DOE Office of Scientific and Technical Information (OSTI.GOV)
Li, Guochang; Chen, George, E-mail: gc@ecs.soton.ac.uk, E-mail: sli@mail.xjtu.edu.cn; School of Electronic and Computer Science, University of Southampton, Southampton SO17 1BJ
Charge transport properties in nanodielectrics present different tendencies for different loading concentrations. The exact mechanisms that are responsible for charge transport in nanodielectrics are not detailed, especially for high loading concentration. A charge transport model in nanodielectrics has been proposed based on quantum tunneling mechanism and dual-level traps. In the model, the thermally assisted hopping (TAH) process for the shallow traps and the tunnelling process for the deep traps are considered. For different loading concentrations, the dominant charge transport mechanisms are different. The quantum tunneling mechanism plays a major role in determining the charge conduction in nanodielectrics with high loadingmore » concentrations. While for low loading concentrations, the thermal hopping mechanism will dominate the charge conduction process. The model can explain the observed conductivity property in nanodielectrics with different loading concentrations.« less
The Effect of Voltage Charging on the Transport Properties of Gold Nanotube Membranes.
Experton, Juliette; Martin, Charles R
2018-05-01
Porous membranes are used in chemical separations and in many electrochemical processes and devices. Research on the transport properties of a unique class of porous membranes that contain monodisperse gold nanotubes traversing the entire membrane thickness is reviewed here. These gold nanotubes can act as conduits for ionic and molecular transports through the membrane. Because the tubes are electronically conductive, they can be electrochemically charged by applying a voltage to the membrane. How this "voltage charging" affects the transport properties of gold nanotube membranes is the subject of this Review. Experiments showing that voltage charging can be used to reversibly switch the membrane between ideally cation- and anion-transporting states are reviewed. Voltage charging can also be used to enhance the ionic conductivity of gold nanotube membranes. Finally, voltage charging to accomplish electroporation of living bacteria as they pass through gold nanotube membranes is reviewed. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Defect states and charge transport in quantum dot solids
Brawand, Nicholas P.; Goldey, Matthew B.; Vörös, Márton; ...
2017-01-16
Defects at the surface of semiconductor quantum dots (QDs) give rise to electronic states within the gap, which are detrimental to charge transport properties of QD devices. We investigated charge transport in silicon quantum dots with deep and shallow defect levels, using ab initio calculations and constrained density functional theory. We found that shallow defects may be more detrimental to charge transport than deep ones, with associated transfer rates differing by up to 5 orders of magnitude for the small dots (1-2 nm) considered here. Hence, our results indicate that the common assumption, that the ability of defects to trapmore » charges is determined by their position in the energy gap of the QD, is too simplistic, and our findings call for a reassessment of the role played by shallow defects in QD devices. Altogether, our results highlight the key importance of taking into account the atomistic structural properties of QD surfaces when investigating transport properties.« less
Multilevel Investigation of Charge Transport in Conjugated Polymers.
Dong, Huanli; Hu, Wenping
2016-11-15
Conjugated polymers have attracted the world's attentions since their discovery due to their great promise for optoelectronic devices. However, the fundamental understanding of charge transport in conjugated polymers remains far from clear. The origin of this challenge is the natural disorder of polymers with complex molecular structures in the solid state. Moreover, an effective way to examine the intrinsic properties of conjugated polymers is absent. Optoelectronic devices are always based on spin-coated films. In films, polymers tend to form highly disordered structures at nanometer to micrometer length scales due to the high degree of conformational freedom of macromolecular chains and the irregular interchain entanglement, thus typically resulting in much lower charge transport properties than their intrinsic performance. Furthermore, a subtle change of processing conditions may dramatically affect the film formation-inducing large variations in the morphology, crystallinity, microstructure, molecular packing, and alignment, and finally varying the effective charge transport significantly and leading to great inconsistency over an order of magnitude even for devices based on the same polymer semiconductor. Meanwhile, the charge transport mechanism in conjugated polymers is still unclear and its investigation is challenging based on such complex microstructures of polymers in films. Therefore, how to objectively evaluate the charge transport and probe the charge transport mechanism of conjugated polymers has confronted the world for decades. In this Account, we present our recent progress on multilevel charge transport in conjugated polymers, from disordered films, uniaxially aligned thin films, and single crystalline micro- or nanowires to molecular scale, where a derivative of poly(para-phenylene ethynylene) with thioacetyl end groups (TA-PPE) is selected as the candidate for investigation, which could also be extended to other conjugated polymer systems. Our systematic investigations demonstrated that 3-4 orders higher charge transport properties could be achieved with the improvement of polymer chain order and confirmed efficient charge transport along the conjugated polymer backbones. Moreover, with downscaling to molecular scale, many novel phenomena were observed such as the largely quantized electronic structure for an 18 nm-long TA-PPE and the modulation of the redox center of tetrathiafulvalene (TTF) units on tunneling charge transport, which opens the door for conjugated polymers used in nanometer quantum devices. We hope the understanding of charge transport in PPE and its related conjugated polymer at multilevel scale in this Account will provide a new method to sketch the charge transport properties of conjugated polymers, and new insights into the combination of more conjugated polymer materials in the multilevel optoelectronic and other related functional devices, which will offer great promise for the next generation of electronic devices.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Huang, Yanhui, E-mail: huangy12@rpi.edu; Schadler, Linda S.
