Thulium heat source IR D Project 91-031
DOE Office of Scientific and Technical Information (OSTI.GOV)
Walter, C.E.; Kammeraad, J.E.; Newman, J.G.
1991-01-01
The goal of the Thulium Heat Source study is to determine the performance capability and evaluate the safety and environmental aspects of a thulium-170 heat source. Thulium-170 has several attractive features, including the fact that it decays to a stable, chemically innocuous isotope in a relatively short time. A longer-range goal is to attract government funding for the development, fabrication, and demonstration testing in an Autonomous Underwater Vehicle (AUV) of one or more thulium isotope power (TIP) prototype systems. The approach is to study parametrically the performance of thulium-170 heat source designs in the power range of 5-50 kW{sub th}.more » At least three heat source designs will be characterized in this power range to assess their performance, mass, and volume. The authors will determine shielding requirements, and consider the safety and environmental aspects of their use.« less
Thulium-170-labeled microparticles for local radiotherapy: preliminary studies.
Polyak, Andras; Das, Tapas; Chakraborty, Sudipta; Kiraly, Reka; Dabasi, Gabriella; Joba, Robert Peter; Jakab, Csaba; Thuroczy, Julianna; Postenyi, Zita; Haasz, Veronika; Janoki, Gergely; Janoki, Gyozo A; Pillai, Maroor R A; Balogh, Lajos
2014-10-01
The present article describes the preparation, characterization, and biological evaluation of Thulium-170 ((170)Tm) [T1/2 = 128.4 days; Eβmax = 968 keV; Eγ = 84 keV (3.26%)] labeled tin oxide microparticles for its possible use in radiation synovectomy (RSV) of medium-sized joints. (170)Tm was produced by irradiation of natural thulium oxide target. 170Tm-labeled microparticles were synthesized with high yield and radionuclidic purity (> 99%) along with excellent in vitro stability by following a simple process. Particle sizes and morphology of the radiolabeled particles were examined by light microscope, dynamic light scattering, and transmission electron microscope and found to be of stable spherical morphology within the range of 1.4-3.2 μm. The preparation was injected into the knee joints of healthy Beagle dogs intraarticularly for biological studies. Serial whole-body and regional images were taken by single-photon-emission computed tomography (SPECT) and SPECT-CT cameras up to 9 months postadministration, which showed very low leakage (< 8% of I.D.) of the instilled particles. The majority of leaked radiocolloid particles were found in inguinal lymph nodes during the 9 months of follow-up. All the animals tolerated the treatment well; the compound did not show any possible radiotoxicological effect. These preliminary studies showed that 170Tm-labeled microparticles could be a promising nontoxic and effective radiopharmaceutical for RSV applications or later local antitumor therapy.
Hungate, F.P.; Riemath, W.F.; Bunnell, L.R.
1975-12-16
A tissue irradiator is provided for the in-vivo irradiation of body tissue. The irradiator comprises a radiation source material contained and completely encapsulated within vitreous carbon. An embodiment for use as an in- vivo blood irradiator comprises a cylindrical body having an axial bore therethrough. A radioisotope is contained within a first portion of vitreous carbon cylindrically surrounding the axial bore, and a containment portion of vitreous carbon surrounds the radioisotope containing portion, the two portions of vitreous carbon being integrally formed as a single unit. Connecting means are provided at each end of the cylindrical body to permit connections to blood- carrying vessels and to provide for passage of blood through the bore. In a preferred embodiment, the radioisotope is thulium-170 which is present in the irradiator in the form of thulium oxide. A method of producing the preferred blood irradiator is also provided, whereby nonradioactive thulium-169 is dispersed within a polyfurfuryl alcohol resin which is carbonized and fired to form the integral vitreous carbon body and the device is activated by neutron bombardment of the thulium-169 to produce the beta-emitting thulium-170.
Infrastructure for thulium-170 isotope power systems for autonomous underwater vehicle fleets
DOE Office of Scientific and Technical Information (OSTI.GOV)
Walter, C.E.
1991-07-01
The radioisotope thulium-170 is a safe and environmentally benign heat source for providing the high endurance and energy densities needed by advanced power systems for autonomous underwater vehicles (AUV). Thulium Isotope Power (TIP) systems have an endurance of {approximately}3000 h, and gravimetric and volumetric energy densities of 3 {times} 10{sup 4} Wh/kg and 3 {times} 10{sup 8} Wh/m{sup 3}, respectively. These energy densities are more than 200 times higher than those currently provided by Ag-Zn battery technology. In order to capitalize on these performance levels with about one hundred AUVs in continuous use, it will be necessary to establish anmore » infrastructure for isotope production and heat-source refurbishment. The infrastructure cost is not trivial, and studies are needed to determine its optimum configuration. The major component of the projected infrastructure is the nuclear reactor used to produce Tm- 170 by neutron absorption in Tm-169. The reactor design should ideally be optimized for TM-170 production. Using the byproduct waste'' heat beneficially would help defray the cost of isotope production. However, generating electric power with the reactor would compromise both the cost of electricity and the isotope production capacity. A coastal location for the reactor would be most convenient from end-use considerations, and the waste'' heat could be used to desalinate seawater in water-thirsty states. 13 refs., 6 figs., 2 tabs.« less
Walter, Carl E.; Van Konynenburg, Richard; VanSant, James H.
1992-01-01
An isotopic heat source is formed using stacks of thin individual layers of a refractory isotopic fuel, preferably thulium oxide, alternating with layers of a low atomic weight diluent, preferably graphite. The graphite serves several functions: to act as a moderator during neutron irradiation, to minimize bremsstrahlung radiation, and to facilitate heat transfer. The fuel stacks are inserted into a heat block, which is encased in a sealed, insulated and shielded structural container. Heat pipes are inserted in the heat block and contain a working fluid. The heat pipe working fluid transfers heat from the heat block to a heat exchanger for power conversion. Single phase gas pressure controls the flow of the working fluid for maximum heat exchange and to provide passive cooling.
Code of Federal Regulations, 2012 CFR
2012-01-01
...-127m .01 5,000 Tellurium-129m .01 5,000 Terbium-160 .01 4,000 Thulium-170 .01 4,000 Tin-113 .01 10,000 Tin-123 .01 3,000 Tin-126 .01 1,000 Titanium-44 .01 100 Vanadium-48 .01 7,000 Xenon-133 1.0 900,000...
Code of Federal Regulations, 2013 CFR
2013-01-01
...-127m .01 5,000 Tellurium-129m .01 5,000 Terbium-160 .01 4,000 Thulium-170 .01 4,000 Tin-113 .01 10,000 Tin-123 .01 3,000 Tin-126 .01 1,000 Titanium-44 .01 100 Vanadium-48 .01 7,000 Xenon-133 1.0 900,000...
Code of Federal Regulations, 2014 CFR
2014-01-01
...-127m .01 5,000 Tellurium-129m .01 5,000 Terbium-160 .01 4,000 Thulium-170 .01 4,000 Tin-113 .01 10,000 Tin-123 .01 3,000 Tin-126 .01 1,000 Titanium-44 .01 100 Vanadium-48 .01 7,000 Xenon-133 1.0 900,000...
Monolithic thulium-doped fiber laser
NASA Astrophysics Data System (ADS)
Aubrecht, J.; Peterka, P.; Honzátko, P.; Todorov, F.; Podrazký, O.; Kamrádek, M.; Proboštová, J.; Kašík, I.
2017-12-01
In this contribution we report and discuss the results of laser characterizations of experimental thulium-doped optical fibers. These active fibers were fabricated in house and were tested in two laser systems to verify their characteristics. The first one, a monolithic fiber laser, was of great interest to us due to its potentially lower overall resonator losses, improved laser lifetime and better robustness. The compact laser cavities with a Bragg gratings inscribed directly into the active optical fiber differs to the second laser system where the Bragg gratings were inscribed into a passive fiber which had to be spliced to the active fiber. The tested fibers were manufactured by the modified chemical vapor deposition method and a solution-doping of thulium ions with Al2O3 or alumina nanoparticles, respectively. We focused on comparison of laser output powers, slope efficiencies, and laser thresholds for particular thulium-doped fiber in different laser configurations.
Thulium fiber laser damage to the ureter
NASA Astrophysics Data System (ADS)
Wilson, Christopher R.; Hardy, Luke A.; Irby, Pierce B.; Fried, Nathaniel M.
2015-07-01
Our laboratory is studying experimental thulium fiber laser (TFL) as a potential alternative lithotripter to the clinical gold standard Holmium:YAG laser. Safety studies characterizing undesirable Holmium laser-induced damage to ureter tissue have been previously reported. Similarly, this study characterizes TFL induced ureter and stone basket damage. A TFL beam with pulse energy of 35 mJ, pulse duration of 500 μs, and pulse rates of 150-500 Hz was delivered through a 100-μm-core, low-OH, silica optical fiber to the porcine ureter wall, in vitro. Ureter perforation times were measured and gross, histological, and optical coherence tomography images of the ablation zone were acquired. TFL operation at 150, 300, and 500 Hz produced mean ureter perforation times of 7.9, 3.8, and 1.8 s, respectively. Collateral damage averaged 510, 370, and 310 μm. TFL mean perforation time exceeded 1 s at each setting, which is a greater safety margin than previously reported during Holmium laser ureter perforation studies.
Holmium:YAG (lambda = 2,120 nm) versus thulium fiber (lambda = 1,908 nm) laser lithotripsy.
Blackmon, Richard L; Irby, Pierce B; Fried, Nathaniel M
2010-03-01
The holmium:YAG laser is currently the most common laser lithotripter. However, recent experimental studies have demonstrated that the thulium fiber laser is also capable of vaporizing urinary stones. The high-temperature water absorption coefficient for the thulium wavelength (mu(a) = 160 cm(-1) at lambda = 1,908 nm) is significantly higher than for the holmium wavelength (mu(a) = 28 cm(-1) at lambda = 2,120 nm). We hypothesize that this should translate into more efficient laser lithotripsy using the thulium fiber laser. This study directly compares stone vaporization rates for holmium and thulium fiber lasers. Holmium laser radiation pulsed at 3 Hz with 70 mJ pulse energy and 220 microseconds pulse duration was delivered through a 100-microm-core silica fiber to human uric acid (UA) and calcium oxalate monohydrate (COM) stones, ex vivo (n = 10 each). Thulium fiber laser radiation pulsed at 10 Hz with 70 mJ pulse energy and 1-millisecond pulse duration was also delivered through a 100-microm fiber for the same sets of 10 stones each. For the same number of pulses and total energy (126 J) delivered to each stone, the mass loss averaged 2.4+/-0.6 mg (UA) and 0.7+/-0.2 mg (COM) for the holmium laser and 12.6+/-2.5 mg (UA) and 6.8+/-1.7 (COM) for the thulium fiber laser. UA and COM stone vaporization rates for the thulium fiber laser averaged 5-10 times higher than for the holmium laser at 70 mJ pulse energies. With further development, the thulium fiber laser may represent an alternative to the conventional holmium laser for more efficient laser lithotripsy.
Palmero-Martí, J L; Panach-Navarrete, J; Valls-González, L; Ganau-Ituren, A; Miralles-Aguado, J; Benedicto-Redón, A
2017-04-01
To compare the results of efficacy and safety of Thulium laser 150W against Greenlight laser 120W in the treatment of short term benign prostatic hyperplasia (12 months after surgery). This is a retrospective observational study where men who underwent the surgical technique of prostate vaporization over a period of four years in our center are included. The homogeneity of the sample was checked, and postoperative complications (acute urinary retention, reentry, need for transfusion), failures per year of surgery (reoperation, peak flow <15ml/sec, no improvement in comparing the I-PSS), and decreased PSA were compared a year after surgery. A bivariate analysis using Chi-square and t-Student was carried out. 116 patients were treated with thulium and 118 with green laser. The sample was homogeneous for preoperative variables (P>.05). No differences in complications were observed: in urine acute retention, 4.3% with thulium and 6.8% with green laser (P=.41); in readmissions, 2.6% with thulium and 1.7% with green laser (P=.68); in need for transfusion, 2.6% with thulium and 0% with green laser (P=.12). No differences were observed in the percentage of patients reoperation (1.7% in the group of thulium, 5.1% in the green laser, P=.28); or in individuals with Qmáx less than 15ml/sec (6.9% with thulium, 6.77% with green laser, P=.75), or in the absence of improvement in the IPSS (5, 2% with thulium, 3.4% with green laser, P=.65). There was also no difference in the levels of PSA in ng/mL a year after surgery: with thulium 2.78±2.09 and with green laser 1.83±1.48 (P=.75). Prostate vaporization with thulium laser 150W is comparable to that made with green laser 120W for the treatment of lower urinary tract symptoms caused by BPH, being both effective and safe techniques to 12 months after surgery. Future prospective randomized studies are needed to confirm this conclusion on both techniques. Copyright © 2016 AEU. Publicado por Elsevier España, S.L.U. All rights reserved.
NASA Astrophysics Data System (ADS)
Rasmagin, S. I.; Krasovskii, V. I.; Apresyan, L. A.; Novikov, I. K.; Krystob, V. I.; Kazaryan, M. A.
2018-04-01
By the method of green synthesis, silver nanoparticles were obtained in colloidal solutions. The solutions were modified with thulium ions. Using the method of electron microscopy and optical method, the properties of silver nanoparticles obtained are studied. The influence of change in concentration of the solution of mint and thulium ions on the properties of colloidal silver nanoparticles was studied.
Kamalski, Digna M A; Vincent, Robert; Wegner, Inge; Bittermann, Arnold J N; Grolman, Wilko
2014-12-01
Comparing hearing results in patients with otosclerosis treated with laser-assisted stapedotomy using the 2-μm thulium laser or the CO2 laser. Prospective nonrandomized clinical study. In a tertiary referral center in France (Jean Causse Ear Clinic, Béziers), 208 primary stapedotomies were performed in 204 patients between March 2008 and November 2009. Sufficient follow-up data were available for 194 procedures. The fenestration in the footplate was made with the thulium laser in 98 procedures and with a flexible CO2 laser in 96 procedures. Preoperative and postoperative audiometric results were compared. Side effects, such as vertigo and tinnitus, were scored. Patients treated with the CO2 laser had better hearing outcome compared with those treated with the thulium laser at both 3 and 12 months of follow-up. At 3 months, the success of the surgery, defined as closure of the air-bone gap to within 10 dB, was 90.0% in the thulium group compared with 96.8% in the CO2 group. Bone conduction shift showed an overall deterioration of 1.6 dB (standard deviation, 6.9 dB) in the thulium group compared with an improvement of 1.3 dB (standard deviation, 4 dB) in the CO2 group. In the thulium group, there were four patients with sensorineural hearing loss (4.4%) and three with tinnitus (3.1%) compared with none in the CO2 group. Stapedotomy surgery performed with a fiber-delivered thulium laser resulted in a higher chance of inner ear damage measured by bone conduction shift compared with the use of a fiber-delivered CO2 laser. We advise not to use the thulium laser for stapedotomy.
NASA Astrophysics Data System (ADS)
Gonzalez, David A.; Hardy, Luke A.; Hutchens, Thomas C.; Irby, Pierce B.; Fried, Nathaniel M.
2018-03-01
This study characterizes laser-induced vapor bubble dynamics for five different distal fiber optic tip configurations, to provide insight into stone retropulsion commonly experienced during laser ablation of kidney stones. A thulium fiber laser with 1908-nm wavelength delivered 34-mJ energy per pulse at 500-μs pulse duration through five different fibers such as 100-μm-core / 170-μm-OD bare fiber tip, 150- to 300-μm-core tapered fiber tip, 100-μm-core / 300-μm-OD ball tip fiber, 100-μm-core / 340-μm-OD hollow steel tip fiber, and 100-μm-core / 560-μm-OD muzzle brake fiber tip. A high-speed camera with 10-μm-spatial and 9.5-μs-temporal resolution was used to image the vapor bubble dynamics. A needle hydrophone measured pressure transients in the forward (0 deg) and side (90 deg) directions while placed at a 6.8 ± 0.4 mm distance from the distal fiber tip. Maximum bubble dimensions (width/length) averaged 0.7/1.5, 1.0/1.6, 0.5/1.1, 0.8/1.9, and 0.7 / 1.5 mm, for bare, tapered, ball, hollow steel, and muzzle brake fiber tips, respectively (n = 5). The hollow steel tip exhibited the most elongated vapor bubble shape, translating into increased forward pressure in this study and consistent with higher stone retropulsion in previous reports. Relative pressures (a.u.) in (forward/side) directions averaged 1.7/1.6, 2.0/2.0, 1.4/1.2, 6.8/1.1, and 0.3/1.2, for each fiber tip (n = 5). For the hollow steel tip, forward pressure was 4 × higher than for the bare fiber. For the muzzle brake fiber tip, forward pressure was 5 × lower than the bare fiber. Bubble dimensions and pressure measurements demonstrated that the muzzle brake fiber tip reduced forward pressure by partially venting vapors through the portholes, which is consistent with the observation of lower stone retropulsion in previous reports.
Thulium fibre laser nerve stimulation and its application in human pain research
NASA Astrophysics Data System (ADS)
Warnaby, Catherine E.
Experimental pain induction, in combination with psychophysical and functional imaging techniques, allows the controlled study of the mechanisms, pathways and brain areas involved in the processing of noxious stimuli. Laser nerve stimulation provides an excellent stimulus that selectively activates the Adelta and C nociceptors with only low concurrent activity in the warmth system. Thulium fibre laser systems, operating near 2mum, offer several advantages over other pain stimulators including the CO[2] and Tm:YAG laser systems. These advantages include direct absorption at the location of the nociceptors, reduced likelihood of tissue damage, improved compatibility with fMRI, and wavelength tunability. The main aims of the thesis were to apply an initial thulium fibre laser system to pain activation studies in healthy subjects and confirm the potential advantages. A 1D finite difference photothermal model confirmed that thulium fibre laser radiation is absorbed throughout the expected location of the nociceptors and produces a lower surface temperature than CO[2] radiation. In order to produce a temperature rise of 9°C at 150mum, thulium radiation induces a surface temperature rise of 12°C compared to 21°C surface temperature rise using CO[2] radiation. The use of thulium fibre radiation greatly reduces the likelihood of tissue damage and first-degree burns when compared to CO[2] radiation. The spatial temperature gradient and the surface temperature rise were also found to be strongly dependent on the thulium fibre laser emission wavelength, which implies that wavelength tuning may be used to obtain the optimum stimulus wavelength in the 2mum region. The 5W initial fibre laser system was fully characterised before application to human pain studies and was shown to have excellent reproducibility of the stimulus parameters, with short-term and long-term deviations of the pulse energy of 5% and 8% of the mean respectively. The thulium fibre laser emits radiation over a 38nm wavelength range from 2.006-2.044mum. The initial system was used successfully to elicit painful sensations and laser evoked potentials (LEPs), which showed the expected dependence on the laser stimulus parameters. In agreement with the modelled results, beam diameters from 5-8mm for a 150ms pulse duration were found to elicit painful responses while minimising tissue damage. Psychophysical assessment of the pain threshold energy and energy density in ten volunteers, using the modified staircase technique and the method of constant stimuli, also showed the expected dependence on the laser beam diameter over this range. The topographical distribution of the LEPs elicited by the thulium fibre laser and a CO[2] pain stimulator were found to be very similar. However, statistically significant differences in the peak latencies of the LEP components were observed. The peak latency of the N2, P2 and P3 components elicited by the thulium fibre laser were found to be longer by 44ms, 52ms and 78ms respectively than those elicited by the CO[2] laser across five volunteers. These latency differences are believed to be due to the difference in beam diameter of the two stimuli, which produces an increase in local spatial summation for the CO[2] laser stimuli. The effectiveness of the thulium fibre laser as a controlled pain stimulator for human pain research has been confirmed. Using the current thulium fibre laser stimulation system, the optimum stimulus parameters are provided by a beam diameter of 6mm and a pulse duration of 150ms. However, further application of the current system to human pain research is limited by the available output power and the delivery of the thulium radiation to the subject. Suggestions are made for further work using an improved thulium fibre laser system with an increased output power of 20W, optical fibre delivery and wavelength tuning.
Kamalski, Digna M A; Verdaasdonk, Rudolf M; de Boorder, Tjeerd; Vincent, Robert; Trabelzini, Franco; Grolman, Wilko
2014-06-01
High-speed thermal imaging enables visualization of heating of the vestibule during laser-assisted stapedotomy, comparing KTP, CO2, and Thulium laser light. Perforation of the stapes footplate with laser bears the risk of heating of the inner ear fluids. The amount of heating depends on absorption of the laser light and subsequent tissue ablation. The ablation of the footplate is driven by strong water absorption for the CO2 and Thulium laser. For the KTP laser wavelength, ablation is driven by carbonization of the footplate and it might penetrate deep into the inner ear without absorption in water. The thermal effects were visualized in an inner ear model, using two new techniques: (1) high-speed Schlieren imaging shows relative dynamic changes of temperatures up to 2 ms resolution in the perilymph. (2) Thermo imaging provides absolute temperature measurements around the footplate up to 40 ms resolution. The high-speed Schlieren imaging showed minimal heating using the KTP laser. Both CO2 and Thulium laser showed heating below the footplate. Thulium laser wavelength generated heating up to 0.6 mm depth. This was confirmed with thermal imaging, showing a rise of temperature of 4.7 (±3.5) °C for KTP and 9.4 (±6.9) for Thulium in the area of 2 mm below the footplate. For stapedotomy, the Thulium and CO2 laser show more extended thermal effects compared to KTP. High-speed Schlieren imaging and thermal imaging are complimentary techniques to study lasers thermal effects in tissue.
THE RARE EARTH ELEMENTS THULIUM AND PROMETHIUM BECOME TECHNICALLY VALUABLE
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kogan, B.I.
1957-01-01
A survey of non-Slavic (mainly American) literature on thulium and promethium is given. Their preparation, propenties, and uses are considered. Thulium is used in flow detection, and promethium is used in miniature batteries. 20 references. (TCO)
Transurethral vaporesection of prostate: diode laser or thulium laser?
Tan, Xinji; Zhang, Xiaobo; Li, Dongjie; Chen, Xiong; Dai, Yuanqing; Gu, Jie; Chen, Mingquan; Hu, Sheng; Bai, Yao; Ning, Yu
2018-05-01
This study compared the safety and effectiveness of the diode laser and thulium laser during prostate transurethral vaporesection for treating benign prostate hyperplasia (BPH). We retrospectively analyzed 205 patients with BPH who underwent a diode laser or thulium laser technique for prostate transurethral vaporesection from June 2016 to June 2017 and who were followed up for 3 months. Baseline characteristics of the patients, perioperative data, postoperative outcomes, and complications were compared. We also assessed the International Prostate Symptom Score (IPSS), quality of life (QoL), maximum flow rate (Q max ), average flow rate (AFR), and postvoid residual volume (PVR) at 1 and 3 months postoperatively to evaluate the functional improvement of each group. There were no significant differences between the diode laser and thulium laser groups related to age, prostate volume, operative time, postoperative hospital stays, hospitalization costs, or perioperative data. The catheterization time was 3.5 ± 0.8 days for the diode laser group and 4.7 ± 1.8 days for the thulium laser group (p < 0.05). Each group had dramatic improvements in IPSS, QoL, Q max , AFR, and PVR compared with the preoperative values (p < 0.05), although there were no significant differences between the two groups. Use of both diode laser and thulium laser contributes to safe, effective transurethral vaporesection in patients with symptomatic BPH. Diode laser, however, is better than thulium laser for prostate transurethral vaporesection because of its shorter catheterization time. The choice of surgical approach is more important than the choice of laser types during clinical decision making for transurethral laser prostatectomy.
Kwon, In Ho; Bae, Youin; Yeo, Un-Cheol; Lee, Jin Yong; Kwon, Hyuck Hoon; Choi, Young Hee; Park, Gyeong-Hun
2018-02-01
The histologic responses to varied parameters of 1,927-nm fractional thulium fiber laser treatment have not yet been sufficiently elucidated. This study sought to evaluate histologic changes immediately after 1,927-nm fractional thulium fiber laser session at various parameters. The dorsal skin of Yucatan mini-pig was treated with 1,927-nm fractional thulium fiber laser at varied parameters, with or without skin drying. The immediate histologic changes were evaluated to determine the effects of varying laser parameters on the width and the depth of treated zones. The increase in the level of pulse energy widened the area of epidermal changes in the low power level, but increased the dermal penetration depth in the high power level. As the pulse energy level increased, the increase in the power level under the given pulse energy level more evidently made dermal penetration deeper and the treatment area smaller. Skin drying did not show significant effects on epidermal changes, but evidently increased the depth of dermal denaturation under both high and low levels of pulse energy. These results may provide important information to establish treatment parameters of the 1,927-nm fractional thulium fiber laser for various skin conditions.
NASA Astrophysics Data System (ADS)
Casperson, Andrew L.; Barton, Robert A.; Scott, Nicholas J.; Fried, Nathaniel M.
2008-02-01
Direct studies comparing different lasers for treatment of BPH are lacking. This preliminary study compares continuous-wave (CW) vs. pulsed prostate tissue vaporization for the Thulium fiber laser and Holmium:YAG laser, both operating near the 1940 nm water absorption peak in tissue. A 50-W Thulium fiber laser (λ= 1908 nm) delivered CW laser radiation through a 600-μm silica fiber in non-contact mode with a 5-mm-diameter spot at the tissue surface. A Holmium:YAG laser (λ= 2120 nm) operated with an energy of 2 J, pulse rate of 25 Hz, and average power of 50 W, and delivered pulsed laser radiation through a 600-μm silica fiber with a 5-mm-diameter laser spot to achieve similar irradiances at the tissue surface. Tissue vaporization was performed in air with the prostate kept hydrated in saline. Tissue vaporization efficiency of both lasers was compared (n = 10 canine prostates for each laser group). Mean vaporization efficiency measured 5.30 +/- 0.48 kJ/g vs. 4.13 +/- 0.46 kJ/g for Thulium fiber and Holmium lasers (P < 0.05). Tissue vaporization rates measured 0.57 +/- 0.05 g/min vs. 0.73 +/- 0.07 g/min (P < 0.05). The Holmium:YAG laser vaporizes prostate tissue at a higher rate than the Thulium fiber laser, for the same average power delivered to the tissue. Both the Thulium fiber laser and Holmium:YAG lasers are capable of vaporizing prostate tissue at a rate > 1 g/min if operated at the high powers (100-W) typically used in the clinic.
Thermochemistry of the gaseous fluorides of samarium, europium, and thulium
NASA Astrophysics Data System (ADS)
Kleinschmidt, P. D.; Lau, K. H.; Hildenbrand, D. L.
1981-01-01
The gaseous mono-, di-, and trifluorides of the lanthanide metals samarium, europium, and thulium were characterized thermochemically from high temperature equilibrium studies carried out by mass spectrometry. Reaction enthalpies and entropies were derived using second-law analysis throughout, and the results were used to evaluate the enthalpies of formation and bond dissociation energies (BDE) of the gaseous fluorides, and to obtain approximate values for the electronic entropies of the MF and MF2 species. The dissociation energies of the monofluorides D°0(SmF)=134 kcal/mole, D°0(EuF)=129 kcal/mole, and D°0(TmF)=121 kcal/mole, all ±2 kcal/mole, are in good agreement with values predicted by the Rittner electrostatic model, whereas values in the polyatomic fluorides show considerable variation and do not seem to follow any clear trends. Although the BDE values in some instances differ from previous estimates, their sums yield trifluoride heats of atomization that are in close accord with values derived from the vaporization thermodynamics of the solid trifluorides.
Photothermal modeling of thulium fibre laser-tissue interactions
NASA Astrophysics Data System (ADS)
Warnaby, Catherine E.; Coleman, Daniel J.; King, Terence A.
2003-10-01
A one-dimensional finite difference model has been used to investigate the temperature distribution within thulium fibre laser-irradiated tissue. Temperature-time and temperature-depth profiles are presented for various laser stimulus parameters in the 2 micron region. These current calculations are aimed at determining theoretical temperature distributions in the application of relatively low power fibre lasers for thermal stimulation of cutaneous nerves in human pain processing. Theoretical skin surface temperatures are compared with those from thermal camera measurements during thulium fibre laser irradiation. The effectiveness of the thulium fibre laser for thermally stimulating cutaneous nerves is confirmed.
Magnetic and Structural Phase Transitions in Thulium under High Pressures and Low Temperatures
DOE Office of Scientific and Technical Information (OSTI.GOV)
Vohra, Yogesh K.; Tsoi, Georgiy M.; Samudrala, Gopi K.
2017-10-01
The nature of 4f electrons in many rare earth metals and compounds may be broadly characterized as being either "localized" or "itinerant", and is held responsible for a wide range of physical and chemical properties. The pressure variable has a very dramatic effect on the electronic structure of rare earth metals which in turn drives a sequence of structural and magnetic transitions. We have carried out four-probe electrical resistance measurements on rare earth metal Thulium (Tm) under high pressures to 33 GPa and low temperatures to 10 K to monitor the magnetic ordering transition. These studies are complemented by anglemore » dispersive x-ray diffraction studies to monitor crystallographic phase transitions at high pressures and low temperatures. We observe an abrupt increase in magnetic ordering temperature in Tm at a pressure of 17 GPa on phase transition from ambient pressure hcp-phase to α-Sm phase transition. In addition, measured equation of state (EOS) at low temperatures show anomalously low thermal expansion coefficients likely linked to magnetic transitions.« less
NASA Astrophysics Data System (ADS)
Branscome, Ewell Caleb
During the Cold War, Deeply Buried Hardened Targets (DBHTs) and the assets they protected were of great strategic and tactical concern to the Department of Defense. Megaton-class nuclear warheads were the only viable means of attacking many of these facilities, and even so, a small subset of DBHTs was anticipated to be robust even in the face of such an attack. Post Cold War, the threat posed by DBHTs has not disappeared. Rather, the conventional warfare advantages of the United States have led to an increasing emphasis by potential adversaries on the construction and use of hardened facilities such as DBHTs for protection of both conventional and unconventional assets. Further, the shift in perceived relative risk to the United States' national security from large scale all-out nuclear attack towards very limited attack by Weapons of Mass Destruction (WMD) has led some to hypothesize that "self-deterrence" may diminish the strategic value of current inventory nuclear weapons. The objective of the work described was to identify and explore a paradigm shifting solution that could offer leap-ahead capabilities to counter current and future DBHT threats while mitigating or eliminating the "self-deterrence" issue. Systematic evaluation of DHBT defeat alternatives lead to the selection of a thermal subterrene as a hypothetical means of providing such a capability. A number of possible implementation alternatives for a thermal subterrene were investigated, resulting in the identification of the RadioIsotope Powered Thermal Penetrator (RIPTP) concept for providing an effectively unlimited hard rock penetration capability using near-term technologies. However, the proposed approach was novel and thus required formulation and application of a physics based multidisciplinary analysis code to enable evaluation of lv design alternatives and analysis of performance. Technical considerations identified as important to the feasibility of a RIPTP for DBHT defeat included: packing of RIPTP components in available volume; close-contact melting in a medium with nonlinear thermodynamic properties; radiation shielding; radiation health physics; point source plume dispersal calculations; alternative technologies for production of radioisotopes; chemical and physical properties of isotope compounds; nuclear reactor characteristics; high temperature material stability and inter-material compatibility; weapon and delivery system integration; a variety of heat transfer regimes including radiation, conduction, convection, nucleate boiling, and film boiling; thermal/mechanical stress analysis (steady-state and transient); rock physical and thermodynamic properties as a function of temperature; detection/mapping of deeply buried facility spaces; and more. The following disciplinary analyses were composed into a multidisciplinary analysis code for a RIPTP: packing of RIPTP components in available volume; close-contact melting analysis; transmutation of isotope species by neutron activation; reactor neutron economy; radioisotope power generation through decay; metamodelled radiation shielding calculations for a RIPTP; and steady state thermal analyses for a RIPTP in various scenarios. Filtering of radioisotopes for potential suitability, their possible production mechanisms, state of technological development, and multidisciplinary analysis code predicted performance lead to the identification of Thulium-170 as the best isotope for powering a RIPTP using present-day technology and technical data. Ytterbium-169 was identified as an alternative isotope offering the potential for significant potential improvements over Thulium-170 in radiological safety as well as RIPTP performance and producibility. Production, however, was determined to require identification of a cost effective technology for highly enriching Ytterbium-168 from its low natural abundance. Performance analysis of the identified baseline Thulium-170 RIPTP suggested that the predicted low penetration rate of about 10 meters/day could be a significant negative factor with regards to possible viability of the concept. Consequently, a survey for potentially enabling technologies was performed using an adaptation of the Technology Impact Forecasting (TIF) approach. It was found that the greatest potential for improving performance of the baseline Thulium-170 RIPTP resulted from increasing overall power density of the penetrator. Several possible technology approaches to achieving significantly increased penetration rates (approximately 50 meters/day expected penetration rate vs. original 13 meters/day) were proposed. However, it was determined that the hypothetical technology having the greatest potential impact on thermal subterrene viability for DHBT defeat with respect to penetration rate was cost-effective enrichment for Ytterbium-168. Development of such a technology would eliminate or enormously reduce the impact of all identified RIPTP performance and producibility concerns. Alternatively, relaxation of the requirement for no radiological hazard to enemy combatants would enable selection of a fissile powered thermal subterrene to provide required power densities consistent with rapid penetration.
Thulium laser urethrotomy for urethral stricture: a preliminary report.
Wang, Linhui; Wang, Zhixiang; Yang, Bo; Yang, Qing; Sun, Yinghao
2010-09-01
The outcome of thulium laser urethrotomy for patients with urethral stricture had not been reported. The purpose of this study was to evaluate outcome of endourethrotomy with the thulium laser as a minimally invasive treatment for urethral stricture. Twenty-one consecutive patients with urethral stricture were evaluated by retrograde uroflowmetry, International Prostate Symptom Score (IPSS), and quality of life preoperatively at a single academic center. All patients were treated with thulium laser urethrotomy. All patients were followed up for 12-24 months postoperatively by uroflowmetry and by retrograde with voiding cystourethrogram every 3 months. And all patients were followed up by mailed questionnaire, including IPSS and quality of life. Retrograde endoscopic thulium laser urethrotomy was performed in all 21 patients. Most patients (N = 16; 76.2%) did not need any reintervention. Five patients developed recurrent strictures, of them two patients were treated by another laser urethrotomy, one patient was treated by open urethroplasty with buccal mucosa and the other two patients' reintervention were treated by urethral dilation. No intraoperative complications were encountered, although in 9.5% (N = 2) of patients, a urinary tract infection was diagnosed postoperatively. No gross hematuria occurred. Including two patients treated with repeat laser urethrotomy, 17(81.0%) showed good flow of urine (Q(ave)>16.0 ml/second) and adequate caliber urethra in retrograde urethrogram (RGU) 12 months after operation. Three (14.3%) patients showed narrow stream of urine (Q(ave)<8.0 ml/second) and urethral dilation was done every month or 2 months. There was one patient whose Q(ave) was between 8.0 and 16.0 ml/second. And this patient was treated by neither urethral dilation nor another laser urethrotomy. The thulium laser urethrotomy was a safe and effective minimally invasive therapeutic modality for urethral stricture. 2010 Wiley-Liss, Inc.
Incisional effects of 1940 nm thulium fiber laser on oral soft tissues
NASA Astrophysics Data System (ADS)
Güney, Melike; Tunç, Burcu; Gülsoy, Murat
2013-02-01
Lasers of different wavelengths are being used in oral surgery for incision and excision purposes with minimal bleeding and pain. Among these wavelengths, those close to 2μ yield more desirable results on oral soft tissue due to their strong absorption by water. The emission of 1940 nm Thulium fiber laser is well absorbed by water which makes it a promising tool for oral soft tissue surgery. This study was conducted to investigate the potential of thulium fiber laser as an incisional and excisional oral surgical tool. Ovine tongue has been used as the target tissue due to its similarities to human oral tissues. Laser light obtained from a 1940 nm Thulium fiber laser was applied in contact mode onto ovine tongue completely submerged in saline solution in vitro, via a 600)μm fiber moved with a velocity of 0.5 mm /s to form incisions. There were a total of 9 groups determined by the power (2,5-3- 3,5 W), and number of passes (1-3-5). The samples were stained with HE for microscopic evaluation of depth of ablation and extent of coagulation. The depth of incisions produced with 1940 nm Thulium fiber laser increased with increasing power and number of passes, however an increase in the width of the coagulation zone was also observed.
Rejuvenation of the male scalp using 1,927 nm non-ablative fractional thulium fiber laser.
Boen, Monica; Wilson, Monique J Vanaman; Goldman, Mitchel P; Wu, Douglas C
2017-07-01
The male scalp undergoes extensive photodamage due to a high prevalence of androgenic alopecia and exposure to ultraviolet radiation. This photodamage presents as solar lentigines, fine rhytides, and keratosis, and can prematurely age a patient. In this study, we demonstrate the safety and efficacy of the fractionated 1,927 nm thulium fiber laser using high density and high energy settings to achieve rejuvenation of the male scalp after a single treatment session. Four male patients with Fitzpatrick skin types II-III and extensive photodamage on the scalp underwent one treatment with the fractional non-ablative 1,927 nm thulium fiber laser. The patients had a 60-90% improvement in dyspigmentation, lentigines, and keratosis. No adverse events were observed and the patients tolerated the procedure well. This case series is the first report in the literature demonstrating the successful rejuvenation of the scalp using the 1,927 nm thulium fiber laser. Lasers Surg. Med. 49:475-479, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.
Trapping of thulium atoms in a cavity-enhanced optical lattice near a magic wavelength of 814.5 nm
NASA Astrophysics Data System (ADS)
Kalganova, E. S.; Golovizin, A. A.; Shevnin, D. O.; Tregubov, D. O.; Khabarova, K. Yu; Sorokin, V. N.; Kolachevsky, N. N.
2018-05-01
A cavity-enhanced optical lattice at a wavelength of 814.5 nm for thulium atoms is designed and its characteristics are investigated. The parametric resonances at the vibrational frequencies of the trap are measured. The enhancement cavity will be applied to search for the magic wavelength of the clock transition at 1.14 μm in thulium atoms.
Thulium fiber laser ablation of kidney stones using a 50-μm-core silica optical fiber
NASA Astrophysics Data System (ADS)
Blackmon, Richard L.; Hutchens, Thomas C.; Hardy, Luke A.; Wilson, Christopher R.; Irby, Pierce B.; Fried, Nathaniel M.
2015-01-01
Our laboratory is currently studying the experimental thulium fiber laser (TFL) as a potential alternative laser lithotripter to the gold standard, clinical Holmium:YAG laser. We have previously demonstrated the efficient coupling of TFL energy into fibers as small as 100-μm-core-diameter without damage to the proximal end. Although smaller fibers have a greater tendency to degrade at the distal tip during lithotripsy, fiber diameters (≤200 μm) have been shown to increase the saline irrigation rates through the working channel of a flexible ureteroscope, to maximize the ureteroscope deflection, and to reduce the stone retropulsion during laser lithotripsy. In this study, a 50-μm-core-diameter, 85-μm-outer-diameter, low-OH silica fiber is characterized for TFL ablation of human calcium oxalate monohydrate urinary stones, ex vivo. The 50-μm-core fiber consumes approximately 30 times less cross-sectional area inside the single working channel of a ureteroscope than the standard 270-μm-core fiber currently used in the clinic. The ureteroscope working channel flow rate, including the 50-μm fiber, decreased by only 10% with no impairment of ureteroscope deflection. The fiber delivered up to 15.4±5.9 W under extreme bending (5-mm-radius) conditions. The stone ablation rate measured 70±22 μg/s for 35-mJ-pulse-energy, 500-μs-pulse-duration, and 50-Hz-pulse-rate. Stone retropulsion and fiber burnback averaged 201±336 and 3000±2600 μm, respectively, after 2 min. With further development, thulium fiber laser lithotripsy using ultra-small, 50-μm-core fibers may introduce new integration and miniaturization possibilities and potentially provide an alternative to conventional Holmium:YAG laser lithotripsy using larger fibers.
Xia, Shu-Jie
2009-05-01
Two-micron (thulium) laser resection of the prostate-tangerine technique (TmLRP-TT) is a transurethral procedure that uses a thulium laser fiber to dissect whole prostatic lobes off the surgical capsule, similar to peeling a tangerine. We recently reported the primary results. Here we introduce this procedure in detail. A 70-W, 2-microm (thulium) laser was used in continuous-wave mode. We joined the incision by making a transverse cut from the level of the verumontanum to the bladder neck, making the resection sufficiently deep to reach the surgical capsule, and resected the prostate into small pieces, just like peeling a tangerine. As we resected the prostate, the pieces were vaporized, sufficiently small to be evacuated through the resectoscope sheath, and the use of the mechanical tissue morcellator was not required. The excellent hemostasis of the thulium laser ensured the safety of TmLRP-TT. No patient required blood transfusion. Saline irrigation was used intraoperatively, and no case of transurethral resection syndrome was observed. The bladder outlet obstruction had clearly resolved after catheter removal in all cases. We designed the tangerine technique and proved it to be the most suitable procedure for the use of thulium laser in the treatment of benign prostatic hyperplasia (BPH). This procedure, which takes less operative time than standard techniques, is safe and combines efficient cutting and rapid organic vaporization, thereby showing the great superiority of the thulium fiber laser in the treatment of BPH. It has been proven to be as safe and efficient as transurethral resection of the prostate (TURP) during the 1-year follow-up.
X-ray diffraction study of elemental thulium to 86 GPa
NASA Astrophysics Data System (ADS)
Pravica, Michael; Romano, Edward; Quine, Zachary; Pravica, Walter
2006-03-01
We have studied the structures and equation of state of elemental thulium up to 86 GPa in a diamond anvil cell using angular-dispersive x-ray powder diffraction methods at the Advanced Photon Source. This is part of a study of phase transitions in the lanthanide-series metals using cyclohexane as a quasi-hydrostatic medium. We present evidence of a series of phase transitions that appear to follow the anticipated hcp ->Sm-type -> dhcp -> distorted fcc sequence of transitions and show the equation of state derived from the x-ray fit data.
High-power thulium-doped fibre laser with intracavity dispersion management
NASA Astrophysics Data System (ADS)
Krylov, Aleksandr A.; Chernyshova, M. A.; Chernykh, D. S.; Senatorov, A. K.; Tupitsyn, I. M.; Kryukov, P. G.; Dianov, Evgenii M.
2012-05-01
This paper reports a scheme for the generation and amplification of pico- and femtosecond pulses in the range 1.93-1.97 μm using thulium-doped silica fibres. Group velocity dispersion (GVD) management in the cavity of the thulium-doped fibre laser oscillator is ensured by a single-mode germanosilicate fibre (75 mol % GeO2 in the core) with a positive GVD. Pulses are obtained down to 200 fs in duration and up to 56 nJ in energy.
Structural origin and laser performance of thulium-doped germanate glasses.
Xu, Rongrong; Xu, Lin; Hu, Lili; Zhang, Junjie
2011-12-15
The structural origin and laser performance of thulium-doped germanate glasses have been studied. The investigation includes two main sections. The first part discusses the Raman spectroscopic and thermal stability of the host glass structure. The low value of the largest phonon energy (850 cm(-1)) reduces the probability of nonradiative relaxation. The large emission cross section of the Tm(3+) : (3)F(4) level (8.69 × 10(-21) cm(2)), the high quantum efficiency of the (3)F(4) level (71%), and the low nonradiative relaxation rate of the (3)F(4) → (3)H(6) transition (0.09 ms(-1)) illustrate good optical properties of the germanate glass. In the second part, the room-temperature laser action from the thulium-doped germanate glass is demonstrated when pumped by a 790 nm laser diode. The maximum output power of 346 mW and slope efficiency of 25.6% are achieved.
Comparing mechanical effects and sound production of KTP, thulium, and CO2 laser in stapedotomy.
Kamalski, Digna M A; Verdaasdonk, Rudolf M; de Boorder, Tjeerd; Vincent, Robert; Versnel, Huib; Grolman, Wilko
2014-08-01
The mechanical and acoustic effects that occur during laser-assisted stapedotomy differ among KTP, CO2, and thulium lasers. Making a fenestration in stapedotomy with a laser minimizes the risk of a floating footplate caused by mechanical forces. Theoretically, the lasers used in stapedotomy could inflict mechanical trauma because of absorption in the perilymph, causing vaporization bubbles. These bubbles can generate a shock wave, when imploding. In an inner ear model, we made a fenestration in a fresh human stapes with KTP, CO2, and thulium laser. During the fenestration, we performed high-speed imaging from different angles to capture mechanical effects. The sounds produced by the fenestration were recorded simultaneously with a hydrophone; these recordings were compared with acoustics produced by a conventional microburr fenestration. KTP laser fenestration showed little mechanical effects, with minimal sound production. With CO2 laser, miniscule bubbles arose in the vestibule; imploding of these bubbles corresponded to the acoustics. Thulium laser fenestration showed large bubbles in the vestibule, with a larger sound production than the other two lasers. Each type of laser generated significantly less noise than the microburr. The microburr maximally reached 95 ± 7 dB(A), compared with 49 ± 8 dB(A) for KTP, 68 ± 4 dB(A) for CO2, and 83 ± 6 dB(A) for thulium. Mechanical and acoustic effects differ among lasers used for stapedotomy. Based on their relatively small effects, KTP and CO2 lasers are preferable to thulium laser.
Yb3+ sensitized Tm3+ upconversion in tellurite lead oxide glass.
Mohanty, Deepak Kumar; Rai, Vineet Kumar; Dwivedi, Y
2012-04-01
Triply ionized thulium/thulium--ytterbium doped/codoped TeO2-Pb3O4 (TPO) glasses have been fabricated by classical quenching method. The upconversion emission spectra in the Tm3+/Tm3+-Yb3+ doped/codoped glasses upon excitation with a diode laser lasing at ∼980 nm has been studied. Effect of the addition of the Yb3+ on the upconversion emission intensity in the visible and near infrared regions of the Tm3+ doped in TPO glass has been studied and the processes involved explored. Copyright © 2011 Elsevier B.V. All rights reserved.
Enhanced performance of an S-band fiber laser using a thulium-doped photonic crystal fiber
NASA Astrophysics Data System (ADS)
Muhammad, A. R.; Emami, S. D.; Hmood, J. K.; Sayar, K.; Penny, R.; Abdul-Rashid, H. A.; Ahmad, H.; Harun, S. W.
2014-11-01
This work proposes a new method to enhance the performance of an S-band fiber laser by using a thulium-doped photonic crystal fiber (PCF). The proposed method is based on amplified spontaneous emission (ASE) suppression provided by the thulium-doped PCF unique geometric structure. The enhanced performance of this filter based PCF is dependent on the short and long cut-off wavelength characteristics that define the fiber transmission window. Realizing the short wavelength cut-off location requires the PCF cladding to be doped with a high index material, which provides a refractive index difference between the core and cladding region. Achieving the long cut-off wavelength necessitates enlarging the size of the air holes surrounding the rare-earth doped core region. The PCF structure is optimized so as to achieve the desired ASE suppression regions of below 0.8 μm and above 1.8 μm. The laser performance is simulated for different host media, namely pure silica, alumino-silicate, and fluoride-based fiber ZBLAN based on this thulium-doped PCF design. The host media spectroscopic details, including lifetime variations and quantum efficiency effect on the lasing emission are also discussed. Information on the filter based PCF design is gathered via a full-vectorial finite element method analysis and specifically a numerical modelling solution for the energy level rate equation using the Runge-Kutta method. Results are analyzed for gain improvement, lasing cavity, laser efficiency and effect of core size diameter variation. Results are compared with conventional thulium-doped fiber and thulium-doped PCF for every single host media. We observe that the ZBLAN host media is the most promising candidate due to its greater quantum efficiency.
Continuous-wave broadly tunable Cr 2+:ZnSe laser pumped by a thulium fiber laser
NASA Astrophysics Data System (ADS)
Sennaroglu, Alphan; Demirbas, Umit; Vermeulen, Nathalie; Ottevaere, Heidi; Thienpont, Hugo
2006-12-01
We describe a compact, broadly tunable, continuous-wave (cw) Cr 2+:ZnSe laser pumped by a thulium fiber laser at 1800 nm. In the experiments, a polycrystalline ZnSe sample with a chromium concentration of 9.5 × 10 18 cm -3 was used. Free-running laser output was around 2500 nm. Output couplers with transmissions of 3%, 6%, and 15% were used to characterize the power performance of the laser. Best power performance was obtained with a 15% transmitting output coupler. In this case, as high as 640 mW of output power was obtained with 2.5 W of pump power at a wavelength of 2480 nm. The stimulated emission cross-section values determined from laser threshold data and emission measurements were in good agreement. Finally, broad, continuous tuning of the laser was demonstrated between 2240 and 2900 nm by using an intracavity Brewster cut MgF 2 prism and a single set of optics.
[Transurethral thulium laser urethrotomy for urethral stricture].
Liu, Chun-Lai; Zhang, Xi-Ling; Liu, Yi-Li; Wang, Ping
2011-09-01
To evaluate the effect of endourethrotomy with thulium laser as a minimally invasive treatment for urethral stricture. We treated 36 cases of urethral stricture or atresia by endourethrotomy with thulium laser, restored the urethral continuity by vaporization excision of the scar tissue, and observed the clinical effects and complications. The mean operation time was 35 min, ranging from 10 to 90 min. Smooth urination was achieved after 2-6 weeks of catheter indwelling, with no urinary incontinence. The patients were followed up for 4-24 (mean 12) months, during which 27 did not need any reintervention, 5 developed urinary thinning but cured by urethral dilation, 3 received another laser urethrotomy for previous negligence of timely urethral dilation, and the other 1 underwent open urethroplasty. Thulium laser urethrotomy is a safe and effective minimally invasive option for short urethral stricture, which is also suitable for severe urethral stricture and urethral atresia. Its short-term outcome is satisfactory, but its long-term effect remains to be further observed.
Chernysheva, Maria; Mou, Chengbo; Arif, Raz; AlAraimi, Mohammed; Rümmeli, Mark; Turitsyn, Sergei; Rozhin, Aleksey
2016-01-01
We have proposed and demonstrated a Q-switched Thulium doped fibre laser (TDFL) with a ‘Yin-Yang’ all-fibre cavity scheme based on a combination of nonlinear optical loop mirror (NOLM) and nonlinear amplified loop mirror (NALM). Unidirectional lasing operation has been achieved without any intracavity isolator. By using a carbon nanotube polymer composite based saturable absorber (SA), we demonstrated the laser output power of ~197 mW and pulse energy of 1.7 μJ. To the best of our knowledge, this is the highest output power from a nanotube polymer composite SA based Q-switched Thulium doped fibre laser. PMID:27063511
Use of thulium-sensitized rare earth-doped low phonon energy crystalline hosts for IR sources.
Ganem, Joseph; Bowman, Steven R
2013-11-01
Crystalline hosts with low phonon energies enable novel energy transfer processes when doped with rare earth ions. Two applications of energy transfer for rare earth ions in thulium-sensitized low phonon energy crystals that result in infrared luminescence are discussed. One application is an endothermic, phonon-assisted cross-relaxation process in thulium-doped yttrium chloride that converts lattice phonons to infrared emission, which raises the possibility of a fundamentally new method for achieving solid-state optical cooling. The other application is an optically pumped mid-IR phosphor using thulium-praseodymium-doped potassium lead chloride that converts 805-nm diode light to broadband emission from 4,000 to 5,500 nm. These two applications in chloride crystals are discussed in terms of critical radii calculated from Forster-Dexter energy transfer theory. It is found that the critical radii for electric dipole-dipole interactions in low phonon energy chloride crystals are comparable to those in conventional oxide and fluoride crystals. It is the reduction in multi-phonon relaxation rates in chloride crystals that enable these additional energy transfer processes and infrared luminescence.
Use of thulium-sensitized rare earth-doped low phonon energy crystalline hosts for IR sources
NASA Astrophysics Data System (ADS)
Ganem, Joseph; Bowman, Steven R.
2013-11-01
Crystalline hosts with low phonon energies enable novel energy transfer processes when doped with rare earth ions. Two applications of energy transfer for rare earth ions in thulium-sensitized low phonon energy crystals that result in infrared luminescence are discussed. One application is an endothermic, phonon-assisted cross-relaxation process in thulium-doped yttrium chloride that converts lattice phonons to infrared emission, which raises the possibility of a fundamentally new method for achieving solid-state optical cooling. The other application is an optically pumped mid-IR phosphor using thulium-praseodymium-doped potassium lead chloride that converts 805-nm diode light to broadband emission from 4,000 to 5,500 nm. These two applications in chloride crystals are discussed in terms of critical radii calculated from Forster-Dexter energy transfer theory. It is found that the critical radii for electric dipole-dipole interactions in low phonon energy chloride crystals are comparable to those in conventional oxide and fluoride crystals. It is the reduction in multi-phonon relaxation rates in chloride crystals that enable these additional energy transfer processes and infrared luminescence.
Use of thulium-sensitized rare earth-doped low phonon energy crystalline hosts for IR sources
2013-01-01
Crystalline hosts with low phonon energies enable novel energy transfer processes when doped with rare earth ions. Two applications of energy transfer for rare earth ions in thulium-sensitized low phonon energy crystals that result in infrared luminescence are discussed. One application is an endothermic, phonon-assisted cross-relaxation process in thulium-doped yttrium chloride that converts lattice phonons to infrared emission, which raises the possibility of a fundamentally new method for achieving solid-state optical cooling. The other application is an optically pumped mid-IR phosphor using thulium-praseodymium-doped potassium lead chloride that converts 805-nm diode light to broadband emission from 4,000 to 5,500 nm. These two applications in chloride crystals are discussed in terms of critical radii calculated from Forster-Dexter energy transfer theory. It is found that the critical radii for electric dipole-dipole interactions in low phonon energy chloride crystals are comparable to those in conventional oxide and fluoride crystals. It is the reduction in multi-phonon relaxation rates in chloride crystals that enable these additional energy transfer processes and infrared luminescence. PMID:24180684
Sobon, Grzegorz; Duzynska, Anna; Świniarski, Michał; Judek, Jarosław; Sotor, Jarosław; Zdrojek, Mariusz
2017-01-01
In this work, we demonstrate a comprehensive study on the nonlinear parameters of carbon nanotube (CNT) saturable absorbers (SA) as a function of the nanotube film thickness. We have fabricated a set of four saturable absorbers with different CNT thickness, ranging from 50 to 200 nm. The CNTs were fabricated via a vacuum filtration technique and deposited on fiber connector end facets. Each SA was characterized in terms of nonlinear transmittance (i.e. optical modulation depth) and tested in a Thulium-doped fiber laser. We show, that increasing the thickness of the CNT layer significantly increases the modulation depth (up to 17.3% with 200 nm thick layer), which strongly influences the central wavelength of the laser, but moderately affects the pulse duration. It means, that choosing the SA with defined CNT thickness might be an efficient method for wavelength-tuning of the laser, without degrading the pulse duration. In our setup, the best performance in terms of bandwidth and pulse duration (8.5 nm and 501 fs, respectively) were obtained with 100 nm thick CNT layer. This is also, to our knowledge, the first demonstration of a fully polarization-maintaining mode-locked Tm-doped laser based on CNT saturable absorber. PMID:28368014
Spectrally Tailored Pulsed Thulium Fiber Laser System for Broadband Lidar CO2 Sensing
NASA Technical Reports Server (NTRS)
Heaps, William S.; Georgieva, Elena M.; McComb, Timothy S.; Cheung, Eric C.; Hassell, Frank R.; Baldauf, Brian K.
2011-01-01
Thulium doped pulsed fiber lasers are capable of meeting the spectral, temporal, efficiency, size and weight demands of defense and civil applications for pulsed lasers in the eye-safe spectral regime due to inherent mechanical stability, compact "all-fiber" master oscillator power amplifier (MOPA) architectures, high beam quality and efficiency. Thulium fiber's longer operating wavelength allows use of larger fiber cores without compromising beam quality, increasing potential single aperture pulse energies. Applications of these lasers include eye-safe laser ranging, frequency conversion to longer or shorter wavelengths for IR countermeasures and sensing applications with otherwise tough to achieve wavelengths and detection of atmospheric species including CO2 and water vapor. Performance of a portable thulium fiber laser system developed for CO2 sensing via a broadband lidar technique with an etalon based sensor will be discussed. The fielded laser operates with approximately 280 J pulse energy in 90-150ns pulses over a tunable 110nm spectral range and has a uniquely tailored broadband spectral output allowing the sensing of multiple CO2 lines simultaneously, simplifying future potentially space based CO2 sensing instruments by reducing the number and complexity of lasers required to carry out high precision sensing missions. Power scaling and future "all fiber" system configurations for a number of ranging, sensing, countermeasures and other yet to be defined applications by use of flexible spectral and temporal performance master oscillators will be discussed. The compact, low mass, robust, efficient and readily power scalable nature of "all-fiber" thulium lasers makes them ideal candidates for use in future space based sensing applications.
Influence of Temperature on Nanosecond Pulse Amplification in Thulium Doped Fiber Lasers
NASA Astrophysics Data System (ADS)
Abdulfattah, Ali; Gausmann, Stefan; Sincore, Alex; Bradford, Joshua; Bodnar, Nathan; Cook, Justin; Shah, Lawrence; Richardson, Martin
2018-05-01
Thulium silica doped fiber (TDF) lasers are becoming important laser sources in both research and applications in industry. A key element of all high-power lasers is thermal management and its impact on laser performance. This is particularly important in TDF lasers, which utilize an unusual cross-relation pumping scheme, and are optically less efficient than other types of fiber lasers. The present work describes an experimental investigation of thermal management in a high power, high repetition-rate, pulsed Thulium (Tm) fiber laser. A tunable nanosecond TDF laser system across the 1838 nm – 1948 nm wavelength range, has been built to propagate 2μm signal seed pulses into a TDF amplifier, comprising a polarized large mode area (PLMA) thulium fiber (TDF) with a 793nm laser diode pump source. The PLMA TDF amplifier is thermally managed by a separately controlled cooling system with a temperature varied from 12°C to 36°C. The maximum output energy (∼400 μJ), of the system is achieved at 12°C at 1947 nm wavelength with ∼32 W of absorbed pump power at 20 kHz with a pulse duration of ∼ 74 ns.
Spatially resolved measurement of the core temperature in a high-power thulium fiber system
NASA Astrophysics Data System (ADS)
Walbaum, Till; Heinzig, Matthias; Beier, Franz; Liem, Andreas; Schreiber, Thomas; Eberhardt, Ramona; Tünnermann, Andreas
2016-03-01
We present measurements of the temperature increase inside the active fiber of a thulium fiber amplifier during high power operation. At a pump power of over 100 W at a wavelength of 793 nm, we measure the core temperature distribution along the first section of a large mode area (LMA) highly thulium doped active fiber by use of an optical backscatter reflectometer. A mode field adaptor is used to maintain single mode operation in the LMA fiber. An increase in temperature of over 100 K can be observed in spite of conductive cooling, located at the pumped fiber end and jeopardizing the fiber coating. The recoated splice can be clearly identified as the hottest fiber region. This allows us to estimate the maximum thermally acceptable pump power for this amplifier. We also observe that the temperature can be decreased by increasing the seed power, which is in agreement with theoretical predictions on the increase of cross relaxation efficiency by depletion of the upper laser level. This underlines the role of power scaling of the respective seed power of a thulium amplifier stage as a means of thermal management.
