activity of both the CAG promoter and β-actin in mature retinal neurons and oligodendrocytes. Moreover, EGFP expression might be regulated by light in both immature and adult animals. Since GM are used in numerous retina bioassays, it is essential to know the differential EGFP expression in order to select cells of interest for each study.
Wilson, Sandra L.; Kalinovsky, Anna; Orvis, Grant D.
2011-01-01
The cerebellum is a highly organized structure partitioned into lobules along the anterior–posterior (A-P) axis and into striped molecular domains along the medial–lateral (M-L) axis. The Engrailed (En) homeobox genes are required for patterning the morphological and molecular domains along both axes, as well as for the establishment of the normal afferent topography required to generate a fully functional cerebellum. As a means to understand how the En genes regulate multiple levels of cerebellum construction, we characterized En1 and En2 expression around birth and at postnatal day (P)21 during the period when the cerebellum undergoes a remarkable transformation from a smooth ovoid structure to a highly foliated structure. We show that both En1 and En2 are expressed in many neuronal cell types in the cerebellum, and expression persists until at least P21. En1 and En2 expression, however, undergoes profound changes in their cellular and spatial distributions between embryonic stages and P21, and their expression domains become largely distinct. Comparison of the distribution of En-expressing Purkinje cells relative to early- and late-onset Purkinje cell M-L stripe proteins revealed that although En1- and En2-expressing Purkinje cell domains do not strictly align with those of ZEBRINII at P21, a clear pattern exists that is most evident at E17.5 by an inverse correlation between the level of En2 expression and PLCβ4 and EPHA4. PMID:21431469
Gene expression platform for synthetic biology in the human pathogen Streptococcus pneumoniae.
Sorg, Robin A; Kuipers, Oscar P; Veening, Jan-Willem
2015-03-20
The human pathogen Streptococcus pneumoniae (pneumococcus) is a bacterium that owes its success to complex gene expression regulation patterns on both the cellular and the population level. Expression of virulence factors enables a mostly hazard-free presence of the commensal, in balance with the host and niche competitors. Under specific circumstances, changes in this expression can result in a more aggressive behavior and the reversion to the invasive form as pathogen. These triggering conditions are very difficult to study due to the fact that environmental cues are often unknown or barely possible to simulate outside the host (in vitro). An alternative way of investigating expression patterns is found in synthetic biology approaches of reconstructing regulatory networks that mimic an observed behavior with orthogonal components. Here, we created a genetic platform suitable for synthetic biology approaches in S. pneumoniae and characterized a set of standardized promoters and reporters. We show that our system allows for fast and easy cloning with the BglBrick system and that reliable and robust gene expression after integration into the S. pneumoniae genome is achieved. In addition, the cloning system was extended to allow for direct linker-based assembly of ribosome binding sites, peptide tags, and fusion proteins, and we called this new generally applicable standard "BglFusion". The gene expression platform and the methods described in this study pave the way for employing synthetic biology approaches in S. pneumoniae.
Jabbour, Florian; Cossard, Guillaume; Le Guilloux, Martine; Sannier, Julie; Nadot, Sophie; Damerval, Catherine
2014-01-01
Floral bilateral symmetry (zygomorphy) has evolved several times independently in angiosperms from radially symmetrical (actinomorphic) ancestral states. Homologs of the Antirrhinum majus Cycloidea gene (Cyc) have been shown to control floral symmetry in diverse groups in core eudicots. In the basal eudicot family Ranunculaceae, there is a single evolutionary transition from actinomorphy to zygomorphy in the stem lineage of the tribe Delphinieae. We characterized Cyc homologs in 18 genera of Ranunculaceae, including the four genera of Delphinieae, in a sampling that represents the floral morphological diversity of this tribe, and reconstructed the evolutionary history of this gene family in Ranunculaceae. Within each of the two RanaCyL (Ranunculaceae Cycloidea-like) lineages previously identified, an additional duplication possibly predating the emergence of the Delphinieae was found, resulting in up to four gene copies in zygomorphic species. Expression analyses indicate that the RanaCyL paralogs are expressed early in floral buds and that the duration of their expression varies between species and paralog class. At most one RanaCyL paralog was expressed during the late stages of floral development in the actinomorphic species studied whereas all paralogs from the zygomorphic species were expressed, composing a species-specific identity code for perianth organs. The contrasted asymmetric patterns of expression observed in the two zygomorphic species is discussed in relation to their distinct perianth architecture.
Jabbour, Florian; Cossard, Guillaume; Le Guilloux, Martine; Sannier, Julie; Nadot, Sophie; Damerval, Catherine
2014-01-01
Floral bilateral symmetry (zygomorphy) has evolved several times independently in angiosperms from radially symmetrical (actinomorphic) ancestral states. Homologs of the Antirrhinum majus Cycloidea gene (Cyc) have been shown to control floral symmetry in diverse groups in core eudicots. In the basal eudicot family Ranunculaceae, there is a single evolutionary transition from actinomorphy to zygomorphy in the stem lineage of the tribe Delphinieae. We characterized Cyc homologs in 18 genera of Ranunculaceae, including the four genera of Delphinieae, in a sampling that represents the floral morphological diversity of this tribe, and reconstructed the evolutionary history of this gene family in Ranunculaceae. Within each of the two RanaCyL (Ranunculaceae Cycloidea-like) lineages previously identified, an additional duplication possibly predating the emergence of the Delphinieae was found, resulting in up to four gene copies in zygomorphic species. Expression analyses indicate that the RanaCyL paralogs are expressed early in floral buds and that the duration of their expression varies between species and paralog class. At most one RanaCyL paralog was expressed during the late stages of floral development in the actinomorphic species studied whereas all paralogs from the zygomorphic species were expressed, composing a species-specific identity code for perianth organs. The contrasted asymmetric patterns of expression observed in the two zygomorphic species is discussed in relation to their distinct perianth architecture. PMID:24752428
Robert-Moreno, Àlex; Naranjo, Silvia; de la Calle-Mustienes, Elisa; Gómez-Skarmeta, José Luis; Alsina, Berta
2010-01-01
POU3F4 is a member of the POU-homedomain transcription factor family with a prominent role in inner ear development. Mutations in the human POU3F4 coding unit leads to X-linked deafness type 3 (DFN3), characterized by conductive hearing loss and progressive sensorineural deafness. Microdeletions found 1 Mb 5′ upstream of the coding region also displayed the same phenotype, suggesting that cis-regulatory elements might be present in that region. Indeed, we and others have recently identified several enhancers at the 1 Mb 5′ upstream interval of the pou3f4 locus. Here we characterize the spatio-temporal patterns of these regulatory elements in zebrafish transgenic lines. We show that the most distal enhancer (HCNR 81675) is activated earlier and drives GFP reporter expression initially to a broad ear domain to progressively restrict to the sensory patches. The proximal enhancer (HCNR 82478) is switched later during development and promotes expression, among in other tissues, in sensory patches from its onset. The third enhancer (HCNR 81728) is also active at later stages in the otic mesenchyme and in the otic epithelium. We also characterize the signaling pathways regulating these enhancers. While HCNR 81675 is regulated by very early signals of retinoic acid, HCNR 82478 is regulated by Fgf activity at a later stage and the HCNR 81728 enhancer is under the control of Hh signaling. Finally, we show that Sox2 and Pax2 transcription factors are bound to HCNR 81675 genomic region during otic development and specific mutations to these transcription factor binding sites abrogates HCNR 81675 enhancer activity. Altogether, our results suggest that pou3f4 expression in inner ear might be under the control of distinct regulatory elements that fine-tune the spatio-temporal activity of this gene and provides novel data on the signaling mechanisms controlling pou3f4 function. PMID:21209840
Expression profiling of G-protein-coupled receptors in human urothelium and related cell lines.
Ochodnický, Peter; Humphreys, Sian; Eccles, Rachel; Poljakovic, Mirjana; Wiklund, Peter; Michel, Martin C
2012-09-01
What's known on the subject? and What does the study add? Urothelium emerged as a crucial integrator of sensory inputs and outputs in the bladder wall, and urothelial G-protein-coupled receptors (GPCRs) may represent plausible targets for treatment of various bladder pathologies. Urothelial cell lines provide a useful tool to study urothelial receptor function, but their validity as models for native human urothelium remains unclear. We characterize the mRNA expression of genes coding for GPCRs in human freshly isolated urothelium and compare the expression pattern with those in human urothelial cell lines. To characterize the mRNA expression pattern of genes coding for G-protein-coupled receptors (GPCRs) in human freshly isolated urothelium. To compare GPCR expression in human urothelium-derived cell lines to explore the suitability of these cell lines as model systems to study urothelial function. Native human urothelium (commercially sourced) and human urothelium-derived non-cancer (UROtsa and TERT-NHUC) and cancer (J82) cell lines were used. For mRNA expression profiling we used custom-designed real-time polymerase chain reaction array for 40 receptors and several related genes. Native urothelium expressed a wide variety of GPCRs, including α(1A), α(1D) and all subtypes of α(2) and β adrenoceptors. In addition, M(2) and M(3) cholinergic muscarinic receptors, angiotensin II AT(1) receptor, serotonin 5-HT(2A) receptor and all subtypes of bradykinin, endothelin, cannabinoid, tachykinin and sphingosine-1-phosphate receptors were detected. Nerve growth factor and both its low- and high-affinity receptors were also expressed in urothelium. In all cell lines expression of most GPCRs was markedly downregulated, with few exceptions. In UROtsa cells, but much less in other cell lines, the expression of β(2) adrenoceptors, M(3) muscarinic receptors, B(1) and B(2) bradykinin receptors, ET(B) endothelin receptors and several subtypes of sphingosine-1-phosphate receptors was largely retained. Human urothelium expresses a wide range of receptors which enables sensing and integration of various extracellular signals. Human urothelium-derived cell lines, especially UROtsa cells, show comparable mRNA expression to native tissue for several physiologically relevant GPCRs, but lose expression of many other receptors. The use of cell lines as model systems of human urothelium requires careful validation of suitability for the genes of interest. © 2012 BJU INTERNATIONAL.
A disease-specific metabolic brain network associated with corticobasal degeneration
Niethammer, Martin; Tang, Chris C.; Feigin, Andrew; Allen, Patricia J.; Heinen, Lisette; Hellwig, Sabine; Amtage, Florian; Hanspal, Era; Vonsattel, Jean Paul; Poston, Kathleen L.; Meyer, Philipp T.; Leenders, Klaus L.
2014-01-01
Corticobasal degeneration is an uncommon parkinsonian variant condition that is diagnosed mainly on clinical examination. To facilitate the differential diagnosis of this disorder, we used metabolic brain imaging to characterize a specific network that can be used to discriminate corticobasal degeneration from other atypical parkinsonian syndromes. Ten non-demented patients (eight females/two males; age 73.9 ± 5.7 years) underwent metabolic brain imaging with 18F-fluorodeoxyglucose positron emission tomography for atypical parkinsonism. These individuals were diagnosed clinically with probable corticobasal degeneration. This diagnosis was confirmed in the three subjects who additionally underwent post-mortem examination. Ten age-matched healthy subjects (five females/five males; age 71.7 ± 6.7 years) served as controls for the imaging studies. Spatial covariance analysis was applied to scan data from the combined group to identify a significant corticobasal degeneration-related metabolic pattern that discriminated (P < 0.001) the patients from the healthy control group. This pattern was characterized by bilateral, asymmetric metabolic reductions involving frontal and parietal cortex, thalamus, and caudate nucleus. These pattern-related changes were greater in magnitude in the cerebral hemisphere opposite the more clinically affected body side. The presence of this corticobasal degeneration-related metabolic topography was confirmed in two independent testing sets of patient and control scans, with elevated pattern expression (P < 0.001) in both disease groups relative to corresponding normal values. We next determined whether prospectively computed expression values for this pattern accurately discriminated corticobasal degeneration from multiple system atrophy and progressive supranuclear palsy (the two most common atypical parkinsonian syndromes) on a single case basis. Based upon this measure, corticobasal degeneration was successfully distinguished from multiple system atrophy (P < 0.001) but not progressive supranuclear palsy, presumably because of the overlap (∼24%) that existed between the corticobasal degeneration- and the progressive supranuclear palsy-related metabolic topographies. Nonetheless, excellent discrimination between these disease entities was achieved by computing hemispheric asymmetry scores for the corticobasal degeneration-related pattern on a prospective single scan basis. Indeed, a logistic algorithm based on the asymmetry scores combined with separately computed expression values for a previously validated progressive supranuclear palsy-related pattern provided excellent specificity (corticobasal degeneration: 92.7%; progressive supranuclear palsy: 94.1%) in classifying 58 testing subjects. In conclusion, corticobasal degeneration is associated with a reproducible disease-related metabolic covariance pattern that may help to distinguish this disorder from other atypical parkinsonian syndromes. PMID:25208922
A disease-specific metabolic brain network associated with corticobasal degeneration.
Niethammer, Martin; Tang, Chris C; Feigin, Andrew; Allen, Patricia J; Heinen, Lisette; Hellwig, Sabine; Amtage, Florian; Hanspal, Era; Vonsattel, Jean Paul; Poston, Kathleen L; Meyer, Philipp T; Leenders, Klaus L; Eidelberg, David
2014-11-01
Corticobasal degeneration is an uncommon parkinsonian variant condition that is diagnosed mainly on clinical examination. To facilitate the differential diagnosis of this disorder, we used metabolic brain imaging to characterize a specific network that can be used to discriminate corticobasal degeneration from other atypical parkinsonian syndromes. Ten non-demented patients (eight females/two males; age 73.9 ± 5.7 years) underwent metabolic brain imaging with (18)F-fluorodeoxyglucose positron emission tomography for atypical parkinsonism. These individuals were diagnosed clinically with probable corticobasal degeneration. This diagnosis was confirmed in the three subjects who additionally underwent post-mortem examination. Ten age-matched healthy subjects (five females/five males; age 71.7 ± 6.7 years) served as controls for the imaging studies. Spatial covariance analysis was applied to scan data from the combined group to identify a significant corticobasal degeneration-related metabolic pattern that discriminated (P < 0.001) the patients from the healthy control group. This pattern was characterized by bilateral, asymmetric metabolic reductions involving frontal and parietal cortex, thalamus, and caudate nucleus. These pattern-related changes were greater in magnitude in the cerebral hemisphere opposite the more clinically affected body side. The presence of this corticobasal degeneration-related metabolic topography was confirmed in two independent testing sets of patient and control scans, with elevated pattern expression (P < 0.001) in both disease groups relative to corresponding normal values. We next determined whether prospectively computed expression values for this pattern accurately discriminated corticobasal degeneration from multiple system atrophy and progressive supranuclear palsy (the two most common atypical parkinsonian syndromes) on a single case basis. Based upon this measure, corticobasal degeneration was successfully distinguished from multiple system atrophy (P < 0.001) but not progressive supranuclear palsy, presumably because of the overlap (∼ 24%) that existed between the corticobasal degeneration- and the progressive supranuclear palsy-related metabolic topographies. Nonetheless, excellent discrimination between these disease entities was achieved by computing hemispheric asymmetry scores for the corticobasal degeneration-related pattern on a prospective single scan basis. Indeed, a logistic algorithm based on the asymmetry scores combined with separately computed expression values for a previously validated progressive supranuclear palsy-related pattern provided excellent specificity (corticobasal degeneration: 92.7%; progressive supranuclear palsy: 94.1%) in classifying 58 testing subjects. In conclusion, corticobasal degeneration is associated with a reproducible disease-related metabolic covariance pattern that may help to distinguish this disorder from other atypical parkinsonian syndromes. © The Author (2014). Published by Oxford University Press on behalf of the Guarantors of Brain. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Dai, Mengyao; Wang, Yao; Fang, Lu; Irwin, David M; Zhu, Tengteng; Zhang, Junpeng; Zhang, Shuyi; Wang, Zhe
2014-01-01
Bats are the only mammals capable of self-powered flight using wings. Differing from mouse or human limbs, four elongated digits within a broad wing membrane support the bat wing, and the foot of the bat has evolved a long calcar that spread the interfemoral membrane. Our recent mRNA sequencing (mRNA-Seq) study found unique expression patterns for genes at the 5' end of the Hoxd gene cluster and for Tbx3 that are associated with digit elongation and wing membrane growth in bats. In this study, we focused on two additional genes, Meis2 and Mab21l2, identified from the mRNA-Seq data. Using whole-mount in situ hybridization (WISH) we validated the mRNA-Seq results for differences in the expression patterns of Meis2 and Mab21l2 between bat and mouse limbs, and further characterize the timing and location of the expression of these two genes. These analyses suggest that Meis2 may function in wing membrane growth and Mab21l2 may have a role in AP and DV axial patterning. In addition, we found that Tbx3 is uniquely expressed in the unique calcar structure found in the bat hindlimb, suggesting a role for this gene in calcar growth and elongation. Moreover, analysis of the coding sequences for Meis2, Mab21l2 and Tbx3 showed that Meis2 and Mab21l2 have high sequence identity, consistent with the functions of genes being conserved, but that Tbx3 showed accelerated evolution in bats. However, evidence for positive selection in Tbx3 was not found, which would suggest that the function of this gene has not been changed. Together, our findings support the hypothesis that the modulation of the spatiotemporal expression patterns of multiple functional conserved genes control limb morphology and drive morphological change in the diversification of mammalian limbs.
Fang, Lu; Irwin, David M.; Zhu, Tengteng; Zhang, Junpeng; Zhang, Shuyi; Wang, Zhe
2014-01-01
Bats are the only mammals capable of self-powered flight using wings. Differing from mouse or human limbs, four elongated digits within a broad wing membrane support the bat wing, and the foot of the bat has evolved a long calcar that spread the interfemoral membrane. Our recent mRNA sequencing (mRNA-Seq) study found unique expression patterns for genes at the 5′ end of the Hoxd gene cluster and for Tbx3 that are associated with digit elongation and wing membrane growth in bats. In this study, we focused on two additional genes, Meis2 and Mab21l2, identified from the mRNA-Seq data. Using whole-mount in situ hybridization (WISH) we validated the mRNA-Seq results for differences in the expression patterns of Meis2 and Mab21l2 between bat and mouse limbs, and further characterize the timing and location of the expression of these two genes. These analyses suggest that Meis2 may function in wing membrane growth and Mab21l2 may have a role in AP and DV axial patterning. In addition, we found that Tbx3 is uniquely expressed in the unique calcar structure found in the bat hindlimb, suggesting a role for this gene in calcar growth and elongation. Moreover, analysis of the coding sequences for Meis2, Mab21l2 and Tbx3 showed that Meis2 and Mab21l2 have high sequence identity, consistent with the functions of genes being conserved, but that Tbx3 showed accelerated evolution in bats. However, evidence for positive selection in Tbx3 was not found, which would suggest that the function of this gene has not been changed. Together, our findings support the hypothesis that the modulation of the spatiotemporal expression patterns of multiple functional conserved genes control limb morphology and drive morphological change in the diversification of mammalian limbs. PMID:25166052
Viana, Antonio A B; Fragoso, Rodrigo R; Guimarães, Luciane M; Pontes, Naiara; Oliveira-Neto, Osmundo B; Artico, Sinara; Nardeli, Sarah M; Alves-Ferreira, Marcio; Batista, João A N; Silva, Maria C M; Grossi-de-Sa, Maria F
2011-11-24
Cotton (Gossypium spp.) is an important crop worldwide that provides raw material to 40% of the textile fiber industry. Important traits have been studied aiming the development of genetically modified crops including resistance to insect and diseases, and tolerance to drought, cold and herbicide. Therefore, the characterization of promoters and regulatory regions is also important to achieve high gene expression and/or a specific expression pattern. Commonly, genes involved in ubiquitination pathways are highly and differentially expressed. In this study, we analyzed the expression of a cotton ubiquitin-conjugating enzyme (E2) family member with no previous characterization. Nucleotide analysis revealed high identity with cotton E2 homologues. Multiple alignment showed a premature stop codon, which prevents the encoding of the conserved cysteine residue at the E2 active site, and an intron that is spliced in E2 homologues, but not in GhGDRP85. The GhGDRP85 gene is highly expressed in different organs of cotton plants, and has high transcript levels in roots. Its promoter (uceApro2) and the 5'UTR compose a regulatory region named uceA1.7, and were isolated from cotton and studied in Arabidopsis thaliana. uceA1.7 shows strong expression levels, equaling or surpassing the expression levels of CaMV35S. The uceA1.7 regulatory sequence drives GUS expression 7-fold higher in flowers, 2-fold in roots and at similar levels in leaves and stems. GUS expression levels are decreased 7- to 15-fold when its 5'UTR is absent in uceApro2. uceA1.7 is a strong constitutive regulatory sequence composed of a promoter (uceApro2) and its 5'UTR that will be useful in genetic transformation of dicots, having high potential to drive high levels of transgene expression in crops, particularly for traits desirable in flower and root tissues.
2011-01-01
Background Cotton (Gossypium spp.) is an important crop worldwide that provides raw material to 40% of the textile fiber industry. Important traits have been studied aiming the development of genetically modified crops including resistance to insect and diseases, and tolerance to drought, cold and herbicide. Therefore, the characterization of promoters and regulatory regions is also important to achieve high gene expression and/or a specific expression pattern. Commonly, genes involved in ubiquitination pathways are highly and differentially expressed. In this study, we analyzed the expression of a cotton ubiquitin-conjugating enzyme (E2) family member with no previous characterization. Results Nucleotide analysis revealed high identity with cotton E2 homologues. Multiple alignment showed a premature stop codon, which prevents the encoding of the conserved cysteine residue at the E2 active site, and an intron that is spliced in E2 homologues, but not in GhGDRP85. The GhGDRP85 gene is highly expressed in different organs of cotton plants, and has high transcript levels in roots. Its promoter (uceApro2) and the 5'UTR compose a regulatory region named uceA1.7, and were isolated from cotton and studied in Arabidopsis thaliana. uceA1.7 shows strong expression levels, equaling or surpassing the expression levels of CaMV35S. The uceA1.7 regulatory sequence drives GUS expression 7-fold higher in flowers, 2-fold in roots and at similar levels in leaves and stems. GUS expression levels are decreased 7- to 15-fold when its 5'UTR is absent in uceApro2. Conclusions uceA1.7 is a strong constitutive regulatory sequence composed of a promoter (uceApro2) and its 5'UTR that will be useful in genetic transformation of dicots, having high potential to drive high levels of transgene expression in crops, particularly for traits desirable in flower and root tissues. PMID:22115195
Regulation of Chlamydia Gene Expression by Tandem Promoters with Different Temporal Patterns.
Rosario, Christopher J; Tan, Ming
2016-01-15
Chlamydia is a genus of pathogenic bacteria with an unusual intracellular developmental cycle marked by temporal waves of gene expression. The three main temporal groups of chlamydial genes are proposed to be controlled by separate mechanisms of transcriptional regulation. However, we have noted genes with discrepancies, such as the early gene dnaK and the midcycle genes bioY and pgk, which have promoters controlled by the late transcriptional regulators EUO and σ(28). To resolve this issue, we analyzed the promoters of these three genes in vitro and in Chlamydia trachomatis bacteria grown in cell culture. Transcripts from the σ(28)-dependent promoter of each gene were detected only at late times in the intracellular infection, bolstering the role of σ(28) RNA polymerase in late gene expression. In each case, however, expression prior to late times was due to a second promoter that was transcribed by σ(66) RNA polymerase, which is the major form of chlamydial polymerase. These results demonstrate that chlamydial genes can be transcribed from tandem promoters with different temporal profiles, leading to a composite expression pattern that differs from the expression profile of a single promoter. In addition, tandem promoters allow a gene to be regulated by multiple mechanisms of transcriptional regulation, such as DNA supercoiling or late regulation by EUO and σ(28). We discuss how tandem promoters broaden the repertoire of temporal gene expression patterns in the chlamydial developmental cycle and can be used to fine-tune the expression of specific genes. Chlamydia is a pathogenic bacterium that is responsible for the majority of infectious disease cases reported to the CDC each year. It causes an intracellular infection that is characterized by coordinated expression of chlamydial genes in temporal waves. Chlamydial transcription has been shown to be regulated by DNA supercoiling, alternative forms of RNA polymerase, and transcription factors, but the number of transcription factors found in Chlamydia is far fewer than the number found in most bacteria. This report describes the use of tandem promoters that allow the temporal expression of a gene or operon to be controlled by more than one regulatory mechanism. This combinatorial strategy expands the range of expression patterns that are available to regulate chlamydial genes. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
2012-01-01
Background microRNAs (miRNAs) have been found to play an essential role in the modulation of numerous biological processes in eukaryotes. Chlamydomonas reinhardtii is an ideal model organism for the study of many metabolic processes including responses to sulfur-deprivation. We used a deep sequencing platform to extensively profile and identify changes in the miRNAs expression that occurred under sulfur-replete and sulfur-deprived conditions. The aim of our research was to characterize the differential expression of Chlamydomonas miRNAs under sulfur-deprived conditions, and subsequently, the target genes of miRNA involved in sulfur-deprivation were further predicted and analyzed. Results By using high-throughput sequencing, we characterized the microRNA transcriptomes under sulphur-replete and sulfur-deprived conditions in Chlamydomonas reinhardtii. We predicted a total of 310 miRNAs which included 85 known miRNAs and 225 novel miRNAs. 13 miRNAs were the specific to the sulfur-deprived conditions. 47 miRNAs showed significantly differential expressions responding to sulfur-deprivation, and most were up-regulated in the small RNA libraries with sulfur-deprivation. Using a web-based integrated system (Web MicroRNAs Designer 3) and combing the former information from a transcriptome of Chlamydomonas reinhardtii, 22 miRNAs and their targets involved in metabolism regulation with sulfur-deprivation were verified. Conclusions Our results indicate that sulfur-deprivation may have a significant influence on small RNA expression patterns, and the differential expressions of miRNAs and interactions between miRNA and its targets might further reveal the molecular mechanism responding to sulfur-deprivation in Chlamydomonas reinhardtii. PMID:22439676
Gene stage-specific expression in the microenvironment of pediatric myelodysplastic syndromes.
Roela, Rosimeire A; Carraro, Dirce M; Brentani, Helena P; Kaiano, Jane H L; Simão, Daniel F; Guarnieiro, Roberto; Lopes, Luiz Fernando; Borojevic, Radovan; Brentani, M Mitzi
2007-05-01
Using cDNA microarray assays we have observed a clear difference in the gene expression pattern between bone marrow stromal cells obtained from healthy children (CT) and from pediatric patients with either myelodysplastic syndromes (MDS) or acute myeloid leukemia (AML) associated with MDS (MDS-AML). The global gene function profiling analysis indicated that in the pediatric MDS microenvironment the disease stages may be characterized mainly by underexpression of genes associated with biological processes such as transport. Furthermore, a subset of downregulated genes related to endocytosis and protein secretion was able to discriminate MDS from MDS-AML.
The Use of Mouse Models to Study Epigenetics
Blewitt, Marnie; Whitelaw, Emma
2013-01-01
Much of what we know about the role of epigenetics in the determination of phenotype has come from studies of inbred mice. Some unusual expression patterns arising from endogenous and transgenic murine alleles, such as the Agouti coat color alleles, have allowed the study of variegation, variable expressivity, transgenerational epigenetic inheritance, parent-of-origin effects, and position effects. These phenomena have taught us much about gene silencing and the probabilistic nature of epigenetic processes. Based on some of these alleles, large-scale mutagenesis screens have broadened our knowledge of epigenetic control by identifying and characterizing novel genes involved in these processes. PMID:24186070
Comparative antennal transcriptome of Apis cerana cerana from four developmental stages.
Zhao, Huiting; Peng, Zhu; Du, Yali; Xu, Kai; Guo, Lina; Yang, Shuang; Ma, Weihua; Jiang, Yusuo
2018-06-20
Apis cerana cerana, an important endemic honey bee species in China, possesses valuable characteristics such as a sensitive olfactory system, good foraging ability, and strong resistance to parasitic mites. Here, we performed transcriptome sequencing of the antenna, the major chemosensory organ of the bee, using an Illumina sequencer, to identify typical differentially expressed genes (DEGs) in adult worker bees of different ages, namely, T1 (1 day); T2 (10 days); T3 (15 days); and T4 (25 days). Surprisingly, the expression levels of DEGs changed significantly between the T1 period and the other three periods. All the DEGs were classified into 26 expression profiles by trend analysis. Selected trend clusters were analyzed, and valuable information on gene expression patterns was obtained. We found that the expression levels of genes encoding cuticle proteins declined after eclosion, while those of immunity-related genes increased. In addition, genes encoding venom proteins and major royal jelly proteins were enriched at the T2 stage; small heat shock proteins showed significantly higher expression at the T3 stage; and some metabolism-related genes were more highly expressed at the T4 stage. The DEGs identified in this study may serve as a valuable resource for the characterization of expression patterns of antennal genes in A. cerana cerana. Furthermore, this study provides insights into the relationship between labor division in social bees and gene function. Copyright © 2018. Published by Elsevier B.V.
Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya
2002-01-01
The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested. PMID:12446630
Handfield, Louis-François; Chong, Yolanda T.; Simmons, Jibril; Andrews, Brenda J.; Moses, Alan M.
2013-01-01
Protein subcellular localization has been systematically characterized in budding yeast using fluorescently tagged proteins. Based on the fluorescence microscopy images, subcellular localization of many proteins can be classified automatically using supervised machine learning approaches that have been trained to recognize predefined image classes based on statistical features. Here, we present an unsupervised analysis of protein expression patterns in a set of high-resolution, high-throughput microscope images. Our analysis is based on 7 biologically interpretable features which are evaluated on automatically identified cells, and whose cell-stage dependency is captured by a continuous model for cell growth. We show that it is possible to identify most previously identified localization patterns in a cluster analysis based on these features and that similarities between the inferred expression patterns contain more information about protein function than can be explained by a previous manual categorization of subcellular localization. Furthermore, the inferred cell-stage associated to each fluorescence measurement allows us to visualize large groups of proteins entering the bud at specific stages of bud growth. These correspond to proteins localized to organelles, revealing that the organelles must be entering the bud in a stereotypical order. We also identify and organize a smaller group of proteins that show subtle differences in the way they move around the bud during growth. Our results suggest that biologically interpretable features based on explicit models of cell morphology will yield unprecedented power for pattern discovery in high-resolution, high-throughput microscopy images. PMID:23785265
Altered temporal patterns of anxiety in aged and amyloid precursor protein (APP) transgenic mice.
Bedrosian, Tracy A; Herring, Kamillya L; Weil, Zachary M; Nelson, Randy J
2011-07-12
Both normal aging and dementia are associated with dysregulation of the biological clock, which contributes to disrupted circadian organization of physiology and behavior. Diminished circadian organization in conjunction with the loss of cholinergic input to the cortex likely contributes to impaired cognition and behavior. One especially notable and relatively common circadian disturbance among the aged is "sundowning syndrome," which is characterized by exacerbated anxiety, agitation, locomotor activity, and delirium during the hours before bedtime. Sundowning has been reported in both dementia patients and cognitively intact elderly individuals living in institutions; however, little is known about temporal patterns in anxiety and agitation, and the neurobiological basis of these rhythms remains unspecified. In the present study, we explored the diurnal pattern of anxiety-like behavior in aged and amyloid precursor protein (APP) transgenic mice. We then attempted to treat the observed behavioral disturbances in the aged mice using chronic nightly melatonin treatment. Finally, we tested the hypothesis that time-of-day differences in acetylcholinesterase and choline acetyltransferase expression and general neuronal activation (i.e., c-Fos expression) coincide with the behavioral symptoms. Our results show a temporal pattern of anxiety-like behavior that emerges in elderly mice. This behavioral pattern coincides with elevated locomotor activity relative to adult mice near the end of the dark phase, and with time-dependent changes in basal forebrain acetylcholinesterase expression. Transgenic APP mice show a similar behavioral phenomenon that is not observed among age-matched wild-type mice. These results may have useful applications to the study and treatment of age- and dementia-related circadian behavioral disturbances, namely, sundowning syndrome.
Vitelli, Francesca; Zhang, Zhen; Huynh, Tuong; Sobotka, Angela; Mupo, Annalisa; Baldini, Antonio
2007-01-01
Fgf8 and Tbx1 have been shown to interact in patterning the aortic arch, and both genes are required in formation and growth of the outflow tract of the heart. However, the nature of the interaction of the two genes is unclear. We have utilized a novel Tbx1Fgf8 allele which drives Fgf8 expression in Tbx1-positive cells and an inducible Cre-LoxP recombination system to address the role of Fgf8 in Tbx1 positive cells in modulating cardiovascular development. Results support a requirement of Fgf8 in Tbx1 expressing cells to finely control patterning of the aortic arch and great arteries specifically during the pharyngeal arch artery remodeling process and indicate that the endoderm is the most likely site of this interaction. Furthermore, our data suggest that Fgf8 and Tbx1 play independent roles in regulating outflow tract development. This finding is clinically relevant since TBX1 is the candidate for DGS/VCFS, characterized clinically by variable expressivity and reduced penetrance of cardiovascular defects; Fgf8 gene variants may provide molecular clues to this variability. PMID:16696966
Haraldsson, Stefan; Klarskov, Louise; Nilbert, Mef; Bernstein, Inge; Bonde, Jesper; Holck, Susanne
2017-01-01
Hereditary non-polyposis colorectal cancer comprises Lynch syndrome and familial colorectal cancer type X (FCCTX). Differences in genetics, demographics and histopathology have been extensively studied. The purpose of this study is to characterize their immunoprofile of markers other than MMR proteins. We compared the expression patterns of cytokeratins (CK7 and CK20), mucins (MUC2/5 AC/6), CDX2 and β-catenin in Lynch syndrome and FCCTX. Differences were identified for CK20 and nuclear β-catenin, which were significantly more often expressed in FCCTX than in Lynch syndrome ( p < 0.001), whereas MUC2, MUC5AC and MUC6 were overexpressed in Lynch syndrome tumors compared with FCCTX tumors ( p = 0.001, < 0.01, and < 0.001, respectively). We observed no differences in the expression patterns of CK7 and CDX2. In summary, we identified significant differences in the immunoprofiles of colorectal cancers linked to FCCTX and Lynch syndrome with a more sporadic-like profile in the former group and a more distinct profile with frequent MUC6 positivity in the latter group.