The high field charge injection and transport properties in reinforced silicone dielectrics were investigated by measuring the time-dependent space charge distribution and the current under dc conditions up to the breakdown field and were compared with the properties of other dielectric polymers. It is argued that the energy and spatial distribution of localized electronic states are crucial in determining these properties for polymer dielectrics. Tunneling to localized states likely dominates the charge injection process. A transient transport regime arises due to the relaxation of charge carriers into deep traps at the energy band tails and is successfully verified by amore » Monte Carlo simulation using the multiple-hopping model. The charge carrier mobility is found to be highly heterogeneous due to the non-uniform trapping. The slow moving electron packet exhibits a negative field dependent drift velocity possibly due to the spatial disorder of traps.« less
Villanueva-Cab, J; Anta, J A; Oskam, G
2016-05-28
Correction for 'The effect of recombination under short-circuit conditions on the determination of charge transport properties in nanostructured photoelectrodes' by J. Villanueva-Cab et al., Phys. Chem. Chem. Phys., 2016, 18, 2303-2308.
NASA Astrophysics Data System (ADS)
Ishii, Hiroyuki; Honma, Keisuke; Kobayashi, Nobuhiko; Hirose, Kenji
2012-06-01
We present a methodology to study the charge-transport properties of organic semiconductors by the time-dependent wave-packet diffusion method, taking the polaron effects into account. As an example, we investigate the transport properties of single-crystal pentacene organic semiconductors coupled with inter- and intramolecular vibrations within the mixed Holstein and Peierls model, which describes both hopping and bandlike transport behaviors due to small and large polaron formations. Taking into account static disorders, which inevitably exist in the molecular crystals, we present the temperature dependence of charge-transport properties in competition among the thermal fluctuation of molecular motions, the polaron formation, and the static disorders.
Optoelectronic properties and depth profile of charge transport in nanocrystal films
NASA Astrophysics Data System (ADS)
Aigner, Willi; Bienek, Oliver; Desta, Derese; Wiggers, Hartmut; Stutzmann, Martin; Pereira, Rui N.
2017-07-01
We investigate the charge transport in nanocrystal (NC) films using field effect transistors (FETs) of silicon NCs. By studying films with various thicknesses in the dark and under illumination with photons with different penetration depths (UV and red light), we are able to predictably change the spatial distribution of charge carriers across the films' profile. The experimental data are compared with photoinduced charge carrier generation rates computed using finite-difference time-domain (FDTD) simulations complemented with optical measurements. This enables us to understand the optoelectronic properties of NC films and the depth profile dependence of the charge transport properties. From electrical measurements, we extract the total (bulk) photoinduced charge carrier densities (nphoto) and the photoinduced charge carrier densities in the FETs channel (nphoto*). We observe that the values of nphoto and their dependence on film thickness are similar for UV and red light illumination, whereas a significant difference is observed for the values of nphoto*. The dependencies of nphoto and nphoto* on film thickness and illumination wavelength are compared with data from FDTD simulations. Combining experimental data and simulation results, we find that charge carriers in the top rough surface of the films cannot contribute to the macroscopic charge transport. Moreover, we conclude that below the top rough surface of NC films, the efficiency of charge transport, including the charge carrier mobility, is homogeneous across the film thickness. Our work shows that the use of NC films as photoactive layers in applications requiring harvesting of strongly absorbed photons such as photodetectors and photovoltaics demands a very rigorous control over the films' roughness.