Optimisation of thulium fibre laser parameters with generation of pulses by pump modulation
DOE Office of Scientific and Technical Information (OSTI.GOV)
Obronov, I V; Larin, S V; Sypin, V E
2015-07-31
The formation of relaxation pulses of a thulium fibre laser (λ = 1.9 μm) by modulating the power of a pump erbium fibre laser (λ = 1.55 μm) is studied. A theoretical model is developed to find the dependences of pulse duration and peak power on different cavity parameters. The optimal cavity parameters for achieving the minimal pulse duration are determined. The results are confirmed by experimental development of a laser emitting pulses with a duration shorter than 10 ns, a peak power of 1.8 kW and a repetition rate of 50 kHz. (control of radiation parameters)
Rare Earth Doped High Temperature Ceramic Selective Emitters
NASA Technical Reports Server (NTRS)
Chubb, Donald L.; Pal, AnnaMarie; Patton, Martin O.; Jenkins, Phillip P.
1999-01-01
As a result of their electron structure, rare earth ions in crystals at high temperature emit radiation in several narrow bands rather than in a continuous blackbody manner. This study develops a spectral emittance model for films of rare earth containing materials. Although there are several possible rare earth doped high temperature materials, this study was confined to rare earth aluminum garnets. Good agreement between experimental and theoretical spectral emittances was found for erbium, thulium and erbium-holmium aluminum garnets. Spectral emittances of these films are sensitive to temperature differences across the film. Emitter efficiency is also a sensitive function of temperature. For thulium aluminum garnet the efficiency is 0.38 at 1700 K but only 0.19 at 1262 K.
Comparing irradiation parameters on disinfecting enterrecoccus faecalis in root canal disinfection
NASA Astrophysics Data System (ADS)
Sarp, Ayşe. S.; Gülsoy, Murat
2016-02-01
Although conventional method carries all the debris, studies on persisting infections in root canals show bacteria and their toxins spread from the root canal and contaminate the apical region. Thus developes apical periodontitis or symptoms, and loss of tooth. Even if the treatment has adequate success, anatomy of root canal system can be very complexwith accessory canals. The disinfecting effect of laser radiation has only recently been used in dentistry. Laser irradiation has a bactericidal effect. Each wavelength has its own advantages and limitations according to their different absorption characteristics, depending on their 'absorption coefficient'. The sterilizing efficiency of two types of wavelengths, a new fiber laser 1940- nm Thulium fiber Laser and an 2940 nm Er:YAG Laser were compared in this study. Irradiation with a power of 0.50 W with 1940- nm Thulium fiber Laser disinfected 95,15% of bacteria, however irradiation with same laser power with Er:YAG Laser caused a reduction of 96,48 %. But there was no significant difference in the disinfection effect of two different laser groups ( p < 0.05, Mann- U-Whitney Test). In addition to this, Er :YAG Laser caused three times more reduction from its own positive control group where 1940- nm Thulium fiber Laser caused 2,5 times effective disinfection.
Different lasers in the treatment of benign prostatic hyperplasia: a network meta-analysis
Zhang, Xingming; Shen, Pengfei; He, Qiying; Yin, Xiaoxue; Chen, Zhibin; Gui, Haojun; Shu, Kunpeng; Tang, Qidun; Yang, Yaojing; Pan, Xiuyi; Wang, Jia; Chen, Ni; Zeng, Hao
2016-01-01
All available surgical treatments for benign prostatic hyperplasia (BPH) have their individual advantages or disadvantages. However, the lack of head-to-head studies comparing different surgeries makes it unavailable to conduct direct analysis. To compare the efficacy and safety among different lasers and transurethral resection of prostate (TURP) for BPH, randomized controlled trials were searched in MEDLINE, EMBASE, Cochrane library, WHO International Clinical Trial Registration Platform, and Clinical Trial.gov by 2015.5; and the effectiveness-, perioperation- and complication-related outcomes were assessed by network meta-analysis. 36 studies involving 3831 patients were included. Holmium laser through resection and enucleation had the best efficacy in maximum flow rate. Thulium laser through vapo-resection was superior in improving international prostate symptom score and holmium laser through enucleation was the best for post-voiding residual volume improvement. Diode laser through vaporization was the rapidest in removing postoperative indwelling catheter, while TURP was the longest. TURP required the longest hospitalization and thulium laser through vapo-resection was relatively shorter. Holmium and thulium lasers seem to be relatively better in surgical efficacy and safety, so that these two lasers might be preferred in selection of optimal laser surgery. Actually, more large-scale and high quality head-to-head RCTs are suggested to validate the conclusions. PMID:27009501
Sun, Weifu; Chen, Zihan; Zhang, Qin; Zhou, Junli; Li, Feng; Jin, Xiao; Li, Dongyu; Li, Qinghua
2016-11-09
In this work, thulium and ytterbium codoped gadolinium molybdate (Gd 2 (MoO 4 ) 3 :Yb/Tm) nanophosphors (NPs) have been synthesized, followed by being incorporated into a photo-catalytic titania (TiO 2 ) nanoparticle layer. In detail, morphology and phase identification of the prepared NPs are first characterized and then the up-conversion of the Gd 2 (MoO 4 ) 3 :Yb/Tm NPs is studied. Electron transfer dynamics after interfacing with bare or NP-doped electron donor TiO 2 and the corresponding photovoltaic performance of solar cells are explored. The results show that Gd 2 (MoO 4 ) 3 :Yb/Tm NPs excited at 976 nm exhibit intense blue (460-498 nm) and weak red (627-669 nm) emissions. The lifetime of electron transfer is shortened from 817 to 316 ps after incorporating NPs and correspondingly the electron transfer rate outstrips by 3 times that of the bare TiO 2 . Consequently, a notable power conversion efficiency of 4.15% is achieved as compared to 3.17% of pure TiO 2 /PTB7. This work demonstrates that the co-doping of robust rare earth ions with different unique functions can widen the harvesting range of the solar spectrum, boost electron transfer rate and eventually strengthen device performance, without complicated interfacial and structural engineering.
Carbon Nanotube Mode-Locked Thulium Fiber Laser With 200 nm Tuning Range
Meng, Yafei; Li, Yao; Xu, Yongbing; Wang, Fengqiu
2017-01-01
We demonstrated a mode-locked thulium/holmium (Tm/Ho) fiber laser continuously tunable across 200 nm (from 1860 nm to 2060 nm), which to the best of our knowledge represents the widest tuning range ever achieved for a passively mode-locked fiber laser oscillator. The combined use of a broadband carbon nanotube (CNT) saturable absorber and a diffraction grating mirror ensures ultra-broad tuning range, superb stability and repeatability, and makes the demonstrated laser a highly practical source for spectroscopy, imaging and optical communications. The laser emits <5 ps pulses with an optical spectral bandwidth of ∼3 nm across the full tuning range. Our results indicate that carbon nanotubes can be an excellent saturable absorber for achieving gain-bandwidth-limited tunable operation for 2 μm thulium fiber lasers. PMID:28322327
Carbon Nanotube Mode-Locked Thulium Fiber Laser With 200 nm Tuning Range
NASA Astrophysics Data System (ADS)
Meng, Yafei; Li, Yao; Xu, Yongbing; Wang, Fengqiu
2017-03-01
We demonstrated a mode-locked thulium/holmium (Tm/Ho) fiber laser continuously tunable across 200 nm (from 1860 nm to 2060 nm), which to the best of our knowledge represents the widest tuning range ever achieved for a passively mode-locked fiber laser oscillator. The combined use of a broadband carbon nanotube (CNT) saturable absorber and a diffraction grating mirror ensures ultra-broad tuning range, superb stability and repeatability, and makes the demonstrated laser a highly practical source for spectroscopy, imaging and optical communications. The laser emits <5 ps pulses with an optical spectral bandwidth of ˜3 nm across the full tuning range. Our results indicate that carbon nanotubes can be an excellent saturable absorber for achieving gain-bandwidth-limited tunable operation for 2 μm thulium fiber lasers.
Tunable thulium-doped fiber laser based on an abrupt-tapered in-fiber interferometer
NASA Astrophysics Data System (ADS)
Hernández-Arriaga, M. V.; Durán-Sánchez, M.; Ibarra-Escamilla, B.; Álvarez-Tamayo, R. I.; Santiago-Hernández, H.; Bello-Jiménez, M.; Kuzin, E. A.
2017-11-01
An experimental study of an all-fiber tunable thulium-doped fiber laser based on an abrupt-tapered in-fiber interferometer is presented. A microfiber filter with length of 6 mm and diameter of 20 μm is used to achieve single laser wavelength tuning in a range of 19.4 nm and dual-wavelength laser operation at 1761.8 and 1793.4 nm with a channel spacing of 31.6 nm. The abrupt-tapered structure allows multi-modal interference at the air-cladding interface. The proposed in-fiber interferometer exhibits characteristics of low cost and simple fabrication, making it suitable for practical applications in wavelength filtering and wavelength selection in all-fiber lasers.
Two-micron (Thulium) Laser Prostatectomy: An Effective Method for BPH Treatment.
Jiang, Qi; Xia, Shujie
2014-01-01
The two-micron (thulium) laser is the newest laser technique for treatment of bladder outlet obstruction resulting from benign prostatic hyperplasia (BPH). It takes less operative time than standard techniques, provides clear vision and lower blood loss as well as shorter catheterization times and hospitalization times. It has been identified to be a safe and efficient method for BPH treatment regardless of the prostate size.
Peng, Bo; Wang, Guang-chun; Zheng, Jun-hua; Xia, Sheng-qiang; Geng, Jiang; Che, Jian-ping; Yan, Yang; Huang, Jian-hua; Xu, Yun-fei; Yang, Bin
2013-04-01
WHAT'S KNOWN ON THE SUBJECT? AND WHAT DOES THE STUDY ADD?: Thulium laser is a new generation of surgical laser. It is a minimally invasive technology with several advantages, including rapid vaporization and minimal tissue damage and bleeding. However, details regarding the safety and efficacy of thulium laser in treating BPH remains unknown. We performed a comparative study in 100 patients with BPH of the safety and efficacy of thulium laser resection of the prostate (TMLRP, n = 50) and bipolar transurethral plasmakinetic prostatectomy (TUPKP, n = 50). We found that the efficacy and indications were the same in TMLRP and TUPKP. In TUPKP, the morbidity of urethrostenosis was low, and was nearly bloodless in surgery and had higher safety. Nevertheless, TUPKP is more suitable for patients with larger prostate volume. To compare the safety and short-term efficacy of thulium laser resection of the prostate (TMLRP) and bipolar transurethral plasmakinetic prostatectomy (TUPKP) for the treatment of patients with benign prostatic hyperplasia (BPH). A total of 100 patients diagnosed with BPH were randomly divided into two groups, treated with either TMLRP (50, group 1) or TUPKP (50, group 2). There was no significant difference in preoperative variables such as age, prostate volume, prostate-specific antigen (PSA) level, International Prostate Symptom Score (IPSS), maximum urinary flow rate (Qmax ) and postvoid residual urine volume (PVR) between the two groups. The perioperative parameters and therapeutic effects were recorded and compared between the two groups. There were significant differences in the following parameters between the two groups (TMLRP vs TUPKP [mean ± SD]): operation duration, 61.2 ± 24.2 vs 30.14 ± 15.9 min; catheterization time, 1.8 ± 0.4 vs 3.2 ± 0.6 d; postoperative hospital stay, 3.3 ± 0.8 vs 4.1 ± 1.3 d. The volume of blood loss and postoperative bladder irrigation were significantly lower in TMLRP group than in the TUPKP group. At 1 month after the operation, there were four cases of urethral stricture in the TUPKP group. At 3 months after the operation, IPSS, quality of life (QoL), Qmax and PVR were significantly improved, with no significant difference between the two groups. TMLRP is superior to TUPKP in terms of safety, blood loss, recovery time and complication rate, and is as efficacious as TUPKP for treating BPH. Operation duration was significantly longer in the TMLRP group than in the TUPKP group. © 2012 BJU International.
Thulium fiber laser lithotripsy using tapered fibers.
Blackmon, Richard L; Irby, Pierce B; Fried, Nathaniel M
2010-01-01
The Thulium fiber laser has recently been tested as a potential alternative to the Holmium:YAG laser for lithotripsy. This study explores use of a short taper for expanding the Thulium fiber laser beam at the distal tip of a small-core fiber. Thulium fiber laser radiation with a wavelength of 1,908 nm, 10 Hz pulse rate, 70 mJ pulse energy, and 1-millisecond pulse duration was delivered through a 2-m-length fiber with 150-microm-core-input-end, 300-microm-core-output-end, and 5-mm-length taper, in contact with human uric acid (UA) and calcium oxalate monohydrate (COM) stones, ex vivo (n = 10 each). Stone mass loss, stone crater depths, fiber transmission losses, fiber burn-back, irrigation rates, and deflection through a flexible ureteroscope were measured for the tapered fiber and compared with conventional fibers. After delivery of 1,800 pulses through the tapered fiber, mass loss measured 12.7+/-2.6 mg for UA and 7.2+/-0.8 mg COM stones, comparable to conventional 100-microm-core fibers (12.6+/-2.5 mg for UA and 6.8+/-1.7 mg for COM stones). No transmission losses or burn-back occurred for the tapered fiber after 36,000 pulses, while a conventional 150-microm fiber experienced significant tip degradation after only 1,800 pulses. High irrigation rates were measured with the tapered fiber inserted through the working port of a flexible ureteroscope without hindering its deflection, mimicking that of a conventional 150 microm fiber. The short tapered distal fiber tip allows expansion of the laser beam, resulting in decreased fiber tip damage compared to conventional small-core fibers, without compromising fiber bending, stone vaporization efficiency, or irrigation rates.
NASA Astrophysics Data System (ADS)
Durán Sánchez, M.; Álvarez-Tamayo, R. I.; Posada-Ramírez, B.; Alaniz-Baylón, J.; Bravo-Huerta, E.; Santiago-Hernández, H.; Hernández-Arriaga, M. V.; Bello-Jiménez, Miguel; Ibarra-Escamilla, B.; Kuzin, E. A.
2018-02-01
We report a linear cavity all-fiber passive Q-switched thulium-doped fiber laser operating at the 2 μm wavelength range. The laser configuration is based on a thulium-doped fiber used as a gain medium and an unpumped segment of holmium-doped fiber which acts as a fiber saturable absorber. The cavity is formed by a fiber optical loop mirror and the flat end facet of the holmium-doped fiber. The fiber segments as saturable absorber is a 1-m long single mode doubleclad holmium-doped fiber. Q-switched pulses are obtained at the wavelength of 2024.5 nm with a pulse width of 1.1 μs. The pulse repetition rate increases as a linear function of the applied pump power. The maximum pulse repetition rate of 100 kHz was obtained with a pump power of 2.4 W.
1700 nm and 1800 nm band tunable thulium doped mode-locked fiber lasers.
Emami, Siamak Dawazdah; Dashtabi, Mahdi Mozdoor; Lee, Hui Jing; Arabanian, Atoosa Sadat; Rashid, Hairul Azhar Abdul
2017-10-06
This paper presents short wavelength operation of tunable thulium-doped mode-locked lasers with sweep ranges of 1702 to 1764 nm and 1788 to 1831 nm. This operation is realized by a combination of the partial amplified spontaneous emission suppression method, the bidirectional pumping mechanism and the nonlinear polarization rotation (NPR) technique. Lasing at emission bands lower than the 1800 nm wavelength in thulium-doped fiber lasers is achieved using mode confinement loss in a specially designed photonic crystal fiber (PCF). The enlargement of the first outer ring air holes around the core region of the PCF attenuates emissions above the cut-off wavelength and dominates the active region. This amplified spontaneous emission (ASE) suppression using our presented PCF is applied to a mode-locked laser cavity and is demonstrated to be a simple and compact solution to widely tunable all-fiber lasers.
Q-switched oscillation in thulium-doped fiber lasers using preloaded dynamic microbending technique
NASA Astrophysics Data System (ADS)
Sakata, H.; Takahashi, N.; Ushiro, Y.
2018-01-01
We demonstrate Q-switched pulse generation in thulium-doped fiber lasers by introducing piezoelectric-driven microbend with preloaded stress. We employed a pair of corrugated chips each attached on piezoelectric actuators (PAs) to clamp the fiber in a ring laser resonator. The thulium-doped fiber is pumped by a laser diode emitting at 1.63 μm and generates the Q-switched laser pulses at around 1.9 μm by switching off the PAs. The laser pulse performance is improved by optimizing the preload and switch-off period for the PAs. The Q-switched pulses with a peak power of 2.8 W and a pulsewidth of 900 ns are observed for a launched pump power of 161 mW. We expect that the in-fiber Q-switching technique will provide efficient laser systems for environmental sensing and medical applications.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Guerra Liberal, Francisco D. C., E-mail: meb12020@fe.up.pt, E-mail: adriana-tavares@msn.com; Tavares, Adriana Alexandre S., E-mail: meb12020@fe.up.pt, E-mail: adriana-tavares@msn.com; Tavares, João Manuel R. S., E-mail: tavares@fe.up.pt
Purpose: Throughout the years, the palliative treatment of bone metastases using bone seeking radiotracers has been part of the therapeutic resources used in oncology, but the choice of which bone seeking agent to use is not consensual across sites and limited data are available comparing the characteristics of each radioisotope. Computational simulation is a simple and practical method to study and to compare a variety of radioisotopes for different medical applications, including the palliative treatment of bone metastases. This study aims to evaluate and compare 11 different radioisotopes currently in use or under research for the palliative treatment of bonemore » metastases using computational methods. Methods: Computational models were used to estimate the percentage of deoxyribonucleic acid (DNA) damage (fast Monte Carlo damage algorithm), the probability of correct DNA repair (Monte Carlo excision repair algorithm), and the radiation-induced cellular effects (virtual cell radiobiology algorithm) post-irradiation with selected particles emitted by phosphorus-32 ({sup 32}P), strontium-89 ({sup 89}Sr), yttrium-90 ({sup 90}Y ), tin-117 ({sup 117m}Sn), samarium-153 ({sup 153}Sm), holmium-166 ({sup 166}Ho), thulium-170 ({sup 170}Tm), lutetium-177 ({sup 177}Lu), rhenium-186 ({sup 186}Re), rhenium-188 ({sup 188}Re), and radium-223 ({sup 223}Ra). Results: {sup 223}Ra alpha particles, {sup 177}Lu beta minus particles, and {sup 170}Tm beta minus particles induced the highest cell death of all investigated particles and radioisotopes. The cell survival fraction measured post-irradiation with beta minus particles emitted by {sup 89}Sr and {sup 153}Sm, two of the most frequently used radionuclides in the palliative treatment of bone metastases in clinical routine practice, was higher than {sup 177}Lu beta minus particles and {sup 223}Ra alpha particles. Conclusions: {sup 223}Ra and {sup 177}Lu hold the highest potential for palliative treatment of bone metastases of all radioisotopes compared in this study. Data reported here may prompt future in vitro and in vivo experiments comparing different radionuclides for palliative treatment of bone metastases, raise the need for the careful rethinking of the current widespread clinical use of {sup 89}Sr and {sup 153}Sm, and perhaps strengthen the use of {sup 223}Ra and {sup 177}Lu in the palliative treatment of bone metastases.« less
Tao, Joy; Champlain, Amanda; Weddington, Charles; Moy, Lauren; Tung, Rebecca
2018-01-01
Burn scars cause cosmetic disfigurement and psychosocial distress. We present two Fitzpatrick phototype (FP) III patients with burn scars successfully treated with combination pulsed dye laser (PDL) and non-ablative fractional lasers (NAFL). A 30-year-old, FP III woman with a history of a second-degree burn injury to the bilateral arms and legs affecting 30% body surface area (BSA) presented for cosmetic treatment. The patient received three treatments with 595 nm PDL (7 mm, 8 J, 6 ms), six with the 1550 nm erbium:glass laser (30 mJ, 14% density, 4-8 passes) and five with the 1927 nm thulium laser (10 mJ, 30% density, 4-8 passes). Treated burn scars improved significantly in thickness, texture and colour. A 33-year-old, FP III man with a history of a second-degree burn injury of the left neck and arm affecting 7% BSA presented for cosmetic treatment. The patient received two treatments with 595 nm PDL (5 mm, 7.5 J, 6 ms), four with the 1550 nm erbium:glass laser (30 mJ, 14% density, 4-8 passes) and two with the 1927 nm thulium laser (10 mJ, 30% density, 4-8 passes). The burn scars became thinner, smoother and more normal in pigmentation and appearance. Our patients' burn scars were treated with a combination of PDL and NAFL (two wavelengths). The PDL targets scar hypervascularity, the 1550 nm erbium:glass stimulates collagen remodelling and the 1927 nm thulium targets epidermal processes, particularly hyperpigmentation. This combination addresses scar thickness, texture and colour with a low side effect profile and is particularly advantageous in patients at higher risk of post-procedure hyperpigmentation. Our cases suggest the combination of 595nm PDL plus NAFL 1550 nm erbium:glass/1927 nm thulium device is effective and well-tolerated for burn scar treatment in skin of colour.
Hollow steel tips for reducing distal fiber burn-back during thulium fiber laser lithotripsy.
Hutchens, Thomas C; Blackmon, Richard L; Irby, Pierce B; Fried, Nathaniel M
2013-07-01
The use of thulium fiber laser (TFL) as a potential alternative laser lithotripter to the clinical holmium:YAG laser is being studied. The TFL's Gaussian spatial beam profile provides efficient coupling of higher laser power into smaller core fibers without proximal fiber tip degradation. Smaller fiber diameters are more desirable, because they free up space in the single working channel of the ureteroscope for increased saline irrigation rates and allow maximum ureteroscope deflection. However, distal fiber tip degradation and "burn-back" increase as fiber diameter decreases due to both excessive temperatures and mechanical stress experienced during stone ablation. To eliminate fiber tip burn-back, the distal tip of a 150-μm core silica fiber was glued inside 1-cm-long steel tubing with fiber tip recessed 100, 250, 500, 1000, or 2000 μm inside the steel tubing to create the hollow-tip fiber. TFL pulse energy of 34 mJ with 500-μs pulse duration and 150-Hz pulse rate was delivered through the hollow-tip fibers in contact with human calcium oxalate monohydrate urinary stones during ex vivo studies. Significant fiber tip burn-back and degradation was observed for bare 150-μm core-diameter fibers. However, hollow steel tip fibers experienced minimal fiber burn-back without compromising stone ablation rates. A simple, robust, compact, and inexpensive hollow fiber tip design was characterized for minimizing distal fiber burn-back during the TFL lithotripsy. Although an increase in stone retropulsion was observed, potential integration of the hollow fiber tip into a stone basket may provide rapid stone vaporization, while minimizing retropulsion.
NASA Astrophysics Data System (ADS)
Gonzalez, David A.; Hardy, Luke A.; Hutchens, Thomas C.; Irby, Pierce B.; Fried, Nathaniel M.
2018-02-01
This study characterizes laser-induced vapor bubbles for five distal fiber optic tip configurations, to provide insight into stone retropulsion experienced during laser ablation of kidney stones. A TFL with 1908-nm wavelength delivered 34 mJ energy per pulse at 500-μs pulse duration through five different fibers: 100-μm-core/170-μm-OD bare fiber tip, 150-μm- to 300-μm-core tapered fiber tip, 100-μm-core/300-μm-OD ball tip fiber, 100-μm-core/340- μm-OD hollow steel tip fiber, and 100-μm-core/560-μm-OD muzzle brake fiber tip. A high speed camera with 10- μm spatial and 9.5-μs temporal resolution imaged vapor bubble dynamics. A needle hydrophone measured pressure transients in forward (0°) and side (90°) directions while placed at a 6.8 +/- 0.4 mm distance from fiber tip. Maximum bubble dimensions (width/length) averaged 0.7/1.5, 1.0/1.6, 0.5/1.1, 0.8/1.9, and 0.7/1.5 mm, for bare, tapered, ball, hollow steel, and muzzle tips, respectively (n=5). The hollow steel tip exhibited the most elongated vapor bubble shape, translating into increased forward pressure in this study and consistent with higher stone retropulsion in previous reports. Relative pressures (a.u.) in (forward/side) directions averaged 1.7/1.6, 2.0/2.0, 1.4/1.2, 6.8/1.1, and 0.3/1.2, for each fiber tip (n=5). For hollow steel tip, forward pressure was 4× higher than for bare fiber. For the muzzle brake fiber tip, forward pressure was 5× lower than for bare fiber. Bubble dimensions and pressure measurements demonstrated that the muzzle tip reduced forward pressure by partially venting vapors through side holes, consistent with lower stone retropulsion observed in previous reports.
Rudy, Charles W; Marandi, Alireza; Vodopyanov, Konstantin L; Byer, Robert L
2013-08-01
We report a supercontinuum spanning well over an octave of measurable bandwidth from about 1 to 3.7 μm in a 2.1 mm long As₂S₃ fiber taper using the in situ tapering method. A sub-100-fs mode-locked thulium-doped fiber laser system with ~300 pJ of pulse energy was used as the pump source. Third-harmonic generation was observed and currently limits the pump pulse energy and achievable spectral bandwidth.
Diode-Pumped Thulium (Tm)/Holmium (Ho) Composite Fiber 2.1-Micrometers Laser
2015-09-01
composite fiber laser of holmium-core and thulium-doped cladding . The composite fiber was optically pumped by an 803-nm fiber coupled diode source and was...4 odd and 5 even modes were exclusive to the core and first cladding . As the Tm laser modes are excluded from lasing in the second (undoped...of the Tm-doped clad /Ho-doped core fiber laser . In particular, calculations of the model overlap of the cladding modes with the core have been
Transoral robotic surgery using the thulium:YAG laser: a prospective study.
Van Abel, Kathryn M; Moore, Eric J; Carlson, Matthew L; Davidson, Jennifer A; Garcia, Joaquin J; Olsen, Steven M; Olsen, Kerry D
2012-02-01
To compare thulium:YAG laser-assisted transoral robotic surgery (TY:TORS) and conventional electrocautery-equipped TORS (EC:TORS) in patients undergoing transoral resection of upper aerodigestive tract malignant neoplasms. Prospective matched cohort study. Tertiary academic referral center. Fifteen patients undergoing TY:TORS were matched on the basis of tumor site, clinical T stage, sex, and age with 30 control subjects undergoing EC:TORS. The primary outcome was a comparison between the feasibility of TY:TORS compared with EC:TORS. The secondary outcome was a comparison between the safety and functional outcome of TY:TORS compared with EC:TORS in patients undergoing resection of upper aerodigestive tract malignant neoplasms. All the tumors underwent complete excision with negative margins. Estimated blood loss was minimal (<150 mL) for 87% of TY:TORS patients (13 of 15) and 63% of EC:TORS controls (19 or 30). Intraoperative pharyngotomy was reported in 8% of TY:TORS patients (1 of 13) and 42% of EC:TORS controls (11 of 30) (P = .03). Postoperative pain was greater in EC:TORS compared with TY:TORS (P = .02). No statistically significant differences were noted in hemostasis, postoperative bleeding rates, or other complications. Compared with EC:TORS, TY:TORS seems feasible and safe. In addition, TY:TORS resulted in fewer intraoperative pharyngotomies and less postoperative pain than did EC:TORS, which may be because of decreased collateral thermal damage, improved visualization, and finer cutting using the thulium laser.
In vivo study of partial liver resection on pigs using a 1.9 μm thulium fiber laser
NASA Astrophysics Data System (ADS)
Theisen-Kunde, D.; Wolken, H.; Danicke, V.; Brinkmann, R.; Bruch, H.; Kleemann, M.
2011-07-01
Dissection of liver tissue can be performed by different techniques (ultrasound, mono and bipolar dissection, water jet dissection and by stapler). In this animal study the potential of a Thulium fiber laser system was investigated for open parenchyma dissection. Based on a cw Thulium fiber laser (IPG laser GmbH, Burbach, Germany), emitting a wavelength at 1.9 μm and a maximal power at 50 W, a surgical dissection device was developed at the Medical Laser Centre Luebeck. Cw laser radiation (40 Watt) was transmitted via a 365 μm fiber with a polished distal fiber tip. Procedure was performed in contact mode; irradiance at the distal fiber tip was 38.2 kW/cm2. After general anesthesia and a median laparotomy an atypical laser resection of the liver was performed in 3 pigs. Healing process was controlled after 2-3 weeks by histological analysis (H&E staining). The final evaluation data included total resection time, blood loss, bile leakage and mass of dissected tissue. All animals treated in this study were cared for in accordance to the European convention on animal care. In general the dissection with the 1.9 μm laser radiation was easily performed. Hemostasis was highly sufficient so blood loss and bile leakage was negligible. Total resection time including hemostasis of the remaining tissue was 26 +/- 12 min. Weight of resected tissue was 17 +/- 8 g. During survival period no complications (bleeding or inflammation) occurred. After 2 weeks histology showed ongoing scar formation about 1 - 2 mm in depth of the dissected area.
Veeraraghavan, Jamunarani; Tan, Ying; Cao, Xi-Xi; Kim, Jin-Ah; Wang, Xian; Chamness, Gary C.; Maiti, Sourindra N.; Cooper, Laurence J. N.; Edwards, Dean P.; Contreras, Alejandro; Hilsenbeck, Susan G.; Chang, Eric C.; Schiff, Rachel; Wang, Xiao-Song
2014-01-01
Characterizing the genetic alterations leading to the more aggressive forms of estrogen receptor positive (ER+) breast cancers are of critical significance in breast cancer management. Here we identify recurrent rearrangements between estrogen receptor gene ESR1 and its neighbor CCDC170, which are enriched in the more aggressive and endocrine-resistant luminal-B tumors, through large-scale analyses of breast cancer transcriptome and copy number alterations. Further screening of 200 ER+ breast cancers identifies eight ESR1-CCDC170 positive tumors. These fusions encode N-terminally truncated CCDC170 proteins (ΔCCDC170). When introduced into ER+ breast cancer cells, ΔCCDC170 leads to markedly increased cell motility and anchorage-independent growth, reduced endocrine sensitivity, and enhanced xenograft tumor formation. Mechanistic studies suggest that ΔCCDC170 engages Gab1 signalosome to potentiate growth factor signaling and enhance cell motility. Together, this study identifies neoplastic ESR1-CCDC170 fusions in a more aggressive subset of ER+ breast cancer, which suggests a new concept of ER pathobiology in breast cancer. PMID:25099679
Optical properties of bismuth and gallium substituted thulium iron garnet films
NASA Astrophysics Data System (ADS)
Gerhardt, R.; Sure, S.; Dötsch, H.; Linkewitz, T.; Tolksdorf, W.
1993-09-01
Bismuth and gallium substituted films of thulium iron garnet, grown by liquid phase epitaxy on [111] oriented substrates of gadolinium gallium garnet, are investigated for optical isolator applications. At a wavelength of λ = 1.3 μm the optical damping, the refractive index, the optical anisotropy, and the Faraday rotation are measured as function of the substitution level. It turns out that the growth induced optical anisotropy is very small, similar to the magnetic anisotropy. The observed difference between forward and backward propagation constants of TM modes is in excellent agreement with calculations.
Proximal fiber tip damage during Holmium:YAG and thulium fiber laser ablation of kidney stones
NASA Astrophysics Data System (ADS)
Wilson, Christopher R.; Hardy, Luke A.; Irby, Pierce B.; Fried, Nathaniel M.
2016-02-01
The Thulium fiber laser (TFL) is being studied as an alternative to Holmium:YAG laser for lithotripsy. TFL beam originates within an 18-μm-core thulium doped silica fiber, and its near single mode, Gaussian beam profile enables transmission of higher laser power through smaller fibers than possible during Holmium laser lithotripsy. This study examines whether TFL beam profile also reduces proximal fiber tip damage compared to Holmium laser multimodal beam. TFL beam at wavelength of 1908 nm was coupled into 105-μm-core silica fibers, with 35-mJ energy, 500-μs pulse duration, and pulse rates of 50-500 Hz. For each pulse rate, 500,000 pulses were delivered. Magnified images of proximal fiber surfaces were taken before and after each trial. For comparison, 20 single-use, 270-μm-core fibers were collected after clinical Holmium laser lithotripsy procedures using standard settings (600 mJ, 350 μs, 6 Hz). Total laser energy, number of laser pulses, and laser irradiation time were recorded, and fibers were rated for damage. For TFL studies, output power was stable, and no proximal fiber damage was observed after delivery of 500,000 pulses at settings up to 35 mJ, 500 Hz, and 17.5 W average power. In contrast, confocal microscopy images of fiber tips after Holmium lithotripsy showed proximal fiber tip degradation in all 20 fibers. The proximal fiber tip of a 105-μm-core fiber transmitted 17.5 W of TFL power without degradation, compared to degradation of 270-μm-core fibers after transmission of 3.6 W of Holmium laser power. The smaller and more uniform TFL beam profile may improve fiber lifetime, and potentially reduce costs for the surgical disposables as well.
Ultra-short wavelength operation in Thulium-doped silica fiber laser with bidirectional pumping
NASA Astrophysics Data System (ADS)
Xiao, Xusheng; Guo, Haitao; Yan, Zhijun; Wang, Hushan; Xu, Yantao; Lu, Min; Wang, Yishan; Peng, Bo
2017-02-01
An ultra-short wavelength operation of Tm-doped all fiber laser based on fiber Bragg gratings (FBGs) was developed. A bi-directional pump configuration for the ultra-short wavelength operation was designed and investigated for the first time. the laser yielded 3.15W of continuous-wave output at 1706.75nm with a narrow-linewidth of 50pm and a maximum slope efficiency of 42.1%. The dependencies of the slope efficiencies and pump threshold of the laser versus the length of active fiber and reflectivity of the output mirror (FBG) were investigated in detail. An experimental comparative study between two Thulium-doped fiber lasers (TDFLs) with two different pumping configuration(forward unidirectional pumping and bidirectional pumping) was presented. It is indisputable that the development of 1.7μm silicate fiber lasers with Watt-level output power open up a number of heart-stirring and tempting application windows.
Jung, Minwan; Han Lee, Ju
2013-04-20
An actively Q-switched thulium-holmium-codoped fiber laser incorporating an Si-based variable optical attenuator (VOA) is experimentally demonstrated. It has been shown that an Si-based VOA with a response time of hundreds of nanoseconds can be used as a cost-effective 2 μm Q switch due to its extremely wide operating bandwidth from 1.5 to 2 μm, and low electrical power consumption. In our study, the laser's slope efficiency was measured to be ~17% at an operating wavelength of 1.89 μm. The repetition rate tuning range was from 20 to 80 kHz, which was limited by the optical damage threshold and the response time. The minimum temporal pulsewidth was measured to be ~184 ns at a modulation frequency of 20 kHz, and the corresponding maximum peak power was ~10 W.
Stepwise emergence of the face-sensitive N170 event-related potential component.
Jemel, Boutheina; Schuller, Anne-Marie; Cheref-Khan, Yasémine; Goffaux, Valérie; Crommelinck, Marc; Bruyer, Raymond
2003-11-14
The present study used a parametric design to characterize early event-related potentials (ERP) to face stimuli embedded in gradually decreasing random noise levels. For both N170 and the vertex positive potential (VPP) there was a linear increase in amplitude and decrease in latency with decreasing levels of noise. In contrast, the earlier visual P1 component was stable across noise levels. The P1/N170 dissociation suggests not only a functional dissociation between low and high-level visual processing of faces but also that the N170 reflects the integration of sensorial information into a unitary representation. In addition, the N170/VPP association supports the view that they reflect the same processes operating when viewing faces.
Pal, Debasis; Ghosh, Aditi; Sen, Ranjan; Pal, Atasi
2016-08-10
A continuous-wave (CW) as well as quasi-continuous wave (QCW) thulium-doped all-fiber laser at 1.94 μm has been designed for targeting applications in urology. The thulium-doped active fiber with an octagonal-shaped inner cladding is pumped at 793 nm to achieve stable CW laser power of 10 W with 32% lasing efficiency (against launched pump power). The linear variation of laser power with pump offers a scope of further power scaling. A QCW operation with variation of duty cycle from 0.5% to 90%, repetition rate from 0.1 Hz to 1 kHz, and pulse width from 40 μs to 2 s has been presented. Laser power of 9.5 W in CW mode of operation and average power of 5.2 W with energy range of 10.4-104 mJ in QCW mode of operation has been employed to fragment calcium oxalate monohydrate kidney stones (size of 1.5-4 cm) having different colors and composition. Dependence of ablation threshold, ablation rate, and average fragmented particle size on the average power and energy has been studied. One minute of laser exposure results in fragmentation of a stone surface with ablation rate of 8 mg/min having minimum particle size of 6.54 μm with an average size of 20-100 μm ensuring the natural removal of fragmented parts through the urethra.
Pang, Kun; Sun, Xiao-Wen; Liu, Shi-Bo; Li, Wei-Guo; Shao, Yi; Zhuo, Jian; Wei, Hai-Bin; Xia, Shu-Jie
2012-11-13
To explore the application of thulium laser (2 µm laser) in managing bladder cuff in nephroureterectomy for upper urinary tract urothelium carcinoma (UUT-UC). The medical records of 56 patients undergoing nephroureterectomy at our hospital were reviewed retrospectively. The operative indicators, oncologic outcomes and clinicopathologic data were compared among the groups of open surgery (Group A), electric coagulation (Group B) and thulium laser technique (Group C). Furthermore a model of burst pressure measurement was built to measure the different burst pressures of sealing distal ureter. The follow-up results: when the indicators of operative duration, intraoperative blood loss volume, removal time of drainage tube, removal time of catheter and hospital stays were compared among three groups, Group A had no statistical differences with Group B/C in terms of removal time of drainage tube and removal time of catheter. But significant statistical differences existed in terms of operative duration, intraoperative blood loss volume and hospital stays ((232 ± 52) vs (148 ± 47) and (130 ± 49) min, (358 ± 81) vs (136 ± 74) and (145 ± 70) ml, (13 ± 3) vs (11 ± 4) and (10 ± 3) d, all P < 0.05). No statistical differences existed between Groups B and C in terms of all the above indicators. Burst pressure measurement results: no statistical differences existed between Group C and B ((116 ± 21) vs (139 ± 32) cm H2O, P > 0.05). For the surgical treatment of UUT-UC, thulium laser technique has no difference in operation indicators and oncologic outcomes compared to open surgery. Besides, it has the advantages of improved spatial beam quality and more precise tissue incision.
Magnetic hysteresis in a lanthanide molecular magnet dimer system
NASA Astrophysics Data System (ADS)
Atkinson, James; Cebulka, Rebecca; Del Barco, Enrique; Roubeau, Olivier; Velasco, Veronica; Barrios, Leo; Aromi, Guillem
Molecular magnets present a wonderful means for studying the dynamics of spin. Often synthesized as a crystal lattice of identical systems, ensemble measurements enable thorough detailing of the internal degrees of freedom. Here we present the results of characterization performed on a dimer system, CeTm(HL)2(H2L)NO3pyH2O (L = ligand, C45H31O15N3), consisting of two lanthanide spins (Cerium and Thulium) with expected local axial anisotropies tilted with respect to each other. Microwave EPR spectroscopy at low temperature reveals hysteresis in observed absorption features, with angle dependence studies indicating the presence of several ``easy axis'' orientations. We attempt to understand this system through modelling via a spin Hamiltonian, and to determine the strength and nature of the coupling between the lanthanide centers. This research was funded through NSF Grant # 24086159.
Filho, Manoel A. M.; Dutra, José Diogo L.; Rocha, Gerd B.; Simas, Alfredo M.
2016-01-01
The RM1 quantum chemical model for the calculation of complexes of Tm(III), Yb(III) and Lu(III) is advanced. Subsequently, we tested the models by fully optimizing the geometries of 126 complexes. We then compared the optimized structures with known crystallographic ones from the Cambridge Structural Database. Results indicate that, for thulium complexes, the accuracy in terms of the distances between the lanthanide ion and its directly coordinated atoms is about 2%. Corresponding results for ytterbium and lutetium are both 3%, levels of accuracy useful for the design of lanthanide complexes, targeting their countless applications. PMID:27223475
High pulse energy sub-nanosecond Tm-doped fiber laser
NASA Astrophysics Data System (ADS)
Cserteg, Andras; Guillemet, Sebastien; Hernandez, Yves; Giannone, Domenico
2012-02-01
We report a core pumped thulium-doped fiber amplifier that generates 1.4 μJ pulses at 1980 nm with a repetition rate of 3.6 MHz preserving the original spectral bandwidth of the oscillator. The amplifier chain is seeded by a passively modelocked fiber laser with 5 mW output power and the pulses are stretched to 800 picoseconds. The amplifier is core pumped by a single mode erbium fiber laser. The slope efficiency is 35%. To the best of our knowledge, this is the first demonstration of sub nanosecond pulses with energies higher than 1 μJ coming out of a thulium-doped fiber amplifier.
2-.mu.m fiber amplified spontaneous emission (ASE) source
NASA Technical Reports Server (NTRS)
Jiang, Shibin (Inventor); Wu, Jianfeng (Inventor); Geng, Jihong (Inventor)
2007-01-01
A 2-.mu.m fiber Amplified Spontaneous Emission (ASE) source provides a wide emission bandwidth and improved spectral stability/purity for a given output power. The fiber ASE source is formed from a heavy metal oxide multicomponent glass selected from germanate, tellurite and bismuth oxides and doped with high concentrations, 0.5-15 wt. %, thulium oxides (Tm.sub.2O.sub.3) or 0.1-5 wt% holmium oxides (Ho.sub.2O.sub.3) or mixtures thereof. The high concentration of thulium dopants provide highly efficient pump absorption and high quantum efficiency. Co-doping of Tm and Ho can broaden the ASE spectrum.
Two kinds of novel tunable Thulium-doped fiber laser
NASA Astrophysics Data System (ADS)
Ma, Xiaowei; Chen, Daru; Feng, Gaofeng; Yang, Junyong
2014-11-01
Two kinds of tunable Thulium-doped fiber laser (TDFL) respectively using a Sagnac loop mirror and a novel tunable multimode interference (MMI) fiber filter are experimentally demonstrated. The TDFL with the Sagnac loop mirror made by a 145.5-cm polarization-maintaining fiber (PMF) can operate with stable dual-wavelength lasing or tunable single-wavelength lasing around 1860nm. Both stable dual-wavelength and tunable single-wavelength lasing are achieved by adjusting a polarization controller in the Sagnac loop mirror. The TDFL with a novel tunable MMI fiber filter formed by splicing a segment of a special no-core fiber that is an all silica fiber without fiber core to single mode fibers can achieve tuning range from 1813.52 nm to 1858.70 nm. The no-core fiber with a large diameter of 200 μm is gradually vertically covered by refractive index matching liquid, which leads to a wavelength tuning of the transmission peak of the MMI fiber filter. The relationship between the refractive index of the refractive index matching liquid and the peak wavelength shift of the MMI fiber filter is also discussed. Using the MMI fiber filter, a Thulium-doped fiber laser with a tuning range of 45.18 nm is demonstrated.
Fiber laser at 2 μm for soft tissue surgery
NASA Astrophysics Data System (ADS)
Ghosh, Aditi; Pal, Debasis; Sen, Ranjan; Pal, Atasi
2014-11-01
Strong water absorption at 2 μm generated recent interest in lasers at this wavelength for soft tissue surgery. A fiber Bragg grating-based, all-fiber, continuous-wave, cladding pumped, thulium-doped fiber laser at 1.95 μm is configured. The thulium-doped active fiber with octagonal-shaped inner cladding is pumped at 808 nm (total power of 17 W) with six laser diodes through a combiner. The laser power of 3.3 W (after elimination of unabsorbed pump power through a passive fiber) with slope efficiency of 23% (against launched pump power) is achieved. The linear variation of laser power with pump offers scope of further power scaling.
152 fs nanotube-mode-locked thulium-doped all-fiber laser
Wang, Jinzhang; Liang, Xiaoyan; Hu, Guohua; Zheng, Zhijian; Lin, Shenghua; Ouyang, Deqin; Wu, Xu; Yan, Peiguang; Ruan, Shuangchen; Sun, Zhipei; Hasan, Tawfique
2016-01-01
Ultrafast fiber lasers with broad bandwidth and short pulse duration have a variety of applications, such as ultrafast time-resolved spectroscopy and supercontinuum generation. We report a simple and compact all-fiber thulium-doped femtosecond laser mode-locked by carbon nanotubes. The oscillator operates in slightly normal cavity dispersion at 0.055 ps2, and delivers 152 fs pulses with 52.8 nm bandwidth and 0.19 nJ pulse energy. This is the shortest pulse duration and the widest spectral width demonstrated from Tm-doped all-fiber lasers based on 1 or 2 dimensional nanomaterials, underscoring their growing potential as versatile saturable absorber materials. PMID:27374764
Single-Frequency Narrow Linewidth 2 Micron Fiber Laser
NASA Technical Reports Server (NTRS)
Jiang, Shibin (Inventor); Spiegelberg, Christine (Inventor); Luo, Tao (Inventor)
2006-01-01
A compact single frequency, single-mode 2 .mu.m fiber laser with narrow linewidth, <100 kHz and preferably <100 kHz, is formed with a low phonon energy glass doped with triply ionized rare-earth thulium and/or holmium oxide and fiber gratings formed in sections of passive silica fiber and fused thereto. Formation of the gratings in passive silica fiber both facilitates splicing to other optical components and reduces noise thus improving linewidth. An increased doping concentration of 0.5 to 15 wt. % for thulium, holmium or mixtures thereof produces adequate gain, hence output power levels for fiber lengths less than 5 cm and preferably less than 3 cm to enable single-frequency operation.
Birnbaum, Eva R.; Bene, Balazs J.; Taylor, Wayne Allen; ...
2016-06-04
Here, this paper discusses the development of a separation method for isolation of Tm-171 from a half-gram irradiated erbium target in support of stockpile stewardship and astrophysics research. The developed procedure is based on cation exchange separation using alpha-hydroxyisobutyric acid (α-HIBA) as chelating agent. It is able to achieve either a decontamination factor of 1.4(4) × 10 5 with 68.9(3) % recovery or 95.4(3) % recovery with a decontamination factor of 5.82(7) × 10 3 for a mock 500-mg target containing 17.9 mg thulium in a single pass-through at room temperature.
High-power single-stage thulium-doped superfluorescent fiber source
NASA Astrophysics Data System (ADS)
Hu, Z. Y.; Yan, P.; Liu, Q.; Ji, E. C.; Xiao, Q. R.; Gong, M. L.
2015-01-01
In this paper, we report a high-power thulium (Tm)-doped superfluorescent fiber source (SFS) in the 2-μm spectral region. The SFS is based on double angle-cleaved facet operation and uses a simple single-stage geometry. The copropagating amplified spontaneous emission (ASE) yields a maximum output of 20.7 W at a center wavelength of 1,960.7 nm, with a full width at half maximum (FWHM) of ~45 nm. The counterpropagating ASE yields a maximum output of 25.2 W at a center wavelength of 1,948.2 nm, with a FWHM of ~50 nm. The maximum combined output of the SFS is as much as 45.9 W, which corresponds to a slope efficiency of 38.9 %. In addition, a model of the ~2 μm SFS in Tm-doped silica fibers pumped at ~790 nm is developed, and the influence of fiber length and end-facet reflectivity on the ASE output performance and the parasitic lasing threshold are studied numerically.
50.4% slope efficiency thulium-doped large-mode-area fiber laser fabricated by powder technology.
Darwich, Dia; Dauliat, Romain; Jamier, Raphaël; Benoit, Aurélien; Auguste, Jean-Louis; Grimm, Stephan; Kobelke, Jens; Schwuchow, Anka; Schuster, Kay; Roy, Philippe
2016-01-15
We report on a triple clad large-mode-area Tm-doped fiber laser with 18 μm core diameter manufactured for the first time by an alternative manufacturing process named REPUSIL. This reactive powder sinter material enables similar properties compared to conventional CVD-made fiber lasers, while offering the potential of producing larger and more uniform material. The fiber characterization in a laser configuration provides a slope efficiency of 47.7% at 20°C, and 50.4% at 0°C with 8 W output power, with a laser peak emission at 1970 nm. Finally, a beam quality near the diffraction-limit (M(x,y)2<1.1) is proved.
Becker, B; Herrmann, T R W; Gross, A J; Netsch, C
2018-05-05
We compared the perioperative and postoperative characteristics of thulium vapoenucleation and holmium laser enucleation of the prostate for the treatment of large volume benign prostatic hyperplasia. A total of 94 patients with benign prostatic hyperplasia and a median prostate size of 80 (IQR 46.75-100) cc were either randomized to thulium vapoenucleation or holmium laser enucleation of the prostate. Patients were assessed preoperatively, 1 and 6 months postoperatively. The median operative time was 60 (IQR 41-79) min without significant differences between the groups. There were no significant differences between the groups regarding catheter time [2 (IQR 2-2) days] and postoperative stay [2 (IQR 2-3) days]. Clavien 1 (13.8%), 2 (3.2%), 3a (2.1%), and Clavien 3b (4.3%) complications occurred without significant differences between the groups. At 6-month follow-up, median maximum flow rate (10.7 vs. 25.9 ml/s), post-void residual urine (100 vs. 6.5 ml), I-PSS (20 vs. 5), quality of life (4 vs. 1), PSA (4.14 vs. 0.71 µg/l), and prostate volume (80 vs. 16 ml) had improved significantly (p < 0.001) compared to baseline without significant differences between the groups. Median PSA decrease was 79.7% (58.8-90.6%) and prostate volume reduction was 74.5% (68.57-87.63%) without differences between the groups. The reoperation rate was zero at 6-month follow-up. Thulium vapoenucleation and holmium laser enucleation of the prostate are safe and effective procedures for the treatment of large volume benign prostatic hyperplasia. Both procedures give satisfactory micturition improvement with low morbidity and sufficient prostate volume reduction at 6-month follow-up.
Liu, Shuo; Yan, Fengping; Feng, Ting; Wu, Beilei; Dong, Ze; Chang, Gee-Kung
2014-08-20
A kind of switchable and spacing-tunable dual-wavelength thulium-doped silica fiber laser based on a nonlinear amplifier loop mirror is presented and experimentally demonstrated. By adjusting the polarization controllers (PCs), stable dual-wavelength operation is obtained at the 2 μm band. The optical signal-to-noise ratio (OSNR) is better than 56 dB. The wavelength tuning is performed by applying static strain into the fiber Bragg grating. A tuning range from 0 to 5.14 nm is achieved for the dual-wavelength spacing. By adjusting the PCs properly, the fiber laser can also operate in single-wavelength state with the OSNR for each wavelength more than 50 dB.
NASA Astrophysics Data System (ADS)
Jung, M.; Lee, J.; Song, W.; Lee, Y. L.; Lee, J. H.; Shin, W.
2016-05-01
We proposed a multimode interference (MMI) fiber based saturable absorber using bismuth telluride at ∼2 μm region. Our MMI based saturable absorber was fabricated by fusion splicing with single mode fiber and null core fiber. The MMI functioned as both wavelength fixed filter and saturable absorber. The 3 dB bandwidth and insertion loss of MMI were 42 nm and 3.4 dB at wavelength of 1958 nm, respectively. We have also reported a passively mode locked thulium doped fiber laser operating at a wavelength of 1958 nm using a multimode interference. A temporal bandwidth of ∼46 ps was experimentally obtained at a repetition rate of 8.58 MHz.
Analysis of soft x-ray emission spectra of laser-produced dysprosium, erbium and thulium plasmas
NASA Astrophysics Data System (ADS)
Sheil, John; Dunne, Padraig; Higashiguchi, Takeshi; Kos, Domagoj; Long, Elaine; Miyazaki, Takanori; O'Reilly, Fergal; O'Sullivan, Gerard; Sheridan, Paul; Suzuki, Chihiro; Sokell, Emma; White, Elgiva; Kilbane, Deirdre
2017-03-01
Soft x-ray emission spectra of dysprosium, erbium and thulium ions created in laser-produced plasmas were recorded with a flat-field grazing-incidence spectrometer in the 2.5-8 nm spectral range. The ions were produced using an Nd:YAG laser of 7 ns pulse duration and the spectra were recorded at various power densities. The experimental spectra were interpreted with the aid of the Cowan suite of atomic structure codes and the flexible atomic code. At wavelengths above 5.5 nm the spectra are dominated by overlapping n = 4 - n = 4 unresolved transition arrays from adjacent ion stages. Below 6 nm, n = 4 - n = 5 transitions also give rise to a series of interesting overlapping spectral features.
Narrow linewidth power scaling and phase stabilization of 2-μm thulium fiber lasers
NASA Astrophysics Data System (ADS)
Goodno, Gregory D.; Book, Lewis D.; Rothenberg, Joshua E.; Weber, Mark E.; Benjamin Weiss, S.
2011-11-01
Thulium-doped fiber lasers (TFLs) emitting retina-safe 2-μm wavelengths offer substantial power-scaling advantages over ytterbium-doped fiber lasers for narrow linewidth, single-mode operation. This article reviews the design and performance of a pump-limited, 600 W, single-mode, single-frequency TFL amplifier chain that balances thermal limitations against those arising from stimulated Brillouin scattering (SBS). A simple analysis of thermal and SBS limits is anchored with measurements on kilowatt class Tm and Yb fiber lasers to highlight the scaling advantage of Tm for narrow linewidth operation. We also report recent results on active phase-locking of a TFL amplifier to an optical reference as a precursor to further parallel scaling via coherent beam combining.
Rare Earths; The Fraternal Fifteen (Rev.)
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gschneidner, Jr., Karl A.
1966-01-01
Rare earths are a set of 15 elements: lanthanum, cerium, praseodymium, neodymium, promethium, samarium, europium, gadolinium, terbium, dysprosium, holmium, erbium, thulium, ytterbium and lutetium. They are not rare and not earths; they are metals and quite abundant. They are studied to develop commercial products which are beneficial to mankind, and because some rare earths are important to fission products.
Magneto-optical trap for thulium atoms
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sukachev, D.; Sokolov, A.; Chebakov, K.
2010-07-15
Thulium atoms are trapped in a magneto-optical trap using a strong transition at 410 nm with a small branching ratio. We trap up to 7x10{sup 4} atoms at a temperature of 0.8(2) mK after deceleration in a 40-cm-long Zeeman slower. Optical leaks from the cooling cycle influence the lifetime of atoms in the magneto-optical trap which varies between 0.3 and 1.5 s in our experiments. The lower limit for the leaking rate from the upper cooling level is measured to be 22(6) s{sup -1}. The repumping laser transferring the atomic population out of the F=3 hyperfine ground-state sublevel gives amore » 30% increase for the lifetime and the number of atoms in the trap.« less
Che, Yuliang; Yang, Hua; Wang, Zhimin; Jin, Hongxiao; Lu, Chunxin; Zuo, Tianming; Beavers, Christine M.
2009-01-01
The structures of two newly synthesized endohedral fullerenes - Tm@C3v-C94 and Ca@C3v-C94 - have been determined by single crystal X-ray diffraction on samples co-crystallized with NiII(octaethylporphyrin). Both compounds exhibit the same cage geometry and conform to the isolated pentagon rule (IPR). The metal ions within these rather large cages are localized near one end and along the C3 axis. While the calcium ion is situated over a C-C bond at a 6:6 ring junction, the thulium ion is positioned above a six-membered ring of the fullerene. PMID:19507844
Cavitation bubble dynamics during thulium fiber laser lithotripsy
NASA Astrophysics Data System (ADS)
Hardy, Luke A.; Kennedy, Joshua D.; Wilson, Christopher R.; Irby, Pierce B.; Fried, Nathaniel M.
2016-02-01
The Thulium fiber laser (TFL) is being explored for lithotripsy. TFL parameters differ from standard Holmium:YAG laser in several ways, including smaller fiber delivery, more strongly absorbed wavelength, low pulse energy/high pulse rate operation, and more uniform temporal pulse structure. High speed imaging of cavitation bubbles was performed at 105,000 fps and 10 μm spatial resolution to determine influence of these laser parameters on bubble formation. TFL was operated at 1908 nm with pulse energies of 5-75 mJ, and pulse durations of 200-1000 μs, delivered through 100-μm-core fiber. Cavitation bubble dynamics using Holmium laser at 2100 nm with pulse energies of 200-1000 mJ and pulse duration of 350 μs was studied, for comparison. A single, 500 μs TFL pulse produced a bubble stream extending 1090 +/- 110 μm from fiber tip, and maximum bubble diameters averaged 590 +/- 20 μm (n=4). These observations are consistent with previous studies which reported TFL ablation stallout at working distances < 1.0 mm. TFL bubble dimensions were five times smaller than for Holmium laser due to lower pulse energy, higher water absorption coefficient, and smaller fiber diameter used.
High-pressure phase transitions in rare earth metal thulium to 195 GPa.
Montgomery, Jeffrey M; Samudrala, Gopi K; Tsoi, Georgiy M; Vohra, Yogesh K
2011-04-20
We have performed image plate x-ray diffraction studies on a heavy rare earth metal, thulium (Tm), in a diamond anvil cell to a pressure of 195 GPa and volume compression V/V₀ = 0.38 at room temperature. The rare earth crystal structure sequence, hcp →Sm-type→ dhcp →fcc → distorted fcc, is observed in Tm below 70 GPa with the exception of a pure fcc phase. The focus of our study is on the ultrahigh-pressure phase transition and Rietveld refinement of crystal structures in the pressure range between 70 and 195 GPa. The hexagonal hR-24 phase is seen to describe the distorted fcc phase between 70 and 124 GPa. Above 124 ± 4 GPa, a structural transformation from hR 24 phase to a monoclinic C 2/m phase is observed with a volume change of -1.5%. The equation of state data shows rapid stiffening above the phase transition at 124 GPa and is indicative of participation of f-electrons in bonding. We compare the behavior of Tm to other heavy rare-earths and heavy actinide metals under extreme conditions of pressure.
High-pressure phase transitions in rare earth metal thulium to 195 GPa
NASA Astrophysics Data System (ADS)
Montgomery, Jeffrey M.; Samudrala, Gopi K.; Tsoi, Georgiy M.; Vohra, Yogesh K.