Mohamed, Wasima; Ray, Sibnath; Brazill, Derrick; Baskar, Ramamurthy
2017-01-01
A number of organisms possess several isoforms of protein kinase C but little is known about the significance of any specific isoform during embryogenesis and development. To address this we characterized a PKC ortholog (PkcA; DDB_G0288147) in Dictyostelium discoideum. pkcA expression switches from prestalk in mound to prespore in slug, indicating a dynamic expression pattern. Mutants lacking the catalytic domain of PkcA (pkcA−) did not exhibit tip dominance. A striking phenotype of pkcA− was the formation of an aggregate with a central hollow, and aggregates later fragmented to form small mounds, each becoming a fruiting body. Optical density wave patterns of cAMP in the late aggregates showed several cAMP wave generation centers. We attribute these defects in pkcA− to impaired cAMP signaling, altered cell motility and decreased expression of the cell adhesion molecules – CadA and CsaA. pkcA− slugs showed ectopic expression of ecmA in the prespore region. Further, the use of a PKC-specific inhibitor, GF109203X that inhibits the activity of catalytic domain phenocopied pkcA−. PMID:26183108
Kaydamov, C; Tewes, A; Adler, K; Manteuffel, R
2000-04-25
We have isolated cDNA sequences encoding alpha and beta subunits of potential G proteins from a cDNA library prepared from somatic embryos of Nicotiana plumbaginifolia Viv. at early developmental stages. The predicted NPGPA1 and NPGPB1 gene products are 75-98% identical to the known respective plant alpha and beta subunits. Southern hybridizations indicate that NPGPA1 is probably a single-copy gene, whereas at least two copies of NPGPB1 exist in the N. plumbaginifolia genome. Northern analyses reveal that both NPGPA1 and NPGPB1 mRNA are expressed in all embryogenic stages and plant tissues examined and their expression is obviously regulated by the plant hormone auxin. Immunohistological localization of NPGPalpha1 and NPGPbeta1 preferentially on plasma and endoplasmic reticulum membranes and their immunochemical detection exclusively in microsomal cell fractions implicate membrane association of both proteins. The temporal and spatial expression patterns of NPGPA1 and NPGPB1 show conformity as well as differences. This could account for not only cooperative, but also individual activities of both subunits during embryogenesis and plant development.
Uhl, Patrizia B; Amann, Barbara; Hauck, Stefanie M; Deeg, Cornelia A
2015-01-26
Retinal pigment epithelium (RPE) builds the outer blood-retinal barrier of the eye. Since one typical feature of the autoimmune disease, equine recurrent uveitis (ERU), is the breakdown of this barrier, we recently performed comparative analysis of healthy and uveitic RPE. We identified for the first time peripherin 2, which is responsible for visual perception and retina development, to be localized in RPE. The purpose of this study was therefore to validate our findings by characterizing the expression patterns of peripherin 2 in RPE and retina. We also investigated whether peripherin 2 expression changes in ERU and if it is expressed by the RPE itself. Via immunohistochemistry, significant downregulation of peripherin 2 in uveitic RPE compared to the control was detectable, but there was no difference in healthy and uveitic retina. A further interesting finding was the clear distinction between peripherin 2 and the phagocytosis marker, rhodopsin, in healthy RPE. In conclusion, changes in the expression pattern of peripherin 2 selectively affect RPE, but not retina, in ERU. Moreover, peripherin 2 is clearly detectable in healthy RPE due to both phagocytosis and the expression by the RPE cells themselves. Our novel findings are very promising for better understanding the molecular mechanisms taking place on RPE in uveitis.
Kcnh1 Voltage-gated Potassium Channels Are Essential for Early Zebrafish Development*
Stengel, Rayk; Rivera-Milla, Eric; Sahoo, Nirakar; Ebert, Christina; Bollig, Frank; Heinemann, Stefan H.; Schönherr, Roland; Englert, Christoph
2012-01-01
The Kcnh1 gene encodes a voltage-gated potassium channel highly expressed in neurons and involved in tumor cell proliferation, yet its physiological roles remain unclear. We have used the zebrafish as a model to analyze Kcnh1 function in vitro and in vivo. We found that the kcnh1 gene is duplicated in teleost fish (i.e. kcnh1a and kcnh1b) and that both genes are maternally expressed during early development. In adult zebrafish, kcnh1a and kcnh1b have distinct expression patterns but share expression in brain and testis. Heterologous expression of both genes in Xenopus oocytes revealed a strong conservation of characteristic functional properties between human and fish channels, including a unique sensitivity to intracellular Ca2+/calmodulin and modulation of voltage-dependent gating by extracellular Mg2+. Using a morpholino antisense approach, we demonstrate a strong kcnh1 loss-of-function phenotype in developing zebrafish, characterized by growth retardation, delayed hindbrain formation, and embryonic lethality. This late phenotype was preceded by transcriptional up-regulation of known cell-cycle inhibitors (p21, p27, cdh2) and down-regulation of pro-proliferative factors, including cyclin D1, at 70% epiboly. These results reveal an unanticipated basic activity of kcnh1 that is crucial for early embryonic development and patterning. PMID:22927438
Sheeba, Caroline J; Andrade, Raquel P; Duprez, Delphine; Palmeirim, Isabel
2010-01-01
Specific interactions between fibroblast growth factors (Fgf1-22) and their tyrosine kinase receptors (FgfR1-4) activate different signalling pathways that are responsible for the biological processes in which Fgf signalling is implicated during embryonic development. In the chick, several Fgf ligands (Fgf2, 4, 8, 9, 10, 12, 13 and 18) and the four FgfRs (FgfR 1, 2, 3 and 4) have been reported to be expressed in the developing limb. The precise spatial and temporal expression of these transcripts is important to guide the limb bud to develop into a wing/leg. In this paper, we present a detailed and systematic analysis of the expression patterns of FgfR1, 2, 3 and 4 throughout chick wing development, by in situ hybridisation on whole mounts and sections. Moreover, we characterize for the first time the different isoforms of FGFR1-3 by analysing their differential expression in limb ectoderm and mesodermal tissues, using RT-PCR and in situ hybridisation on sections. Finally, isoform-specific sequences for FgfR1IIIb, FgfR1IIIc, FgfR3IIIb and FgfR3IIIc were determined and deposited in GenBank with the following accession numbers: GU053725, GU065444, GU053726, GU065445, respectively.
Wu, Songyuan; Tong, Xiaoling; Peng, Chenxing; Xiong, Gao; Lu, Kunpeng; hu, Hai; Tan, Duan; Li, Chunlin; Han, Minjin; Lu, Cheng; Dai, Fangyin
2016-01-01
The insect cuticle is a critical protective shell that is composed predominantly of chitin and various cuticular proteins and pigments. Indeed, insects often change their surface pigment patterns in response to selective pressures, such as threats from predators, sexual selection and environmental changes. However, the molecular mechanisms underlying the construction of the epidermis and its pigmentation patterns are not fully understood. Among Lepidoptera, the silkworm is a favorable model for color pattern research. The black dilute (bd) mutant of silkworm is the result of a spontaneous mutation; the larval body color is notably melanized. We performed integument transcriptome sequencing of the wild-type strain Dazao and the mutant strains +/bd and bd/bd. In these experiments, during an early stage of the fourth molt, a stage at which approximately 51% of genes were expressed genome wide (RPKM ≥1) in each strain. A total of 254 novel transcripts were characterized using Cuffcompare and BLAST analyses. Comparison of the transcriptome data revealed 28 differentially expressed genes (DEGs) that may contribute to bd larval melanism, including 15 cuticular protein genes that were remarkably highly expressed in the bd/bd mutant. We suggest that these significantly up-regulated cuticular proteins may promote melanism in silkworm larvae. PMID:27193628
Remote reprogramming of hepatic circadian transcriptome by breast cancer.
Hojo, Hiroaki; Enya, Sora; Arai, Miki; Suzuki, Yutaka; Nojiri, Takashi; Kangawa, Kenji; Koyama, Shinsuke; Kawaoka, Shinpei
2017-05-23
Cancers adversely affect organismal physiology. To date, the genes within a patient responsible for systemically spreading cancer-induced physiological disruption remain elusive. To identify host genes responsible for transmitting disruptive, cancer-driven signals, we thoroughly analyzed the transcriptome of a suite of host organs from mice bearing 4T1 breast cancer, and discovered complexly rewired patterns of circadian gene expression in the liver. Our data revealed that 7 core clock transcription factors, represented by Rev-erba and Rorg, exhibited abnormal daily expression rhythm in the liver of 4T1-bearing mice. Accordingly, expression patterns of specific set of downstream circadian genes were compromised. Osgin1, a marker for oxidative stress, was an example. Specific downstream genes, including E2f8, a transcriptional repressor that controls cellular polyploidy, displayed a striking pattern of disruption, "day-night reversal." Meanwhile, we found that the liver of 4T1-bearing mice suffered from increased oxidative stress. The tetraploid hepatocytes population was concomitantly increased in 4T1-bearing mice, which has not been previously appreciated as a cancer-induced phenotype. In summary, the current study provides a comprehensive characterization of the 4T1-affected hepatic circadian transcriptome that possibly underlies cancer-induced physiological alteration in the liver.
Age-related modulation of angiogenesis-regulating factors in the swine meniscus.
Di Giancamillo, Alessia; Deponti, Daniela; Modina, Silvia; Tessaro, Irene; Domeneghini, Cinzia; Peretti, Giuseppe Maria
2017-11-01
An in-depth knowledge of the native meniscus morphology and biomechanics in its different areas is essential to develop an engineered tissue. Meniscus is characterized by a great regional variation in extracellular matrix components and in vascularization. Then, the aim of this work was to characterize the expression of factors involved in angiogenesis in different areas during meniscus maturation in pigs. The menisci were removed from the knee joints of neonatal, young and adult pigs, and they were divided into the inner, intermediate and outer areas. Vascular characterization and meniscal maturation were evaluated by immunohistochemistry and Western blot analysis. In particular, expression of the angiogenic factor Vascular Endothelial Growth Factor (VEGF) and the anti-angiogenic marker Endostatin (ENDO) was analysed, as well as the vascular endothelial cadherin (Ve-CAD). In addition, expression of Collagen II (COLL II) and SOX9 was examined, as markers of the fibro-cartilaginous differentiation. Expression of VEGF and Ve-CAD had a similar pattern in all animals, with a significant increase from the inner to the outer part of the meniscus. Pooling the zones, expression of both proteins was significantly higher in the neonatal meniscus than in young and adult menisci. Conversely, the young meniscus revealed a significantly higher expression of ENDO compared to the neonatal and adult ones. Analysis of tissue maturation markers showed an increase in COLL II and a decrease in SOX9 expression with age. These preliminary data highlight some of the changes that occur in the swine meniscus during growth, in particular the ensemble of regulatory factors involved in angiogenesis. © 2017 The Authors. Journal of Cellular and Molecular Medicine published by John Wiley & Sons Ltd and Foundation for Cellular and Molecular Medicine.
Characterization of candidate genes in inflammatory bowel disease–associated risk loci
Peloquin, Joanna M.; Sartor, R. Balfour; Newberry, Rodney D.; McGovern, Dermot P.; Yajnik, Vijay; Lira, Sergio A.
2016-01-01
GWAS have linked SNPs to risk of inflammatory bowel disease (IBD), but a systematic characterization of disease-associated genes has been lacking. Prior studies utilized microarrays that did not capture many genes encoded within risk loci or defined expression quantitative trait loci (eQTLs) using peripheral blood, which is not the target tissue in IBD. To address these gaps, we sought to characterize the expression of IBD-associated risk genes in disease-relevant tissues and in the setting of active IBD. Terminal ileal (TI) and colonic mucosal tissues were obtained from patients with Crohn’s disease or ulcerative colitis and from healthy controls. We developed a NanoString code set to profile 678 genes within IBD risk loci. A subset of patients and controls were genotyped for IBD-associated risk SNPs. Analyses included differential expression and variance analysis, weighted gene coexpression network analysis, and eQTL analysis. We identified 116 genes that discriminate between healthy TI and colon samples and uncovered patterns in variance of gene expression that highlight heterogeneity of disease. We identified 107 coexpressed gene pairs for which transcriptional regulation is either conserved or reversed in an inflammation-independent or -dependent manner. We demonstrate that on average approximately 60% of disease-associated genes are differentially expressed in inflamed tissue. Last, we identified eQTLs with either genotype-only effects on expression or an interaction effect between genotype and inflammation. Our data reinforce tissue specificity of expression in disease-associated candidate genes, highlight genes and gene pairs that are regulated in disease-relevant tissue and inflammation, and provide a foundation to advance the understanding of IBD pathogenesis. PMID:27668286
Arroyo-Caro, José María; Chileh, Tarik; Kazachkov, Michael; Zou, Jitao; Alonso, Diego López; García-Maroto, Federico
2013-02-01
The multigene family encoding proteins related to lysophosphatidyl-acyltransferases (LPATs) has been analyzed in the castor plant Ricinus communis. Among them, two genes designated RcLPAT2 and RcLPATB, encoding proteins with LPAT activity and expressed in the developing seed, have been cloned and characterized in some detail. RcLPAT2 groups with well characterized members of the so-called A-class LPATs and it shows a generalized expression pattern in the plant and along seed development. Enzymatic assays of RcLPAT2 indicate a preference for ricinoleoyl-CoA over other fatty acid thioesters when ricinoleoyl-LPA is used as the acyl acceptor, while oleoyl-CoA is the preferred substrate when oleoyl-LPA is employed. RcLPATB groups with B-class LPAT enzymes described as seed specific and selective for unusual fatty acids. However, RcLPATB exhibit a broad specificity on the acyl-CoAs, with saturated fatty acids (12:0-16:0) being the preferred substrates. RcLPATB is upregulated coinciding with seed triacylglycerol accumulation, but its expression is not restricted to the seed. These results are discussed in the light of a possible role for LPAT isoenzymes in the channelling of ricinoleic acid into castor bean triacylglycerol. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.
Uribe, Mary Luz; Haro, Carmen; Campello, Laura; Cruces, Jesús; Martín-Nieto, José
2016-01-01
Purpose The POMGNT1 gene, encoding protein O-linked-mannose β-1,2-N-acetylglucosaminyltransferase 1, is associated with muscle-eye-brain disease (MEB) and other dystroglycanopathies. This gene’s lack of function or expression causes hypoglycosylation of α-dystroglycan (α-DG) in the muscle and the central nervous system, including the brain and the retina. The ocular symptoms of patients with MEB include retinal degeneration and detachment, glaucoma, and abnormal electroretinogram. Nevertheless, the POMGnT1 expression pattern in the healthy mammalian retina has not yet been investigated. In this work, we address the expression of the POMGNT1 gene in the healthy retina of a variety of mammals and characterize the distribution pattern of this gene in the adult mouse retina and the 661W photoreceptor cell line. Methods Using reverse transcription (RT)–PCR and immunoblotting, we studied POMGNT1 expression at the mRNA and protein levels in various mammalian species, from rodents to humans. Immunofluorescence confocal microscopy analyses were performed to characterize the distribution profile of its protein product in mouse retinal sections and in 661W cultured cells. The intranuclear distribution of POMT1 and POMT2, the two enzymes preceding POMGnT1 in the α-DG O-mannosyl glycosylation pathway, was also analyzed. Results POMGNT1 mRNA and its encoded protein were expressed in the neural retina of all mammals studied. POMGnT1 was located in the cytoplasmic fraction in the mouse retina and concentrated in the myoid portion of the photoreceptor inner segments, where the protein colocalized with GM130, a Golgi complex marker. The presence of POMGnT1 in the Golgi complex was also evident in 661W cells. However, and in contrast to retinal tissue, POMGnT1 additionally accumulated in the nucleus of the 661W photoreceptors. Colocalization was found within this organelle between POMGnT1 and POMT1/2, the latter associated with euchromatic regions of the nucleus. Conclusions Our results indicate that POMGnT1 participates not only in the synthesis of O-mannosyl glycans added to α-DG in the Golgi complex but also in the glycosylation of other yet-to-be-identified proteins in the nucleus of mouse photoreceptors. PMID:27375352
Cui, Dapeng; Dougherty, Kimberly J.; Machacek, David W.; Sawchuk, Michael; Hochman, Shawn; Baro, Deborah J.
2009-01-01
Studies in the developing spinal cord suggest that different motoneuron (MN) cell types express very different genetic programs, but the degree to which adult programs differ is unknown. To compare genetic programs between adult MN columnar cell types, we used laser capture micro-dissection (LCM) and Affymetrix microarrays to create expression profiles for three columnar cell types: lateral and medial MNs from lumbar segments and sympathetic preganglionic motoneurons located in the thoracic intermediolateral nucleus. A comparison of the three expression profiles indicated that ~7% (813/11,552) of the genes showed significant differences in their expression levels. The largest differences were observed between sympathetic preganglionic MNs and the lateral motor column, with 6% (706/11,552) of the genes being differentially expressed. Significant differences in expression were observed for 1.8% (207/11,552) of the genes when comparing sympathetic preganglionic MNs with the medial motor column. Lateral and medial MNs showed the least divergence, with 1.3% (150/11,552) of the genes being differentially expressed. These data indicate that the amount of divergence in expression profiles between identified columnar MNs does not strictly correlate with divergence of function as defined by innervation patterns (somatic/muscle vs. autonomic/viscera). Classification of the differentially expressed genes with regard to function showed that they underpin all fundamental cell systems and processes, although most differentially expressed genes encode proteins involved in signal transduction. Mining the expression profiles to examine transcription factors essential for MN development suggested that many of the same transcription factors participatein combinatorial codes in embryonic and adult neurons, but patterns of expression change significantly. PMID:16317082
Comparative transcriptomics of 5 high-altitude vertebrates and their low-altitude relatives
Tang, Qianzi; Zhou, Xuming; Jin, Long; Guan, Jiuqiang; Liu, Rui; Li, Jing; Long, Kereng; Tian, Shilin; Che, Tiandong; Hu, Silu; Liang, Yan; Yang, Xuemei; Tao, Xuan; Zhong, Zhijun; Wang, Guosong; Chen, Xiaohui; Li, Diyan; Ma, Jideng; Wang, Xun; Mai, Miaomiao; Jiang, An’an; Luo, Xiaolin; Lv, Xuebin; Gladyshev, Vadim N; Li, Xuewei
2017-01-01
Abstract Background Species living at high altitude are subject to strong selective pressures due to inhospitable environments (e.g., hypoxia, low temperature, high solar radiation, and lack of biological production), making these species valuable models for comparative analyses of local adaptation. Studies that have examined high-altitude adaptation have identified a vast array of rapidly evolving genes that characterize the dramatic phenotypic changes in high-altitude animals. However, how high-altitude environment shapes gene expression programs remains largely unknown. Findings We generated a total of 910 Gb of high-quality RNA-seq data for 180 samples derived from 6 tissues of 5 agriculturally important high-altitude vertebrates (Tibetan chicken, Tibetan pig, Tibetan sheep, Tibetan goat, and yak) and their cross-fertile relatives living in geographically neighboring low-altitude regions. Of these, ∼75% reads could be aligned to their respective reference genomes, and on average ∼60% of annotated protein coding genes in each organism showed FPKM expression values greater than 0.5. We observed a general concordance in topological relationships between the nucleotide alignments and gene expression–based trees. Tissue and species accounted for markedly more variance than altitude based on either the expression or the alternative splicing patterns. Cross-species clustering analyses showed a tissue-dominated pattern of gene expression and a species-dominated pattern for alternative splicing. We also identified numerous differentially expressed genes that could potentially be involved in phenotypic divergence shaped by high-altitude adaptation. Conclusions These data serve as a valuable resource for examining the convergence and divergence of gene expression changes between species as they adapt or acclimatize to high-altitude environments. PMID:29149296
Gilchrist, Samuel E; Alcorn, Jane
2010-04-01
Since solute carrier (SLC) and ATP-binding cassette (ABC) transporters play pivotal roles in the transport of both nutrients and drugs into breast milk, drug-nutrient transport interactions at the lactating mammary gland are possible. Our purpose was to characterize lactation stage-dependent changes in transporter expression in rat mammary gland and isolated mammary epithelial organoids (MEO) to provide additional insight for the safe use of maternal medications during breastfeeding. We used quantitative reverse transcription-polymerase chain reaction to assess the temporal expression patterns of SLC and ABC transporters in rat mammary gland and isolated MEO at different stages of lactation. In whole mammary gland five distinct patterns of expression emerged relative to late gestation: (i) decreasing throughout lactation (Mdr1a, Mdr1b, Mrp1, Octn2, Ent2, Ent3, Ncbt2, Mtx1); (ii) prominent increase in early lactation, which may remain elevated or decline with advancing lactation (Octn1, Cnt2, Cnt3, Ent1, Pept1, Pept2); (iii) constant but decreasing later in lactation (Octn3, Dmt1); (iv) increasing until mid-to-late lactation (Oct1, Cnt1); and (v) prominent increase late in lactation (Ncbt1). In isolated MEO (an enriched source of mammary epithelial cells) major differences in expression patterns were noted for Octn3, Ncbt1, and Mtx1, but otherwise were reasonably similar with the whole mammary gland. In conclusion our study augments existing data on transporter expression in the lactating mammary gland. These data should facilitate investigations into lactation-stage dependent changes in drug or nutrient milk-to-serum concentration ratios, the potential for drug- or disease-transporter interactions, and mechanistic studies of transporter function in the lactating mammary gland.
Feng, Nan; Song, Gaoyuan; Guan, Jiantao; Chen, Kai; Jia, Meiling; Huang, Dehua; Wu, Jiajie; Zhang, Lichao; Kong, Xiuying; Geng, Shuaifeng
2017-01-01
Early reproductive development in cereals is crucial for final grain number per spike and hence the yield potential of the crop. To date, however, no systematic analyses of gene expression profiles during this important process have been conducted for common wheat (Triticum aestivum). Here, we studied the transcriptome profiles at four stages of early wheat reproductive development, from spikelet initiation to floral organ differentiation. K-means clustering and stage-specific transcript identification detected dynamically expressed homeologs of important transcription regulators in spikelet and floral meristems that may be involved in spikelet initiation, floret meristem specification, and floral organ patterning, as inferred from their homologs in model plants. Small RNA transcriptome sequencing discovered key microRNAs that were differentially expressed during wheat inflorescence development alongside their target genes, suggesting that miRNA-mediated regulatory mechanisms for floral development may be conserved in cereals and Arabidopsis. Our analysis was further substantiated by the functional characterization of the ARGONAUTE1d (AGO1d) gene, which was initially expressed in stamen primordia and later in the tapetum during anther maturation. In agreement with its stage-specific expression pattern, the loss of function of the predominantly expressed B homeolog of AGO1d in a tetraploid durum wheat mutant resulted in smaller anthers with more infertile pollens than the wild type and a reduced grain number per spike. Together, our work provides a first glimpse of the gene regulatory networks in wheat inflorescence development that may be pivotal for floral and grain development, highlighting potential targets for genetic manipulation to improve future wheat yields. PMID:28515146
Luchetti, Andrea; Ciafrè, Silvia Anna; Murdocca, Michela; Malgieri, Arianna; Masotti, Andrea; Sanchez, Massimo; Farace, Maria Giulia; Novelli, Giuseppe; Sangiuolo, Federica
2015-01-01
Spinal muscular atrophy (SMA) is an inherited neuromuscular disorder and the leading genetic cause of death in infants. Despite the disease-causing gene, survival motor neuron (SMN1), encodes a ubiquitous protein, SMN1 deficiency preferentially affects spinal motor neurons (MNs), leaving the basis of this selective cell damage still unexplained. As neural stem cells (NSCs) are multipotent self-renewing cells that can differentiate into neurons, they represent an in vitro model for elucidating the pathogenetic mechanism of neurodegenerative diseases such as SMA. Here we characterize for the first time neural stem cells (NSCs) derived from embryonic spinal cords of a severe SMNΔ7 SMA mouse model. SMNΔ7 NSCs behave as their wild type (WT) counterparts, when we consider neurosphere formation ability and the expression levels of specific regional and self-renewal markers. However, they show a perturbed cell cycle phase distribution and an increased proliferation rate compared to wild type cells. Moreover, SMNΔ7 NSCs are characterized by the differential expression of a limited number of miRNAs, among which miR-335-5p and miR-100-5p, reduced in SMNΔ7 NSCs compared to WT cells. We suggest that such miRNAs may be related to the proliferation differences characterizing SMNΔ7 NSCs, and may be potentially involved in the molecular mechanisms of SMA. PMID:26258776
Luchetti, Andrea; Ciafrè, Silvia Anna; Murdocca, Michela; Malgieri, Arianna; Masotti, Andrea; Sanchez, Massimo; Farace, Maria Giulia; Novelli, Giuseppe; Sangiuolo, Federica
2015-08-06
Spinal muscular atrophy (SMA) is an inherited neuromuscular disorder and the leading genetic cause of death in infants. Despite the disease-causing gene, survival motor neuron (SMN1), encodes a ubiquitous protein, SMN1 deficiency preferentially affects spinal motor neurons (MNs), leaving the basis of this selective cell damage still unexplained. As neural stem cells (NSCs) are multipotent self-renewing cells that can differentiate into neurons, they represent an in vitro model for elucidating the pathogenetic mechanism of neurodegenerative diseases such as SMA. Here we characterize for the first time neural stem cells (NSCs) derived from embryonic spinal cords of a severe SMNΔ7 SMA mouse model. SMNΔ7 NSCs behave as their wild type (WT) counterparts, when we consider neurosphere formation ability and the expression levels of specific regional and self-renewal markers. However, they show a perturbed cell cycle phase distribution and an increased proliferation rate compared to wild type cells. Moreover, SMNΔ7 NSCs are characterized by the differential expression of a limited number of miRNAs, among which miR-335-5p and miR-100-5p, reduced in SMNΔ7 NSCs compared to WT cells. We suggest that such miRNAs may be related to the proliferation differences characterizing SMNΔ7 NSCs, and may be potentially involved in the molecular mechanisms of SMA.
Bertrand, Erin M; McCrow, John P; Moustafa, Ahmed; Zheng, Hong; McQuaid, Jeffrey B; Delmont, Tom O; Post, Anton F; Sipler, Rachel E; Spackeen, Jenna L; Xu, Kai; Bronk, Deborah A; Hutchins, David A; Allen, Andrew E
2015-08-11
Southern Ocean primary productivity plays a key role in global ocean biogeochemistry and climate. At the Southern Ocean sea ice edge in coastal McMurdo Sound, we observed simultaneous cobalamin and iron limitation of surface water phytoplankton communities in late Austral summer. Cobalamin is produced only by bacteria and archaea, suggesting phytoplankton-bacterial interactions must play a role in this limitation. To characterize these interactions and investigate the molecular basis of multiple nutrient limitation, we examined transitions in global gene expression over short time scales, induced by shifts in micronutrient availability. Diatoms, the dominant primary producers, exhibited transcriptional patterns indicative of co-occurring iron and cobalamin deprivation. The major contributor to cobalamin biosynthesis gene expression was a gammaproteobacterial population, Oceanospirillaceae ASP10-02a. This group also contributed significantly to metagenomic cobalamin biosynthesis gene abundance throughout Southern Ocean surface waters. Oceanospirillaceae ASP10-02a displayed elevated expression of organic matter acquisition and cell surface attachment-related genes, consistent with a mutualistic relationship in which they are dependent on phytoplankton growth to fuel cobalamin production. Separate bacterial groups, including Methylophaga, appeared to rely on phytoplankton for carbon and energy sources, but displayed gene expression patterns consistent with iron and cobalamin deprivation. This suggests they also compete with phytoplankton and are important cobalamin consumers. Expression patterns of siderophore- related genes offer evidence for bacterial influences on iron availability as well. The nature and degree of this episodic colimitation appear to be mediated by a series of phytoplankton-bacterial interactions in both positive and negative feedback loops.
Corey, Daniel M; Rinkevich, Yuval; Weissman, Irving L
2016-03-15
Although tumor blood vessels have been a major therapeutic target for cancer chemotherapy, little is known regarding the stepwise development of the tumor microenvironment. Here, we use a multicolor Cre-dependent marker system to trace clonality within the tumor microenvironment to show that tumor blood vessels follow a pattern of dynamic clonal evolution. In an advanced melanoma tumor microenvironment, the vast majority of tumor vasculature clones are derived from a common precursor. Quantitative lineage analysis reveals founder clones diminish in frequency and are replaced by subclones as tumors evolve. These tumor-specific blood vessels are characterized by a developmental switch to a more invasive and immunologically silent phenotype. Gene expression profiling and pathway analysis reveals selection for traits promoting upregulation of alternative angiogenic programs such as unregulated HGF-MET signaling and enhanced autocrine signaling through VEGF and PDGF. Furthermore, we show a developmental switch in the expression of functionally significant primary lymphocyte adhesion molecules on tumor endothelium, such as the loss in expression of the mucosal addressin MAdCAM-1, whose counter receptor a4β7 on lymphocytes controls lymphocyte homing. Changes in adhesive properties on tumor endothelial subclones are accompanied by decreases in expression of lymphocyte chemokines CXCL16, CXCL13, CXCL12, CXCL9, CXCL10, and CCL19. These evolutionary patterns in the expressed genetic program within tumor endothelium will have both a quantitative and functional impact on lymphocyte distribution that may well influence tumor immune function and underlie escape mechanisms from current antiangiogenic pharmacotherapies. ©2015 American Association for Cancer Research.
Hodar, Christian; Zuñiga, Alejandro; Pulgar, Rodrigo; Travisany, Dante; Chacon, Carlos; Pino, Michael; Maass, Alejandro; Cambiazo, Verónica
2014-02-10
In the early Drosophila melanogaster embryo, Dpp, a secreted molecule that belongs to the TGF-β superfamily of growth factors, activates a set of downstream genes to subdivide the dorsal region into amnioserosa and dorsal epidermis. Here, we examined the expression pattern and transcriptional regulation of Dtg, a new target gene of Dpp signaling pathway that is required for proper amnioserosa differentiation. We showed that the expression of Dtg was controlled by Dpp and characterized a 524-bp enhancer that mediated expression in the dorsal midline, as well as, in the differentiated amnioserosa in transgenic reporter embryos. This enhancer contained a highly conserved region of 48-bp in which bioinformatic predictions and in vitro assays identified three Mad binding motifs. Mutational analysis revealed that these three motifs were necessary for proper expression of a reporter gene in transgenic embryos, suggesting that short and highly conserved genomic sequences may be indicative of functional regulatory regions in D. melanogaster genes. Dtg orthologs were not detected in basal lineages of Dipterans, which unlike D. melanogaster develop two extra-embryonic membranes, amnion and serosa, nevertheless Dtg orthologs were identified in the transcriptome of Musca domestica, in which dorsal ectoderm patterning leads to the formation of a single extra-embryonic membrane. These results suggest that Dtg was recruited as a new component of the network that controls dorsal ectoderm patterning in the lineage leading to higher Cyclorrhaphan flies, such as D. melanogaster and M. domestica. Copyright © 2013 Elsevier B.V. All rights reserved.
Multivariate analysis of flow cytometric data using decision trees.
Simon, Svenja; Guthke, Reinhard; Kamradt, Thomas; Frey, Oliver
2012-01-01
Characterization of the response of the host immune system is important in understanding the bidirectional interactions between the host and microbial pathogens. For research on the host site, flow cytometry has become one of the major tools in immunology. Advances in technology and reagents allow now the simultaneous assessment of multiple markers on a single cell level generating multidimensional data sets that require multivariate statistical analysis. We explored the explanatory power of the supervised machine learning method called "induction of decision trees" in flow cytometric data. In order to examine whether the production of a certain cytokine is depended on other cytokines, datasets from intracellular staining for six cytokines with complex patterns of co-expression were analyzed by induction of decision trees. After weighting the data according to their class probabilities, we created a total of 13,392 different decision trees for each given cytokine with different parameter settings. For a more realistic estimation of the decision trees' quality, we used stratified fivefold cross validation and chose the "best" tree according to a combination of different quality criteria. While some of the decision trees reflected previously known co-expression patterns, we found that the expression of some cytokines was not only dependent on the co-expression of others per se, but was also dependent on the intensity of expression. Thus, for the first time we successfully used induction of decision trees for the analysis of high dimensional flow cytometric data and demonstrated the feasibility of this method to reveal structural patterns in such data sets.
NASA Astrophysics Data System (ADS)
Xu, Dandan; He, Gen; Mai, Kangsen; Zhou, Huihui; Xu, Wei; Song, Fei
2016-04-01
Turbot ( Scophthalmus maximus L.), a carnivorous fish species with high dietary protein requirement, was chosen to examine the expression pattern of peptide and amino acid transporter genes along its digestive tract which was divided into six segments including stomach, pyloric caeca, rectum, and three equal parts of the remainder of the intestine. The results showed that the expression of two peptide and eleven amino acid transporters genes exhibited distinct patterns. Peptide transporter 1 (PepT1) was rich in proximal intestine while peptide transporter 2 (PepT2) was abundant in distal intestine. A number of neutral and cationic amino acid transporters expressed richly in whole intestine including B0-type amino acid transporter 1 (B0AT1), L-type amino acid transporter 2 (LAT2), T-type amino acid transporter 1 (TAT1), proton-coupled amino acid transporter 1 (PAT1), y+L-type amino acid transporter 1 (y+LAT1), and cationic amino acid transporter 2 (CAT2) while ASC amino acid transporter 2 (ASCT2), sodium-coupled neutral amino acid transporter 2 (SNAT2), and y+L-type amino acid transporter 2 (y+LAT2) abundantly expressed in stomach. In addition, system b0,+ transporters (rBAT and b0,+AT) existed richly in distal intestine. These findings comprehensively characterized the distribution of solute carrier family proteins, which revealed the relative importance of peptide and amino acid absorption through luminal membrane. Our findings are helpful to understand the mechanism of the utilization of dietary protein in fish with a short digestive tract.
Tian, Xue; Meng, Xiaolin; Wang, Liangyan; Song, Yunfei; Zhang, Danli; Ji, Yuankai; Li, Xuejun; Dong, Changsheng
2015-01-25
Slc7a11 encoding solute carrier family 7 member 11 (amionic amino acid transporter light chain, xCT), has been identified to be a critical genetic regulator of pheomelanin synthesis in hair and melanocytes. To better understand the molecular characterization of Slc7a11 and the expression patterns in skin of white versus brown alpaca (lama paco), we cloned the full length coding sequence (CDS) of alpaca Slc7a11 gene and analyzed the expression patterns using Real Time PCR, Western blotting and immunohistochemistry. The full length CDS of 1512bp encodes a 503 amino acid polypeptide. Sequence analysis showed that alpaca xCT contains 12 transmembrane regions consistent with the highly conserved amino acid permease (AA_permease_2) domain similar to other vertebrates. Sequence alignment and phylogenetic analysis revealed that alpaca xCT had the highest identity and shared the same branch with Camelus ferus. Real Time PCR and Western blotting suggested that xCT was expressed at significantly high levels in brown alpaca skin, and transcripts and protein possessed the same expression pattern in white and brown alpaca skins. Additionally, immunohistochemical analysis further demonstrated that xCT staining was robustly increased in the matrix and root sheath of brown alpaca skin compared with that of white. These results suggest that Slc7a11 functions in alpaca coat color regulation and offer essential information for further exploration on the role of Slc7a11 in melanogenesis. Copyright © 2014 Elsevier B.V. All rights reserved.