Mahdavifar, Maryam; Khoeini, Farhad
2018-08-10
We report peculiar charge and spin transport properties in S-shaped silicene junctions with the Kane-Mele tight-binding model. In this work, we investigate the effects of electric and exchange fields on the charge and spin transport properties. Our results show that by applying a perpendicular electric field, metal-semiconductor and also semimetal-semiconductor phase transitions occur in our systems. Furthermore, full spin current can be obtained in the structures, so the half-metallic states are observable. Our results enable us to control charge and spin currents and provide new opportunities and applications in silicene-based electronics, optoelectronics, and spintronics.
Charge transport properties of intrinsic layer in diamond vertical pin diode
NASA Astrophysics Data System (ADS)
Shimaoka, Takehiro; Kuwabara, Daisuke; Hara, Asuka; Makino, Toshiharu; Tanaka, Manobu; Koizumi, Satoshi
2017-05-01
Diamond is hoped to be utilized in ultimate power electronic devices exhibiting ultra-high blocking voltages. For practical device formation, it is important to characterize the electric properties to precisely simulate carrier transport and to practically design optimum device structures. In this study, we experimentally evaluated the charge transport properties of intrinsic layers in diamond vertical pin diodes using alpha-particle induced charge distribution measurements. The charge collection efficiencies were 98.1 ± 0.6% for a {111} pin diode and 96.9 ± 0.6% for a {100} pin diode, which means that almost all generated charges are collected accordingly equivalent to conventional Silicon pin photodiodes. Mobility-lifetime (μτ) products of holes were (2.2 ± 0.3) × 10-6 cm2/V for {111} and (1.8 ± 0.1) × 10-5 cm2/V for {100} diamond pin diodes.
NASA Astrophysics Data System (ADS)
Ding, Guodong; Mahmood, Asif; Tang, Ailing; Chen, Fan; Zhou, Erjun
2018-01-01
Three new diketopyrrolopyrrole based compounds with Acceptor-Donor-Acceptor-Donor-Acceptor (A-D-A-D-A) skeletons were designed and synthesized through varying the electron-deficient core from diphenylquinoxaline (DP-Qx), thieno[3,4-c]pyrrole-4,6-dione (DP-TPD) to 2-dodecyl-6,7-diphenyl-2H-[1,2,3]triazole[4,5-g]quinoxaline (DP-TQx). We have calculated and studied the effect of central acceptor units on electronic, optical and non-optical properties. As well as, we have predicted the charge transport properties. Results indicate that change of central acceptor unit remarkably affects the molecular electronic, optical and non-optical properties. And the molecular band gap and UV/vis adsorption spectra are significantly changed. It should be noted that Compound 3 with 2-dodecyl-6,7-diphenyl-2H-[1,2,3]triazole[4,5-g]quinoxaline as core show superior non-optical properties as compare to other compounds. Our study here indicate that inserting the strong electron-deficient moieties improves intramolecular charge transfer (ICT) and charge transport properties dramatically.
Charge injection and transport properties of an organic light-emitting diode
Juhasz, Peter; Nevrela, Juraj; Micjan, Michal; Novota, Miroslav; Uhrik, Jan; Stuchlikova, Lubica; Jakabovic, Jan; Harmatha, Ladislav
2016-01-01
Summary The charge behavior of organic light emitting diode (OLED) is investigated by steady-state current–voltage technique and impedance spectroscopy at various temperatures to obtain activation energies of charge injection and transport processes. Good agreement of activation energies obtained by steady-state and frequency-domain was used to analyze their contributions to the charge injection and transport. We concluded that charge is injected into the OLED device mostly through the interfacial states at low voltage region, whereas the thermionic injection dominates in the high voltage region. This comparison of experimental techniques demonstrates their capabilities of identification of major bottleneck of charge injection and transport. PMID:26925351
NASA Astrophysics Data System (ADS)
Blokhin, A. M.; Kruglova, E. A.; Semisalov, B. V.