2011-04-01
We have performed image plate x-ray diffraction studies on a heavy rare earth metal, thulium (Tm), in a diamond anvil cell to a pressure of 195 GPa and volume compression V/Vo = 0.38 at room temperature. The rare earth crystal structure sequence, {hcp}\\to {Sm {-}type} \\to {dhcp} \\to {fcc} \\to distorted fcc, is observed in Tm below 70 GPa with the exception of a pure fcc phase. The focus of our study is on the ultrahigh-pressure phase transition and Rietveld refinement of crystal structures in the pressure range between 70 and 195 GPa. The hexagonal hR- 24 phase is seen to describe the distorted fcc phase between 70 and 124 GPa. Above 124 ± 4 GPa, a structural transformation from hR 24 phase to a monoclinic C 2/m phase is observed with a volume change of - 1.5%. The equation of state data shows rapid stiffening above the phase transition at 124 GPa and is indicative of participation of f-electrons in bonding. We compare the behavior of Tm to other heavy rare-earths and heavy actinide metals under extreme conditions of pressure.
Structural and optical study on antimony-silicate glasses doped with thulium ions.
Dorosz, D; Zmojda, J; Kochanowicz, M; Miluski, P; Jelen, P; Sitarz, M
2015-01-05
Structural, spectroscopic and thermal properties of SiO₂-Al₂O₃-Sb₂O₃-Na₂O glass system doped with 0.2 mol% Tm₂O₃ have been presented. Synthesis of antimony-silicate glasses with relatively low phonon energy (600 cm(-1), which implicates a small non-radiative decay rate) was performed by conventional high-temperature melt-quenching methods. The effect of SiO₂/Sb₂O₃ ratio in fabricated Tm(3+) doped glass on thermal, structural and luminescence properties was investigated. On the basis of structural investigations decomposition of absorption bands in the infrared FTIR region was performed, thus determining that antimony ions are the only glass-forming ions, setting up the lattice of fabricated glasses. Luminescence band at the wavelength of 1.8 μm corresponding to (3)F₄→(3)H₆ transition in thulium ions was obtained under 795 nm laser pumping. It was observed that combination of relatively low phonon energy and greater separation of optically active centers in the fabricated glasses influenced in decreasing the luminescence intensity at 1800 nm. Copyright © 2014 Elsevier B.V. All rights reserved.
NASA Astrophysics Data System (ADS)
Marques, Andrew J.; Jivraj, Jamil; Reyes, Robnier; Ramjist, Joel; Gu, Xijia J.; Yang, Victor X. D.
2017-02-01
Tissue removal using electrocautery is standard practice in neurosurgery since tissue can be cut and cauterized simultaneously. Thermally mediated tissue ablation using lasers can potentially possess the same benefits but with increased precision. However, given the critical nature of the spine, brain, and nerves, the effects of direct photo-thermal interaction on neural tissue needs to be known, yielding not only high precision of tissue removal but also increased control of peripheral heat damage. The proposed use of lasers as a neurosurgical tool requires that a common ground is found between ablation rates and resulting peripheral heat damage. Most surgical laser systems rely on the conversion of light energy into heat resulting in both desirable and undesirable thermal damage to the targeted tissue. Classifying the distribution of thermal energy in neural tissue, and thus characterizing the extent of undesirable thermal damage, can prove to be exceptionally challenging considering its highly inhomogenous composition when compared to other tissues such as muscle and bone. Here we present the characterization of neural tissue ablation rate and heat affected zone of a 1.94 micron thulium doped fiber laser for neural tissue ablation. In-Vivo ablation of porcine cerebral cortex is performed. Ablation volumes are studied in association with laser parameters. Histological samples are taken and examined to characterize the extent of peripheral heat damage.
Rivolta, Davide; Castellanos, Nazareth P; Stawowsky, Cerisa; Helbling, Saskia; Wibral, Michael; Grützner, Christine; Koethe, Dagmar; Birkner, Katharina; Kranaster, Laura; Enning, Frank; Singer, Wolf; Leweke, F Markus; Uhlhaas, Peter J
2014-04-23
Schizophrenia is characterized by dysfunctions in neural circuits that can be investigated with electrophysiological methods, such as EEG and MEG. In the present human study, we examined event-related fields (ERFs), in a sample of medication-naive, first-episode schizophrenia (FE-ScZ) patients (n = 14) and healthy control participants (n = 17) during perception of Mooney faces to investigate the integrity of neuromagnetic responses and their experience-dependent modification. ERF responses were analyzed for M100, M170, and M250 components at the sensor and source levels. In addition, we analyzed peak latency and adaptation effects due to stimulus repetition. FE-ScZ patients were characterized by significantly impaired sensory processing, as indicated by a reduced discrimination index (A'). At the sensor level, M100 and M170 responses in FE-ScZ were within the normal range, whereas the M250 response was impaired. However, source localization revealed widespread elevated activity for M100 and M170 in FE-ScZ and delayed peak latencies for the M100 and M250 responses. In addition, M170 source activity in FE-ScZ was not modulated by stimulus repetitions. The present findings suggest that neural circuits in FE-ScZ may be characterized by a disturbed balance between excitation and inhibition that could lead to a failure to gate information flow and abnormal spreading of activity, which is compatible with dysfunctional glutamatergic neurotransmission.
Emmorey, Karen; Midgley, Katherine J; Kohen, Casey B; Sehyr, Zed Sevcikova; Holcomb, Phillip J
2017-11-01
The temporo-occipitally distributed N170 ERP component is hypothesized to reflect print-tuning in skilled readers. This study investigated whether skilled deaf and hearing readers (matched on reading ability, but not phonological awareness) exhibit similar N170 patterns, given their distinct experiences learning to read. Thirty-two deaf and 32 hearing adults viewed words and symbol strings in a familiarity judgment task. In the N170 epoch (120-240ms) hearing readers produced greater negativity for words than symbols at left hemisphere (LH) temporo-parietal and occipital sites, while deaf readers only showed this asymmetry at occipital sites. Linear mixed effects regression was used to examine the influence of continuous measures of reading, spelling, and phonological skills on the N170 (120-240ms). For deaf readers, better reading ability was associated with a larger N170 over the right hemisphere (RH), but for hearing readers better reading ability was associated with a smaller RH N170. Better spelling ability was related to larger occipital N170s in deaf readers, but this relationship was weak in hearing readers. Better phonological awareness was associated with smaller N170s in the LH for hearing readers, but this association was weaker and in the RH for deaf readers. The results support the phonological mapping hypothesis for a left-lateralized temporo-parietal N170 in hearing readers and indicate that skilled reading is characterized by distinct patterns of neural tuning to print in deaf and hearing adults. Copyright © 2017 Elsevier Ltd. All rights reserved.
Dave, Utsav D; Uvin, Sarah; Kuyken, Bart; Selvaraja, Shankar; Leo, Francois; Roelkens, Gunther
2013-12-30
A 1,000 nm wide supercontinuum, spanning from 1470 nm in the telecom band to 2470 nm in the mid-infrared is demonstrated in a 800 nm x 220 nm 1 cm long hydrogenated amorphous silicon strip waveguide. The pump source was a picosecond Thulium doped fiber laser centered at 1950 nm. The real part of the nonlinear parameter of this waveguide at 1950 nm is measured to be 100 ± 10 W -1m-1, while the imaginary part of the nonlinear parameter is measured to be 1.2 ± 0.2 W-1m-1. The supercontinuum is stable over a period of at least several hours, as the hydrogenated amorphous silicon waveguides do not degrade when exposed to the high power picosecond pulse train.
Spectroscopic properties of Tm3+/Al3+ co-doped sol-gel silica glass
NASA Astrophysics Data System (ADS)
Wang, Xue; Lou, Fengguang; Wang, Shikai; Yu, Chunlei; Chen, Danping; Hu, Lili
2015-04-01
Tm3+/Al3+ co-doped silica glass was prepared by sol-gel method combined with high temperature sintering. Glasses with compositions of xTm2O3-15xAl2O3-(100 - 16x) SiO2 (in mol%, x = 0.1, 0.3, 0.5, 0.8 and 1.0) were prepared. The high thulium doped silica glass was realized. Their spectroscopic parameters were calculated and analyzed by Judd-Ofelt theory. Large absorption cross section (4.65 × 10-21 cm2 at 1668 nm) and stimulated emission cross section (6.00 × 10-21 cm2 at 1812 nm), as well as low hydroxyl content (0.180 cm-1), long fluorescence lifetime (834 μs at 1800 nm), large σem × τrad (30.05 × 10-21 cm2 ms) and large relative intensity ratio of the 1.8 μm (3F4 → 3H6) to 1.46 (3H4 → 3F4) emissions (90.33) are achieved in this Tm3+/Al3+ co-doped silica glasses. According to emission characteristics, the optimum thulium doping concentration is around 0.8 mol%. The cross relaxation (CR) between ground and excited states of Tm3+ ions was used to explain the optimum thulium doping concentration. These results suggest that the sol-gel method is an effective way to prepare Tm3+ doped silica glass with high Tm3+ doping and prospective spectroscopic properties.
NASA Astrophysics Data System (ADS)
Lutz, Thomas; Veissier, Lucile; Thiel, Charles W.; Woodburn, Philip J. T.; Cone, Rufus L.; Barclay, Paul E.; Tittel, Wolfgang
2016-01-01
High-quality rare-earth-ion (REI) doped materials are a prerequisite for many applications such as quantum memories, ultra-high-resolution optical spectrum analyzers and information processing. Compared to bulk materials, REI doped powders offer low-cost fabrication and a greater range of accessible material systems. Here we show that crystal properties, such as nuclear spin lifetime, are strongly affected by mechanical treatment, and that spectral hole burning can serve as a sensitive method to characterize the quality of REI doped powders. We focus on the specific case of thulium doped ? (Tm:YAG). Different methods for obtaining the powders are compared and the influence of annealing on the spectroscopic quality of powders is investigated on a few examples. We conclude that annealing can reverse some detrimental effects of powder fabrication and, in certain cases, the properties of the bulk material can be reached. Our results may be applicable to other impurities and other crystals, including color centers in nano-structured diamond.
Broadband photocarrier dynamics and nonlinear absorption of PLD-grown WTe2 semimetal films
NASA Astrophysics Data System (ADS)
Gao, Wenbin; Huang, Lei; Xu, Jinlong; Chen, Yequan; Zhu, Chunhui; Nie, Zhonghui; Li, Yao; Wang, Xuefeng; Xie, Zhenda; Zhu, Shining; Xu, Jun; Wan, Xiangang; Zhang, Chao; Xu, Yongbing; Shi, Yi; Wang, Fengqiu
2018-04-01
WTe2 is a unique material in the family of transition metal dichalcogenides and it has been proposed as a candidate for type-II Weyl semimetals. However, thus far, studies on the optical properties of this emerging material have been significantly hindered by the lack of large-area, high-quality WTe2 materials. Here, we grow a centimeter-scale, highly crystalline WTe2 ultrathin film (˜35 nm) by a pulsed laser deposition technique. Broadband pump-probe spectroscopy (1.2-2.5 μm) reveals a peculiar ultrafast optical response where an initial photo-bleaching signal (lasting ˜3 ps) is followed by a long-lived photoinduced absorption signature. Nonlinear absorption characterization using femtosecond pulses confirms the saturable absorption response of the WTe2 ultrathin films, and we further demonstrated a mode-locked Thulium fiber laser using a WTe2 absorber. Our work provides important insights into linear and nonlinear optical responses of WTe2 thin films.
NASA Astrophysics Data System (ADS)
Katta, Nitesh; Mcelroy, Austin; Estrada, Arnold; Milner, Thomas E.
2017-02-01
Neurological cancer surgeries require specialized tools that enhance imaging for precise cutting and removal of tissue without damaging adjacent neurological structures. The novel combination of high-resolution fast optical coherence tomography (OCT) alongside short pulsed nanosecond thulium (Tm) lasers offers stark advantages utilizing the superior beam quality, high volumetric tissue removal rates of thulium lasers with minimal residual thermal footprint in the tissue and avoiding damage to delicate sub-surface structures (e.g., nerves and microvessels); which has not been showcased before. A bench-top system is constructed, using a 15W 1940nm nanosecond pulsed Tm fiber laser (500uJ pulse energy, 100ns pulse duration, 30kHz repetition rate) for removing tissue and a swept source laser (1310±70nm, 100kHz sweep rate) is utilized for OCT imaging, forming a combined Tm/OCT system - a smart laser knife. The OCT image-guidance informs the Tm laser for cutting/removal of targeted tissue structures. Tissue phantoms were constructed to demonstrate surgical incision with blood vessel avoidance on the surface where 2mm wide 600um deep cuts are executed around the vessel using OCT to guide the procedure. Cutting up to delicate subsurface blood vessels (2mm deep) is demonstrated while avoiding damage to their walls. A tissue removal rate of 5mm^3/sec is obtained from the bench-top system. We constructed a blow-off model to characterize Tm cut depths taking into account the absorption coefficients and beam delivery systems to compute Arrhenius damage integrals. The model is used to compare predicted tissue removal rate and residual thermal injury with experimental values in response to Tm laser-tissue modification.
Photothermal effect of infrared lasers on ex vivo lamb brain tissues
NASA Astrophysics Data System (ADS)
Özgürün, Baturay; Gülsoy, Murat
2018-02-01
Here, the most suitable infrared laser for a neurosurgery operation is suggested, among 1940-nm thulium fiber, 1470-nm diode, 1070-nm ytterbium fiber and 980-nm diode lasers. Cortical and subcortical ex-vivo lamb brain tissues are exposed to the laser light with the combinations of some laser parameters such as output power, energy density, operation mode (continuous and pulsed-modulated) and operation time. In this way, the greatest ablation efficiency associated with the best neurosurgical laser type can be defined. The research can be divided into two parts; pre-dosimetry and dosimetry studies. The former is used to determine safe operation zones for the dosimetry study by defining coagulation and carbonization onset times for each of the brain tissues. The latter is the main part of this research, and both tissues are exposed to laser irradiation with various energy density levels associated with the output power and operation time. In addition, photo-thermal effects are compared for two laser operation modes, and then coagulation and ablation diameters to calculate the ablation efficiency are measured under a light microscope. Consequently, results are compared graphically and statistically, and it is found that thulium and 1470-nm diode lasers can be utilized as subcortical and cortical tissue ablator devices, respectively.
Zhao, Ruizhe; Wang, Xingjie; Jiang, Chenyi; Shi, Fei; Zhu, Yiping; Yang, Boyu; Zhuo, Jian; Jing, Yifeng; Luo, Guangheng; Xia, Shujie; Han, Bangmin
2018-06-01
Urinary tract infection, urinary frequency, urgency, urodynia and haemorrhage are common post-operative complications of thulium laser resection of the prostate (TmLRP). Our study mainly focuses on the role of finasteride in prostate wound healing through AR signalling. TmLRP beagles were randomly distributed into different treatment groups. Serum and intra-prostatic testosterone and DHT level were determined. Histological analysis was conducted to study the re-epithelialization and inflammatory response of the prostatic urethra in each group. We investigated the role of androgen in proliferation and inflammatory response in prostate. In addition, the effects of TNF-α on prostate epithelium and stromal cells were also investigated. Testosterone and DHT level increased in testosterone group and DHT decreased in finasteride group. Accelerated wound healing of prostatic urethra was observed in the finasteride group. DHT suppressed proliferation of prostate epithelium and enhanced inflammatory response in prostate. We confirmed that DHT enhanced macrophages TNF-α secretion through AR signalling. TNF-α suppressed proliferation of prostate epithelial cells and retarded cell migration. TNF-α also played a pivotal role in suppressing fibroblasts activation and contraction. Testosterone treatment repressed re-epithelialization and wound healing of prostatic urethra. Finasteride treatment may be an effective way to promote prostate re-epithelialization. © 2017 John Wiley & Sons Ltd.
NASA Astrophysics Data System (ADS)
Kharlamova, M. V.
2015-01-01
In the present work, a detailed Raman spectroscopy investigation on the single-walled carbon nanotubes (SWCNTs) filled with praseodymium chloride, terbium chloride and thulium chloride was performed. The salts were incorporated inside the SWCNTs by a capillary filling method using melts, and the high-resolution transmission electron microscopy data proved the high filling degree of the nanotube channels. A thorough analysis of the radial breathing mode and G-band of the Raman spectra of the pristine and filled SWCNTs showed that the encapsulated salts cause acceptor doping of the host nanotubes, and the doping efficiency depends on the compound. The incorporated thulium chloride has the strongest doping effect on the SWCNTs, whereas praseodymium chloride has the weakest effect. It was found that the encapsulated salts modify more significantly the electronic structure of metallic nanotubes than semiconducting SWCNTs.
NASA Astrophysics Data System (ADS)
Zulkifli, A. Z.; Latiff, A. A.; Paul, M. C.; Yasin, M.; Ahmad, H.; Harun, S. W.
2016-12-01
In this paper, a dual-wavelength fiber laser (DWFL) using nano-engineered Thulium-doped fiber as a gain medium with a bent singlemode-multimode-singlemode fiber structure (SMS) is demonstrated. The SMS structure is packaged systematically using Cr-39 polymer plates to provide linear bending via applied load. Experimental results have proved that the bent SMS is capable to provide highly effective wavelength filter and wavelengths stabilizer by balancing the net cavity gain between the two wavelengths. The DWFL provides very narrow spacing of 0.9 nm, narrow 3 dB spectral linewidth of ∼0.07 nm and SNR of ∼42 dB. Based on stability test, very small mode hopping is observed at the two wavelengths having deviations of ±0 nm and ±0.04 nm respectively. In conjunction, the DWFL provides very stable relative wavelength spacing with a deviation of ±0.04 nm.
Switchable multiwavelength thulium-doped fiber ring lasers
NASA Astrophysics Data System (ADS)
Zhao, Shui; Lu, Ping; Liu, Deming; Zhang, Jiangshan
2013-08-01
Two kinds of thulium-doped fiber ring lasers based on a spatial mode beating filter and comb filtering effect are presented and experimentally demonstrated, which all show multiwavelength laser spectrum around 2 μm. In the implementation of the first type of experiment configuration by the use of a piece of multimode fiber (MMF) as a spatial mode beating filter, dual-,triple-, and quadruple-wavelengths appeared whose extinction noise ratio is 25 dB by adjusting the angle of polarization controller. Different wavelength spaces are obtained by inserting different lengths of MMF. The second type is achieved by inserting a Sagnac loop mirror, which was constructed by a 3-dB coupler and a piece of polarization maintaining fiber. Seven stable wavelengths with channel spacing of 0.65 nm and an extinction ratio of 35 dB was achieved. These systems are simple and easy to construct, which can be useful for 2 μm wavelength-division-multiplexed applications.
Wavelength-tunable thulium-doped fiber laser by employing a self-made Fabry-Perot filter
NASA Astrophysics Data System (ADS)
Wang, Y. P.; Ju, Y. L.; Wu, C. T.; Liu, W.; Yang, C.
2017-06-01
In this demonstration, we proposed a novel wavelength-tunable thulium-doped fiber laser (TDFL) with a self-made Fabry-Perot (F-P) filter. When the F-P filter was not inserted, the maximum output power of 11.1 W was achieved when the pump power was 70.2 W. The corresponding optical-to-optical conversion efficiency was 15.8% and the slope efficiency was 22.1%. When the F-P filter was inserted, the output wavelength could be tuned from 1952.9 to 1934.9 nm with the change of cavity length of F-P filter which was fixed on a piezoelectric ceramic transducer (PZT) controlled by the voltage applied to it. The full width at half maximum (FWHM) was no more than 0.19 nm. Furthermore, the wavelength fluctuations of the tunable fiber laser were kept within ±0.2 nm.
Wilson, Christopher R; Hutchens, Thomas C; Hardy, Luke A; Irby, Pierce B; Fried, Nathaniel M
2015-10-01
The thulium fiber laser (TFL) is being explored as an alternative laser lithotripter to the standard holmium:yttrium-aluminum-garnet laser. The more uniform beam profile of the TFL enables higher power transmission through smaller fibers. In this study, a 100-μm core, 140-μm outer-diameter (OD) silica fiber with 5-mm length hollow steel tip was integrated with 1.3F (0.433-mm OD) nitinol wire basket to form a 1.9F (0.633-mm OD) device. TFL energy of 30 mJ, 500 μs pulse duration, and 500 Hz pulse rate was delivered to human uric acid stones, ex vivo. Stone ablation rates measured 1.5 ± 0.2 mg/s, comparable to 1.7 ± 0.3 mg/s using bare fiber tips separately with stone basket. With further development, this device may minimize stone retropulsion, allowing more efficient TFL lithotripsy at higher pulse rates. It may also provide increased flexibility, higher saline irrigation rates through the ureteroscope working channel, reduce fiber degradation compared with separate fiber and basket manipulation, and reduce laser-induced nitinol wire damage.
NASA Astrophysics Data System (ADS)
Hardy, Luke A.; Wilson, Christopher R.; Irby, Pierce B.; Fried, Nathaniel M.
2014-03-01
The Holmium:YAG laser (λ = 2120 nm) is currently the preferred laser for fragmenting kidney stones in the clinic. However, this laser has some limitations, including operation at low pulse rates and a multimode spatial beam profile which prohibits its use with smaller, more flexible optical fibers. Our laboratory is studying the Thulium fiber laser (λ = 1908 nm) as an alternative lithotripter. The TFL has several advantages, including lower stone ablation thresholds, use with smaller and more flexible fibers, and operation at arbitrary pulse lengths and pulse rates. Previous studies have reported increased stone ablation rates with TFL operation at higher pulse rates, however, stone retropulsion remains an obstacle to even more efficient stone ablation. This study explores TFL operation at high pulse rates in combination with a stone stabilization device (e.g. stone basket) for improved efficiency. A TFL beam with pulse energy of 35 mJ, pulse duration of 500-μs, and pulse rates of 10-500 Hz was coupled into 100-μm-core, low-OH, silica fibers, in contact mode with uric acid and calcium oxalate monohydrate stones, ex vivo. TFL operation at 500 Hz produced UA and COM stone ablation rates up to 5.0 mg/s and 1.3 mg/s, respectively. High TFL pulse rates produced increased stone ablation rates sufficient for use in the clinic.
Defidio, Lorenzo; De Dominicis, Mauro; Di Gianfrancesco, Luca; Fuchs, Gerhard; Patel, Anup
2011-09-01
Thulium laser ablation (TLA) outcomes with blinded performance evaluation after retrograde intra-renal surgical (RIRS) treatment of upper urinary tract transitional cell carcinomas (UUT-TCC). A UUT-TCC patient cohort undergoing RIRS-TLA by an international endoscopic surgical collaboration in a European center (April 2005-July 2009), underwent outcomes evaluation. All 4 surgeons were blinded and independently scored both TLA and Holmium:YAG laser ablation performance aspects annually using a Likert scoring system (0-10). All patients (n = 59, median age 66 years, 9 with solitary kidney) had complete UUT inspection. Presenting lesion(s) were intra-renal (n = 30, 51%), ureteral (n = 13, 22%), and combined (n = 16, 27%). Single-stage TLA sufficed in 81.4% (tumors < 1.5 cm). Significant recurrence free survival differences occurred according to primary tumor size >/< 1.5 cm and multi-focality, but location made no difference. Median Likert scores were i) fiber-tip stability --5.5/8.75, p = 0.016; ii) reduced bleeding--5/8.5, p = 0.004; iii)fiber-tip precision--5.5/8.5, p = 0.003; iv) mucosal perforation reduction--3.5/7.5, p = 0.001; v) ablation efficiency tumors < 1.5 cm--6/9, p = 0.017; tumors > 1.5 cm--6.75/6.75, p = 1, and vi) overall efficiency--6/7.5, p = 0.09, for Holmium:YAG and TLA, respectively. The Thulium laser delivered non-inferior recurrence free survival to RIRS-UUT-TCC Holmium:YAG laser ablation, but better median parameter performance scores in fiber-tip stability, precision, reduced bleeding and mucosal perforation reduction in expert ratings. Despite improved photothermal coagulation, and endo-visualization for tumors < 1.5 cm, both ablation and overall efficiency remained challenging for larger tumors with both existing laser technologies.
Exploring high power, extreme wavelength operating potential of rare-earth-doped silica fiber
NASA Astrophysics Data System (ADS)
Zhou, Pu; Li, Ruixian; Xiao, Hu; Huang, Long; Zhang, Hanwei; Leng, Jinyong; Chen, Zilun; Xu, Jiangmin; Wu, Jian; Wang, Xiong
2017-08-01
Ytterbium-doped fiber laser (YDFL) and Thulium doped fiber laser (TDFL) have been two kinds of the most widely studied fiber laser in recent years. Although both silica-based Ytterbium-doped fiber and Thulium doped fiber have wide emission spectrum band (more than 200 nm and 400 nm, respectively), the operation spectrum region of previously demonstrated high power YDFL and TDFL fall into 1060-1100 nm and 1900-2050nm. Power scaling of YDFL and TDFL operates at short-wavelength or long-wavelength band, especially for extreme wavelength operation, although is highly required in a large variety of application fields, is quite challenging due to small net gain and strong amplified spontaneous emission (ASE). In this paper, we will present study on extreme wavelength operation of high power YDFL and TDFL in our group. Comprehensive mathematical models are built to investigate the feasibility of high power operation and propose effective technical methods to achieve high power operation. We have achieved (1) Diodepumped 1150nm long wavelength YDFL with 120-watt level output power (2) Diode-pumped 1178nm long wavelength YDFL operates at high temperature with 30-watt level output power (3) Random laser pumped 2153nm long wavelength TDFL with 20-watt level output power (4) Diode-pumped 1018nm short wavelength YDFL with a record 2 kilowatt output power is achieved by using home-made fiber combiner.
Mandrile, Giorgia; van Woerden, Christiaan S; Berchialla, Paola; Beck, Bodo B; Acquaviva Bourdain, Cécile; Hulton, Sally-Anne; Rumsby, Gill
2014-12-01
Primary hyperoxaluria type 1 displays a heterogeneous phenotype, likely to be affected by genetic and non-genetic factors, including timeliness of diagnosis and quality of care. As previous genotype-phenotype studies were hampered by limited patient numbers the European OxalEurope Consortium was constituted. This preliminary retrospective report is based on 526 patients of which 410 have the AGXT genotype defined. We grouped mutations by the predicted effect as null, missense leading to mistargeting (G170R), and other missense, and analyzed their phenotypic correlations. Median age of end-stage renal disease increased from 9.9 for 88 homozygous null patients, 11.5 for 42 heterozygous null/missense, 16.9 for 116 homozygous missense patients, 25.1 for 61 G170R/null patients, 31.2 for 32 G170R/missense patients, and 33.9 years for 71 homozygous G170R patients. The outcome of some recurrent missense mutations (p.I244T, p.F152I, p.M195R, p.D201E, p.S81L, p.R36C) and an unprecedented number of G170R homozygotes is described in detail. Diagnosis is still delayed and actions aimed at increasing awareness of primary hyperoxaluria type 1 are recommended. Thus, in addition to G170R, other causative mutations are associated with later onset of end-stage renal disease. The OxalEurope registry will provide necessary tools for characterizing those genetic and non-genetic factors through a combination of genetic, functional, and biostatistical approaches.
8.76 W mid-infrared supercontinuum generation in a thulium doped fiber amplifier
NASA Astrophysics Data System (ADS)
Michalska, Maria; Grzes, Pawel; Swiderski, Jacek
2018-07-01
A stable mid-infrared supercontinuum (SC) generation with a maximum average power of 8.76 W in a spectral band of 1.9-2.65 μm is reported. To broaden the bandwidth of SC, a 1.55 μm pulsed laser system delivering 1 ns pulses at a pulse repetition frequency of 500 kHz was used as a seed source for one-stage thulium-doped fiber amplifier. The power conversion efficiency for wavelengths longer than 2.4 μm and 2.5 μm was determined to be 28% and 18%, respectively, which is believed to be the most efficient power distribution towards the mid-infrared in SC sources based on Tm-doped fibers. The power spectral density of the continuum was calculated to be >13 mW/nm with a potential of further scaling-up. A long-term power stability test, showing power fluctuations <3%, proved the robustness and reliability of the developed SC source.
NASA Technical Reports Server (NTRS)
Filer, Elizabeth D.; Barnes, Norman P.; Morrison, Clyde A.
1991-01-01
The calculated energy levels, the branching ratios, and the estimated thresholds for thulium operating on the 3F4 to 3H6 transitions are reported. Garnet materials with the general formula A3B2C3O12 are evaluated. Calculations are performed for the A side under the assumption of D2 symmetry. X-ray data available in the literature are used to evaluate the crystal-field components, A sub nm. Even-n components are employed to calculate the crystal-field splittings within the manifold. Thermal occupation factors are determined in a straightforward manner using a Boltzmann distribution for the respective manifolds. Odd-n components are applied to calculate the transition probabilities for electric field transitions. It is determined that the magnetic dipole contributions to the transition probability are comparable to the electric dipole contributions in some cases. Thresholds as a function of the density of thulium atoms are calculated.
Microsecond gain-switched master oscillator power amplifier (1958 nm) with high pulse energy
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ke Yin; Weiqiang Yang; Bin Zhang
2014-02-28
An all-fibre master oscillator power amplifier (MOPA) emitting high-energy pulses at 1958 nm is presented. The seed laser is a microsecond gain-switched thulium-doped fibre laser (TDFL) pumped with a commercial 1550-nm pulsed fibre laser. The TDFL operates at a repetition rate f in the range of 10 to 100 kHz. The two-stage thulium-doped fibre amplifier is built to scale the energy of the pulses generated by the seed laser. The maximum output pulse energy higher than 0.5 mJ at 10 kHz is achieved which is comparable with the theoretical maximum extractable pulse energy. The slope efficiency of the second stagemore » amplifier with respect to the pump power is 30.4% at f = 10 kHz. The wavelength of the output pulse laser is centred near 1958 nm at a spectral width of 0.25 nm after amplification. Neither nonlinear effects nor significant amplified spontaneous emission (ASE) is observed in the amplification experiments. (lasers)« less
High-power thulium-doped fiber laser in an all-fiber configuration
NASA Astrophysics Data System (ADS)
Baravets, Yauhen; Todorov, Filip; Honzatko, Pavel
2016-12-01
High-power Tm-doped fiber lasers are greatly suitable for various applications, such as material processing, medicine, environmental monitoring and topography. In this work we present an all-fiber narrowband CW laser in near fundamental mode operation based on a Tm-doped double-clad active fiber pumped by 793 nm laser diodes with a central wavelength stabilized at 2039 nm by a fiber Bragg grating. The achieved output power is 60 W with a slope efficiency of 46%. The measured beam quality factor is less than 1.4. Further increasing of the output power is possible using various power scaling techniques, for example, coherent combination of several Tm-doped fiber lasers. The developed fiber laser could be employed for welding, cutting and marking of thermoplastics in industry, minimally invasive surgery in medicine or sensors in lidar systems. Future improvements of thulium fiber lasers are possible due to the extremely wide gain-bandwidth of the active medium and the rapid growth of 2-μm fiber components production.
All-fiber thulium/holmium-doped mode-locked laser by tungsten disulfide saturable absorber
NASA Astrophysics Data System (ADS)
Yu, Hao; Zheng, Xin; Yin, Ke; Cheng, Xiang'ai; Jiang, Tian
2017-01-01
A passively mode-locked thulium/holmium-doped fiber laser (THDFL) based on tungsten disulfide (WS2) saturable absorber (SA) was demonstrated. The WS2 nanosheets were prepared by liquid phase exfoliation method and the SA was fabricated by depositing the few-layer WS2 nanosheets on the surface of a fiber taper. The modulation depth, saturable intensity, and non-saturable loss of this SA were measured to be 8.2%, 0.82 GW cm-2, and 29.4%, respectively. Based on this SA, a stable mode-locked laser operated at 1.91 µm was achieved with pulse duration of 825 fs and repetition rate of 15.49 MHz, and signal-to-noise ratio (SNR) of 67 dB. Meanwhile, by increasing the pump power and adjusting the position of polarization controller, harmonic mode-locking operations were obtained. These results showed that the WS2 nanosheet-based SA could be served as a desirable candidate for a short-pulse mode locker at 2 µm wavelength.
NASA Astrophysics Data System (ADS)
Engin, Doruk; Mathason, Brian; Storm, Mark
2017-08-01
Global wind measurements are critically needed to improve and extend NOAA weather forecasting that impacts U.S. economic activity such as agriculture crop production, as well as hurricane forecasting, flooding, and FEMA disaster planning.1 NASA and the 2007 National Research Council (NRC) Earth Science Decadal Study have also identified global wind measurements as critical for global change research. NASA has conducted aircraft-based wind lidar measurements using 2 um Ho:YLF lasers, which has shown that robust wind measurements can be made. Fibertek designed and demonstrated a high-efficiency, 100 W average power continuous wave (CW) 1940 nm thulium (Tm)- doped fiber laser bread-board system meeting all requirements for a NASA Earth Science spaceflight 2 μm Ho:YLF pump laser. Our preliminary design shows that it is possible to package the laser for high-reliability spaceflight operation in an ultra-compact 2″x8″x14″ size and weight <8.5 lbs. A spaceflight 100 W polarization maintaining (PM) Tm laser provides a path to space for a pulsed, Q-switched 2 μm Ho:YLF laser with 30-80 mJ/pulse range at 100-200 Hz repletion rates.
Modulated and continuous-wave operations of low-power thulium (Tm:YAP) laser in tissue welding
NASA Astrophysics Data System (ADS)
Bilici, Temel; Tabakoğlu, Haşim Özgür; Topaloğlu, Nermin; Kalaycıoğlu, Hamit; Kurt, Adnan; Sennaroglu, Alphan; Gülsoy, Murat
2010-05-01
Our aim is to explore the welding capabilities of a thulium (Tm:YAP) laser in modulated and continuous-wave (CW) modes of operation. The Tm:YAP laser system developed for this study includes a Tm:YAP laser resonator, diode laser driver, water chiller, modulation controller unit, and acquisition/control software. Full-thickness incisions on Wistar rat skin were welded by the Tm:YAP laser system at 100 mW and 5 s in both modulated and CW modes of operation (34.66 W/cm2). The skin samples were examined during a 21-day healing period by histology and tensile tests. The results were compared with the samples closed by conventional suture technique. For the laser groups, immediate closure at the surface layers of the incisions was observed. Full closures were observed for both modulated and CW modes of operation at day 4. The tensile forces for both modulated and CW modes of operation were found to be significantly higher than the values found by conventional suture technique. The 1980-nm Tm:YAP laser system operating in both modulated and CW modes maximizes the therapeutic effect while minimizing undesired side effects of laser tissue welding. Hence, it is a potentially important alternative tool to the conventional suturing technique.
Hutchens, Thomas C; Gonzalez, David A; Irby, Pierce B; Fried, Nathaniel M
2017-01-01
The experimental thulium fiber laser (TFL) is being explored as an alternative to the current clinical gold standard Holmium:YAG laser for lithotripsy. The near single-mode TFL beam allows coupling of higher power into smaller optical fibers than the multimode Holmium laser beam profile, without proximal fiber tip degradation. A smaller fiber is desirable because it provides more space in the ureteroscope working channel for increased saline irrigation rates and allows maximum ureteroscope deflection. However, distal fiber tip burnback increases as fiber diameter decreases. Previous studies utilizing hollow steel sheaths around recessed distal fiber tips reduced fiber burnback but increased stone retropulsion. A “fiber muzzle brake” was tested for reducing both fiber burnback and stone retropulsion by manipulating vapor bubble expansion. TFL lithotripsy studies were performed at 1908 nm, 35 mJ, 500 ?? ? s , and 300 Hz using a 100 - ? m -core fiber. The optimal stainless steel muzzle brake tip tested consisted of a 1-cm-long, 560 - ? m -outer-diameter, 360 - ? m -inner-diameter tube with a 275 - ? m -diameter through hole located 250 ?? ? m from the distal end. The fiber tip was recessed a distance of 500 ?? ? m . Stone phantom retropulsion, fiber tip burnback, and calcium oxalate stone ablation studies were performed ex vivo. Small stones with a mass of 40 ± 4 ?? mg and 4-mm-diameter were ablated over a 1.5-mm sieve in 25 ± 4 ?? s
Efficient Single-Frequency Thulium Doped Fiber Laser Near 2-micrometers
NASA Technical Reports Server (NTRS)
Geng, Jihong; Wu, Jianfeng; Jiang, Shibin; Yu, Jirong
2007-01-01
We demonstrate highly efficient diode-pumped single-frequency fiber laser with 35% slope efficiency and 50mW output power operating near 2 micrometers, which generated from a 2-cm long piece of highly Tm(3+)-doped germanate glass fiber pumped at 800nm.
Thulium fiber laser lithotripsy using a muzzle brake fiber tip
NASA Astrophysics Data System (ADS)
Hutchens, Thomas C.; Gonzalez, David A.; Irby, Pierce B.; Fried, Nathaniel M.
2017-02-01
The Thulium fiber laser (TFL) is being explored as an alternative to Holmium:YAG laser for lithotripsy. TFL beam profile allows coupling of higher power into smaller fibers than multimode Holmium laser beam, without proximal fiber tip degradation. A smaller fiber provides more space in ureteroscope working channel for increased saline irrigation and allows maximum ureteroscope flexion. However, distal fiber tip burnback increases as fiber diameter decreases. Previous studies utilizing hollow steel sheaths around recessed distal fiber tips reduced fiber burnback, but increased retropulsion. In this study, a "fiber muzzle brake" was tested for reducing fiber burnback and stone retropulsion. TFL lithotripsy studies were performed at 1908 nm, 35 mJ, 500 μs, and 300 Hz using a 100-μm-core fiber. The optimal stainless steel muzzle brake tip tested consisted of a 1-cm-long, 560-μm-OD, 360-μm-ID tube with 275-μm thru hole located 250-μm from the distal end. The fiber tip was recessed a distance of 500 μm. Stone phantom retropulsion, fiber tip burnback, and calcium oxalate stone ablation studies were performed, ex vivo. Small stones with a mass of 40 +/- 4 mg and 4-mm-diameter were ablated over a 1.5-mm sieve in 25 +/- 4 s (n=10), without distal fiber tip burnback. Reduction in stone phantom retropulsion distance by 50% and 85% was observed when using muzzle brake tips versus 100-μm-core bare fibers and hollow steel tip fibers. The muzzle brake fiber tip provided efficient stone ablation, reduced stone retropulsion, and minimal fiber degradation during TFL lithotripsy.
Image-guided smart laser system for precision implantation of cells in cartilage
NASA Astrophysics Data System (ADS)
Katta, Nitesh; Rector, John A.; Gardner, Michael R.; McElroy, Austin B.; Choy, Kevin C.; Crosby, Cody; Zoldan, Janet; Milner, Thomas E.
2017-03-01
State-of-the-art treatment for joint diseases like osteoarthritis focus on articular cartilage repair/regeneration by stem cell implantation therapy. However, the technique is limited by a lack of precision in the physician's imaging and cell deposition toolkit. We describe a novel combination of high-resolution, rapid scan-rate optical coherence tomography (OCT) alongside a short-pulsed nanosecond thulium (Tm) laser for precise cell seeding in cartilage. The superior beam quality of thulium lasers and wavelength of operation 1940 nm offers high volumetric tissue removal rates and minimizes the residual thermal footprint. OCT imaging enables targeted micro-well placement, precise cell deposition, and feature contrast. A bench-top system is constructed using a 15 W, 1940 nm, nanosecond-pulsed Tm fiber laser (500 μJ pulse energy, 100 ns pulse duration, 30kHz repetition rate) for removing tissue, and a swept source laser (1310 ± 70 nm, 100 kHz sweep rate) for OCT imaging, forming a combined Tm/OCT system - a "smart laser knife". OCT assists the smart laser knife user in characterizing cartilage to inform micro-well placement. The Tm laser creates micro-wells (2.35 mm diameter length, 1.5 mm width, 300 μm deep) and micro-incisions (1 mm wide, 200 μm deep) while OCT image-guidance assists and demonstrates this precision cutting and cell deposition with real-time feedback. To test micro-well creation and cell deposition protocol, gelatin phantoms are constructed mimicking cartilage optical properties and physiological structure. Cell viability is then assessed to illustrate the efficacy of the hydrogel deposition. Automated OCT feedback is demonstrated for cutting procedures to avoid important surface/subsurface structures. This bench-top smart laser knife system described here offers a new image-guided approach to precise stem cell seeding that can enhance the efficacy of articular cartilage repair.
Nonablative 1927 nm fractional resurfacing for the treatment of facial photopigmentation.
Brauer, Jeremy A; McDaniel, David H; Bloom, Bradley S; Reddy, Kavitha K; Bernstein, Leonard J; Geronemus, Roy G
2014-11-01
Long-term exposure to sunlight, including ultraviolet A and B, produces signs associated with photoaging and photodamage, including laxity and discoloration of the skin. Initial laser treatment for dyspigmentation included the use of ablative lasers, followed by Q-switched lasers and more recently fractional lasers. We investigated the safety and efficacy of a fractionated 1927nm non-ablative thulium laser for the treatment of photo-induced pigmentation. Prospective multi-center study of subjects with clinically identifiable photopigmentation. The study protocol was approved by BioMed Institutional Review Board (San Diego, CA). Subjects received two treatments with a non-ablative 1927nm fractionated thulium laser (Fraxel Dual 1550/1927 Laser System, Solta, Hayward CA), energy level of 10mJ, coverage of 40% and 4-6 passes. Subject pain, erythema and edema were recorded immediately after treatment. Two dimensional photography was obtained before each treatment and at one and three month follow up visits. Independent blinded physician assessment was performed evaluating overall improvement in appearance as well as pigment specific improvement. Forty men and women, ages 30 to 80 years, Fitzpatrick skin types I-IV, with photo-induced facial pigmentation were enrolled and treated, and 39 completed the three month follow up visit. Mean pain sensation for subjects during laser treatments was reported to be 4.3 on a 10-point scale. Mean scores for erythema, edema, and skin roughness throughout all treatments indicated moderate erythema, mild edema and mild skin roughness. Assessment of overall improvement was graded as moderate to very significant in 82% of subjects at one month and in 69% of subjects at three months after the second treatment. Assessment of lentigines and ephelides demonstrated moderate to very significant improvement in approximately 68% of subjects at the one month and in 51% of subjects at three months after the second treatment. Independent blinded physician assessment of randomized photography also demonstrated a durable response at three month follow up visit. Treatment was well tolerated and no serious adverse events related to treatment were observed or reported. Study limitations included a limited number of male subjects, lack of Fitzpatrick skin types V and VI, and decrease in improvement at 3 months post-treatment. Two treatments with a 1927nm non-ablative fractionated thulium laser produced moderate to marked improvement in overall appearance and pigmentation with high patient satisfaction. The response to treatment was maintained at one and three months follow up.
Photoselective laser ablation of the prostate: a review of the current 2015 tissue ablation options.
Tholomier, Côme; Valdivieso, Roger; Hueber, Pierre-Alain; Zorn, Kevin C
2015-10-01
Transurethral resection of the prostate (TURP) is still considered the gold standard to treat benign prostatic hyperplasia (BPH). However, photoselective vaporization of the prostate (PVP) has gained widespread acceptance as an alternative option requiring preoperative patient selection. Four laser systems are currently in use: holmium, thulium, diode and GreenLight. The goal of this article is to review the physics and the basics behind laser prostatectomies, as well as to present the most current literature concerning the results, advantages, disadvantages and international recommendations for each vaporization procedure. Holmium laser ablation of the prostate (HoLAP) and GreenLight photoselective vaporization of the prostate are an alternative to TURP for small to medium-sized prostates, providing equivalent efficacy and safety. GreenLight is also safe and effective in large-sized prostates and especially beneficial in anti-coagulated individuals compared to TURP. Thulium vaporization of the prostate (ThuVAP) and diode vaporization both require additional randomized trials and long term studies before conclusion is made, despite promising initial results. Diode vaporization provides the best hemostasis overall, but at the cost of increased complication and re-treatment rate, and thus is not recommended except in severely anti-coagulated patients. Laser vaporization is a safe and effective alternative to TURP in the treatment of benign prostatic hyperplasia (BPH) for carefully selected patients. However, further research is still needed to assess the durability of each technology.
Kume, Yuko; Maekawa, Toshihiko; Urakawa, Tomokazu; Hironaga, Naruhito; Ogata, Katsuya; Shigyo, Maki; Tobimatsu, Shozo
2016-08-01
When and where the awareness of faces is consciously initiated is unclear. We used magnetoencephalography to probe the brain responses associated with face awareness under intermittent pseudo-rivalry (PR) and binocular rivalry (BR) conditions. The stimuli comprised three pictures: a human face, a monkey face and a house. In the PR condition, we detected the M130 component, which has been minimally characterized in previous research. We obtained a clear recording of the M170 component in the fusiform face area (FFA), and found that this component had an earlier response time to faces compared with other objects. The M170 occurred predominantly in the right hemisphere in both conditions. In the BR condition, the amplitude of the M130 significantly increased in the right hemisphere irrespective of the physical characteristics of the visual stimuli. Conversely, we did not detect the M170 when the face image was suppressed in the BR condition, although this component was clearly present when awareness for the face was initiated. We also found a significant difference in the latency of the M170 (human
Switchable thulium-doped fiber laser from polarization rotation vector to scalar soliton
NASA Astrophysics Data System (ADS)
Wu, Zhichao; Fu, Songnian; Jiang, Kai; Song, Jue; Li, Huizi; Tang, Ming; Shum, Ping; Liu, Deming
2016-10-01
We experimentally demonstrate switchable temporal soliton generation from a thulium-doped fiber laser (TDFL), using carbon nanotubes as the mode-locker. With the help of residual polarization dependent loss of a wavelength division multiplexer, a weak nonlinear polarization rotation (NPR) effect can be achieved within the laser cavity, which may provide joint contribution for passive mode-locking operation. By finely adjusting the polarization to alter the strength of NPR-based saturable absorption, the TDFL either approaches the operation regime of scalar soliton with strong NPR effect, or generates polarization rotation locked vector soliton (PRLVS) with weak NPR effect. The scalar solitons and PRLVSs possess 3-dB optical spectrum bandwidth of 2.2 nm and 2 nm, pulse-width of 1.8 ps and 2 ps, respectively. Moreover, the PRLVSs demonstrate a typical energy exchange between two polarized components on optical spectra and a period-doubling feature in time domain. Such operation principle can also be used in 1550 nm band fiber lasers and other nonlinear systems.
Switchable thulium-doped fiber laser from polarization rotation vector to scalar soliton
Wu, Zhichao; Fu, Songnian; Jiang, Kai; Song, Jue; Li, Huizi; Tang, Ming; Shum, Ping; Liu, Deming
2016-01-01
We experimentally demonstrate switchable temporal soliton generation from a thulium-doped fiber laser (TDFL), using carbon nanotubes as the mode-locker. With the help of residual polarization dependent loss of a wavelength division multiplexer, a weak nonlinear polarization rotation (NPR) effect can be achieved within the laser cavity, which may provide joint contribution for passive mode-locking operation. By finely adjusting the polarization to alter the strength of NPR-based saturable absorption, the TDFL either approaches the operation regime of scalar soliton with strong NPR effect, or generates polarization rotation locked vector soliton (PRLVS) with weak NPR effect. The scalar solitons and PRLVSs possess 3-dB optical spectrum bandwidth of 2.2 nm and 2 nm, pulse-width of 1.8 ps and 2 ps, respectively. Moreover, the PRLVSs demonstrate a typical energy exchange between two polarized components on optical spectra and a period-doubling feature in time domain. Such operation principle can also be used in 1550 nm band fiber lasers and other nonlinear systems. PMID:27708427
Switchable thulium-doped fiber laser from polarization rotation vector to scalar soliton.
Wu, Zhichao; Fu, Songnian; Jiang, Kai; Song, Jue; Li, Huizi; Tang, Ming; Shum, Ping; Liu, Deming
2016-10-06
We experimentally demonstrate switchable temporal soliton generation from a thulium-doped fiber laser (TDFL), using carbon nanotubes as the mode-locker. With the help of residual polarization dependent loss of a wavelength division multiplexer, a weak nonlinear polarization rotation (NPR) effect can be achieved within the laser cavity, which may provide joint contribution for passive mode-locking operation. By finely adjusting the polarization to alter the strength of NPR-based saturable absorption, the TDFL either approaches the operation regime of scalar soliton with strong NPR effect, or generates polarization rotation locked vector soliton (PRLVS) with weak NPR effect. The scalar solitons and PRLVSs possess 3-dB optical spectrum bandwidth of 2.2 nm and 2 nm, pulse-width of 1.8 ps and 2 ps, respectively. Moreover, the PRLVSs demonstrate a typical energy exchange between two polarized components on optical spectra and a period-doubling feature in time domain. Such operation principle can also be used in 1550 nm band fiber lasers and other nonlinear systems.
Miniaturized Lab System for Future Cold Atom Experiments in Microgravity
NASA Astrophysics Data System (ADS)
Kulas, Sascha; Vogt, Christian; Resch, Andreas; Hartwig, Jonas; Ganske, Sven; Matthias, Jonas; Schlippert, Dennis; Wendrich, Thijs; Ertmer, Wolfgang; Maria Rasel, Ernst; Damjanic, Marcin; Weßels, Peter; Kohfeldt, Anja; Luvsandamdin, Erdenetsetseg; Schiemangk, Max; Grzeschik, Christoph; Krutzik, Markus; Wicht, Andreas; Peters, Achim; Herrmann, Sven; Lämmerzahl, Claus
2017-02-01
We present the technical realization of a compact system for performing experiments with cold 87Rb and 39K atoms in microgravity in the future. The whole system fits into a capsule to be used in the drop tower Bremen. One of the advantages of a microgravity environment is long time evolution of atomic clouds which yields higher sensitivities in atom interferometer measurements. We give a full description of the system containing an experimental chamber with ultra-high vacuum conditions, miniaturized laser systems, a high-power thulium-doped fiber laser, the electronics and the power management. In a two-stage magneto-optical trap atoms should be cooled to the low μK regime. The thulium-doped fiber laser will create an optical dipole trap which will allow further cooling to sub- μK temperatures. The presented system fulfills the demanding requirements on size and power management for cold atom experiments on a microgravity platform, especially with respect to the use of an optical dipole trap. A first test in microgravity, including the creation of a cold Rb ensemble, shows the functionality of the system.
NASA Astrophysics Data System (ADS)
Wu, C. N.; Tseng, C. C.; Lin, K. Y.; Cheng, C. K.; Yeh, S. L.; Fanchiang, Y. T.; Hong, M.; Kwo, J.
2018-05-01
High-quality single-crystal thulium iron garnet (TmIG) films of 10-30 nm thick were grown by off-axis sputtering at room temperature (RT) followed by post-annealing. X-ray photoelectron spectroscopy (XPS) was employed to determine the TmIG film composition to optimize the growth conditions, along with the aid of x-ray diffraction (XRD) structural analysis and atomic force microscope (AFM) for surface morphology. The optimized films exhibited perpendicular magnetic anisotropy (PMA) and the saturation magnetization at RT was ˜99 emu/cm3, close to the RT bulk value ˜110 emu/cm3 with a very low coercive field of ˜2.4 Oe. We extracted the H⊥ of 1734 Oe and the peak-to-peak linewidth ΔH of ferromagnetic resonance are only about 99 Oe, significantly lower than that of PLD grown TmIG film and bulk single crystals. The high-quality sputtered single-crystal TmIG films show great potential to be integrated with topological insulators or heavy metals with strong spin-orbit coupling for spintronic applications.
NASA Astrophysics Data System (ADS)
Hardy, Luke A.; Gonzalez, David A.; Irby, Pierce B.; Fried, Nathaniel M.
2018-02-01
Previous Thulium fiber laser lithotripsy (TFL) studies were limited to a peak power of 70 W (35 mJ / 500 μs), requiring operation in dusting mode with low pulse energy (35 mJ) and high pulse rate (300 Hz). In this study, a novel, compact, air-cooled, TFL capable of operating at up to 500 W peak power, 50 W average power, and 2000 Hz, was tested. The 1940-nm TFL was used with pulse duration (500 μs), average power (10 W), and fiber (270- μm-core) fixed, while pulse energy and pulse rate were changed. A total of 23 large uric acid (UA) stones and 16 large calcium oxalate monohydrate (COM) stones were each separated into 3 modes (Group 1-"Dusting"- 33mJ/300Hz; Group 2-"Fragmentation"-200mJ/50Hz; Group 3-"Dual mode"-Fragmentation then Dusting). The fiber was held manually in contact with stone on a 2-mm-mesh sieve submerged in a flowing saline bath. UA ablation rates were 2.3+/-0.8, 2.3+/-0.2, and 4.4+/-0.8 mg/s and COM ablation rates were 0.4+/-0.1, 1.0+/-0.1, and 0.9+/-0.4 mg/s, for Groups 1, 2, and 3. Dual mode provided 2x higher UA ablation rates than other modes. COM ablation threshold is 3x higher than UA, so dusting provided lower COM ablation rates than other modes. Future studies will explore higher average laser power than 10 W for rapid TFL ablation of large stones.
Netsch, Christopher; Stoehrer, M; Brüning, M; Gabuev, A; Bach, T; Herrmann, T R W; Gross, A J
2014-02-01
To evaluate the safety and efficacy of Thulium VapoEnucleation of the prostate (ThuVEP) for patients on oral anticoagulants (OA) with symptomatic benign prostatic obstruction (BPO). Fifty-six patients, undergoing ThuVEP at two institutions, were evaluated from May 2009 until June 2011. All patients were at high cardiopulmonary risk and presented with a median American Society of Anesthesiology score of 3 [interquartile range (IQR) 2-3]. Thirty-two patients were on aspirin, 8 were on clopidogrel or clopidogrel and aspirin, and 16 on phenprocoumon at the time of surgery. Patient demographic, perioperative, and follow-up data were analyzed. Median prostate volume was 50 (IQR 34-76) cc, and resected tissue weight was 32 (IQR 20-50) g. The median operative time was 61.5 (IQR 40-100.75) min, and the catheter time 2 (IQR 2-3) days. There were no perioperative thromboembolic events. Five patients (8.9%) required a second-look operation in the immediate postoperative course (hemorrhage n = 4, residual adenoma n = 1) and four (7.1%) blood transfusions. Complications within the first 30 days included urinary tract infections (1.7%), urinary retention (3.6%), and delayed bleeding (7.1%). These complications were managed conservatively. At 12-month follow-up, median QoL [5 (IQR 3.75-5) vs. 1 (IQR 1-2)], IPSS [21.5 (IQR 15.5-23.75) vs. 5 (IQR 3-8)], Qmax [7.7 (IQR 6.3-10) vs. 28.3 (IQR 21.25-39.2) ml/s], and postvoiding residual urine [100 (IQR 46-200) vs. 17.5 (IQR 0-36) ml] improved significantly (p < 0.002). Thulium VapoEnucleation of the prostate seems to be a safe and efficacious procedure for the treatment of symptomatic BPO in patients at high cardiopulmonary risk on OA.
Garman, Heather D.; Spaulding, Christine J.; Webb, Sara Jane; Mikami, Amori Yee; Morris, James P.
2016-01-01
This study examined social motivation and early-stage face perception as frameworks for understanding impairments in facial emotion recognition (FER) in a well-characterized sample of youth with autism spectrum disorders (ASD). Early-stage face perception (N170 event-related potential latency) was recorded while participants completed a standardized FER task, while social motivation was obtained via parent report. Participants with greater social motivation exhibited poorer FER, while those with shorter N170 latencies exhibited better FER for child angry faces stimuli. Social motivation partially mediated the relationship between a faster N170 and better FER. These effects were all robust to variations in IQ, age, and ASD severity. These findings augur against theories implicating social motivation as uniformly valuable for individuals with ASD, and augment models suggesting a close link between early-stage face perception, social motivation, and FER in this population. Broader implications for models and development of FER in ASD are discussed. PMID:26743637
Garman, Heather D; Spaulding, Christine J; Webb, Sara Jane; Mikami, Amori Yee; Morris, James P; Lerner, Matthew D
2016-12-01
This study examined social motivation and early-stage face perception as frameworks for understanding impairments in facial emotion recognition (FER) in a well-characterized sample of youth with autism spectrum disorders (ASD). Early-stage face perception (N170 event-related potential latency) was recorded while participants completed a standardized FER task, while social motivation was obtained via parent report. Participants with greater social motivation exhibited poorer FER, while those with shorter N170 latencies exhibited better FER for child angry faces stimuli. Social motivation partially mediated the relationship between a faster N170 and better FER. These effects were all robust to variations in IQ, age, and ASD severity. These findings augur against theories implicating social motivation as uniformly valuable for individuals with ASD, and augment models suggesting a close link between early-stage face perception, social motivation, and FER in this population. Broader implications for models and development of FER in ASD are discussed.
Lin, H Y; Masso-Welch, P; Di, Y P; Cai, J W; Shen, J W; Subjeck, J R
1993-01-01
Anoxia, glucose starvation, calcium ionophore A23187, EDTA, glucosamine, and several other conditions that adversely affect the function of the endoplasmic reticulum (ER) induce the synthesis of the glucose-regulated class of stress proteins (GRPs). The primary GRPs induced by these stresses migrate at 78 and 94 kDa (GRP78 and GRP94). In addition, another protein of approximately 150-170 kDa (GRP170) has been previously observed and is coordinately induced with GRP78 and GRP94. To characterize this novel stress protein, we have prepared an antisera against purified GRP170. Immunofluorescence, Endoglycosidase H sensitivity, and protease resistance of this protein in microsomes indicates that GRP170 is an ER lumenal glycoprotein retained in a pre-Golgi compartment. Immunoprecipitation of GRP170 with our antibody coprecipitates the GRP78 (also referred to as the B cell immunoglobulin-binding protein) and GRP94 members of this stress protein family in Chinese hamster ovary cells under stress conditions. ATP depletion, by immunoprecipitation in the presence of apyrase, does not affect the interaction between GRP78 and GRP170 but results in the coprecipitation of an unidentified 60-kDa protein. In addition, GRP170 is found to be coprecipitated with immunoglobulin (Ig) in four different B cell hybridomas expressing surface IgM, cytoplasmic Ig light chain only, cytoplasmic Ig heavy chain only, or an antigen specific secreted IgG. In addition, in IgM surface expressing WEHI-231 B cells, anti-IgM coprecipitates GRP78, GRP94, as well as GRP170; antibodies against GRP170 and GRP94 reciprocally coprecipitate GRP94/GRP170 as well as GRP78. Results suggest that this 170-kDa GRP is a retained ER lumenal glycoprotein that is constitutively present and that may play a role in immunoglobulin folding and assembly in conjunction or consecutively with GRP78 and GRP94. Images PMID:8305733
NASA Astrophysics Data System (ADS)
Ogundimu, Emmanuel O.; Akinlabi, Esther T.; Erinosho, Mutiu F.