Bertrand, Erin M.; McCrow, John P.; Moustafa, Ahmed; Zheng, Hong; McQuaid, Jeffrey B.; Delmont, Tom O.; Post, Anton F.; Sipler, Rachel E.; Spackeen, Jenna L.; Xu, Kai; Bronk, Deborah A.; Hutchins, David A.; Allen, Andrew E.
2015-01-01
Southern Ocean primary productivity plays a key role in global ocean biogeochemistry and climate. At the Southern Ocean sea ice edge in coastal McMurdo Sound, we observed simultaneous cobalamin and iron limitation of surface water phytoplankton communities in late Austral summer. Cobalamin is produced only by bacteria and archaea, suggesting phytoplankton–bacterial interactions must play a role in this limitation. To characterize these interactions and investigate the molecular basis of multiple nutrient limitation, we examined transitions in global gene expression over short time scales, induced by shifts in micronutrient availability. Diatoms, the dominant primary producers, exhibited transcriptional patterns indicative of co-occurring iron and cobalamin deprivation. The major contributor to cobalamin biosynthesis gene expression was a gammaproteobacterial population, Oceanospirillaceae ASP10-02a. This group also contributed significantly to metagenomic cobalamin biosynthesis gene abundance throughout Southern Ocean surface waters. Oceanospirillaceae ASP10-02a displayed elevated expression of organic matter acquisition and cell surface attachment-related genes, consistent with a mutualistic relationship in which they are dependent on phytoplankton growth to fuel cobalamin production. Separate bacterial groups, including Methylophaga, appeared to rely on phytoplankton for carbon and energy sources, but displayed gene expression patterns consistent with iron and cobalamin deprivation. This suggests they also compete with phytoplankton and are important cobalamin consumers. Expression patterns of siderophore- related genes offer evidence for bacterial influences on iron availability as well. The nature and degree of this episodic colimitation appear to be mediated by a series of phytoplankton–bacterial interactions in both positive and negative feedback loops. PMID:26221022
SELDI-TOF-based serum proteomic pattern diagnostics for early detection of cancer.
Petricoin, Emanuel F; Liotta, Lance A
2004-02-01
Proteomics is more than just generating lists of proteins that increase or decrease in expression as a cause or consequence of pathology. The goal should be to characterize the information flow through the intercellular protein circuitry that communicates with the extracellular microenvironment and then ultimately to the serum/plasma macroenvironment. The nature of this information can be a cause, or a consequence, of disease and toxicity-based processes. Serum proteomic pattern diagnostics is a new type of proteomic platform in which patterns of proteomic signatures from high dimensional mass spectrometry data are used as a diagnostic classifier. This approach has recently shown tremendous promise in the detection of early-stage cancers. The biomarkers found by SELDI-TOF-based pattern recognition analysis are mostly low molecular weight fragments produced at the specific tumor microenvironment.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Liu, Chenchen; Yue, Ben; Yuan, Chenwei
The THO complex 1 (Thoc1) is a nuclear matrix protein playing vital roles in transcription elongation and mRNA export. Recently, aberrant expression of Thoc1 has been reported in an increasing array of tumor types. However, the clinical significance of Thoc1 expression in colorectal cancer (CRC) is still unknown. The present study aimed to characterize the expression of Thoc1 in human CRC and evaluate its clinical significance. Quantitative real-time polymerase chain reaction (qRT-PCR) and Western blotting analyses showed that the mRNA and protein expression of Thoc1 in CRC specimens was significantly higher than that in adjacent normal colon mucosae. Immunohistochemistry (IHC)more » was conducted to characterize the expression pattern of Thoc1 in 185 archived paraffin-embedded CRC specimens. Statistical analyses revealed that high levels of Thoc1 expression were associated with the clinical stages and tumor differentiation. CRC patients with high levels of Thoc1 expression had poorer overall-survival and disease-free survival, whereas those with lower levels of Thoc1 expression survived longer. Furthermore, multivariate Cox regression analyses demonstrated that Thoc1 expression remained an independent prognostic factor for increased disease recurrence and decreased survival. Our results suggest for the first time that Thoc1 is involved in the development and progression of CRC, and elevated expression of Thoc1 is associated with aggressive phenotype and poor prognosis in CRC. These findings may prove to be clinically useful for developing a new therapeutic target of CRC treatment.« less
Zhou, Yi; Yu, Fan; Gao, Yun; Luo, Yongju; Tang, Zhanyang; Guo, Zhongbao; Guo, Enyan; Gan, Xi; Zhang, Ming; Zhang, Yaping
2014-01-01
MicroRNAs (miRNAs) are endogenous non-coding small RNAs which play important roles in the regulation of gene expression by cleaving or inhibiting the translation of target gene transcripts. Thereinto, some specific miRNAs show regulatory activities in gonad development via translational control. In order to further understand the role of miRNA-mediated posttranscriptional regulation in Nile tilapia (Oreochromis niloticus) ovary and testis, two small RNA libraries of Nile tilapia were sequenced by Solexa small RNA deep sequencing methods. A total of 9,731,431 and 8,880,497 raw reads, representing 5,407,800 and 4,396,281 unique sequences were obtained from the sexually mature ovaries and testes, respectively. After comparing the small RNA sequences with the Rfam database, 1,432,210 reads in ovaries and 984,146 reads in testes were matched to the genome sequence of Nile tilapia. Bioinformatic analysis identified 764 mature miRNA, 209 miRNA-5p and 202 miRNA-3p were found in the two libraries, of which 525 known miRNAs are both expressed in the ovary and testis of Nile tilapia. Comparison of expression profiles of the testis, miR-727, miR-129 and miR-29 families were highly expressed in tilapia ovary. Additionally, miR-132, miR-212, miR-33a and miR-135b families, showed significant higher expression in testis compared with that in ovary. Furthermore, the expression patterns of the miRNAs were analyzed in different developmental stages of gonad. The result showed different expression patterns were observed during development of testis and ovary. In addition, the identification and characterization of differentially expressed miRNAs in the ovaries and testis of Nile tilapia provides important information on the role of miRNA in the regulation of the ovarian and testicular development and function. This data will be helpful to facilitate studies on the regulation of miRNAs during teleosts reproduction. PMID:24466258
Yatsu, Ryohei; Miyagawa, Shinichi; Kohno, Satomi; Parrott, Benjamin B; Yamaguchi, Katsushi; Ogino, Yukiko; Miyakawa, Hitoshi; Lowers, Russell H; Shigenobu, Shuji; Guillette, Louis J; Iguchi, Taisen
2016-01-25
The American alligator (Alligator mississippiensis) displays temperature-dependent sex determination (TSD), in which incubation temperature during embryonic development determines the sexual fate of the individual. However, the molecular mechanisms governing this process remain a mystery, including the influence of initial environmental temperature on the comprehensive gonadal gene expression patterns occurring during TSD. Our characterization of transcriptomes during alligator TSD allowed us to identify novel candidate genes involved in TSD initiation. High-throughput RNA sequencing (RNA-seq) was performed on gonads collected from A. mississippiensis embryos incubated at both a male and a female producing temperature (33.5 °C and 30 °C, respectively) in a time series during sexual development. RNA-seq yielded 375.2 million paired-end reads, which were mapped and assembled, and used to characterize differential gene expression. Changes in the transcriptome occurring as a function of both development and sexual differentiation were extensively profiled. Forty-one differentially expressed genes were detected in response to incubation at male producing temperature, and included genes such as Wnt signaling factor WNT11, histone demethylase KDM6B, and transcription factor C/EBPA. Furthermore, comparative analysis of development- and sex-dependent differential gene expression revealed 230 candidate genes involved in alligator sex determination and differentiation, and early details of the suspected male-fate commitment were profiled. We also discovered sexually dimorphic expression of uncharacterized ncRNAs and other novel elements, such as unique expression patterns of HEMGN and ARX. Twenty-five of the differentially expressed genes identified in our analysis were putative transcriptional regulators, among which were MYBL2, MYCL, and HOXC10, in addition to conventional sex differentiation genes such as SOX9, and FOXL2. Inferred gene regulatory network was constructed, and the gene-gene and temperature-gene interactions were predicted. Gonadal global gene expression kinetics during sex determination has been extensively profiled for the first time in a TSD species. These findings provide insights into the genetic framework underlying TSD, and expand our current understanding of the developmental fate pathways during vertebrate sex determination.
Dobias, S L; Ma, L; Wu, H; Bell, J R; Maxson, R
1997-01-01
Msx- class homeobox genes, characterized by a distinct and highly conserved homeodomain, have been identified in a wide variety of metazoans from vertebrates to coelenterates. Although there is evidence that they participate in inductive tissue interactions that underlie vertebrate organogenesis, including those that pattern the neural crest, there is little information about their function in simple deuterostomes. Both to learn more about the ancient function of Msx genes, and to shed light on the evolution of developmental mechanisms within the lineage that gave rise to vertebrates, we have isolated and characterized Msx genes from ascidians and echinoderms. Here we describe the sequence and expression of a sea urchin (Strongylocentrotus purpouratus) Msx gene whose homeodomain is very similar to that of vertebrate Msx2. This gene, designated SpMsx, is first expressed in blastula stage embryos, apparently in a non-localized manner. Subsequently, during the early phases of gastrulation, SpMsx transcripts are expressed intensely in the invaginating archenteron and secondary mesenchyme, and at reduced levels in the ectoderm. In the latter part of gastrulation, SpMsx transcripts are concentrated in the oral ectoderm and gut, and continue to be expressed at those sites through the remainder of embryonic development. That vertebrate Msx genes are regulated by inductive tissue interactions and growth factors suggested to us that the restriction of SpMsx gene expression to the oral ectoderm and derivatives of the vegetal plate might similarly be regulated by the series of signaling events that pattern these embryonic territories. As a first test of this hypothesis, we examined the influence of exogastrulation and cell-dissociation on SpMsx gene expression. In experimentally-induced exogastrulae, SpMsx transcripts were distributed normally in the oral ectoderm, evaginated gut, and secondary mesenchyme. However, when embryos were dissociated into their component cells, SpMsx transcripts failed to accumulate. These data show that the localization of SpMsx transcripts in gastrulae does not depend on interactions between germ layers, yet the activation and maintenance of SpMsx expression does require cell-cell or cell-matrix interactions.
Barvkar, Vitthal T; Pardeshi, Varsha C; Kale, Sandip M; Kadoo, Narendra Y; Gupta, Vidya S
2012-05-08
The glycosylation process, catalyzed by ubiquitous glycosyltransferase (GT) family enzymes, is a prevalent modification of plant secondary metabolites that regulates various functions such as hormone homeostasis, detoxification of xenobiotics and biosynthesis and storage of secondary metabolites. Flax (Linum usitatissimum L.) is a commercially grown oilseed crop, important because of its essential fatty acids and health promoting lignans. Identification and characterization of UDP glycosyltransferase (UGT) genes from flax could provide valuable basic information about this important gene family and help to explain the seed specific glycosylated metabolite accumulation and other processes in plants. Plant genome sequencing projects are useful to discover complexity within this gene family and also pave way for the development of functional genomics approaches. Taking advantage of the newly assembled draft genome sequence of flax, we identified 137 UDP glycosyltransferase (UGT) genes from flax using a conserved signature motif. Phylogenetic analysis of these protein sequences clustered them into 14 major groups (A-N). Expression patterns of these genes were investigated using publicly available expressed sequence tag (EST), microarray data and reverse transcription quantitative real time PCR (RT-qPCR). Seventy-three per cent of these genes (100 out of 137) showed expression evidence in 15 tissues examined and indicated varied expression profiles. The RT-qPCR results of 10 selected genes were also coherent with the digital expression analysis. Interestingly, five duplicated UGT genes were identified, which showed differential expression in various tissues. Of the seven intron loss/gain positions detected, two intron positions were conserved among most of the UGTs, although a clear relationship about the evolution of these genes could not be established. Comparison of the flax UGTs with orthologs from four other sequenced dicot genomes indicated that seven UGTs were flax diverged. Flax has a large number of UGT genes including few flax diverged ones. Phylogenetic analysis and expression profiles of these genes identified tissue and condition specific repertoire of UGT genes from this crop. This study would facilitate precise selection of candidate genes and their further characterization of substrate specificities and in planta functions.
2012-01-01
Background The glycosylation process, catalyzed by ubiquitous glycosyltransferase (GT) family enzymes, is a prevalent modification of plant secondary metabolites that regulates various functions such as hormone homeostasis, detoxification of xenobiotics and biosynthesis and storage of secondary metabolites. Flax (Linum usitatissimum L.) is a commercially grown oilseed crop, important because of its essential fatty acids and health promoting lignans. Identification and characterization of UDP glycosyltransferase (UGT) genes from flax could provide valuable basic information about this important gene family and help to explain the seed specific glycosylated metabolite accumulation and other processes in plants. Plant genome sequencing projects are useful to discover complexity within this gene family and also pave way for the development of functional genomics approaches. Results Taking advantage of the newly assembled draft genome sequence of flax, we identified 137 UDP glycosyltransferase (UGT) genes from flax using a conserved signature motif. Phylogenetic analysis of these protein sequences clustered them into 14 major groups (A-N). Expression patterns of these genes were investigated using publicly available expressed sequence tag (EST), microarray data and reverse transcription quantitative real time PCR (RT-qPCR). Seventy-three per cent of these genes (100 out of 137) showed expression evidence in 15 tissues examined and indicated varied expression profiles. The RT-qPCR results of 10 selected genes were also coherent with the digital expression analysis. Interestingly, five duplicated UGT genes were identified, which showed differential expression in various tissues. Of the seven intron loss/gain positions detected, two intron positions were conserved among most of the UGTs, although a clear relationship about the evolution of these genes could not be established. Comparison of the flax UGTs with orthologs from four other sequenced dicot genomes indicated that seven UGTs were flax diverged. Conclusions Flax has a large number of UGT genes including few flax diverged ones. Phylogenetic analysis and expression profiles of these genes identified tissue and condition specific repertoire of UGT genes from this crop. This study would facilitate precise selection of candidate genes and their further characterization of substrate specificities and in planta functions. PMID:22568875
Bachleda, Amelia; Morrison, Richard S.; Murphy, Sean P.
2011-01-01
Drugs that inhibit specific histone deacetylase (HDAC) activities have enormous potential in preventing the consequences of acute injury to the nervous system and in allaying neurodegeneration. However, very little is known about the expression pattern of the HDACs in the central nervous system (CNS). Identifying the cell types that express HDACs in the CNS is important for determining therapeutic targets for HDAC inhibitors and evaluating potential side effects. We characterized the cellular expression of HDACs 1–3, and HDACs 4 and 6, in the adult mouse brain in the cingulate cortex, parietal cortex, dentate gyrus, and CA1 regions of the hippocampus and subcortical white matter. Expression of class I HDACs showed a cell-and region-specific pattern. Transient focal ischemia induced by temporary middle cerebral artery occlusion, or global ischemia induced by in vitro oxygen–glucose deprivation, altered the extent of HDAC expression in a region- and cell-specific manner. The pan-HDAC inhibitor, SAHA, reduced ischemia-induced alterations in HDACs. The results suggest that in addition to promoting epigenetic changes in transcriptional activity in the nucleus of neurons and glia, HDACs may also have non-transcriptional actions in axons and the distant processes of glial cells and may significantly modulate the response to injury in a cell- and region-specific manner. PMID:21966324
The evolution of aryl hydrocarbon signaling proteins: diversity of ARNT isoforms among fish species.
Powell, W H; Hahn, M E
2000-01-01
The aryl hydrocarbon receptor nuclear translocator (ARNT) mediates aryl hydrocarbon signaling and toxicity by dimerizing with the ligand-activated aryl hydrocarbon receptor (AHR), forming a complex that binds specific DNA elements and alters transcription of target genes. Two genes encode different forms of ARNT in rodents: ARNT1, which is widely expressed, and ARNT2, which exhibits a very restricted expression pattern. In an effort to characterize aryl hydrocarbon signaling mechanisms in fishes, we previously isolated an ARNT cDNA from Fundulus heteroclitus and discovered that this species expresses ARNT2 ubiquitously. This situation differs not only from mammals, but also from rainbow trout, which expresses a divergent ARNT gene that we hypothesized was peculiar to salmonids (rtARNTa/b). In this communication, we examine the ARNT sequences of multiple fish species, including a newly isolated cDNA from scup (Stenotomus chrysops). Our phylogenetic analysis demonstrates that zebrafish ARNT, like the Fundulus protein, is an ARNT2. Contrary to expectations, the scup ARNT is closely related to the rainbow trout protein, demonstrating that the existence of this ARNT isoform predates the divergence of salmonids from the other teleosts. Thus, different species of fish express distinct and highly conserved isoforms of ARNT. The number, type, and expression pattern of ARNT proteins may contribute to interspecies differences in aryl hydrocarbon toxicity, possibly through distinct interactions with additional PAS-family proteins.
Frasson, Amanda Piccoli; Dos Santos, Odelta; Meirelles, Lúcia Collares; Macedo, Alexandre José; Tasca, Tiana
2016-01-01
Trichomonas vaginalis is a protozoan that parasitizes the human urogenital tract causing trichomoniasis, the most common non-viral sexually transmitted disease. The parasite has unique genomic characteristics such as a large genome size and expanded gene families. Ectonucleoside triphosphate diphosphohydrolase (E-NTPDase) is an enzyme responsible for hydrolyzing nucleoside tri- and diphosphates and has already been biochemically characterized in T. vaginalis. Considering the important role of this enzyme in the production of extracellular adenosine for parasite uptake, we evaluated the gene expression of five putative NTPDases in T. vaginalis. We showed that all five putative TvNTPDase genes (TvNTPDase1-5) were expressed by both fresh clinical and long-term grown isolates. The amino acid alignment predicted the presence of the five crucial apyrase conserved regions, transmembrane domains, signal peptides, phosphorylation and catalytic sites. Moreover, a phylogenetic analysis showed that TvNTPDase sequences make up a clade with NTPDases intracellularly located. Biochemical NTPDase activity (ATP and ADP hydrolysis) is responsive to the serum-restrictive conditions and the gene expression of TvNTPDases was mostly increased, mainly TvNTPDase2 and TvNTPDase4, although there was not a clear pattern of expression among them. In summary, the present report demonstrates the gene expression patterns of predicted NTPDases in T. vaginalis. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Honarpisheh, Mohsen; Köhler, Paulina; von Rauchhaupt, Ekaterina; Lech, Maciej
2018-01-01
Noncoding RNAs (ncRNAs), including microRNAs (miRNAs), represent a family of RNA molecules that do not translate into protein. Nevertheless, they have the ability to regulate gene expression and play an essential role in immune cell differentiation and function. MicroRNAs were found to be differentially expressed in various tissues, and changes in their expression have been associated with several pathological processes. Yet, their roles in systemic lupus erythematosus (SLE) and lupus nephritis (LN) remain to be elucidated. Both SLE and LN are characterized by a complex dysfunction of the innate and adaptive immunity. Recently, significant findings have been made in understanding SLE through the use of genetic variant identification and expression pattern analysis and mouse models, as well as epigenetic analyses. Abnormalities in immune cell responses, cytokine and chemokine production, cell activation, and apoptosis have been linked to a unique expression pattern of a number of miRNAs that have been implicated in the immune pathogenesis of this autoimmune disease. The recent evidence that significantly increased the understanding of the pathogenesis of SLE drives a renewed interest in efficient therapy targets. This review aims at providing an overview of the current state of research on the expression and role of miRNAs in the immune pathogenesis of SLE and LN.
Köhler, Paulina; von Rauchhaupt, Ekaterina
2018-01-01
Noncoding RNAs (ncRNAs), including microRNAs (miRNAs), represent a family of RNA molecules that do not translate into protein. Nevertheless, they have the ability to regulate gene expression and play an essential role in immune cell differentiation and function. MicroRNAs were found to be differentially expressed in various tissues, and changes in their expression have been associated with several pathological processes. Yet, their roles in systemic lupus erythematosus (SLE) and lupus nephritis (LN) remain to be elucidated. Both SLE and LN are characterized by a complex dysfunction of the innate and adaptive immunity. Recently, significant findings have been made in understanding SLE through the use of genetic variant identification and expression pattern analysis and mouse models, as well as epigenetic analyses. Abnormalities in immune cell responses, cytokine and chemokine production, cell activation, and apoptosis have been linked to a unique expression pattern of a number of miRNAs that have been implicated in the immune pathogenesis of this autoimmune disease. The recent evidence that significantly increased the understanding of the pathogenesis of SLE drives a renewed interest in efficient therapy targets. This review aims at providing an overview of the current state of research on the expression and role of miRNAs in the immune pathogenesis of SLE and LN. PMID:29854836
Partridge, Chris; de Cesare, Sergio; Mitchell, Andrew; Odell, James
2018-01-01
Formalization is becoming more common in all stages of the development of information systems, as a better understanding of its benefits emerges. Classification systems are ubiquitous, no more so than in domain modeling. The classification pattern that underlies these systems provides a good case study of the move toward formalization in part because it illustrates some of the barriers to formalization, including the formal complexity of the pattern and the ontological issues surrounding the "one and the many." Powersets are a way of characterizing the (complex) formal structure of the classification pattern, and their formalization has been extensively studied in mathematics since Cantor's work in the late nineteenth century. One can use this formalization to develop a useful benchmark. There are various communities within information systems engineering (ISE) that are gradually working toward a formalization of the classification pattern. However, for most of these communities, this work is incomplete, in that they have not yet arrived at a solution with the expressiveness of the powerset benchmark. This contrasts with the early smooth adoption of powerset by other information systems communities to, for example, formalize relations. One way of understanding the varying rates of adoption is recognizing that the different communities have different historical baggage. Many conceptual modeling communities emerged from work done on database design, and this creates hurdles to the adoption of the high level of expressiveness of powersets. Another relevant factor is that these communities also often feel, particularly in the case of domain modeling, a responsibility to explain the semantics of whatever formal structures they adopt. This paper aims to make sense of the formalization of the classification pattern in ISE and surveys its history through the literature, starting from the relevant theoretical works of the mathematical literature and gradually shifting focus to the ISE literature. The literature survey follows the evolution of ISE's understanding of how to formalize the classification pattern. The various proposals are assessed using the classical example of classification; the Linnaean taxonomy formalized using powersets as a benchmark for formal expressiveness. The broad conclusion of the survey is that (1) the ISE community is currently in the early stages of the process of understanding how to formalize the classification pattern, particularly in the requirements for expressiveness exemplified by powersets, and (2) that there is an opportunity to intervene and speed up the process of adoption by clarifying this expressiveness. Given the central place that the classification pattern has in domain modeling, this intervention has the potential to lead to significant improvements.
2012-01-01
Background Annelids and arthropods each possess a segmented body. Whether this similarity represents an evolutionary convergence or inheritance from a common segmented ancestor is the subject of ongoing investigation. Methods To investigate whether annelids and arthropods share molecular components that control segmentation, we isolated orthologs of the Drosophila melanogaster pair-rule genes, runt, paired (Pax3/7) and eve, from the polychaete annelid Capitella teleta and used whole mount in situ hybridization to characterize their expression patterns. Results When segments first appear, expression of the single C. teleta runt ortholog is only detected in the brain. Later, Ct-runt is expressed in the ventral nerve cord, foregut and hindgut. Analysis of Pax genes in the C. teleta genome reveals the presence of a single Pax3/7 ortholog. Ct-Pax3/7 is initially detected in the mid-body prior to segmentation, but is restricted to two longitudinal bands in the ventral ectoderm. Each of the two C. teleta eve orthologs has a unique and complex expression pattern, although there is partial overlap in several tissues. Prior to and during segment formation, Ct-eve1 and Ct-eve2 are both expressed in the bilaterial pair of mesoteloblasts, while Ct-eve1 is expressed in the descendant mesodermal band cells. At later stages, Ct-eve2 is expressed in the central and peripheral nervous system, and in mesoderm along the dorsal midline. In late stage larvae and adults, Ct-eve1 and Ct-eve2 are expressed in the posterior growth zone. Conclusions C. teleta eve, Pax3/7 and runt homologs all have distinct expression patterns and share expression domains with homologs from other bilaterians. None of the pair-rule orthologs examined in C. teleta exhibit segmental or pair-rule stripes of expression in the ectoderm or mesoderm, consistent with an independent origin of segmentation between annelids and arthropods. PMID:22510249
Muthamilarasan, Mehanathan; Khandelwal, Rohit; Yadav, Chandra Bhan; Bonthala, Venkata Suresh; Khan, Yusuf; Prasad, Manoj
2014-01-01
MYB proteins represent one of the largest transcription factor families in plants, playing important roles in diverse developmental and stress-responsive processes. Considering its significance, several genome-wide analyses have been conducted in almost all land plants except foxtail millet. Foxtail millet (Setaria italica L.) is a model crop for investigating systems biology of millets and bioenergy grasses. Further, the crop is also known for its potential abiotic stress-tolerance. In this context, a comprehensive genome-wide survey was conducted and 209 MYB protein-encoding genes were identified in foxtail millet. All 209 S. italica MYB (SiMYB) genes were physically mapped onto nine chromosomes of foxtail millet. Gene duplication study showed that segmental- and tandem-duplication have occurred in genome resulting in expansion of this gene family. The protein domain investigation classified SiMYB proteins into three classes according to number of MYB repeats present. The phylogenetic analysis categorized SiMYBs into ten groups (I-X). SiMYB-based comparative mapping revealed a maximum orthology between foxtail millet and sorghum, followed by maize, rice and Brachypodium. Heat map analysis showed tissue-specific expression pattern of predominant SiMYB genes. Expression profiling of candidate MYB genes against abiotic stresses and hormone treatments using qRT-PCR revealed specific and/or overlapping expression patterns of SiMYBs. Taken together, the present study provides a foundation for evolutionary and functional characterization of MYB TFs in foxtail millet to dissect their functions in response to environmental stimuli.
Zhang, Y-N; Zhang, J; Yan, S-W; Chang, H-T; Liu, Y; Wang, G-R; Dong, S-L
2014-10-01
The sex pheromone communication system in moths is highly species-specific and extremely sensitive, and pheromone receptors (PRs) are thought to be the most important factors in males. In the present study, three full-length cDNAs encoding PRs were characterized from Sesamia inferens antennae. These three PRs were all male-specific in expression, but their relative expression levels were very different; SinfOR29 was 17- to 23-fold higher than the other two PRs. Phylogenetic and motif pattern analyses showed that these three PRs were allocated to different PR subfamilies with different motif patterns. Functional analysis using the heterologous expression system of Xenopus oocytes demonstrated that SinfOR29 specifically and sensitively responded to the major pheromone component, Z11-16:OAc [concentration for 50% of maximal effect (EC50 ) = 3.431 × 10(-7) M], while SinfOR21 responded robustly to a minor pheromone component Z11-16:OH (EC50 = 1.087 × 10(-6) M). SinfOR27, however, displayed no response to any of the three pheromone components, but, interestingly, it was sensitive to a non-sex pheromone component Z9,E12-14:OAc (EC50 = 1.522 × 10(-6) M). Our results provide insight into the molecular mechanisms of specificity and sensitivity of the sex pheromone communication system in moths. © 2014 The Royal Entomological Society.
Whole Genome Analysis of a Wine Yeast Strain
Hauser, Nicole C.; Fellenberg, Kurt; Gil, Rosario; Bastuck, Sonja; Hoheisel, Jörg D.
2001-01-01
Saccharomyces cerevisiae strains frequently exhibit rather specific phenotypic features needed for adaptation to a special environment. Wine yeast strains are able to ferment musts, for example, while other industrial or laboratory strains fail to do so. The genetic differences that characterize wine yeast strains are poorly understood, however. As a first search of genetic differences between wine and laboratory strains, we performed DNA-array analyses on the typical wine yeast strain T73 and the standard laboratory background in S288c. Our analysis shows that even under normal conditions, logarithmic growth in YPD medium, the two strains have expression patterns that differ significantly in more than 40 genes. Subsequent studies indicated that these differences correlate with small changes in promoter regions or variations in gene copy number. Blotting copy numbers vs. transcript levels produced patterns, which were specific for the individual strains and could be used for a characterization of unknown samples. PMID:18628902
Dissociation of Down syndrome and Alzheimer's disease effects with imaging.
Matthews, Dawn C; Lukic, Ana S; Andrews, Randolph D; Marendic, Boris; Brewer, James; Rissman, Robert A; Mosconi, Lisa; Strother, Stephen C; Wernick, Miles N; Mobley, William C; Ness, Seth; Schmidt, Mark E; Rafii, Michael S
2016-06-01
Down Syndrome (DS) adults experience accumulation of Alzheimer's disease (AD)-like amyloid plaques and tangles and a high incidence of dementia and could provide an enriched population to study AD-targeted treatments. However, to evaluate effects of therapeutic intervention, it is necessary to dissociate the contributions of DS and AD from overall phenotype. Imaging biomarkers offer the potential to characterize and stratify patients who will worsen clinically but have yielded mixed findings in DS subjects. We evaluated 18F fluorodeoxyglucose positron emission tomography (PET), florbetapir PET, and structural magnetic resonance (sMR) image data from 12 nondemented DS adults using advanced multivariate machine learning methods. Our results showed distinctive patterns of glucose metabolism and brain volume enabling dissociation of DS and AD effects. AD-like pattern expression corresponded to amyloid burden and clinical measures. These findings lay groundwork to enable AD clinical trials with characterization and disease-specific tracking of DS adults.
Rau, K K; Jiang, N; Johnson, R D; Cooper, B Y
2007-04-01
Recordings were made from small and medium diameter dorsal root ganglia (DRG) neurons that expressed transient receptor potential (TRP) proteins. Physiologically characterized skin nociceptors expressed either TRPV1 (type 2) or TRPV2 (type 4) in isolation. Other nociceptors co-expressed both TRP proteins and innervated deep tissue sites (gastrocnemius muscle, distal colon; type 5, type 8) and skin (type 8). Subpopulations of myelinated (type 8) and unmyelinated (type 5) nociceptors co-expressed both TRPs. Cells that expressed TRPV1 were excellent transducers of intense heat. Proportional inward currents were obtained from a threshold of approximately 46.5 to approximately 56 degrees C. In contrast, cells expressing TRPV2 alone (52 degrees C threshold) did not reliably transduce the intensity of thermal events. Studies were undertaken to assess the capacity of skin and deep nociceptors to exhibit sensitization to repeated intense thermal stimuli [heat-heat sensitization (HHS)]. Only nociceptors that expressed TRPV2, alone or in combination with TRPV1, exhibited HHS. HHS was shown to be Ca(2+) dependent in either case. Intracellular Ca(2+) dependent pathways to HHS varied with the pattern of TRP protein expression. Cells co-expressing both TRPs modulated heat reactivity through serine/threonine phosphorylation or PLA(2)-dependent pathways. Cells expressing only TRPV2 may have relied on tyrosine kinases for HHS. We conclude that heat sensitization in deep and superficial capsaicin and capsaicin-insensitive C and Adelta nociceptors varies with the distribution of TRPV1 and TRPV2 proteins. The expression pattern of these proteins are specific to subclasses of physiologically identified C and A fiber nociceptors with highly restricted tissue targets.
Yu, Ying; Wu, Guangwen; Yuan, Hongmei; Cheng, Lili; Zhao, Dongsheng; Huang, Wengong; Zhang, Shuquan; Zhang, Liguo; Chen, Hongyu; Zhang, Jian; Guan, Fengzhi
2016-05-27
MicroRNAs (miRNAs) play a critical role in responses to biotic and abiotic stress and have been characterized in a large number of plant species. Although flax (Linum usitatissimum L.) is one of the most important fiber and oil crops worldwide, no reports have been published describing flax miRNAs (Lus-miRNAs) induced in response to saline, alkaline, and saline-alkaline stresses. In this work, combined small RNA and degradome deep sequencing was used to analyze flax libraries constructed after alkaline-salt stress (AS2), neutral salt stress (NSS), alkaline stress (AS), and the non-stressed control (CK). From the CK, AS, AS2, and NSS libraries, a total of 118, 119, 122, and 120 known Lus-miRNAs and 233, 213, 211, and 212 novel Lus-miRNAs were isolated, respectively. After assessment of differential expression profiles, 17 known Lus-miRNAs and 36 novel Lus-miRNAs were selected and used to predict putative target genes. Gene ontology term enrichment analysis revealed target genes that were involved in responses to stimuli, including signaling and catalytic activity. Eight Lus-miRNAs were selected for analysis using qRT-PCR to confirm the accuracy and reliability of the miRNA-seq results. The qRT-PCR results showed that changes in stress-induced expression profiles of these miRNAs mirrored expression trends observed using miRNA-seq. Degradome sequencing and transcriptome profiling showed that expression of 29 miRNA-target pairs displayed inverse expression patterns under saline, alkaline, and saline-alkaline stresses. From the target prediction analysis, the miR398a-targeted gene codes for a copper/zinc superoxide dismutase, and the miR530 has been shown to explicitly target WRKY family transcription factors, which suggesting that these two micRNAs and their targets may significant involve in the saline, alkaline, and saline-alkaline stress response in flax. Identification and characterization of flax miRNAs, their target genes, functional annotations, and gene expression patterns are reported in this work. These findings will enhance our understanding of flax miRNA regulatory mechanisms under saline, alkaline, and saline-alkaline stresses and provide a foundation for future elucidation of the specific functions of these miRNAs.
Charles, Rhonda; Sakurai, Takeshi; Takahashi, Nagahide; Elder, Gregory A.; Gama Sosa, Miguel A.; Young, Larry J.; Buxbaum, Joseph D.