2018-03-01
The hydrodynamical model is used for description of the process of charge transport in semiconductors with a high rate of reliability. It is a set of nonlinear partial differential equations with small parameters and specific conditions at the boundaries of field effect transistors (FETs), which essentially complicates the process of finding its stationary solutions. To overcome these difficulties in the case of FETs with elements having different dielectric properties, a fast pseudospectral method has been developed. This method was used for advanced numerical simulation of charge transport in DG-MOSFET.
Charge transport network dynamics in molecular aggregates
DOE Office of Scientific and Technical Information (OSTI.GOV)
Jackson, Nicholas E.; Chen, Lin X.; Ratner, Mark A.
2016-07-20
Due to the nonperiodic nature of charge transport in disordered systems, generating insight into static charge transport networks, as well as analyzing the network dynamics, can be challenging. Here, we apply time-dependent network analysis to scrutinize the charge transport networks of two representative molecular semiconductors: a rigid n-type molecule, perylenediimide, and a flexible p-type molecule, bBDT(TDPP)2. Simulations reveal the relevant timescale for local transfer integral decorrelation to be ~100 fs, which is shown to be faster than that of a crystalline morphology of the same molecule. Using a simple graph metric, global network changes are observed over timescales competitive withmore » charge carrier lifetimes. These insights demonstrate that static charge transport networks are qualitatively inadequate, whereas average networks often overestimate network connectivity. Finally, a simple methodology for tracking dynamic charge transport properties is proposed.« less
Theory of high-resolution tunneling spin transport on a magnetic skyrmion
NASA Astrophysics Data System (ADS)
Palotás, Krisztián; Rózsa, Levente; Szunyogh, László
2018-05-01
Tunneling spin transport characteristics of a magnetic skyrmion are described theoretically in magnetic scanning tunneling microscopy (STM). The spin-polarized charge current in STM (SP-STM) and tunneling spin transport vector quantities, the longitudinal spin current and the spin transfer torque, are calculated in high spatial resolution within the same theoretical framework. A connection between the conventional charge current SP-STM image contrasts and the magnitudes of the spin transport vectors is demonstrated that enables the estimation of tunneling spin transport properties based on experimentally measured SP-STM images. A considerable tunability of the spin transport vectors by the involved spin polarizations is also highlighted. These possibilities and the combined theory of tunneling charge and vector spin transport pave the way for gaining deep insight into electric-current-induced tunneling spin transport properties in SP-STM and to the related dynamics of complex magnetic textures at surfaces.
Trap Modulated Charge Carrier Transport in Polyethylene/Graphene Nanocomposites.
Li, Zhonglei; Du, Boxue; Han, Chenlei; Xu, Hang
2017-06-21
The role of trap characteristics in modulating charge transport properties is attracting much attentions in electrical and electronic engineering, which has an important effect on the electrical properties of dielectrics. This paper focuses on the electrical properties of Low-density Polyethylene (LDPE)/graphene nanocomposites (NCs), as well as the corresponding trap level characteristics. The dc conductivity, breakdown strength and space charge behaviors of NCs with the filler content of 0 wt%, 0.005 wt%, 0.01 wt%, 0.1 wt% and 0.5 wt% are studied, and their trap level distributions are characterized by isothermal discharge current (IDC) tests. The experimental results show that the 0.005 wt% LDPE/graphene NCs have a lower dc conductivity, a higher breakdown strength and a much smaller amount of space charge accumulation than the neat LDPE. It is indicated that the graphene addition with a filler content of 0.005 wt% introduces large quantities of deep carrier traps that reduce charge carrier mobility and result in the homocharge accumulation near the electrodes. The deep trap modulated charge carrier transport attributes to reduce the dc conductivity, suppress the injection of space charges into polymer bulks and enhance the breakdown strength, which is of great significance in improving electrical properties of polymer dielectrics.