Stainless steel is a family of Fe-based alloys having excellent resistance to corrosion and as such has been used imperatively for kitchen utensils, transportation, building constructions and much more. This paper presents the work conducted on the material characterizations of a tungsten inert gas (TIG)-metal inert gas (MIG) hybrid welded joint of type 304 austenitic stainless steel. The welding processes were conducted in three phases. The phases of welding employed are MIG welding using a current of 170A, TIG welding using a current of 190A, and a hybrid TIG-MIG welding with currents of 190/170A, respectively. The MIG, TIG, and hybrid TIG-MIG weldments were characterized with incomplete penetration, full penetration and excess penetration of weld. Intergranular austenite was created toward transition and heat affected zones. The thickness of the delta ferrite (δ-Fe) formed in the microstructures of the TIG weld is more than the thickness emerged in the microstructures of MIG and hybrid TIG-MIG welds. A TIG-MIG hybrid weld of specimen welded at the currents of 190/170A has the highest ultimate tensile strength value and percentage elongation of 397.72MPa and 35.7%. The TIG-MIG hybrid welding can be recommended for high-tech industrial applications such as nuclear, aircraft, food processing, and automobile industry.
NASA Astrophysics Data System (ADS)
Hardy, Luke A.; Irby, Pierce B.; Fried, Nathaniel M.
2018-02-01
We investigated proposed mechanisms of laser lithotripsy, specifically for the novel, experimental Thulium fiber laser (TFL). Previous lithotripsy studies with the conventional Holmium:YAG laser noted a primary photothermal mechanism (vaporization). Our hypothesis is that an additional mechanical effect (fragmentation) occurs due to vaporization of water in stone material from high absorption of energy, called micro-explosions. The TFL irradiated calcium oxalate monohydrate (COM) and uric acid (UA) stones, as well as artificial stones (Ultracal30 and BegoStone), in air and water environments. TFL energy was varied to determine the relative effect on the ablation mechanism. Scanning electron microscopy (SEM) was used to study qualitative and characteristic changes in surface topography with correlation to presumed ablation mechanisms. Laser irradiation of stones in air produced charring and melting of the stone surface consistent with a photothermal effect and minimal fragmentation, suggesting no mechanical effect from micro-explosions. For COM stones ablated in water, there was prominent fragmentation in addition to recognized photothermal effects, supporting dual mechanisms during TFL lithotripsy. For UA stones, there were minimal photothermal effects, and dominant effects were mechanical. By increasing TFL pulse energy, a greater mechanical effect was demonstrated for both stone types. For artificial stones, there was no significant evidence of mechanical effects. TFL laser lithotripsy relies on two prominent mechanisms for stone ablation, photothermal and mechanical. Water is necessary for the mechanical effect which can be augmented by increasing pulse energy. Artificial stones may not provide a predictive model for mechanical effects during laser lithotripsy.
Population Structure in Nontypeable Haemophilus influenzae
LaCross, Nathan C.; Marrs, Carl F.; Gilsdorf, Janet R.
2013-01-01
Nontypeable Haemophilus influenzae (NTHi) frequently colonize the human pharynx asymptomatically, and are an important cause of otitis media in children. Past studies have identified typeable H. influenzae as being clonal, but the population structure of NTHi has not been extensively characterized. The research presented here investigated the diversity and population structure in a well-characterized collection of NTHi isolated from the middle ears of children with otitis media or the pharynges of healthy children in three disparate geographic regions. Multilocus sequence typing identified 109 unique sequence types among 170 commensal and otitis media-associated NTHi isolates from Finland, Israel, and the US. The largest clonal complex contained only five sequence types, indicating a high level of genetic diversity. The eBURST v3, ClonalFrame 1.1, and structure 2.3.3 programs were used to further characterize diversity and population structure from the sequence typing data. Little clustering was apparent by either disease state (otitis media or commensalism) or geography in the ClonalFrame phylogeny. Population structure was clearly evident, with support for eight populations when all 170 isolates were analyzed. Interestingly, one population contained only commensal isolates, while two others consisted solely of otitis media isolates, suggesting associations between population structure and disease. PMID:23266487
Roland, Bartholomew P.; Amrich, Christopher G.; Kammerer, Charles J.; ...
2014-10-16
Triosephosphate isomerase (TPI) is a glycolytic enzyme which homodimerizes for full catalytic activity. Mutations of the TPI gene elicit a disease known as TPI Deficiency, a glycolytic enzymopathy noted for its unique severity of neurological symptoms. Evidence suggests that TPI Deficiency pathogenesis may be due to conformational changes of the protein, likely affecting dimerization and protein stability. In this report, we genetically and physically characterize a human disease-associated TPI mutation caused by an I170V substitution. Human TPI I170V elicits behavioral abnormalities in Drosophila. An examination of hTPI I170V enzyme kinetics revealed this substitution reduced catalytic turnover, while assessments of thermalmore » stability demonstrated an increase in enzyme stability. Furthermore, the crystal structure of the homodimeric I170V mutant reveals changes in the geometry of critical residues within the catalytic pocket. In the end, collectively these data reveal new observations of the structural and kinetic determinants of TPI deficiency pathology, providing new insights into disease pathogenesis.« less
Carmignani, Luca; Bozzini, Giorgio; Macchi, Alberto; Maruccia, Serena; Picozzi, Stefano; Casellato, Stefano
2015-01-01
Treatment of patients with lower urinary tract symptoms (LUTS) secondary to benign prostatic hyperplasia (BPH) may affect the quality of sexual function and ejaculation. The effect of new surgical procedures, which are currently available to treat BPH, on erection and ejaculation, has been poorly studied. This study aimed to assess the effect of thulium laser enucleation of the prostate (ThuLEP) on sexual function and retrograde ejaculation in patients with LUTS secondary to BPH. We performed a prospective study in 110 consecutive patients who had undergone ThuLEP to analyze changes in sexual function and urinary symptoms. To evaluate changes in erection and ejaculation, and the effect of urinary symptoms on the quality of life (QoL), five validated questionnaires were used: the ICIQ-MLUTSsex, MSHQ-EjD, International Index of Erectile Function 5, International Prognostic Scoring System (IPSS) questionnaire, and QoL index of the intraclass correlation coefficients. Patients also underwent IPSS and flowmetry to assess the outcome of flow. Patients were evaluated before surgery and 3-6 months after ThuLEP, whereas those with previous abdominal surgery were excluded. The patients' mean age was 67.83 years. Postoperative urinary symptoms improved after surgery. No significant differences in erectile function before and after surgery were observed. As compared with other techniques described in the literature, the percentage of patients with conserved ejaculation increased by 52.7% after ThuLEP. ThuLEP positively affects urinary symptoms and their effect on the QoL of patients as assessed by questionnaire scores. While endoscopic management of BPH (e.g. transurethral resection of the prostate) causes retrograde ejaculation in most patients, those who undergo ThuLEP have conserved ejaculation and erectile function.
Thulium fiber laser lithotripsy using small spherical distal fiber tips
NASA Astrophysics Data System (ADS)
Wilson, Christopher R.; Hardy, Luke A.; Kennedy, Joshua D.; Irby, Pierce B.; Fried, Nathaniel M.
2016-02-01
This study tests a 100-μm-core fiber with 300-μm-diameter ball tip during Thulium fiber laser (TFL) lithotripsy. The TFL was operated at 1908 nm wavelength with 35-mJ pulse energy, 500-μs pulse duration, and 300-Hz pulse rate. Calcium oxalate/phosphate stone samples were weighed, laser procedure times measured, and ablation rates calculated for ball tip fibers, with comparison to bare tip fibers. Photographs of ball tips were taken before and after each procedure to observe ball tip degradation and determine number of procedures completed before need to replace fiber. Saline irrigation rates and ureteroscope deflection were measured with and without TFL fiber present. There was no statistical difference (P > 0.05) between stone ablation rates for single-use ball tip fiber (1.3 +/- 0.4 mg/s) (n=10), multiple-use ball tip fiber (1.3 +/- 0.5 mg/s) (n=44), and conventional single-use bare tip fibers (1.3 +/- 0.2 mg/s) (n=10). Ball tip durability varied widely, but fibers averaged > 4 stone procedures before decline in stone ablation rates due to mechanical damage at front surface of ball tip. The small fiber diameter did not impact ureteroscope deflection or saline flow rates. The miniature ball tip fiber may provide a cost-effective design for safe fiber insertion through the ureteroscope working channel and the ureter without risk of scope damage or tissue perforation, and without compromising stone ablation efficiency during TFL ablation of kidney stones.
NASA Astrophysics Data System (ADS)
Mohd Rusdi, Muhammad Farid; Latiff, Anas Abdul; Paul, Mukul Chandra; Das, Shyamal; Dhar, Anirban; Ahmad, Harith; Harun, Sulaiman Wadi
2017-03-01
We report the generation of mode-locked thulium-holmium doped fiber laser (THDFL) at 1979 nm. This is a first demonstration of mode-locked by using Titanium Dioxide (TiO2) film as a saturable absorber (SA). A piece of 1 mm×1 mm TiO2 film was sandwiched in between two fiber ferrule in the cavity. Fabrication process of TiO2 film incorporated a TiO2 and a polyvinyl alcohol (PVA). The stable 9 MHz repetition rate of mode-locked mode operation with 58 dB SNR was generated under pump power of 902-1062 mW. At maximum pump power, the mode-locked THDFL has output power and pulse energy of 15 mW and 1.66 nJ, respectively. Our results demonstrate the TiO2 can be used promisingly in ultrafast photonics applications.
Detection of unculturable bacteria in periodontal health and disease by PCR.
Harper-Owen, R; Dymock, D; Booth, V; Weightman, A J; Wade, W G
1999-05-01
Recently developed molecular methods have made it possible to characterize mixed microflora in their entirety, including the substantial numbers of bacteria which do not grow on artificial culture media. In a previous study, molecular analysis of the microflora associated with acute oral infections resulted in the identification of three phylotypes, PUS3.42, PUS9.170, and PUS9.180, representing as-yet-uncultured organisms. The aim of this study was to design and validate specific PCR primers for these phylotypes and to determine their incidences in samples collected from healthy and diseased periodontal tissues. Two specific reverse primers were devised for each phylotype, and these were used in duplex PCRs with universal forward and reverse primers. All three phylotypes were detected in periodontal sites; PUS9.170, related to oral asaccharolytic Eubacterium spp., was significantly associated with disease. This study demonstrates the possibility of using unculturable, and therefore uncharacterized, organisms as markers of disease.
120-W 2-µm thulium:yttrium-aluminium-garnet vapoenucleation of the prostate: 12-month follow-up.
Netsch, Christopher; Pohlmann, Laura; Herrmann, Thomas R W; Gross, Andreas J; Bach, Thorsten
2012-07-01
Study Type - Therapy (case series) Level of Evidence 4 What's known on the subject? and What does the study add? Thulium VapoEnucleation of the prostate (ThuVEP) has been introduced as a minimally invasive treatment modality of benign prostate obstruction (BPO). This study reports the largest series of patients with symptomatic BPO undergoing ThuVEP. Efficacy of this procedure was confirmed by prostate volume and PSA measurements at 12-month follow up, which have not been reported after ThuVEP so far. To evaluate the safety and efficacy of 120-W 2-µm thulium:yttrium-aluminium-garnet (YAG) vapoenucleation of the prostate (ThuVEP) for patients with symptomatic benign prostatic obstruction. In total, 207 consecutive patients undergoing ThuVEP at our institution were evaluated prospectively. ThuVEP was carried out using the 120-W 2-µm continuous-wave Tm:YAG laser. The enucleated tissue was then morcellated within the bladder. Patient demographic, perioperative and 12-month follow-up data were analysed. The complications were assessed. Mean preoperative prostate volume was 57.8 ± 31.5 mL. Total operation duration averaged 64.9 ± 29.9 min, and the enucleation time was 36.5 ± 20.1 min. The mean catheter time was 2.2 ± 0.6 days. Thirteen (6.28%) patients required a second-look operation in the immediate postoperative course (failed morcellation n= 1, clot retention n= 4, residual tissue at the apex of the prostate n= 8). Four patients needed blood transfusions (1.93%) postoperatively. In all, 147 (71%) patients were available for review at the 12-month follow-up mark. Quality of life (4.4 ± 1.3 vs 1.2 ± 1.1), international prostate symptom score (21.9 ± 7.2 vs 5.1 ± 4), maximum urinary flow rate (9.4 ± 3.8 vs 23.5 ± 10.9 mL/s), postvoiding residual urine (159.2 ± 153.2 vs 26.7 ± 38.3 mL), prostate-specific antigen (5.0 ± 5.2 vs 0.6 ± 0.5 ng/mL) and prostate volume (57.8 ± 31.5 vs 10.7 ± 4.4 mL) changed significantly (P= 0.000). Median prostate-specific antigen reduction and prostate volume reduction were 87% and 80% respectively at follow-up. Urethral stricture and bladder neck contracture developed in 1.45% and 1.93% respectively of the patients. 120-W ThuVEP is a safe and efficacious procedure for the treatment of symptomatic benign prostatic obstruction. The incidence of complications with ThuVEP was low. © 2011 BJU INTERNATIONAL.
40 CFR 159.170 - Human epidemiological and exposure studies.
Code of Federal Regulations, 2010 CFR
2010-07-01
... studies. 159.170 Section 159.170 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED... Information § 159.170 Human epidemiological and exposure studies. Information must be submitted which concerns any study that a person described in § 159.158(a) has concluded, or might reasonably conclude, shows...
Jenkins, Benjamin J; Seyssel, Kevin; Chiu, Sally; Pan, Pin-Ho; Lin, Shih-Yi; Stanley, Elizabeth; Ament, Zsuzsanna; West, James A; Summerhill, Keith; Griffin, Julian L; Vetter, Walter; Autio, Kaija J; Hiltunen, Kalervo; Hazebrouck, Stéphane; Stepankova, Renata; Chen, Chun-Jung; Alligier, Maud; Laville, Martine; Moore, Mary; Kraft, Guillaume; Cherrington, Alan; King, Sarah; Krauss, Ronald M; de Schryver, Evelyn; Van Veldhoven, Paul P; Ronis, Martin; Koulman, Albert
2017-03-23
Recent findings have shown an inverse association between circulating C15:0/C17:0 fatty acids with disease risk, therefore, their origin needs to be determined to understanding their role in these pathologies. Through combinations of both animal and human intervention studies, we comprehensively investigated all possible contributions of these fatty acids from the gut-microbiota, the diet, and novel endogenous biosynthesis. Investigations included an intestinal germ-free study and a C15:0/C17:0 diet dose response study. Endogenous production was assessed through: a stearic acid infusion, phytol supplementation, and a Hacl1 -/- mouse model. Two human dietary intervention studies were used to translate the results. Finally, a study comparing baseline C15:0/C17:0 with the prognosis of glucose intolerance. We found that circulating C15:0/C17:0 levels were not influenced by the gut-microbiota. The dose response study showed C15:0 had a linear response, however C17:0 was not directly correlated. The phytol supplementation only decreased C17:0. Stearic acid infusion only increased C17:0. Hacl1 -/- only decreased C17:0. The glucose intolerance study showed only C17:0 correlated with prognosis. To summarise, circulating C15:0 and C17:0 are independently derived; C15:0 correlates directly with dietary intake, while C17:0 is substantially biosynthesized, therefore, they are not homologous in the aetiology of metabolic disease. Our findings emphasize the importance of the biosynthesis of C17:0 and recognizing its link with metabolic disease.
Comparative laser-tissue interaction effects at 1.96 and 2.01 um of Cr; Tm:YAG laser
NASA Astrophysics Data System (ADS)
Pankratov, Michail M.; Perrault, Donald F., Jr.; Shapshay, Stanley M.; Pinto, Joseph F.; Esterowitz, Dina; Aretz, H. Thomas
1992-08-01
A pulsed spiking and nonspiking Cr; thulium (Tm):YAG flash lamp pumped laser operating at 1.96 and 2.01 μm was investigated in vitro in the clinically relevant power range for its basic laser-tissue interaction with soft, cartilaginous, and bone tissues. Some explanations of the differences and possible medical applications are discussed.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Roland, Bartholomew P.; Amrich, Christopher G.; Kammerer, Charles J.
Triosephosphate isomerase (TPI) is a glycolytic enzyme which homodimerizes for full catalytic activity. Mutations of the TPI gene elicit a disease known as TPI Deficiency, a glycolytic enzymopathy noted for its unique severity of neurological symptoms. Evidence suggests that TPI Deficiency pathogenesis may be due to conformational changes of the protein, likely affecting dimerization and protein stability. In this report, we genetically and physically characterize a human disease-associated TPI mutation caused by an I170V substitution. Human TPI I170V elicits behavioral abnormalities in Drosophila. An examination of hTPI I170V enzyme kinetics revealed this substitution reduced catalytic turnover, while assessments of thermalmore » stability demonstrated an increase in enzyme stability. Furthermore, the crystal structure of the homodimeric I170V mutant reveals changes in the geometry of critical residues within the catalytic pocket. In the end, collectively these data reveal new observations of the structural and kinetic determinants of TPI deficiency pathology, providing new insights into disease pathogenesis.« less
Saredi, Giovanni; Pirola, Giacomo Maria; Pacchetti, Andrea; Lovisolo, Jon Alexander; Borroni, Giacomo; Sembenini, Federico; Marconi, Alberto Mario
2015-06-09
The aim of this study was to determine the learning curve for thulium laser enucleation of the prostate (ThuLEP) for two surgeons with different levels of urological endoscopic experience. From June 2012 to August 2013, ThuLEP was performed on 100 patients in our institution. We present the results of a prospective evaluation during which we analyzed data related to the learning curves for two surgeons of different levels of experience. The prostatic adenoma volumes ranged from 30 to 130 mL (average 61.2 mL). Surgeons A and B performed 48 and 52 operations, respectively. Six months after surgery, all patients were evaluated with the International Prostate Symptom Score questionnaire, uroflowmetry, and prostate-specific antigen test. Introduced in 2010, ThuLEP consists of blunt enucleation of the prostatic apex and lobes using the sheath of the resectoscope. This maneuver allows clearer visualization of the enucleation plane and precise identification of the prostatic capsule. These conditions permit total resection of the prostatic adenoma and coagulation of small penetrating vessels, thereby reducing the laser emission time. Most of the complications in this series were encountered during morcellation, which in some cases was performed under poor vision because of venous bleeding due to surgical perforation of the capsule during enucleation. Based on this analysis, we concluded that it is feasible for laser-naive urologists with endoscopic experience to learn to perform ThuLEP without tutoring. Those statements still require further validation in larger multicentric study cohort by several surgeon. The main novelty during the learning process was the use of a simulator that faithfully reproduced all of the surgical steps in prostates of various shapes and volumes.
Bozzini, G; Seveso, M; Melegari, S; de Francesco, O; Buffi, N M; Guazzoni, G; Provenzano, M; Mandressi, A; Taverna, G
2017-06-01
To compare clinical intra and early postoperative outcomes between thulium laser transurethral enucleation of the prostate (ThuLEP) and transurethral bipolar resection of the prostate (TURis) for treating benign prostatic hyperplasia (BPH) in a prospective randomized trial. The study randomized 208 consecutive patients with BPH to ThuLEP (n=102) or TURis (n=106). For all patients were evaluated preoperatively with regards to blood loss, catheterization time, irrigation volume, hospital stay and operative time. At 3 months after surgery they were also evaluated by International Prostate Symptom Score (IPSS), maximum flow rate (Qmax), and postvoid residual urine volume (PVR). The patients in each study arm each showed no significant difference in preoperative parameters. Compared with TURIS, ThuLEP had same operative time (53.69±31.44 vs 61.66±18.70minutes, P=.123) but resulted in less hemoglobin decrease (0.45 vs 2.83g/dL, P=.005). ThuLEP also needed less catheterization time (1.3 vs 4.8 days, P=.011), irrigation volume (29.4 vs 69.2 L, P=.002), and hospital stay (1.7 vs 5.2 days, P=.016). During the 3 months of follow-up, the procedures did not demonstrate a significant difference in Qmax, IPSS, PVR, and QOLS. ThuLEP and TURis both relieve lower urinary tract symptoms equally, with high efficacy and safety. ThuLEP was statistically superior to TURis in blood loss, catheterization time, irrigation volume, and hospital stay. However, procedures did not differ significantly in Qmax, IPSS, PVR, and QOLS through 3 months of follow-up. Copyright © 2016 AEU. Publicado por Elsevier España, S.L.U. All rights reserved.
An integrated fiber and stone basket device for use in Thulium fiber laser lithotripsy
NASA Astrophysics Data System (ADS)
Wilson, Christopher R.; Hutchens, Thomas C.; Hardy, Luke A.; Irby, Pierce B.; Fried, Nathaniel M.
2014-03-01
The Thulium fiber laser (TFL) is being explored as an alternative laser lithotripter to the Holmium:YAG laser. The TFL's superior near-single mode beam profile enables higher power transmission through smaller fibers with reduced proximal fiber tip damage. Recent studies have also reported that attaching hollow steel tubing to the distal fiber tip decreases fiber degradation and burn-back without compromising stone ablation rates. However, significant stone retropulsion was observed, which increased with pulse rate. In this study, the hollow steel tip fiber design was integrated with a stone basket to minimize stone retropulsion during ablation. A device was constructed consisting of a 100-μm-core, 140-μm-OD silica fiber outfitted with 5-mm-long stainless steel tubing at the distal tip, and integrated with a 1.3-Fr (0.433-mm-OD) disposable nitinol wire basket, to form an overall 1.9-Fr (0.633-mm- OD) integrated device. This compact design may provide several potential advantages including increased flexibility, higher saline irrigation rates through the ureteroscope working channel, and reduced fiber tip degradation compared to separate fiber and stone basket manipulation. TFL pulse energy of 31.5 mJ with 500 μs pulse duration and pulse rate of 500 Hz was delivered through the integrated fiber/basket device in contact with human uric acid stones, ex vivo. TFL stone ablation rates measured 1.5 +/- 0.2 mg/s, comparable to 1.7 +/- 0.3 mg/s (P > 0.05) using standard bare fiber tips separately with a stone basket. With further development, this device may be useful for minimizing stone retropulsion, thus enabling more efficient TFL lithotripsy at higher pulse rates.
Wang, Xing-Jie; Zhuo, Jian; Luo, Guang-Heng; Zhu, Yi-Ping; Yu, Dian-Jun; Zhao, Rui-Zhe; Jiang, Chen-Yi; Shi, Yun-Feng; Li, Hao; Chen, Lei; Hao, Kui-Yuan; Han, Xia; Zhao, Sheng; Bei, Xiao-Yu; Jing, Yi-Feng; Xia, Shu-Jie
2017-05-01
Complications after a thulium laser resection of the prostate (TmLRP) are related to re-epithelialization of the prostatic urethra. Since prostate growth and development are induced by androgen, the aim of this study was to determine the role and explore the mechanism of androgen in wound healing of the prostatic urethra. Beagles that received TmLRPs were randomly distributed into a castration group, a testosterone undecanoate (TU) group, and a control group. The prostate wound was assessed once a week using a cystoscope. Histological analysis was then carried out to study the re-epithelialization of the prostatic urethra in each group. The inflammatory response in the wound tissue and urine was also investigated. The healing of the prostatic urethra after a TmLRP was more rapid in the castration group and slower in the TU group than that in the control group. Castration accelerated re-epithelialization by promoting basal cell proliferation in the wound surface and beneath the wound and by accelerating the differentiation of basal cells into urothelial cells. Castration reduced the duration of the inflammatory phase and induced the conversion of M1 macrophages to M2 macrophages, thus accelerating the maturation of the wound. By contrast, androgen supplementation enhanced the inflammatory response and prolonged the inflammatory phase. Moreover, the anti-inflammatory phase was delayed and weakened. Androgen deprivation promotes re-epithelialization of the wound, regulates the inflammatory response, and accelerates wound healing of the prostatic urethra after a TmLRP. Prostate 77:708-717, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.
Jenkins, Benjamin J.; Seyssel, Kevin; Chiu, Sally; Pan, Pin-Ho; Lin, Shih-Yi; Stanley, Elizabeth; Ament, Zsuzsanna; West, James A.; Summerhill, Keith; Griffin, Julian L.; Vetter, Walter; Autio, Kaija J.; Hiltunen, Kalervo; Hazebrouck, Stéphane; Stepankova, Renata; Chen, Chun-Jung; Alligier, Maud; Laville, Martine; Moore, Mary; Kraft, Guillaume; Cherrington, Alan; King, Sarah; Krauss, Ronald M.; de Schryver, Evelyn; Van Veldhoven, Paul P.; Ronis, Martin; Koulman, Albert
2017-01-01
Recent findings have shown an inverse association between circulating C15:0/C17:0 fatty acids with disease risk, therefore, their origin needs to be determined to understanding their role in these pathologies. Through combinations of both animal and human intervention studies, we comprehensively investigated all possible contributions of these fatty acids from the gut-microbiota, the diet, and novel endogenous biosynthesis. Investigations included an intestinal germ-free study and a C15:0/C17:0 diet dose response study. Endogenous production was assessed through: a stearic acid infusion, phytol supplementation, and a Hacl1−/− mouse model. Two human dietary intervention studies were used to translate the results. Finally, a study comparing baseline C15:0/C17:0 with the prognosis of glucose intolerance. We found that circulating C15:0/C17:0 levels were not influenced by the gut-microbiota. The dose response study showed C15:0 had a linear response, however C17:0 was not directly correlated. The phytol supplementation only decreased C17:0. Stearic acid infusion only increased C17:0. Hacl1−/− only decreased C17:0. The glucose intolerance study showed only C17:0 correlated with prognosis. To summarise, circulating C15:0 and C17:0 are independently derived; C15:0 correlates directly with dietary intake, while C17:0 is substantially biosynthesized, therefore, they are not homologous in the aetiology of metabolic disease. Our findings emphasize the importance of the biosynthesis of C17:0 and recognizing its link with metabolic disease. PMID:28332596
Etching of enamel for direct bonding with a thulium fiber laser
NASA Astrophysics Data System (ADS)
Kabaş Sarp, Ayşe S.; Gülsoy, Murat
2011-03-01
Background: Laser etching of enamel for direct bonding can decrease the risk of surface enamel loss and demineralization which are the adverse effects of acid etching technique. However, in excess of +5.5°C can cause irreversible pulpal responses. In this study, a 1940- nm Thulium Fiber Laser in CW mode was used for laser etching. Aim: Determination of the suitable Laser parameters of enamel surface etching for direct bonding of ceramic brackets and keeping that intrapulpal temperature changes below the threshold value. Material and Method: Polycrystalline ceramic orthodontic brackets were bonded on bovine teeth by using 2 different kinds of etching techniques: Acid and Laser Etching. In addition to these 3 etched groups, there was also a group which was bonded without etching. Brackets were debonded with a material testing machine. Breaking time and the load at the breaking point were measured. Intrapulpal temperature changes were recorded by a K-type Thermocouple. For all laser groups, intrapulpal temperature rise was below the threshold value of 5.5°C. Results and Conclusion: Acid-etched group ( 11.73 MPa) significantly required more debonding force than 3- second- irradiated ( 5.03 MPa) and non-etched groups ( 3.4 MPa) but the results of acid etched group and 4- second- irradiated group (7.5 MPa) showed no significant difference. Moreover, 4- second irradiated group was over the minimum acceptable value for clinical use. Also, 3- second lasing caused a significant reduction in time according to acid-etch group. As a result, 1940- nm laser irradiation is a promising method for laser etching.
Recent development on high-power tandem-pumped fiber laser
NASA Astrophysics Data System (ADS)
Zhou, Pu; Xiao, Hu; Leng, Jinyong; Zhang, Hanwei; Xu, Jiangmin; Wu, Jian
2016-11-01
High power fiber laser is attracting more and more attention due to its advantage in excellent beam quality, high electricto- optical conversion efficiency and compact system configuration. Power scaling of fiber laser is challenged by the brightness of pump source, nonlinear effect, modal instability and so on. Pumping active fiber by using high-brightness fiber laser instead of common laser diode may be the solution for the brightness limitation. In this paper, we will present the recent development of various kinds of high power fiber laser based on tandem pumping scheme. According to the absorption property of Ytterbium-doped fiber, Thulium-doped fiber and Holmium-doped fiber, we have theoretically studied the fiber lasers that operate at 1018 nm, 1178 nm and 1150 nm, respectively in detail. Consequently, according to the numerical results we have optimized the fiber laser system design, and we have achieved (1) 500 watt level 1018nm Ytterbium-doped fiber laser (2) 100 watt level 1150 nm fiber laser and 100 watt level random fiber laser (3) 30 watt 1178 nm Ytterbium-doped fiber laser, 200 watt-level random fiber laser. All of the above-mentioned are the record power for the corresponded type of fiber laser to the best of our knowledge. By using the high-brightness fiber laser operate at 1018 nm, 1178 nm and 1150 nm that we have developed, we have achieved the following high power fiber laser (1) 3.5 kW 1090 nm Ytterbium-doped fiber amplifier (2) 100 watt level Thulium-doped fiber laser and (3) 50 watt level Holmium -doped fiber laser.
Rare Earth Element Concentrations in Geothermal Wells at the Puna Geothermal Field, Hawaii
DOE Office of Scientific and Technical Information (OSTI.GOV)
Fowler, Andrew; Zierenberg, Robert
Rare earth element concentrations in the geothermal wells at the Puna geothermal field, Hawaii. Samples taken from geothermal wells KS-5, KS-6W, KS-9W, KS-14E, and KS-16N. Includes pH and concentrations for Cerium, Dysprosium, Erbium, Europium, Gadolinium, Holmium, Lanthanum, Lutetium, Neodymium, Praseodymium, Samarium, Terbium, Thulium, Yttrium, and Ytterbium. Samples collected on November 11-17, 2016.
Liebi, Marianne; Kuster, Simon; Kohlbrecher, Joachim; Ishikawa, Takashi; Fischer, Peter; Walde, Peter; Windhab, Erich J
2013-11-27
Lanthanides have been used for several decades to increase the magnetic alignability of bicelles. DMPE-DTPA (1,2-dimyristoyl-sn-glycero-3-phospho-ethanolamine-diethylenetriaminepentaacetate) is commonly applied to anchor the lanthanides into the bicelles. However, because DMPE-DTPA has the tendency to accumulate at the highly curved edge region of the bicelles and if located there does not contribute to the magnetic orientation energy, we have tested cholesterol-DTPA complexed with thulium ions (Tm(3+)) as an alternative chelator to increase the magnetic alignability. Differential scanning calorimetric (DSC) measurements indicate the successful integration of cholesterol-DTPA into a DMPC (1,2-dimyristoyl-sn-glycero-3-phosphocholine) bilayer. Cryo transmission electron microscopy and small-angle neutron scattering (SANS) measurements show that the disklike structure, that is, bicelles, is maintained if cholesterol-DTPA·Tm(3+) is integrated into a mixture of DMPC, cholesterol, and DMPE-DTPA·Tm(3+). The size of the bicelles is increased compared to the size of the bicelles obtained from mixtures without cholesterol-DTPA·Tm(3+). Magnetic-field-induced birefringence and SANS measurements in a magnetic field show that with addition of cholesterol-DTPA·Tm(3+) the magnetic alignability of these bicelles is significantly increased compared to bicelles composed of DMPC, cholesterol, and DMPE-DTPA·Tm(3+) only.
NASA Astrophysics Data System (ADS)
Ahmad, H.; Samion, M. Z.; Sharbirin, A. S.; Norizan, S. F.; Aidit, S. N.; Ismail, M. F.
2018-05-01
Graphene, a 2D material, has been used for generation of pulse lasers due to the presence of its various fascinating optical properties compared to other materials. Hence in this paper, we report the first demonstration of a thulium doped fiber laser with a wavelength-tunable, passive Q-switched output using a graphene-polyvinyl-alcohol composite film for operation in the 2.0 µm region. The proposed laser has a wavelength-tunable output spanning from 1932.0 nm to 1946.0 nm, giving a total tuning range of 14.0 nm. The generated pulse has a maximum repetition rate and average output power of 36.29 kHz and 0.394 mW at the maximum pump power of 130.87 mW, as well as a pulse width of 6.8 µs at this pump power. The generated pulses have a stable output, having a signal-to-noise ratio of 31.75 dB, and the laser output is stable when tested over a period of 60 min. The proposed laser would have multiple applications for operation near the 2.0 micron region, especially for bio-medical applications and range-finding.
Therapeutic applications of lasers in urology: an update.
Fried, Nathaniel M
2006-01-01
There has been renewed interest in the use of lasers for minimally invasive treatment of urologic diseases in recent years. The introduction of more compact, higher power, less expensive and more user-friendly solid-state lasers, such as the holmium:yttrium-aluminum-garnet (YAG), frequency-doubled neodymium:YAG and diode lasers has made the technology more attractive for clinical use. The availability of small, flexible, biocompatible, inexpensive and disposable silica optical fiber delivery systems for use in flexible endoscopes has also promoted the development of new laser procedures. The holmium:YAG laser is currently the workhorse laser in urology since it can be used for multiple soft- and hard-tissue applications, including laser lithotripsy, benign prostate hyperplasia, bladder tumors and strictures. More recently, higher power potassium-titanyl-phosphate lasers have been introduced and show promise for the treatment of benign prostatic hyperplasia. On the horizon, newer and more effective photosensitizing drugs are being tested for potential use in photodynamic therapy of bladder and prostate cancer. Additionally, new experimental lasers such as the erbium:YAG, Thulium and Thulium fiber lasers, may provide more precise incision of soft tissues, more efficient laser lithotripsy and more rapid prostate ablation. This review provides an update on the most important new clinical and experimental therapeutic applications of lasers in urology over the past 5 years.
Detection of Unculturable Bacteria in Periodontal Health and Disease by PCR
Harper-Owen, R.; Dymock, D.; Booth, V.; Weightman, A. J.; Wade, W. G.
1999-01-01
Recently developed molecular methods have made it possible to characterize mixed microflora in their entirety, including the substantial numbers of bacteria which do not grow on artificial culture media. In a previous study, molecular analysis of the microflora associated with acute oral infections resulted in the identification of three phylotypes, PUS3.42, PUS9.170, and PUS9.180, representing as-yet-uncultured organisms. The aim of this study was to design and validate specific PCR primers for these phylotypes and to determine their incidences in samples collected from healthy and diseased periodontal tissues. Two specific reverse primers were devised for each phylotype, and these were used in duplex PCRs with universal forward and reverse primers. All three phylotypes were detected in periodontal sites; PUS9.170, related to oral asaccharolytic Eubacterium spp., was significantly associated with disease. This study demonstrates the possibility of using unculturable, and therefore uncharacterized, organisms as markers of disease. PMID:10203507
Kotsakis, Stathis D; Miriagou, Vivi; Tzelepi, Eva; Tzouvelekis, Leonidas S
2010-11-01
In GES-type β-lactamases, positions 104 and 170 are occupied by Glu or Lys and by Gly, Asn, or Ser, respectively. Previous studies have indicated an important role of these amino acids in the interaction with β-lactams, although their precise role, especially that of residue 104, remains uncertain. In this study, we constructed GES-1 (Glu104, Gly170), GES-2 (Glu104, Asn170), GES-5 (Glu104, Ser170), GES-6 (Lys104, Ser170), GES-7 (Lys104, Gly170), and GES-13 (Lys104, Asn170) by site-specific mutagenesis and compared their hydrolytic properties. Isogenic comparisons of β-lactam resistance levels conferred by these GES variants were also performed. Data indicated the following patterns: (i) Lys104-containing enzymes exhibited enhanced hydrolysis of oxyimino-cephalosporins and reduced efficiency against imipenem in relation to enzymes possessing Glu104, (ii) Asn170-containing enzymes showed reduced hydrolysis rates of penicillins and older cephalosporins, (iii) Ser170 enabled GES to hydrolyze cefoxitin efficiently, and (iv) Asn170 and Ser170 increased the carbapenemase character of GES enzymes but reduced their activity against ceftazidime. Molecular dynamic simulations of GES apoenzyme models, as well as construction of GES structures complexed with cefoxitin and an achiral ceftazidime-like boronic acid, provided insights into the catalytic behavior of the studied mutants. There were indications that an increased stability of the hydrogen bonding network of Glu166-Lys73-Ser70 and an altered positioning of Trp105 correlated with the substrate spectra, especially with acylation of GES by imipenem. Furthermore, likely effects of Ser170 on GES interactions with cefoxitin and of Lys104 on interactions with oxyimino-cephalosporins were revealed. Overall, the data unveiled the importance of residues 104 and 170 in the function of GES enzymes.
Code of Federal Regulations, 2010 CFR
2010-04-01
... flavors. (ii) Condiments such as spices and mint leaves. (iii) Dry nutritive carbohydrate sweeteners. (iv... condiment such as spices and mint leaves that characterizes the product, e.g., “Spice added”. Where a...
Widely tunable 1.94-μm Tm:BaY2F8 laser
NASA Astrophysics Data System (ADS)
Galzerano, Gianluca; Cornacchia, Francesco; Parisi, Daniela; Toncelli, Alessandra; Tonelli, Mauro; Laporta, Paolo
2005-04-01
A novel BaY2F8 crystal doped with thulium ions is grown and extensively investigated. Owing to the large number of vibronic levels and to a favorable electron-phonon coupling, extremely wide absorption and emission bands around 1.9 μm are observed. A room-temperature Tm:BaY2F8 laser tunable over a 210-nm interval, from 1849 to 2059 nm, is demonstrated.
Generation of bound states of pulses in a SESAM mode-locked Cr:ZnSe laser
NASA Astrophysics Data System (ADS)
Bu, Xiangbao; Shi, Yuhang; Xu, Jia; Li, Huijuan; Wang, Pu
2018-06-01
We report on the generation of bound states of pulses in a SESAM mode-locked Cr:ZnSe laser around 2415 nm. A thulium-doped double-clad fiber laser at 1908 nm was used as the pump source. Bound states with various pulse separations at different dispersion regimes were obtained. Especially, in the anomalous dispersion regime, vibrating bound state of solitons exhibiting an evolving phase was obtained.
Experimental study of a VBG-based Tm : YLF slab laser at different output coupler parameters
DOE Office of Scientific and Technical Information (OSTI.GOV)
Duan, X M; Ding, Y; Dai, T Y
2015-04-30
The performance of a Tm : YLF slab laser is studied at different output coupler parameters. Use is made of a 20-mm-long a-cut slab crystal doped with 2.5 at. % thulium ions. With a volume Bragg grating and a Fabry – Perot etalon, the selected output wavelength of this Tm : YLF slab laser is 1908 nm. For the optimised output coupler with a transmission of 20% and a radius of curvature of 300 mm, the output power exceeds 74.1 W and the slope efficiency with respect to the absorbed pump power reaches 48.4%. In addition, the beam quality ofmore » the Tm : YLF slab laser is improved. (lasers)« less
Blackmon, Richard L; Irby, Pierce B; Fried, Nathaniel M
2011-07-01
The holmium:YAG (Ho:YAG) laser lithotriptor is capable of operating at high pulse energies, but efficient operation is limited to low pulse rates (∼10 Hz) during lithotripsy. On the contrary, the thulium fiber laser (TFL) is limited to low pulse energies, but can operate efficiently at high pulse rates (up to 1000 Hz). This study compares stone ablation threshold, ablation rate, and retropulsion for the two different Ho:YAG and TFL operation modes. The TFL (λ = 1908 nm) was operated with pulse energies of 5 to 35 mJ, 500-μs pulse duration, and pulse rates of 10 to 400 Hz. The Ho:YAG laser (λ = 2120 nm) was operated with pulse energies of 30 to 550 mJ, 350-μs pulse duration, and a pulse rate of 10 Hz. Laser energy was delivered through 200- and 270-μm-core optical fibers in contact mode with human calcium oxalate monohydrate (COM) stones for ablation studies and plaster-of-Paris stone phantoms for retropulsion studies. The COM stone ablation threshold for Ho:YAG and TFL measured 82.6 and 20.8 J∕cm(2), respectively. Stone retropulsion with the Ho:YAG laser linearly increased with pulse energy. Retropulsion with TFL was minimal at pulse rates less than 150 Hz, then rapidly increased at higher pulse rates. For minimal stone retropulsion, Ho:YAG operation at pulse energies less than 175 mJ at 10 Hz and TFL operation at 35 mJ at 100 Hz is recommended, with both lasers producing comparable ablation rates. Further development of a TFL operating with both high pulse energies of 100 to 200 mJ and high pulse rates of 100 to 150 Hz may also provide an alternative to the Ho:YAG laser for higher ablation rates, when retropulsion is not a primary concern.
NASA Astrophysics Data System (ADS)
Hutchens, Thomas C.; Gonzalez, David A.; Irby, Pierce B.; Fried, Nathaniel M.
2017-01-01
The experimental thulium fiber laser (TFL) is being explored as an alternative to the current clinical gold standard Holmium:YAG laser for lithotripsy. The near single-mode TFL beam allows coupling of higher power into smaller optical fibers than the multimode Holmium laser beam profile, without proximal fiber tip degradation. A smaller fiber is desirable because it provides more space in the ureteroscope working channel for increased saline irrigation rates and allows maximum ureteroscope deflection. However, distal fiber tip burnback increases as fiber diameter decreases. Previous studies utilizing hollow steel sheaths around recessed distal fiber tips reduced fiber burnback but increased stone retropulsion. A "fiber muzzle brake" was tested for reducing both fiber burnback and stone retropulsion by manipulating vapor bubble expansion. TFL lithotripsy studies were performed at 1908 nm, 35 mJ, 500 μs, and 300 Hz using a 100-μm-core fiber. The optimal stainless steel muzzle brake tip tested consisted of a 1-cm-long, 560-μm-outer-diameter, 360-μm-inner-diameter tube with a 275-μm-diameter through hole located 250 μm from the distal end. The fiber tip was recessed a distance of 500 μm. Stone phantom retropulsion, fiber tip burnback, and calcium oxalate stone ablation studies were performed ex vivo. Small stones with a mass of 40±4 mg and 4-mm-diameter were ablated over a 1.5-mm sieve in 25±4 s (n=10) without visible distal fiber tip burnback. Reduction in stone phantom retropulsion distance by 50% and 85% was observed when using muzzle brake tips versus 100-μm-core bare fibers and hollow steel tip fibers, respectively. The muzzle brake fiber tip simultaneously provided efficient stone ablation, reduced stone retropulsion, and minimal fiber degradation during TFL lithotripsy.
Akechi, Hironori; Kikuchi, Yukiko; Tojo, Yoshikuni; Osanai, Hiroo; Hasegawa, Toshikazu
2014-01-27
Numerous studies have revealed atypical face processing in autism spectrum disorders (ASD) characterized by social interaction and communication difficulties. This study investigated sensitivity to face-likeness in ASD. In Experiment 1, we found a strong positive correlation between the face-likeness ratings of non-face objects in the ASD (11-19 years old) and the typically developing (TD) group (9-21 years old). In Experiment 2 (the scalp-recorded event-related potential experiment), the participants of both groups (ASD, 12-19 years old; TD, 12-18 years old) exhibited an enhanced face-sensitive N170 amplitude to a face-like object. Whereas the TD adolescents showed an enhanced N170 during the face-likeness judgements, adolescents with ASD did not. Thus, both individuals with ASD and TD individuals have a perceptual and neural sensitivity to face-like features in objects. When required to process face-like features, a face-related brain system reacts more strongly in TD individuals but not in individuals with ASD.
NASA Astrophysics Data System (ADS)
Grimbergen, Matthijs C. M.; Klaessens, John H.; van der Veen, Albert J.; Verdaasdonk, Rudolf M.
2016-03-01
During laparoscopic surgery, devices are require to either cut, ablate or coagulate tissue and veins with high precision and controlled lateral damage preferably in an one-for-all modality. The tissue interactions of 3 new treatment modalities were studied using special imaging techniques to obtain a better understanding the working mechanism in view of effective and safe application. The Plasmajet produces a high temperature ionized gas 'flame' directed to the tissue surface at the tip of a 4 mm diameter rigid hand piece. The Lumenis DUO CO2 laser enables endoscopic laser energy delivery through a 1 mm outer diameter flexible hollow waveguide. The 2 µm 'Thulium' laser is delivered by (standard) 400 µm diameter optical fiber. Thermal imaging and Schlieren techniques were used to assess the superficial ablative and coagulation effects these surgical instruments scanning at preset velocities and distances from the surface of biological tissues and phantoms . The CO2 was very effective in tissue ablation even at a distance up to 10 mm due to a very small diverging beam from the hollow waveguide. In contrast, the Thulium laser showed less ablation and increasing coagulation at larger distance to the tissue. The gas 'flame' of the Plasmajet spread the thermal energy over the surface for effective superficial ablation and coagulation. However, the pressure of the gas flow is substantial on the tissue surface creating turbulence and even indirect cooling. The specific ablation and coagulation effects of the three treatment modalities have to be appreciate and the effective and safe application will depend on the preference and skills of the surgeon
1980-06-01
N NLL 0 0 C~CP (qw ) P /.op -40- individual excitation functions for each evaporation channel. For this study the lower...c’ + a" (alpha particles) =8a + a" (protons) £ £’ + P " (neutrons) C ’’, = 1 or 0 1ŕ,81","," = I or 0 V + V’ - I INDIVIDUAL (a, p or n ) VELOCITY...velocity profile of +10%, 0, -10% of v0 was taken. All angular distributions * - -- - - - - 76- M0 U3 LuL I M (0w DN~ N + 1 tJ < N I $ P ll7 -77-
Rare Earth Element Concentrations from Wells at the Don A. Campbell Geothermal Plant, Nevada
DOE Office of Scientific and Technical Information (OSTI.GOV)
Fowler, Andrew; Zierenberg, Robert
* Requires permission of originators for use. Rare earth element concentrations in thermal springs from the wells at the Don A. Campbell geothermal plant, Nevada. Samples taken from geothermal wells 85-11, 65-11, 54-11, and 64-11. Includes pH and concentrations for Cerium, Dysprosium, Erbium, Europium, Gadolinium, Holmium, Lanthanum, Lutetium, Neodymium, Praseodymium, Samarium, Terbium, Thulium, Yttrium, and Ytterbium. Samples from Don A. Campbell, Nevada collected on October 14, 2016.
Cryogenic Tm: YAG Laser in the Near Infrared
2015-05-29
Applications Group. The focus of his work at Lincoln Laboratory has been solid-state lasers including microchip lasers , external-cavity diode lasers ...REPLACE THIS LINE WITH YOUR PAPER IDENTIFICATION NUMBER (DOUBLE-CLICK HERE TO EDIT) < Cryogenic Tm:YAG Laser in the Near Infrared* Tso Yee Fan...Senior Member, IEEE, Juan R. Ochoa, and Patricia A. Reed Abstract- Thulium laser operation on the 3H4 - 3H6 transition at 823 nm has been demonstrated
Fiber-optic manipulation of urinary stone phantoms using holmium:YAG and thulium fiber lasers.
Blackmon, Richard L; Case, Jason R; Trammell, Susan R; Irby, Pierce B; Fried, Nathaniel M
2013-02-01
Fiber-optic attraction of urinary stones during laser lithotripsy may be exploited to manipulate stone fragments inside the urinary tract without mechanical grasping tools, saving the urologist time and space in the ureteroscope working channel. We compare thulium fiber laser (TFL) high pulse rate/low pulse energy operation to conventional holmium:YAG low pulse rate/high pulse energy operation for fiber-optic suctioning of plaster-of-paris (PoP) stone phantoms. A TFL (wavelength of 1908 nm, pulse energy of 35 mJ, pulse duration of 500 μs, and pulse rate of 10 to 350 Hz) and a holmium laser (wavelength of 2120 nm, pulse energy of 35 to 360 mJ, pulse duration of 300 μs, and pulse rate of 20 Hz) were tested using 270-μm-core optical fibers. A peak drag speed of ~2.5 mm/s was measured for both TFL (35 mJ and 150 to 250 Hz) and holmium laser (210 mJ and 20 Hz). Particle image velocimetry and thermal imaging were used to track water flow for all parameters. Fiber-optic suctioning of urinary stone phantoms is feasible. TFL operation at high pulse rates/low pulse energies is preferable to holmium operation at low pulse rates/high pulse energies for rapid and smooth stone pulling. With further development, this novel technique may be useful for manipulating stone fragments in the urinary tract.
Robinson, Deanne Mraz; Frulla, Ashton P
2017-07-01
INTRODUCTION: A topical proprietary procedural enhancement system (PES) containing a combination of active ingredients including a tripeptide and hexapeptide (TriHex Technology™, Alastin Procedure Enhancement Invasive System, ALASTIN Skincare™, Inc., Carlsbad, CA) has been used successfully to aid in healing and improve symptomatology following resurfacing procedures.
METHODS: PES (Gentle Cleanser, Regenerating Skin Nectar with TriHex Technology™, Ultra Nourishing Moisturizer with TriHex Technology™, Soothe + Protect Recovery Balm, Broad Spectrum 30+ Sunscreen) was compared to a basic regimen (Aquaphor™, Cerave™ cleanser, Vanicream™, Alastin Broad Spectrum 30+ Sunscreen) in a split face/ décolleté trial following fractional non-ablative thulium-doped resurfacing treatment to the face or décolleté. The skin was pre-conditioned and treated during and after the procedure using the two regimens.
RESULTS: A blinded investigator rated the PES statistically superior to the basic regimen on healing post-laser treatment on day 4 based on lentigines, texture, and Global Skin Quality. Subjects also reported 'better looking and feeling' skin on the PES side.
CONCLUSION: PES appears to improve healing post-non ablative thulium-doped resurfacing treatment to the face/décolleté in comparison with standard of care.
J Drugs Dermatol. 2017;16(7):707-710.
.Investigating the Features of the M170 in Congenital Prosopagnosia
Rivolta, Davide; Palermo, Romina; Schmalzl, Laura; Williams, Mark A.
2012-01-01
Face perception generates specific neural activity as early as 170 ms post-stimulus onset, termed the M170 when measured with Magnetoencephalography (MEG). We examined the M170 in six people with congenital prosopagnosia (CP) and 11 typical controls. Previous research indicates that there are two neural generators for the M170 (one within the right lateral occipital area – rLO and one within the right fusiform gyrus – rFG), and in the current study we explored whether these sources reflect the processing of different types of information. Individuals with CP showed face-selective M170 responses within the rLO and right rFG, which did not differ in magnitude to those of the controls. To examine possible links between neural activity and behavior we correlated the CPs’ MEG activity generated within rLO and rFG with their face perception skills. The rLO-M170 correlated with holistic/configural face processing, whereas the rFG-M170 correlated with featural processing. Hence, the results of our study demonstrate that individuals with CP can show an M170 that is within the normal range, and that the M170 in the rLO and rFG are involved in different aspects of face processing. PMID:22416228
Characterization of emissions composition for selected household products available in Korea.
Kwon, Ki-Dong; Jo, Wan-Kuen; Lim, Ho-Jin; Jeong, Woo-Sik
2007-09-05
The present study investigated the emission composition for 59 household products currently sold in Korea, using a headspace analysis. The chemical composition and concentrations of total volatile organic compounds (VOCs) broadly varied along with products, even within the same product category. Up to 1-17 organic compounds were detected in the headspace gas phase of any one of the products. The chemical composition of certain household products determined in the current study was different from that of other studies from other countries. Between 4 and 37 compounds were detected in the headspace gas phase of each product class. Several compounds were identified in more than one product class. Of the 59 household products analyzed, 58 emitted one or more of the 72 compounds at chromatographic peak areas above 10(4). There were 11 analytes which occurred with a frequency of more than 10%: limonene (44.2%), ethanol (30.5%), acetone (18.6%), alpha-pinene (18.6%), o,m,p-xylenes (18.6%), decane (17.0%), toluene (17.0%), beta-myrcene (11.9%), ammonia (10.2%), ethylbenzene (10.2%), and hexane (10.2%).
Development of diagnostics in the search of an explanation for toxic airline syndrome 1
Schopfer, Lawrence M.; Furlong, Clement E.; Lockridge, Oksana
2010-01-01
Toxic airline syndrome is assumed to be caused by exposure to tri-cresyl phosphate, an additive in engine lubricants and hydraulic fluids, which is activated to the toxic 2-(o-cresyl)-4H-1,3,2-benzodioxaphosphoran-2-one (CBDP). At present there is no laboratory evidence to support intoxication of airline crew by CBDP. Our goal was to develop methods for testing in vivo exposure by identifying and characterizing biomarkers. Mass spectrometry was used to study the reaction of CBDP with human albumin, free tyrosine, and human butyrylcholinesterase. Human albumin made a covalent bond with CBDP, adding a mass of 170 to tyrosine 411 to yield the ortho-cresyl phosphotyrosine derivative. Human butyrylcholinesterase made a covalent bond with CBDP on serine 198 to yield 5 adducts with added masses of 80, 108, 156, 170, and 186. The most abundant adduct had an added mass of 80 from phosphate (HPO3), a surprising result since no pesticide or nerve agent is known to yield phosphorylated serine with an added mass of 80. The next most abundant adduct had an added mass of 170 to form ortho-cresyl phosphoserine. It is concluded that toxic gases or oil mists in cabin air may form adducts on plasma butyrylcholinesterase and albumin, detectable by mass spectrometry. PMID:20447373
NASA Astrophysics Data System (ADS)
Saravanabhavan, Munusamy; Sathya, Krishnan; Puranik, Vedavati G.; Sekar, Marimuthu
2014-01-01
Carbazole picrate (CP), a new organic compound has been synthesized, characterized by various analytical and spectroscopic technique such as FT-IR, UV-Vis, 1H and 13C NMR spectroscopy. An orthorhombic geometry was proposed based on single crystal XRD study. The thermal stability of the crystal was studied by using thermo-gravimetric and differential thermal analyses and found that it was stable up to 170 °C. Further, the newly synthesized title compound was tested for its in vitro antibacterial and antifungal activity against various bacterial and fungal species. Also, the compound was tested for its binding activity with Calf thymus (CT) DNA and the results show a considerable interaction between CP and CT-DNA.
2009-03-01
wavelength, pulse energy, and pulse rate) to produce strongest and most rapid erectile response as measured by intracavernosal pressure in the penis ...PC Fiber Rod Housing Optics 5-mm-ID Port Probe Handle Probe Stem Enlarged View of Probe Tip Oscilloscope FunctionGenerator Thulium Fiber Laser Shutter...rapid erectile response as measured by intracavernosal pressure (ICP) in the penis . ICP values were increased from an initial range of 30-40 mmHg
2007-11-01
Proceedings 3. DATES COVERED (From - To) June 2007- November 2007 4. TITLE AND SUBTITLE An In Vitro Corneal Model with a Laser Damage Threshold at 2...2-µm wavelength output of a thulium fiber laser with 4 mm beam diameter for 0.25 seconds in a thermally controlled environment and then assayed for...data in the literature. 15. SUBJECT TERMS corneal organotypic culture, laser , threshold, thermography, Probit 16. SECURITY CLASSIFICATION OF
Diode-Pumped, 2-Micron, Q-Switched Thulium: Y3Al5O12 (Tm:Yag) Microchip Laser
2011-05-01
switch with a chromium -doped zinc selenide crystal acting as a saturable absorber passive Q-switch. Finally, we will propose possible future...literature by Heine and Huber [4] and others, while passive Q-switching of 2 μm lasers by a chromium -doped zinc selenide has been demonstrated by Tsai and...these objectives for each component of the laser system. In Chapter 4 a design is presented for replacing our acousto-optic Q-switch with a chromium
TmDOTA -: A Sensitive Probe for MR Thermometry in Vivo
NASA Astrophysics Data System (ADS)
Zuo, Chun S.; Mahmood, Ashfaq; Sherry, A. Dean
2001-07-01
The lanthanide complex, thulium 1,4,7,10-tetraazacyclodo- decane-1,4,7,10-tetraacetic acid (TmDOTA-), has been investigated as an agent for MR thermometry in vivo. The chemical shifts of the TmDOTA- protons were highly sensitive to temperature at a clinically relevant field strength, yet insensitive to pH and the presence of Ca2+. Given the excellent stability of lanthanide-DOTA complexes and high thermal sensitivity, TmDOTA- is expected to be a good candidate for MR thermometry in vivo.
New World Vistas: Air and Space Power for the 21st Century. Directed Energy Volume
1995-01-01
single mode diode pumped Thulium doped glass fiber laser. Full scale 5-10 watt devices have operated in the laboratory at overall efficiencies of 10...operating in the 900-950 nm range together with the development of ytterbium (Yb) doped laser crystals. The Yb ion generates roughly one third as much...mirror in the high power oscillator resonator . Since a potentially large amount of power is dissipated in the nonlinear medium, careful attention to
Quasi four-level Tm:LuAG laser
NASA Technical Reports Server (NTRS)
Jani, Mahendra G. (Inventor); Barnes, Norman P. (Inventor); Hutcheson, Ralph L. (Inventor); Rodriguez, Waldo J. (Inventor)
1997-01-01
A quasi four-level solid-state laser is provided. A laser crystal is disposed in a laser cavity. The laser crystal has a LuAG-based host material doped to a final concentration between about 2% and about 7% thulium (Tm) ions. For the more heavily doped final concentrations, the LuAG-based host material is a LuAG seed crystal doped with a small concentration of Tm ions. Laser diode arrays are disposed transversely to the laser crystal for energizing the Tm ions.
Navas, Javier; Sánchez-Coronilla, Antonio; Aguilar, Teresa; De los Santos, Desireé M; Hernández, Norge C; Alcántara, Rodrigo; Fernández-Lorenzo, Concha; Martín-Calleja, Joaquín
2014-11-07
This is an experimental and theoretical study of thulium doped TiO2 nanoparticles. From an experimental perspective, a method was used to synthesize thulium-doped TiO2 nanoparticles in which Tm(3+) replaces Ti(4+) in the lattice, which to our knowledge has neither been reported nor studied theoretically so far. Different proportions of anatase and rutile phases were obtained at different annealing temperatures, and XRD and Raman spectroscopy also revealed the presence of a pyrochlore phase (Tm2Ti2O7) at 1173 K. Thus, the structure of the Tm-doped nanoparticles was thermally-controlled. Furthermore, XPS showed the presence of Tm(3+) in the samples synthesized, which produces oxygen vacancies to maintain the local neutrality in the lattice. The presence of Tm(3+) in the samples led to changes in the UV-Vis absorption spectra, so they showed photoluminescence properties and new states in the band gap, which produce a new lower energy electronic transition than the main TiO2 one. Periodic DFT calculations were performed to understand the experimentally produced structures. The production of oxygen vacancies was analysed and the changes generated in the structure were fully detailed. The DOS and PDOS analyses confirmed the experimental results obtained using UV-Vis spectroscopy, and showed that the new electronic states in the band gap are due to interactions of the f state of Tm and the p state of O. Likewise, the charge study and the ELF analysis indicate that when Tm is introduced into the TiO2 structure, the Ti-O bond around the oxygen vacancy is strengthened. Finally, an example of a photocatalytic application was developed to show the high efficiency of the samples due to the heterojunction in the interfaces of the phases in the samples, which improved the charge separation and the good charge carrier mobility due to the presence of the pyrochlore phase, as was also shown theoretically.