2014-01-01
Central arginine vasopressin receptor 1A (AVPR1A) modulates a wide range of behaviors, including stress management and territorial aggression, as well as social bonding and recognition. Inter- and intra-species variations in the expression pattern of AVPR1A in the brain and downstream differential behavioral phenotypes have been attributed to differences in the non-coding regions of the AVPR1A gene, including polymorphic elements within upstream regulatory areas. Gene association studies have suggested a link between AVPR1A polymorphisms and autism, and AVPR1A has emerged as a potential pharmacological target for treatment of social cognitive impairments and mood and anxiety disorders. To further investigate the genetic mechanism giving rise to species differences in AVPR1A expression patterns and associated social behaviors, and to create a preclinical mouse model useful for screening drugs targeting AVPR1A, we engineered and extensively characterized bacterial artificial chromosome (BAC) transgenic mice harboring the entire human AVPR1A locus with the surrounding regulatory elements. Compared with wild-type animals, the humanized mice displayed a more widely distributed ligand-AVPR1A binding pattern, which overlapped with that of primates. Furthermore, humanized AVPR1A mice displayed increased reciprocal social interactions compared with wild-type animals, but no differences in social approach and preference for social novelty were observed. Aspects of learning and memory, specifically novel object recognition and spatial relocation recognition, were unaffected. The biological alterations in humanized AVPR1A mice resulted in the rescue of the prepulse inhibition impairments that were observed in knockout mice, indicating conserved functionality. Although further behavioral paradigms and additional cohorts need to be examined in humanized AVPR1A mice, the results demonstrate that species-specific variations in the genomic content of regulatory regions surrounding the AVPR1A locus are responsible for differential receptor protein expression patterns across species and that they are likely to contribute to species-specific behavioral variation. The humanized AVPR1A mouse is a potential preclinical model for further understanding the regulation of receptor gene expression and the impact of variation in receptor expression on behaviors, and should be useful for screening drugs targeting human AVPR1A, taking advantage of the expression of human AVPR1A in human-relevant brain regions. PMID:24924430
Quantum dot nanoprobe-based quantitative analysis for prostate cancer (Conference Presentation)
NASA Astrophysics Data System (ADS)
Kang, Benedict J.; Jang, Gun Hyuk; Park, Sungwook; Lee, Kwan Hyi
2016-09-01
Prostate cancer causes one of the leading cancer-related deaths among the Caucasian adult males in Europe and the United State of America. However, it has a high recovery rate indicating when a proper treatment is delivered to a patient. There are cases of over- or under-treatments which exacerbate the disease states indicating the importance of proper therapeutic approach depending on stage of the disease. Recognition of the unmet needs has raised a need for stratification of the disease. There have been attempts to stratify based on biomarker expression patterns in the course of disease progression. To closely observe the biomarker expression patterns, we propose the use of quantitative imaging method by using fabricated quantum dot-based nanoprobe to quantify biomarker expression on the surface of prostate cancer cells. To characterize the cell line and analyze the biomarker levels, cluster of differentiation 44 (CD 44), prostate specific membrane antigen (PSMA), and epithelial cell adhesion molecule (EpCAM) are used. Each selected biomarker per cell line has been quantified from which we established a signature of biomarkers of a prostate cancer cell line.
2012-01-01
Background Esophageal squamous cell carcinoma (ESCC), the predominant histological subtype of esophageal cancer, is characterized by high mortality. Previous work identified important mRNA expression differences between normal and tumor cells; however, to date there are limited ex vivo studies examining expression changes occurring during normal esophageal squamous cell differentiation versus those associated with tumorigenesis. In this study, we used a unique tissue microdissection strategy and microarrays to measure gene expression profiles associated with cell differentiation versus tumorigenesis in twelve cases of patient-matched normal basal squamous epithelial cells (NB), normal differentiated squamous epithelium (ND), and squamous cell cancer. Class comparison and pathway analysis were used to compare NB versus tumor in a search for unique therapeutic targets. Results As a first step towards this goal, gene expression profiles and pathways were evaluated. Overall, ND expression patterns were markedly different from NB and tumor; whereas, tumor and NB were more closely related. Tumor showed a general decrease in differentially expressed genes relative to NB as opposed to ND that exhibited the opposite trend. FSH and IgG networks were most highly dysregulated in normal differentiation and tumorigenesis, respectively. DNA repair pathways were generally elevated in NB and tumor relative to ND indicating involvement in both normal and pathological growth. PDGF signaling pathway and 12 individual genes unique to the tumor/NB comparison were identified as therapeutic targets, and 10 associated ESCC gene-drug pairs were identified. We further examined the protein expression level and the distribution patterns of four genes: ODC1, POSTN, ASPA and IGF2BP3. Ultimately, three genes (ODC1, POSTN, ASPA) were verified to be dysregulated in the same pattern at both the mRNA and protein levels. Conclusions These data reveal insight into genes and molecular pathways mediating ESCC development and provide information potentially useful in designing novel therapeutic interventions for this tumor type. PMID:22280838
Bernardo, Alessandra Augusta; Bicudo, Hermione Elly Melara de Campos
2009-09-01
Esterases are known for their involvement in several physiological processes and high degree of polymorphism, in many organisms. Such polymorphism has been used to characterize species and species groups and to study genetic changes occurred in their evolutionary history. In the present study, the esterase patterns of 19 strains from 10 species representative of the five subgroups of the saltans species group were analyzed using polyacrylamide gel electrophoresis and alpha- and beta- naphthyl acetates as substrates. Fifty-one esterase bands were detected and classified as 31 alpha-esterases, 18 beta-esterases and two alpha/beta-esterases. On the basis of the inhibition patterns using Malathion and eserine sulfate, 34 bands were classified as carboxylesterases, 14 as acethylesterases and three as cholinesterases. Ten gene loci were tentatively established on the basis of data on band position in the gel, substrate preference and inhibition pattern. Twenty bands were species-specific, the remaining being shared by species from the same or different subgroups. Bands detected exclusively in males and bands with a different frequency or degree of expression between sexes were also detected. In the gels prepared for analysis of gene expression in the body parts (head, thorax and abdomen), the degree of expression of the beta-esterases was higher in the thorax, while the alpha-esterases were expressed predominantly in the abdomen and thorax. A global view of the data available at present on the esterases of the species from the saltans group and their degree of polymorphism are presented, as well as the possibility of using some beta-esterases, because of their characteristics in the gels, as markers for species identification.
NASA Astrophysics Data System (ADS)
Bucklin, A. C.; Batta Lona, P. G.; Maas, A. E.; O'Neill, R. J.; Wiebe, P. H.
2015-12-01
In response to the changing Antarctic climate, the Southern Ocean salp Salpa thompsoni has shown altered patterns of distribution and abundance that are anticipated to have profound impacts on pelagic food webs and ecosystem dynamics. The physiological and molecular processes that underlay ecological function and biogeographical distribution are key to understanding present-day dynamics and predicting future trajectories. This study examined transcriptome-wide patterns of gene expression in relation to biological and physical oceanographic conditions in coastal, shelf and offshore waters of the Western Antarctic Peninsula (WAP) region during austral spring and summer 2011. Based on field observations and collections, seasonal changes in the distribution and abundance of salps of different life stages were associated with differences in water mass structure of the WAP. Our observations are consistent with previous suggestions that bathymetry and currents in Bransfield Strait could generate a retentive cell for an overwintering population of S. thompsoni, which may generate the characteristic salp blooms found throughout the region later in summer. The statistical analysis of transcriptome-wide patterns of gene expression revealed differences among salps collected in different seasons and from different habitats (i.e., coastal versus offshore) in the WAP. Gene expression patterns also clustered by station in austral spring - but not summer - collections, suggesting stronger heterogeneity of environmental conditions. During the summer, differentially expressed genes covered a wider range of functions, including those associated with stress responses. Future research using novel molecular transcriptomic / genomic characterization of S. thompsoni will allow more complete understanding of individual-, population-, and species-level responses to environmental variability and prediction of future dynamics of Southern Ocean food webs and ecosystems.
Talar, Urszula; Kiełbowicz-Matuk, Agnieszka; Czarnecka, Jagoda; Rorat, Tadeusz
2017-01-01
Plant B-box domain proteins (BBX) mediate many light-influenced developmental processes including seedling photomorphogenesis, seed germination, shade avoidance and photoperiodic regulation of flowering. Despite the wide range of potential functions, the current knowledge regarding BBX proteins in major crop plants is scarce. In this study, we identify and characterize the StBBX gene family in potato, which is composed of 30 members, with regard to structural properties and expression profiles under diurnal cycle, etiolation and de-etiolations. Based on domain organization and phylogenetic relationships, StBBX genes have been classified into five groups. Using real-time quantitative PCR, we found that expression of most of them oscillates following a 24-h rhythm; however, large differences in expression profiles were observed between the genes regarding amplitude and position of the maximal and minimal expression levels in the day/night cycle. On the basis of the time-of-day/time-of-night, we distinguished three expression groups specifically expressed during the light and two during the dark phase. In addition, we showed that the expression of several StBBX genes is under the control of the circadian clock and that some others are specifically associated with the etiolation and de-etiolation conditions. Thus, we concluded that StBBX proteins are likely key players involved in the complex diurnal and circadian networks regulating plant development as a function of light conditions and day duration.
Moreno-Sánchez, Natalia; Rueda, Julia; Reverter, Antonio; Carabaño, María Jesús; Díaz, Clara
2012-03-01
Variations on the transcriptome from one skeletal muscle type to another still remain unknown. The reliable identification of stable gene coexpression networks is essential to unravel gene functions and define biological processes. The differential expression of two distinct muscles, M. flexor digitorum (FD) and M. psoas major (PM), was studied using microarrays in cattle to illustrate muscle-specific transcription patterns and to quantify changes in connectivity regarding the expected gene coexpression pattern. A total of 206 genes were differentially expressed (DE), 94 upregulated in PM and 112 in FD. The distribution of DE genes in pathways and biological functions was explored in the context of system biology. Global interactomes for genes of interest were predicted. Fast/slow twitch genes, genes coding for extracellular matrix, ribosomal and heat shock proteins, and fatty acid uptake centred the specific gene expression patterns per muscle. Genes involved in repairing mechanisms, such as ribosomal and heat shock proteins, suggested a differential ability of muscles to react to similar stressing factors, acting preferentially in slow twitch muscles. Muscle attributes do not seem to be completely explained by the muscle fibre composition. Changes in connectivity accounted for 24% of significant correlations between DE genes. Genes changing their connectivity mostly seem to contribute to the main differential attributes that characterize each specific muscle type. These results underscore the unique flexibility of skeletal muscle where a substantial set of genes are able to change their behavior depending on the circumstances.
Skeletal muscle repair in a mouse model of nemaline myopathy
Sanoudou, Despina; Corbett, Mark A.; Han, Mei; Ghoddusi, Majid; Nguyen, Mai-Anh T.; Vlahovich, Nicole; Hardeman, Edna C.; Beggs, Alan H.
2012-01-01
Nemaline myopathy (NM), the most common non-dystrophic congenital myopathy, is a variably severe neuromuscular disorder for which no effective treatment is available. Although a number of genes have been identified in which mutations can cause NM, the pathogenetic mechanisms leading to the phenotypes are poorly understood. To address this question, we examined gene expression patterns in an NM mouse model carrying the human Met9Arg mutation of alpha-tropomyosin slow (Tpm3). We assessed five different skeletal muscles from affected mice, which are representative of muscles with differing fiber-type compositions, different physiological specializations and variable degrees of pathology. Although these same muscles in non-affected mice showed marked variation in patterns of gene expression, with diaphragm being the most dissimilar, the presence of the mutant protein in nemaline muscles resulted in a more similar pattern of gene expression among the muscles. This result suggests a common process or mechanism operating in nemaline muscles independent of the variable degrees of pathology. Transcriptional and protein expression data indicate the presence of a repair process and possibly delayed maturation in nemaline muscles. Markers indicative of satellite cell number, activated satellite cells and immature fibers including M-Cadherin, MyoD, desmin, Pax7 and Myf6 were elevated by western-blot analysis or immunohistochemistry. Evidence suggesting elevated focal repair was observed in nemaline muscle in electron micrographs. This analysis reveals that NM is characterized by a novel repair feature operating in multiple different muscles. PMID:16877500
Skeletal muscle repair in a mouse model of nemaline myopathy.
Sanoudou, Despina; Corbett, Mark A; Han, Mei; Ghoddusi, Majid; Nguyen, Mai-Anh T; Vlahovich, Nicole; Hardeman, Edna C; Beggs, Alan H
2006-09-01
Nemaline myopathy (NM), the most common non-dystrophic congenital myopathy, is a variably severe neuromuscular disorder for which no effective treatment is available. Although a number of genes have been identified in which mutations can cause NM, the pathogenetic mechanisms leading to the phenotypes are poorly understood. To address this question, we examined gene expression patterns in an NM mouse model carrying the human Met9Arg mutation of alpha-tropomyosin slow (Tpm3). We assessed five different skeletal muscles from affected mice, which are representative of muscles with differing fiber-type compositions, different physiological specializations and variable degrees of pathology. Although these same muscles in non-affected mice showed marked variation in patterns of gene expression, with diaphragm being the most dissimilar, the presence of the mutant protein in nemaline muscles resulted in a more similar pattern of gene expression among the muscles. This result suggests a common process or mechanism operating in nemaline muscles independent of the variable degrees of pathology. Transcriptional and protein expression data indicate the presence of a repair process and possibly delayed maturation in nemaline muscles. Markers indicative of satellite cell number, activated satellite cells and immature fibers including M-Cadherin, MyoD, desmin, Pax7 and Myf6 were elevated by western-blot analysis or immunohistochemistry. Evidence suggesting elevated focal repair was observed in nemaline muscle in electron micrographs. This analysis reveals that NM is characterized by a novel repair feature operating in multiple different muscles.
PsPMEP, a pollen-specific pectin methylesterase of pea (Pisum sativum L.).
Gómez, María Dolores; Renau-Morata, Begoña; Roque, Edelín; Polaina, Julio; Beltrán, José Pío; Cañas, Luis A
2013-09-01
Pectin methylesterases (PMEs) are a family of enzymes involved in plant reproductive processes such as pollen development and pollen tube growth. We have isolated and characterized PsPMEP, a pea (Pisum sativum L.) pollen-specific gene that encodes a protein with homology to PMEs. Sequence analysis showed that PsPMEP belongs to group 2 PMEs, which are characterized by the presence of a processable amino-terminal PME inhibitor domain followed by the catalytic PME domain. Moreover, PsPMEP contains several motifs highly conserved among PMEs with the essential amino acid residues involved in enzyme substrate binding and catalysis. Northern blot and in situ hybridization analyses showed that PsPMEP is expressed in pollen grains from 4 days before anthesis till anther dehiscence and in pollinated carpels. In the PsPMEP promoter region, we have identified several conserved cis-regulatory elements that have been associated with gene pollen-specific expression. Expression analysis of PsPMEP promoter fused to the uidA reporter gene in Arabidopsis thaliana plants showed a similar expression pattern when compared with pea, indicating that this promoter is also functional in a non-leguminous plant. GUS expression was detected in mature pollen grains, during pollen germination, during pollen tube elongation along the transmitting tract, and when the pollen tube reaches the embryo sac in the ovule.
Bajek, Anna; Gurtowska, Natalia; Gackowska, Lidia; Kubiszewska, Izabela; Bodnar, Magdalena; Marszałek, Andrzej; Januszewski, Rafał; Michalkiewicz, Jacek; Drewa, Tomasz
2015-05-14
Adipose-derived stem cells (ASCs) possess a high differentiation and proliferation potential. However, the phenotypic characterization of ASCs is still difficult. Until now, there is no extensive analysis of ASCs markers depending on different liposuction methods. Therefore, the aim of the present study was to analyse 242 surface markers and determine the differences in the phenotypic pattern between ASCs obtained during mechanical and ultrasound-assisted liposuction. ASCs were isolated from healthy donors, due to mechanical and ultrasound-assisted liposuction and cultured in standard medium to the second passage. Differentiation potential and markers expression was evaluated to confirm the mesenchymal nature of cells. Then, the BD LyoplateTM Human Cell Surface Marker Screening Panel was used. Results shown that both population of ASCs are characterized by high expression of markers specific for ASCs: cluster of differentiation (CD)9, CD10, CD34, CD44, CD49d, CD54, CD55, CD59, CD71 and low expression of CD11a, CD11c and CD144. Moreover, we have noticed significant differences in antigen expression in 58 markers from the 242 studied. Presented study shows for the first time that different liposuction methods are not a significant factor which can influence the expression of human ASCs surface markers. © 2015 The Authors.
Castresana, C; de Carvalho, F; Gheysen, G; Habets, M; Inzé, D; Van Montagu, M
1990-01-01
The Nicotiana plumbaginifolia gn1 gene encoding a beta-1,3-glucanase isoform has been characterized. The gn1 product represents an isoform distinct from the previously identified tobacco beta-1,3-glucanases. By expressing gn1 in Escherichia coli, we have determined directly that the encoded protein does, indeed, correspond to a beta-1,3-glucanase. In N. plumbaginifolia, gn1 was found to be expressed in roots and older leaves. Transgenic tobacco plants containing the 5'-noncoding region of gn1 fused to the beta-glucuronidase (GUS) reporter gene also showed maximum levels of GUS activity in roots and older leaves. No detectable activity was present in the upper part of the transgenic plants with the exception of stem cells at the bases of emerging shoots. The expression conferred by the gn1 promoter was differentially induced in response to specific plant stress treatments. Studies of three plant-bacteria interactions showed high levels of GUS activity when infection resulted in a hypersensitive reaction. Increased gene expression was confined to cells surrounding the necrotic lesions. The observed expression pattern suggests that the characterized beta-1,3-glucanase plays a role both in plant development and in the defense response against pathogen infection. PMID:2152158
Characterization of Visual Scanning Patterns in Air Traffic Control
McClung, Sarah N.; Kang, Ziho
2016-01-01
Characterization of air traffic controllers' (ATCs') visual scanning strategies is a challenging issue due to the dynamic movement of multiple aircraft and increasing complexity of scanpaths (order of eye fixations and saccades) over time. Additionally, terminologies and methods are lacking to accurately characterize the eye tracking data into simplified visual scanning strategies linguistically expressed by ATCs. As an intermediate step to automate the characterization classification process, we (1) defined and developed new concepts to systematically filter complex visual scanpaths into simpler and more manageable forms and (2) developed procedures to map visual scanpaths with linguistic inputs to reduce the human judgement bias during interrater agreement. The developed concepts and procedures were applied to investigating the visual scanpaths of expert ATCs using scenarios with different aircraft congestion levels. Furthermore, oculomotor trends were analyzed to identify the influence of aircraft congestion on scan time and number of comparisons among aircraft. The findings show that (1) the scanpaths filtered at the highest intensity led to more consistent mapping with the ATCs' linguistic inputs, (2) the pattern classification occurrences differed between scenarios, and (3) increasing aircraft congestion caused increased scan times and aircraft pairwise comparisons. The results provide a foundation for better characterizing complex scanpaths in a dynamic task and automating the analysis process. PMID:27239190
Characterization of Visual Scanning Patterns in Air Traffic Control.
McClung, Sarah N; Kang, Ziho
2016-01-01
Characterization of air traffic controllers' (ATCs') visual scanning strategies is a challenging issue due to the dynamic movement of multiple aircraft and increasing complexity of scanpaths (order of eye fixations and saccades) over time. Additionally, terminologies and methods are lacking to accurately characterize the eye tracking data into simplified visual scanning strategies linguistically expressed by ATCs. As an intermediate step to automate the characterization classification process, we (1) defined and developed new concepts to systematically filter complex visual scanpaths into simpler and more manageable forms and (2) developed procedures to map visual scanpaths with linguistic inputs to reduce the human judgement bias during interrater agreement. The developed concepts and procedures were applied to investigating the visual scanpaths of expert ATCs using scenarios with different aircraft congestion levels. Furthermore, oculomotor trends were analyzed to identify the influence of aircraft congestion on scan time and number of comparisons among aircraft. The findings show that (1) the scanpaths filtered at the highest intensity led to more consistent mapping with the ATCs' linguistic inputs, (2) the pattern classification occurrences differed between scenarios, and (3) increasing aircraft congestion caused increased scan times and aircraft pairwise comparisons. The results provide a foundation for better characterizing complex scanpaths in a dynamic task and automating the analysis process.
Geng, Meijuan; Li, Hui; Jin, Chuan; Liu, Qian; Chen, Chengbin; Song, Wenqin; Wang, Chunguo
2014-02-01
MicroRNAs (miRNAs) are a class of small endogenous, non-coding RNAs that have key regulatory functions in plant growth, development, and other biological processes. Hypocotyl and cotyledon are the two major tissues of cauliflower (Brassica oleracea L. var. botrytis) seedlings. Tissue culture experiments have indicated that the regenerative abilities of these two tissues are significantly different. However, the characterization of miRNAs and their roles in regulating organ development in cauliflower remain unexplored. In the present study, two small RNA libraries were sequenced by Solexa sequencing technology. 99 known miRNAs belonging to 28 miRNA families were identified, in which 6 miRNA families were detected only in Brassicaceae. A total of 162 new miRNA sequences with single nucleotide substitutions corresponding to the known miRNAs, and 32 potentially novel miRNAs were also first discovered. Comparative analysis indicated that 42 of 99 known miRNAs and 17 of 32 novel miRNAs exhibited significantly differential expression between hypocotyl and cotyledon, and the differential expression of several miRNAs was further validated by stem-loop RT-PCR. In addition, 235 targets for 89 known miRNAs and 198 targets for 24 novel miRNAs were predicted, and their functions were further discussed. The expression patterns of several representative targets were also confirmed by qRT-PCR analysis. The results identified that the transcriptional expression patterns of miRNAs were negatively correlated with their targets. These findings gave new insights into the characteristics of miRNAs in cauliflower, and provided important clues to elucidate the roles of miRNAs in the tissue differentiation and development of cauliflower.
Kandasamy, Majury; Roll, Lars; Langenstroth, Daniel; Brüstle, Oliver; Faissner, Andreas
2017-06-01
Neural stem cells (NSCs) have the ability to self-renew and to differentiate into various cell types of the central nervous system. This potential can be recapitulated by human induced pluripotent stem cells (hiPSCs) in vitro. The differentiation capacity of hiPSCs is characterized by several stages with distinct morphologies and the expression of various marker molecules. We used the monoclonal antibodies (mAbs) 487 LeX , 5750 LeX and 473HD to analyze the expression pattern of particular carbohydrate motifs as potential markers at six differentiation stages of hiPSCs. Mouse ESCs were used as a comparison. At the pluripotent stage, 487 LeX -, 5750 LeX - and 473HD-related glycans were differently expressed. Later, cells of the three germ layers in embryoid bodies (hEBs) and, even after neuralization of hEBs, subpopulations of cells were labeled with these surface antibodies. At the human rosette-stage of NSCs (hR-NSC), LeX- and 473HD-related epitopes showed antibody-specific expression patterns. We also found evidence that these surface antibodies could be used to distinguish the hR-NSCs from the hSR-NSCs stages. Characterization of hNSCs FGF-2/EGF derived from hSR-NSCs revealed that both LeX antibodies and the 473HD antibody labeled subpopulations of hNSCs FGF-2/EGF . Finally, we identified potential LeX carrier molecules that were spatiotemporally regulated in early and late stages of differentiation. Our study provides new insights into the regulation of glycoconjugates during early human stem cell development. The mAbs 487 LeX , 5750 LeX and 473HD are promising tools for identifying distinct stages during neural differentiation.
Six commercially available angiotensin II AT1 receptor antibodies are non-specific.
Benicky, Julius; Hafko, Roman; Sanchez-Lemus, Enrique; Aguilera, Greti; Saavedra, Juan M
2012-11-01
Commercially available Angiotensin II AT1 receptor antibodies are widely employed for receptor localization and quantification, but they have not been adequately validated. In this study, six commercially available AT1 receptor antibodies were characterized by established criteria: sc-1173 and sc-579 from Santa Cruz Biotechnology, Inc., AAR-011 from Alomone Labs, Ltd., AB15552 from Millipore, and ab18801 and ab9391 from Abcam. The immunostaining patterns observed were different for every antibody tested, and were unrelated to the presence or absence of AT1 receptors. The antibodies detected a 43 kDa band in western blots, corresponding to the predicted size of the native AT1 receptor. However, identical bands were observed in wild-type mice and in AT1A knock-out mice not expressing the target protein. Moreover, immunoreactivity detected in rat hypothalamic 4B cells not expressing AT1 receptors or transfected with AT1A receptor construct was identical, as revealed by western blotting and immunocytochemistry in cultured 4B cells. Additional prominent immunoreactive bands above and below 43 kDa were observed by western blotting in extracts from tissues of AT1A knock-out and wild-type mice and in 4B cells with or without AT1 receptor expression. In all cases, the patterns of immunoreactivity were independent of the AT1 receptor expression and different for each antibody studied. We conclude that, in our experimental setup, none of the commercially available AT1 receptor antibodies tested met the criteria for specificity and that competitive radioligand binding remains the only reliable approach to study AT1 receptor physiology in the absence of full antibody characterization.
Six Commercially Available Angiotensin II AT1 Receptor Antibodies are Non-specific
Benicky, Julius; Hafko, Roman; Sanchez-Lemus, Enrique; Aguilera, Greti
2012-01-01
Commercially available Angiotensin II AT1 receptor antibodies are widely employed for receptor localization and quantification, but they have not been adequately validated. In this study, six commercially available AT1 receptor antibodies were characterized by established criteria: sc-1173 and sc-579 from Santa Cruz Biotechnology, Inc., AAR-011 from Alomone Labs, Ltd., AB15552 from Millipore, and ab18801 and ab9391 from Abcam. The immunostaining patterns observed were different for every antibody tested, and were unrelated to the presence or absence of AT1 receptors. The antibodies detected a 43 kDa band in western blots, corresponding to the predicted size of the native AT1 receptor. However, identical bands were observed in wild-type mice and in AT1A knock-out mice not expressing the target protein. Moreover, immunoreactivity detected in rat hypothalamic 4B cells not expressing AT1 receptors or transfected with AT1A receptor construct was identical, as revealed by western blotting and immunocytochemistry in cultured 4B cells. Additional prominent immunoreactive bands above and below 43 kDa were observed by western blotting in extracts from tissues of AT1A knock-out and wild-type mice and in 4B cells with or without AT1 receptor expression. In all cases, the patterns of immunoreactivity were independent of the AT1 receptor expression and different for each antibody studied. We conclude that, in our experimental setup, none of the commercially available AT1 receptor antibodies tested met the criteria for specificity and that competitive radioligand binding remains the only reliable approach to study AT1 receptor physiology in the absence of full antibody characterization. PMID:22843099
Kobayashi, Yusuke; Nakamura, Kanako; Nomura, Hiroyuki; Banno, Kouji; Irie, Haruko; Adachi, Masataka; Iida, Miho; Umene, Kiyoko; Nogami, Yuya; Masuda, Kenta; Kisu, Iori; Ueki, Arisa; Yamagami, Wataru; Kataoka, Fumio; Hirasawa, Akira; Tominaga, Eiichiro; Susumu, Nobuyuki; Aoki, Daisuke
2015-03-01
Synchronous primary endometrial and ovarian cancers have been an important topic in clinical medicine because it is sometimes difficult to distinguish whether there are 2 primary tumors or a single primary tumor and an associated metastasis. In addition, although these tumors are recommended for either immunohistochemistry for DNA mismatch repair (MMR) proteins or a microsatellite instability test in the Bethesda guidelines as Lynch syndrome-associated cancers, few studies have completed these analyses. In this study, we characterized the clinicopathologic features and the expression pattern of MMR proteins in synchronous primary endometrial and ovarian cancers. Clinicopathologic features and the expression pattern of MMR proteins (MLH1, MSH2, and MSH6) were characterized and analyzed in 32 synchronous primary endometrial and ovarian cancers. Most synchronous cancers are endometrioid type (endometrioid/endometrioid) (n = 24, 75%), grade 1 (n = 19, 59.4%), and diagnosed as stage I (n = 15, 46.9%) in both endometrium and ovary. It is worth mentioning that 75% of the patients (n = 24) had endometriosis, which was more common (n = 21, 87.5%) in endometrioid/endometrioid cancers, whereas only 3 cases (37.5%) were of different histology (P = 0.018). Loss of expression of at least 1 MMR protein was observed in 17 (53.1%) of the endometrial tumors and in 10 (31.3%) of ovarian tumors. Only 4 cases (12.5%) that had specific MMR protein loss showed the same type of loss for both endometrial and ovarian tumors, in which 3 of the cases were losses in MLH1. One case showed concordant MSH6 protein loss, although the cases did not meet the Amsterdam criteria II. These results suggest that most synchronous primary endometrial ovarian cancers are not hereditary cancers caused by germ line mutations but rather sporadic cancers.
Nguyen, Chinh Bkrong; Alsøe, Lene; Lindvall, Jessica M; Sulheim, Dag; Fagermoen, Even; Winger, Anette; Kaarbø, Mari; Nilsen, Hilde; Wyller, Vegard Bruun
2017-05-11
Chronic fatigue syndrome (CFS) is a prevalent and disabling condition affecting adolescents. The pathophysiology is poorly understood, but immune alterations might be an important component. This study compared whole blood gene expression in adolescent CFS patients and healthy controls, and explored associations between gene expression and neuroendocrine markers, immune markers and clinical markers within the CFS group. CFS patients (12-18 years old) were recruited nation-wide to a single referral center as part of the NorCAPITAL project. A broad case definition of CFS was applied, requiring 3 months of unexplained, disabling chronic/relapsing fatigue of new onset, whereas no accompanying symptoms were necessary. Healthy controls having comparable distribution of gender and age were recruited from local schools. Whole blood samples were subjected to RNA sequencing. Immune markers were blood leukocyte counts, plasma cytokines, serum C-reactive protein and immunoglobulins. Neuroendocrine markers encompassed plasma and urine levels of catecholamines and cortisol, as well as heart rate variability indices. Clinical markers consisted of questionnaire scores for symptoms of post-exertional malaise, inflammation, fatigue, depression and trait anxiety, as well as activity recordings. A total of 29 CFS patients and 18 healthy controls were included. We identified 176 genes as differentially expressed in patients compared to controls, adjusting for age and gender factors. Gene set enrichment analyses suggested impairment of B cell differentiation and survival, as well as enhancement of innate antiviral responses and inflammation in the CFS group. A pattern of co-expression could be identified, and this pattern, as well as single gene transcripts, was significantly associated with indices of autonomic nervous activity, plasma cortisol, and blood monocyte and eosinophil counts. Also, an association with symptoms of post-exertional malaise was demonstrated. Adolescent CFS is characterized by differential gene expression pattern in whole blood suggestive of impaired B cell differentiation and survival, and enhanced innate antiviral responses and inflammation. This expression pattern is associated with neuroendocrine markers of altered HPA axis and autonomic nervous activity, and with symptoms of post-exertional malaise. Trial registration Clinical Trials NCT01040429.
Wood, Kathleen H; Johnson, Brian S; Welsh, Sarah A; Lee, Jun Y; Cui, Yue; Krizman, Elizabeth; Brodkin, Edward S; Blendy, Julie A; Robinson, Michael B; Bartolomei, Marisa S; Zhou, Zhaolan
2016-04-01
DNA methylation is recognized by methyl-CpG-binding domain (MBD) proteins. Multiple MBDs are linked to neurodevelopmental disorders in humans and mice. However, the functions of MBD2 are poorly understood. We characterized Mbd2 knockout mice and determined spatiotemporal expression of MBDs and MBD2-NuRD (nucleosome remodeling deacetylase) interactions. We analyzed behavioral phenotypes, generated biotin-tagged MBD1 and MBD2 knockin mice, and performed biochemical studies of MBD2-NuRD. Most behavioral measures are minimally affected in Mbd2 knockout mice. In contrast to other MBDs, MBD2 shows distinct expression patterns. Unlike most MBDs, MBD2 is ubiquitously expressed in all tissues examined and appears dispensable for brain functions measured in this study. We provide novel genetic tools and reveal new directions to investigate MBD2 functions in vivo.
Hodgkin's-like lymphoma in a ferret (Mustela putorius furo).
Matsumoto, Isao; Uchida, Kazuyuki; Chambers, James Kenn; Nibe, Kazumi; Sato, Yu; Hamasu, Taku; Nakayama, Hiroyuki
2017-10-07
A 7-year-old castrated male ferret developed unilateral cervical lymphadenomegaly over a 1-month period. Histological examination revealed proliferation of tumor cells in a diffuse and partially nodular pattern. The tumor cells were predominantly Hodgkin cells and binucleated Reed-Sternberg cells, characterized by abundant, clear, vacuolated cytoplasm, pleomorphic, ovoid nuclei with thick nuclear membranes and distinct nucleoli. Multinucleated cells, resembling lymphocytic and histiocytic (L&H) cells, were also observed. Immunohistochemically, the tumor cells expressed Pax-5, BLA-36 and vimentin. A small population of the tumor cells expressed CD20. This case showed proliferation of Hodgkin/Reed-Sternberg cells in conjunction with L&H cells that were histologically analogous to feline Hodgkin's-like lymphoma. However, Pax-5 and BLA-36 expression along with rare CD20 expression were consistent with classical Hodgkin's lymphoma in humans.
Systematic Proteomic Approach to Characterize the Impacts of ...
Chemical interactions have posed a big challenge in toxicity characterization and human health risk assessment of environmental mixtures. To characterize the impacts of chemical interactions on protein and cytotoxicity responses to environmental mixtures, we established a systems biology approach integrating proteomics, bioinformatics, statistics, and computational toxicology to measure expression or phosphorylation levels of 21 critical toxicity pathway regulators and 445 downstream proteins in human BEAS-28 cells treated with 4 concentrations of nickel, 2 concentrations each of cadmium and chromium, as well as 12 defined binary and 8 defined ternary mixtures of these metals in vitro. Multivariate statistical analysis and mathematical modeling of the metal-mediated proteomic response patterns showed a high correlation between changes in protein expression or phosphorylation and cellular toxic responses to both individual metals and metal mixtures. Of the identified correlated proteins, only a small set of proteins including HIF-1a is likely to be responsible for selective cytotoxic responses to different metals and metals mixtures. Furthermore, support vector machine learning was utilized to computationally predict protein responses to uncharacterized metal mixtures using experimentally generated protein response profiles corresponding to known metal mixtures. This study provides a novel proteomic approach for characterization and prediction of toxicities of
Bähr, Andrea; Käser, Tobias; Kemter, Elisabeth; Gerner, Wilhelm; Kurome, Mayuko; Baars, Wiebke; Herbach, Nadja; Witter, Kirsti; Wünsch, Annegret; Talker, Stephanie C; Kessler, Barbara; Nagashima, Hiroshi; Saalmüller, Armin; Schwinzer, Reinhard; Wolf, Eckhard; Klymiuk, Nikolai
2016-01-01
We have successfully established and characterized a genetically modified pig line with ubiquitous expression of LEA29Y, a human CTLA4-Ig derivate. LEA29Y binds human B7.1/CD80 and B7.2/CD86 with high affinity and is thus a potent inhibitor of T cell co-stimulation via this pathway. We have characterized the expression pattern and the biological function of the transgene as well as its impact on the porcine immune system and have evaluated the potential of these transgenic pigs to propagate via assisted breeding methods. The analysis of LEA29Y expression in serum and multiple organs of CAG-LEA transgenic pigs revealed that these animals produce a biologically active transgenic product at a considerable level. They present with an immune system affected by transgene expression, but can be maintained until sexual maturity and propagated by assisted reproduction techniques. Based on previous experience with pancreatic islets expressing LEA29Y, tissues from CAG-LEA29Y transgenic pigs should be protected against rejection by human T cells. Furthermore, their immune-compromised phenotype makes CAG-LEA29Y transgenic pigs an interesting large animal model for testing human cell therapies and will provide an important tool for further clarifying the LEA29Y mode of action.