Kanimozhi, Catherine; Yaacobi-Gross, Nir; Burnett, Edmund K; Briseno, Alejandro L; Anthopoulos, Thomas D; Salzner, Ulrike; Patil, Satish
2014-08-28
The primary role of substituted side chains in organic semiconductors is to increase their solubility in common organic solvents. In the recent past, many literature reports have suggested that the side chains play a critical role in molecular packing and strongly impact the charge transport properties of conjugated polymers. In this work, we have investigated the influence of side-chains on the charge transport behavior of a novel class of diketopyrrolopyrrole (DPP) based alternating copolymers. To investigate the role of side-chains, we prepared four diketopyrrolopyrrole-diketopyrrolopyrrole (DPP-DPP) conjugated polymers with varied side-chains and carried out a systematic study of thin film microstructure and charge transport properties in polymer thin-film transistors (PTFTs). Combining results obtained from grazing incidence X-ray diffraction (GIXD) and charge transport properties in PTFTs, we conclude side-chains have a strong influence on molecular packing, thin film microstructure, and the charge carrier mobility of DPP-DPP copolymers. However, the influence of side-chains on optical properties was moderate. The preferential "edge-on" packing and dominant n-channel behavior with exceptionally high field-effect electron mobility values of >1 cm(2) V(-1) s(-1) were observed by incorporating hydrophilic (triethylene glycol) and hydrophobic side-chains of alternate DPP units. In contrast, moderate electron and hole mobilities were observed by incorporation of branched hydrophobic side-chains. This work clearly demonstrates that the subtle balance between hydrophobicity and hydrophilicity induced by side-chains is a powerful strategy to alter the molecular packing and improve the ambipolar charge transport properties in DPP-DPP based conjugated polymers. Theoretical analysis supports the conclusion that the side-chains influence polymer properties through morphology changes, as there is no effect on the electronic properties in the gas phase. The exceptional electron mobility is at least partially a result of the strong intramolecular conjugation of the donor and acceptor as evidenced by the unusually wide conduction band of the polymer.
Charge Transport Processes in Molecular Junctions
NASA Astrophysics Data System (ADS)
Smith, Christopher Eugene
Molecular electronics (ME) has evolved into a rich area of exploration that combines the fields of chemistry, materials, electronic engineering and computational modeling to explore the physics behind electronic conduction at the molecular level. Through studying charge transport properties of single molecules and nanoscale molecular materials the field has gained the potential to bring about new avenues for the miniaturization of electrical components where quantum phenomena are utilized to achieve solid state molecular device functionality. Molecular junctions are platforms that enable these studies and consist of a single molecule or a small group of molecules directly connected to electrodes. The work presented in this thesis has built upon the current understanding of the mechanisms of charge transport in ordered junctions using self-assembled monolayer (SAM) molecular thin films. Donor and acceptor compounds were synthesized and incorporated into SAMs grown on metal substrates then the transport properties were measured with conducting probe atomic force microscopy (CP-AFM). In addition to experimentally measured current-voltage (I-V) curves, the transport properties were addressed computationally and modeled theoretically. The key objectives of this project were to 1) investigate the impact of molecular structure on hole and electron charge transport, 2) understand the nature of the charge carriers and their structure-transport properties through long (<4 nm) conjugated molecular wires, and 3) quantitatively extract interfacial properties characteristic to macroscopic junctions, such as energy level alignment and molecule-contact electronic coupling from experimental I-V curves. Here, we lay ground work for creating a more complete picture of charge transport in macroscopically ordered molecular junctions of controlled architecture, length and charge carrier. The polaronic nature of hopping transport has been predicted in long, conjugated molecular wires. Using quantum-based calculations, we modeled 'p-type' polaron transport through oligophenylenethiophene (OPTI) wires and assigned transport activation energies to specific modes of nuclear motion. We also show control over 'n-type', LUMO-mediated transport in short ( 2 nm) redox-active perylenediimide (PDI) SAMs bound to contacts through isocyano linkers. By changing the contact work function (φ) and temperature, we were able to verify thermally-assisted LUMO transport. Transition voltage spectroscopy and the single level model was employed to fit the experimental I-V curves and extract the electronic coupling (epsilon) and the EF-LUMO offset (epsilonl). It was found that epsilonl does not change with φ (LUMO pinning), while Gamma changes with both φ and temperature. Further, the PDI SAMs could be reversibly chemically gated to modulate the transport. These results help advance our understanding of transport behavior in semiconducting molecular thin films, and open opportunities to engineer improved electronic functionality into molecular devices.