Al-Khattawi, Ali; Koner, Jasdip; Rue, Peter; Kirby, Dan; Perrie, Yvonne; Rajabi-Siahboomi, Ali; Mohammed, Afzal R
2015-08-01
The importance of mannitol has increased recently as an emerging diluent for orodispersible dosage forms. The study aims to prepare spray dried mannitol retaining high porosity and mechanical strength for the development of orally disintegrating tablets (ODTs). Aqueous feed of d-mannitol (10% w/v) comprising ammonium bicarbonate, NH4HCO3 (5% w/v) as pore former was spray dried at inlet temperature of 110-170°C. Compacts were prepared at 151MPa and characterized for porosity, hardness and disintegration time. Particle morphology and drying mechanisms were studied using thermal (HSM, DSC and TGA) and polymorphic (XRD) methods. Tablet porosity increased from 0.20±0.002 for pure mannitol to 0.53±0.03 using fabricated porous mannitol. Disintegration time dropped by 50-77% from 135±5.29s for pure mannitol to 75.33±2.52-31.67±1.53s for mannitol 110-170°C. Hardness increased by 150% at 110°C (258.67±28.89N) and 30% at 150°C (152.70±10.58N) compared to pure mannitol tablets (104.17±1.70N). Increasing inlet temperature resulted in reducing tablet hardness due to generation of 'micro-sponge'-like particles exhibiting significant elastic recovery. Impact of mannitol polymorphism on plasticity/elasticity cannot be ruled out as a mixture of α and β polymorphs formed upon spray drying. Copyright © 2015 Elsevier B.V. All rights reserved.
NASA Astrophysics Data System (ADS)
Rodriguez-Novelo, J. C.; Sanchez-Nieves, J. A.; Sierra-Calderon, A.; Sanchez-Lara, R.; Alvarez-Chavez, J. A.
2017-08-01
The development of novel Al-, Ge- doped and un-doped standard single mode fibers for future optical communication at 2μm requires the integration of, among other pieces of equipment, an optical time domain reflectometry (OTDR) technique for precise spectral attenuation characterization, including the well-known cut-back method. The integration of a state of the art OTDR at 2μm could provide valuable attenuation information from the aforementioned novel fibers. The proposed setup consists of a 1.7 mW, 1960nm pump source, a 30 dB gain Thulium doped fibre amplifier at 2μm, an 0.8mm focal length lens with a 0.5 NA, a 30 MHz acusto-optic modulator, a 3.1 focal length lens with a 0.68NA, an optical circulator at 2μm, an InGaAs photodetector for 1.2 nm-2.6 nm range, a voltage amplifier and an oscilloscope. The propagated pulse rate is 50 KHz, with 500 ns, 200 ns, 100 ns and 50 ns pulse widths. Attenuation versus novel fibers types for lengths ranging from 400- to 1000- meter samples were obtained using the proposed setup.
Fiber-optic manipulation of urinary stone phantoms using holmium:YAG and thulium fiber lasers
NASA Astrophysics Data System (ADS)
Blackmon, Richard L.; Case, Jason R.; Trammell, Susan R.; Irby, Pierce B.; Fried, Nathaniel M.
2013-02-01
Fiber-optic attraction of urinary stones during laser lithotripsy may be exploited to manipulate stone fragments inside the urinary tract without mechanical grasping tools, saving the urologist time and space in the ureteroscope working channel. We compare thulium fiber laser (TFL) high pulse rate/low pulse energy operation to conventional holmium:YAG low pulse rate/high pulse energy operation for fiber-optic suctioning of plaster-of-paris (PoP) stone phantoms. A TFL (wavelength of 1908 nm, pulse energy of 35 mJ, pulse duration of 500 μs, and pulse rate of 10 to 350 Hz) and a holmium laser (wavelength of 2120 nm, pulse energy of 35 to 360 mJ, pulse duration of 300 μs, and pulse rate of 20 Hz) were tested using 270-μm-core optical fibers. A peak drag speed of ˜2.5 mm/s was measured for both TFL (35 mJ and 150 to 250 Hz) and holmium laser (210 mJ and 20 Hz). Particle image velocimetry and thermal imaging were used to track water flow for all parameters. Fiber-optic suctioning of urinary stone phantoms is feasible. TFL operation at high pulse rates/low pulse energies is preferable to holmium operation at low pulse rates/high pulse energies for rapid and smooth stone pulling. With further development, this novel technique may be useful for manipulating stone fragments in the urinary tract.
NASA Astrophysics Data System (ADS)
Gebhardt, Martin; Gaida, Christian; Heuermann, T.; Stutzki, F.; Jauregui, C.; Antonio-Lopez, J.; Schüuzgen, A.; Amezcua-Correa, R.; Tünnermann, A.; Limpert, J.
2018-02-01
In this contribution we demonstrate the nonlinear pulse compression of an ultrafast thulium-doped fiber laser down to 14 fs FWHM duration (sub-3 optical cycles) at a record average power of 43 W and 34.5 μJ pulse energy. To the best of our knowledge, we present the highest average power few-cycle laser source at 2 μm wavelength. This performance level in combination with GW-class peak power makes our laser source extremely interesting for driving high-harmonic generation or for generating mid-infrared frequency combs via intra-pulse frequency down-conversion at an unprecedented average power. The experiments were enabled by an ultrafast thulium-doped fiber laser delivering 110 fs pulses at high repetition rates, and an argon gas-filled antiresonant hollow-core fiber (ARHCF) with excellent transmission and weak anomalous dispersion, leading to the self-compression of the pulses. We have shown that ARHCFs are well-suited for nonlinear pulse compression around 2 μm wavelength and that this concept features excellent power handling capabilities. Based on this result, we discuss the next steps for energy and average power scaling including upscaling the fiber dimensions in order to fully exploit the capabilities of our laser system, which can deliver several GW of peak power. This way, a 100 W-class laser source with mJ-level few-cycle pulses at 2 μm wavelength is feasible in the near future.
Akechi, Hironori; Kikuchi, Yukiko; Tojo, Yoshikuni; Osanai, Hiroo; Hasegawa, Toshikazu
2014-01-01
Numerous studies have revealed atypical face processing in autism spectrum disorders (ASD) characterized by social interaction and communication difficulties. This study investigated sensitivity to face-likeness in ASD. In Experiment 1, we found a strong positive correlation between the face-likeness ratings of non-face objects in the ASD (11–19 years old) and the typically developing (TD) group (9–21 years old). In Experiment 2 (the scalp-recorded event-related potential experiment), the participants of both groups (ASD, 12–19 years old; TD, 12–18 years old) exhibited an enhanced face-sensitive N170 amplitude to a face-like object. Whereas the TD adolescents showed an enhanced N170 during the face-likeness judgements, adolescents with ASD did not. Thus, both individuals with ASD and TD individuals have a perceptual and neural sensitivity to face-like features in objects. When required to process face-like features, a face-related brain system reacts more strongly in TD individuals but not in individuals with ASD. PMID:24464152
Wang, Yongxiang; Zhang, Anyun; Yang, Yongqiang; Lei, Changwei; Jiang, Wei; Liu, Bihui; Shi, Hongping; Kong, Linghan; Cheng, Guangyang; Zhang, Xiuzhong; Yang, Xin; Wang, Hongning
2017-12-04
The aim of this study was to investigate the prevalence and characterization of Salmonella concerning the poultry industry in China. A total of 170 non-duplicate Salmonella isolates were recovered from the 1540 chicken samples. Among the Salmonella isolates from chickens, the predominant serovars were S. enterica serovar Enteritidis (S. Enteritidis) (49/170, 28.8%), S. enterica serovar Indiana (S. Indiana) (37/170, 21.8%) and S. enterica serovar California (S. California) (34/170, 20.0%). High antimicrobial resistance was observed for ciprofloxacin (68.2%), amikacin (48.2%) and cefotaxime (44.7%). Of particular concerns were the 18 S. Indiana and 17 S. California isolates, which were concurrently resistant to cefotaxime, amikacin and ciprofloxacin. The bla CTX-M genes, 16S rRNA methylase genes (armA, rmtD or rmtC) and five plasmid-mediated quinolone resistance (PMQR) determinants (aac(6')-Ib-cr, oqxAB, qnrB, qepA and qnrD) were identified in 18 S. Indiana and 17 S. California isolates. To clarify their genetic correlation, pulsed-field gel electrophoresis (PFGE) and multilocus sequence typing (MLST) were further conducted. PFGE profiles showed that the majority of S. Indiana and S. California isolates were clonally unrelated with a standard cut-off of 85%. The results of MLST demonstrated that ST17 and ST40 were the most common ST types in S. Indiana and S. California isolates, respectively. Our findings indicated that the multiple antibiotic resistant S. Indiana and S. California isolates were widespread in chicken in China and might pose a potential threat to public health. Copyright © 2017 Elsevier B.V. All rights reserved.
Molecular epidemiology and genotyping of hepatitis B virus of HBsAg-positive patients in Oman.
Al Baqlani, Said Ali; Sy, Bui Tien; Ratsch, Boris A; Al Naamani, Khalid; Al Awaidy, Salah; Busaidy, Suleiman Al; Pauli, Georg; Bock, C-Thomas
2014-01-01
Hepatitis B virus (HBV) infection is a major global health burden with distinct geographic public health significance. Oman is a country with intermediate HBV carrier prevalence; however, little is known about the incidence of HBV variants in circulation. We investigated the HBV genotype distribution, the occurrence of antiviral resistance, and HBV surface antigen (HBsAg) escape mutations in HBsAg-positive patients in Oman. Serum samples were collected from 179 chronically HBV-infected patients enrolled in various gastroenterology clinics in Oman. HBV genotypes were determined by sequencing and phylogenetic analysis. Mutations in the HBV polymerase and the HBsAg gene were characterized by mutational analysis. HBV genotypes D (130/170; 76.47%) and A (32/170; 18.28%) are predominant in Oman. The HBV genotypes C and E were less frequent (each 1.18%), while the HBV genotypes B, G, F, and H were not detected. Four patients revealed HBV genotype mixtures (HBV-A/D and D/C). The analyses of vaccine escape mutations yield that 148/170 (87.06%) HBV sequences were wild type. 22/170 (12.94%) HBV sequences showed mutations in the "a" determinant of the HBsAg domain. Two patients showed the described HBV vaccine escape mutation sP120T. 8/146 (5.48%) HBV isolates harbored mutations in the HBV polymerase known to confer resistance against antiviral therapy. Especially the lamivudine resistance mutations rtL180M/rtM204V and rtM204I were detected. This study shows the distribution of HBV genotypes, therapy resistance, and vaccine escape mutations in HBV-infected patients in Oman. Our findings will have a major impact on therapy management and diagnostics of chronic HBV infections in Oman to control HBV infection in this intermediate HBV-endemic country.
Saravanabhavan, Munusamy; Sathya, Krishnan; Puranik, Vedavati G; Sekar, Marimuthu
2014-01-24
Carbazole picrate (CP), a new organic compound has been synthesized, characterized by various analytical and spectroscopic technique such as FT-IR, UV-Vis, (1)H and (13)C NMR spectroscopy. An orthorhombic geometry was proposed based on single crystal XRD study. The thermal stability of the crystal was studied by using thermo-gravimetric and differential thermal analyses and found that it was stable up to 170°C. Further, the newly synthesized title compound was tested for its in vitro antibacterial and antifungal activity against various bacterial and fungal species. Also, the compound was tested for its binding activity with Calf thymus (CT) DNA and the results show a considerable interaction between CP and CT-DNA. Copyright © 2013 Elsevier B.V. All rights reserved.
Kirschbaum, Andreas; Höchsmann, N; Steinfeldt, T; Seyfer, P; Pehl, A; Bartsch, D K; Palade, E
2016-08-01
Lung metastases in healthy patients should be removed non-anatomically whenever possible. This can be done with a laser. Lung parenchyma can be cut very well, because of its high energy absorption at a wavelength of 1940 nm. A coagulation layer is created on the resected surface. It is not clear, whether this surface also needs to be sutured to ensure that it remains airtight even at higher ventilation pressures. It would be helpful, if suturing could be avoided, because the lung can become too puckered, especially with multiple resections, resulting in considerable restriction. We carried out our experiments on isolated and ventilated paracardiac lung lobes of pigs. Non-anatomic resection was carried out reproducibly using three different thulium laser fibres (230, 365 and 600 μm) at two different laser power levels (10 W, 30 W) and three different resection depths (0.5, 1.0 and 2.0 cm). Initial airtightness was investigated while ventilating at normal frequency. We also investigated the bursting pressures of the resected areas by increasing the inspiratory pressure. When 230- and 365-μm fibres were used with a power of 10 W, 70 % of samples were initially airtight up to a resection depth of 1 cm. This rate fell at depths of up to 2 cm. All resected surfaces remained airtight during ventilation when 600-μm fibres were used at both laser power levels (10 and 30 W). The bursting pressures achieved with 600-μm fibres were higher than with the other fibres used: 0.5 cm, 41.6 ± 3.2 mbar; 1 cm, 38.2 ± 2.5 mbar; 2 cm, 33.7 ± 4.8 mbar. As laser power and thickness of laser fibre increased, so the coagulation zone became thicker. With a 600-μm fibre, it measured 145.0 ± 8.2 μm with 10 W power and 315.5 ± 6.4 μm with 30 W power. Closure with sutures after non-anatomic resection of lung parenchyma is not necessary when a thulium laser is used provided a 600-μm fibre and adequate laser power (30 W) are employed. At deeper resection levels, the risk of cutting small segmental bronchi is considerably increased. They must always be closed with sutures.
Measuring the face-sensitive N170 with a gaming EEG system: A validation study.
de Lissa, Peter; Sörensen, Sidsel; Badcock, Nicholas; Thie, Johnson; McArthur, Genevieve
2015-09-30
The N170 is a "face-sensitive" event-related potential (ERP) that occurs at around 170ms over occipito-temporal brain regions. The N170's potential to provide insight into the neural processing of faces in certain populations (e.g., children and adults with cognitive impairments) is limited by its measurement in scientific laboratories that can appear threatening to some people. The advent of cheap, easy-to-use portable gaming EEG systems provides an opportunity to record EEG in new contexts and populations. This study tested the validity of the face-sensitive N170 ERP measured with an adapted commercial EEG system (the Emotiv EPOC) that is used at home by gamers. The N170 recorded through both the gaming EEG system and the research EEG system exhibited face-sensitivity, with larger mean amplitudes in response to the face stimuli than the non-face stimuli, and a delayed N170 peak in response to face inversion. The EPOC system produced very similar N170 ERPs to a research-grade Neuroscan system, and was capable of recording face-sensitivity in the N170, validating its use as research tool in this arena. This opens new possibilities for measuring the face-sensitive N170 ERP in people who cannot travel to a traditional ERP laboratory (e.g., elderly people in care), who cannot tolerate laboratory conditions (e.g., people with autism), or who need to be tested in situ for practical or experimental reasons (e.g., children in schools). Copyright © 2015 Elsevier B.V. All rights reserved.
Development of diagnostics in the search for an explanation of aerotoxic syndrome.
Schopfer, Lawrence M; Furlong, Clement E; Lockridge, Oksana
2010-09-01
Aerotoxic syndrome is assumed to be caused by exposure to tricresyl phosphate, an additive in engine lubricants and hydraulic fluids that is activated to the toxic 2-(ortho-cresyl)-4H-1,3,2-benzodioxaphosphoran-2-one (CBDP). Currently, there is no laboratory evidence to support intoxication of airline crew members by CBDP. Our goal was to develop methods for testing in vivo exposure by identifying and characterizing biomarkers. Mass spectrometry was used to study the reaction of CBDP with human albumin, free tyrosine, and human butyrylcholinesterase. Human albumin made a covalent bond with CBDP, adding a mass of 170amu to Tyr411 to yield the o-cresyl phosphotyrosine derivative. Human butyrylcholinesterase made a covalent bond with CBDP on Ser198 to yield five adducts with added masses of 80, 108, 156, 170, and 186amu. The most abundant adduct had an added mass of 80amu from phosphate (HPO(3)), a surprising result given that no pesticide or nerve agent is known to yield phosphorylated serine with an added mass of 80amu. The next most abundant adduct had an added mass of 170amu to form o-cresyl phosphoserine. It is concluded that toxic gases or oil mists in cabin air may form adducts on plasma butyrylcholinesterase and albumin, detectable by mass spectrometry. 2010 Elsevier Inc. All rights reserved.
Chiodini, Giovanni; Caliro, Stefano; Lowenstern, Jacob B.; Evans, William C.; Bergfeld, D.; Tassi, Franco; Tedesco, Dario
2012-01-01
The chemistry of Yellowstone fumarole gases shows the existence of two component waters, type MC, influenced by the addition of deep mantle fluid, and type CC, influenced by crustal interactions (CC). MC is high in 3He/4He (22 Ra) and low in 4He/40Ar (~1), reflecting input of deep mantle components. The other water is characterized by 4He concentrations 3-4 orders of magnitude higher than air-saturated meteoric water (ASW). These high He concentrations originate through circulation in Pleistocene volcanic rocks, as well as outgassing of Tertiary and older (including Archean) basement, some of which could be particularly rich in uranium, a major 4He source. Consideration of CO2-CH4-CO-H2O-H2 gas equilibrium reactions indicates equilibration temperatures from 170 °C to 310 °C. The estimated temperatures highly correlate with noble-gas variations, suggesting that the two waters differ in temperature. Type CC is ~170 °C whereas the MC is hotter, at 340 °C. This result is similar to models proposed by previous studies of thermal water chemistry. However, instead of mixing the deep hot component simply with cold, meteoric waters we argue that addition of a 4He-rich component, equilibrated at temperatures around 170 °C, is necessary to explain the range in fumarole gas chemistry.
ERIC Educational Resources Information Center
Zhao, Pei; Zhao, Jing; Weng, Xuchu; Li, Su
2018-01-01
Visual word N170 is an index of perceptual expertise for visual words across different writing systems. Recent developmental studies have shown the early emergence of visual word N170 and its close association with individual's reading ability. In the current study, we investigated whether fine-tuning N170 for Chinese characters could emerge after…
Selectivity of N170 for visual words in the right hemisphere: Evidence from single-trial analysis.
Yang, Hang; Zhao, Jing; Gaspar, Carl M; Chen, Wei; Tan, Yufei; Weng, Xuchu
2017-08-01
Neuroimaging and neuropsychological studies have identified the involvement of the right posterior region in the processing of visual words. Interestingly, in contrast, ERP studies of the N170 typically demonstrate selectivity for words more strikingly over the left hemisphere. Why is right hemisphere selectivity for words during the N170 epoch typically not observed, despite the clear involvement of this region in word processing? One possibility is that amplitude differences measured on averaged ERPs in previous studies may have been obscured by variation in peak latency across trials. This study examined this possibility by using single-trial analysis. Results show that words evoked greater single-trial N170s than control stimuli in the right hemisphere. Additionally, we observed larger trial-to-trial variability on N170 peak latency for words as compared to control stimuli over the right hemisphere. Results demonstrate that, in contrast to much of the prior literature, the N170 can be selective to words over the right hemisphere. This discrepancy is explained in terms of variability in trial-to-trial peak latency for responses to words over the right hemisphere. © 2017 Society for Psychophysiological Research.
Ibáñez, Agustin; Petroni, Agustin; Urquina, Hugo; Torrente, Fernando; Torralva, Teresa; Hurtado, Esteban; Guex, Raphael; Blenkmann, Alejandro; Beltrachini, Leandro; Muravchik, Carlos; Baez, Sandra; Cetkovich, Marcelo; Sigman, Mariano; Lischinsky, Alicia; Manes, Facundo
2011-01-01
Although it has been shown that adults with attention-deficit hyperactivity disorder (ADHD) have impaired social cognition, no previous study has reported the brain correlates of face valence processing. This study looked for behavioral, neuropsychological, and electrophysiological markers of emotion processing for faces (N170) in adult ADHD compared to controls matched by age, gender, educational level, and handedness. We designed an event-related potential (ERP) study based on a dual valence task (DVT), in which faces and words were presented to test the effects of stimulus type (faces, words, or face-word stimuli) and valence (positive versus negative). Individual signatures of cognitive functioning in participants with ADHD and controls were assessed with a comprehensive neuropsychological evaluation, including executive functioning (EF) and theory of mind (ToM). Compared to controls, the adult ADHD group showed deficits in N170 emotion modulation for facial stimuli. These N170 impairments were observed in the absence of any deficit in facial structural processing, suggesting a specific ADHD impairment in early facial emotion modulation. The cortical current density mapping of N170 yielded a main neural source of N170 at posterior section of fusiform gyrus (maximum at left hemisphere for words and right hemisphere for faces and simultaneous stimuli). Neural generators of N170 (fusiform gyrus) were reduced in ADHD. In those patients, N170 emotion processing was associated with performance on an emotional inference ToM task, and N170 from simultaneous stimuli was associated with EF, especially working memory. This is the first report to reveal an adult ADHD-specific impairment in the cortical modulation of emotion for faces and an association between N170 cortical measures and ToM and EF.
Photodegradation of near-infrared-pumped Tm(3+)-doped ZBLAN fiber upconversion lasers.
Booth, I J; Archambault, J L; Ventrudo, B F
1996-03-01
Photodegradation has been observed in Tm(3+)-doped ZBLAN fiber lasers pumped with laser diodes at 1135 nm. After upconversion lasing at 482 nm, the fiber develops color centers that absorb strongly at wavelengths below ~650 nm, affecting further upconversion lasing. The rate of damage formation is strongly dependent on the pump power level and on the thulium concentration. The color centers are bleached by intense blue light but recover with thermal excitation and can be removed by thermal annealing at temperature near 100 degrees C.
152 W average power Tm-doped fiber CPA system.
Stutzki, Fabian; Gaida, Christian; Gebhardt, Martin; Jansen, Florian; Wienke, Andreas; Zeitner, Uwe; Fuchs, Frank; Jauregui, Cesar; Wandt, Dieter; Kracht, Dietmar; Limpert, Jens; Tünnermann, Andreas
2014-08-15
A high-power thulium (Tm)-doped fiber chirped-pulse amplification system emitting a record compressed average output power of 152 W and 4 MW peak power is demonstrated. This result is enabled by utilizing Tm-doped photonic crystal fibers with mode-field diameters of 35 μm, which mitigate detrimental nonlinearities, exhibit slope efficiencies of more than 50%, and allow for reaching a pump-power-limited average output power of 241 W. The high-compression efficiency has been achieved by using multilayer dielectric gratings with diffraction efficiencies higher than 98%.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hoffman, R. D.
2013-09-06
We have developed a set of modeled nuclear reaction cross sections for use in radiochemical diagnostics. Systematics for the input parameters required by the Hauser-Feshbach statistical model were developed and used to calculate neutron induced nuclear reaction cross sections for targets ranging from Terbium (Z = 65) to Rhenium (Z = 75). Of particular interest are the cross sections on Tm, Lu, and Ta including reactions on isomeric targets.
99 W mid-IR operation of a ZGP OPO at 25% duty cycle.
Hemming, Alexander; Richards, Jim; Davidson, Alan; Carmody, Neil; Bennetts, Shayne; Simakov, Nikita; Haub, John
2013-04-22
We have demonstrated the highest reported output power from a mid-IR ZGP OPO. The laser is a cascaded hybrid system consisting of a thulium fibre laser, Ho:YAG solid state laser and a Zinc Germanium Phosphide parametric oscillator. The system produces 27 W of output power in the 3-5 μm wavelength range with an M(2) = 4.0 when operating in a repetitively q-switched mode, and a modulated peak output power of 99 W at a reduced duty cycle of 25%.
Print-specific N170 involves multiple subcomponents for Japanese Hiragana.
Uno, Tomoki; Okumura, Yasuko; Kasai, Tetsuko
2017-05-22
Print-specific N170 in event-related potentials is generally considered to reflect relatively automatic processing for letter strings, which is crucial for fluent reading. However, our previous studies demonstrated that print-specific N170 for transparent Japanese Hiragana script consists of at least two subcomponents under rapid stimulus presentation: an attention-related left-lateralized N170 and a bilateral N170 associated with more automatic orthographic processes (Okumura, Kasai & Murohashi, 2014, 2015). The present study aimed to confirm the latter component by controlling presentation frequency of letters and nonlinguistic visual controls (i.e., symbols), but found a quite different pattern of results; an enhanced occipito-temporal positivity for words (80-120ms poststimulus) followed by the typical left-lateralized N170 and an enhanced parietal negativity for nonwords (150-200ms). These results should provide further insights into the interaction processes between attention and early stages of print processing. Copyright © 2017 Elsevier B.V. All rights reserved.
Novel fiber optic tip designs and devices for laser surgery
NASA Astrophysics Data System (ADS)
Hutchens, Thomas Clifton
Fiber optic delivery of laser energy has been used for years in various types of surgical procedures in the human body. Optical energy provides several benefits over electrical or mechanical surgery, including the ability to selectively target specific tissue types while preserving others. Specialty fiber optic tips have also been introduced to further customize delivery of laser energy to the tissue. Recent evolution in lasers and miniaturization has opened up opportunities for many novel surgical techniques. Currently, ophthalmic surgeons use relatively invasive mechanical tools to dissect retinal deposits which occur in proliferative diabetic retinopathy. By using the tight focusing properties of microspheres combined with the short optical penetration depth of the Erbium:YAG laser and mid-IR fiber delivery, a precise laser scalpel can be constructed as an alternative, less invasive and more precise approach to this surgery. Chains of microspheres may allow for a self limiting ablation depth of approximately 10 microm based on the defocusing of paraxial rays. The microsphere laser scalpel may also be integrated with other surgical instruments to reduce the total number of handpieces for the surgeon. In current clinical laser lithotripsy procedures, poor input coupling of the Holmium:YAG laser energy frequently damages and requires discarding of the optical fiber. However, recent stone ablation studies with the Thulium fiber laser have provided comparable results to the Ho:YAG laser. The improved spatial beam profile of the Thulium fiber laser can also be efficiently coupled into a fiber approximately one third the diameter and reduces the risk of damaging the fiber input. For this reason, the trunk optical fiber minus the distal fiber tip can be preserved between procedures. The distal fiber tip, which degrades during stone ablation, could be made detachable and disposable. A novel, low-profile, twist-locking, detachable distal fiber tip interface was designed, assembled, and tested for use in Thulium fiber laser lithotripsy. A 1.00-mm-outer-diameter detachable fiber tip interface was designed, constructed, and tested ex vivo on urinary stones in the laboratory. Similar stone ablation rates between the previously studied tapered distal fiber tip and the detachable fiber tip were measured. For urologists desiring faster TFL lithotripsy procedures, the incorporation of detachable distal fiber tips allows for rapid replacement of damaged fiber tips without concern about the laser to trunk fiber connection. This method for preserving the trunk fiber could be a motivation for integrating a dedicated laser fiber into the ureteroscope, with detachable distal tips, thus freeing the working channel for the use of other surgical instruments. During laser lithotripsy, distal fiber tip degradation increases as the fiber core diameter decreases. However, smaller fiber diameters (≤ 200 microm) are more desirable because of increased saline irrigation rates in the single working channel of the ureteroscope and less impact on ureteroscope deflection. A hollow fiber cap is proposed to reduced fiber tip degradation in small diameter fibers, without compromising stone ablation rates. The disadvantage of the hollow fiber tip observed in the study is the increase in stone retropulsion. However, integrating the hollow fiber tip with a clinically used stone basket may allow for a robust stone ablation instrument that also minimizes retropulsion. These surgical approaches involving novel specialty fiber optic tip designs are discussed in this thesis.
Zhuo, Jian; Wei, Hai-Bin; Zhang, Fei; Liu, Hai-Tao; Zhao, Fu-Jun; Han, Bang-Min; Sun, Xiao-Wen; Xia, Shu-Jie
2017-01-01
The 2-μm thulium laser resection of the prostate-tangerine technique (TmLRP-TT) has been introduced as a minimally invasive treatment for benign prostatic hyperplasia (BPH). This study was undertaken to assess the clinical efficacy and safety of TmLRP-TT for the treatment of BPH patients with previously negative transrectal prostate biopsy. A prospective analysis of 51 patients with previously negative transrectal prostate biopsy who underwent surgical treatment using TmLRP-TT was performed from December 2011 to December 2013. Preoperative status, surgical details, and perioperative complications were recorded. The follow-up outcome was evaluated with subjective and objective tests at 1 and 6 months. TmLRP-TT was successfully completed in all patients. Mean prostate volume, operative duration, and catheterization time were 93.3 ± 37.9 ml, 69.5 ± 39.5 min, and 6.5 ± 1.3 days, respectively. The mean International Prostate Symptom Score, quality of life score, maximum urinary flow rate, and post-void residual urine volume changed notably at 6-month follow-up (22.5 ± 6.9 vs 6.1 ± 3.2, 4.8 ± 1.3 vs 1.1 ± 0.9, 7.3 ± 4.5 vs 18.9 ± 7.1 ml s-1 , and 148.7 ± 168.7 vs 28.4 ± 17.9 ml). Two (3.9%) patients required blood transfusion perioperatively, while 3 (5.9%) patients experienced transient hematuria postoperatively, and 2 (3.9%) patients received 3 days recatheterization due to clot retention. TmLRP-TT is a safe and effective minimally invasive technique for patients with previously negative transrectal prostate biopsy during the 6-month follow-up. This promising technology may be a feasible surgical method for previously negative transrectal prostate biopsy in the future.
Zhuo, Jian; Wei, Hai-Bin; Zhang, Fei; Liu, Hai-Tao; Zhao, Fu-Jun; Han, Bang-Min; Sun, Xiao-Wen; Jun-Lu; Xia, Shu-Jie
2017-01-01
The 2-μm thulium laser resection of the prostate-tangerine technique (TmLRP-TT) has been introduced as a minimally invasive treatment for benign prostatic hyperplasia (BPH). This study was undertaken to assess the clinical efficacy and safety of TmLRP-TT for the treatment of BPH patients with previously negative transrectal prostate biopsy. A prospective analysis of 51 patients with previously negative transrectal prostate biopsy who underwent surgical treatment using TmLRP-TT was performed from December 2011 to December 2013. Preoperative status, surgical details, and perioperative complications were recorded. The follow-up outcome was evaluated with subjective and objective tests at 1 and 6 months. TmLRP-TT was successfully completed in all patients. Mean prostate volume, operative duration, and catheterization time were 93.3 ± 37.9 ml, 69.5 ± 39.5 min, and 6.5 ± 1.3 days, respectively. The mean International Prostate Symptom Score, quality of life score, maximum urinary flow rate, and post-void residual urine volume changed notably at 6-month follow-up (22.5 ± 6.9 vs 6.1 ± 3.2, 4.8 ± 1.3 vs 1.1 ± 0.9, 7.3 ± 4.5 vs 18.9 ± 7.1 ml s−1, and 148.7 ± 168.7 vs 28.4 ± 17.9 ml). Two (3.9%) patients required blood transfusion perioperatively, while 3 (5.9%) patients experienced transient hematuria postoperatively, and 2 (3.9%) patients received 3 days recatheterization due to clot retention. TmLRP-TT is a safe and effective minimally invasive technique for patients with previously negative transrectal prostate biopsy during the 6-month follow-up. This promising technology may be a feasible surgical method for previously negative transrectal prostate biopsy in the future. PMID:26732107
Thulium fiber laser lithotripsy in an in vitro ureter model
NASA Astrophysics Data System (ADS)
Hardy, Luke A.; Wilson, Christopher R.; Irby, Pierce B.; Fried, Nathaniel M.
2014-12-01
Using a validated in vitro ureter model for laser lithotripsy, the performance of an experimental thulium fiber laser (TFL) was studied and compared to the clinical gold standard holmium:YAG laser. The holmium laser (λ=2120 nm) was operated with standard parameters of 600 mJ, 350 μs, 6 Hz, and 270-μm-core optical fiber. The TFL (λ=1908 nm) was operated with 35 mJ, 500 μs, 150 to 500 Hz, and a 100-μm-core fiber. Urinary stones (60% calcium oxalate monohydrate/40% calcium phosphate) of uniform mass and diameter (4 to 5 mm) were laser ablated with fibers through a flexible video-ureteroscope under saline irrigation with flow rates of 22.7 and 13.7 ml/min for the TFL and holmium laser, respectively. The temperature 3 mm from the tube's center and 1 mm above the mesh sieve was measured by a thermocouple and recorded throughout each experiment for both lasers. Total laser and operation times were recorded once all stone fragments passed through a 1.5-mm sieve. The holmium laser time measured 167±41 s (n=12). TFL times measured 111±49, 39±11, and 23±4 s, for pulse rates of 150, 300, and 500 Hz, respectively (n=12 each). Mean peak saline irrigation temperatures reached 24±1°C for holmium, and 33±3°C, 33±7°C, and 39±6°C, for TFL at pulse rates of 150, 300, and 500 Hz, respectively. To avoid thermal buildup and provide a sufficient safety margin, TFL lithotripsy should be performed with pulse rates below 500 Hz and/or increased saline irrigation rates. The TFL rapidly fragmented kidney stones due in part to its high pulse rate, high power density, high average power, and observation of reduced stone retropulsion and may provide a clinical alternative to the conventional holmium laser for lithotripsy.
NASA Astrophysics Data System (ADS)
Hardy, Luke A.; Wilson, Christopher R.; Irby, Pierce B.; Fried, Nathaniel M.
2015-02-01
Using a validated in vitro ureter model for laser lithotripsy, the performance of an experimental Thulium fiber laser (TFL) was studied and compared to clinical gold standard Holmium:YAG laser. The Holmium laser (λ = 2120 nm) was operated with standard parameters of 600 mJ, 350 μs, 6 Hz, and 270-μm-core optical fiber. TFL (λ = 1908 nm) was operated with 35 mJ, 500 μs, 150-500 Hz, and 100-μm-core fiber. Urinary stones (60% calcium oxalate monohydrate / 40% calcium phosphate), of uniform mass and diameter (4-5 mm) were laser ablated with fibers through a flexible video-ureteroscope under saline irrigation with flow rates of 22.7 ml/min and 13.7 ml/min for the TFL and Holmium laser, respectively. The temperature 3 mm from tube's center and 1 mm above mesh sieve was measured by a thermocouple and recorded during experiments. Total laser and operation times were recorded once all stone fragments passed through a 1.5-mm sieve. Holmium laser time measured 167 +/- 41 s (n = 12). TFL times measured 111 +/- 49 s, 39 +/- 11 s, and 23 +/- 4 s, for pulse rates of 150, 300, and 500 Hz (n = 12 each). Mean peak saline irrigation temperatures reached 24 +/- 1 °C for Holmium, and 33 +/- 3 °C, 33 +/- 7 °C, and 39 +/- 6 °C, for TFL at pulse rates of 150, 300, and 500 Hz. To avoid thermal buildup and provide a sufficient safety margin, TFL lithotripsy should be performed with pulse rates below 500 Hz and/or increased saline irrigation rates. The TFL rapidly fragmented kidney stones due in part to its high pulse rate, high power density, high average power, and reduced stone retropulsion, and may provide a clinical alternative to the conventional Holmium laser for lithotripsy.
Thulium fiber laser recanalization of occluded ventricular catheters in an ex vivo tissue model
NASA Astrophysics Data System (ADS)
Hutchens, Thomas C.; Gonzalez, David A.; Hardy, Luke A.; McLanahan, C. Scott; Fried, Nathaniel M.
2017-04-01
Hydrocephalus is a chronic medical condition that occurs in individuals who are unable to reabsorb cerebrospinal fluid (CSF) created within the ventricles of the brain. Treatment requires excess CSF to be diverted from the ventricles to another part of the body, where it can be returned to the vascular system via a shunt system beginning with a catheter within the ventricle. Catheter failures due to occlusion by brain tissues commonly occur and require surgical replacement of the catheter. In this preliminary study, minimally invasive clearance of occlusions is explored using an experimental thulium fiber laser (TFL), with comparison to a conventional holmium: yttrium aluminium garnet (YAG) laser. The TFL utilizes smaller optical fibers (<200-μm OD) compared with holmium laser (>450-μm OD), providing critical extra cross-sectional space within the 1.2-mm-inner-diameter ventricular catheter for simultaneous application of an endoscope for image guidance and a saline irrigation tube for visibility and safety. TFL ablation rates using 100-μm core fiber, 33-mJ pulse energy, 500-μs pulse duration, and 20- to 200-Hz pulse rates were compared to holmium laser using a 270-μm core fiber, 325-mJ, 300-μs, and 10 Hz. A tissue occluded catheter model was prepared using coagulated egg white within clear silicone tubing. An optimal TFL pulse rate of 50 Hz was determined, with an ablation rate of 150 μm/s and temperature rise outside the catheter of ˜10°C. High-speed camera images were used to explore the mechanism for removal of occlusions. Image guidance using a miniature, 0.7-mm outer diameter, 10,000 pixel endoscope was explored to improve procedure safety. With further development, simultaneous application of TFL with small fibers, miniature endoscope for image guidance, and irrigation tube for removal of tissue debris may provide a safe, efficient, and minimally invasive method of clearing occluded catheters in the treatment of hydrocephalus.
P1 and N170 components distinguish human-like and animal-like makeup stimuli.
Luo, Shuwei; Luo, Wenbo; He, Weiqi; Chen, Xu; Luo, Yuejia
2013-06-19
This study used event-related potentials to investigate the sensitivity of P1 and N170 components to human-like and animal-like makeup stimuli, which were derived from pictures of Peking opera characters. As predicted, human-like makeup stimuli elicited larger P1 and N170 amplitudes than did animal-like makeup stimuli. Interestingly, a right hemisphere advantage was observed for human-like but not for animal-like makeup stimuli. Dipole source analyses of 130-200-ms window showed that the bilateral fusiform face area may contribute to the differential sensitivity of the N170 component in response to human-like and animal-like makeup stimuli. The present study suggests that the amplitudes of both the P1 and the N170 are sensitive for the mouth component of face-like stimuli.
NASA Astrophysics Data System (ADS)
Wilke, K.; Stickel, M.; Haas, M.; Herbstmeier, U.; Klaas, U.; Lemke, D.
2003-04-01
The ISOPHOT experiment onboard the ISO satellite generated a complete view of the Small Magellanic Cloud (SMC) at 170 mu m with 1.5 arcmin resolution. The map is analysed using an automated photometry program enabling accurate photometric characterization of the far infrared (FIR) emitting regions. An integrated FIR luminosity of 8.5x 107 Lsun is obtained, leading to a star formation rate of SFRFIR=0.015 Msun/yr. With an average dust temperature of
Debus, Richard J; Aznar, Constantino; Campbell, Kristy A; Gregor, Wolfgang; Diner, Bruce A; Britt, R David
2003-09-16
Aspartate 170 of the D1 polypeptide provides part of the high-affinity binding site for the first Mn(II) ion that is photooxidized during the light-driven assembly of the (Mn)(4) cluster in photosystem II [Campbell, K. A., Force, D. A., Nixon, P. J., Dole, F., Diner, B. A., and Britt, R. D. (2000) J. Am. Chem. Soc. 122, 3754-3761]. However, despite a wealth of data on D1-Asp170 mutants accumulated over the past decade, there is no consensus about whether this residue ligates the assembled (Mn)(4) cluster. To address this issue, we have conducted an EPR and ESEEM (electron spin-echo envelope modulation) study of D1-D170H PSII particles purified from the cyanobacterium Synechocystis sp. PCC 6803. The line shapes of the S(1) and S(2) state multiline EPR signals of D1-D170H PSII particles are unchanged from those of wild-type PSII particles, and the signal amplitudes correlate approximately with the lower O(2) evolving activity of the mutant PSII particles (40-60% compared to that of the wild type). These data provide further evidence that the assembled (Mn)(4) clusters in D1-D170H cells function normally, even though the assembly of the (Mn)(4) cluster is inefficient in this mutant. In the two-pulse frequency domain ESEEM spectrum of the 9.2 GHz S(2) state multiline EPR signal of D1-D170H PSII particles, the histidyl nitrogen modulation observed at 4-5 MHz is unchanged from that of wild-type PSII particles and no significant new modulation is observed. Three scenarios are presented to explain this result. (1) D1-Asp170 ligates the assembled (Mn)(4) cluster, but the hyperfine couplings to the ligating histidyl nitrogen of D1-His170 are too large or anisotropic to be detected by ESEEM analyses conducted at 9.2 GHz. (2) D1-Asp170 ligates the assembled (Mn)(4) cluster, but D1-His170 does not. (3) D1-Asp170 does not ligate the assembled (Mn)(4) cluster.
A practical and scalable manufacturing process for an anti-fungal agent, Nikkomycin Z.
Stenland, Christopher J; Lis, Lev G; Schendel, Frederick J; Hahn, Nicholas J; Smart, Mary A; Miller, Amy L; von Keitz, Marc G; Gurvich, Vadim J
2013-02-15
A scalable and reliable manufacturing process for Nikkomycin Z HCl on a 170 g scale has been developed and optimized. The process is characterized by a 2.3 g/L fermentation yield, 79% purification yield, and >98% relative purity of the final product. This method is suitable for further scale up and cGMP production. The Streptomyces tendae ΔNikQ strain developed during the course of this study is superior to any previously reported strain in terms of higher yield and purity of Nikkomycin Z.
Studies on temperature coefficient of resistivity of Cu2Se - V2O5 nanocomposite
NASA Astrophysics Data System (ADS)
Sairam, S.; Rai, Ranjan; Molli, Muralikrishna
2018-05-01
Nanocomposite of Copper Selenide in Vanadium Pentoxide (Cu2Se-V2O5) was prepared and characterized using XRD for phase analysis, SEM for morphology, and EDAX for elemental analysis. Electrical resistivity measurement was carried out using van der Pauw method as a function of temperature from 35 °C to 170 °C for 5 mol% Cu2Se - 95 mol%V2O5 composite. The temperature coefficient of resistivity was found to be -1.8% per °C.
1987-05-01
possibilities and the latter providing a photodetector with low dark currents . Some mention will also be made of structures devised by Nakagawa7 ,8...developments concerning the growth and the characterization of Hgl_xCdxTe-Cdte SLs and related Hg based superlattice systems. These SLs are now currently ...minority carriers in the base region. When a current is flowing, the drift velocities of minority and majority carriers are oppositely directed, and
Unconscious Processing of Facial Expressions in Individuals with Internet Gaming Disorder.
Peng, Xiaozhe; Cui, Fang; Wang, Ting; Jiao, Can
2017-01-01
Internet Gaming Disorder (IGD) is characterized by impairments in social communication and the avoidance of social contact. Facial expression processing is the basis of social communication. However, few studies have investigated how individuals with IGD process facial expressions, and whether they have deficits in emotional facial processing remains unclear. The aim of the present study was to explore these two issues by investigating the time course of emotional facial processing in individuals with IGD. A backward masking task was used to investigate the differences between individuals with IGD and normal controls (NC) in the processing of subliminally presented facial expressions (sad, happy, and neutral) with event-related potentials (ERPs). The behavioral results showed that individuals with IGD are slower than NC in response to both sad and neutral expressions in the sad-neutral context. The ERP results showed that individuals with IGD exhibit decreased amplitudes in ERP component N170 (an index of early face processing) in response to neutral expressions compared to happy expressions in the happy-neutral expressions context, which might be due to their expectancies for positive emotional content. The NC, on the other hand, exhibited comparable N170 amplitudes in response to both happy and neutral expressions in the happy-neutral expressions context, as well as sad and neutral expressions in the sad-neutral expressions context. Both individuals with IGD and NC showed comparable ERP amplitudes during the processing of sad expressions and neutral expressions. The present study revealed that individuals with IGD have different unconscious neutral facial processing patterns compared with normal individuals and suggested that individuals with IGD may expect more positive emotion in the happy-neutral expressions context. • The present study investigated whether the unconscious processing of facial expressions is influenced by excessive online gaming. A validated backward masking paradigm was used to investigate whether individuals with Internet Gaming Disorder (IGD) and normal controls (NC) exhibit different patterns in facial expression processing.• The results demonstrated that individuals with IGD respond differently to facial expressions compared with NC on a preattentive level. Behaviorally, individuals with IGD are slower than NC in response to both sad and neutral expressions in the sad-neutral context. The ERP results further showed (1) decreased amplitudes in the N170 component (an index of early face processing) in individuals with IGD when they process neutral expressions compared with happy expressions in the happy-neutral expressions context, whereas the NC exhibited comparable N170 amplitudes in response to these two expressions; (2) both the IGD and NC group demonstrated similar N170 amplitudes in response to sad and neutral faces in the sad-neutral expressions context.• The decreased amplitudes of N170 to neutral faces than happy faces in individuals with IGD might due to their less expectancies for neutral content in the happy-neutral expressions context, while individuals with IGD may have no different expectancies for neutral and sad faces in the sad-neutral expressions context.
NASA Astrophysics Data System (ADS)
Sroka, Ronald; Frank, Johannes; Reichenberger, Frank; Behr, J.; Gesierich, Wolfgang
2017-04-01
Granulation and tumor regrowth in the area of bronchi stent implants may result in restenosis. It had been shown that by means of Thulium-Fibre-Laser (TFL) a controlled ablation and reduction of the tissue within the stent could be performed. When using Nd:YAG irradiation there is risk for explosive flames, burns of fibre and stent, ruptures of stent meshes as well as perforation of stent and cover. Therefore it was the aim to investigate the safety margin when using TFL. Four different types of clinical used stents (with/without cover) were fixed to pig trachea tissue. Irradiation was performed by fibre assisted TFL-1940nm-laser irradiation while laser power, light application duration and distance, as well as oxygen percentage and contamination were varied. In case of Nitinol-stents rupture were observed at power levels >=7W or distances of <5mm, oxygen conc. of 40% result in increased flame appearance. Polyurethan-covers were ruptured at each variable, flame appeared at 5W. Silicon-stents were destroyed at power levels of about 5W and distances of <5mm and additionally 30%-oxygen or contamination either by blood or soot result in increased appearance of burns and flames. Based upon these observations in clinical TFL-irradiation the distance should >=5 mm and the power level should be <=6W. Furthermore the oxygen conc. should not exceed 30% and short term continuous irradiation of less than 15s exposition should be considered. In case of Silicon-stents light application on contaminated area should be avoided.
A Characterization of t/s-Diagnosability and Sequential t-Diagnosability in Designs
1990-10-01
41 151 161 171 181 r91 1101 REFERENCES K.-Y. Chwa and S. L. Hakimi, “On fault identification in diagnosable systems,” ZEEE Tmns. Comput...1975, pp. 167-170. S. L. Hakimi and A. T. Amin, “Characterization of the connection assignment problem of diagnosable systems,” ZEEE Trans. Comput...S. Karunanithi and A. D. Friedman, “Analysis of digital systems using a new measure of system diagnosis,” ZEEE Trans. Cornput., vol. C- A
N170 Tuning in Chinese: Logographic Characters and Phonetic Pinyin Script
ERIC Educational Resources Information Center
Qin, Rui; Maurits, Natasha; Maassen, Ben
2016-01-01
In alphabetic languages, print consistently elicits enhanced, left-lateralized N170 responses in the event-related potential compared to control stimuli. In the current study, we adopted a cross-linguistic design to investigate N170 tuning to logographic Chinese and to "pinyin," an auxiliary phonetic system in Chinese. The results…
21 CFR 145.170 - Canned peaches.
Code of Federal Regulations, 2010 CFR
2010-04-01
... ingredients: (i) Natural and artificial flavors. (ii) Spice. (iii) Vinegar, lemon juice, or organic acids. (iv....22 of this chapter and a declaration of any spice or seasoning that characterizes the product; for example, “Spice added”, or in lieu of the word “Spice”, the common name of the spice, “Seasoned with...
Wu, Xingqu; Chen, Jiu; Jia, Ting; Ma, Wentao; Zhang, Yan; Deng, Zihe; Yang, Laiqi
2016-03-01
States of depression are considered to relate to a cognitive bias reactivity to emotional events. Moreover, gender effect may influence differences in emotional processing. The current study is to investigate whether there is an interaction of cognitive bias by gender on emotional processing in minor depression (MiD) and major depression (MaD). N170 component was obtained during a visual emotional oddball paradigm to manipulate the processing of emotional information in 33 MiD, 36 MaD, and 32 controls (CN). Compared with CN, in male, both MiD and MaD had lower N170 amplitudes for happy faces, but MaD had higher N170 amplitudes for sad faces; in female, both MiD and MaD had lower N170 amplitudes for happy and neutral faces, but higher N170 amplitudes for sad faces. Compared with MaD in male, MiD had higher N170 amplitudes for happy faces, lower N170 amplitudes for sad faces; in female, MiD only had higher N170 amplitudes for sad faces. Interestingly, a negative relationship was observed between N170 amplitude and the HDRS score for identification of happy faces in depressed patients while N170 amplitude was positively correlated with the HDRS score for sad faces identification. These results provide novel evidence for the mood-brightening effect with an interaction of cognitive bias by gender on emotional processing. It further suggests that female depression may be more vulnerable than male during emotional face processing with the unconscious negative cognitive bias and depressive syndromes may exist on a spectrum of severity on emotional face processing.
Temporal model of an optically pumped co-doped solid state laser
NASA Technical Reports Server (NTRS)
Wangler, T. G.; Swetits, J. J.; Buoncristiani, A. M.
1993-01-01
Currently, research is being conducted on the optical properties of materials associated with the development of solid state lasers in the two micron region. In support of this effort, a mathematical model describing the energy transfer in a holmium laser sensitized with thulium is developed. In this paper, we establish some qualitative properties of the solution of the model, such as non-negativity, boundedness, and integrability. A local stability analysis is then performed from which conditions for asymptotic stability are attained. Finally, we report on our numerical analysis of the system and how it compares with experimental results.
NASA Astrophysics Data System (ADS)
Michalska, M.; Brojek, W.; Rybak, Z.; Sznelewski, P.; Mamajek, M.; Gogler, S.; Swiderski, J.
2016-12-01
An all-fiber, diode-pumped, continuous-wave Tm3+-doped fiber laser operated at a wavelength of 1.94 μm was developed. 37.4 W of output power with a slope efficiency as high as 57% with respect to absorbed pump power at 790 nm was demonstrated. The laser output beam quality factor M2 was measured to be 1.2. The output beam was very stable with power fluctuations <1% measured over 1 hour. The laser system is to be implemented as a scalpel for surgery of soft biological tissues.
Improving Lifetime of Quasi-CW Laser Diode Arrays for Pumping 2-Micron Solid State Lasers
NASA Technical Reports Server (NTRS)
Amzajerdian, Farzin; Meadows, Byron L.; Baker, Nathaniel R.; Barnes, Bruce W.; Singh, Upendra N.; Kavaya, Michael J.
2007-01-01
Operating high power laser diode arrays in long pulse regime of about 1 msec, which is required for pumping 2-micron thulium and holmium-based lasers, greatly limits their useful lifetime. This paper describes performance of laser diode arrays operating in long pulse mode and presents experimental data on the active region temperature and pulse-to-pulse thermal cycling that are the primary cause of their premature failure and rapid degradation. This paper will then offer a viable approach for determining the optimum design and operational parameters leading to the maximum attainable lifetime.
Improving Reliability of High Power Quasi-CW Laser Diode Arrays Operating in Long Pulse Mode
NASA Technical Reports Server (NTRS)
Amzajerdian, Farzin; Meadows, Byron L.; Barnes, Bruce W.; Lockard, George E.; Singh, Upendra N.; Kavaya, Michael J.; Baker, Nathaniel R.
2006-01-01
Operating high power laser diode arrays in long pulse regime of about 1 msec, which is required for pumping 2-micron thulium and holmium-based lasers, greatly limits their useful lifetime. This paper describes performance of laser diode arrays operating in long pulse mode and presents experimental data of the active region temperature and pulse-to-pulse thermal cycling that are the primary cause of their premature failure and rapid degradation. This paper will then offer a viable approach for determining the optimum design and operational parameters leading to the maximum attainable lifetime.
Ultrasmall lanthanide-doped nanoparticles as multimodal platforms
NASA Astrophysics Data System (ADS)
Yust, Brian G.; Pedraza, Francisco J.; Sardar, Dhiraj K.
2014-03-01
Recently, there has been a great amount of interest in nanoparticles which are able to provide a platform with high contrast for multiple imaging modalities in order to advance the tools available to biomedical researchers and physicians. However, many nanoparticles do not have ideal properties to provide high contrast in different imaging modes. In order to address this, ultrasmall lanthanide doped oxide and fluoride nanoparticles with strong NIR to NIR upconversion fluorescence and a strong magnetic response for magnetic resonance imaging (MRI) have been developed. Specifically, these nanoparticles incorporate gadolinium, dysprosium, or a combination of both into the nano-crystalline host to achieve the magnetic properties. Thulium, erbium, and neodymium codopants provide the strong NIR absorption and emission lines that allow for deeper tissue imaging since near infrared light is not strongly absorbed or scattered by most tissues within this region. This also leads to better image quality and lower necessary excitation intensities. As a part of the one pot synthesis, these nanoparticles are coated with peg, pmao, or d-glucuronic acid to make them water soluble, biocompatible, and bioconjugable due to the available carboxyl or amine groups. Here, the synthesis, morphological characterization, magnetic response, NIR emission, and the quantum yield will be discussed. Cytotoxicity tested through cell viability at varying concentrations of nanoparticles in growth media will also be discussed.
Relative expertise affects N170 during selective attention to superimposed face-character images.
Ip, Chengteng; Wang, Hailing; Fu, Shimin
2017-07-01
It remains unclear whether the N170 of ERPs reflects domain-specific or domain-general visual object processing. In this study, we used superimposed images of a face and a Chinese character such that participants' relative expertise for the two object types was either similar (Experiment 1 and 2) or different (Experiment 3). Experiment 1 showed that N170 amplitude was larger when participants attended to the character instead of the face of a face-character combination. This result was unchanged in Experiment 2, in which task difficulty was selectively increased for the face component of the combined stimuli. Experiment 3 showed that, although this N170 enhancement for attending to characters relative to faces persisted for false characters with recognizable parts, it disappeared for unrecognizable characters. Therefore, N170 amplitude was significantly greater for Chinese characters than for faces presented within a combined image, independent of the relative task difficulty. This result strongly calls N170 face selectivity into question, demonstrating that, contrary to the expectations established by a domain-specific account, N170 is modulated by expertise. © 2017 Society for Psychophysiological Research.
46 CFR 170.170 - Weather criteria.
Code of Federal Regulations, 2014 CFR
2014-10-01
... 46 Shipping 7 2014-10-01 2014-10-01 false Weather criteria. 170.170 Section 170.170 Shipping COAST... ALL INSPECTED VESSELS Intact Stability Criteria § 170.170 Weather criteria. (a) Each vessel must be... weather deck or abnormal sheer. (c) When doing the calculations required by paragraph (a) of this section...
46 CFR 170.170 - Weather criteria.
Code of Federal Regulations, 2011 CFR
2011-10-01
... 46 Shipping 7 2011-10-01 2011-10-01 false Weather criteria. 170.170 Section 170.170 Shipping COAST... ALL INSPECTED VESSELS Intact Stability Criteria § 170.170 Weather criteria. (a) Each vessel must be... weather deck or abnormal sheer. (c) When doing the calculations required by paragraph (a) of this section...
46 CFR 170.170 - Weather criteria.
Code of Federal Regulations, 2012 CFR
2012-10-01
... 46 Shipping 7 2012-10-01 2012-10-01 false Weather criteria. 170.170 Section 170.170 Shipping COAST... ALL INSPECTED VESSELS Intact Stability Criteria § 170.170 Weather criteria. (a) Each vessel must be... weather deck or abnormal sheer. (c) When doing the calculations required by paragraph (a) of this section...
46 CFR 170.170 - Weather criteria.
Code of Federal Regulations, 2013 CFR
2013-10-01
... 46 Shipping 7 2013-10-01 2013-10-01 false Weather criteria. 170.170 Section 170.170 Shipping COAST... ALL INSPECTED VESSELS Intact Stability Criteria § 170.170 Weather criteria. (a) Each vessel must be... weather deck or abnormal sheer. (c) When doing the calculations required by paragraph (a) of this section...
Optical study of Tm-doped solid solution (Sc0.5Y0.5)2SiO5 crystal
NASA Astrophysics Data System (ADS)
Shi, Jiaojiao; Liu, Bin; Zheng, Lihe; Wang, Qingguo; Tang, Huili; Liu, Junfang; Su, Liangbi; Wu, Feng; Zhao, Hengyu; He, Nuotian; Li, Na; Li, Qiu; Guo, Chao; Xu, Jun; Yang, Kejian; Xu, Xiaodong; Ryba-Romanowski, Witold; Lisiecki, Radosław; Solarz, Piotr
2018-04-01
Tm-doped (Sc0.5Y0.5)2SiO5 (SYSO) crystals were grown by Czochralski method. The UV-VIR-NIR absorption spectra and the near-infrared emission spectra were measured and analysed by the Judd-Ofelt approach. Temperature influence on both absorption and emission spectra has been determined from the data recorded at room temperature and 10 K. It has been found that the structural disorder resulting from dissimilar ionic radii of Sc3+ and Y3+ in the solid solution (Sc0.5Y0.5)2SiO5 crystal brings about a strong inhomogeneous broadening of Tm3+ ions spectra. However, it affects the excited state relaxation dynamics inherent to thulium-doped Y2SiO5 and Sc2SiO5 hosts weakly.
High-pressure structural, elastic, and thermodynamic properties of zircon-type HoPO 4 and TmPO 4
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gomis, O.; Lavina, B.; Rodríguez-Hernández, P.
2017-01-20
Zircon-type holmium phosphate (HoPO 4) and thulium phosphate (TmPO 4) have been studied by single-crystal x-ray diffraction and ab initio calculations. We report on the influence of pressure on the crystal structure, and on the elastic and thermodynamic properties. The equation of state for both compounds is accurately determined. We have also obtained information on the polyhedral compressibility which is used to explain the anisotropic axial compressibility and the bulk compressibility. Both compounds are ductile and more resistive to volume compression than to shear deformation at all pressures. Furthermore, the elastic anisotropy is enhanced upon compression. Finally, the calculations indicatemore » that the possible causes that make the zircon structure unstable are mechanical instabilities and the softening of a silent B 1u mode.« less
Molecular Epidemiology and Genotyping of Hepatitis B Virus of HBsAg-Positive Patients in Oman
Al Naamani, Khalid; Al Awaidy, Salah; Busaidy, Suleiman Al; Pauli, Georg; Bock, C.-Thomas
2014-01-01
Background Hepatitis B virus (HBV) infection is a major global health burden with distinct geographic public health significance. Oman is a country with intermediate HBV carrier prevalence; however, little is known about the incidence of HBV variants in circulation. We investigated the HBV genotype distribution, the occurrence of antiviral resistance, and HBV surface antigen (HBsAg) escape mutations in HBsAg-positive patients in Oman. Methods Serum samples were collected from 179 chronically HBV-infected patients enrolled in various gastroenterology clinics in Oman. HBV genotypes were determined by sequencing and phylogenetic analysis. Mutations in the HBV polymerase and the HBsAg gene were characterized by mutational analysis. Results HBV genotypes D (130/170; 76.47%) and A (32/170; 18.28%) are predominant in Oman. The HBV genotypes C and E were less frequent (each 1.18%), while the HBV genotypes B, G, F, and H were not detected. Four patients revealed HBV genotype mixtures (HBV-A/D and D/C). The analyses of vaccine escape mutations yield that 148/170 (87.06%) HBV sequences were wild type. 22/170 (12.94%) HBV sequences showed mutations in the “a” determinant of the HBsAg domain. Two patients showed the described HBV vaccine escape mutation sP120T. 8/146 (5.48%) HBV isolates harbored mutations in the HBV polymerase known to confer resistance against antiviral therapy. Especially the lamivudine resistance mutations rtL180M/rtM204V and rtM204I were detected. Conclusion This study shows the distribution of HBV genotypes, therapy resistance, and vaccine escape mutations in HBV-infected patients in Oman. Our findings will have a major impact on therapy management and diagnostics of chronic HBV infections in Oman to control HBV infection in this intermediate HBV-endemic country. PMID:24835494
ERIC Educational Resources Information Center
Health Resources and Services Administration (DHHS/PHS), Rockville, MD. Office for Maternal and Child Health Services.