Zhang, Zhongbao; Zhang, Jiewei; Chen, Yajuan; Li, Ruifen; Wang, Hongzhi; Ding, Liping; Wei, Jianhua
2014-09-01
Hexokinases (HXKs, EC 2.7.1.1) play important roles in metabolism, glucose (Glc) signaling, and phosphorylation of Glc and fructose and are ubiquitous in all organisms. Despite their physiological importance, the maize HXK (ZmHXK) genes have not been analyzed systematically. We isolated and characterized nine members of the ZmHXK gene family which were distributed on 3 of the 10 maize chromosomes. A multiple sequence alignment and motif analysis revealed that the maize ZmHXK proteins share three conserved domains. Phylogenetic analysis revealed that the ZmHXK family can be divided into four subfamilies. We identified putative cis-elements in the ZmHXK promoter sequences potentially involved in phytohormone and abiotic stress responses, sugar repression, light and circadian rhythm regulation, Ca(2+) responses, seed development and germination, and CO2-responsive transcriptional activation. To study the functions of maize HXK isoforms, we characterized the expression of the ZmHXK5 and ZmHXK6 genes, which are evolutionarily related to the OsHXK5 and OsHXK6 genes from rice. Analysis of tissue-specific expression patterns using quantitative real time-PCR showed that ZmHXK5 was highly expressed in tassels, while ZmHXK6 was expressed in both tassels and leaves. ZmHXK5 and ZmHXK6 expression levels were upregulated by phytohormones and by abiotic stress.
Karanjalker, G R; Ravishankar, K V; Shivashankara, K S; Dinesh, M R; Roy, T K; Sudhakar Rao, D V
2018-01-01
Mango (Mangiferaindica L.) fruits are generally classified based on peel color into green, yellow, and red types. Mango peel turns from green to yellow or red or retain green colors during ripening. The carotenoids and anthocyanins are the important pigments responsible for the colors of fruits. In the present study, peels of different colored cultivars at three ripening stages were characterized for pigments, colors, and gene expression analysis. The yellow colored cultivar "Arka Anmol" showed higher carotenoid content, wherein β-carotene followed by violaxanthin were the major carotenoid compounds that increased during ripening. The red colored cultivars were characterized with higher anthocyanins with cyanidin-3-O-monoglucosides and peonidin-3-O-glucosides as the major anthocyanins. The gene expression analysis by qRT-PCR showed the higher expression of carotenoid biosynthetic genes viz. lycopene-β-cyclase and violaxanthin-de-epoxidase in yellow colored cv. Arka Anmol, and the expression was found to increase during ripening. However, in red colored cv. "Janardhan Pasand," there is increased regulation of all anthocyanin biosynthetic genes including transcription factors MYB and basic helix loop. This indicated the regulation of the anthocyanins by these genes in red mango peel. The results showed that the accumulation pattern of particular pigments and higher expression of specific biosynthetic genes in mango peel impart different colors.
Microarray characterization of gene expression changes in blood during acute ethanol exposure
2013-01-01
Background As part of the civil aviation safety program to define the adverse effects of ethanol on flying performance, we performed a DNA microarray analysis of human whole blood samples from a five-time point study of subjects administered ethanol orally, followed by breathalyzer analysis, to monitor blood alcohol concentration (BAC) to discover significant gene expression changes in response to the ethanol exposure. Methods Subjects were administered either orange juice or orange juice with ethanol. Blood samples were taken based on BAC and total RNA was isolated from PaxGene™ blood tubes. The amplified cDNA was used in microarray and quantitative real-time polymerase chain reaction (RT-qPCR) analyses to evaluate differential gene expression. Microarray data was analyzed in a pipeline fashion to summarize and normalize and the results evaluated for relative expression across time points with multiple methods. Candidate genes showing distinctive expression patterns in response to ethanol were clustered by pattern and further analyzed for related function, pathway membership and common transcription factor binding within and across clusters. RT-qPCR was used with representative genes to confirm relative transcript levels across time to those detected in microarrays. Results Microarray analysis of samples representing 0%, 0.04%, 0.08%, return to 0.04%, and 0.02% wt/vol BAC showed that changes in gene expression could be detected across the time course. The expression changes were verified by qRT-PCR. The candidate genes of interest (GOI) identified from the microarray analysis and clustered by expression pattern across the five BAC points showed seven coordinately expressed groups. Analysis showed function-based networks, shared transcription factor binding sites and signaling pathways for members of the clusters. These include hematological functions, innate immunity and inflammation functions, metabolic functions expected of ethanol metabolism, and pancreatic and hepatic function. Five of the seven clusters showed links to the p38 MAPK pathway. Conclusions The results of this study provide a first look at changing gene expression patterns in human blood during an acute rise in blood ethanol concentration and its depletion because of metabolism and excretion, and demonstrate that it is possible to detect changes in gene expression using total RNA isolated from whole blood. The analysis approach for this study serves as a workflow to investigate the biology linked to expression changes across a time course and from these changes, to identify target genes that could serve as biomarkers linked to pilot performance. PMID:23883607
Patterns Cancer Prevention Through Induction of Phase 2 Enzymes
2003-04-01
2) enzymes. During our Phase I Award, we identified sulforaphane as the most potent inducer of carcinogen defenses in the prostate cell. We have...characterized global effects of sulforaphane in prostate cancer cell lines using cDNA microarray technology that allows large-scale determination of...changes in gene expression. These findings argue strongly for a preventive intervention trial involving with sulforaphane . During our Phase 2 Award, we used
Dezene P. W. Huber; Melissa Erickson; Christian Leutenegger; Joerg Bohlmann; Steven J. Seybold
2007-01-01
Cytochromes P450 family genes (P450s) are found in a diverse array of organisms ranging from bacteria to mammals to plants to arthropods. Although there are exceptions to this rule, organisms generally contain a fairly large number of P450 genes and pseudogenes in their genomes. For instance, among arthropods whose genomes are well characterized, the mosquito,
Ryu, Hyang Joo; Kim, Eun Kyung; Heo, Su Jin; Cho, Byoung Chul; Kim, Hye Ryun; Yoon, Sun Och
2017-11-01
We evaluated the expression patterns of p16, which is used as a surrogate marker of HPV infection in head and neck squamous cell carcinoma (HNSCC), in regard to their biological and prognostic implications. p16 expression patterns and infiltrated immune cells were analyzed through immunohistochemistry of p16, CD3, CD8, PD-1, FOXP3, and CD163 on surgically resected HNSCCs (n = 393). Patterns of p16 immunoexpression were defined as STRONG (strong, diffuse expression in cytoplasm, and nucleus in >70% of tumor cells), MARGINAL (expression restricted to tumor margins), MOSAIC (ragged, discontinued expression), NUCLEAR (expression in nuclei only), and ABSENT (no expression). The STRONG pattern was more frequent in the oropharynx, and the MARGINAL pattern was noted only in the oral cavity. MOSAIC and NUCLEAR patterns were noted at variable sites. No two patterns of p16 expression showed the same immune cell composition of CD3+ T cells, CD8+ cytotoxic T cells, PD-1+ T cells, FOXP3+ regulatory T cells, and CD163+ macrophages. In overall and disease-free survival analyses, the STRONG pattern showed the most favorable prognosis, while the NUCLEAR pattern had the worst prognosis. HNSCC anatomical sites, tumor-related immune cell components, and patient outcomes were associated with p16 expression patterns. Each architectural pattern of p16 expression may be related to different biological and prognostic phenotypes. © 2017 APMIS. Published by John Wiley & Sons Ltd.
Chen, Xiang; Velliste, Meel; Murphy, Robert F.
2010-01-01
Proteomics, the large scale identification and characterization of many or all proteins expressed in a given cell type, has become a major area of biological research. In addition to information on protein sequence, structure and expression levels, knowledge of a protein’s subcellular location is essential to a complete understanding of its functions. Currently subcellular location patterns are routinely determined by visual inspection of fluorescence microscope images. We review here research aimed at creating systems for automated, systematic determination of location. These employ numerical feature extraction from images, feature reduction to identify the most useful features, and various supervised learning (classification) and unsupervised learning (clustering) methods. These methods have been shown to perform significantly better than human interpretation of the same images. When coupled with technologies for tagging large numbers of proteins and high-throughput microscope systems, the computational methods reviewed here enable the new subfield of location proteomics. This subfield will make critical contributions in two related areas. First, it will provide structured, high-resolution information on location to enable Systems Biology efforts to simulate cell behavior from the gene level on up. Second, it will provide tools for Cytomics projects aimed at characterizing the behaviors of all cell types before, during and after the onset of various diseases. PMID:16752421
Pourabed, Ehsan; Ghane Golmohamadi, Farzan; Soleymani Monfared, Peyman; Razavi, Seyed Morteza; Shobbar, Zahra-Sadat
2015-01-01
The basic leucine zipper (bZIP) family is one of the largest and most diverse transcription factors in eukaryotes participating in many essential plant processes. We identified 141 bZIP proteins encoded by 89 genes from the Hordeum vulgare genome. HvbZIPs were classified into 11 groups based on their DNA-binding motif. Amino acid sequence alignment of the HvbZIPs basic-hinge regions revealed some highly conserved residues within each group. The leucine zipper heptads were analyzed predicting their dimerization properties. 34 conserved motifs were identified outside the bZIP domain. Phylogenetic analysis indicated that major diversification within the bZIP family predated the monocot/dicot divergence, although intra-species duplication and parallel evolution seems to be occurred afterward. Localization of HvbZIPs on the barley chromosomes revealed that different groups have been distributed on seven chromosomes of barley. Six types of intron pattern were detected within the basic-hinge regions. Most of the detected cis-elements in the promoter and UTR sequences were involved in seed development or abiotic stress response. Microarray data analysis revealed differential expression pattern of HvbZIPs in response to ABA treatment, drought, and cold stresses and during barley grain development and germination. This information would be helpful for functional characterization of bZIP transcription factors in barley.
Raman intensity and vibrational modes of armchair CNTs
NASA Astrophysics Data System (ADS)
Hur, Jaewoong; Stuart, Steven J.
2017-07-01
Raman intensity changes and frequency patterns have been studied using the various armchair (n, n) to understand the variations of bond polarizability, in regard to changing diameters, lengths, and the number of atoms in the (n, n). The Raman intensity trends of the (n, n) are validated by those of Cn isomers. For frequency trends, similar frequency patterns and frequency inward shifts for the (n, n) are characterized. Also, VDOS trends of the (n, n) expressing Raman modes are interpreted. The decomposition of vibrational modes in the (n, n) into radial, longitudinal, and tangential mode is beneficially used to recognize the distinct characteristics of vibrational modes.
You, Yanchun; Xie, Miao; Ren, Nana; Cheng, Xuemin; Li, Jianyu; Ma, Xiaoli; Zou, Minming; Vasseur, Liette; Gurr, Geoff M; You, Minsheng
2015-03-05
Glutathione S-transferases (GSTs) are multifunctional detoxification enzymes that play important roles in insects. The completion of several insect genome projects has enabled the identification and characterization of GST genes over recent years. This study presents a genome-wide investigation of the diamondback moth (DBM), Plutella xylostella, a species in which the GSTs are of special importance because this pest is highly resistant to many insecticides. A total of 22 putative cytosolic GSTs were identified from a published P. xylostella genome and grouped into 6 subclasses (with two unclassified). Delta, Epsilon and Omega GSTs were numerically superior with 5 genes for each of the subclasses. The resulting phylogenetic tree showed that the P. xylostella GSTs were all clustered into Lepidoptera-specific branches. Intron sites and phases as well as GSH binding sites were strongly conserved within each of the subclasses in the GSTs of P. xylostella. Transcriptome-, RNA-seq- and qRT-PCR-based analyses showed that the GST genes were developmental stage- and strain-specifically expressed. Most of the highly expressed genes in insecticide resistant strains were also predominantly expressed in the Malpighian tubules, midgut or epidermis. To date, this is the most comprehensive study on genome-wide identification, characterization and expression profiling of the GST family in P. xylostella. The diversified features and expression patterns of the GSTs are inferred to be associated with the capacity of this species to develop resistance to a wide range of pesticides and biological toxins. Our findings provide a base for functional research on specific GST genes, a better understanding of the evolution of insecticide resistance, and strategies for more sustainable management of the pest.
Rund, Samuel S C; Yoo, Boyoung; Alam, Camille; Green, Taryn; Stephens, Melissa T; Zeng, Erliang; George, Gary F; Sheppard, Aaron D; Duffield, Giles E; Milenković, Tijana; Pfrender, Michael E
2016-08-18
Marine and freshwater zooplankton exhibit daily rhythmic patterns of behavior and physiology which may be regulated directly by the light:dark (LD) cycle and/or a molecular circadian clock. One of the best-studied zooplankton taxa, the freshwater crustacean Daphnia, has a 24 h diel vertical migration (DVM) behavior whereby the organism travels up and down through the water column daily. DVM plays a critical role in resource tracking and the behavioral avoidance of predators and damaging ultraviolet radiation. However, there is little information at the transcriptional level linking the expression patterns of genes to the rhythmic physiology/behavior of Daphnia. Here we analyzed genome-wide temporal transcriptional patterns from Daphnia pulex collected over a 44 h time period under a 12:12 LD cycle (diel) conditions using a cosine-fitting algorithm. We used a comprehensive network modeling and analysis approach to identify novel co-regulated rhythmic genes that have similar network topological properties and functional annotations as rhythmic genes identified by the cosine-fitting analyses. Furthermore, we used the network approach to predict with high accuracy novel gene-function associations, thus enhancing current functional annotations available for genes in this ecologically relevant model species. Our results reveal that genes in many functional groupings exhibit 24 h rhythms in their expression patterns under diel conditions. We highlight the rhythmic expression of immunity, oxidative detoxification, and sensory process genes. We discuss differences in the chronobiology of D. pulex from other well-characterized terrestrial arthropods. This research adds to a growing body of literature suggesting the genetic mechanisms governing rhythmicity in crustaceans may be divergent from other arthropod lineages including insects. Lastly, these results highlight the power of using a network analysis approach to identify differential gene expression and provide novel functional annotation.
Wei, Xiumei; Yang, Jianmin; Liu, Xiangquan; Yang, Dinglong; Xu, Jie; Fang, Jinghui; Wang, Weijun; Yang, Jialong
2012-08-01
C-type lectin and galectin are two types of animal carbohydrate-binding proteins which serve as pathogen recognition molecules and play crucial roles in the innate immunity of invertebrates. In the present study, a C-type lectin (designated as SgCTL-1) and galectin (designated as SgGal-1) were identified from mollusk Solen grandis, and their expression patterns, both in tissues and toward three pathogen-associated molecular patterns (PAMPs) stimulation were characterized. The full-length cDNA of SgCTL-1 and SgGal-1 was 1280 and 1466 bp, containing an open reading frame (ORF) of 519 and 1218 bp, respectively. Their deduced amino acid sequences showed high similarity to other members of C-type lectin and galectin superfamily, respectively. SgCTL-1 encoded a single carbohydrate-recognition domain (CRD), and the motif of Ca(2+)-binding site 2 was EPN (Glu(135)-Pro(136)-Asn(137)). While SgGal-1 encoded two CRDs, and the amino acid residues constituted the carbohydrate-binding motifs were well conserved in CRD1 but partially conserved in CRD2. Although SgCTL-1 and SgGal-1 exhibited different tissue expression pattern, they were both constitutively expressed in all tested tissues, including hemocytes, gonad, mantle, muscle, gill and hepatopancreas, and they were both highly expressed in hepatopancreas and gill. Furthermore, the mRNA expression of two lectins in hemocytes was significantly (P < 0.01) up-regulated with different levels after S. grandis were stimulated by lipopolysaccharide (LPS), peptidoglycan (PGN) or β-1,3-glucan. Our results suggested that SgCTL-1 and SgGal-1 from razor clam were two novel members of animal lectins, and they might function as pattern recognition receptors (PRRs) taking part in the process of pathogen recognition. Copyright © 2012 Elsevier Ltd. All rights reserved.
Zhao, Yan-Hong; Zhang, Xue-Fang; Zhao, Yan-Qiu; Bai, Fan; Qin, Fan; Sun, Jing; Dong, Ying
2017-08-01
Chronic myeloid leukemia (CML) is characterized by the accumulation of active BCR-ABL protein. Imatinib is the first-line treatment of CML; however, many patients are resistant to this drug. In this study, we aimed to compare the differences in expression patterns and functions of time-series genes in imatinib-resistant CML cells under different drug treatments. GSE24946 was downloaded from the GEO database, which included 17 samples of K562-r cells with (n=12) or without drug administration (n=5). Three drug treatment groups were considered for this study: arsenic trioxide (ATO), AMN107, and ATO+AMN107. Each group had one sample at each time point (3, 12, 24, and 48 h). Time-series genes with a ratio of standard deviation/average (coefficient of variation) >0.15 were screened, and their expression patterns were revealed based on Short Time-series Expression Miner (STEM). Then, the functional enrichment analysis of time-series genes in each group was performed using DAVID, and the genes enriched in the top ten functional categories were extracted to detect their expression patterns. Different time-series genes were identified in the three groups, and most of them were enriched in the ribosome and oxidative phosphorylation pathways. Time-series genes in the three treatment groups had different expression patterns and functions. Time-series genes in the ATO group (e.g. CCNA2 and DAB2) were significantly associated with cell adhesion, those in the AMN107 group were related to cellular carbohydrate metabolic process, while those in the ATO+AMN107 group (e.g. AP2M1) were significantly related to cell proliferation and antigen processing. In imatinib-resistant CML cells, ATO could influence genes related to cell adhesion, AMN107 might affect genes involved in cellular carbohydrate metabolism, and the combination therapy might regulate genes involved in cell proliferation.
Maize Opaque Endosperm Mutations Create Extensive Changes in Patterns of Gene ExpressionW⃞
Hunter, Brenda G.; Beatty, Mary K.; Singletary, George W.; Hamaker, Bruce R.; Dilkes, Brian P.; Larkins, Brian A.; Jung, Rudolf
2002-01-01
Maize starchy endosperm mutants have kernel phenotypes that include a brittle texture, susceptibility to insect pests, and inferior functional characteristics of products made from their flour. At least 18 such mutants have been identified, but only in the cases of opaque2 (o2) and floury2 (fl2), which affect different aspects of storage protein synthesis, is the molecular basis of the mutation known. To better understand the relationship between the phenotypes of these mutants and their biochemical bases, we characterized the protein and amino acid composition, as well as the mRNA transcript profiles, of nearly isogenic inbred lines of W64A o1, o2, o5, o9, o11, Mucuronate (Mc), Defective endosperm B30 (DeB30), and fl2. The largest reductions in zein protein synthesis occur in the W64A o2, DeB30, and fl2 mutants, which have ∼35 to 55% of the wild-type level of storage proteins. Zeins in W64A o5, o9, o11, and Mc are within 80 to 90% of the amount found in the wild type. Only in the cases of o5 and Mc were significant qualitative changes in zein synthesis observed. The pattern of gene expression in normal and mutant genotypes was assayed by profiling endosperm mRNA transcripts at 18 days after pollination with an Affymetrix GeneChip containing >1400 selected maize gene sequences. Compared with W64A sugary1, a mutant defective in starch synthesis, alterations in the gene expression patterns of the opaque mutants are very pleiotropic. Increased expression of genes associated with physiological stress, and the unfolded protein response, are common features of the opaque mutants. Based on global patterns of gene expression, these mutants were categorized in four phenotypic groups as follows: W64A+ and o1; o2; o5/o9/o11; and Mc and fl2. PMID:12368507
Gavazzi, Floriana; Pigna, Gaia; Braglia, Luca; Gianì, Silvia; Breviario, Diego; Morello, Laura
2017-12-08
Microtubules, polymerized from alpha and beta-tubulin monomers, play a fundamental role in plant morphogenesis, determining the cell division plane, the direction of cell expansion and the deposition of cell wall material. During polarized pollen tube elongation, microtubules serve as tracks for vesicular transport and deposition of proteins/lipids at the tip membrane. Such functions are controlled by cortical microtubule arrays. Aim of this study was to first characterize the flax β-tubulin family by sequence and phylogenetic analysis and to investigate differential expression of β-tubulin genes possibly related to fibre elongation and to flower development. We report the cloning and characterization of the complete flax β-tubulin gene family: exon-intron organization, duplicated gene comparison, phylogenetic analysis and expression pattern during stem and hypocotyl elongation and during flower development. Sequence analysis of the fourteen expressed β-tubulin genes revealed that the recent whole genome duplication of the flax genome was followed by massive retention of duplicated tubulin genes. Expression analysis showed that β-tubulin mRNA profiles gradually changed along with phloem fibre development in both the stem and hypocotyl. In flowers, changes in relative tubulin transcript levels took place at anthesis in anthers, but not in carpels. Phylogenetic analysis supports the origin of extant plant β-tubulin genes from four ancestral genes pre-dating angiosperm separation. Expression analysis suggests that particular tubulin subpopulations are more suitable to sustain different microtubule functions such as cell elongation, cell wall thickening or pollen tube growth. Tubulin genes possibly related to different microtubule functions were identified as candidate for more detailed studies.
Guo, Yanan; Sim, Andre D.; Kabir, M. Shahjahan; Chettri, Pranav; Ozturk, Ibrahim K.; Hunziker, Lukas; Ganley, Rebecca J.; Cox, Murray P.
2015-01-01
Summary We present genome‐wide gene expression patterns as a time series through the infection cycle of the fungal pine needle blight pathogen, Dothistroma septosporum, as it invades its gymnosperm host, Pinus radiata. We determined the molecular changes at three stages of the disease cycle: epiphytic/biotrophic (early), initial necrosis (mid) and mature sporulating lesion (late). Over 1.7 billion combined plant and fungal reads were sequenced to obtain 3.2 million fungal‐specific reads, which comprised as little as 0.1% of the sample reads early in infection. This enriched dataset shows that the initial biotrophic stage is characterized by the up‐regulation of genes encoding fungal cell wall‐modifying enzymes and signalling proteins. Later necrotrophic stages show the up‐regulation of genes for secondary metabolism, putative effectors, oxidoreductases, transporters and starch degradation. This in‐depth through‐time transcriptomic study provides our first snapshot of the gene expression dynamics that characterize infection by this fungal pathogen in its gymnosperm host. PMID:25919703
Molecular and characterization of NnPPO cDNA from lotus (Nelumbo nucifera) in rhizome browning.
Dong, C; Yu, A Q; Yang, M G; Zhou, M Q; Hu, Z L
2016-04-30
The complete cDNA (NnPPO) of polyphenol oxidase in Nelumbo nucifera was successfully isolated, using Rapid amplification cDNA end (RACE) assays. The full-length cDNA of NnPPO was 2069 bp in size, containing a 1791 bp open reading frame coding 597 amino acids. The putative NnPPO possessed the conserved active sites and domains for PPO function. Phylogenetic analysis revealed that NnPPO shared high homology with PPO of high plants, and the homology modeling proved that NnPPO had the typical structure of PPO family. In order to characterize the role of NnPPO, Real-time PCR assay demonstrated that NnPPO mRNA was expressed in different tissues of N. nucifera including young leave, rhizome, flower, root and leafstalk, with the highest expression in rhizome. Patterns of NnPPO expression in rhizome illustrated its mRNA level was significantly elevated, which was consistent with the change of NnPPO activity during rhizome browning. Therefore, transcriptional activation of NnPPO was probably the main reason causing rhizome browning.
Increased sensorimotor network activity in DYT1 dystonia: a functional imaging study
Argyelan, Miklos; Habeck, Christian; Ghilardi, M. Felice; Fitzpatrick, Toni; Dhawan, Vijay; Pourfar, Michael; Bressman, Susan B.; Eidelberg, David
2010-01-01
Neurophysiological studies have provided evidence of primary motor cortex hyperexcitability in primary dystonia, but several functional imaging studies suggest otherwise. To address this issue, we measured sensorimotor activation at both the regional and network levels in carriers of the DYT1 dystonia mutation and in control subjects. We used 15Oxygen-labelled water and positron emission tomography to scan nine manifesting DYT1 carriers, 10 non-manifesting DYT1 carriers and 12 age-matched controls while they performed a kinematically controlled motor task; they were also scanned in a non-motor audio-visual control condition. Within- and between-group contrasts were analysed with statistical parametric mapping. For network analysis, we first identified a normal motor-related activation pattern in a set of 39 motor and audio-visual scans acquired in an independent cohort of 18 healthy volunteer subjects. The expression of this pattern was prospectively quantified in the motor and control scans acquired in each of the gene carriers and controls. Network values for the three groups were compared with ANOVA and post hoc contrasts. Voxel-wise comparison of DYT1 carriers and controls revealed abnormally increased motor activation responses in the former group (P < 0.05, corrected; statistical parametric mapping), localized to the sensorimotor cortex, dorsal premotor cortex, supplementary motor area and the inferior parietal cortex. Network analysis of the normative derivation cohort revealed a significant normal motor-related activation pattern topography (P < 0.0001) characterized by covarying neural activity in the sensorimotor cortex, dorsal premotor cortex, supplementary motor area and cerebellum. In the study cohort, normal motor-related activation pattern expression measured during movement was abnormally elevated in the manifesting gene carriers (P < 0.001) but not in their non-manifesting counterparts. In contrast, in the non-motor control condition, abnormal increases in network activity were present in both groups of gene carriers (P < 0.001). In this condition, normal motor-related activation pattern expression in non-manifesting carriers was greater than in controls, but lower than in affected carriers. In the latter group, measures of normal motor-related activation pattern expression in the audio-visual condition correlated with independent dystonia clinical ratings (r = 0.70, P = 0.04). These findings confirm that overexcitability of the sensorimotor system is a robust feature of dystonia. The presence of elevated normal motor-related activation pattern expression in the non-motor condition suggests that abnormal integration of audio-visual input with sensorimotor network activity is an important trait feature of this disorder. Lastly, quantification of normal motor-related activation pattern expression in individual cases may have utility as an objective descriptor of therapeutic response in trials of new treatments for dystonia and related disorders. PMID:20207699
Cario, Gunnar; Fetz, Andrea; Bretscher, Christian; Möricke, Anja; Schrauder, Andre; Stanulla, Martin; Schrappe, Martin
2008-09-01
Response to initial glucocorticoid (GC) treatment is a strong prognostic factor in childhood acute lymphoblastic leukemia (ALL). Patients with a poor prednisone response (PPR) have a poor event-free survival as compared to those with a good prednisone response (PGR). Causes of prednisone resistance are still not well understood. We hypothesized that GC resistance is an intrinsic feature of ALL cells which is reflected in the gene expression pattern and analyzed genome-wide gene expression using microarrays. A case-control study was performed comparing gene expression profiles from initial ALL samples of 20 patients with PPR and those of 20 patients with PGR. Differential gene expression of a subset of genes was confirmed by real-time quantitative polymerase chain reaction analysis and validation was performed in a second independent patient sample (n=20). We identified 121 genes that clearly distinguished prednisone-resistant from sensitive ALL samples (FDR<5%, fold change>or=1.5). Differential gene expression of 21 of these genes could be validated in a second independent set. Of importance, there was a remarkable concordance of genes identified by comparing expression signatures of PPR and PGR cells at diagnosis and those previously described to be up- or downregulated in leukemic cells persisting under GC treatment. Thus, GC resistance seems at least in part to be an intrinsic feature of leukemic cells. Leukemic cells of patients with PPR are characterized by gene expression pattern which are similar to those of resistant cells persisting under glucocorticoid treatment.
Tu, N; Chen, H; Winnikes, U; Reinert, I; Pirke, K M; Lentes, K U
2000-09-22
Uncoupling protein-3 (UCP3) is considered as an important regulator of energy expenditure and thermogenesis in humans. To get insight into the mechanisms regulating its expression we have cloned and characterized about 5 kb of the 5'-flanking region of the human UCP3 (hUCP3) gene. 5'-RACE analysis suggested a single transcription initiation site 187 bp upstream from the translational start site. The promoter region contains both TATA and CAAT boxes as well as consensus motifs for PPRE, TRE, CRE and muscle-specific factors like MyoD and MEF2 sites. Functional characterization of a 3 kb hUCP3 promoter fragment in multiple cell lines using a CAT-ELISA identified a cis-acting negative regulatory element between -2983 and -982 while the region between -982 and -284 showed greatly increased basal promoter activity suggesting the presence of a strong enhancer element. Promoter activity was particularly enhanced in the murine skeletal muscle cell line C2C12 reflecting the tissue-selective expression pattern of UCP3.
Discover mouse gene coexpression landscapes using dictionary learning and sparse coding.
Li, Yujie; Chen, Hanbo; Jiang, Xi; Li, Xiang; Lv, Jinglei; Peng, Hanchuan; Tsien, Joe Z; Liu, Tianming
2017-12-01
Gene coexpression patterns carry rich information regarding enormously complex brain structures and functions. Characterization of these patterns in an unbiased, integrated, and anatomically comprehensive manner will illuminate the higher-order transcriptome organization and offer genetic foundations of functional circuitry. Here using dictionary learning and sparse coding, we derived coexpression networks from the space-resolved anatomical comprehensive in situ hybridization data from Allen Mouse Brain Atlas dataset. The key idea is that if two genes use the same dictionary to represent their original signals, then their gene expressions must share similar patterns, thereby considering them as "coexpressed." For each network, we have simultaneous knowledge of spatial distributions, the genes in the network and the extent a particular gene conforms to the coexpression pattern. Gene ontologies and the comparisons with published gene lists reveal biologically identified coexpression networks, some of which correspond to major cell types, biological pathways, and/or anatomical regions.
Choi, Yohan; Park, Ji Yeon; Wilson, Kalin; Rosewell, Katherine L; Brännström, Mats; Akin, James W; Curry, Thomas E; Jo, Misung
2017-06-01
The chemokine CXC motif ligand 12 (CXCL12) and its cognate receptor, CXCR4, have been implicated in the ovulatory process in various animal models. However, little is known about the expression and regulation of CXCL12 and CXCR4 and their functions during the ovulatory period in the human ovary. In this study, we characterized the expression patterns of CXCL12 and CXCR4 in preovulatory follicles collected before the luteinizing hormone (LH) surge and at defined hours after hCG administration in women with the regular menstrual cycle. The levels of mRNA and protein for CXCR4 were increased in granulosa cells of late ovulatory follicles, whereas CXCL12 expression was constant in follicles throughout the ovulatory period. Both CXCR4 and CXCL12 were localized to a subset of leukocytes around and inside the vasculature of human preovulatory follicles. Using a human granulosa cell culture model, the regulatory mechanisms and functions of CXCL12 and CXCR4 expression were investigated. Human chorionic gonadotropin (hCG) stimulated CXCR4 expression, whereas CXCL12 expression was not affected, mimicking in vivo expression patterns. Both RU486 (progesterone receptor antagonist) and CoCl2 (HIFs activator) blocked the hCG-induced increase in CXCR4 expression, whereas AG1478 (EGFR inhibitor) had no effect. The treatment with CXCL12 had no effect on granulosa cell viability but decreased hCG-stimulated CXCR4 expression. © The Authors 2017. Published by Oxford University Press on behalf of Society for the Study of Reproduction. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Characterization and expression of cyp19a gene in the Chinese giant salamander Andrias davidianus.
Hu, Qiaomu; Xiao, Hanbing; Tian, HaiFeng; Meng, Yan
2016-02-01
We cloned the full length cyp19a of Chinese giant salamander Andrias davidianus, determined its distribution in tissues and developing gonads, and analyzed the CpG methylation pattern of the cyp19a promoter. The results revealed isoforms of 1706 bp (G arom) and 1698 bp (B arom) in length, differing in the 5' flanking region, both encoding 502 amino acids. The G arom gene was observed mainly in the ovary and kidney, with little in other investigated tissues, while B arom expression was high in the brain, ovary, testis, and pituitary, with low or undetected expression in other examined tissues. Total aromatase expression was high in the ovary; moderate in the kidney, brain, testis, and pituitary; and low in the remaining tissues. G arom expression was significantly higher in the ovary than in the testis and gradually decreased with maturation of the salamander. A single injection of methyltestosterone or letrozole resulted in ovarian G arom expression decreasing over a 12-96 h period. A 1366 bp sequence of the cyp19a promoter was cloned and shown to be conserved in selected species. CpG methylation level was negatively correlated with cyp19a expression in the examined tissues and developing ovaries. Five and three CpG methylation sites positively correlated with DNA methylation levels in tissues and developing ovary, suggesting that they play an important role in regulating cyp19a expression. The aromatase gene showed two isoforms with distinct expression patterns, and the promoter methylation level at specific CpG sites was associated with variation in expression profiles of tissues and developing ovaries. Copyright © 2015 Elsevier Inc. All rights reserved.
Teles, Magda C; Cardoso, Sara D; Oliveira, Rui F
2016-01-01
Social living animals need to adjust the expression of their behavior to their status within the group and to changes in social context and this ability (social plasticity) has an impact on their Darwinian fitness. At the proximate level social plasticity must rely on neuroplasticity in the brain social decision-making network (SDMN) that underlies the expression of social behavior, such that the same neural circuit may underlie the expression of different behaviors depending on social context. Here we tested this hypothesis in zebrafish by characterizing the gene expression response in the SDMN to changes in social status of a set of genes involved in different types of neural plasticity: bdnf, involved in changes in synaptic strength; npas4, involved in contextual learning and dependent establishment of GABAergic synapses; neuroligins (nlgn1 and nlgn2) as synaptogenesis markers; and genes involved in adult neurogenesis (wnt3 and neurod). Four social phenotypes were experimentally induced: Winners and Losers of a real-opponent interaction; Mirror-fighters, that fight their own image in a mirror and thus do not experience a change in social status despite the expression of aggressive behavior; and non-interacting fish, which were used as a reference group. Our results show that each social phenotype (i.e., Winners, Losers, and Mirror-fighters) present specific patterns of gene expression across the SDMN, and that different neuroplasticity genes are differentially expressed in different nodes of the network (e.g., BDNF in the dorsolateral telencephalon, which is a putative teleost homolog of the mammalian hippocampus). Winners expressed unique patterns of gene co-expression across the SDMN, whereas in Losers and Mirror-fighters the co-expression patterns were similar in the dorsal regions of the telencephalon and in the supracommissural nucleus of the ventral telencephalic area, but differents in the remaining regions of the ventral telencephalon. These results indicate that social plasticity relies on multiple neuroplasticity mechanisms across the SDMN, and that there is not a single neuromolecular module underlying this type of behavioral flexibility.