This document is a compendium of approximately 170 national health promotion and disease prevention objectives affecting mothers, infants, children, adolescents, and youth. It offers a vision characterized by reductions of preventable death and disability, enhanced quality of life, and reduced disparities in the health status of the populations in…
Ni.sub.3 Al-based intermetallic alloys having improved strength above 850.degree. C.
Liu, Chain T.
2000-01-01
Intermetallic alloys composed essentially of: 15.5% to 17.0% Al, 3.5% to 5.5% Mo, 4% to 8% Cr, 0.04% to 0.2% Zr, 0.04% to 1.5% B, balance Ni, are characterized by melting points above 1200.degree. C. and superior strengths at temperatures above 1000.degree. C.
Code of Federal Regulations, 2012 CFR
2012-04-01
... defined in § 170.3(o)(9) of this chapter to hydrolyze proteins or polypeptides. (2) The ingredient is used... 21 Food and Drugs 3 2012-04-01 2012-04-01 false Trypsin. 184.1914 Section 184.1914 Food and Drugs... characterizing enzyme activity is that of a peptide hydrolase (EC 3.4.21.4). (b) The ingredient meets the general...
Code of Federal Regulations, 2013 CFR
2013-04-01
... practice conditions of use: (1) The ingredient is used as an enzyme as defined in § 170.3(o)(9) of this... 21 Food and Drugs 3 2013-04-01 2013-04-01 false Bromelain. 184.1024 Section 184.1024 Food and... amorphous powder. Its characterizing enzyme activity is that of a peptide hydrolase (EC 3.4.22.32). (b) The...
Code of Federal Regulations, 2010 CFR
2010-04-01
... defined in § 170.3(o)(9) of this chapter to hydrolyze proteins or polypeptides. (2) The ingredient is used... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Trypsin. 184.1914 Section 184.1914 Food and Drugs... characterizing enzyme activity is that of a peptide hydrolase (EC 3.4.21.4). (b) The ingredient meets the general...
Code of Federal Regulations, 2010 CFR
2010-04-01
... defined in § 170.3(o)(9) of this chapter to hydrolyze proteins or polypeptides. (2) The ingredient is used... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Bromelain. 184.1024 Section 184.1024 Food and Drugs... amorphous powder. Its characterizing enzyme activity is that of a peptide hydrolase (EC 3.4.22.32). (b) The...
Code of Federal Regulations, 2011 CFR
2011-04-01
... amber to brown liquid. Its characterizing enzyme activity is that of a peptide hydrolase (EC 3.4.23.1...) The ingredient is used as an enzyme as defined in § 170.3(o)(9) of this chapter to hydrolyze proteins... 21 Food and Drugs 3 2011-04-01 2011-04-01 false Pepsin. 184.1595 Section 184.1595 Food and Drugs...
Code of Federal Regulations, 2012 CFR
2012-04-01
... amber to brown liquid. Its characterizing enzyme activity is that of a peptide hydrolase (EC 3.4.23.1...) The ingredient is used as an enzyme as defined in § 170.3(o)(9) of this chapter to hydrolyze proteins... 21 Food and Drugs 3 2012-04-01 2012-04-01 false Pepsin. 184.1595 Section 184.1595 Food and Drugs...
Code of Federal Regulations, 2014 CFR
2014-04-01
... practice conditions of use: (1) The ingredient is used as an enzyme as defined in § 170.3(o)(9) of this... 21 Food and Drugs 3 2014-04-01 2014-04-01 false Bromelain. 184.1024 Section 184.1024 Food and... characterizing enzyme activity is that of a peptide hydrolase (EC 3.4.22.32). (b) The ingredient meets the...
Code of Federal Regulations, 2010 CFR
2010-04-01
... amber to brown liquid. Its characterizing enzyme activity is that of a peptide hydrolase (EC 3.4.23.1...) The ingredient is used as an enzyme as defined in § 170.3(o)(9) of this chapter to hydrolyze proteins... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Pepsin. 184.1595 Section 184.1595 Food and Drugs...
Code of Federal Regulations, 2011 CFR
2011-04-01
...) The ingredient is used as an enzyme as defined in § 170.3(o)(9) of this chapter to hydrolyze proteins... 21 Food and Drugs 3 2011-04-01 2011-04-01 false Ficin. 184.1316 Section 184.1316 Food and Drugs... a white to off-white powder. Its characterizing enzyme activity is that of a peptide hydrolase (EC 3...
Code of Federal Regulations, 2014 CFR
2014-04-01
.... Its characterizing enzyme activity is that of a peptide hydrolase (EC 3.4.23.1). (b) The ingredient... manufacturing practice conditions of use: (1) The ingredient is used as an enzyme as defined in § 170.3(o)(9) of... 21 Food and Drugs 3 2014-04-01 2014-04-01 false Pepsin. 184.1595 Section 184.1595 Food and Drugs...
Code of Federal Regulations, 2010 CFR
2010-04-01
...) The ingredient is used as an enzyme as defined in § 170.3(o)(9) of this chapter to hydrolyze proteins... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Ficin. 184.1316 Section 184.1316 Food and Drugs... a white to off-white powder. Its characterizing enzyme activity is that of a peptide hydrolase (EC 3...
Code of Federal Regulations, 2012 CFR
2012-04-01
...) The ingredient is used as an enzyme as defined in § 170.3(o)(9) of this chapter to hydrolyze proteins... 21 Food and Drugs 3 2012-04-01 2012-04-01 false Ficin. 184.1316 Section 184.1316 Food and Drugs... a white to off-white powder. Its characterizing enzyme activity is that of a peptide hydrolase (EC 3...
Code of Federal Regulations, 2012 CFR
2012-04-01
... defined in § 170.3(o)(9) of this chapter to hydrolyze proteins or polypeptides. (2) The ingredient is used... 21 Food and Drugs 3 2012-04-01 2012-04-01 false Bromelain. 184.1024 Section 184.1024 Food and... amorphous powder. Its characterizing enzyme activity is that of a peptide hydrolase (EC 3.4.22.32). (b) The...
Munk, Aisha J. L.; Hermann, Andrea; El Shazly, Jasmin; Grant, Phillip; Hennig, Jürgen
2016-01-01
Background In event-related potentials, the N170 manifests itself especially in reaction to faces. In the healthy population, face-inversion leads to stronger negative amplitudes and prolonged latencies of the N170, effects not being present in patients with autism-spectrum-disorder (ASD). ASD has frequently been associated with differences in oxytocinergic neurotransmission. This ERP-study aimed to investigate the face-inversion effect in association with oxytocinergic candidate genes. It was expected that risk-allele-carriers of the oxytocin-receptor-gene-polymorphism (rs53576) and of CD38 (rs379863) responded similar to upright and inverted faces as persons with ASD. Additionally, reactions to different facial emotional expressions were studied. As there have been difficulties with replications of those molecular genetic association studies, we aimed to replicate our findings in a second study. Method Seventy-two male subjects in the first-, and seventy-eight young male subjects in the replication-study conducted a face-inversion-paradigm, while recording EEG. DNA was extracted from buccal cells. Results Results revealed stronger N170-amplitudes and longer latencies in reaction to inverted faces in comparison to upright ones. Furthermore, effects of emotion on N170 were evident. Those effects were present in the first and in the second study. Whereas we found molecular-genetic associations of oxytocinergic polymorphisms with the N170 in the first study, we failed to do so in the replication sample. Conclusion Results indicate that a deeper theoretical understanding of this research-field is needed, in order to generate possible explanations for these findings. Results, furthermore, support the hypotheses that success of reproducibility is correlated with strength of lower original p-values and larger effect sizes in the original study. PMID:27015428
It's a word: early electrophysiological response to the character likeness of pictographs.
Zhang, Mingxia; Jiang, Ting; Mei, Leilei; Yang, Hongmin; Chen, Chuansheng; Xue, Gui; Dong, Qi
2011-07-01
Using unfamiliar and meaningless pictographs that varied in their degree of similarity to Chinese characters, the current study tested whether the early electrophysiological response was modulated by character likeness. We measured P100 and N170 while 20 native Chinese speakers were viewing Chinese characters, drawings of objects, and pictographs. Comparisons across the three categories of stimuli showed that pictographs elicited a smaller N170 amplitude than did Chinese characters and a stronger N170 amplitude than did objects, but did not differ in the P100 amplitude from the other two categories. Within the category of pictographs, stimuli with a higher degree of character likeness elicited larger N170 amplitudes and shorter N170 peak latencies, and this effect was again not observed in P100. These results suggest that N170 is sensitive to visual stimuli's character likeness even though they are unfamiliar pictographs with no meanings or sounds. Copyright © 2010 Society for Psychophysiological Research.
Musi, Gennaro; Russo, Andrea; Conti, Andrea; Mistretta, Francesco A; Di Trapani, Ettore; Luzzago, Stefano; Bianchi, Roberto; Renne, Giuseppe; Ramoni, Stefano; Ferro, Matteo; Matei, Deliu Victor; Cusini, Marco; Carmignani, Luca; de Cobelli, Ottavio
2018-02-01
To evaluate the oncological and functional outcomes of patients diagnosed with penile cancer undergoing conservative treatment through thulium-yttrium-aluminium-garnet (Tm:YAG) laser ablation. Twenty-six patients with a penile lesion underwent ablation with a RevoLix 200 W continuous-wave laser. The procedure was carried out with a pen-like laser hand piece, using a 360 μm laser fiber and 15-20 W of power. Median (IQR) follow-up time was 24 (15-30) months. Recurrence rate and post-operative sexual function were assessed. Median age at surgery was 61 years. Median (inter quartile range) size of the lesions was 15 [10-20] mm. Overall, 11 (47.8%) and 12 (52.2%) at the final pathology presented in situ and invasive squamous cell carcinoma (SCC), respectively. The final pathological stage was pTis, pT1a, pT2, and pT3 in 11 (47.8%), 7 (30.4%), 3 (13.0%), and 2 (8.7%) patients, respectively. Moreover, four (17.4%) patients had a recurrence of which three (13.0%) and one (4.3%) patients developed an invasive or in situ recurrence, respectively. After treatment 6 (26.1%) patients reported a conserved penile sensitivity, while 13 (56.5%) and 4 (17.4%) patients experienced a better or worse sensitivity after ablation, respectively. Post-treatment sexual activity was achieved within the first month after laser ablation in 82.6% of the patients. Early stage penile carcinomas can be effectively treated with an organ preservation strategy. Tm:YAG conservative laser treatment is easy, safe and offers good functional outcome, with a minor impact on patient's quality of life.
Musi, Gennaro; Mistretta, Francesco A; Marenghi, Carlo; Russo, Andrea; Catellani, Michele; Nazzani, Sebastiano; Conti, Andrea; Luzzago, Stefano; Ferro, Matteo; Matei, Deliu V; Carmignani, Luca; de Cobelli, Ottavio
2018-03-01
To evaluate the efficacy and safety of ureteroscopic thulium laser (TL) treatment of upper urinary tract carcinoma (UTUC). Forty-two consecutive patients underwent conservative TL treatment for UTUC at two referral institutions. All patients underwent preliminary biopsy and then laser vaporization. A 272 μm and 365 μm laser fibers were used with a flexible and semirigid scope, respectively. Ablation was carried out with a 10 to 20 W power. Mean age at surgery was 68 years (SD 10.7). Mean tumor size was 14.3 mm (range 2-30 mm). Preliminary biopsy revealed the presence of low-grade disease in 29 (69.1%) patients, high-grade disease in 4 (9.5%) and 1 carcinoma in situ 1 (2.4%), whereas it was not conclusive in 8 (19%) cases. Final stage was pTa and pTis in 41 (97.6%) and 1 (2.4%) patients, respectively. Thirty eight percent (16) experienced Clavien-Dindo grade I complication, 47.6% (20) grade II, and 2.4% (1) grade III. Five (12%) patients underwent a second-look procedure due to residual disease. Eight (19%) patients experienced clinical recurrence. The median estimated recurrence-free survival was 44 months (SE 3.68). Four patients (9.5%) underwent a nephroureterectomy. Final pathological stage was pTis, pT3 high grade, pTa low grade, and pT0. Median follow-up was 26.3 months (range 2-54 months), and no progression or upstaging of disease occurred. TL management of UTUC is a safe and efficacious conservative treatment. Our experience shows optimal vaporization and hemostatic control in the absence of major complications.
Towards sub-100 fs multi-GW pulses directly emitted from a Thulium-doped fiber CPA system
NASA Astrophysics Data System (ADS)
Gaida, C.; Gebhardt, M.; Stutzki, F.; Jauregui, C.; Limpert, J.; Tünnermann, A.
2017-02-01
Experimental demonstrations of Tm-doped fiber amplifiers (typically in CW- or narrow-band pulsed operation) span a wavelength range going from about 1700 nm to well beyond 2000 nm. Thus, it should be possible to obtain a bandwidth of more than 100 nm, which would enable sub-100 fs pulse duration in an efficient, linear amplification scheme. In fact, this would allow the emission of pulses with less than 20 optical cycles directly from a Tm-doped fiber system, something that seems to be extremely challenging for other dopants in a fused silica fiber. In this contribution, we summarize the current development of our Thulium-doped fiber CPA system, demonstrate preliminary experiments for further scaling and discuss important design factors for the next steps. The current single-channel laser system presented herein delivers a pulse-peak power of 2 GW and a nearly transform-limited pulse duration of 200 fs in combination with 28.7 W of average power. Special care has been taken to reduce the detrimental impact of water vapor absorption by placing the whole system in a dry atmosphere housing (<0.1% rel. humidity) and by using a sufficiently long wavelength (1920-1980 nm). The utilization of a low-pressure chamber in the future will allow for the extension of the amplification bandwidth. Preliminary experiments demonstrating a broader amplification bandwidth that supports almost 100 fs pulse duration and average power scaling to < 100W have already been performed. Based on these results, a Tm-doped fiber CPA with sub-100 fs pulse duration, multi-GW pulse peak power and >100 W average power can be expected in the near future.
Gao, Yu; Zheng, Lanyan; Li, Jian-Jun; Du, Yuguang
2016-12-15
Two structural Ca 2+ (proximal and distal) is known to be important for ligninolytic peroxidases. However, few studies toward impact of residues involved in two Ca 2+ on properties of ligninolytic peroxidases have been done, especially the proximal one. In this study, mutants of nine residues involved in liganding two Ca 2+ of Pleurotus eryngii versatile peroxidase (VP) were investigated. Most mutants almost completely lost activities, except the mutants of proximal Ca 2+ - S170A and V192T. In comparison with WT (wild type), optimal pH values of S170A, S170D, and V192T shifted from pH 3.0 to pH 3.5. The order of thermal and pH stabilities of WT, V192T, S170A, and S170D is similar to that of their specific activities: WT > V192T > S170A > S170D. The CD (circular dichroism) results of WT and several mutants indicated that mutations had some effects on secondary structures. For the first time, it was observed that the thermostability of ligninolytic peroxidases is related with proximal Ca 2+ too, and the mutant containing distal Ca 2+ only was obtained. Our results clearly demonstrated that enzymatic activities, pH and thermal stabilities, Ca 2+ content, and secondary structures of VP have close relationship with the residues involved in two structural Ca 2+ . Copyright © 2016 Elsevier Inc. All rights reserved.
Deng, Zheng; Sun, Menghao; Zhu, Yiping; Zhuo, Jian; Zhao, Fujun; Xia, Shujie; Han, Bangmin; Herrmann, Thomas R W
2018-04-12
To compare the efficacy and safety of thulium laser VapoResection of the prostate (ThuVaRP) versus standard traditional transurethral resection of the prostate (TURP) or plasmakinetic resection of prostate (PKRP) for benign prostatic obstruction. Systematic searches were performed in the Medline, EMBASE, the Cochrane Library, Web of Science, and CNKI in December 2017. The outcomes of demographic and clinical characteristics, perioperative variables, complications, and postoperative efficacy including International Prostate Symptom Score (IPSS), quality of life (QoL), maximum flow rate (Qmax), and postvoid residual (PVR) were assessed. 16 studies were selected in the meta-analysis including nine randomized controlled trials (RCTs) and seven non-RCTs. Among of them, nine studies compared ThuVaRP with PKRP, while seven studies compared ThuVaRP with TURP. It seemed that ThuVaRP needed longer operation time than TURP (WMD = 6.41, 95% CI 1.38-11.44, p = 0.01) and PKRP (WMD = 10.15, 95% CI 5.20-15.10, p < 0.0001). ThuVaRP was associated with less serum hemoglobin decreased, catheterization time, and the length of hospital stay compared with TURP (WMD = - 0.58, 95% CI - 0.77 to 0.38, p < 0.00001; WMD = - 1.89, 95% CI - 2.67 to 1.11, p < 0.00001; WMD = - 2.25, 95% CI - 2.91 to 1.60, p < 0.00001) and PKRP (WMD = - 0.28, 95% CI - 0.46 to 0.10, p = 0.002; WMD = - 1.88, 95% CI - 2.87 to 0.89, p = 0.0002; WMD = - 2.08, 95% CI - 2.63 to 1.54, p<0.00001). According to our assessment, there was no significantly difference in postoperative efficacy. The pooled data indicated that ThuVaRP had a nearly efficacy to TURP and PKRP based on IPSS, QoL, Qmax, and PVR. Although ThuVaRP was associated with longer operation time, it got distinct superiority on serum hemoglobin decreased, catheterization time, and hospital stay.
Worthington, Jo; Taylor, Hilary; Abrams, Paul; Brookes, Sara T; Cotterill, Nikki; Noble, Sian M; Page, Tobias; Swami, K Satchi; Lane, J Athene; Hashim, Hashim
2017-04-17
Transurethral resection of the prostate (TURP) has been the standard operation for benign prostatic obstruction (BPO) for 40 years, with approximately 25,000 procedures performed annually, and has remained largely unchanged. It is generally a successful operation, but has well-documented risks for the patient. Thulium laser transurethral vaporesection of the prostate (ThuVARP) vaporises and resects the prostate using a surgical technique similar to TURP. The small amount of study data currently available suggests that ThuVARP may have certain advantages over TURP, including reduced blood loss and shorter hospital stay, earlier return to normal activities, and shorter duration of catheterisation. A multicentre, pragmatic, randomised, controlled, parallel-group trial of ThuVARP versus standard TURP in men with BPO. Four hundred and ten men suitable for prostate surgery were randomised to receive either ThuVARP or TURP at four university teaching hospitals, and three district general hospitals. The key aim of the trial is to determine whether ThuVARP is equivalent to TURP judged on both the patient-reported International Prostate Symptom Score (IPSS) and the maximum urine flow rate (Qmax) at 12 months post-surgery. The general population has an increased life expectancy. As men get older their prostates enlarge, potentially causing BPO, which often requires surgery. Therefore, as the population ages, more prostate operations are needed to relieve obstruction. There is hence sustained interest in the condition and increasing need to find safer techniques than TURP. Various laser techniques have become available but none are widely used in the NHS because of lengthy training required for surgeons or inferior performance on clinical outcomes. Promising initial evidence from one RCT shows that ThuVARP has equivalent clinical effectiveness when compared to TURP, as well as other potential advantages. As ThuVARP uses a technique similar to that used in TURP, the learning curve is short, potentially making it also very quickly generalisable. This randomised study is designed to provide the high-quality evidence, in an NHS setting, with a range of patient-reported, clinical and cost-effectiveness outcomes, which will underpin and inform future NICE guidance. ISRCTN registry, ISRCTN00788389 . Registered on 20 September 2013.
The N170 component is sensitive to face-like stimuli: a study of Chinese Peking opera makeup.
Liu, Tiantian; Mu, Shoukuan; He, Huamin; Zhang, Lingcong; Fan, Cong; Ren, Jie; Zhang, Mingming; He, Weiqi; Luo, Wenbo
2016-12-01
The N170 component is considered a neural marker of face-sensitive processing. In the present study, the face-sensitive N170 component of event-related potentials (ERPs) was investigated with a modified oddball paradigm using a natural face (the standard stimulus), human- and animal-like makeup stimuli, scrambled control images that mixed human- and animal-like makeup pieces, and a grey control image. Nineteen participants were instructed to respond within 1000 ms by pressing the ' F ' or ' J ' key in response to the standard or deviant stimuli, respectively. We simultaneously recorded ERPs, response accuracy, and reaction times. The behavioral results showed that the main effect of stimulus type was significant for reaction time, whereas there were no significant differences in response accuracies among stimulus types. In relation to the ERPs, N170 amplitudes elicited by human-like makeup stimuli, animal-like makeup stimuli, scrambled control images, and a grey control image progressively decreased. A right hemisphere advantage was observed in the N170 amplitudes for human-like makeup stimuli, animal-like makeup stimuli, and scrambled control images but not for grey control image. These results indicate that the N170 component is sensitive to face-like stimuli and reflect configural processing in face recognition.
Neural and cognitive face-selective markers: An integrative review.
Yovel, Galit
2016-03-01
Faces elicit robust and selective neural responses in the primate brain. These neural responses have been investigated with functional MRI and EEG in numerous studies, which have reported face-selective activations in the occipital-temporal cortex and an electrophysiological face-selective response that peaks 170 ms after stimulus onset at occipital-temporal sites. Evidence for face-selective processes has also been consistently reported in cognitive studies, which investigated the face inversion effect, the composite face effect and the left visual field (LVF) superiority. These cognitive effects indicate that the perceptual representation that we generate for faces differs from the representation that is generated for inverted faces or non-face objects. In this review, I will show that the fMRI and ERP face-selective responses are strongly associated with these three well-established behavioral face-selective measures. I will further review studies that examined the relationship between fMRI and EEG face-selective measures suggesting that they are strongly linked. Taken together these studies imply that a holistic representation of a face is generated at 170 ms after stimulus onset over the right hemisphere. These findings, which reveal a strong link between the various and complementary cognitive and neural measures of face processing, allow to characterize where, when and how faces are represented during the first 200 ms of face processing. Copyright © 2015 Elsevier Ltd. All rights reserved.
Code of Federal Regulations, 2013 CFR
2013-04-01
... practice conditions of use: (1) The ingredient is used as an enzyme as defined in § 170.3(o)(9) of this... 21 Food and Drugs 3 2013-04-01 2013-04-01 false Trypsin. 184.1914 Section 184.1914 Food and Drugs... characterizing enzyme activity is that of a peptide hydrolase (EC 3.4.21.4). (b) The ingredient meets the general...
Chen, Jiu; Ma, Wentao; Zhang, Yan; Wu, Xingqu; Wei, Dunhong; Liu, Guangxiong; Deng, Zihe; Yang, Laiqi; Zhang, Zhijun
2014-01-01
Background States of depression are associated with increased sensitivity to negative events. For this novel study, we have assessed the relationship between the number of depressive episodes and the dysfunctional processing of emotional facial expressions. Methodology/Principal Findings We used a visual emotional oddball paradigm to manipulate the processing of emotional information while event-related brain potentials were recorded in 45 patients with first episode major depression (F-MD), 40 patients with recurrent major depression (R-MD), and 46 healthy controls (HC). Compared with the HC group, F-MD patients had lower N170 amplitudes when identifying happy, neutral, and sad faces; R-MD patients had lower N170 amplitudes when identifying happy and neutral faces, but higher N170 amplitudes when identifying sad faces. F-MD patients had longer N170 latencies when identifying happy, neutral, and sad faces relative to the HC group, and R-MD patients had longer N170 latencies when identifying happy and neutral faces, but shorter N170 latencies when identifying sad faces compared with F-MD patients. Interestingly, a negative relationship was observed between N170 amplitude and the depressive severity score for identification of happy faces in R-MD patients while N170 amplitude was positively correlated with the depressive severity score for identification of sad faces in F-MD and R-MD patients. Additionally, the deficits of N170 amplitude for sad faces positively correlated with the number of depressive episodes in R-MD patients. Conclusion/Significance These results provide new evidence that having more recurrent depressive episodes and serious depressive states are likely to aggravate the already abnormal processing of emotional facial expressions in patients with depression. Moreover, it further suggests that the impaired processing as indexed by N170 amplitude for positive face identification may be a potentially useful biomarker for predicting propagation of depression while N170 amplitude for negative face identification could be a potential biomarker for depression recurrence. PMID:25314024
Sillakivi, T; Yang, Q; Peetsalu, A; Ohmann, C
2000-08-01
Ulcer surgery and the epidemiology of peptic ulcer perforation have changed considerably in recent decades. Within two prospective studies, 170 perforated peptic ulcer patients from 12 Eastern European centres and 37 patients from 11 German centres were analysed. The median age of patients was 43 years in the Copernicus study and 49 years in the MEDWIS study (P=n.s.), being higher for MEDWIS female patients (73 vs 53 years, respectively; P<0.05). Female patients made up 17% (29/170) of the Copernicus study and 35% (40/170) of the MEDWIS study (P<0.05). Twenty-three per cent (40/170) of patients in the Copernicus study and 54% (20/37) in the MEDWIS study had gastric ulcer perforation (P<0.001). The proportion of definitive operations was higher in Eastern Europe (41.1%; 67/163) than it was in Germany (16.1%; 5/31) (P<0.01). German patients experienced more general complications than Eastern European patients (35 vs 12%, respectively; P<0.01) and a higher mortality [13% (5/37) vs 2% (4/170), respectively; P<0.01]. Delayed admission > or =12 h and age > or =60 years remained predictors for complications in multivariate logistic regression analysis. The proportion of both women and gastric ulcers was higher among German patients, while Eastern European patients underwent more definitive operations. German patients experienced more general complications and a higher mortality. Complications were related to high age and delayed admission.
Qualification Testing of Laser Diode Pump Arrays for a Space-Based 2-micron Coherent Doppler Lidar
NASA Technical Reports Server (NTRS)
Amzajerdian, Farzin; Meadows, Byron L.; Baker, Nathaniel R.; Barnes, Bruce W.; Singh, Upendra N.; Kavaya, Michael J.
2007-01-01
The 2-micron thulium and holmium-based lasers being considered as the transmitter source for space-based coherent Doppler lidar require high power laser diode pump arrays operating in a long pulse regime of about 1 msec. Operating laser diode arrays over such long pulses drastically impact their useful lifetime due to the excessive localized heating and substantial pulse-to-pulse thermal cycling of their active regions. This paper describes the long pulse performance of laser diode arrays and their critical thermal characteristics. A viable approach is then offered that allows for determining the optimum operational parameters leading to the maximum attainable lifetime.
All-fiber laser at 1.94 µm: effect on soft tissue
NASA Astrophysics Data System (ADS)
Pal, Atasi; Pal, Debasis; Das Chowdhury, Sourav; Sen, Ranjan
2017-02-01
A focused laser beam at wavelength of strong water absorption at 1.94 μm can be a good scalpel for precision soft tissue surgery. A fiber Bragg grating-based, all-fiber, continuous-wave as well as modulated, cladding pumped, thulium-doped fiber laser at 1.94 μm has been configured to deliver up to 10 W of laser power under pumping at 793 nm having an efficiency of 32 %. The laser was exposed to freshly sacrificed chicken breast at different power level and exposure time. The formalin-fixed samples were examined by microscopy to identify the ablation region, carbonization and necrosis region for laser parameter optimization.
Double-Wall Carbon Nanotubes for Wide-Band, Ultrafast Pulse Generation
2014-01-01
We demonstrate wide-band ultrafast optical pulse generation at 1, 1.5, and 2 μm using a single-polymer composite saturable absorber based on double-wall carbon nanotubes (DWNTs). The freestanding optical quality polymer composite is prepared from nanotubes dispersed in water with poly(vinyl alcohol) as the host matrix. The composite is then integrated into ytterbium-, erbium-, and thulium-doped fiber laser cavities. Using this single DWNT–polymer composite, we achieve 4.85 ps, 532 fs, and 1.6 ps mode-locked pulses at 1066, 1559, and 1883 nm, respectively, highlighting the potential of DWNTs for wide-band ultrafast photonics. PMID:24735347
Efficient, diode-pumped Tm3+:BaY2F8 vibronic laser
NASA Astrophysics Data System (ADS)
Cornacchia, F.; Parisi, D.; Bernardini, C.; Toncelli, A.; Tonelli, M.
2004-05-01
In this work we report the spectroscopy and laser results of several Thulium doped BaY2F8 single crystals grown using the Czochralski technique. The doping concentration is between 2at.% and 18at.%. We performed room temperature laser experiments pumping the samples with a laser diode at 789 nm obtaining 61% as maximum optical-to-optical efficiency with a maximum output power of 290 mW and a minimum lasing threshold of 26 mW. The lasing wavelength changed with the dopant concentration from 1927 nm up to 2030 nm and the nature of the transition changed from purely electronic to vibronic, accordingly.
HO:LULF and HO:LULF Laser Materials
NASA Technical Reports Server (NTRS)
Barnes, Norman P. (Inventor); Morrison, Clyde A. (Inventor); Filer, Elizabeth D. (Inventor); Jani, Mahendra G. (Inventor); Murray, Keith E. (Inventor); Lockard, George E. (Inventor)
1998-01-01
A laser host material LULF (LuLiF4) is doped with holmium (Ho) and thulium (Tm) to produce a new laser material that is capable of laser light production in the vicinity of 2 microns. The material provides an advantage in efficiency over conventional Ho lasers because the LULF host material allows for decreased threshold and upconversion over such hosts as YAG and YLF. The addition of Tm allows for pumping by commonly available GaAlAs laser diodes. For use with flashlamp pumping, erbium (Er) may be added as an additional dopant. For further upconversion reduction, the Tm can be eliminated and the Ho can be directly pumped.
Crystallographic phases in heavy rare earth metals under megabar pressures
NASA Astrophysics Data System (ADS)
Samudrala, G. K.; Vohra, Y. K.
2012-07-01
Experiments aimed at understanding the crystallographic phases of heavy rare earth metals were carried out in a diamond anvil cell at the Advanced Photon Source, Argonne National Laboratory. Heavy rare earth metals dysprosium (Dy), holmium (Ho), erbium (Er) and thulium (Tm) were compressed to multi-megabar pressures. The rare earth crystal sequence hcp→Sm-type→dhcp→distorted-fcc (dfcc) is observed in all four elements. Upon further compression, a structural transformation to a monoclinic C2/m phase has been observed. We summarize the results from these experiments and present Rietveld structural refinements on high pressure phases for the specific case of dysprosium.
Miniature ball-tip optical fibers for use in thulium fiber laser ablation of kidney stones
NASA Astrophysics Data System (ADS)
Wilson, Christopher R.; Hardy, Luke A.; Kennedy, Joshua D.; Irby, Pierce B.; Fried, Nathaniel M.
2016-01-01
Optical fibers, consisting of 240-μm-core trunk fibers with rounded, 450-μm-diameter ball tips, are currently used during Holmium:YAG laser lithotripsy to reduce mechanical damage to the inner lining of the ureteroscope working channel during fiber insertion and prolong ureteroscope lifetime. Similarly, this study tests a smaller, 100-μm-core fiber with 300-μm-diameter ball tip during thulium fiber laser (TFL) lithotripsy. TFL was operated at a wavelength of 1908 nm, with 35-mJ pulse energy, 500-μs pulse duration, and 300-Hz pulse rate. Calcium oxalate/phosphate stone samples were weighed, laser procedure times were measured, and ablation rates were calculated for ball tip fibers, with comparison to bare tip fibers. Photographs of ball tips were taken before and after each procedure to track ball tip degradation and determine number of procedures completed before need for replacement. A high speed camera also recorded the cavitation bubble dynamics during TFL lithotripsy. Additionally, saline irrigation rates and ureteroscope deflection were measured with and without the presence of TFL fiber. There was no statistical difference (P>0.05) between stone ablation rates for single-use ball tip fiber (1.3±0.4 mg/s) (n=10), multiple-use ball tip fiber (1.3±0.5 mg/s) (n=44), and conventional single-use bare tip fibers (1.3±0.2 mg/s) (n=10). Ball tip durability varied widely, but fibers averaged greater than four stone procedures before failure, defined by rapid decline in stone ablation rates. Mechanical damage at the front surface of the ball tip was the limiting factor in fiber lifetime. The small fiber diameter did not significantly impact ureteroscope deflection or saline flow rates. The miniature ball tip fiber may provide a cost-effective design for safe fiber insertion through the ureteroscope working channel and into the ureter without risk of instrument damage or tissue perforation, and without compromising stone ablation efficiency during TFL lithotripsy.
Horovitz, Silvina G; Rossion, Bruno; Skudlarski, Pawel; Gore, John C
2004-08-01
Face perception is typically associated with activation in the inferior occipital, superior temporal (STG), and fusiform gyri (FG) and with an occipitotemporal electrophysiological component peaking around 170 ms on the scalp, the N170. However, the relationship between the N170 and the multiple face-sensitive activations observed in neuroimaging is unclear. It has been recently shown that the amplitude of the N170 component monotonically decreases as gaussian noise is added to a picture of a face [Jemel et al., 2003]. To help clarify the sources of the N170 without a priori assumptions regarding their number and locations, ERPs and fMRI were recorded in five subjects in the same experiment, in separate sessions. We used a parametric paradigm in which the amplitude of the N170 was modulated by varying the level of noise in a picture, and identified regions where the percent signal change in fMRI correlated with the ERP data. N170 signals were observed for pictures of both cars and faces but were stronger for faces. A monotonic decrease with added noise was observed for the N170 at right hemisphere sites but was less clear on the left and occipital central sites. Correlations between fMRI signal and N170 amplitudes for faces were highly significant (P < 0.001) in bilateral fusiform gyrus and superior temporal gyrus. For cars, the strongest correlations were observed in the parahippocampal region and in the STG (P < 0.005). Besides contributing to clarify the spatiotemporal course of face processing, this study illustrates how ERP information may be used synergistically in fMRI analyses. Parametric designs may be developed further to provide some timing information on fMRI activity and help identify the generators of ERP signals.
The Naked Truth: The Face and Body Sensitive N170 Response Is Enhanced for Nude Bodies
Hietanen, Jari K.; Nummenmaa, Lauri
2011-01-01
Recent event-related potential studies have shown that the occipitotemporal N170 component - best known for its sensitivity to faces - is also sensitive to perception of human bodies. Considering that in the timescale of evolution clothing is a relatively new invention that hides the bodily features relevant for sexual selection and arousal, we investigated whether the early N170 brain response would be enhanced to nude over clothed bodies. In two experiments, we measured N170 responses to nude bodies, bodies wearing swimsuits, clothed bodies, faces, and control stimuli (cars). We found that the N170 amplitude was larger to opposite and same-sex nude vs. clothed bodies. Moreover, the N170 amplitude increased linearly as the amount of clothing decreased from full clothing via swimsuits to nude bodies. Strikingly, the N170 response to nude bodies was even greater than that to faces, and the N170 amplitude to bodies was independent of whether the face of the bodies was visible or not. All human stimuli evoked greater N170 responses than did the control stimulus. Autonomic measurements and self-evaluations showed that nude bodies were affectively more arousing compared to the other stimulus categories. We conclude that the early visual processing of human bodies is sensitive to the visibility of the sex-related features of human bodies and that the visual processing of other people's nude bodies is enhanced in the brain. This enhancement is likely to reflect affective arousal elicited by nude bodies. Such facilitated visual processing of other people's nude bodies is possibly beneficial in identifying potential mating partners and competitors, and for triggering sexual behavior. PMID:22110574
Maurer, Urs; Zevin, Jason D.; McCandliss, Bruce D.
2015-01-01
The N170 component of the event-related potential (ERP) reflects experience-dependent neural changes in several forms of visual expertise, including expertise for visual words. Readers skilled in writing systems that link characters to phonemes (i.e., alphabetic writing) typically produce a left-lateralized N170 to visual word forms. This study examined the N170 in three Japanese scripts that link characters to larger phonological units. Participants were monolingual English speakers (EL1) and native Japanese speakers (JL1) who were also proficient in English. ERPs were collected using a 129-channel array, as participants performed a series of experiments viewing words or novel control stimuli in a repetition detection task. The N170 was strongly left-lateralized for all three Japanese scripts (including logographic Kanji characters) in JL1 participants, but bilateral in EL1 participants viewing these same stimuli. This demonstrates that left-lateralization of the N170 is dependent on specific reading expertise and is not limited to alphabetic scripts. Additional contrasts within the moraic Katakana script revealed equivalent N170 responses in JL1 speakers for familiar Katakana words and for Kanji words transcribed into novel Katakana words, suggesting that the N170 expertise effect is driven by script familiarity rather than familiarity with particular visual word forms. Finally, for English words and novel symbol string stimuli, both EL1 and JL1 subjects produced equivalent responses for the novel symbols, and more left-lateralized N170 responses for the English words, indicating that such effects are not limited to the first language. Taken together, these cross-linguistic results suggest that similar neural processes underlie visual expertise for print in very different writing systems. PMID:18370600
40 CFR 159.170 - Human epidemiological and exposure studies.
Code of Federal Regulations, 2012 CFR
2012-07-01
... 40 Protection of Environment 25 2012-07-01 2012-07-01 false Human epidemiological and exposure... Information § 159.170 Human epidemiological and exposure studies. Information must be submitted which concerns... that a correlation may exist between exposure to a pesticide and observed adverse effects in humans...
40 CFR 159.170 - Human epidemiological and exposure studies.
Code of Federal Regulations, 2014 CFR
2014-07-01
... 40 Protection of Environment 24 2014-07-01 2014-07-01 false Human epidemiological and exposure... Information § 159.170 Human epidemiological and exposure studies. Information must be submitted which concerns... that a correlation may exist between exposure to a pesticide and observed adverse effects in humans...
40 CFR 159.170 - Human epidemiological and exposure studies.
Code of Federal Regulations, 2013 CFR
2013-07-01
... 40 Protection of Environment 25 2013-07-01 2013-07-01 false Human epidemiological and exposure... Information § 159.170 Human epidemiological and exposure studies. Information must be submitted which concerns... that a correlation may exist between exposure to a pesticide and observed adverse effects in humans...
40 CFR 159.170 - Human epidemiological and exposure studies.
Code of Federal Regulations, 2011 CFR
2011-07-01
... 40 Protection of Environment 24 2011-07-01 2011-07-01 false Human epidemiological and exposure... Information § 159.170 Human epidemiological and exposure studies. Information must be submitted which concerns... that a correlation may exist between exposure to a pesticide and observed adverse effects in humans...
Exploring the effects of antisocial personality traits on brain potentials during face processing.
Pfabigan, Daniela M; Alexopoulos, Johanna; Sailer, Uta
2012-01-01
Antisocial individuals are characterized to display self-determined and inconsiderate behavior during social interaction. Furthermore, recognition deficits regarding fearful facial expressions have been observed in antisocial populations. These observations give rise to the question whether or not antisocial behavioral tendencies are associated with deficits in basic processing of social cues. The present study investigated early visual stimulus processing of social stimuli in a group of healthy female individuals with antisocial behavioral tendencies compared to individuals without these tendencies while measuring event-related potentials (P1, N170). To this end, happy and angry faces served as feedback stimuli which were embedded in a gambling task. Results showed processing differences as early as 88-120 ms after feedback onset. Participants low on antisocial traits displayed larger P1 amplitudes than participants high on antisocial traits. No group differences emerged for N170 amplitudes. Attention allocation processes, individual arousal levels as well as face processing are discussed as possible causes of the observed group differences in P1 amplitudes. In summary, the current data suggest that sensory processing of facial stimuli is functionally intact but less ready to respond in healthy individuals with antisocial tendencies.
Surgical Management and Prognostic Factors of Vulvovaginal Melanoma.
Ditto, Antonino; Bogani, Giorgio; Martinelli, Fabio; Di Donato, Violante; Laufer, Joel; Scasso, Santiago; Chiappa, Valentina; Signorelli, Mauro; Indini, Alice; Lorusso, Domenica; Raspagliesi, Francesco
2016-07-01
The aim of the study was to evaluate the surgical management and the role of different prognostic factors on survival outcomes of women affected by genital (i.e., vulvar and vaginal) melanoma. Data of patients undergoing primary surgical treatment for genital melanoma were evaluated in this retrospective study. Baseline, pathological, and postoperative variables were tested to identify prognostic factors. Five-year disease-free survival (DFS) and overall survival (OS) were analyzed using Kaplan-Meier and Cox proportional hazards models. Overall, 98 patients met the inclusion criteria. Sixty-seven (68%) and 31 (32%) patients in this study population were diagnosed with vulvar and vaginal melanoma, respectively. Median (range) DFS and OS were 12 (1-70) and 22 (1-70) months, respectively. Considering factors influencing DFS, we observed that at multivariate analysis, only vaginal localization (hazard ratio [HR] = 3.72; 95% CI = 1.05-13.2) and number of mitoses (HR = 1.24; 95% CI = 1.11-1.39) proved to be associated with worse DFS. Nodal status was the only independent factor influencing 5-year OS in patients with vulvar (HR = 1.76; 95% CI = 1.22-2.54; p = .002) and vaginal (HR = 3.65; 95% CI = 1.08-12.3; p = .03) melanoma. Genital melanomas are characterized by a poor prognosis. Number of mitoses and lymph node status are the main factors influencing survival. Surgery is the mainstay of treatment. A correct and prompt diagnosis is paramount.
Role of mp 170 Seprase in Breast Cancer.
1999-07-01
endogenous Seprase/FAPa in MDA-436 cells. Previously, three hammerhead ribozyme constructs targeting Seprase/FAPa at nucleotide residues 703, 892...breast cancer cells using the ribozyme approach. In contrast, I also constructed two hammerhead ribozymes targeting FGF-BP2 at nucleotide residues 223 and...molecule for further characterization, however, with little success. Ribozyme constructs targeting Seprase/FAPa were made, and despite their in vitro
Capsicum annum, a new host of watermelon mosaic virus.
Hajizadeh, Mohammad; Mohammadi, Kazhal
2016-03-01
The occurrence of Watermelon mosaic virus (WMV) in sweet pepper (Capsicum annuum L.) in Kurdistan province, Iran was confirmed by reverse transcriptase-polymerase chain reaction (RT-PCR) and partial characterization of coat protein. To the best of our knowledge, this is the first report of WMV infecting C. annuum, adding a new host to list of more than 170 species infected by this virus.
LOS selective fading and AN/FRC-170(V) radio hybrid computer simulation phase A report
NASA Astrophysics Data System (ADS)
Klukis, M. K.; Lyon, T. I.; Walker, R.
1981-09-01
This report documents results of the first phase of modeling, simulation and study of the dual diversity AN/FRC-170(V) radio and frequency selective fading line of sight channel. Both hybrid computer and circuit technologies were used to develop a fast, accurate and flexible simulation tool to investigate changes and proposed improvements to the design of the AN/FRC-170(V) radio. In addition to the simulation study, a remote hybrid computer terminal was provided to DCEC for interactive study of the modeled radio and channel. Simulated performance of the radio for Rayleigh, line of sight two ray channels, and additive noise are included in the report.
Andrade, Felipe; Casciola-Rosen, Livia A; Rosen, Antony
2005-04-01
To determine whether ultraviolet B (UVB) irradiation induces novel modifications in autoantigens targeted during experimental photoinduced epidermal damage. To search for novel UVB-induced autoantigen modifications, lysates made from UVB-irradiated human keratinocytes or HeLa cells were immunoblotted using human autoantibodies that recognize ribonucleoprotein autoantigens. Novel autoantigen structures identified were further characterized using nucleases and RNA hybridization. Human sera that recognize U1-70 kd (U1-70K) and La by immunoblotting also recognized multiple novel species when they were used to immunoblot lysates of UVB-irradiated keratinocytes or HeLa cells. These species were not present in control cells and were not observed when apoptosis was induced by Fas ligation or cytotoxic lymphocyte granule contents. Biochemical analysis using multiple assays revealed that these novel UVB-induced molecular species result from the covalent crosslinking between the U1 RNA and the hYRNA molecules with their associated proteins, including U1-70K, La, and likely components of the Sm particle. These data demonstrate that UVB irradiation of live cells can directly induce covalent RNA-protein complexes, which are recognized by human autoantibodies. As previously described for other autoantigens, these covalent complexes of RNA and proteins may have important consequences in terms of antigen capture and processing.
Analysis of the velocity law in the wind of the Be star Lambda Pavonis
NASA Technical Reports Server (NTRS)
Chen, Haiqi; Ringuelet, Adela; Sahade, Jorge; Kondo, Yoji
1989-01-01
This paper reanalyzes the IUE spectra of Lambda Pavonis secured in 1982 (Sahade et al.). It is found that the profiles of the broad UV lines are either rotationally broadened or nonrotationally broadened and that the rotationally broadened profiles can be sorted out in two groups characterized by rotational velocity values of 170 km/s and of 210 km/s, respectively. From the analysis of the rotational and of the radial velocities it is possible to distinguish two regions in the extended atmosphere of the star, namely, a region which is rotating and a region which is expanding. In the rotating region, the radial velocities are about zero, and the rotational velocity increases from 170 km/s to 250 km/s. In the expanding region, the rotational energy dissipates, the wind is accelerated to a maximum of -155 km/s, and farther out it decelerates.
The role of lasers in modern urology.
Dołowy, Łukasz; Krajewski, Wojciech; Dembowski, Janusz; Zdrojowy, Romuald; Kołodziej, Anna
2015-01-01
The functioning of modern urological departments and the high level of service they provide is possible through, among other things, the use of modern laser techniques. Open operations have been replaced by minimally invasive procedures, and classical surgical tools by advanced lasers. The search for new applications with lasers began as technology developed. Among many devices available, holmium, diode and thulium lasers are currently the most popular. Depending on the wavelength, the absorption by water and hemoglobin and the depth of penetration, lasers can be used for coagulation, vaporization and enucleation. In many centres, after all the possibilities of pharmacological treatment have been exhausted, lasers are used as the primary treatment for patients with benign prostatic hyperplasia, with therapeutic results that are better than those obtained through open or endoscopic operations. The use of lasers in the treatment of urolithiasis, urinary strictures and bladder tumours has made treatment of older patients with multiple comorbidities safe, without further necessity to modify the anticoagulant drug treatment. Laser procedures are additionally less invasive, reduce hospitalization time and enable a shorter bladder catheterization time, sometimes even eliminating the need for bladder catherterization completely. Such procedures are also characterized by more stable outcomes and a lower number of reoperations. There are also indications that with the increased competition among laser manufacturers, decreased purchase and maintenance costs, and increased operational safety, laser equipment will become mandatory and indispensable asset in all urology wards.
Magnetic phase investigations on fluorine (F) doped LiFePO4
NASA Astrophysics Data System (ADS)
Radhamani, A. V.
2018-03-01
LiFePO4 (LFP) is a very promising cathode material for Li-ion batteries due to its high thermal stability, less toxicity and high theoretical capacity (170 mAh g-1). Anion doping, especially fluorine (F) at the oxygen site is one way to improve the low electronic conductivity of the material. In this line, fluorine doped LFP was prepared at different fluorine concentrations (1 to 40 mol%) to study the structural, spectroscopic and magnetic properties in view of the material property optimization for battery applications. The investigation of the magnetic properties was found to be successful for the determination of small amounts of magnetic impurities which were not noticeably observed from structural characterizations. Determination of conducting magnetic impurities has its own relevance in the current scenario of Li-ion based battery applications. Systematic characterization studies along with the implications of magnetic phases on the material activity of fluorine doped LiFePO4 nanoparticles will be discussed in detail.
21 CFR 184.1330 - Acacia (gum arabic).
Code of Federal Regulations, 2011 CFR
2011-04-01
...) of this chapter; formulation aid, § 170.3(o)(14) of this chapter; stabilizer and thickener, § 170.3(o... and thickener, § 170.3(o)(28) of this chapter; surface-finishing agent, § 170.3(o)(30) of this chapter... chapter; stabilizer and thickener, § 170.3(o)(28) of this chapter. Fats and oils, § 170.3(n)(12) of this...
Yuan, Bangqing; Xian, Ronghua; Wu, Xianqu; Jing, Junjie; Chen, Kangning; Liu, Guojun; Zhou, Zhenhua
2012-07-01
Previous evidence suggested that the stress protein grp170 can function as a highly efficient molecular chaperone, binding to large protein substrates and acting as a potent vaccine against specific tumors when purified from the same tumor. In addition, Pokemon can be found in almost all malignant tumor cells and is regarded to be a promising candidate for the treatment of tumors. However, the potential of the grp170-Pokemon chaperone complex has not been well described. In the present study, the natural chaperone complex between grp170 and the Pokemon was formed by heat shock, and its immunogenicity was detected by ELISPOT and (51)Cr-release assays in vitro and by tumor bearing models in vivo. Our results demonstrated that the grp170-Pokemon chaperone complex could elicit T cell responses as determined by ELISPOT and (51)Cr-release assays. In addition, immunized C57BL/6 mice were challenged with subcutaneous (s.c.) injection of Lewis cancer cells to induce primary tumors. Treatment of mice with the grp170-Pokemon chaperone complex also significantly inhibited tumor growth and prolonged the life span of tumor-bearing mice. Our results indicated that the grp170-Pokemon chaperone complex might represent a powerful approach to tumor immunotherapy and have significant potential for clinical application. Copyright © 2012 Elsevier GmbH. All rights reserved.
21 CFR 184.1133 - Ammonium alginate.
Code of Federal Regulations, 2011 CFR
2011-04-01
..., § 170.3(n)(9) of this chapter 0.4 Stabilizer, thickener, § 170.3(o)(28) of this chapter. Fats and oils, § 170.3(n)(12) of this chapter 0.5 Do. Gelatins, puddings, § 170.3(n)(22) of this chapter 0.5 Do... Humectant, § 170.3(o)(16) of this chapter; stabilizer, thickener, § 170.3(o)(28) of this chapter. (d) Prior...
21 CFR 184.1133 - Ammonium alginate.
Code of Federal Regulations, 2010 CFR
2010-04-01
..., § 170.3(n)(9) of this chapter 0.4 Stabilizer, thickener, § 170.3(o)(28) of this chapter. Fats and oils, § 170.3(n)(12) of this chapter 0.5 Do. Gelatins, puddings, § 170.3(n)(22) of this chapter 0.5 Do... Humectant, § 170.3(o)(16) of this chapter; stabilizer, thickener, § 170.3(o)(28) of this chapter. (d) Prior...
Yin, Xinjian; Wu, Jianping; Yang, Lirong
2018-05-01
The objective of this study was to identify and exploit a robust biocatalyst that can be applied in reductive amination for enantioselective synthesis of the competitive herbicide L-phosphinothricin. Applying a genome mining-based library construction strategy, eight NADPH-specific glutamate dehydrogenases (GluDHs) were identified for reductively aminating 2-oxo-4-[(hydroxy)(methyl)phosphinoyl]butyric acid (PPO) to L-phosphinothricin. Among them, the glutamate dehydrogenase cloned from Pseudomonas putida (PpGluDH) exhibited relatively high catalytic activity and favorable soluble expression. This enzyme was purified to homogeneity for further characterization. The specific activity of PpGluDH was 296.1 U/g-protein, which is significantly higher than the reported value for a GluDH. To the best of our knowledge, there has not been any report on protein engineering of GluDH for PPO-oriented activity. Taking full advantage of the available information and the diverse characteristics of the enzymes in the enzyme library, PpGluDH was engineered by site-directed mutation based on multiple sequence alignment. The mutant I170M, which had 2.1-fold enhanced activity, was successfully produced. When the I170M mutant was applied in the batch production of L-phosphinothricin, it showed markedly improved catalytic efficiency compared with the wild type enzyme. The conversion reached 99% (0.1 M PPO) with an L-phosphinothricin productivity of 1.35 g/h·L, which far surpassed the previously reported level. These results show that PpGluDH I170M is a promising biocatalyst for highly enantioselective synthesis of L-phosphinothricin by reductive amination.
Dégut, Clément; Ponchon, Luc; Folly-Klan, Marcia; Barraud, Pierre; Tisné, Carine
2016-03-01
The enzymes of the TrmI family catalyze the formation of the m(1)A58 modification in tRNA. We previously solved the crystal structure of the Thermus thermophilus enzyme and conducted a biophysical study to characterize the interaction between TrmI and tRNA. TrmI enzymes are active as a tetramer and up to two tRNAs can bind to TrmI simultaneously. In this paper, we present the structures of two TrmI mutants (D170A and Y78A). These residues are conserved in the active site of TrmIs and their mutations result in a dramatic alteration of TrmI activity. Both structures of TrmI mutants revealed the flexibility of the N-terminal domain that is probably important to bind tRNA. The structure of TrmI Y78A catalytic domain is unmodified regarding the binding of the SAM co-factor and the conformation of residues potentially interacting with the substrate adenine. This structure reinforces the previously proposed role of Y78, i.e. stabilize the conformation of the A58 ribose needed to hold the adenosine in the active site. The structure of the D170A mutant shows a flexible active site with one loop occupying in part the place of the co-factor and the second loop moving at the entrance to the active site. This structure and recent data confirms the central role of D170 residue binding the amino moiety of SAM and the exocyclic amino group of adenine. Possible mechanisms for methyl transfer are then discussed. Copyright © 2015 Elsevier B.V. All rights reserved.
Structural face encoding: How task affects the N170's sensitivity to race.
Senholzi, Keith B; Ito, Tiffany A
2013-12-01
The N170 event-related potential (ERP) component differentiates faces from non-faces, but studies aimed at investigating whether the processing indexed by this component is also sensitive to racial differences among faces have garnered conflicting results. Here, we explore how task affects the influence of race on the N170 among White participants. N170s were larger to ingroup White faces than outgroup Black faces, but only for those required to attend to race, suggesting that attention to race can result in deeper levels of processing for ingroup members. Conversely, N170s were larger to Black faces than White faces for participants who attended to the unique identity of the faces, suggesting that attention to identity can result in preferential recruitment of cognitive resources for outgroup members. Taken together, these findings suggest that race can differentially impact face processing at early stages of encoding, but differences in processing are contingent upon one's goal state.
The face-selective N170 component is modulated by facial color.
Nakajima, Kae; Minami, Tetsuto; Nakauchi, Shigeki
2012-08-01
Faces play an important role in social interaction by conveying information and emotion. Of the various components of the face, color particularly provides important clues with regard to perception of age, sex, health status, and attractiveness. In event-related potential (ERP) studies, the N170 component has been identified as face-selective. To determine the effect of color on face processing, we investigated the modulation of N170 by facial color. We recorded ERPs while subjects viewed facial color stimuli at 8 hue angles, which were generated by rotating the original facial color distribution around the white point by 45° for each human face. Responses to facial color were localized to the left, but not to the right hemisphere. N170 amplitudes gradually increased in proportion to the increase in hue angle from the natural-colored face. This suggests that N170 amplitude in the left hemisphere reflects processing of facial color information. Copyright © 2012 Elsevier Ltd. All rights reserved.
The effects of facial color and inversion on the N170 event-related potential (ERP) component.
Minami, T; Nakajima, K; Changvisommid, L; Nakauchi, S
2015-12-17
Faces are important for social interaction because much can be perceived from facial details, including a person's race, age, and mood. Recent studies have shown that both configural (e.g. face shape and inversion) and surface information (e.g. surface color and reflectance properties) are important for face perception. Therefore, the present study examined the effects of facial color and inverted face properties on event-related potential (ERP) responses, particularly the N170 component. Stimuli consisted of natural and bluish-colored faces. Faces were presented in both upright and upside down orientations. An ANOVA was used to analyze N170 amplitudes and verify the effects of the main independent variables. Analysis of N170 amplitude revealed the significant interactions between stimulus orientation and color. Subsequent analysis indicated that N170 was larger for bluish-colored faces than natural-colored faces, and N170 to natural-colored faces was larger in response to inverted stimulus as compared to upright stimulus. Additionally, a multivariate pattern analysis (MVPA) investigated face-processing dynamics without any prior assumptions. Results distinguished, above chance, both facial color and orientation from single-trial electroencephalogram (EEG) signals. Decoding performance for color classification of inverted faces was significantly diminished as compared to an upright orientation. This suggests that processing orientation is predominant over facial color. Taken together, the present findings elucidate the temporal and spatial distribution of orientation and color processing during face processing. Copyright © 2015 IBRO. Published by Elsevier Ltd. All rights reserved.
Hardin, Shane C; Tang, Guo-Qing; Scholz, Anke; Holtgraewe, Daniela; Winter, Heike; Huber, Steven C
2003-09-01
Sequence analysis identified serine 170 (S170) of the maize (Zea mays L.) SUS1 sucrose synthase (SUS) protein as a possible, second phosphorylation site. Maize leaves contained two calcium-dependent protein kinase activities and a calcium-independent kinase activity with characteristics of an sucrose non-fermenting 1 (SNF1)-related protein kinase. Phosphorylation of the novel S170 and the known serine 15 (S15) site by these protein kinases was determined in peptide substrates and detected in SUS1 protein substrates utilizing sequence- and phosphorylation-specific antibodies. We demonstrate phosphorylation of S170 in vitro and in vivo. The calcium-dependent protein kinases phosphorylated both S170 and S15, whereas SNF1-related protein kinase activity was restricted to S15. Calcium-dependent protein-kinase-mediated S170 and S15 phosphorylation kinetics were determined in wild-type and mutant SUS1 substrates. These analyses revealed that kinase specificity for S170 was threefold lower than that for S15, and that phosphorylation of S170 was stimulated by prior phosphorylation at the S15 site. The SUS-binding peptides encoded by early nodulin 40 (ENOD40) specifically antagonized S170 phosphorylation in vitro. A model wherein S170 phosphorylation functions as part of a mechanism targeting SUS for proteasome-mediated degradation is supported by the observations that SUS proteolytic fragments: (i) were detected and possessed relatively high phosphorylated-S170 (pS170) stoichiometry; (ii) were spatially coincident with proteasome activity within developing leaves; and (iii) co-sedimented with proteasome activity. In addition, full-length pS170-SUS protein was less stable than S170-SUS in cultured leaf segments and was stabilized by proteasome inhibition. Post-translational control of SUS protein level through pS170-promoted proteolysis may explain the specific and significant decrease in SUS abundance that accompanies the sink-to-source transition in developing maize leaves.
Labrie, Simon J.; Tremblay, Denise M.; Moisan, Maxim; Villion, Manuela; Magadán, Alfonso H.; Campanacci, Valérie; Cambillau, Christian
2012-01-01
The dairy industry uses the mesophilic, Gram-positive, lactic acid bacterium (LAB) Lactococcus lactis to produce an array of fermented milk products. Milk fermentation processes are susceptible to contamination by virulent phages, but a plethora of phage control strategies are available. One of the most efficient is to use LAB strains carrying phage resistance systems such as abortive infection (Abi) mechanisms. Yet, the mode of action of most Abi systems remains poorly documented. Here, we shed further light on the antiviral activity of the lactococcal AbiT system. Twenty-eight AbiT-resistant phage mutants derived from the wild-type AbiT-sensitive lactococcal phages p2, bIL170, and P008 were isolated and characterized. Comparative genomic analyses identified three different genes that were mutated in these virulent AbiT-insensitive phage derivatives: e14 (bIL170 [e14bIL170]), orf41 (P008 [orf41P008]), and orf6 (p2 [orf6p2] and P008 [orf6P008]). The genes e14bIL170 and orf41P008 are part of the early-expressed genomic region, but bioinformatic analyses did not identify their putative function. orf6 is found in the phage morphogenesis module. Antibodies were raised against purified recombinant ORF6, and immunoelectron microscopy revealed that it is the major capsid protein (MCP). Coexpression in L. lactis of ORF6p2 and ORF5p2, a protease, led to the formation of procapsids. To our knowledge, AbiT is the first Abi system involving distinct phage genes. PMID:22820334
ERIC Educational Resources Information Center
Hsu, Chun-Hsien; Tsai, Jie-Li; Lee, Chia-Ying; Tzeng, Ovid J. -L.
2009-01-01
In this study, event-related potentials (ERPs) were used to trace the temporal dynamics of phonological consistency and phonetic combinability in the reading of Chinese phonograms. The data showed a significant consistency-by-combinability interaction at N170. High phonetic combinability characters elicited greater negativity at N170 than did low…
Novel approach for solid state cryocoolers.
Volpi, Azzurra; Di Lieto, Alberto; Tonelli, Mauro
2015-04-06
Laser cooling in solids is based on anti-Stokes luminescence, via the annihilation of lattice phonons needed to compensate the energy of emitted photons, higher than absorbed ones. Usually the anti-Stokes process is obtained using a rare-earth active ion, like Yb. In this work we demonstrate a novel approach for optical cooling based not only to Yb anti-Stokes cycle but also to virtuous energy-transfer processes from the active ion, obtaining an increase of the cooling efficiency of a single crystal LiYF(4) (YLF) doped Yb at 5at.% with a controlled co-doping of 0.0016% Thulium ions. A model for efficiency enhancement based on Yb-Tm energy transfer is also suggested.
NASA Astrophysics Data System (ADS)
Posada-Ramírez, B.; Durán-Sánchez, M.; Álvarez-Tamayo, R. I.; Ibarra-Escamilla, B.; Hernández-Arriaga, M. V.; Sánchez-de-la-Llave, D.; Kuzin, E. A.
2017-08-01
We propose an all-fiber Tm-doped fiber laser with a tunable and narrow laser line generated in a wavelength region of 2 µm. A single laser line with a linewidth below 0.05 nm, tunable in a wavelength range of 44.25 nm, is obtained. The laser linewidth and the discrete wavelength tuning range depend on the characteristics of the two fiber optical loop mirrors with high birefringence in the loop that forms the cavity. Dual-wavelength laser operation is also observed at tuning range limits with a wavelength separation of 47 nm. Alternate wavelength switching is also observed.
Modelling of graphene Q-switched Tm lasers
NASA Astrophysics Data System (ADS)
Yasukevich, A. S.; Loiko, P.; Gusakova, N. V.; Serres, J. M.; Mateos, X.; Yumashev, K. V.; Kuleshov, N. V.; Petrov, V.; Griebner, U.; Aguiló, M.; Díaz, F.
2017-04-01
We report on a model of diode-pumped Thulium lasers passively Q-switched by a graphene saturable absorber applicable also for any other "fast" saturable absorber. It reasonably predicts the dependence of the pulse duration, pulse energy and pulse repetition frequency on the absorbed power. The model is applied in the present work for a Tm: KLuW microchip laser passively Q-switched with a multi-layer graphene saturable absorber. The laser generates 1 W at 1926 nm with a slope efficiency of 39%. Stable 190 ns /4.1 μJ pulses are achieved at a pulse repetition frequency of 260 kHz. The potential of graphene for the generation of few-ns pulses at 2 μm is discussed.
Watt-level ~2 μm laser output in Tm3+-doped tungsten tellurite glass double-cladding fiber.
Li, Kefeng; Zhang, Guang; Hu, Lili
2010-12-15
We report, for the first time to the best of our knowledge, a watt level cw fiber laser at ~2 μm from a piece of 40-cm-long newly developed highly thulium-doped (3.76 × 10(20) ions/cm(3)) tungsten tellurite glass double cladding fiber pumped by a commercial 800 nm laser diode. The maximum output power of the fiber laser reaches 1.12 W. The slope efficiency and the optical-optical efficiency with respect to the absorbed pump are 20% and 16%, respectively. The lasing threshold is 1.46 W, and the lasing wavelength is centered at 1937 nm.
Thermodynamic Investigation of the Reduction-Distillation Process for Rare Earth Metals Production
NASA Astrophysics Data System (ADS)
Judge, W. D.; Azimi, G.
2017-10-01
Owing to their high vapor pressure, the four rare earth metals samarium, europium, thulium, and ytterbium are produced by reduction-distillation whereby their oxides are reduced with metallic lanthanum in vacuo, and the produced metal is subsequently vaporized off. Here, we performed a thorough thermodynamic investigation to establish a fundamental understanding of the reduction-distillation process. Thermodynamic functions including vapor pressures, Gibbs free energies, and enthalpies of reaction were calculated and compared with available experimental data. Furthermore, the kinetics of the process was explored and theoretical evaporation rates were calculated from thermodynamic data. The thermodynamic model developed in this work can help optimize processing conditions to maximize the yield and improve the overall process.
Comparison of different wavelength pump sources for Tm subnanosecond amplifier
NASA Astrophysics Data System (ADS)
Cserteg, Andras; Guillemet, Sébastien; Hernandez, Yves; Giannone, Domenico
2012-06-01
We report here a comparison of different pumping wavelengths for short pulse Thulium fibre amplifiers. We compare the results in terms of efficiency and required fibre length. As we operate the laser in the sub-nanosecond regime, the fibre length is a critical parameter regarding non linear effects. With 793 nm clad-pumping, a 4 m long active fibre was necessary, leading to strong spectral deformation through Self Phase Modulation (SPM). Core-pumping scheme was then more in-depth investigated with several wavelengths tested. Good results with Erbium and Raman shifted pumping sources were obtained, with very short fibre length, aiming to reach a few micro-joules per pulse without (or with limited) SPM.
48 CFR 243.170 - Identification of foreign military sale (FMS) requirements.
Code of Federal Regulations, 2010 CFR
2010-10-01
... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Identification of foreign military sale (FMS) requirements. 243.170 Section 243.170 Federal Acquisition Regulations System DEFENSE....170 Identification of foreign military sale (FMS) requirements. Follow the procedures at PGI 243.170...
Risk factors for autistic regression: results of an ambispective cohort study.
Zhang, Ying; Xu, Qiong; Liu, Jing; Li, She-chang; Xu, Xiu
2012-08-01
A subgroup of children diagnosed with autism experience developmental regression featured by a loss of previously acquired abilities. The pathogeny of autistic regression is unknown, although many risk factors likely exist. To better characterize autistic regression and investigate the association between autistic regression and potential influencing factors in Chinese autistic children, we conducted an ambispective study with a cohort of 170 autistic subjects. Analyses by multiple logistic regression showed significant correlations between autistic regression and febrile seizures (OR = 3.53, 95% CI = 1.17-10.65, P = .025), as well as with a family history of neuropsychiatric disorders (OR = 3.62, 95% CI = 1.35-9.71, P = .011). This study suggests that febrile seizures and family history of neuropsychiatric disorders are correlated with autistic regression.
Gender Differences in Graduate Students' Perspectives on the Culture of Science
NASA Astrophysics Data System (ADS)
Ferreira, Maria M.
In this study, gender differences in graduate students' perspectives on the culture of science were examined in two graduate departments (biology and chemistry) at a large research university. Data from a survey questionnaire from 170 students and interviews with 32 of them indicated that the culture of science as experienced by the participants of this study was characterized by competition, a narrow focus, and a belief in objectivity. These perspectives were particularly common among the female students, who also perceived a role conflict between a successful career in science and having a family. The study shows that although women have greater access to careers in science, the culture of the scientific enterprise continues to be based on the masculine ideals of 17th-century England.
Rashrash, Mohamed; Phalakornkule, Kanitha; Carpenter, Janet S; Jones, Josette F
2016-01-01
Background Advancements in information technology (IT) and its increasingly ubiquitous nature expand the ability to engage patients in the health care process and motivate health behavior change. Objective Our aim was to systematically review the (1) impact of IT platforms used to promote patients’ engagement and to effect change in health behaviors and health outcomes, (2) behavior theories or models applied as bases for developing these interventions and their impact on health outcomes, (3) different ways of measuring health outcomes, (4) usability, feasibility, and acceptability of these technologies among patients, and (5) challenges and research directions for implementing IT platforms to meaningfully impact patient engagement and health outcomes. Methods PubMed, Web of Science, PsycINFO, and Google Scholar were searched for studies published from 2000 to December 2014. Two reviewers assessed the quality of the included papers, and potentially relevant studies were retrieved and assessed for eligibility based on predetermined inclusion criteria. Results A total of 170 articles met the inclusion criteria and were reviewed in detail. Overall, 88.8% (151/170) of studies showed positive impact on patient behavior and 82.9% (141/170) reported high levels of improvement in patient engagement. Only 47.1% (80/170) referenced specific behavior theories and only 33.5% (57/170) assessed the usability of IT platforms. The majority of studies used indirect ways to measure health outcomes (65.9%, 112/170). Conclusions In general, the review has shown that IT platforms can enhance patient engagement and improve health outcomes. Few studies addressed usability of these interventions, and the reason for not using specific behavior theories remains unclear. Further research is needed to clarify these important questions. In addition, an assessment of these types of interventions should be conducted based on a common framework using a large variety of measurements; these measurements should include those related to motivation for health behavior change, long-standing adherence, expenditure, satisfaction, and health outcomes. PMID:26795082
The Background of Reduced Face Specificity of N170 in Congenital Prosopagnosia
Schweinberger, Stefan R.; Vakli, Pál; Kovács, Gyula
2014-01-01
Congenital prosopagnosia is lifelong face-recognition impairment in the absence of evidence for structural brain damage. To study the neural correlates of congenital prosopagnosia, we measured the face-sensitive N170 component of the event-related potential in three members of the same family (father (56 y), son (25 y) and daughter (22 y)) and in age-matched neurotypical participants (young controls: n = 14; 24.5 y±2.1; old controls: n = 6; 57.3 y±5.4). To compare the face sensitivity of N170 in congenital prosopagnosic and neurotypical participants we measured the event-related potentials for faces and phase-scrambled random noise stimuli. In neurotypicals we found significantly larger N170 amplitude for faces compared to noise stimuli, reflecting normal early face processing. The congenital prosopagnosic participants, by contrast, showed reduced face sensitivity of the N170, and this was due to a larger than normal noise-elicited N170, rather than to a smaller face-elicited N170. Interestingly, single-trial analysis revealed that the lack of face sensitivity in congenital prosopagnosia is related to a larger oscillatory power and phase-locking in the theta frequency-band (4–7 Hz, 130–190 ms) as well as to a lower intertrial jitter of the response latency for the noise stimuli. Altogether, these results suggest that congenital prosopagnosia is due to the deficit of early, structural encoding steps of face perception in filtering between face and non-face stimuli. PMID:24983881
Barca-Tierno, Verónica; Aza-Carmona, Miriam; Barroso, Eva; Heine-Suner, Damia; Azmanov, Dimitar; Rosell, Jordi; Ezquieta, Begoña; Montané, Lucia Sentchordi; Vendrell, Teresa; Cruz, Jaime; Santos, Fernando; Rodríguez, José Ignacio; Pozo, Jesús; Argente, Jesús; Kalaydjieva, Luba; Gracía, Ricardo; Campos-Barros, Ángel; Benito-Sanz, Sara; Heath, Karen E
2011-01-01
We report the clinical and molecular characteristics of 12 Spanish families with multiple members affected with Léri-Weill dyschondrosteosis (LWD) or Langer mesomelic dysplasia (LMD), who present the SHOX (short stature homeobox gene) mutation p.A170P (c.508G>C) in heterozygosity or homozygosity, respectively. In all studied families, the A170P mutation co-segregated with the fully penetrant phenotype of mesomelic limb shortening and Madelung deformity. A shared haplotype around SHOX was observed by microsatellite analysis, confirming the presence of a common ancestor, probably of Gypsy origin, as 11 of the families were of this ethnic group. Mutation screening in 359 Eastern-European Gypsies failed to identify any carriers. For the first time, we have shown SHOX expression in the human growth plate of a 22-week LMD fetus, homozygous for the A170P mutation. Although the mutant SHOX protein was expressed in all zones of the growth plate, the chondrocyte columns in the proliferative zone were disorganized with the chondrocytes occurring in smaller columnal clusters. We have also identified a novel mutation at the same residue, c. 509C>A (p.A170D), in two unrelated Spanish LWD families, which similar to A170P mutation impedes nuclear localization of SHOX. In conclusion, we have identified A170P as the first frequent SHOX mutation in Gypsy LWD and LMD individuals. PMID:21712857
Barca-Tierno, Verónica; Aza-Carmona, Miriam; Barroso, Eva; Heine-Suner, Damia; Azmanov, Dimitar; Rosell, Jordi; Ezquieta, Begoña; Montané, Lucia Sentchordi; Vendrell, Teresa; Cruz, Jaime; Santos, Fernando; Rodríguez, José Ignacio; Pozo, Jesús; Argente, Jesús; Kalaydjieva, Luba; Gracía, Ricardo; Campos-Barros, Angel; Benito-Sanz, Sara; Heath, Karen E
2011-12-01
We report the clinical and molecular characteristics of 12 Spanish families with multiple members affected with Léri-Weill dyschondrosteosis (LWD) or Langer mesomelic dysplasia (LMD), who present the SHOX (short stature homeobox gene) mutation p.A170P (c.508G>C) in heterozygosity or homozygosity, respectively. In all studied families, the A170P mutation co-segregated with the fully penetrant phenotype of mesomelic limb shortening and Madelung deformity. A shared haplotype around SHOX was observed by microsatellite analysis, confirming the presence of a common ancestor, probably of Gypsy origin, as 11 of the families were of this ethnic group. Mutation screening in 359 Eastern-European Gypsies failed to identify any carriers. For the first time, we have shown SHOX expression in the human growth plate of a 22-week LMD fetus, homozygous for the A170P mutation. Although the mutant SHOX protein was expressed in all zones of the growth plate, the chondrocyte columns in the proliferative zone were disorganized with the chondrocytes occurring in smaller columnal clusters. We have also identified a novel mutation at the same residue, c. 509C>A (p.A170D), in two unrelated Spanish LWD families, which similar to A170P mutation impedes nuclear localization of SHOX. In conclusion, we have identified A170P as the first frequent SHOX mutation in Gypsy LWD and LMD individuals.
46 CFR 170.170 - Calculations required.
Code of Federal Regulations, 2010 CFR
2010-10-01
... REQUIREMENTS FOR ALL INSPECTED VESSELS Weather Criteria § 170.170 Calculations required. (a) Each vessel must... weather deck or abnormal sheer. (c) When doing the calculations required by paragraph (a) of this section...
NASA Astrophysics Data System (ADS)
Barbosa, Thais S.; Riva, Matthieu; Chen, Yuzhi; da Silva, Cleyton M.; Ameida, Jose Claudino S.; Zhang, Zhenfa; Gold, Avram; Arbilla, Graciela; Bauerfeldt, Glauco F.; Surratt, Jason D.
2017-08-01
Cis-3-hexen-1-ol (cis-HXO) is a green leaf volatile emitted from plants under stress and belongs to an important class of biogenic volatile organic compounds. In this study, we have investigated the potential formation of organosulfates (OSs) from the hydroxyl radical (OH)-initiated oxidation and ozonolysis of cis-HXO using either non-acidified or acidified sulfate seed aerosols under different relative humidity (RH) conditions. For selected ozonolysis experiments, an OH scavenger was utilized. Ultra performance liquid chromatography interfaced to high-resolution quadrupole time-of-flight mass spectrometry with electrospray ionization (UPLC/ESI-HR-Q-TOFMS) was used to characterize cis-HXO-derived secondary organic aerosol (SOA) formation. Chemical characterization of cis-HXO-derived SOA products reveals that OSs were generated in significant quantity from multiphase chemistry of gas-phase oxidation products of cis-HXO. Ambient fine aerosol (PM2.5) samples collected from Rio de Janeiro, Brazil, were also analyzed. Seven cis-HXO-derived OSs identified in the lab study with molecular weights 154, 186, 170, 210, 212, 226 and 270 were also found in the PM2.5 samples collected in Brazil. This study provides direct evidence that the oxidation of cis-HXO by OH and O3 yields biogenic SOA through the formation of polar OSs.
The N170 is not modulated by attention in autism spectrum conditions.
Churches, Owen; Wheelwright, Sally; Baron-Cohen, Simon; Ring, Howard
2010-04-21
Face processing deficits are characteristic of autism spectrum conditions. However, event-related potential studies of autism spectrum conditions have found inconsistent results for the face selective N170 component. In this study, 15 adult males with autism spectrum conditions and 15 matched, typically developing controls completed a task in which pictures of faces were either attended to or ignored. In the control group, the N170 was larger when faces were attended to. However, there was no such modulation in the autism spectrum conditions group. This finding helps clarify the results from the earlier event-related potential studies of face processing in autism spectrum conditions and suggests that visual attention does not enhance face processing in autism spectrum conditions as it does in typical development.
Abbasian Ardakani, Ali; Reiazi, Reza; Mohammadi, Afshin
2018-03-30
This study investigated the potential of a clinical decision support approach for the classification of metastatic and tumor-free cervical lymph nodes (LNs) in papillary thyroid carcinoma on the basis of radiologic and textural analysis through ultrasound (US) imaging. In this research, 170 metastatic and 170 tumor-free LNs were examined by the proposed clinical decision support method. To discover the difference between the groups, US imaging was used for the extraction of radiologic and textural features. The radiologic features in the B-mode scans included the echogenicity, margin, shape, and presence of microcalcification. To extract the textural features, a wavelet transform was applied. A support vector machine classifier was used to classify the LNs. In the training set data, a combination of radiologic and textural features represented the best performance with sensitivity, specificity, accuracy, and area under the curve (AUC) values of 97.14%, 98.57%, 97.86%, and 0.994, respectively, whereas the classification based on radiologic and textural features alone yielded lower performance, with AUCs of 0.964 and 0.922. On testing the data set, the proposed model could classify the tumor-free and metastatic LNs with an AUC of 0.952, which corresponded to sensitivity, specificity, and accuracy of 93.33%, 96.66%, and 95.00%. The clinical decision support method based on textural and radiologic features has the potential to characterize LNs via 2-dimensional US. Therefore, it can be used as a supplementary technique in daily clinical practice to improve radiologists' understanding of conventional US imaging for characterizing LNs. © 2018 by the American Institute of Ultrasound in Medicine.
21 CFR 184.1330 - Acacia (gum arabic).
Code of Federal Regulations, 2010 CFR
2010-04-01
....3(o)(14) of this chapter; stabilizer and thickener, § 170.3(o)(28) of this chapter. Gelatins...; formulation aid, § 170.3(o)(14) of this chapter; stabilizer and thickener, § 170.3(o)(28) of this chapter... chapter 12.4 Formulation aid, § 170.3(o)(14) of this chapter; stabilizer and thickener, § 170.3(o)(28) of...
The Endoplasmic Reticulum Chaperone GRP170: From Immunobiology to Cancer Therapeutics
Wang, Hongxia; Pezeshki, Abdul Mohammad; Yu, Xiaofei; Guo, Chunqing; Subjeck, John R.; Wang, Xiang-Yang
2014-01-01
Glucose-regulated protein 170 (GRP170) is the largest member of glucose-regulated protein family that resides in the endoplasmic reticulum (ER). As a component of the ER chaperone network, GRP170 assists in protein folding, assembly, and transportation of secretory or transmembrane proteins. The well documented cytoprotective activity of intracellular GRP170 due to its intrinsic chaperoning property has been shown to provide a survival benefit in cancer cells during tumor progression or metastasis. Accumulating evidence shows that extracellular GRP170 displays a superior capacity in delivering tumor antigens to specialized antigen-presenting cells for cross-presentation, resulting in generation of an anti-tumor immune response dependent on cytotoxic CD8+ T cells. This unique feature of GRP170 provides a molecular basis for using GRP170 as an immunostimulatory adjuvant to develop a recombinant vaccine for therapeutic immunization against cancers. This review summarizes the latest findings in understanding the biological effects of GRP170 on cell functions and tumor progression. The immunomodulating activities of GRP170 during interactions with the innate and adaptive arms of the immune system as well as its therapeutic applications in cancer immunotherapy will be discussed. PMID:25629003
Effect of frying temperature and time on image characterizations of pellet snacks.
Mohammadi Moghaddam, Toktam; BahramParvar, Maryam; Razavi, Seyed M A
2015-05-01
The development of non-destructive methods for the evaluation of food properties has important advantages for the food processing industries. So, the aim of this study was to evaluate the effects of frying temperature (150, 170, and 190 °C) and time (0.5, 1.5, 2.5, 3.5 and 4.5 min) on image properties (L*, a* and b*, fractal dimension, correlation, entropy, contrast and homogeneity) of pellet snacks. Textures were computed separately for eight channels (RGB, R, G, B, U, V, H and S). Enhancing the frying time from 0.5 min to 2.5 min increased the fractal dimension; but its increase from 2.5 min to 4.5 min could not expand the samples. Then, the highest volume of pellet snacks was observed at 2.5 min. Features derived from the image texture contained better information than color features. The best result was for U channel which showed that increasing the frying time increased the contrast, entropy and correlation. Developing the frying temperature up to 170 °C decreased contrast, entropy and correlation of images; however these factors were increased when frying temperature was 190 °C. These results were invert for homogeneity.
Indium oxide based fiber optic SPR sensor
DOE Office of Scientific and Technical Information (OSTI.GOV)
Shukla, Sarika; Sharma, Navneet K., E-mail: navneetk.sharma@jiit.ac.in
2016-05-06
Surface plasmon resonance based fiber optic sensor using indium oxide layer is presented and theoretically studied. It has been found that with increase in thickness of indium oxide layer beyond 170 nm, the sensitivity of SPR sensor decreases. 170 nm thick indium oxide layer based SPR sensor holds maximum sensitivity.
48 CFR 1602.170-4 - Contractor.
Code of Federal Regulations, 2010 CFR
2010-10-01
... 48 Federal Acquisition Regulations System 6 2010-10-01 2010-10-01 true Contractor. 1602.170-4 Section 1602.170-4 Federal Acquisition Regulations System OFFICE OF PERSONNEL MANAGEMENT FEDERAL EMPLOYEES... 1602.170-4 Contractor. Contractor means carrier. ...
Tanaka, Hideaki
2016-01-01
Cosmetic makeup significantly influences facial perception. Because faces consist of similar physical structures, cosmetic makeup is typically used to highlight individual features, particularly those of the eyes (i.e., eye shadow) and mouth (i.e., lipstick). Though event-related potentials have been utilized to study various aspects of facial processing, the influence of cosmetics on specific ERP components remains unclear. The present study aimed to investigate the relationship between the application of cosmetic makeup and the amplitudes of the P1 and N170 event-related potential components during facial perception tasks. Moreover, the influence of visual perception on N170 amplitude, was evaluated under three makeup conditions: Eye Shadow, Lipstick, and No Makeup. Electroencephalography was used to monitor 17 participants who were exposed to visual stimuli under each these three makeup conditions. The results of the present study subsequently demonstrated that the Lipstick condition elicited a significantly greater N170 amplitude than the No Makeup condition, while P1 amplitude was unaffected by any of the conditions. Such findings indicate that the application of cosmetic makeup alters general facial perception but exerts no influence on the perception of low-level visual features. Collectively, these results support the notion that the application of makeup induces subtle alterations in the processing of facial stimuli, with a particular effect on the processing of specific facial components (i.e., the mouth), as reflected by changes in N170 amplitude.
Tanaka, Hideaki
2016-01-01
Cosmetic makeup significantly influences facial perception. Because faces consist of similar physical structures, cosmetic makeup is typically used to highlight individual features, particularly those of the eyes (i.e., eye shadow) and mouth (i.e., lipstick). Though event-related potentials have been utilized to study various aspects of facial processing, the influence of cosmetics on specific ERP components remains unclear. The present study aimed to investigate the relationship between the application of cosmetic makeup and the amplitudes of the P1 and N170 event-related potential components during facial perception tasks. Moreover, the influence of visual perception on N170 amplitude, was evaluated under three makeup conditions: Eye Shadow, Lipstick, and No Makeup. Electroencephalography was used to monitor 17 participants who were exposed to visual stimuli under each these three makeup conditions. The results of the present study subsequently demonstrated that the Lipstick condition elicited a significantly greater N170 amplitude than the No Makeup condition, while P1 amplitude was unaffected by any of the conditions. Such findings indicate that the application of cosmetic makeup alters general facial perception but exerts no influence on the perception of low-level visual features. Collectively, these results support the notion that the application of makeup induces subtle alterations in the processing of facial stimuli, with a particular effect on the processing of specific facial components (i.e., the mouth), as reflected by changes in N170 amplitude. PMID:27656161
25 CFR 170.406 - How must tribes use planning funds?
Code of Federal Regulations, 2013 CFR
2013-04-01
... 25 Indians 1 2013-04-01 2013-04-01 false How must tribes use planning funds? 170.406 Section 170... Transportation Planning § 170.406 How must tribes use planning funds? (a) IRR Program funds as defined in 23 U.S... Guidelines (TPPG) or listed in § 170.402. (b) A tribe may ask the BIA regional office to enter into a self...
25 CFR 170.406 - How must tribes use planning funds?
Code of Federal Regulations, 2012 CFR
2012-04-01
... 25 Indians 1 2012-04-01 2011-04-01 true How must tribes use planning funds? 170.406 Section 170... Transportation Planning § 170.406 How must tribes use planning funds? (a) IRR Program funds as defined in 23 U.S... Guidelines (TPPG) or listed in § 170.402. (b) A tribe may ask the BIA regional office to enter into a self...
25 CFR 170.406 - How must tribes use planning funds?
Code of Federal Regulations, 2011 CFR
2011-04-01
... 25 Indians 1 2011-04-01 2011-04-01 false How must tribes use planning funds? 170.406 Section 170... Transportation Planning § 170.406 How must tribes use planning funds? (a) IRR Program funds as defined in 23 U.S... Guidelines (TPPG) or listed in § 170.402. (b) A tribe may ask the BIA regional office to enter into a self...
25 CFR 170.406 - How must tribes use planning funds?
Code of Federal Regulations, 2014 CFR
2014-04-01
... 25 Indians 1 2014-04-01 2014-04-01 false How must tribes use planning funds? 170.406 Section 170... Transportation Planning § 170.406 How must tribes use planning funds? (a) IRR Program funds as defined in 23 U.S... Guidelines (TPPG) or listed in § 170.402. (b) A tribe may ask the BIA regional office to enter into a self...
Code of Federal Regulations, 2010 CFR
2010-10-01
... 48 Federal Acquisition Regulations System 5 2010-10-01 2010-10-01 false [Reserved] 702.170-14 Section 702.170-14 Federal Acquisition Regulations System AGENCY FOR INTERNATIONAL DEVELOPMENT GENERAL DEFINITIONS OF WORDS AND TERMS Definitions 702.170-14 [Reserved] ...
Material science as basis for nuclear medicine: Holmium irradiation for radioisotopes production
NASA Astrophysics Data System (ADS)
Usman, Ahmed Rufai; Khandaker, Mayeen Uddin; Haba, Hiromitsu; Otuka, Naohiko
2018-05-01
Material Science, being an interdisciplinary field, plays important roles in nuclear science. These applications are seen in weaponry, armoured vehicles, accelerator structure and development, semiconductor detectors, nuclear medicine and many more. Present study presents the applications of some metals in nuclear medicine (radioisotope production). The charged-particle-induced nuclear reactions by using cyclotrons or accelerators have become a very vital feature of the modern nuclear medicine. Realising the importance of excitation functions for the efficient production of medical radionuclides, some very high purity holmium metals are generally prepared or purchased for bombardment in nuclear accelerators. In the present work, various methods to obtain pure holmium for radioisotope production have been discussed while also presenting details of our present studies. From the experimental work of the present studies, some very high purity holmium foils have been used in the work for a comprehensive study of residual radionuclides production cross-sections. The study was performed using a stacked-foil activation technique combined with γ-ray spectrometry. The stack was bombarded with 50.4 MeV alpha particle beam from AVF cyclotron of RI Beam Factory, Nishina Centre for Accelerator-Based Science, RIKEN, Japan. The work produced thulium radionuclides useful in nuclear medicine.
36 CFR 909.170 - Compliance procedures.
Code of Federal Regulations, 2010 CFR
2010-07-01
....170 Section 909.170 Parks, Forests, and Public Property PENNSYLVANIA AVENUE DEVELOPMENT CORPORATION... PENNSYLVANIA AVENUE DEVELOPMENT CORPORATION § 909.170 Compliance procedures. (a) Except as provided in... implementation of this section. Complaints may be sent to the General Counsel, Pennsylvania Avenue Development...
48 CFR 1615.170 - Applicability.
Code of Federal Regulations, 2011 CFR
2011-10-01
... 48 Federal Acquisition Regulations System 6 2011-10-01 2011-10-01 false Applicability. 1615.170 Section 1615.170 Federal Acquisition Regulations System OFFICE OF PERSONNEL MANAGEMENT FEDERAL EMPLOYEES... Source Selection Processes and Techniques. 1615.170 Applicability. FAR subpart 15.1 has no practical...
48 CFR 2115.170 - Applicability.
Code of Federal Regulations, 2011 CFR
2011-10-01
... 48 Federal Acquisition Regulations System 6 2011-10-01 2011-10-01 false Applicability. 2115.170 Section 2115.170 Federal Acquisition Regulations System OFFICE OF PERSONNEL MANAGEMENT, FEDERAL EMPLOYEES... BY NEGOTIATION Source Selection Processes and Techniques 2115.170 Applicability. FAR subpart 15.1 has...
48 CFR 1615.170 - Applicability.
Code of Federal Regulations, 2010 CFR
2010-10-01
... 48 Federal Acquisition Regulations System 6 2010-10-01 2010-10-01 true Applicability. 1615.170 Section 1615.170 Federal Acquisition Regulations System OFFICE OF PERSONNEL MANAGEMENT FEDERAL EMPLOYEES... Source Selection Processes and Techniques. 1615.170 Applicability. FAR subpart 15.1 has no practical...
48 CFR 1615.170 - Applicability.
Code of Federal Regulations, 2014 CFR
2014-10-01
... 48 Federal Acquisition Regulations System 6 2014-10-01 2014-10-01 false Applicability. 1615.170 Section 1615.170 Federal Acquisition Regulations System OFFICE OF PERSONNEL MANAGEMENT FEDERAL EMPLOYEES... Source Selection Processes and Techniques 1615.170 Applicability. FAR subpart 15.1 has no practical...
48 CFR 1615.170 - Applicability.
Code of Federal Regulations, 2012 CFR
2012-10-01
... 48 Federal Acquisition Regulations System 6 2012-10-01 2012-10-01 false Applicability. 1615.170 Section 1615.170 Federal Acquisition Regulations System OFFICE OF PERSONNEL MANAGEMENT FEDERAL EMPLOYEES... Source Selection Processes and Techniques 1615.170 Applicability. FAR subpart 15.1 has no practical...
48 CFR 2115.170 - Applicability.
Code of Federal Regulations, 2012 CFR
2012-10-01
... 48 Federal Acquisition Regulations System 6 2012-10-01 2012-10-01 false Applicability. 2115.170 Section 2115.170 Federal Acquisition Regulations System OFFICE OF PERSONNEL MANAGEMENT, FEDERAL EMPLOYEES... BY NEGOTIATION Source Selection Processes and Techniques 2115.170 Applicability. FAR subpart 15.1 has...
48 CFR 2115.170 - Applicability.
Code of Federal Regulations, 2014 CFR
2014-10-01
... 48 Federal Acquisition Regulations System 6 2014-10-01 2014-10-01 false Applicability. 2115.170 Section 2115.170 Federal Acquisition Regulations System OFFICE OF PERSONNEL MANAGEMENT, FEDERAL EMPLOYEES... BY NEGOTIATION Source Selection Processes and Techniques 2115.170 Applicability. FAR subpart 15.1 has...
40 CFR 161.170 - Preliminary analysis.
Code of Federal Regulations, 2013 CFR
2013-07-01
... 40 Protection of Environment 25 2013-07-01 2013-07-01 false Preliminary analysis. 161.170 Section 161.170 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) PESTICIDE PROGRAMS DATA REQUIREMENTS FOR REGISTRATION OF ANTIMICROBIAL PESTICIDES Product Chemistry Data Requirements § 161.170...
40 CFR 161.170 - Preliminary analysis.
Code of Federal Regulations, 2011 CFR
2011-07-01
... 40 Protection of Environment 24 2011-07-01 2011-07-01 false Preliminary analysis. 161.170 Section 161.170 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) PESTICIDE PROGRAMS DATA REQUIREMENTS FOR REGISTRATION OF ANTIMICROBIAL PESTICIDES Product Chemistry Data Requirements § 161.170...
48 CFR 3432.170 - Method of payment.
Code of Federal Regulations, 2010 CFR
2010-10-01
... 48 Federal Acquisition Regulations System 7 2010-10-01 2010-10-01 false Method of payment. 3432.170 Section 3432.170 Federal Acquisition Regulations System DEPARTMENT OF EDUCATION ACQUISITION REGULATION GENERAL CONTRACTING REQUIREMENTS CONTRACT FINANCING General 3432.170 Method of payment. The...
Energy transfer processes between Tm(3+) and Ho(3+) in LiYF4. Ph.D. Thesis Final Report
NASA Technical Reports Server (NTRS)
Oezen, Goenuel
1991-01-01
The spectroscopic properties of the crystal LiYF4 doped with Thulium (Tm) and Holmium (Ho) ions are studied. The basic processes are discussed that regulate the transfer of energy between these two ions in this crystal. In this system Tm is considered the donor ion and the Ho the acceptor ion. Spectral data were obtained on three samples available: LiYF4:Tm(3+) (0.5 percent), LiYF4:Ho(3+) (1 percent), and LiYF4:Tm(3+) (5 percent), Ho(3+) (0.2 percent). Spectral data, which include absorption, luminescence, excitation, and the response to pulsed excitation in a wide range of temperatures, allowed to look at the energy transfer processes by considering the kinetic evolution of the emission of the two ions (donor and acceptor) involved in the process and the basic spectroscopic properties related to them. This inclusive approach has led to the validation of the physical model.
Interface induced ferromagnetism in topological insulator above room temperature
NASA Astrophysics Data System (ADS)
Tang, Chi; Chang, Cui-Zu; Liu, Yawen; Chen, Tingyong; Moodera, Jagadeesh; Shi, Jing
The quantum anomalous Hall effect (QAHE) observed in magnetic topological insulators (TI), an outcome of time reversal symmetry broken surface states, exhibits many exotic properties. However, a major obstacle towards high temperature QAHE is the low Curie temperature in the disordered magnetically doped TI systems. Here we report a study on heterostructures of TI and magnetic insulator in which the magnetic insulator, namely thulium iron garnet or TIG, has perpendicular magnetic anisotropy. At the TIG/TI interface, TIG magnetizes the surface states of the TI film by exchange coupling, as revealed by the anomalous Hall effect (AHE). We demonstrate that squared AHE hysteresis loops persist well above room temperature. The interface proximity induced high-temperature ferromagnetism in topological insulators opens up new possibilities for the realization of QAHE at high temperatures. This work was supported as part of the SHINES, an Energy Frontier Research Center funded by the U.S. Department of Energy, Office of Science, Basic Energy Sciences under Award # SC0012670.
Ibáñez, Agustín; Riveros, Rodrigo; Hurtado, Esteban; Gleichgerrcht, Ezequiel; Urquina, Hugo; Herrera, Eduar; Amoruso, Lucía; Reyes, Migdyrai Martin; Manes, Facundo
2012-01-30
Previous studies have reported facial emotion recognition impairments in schizophrenic patients, as well as abnormalities in the N170 component of the event-related potential. Current research on schizophrenia highlights the importance of complexly-inherited brain-based deficits. In order to examine the N170 markers of face structural and emotional processing, DSM-IV diagnosed schizophrenia probands (n=13), unaffected first-degree relatives from multiplex families (n=13), and control subjects (n=13) matched by age, gender and educational level, performed a categorization task which involved words and faces with positive and negative valence. The N170 component, while present in relatives and control subjects, was reduced in patients, not only for faces, but also for face-word differences, suggesting a deficit in structural processing of stimuli. Control subjects showed N170 modulation according to the valence of facial stimuli. However, this discrimination effect was found to be reduced both in patients and relatives. This is the first report showing N170 valence deficits in relatives. Our results suggest a generalized deficit affecting the structural encoding of faces in patients, as well as the emotion discrimination both in patients and relatives. Finally, these findings lend support to the notion that cortical markers of facial discrimination can be validly considered as vulnerability markers. © 2011 Elsevier Ireland Ltd. All rights reserved.
Inverting faces elicits sensitivity to race on the N170 component: a cross-cultural study.
Vizioli, Luca; Foreman, Kay; Rousselet, Guillaume A; Caldara, Roberto
2010-01-29
Human beings are natural experts at processing faces, with some notable exceptions. Same-race faces are better recognized than other-race faces: the so-called other-race effect (ORE). Inverting faces impairs recognition more than for any other inverted visual object: the so-called face inversion effect (FIE). Interestingly, the FIE is stronger for same- compared to other-race faces. At the electrophysiological level, inverted faces elicit consistently delayed and often larger N170 compared to upright faces. However, whether the N170 component is sensitive to race is still a matter of ongoing debate. Here we investigated the N170 sensitivity to race in the framework of the FIE. We recorded EEG from Western Caucasian and East Asian observers while presented with Western Caucasian, East Asian and African American faces in upright and inverted orientations. To control for potential confounds in the EEG signal that might be evoked by the intrinsic and salient differences in the low-level properties of faces from different races, we normalized their amplitude-spectra, luminance and contrast. No differences on the N170 were observed for upright faces. Critically, inverted same-race faces lead to greater recognition impairment and elicited larger N170 amplitudes compared to inverted other-race faces. Our results indicate a finer-grained neural tuning for same-race faces at early stages of processing in both groups of observers.
Komes, Jessica; Schweinberger, Stefan R.; Wiese, Holger
2015-01-01
Previous event-related potential (ERP) research revealed that older relative to younger adults show reduced inversion effects in the N170 (with more negative amplitudes for inverted than upright faces), suggestive of impairments in face perception. However, as these studies used young to middle-aged faces only, this finding may reflect preferential processing of own- relative to other-age faces rather than age-related decline. We conducted an ERP study in which young and older participants categorized young and old upright or inverted faces by age. Stimuli were presented either unfiltered or low-pass filtered at 30, 20, or 10 cycles per image (CPI). Response times revealed larger inversion effects, with slower responses for inverted faces, for young faces in young participants. Older participants did not show a corresponding effect. ERPs yielded a trend toward reduced N170 inversion effects in older relative to younger adults independent of face age. Moreover, larger inversion effects for young relative to old faces were detected, and filtering resulted in smaller N170 amplitudes. The reduced N170 inversion effect in older adults may reflect age-related changes in neural correlates of face perception. A smaller N170 inversion effect for old faces may indicate that facial changes with age hamper early face perception stages. PMID:26441790
Ishida, Hideki; Kondo, Tsunenori; Shimizu, Tomokazu; Nozaki, Taiji; Tanabe, Kazunari
2015-03-01
The purpose of this study is to examine whether postoperative antiblood type antibody rebound is attributed to kidney allograft rejection in ABO blood type-incompatible (ABO-I) living-related kidney transplantation (KTx). A total of 191 ABO-I recipients who received ABO-I living-related KTx between 2001 and 2013 were divided into two groups: Group 1 consisted of low rebound [(≦1:32), N = 170] and Group 2 consisted of high rebound [(≧1:64), N = 21], according to the levels of the rebounded antiblood type antibodies within 1 year after transplantation. No prophylactic treatment for rejection was administered for elevated antiblood type antibodies, regardless of the levels of the rebounded antibodies. Within 1 year after transplantation, T-cell-mediated rejection was observed in 13 of 170 recipients (13/170, 8%) in Group 1 and in 2 of 21 recipients (2/21, 10%) in Group 2 (Groups 1 vs. 2, P = 0.432). Antibody-mediated rejection was observed in 15 of 170 recipients (15/170, 9%) and 2 of 21 recipients (2/21, 10%) in Groups 1 and 2, respectively (P = 0.898). In this study, we found no correlation between the postoperative antiblood type antibody rebound and the incidence of acute rejection. We concluded that no treatment is necessary for rebounded antiblood type antibodies. © 2014 Steunstichting ESOT.
Sex differences in interhemispheric communication during face identity encoding: evidence from ERPs.
Godard, Ornella; Leleu, Arnaud; Rebaï, Mohamed; Fiori, Nicole
2013-01-01
Sex-related hemispheric lateralization and interhemispheric transmission times (IHTTs) were examined in twenty-four participants at the level of the first visual ERP components (P1 and N170) during face identity encoding in a divided visual-field paradigm. While no lateralization-related and sex-related differences were reflected in the P1 characteristics, these two factors modulated the N170. Indeed, N170 amplitudes indicated a right hemisphere (RH) dominance in men (and a more bilateral functioning in women). N170 latencies and the derived IHTTs confirmed the RH advantage in men but showed the reverse asymmetry in women. Altogether, the results of this study suggest a clear asymmetry in men and a more divided work between the hemispheres in women, with a tendency toward a left hemisphere (LH) advantage. Thus, by extending the pattern to the right-sided face processing, our results generalize previous findings from studies using other materials and indicating longer transfers from the specialized to the non-specialized hemisphere, especially in the male brain. Because asymmetries started from the N170 component, the first electrophysiological index of high-level perceptual processing on face representations, they also suggest a functional account for hemispheric lateralization and sex-related differences rather than a structural one. Copyright © 2013 Elsevier Ireland Ltd and the Japan Neuroscience Society. All rights reserved.
Wong, Chuan Loo; Yong, Chean Yeah; Muhamad, Azira; Syahir, Amir; Omar, Abdul Rahman; Sieo, Chin Chin; Tan, Wen Siang
2018-05-01
Foot-and-mouth disease (FMD) is a major threat to the livestock industry worldwide. Despite constant surveillance and effective vaccination, the perpetual mutations of the foot-and-mouth disease virus (FMDV) pose a huge challenge to FMD diagnosis. The immunodominant region of the FMDV VP1 protein (residues 131-170) displayed on phage T7 has been used to detect anti-FMDV in bovine sera. In the present study, the functional epitope was further delineated using amino acid sequence alignment, homology modelling and phage display. Two highly conserved regions (VP1 145-152 and VP1 159-170 ) were identified among different FMDV serotypes. The coding regions of these two epitopes were fused separately to the T7 genome and displayed on the phage particles. Interestingly, chimeric phage displaying the VP1 159-170 epitope demonstrated a higher antigenicity than that displaying the VP1 131-170 epitope. By contrast, phage T7 displaying the VP1 145-152 epitope did not react significantly with the anti-FMDV antibodies in vaccinated bovine sera. This study has successfully identified a smaller functional epitope, VP1 159-170 , located at the C-terminal end of the structural VP1 protein. The phage T7 displaying this shorter epitope is a promising diagnostic reagent to detect anti-FMDV antibodies in vaccinated animals.
Lin, Xiu-mei; Xie, Zhao-xia; Zhu, Yan
2002-12-28
To investigate the relevance between the expression of P-170 and MRP and clinical drug resistance in acute leukemia. The expression of P-170 and MRP in mononuclear cells of bone marrows was analyzed by the immunohistochemical technique in 72 acute leukemia patients. The expression of P-170 was positive in 46 and negative in 26 of the 72 post-chemotherapy acute leukemia patients. The therapeutic effect of the P-170 positive expression patients was significantly poorer than that of the negative expression patients (P < 0.01). The expression of MRP was positive in 39 and negative in 33 of the 72 post-chemotherapy acute leukemia patients. The therapeutic effect of the MRP positive expression patients was significantly poorer than that in the negative expression patients (P < 0.01). The expression of P-170 and MRP had a significant concordance (Kappa = 0.427, P < 0.01). The sensitivity of P-170 and MRP which were analyzed simultaneously was 97.5%, which was higher than that of P-170 (90%) or MRP (77.5%) analyzed respectively in drug resistance patients. The expression of P-170 and/or MRP was significantly related with drug resistance in clinical chemotherapy. The therapeutic effect was significantly poorer in P-170 and/or MRP positive expression patients than that in negative expression patients. These data suggest that P-170 and MRP analyzed simultaneously can improve the value of diagnosis and prognosis in patients with drug resistance leukemia.
40 CFR 170.150 - Decontamination.
Code of Federal Regulations, 2010 CFR
2010-07-01
... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Decontamination. 170.150 Section 170... PROTECTION STANDARD Standard for Workers § 170.150 Decontamination. (a)(1) Requirement. The agricultural employer must provide decontamination supplies for workers in accordance with this section whenever: (i...
45 CFR 170.555 - Certification to newer versions of certain standards.
Code of Federal Regulations, 2014 CFR
2014-10-01
... standards. 170.555 Section 170.555 Public Welfare Department of Health and Human Services HEALTH INFORMATION TECHNOLOGY HEALTH INFORMATION TECHNOLOGY STANDARDS, IMPLEMENTATION SPECIFICATIONS, AND CERTIFICATION CRITERIA AND CERTIFICATION PROGRAMS FOR HEALTH INFORMATION TECHNOLOGY ONC HIT Certification Program § 170.555...
45 CFR 170.555 - Certification to newer versions of certain standards.
Code of Federal Regulations, 2013 CFR
2013-10-01
... standards. 170.555 Section 170.555 Public Welfare DEPARTMENT OF HEALTH AND HUMAN SERVICES HEALTH INFORMATION TECHNOLOGY HEALTH INFORMATION TECHNOLOGY STANDARDS, IMPLEMENTATION SPECIFICATIONS, AND CERTIFICATION CRITERIA AND CERTIFICATION PROGRAMS FOR HEALTH INFORMATION TECHNOLOGY ONC HIT Certification Program § 170.555...
Code of Federal Regulations, 2014 CFR
2014-10-01
... 48 Federal Acquisition Regulations System 3 2014-10-01 2014-10-01 false Reports. 229.170-3 Section 229.170-3 Federal Acquisition Regulations System DEFENSE ACQUISITION REGULATIONS SYSTEM, DEPARTMENT OF DEFENSE GENERAL CONTRACTING REQUIREMENTS TAXES General 229.170-3 Reports. The contracting officer shall...
46 CFR 170.160 - Specific applicability
Code of Federal Regulations, 2010 CFR
2010-10-01
... 46 Shipping 7 2010-10-01 2010-10-01 false Specific applicability 170.160 Section 170.160 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) SUBDIVISION AND STABILITY STABILITY REQUIREMENTS FOR ALL INSPECTED VESSELS Weather Criteria § 170.160 Specific applicability (a) Except as provided...
48 CFR 702.170-3 - Contracting activities.
Code of Federal Regulations, 2010 CFR
2010-10-01
... 48 Federal Acquisition Regulations System 5 2010-10-01 2010-10-01 false Contracting activities. 702.170-3 Section 702.170-3 Federal Acquisition Regulations System AGENCY FOR INTERNATIONAL DEVELOPMENT GENERAL DEFINITIONS OF WORDS AND TERMS Definitions 702.170-3 Contracting activities. The...
48 CFR 702.170-13 - Procurement Executive.
Code of Federal Regulations, 2010 CFR
2010-10-01
... 48 Federal Acquisition Regulations System 5 2010-10-01 2010-10-01 false Procurement Executive. 702.170-13 Section 702.170-13 Federal Acquisition Regulations System AGENCY FOR INTERNATIONAL DEVELOPMENT GENERAL DEFINITIONS OF WORDS AND TERMS Definitions 702.170-13 Procurement Executive. “Procurement...
48 CFR 702.170-2 - Administrator.
Code of Federal Regulations, 2010 CFR
2010-10-01
... 48 Federal Acquisition Regulations System 5 2010-10-01 2010-10-01 false Administrator. 702.170-2 Section 702.170-2 Federal Acquisition Regulations System AGENCY FOR INTERNATIONAL DEVELOPMENT GENERAL DEFINITIONS OF WORDS AND TERMS Definitions 702.170-2 Administrator. Administrator means the Administrator or...
48 CFR 702.170-4 - Cooperating country.
Code of Federal Regulations, 2010 CFR
2010-10-01
... 48 Federal Acquisition Regulations System 5 2010-10-01 2010-10-01 false Cooperating country. 702.170-4 Section 702.170-4 Federal Acquisition Regulations System AGENCY FOR INTERNATIONAL DEVELOPMENT GENERAL DEFINITIONS OF WORDS AND TERMS Definitions 702.170-4 Cooperating country. Cooperating country...
Code of Federal Regulations, 2010 CFR
2010-04-01
... 24 Housing and Urban Development 5 2010-04-01 2010-04-01 false Service. 1720.170 Section 1720.170... ASSISTANT SECRETARY FOR HOUSING-FEDERAL HOUSING COMMISSIONER, DEPARTMENT OF HOUSING AND URBAN DEVELOPMENT... General Provisions § 1720.170 Service. Notices, orders, processes, determinations and other documents...
Code of Federal Regulations, 2013 CFR
2013-04-01
... 24 Housing and Urban Development 5 2013-04-01 2013-04-01 false Service. 1720.170 Section 1720.170... ASSISTANT SECRETARY FOR HOUSING-FEDERAL HOUSING COMMISSIONER, DEPARTMENT OF HOUSING AND URBAN DEVELOPMENT... General Provisions § 1720.170 Service. Notices, orders, processes, determinations and other documents...
Code of Federal Regulations, 2011 CFR
2011-04-01
... 24 Housing and Urban Development 5 2011-04-01 2011-04-01 false Service. 1720.170 Section 1720.170... ASSISTANT SECRETARY FOR HOUSING-FEDERAL HOUSING COMMISSIONER, DEPARTMENT OF HOUSING AND URBAN DEVELOPMENT... General Provisions § 1720.170 Service. Notices, orders, processes, determinations and other documents...
Code of Federal Regulations, 2014 CFR
2014-04-01
... 24 Housing and Urban Development 5 2014-04-01 2014-04-01 false Service. 1720.170 Section 1720.170... ASSISTANT SECRETARY FOR HOUSING-FEDERAL HOUSING COMMISSIONER, DEPARTMENT OF HOUSING AND URBAN DEVELOPMENT... General Provisions § 1720.170 Service. Notices, orders, processes, determinations and other documents...
Code of Federal Regulations, 2012 CFR
2012-04-01
... 24 Housing and Urban Development 5 2012-04-01 2012-04-01 false Service. 1720.170 Section 1720.170... ASSISTANT SECRETARY FOR HOUSING-FEDERAL HOUSING COMMISSIONER, DEPARTMENT OF HOUSING AND URBAN DEVELOPMENT... General Provisions § 1720.170 Service. Notices, orders, processes, determinations and other documents...
25 CFR 170.6 - Information Collection.
Code of Federal Regulations, 2010 CFR
2010-04-01
... 25 Indians 1 2010-04-01 2010-04-01 false Information Collection. 170.6 Section 170.6 Indians BUREAU OF INDIAN AFFAIRS, DEPARTMENT OF THE INTERIOR LAND AND WATER INDIAN RESERVATION ROADS PROGRAM Policies, Applicability, and Definitions § 170.6 Information Collection. The information collection...
25 CFR 170.6 - Information Collection.
Code of Federal Regulations, 2011 CFR
2011-04-01
... 25 Indians 1 2011-04-01 2011-04-01 false Information Collection. 170.6 Section 170.6 Indians BUREAU OF INDIAN AFFAIRS, DEPARTMENT OF THE INTERIOR LAND AND WATER INDIAN RESERVATION ROADS PROGRAM Policies, Applicability, and Definitions § 170.6 Information Collection. The information collection...
48 CFR 3404.170 - Ratification of unauthorized contract awards.
Code of Federal Regulations, 2010 CFR
2010-10-01
... 48 Federal Acquisition Regulations System 7 2010-10-01 2010-10-01 false Ratification of unauthorized contract awards. 3404.170 Section 3404.170 Federal Acquisition Regulations System DEPARTMENT OF EDUCATION ACQUISITION REGULATION GENERAL ADMINISTRATIVE MATTERS Contract Execution 3404.170 Ratification of...
Chinese Characters Elicit Face-Like N170 Inversion Effects
ERIC Educational Resources Information Center
Wang, Man-Ying; Kuo, Bo-Cheng; Cheng, Shih-Kuen
2011-01-01
Recognition of both faces and Chinese characters is commonly believed to rely on configural information. While faces typically exhibit behavioral and N170 inversion effects that differ from non-face stimuli (Rossion, Joyce, Cottrell, & Tarr, 2003), the current study examined whether a similar reliance on configural processing may result in similar…
Hydrographic Measurements in the Strait of Gibraltar, June 1986
1987-04-01
59.2 051 201 170 19 Jun 1358 57 36-04.5 5-50.0 052 202 170 19 Jun 1427 168 36-02.2 5-50.5 053 203 170 19 Jun 1501 198 35-59.9 5-50.9 054 204 170 19...04.4 061 202 170 19 Jun 2154 128 36-02.2 062 203 170 19 Jun 2223 207 36-00.5 063 204 170 19 Jun 2306 426 35-57.7 064 205 171 20 Jun 0010 277 35...Jun 0605 6i>9 35-55.1 5-38.8 192 802 176 25 Jun 0640 669 35-55.0 5-38.8 193 802 176 25 Jun 0736 636 35-55.0 5-38.9 194 802 176 25 Jun 0800 640 35
Zhang, Wenqiang; Lin, Xiaojuan; Jiang, Ping; Tao, Zexin; Liu, Xiaolin; Ji, Feng; Wang, Tongzhan; Wang, Suting; Lv, Hui; Xu, Aiqiang; Wang, Haiyan
2016-08-01
Coxsackievirus B3 (CV-B3) has frequently been associated with aseptic meningitis outbreaks in China. To identify sequence motifs related to aseptic meningitis and to construct an infectious clone, the genome sequence of 08TC170, a representative strain isolated from cerebrospinal fluid (CSF) samples from an outbreak in Shandong in 2008, was determined, and the coding regions for P1-P3 and VP1 were aligned. The first 21 and last 20 residues were "TTAAAACAGCCTGTGGGTTGT" and "ATTCTCCGCATTCGGTGCGG", respectively. The whole genome consisted of 7401 nucleotides, sharing 80.8 % identity with the prototype strain Nancy and low sequence similarity with members of clusters A-C. In contrast, 08TC170 showed high sequence similarity to members of cluster D. An especially high level of sequence identity (≥97.7 %) was found within a branch constituted by 08TC170 and four Chinese strains that clustered together in all of the P1-P3 phylogenic trees. In addition, 08TC170 also possessed a close relationship to the Hong Kong strain 26362/08 in VP1. Similarity plot analysis showed that 08TC170 was most similar to the Chinese CV-B3 strain SSM in P1 and the partial P2 coding region but to the CV-B5 or E-6 strain in 2C and following regions. A T277A mutation was found in 08TC170 and other strains isolated in 2008-2010, but not in strains isolated before 2008, which had high sequence similarity and formed the cluster A277. The results suggested that 08TC170 was the product of both intertypic recombination and point mutation, whose effects on viral neurovirulence will be investigated in a further study. The high homology between 08TC170 and other strains revealed their co-circulation in mainland China and Hong Kong and indicates that further surveillance is needed.
25 CFR 170.805 - What are the local, tribal, and BIA roles in transportation facility maintenance?
Code of Federal Regulations, 2010 CFR
2010-04-01
... transportation facility maintenance? 170.805 Section 170.805 Indians BUREAU OF INDIAN AFFAIRS, DEPARTMENT OF THE INTERIOR LAND AND WATER INDIAN RESERVATION ROADS PROGRAM BIA Road Maintenance § 170.805 What are the local... Road Maintenance dollars. ...
21 CFR 184.1472 - Menhaden oil.
Code of Federal Regulations, 2011 CFR
2011-04-01
... percent Pastas, § 170.3(n)(23) of this chapter 2.0 percent Plant protein products, § 170.3(n)(33) of this..., § 170.3(n)(35) of this chapter 1.0 percent Processed vegetable juices, § 170.3(n)(36) of this chapter 1...
10 CFR 170.5 - Communications.
Code of Federal Regulations, 2012 CFR
2012-01-01
... 10 Energy 2 2012-01-01 2012-01-01 false Communications. 170.5 Section 170.5 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) FEES FOR FACILITIES, MATERIALS, IMPORT AND EXPORT LICENSES, AND OTHER REGULATORY SERVICES UNDER THE ATOMIC ENERGY ACT OF 1954, AS AMENDED General Provisions § 170.5 Communications...
10 CFR 170.4 - Interpretations.
Code of Federal Regulations, 2011 CFR
2011-01-01
... 10 Energy 2 2011-01-01 2011-01-01 false Interpretations. 170.4 Section 170.4 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) FEES FOR FACILITIES, MATERIALS, IMPORT AND EXPORT LICENSES, AND OTHER REGULATORY SERVICES UNDER THE ATOMIC ENERGY ACT OF 1954, AS AMENDED General Provisions § 170.4...
10 CFR 170.4 - Interpretations.
Code of Federal Regulations, 2012 CFR
2012-01-01
... 10 Energy 2 2012-01-01 2012-01-01 false Interpretations. 170.4 Section 170.4 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) FEES FOR FACILITIES, MATERIALS, IMPORT AND EXPORT LICENSES, AND OTHER REGULATORY SERVICES UNDER THE ATOMIC ENERGY ACT OF 1954, AS AMENDED General Provisions § 170.4...