Teles, Magda C.; Cardoso, Sara D.; Oliveira, Rui F.
2016-01-01
Social living animals need to adjust the expression of their behavior to their status within the group and to changes in social context and this ability (social plasticity) has an impact on their Darwinian fitness. At the proximate level social plasticity must rely on neuroplasticity in the brain social decision-making network (SDMN) that underlies the expression of social behavior, such that the same neural circuit may underlie the expression of different behaviors depending on social context. Here we tested this hypothesis in zebrafish by characterizing the gene expression response in the SDMN to changes in social status of a set of genes involved in different types of neural plasticity: bdnf, involved in changes in synaptic strength; npas4, involved in contextual learning and dependent establishment of GABAergic synapses; neuroligins (nlgn1 and nlgn2) as synaptogenesis markers; and genes involved in adult neurogenesis (wnt3 and neurod). Four social phenotypes were experimentally induced: Winners and Losers of a real-opponent interaction; Mirror-fighters, that fight their own image in a mirror and thus do not experience a change in social status despite the expression of aggressive behavior; and non-interacting fish, which were used as a reference group. Our results show that each social phenotype (i.e., Winners, Losers, and Mirror-fighters) present specific patterns of gene expression across the SDMN, and that different neuroplasticity genes are differentially expressed in different nodes of the network (e.g., BDNF in the dorsolateral telencephalon, which is a putative teleost homolog of the mammalian hippocampus). Winners expressed unique patterns of gene co-expression across the SDMN, whereas in Losers and Mirror-fighters the co-expression patterns were similar in the dorsal regions of the telencephalon and in the supracommissural nucleus of the ventral telencephalic area, but differents in the remaining regions of the ventral telencephalon. These results indicate that social plasticity relies on multiple neuroplasticity mechanisms across the SDMN, and that there is not a single neuromolecular module underlying this type of behavioral flexibility. PMID:26909029
Dawson, G
1994-01-01
Emotion expressions can be characterized by both the type of emotion displayed and the intensity with which the emotion is expressed. Individual differences in these two aspects of emotion appear to vary independently and may perhaps account for distinct dimensions of temperament, personality, and vulnerability to psychopathology. We reviewed several sets of data gathered in our laboratory that indicate that these two dimensions of emotion expression are associated with distinct and independent patterns of frontal EEG activity in infants. Specifically, whereas the type of emotion expression was found to be associated with asymmetries in frontal EEG activity, the intensity of emotion expression was found to be associated with generalized activation of both the right and the left frontal regions. Moreover, we reviewed and provided evidence that measures of asymmetrical frontal activity are better predictors of individual differences in the tendency to express certain emotions, such as distress and sadness, whereas measures of generalized frontal activity are better predictors of individual differences in emotional reactivity and emotion intensity. The neuroanatomical bases of emotion were discussed with special reference to the role of the frontal lobe in emotion regulation. It was hypothesized that the frontal activation asymmetries that have been found to accompany emotion expressions reflect specific regulation strategies. The left frontal region is specialized for regulation strategies involving action schemes that serve to maintain continuity and stability of the organism-environment relation and of ongoing motor schemes, such as those involved in language and the expression of happiness and interest. In contrast, the right frontal region appears to be specialized for regulation strategies that involve processing novel stimuli that disrupt ongoing activity, such as might occur during the expression of fear, disgust, and distress. Furthermore, it was proposed that individual differences in patterns of frontal EEG asymmetries during emotion may be related to socialization influences rather than solely innate factors. It was speculated that the pattern of generalized frontal lobe activation that accompanies the experience of intense emotions may reflect, in part, the relatively diffuse influence of subcortical structures on the cortex and may serve to increase the infant's general readiness to receive and respond to significant external stimuli.
CSAX: Characterizing Systematic Anomalies in eXpression Data.
Noto, Keith; Majidi, Saeed; Edlow, Andrea G; Wick, Heather C; Bianchi, Diana W; Slonim, Donna K
2015-05-01
Methods for translating gene expression signatures into clinically relevant information have typically relied upon having many samples from patients with similar molecular phenotypes. Here, we address the question of what can be done when it is relatively easy to obtain healthy patient samples, but when abnormalities corresponding to disease states may be rare and one-of-a-kind. The associated computational challenge, anomaly detection, is a well-studied machine-learning problem. However, due to the dimensionality and variability of expression data, existing methods based on feature space analysis or individual anomalously expressed genes are insufficient. We present a novel approach, CSAX, that identifies pathways in an individual sample in which the normal expression relationships are disrupted. To evaluate our approach, we have compiled and released a compendium of public expression data sets, reformulated to create a test bed for anomaly detection. We demonstrate the accuracy of CSAX on the data sets in our compendium, compare it to other leading methods, and show that CSAX aids in both identifying anomalies and explaining their underlying biology. We describe an approach to characterizing the difficulty of specific expression anomaly detection tasks. We then illustrate CSAX's value in two developmental case studies. Confirming prior hypotheses, CSAX highlights disruption of platelet activation pathways in a neonate with retinopathy of prematurity and identifies, for the first time, dysregulated oxidative stress response in second trimester amniotic fluid of fetuses with obese mothers. Our approach provides an important step toward identification of individual disease patterns in the era of precision medicine.
Molecular characterization of FLOWERING LOCUS T-like genes of apple (Malus x domestica Borkh.).
Kotoda, Nobuhiro; Hayashi, Hidehiro; Suzuki, Motoko; Igarashi, Megumi; Hatsuyama, Yoshimichi; Kidou, Shin-Ichiro; Igasaki, Tomohiro; Nishiguchi, Mitsuru; Yano, Kanako; Shimizu, Tokurou; Takahashi, Sae; Iwanami, Hiroshi; Moriya, Shigeki; Abe, Kazuyuki
2010-04-01
The two FLOWERING LOCUS T (FT)-like genes of apple (Malus x domestica Borkh.), MdFT1 and MdFT2, have been isolated and characterized. MdFT1 and MdFT2 were mapped, respectively, on distinct linkage groups (LGs) with partial homoeology, LG 12 and LG 4. The expression pattern of MdFT1 and MdFT2 differed in that MdFT1 was expressed mainly in apical buds of fruit-bearing shoots in the adult phase, with little expression in the juvenile tissues, whereas MdFT2 was expressed mainly in reproductive organs, including flower buds and young fruit. On the other hand, both genes had the potential to induce early flowering since transgenic Arabidopsis, which ectopically expressed MdFT1 or MdFT2, flowered earlier than wild-type plants. Furthermore, overexpression of MdFT1 conferred precocious flowering in apple, with altered expression of other endogenous genes, such as MdMADS12. These results suggest that MdFT1 could function to promote flowering by altering the expression of those genes and that, at least, other genes may play an important role as well in the regulation of flowering in apple. The long juvenile period of fruit trees prevents early cropping and efficient breeding. Our findings will be useful information to unveil the molecular mechanism of flowering and to develop methods to shorten the juvenile period in various fruit trees, including apple.
Cario, Elke; Brown, Dennis; McKee, Mary; Lynch-Devaney, Kathryn; Gerken, Guido; Podolsky, Daniel K.
2002-01-01
Commensal-associated molecular patterns, the major products of nonpathogenic bacteria, are present at high concentrations at the apical surface of the intestinal epithelium. However, the nature of the interaction of commensal-associated molecular patterns with the lumenal surface of the epithelium has not been defined. We have recently demonstrated that intestinal epithelial cells constitutively express several Toll-like receptors (TLRs) in vitro and in vivo that seem to be the key receptors responsible for immune cell activation in response to various bacterial products. In this study we characterize the subcellular distribution of two major TLRs, TLR2 and TLR4, and their ligand-specific dynamic regulation in the model human intestinal epithelial cell line T84. Immunocytochemical studies indicate that TLR2 and TLR4 are constitutively expressed at the apical pole of differentiated T84 cells. After stimulation with lipopolysaccharide or peptidoglycan, TLRs selectively traffic to cytoplasmic compartments near the basolateral membrane. Thus, we demonstrate that TLRs are positioned at the apical pole where they are poised to monitor the sensitive balance of the lumenal microbial array. The results of this dynamic epithelial surveillance can then be conveyed to the underlying cell populations of the lamina propria via these innate immune pattern recognition receptors. PMID:11786410
Robischon, Marcel; Du, Juan; Miura, Eriko; Groover, Andrew
2011-03-01
The secondary growth of a woody stem requires the formation of a vascular cambium at an appropriate position and proper patterning of the vascular tissues derived from the cambium. Class III homeodomain-leucine zipper (HD ZIP) transcription factors have been implicated in polarity determination and patterning in lateral organs and primary vascular tissues and in the initiation and function of shoot apical meristems. We report here the functional characterization of a Populus class III HD ZIP gene, popREVOLUTA (PRE), that demonstrates another role for class III HD ZIPs in regulating the development of cambia and secondary vascular tissues. PRE is orthologous to Arabidopsis (Arabidopsis thaliana) REVOLUTA and is expressed in both the shoot apical meristem and in the cambial zone and secondary vascular tissues. Transgenic Populus expressing a microRNA-resistant form of PRE presents unstable phenotypic abnormalities affecting both primary and secondary growth. Surprisingly, phenotypic changes include abnormal formation of cambia within cortical parenchyma that can produce secondary vascular tissues in reverse polarity. Genes misexpressed in PRE mutants include transcription factors and auxin-related genes previously implicated in class III HD ZIP functions during primary growth. Together, these results suggest that PRE plays a fundamental role in the initiation of the cambium and in regulating the patterning of secondary vascular tissues.
Bai, W L; Yang, R J; Yin, R H; Jiang, W Q; Luo, G B; Yin, R L; Zhao, S J; Li, C; Zhao, Z H
2012-04-01
Osteopontin (OPN) is a secreted phosphorylated glycoprotein. It has an important role in mammary gland development and lactation, as well as, is thought to be a potential candidate gene for lactation traits. In the present work, we isolated and characterized a full-length open reading frame (ORF) of yak OPN cDNA from lactating mammary tissue, and examined its expression pattern in mammary gland during different stages of lactation, as well as, the recombinant OPN protein of yak was expressed successfully in E. coli. The sequencing results indicated that the isolated cDNA was 1132-bp in length containing a complete ORF of 837-bp. It encoded a precursor protein of yak OPN consisting of 278 amino acid with a signal peptide of 16 amino acids. Yak OPN has a predicted molecular mass of 29285.975 Da and an isoelectric point of 4.245. It had an identity of 65.50-99.16% in cDNA, identity of 52.06-98.56% and similarity of 65.40-98.56% in deduced amino acids with the corresponding sequences of cattle, buffalo, sheep, goat, pig, human, and rabbit. The phylogenetic analysis indicated that yak OPN had the closest evolutionary relationship with that of cattle, and next buffalo. In mammary gland, yak OPN was generally transcribed in a declining pattern from colostrum period to dry period with an apparent increase of OPN expression being present in the late period of lactation compared with peak period of lactation. Western blot analysis indicated that His-tagged yak OPN protein expressed in E. coli could be recognized not only by an anti-His-tag antibody but also by an anti-human OPN antibody. These results from the present work provided a foundation for further insight into the role of OPN gene in yak lactation.
Lin, Hailan; Lin, Xijian; Zhu, Jiwei; Yu, Xiao-Qiang; Xia, Xiaofeng; Yao, Fengluan; Yang, Guang; You, Minsheng
2017-02-14
Serine protease inhibitors (SPIs) have been found in all living organisms and play significant roles in digestion, development and innate immunity. In this study, we present a genome-wide identification and expression profiling of SPI genes in the diamondback moth, Plutella xylostella (L.), a major pest of cruciferous crops with global distribution and broad resistance to different types of insecticides. A total of 61 potential SPI genes were identified in the P. xylostella genome, and these SPIs were classified into serpins, canonical inhibitors, and alpha-2-macroglobulins based on their modes of action. Sequence alignments showed that amino acid residues in the hinge region of known inhibitory serpins from other insect species were conserved in most P. xylostella serpins, suggesting that these P. xylostella serpins may be functionally active. Phylogenetic analysis confirmed that P. xylostella inhibitory serpins were clustered with known inhibitory serpins from six other insect species. More interestingly, nine serpins were highly similar to the orthologues in Manduca sexta which have been demonstrated to participate in regulating the prophenoloxidase activation cascade, an important innate immune response in insects. Of the 61 P.xylostella SPI genes, 33 were canonical SPIs containing seven types of inhibitor domains, including Kunitz, Kazal, TIL, amfpi, Antistasin, WAP and Pacifastin. Moreover, some SPIs contained additional non-inhibitor domains, including spondin_N, reeler, and other modules, which may be involved in protein-protein interactions. Gene expression profiling showed gene-differential, stage- and sex-specific expression patterns of SPIs, suggesting that SPIs may be involved in multiple physiological processes in P. xylostella. This is the most comprehensive investigation so far on SPI genes in P. xylostella. The characterized features and expression patterns of P. xylostella SPIs indicate that the SPI family genes may be involved in innate immunity of this species. Our findings provide valuable information for uncovering further biological roles of SPI genes in P. xylostella.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Krasnoshtein, F.; Buchwald, M.
1994-09-01
Fanconi anemia (FA) is an autosomal recessive disorder characterized by a variety of congenital and skeletal malformations, progressive pancytopanenia and predisposition to malignancies. FA cells display chromosomal instability and hypersensitivity to DNA-damaging agents. Both the human and the corresponding murine cDNAs have been cloned in our lab. Here we describe the expression of Facc during mouse development, using mRNA in situ hybridization. Our aim is to obtain clues on the possible function of the Facc gene product during development that may help elucidate basic defect(s) in FA. In addition, knowledge of the exact pattern of Facc expression will assist inmore » interpreting the phenotypes of mutant mice, currently being developed. In embryos the gene is diffusely expressed over the entire embryo, with higher hybridization levels in the mesenchyme and in both upper and lower extremities. Specific expression of Facc is seen in the perichondrium and marrow of long bones of hind limbs/hip; long bones of front limbs/shoulder region; developing digits of front and hind paws; and ribs. The signal is also detected in the following regions: cranial/frontal; facial/periorbital and maxillary/mandibular, hair follicles, diaphragm and lung. In addition, generalized Facc expression is seen during these embryonic stages. The pattern of Facc expression is consistent with the known skeletal abnormalities in FA patients, which include radial ray deformities, metacarpal hypoplasia, and abnormalities of lower limbs, ribs, head and face. The signal in the lung is consistent with the lung lobe absence and abnormal pulmonary drainage that have been detected in some FA patients. The sloped forehead and microcephaly in FA patients may have some association with the signal seen in the frontal region of the mouse cranium. Taken together, our results suggest that Facc is directly involved in the development of various embryonic tissues, particularly bone.« less
Hutton, John J; Jegga, Anil G; Kong, Sue; Gupta, Ashima; Ebert, Catherine; Williams, Sarah; Katz, Jonathan D; Aronow, Bruce J
2004-01-01
Background In this study we have built and mined a gene expression database composed of 65 diverse mouse tissues for genes preferentially expressed in immune tissues and cell types. Using expression pattern criteria, we identified 360 genes with preferential expression in thymus, spleen, peripheral blood mononuclear cells, lymph nodes (unstimulated or stimulated), or in vitro activated T-cells. Results Gene clusters, formed based on similarity of expression-pattern across either all tissues or the immune tissues only, had highly significant associations both with immunological processes such as chemokine-mediated response, antigen processing, receptor-related signal transduction, and transcriptional regulation, and also with more general processes such as replication and cell cycle control. Within-cluster gene correlations implicated known associations of known genes, as well as immune process-related roles for poorly described genes. To characterize regulatory mechanisms and cis-elements of genes with similar patterns of expression, we used a new version of a comparative genomics-based cis-element analysis tool to identify clusters of cis-elements with compositional similarity among multiple genes. Several clusters contained genes that shared 5–6 cis-elements that included ETS and zinc-finger binding sites. cis-Elements AP2 EGRF ETSF MAZF SP1F ZF5F and AREB ETSF MZF1 PAX5 STAT were shared in a thymus-expressed set; AP4R E2FF EBOX ETSF MAZF SP1F ZF5F and CREB E2FF MAZF PCAT SP1F STAT cis-clusters occurred in activated T-cells; CEBP CREB NFKB SORY and GATA NKXH OCT1 RBIT occurred in stimulated lymph nodes. Conclusion This study demonstrates a series of analytic approaches that have allowed the implication of genes and regulatory elements that participate in the differentiation, maintenance, and function of the immune system. Polymorphism or mutation of these could adversely impact immune system functions. PMID:15504237
Welch, Kenneth C.; Allalou, Amina; Sehgal, Prateek; Cheng, Jason; Ashok, Aarthi
2013-01-01
Glucose transporter (GLUT) proteins play a key role in the transport of monosaccharides across cellular membranes, and thus, blood sugar regulation and tissue metabolism. Patterns of GLUT expression, including the insulin-responsive GLUT4, have been well characterized in mammals. However, relatively little is known about patterns of GLUT expression in birds with existing data limited to the granivorous or herbivorous chicken, duck and sparrow. The smallest avian taxa, hummingbirds, exhibit some of the highest fasted and fed blood glucose levels and display an unusual ability to switch rapidly and completely between endogenous fat and exogenous sugar to fuel energetically expensive hovering flight. Despite this, nothing is known about the GLUT transporters that enable observed rapid rates of carbohydrate flux. We examined GLUT (GLUT1, 2, 3, & 4) expression in pectoralis, leg muscle, heart, liver, kidney, intestine and brain from both zebra finches (Taeniopygia guttata) and ruby-throated hummingbirds (Archilochus colubris). mRNA expression of all four transporters was probed using reverse-transcription PCR (RT-PCR). In addition, GLUT1 and 4 protein expression were assayed by western blot and immunostaining. Patterns of RNA and protein expression of GLUT1-3 in both species agree closely with published reports from other birds and mammals. As in other birds, and unlike in mammals, we did not detect GLUT4. A lack of GLUT4 correlates with hyperglycemia and an uncoupling of exercise intensity and relative oxidation of carbohydrates in hummingbirds. The function of GLUTs present in hummingbird muscle tissue (e.g. GLUT1 and 3) remain undescribed. Thus, further work is necessary to determine if high capillary density, and thus surface area across which cellular-mediated transport of sugars into active tissues (e.g. muscle) occurs, rather than taxon-specific differences in GLUT density or kinetics, can account for observed rapid rates of sugar flux into these tissues. PMID:24155916
PiiL: visualization of DNA methylation and gene expression data in gene pathways.
Moghadam, Behrooz Torabi; Zamani, Neda; Komorowski, Jan; Grabherr, Manfred
2017-08-02
DNA methylation is a major mechanism involved in the epigenetic state of a cell. It has been observed that the methylation status of certain CpG sites close to or within a gene can directly affect its expression, either by silencing or, in some cases, up-regulating transcription. However, a vertebrate genome contains millions of CpG sites, all of which are potential targets for methylation, and the specific effects of most sites have not been characterized to date. To study the complex interplay between methylation status, cellular programs, and the resulting phenotypes, we present PiiL, an interactive gene expression pathway browser, facilitating analyses through an integrated view of methylation and expression on multiple levels. PiiL allows for specific hypothesis testing by quickly assessing pathways or gene networks, where the data is projected onto pathways that can be downloaded directly from the online KEGG database. PiiL provides a comprehensive set of analysis features that allow for quick and specific pattern searches. Individual CpG sites and their impact on host gene expression, as well as the impact on other genes present in the regulatory network, can be examined. To exemplify the power of this approach, we analyzed two types of brain tumors, Glioblastoma multiform and lower grade gliomas. At a glance, we could confirm earlier findings that the predominant methylation and expression patterns separate perfectly by mutations in the IDH genes, rather than by histology. We could also infer the IDH mutation status for samples for which the genotype was not known. By applying different filtering methods, we show that a subset of CpG sites exhibits consistent methylation patterns, and that the status of sites affect the expression of key regulator genes, as well as other genes located downstream in the same pathways. PiiL is implemented in Java with focus on a user-friendly graphical interface. The source code is available under the GPL license from https://github.com/behroozt/PiiL.git .
Sociogenomics of Cooperation and Conflict during Colony Founding in the Fire Ant Solenopsis invicta
Manfredini, Fabio; Riba-Grognuz, Oksana; Wurm, Yannick; Keller, Laurent; Shoemaker, DeWayne; Grozinger, Christina M.
2013-01-01
One of the fundamental questions in biology is how cooperative and altruistic behaviors evolved. The majority of studies seeking to identify the genes regulating these behaviors have been performed in systems where behavioral and physiological differences are relatively fixed, such as in the honey bee. During colony founding in the monogyne (one queen per colony) social form of the fire ant Solenopsis invicta, newly-mated queens may start new colonies either individually (haplometrosis) or in groups (pleometrosis). However, only one queen (the “winner”) in pleometrotic associations survives and takes the lead of the young colony while the others (the “losers”) are executed. Thus, colony founding in fire ants provides an excellent system in which to examine the genes underpinning cooperative behavior and how the social environment shapes the expression of these genes. We developed a new whole genome microarray platform for S. invicta to characterize the gene expression patterns associated with colony founding behavior. First, we compared haplometrotic queens, pleometrotic winners and pleometrotic losers. Second, we manipulated pleometrotic couples in order to switch or maintain the social ranks of the two cofoundresses. Haplometrotic and pleometrotic queens differed in the expression of genes involved in stress response, aging, immunity, reproduction and lipid biosynthesis. Smaller sets of genes were differentially expressed between winners and losers. In the second experiment, switching social rank had a much greater impact on gene expression patterns than the initial/final rank. Expression differences for several candidate genes involved in key biological processes were confirmed using qRT-PCR. Our findings indicate that, in S. invicta, social environment plays a major role in the determination of the patterns of gene expression, while the queen's physiological state is secondary. These results highlight the powerful influence of social environment on regulation of the genomic state, physiology and ultimately, social behavior of animals. PMID:23950725
Wang, Lu; Ruan, Yong-Ling
2012-10-01
Despite substantial evidence on the essential roles of cell wall invertase (CWIN) in seed filling, it remains largely unknown how CWIN exerts its regulation early in seed development, a critical stage that sets yield potential. To fill this knowledge gap, we systematically examined the spatial and temporal expression patterns of a major CWIN gene, GhCWIN1, in cotton (Gossypium hirsutum) seeds from prefertilization to prestorage phase. GhCWIN1 messenger RNA was abundant at the innermost seed coat cell layer at 5 d after anthesis but became undetectable at 10 d after anthesis, at the onset of its differentiation into transfer cells characterized by wall ingrowths, suggesting that CWIN may negatively regulate transfer cell differentiation. Within the filial tissues, GhCWIN1 transcript was detected in endosperm cells undergoing nuclear division but not in those cells at the cellularization stage, with similar results observed in Arabidopsis (Arabidopsis thaliana) endosperm for CWIN, AtCWIN4. These findings indicate a function of CWIN in nuclear division but not cell wall biosynthesis in endosperm, contrasting to the role proposed for sucrose synthase (Sus). Further analyses revealed a preferential expression pattern of GhCWIN1 and AtCWIN4 in the provascular region of the torpedo embryos in cotton and Arabidopsis seed, respectively, indicating a role of CWIN in vascular initiation. Together, these novel findings provide insights into the roles of CWIN in regulating early seed development spatially and temporally. By comparing with previous studies on Sus expression and in conjunction with the expression of other related genes, we propose models of CWIN- and Sus-mediated regulation of early seed development.
Fourquin, Chloé; Primo, Amparo; Martínez-Fernández, Irene; Huet-Trujillo, Estefanía; Ferrándiz, Cristina
2014-01-01
Background and Aims CRABS CLAW (CRC) is a member of the YABBY family of transcription factors involved in carpel morphogenesis, floral determinacy and nectary specification in arabidopsis. CRC orthologues have been functionally characterized across angiosperms, revealing additional roles in leaf vascular development and carpel identity specification in Poaceae. These studies support an ancestral role of CRC orthologues in carpel development, while roles in vascular development and nectary specification appear to be derived. This study aimed to expand research on CRC functional conservation to the legume family in order to better understand the evolutionary history of CRC orthologues in angiosperms. Methods CRC orthologues from Pisum sativum and Medicago truncatula were identified. RNA in situ hybridization experiments determined the corresponding expression patterns throughout flower development. The phenotypic effects of reduced CRC activity were investigated in P. sativum using virus-induced gene silencing. Key Results CRC orthologues from P. sativum and M. truncatula showed similar expression patterns, mainly restricted to carpels and nectaries. However, these expression patterns differed from those of other core eudicots, most importantly in a lack of abaxial expression in the carpel and in atypical expression associated with the medial vein of the ovary. CRC downregulation in pea caused defects in carpel fusion and style/stigma development, both typically associated with CRC function in eudicots, but also affected vascular development in the carpel. Conclusions The data support the conserved roles of CRC orthologues in carpel fusion, style/stigma development and nectary development. In addition, an intriguing new aspect of CRC function in legumes was the unexpected role in vascular development, which could be shared by other species from widely diverged clades within the angiosperms, suggesting that this role could be ancestral rather than derived, as so far generally accepted. PMID:24989787
Zandawala, Meet; Haddad, Amir S; Hamoudi, Zina; Orchard, Ian
2015-09-01
The mammalian gonadotropin-releasing hormone is evolutionarily related to the arthropod adipokinetic hormone and the recently discovered adipokinetic hormone/corazonin-related peptide (ACP). The function of the ACP signaling system in arthropods is currently unknown. In the present study, we identify and characterize the ACP signaling system in the kissing bug Rhodnius prolixus. We isolated the complete cDNA sequence encoding R. prolixus ACP (Rhopr-ACP) and examined its expression pattern. Rhopr-ACP is predominantly expressed in the central nervous system. In particular, it is found in both the brain and corpus cardiacum (CC)/corpora allata (CA) complex. To gain an insight into its role in R. prolixus, we also isolated and functionally characterized cDNA sequences of three splice variants (Rhopr-ACPR-A, B and C) encoding R. prolixus ACP G protein-coupled receptor (Rhopr-ACPR). Rhopr-ACPR-A has only five transmembrane domains, whereas Rhopr-ACPR-B and C have all seven domains. Interestingly, Rhopr-ACPR-A, B and C were all activated by Rhopr-ACP, albeit at different sensitivities, when expressed in Chinese hamster ovary cells stably expressing the human G-protein G16 (CHO/G16). To our knowledge, this is the first study to isolate a truncated receptor cDNA in invertebrates that is functional in a heterologous expression system. Moreover, Rhopr-ACPR-B and C but not Rhopr-ACPR-A can be coupled with Gq α subunits. Expression profiling indicates that Rhopr-ACPR is highly expressed in the central nervous system, as well as the CC/CA complex, suggesting that it may control the release of other hormones found in the CC in a manner analogous to gonadotropin-releasing hormone. Temporal expression profiling shows that both Rhopr-ACP and Rhopr-ACPR are upregulated after ecdysis, suggesting that this neuropeptide may be involved in processes associated with post-ecdysis. © 2015 FEBS.
Han, X F; Guo, X; Li, T Z; Liu, G R; Huang, L J
2017-12-18
To evaluate the efficiency of thoracic endovascular aortic repair (TEVAR) in dealing with abdominal aortic branch malperfusion based on the analysis of aortic computed tomography angiography (CTA) images in pre- and post-TEVAR. Retrospective analysis from September 2015 to March 2016 in single institution to 32 patients, diagnosed as Stanford B aortic dissection with abdominal aortic branch malperfusion, CTA images in pre- and post-TEVAR were collected. Based on the aortic branch malperfusion pattern redefined by Nagamine, we identified and characterized branch malperfusion pattern for four abdominal aortic branches (celiac trunk, superior mesenteric artery, bilateral renal artery) in statistical analysis. In the four abdominal aortic branches (total 128 branches), 86 branches (67.2%) expressed with Class I patterns, in which subtype I-b presented with 0.8%, subtype I-c with 5.5%; 14 branches (10.9%) expressed with Class II patterns, in which subtype II-b-1 with 3.9%, subtype II-b-2 with 3.1%; 16 branches (12.5%) expressed with Class III patterns, all with subtype III-a, no subtype III-b and III-c presented. The remaining 12 branches were normal. The 100% successful rate of TEVAR obtained in 32 patients performed. The mean following-up was 4 months. Aortic CTA showed that among the 14 "high-risk" abdominal aortic branch malperfusion, 13 (92.9%) with obvious branch malperfusion in post-TEVAR were observed to improve, and the remaining one branch malperfusion (7.1%) was observed to change from subtype I-b to I-c. Few ratios in abdominal aortic branches suffered with obvious malperfusion complicated by Stanford B aortic dissection. For branches with "high-risk" malperfusion pattern, optimal changes were observed in abdominal aortic branch without revascularization in post-TEVAR, as well other branches with non-"high-risk" pattern perfusion were mostly stable in post-TEVAR. It could be of profound benefit to extend branch malperfusion patterns redefined by Nagamine in clinical practice to assess aortic dissection and in further guide for revascularization or not.
Ectopic Six3 expression in the dragon eye goldfish.
Ma, Dong-Mei; Zhu, Hua-Ping; Gui, Jian-Fang
2008-02-01
For goldfish (Carassius auratus), there are many varieties with different eye phenotypes due to artificial selection and adaptive evolution. Dragon eye is a variant eye characterized by a large-size eyeball protruding out of the socket similar to the eye of dragon in Chinese legends. In this study, anatomical structure of the goldfish dragon eye was compared with that of the common eye, and a stretching of the retina was observed in the enlarged dragon eye. Moreover, the homeobox-containing transcription factor Six3 cDNAs were cloned from the two types of goldfish, and the expression patterns were analyzed in both normal eye and dragon eye goldfish. No amino acid sequence differences were observed between the two deduced peptides, and the expression pattern of Six3 protein in dragon eye is quite similar to common eye during embryogenesis, but from 2 days after hatching, ectopic Six3 expression began to occur in the dragon eye, especially in the outer nuclear layer cells. With eye development, more predominant Six3 distribution was detected in the outer nuclear layer cells of dragon eye than that of normal eye, and fewer cell-layers in outer nuclear layer were observed in dragon eye retina than in normal eye retina. The highlight of this study is that higher Six3 expression occurs in dragon eye goldfish than in normal eye goldfish during retinal development of larvae.
Rojas-Peña, Monica L; Olivares-Navarrete, Rene; Hyzy, Sharon; Arafat, Dalia; Schwartz, Zvi; Boyan, Barbara D; Williams, Joseph; Gibson, Greg
2014-01-01
Craniosynostosis, the premature fusion of one or more skull sutures, occurs in approximately 1 in 2500 infants, with the majority of cases non-syndromic and of unknown etiology. Two common reasons proposed for premature suture fusion are abnormal compression forces on the skull and rare genetic abnormalities. Our goal was to evaluate whether different sub-classes of disease can be identified based on total gene expression profiles. RNA-Seq data were obtained from 31 human osteoblast cultures derived from bone biopsy samples collected between 2009 and 2011, representing 23 craniosynostosis fusions and 8 normal cranial bones or long bones. No differentiation between regions of the skull was detected, but variance component analysis of gene expression patterns nevertheless supports transcriptome-based classification of craniosynostosis. Cluster analysis showed 4 distinct groups of samples; 1 predominantly normal and 3 craniosynostosis subtypes. Similar constellations of sub-types were also observed upon re-analysis of a similar dataset of 199 calvarial osteoblast cultures. Annotation of gene function of differentially expressed transcripts strongly implicates physiological differences with respect to cell cycle and cell death, stromal cell differentiation, extracellular matrix (ECM) components, and ribosomal activity. Based on these results, we propose non-syndromic craniosynostosis cases can be classified by differences in their gene expression patterns and that these may provide targets for future clinical intervention.
Rojas-Peña, Monica L.; Olivares-Navarrete, Rene; Hyzy, Sharon; Arafat, Dalia; Schwartz, Zvi; Boyan, Barbara D.; Williams, Joseph; Gibson, Greg
2014-01-01
Craniosynostosis, the premature fusion of one or more skull sutures, occurs in approximately 1 in 2500 infants, with the majority of cases non-syndromic and of unknown etiology. Two common reasons proposed for premature suture fusion are abnormal compression forces on the skull and rare genetic abnormalities. Our goal was to evaluate whether different sub-classes of disease can be identified based on total gene expression profiles. RNA-Seq data were obtained from 31 human osteoblast cultures derived from bone biopsy samples collected between 2009 and 2011, representing 23 craniosynostosis fusions and 8 normal cranial bones or long bones. No differentiation between regions of the skull was detected, but variance component analysis of gene expression patterns nevertheless supports transcriptome-based classification of craniosynostosis. Cluster analysis showed 4 distinct groups of samples; 1 predominantly normal and 3 craniosynostosis subtypes. Similar constellations of sub-types were also observed upon re-analysis of a similar dataset of 199 calvarial osteoblast cultures. Annotation of gene function of differentially expressed transcripts strongly implicates physiological differences with respect to cell cycle and cell death, stromal cell differentiation, extracellular matrix (ECM) components, and ribosomal activity. Based on these results, we propose non-syndromic craniosynostosis cases can be classified by differences in their gene expression patterns and that these may provide targets for future clinical intervention. PMID:25184005
Patterning in time and space: HoxB cluster gene expression in the developing chick embryo.
Gouveia, Analuce; Marcelino, Hugo M; Gonçalves, Lisa; Palmeirim, Isabel; Andrade, Raquel P
2015-01-01
The developing embryo is a paradigmatic model to study molecular mechanisms of time control in Biology. Hox genes are key players in the specification of tissue identity during embryo development and their expression is under strict temporal regulation. However, the molecular mechanisms underlying timely Hox activation in the early embryo remain unknown. This is hindered by the lack of a rigorous temporal framework of sequential Hox expression within a single cluster. Herein, a thorough characterization of HoxB cluster gene expression was performed over time and space in the early chick embryo. Clear temporal collinearity of HoxB cluster gene expression activation was observed. Spatial collinearity of HoxB expression was evidenced in different stages of development and in multiple tissues. Using embryo explant cultures we showed that HoxB2 is cyclically expressed in the rostral presomitic mesoderm with the same periodicity as somite formation, suggesting a link between timely tissue specification and somite formation. We foresee that the molecular framework herein provided will facilitate experimental approaches aimed at identifying the regulatory mechanisms underlying Hox expression in Time and Space.