10 CFR 170.5 - Communications.
Code of Federal Regulations, 2011 CFR
2011-01-01
... 10 Energy 2 2011-01-01 2011-01-01 false Communications. 170.5 Section 170.5 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) FEES FOR FACILITIES, MATERIALS, IMPORT AND EXPORT LICENSES, AND OTHER REGULATORY SERVICES UNDER THE ATOMIC ENERGY ACT OF 1954, AS AMENDED General Provisions § 170.5 Communications...
10 CFR 170.4 - Interpretations.
Code of Federal Regulations, 2014 CFR
2014-01-01
... 10 Energy 2 2014-01-01 2014-01-01 false Interpretations. 170.4 Section 170.4 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) FEES FOR FACILITIES, MATERIALS, IMPORT AND EXPORT LICENSES, AND OTHER REGULATORY SERVICES UNDER THE ATOMIC ENERGY ACT OF 1954, AS AMENDED General Provisions § 170.4...
10 CFR 170.4 - Interpretations.
Code of Federal Regulations, 2013 CFR
2013-01-01
... 10 Energy 2 2013-01-01 2013-01-01 false Interpretations. 170.4 Section 170.4 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) FEES FOR FACILITIES, MATERIALS, IMPORT AND EXPORT LICENSES, AND OTHER REGULATORY SERVICES UNDER THE ATOMIC ENERGY ACT OF 1954, AS AMENDED General Provisions § 170.4...
10 CFR 170.4 - Interpretations.
Code of Federal Regulations, 2010 CFR
2010-01-01
... 10 Energy 2 2010-01-01 2010-01-01 false Interpretations. 170.4 Section 170.4 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) FEES FOR FACILITIES, MATERIALS, IMPORT AND EXPORT LICENSES, AND OTHER REGULATORY SERVICES UNDER THE ATOMIC ENERGY ACT OF 1954, AS AMENDED General Provisions § 170.4...
21 CFR 184.1187 - Calcium alginate.
Code of Federal Regulations, 2011 CFR
2011-04-01
... Stabilizer, thickener, § 170.3(o)(28) of this chapter. Alcoholic beverages, § 170.3(n)(2) of this chapter 0.4... this chapter 0.6 Do. Fats and oils, § 170.3(n)(12) of this chapter 0.5 Do. Gelatins, puddings, § 170.3...
21 CFR 184.1199 - Calcium gluconate.
Code of Federal Regulations, 2011 CFR
2011-04-01
...; sequestrant as defined in § 170.3(o)(26) of this chapter; stabilizer or thickener as defined in § 170.3(o)(28... defined in § 170.3(n)(10) of this chapter; 4.5 percent for gelatins and puddings as defined in § 170.3(n...
21 CFR 184.1187 - Calcium alginate.
Code of Federal Regulations, 2010 CFR
2010-04-01
... Stabilizer, thickener, § 170.3(o)(28) of this chapter. Alcoholic beverages, § 170.3(n)(2) of this chapter 0.4... this chapter 0.6 Do. Fats and oils, § 170.3(n)(12) of this chapter 0.5 Do. Gelatins, puddings, § 170.3...
21 CFR 184.1199 - Calcium gluconate.
Code of Federal Regulations, 2010 CFR
2010-04-01
...; sequestrant as defined in § 170.3(o)(26) of this chapter; stabilizer or thickener as defined in § 170.3(o)(28... defined in § 170.3(n)(10) of this chapter; 4.5 percent for gelatins and puddings as defined in § 170.3(n...
40 CFR 68.170 - Prevention program/Program 2.
Code of Federal Regulations, 2011 CFR
2011-07-01
... 40 Protection of Environment 15 2011-07-01 2011-07-01 false Prevention program/Program 2. 68.170 Section 68.170 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS (CONTINUED) CHEMICAL ACCIDENT PREVENTION PROVISIONS Risk Management Plan § 68.170 Prevention program/Program...
42 CFR 457.170 - Withdrawal process.
Code of Federal Regulations, 2010 CFR
2010-10-01
...) STATE CHILDREN'S HEALTH INSURANCE PROGRAMS (SCHIPs) ALLOTMENTS AND GRANTS TO STATES Introduction; State Plans for Child Health Insurance Programs and Outreach Strategies § 457.170 Withdrawal process. (a... 42 Public Health 4 2010-10-01 2010-10-01 false Withdrawal process. 457.170 Section 457.170 Public...
40 CFR 7.170 - Alternative funds disbursal procedures.
Code of Federal Regulations, 2010 CFR
2010-07-01
... 40 Protection of Environment 1 2010-07-01 2010-07-01 false Alternative funds disbursal procedures. 7.170 Section 7.170 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY GENERAL... Discrimination Prohibited on the Basis of Age § 7.170 Alternative funds disbursal procedures. (a) When EPA...
45 CFR 170.504 - Reconsideration process for requests for ONC-AA status.
Code of Federal Regulations, 2014 CFR
2014-10-01
... status. 170.504 Section 170.504 Public Welfare Department of Health and Human Services HEALTH INFORMATION TECHNOLOGY HEALTH INFORMATION TECHNOLOGY STANDARDS, IMPLEMENTATION SPECIFICATIONS, AND CERTIFICATION CRITERIA AND CERTIFICATION PROGRAMS FOR HEALTH INFORMATION TECHNOLOGY ONC HIT Certification Program § 170.504...
45 CFR 170.504 - Reconsideration process for requests for ONC-AA status.
Code of Federal Regulations, 2013 CFR
2013-10-01
... status. 170.504 Section 170.504 Public Welfare DEPARTMENT OF HEALTH AND HUMAN SERVICES HEALTH INFORMATION TECHNOLOGY HEALTH INFORMATION TECHNOLOGY STANDARDS, IMPLEMENTATION SPECIFICATIONS, AND CERTIFICATION CRITERIA AND CERTIFICATION PROGRAMS FOR HEALTH INFORMATION TECHNOLOGY ONC HIT Certification Program § 170.504...
48 CFR 411.170 - Brand name or equal.
Code of Federal Regulations, 2013 CFR
2013-10-01
... 48 Federal Acquisition Regulations System 4 2013-10-01 2013-10-01 false Brand name or equal. 411.170 Section 411.170 Federal Acquisition Regulations System DEPARTMENT OF AGRICULTURE COMPETITION AND ACQUISITION PLANNING DESCRIBING AGENCY NEEDS Selecting and Developing Requirements Documents 411.170 Brand...
48 CFR 411.170 - Brand name or equal.
Code of Federal Regulations, 2012 CFR
2012-10-01
... 48 Federal Acquisition Regulations System 4 2012-10-01 2012-10-01 false Brand name or equal. 411.170 Section 411.170 Federal Acquisition Regulations System DEPARTMENT OF AGRICULTURE COMPETITION AND ACQUISITION PLANNING DESCRIBING AGENCY NEEDS Selecting and Developing Requirements Documents 411.170 Brand...
48 CFR 411.170 - Brand name or equal.
Code of Federal Regulations, 2014 CFR
2014-10-01
... 48 Federal Acquisition Regulations System 4 2014-10-01 2014-10-01 false Brand name or equal. 411.170 Section 411.170 Federal Acquisition Regulations System DEPARTMENT OF AGRICULTURE COMPETITION AND ACQUISITION PLANNING DESCRIBING AGENCY NEEDS Selecting and Developing Requirements Documents 411.170 Brand...
48 CFR 411.170 - Brand name or equal.
Code of Federal Regulations, 2011 CFR
2011-10-01
... 48 Federal Acquisition Regulations System 4 2011-10-01 2011-10-01 false Brand name or equal. 411.170 Section 411.170 Federal Acquisition Regulations System DEPARTMENT OF AGRICULTURE COMPETITION AND ACQUISITION PLANNING DESCRIBING AGENCY NEEDS Selecting and Developing Requirements Documents 411.170 Brand...
13 CFR 120.170 - Flood insurance.
Code of Federal Regulations, 2010 CFR
2010-01-01
... 13 Business Credit and Assistance 1 2010-01-01 2010-01-01 false Flood insurance. 120.170 Section 120.170 Business Credit and Assistance SMALL BUSINESS ADMINISTRATION BUSINESS LOANS Policies Applying to All Business Loans Requirements Imposed Under Other Laws and Orders § 120.170 Flood insurance...
Code of Federal Regulations, 2010 CFR
2010-10-01
... 48 Federal Acquisition Regulations System 5 2010-10-01 2010-10-01 false Overseas. 702.170-12 Section 702.170-12 Federal Acquisition Regulations System AGENCY FOR INTERNATIONAL DEVELOPMENT GENERAL DEFINITIONS OF WORDS AND TERMS Definitions 702.170-12 Overseas. Overseas means outside the United States, its...
48 CFR 702.170-7 - Foreign Assistance Act.
Code of Federal Regulations, 2010 CFR
2010-10-01
... 48 Federal Acquisition Regulations System 5 2010-10-01 2010-10-01 false Foreign Assistance Act. 702.170-7 Section 702.170-7 Federal Acquisition Regulations System AGENCY FOR INTERNATIONAL DEVELOPMENT GENERAL DEFINITIONS OF WORDS AND TERMS Definitions 702.170-7 Foreign Assistance Act. Foreign...
Code of Federal Regulations, 2010 CFR
2010-10-01
... 48 Federal Acquisition Regulations System 5 2010-10-01 2010-10-01 false Mission. 702.170-11 Section 702.170-11 Federal Acquisition Regulations System AGENCY FOR INTERNATIONAL DEVELOPMENT GENERAL DEFINITIONS OF WORDS AND TERMS Definitions 702.170-11 Mission. Mission means the USAID mission or the...
48 CFR 702.170-6 - Executive agency.
Code of Federal Regulations, 2010 CFR
2010-10-01
... 48 Federal Acquisition Regulations System 5 2010-10-01 2010-10-01 false Executive agency. 702.170-6 Section 702.170-6 Federal Acquisition Regulations System AGENCY FOR INTERNATIONAL DEVELOPMENT GENERAL DEFINITIONS OF WORDS AND TERMS Definitions 702.170-6 Executive agency. Executive agency includes...
40 CFR 408.170 - Applicability; description of the Alaskan mechanized salmon processing subcategory.
Code of Federal Regulations, 2010 CFR
2010-07-01
... Alaskan mechanized salmon processing subcategory. 408.170 Section 408.170 Protection of Environment... PROCESSING POINT SOURCE CATEGORY Alaskan Mechanized Salmon Processing Subcategory § 408.170 Applicability; description of the Alaskan mechanized salmon processing subcategory. The provisions of this subpart are...
40 CFR 408.170 - Applicability; description of the Alaskan mechanized salmon processing subcategory.
Code of Federal Regulations, 2011 CFR
2011-07-01
... Alaskan mechanized salmon processing subcategory. 408.170 Section 408.170 Protection of Environment... PROCESSING POINT SOURCE CATEGORY Alaskan Mechanized Salmon Processing Subcategory § 408.170 Applicability; description of the Alaskan mechanized salmon processing subcategory. The provisions of this subpart are...
40 CFR 68.170 - Prevention program/Program 2.
Code of Federal Regulations, 2010 CFR
2010-07-01
... 40 Protection of Environment 15 2010-07-01 2010-07-01 false Prevention program/Program 2. 68.170 Section 68.170 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS (CONTINUED) CHEMICAL ACCIDENT PREVENTION PROVISIONS Risk Management Plan § 68.170 Prevention program/Program...
34 CFR 1200.170 - Compliance procedures.
Code of Federal Regulations, 2011 CFR
2011-07-01
... 34 Education 4 2011-07-01 2011-07-01 false Compliance procedures. 1200.170 Section 1200.170... THE NATIONAL COUNCIL ON DISABILITY § 1200.170 Compliance procedures. (a) Except as provided in... agency shall notify the Architectural and Transportation Barriers Compliance Board upon receipt of any...
49 CFR 807.170 - Compliance procedures.
Code of Federal Regulations, 2011 CFR
2011-10-01
... 49 Transportation 7 2011-10-01 2011-10-01 false Compliance procedures. 807.170 Section 807.170... TRANSPORTATION SAFETY BOARD § 807.170 Compliance procedures. (a) Except as provided in paragraph (b) of this... the Architectural and Transportation Barriers Compliance Board upon receipt of any complaint alleging...
45 CFR 1175.170 - Compliance procedures.
Code of Federal Regulations, 2010 CFR
2010-10-01
... 45 Public Welfare 3 2010-10-01 2010-10-01 false Compliance procedures. 1175.170 Section 1175.170... PROGRAMS OR ACTIVITIES CONDUCTED BY THE NATIONAL ENDOWMENT FOR THE HUMANITIES § 1175.170 Compliance...) The agency shall notify the Architectural and Transportation Barriers Compliance Board upon receipt of...
Silicone Liner-Free Pressure Sensitive Adhesive Labels
NASA Astrophysics Data System (ADS)
Empereur, Johanne; Chaussy, Didier; Belgacem, Mohamed Naceur
2008-08-01
Pressure sensitive adhesives (PSA) were microencapsulated using simple and complex coacervation and aminoplaste. The microcapsules thus prepared were characterized by FTIR spectroscopy, particle size distribution, rheological behavior and peeling tests. The microcapsules were isolated and found to be out of sticky indicating that the PSAs were indeed encapsulated. The prepared suspensions were deposited at the surface of a paper sheets and the dried labels were then pressed against each other. The ensuing complex was then characterized in terms of peeling forces and showed that the encapsulation using aminoplaste technique of a commercial PSA yielded peel energy of 170 J/m2, which constitutes the recovering of about 68% of the adhesive power of the original non encapsulated PSA.
The role of lasers in modern urology
Dołowy, Łukasz; Dembowski, Janusz; Zdrojowy, Romuald; Kołodziej, Anna
2015-01-01
Introduction The functioning of modern urological departments and the high level of service they provide is possible through, among other things, the use of modern laser techniques. Material and methods Open operations have been replaced by minimally invasive procedures, and classical surgical tools by advanced lasers. The search for new applications with lasers began as technology developed. Among many devices available, holmium, diode and thulium lasers are currently the most popular. Results Depending on the wavelength, the absorption by water and hemoglobin and the depth of penetration, lasers can be used for coagulation, vaporization and enucleation. In many centres, after all the possibilities of pharmacological treatment have been exhausted, lasers are used as the primary treatment for patients with benign prostatic hyperplasia, with therapeutic results that are better than those obtained through open or endoscopic operations. The use of lasers in the treatment of urolithiasis, urinary strictures and bladder tumours has made treatment of older patients with multiple comorbidities safe, without further necessity to modify the anticoagulant drug treatment. Laser procedures are additionally less invasive, reduce hospitalization time and enable a shorter bladder catheterization time, sometimes even eliminating the need for bladder catherterization completely. Such procedures are also characterized by more stable outcomes and a lower number of reoperations. Conclusions There are also indications that with the increased competition among laser manufacturers, decreased purchase and maintenance costs, and increased operational safety, laser equipment will become mandatory and indispensable asset in all urology wards. PMID:26251737
21 CFR 211.170 - Reserve samples.
Code of Federal Regulations, 2014 CFR
2014-04-01
... 21 Food and Drugs 4 2014-04-01 2014-04-01 false Reserve samples. 211.170 Section 211.170 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) DRUGS: GENERAL CURRENT GOOD MANUFACTURING PRACTICE FOR FINISHED PHARMACEUTICALS Laboratory Controls § 211.170 Reserve...
21 CFR 211.170 - Reserve samples.
Code of Federal Regulations, 2012 CFR
2012-04-01
... 21 Food and Drugs 4 2012-04-01 2012-04-01 false Reserve samples. 211.170 Section 211.170 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) DRUGS: GENERAL CURRENT GOOD MANUFACTURING PRACTICE FOR FINISHED PHARMACEUTICALS Laboratory Controls § 211.170 Reserve...
21 CFR 211.170 - Reserve samples.
Code of Federal Regulations, 2011 CFR
2011-04-01
... 21 Food and Drugs 4 2011-04-01 2011-04-01 false Reserve samples. 211.170 Section 211.170 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) DRUGS: GENERAL CURRENT GOOD MANUFACTURING PRACTICE FOR FINISHED PHARMACEUTICALS Laboratory Controls § 211.170 Reserve...
21 CFR 211.170 - Reserve samples.
Code of Federal Regulations, 2013 CFR
2013-04-01
... 21 Food and Drugs 4 2013-04-01 2013-04-01 false Reserve samples. 211.170 Section 211.170 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) DRUGS: GENERAL CURRENT GOOD MANUFACTURING PRACTICE FOR FINISHED PHARMACEUTICALS Laboratory Controls § 211.170 Reserve...
Code of Federal Regulations, 2013 CFR
2013-01-01
... 10 Energy 2 2013-01-01 2013-01-01 false Purpose. 170.1 Section 170.1 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) FEES FOR FACILITIES, MATERIALS, IMPORT AND EXPORT LICENSES, AND OTHER REGULATORY SERVICES UNDER THE ATOMIC ENERGY ACT OF 1954, AS AMENDED General Provisions § 170.1 Purpose. The...
Code of Federal Regulations, 2012 CFR
2012-01-01
... 10 Energy 2 2012-01-01 2012-01-01 false Purpose. 170.1 Section 170.1 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) FEES FOR FACILITIES, MATERIALS, IMPORT AND EXPORT LICENSES, AND OTHER REGULATORY SERVICES UNDER THE ATOMIC ENERGY ACT OF 1954, AS AMENDED General Provisions § 170.1 Purpose. The...
Code of Federal Regulations, 2010 CFR
2010-01-01
... 10 Energy 2 2010-01-01 2010-01-01 false Scope. 170.2 Section 170.2 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) FEES FOR FACILITIES, MATERIALS, IMPORT AND EXPORT LICENSES, AND OTHER REGULATORY SERVICES UNDER THE ATOMIC ENERGY ACT OF 1954, AS AMENDED General Provisions § 170.2 Scope. Except for...
Code of Federal Regulations, 2012 CFR
2012-01-01
... 10 Energy 2 2012-01-01 2012-01-01 false Scope. 170.2 Section 170.2 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) FEES FOR FACILITIES, MATERIALS, IMPORT AND EXPORT LICENSES, AND OTHER REGULATORY SERVICES UNDER THE ATOMIC ENERGY ACT OF 1954, AS AMENDED General Provisions § 170.2 Scope. Except for...
Code of Federal Regulations, 2011 CFR
2011-01-01
... 10 Energy 2 2011-01-01 2011-01-01 false Purpose. 170.1 Section 170.1 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) FEES FOR FACILITIES, MATERIALS, IMPORT AND EXPORT LICENSES, AND OTHER REGULATORY SERVICES UNDER THE ATOMIC ENERGY ACT OF 1954, AS AMENDED General Provisions § 170.1 Purpose. The...
Code of Federal Regulations, 2011 CFR
2011-01-01
... 10 Energy 2 2011-01-01 2011-01-01 false Scope. 170.2 Section 170.2 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) FEES FOR FACILITIES, MATERIALS, IMPORT AND EXPORT LICENSES, AND OTHER REGULATORY SERVICES UNDER THE ATOMIC ENERGY ACT OF 1954, AS AMENDED General Provisions § 170.2 Scope. Except for...
Code of Federal Regulations, 2014 CFR
2014-01-01
... 10 Energy 2 2014-01-01 2014-01-01 false Purpose. 170.1 Section 170.1 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) FEES FOR FACILITIES, MATERIALS, IMPORT AND EXPORT LICENSES, AND OTHER REGULATORY SERVICES UNDER THE ATOMIC ENERGY ACT OF 1954, AS AMENDED General Provisions § 170.1 Purpose. The...
Code of Federal Regulations, 2010 CFR
2010-01-01
... 10 Energy 2 2010-01-01 2010-01-01 false Purpose. 170.1 Section 170.1 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) FEES FOR FACILITIES, MATERIALS, IMPORT AND EXPORT LICENSES, AND OTHER REGULATORY SERVICES UNDER THE ATOMIC ENERGY ACT OF 1954, AS AMENDED General Provisions § 170.1 Purpose. The...
Code of Federal Regulations, 2014 CFR
2014-01-01
... 10 Energy 2 2014-01-01 2014-01-01 false Scope. 170.2 Section 170.2 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) FEES FOR FACILITIES, MATERIALS, IMPORT AND EXPORT LICENSES, AND OTHER REGULATORY SERVICES UNDER THE ATOMIC ENERGY ACT OF 1954, AS AMENDED General Provisions § 170.2 Scope. Except for...
Code of Federal Regulations, 2013 CFR
2013-01-01
... 10 Energy 2 2013-01-01 2013-01-01 false Scope. 170.2 Section 170.2 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) FEES FOR FACILITIES, MATERIALS, IMPORT AND EXPORT LICENSES, AND OTHER REGULATORY SERVICES UNDER THE ATOMIC ENERGY ACT OF 1954, AS AMENDED General Provisions § 170.2 Scope. Except for...
45 CFR 170.503 - Requests for ONC-AA status and ONC-AA ongoing responsibilities.
Code of Federal Regulations, 2014 CFR
2014-10-01
... responsibilities. 170.503 Section 170.503 Public Welfare Department of Health and Human Services HEALTH INFORMATION TECHNOLOGY HEALTH INFORMATION TECHNOLOGY STANDARDS, IMPLEMENTATION SPECIFICATIONS, AND CERTIFICATION CRITERIA AND CERTIFICATION PROGRAMS FOR HEALTH INFORMATION TECHNOLOGY ONC HIT Certification Program § 170.503...
45 CFR 170.503 - Requests for ONC-AA status and ONC-AA ongoing responsibilities.
Code of Federal Regulations, 2013 CFR
2013-10-01
... responsibilities. 170.503 Section 170.503 Public Welfare DEPARTMENT OF HEALTH AND HUMAN SERVICES HEALTH INFORMATION TECHNOLOGY HEALTH INFORMATION TECHNOLOGY STANDARDS, IMPLEMENTATION SPECIFICATIONS, AND CERTIFICATION CRITERIA AND CERTIFICATION PROGRAMS FOR HEALTH INFORMATION TECHNOLOGY ONC HIT Certification Program § 170.503...
42 CFR 494.170 - Condition: Medical records.
Code of Federal Regulations, 2014 CFR
2014-10-01
... 42 Public Health 5 2014-10-01 2014-10-01 false Condition: Medical records. 494.170 Section 494.170... Administration § 494.170 Condition: Medical records. The dialysis facility must maintain complete, accurate, and...: Completion of patient records and centralization of clinical information. (1) Current medical records and...
42 CFR 494.170 - Condition: Medical records.
Code of Federal Regulations, 2013 CFR
2013-10-01
... 42 Public Health 5 2013-10-01 2013-10-01 false Condition: Medical records. 494.170 Section 494.170... Administration § 494.170 Condition: Medical records. The dialysis facility must maintain complete, accurate, and...: Completion of patient records and centralization of clinical information. (1) Current medical records and...
46 CFR 170.055 - Definitions concerning a vessel.
Code of Federal Regulations, 2010 CFR
2010-10-01
... 46 Shipping 7 2010-10-01 2010-10-01 false Definitions concerning a vessel. 170.055 Section 170.055 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) SUBDIVISION AND STABILITY STABILITY REQUIREMENTS FOR ALL INSPECTED VESSELS Definitions § 170.055 Definitions concerning a vessel. (a) Auxiliary...
10 CFR 170.5 - Communications.
Code of Federal Regulations, 2013 CFR
2013-01-01
... 10 Energy 2 2013-01-01 2013-01-01 false Communications. 170.5 Section 170.5 Energy NUCLEAR... REGULATORY SERVICES UNDER THE ATOMIC ENERGY ACT OF 1954, AS AMENDED General Provisions § 170.5 Communications. All communications concerning the regulations in this part should be addressed to the NRC's Chief...
10 CFR 170.5 - Communications.
Code of Federal Regulations, 2014 CFR
2014-01-01
... 10 Energy 2 2014-01-01 2014-01-01 false Communications. 170.5 Section 170.5 Energy NUCLEAR... REGULATORY SERVICES UNDER THE ATOMIC ENERGY ACT OF 1954, AS AMENDED General Provisions § 170.5 Communications. All communications concerning the regulations in this part should be addressed to the NRC's Chief...
46 CFR 133.170 - Line-throwing appliance.
Code of Federal Regulations, 2012 CFR
2012-10-01
... 46 Shipping 4 2012-10-01 2012-10-01 false Line-throwing appliance. 133.170 Section 133.170 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) OFFSHORE SUPPLY VESSELS LIFESAVING SYSTEMS Requirements for All OSVs § 133.170 Line-throwing appliance. (a) General. Each OSV must have a...
46 CFR 133.170 - Line-throwing appliance.
Code of Federal Regulations, 2014 CFR
2014-10-01
... 46 Shipping 4 2014-10-01 2014-10-01 false Line-throwing appliance. 133.170 Section 133.170 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) OFFSHORE SUPPLY VESSELS LIFESAVING SYSTEMS Requirements for All OSVs § 133.170 Line-throwing appliance. (a) General. Each OSV must have a...
12 CFR 19.170 - Discovery depositions.
Code of Federal Regulations, 2012 CFR
2012-01-01
... 12 Banks and Banking 1 2012-01-01 2012-01-01 false Discovery depositions. 19.170 Section 19.170 Banks and Banking COMPTROLLER OF THE CURRENCY, DEPARTMENT OF THE TREASURY RULES OF PRACTICE AND PROCEDURE Discovery Depositions and Subpoenas § 19.170 Discovery depositions. (a) General rule. In any...
42 CFR 494.170 - Condition: Medical records.
Code of Federal Regulations, 2011 CFR
2011-10-01
... 42 Public Health 5 2011-10-01 2011-10-01 false Condition: Medical records. 494.170 Section 494.170... Administration § 494.170 Condition: Medical records. The dialysis facility must maintain complete, accurate, and...: Completion of patient records and centralization of clinical information. (1) Current medical records and...
10 CFR 170.5 - Communications.
Code of Federal Regulations, 2010 CFR
2010-01-01
... 10 Energy 2 2010-01-01 2010-01-01 false Communications. 170.5 Section 170.5 Energy NUCLEAR... REGULATORY SERVICES UNDER THE ATOMIC ENERGY ACT OF 1954, AS AMENDED General Provisions § 170.5 Communications. All communications concerning the regulations in this part should be addressed to the NRC's Chief...
48 CFR 702.170-5 - Cooperating country national (CCN).
Code of Federal Regulations, 2010 CFR
2010-10-01
... 48 Federal Acquisition Regulations System 5 2010-10-01 2010-10-01 false Cooperating country national (CCN). 702.170-5 Section 702.170-5 Federal Acquisition Regulations System AGENCY FOR INTERNATIONAL DEVELOPMENT GENERAL DEFINITIONS OF WORDS AND TERMS Definitions 702.170-5 Cooperating country national (CCN...
Code of Federal Regulations, 2010 CFR
2010-10-01
... 48 Federal Acquisition Regulations System 5 2010-10-01 2010-10-01 false USAID. 702.170-1 Section 702.170-1 Federal Acquisition Regulations System AGENCY FOR INTERNATIONAL DEVELOPMENT GENERAL DEFINITIONS OF WORDS AND TERMS Definitions 702.170-1 USAID. USAID means the U.S. Agency for International...
33 CFR 167.170 - Off Delaware Bay Approach Traffic Separation Scheme: General.
Code of Federal Regulations, 2012 CFR
2012-07-01
... Separation Scheme: General. 167.170 Section 167.170 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) PORTS AND WATERWAYS SAFETY OFFSHORE TRAFFIC SEPARATION SCHEMES Description of Traffic Separation Schemes and Precautionary Areas Atlantic East Coast § 167.170 Off Delaware...
33 CFR 167.170 - Off Delaware Bay Approach Traffic Separation Scheme: General.
Code of Federal Regulations, 2010 CFR
2010-07-01
... Separation Scheme: General. 167.170 Section 167.170 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) PORTS AND WATERWAYS SAFETY OFFSHORE TRAFFIC SEPARATION SCHEMES Description of Traffic Separation Schemes and Precautionary Areas Atlantic East Coast § 167.170 Off Delaware...
33 CFR 167.170 - Off Delaware Bay Approach Traffic Separation Scheme: General.
Code of Federal Regulations, 2014 CFR
2014-07-01
... Separation Scheme: General. 167.170 Section 167.170 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) PORTS AND WATERWAYS SAFETY OFFSHORE TRAFFIC SEPARATION SCHEMES Description of Traffic Separation Schemes and Precautionary Areas Atlantic East Coast § 167.170 Off Delaware...
33 CFR 167.170 - Off Delaware Bay Approach Traffic Separation Scheme: General.
Code of Federal Regulations, 2013 CFR
2013-07-01
... Separation Scheme: General. 167.170 Section 167.170 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) PORTS AND WATERWAYS SAFETY OFFSHORE TRAFFIC SEPARATION SCHEMES Description of Traffic Separation Schemes and Precautionary Areas Atlantic East Coast § 167.170 Off Delaware...
33 CFR 167.170 - Off Delaware Bay Approach Traffic Separation Scheme: General.
Code of Federal Regulations, 2011 CFR
2011-07-01
... Separation Scheme: General. 167.170 Section 167.170 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) PORTS AND WATERWAYS SAFETY OFFSHORE TRAFFIC SEPARATION SCHEMES Description of Traffic Separation Schemes and Precautionary Areas Atlantic East Coast § 167.170 Off Delaware...
21 CFR 170.45 - Fluorine-containing compounds.
Code of Federal Regulations, 2014 CFR
2014-04-01
... 21 Food and Drugs 3 2014-04-01 2014-04-01 false Fluorine-containing compounds. 170.45 Section 170.45 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD ADDITIVES Specific Administrative Rulings and Decisions § 170.45 Fluorine-containing compounds...
45 CFR 1153.170 - Compliance procedures.
Code of Federal Regulations, 2010 CFR
2010-10-01
... 45 Public Welfare 3 2010-10-01 2010-10-01 false Compliance procedures. 1153.170 Section 1153.170... PROGRAMS OR ACTIVITIES CONDUCTED BY THE NATIONAL ENDOWMENT FOR THE ARTS § 1153.170 Compliance procedures... and Transportation Barriers Compliance Board upon receipt of any complaint alleging that a building or...
Nediani, Miriam T.; García, Luis; Saavedra, Lucila; Martínez, Sandra; López Alzogaray, Soledad; Fadda, Silvina
2017-01-01
Quality and safety are important challenges in traditional fermented sausage technology. Consequently, the development of a tailored starter culture based on indigenous microbiota constitutes an interesting alternative. In the present study, spontaneously fermented goat meat sausages were created and analyzed using a physicochemical and microbiological approach. Thereafter 170 lactic acid bacteria (LAB) strains were isolated and preliminary characterized by phenotypic assays. The hygienic and technological properties, and growth and fermentative potential of isolates using a goat-meat-based culture medium were evaluated. All strains proved to have bioprotective features due to their acidogenic metabolism. Almost all grew optimally in meat environments. LAB isolates presented proteolytic activity against meat proteins and enriched amino acid contents of the goat-meat-based model. The most efficient strains were four different Lactobacillus sakei isolates, as identified by genotyping and RAPD analysis. L. sakei strains are proposed as optimal candidates to improve the production of fermented goat meat sausages, creating a new added-value fermented product. PMID:28513575
Nediani, Miriam T; García, Luis; Saavedra, Lucila; Martínez, Sandra; López Alzogaray, Soledad; Fadda, Silvina
2017-05-17
Quality and safety are important challenges in traditional fermented sausage technology. Consequently, the development of a tailored starter culture based on indigenous microbiota constitutes an interesting alternative. In the present study, spontaneously fermented goat meat sausages were created and analyzed using a physicochemical and microbiological approach. Thereafter 170 lactic acid bacteria (LAB) strains were isolated and preliminary characterized by phenotypic assays. The hygienic and technological properties, and growth and fermentative potential of isolates using a goat-meat-based culture medium were evaluated. All strains proved to have bioprotective features due to their acidogenic metabolism. Almost all grew optimally in meat environments. LAB isolates presented proteolytic activity against meat proteins and enriched amino acid contents of the goat-meat-based model. The most efficient strains were four different Lactobacillus sakei isolates, as identified by genotyping and RAPD analysis. L. sakei strains are proposed as optimal candidates to improve the production of fermented goat meat sausages, creating a new added-value fermented product.
Design and Characterization of the UTIAS Anechoic Wind Tunnel
NASA Astrophysics Data System (ADS)
Chow, Derrick H. F.
The anechoic open-jet wind tunnel facility at the University of Toronto Institute for Aerospace Studies was updated and characterized to meet the needs of current and future aeroacoustic experiments. The wind tunnel inlet was resurfaced and flow-conditioning screens were redesigned to improve the freestream turbulence intensity to below 0.4% in the test section. The circular nozzle was replaced with a square secondary contraction that increased the maximum test section velocity to 75 m/s and improved flow uniformity to over 99% across a usable cross-sectional area of 500 mm x 500 mm. Acoustic baffles were installed in front of the wind tunnel inlet and foam wedges were installed in the anechoic chamber. The overall background sound pressure levels in the chamber were improved by 8-18 db over the range of operational freestream velocities. The anechoic chamber cut-off frequency is 170 Hz and the reverberation time for a 60 dB sound power decay is 0.032 s.
Carbon, Claus-Christian; Deffke, Iris; Sander, Tilmann; Grüter, Thomas; Grüter, Martina; Trahms, Lutz; Curio, Gabriel
2015-01-01
Modularity of face processing is still a controversial issue. Congenital prosopagnosia (cPA), a selective and lifelong impairment in familiar face recognition without evidence of an acquired cerebral lesion, offers a unique opportunity to support this fundamental hypothesis. However, in spite of the pronounced behavioural impairment, identification of a functionally relevant neural alteration in congenital prosopagnosia by electrophysiogical methods has not been achieved so far. Here we show that persons with congenital prosopagnosia can be distinguished as a group from unimpaired persons using magnetoencephalography. Early face-selective MEG-responses in the range of 140 to 200ms (the M170) showed prolonged latency and decreased amplitude whereas responses to another category (houses) were indistinguishable between subjects with congenital prosopagnosia and unimpaired controls. Latency and amplitude of face-selective EEG responses (the N170) which were simultaneously recorded were statistically indistinguishable between subjects with cPA and healthy controls which resolves heterogeneous and partly conflicting results from existing studies. The complementary analysis of categorical differences (evoked activity to faces minus evoked activity to houses) revealed that the early part of the 170ms response to faces is altered in subjects with cPA. This finding can be adequately explained in a common framework of holistic and part-based face processing. Whereas a significant brain-behaviour correlation of face recognition performance and the size of the M170 amplitude is found in controls a corresponding correlation is not seen in subjects with cPA. This indicates functional relevance of the alteration found for the 170ms response to faces in cPA and pinpoints the impairment of face processing to early perceptual stages. PMID:26393348
Coote, K J; Paisley, D; Czarnecki, S; Tweed, M; Watson, H; Young, A; Sugar, R; Vyas, M; Smith, N J; Baettig, U; Groot-Kormelink, P J; Gosling, M; Lock, R; Ethell, B; Williams, G; Schumacher, A; Harris, J; Abraham, W M; Sabater, J; Poll, C T; Faller, T; Collingwood, S P; Danahay, H
2015-01-01
Background and Purpose Inhaled amiloride, a blocker of the epithelial sodium channel (ENaC), enhances mucociliary clearance (MCC) in cystic fibrosis (CF) patients. However, the dose of amiloride is limited by the mechanism-based side effect of hyperkalaemia resulting from renal ENaC blockade. Inhaled ENaC blockers with a reduced potential to induce hyperkalaemia provide a therapeutic strategy to improve mucosal hydration and MCC in the lungs of CF patients. The present study describes the preclinical profile of a novel ENaC blocker, NVP-QBE170, designed for inhaled delivery, with a reduced potential to induce hyperkalaemia. Experimental Approach The in vitro potency and duration of action of NVP-QBE170 were compared with amiloride and a newer ENaC blocker, P552-02, in primary human bronchial epithelial cells (HBECs) by short-circuit current. In vivo efficacy and safety were assessed in guinea pig (tracheal potential difference/hyperkalaemia), rat (hyperkalaemia) and sheep (MCC). Key Results In vitro, NVP-QBE170 potently inhibited ENaC function in HBEC and showed a longer duration of action to comparator molecules. In vivo, intratracheal (i.t.) instillation of NVP-QBE170 attenuated ENaC activity in the guinea pig airways with greater potency and duration of action than that of amiloride without inducing hyperkalaemia in either guinea pig or rat. Dry powder inhalation of NVP-QBE170 by conscious sheep increased MCC and was better than inhaled hypertonic saline in terms of efficacy and duration of action. Conclusions and Implications NVP-QBE170 highlights the potential for inhaled ENaC blockers to exhibit efficacy in the airways with a reduced risk of hyperkalaemia, relative to existing compounds. PMID:25573195
Coote, K J; Paisley, D; Czarnecki, S; Tweed, M; Watson, H; Young, A; Sugar, R; Vyas, M; Smith, N J; Baettig, U; Groot-Kormelink, P J; Gosling, M; Lock, R; Ethell, B; Williams, G; Schumacher, A; Harris, J; Abraham, W M; Sabater, J; Poll, C T; Faller, T; Collingwood, S P; Danahay, H
2015-06-01
Inhaled amiloride, a blocker of the epithelial sodium channel (ENaC), enhances mucociliary clearance (MCC) in cystic fibrosis (CF) patients. However, the dose of amiloride is limited by the mechanism-based side effect of hyperkalaemia resulting from renal ENaC blockade. Inhaled ENaC blockers with a reduced potential to induce hyperkalaemia provide a therapeutic strategy to improve mucosal hydration and MCC in the lungs of CF patients. The present study describes the preclinical profile of a novel ENaC blocker, NVP-QBE170, designed for inhaled delivery, with a reduced potential to induce hyperkalaemia. The in vitro potency and duration of action of NVP-QBE170 were compared with amiloride and a newer ENaC blocker, P552-02, in primary human bronchial epithelial cells (HBECs) by short-circuit current. In vivo efficacy and safety were assessed in guinea pig (tracheal potential difference/hyperkalaemia), rat (hyperkalaemia) and sheep (MCC). In vitro, NVP-QBE170 potently inhibited ENaC function in HBEC and showed a longer duration of action to comparator molecules. In vivo, intratracheal (i.t.) instillation of NVP-QBE170 attenuated ENaC activity in the guinea pig airways with greater potency and duration of action than that of amiloride without inducing hyperkalaemia in either guinea pig or rat. Dry powder inhalation of NVP-QBE170 by conscious sheep increased MCC and was better than inhaled hypertonic saline in terms of efficacy and duration of action. NVP-QBE170 highlights the potential for inhaled ENaC blockers to exhibit efficacy in the airways with a reduced risk of hyperkalaemia, relative to existing compounds. © 2015 The British Pharmacological Society.
The role of encoding and attention in facial emotion memory: an EEG investigation.
Brenner, Colleen A; Rumak, Samuel P; Burns, Amy M N; Kieffaber, Paul D
2014-09-01
Facial expressions are encoded via sensory mechanisms, but meaning extraction and salience of these expressions involve cognitive functions. We investigated the time course of sensory encoding and subsequent maintenance in memory via EEG. Twenty-nine healthy participants completed a facial emotion delayed match-to-sample task. P100, N170 and N250 ERPs were measured in response to the first stimulus, and evoked theta power (4-7Hz) was measured during the delay interval. Negative facial expressions produced larger N170 amplitudes and greater theta power early in the delay. N170 amplitude correlated with theta power, however larger N170 amplitude coupled with greater theta power only predicted behavioural performance for one emotion condition (very happy) out of six tested (see Supplemental Data). These findings indicate that the N170 ERP may be sensitive to emotional facial expressions when task demands require encoding and retention of this information. Furthermore, sustained theta activity may represent continued attentional processing that supports short-term memory, especially of negative facial stimuli. Further study is needed to investigate the potential influence of these measures, and their interaction, on behavioural performance. Crown Copyright © 2014. Published by Elsevier B.V. All rights reserved.
46 CFR 150.170 - Right of appeal.
Code of Federal Regulations, 2011 CFR
2011-10-01
... 46 Shipping 5 2011-10-01 2011-10-01 false Right of appeal. 150.170 Section 150.170 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) CERTAIN BULK DANGEROUS CARGOES COMPATIBILITY OF CARGOES § 150.170 Right of appeal. Any person directly affected by a decision or action taken under this...
46 CFR 150.170 - Right of appeal.
Code of Federal Regulations, 2012 CFR
2012-10-01
... 46 Shipping 5 2012-10-01 2012-10-01 false Right of appeal. 150.170 Section 150.170 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) CERTAIN BULK DANGEROUS CARGOES COMPATIBILITY OF CARGOES § 150.170 Right of appeal. Any person directly affected by a decision or action taken under this...
46 CFR 150.170 - Right of appeal.
Code of Federal Regulations, 2014 CFR
2014-10-01
... 46 Shipping 5 2014-10-01 2014-10-01 false Right of appeal. 150.170 Section 150.170 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) CERTAIN BULK DANGEROUS CARGOES COMPATIBILITY OF CARGOES § 150.170 Right of appeal. Any person directly affected by a decision or action taken under this...
46 CFR 150.170 - Right of appeal.
Code of Federal Regulations, 2013 CFR
2013-10-01
... 46 Shipping 5 2013-10-01 2013-10-01 false Right of appeal. 150.170 Section 150.170 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) CERTAIN BULK DANGEROUS CARGOES COMPATIBILITY OF CARGOES § 150.170 Right of appeal. Any person directly affected by a decision or action taken under this...
25 CFR 170.812 - What is emergency maintenance?
Code of Federal Regulations, 2010 CFR
2010-04-01
... 25 Indians 1 2010-04-01 2010-04-01 false What is emergency maintenance? 170.812 Section 170.812 Indians BUREAU OF INDIAN AFFAIRS, DEPARTMENT OF THE INTERIOR LAND AND WATER INDIAN RESERVATION ROADS PROGRAM BIA Road Maintenance § 170.812 What is emergency maintenance? Emergency maintenance is work that...
25 CFR 170.800 - Who owns IRR transportation facilities?
Code of Federal Regulations, 2010 CFR
2010-04-01
... 25 Indians 1 2010-04-01 2010-04-01 false Who owns IRR transportation facilities? 170.800 Section 170.800 Indians BUREAU OF INDIAN AFFAIRS, DEPARTMENT OF THE INTERIOR LAND AND WATER INDIAN RESERVATION ROADS PROGRAM BIA Road Maintenance § 170.800 Who owns IRR transportation facilities? Public authorities...
Code of Federal Regulations, 2010 CFR
2010-07-01
... sodium dichromate and sodium sulfate production subcategory. 415.170 Section 415.170 Protection of... MANUFACTURING POINT SOURCE CATEGORY Sodium Dichromate and Sodium Sulfate Production Subcategory § 415.170 Applicability; description of the sodium dichromate and sodium sulfate production subcategory. The provisions of...
Code of Federal Regulations, 2012 CFR
2012-07-01
... sodium dichromate and sodium sulfate production subcategory. 415.170 Section 415.170 Protection of... MANUFACTURING POINT SOURCE CATEGORY Sodium Dichromate and Sodium Sulfate Production Subcategory § 415.170 Applicability; description of the sodium dichromate and sodium sulfate production subcategory. The provisions of...
Code of Federal Regulations, 2011 CFR
2011-07-01
... sodium dichromate and sodium sulfate production subcategory. 415.170 Section 415.170 Protection of... MANUFACTURING POINT SOURCE CATEGORY Sodium Dichromate and Sodium Sulfate Production Subcategory § 415.170 Applicability; description of the sodium dichromate and sodium sulfate production subcategory. The provisions of...
Code of Federal Regulations, 2013 CFR
2013-07-01
... sodium dichromate and sodium sulfate production subcategory. 415.170 Section 415.170 Protection of... MANUFACTURING POINT SOURCE CATEGORY Sodium Dichromate and Sodium Sulfate Production Subcategory § 415.170 Applicability; description of the sodium dichromate and sodium sulfate production subcategory. The provisions of...
Code of Federal Regulations, 2014 CFR
2014-07-01
... sodium dichromate and sodium sulfate production subcategory. 415.170 Section 415.170 Protection of... MANUFACTURING POINT SOURCE CATEGORY Sodium Dichromate and Sodium Sulfate Production Subcategory § 415.170 Applicability; description of the sodium dichromate and sodium sulfate production subcategory. The provisions of...
10 CFR 170.12 - Payment of fees.
Code of Federal Regulations, 2012 CFR
2012-01-01
... 10 Energy 2 2012-01-01 2012-01-01 false Payment of fees. 170.12 Section 170.12 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) FEES FOR FACILITIES, MATERIALS, IMPORT AND EXPORT LICENSES, AND OTHER REGULATORY SERVICES UNDER THE ATOMIC ENERGY ACT OF 1954, AS AMENDED General Provisions § 170.12 Payment of...
10 CFR 170.12 - Payment of fees.
Code of Federal Regulations, 2011 CFR
2011-01-01
... 10 Energy 2 2011-01-01 2011-01-01 false Payment of fees. 170.12 Section 170.12 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) FEES FOR FACILITIES, MATERIALS, IMPORT AND EXPORT LICENSES, AND OTHER REGULATORY SERVICES UNDER THE ATOMIC ENERGY ACT OF 1954, AS AMENDED General Provisions § 170.12 Payment of...
10 CFR 170.12 - Payment of fees.
Code of Federal Regulations, 2014 CFR
2014-01-01
... 10 Energy 2 2014-01-01 2014-01-01 false Payment of fees. 170.12 Section 170.12 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) FEES FOR FACILITIES, MATERIALS, IMPORT AND EXPORT LICENSES, AND OTHER REGULATORY SERVICES UNDER THE ATOMIC ENERGY ACT OF 1954, AS AMENDED General Provisions § 170.12 Payment of...
10 CFR 170.12 - Payment of fees.
Code of Federal Regulations, 2013 CFR
2013-01-01
... 10 Energy 2 2013-01-01 2013-01-01 false Payment of fees. 170.12 Section 170.12 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) FEES FOR FACILITIES, MATERIALS, IMPORT AND EXPORT LICENSES, AND OTHER REGULATORY SERVICES UNDER THE ATOMIC ENERGY ACT OF 1954, AS AMENDED General Provisions § 170.12 Payment of...
10 CFR 170.12 - Payment of fees.
Code of Federal Regulations, 2010 CFR
2010-01-01
... 10 Energy 2 2010-01-01 2010-01-01 false Payment of fees. 170.12 Section 170.12 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) FEES FOR FACILITIES, MATERIALS, IMPORT AND EXPORT LICENSES, AND OTHER REGULATORY SERVICES UNDER THE ATOMIC ENERGY ACT OF 1954, AS AMENDED General Provisions § 170.12 Payment of...
48 CFR 1815.403-170 - Waivers of cost or pricing data.
Code of Federal Regulations, 2012 CFR
2012-10-01
... data. 1815.403-170 Section 1815.403-170 Federal Acquisition Regulations System NATIONAL AERONAUTICS AND SPACE ADMINISTRATION CONTRACTING METHODS AND CONTRACT TYPES CONTRACTING BY NEGOTIATION Contract Pricing 1815.403-170 Waivers of cost or pricing data. (a) NASA has waived the requirement for the submission of...
48 CFR 1815.403-170 - Waivers of cost or pricing data.
Code of Federal Regulations, 2013 CFR
2013-10-01
... data. 1815.403-170 Section 1815.403-170 Federal Acquisition Regulations System NATIONAL AERONAUTICS AND SPACE ADMINISTRATION CONTRACTING METHODS AND CONTRACT TYPES CONTRACTING BY NEGOTIATION Contract Pricing 1815.403-170 Waivers of cost or pricing data. (a) NASA has waived the requirement for the submission of...
48 CFR 1815.403-170 - Waivers of cost or pricing data.
Code of Federal Regulations, 2014 CFR
2014-10-01
... data. 1815.403-170 Section 1815.403-170 Federal Acquisition Regulations System NATIONAL AERONAUTICS AND SPACE ADMINISTRATION CONTRACTING METHODS AND CONTRACT TYPES CONTRACTING BY NEGOTIATION Contract Pricing 1815.403-170 Waivers of cost or pricing data. (a) NASA has waived the requirement for the submission of...
21 CFR 184.1685 - Rennet (animal-derived) and chymosin preparation (fermentation-derived).
Code of Federal Regulations, 2011 CFR
2011-04-01
... defined in § 170.3(o)(24) of this chapter; and a stabilizer and thickener as defined in § 170.3(o)(28) of... as defined in § 170.3(n)(20) of this chapter; gelatins, puddings, and fillings as defined in § 170.3...
48 CFR 1602.170-13 - Similarly sized subscriber groups.
Code of Federal Regulations, 2013 CFR
2013-10-01
... groups. 1602.170-13 Section 1602.170-13 Federal Acquisition Regulations System OFFICE OF PERSONNEL... Definitions of FEHBP Terms 1602.170-13 Similarly sized subscriber groups. (a) Similarly sized subscriber groups (SSSGs) are a comprehensive medical plan carrier's two employer groups that: (1) As of the date...
48 CFR 1602.170-13 - Similarly sized subscriber groups.
Code of Federal Regulations, 2014 CFR
2014-10-01
... groups. 1602.170-13 Section 1602.170-13 Federal Acquisition Regulations System OFFICE OF PERSONNEL... Definitions of FEHBP Terms 1602.170-13 Similarly sized subscriber groups. (a) Similarly sized subscriber groups (SSSGs) are a comprehensive medical plan carrier's two employer groups that: (1) As of the date...
40 CFR 81.170 - Miles City Intrastate Air Quality Control Region.
Code of Federal Regulations, 2012 CFR
2012-07-01
... 40 Protection of Environment 18 2012-07-01 2012-07-01 false Miles City Intrastate Air Quality Control Region. 81.170 Section 81.170 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED... Quality Control Regions § 81.170 Miles City Intrastate Air Quality Control Region. The Miles City...
40 CFR 81.170 - Miles City Intrastate Air Quality Control Region.
Code of Federal Regulations, 2014 CFR
2014-07-01
... 40 Protection of Environment 18 2014-07-01 2014-07-01 false Miles City Intrastate Air Quality Control Region. 81.170 Section 81.170 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED... Quality Control Regions § 81.170 Miles City Intrastate Air Quality Control Region. The Miles City...
40 CFR 81.170 - Miles City Intrastate Air Quality Control Region.
Code of Federal Regulations, 2013 CFR
2013-07-01
... 40 Protection of Environment 18 2013-07-01 2013-07-01 false Miles City Intrastate Air Quality Control Region. 81.170 Section 81.170 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED... Quality Control Regions § 81.170 Miles City Intrastate Air Quality Control Region. The Miles City...
Code of Federal Regulations, 2013 CFR
2013-01-01
... 2 Grants and Agreements 1 2013-01-01 2013-01-01 false Entity. 170.310 Section 170.310 Grants and Agreements Office of Management and Budget Guidance for Grants and Agreements OFFICE OF MANAGEMENT AND BUDGET... COMPENSATION INFORMATION Definitions § 170.310 Entity. Entity has the meaning given in 2 CFR part 25. ...
Code of Federal Regulations, 2014 CFR
2014-01-01
... 2 Grants and Agreements 1 2014-01-01 2014-01-01 false Entity. 170.310 Section 170.310 Grants and Agreements Office of Management and Budget Guidance for Grants and Agreements OFFICE OF MANAGEMENT AND BUDGET... INFORMATION Definitions § 170.310 Entity. Entity has the meaning given in 2 CFR part 25. ...
Code of Federal Regulations, 2012 CFR
2012-01-01
... 2 Grants and Agreements 1 2012-01-01 2012-01-01 false Entity. 170.310 Section 170.310 Grants and Agreements Office of Management and Budget Guidance for Grants and Agreements OFFICE OF MANAGEMENT AND BUDGET... COMPENSATION INFORMATION Definitions § 170.310 Entity. Entity has the meaning given in 2 CFR part 25. ...
41 CFR 102-41.170 - Is unclaimed personal property available for donation?
Code of Federal Regulations, 2010 CFR
2010-07-01
... property available for donation? 102-41.170 Section 102-41.170 Public Contracts and Property Management... Personal Property § 102-41.170 Is unclaimed personal property available for donation? No, unclaimed personal property is not available for donation because reimbursement at fair market value is required. ...
12 CFR 19.170 - Discovery depositions.
Code of Federal Regulations, 2010 CFR
2010-01-01
... 12 Banks and Banking 1 2010-01-01 2010-01-01 false Discovery depositions. 19.170 Section 19.170... PROCEDURE Discovery Depositions and Subpoenas § 19.170 Discovery depositions. (a) General rule. In any... deposition of an expert, or of a person, including another party, who has direct knowledge of matters that...
12 CFR 19.170 - Discovery depositions.
Code of Federal Regulations, 2011 CFR
2011-01-01
... 12 Banks and Banking 1 2011-01-01 2011-01-01 false Discovery depositions. 19.170 Section 19.170... PROCEDURE Discovery Depositions and Subpoenas § 19.170 Discovery depositions. (a) General rule. In any... deposition of an expert, or of a person, including another party, who has direct knowledge of matters that...
Code of Federal Regulations, 2011 CFR
2011-01-01
... 2 Grants and Agreements 1 2011-01-01 2011-01-01 false Entity. 170.310 Section 170.310 Grants and Agreements Office of Management and Budget Guidance for Grants and Agreements OFFICE OF MANAGEMENT AND BUDGET... INFORMATION Definitions § 170.310 Entity. Entity has the meaning given in 2 CFR part 25. ...
40 CFR 170.130 - Pesticide safety training for workers.
Code of Federal Regulations, 2012 CFR
2012-07-01
... 40 Protection of Environment 25 2012-07-01 2012-07-01 false Pesticide safety training for workers. 170.130 Section 170.130 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) PESTICIDE PROGRAMS WORKER PROTECTION STANDARD Standard for Workers § 170.130 Pesticide safety training for workers. (a) General requirement—(1)...
40 CFR 170.130 - Pesticide safety training for workers.
Code of Federal Regulations, 2014 CFR
2014-07-01
... 40 Protection of Environment 24 2014-07-01 2014-07-01 false Pesticide safety training for workers. 170.130 Section 170.130 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) PESTICIDE PROGRAMS WORKER PROTECTION STANDARD Standard for Workers § 170.130 Pesticide safety training for workers. (a) General requirement—(1)...
41 CFR 102-41.170 - Is unclaimed personal property available for donation?
Code of Federal Regulations, 2011 CFR
2011-01-01
... property available for donation? 102-41.170 Section 102-41.170 Public Contracts and Property Management... Personal Property § 102-41.170 Is unclaimed personal property available for donation? No, unclaimed personal property is not available for donation because reimbursement at fair market value is required. ...
41 CFR 102-41.170 - Is unclaimed personal property available for donation?
Code of Federal Regulations, 2012 CFR
2012-01-01
... property available for donation? 102-41.170 Section 102-41.170 Public Contracts and Property Management... Personal Property § 102-41.170 Is unclaimed personal property available for donation? No, unclaimed personal property is not available for donation because reimbursement at fair market value is required. ...
41 CFR 102-41.170 - Is unclaimed personal property available for donation?
Code of Federal Regulations, 2014 CFR
2014-01-01
... property available for donation? 102-41.170 Section 102-41.170 Public Contracts and Property Management... Personal Property § 102-41.170 Is unclaimed personal property available for donation? No, unclaimed personal property is not available for donation because reimbursement at fair market value is required. ...
41 CFR 102-41.170 - Is unclaimed personal property available for donation?
Code of Federal Regulations, 2013 CFR
2013-07-01
... property available for donation? 102-41.170 Section 102-41.170 Public Contracts and Property Management... Personal Property § 102-41.170 Is unclaimed personal property available for donation? No, unclaimed personal property is not available for donation because reimbursement at fair market value is required. ...
46 CFR 150.170 - Right of appeal.
Code of Federal Regulations, 2010 CFR
2010-10-01
... 46 Shipping 5 2010-10-01 2010-10-01 false Right of appeal. 150.170 Section 150.170 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) CERTAIN BULK DANGEROUS CARGOES COMPATIBILITY OF CARGOES § 150.170 Right of appeal. Any person directly affected by a decision or action taken under this...
46 CFR 170.003 - Right of appeal.
Code of Federal Regulations, 2010 CFR
2010-10-01
... 46 Shipping 7 2010-10-01 2010-10-01 false Right of appeal. 170.003 Section 170.003 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) SUBDIVISION AND STABILITY STABILITY REQUIREMENTS FOR ALL INSPECTED VESSELS General Provisions § 170.003 Right of appeal. Any person directly affected by a...
33 CFR 110.170 - Lockwoods Folly Inlet, N.C.
Code of Federal Regulations, 2010 CFR
2010-07-01
... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false Lockwoods Folly Inlet, N.C. 110.170 Section 110.170 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY ANCHORAGES ANCHORAGE REGULATIONS Anchorage Grounds § 110.170 Lockwoods Folly Inlet, N.C. (a) Explosives...
33 CFR 110.170 - Lockwoods Folly Inlet, N.C.
Code of Federal Regulations, 2011 CFR
2011-07-01
... 33 Navigation and Navigable Waters 1 2011-07-01 2011-07-01 false Lockwoods Folly Inlet, N.C. 110.170 Section 110.170 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY ANCHORAGES ANCHORAGE REGULATIONS Anchorage Grounds § 110.170 Lockwoods Folly Inlet, N.C. (a) Explosives...
21 CFR 170.19 - Pesticide chemicals in processed foods.
Code of Federal Regulations, 2014 CFR
2014-04-01
... 21 Food and Drugs 3 2014-04-01 2014-04-01 false Pesticide chemicals in processed foods. 170.19 Section 170.19 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD ADDITIVES General Provisions § 170.19 Pesticide chemicals in processed foods. When pesticide...
21 CFR 170.19 - Pesticide chemicals in processed foods.
Code of Federal Regulations, 2010 CFR
2010-04-01
... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Pesticide chemicals in processed foods. 170.19 Section 170.19 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR HUMAN CONSUMPTION (CONTINUED) FOOD ADDITIVES General Provisions § 170.19 Pesticide...
21 CFR 170.19 - Pesticide chemicals in processed foods.
Code of Federal Regulations, 2012 CFR
2012-04-01
... 21 Food and Drugs 3 2012-04-01 2012-04-01 false Pesticide chemicals in processed foods. 170.19 Section 170.19 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR HUMAN CONSUMPTION (CONTINUED) FOOD ADDITIVES General Provisions § 170.19 Pesticide...
21 CFR 170.19 - Pesticide chemicals in processed foods.
Code of Federal Regulations, 2013 CFR
2013-04-01
... 21 Food and Drugs 3 2013-04-01 2013-04-01 false Pesticide chemicals in processed foods. 170.19 Section 170.19 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR HUMAN CONSUMPTION (CONTINUED) FOOD ADDITIVES General Provisions § 170.19 Pesticide...