Patterning in time and space: HoxB cluster gene expression in the developing chick embryo
Gouveia, Analuce; Marcelino, Hugo M; Gonçalves, Lisa; Palmeirim, Isabel; Andrade, Raquel P
2015-01-01
The developing embryo is a paradigmatic model to study molecular mechanisms of time control in Biology. Hox genes are key players in the specification of tissue identity during embryo development and their expression is under strict temporal regulation. However, the molecular mechanisms underlying timely Hox activation in the early embryo remain unknown. This is hindered by the lack of a rigorous temporal framework of sequential Hox expression within a single cluster. Herein, a thorough characterization of HoxB cluster gene expression was performed over time and space in the early chick embryo. Clear temporal collinearity of HoxB cluster gene expression activation was observed. Spatial collinearity of HoxB expression was evidenced in different stages of development and in multiple tissues. Using embryo explant cultures we showed that HoxB2 is cyclically expressed in the rostral presomitic mesoderm with the same periodicity as somite formation, suggesting a link between timely tissue specification and somite formation. We foresee that the molecular framework herein provided will facilitate experimental approaches aimed at identifying the regulatory mechanisms underlying Hox expression in Time and Space. PMID:25602523
Oudin, Madeleine J; Hughes, Shannon K; Rohani, Nazanin; Moufarrej, Mira N; Jones, Joan G; Condeelis, John S; Lauffenburger, Douglas A; Gertler, Frank B
2016-03-01
Several functionally distinct isoforms of the actin regulatory Mena are produced by alternative splicing during tumor progression. Forced expression of the Mena(INV) isoform drives invasion, intravasation and metastasis. However, the abundance and distribution of endogenously expressed Mena(INV) within primary tumors during progression remain unknown, as most studies to date have only assessed relative mRNA levels from dissociated tumor samples. We have developed a Mena(INV) isoform-specific monoclonal antibody and used it to examine Mena(INV) expression patterns in mouse mammary and human breast tumors. Mena(INV) expression increases during tumor progression and to examine the relationship between Mena(INV) expression and markers for epithelial or mesenchymal status, stemness, stromal cell types and hypoxic regions. Further, while Mena(INV) robustly expressed in vascularized areas of the tumor, it is not confined to cells adjacent to blood vessels. Altogether, these data demonstrate the specificity and utility of the anti-Mena(INV)-isoform specific antibody, and provide the first description of endogenous Mena(INV) protein expression in mouse and human tumors.
New insights into plant glycoside hydrolase family 32 in Agave species
Avila de Dios, Emmanuel; Gomez Vargas, Alan D.; Damián Santos, Maura L.; Simpson, June
2015-01-01
In order to optimize the use of agaves for commercial applications, an understanding of fructan metabolism in these species at the molecular and genetic level is essential. Based on transcriptome data, this report describes the identification and molecular characterization of cDNAs and deduced amino acid sequences for genes encoding fructosyltransferases, invertases and fructan exohydrolases (FEH) (enzymes belonging to plant glycoside hydrolase family 32) from four different agave species (A. tequilana, A. deserti, A. victoriae-reginae, and A. striata). Conserved amino acid sequences and a hypervariable domain allowed classification of distinct isoforms for each enzyme type. Notably however neither 1-FFT nor 6-SFT encoding cDNAs were identified. In silico analysis revealed that distinct isoforms for certain enzymes found in a single species, showed different levels and tissue specific patterns of expression whereas in other cases expression patterns were conserved both within the species and between different species. Relatively high levels of in silico expression for specific isoforms of both invertases and fructosyltransferases were observed in floral tissues in comparison to vegetative tissues such as leaves and stems and this pattern was confirmed by Quantitative Real Time PCR using RNA obtained from floral and leaf tissue of A. tequilana. Thin layer chromatography confirmed the presence of fructans with degree of polymerization (DP) greater than DP three in both immature buds and fully opened flowers also obtained from A. tequilana. PMID:26300895
New insights into plant glycoside hydrolase family 32 in Agave species.
Avila de Dios, Emmanuel; Gomez Vargas, Alan D; Damián Santos, Maura L; Simpson, June
2015-01-01
In order to optimize the use of agaves for commercial applications, an understanding of fructan metabolism in these species at the molecular and genetic level is essential. Based on transcriptome data, this report describes the identification and molecular characterization of cDNAs and deduced amino acid sequences for genes encoding fructosyltransferases, invertases and fructan exohydrolases (FEH) (enzymes belonging to plant glycoside hydrolase family 32) from four different agave species (A. tequilana, A. deserti, A. victoriae-reginae, and A. striata). Conserved amino acid sequences and a hypervariable domain allowed classification of distinct isoforms for each enzyme type. Notably however neither 1-FFT nor 6-SFT encoding cDNAs were identified. In silico analysis revealed that distinct isoforms for certain enzymes found in a single species, showed different levels and tissue specific patterns of expression whereas in other cases expression patterns were conserved both within the species and between different species. Relatively high levels of in silico expression for specific isoforms of both invertases and fructosyltransferases were observed in floral tissues in comparison to vegetative tissues such as leaves and stems and this pattern was confirmed by Quantitative Real Time PCR using RNA obtained from floral and leaf tissue of A. tequilana. Thin layer chromatography confirmed the presence of fructans with degree of polymerization (DP) greater than DP three in both immature buds and fully opened flowers also obtained from A. tequilana.
SoxB1-driven transcriptional network underlies neural-specific interpretation of morphogen signals.
Oosterveen, Tony; Kurdija, Sanja; Ensterö, Mats; Uhde, Christopher W; Bergsland, Maria; Sandberg, Magnus; Sandberg, Rickard; Muhr, Jonas; Ericson, Johan
2013-04-30
The reiterative deployment of a small cadre of morphogen signals underlies patterning and growth of most tissues during embyogenesis, but how such inductive events result in tissue-specific responses remains poorly understood. By characterizing cis-regulatory modules (CRMs) associated with genes regulated by Sonic hedgehog (Shh), retinoids, or bone morphogenetic proteins in the CNS, we provide evidence that the neural-specific interpretation of morphogen signaling reflects a direct integration of these pathways with SoxB1 proteins at the CRM level. Moreover, expression of SoxB1 proteins in the limb bud confers on mesodermal cells the potential to activate neural-specific target genes upon Shh, retinoid, or bone morphogenetic protein signaling, and the collocation of binding sites for SoxB1 and morphogen-mediatory transcription factors in CRMs faithfully predicts neural-specific gene activity. Thus, an unexpectedly simple transcriptional paradigm appears to conceptually explain the neural-specific interpretation of pleiotropic signaling during vertebrate development. Importantly, genes induced in a SoxB1-dependent manner appear to constitute repressive gene regulatory networks that are directly interlinked at the CRM level to constrain the regional expression of patterning genes. Accordingly, not only does the topology of SoxB1-driven gene regulatory networks provide a tissue-specific mode of gene activation, but it also determines the spatial expression pattern of target genes within the developing neural tube.
High-Dimensional Sparse Factor Modeling: Applications in Gene Expression Genomics
Carvalho, Carlos M.; Chang, Jeffrey; Lucas, Joseph E.; Nevins, Joseph R.; Wang, Quanli; West, Mike
2010-01-01
We describe studies in molecular profiling and biological pathway analysis that use sparse latent factor and regression models for microarray gene expression data. We discuss breast cancer applications and key aspects of the modeling and computational methodology. Our case studies aim to investigate and characterize heterogeneity of structure related to specific oncogenic pathways, as well as links between aggregate patterns in gene expression profiles and clinical biomarkers. Based on the metaphor of statistically derived “factors” as representing biological “subpathway” structure, we explore the decomposition of fitted sparse factor models into pathway subcomponents and investigate how these components overlay multiple aspects of known biological activity. Our methodology is based on sparsity modeling of multivariate regression, ANOVA, and latent factor models, as well as a class of models that combines all components. Hierarchical sparsity priors address questions of dimension reduction and multiple comparisons, as well as scalability of the methodology. The models include practically relevant non-Gaussian/nonparametric components for latent structure, underlying often quite complex non-Gaussianity in multivariate expression patterns. Model search and fitting are addressed through stochastic simulation and evolutionary stochastic search methods that are exemplified in the oncogenic pathway studies. Supplementary supporting material provides more details of the applications, as well as examples of the use of freely available software tools for implementing the methodology. PMID:21218139
Kleene, Kenneth C
2005-01-01
This review proposes that the peculiar patterns of gene expression in spermatogenic cells are the consequence of powerful evolutionary forces known as sexual selection. Sexual selection is generally characterized by intense competition of males for females, an enormous variety of the strategies to maximize male reproductive success, exaggerated male traits at all levels of biological organization, co-evolution of sexual traits in males and females, and conflict between the sexual advantage of the male trait and the reproductive fitness of females and the individual fitness of both sexes. In addition, spermatogenesis is afflicted by selfish genes that promote their transmission to progeny while causing deleterious effects. Sexual selection, selfish genes, and genetic conflict provide compelling explanations for many atypical features of gene expression in spermatogenic cells including the gross overexpression of certain mRNAs, transcripts encoding truncated proteins that cannot carry out basic functions of the proteins encoded by the same genes in somatic cells, the large number of gene families containing paralogous genes encoding spermatogenic cell-specific isoforms, the large number of testis-cancer-associated genes that are expressed only in spermatogenic cells and malignant cells, and the overbearing role of Sertoli cells in regulating the number and quality of spermatozoa.
Ren, Xianyun; Yu, Xuan; Gao, Baoquan; Liu, Ping; Li, Jian
2017-07-01
Caspases are a family of proteases involved in many important biological processes including apoptosis and inflammation. In this study, we analyzed the expression patterns and effects on immune response in various tissues of the edible crab Portunus trituberculatus. PtCas 2, PtCas 3 and PtCas 4 share overall sequence identities of 55.88%-74.86%, 8.47%-46.54% and 20.11%-50.87%, respectively, with their other crustacean species. PtCas 2, PtCas 3 and PtCas 4 have the same caspase domain and catalytic site found in known caspases. The expression levels of the three caspases differed between tissues. Following bacterial and viral infection, the expression levels of the three caspases reached a maximum level at 24 h post-infection (hpi) in case of bacteria, whereas it was 48 hpi in virus. Moreover, the WSSV, Vibrio alginolyticus or V. parahaemolyticus induced the activities of PtCas 2-4 in a time-dependent manner. These results indicate an involvement of caspases in bacterial and viral induced immune response and demonstrate for the first time that PtCas 2, PtCas 3 and PtCas 4 are essential for optimal response to bacterial and virus infection in crabs. Copyright © 2017 Elsevier Ltd. All rights reserved.
Gan, Zhen; Wang, Bei; Zhou, Wei; Lu, Yishan; Zhu, Weiwei; Tang, Jufen; Jian, JiChang; Wu, Zaohe
2015-05-01
CD59, the major inhibitor of membrane attack complex, plays a crucial role in regulation of complement activation. In this paper, a CD59 gene of Nile tilapia, Oreochromis niloticus (designated as On-CD59) was cloned and its expression pattern under the stimulation of Streptococcus agalactiae was investigated. Sequence analysis showed main structural features required for complement-inhibitory activity were detected in the deduced amino acid sequence of On-CD59. In healthy Nile tilapia, the On-CD59 transcripts could be detected in all the examined tissues, with the most abundant expression in the brain. When immunized with inactivated S. agalactiae, there was a clear time-dependent expression pattern of On-CD59 in the skin, brain, head kidney, thymus and spleen, with quite different kinetic expressions. The assays for the complement-inhibitory activity suggested that recombinant On-CD59 protein had a species-selective inhibition of complement. Moreover, our works showed that recombinant On-CD59 protein may possess both binding activities to PGN and LTA and inhibiting activity of S. agalactiae. These findings indicated that On-CD59 may play important roles in the immune response to S. agalactiae in Nile tilapia. Copyright © 2015 Elsevier Ltd. All rights reserved.
The Peripheral Olfactory Repertoire of the Lightbrown Apple Moth, Epiphyas postvittana
Thrimawithana, Amali H.; Crowhurst, Ross N.; Newcomb, Richard D.
2015-01-01
The lightbrown apple moth, Epiphyas postvittana is an increasingly global pest of horticultural crops. Like other moths, E. postvittana relies on olfactory cues to locate mates and oviposition sites. To detect these cues, moths have evolved families of genes encoding elements of the peripheral olfactory reception system, including odor carriers, receptors and degrading enzymes. Here we undertake a transcriptomic approach to identify members of these families expressed in the adult antennae of E. postvittana, describing open reading frames encoding 34 odorant binding proteins, 13 chemosensory proteins, 70 odorant receptors, 19 ionotropic receptors, nine gustatory receptors, two sensory neuron membrane proteins, 27 carboxylesterases, 20 glutathione-S-transferases, 49 cytochrome p450s and 18 takeout proteins. For the odorant receptors, quantitative RT-PCR corroborated RNAseq count data on steady state transcript levels. Of the eight odorant receptors that group phylogenetically with pheromone receptors from other moths, two displayed significant male-biased expression patterns, one displayed significant female-biased expression pattern and five were expressed equally in the antennae of both sexes. In addition, we found two male-biased odorant receptors that did not group with previously described pheromone receptors. This suite of olfaction-related genes provides a substantial resource for the functional characterization of this signal transduction system and the development of odor-mediated control strategies for horticultural pests. PMID:26017144
Characterization and expression profiles of MaACS and MaACO genes from mulberry (Morus alba L.)*
Liu, Chang-ying; Lü, Rui-hua; Li, Jun; Zhao, Ai-chun; Wang, Xi-ling; Diane, Umuhoza; Wang, Xiao-hong; Wang, Chuan-hong; Yu, Ya-sheng; Han, Shu-mei; Lu, Cheng; Yu, Mao-de
2014-01-01
1-Aminocyclopropane-1-carboxylic acid synthase (ACS) and 1-aminocyclopropane-1-carboxylic acid oxidase (ACO) are encoded by multigene families and are involved in fruit ripening by catalyzing the production of ethylene throughout the development of fruit. However, there are no reports on ACS or ACO genes in mulberry, partly because of the limited molecular research background. In this study, we have obtained five ACS gene sequences and two ACO gene sequences from Morus Genome Database. Sequence alignment and phylogenetic analysis of MaACO1 and MaACO2 showed that their amino acids are conserved compared with ACO proteins from other species. MaACS1 and MaACS2 are type I, MaACS3 and MaACS4 are type II, and MaACS5 is type III, with different C-terminal sequences. Quantitative reverse transcriptase polymerase chain reaction (qRT-PCR) expression analysis showed that the transcripts of MaACS genes were strongly expressed in fruit, and more weakly in other tissues. The expression of MaACO1 and MaACO2 showed different patterns in various mulberry tissues. MaACS and MaACO genes demonstrated two patterns throughout the development of mulberry fruit, and both of them were strongly up-regulated by abscisic acid (ABA) and ethephon. PMID:25001221
Characterization of the c-type lysozyme gene family in Anopheles gambiae.
Li, Bin; Calvo, Eric; Marinotti, Osvaldo; James, Anthony A; Paskewitz, Susan M
2005-11-07
Seven new c-type lysozyme genes were found using the Anopheles gambiae genome sequence, increasing to eight the total number of genes in this family identified in this species. The eight lysozymes in An. gambiae have considerable variation in gene structure and expression patterns. Lys c-6 has the most unusual primary amino acid structure as the predicted protein consists of five lysozyme-like domains. Transcript abundance of each c-type lysozyme was determined by semiquantitative RT-PCR. Lys c-1, c-6 and c-7 are expressed constitutively in all developmental stages from egg to adult. Lys c-2 and c-4 also are found in all stages, but with relatively much higher levels in adults. Conversely, Lys c-3 and c-8 transcripts are highest in larvae. Lys c-1, c-6 and c-7 transcripts are found in nearly all the adult tissue samples examined while Lys c-2 and Lys c-4 are more restricted in their expression. Lys c-1 and c-2 transcripts are clearly immune responsive and are increased significantly 6-12 h post challenge with bacteria. The functional adaptive changes that may have evolved during the expansion of this gene family are briefly discussed in terms of the expression patterns, gene and protein structures.
Hubert, Amy; Henderson, Jordana M; Cowles, Martis W; Ross, Kelly G; Hagen, Matthew; Anderson, Christa; Szeterlak, Claudia J; Zayas, Ricardo M
2015-10-12
Planarians are renowned for their regenerative capacity and are an attractive model for the study of adult stem cells and tissue regeneration. In an effort to better understand the molecular mechanisms underlying planarian regeneration, we performed a functional genomics screen aimed at identifying genes involved in this process in Schmidtea mediterranea. We used microarrays to detect changes in gene expression in regenerating and non-regenerating tissues in planarians regenerating one side of the head and followed this with high-throughput screening by in situ hybridization and RNAi to characterize the expression patterns and function of the differentially expressed genes. Along with five previously characterized genes (Smed-cycD, Smed-morf41/mrg-1, Smed-pdss2/dlp1, Smed-slbp, and Smed-tph), we identified 20 additional genes necessary for stem cell maintenance (Smed-sart3, Smed-smarcc-1, Smed-espl1, Smed-rrm2b-1, Smed-rrm2b-2, Smed-dkc1, Smed-emg1, Smed-lig1, Smed-prim2, Smed-mcm7, and a novel sequence) or general regenerative capability (Smed-rbap46/48-2, Smed-mcm2, Smed-ptbp1, and Smed-fen-1) or that caused tissue-specific defects upon knockdown (Smed-ddc, Smed-gas8, Smed-pgbd4, and Smed-b9d2). We also found that a homolog of the nuclear transport factor Importin-α plays a role in stem cell function and tissue patterning, suggesting that controlled nuclear import of proteins is important for regeneration. Through this work, we described the roles of several previously uncharacterized genes in planarian regeneration and implicated nuclear import in this process. We have additionally created an online database to house our in situ and RNAi data to make it accessible to the planarian research community.
Pham, Tammy L; St-Pierre, Marie-Eve; Ravel-Chapuis, Aymeric; Parks, Tara E C; Langlois, Stéphanie; Penuela, Silvia; Jasmin, Bernard J; Cowan, Kyle N
2018-05-10
Pannexin 1 (Panx1) and Pannexin 3 (Panx3) are single membrane channels recently implicated in myogenic commitment, as well as myoblast proliferation and differentiation in vitro. However, their expression patterns during skeletal muscle development and regeneration had yet to be investigated. Here, we show that Panx1 levels increase during skeletal muscle development becoming highly expressed together with Panx3 in adult skeletal muscle. In adult mice, Panx1 and Panx3 were differentially expressed in fast- and slow-twitch muscles. We also report that Panx1/PANX1 and Panx3/PANX3 are co-expressed in mouse and human satellite cells, which play crucial roles in skeletal muscle regeneration. Interestingly, Panx1 and Panx3 levels were modulated in muscle degeneration/regeneration, similar to the pattern seen during skeletal muscle development. As Duchenne muscular dystrophy is characterized by skeletal muscle degeneration and impaired regeneration, we next used mild and severe mouse models of this disease and found a significant dysregulation of Panx1 and Panx3 levels in dystrophic skeletal muscles. Together, our results are the first demonstration that Panx1 and Panx3 are differentially expressed amongst skeletal muscle types with their levels being highly modulated during skeletal muscle development, regeneration, and dystrophy. These findings suggest that Panx1 and Panx3 channels may play important and distinct roles in healthy and diseased skeletal muscles. © 2018 Wiley Periodicals, Inc.
NASA Astrophysics Data System (ADS)
Wen, Haishen; Si, Yufeng; Zhang, Yuanqing; He, Feng; Li, Jifang
2015-03-01
Follistatin (FST) is a monomeric glycoprotein highly enriched in cysteines and belongs to TGF-β superfamily. FST can suppress the secretion of follicle-stimulating hormone and plays a vital role in the reproduction of vertebrates. We used rapid amplification of cDNA ends technology to clone the FST gene of half-smooth tongue sole, Cynoglossus semilaevis. We characterized its phylogenetic context and expression patterns to elucidate its function in the breeding season. The full-length sequence of FST is 1 455 bp and encodes a protein of 321 amino acids. We investigated the expression pattern of FST in C. semilaevis at different stages of reproduction using reverse transcription-polymerase chain reaction (RTPCR). FST mRNA was expressed in all 13 tissues analyzed, and was expressed at high levels in gonad and at slightly lower levels in gill and brain. During the reproductive cycle of C. semilaevis, the transcript level of FST was the highest in the perinucleolus stage, decreased in the primary yolk stage, slightly increased in the tertiary yolk stage, and then reduced to a minimal level in the atretic follicles stage of the ovary. We concluded that FST suppressed follicle-stimulating hormone, which stimulated oocyte development. However, no significant variation was observed across all stages of testis development, although the expression level in the spermatogenesis stage was relatively low, which may result from the regulation of FST by aromatase.
Lu, Yanhui; Bai, Qi; Zheng, Xusong; Lu, Zhongxian
2017-08-01
Catalase (CAT) is an important antioxidant enzyme that protects organisms against oxidative stresses by eliminating hydrogen peroxide. In this study, we cloned and characterized a full-length cDNA of CAT from Chilo suppressalis (CsCAT) and examined the influence of environmental stresses on CsCAT expression and enzyme activity. The cDNA contains a 1659-bp open reading frame encoding a polypeptide of 553 amino acids most closely related (90.14%) to Papilio polytes catalases. The CsCAT was expressed in all developmental stages with the highest expression in the fat body, and the CsCAT enzyme activity closely mirrored its observed mRNA expression patterns. The CsCAT mRNA was up-regulated when the larvae were exposed to high temperature (≥30 °C), insecticides (abamectin and chlorantraniliprole), chemicals (H2O2, CHP, CdCl2, and CuSO4), and a dead-end trap plant (vetiver grass), and the CsCAT enzyme activity again mirrored the observed CsCAT expression patterns. These results suggest that up-regulation of CsCAT may enhance the defense response of C. suppressalis by weakening the effects of environmental stresses, and provide insight into the role of CsCAT during development of C. suppressalis. © The Authors 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Liu, Yan-Xia; Li, Fen-Xiang; Liu, Zhuan-Zhuan; Jia, Zhi-Rong; Zhou, Yan-He; Zhang, Hao; Yan, Hui; Zhou, Xian-Qiang; Chen, Xiao-Guang
2016-06-01
Mosquito microRNAs (miRNAs) are involved in host-virus interaction, and have been reported to be altered by dengue virus (DENV) infection in Aedes albopictus (Diptera: Culicidae). However, little is known about the molecular mechanisms of Aedes albopictus midgut-the first organ to interact with DENV-involved in its resistance to DENV. Here we used high-throughput sequencing to characterize miRNA and messenger RNA (mRNA) expression patterns in Aedes albopictus midgut in response to dengue virus serotype 2. A total of three miRNAs and 777 mRNAs were identified to be differentially expressed upon DENV infection. For the mRNAs, we identified 198 immune-related genes and 31 of them were differentially expressed. Gene Ontology and Kyoto Encyclopedia of Genes and Genomes enrichment analyses also showed that the differentially expressed immune-related genes were involved in immune response. Then the differential expression patterns of six immune-related genes and three miRNAs were confirmed by real-time reverse transcription polymerase chain reaction. Furthermore, seven known miRNA-mRNA interaction pairs were identified by aligning our two datasets. These analyses of miRNA and mRNA transcriptomes provide valuable information for uncovering the DENV response genes and provide a basis for future study of the resistance mechanisms in Aedes albopictus midgut. © 2016 Institute of Zoology, Chinese Academy of Sciences.
Civetta, Alberto
2016-05-01
Understanding the origin of species is of interest to biologist in general and evolutionary biologist in particular. Hybrid male sterility (HMS) has been a focus in studies of speciation because sterility imposes a barrier to free gene flow between organisms, thus effectively isolating them as distinct species. In this review, I focus on the role of differential gene expression in HMS and speciation. Microarray and qPCR assays have established associations between misregulation of gene expression and sterility in hybrids between closely related species. These studies originally proposed disrupted expression of spermatogenesis genes as a causative of sterility. Alternatively, rapid genetic divergence of regulatory elements, particularly as they relate to the male sex (fast-male evolution), can drive the misregulation of sperm developmental genes in the absence of sterility. The use of fertile hybrids (both backcross and F1 progeny) as controls has lent support to this alternative explanation. Differences in gene expression between fertile and sterile hybrids can also be influenced by a pattern of faster evolution of the sex chromosome (fast-X evolution) than autosomes. In particular, it would be desirable to establish whether known X-chromosome sterility factors can act as trans-regulatory drivers of genome-wide patterns of misregulation. Genome-wide expression studies coupled with assays of proxies of sterility in F1 and BC progeny have identified candidate HMS genes but functional assays, and a better phenotypic characterization of sterility phenotypes, are needed to rigorously test how these genes might contribute to HMS.
Parabolic flight induces changes in gene expression patterns in Arabidopsis thaliana.
Paul, Anna-Lisa; Manak, Michael S; Mayfield, John D; Reyes, Matthew F; Gurley, William B; Ferl, Robert J
2011-10-01
Our primary objective was to evaluate gene expression changes in Arabidopsis thaliana in response to parabolic flight as part of a comprehensive approach to the molecular biology of spaceflight-related adaptations. In addition, we wished to establish parabolic flight as a tractable operations platform for molecular biology studies. In a succession of experiments on NASA's KC-135 and C-9 parabolic aircraft, Arabidopsis plants were presented with replicated exposure to parabolic flight. Transcriptome profiling revealed that parabolic flight caused changes in gene expression patterns that stood the statistical tests of replication on three different flight days. The earliest response, after 20 parabolas, was characterized by a prominence of genes associated with signal transduction. After 40 parabolas, this prominence was largely replaced by genes associated with biotic and abiotic stimuli and stress. Among these responses, three metabolic processes stand out in particular: the induction of auxin metabolism and signaling, the differential expression of genes associated with calcium-mediated signaling, and the repression of genes associated with disease resistance and cell wall biochemistry. Many, but not all, of these responses are known to be involved in gravity sensing in plants. Changes in auxin-related gene expression were also recorded by reporter genes tuned to auxin signal pathways. These data demonstrate that the parabolic flight environment is appropriate for molecular biology research involving the transition to microgravity, in that with replication, proper controls, and analyses, gene expression changes can be observed in the time frames of typical parabolic flight experiments.
Hussain, Khalid; Mungikar, Kanak; Kulkarni, Abhijeet; Kamble, Avinash
2018-05-05
Upon confrontation with unfavourable conditions, plants invoke a very complex set of biochemical and physiological reactions and alter gene expression patterns to combat the situations. MicroRNAs (miRNAs), a class of small non-coding RNA, contribute extensively in regulation of gene expression through translation inhibition or degradation of their target mRNAs during such conditions. Therefore, identification of miRNAs and their targets holds importance in understanding the regulatory networks triggered during stress. Structure and sequence similarity based in silico prediction of miRNAs in Cajanus cajan L. (Pigeonpea) draft genome sequence has been carried out earlier. These annotations also appear in related GenBank genome sequence entries. However, there are no reports available on context dependent miRNA expression and their targets in pigeonpea. Therefore, in the present study we addressed these questions computationally, using pigeonpea EST sequence information. We identified five novel pigeonpea miRNA precursors, their mature forms and targets. Interestingly, only one of these miRNAs (miR169i-3p) was identified earlier in draft genome sequence. We then validated expression of these miRNAs, experimentally. It was also observed that these miRNAs show differential expression patterns in response to Fusarium inoculation indicating their biotic stress responsive nature. Overall these results will help towards better understanding the regulatory network of defense during pigeonpea -pathogen interactions and role of miRNAs in the process. Copyright © 2018 Elsevier B.V. All rights reserved.
Identification and characterization of microRNAs in Phaseolus vulgaris by high-throughput sequencing
2012-01-01
Background MicroRNAs (miRNAs) are endogenously encoded small RNAs that post-transcriptionally regulate gene expression. MiRNAs play essential roles in almost all plant biological processes. Currently, few miRNAs have been identified in the model food legume Phaseolus vulgaris (common bean). Recent advances in next generation sequencing technologies have allowed the identification of conserved and novel miRNAs in many plant species. Here, we used Illumina's sequencing by synthesis (SBS) technology to identify and characterize the miRNA population of Phaseolus vulgaris. Results Small RNA libraries were generated from roots, flowers, leaves, and seedlings of P. vulgaris. Based on similarity to previously reported plant miRNAs,114 miRNAs belonging to 33 conserved miRNA families were identified. Stem-loop precursors and target gene sequences for several conserved common bean miRNAs were determined from publicly available databases. Less conserved miRNA families and species-specific common bean miRNA isoforms were also characterized. Moreover, novel miRNAs based on the small RNAs were found and their potential precursors were predicted. In addition, new target candidates for novel and conserved miRNAs were proposed. Finally, we studied organ-specific miRNA family expression levels through miRNA read frequencies. Conclusions This work represents the first massive-scale RNA sequencing study performed in Phaseolus vulgaris to identify and characterize its miRNA population. It significantly increases the number of miRNAs, precursors, and targets identified in this agronomically important species. The miRNA expression analysis provides a foundation for understanding common bean miRNA organ-specific expression patterns. The present study offers an expanded picture of P. vulgaris miRNAs in relation to those of other legumes. PMID:22394504
The many faces of REST oversee epigenetic programming of neuronal genes.
Ballas, Nurit; Mandel, Gail
2005-10-01
Nervous system development relies on a complex signaling network to engineer the orderly transitions that lead to the acquisition of a neural cell fate. Progression from the non-neuronal pluripotent stem cell to a restricted neural lineage is characterized by distinct patterns of gene expression, particularly the restriction of neuronal gene expression to neurons. Concurrently, cells outside the nervous system acquire and maintain a non-neuronal fate that permanently excludes expression of neuronal genes. Studies of the transcriptional repressor REST, which regulates a large network of neuronal genes, provide a paradigm for elucidating the link between epigenetic mechanisms and neurogenesis. REST orchestrates a set of epigenetic modifications that are distinct between non-neuronal cells that give rise to neurons and those that are destined to remain as nervous system outsiders.
McDuffie, Andrea S.; Hagerman, Randi J.; Abbeduto, Leonard
2013-01-01
In light of evidence that receptive language may be a relative weakness for individuals with autism spectrum disorder (ASD), this study characterized receptive vocabulary profiles in boys with ASD using cross-sectional developmental trajectories relative to age, nonverbal cognition, and expressive vocabulary. Participants were 49 boys with ASD (4–11 years) and 80 typically developing boys (2–11 years). Receptive vocabulary, assessed with the Peabody Picture Vocabulary Test, was a weakness for boys with ASD relative to age and nonverbal cognition. Relative to expressive vocabulary, assessed with the Expressive Vocabulary Test, receptive vocabulary increased at a lower rate for boys with ASD. Vocabulary trajectories in ASD are distinguished from typical development; however, nonverbal cognition largely accounts for the patterns observed. PMID:23588510
2010-01-01
Background Carotenoids are a group of C40 isoprenoid molecules that play diverse biological and ecological roles in plants. Tomato is an important vegetable in human diet and provides the vitamin A precursor β-carotene. Genes encoding enzymes involved in carotenoid biosynthetic pathway have been cloned. However, regulation of genes involved in carotenoid biosynthetic pathway and accumulation of specific carotenoid in chromoplasts are not well understood. One of the approaches to understand regulation of carotenoid metabolism is to characterize the promoters of genes encoding proteins involved in carotenoid metabolism. Lycopene β-cyclase is one of the crucial enzymes in carotenoid biosynthesis pathway in plants. Its activity is required for synthesis of both α-and β-carotenes that are further converted into other carotenoids such as lutein, zeaxanthin, etc. This study describes the isolation and characterization of chromoplast-specific Lycopene β-cyclase (CYC-B) promoter from a green fruited S. habrochaites genotype EC520061. Results A 908 bp region upstream to the initiation codon of the Lycopene β-cyclase gene was cloned and identified as full-length promoter. To identify promoter region necessary for regulating developmental expression of the ShCYC-B gene, the full-length promoter and its three different 5' truncated fragments were cloned upstream to the initiation codon of GUS reporter cDNA in binary vectors. These four plant transformation vectors were separately transformed in to Agrobacterium. Agrobacterium-mediated transient and stable expression systems were used to study the GUS expression driven by the full-length promoter and its 5' deletion fragments in tomato. The full-length promoter showed a basal level activity in leaves, and its expression was upregulated > 5-fold in flowers and fruits in transgenic tomato plants. Deletion of -908 to -577 bp 5' to ATG decreases the ShCYC-B promoter strength, while deletion of -908 to -437 bp 5' to ATG led to significant increase in the activity of GUS in the transgenic plants. Promoter deletion analysis led to the identification of a short promoter region (-436 bp to ATG) that exhibited a higher promoter strength but similar developmental expression pattern as compared with the full-length ShCYC-B promoter. Conclusion Functional characterization of the full-length ShCYC-B promoter and its deletion fragments in transient expression system in fruto as well as in stable transgenic tomato revealed that the promoter is developmentally regulated and its expression is upregulated in chromoplast-rich flowers and fruits. Our study identified a short promoter region with functional activity and developmental expression pattern similar to that of the full-length ShCYC-B promoter. This 436 bp promoter region can be used in promoter::reporter fusion molecular genetic screens to identify mutants impaired in CYC-B expression, and thus can be a valuable tool in understanding carotenoid metabolism in tomato. Moreover, this short promoter region of ShCYC-B may be useful in genetic engineering of carotenoid content and other agronomic traits in tomato fruits. PMID:20380705
2012-01-01
Background The fetal and adult globin genes in the human β-globin cluster on chromosome 11 are sequentially expressed to achieve normal hemoglobin switching during human development. The pharmacological induction of fetal γ-globin (HBG) to replace abnormal adult sickle βS-globin is a successful strategy to treat sickle cell disease; however the molecular mechanism of γ-gene silencing after birth is not fully understood. Therefore, we performed global gene expression profiling using primary erythroid progenitors grown from human peripheral blood mononuclear cells to characterize gene expression patterns during the γ-globin to β-globin (γ/β) switch observed throughout in vitro erythroid differentiation. Results We confirmed erythroid maturation in our culture system using cell morphologic features defined by Giemsa staining and the γ/β-globin switch by reverse transcription-quantitative PCR (RT-qPCR) analysis. We observed maximal γ-globin expression at day 7 with a switch to a predominance of β-globin expression by day 28 and the γ/β-globin switch occurred around day 21. Expression patterns for transcription factors including GATA1, GATA2, KLF1 and NFE2 confirmed our system produced the expected pattern of expression based on the known function of these factors in globin gene regulation. Subsequent gene expression profiling was performed with RNA isolated from progenitors harvested at day 7, 14, 21, and 28 in culture. Three major gene profiles were generated by Principal Component Analysis (PCA). For profile-1 genes, where expression decreased from day 7 to day 28, we identified 2,102 genes down-regulated > 1.5-fold. Ingenuity pathway analysis (IPA) for profile-1 genes demonstrated involvement of the Cdc42, phospholipase C, NF-Kβ, Interleukin-4, and p38 mitogen activated protein kinase (MAPK) signaling pathways. Transcription factors known to be involved in γ-and β-globin regulation were identified. The same approach was used to generate profile-2 genes where expression was up-regulated over 28 days in culture. IPA for the 2,437 genes with > 1.5-fold induction identified the mitotic roles of polo-like kinase, aryl hydrocarbon receptor, cell cycle control, and ATM (Ataxia Telangiectasia Mutated Protein) signaling pathways; transcription factors identified included KLF1, GATA1 and NFE2 among others. Finally, profile-3 was generated from 1,579 genes with maximal expression at day 21, around the time of the γ/β-globin switch. IPA identified associations with cell cycle control, ATM, and aryl hydrocarbon receptor signaling pathways. Conclusions The transcriptome analysis completed with erythroid progenitors grown in vitro identified groups of genes with distinct expression profiles, which function in metabolic pathways associated with cell survival, hematopoiesis, blood cells activation, and inflammatory responses. This study represents the first report of a transcriptome analysis in human primary erythroid progenitors to identify transcription factors involved in hemoglobin switching. Our results also demonstrate that the in vitro liquid culture system is an excellent model to define mechanisms of global gene expression and the DNA-binding protein and signaling pathways involved in globin gene regulation. PMID:22537182
Tan, Powell Patrick Cheng; French, Leon; Pavlidis, Paul
2013-01-01
An important goal in neuroscience is to understand gene expression patterns in the brain. The recent availability of comprehensive and detailed expression atlases for mouse and human creates opportunities to discover global patterns and perform cross-species comparisons. Recently we reported that the major source of variation in gene transcript expression in the adult normal mouse brain can be parsimoniously explained as reflecting regional variation in glia to neuron ratios, and is correlated with degree of connectivity and location in the brain along the anterior-posterior axis. Here we extend this investigation to two gene expression assays of adult normal human brains that consisted of over 300 brain region samples, and perform comparative analyses of brain-wide expression patterns to the mouse. We performed principal components analysis (PCA) on the regional gene expression of the adult human brain to identify the expression pattern that has the largest variance. As in the mouse, we observed that the first principal component is composed of two anti-correlated patterns enriched in oligodendrocyte and neuron markers respectively. However, we also observed interesting discordant patterns between the two species. For example, a few mouse neuron markers show expression patterns that are more correlated with the human oligodendrocyte-enriched pattern and vice-versa. In conclusion, our work provides insights into human brain function and evolution by probing global relationships between regional cell type marker expression patterns in the human and mouse brain. PMID:23440889
Tan, Powell Patrick Cheng; French, Leon; Pavlidis, Paul
2013-01-01
An important goal in neuroscience is to understand gene expression patterns in the brain. The recent availability of comprehensive and detailed expression atlases for mouse and human creates opportunities to discover global patterns and perform cross-species comparisons. Recently we reported that the major source of variation in gene transcript expression in the adult normal mouse brain can be parsimoniously explained as reflecting regional variation in glia to neuron ratios, and is correlated with degree of connectivity and location in the brain along the anterior-posterior axis. Here we extend this investigation to two gene expression assays of adult normal human brains that consisted of over 300 brain region samples, and perform comparative analyses of brain-wide expression patterns to the mouse. We performed principal components analysis (PCA) on the regional gene expression of the adult human brain to identify the expression pattern that has the largest variance. As in the mouse, we observed that the first principal component is composed of two anti-correlated patterns enriched in oligodendrocyte and neuron markers respectively. However, we also observed interesting discordant patterns between the two species. For example, a few mouse neuron markers show expression patterns that are more correlated with the human oligodendrocyte-enriched pattern and vice-versa. In conclusion, our work provides insights into human brain function and evolution by probing global relationships between regional cell type marker expression patterns in the human and mouse brain.
Muthamilarasan, Mehanathan; Khandelwal, Rohit; Yadav, Chandra Bhan; Bonthala, Venkata Suresh; Khan, Yusuf; Prasad, Manoj
2014-01-01
MYB proteins represent one of the largest transcription factor families in plants, playing important roles in diverse developmental and stress-responsive processes. Considering its significance, several genome-wide analyses have been conducted in almost all land plants except foxtail millet. Foxtail millet (Setaria italica L.) is a model crop for investigating systems biology of millets and bioenergy grasses. Further, the crop is also known for its potential abiotic stress-tolerance. In this context, a comprehensive genome-wide survey was conducted and 209 MYB protein-encoding genes were identified in foxtail millet. All 209 S. italica MYB (SiMYB) genes were physically mapped onto nine chromosomes of foxtail millet. Gene duplication study showed that segmental- and tandem-duplication have occurred in genome resulting in expansion of this gene family. The protein domain investigation classified SiMYB proteins into three classes according to number of MYB repeats present. The phylogenetic analysis categorized SiMYBs into ten groups (I - X). SiMYB-based comparative mapping revealed a maximum orthology between foxtail millet and sorghum, followed by maize, rice and Brachypodium. Heat map analysis showed tissue-specific expression pattern of predominant SiMYB genes. Expression profiling of candidate MYB genes against abiotic stresses and hormone treatments using qRT-PCR revealed specific and/or overlapping expression patterns of SiMYBs. Taken together, the present study provides a foundation for evolutionary and functional characterization of MYB TFs in foxtail millet to dissect their functions in response to environmental stimuli. PMID:25279462
Higón, M; Monteagudo, C; Fried, B; Esteban, J G; Toledo, R; Marcilla, A
2008-10-01
We cloned and expressed Echinostoma caproni HSP70 in Escherichia coli. This molecule presents an open reading frame (ORF) of 655 amino acids, and a theoretical molecular weight of 71 kDa. E. caproni HSP70 protein showed a high homology to other helminth molecules, major differences being located in the C-terminal region of the molecule, with a hydrophobic portion. Studies of protein and messenger RNA (mRNA) expression revealed a distinct pattern, depending on the host (low- or high-compatible). Specific polyclonal antisera raised against the recombinant protein expressed in Escherichia coli demonstrated its selective presence in excretory/secretory products (ESP) of adult parasites obtained from high-compatible hosts. Immunological studies showed clearly the association of HSP70 with the parasite surface and other structures, including eggs.
SSX2-4 expression in early-stage non-small cell lung cancer.
Greve, K B V; Pøhl, M; Olsen, K E; Nielsen, O; Ditzel, H J; Gjerstorff, M F
2014-05-01
The expression of cancer/testis antigens SSX2, SSX3, and SSX4 in non-small cell lung cancers (NSCLC) was examined, since they are considered promising targets for cancer immunotherapy due to their immunogenicity and testis-restricted normal tissue expression. We characterized three SSX antibodies and performed immunohistochemical staining of 25 different normal tissues and 143 NSCLCs. The antibodies differed in binding to two distinctive splice variants of SSX2 that exhibited different subcellular staining patterns, suggesting that the two splice variants display different functions. SSX2-4 expression was only detected in 5 of 143 early-stage NSCLCs, which is rare compared to other cancer/testis antigens (e.g. MAGE-A and GAGE). However, further studies are needed to determine whether SSX can be used as a prognostic or predictive biomarker in NSCLC. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Rinder, H; Bayer, T A; Gertzen, E M; Hoffmann, W
1992-01-01
Ependymins are secretory products of meningeal cells and represent the predominant glycoproteins in the cerebrospinal fluid from various orders of teleost fish. In the zebrafish, their expression starts between 48 and 72 h post-fertilization. Generally, they share characteristics with proteins involved in cell-contact phenomena. Here, we characterize the ependymin gene from Brachydanio rerio and its flanking regions. The sequence was obtained from clones generated using the polymerase chain reaction (PCR), including a variation of an "anchored" PCR. Also, clones from a conventional phage library were analyzed. We found that the transcribed portion is arranged in six exons. Transient expression of an ependymin-promoter-lacZ gene fusion in zebrafish embryos revealed that the 2.0-kb upstream regulatory region used is sufficient to direct the ependymin-specific correct temporal and spatial expression pattern of the lacZ reporter gene.
Functional Smiles: Tools for Love, Sympathy, and War.
Rychlowska, Magdalena; Jack, Rachael E; Garrod, Oliver G B; Schyns, Philippe G; Martin, Jared D; Niedenthal, Paula M
2017-09-01
A smile is the most frequent facial expression, but not all smiles are equal. A social-functional account holds that smiles of reward, affiliation, and dominance serve basic social functions, including rewarding behavior, bonding socially, and negotiating hierarchy. Here, we characterize the facial-expression patterns associated with these three types of smiles. Specifically, we modeled the facial expressions using a data-driven approach and showed that reward smiles are symmetrical and accompanied by eyebrow raising, affiliative smiles involve lip pressing, and dominance smiles are asymmetrical and contain nose wrinkling and upper-lip raising. A Bayesian-classifier analysis and a detection task revealed that the three smile types are highly distinct. Finally, social judgments made by a separate participant group showed that the different smile types convey different social messages. Our results provide the first detailed description of the physical form and social messages conveyed by these three types of functional smiles and document the versatility of these facial expressions.
Wu, Shuanghua; Lei, Jianjun; Chen, Guoju; Chen, Hancai; Cao, Bihao; Chen, Changming
2017-01-01
Chinese kale, a vegetable of the cruciferous family, is a popular crop in southern China and Southeast Asia due to its high glucosinolate content and nutritional qualities. However, there is little research on the molecular genetics and genes involved in glucosinolate metabolism and its regulation in Chinese kale. In this study, we sequenced and characterized the transcriptomes and expression profiles of genes expressed in 11 tissues of Chinese kale. A total of 216 million 150-bp clean reads were generated using RNA-sequencing technology. From the sequences, 98,180 unigenes were assembled for the whole plant, and 49,582~98,423 unigenes were assembled for each tissue. Blast analysis indicated that a total of 80,688 (82.18%) unigenes exhibited similarity to known proteins. The functional annotation and classification tools used in this study suggested that genes principally expressed in Chinese kale, were mostly involved in fundamental processes, such as cellular and molecular functions, the signal transduction, and biosynthesis of secondary metabolites. The expression levels of all unigenes were analyzed in various tissues of Chinese kale. A large number of candidate genes involved in glucosinolate metabolism and its regulation were identified, and the expression patterns of these genes were analyzed. We found that most of the genes involved in glucosinolate biosynthesis were highly expressed in the root, petiole, and in senescent leaves. The expression patterns of ten glucosinolate biosynthetic genes from RNA-seq were validated by quantitative RT-PCR in different tissues. These results provided an initial and global overview of Chinese kale gene functions and expression activities in different tissues. PMID:28228764
Giraldo, Sergio I; Ramirez, Rafael
2016-01-01
Expert musicians introduce expression in their performances by manipulating sound properties such as timing, energy, pitch, and timbre. Here, we present a data driven computational approach to induce expressive performance rule models for note duration, onset, energy, and ornamentation transformations in jazz guitar music. We extract high-level features from a set of 16 commercial audio recordings (and corresponding music scores) of jazz guitarist Grant Green in order to characterize the expression in the pieces. We apply machine learning techniques to the resulting features to learn expressive performance rule models. We (1) quantitatively evaluate the accuracy of the induced models, (2) analyse the relative importance of the considered musical features, (3) discuss some of the learnt expressive performance rules in the context of previous work, and (4) assess their generailty. The accuracies of the induced predictive models is significantly above base-line levels indicating that the audio performances and the musical features extracted contain sufficient information to automatically learn informative expressive performance patterns. Feature analysis shows that the most important musical features for predicting expressive transformations are note duration, pitch, metrical strength, phrase position, Narmour structure, and tempo and key of the piece. Similarities and differences between the induced expressive rules and the rules reported in the literature were found. Differences may be due to the fact that most previously studied performance data has consisted of classical music recordings. Finally, the rules' performer specificity/generality is assessed by applying the induced rules to performances of the same pieces performed by two other professional jazz guitar players. Results show a consistency in the ornamentation patterns between Grant Green and the other two musicians, which may be interpreted as a good indicator for generality of the ornamentation rules.
Expression of forkhead box transcription factor genes Foxp1 and Foxp2 during jaw development.
Cesario, Jeffry M; Almaidhan, Asma A; Jeong, Juhee
2016-03-01
Development of the face is regulated by a large number of genes that are expressed in temporally and spatially specific patterns. While significant progress has been made on characterizing the genes that operate in the oral region of the face, those regulating development of the aboral (lateral) region remain largely unknown. Recently, we discovered that transcription factors LIM homeobox (LHX) 6 and LHX8, which are key regulators of oral development, repressed the expression of the genes encoding forkhead box transcription factors, Foxp1 and Foxp2, in the oral region. To gain insights into the potential role of the Foxp genes in region-specific development of the face, we examined their expression patterns in the first pharyngeal arch (primordium for the jaw) of mouse embryos at a high spatial and temporal resolution. Foxp1 and Foxp2 were preferentially expressed in the aboral and posterior parts of the first pharyngeal arch, including the developing temporomandibular joint. Through double immunofluorescence and double fluorescent RNA in situ hybridization, we found that Foxp1 was expressed in the progenitor cells for the muscle, bone, and connective tissue. Foxp2 was expressed in subsets of bone and connective tissue progenitors but not in the myoblasts. Neither gene was expressed in the dental mesenchyme nor in the oral half of the palatal shelf undergoing extensive growth and morphogenesis. Together, we demonstrated for the first time that Foxp1 and Foxp2 are expressed during craniofacial development. Our data suggest that the Foxp genes may regulate development of the aboral and posterior regions of the jaw. Copyright © 2016 Elsevier B.V. All rights reserved.
Giraldo, Sergio I.; Ramirez, Rafael
2016-01-01
Expert musicians introduce expression in their performances by manipulating sound properties such as timing, energy, pitch, and timbre. Here, we present a data driven computational approach to induce expressive performance rule models for note duration, onset, energy, and ornamentation transformations in jazz guitar music. We extract high-level features from a set of 16 commercial audio recordings (and corresponding music scores) of jazz guitarist Grant Green in order to characterize the expression in the pieces. We apply machine learning techniques to the resulting features to learn expressive performance rule models. We (1) quantitatively evaluate the accuracy of the induced models, (2) analyse the relative importance of the considered musical features, (3) discuss some of the learnt expressive performance rules in the context of previous work, and (4) assess their generailty. The accuracies of the induced predictive models is significantly above base-line levels indicating that the audio performances and the musical features extracted contain sufficient information to automatically learn informative expressive performance patterns. Feature analysis shows that the most important musical features for predicting expressive transformations are note duration, pitch, metrical strength, phrase position, Narmour structure, and tempo and key of the piece. Similarities and differences between the induced expressive rules and the rules reported in the literature were found. Differences may be due to the fact that most previously studied performance data has consisted of classical music recordings. Finally, the rules' performer specificity/generality is assessed by applying the induced rules to performances of the same pieces performed by two other professional jazz guitar players. Results show a consistency in the ornamentation patterns between Grant Green and the other two musicians, which may be interpreted as a good indicator for generality of the ornamentation rules. PMID:28066290
Gurunathan, Rajalakshmi; Van Emden, Bernard; Panchanathan, Sethuraman; Kumar, Sudhir
2004-01-01
Background Modern developmental biology relies heavily on the analysis of embryonic gene expression patterns. Investigators manually inspect hundreds or thousands of expression patterns to identify those that are spatially similar and to ultimately infer potential gene interactions. However, the rapid accumulation of gene expression pattern data over the last two decades, facilitated by high-throughput techniques, has produced a need for the development of efficient approaches for direct comparison of images, rather than their textual descriptions, to identify spatially similar expression patterns. Results The effectiveness of the Binary Feature Vector (BFV) and Invariant Moment Vector (IMV) based digital representations of the gene expression patterns in finding biologically meaningful patterns was compared for a small (226 images) and a large (1819 images) dataset. For each dataset, an ordered list of images, with respect to a query image, was generated to identify overlapping and similar gene expression patterns, in a manner comparable to what a developmental biologist might do. The results showed that the BFV representation consistently outperforms the IMV representation in finding biologically meaningful matches when spatial overlap of the gene expression pattern and the genes involved are considered. Furthermore, we explored the value of conducting image-content based searches in a dataset where individual expression components (or domains) of multi-domain expression patterns were also included separately. We found that this technique improves performance of both IMV and BFV based searches. Conclusions We conclude that the BFV representation consistently produces a more extensive and better list of biologically useful patterns than the IMV representation. The high quality of results obtained scales well as the search database becomes larger, which encourages efforts to build automated image query and retrieval systems for spatial gene expression patterns. PMID:15603586
Lineage tracing of dlx1a/2a and dlx5a/6a expressing cells in the developing zebrafish brain.
Solek, Cynthia M; Feng, Shengrui; Perin, Sofia; Weinschutz Mendes, Hellen; Ekker, Marc
2017-07-01
Lineage tracing of specific populations of progenitor cells provides crucial information about developmental programs. Four members of the Dlx homeobox gene family, Dlx1,2, 5 and 6, are involved in the specification of γ-aminobutyric acid (GABA)ergic neurons in the vertebrate forebrain. Orthologous genes in mammals and teleost show similarities in expression patterns and transcriptional regulation mechanisms. We have used lineage tracing to permanently label dlx-expressing cells in the zebrafish and have characterized the progeny of these cells in the larva and in the juvenile and adult brain. We have found that dlx1a/2a and dlx5a/6a expressing progenitors give rise, for the most part, to small populations of cells which constitute only a small proportion of GABAergic cells in the adult brain tissue. Moreover, some of the cells do not acquire a neuronal phenotype suggesting that, regardless of the time a cell expresses dlx genes in the brain, it can potentially give rise to cells other than neurons. In some instances, labeling larval dlx5a/6a-expressing cells, but not dlx1a/2a-expressing cells, results in massively expanding, widespread clonal expansion throughout the adult brain. Our data provide a detailed lineage analysis of the dlx1a/2a and dlx5a/6a expressing progenitors in the zebrafish brain and lays the foundation for further characterization of the role of these transcription factors beyond the specification of GABAergic neurons. Copyright © 2017 Elsevier Inc. All rights reserved.
Kaplan, Marielle; Shur, Anna; Tendler, Yvgeny
2018-04-23
Arterial macrophages comprise a heterogeneous population: pro-inflammatory (M1) and anti-inflammatory (M2). Since C-reactive protein (CRP) is produced by macrophages in atherosclerotic lesions, understanding of CRP regulation in macrophages could be crucial to decipher inflammatory patterns in atherogenesis. We aimed to analyze CRP expression in M1/M2 macrophages and to question whether it involves NFκB signaling pathway. Furthermore, we questioned whether oxidative stress affect macrophage phenotype and modulate macrophage CRP expression. M1/M2 macrophage polarization was validated using THP-1 macrophages. CRP mRNA and protein expression were determined using real-time PCR and immunohistochemistry. Involvement of NFκB was determined by nuclear translocation of p50 subunit and the use of NFκB inhibitor. Involvement of oxidative stress in macrophage phenotypes induction was studied using oxidized-LDL (Ox-LDL) and antioxidants. M1 macrophages were characterized by elevated CRP mRNA expression (by 67%), CRP protein levels (by 108%), and upregulation of NFκB activation compared to control, but these features were not shared by M2 macrophages. Macrophages incubation with Ox-LDL led to a moderate M1 phenotype combined with a M2 phenotype, correlated with increased CRP mRNA expression. Antioxidants inhibited by up to 86% IL6 expression but did not significantly affect IL10 secretion. Antioxidants significantly inhibited CRP expression in M1 macrophages, but not in M2 macrophages. Elevated expression of CRP was characteristic of M1 macrophages rather than M2 through NFκB activation. Oxidative stress could be one of the endogenous triggers for macrophage activation to a mixed M1 and M2 phenotype, in association with increased expression of CRP.
Ma, L; Swalla, B J; Zhou, J; Dobias, S L; Bell, J R; Chen, J; Maxson, R E; Jeffery, W R
1996-03-01
The Msx homeobox genes are expressed in complex patterns during vertebrate development in conjunction with inductive tissue interactions. As a means of understanding the archetypal role of Msx genes in chordates, we have isolated and characterized an Msx gene in ascidians, protochordates with a relatively simple body plan. The Mocu Msx-a and McMsx-a genes, isolated from the ascidians Molgula oculata and Molgula citrina, respectively, have homeodomains that place them in the msh-like subclass of Msx genes. Therefore, the Molgula Msx-a genes are most closely related to the msh genes previously identified in a number of invertebrates. Southern blot analysis suggests that there are one or two copies of the Msx-a gene in the Molgula genome. Northern blot and RNase protection analysis indicate that Msx-a transcripts are restricted to the developmental stages of the life cycle. In situ hybridization showed that Msx-a mRNA first appears just before gastrulation in the mesoderm (presumptive notochord and muscle) and ectoderm (neural plate) cells. Transcript levels decline in mesoderm cells after the completion of gastrulation, but are enhanced in the folding neural plate during neurulation. Later, Msx-a mRNA is also expressed in the posterior ectoderm and in a subset of the tail muscle cells. The ectoderm and mesoderm cells that express Msx-a are undergoing morphogenetic movements during gastrulation, neurulation, and tail formation. Msx-a expression ceases after these cells stop migrating. The ascidian M. citrina, in which adult tissues and organs begin to develop precociously in the larva, was used to study Msx-a expression during adult development. Msx-a transcripts are expressed in the heart primordium and the rudiments of the ampullae, epidermal protrusions with diverse functions in the juvenile. The heart and ampullae develop in regions where mesenchyme cells interact with endodermal or epidermal epithelia. A comparison of the expression patterns of the Molgula genes with those of their vertebrate congeners suggests that the archetypal roles of the Msx genes may be in morphogenetic movements during embryogenesis and in mesenchymal-epithelial interactions during organogenesis.
HPASubC: A suite of tools for user subclassification of human protein atlas tissue images.
Cornish, Toby C; Chakravarti, Aravinda; Kapoor, Ashish; Halushka, Marc K
2015-01-01
The human protein atlas (HPA) is a powerful proteomic tool for visualizing the distribution of protein expression across most human tissues and many common malignancies. The HPA includes immunohistochemically-stained images from tissue microarrays (TMAs) that cover 48 tissue types and 20 common malignancies. The TMA data are used to provide expression information at the tissue, cellular, and occasionally, subcellular level. The HPA also provides subcellular data from confocal immunofluorescence data on three cell lines. Despite the availability of localization data, many unique patterns of cellular and subcellular expression are not documented. To get at this more granular data, we have developed a suite of Python scripts, HPASubC, to aid in subcellular, and cell-type specific classification of HPA images. This method allows the user to download and optimize specific HPA TMA images for review. Then, using a playstation-style video game controller, a trained observer can rapidly step through 10's of 1000's of images to identify patterns of interest. We have successfully used this method to identify 703 endothelial cell (EC) and/or smooth muscle cell (SMCs) specific proteins discovered within 49,200 heart TMA images. This list will assist us in subdividing cardiac gene or protein array data into expression by one of the predominant cell types of the myocardium: Myocytes, SMCs or ECs. The opportunity to further characterize unique staining patterns across a range of human tissues and malignancies will accelerate our understanding of disease processes and point to novel markers for tissue evaluation in surgical pathology.
Akagi, Takashi; Katayama-Ikegami, Ayako; Kobayashi, Shozo; Sato, Akihiko; Kono, Atsushi; Yonemori, Keizo
2012-01-01
Proanthocyanidins (PAs) are secondary metabolites that contribute to plant protection and crop quality. Persimmon (Diospyros kaki) has a unique characteristic of accumulating large amounts of PAs, particularly in its fruit. Normal astringent-type and mutant nonastringent-type fruits show different PA accumulation patterns depending on the seasonal expression patterns of DkMyb4, which is a Myb transcription factor (TF) regulating many PA pathway genes in persimmon. In this study, attempts were made to identify the factors involved in DkMyb4 expression and the resultant PA accumulation in persimmon fruit. Treatment with abscisic acid (ABA) and an ABA biosynthesis inhibitor resulted in differential changes in the expression patterns of DkMyb4 and PA biosynthesis in astringent-type and nonastringent-type fruits depending on the development stage. To obtain an ABA-signaling TF, we isolated a full-length basic leucine zipper (bZIP) TF, DkbZIP5, which is highly expressed in persimmon fruit. We also showed that ectopic DkbZIP5 overexpression in persimmon calluses induced the up-regulation of DkMyb4 and the resultant PA biosynthesis. In addition, a detailed molecular characterization using the electrophoretic mobility shift assay and transient reporter assay indicated that DkbZIP5 recognized ABA-responsive elements in the promoter region of DkMyb4 and acted as a direct regulator of DkMyb4 in an ABA-dependent manner. These results suggest that ABA signals may be involved in PA biosynthesis in persimmon fruit via DkMyb4 activation by DkbZIP5. PMID:22190340
HPASubC: A suite of tools for user subclassification of human protein atlas tissue images
Cornish, Toby C.; Chakravarti, Aravinda; Kapoor, Ashish; Halushka, Marc K.
2015-01-01
Background: The human protein atlas (HPA) is a powerful proteomic tool for visualizing the distribution of protein expression across most human tissues and many common malignancies. The HPA includes immunohistochemically-stained images from tissue microarrays (TMAs) that cover 48 tissue types and 20 common malignancies. The TMA data are used to provide expression information at the tissue, cellular, and occasionally, subcellular level. The HPA also provides subcellular data from confocal immunofluorescence data on three cell lines. Despite the availability of localization data, many unique patterns of cellular and subcellular expression are not documented. Materials and Methods: To get at this more granular data, we have developed a suite of Python scripts, HPASubC, to aid in subcellular, and cell-type specific classification of HPA images. This method allows the user to download and optimize specific HPA TMA images for review. Then, using a playstation-style video game controller, a trained observer can rapidly step through 10's of 1000's of images to identify patterns of interest. Results: We have successfully used this method to identify 703 endothelial cell (EC) and/or smooth muscle cell (SMCs) specific proteins discovered within 49,200 heart TMA images. This list will assist us in subdividing cardiac gene or protein array data into expression by one of the predominant cell types of the myocardium: Myocytes, SMCs or ECs. Conclusions: The opportunity to further characterize unique staining patterns across a range of human tissues and malignancies will accelerate our understanding of disease processes and point to novel markers for tissue evaluation in surgical pathology. PMID:26167380
Patterns of expressed emotion in adolescent eating disorders.
Rienecke, Renee D; Sim, Leslie; Lock, James; Le Grange, Daniel
2016-12-01
This goal of this study was to understand the patterns of expressed emotions (EEs) in adolescent eating disorders. As such, this study compared EE among families of adolescents with anorexia nervosa (AN), bulimia nervosa (BN), and a psychiatric control group, major depressive disorder (MDD). This study also examined the influence of family status (intact vs. nonintact) and the presence of siblings on EE. Two-hundred and fifteen adolescents (ages 12-19) and their families were recruited for this study including 121 adolescents with AN, 54 adolescents with BN, and 40 adolescents with MDD. Adolescents with at least one parent completed the Standardized Clinical Family Interview. Adolescents completed structured diagnostic interviews to assess eligibility for the study, as well as a standardized questionnaire to assess depression. Analyses revealed that fathers showed higher levels of critical comments to adolescents with BN or MDD than those with AN, whereas mothers made more critical comments toward patients with BN. Mothers made the least number of positive remarks toward patients with MDD. In terms of the influence of family status, fathers from intact families showed more expressions of warmth and were less critical than fathers from nonintact families, whereas mothers from intact families were less critical but also made fewer positive remarks than mothers from nonintact families. The presence of siblings appeared to reduce mothers' expression of warmth and emotional overinvolvement. Unique patterns of EE were found to characterize AN, BN, and MDD. Family status and the presence of siblings exert an influence on EE that should be taken into consideration in future research. © 2016 Association for Child and Adolescent Mental Health.
Li, Xiao Ming; Sang, Ya Lin; Zhao, Xiang Yu; Zhang, Xian Sheng
2013-01-01
In angiosperms, successful pollen-pistil interactions are the prerequisite and guarantee of subsequent fertilization and seed production. Recent profile analyses have helped elucidate molecular mechanisms underlying these processes at both transcriptomic and proteomic levels, but the involvement of miRNAs in pollen-pistil interactions is still speculative. In this study, we sequenced four small RNA libraries derived from mature pollen, in vitro germinated pollen, mature silks, and pollinated silks of maize (Zea mays L.). We identified 161 known miRNAs belonging to 27 families and 82 novel miRNAs. Of these, 40 conserved and 16 novel miRNAs showed different expression levels between mature and germinated pollen, and 30 conserved and eight novel miRNAs were differentially expressed between mature and pollinated silks. As candidates for factors associated with pollen-silk (pistil) interactions, expression patterns of the two sets of differentially expressed miRNAs were confirmed by stem-loop real-time RT-PCR. Transcript levels of 22 predicted target genes were also validated using real-time RT-PCR; most of these exhibited expression patterns contrasting with those of their corresponding miRNAs. In addition, GO analysis of target genes of differentially expressed miRNAs revealed that functional categories related to auxin signal transduction and gene expression regulation were overrepresented. These results suggest that miRNA-mediated auxin signal transduction and transcriptional regulation have roles in pollen-silk interactions. The results of our study provide novel information for understanding miRNA regulatory roles in pollen-pistil interactions.
Kamal, Noura M; Salem, Hend M; Dahmoush, Heba M
2017-07-01
Mucoepidermoid carcinoma (MEC) is the most common malignant salivary gland tumor which displays biological, histological and clinical diversity thus representing a challenge for its diagnosis and management. Epithelial cell adhesion molecule (EpCAM) is a transmembrane glycoprotein identified as a tumor specific antigen due to its frequent overexpression in the majority of epithelial carcinomas and its correlation with prognosis. It is considered to be a promising biomarker used as a therapeutic target already in ongoing clinical trials. The purpose of this study was to investigate the pattern, cellular characterization and level of EpCAM expression in MEC and demonstrate its correlation with histologic grading which may benefit future clinical trials using EpCAM targeted therapy. 48 specimens (12 normal salivary gland tissue and 36 MEC) were collected and EpCAM membranous expression was evaluated by immunohistochemistry. Total immunoscore (TIS) was evaluated, the term 'EpCAM overexpression' was given for tissues showing a total immunoscore >4. A highly significant difference was observed between TIS percent values in control and different grades of MEC (p<0.001). High grade MEC (HG-MEC) was the highest EpCAM expressor. In addition, EpCAM expression pattern differed among the different grades. EpCAM expression was detected in MEC, and its overexpression correlated with increasing the histological grade. The diffuse membranous expression in HG-MEC could be of diagnostic value in relation to the patchy expression observed in both low grade and intermediate grade MEC. Copyright © 2017 Elsevier Ltd. All rights reserved.
Reyes-Bermudez, Alejandro; Villar-Briones, Alejandro; Ramirez-Portilla, Catalina; Hidaka, Michio; Mikheyev, Alexander S.
2016-01-01
Corals belong to the most basal class of the Phylum Cnidaria, which is considered the sister group of bilaterian animals, and thus have become an emerging model to study the evolution of developmental mechanisms. Although cell renewal, differentiation, and maintenance of pluripotency are cellular events shared by multicellular animals, the cellular basis of these fundamental biological processes are still poorly understood. To understand how changes in gene expression regulate morphogenetic transitions at the base of the eumetazoa, we performed quantitative RNA-seq analysis during Acropora digitifera’s development. We collected embryonic, larval, and adult samples to characterize stage-specific transcription profiles, as well as broad expression patterns. Transcription profiles reconstructed development revealing two main expression clusters. The first cluster grouped blastula and gastrula and the second grouped subsequent developmental time points. Consistently, we observed clear differences in gene expression between early and late developmental transitions, with higher numbers of differentially expressed genes and fold changes around gastrulation. Furthermore, we identified three coexpression clusters that represented discrete gene expression patterns. During early transitions, transcriptional networks seemed to regulate cellular fate and morphogenesis of the larval body. In late transitions, these networks seemed to play important roles preparing planulae for switch in lifestyle and regulation of adult processes. Although developmental progression in A. digitifera is regulated to some extent by differential coexpression of well-defined gene networks, stage-specific transcription profiles appear to be independent entities. While negative regulation of transcription is predominant in early development, cell differentiation was upregulated in larval and adult stages. PMID:26941230
Albuquerque, Érika V S; Bezerra, Caroline A; Romero, Juan V; Valencia, Jorge W A; Valencia-Jiménez, Arnubio; Pimenta, Lucas M; Barbosa, Aulus E A D; Silva, Maria C M; Meneguim, Ana M; Sá, Maria Eugênia L; Engler, Gilbert; de Almeida-Engler, Janice; Fernandez, Diana; Grossi-de-Sá, Maria F
Genetic transformation of coffee ( Coffea spp.), the second most traded commodity worldwide, is an alternative approach to introducing features that cannot be introgressed by traditional crossings. The transgenic stability, heritability and quantitative and spatial expression patterns of the seed-specific promoter phytohemagglutinin (PHA-L) from Phaseolus vulgaris were characterized in genetically modified C. arabica expressing the α-amylase inhibitor-1 ( α-AI1 ) gene. The α-AI1 inhibitor shows considerable activity toward digestive enzymes of the coffee berry borer (CBB) Hypothenemus hampei . This insect pest expends its life cycle almost entirely in coffee berries. Transgene containment in the fruit is important to meeting food and environmental safety requirements for releasing genetically modified (GM) crops. PCR analysis of T2 coffee plants showed a Mendelian single-copy segregation pattern. Ectopic transgene expression was only detected in coffee grains, as demonstrated by reverse transcription-PCR analysis of different plant tissues. An intense immunocytochemical signal associated with α-AI1 protein expression was localized to endospermic cells. In addition, a delay in the larval development of CBB was observed after challenging transgenic coffee seeds with the insect. These results indicate that the PHA-L promoter might be a useful tool in coffee for the seed-specific expression of genes related to coffee bean productivity, quality and pest protection. The biotechnological applicability of the α-AI1 gene for controlling CBB is also discussed. This work is the first report showing a seed-specific transgene expression in coffee plants.