The Optoelectronic Properties of Nanoparticles from First Principles Calculations
NASA Astrophysics Data System (ADS)
Brawand, Nicholas Peter
The tunable optoelectronic properties of nanoparticles through the modification of their size, shape, and surface chemistry, make them promising platforms for numerous applications, including electronic and solar conversion devices. However, the rational design and optimization of nanostructured materials remain open challenges, e.g. due to difficulties in controlling and reproducing synthetic processes and in precise atomic-scale characterization. Hence, the need for accurate theoretical predictions, which can complement and help interpret experiments and provide insight into the underlying physical properties of nanostructured materials. This dissertation focuses on the development and application of first principles calculations to predict the optoelectronic properties of nanoparticles. Novel methods based on density functional theory are developed, implemented, and applied to predict both optical and charge transport properties. In particular, the generalization of dielectric dependent hybrid functionals to finite systems is introduced and shown to yield highly accurate electronic structure properties of molecules and nanoparticles, including photoemission and absorption properties. In addition, an implementation of constrained density functional theory is discussed, for the calculation of hopping transport in nanoparticle systems. The implementation was verified against literature results and compared against other methods used to compute transport properties, showing that some methods used in the literature give unphysical results for thermally disordered systems. Furthermore, the constrained density functional theory implementation was coupled to the self-consistent image charge method, making it possible to include image charge effects self-consistently when predicting charge transport properties of nanoparticles near interfaces. The methods developed in this dissertation were then applied to study the optoelectronic and transport properties of specific systems, in particular, silicon and lead chalcogenide nanoparticles. In the case of Si, blinking in oxidized Si nanoparticles was addressed. Si dangling bonds at the surface were found to introduce defect states which, depending on their charge and local stress conditions, may give rise to ON and OFF states responsible for exponential blinking statistics. We also investigated, engineering of band edge positions of nanoparticles through post-synthetic surface chemistry modification, with a focus on lead chalcogenides. In collaboration with experiment, we demonstrated how band edge positions of lead sulfide nanoparticles can be tuned by over 2.0 eV. We established a clear relationship between ligand dipole moments and nanoparticle band edge shifts which can be used to engineer nanoparticles for optoelectronic applications. Calculations of transport properties focused on charge transfer in silicon and lead chalcogenide nanoparticles. Si nanoparticles with deep defects and shallow impurities were investigated, showing that shallow defects may be more detrimental to charge transport than previously assumed. In the case of lead chalcogenide nanoparticles, hydrogen was found to form complexes with defects which can be used to remove potentially detrimental charge traps in nanoparticle solids. The methods and results presented in this dissertation are expected to help guide engineering of nanoparticles for future device applications.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Berdiyorov, G. R., E-mail: gberdiyorov@qf.org.qa; El-Mellouhi, F.; Madjet, M. E.
Density functional theory in combination with the nonequilibrium Green's function formalism is used to study the electronic transport properties of methylammonium lead-iodide perovskite CH{sub 3}NH{sub 3}PbI{sub 3}. Electronic transport in homogeneous ferroelectric and antiferroelectric phases, both of which do not contain any charged domain walls, is quite similar. The presence of charged domain wall drastically (by about an order of magnitude) enhances the electronic transport in the lateral direction. The increase of the transmission originates from the smaller variation of the electrostatic potential profile along the charged domain walls. This fact may provide a tool for tuning transport properties ofmore » such hybrid materials by manipulating molecular cations having dipole moment.« less
Ambipolar nature of dimethyl benzo difuran (DMBDF) molecule: A charge transport study
NASA Astrophysics Data System (ADS)
Sahoo, Smruti Ranjan; Sahu, Sridhar
2017-05-01
We describe a theoretical study of the charge transport properties of the organic dimethyl benzo difuran (DMBDF) molecule based on density functional theory (DFT). Reorganization energy, ionization potential (IP), electron affinity (EA), energy gaps, transfer integral (t) and charge mobility (μ) has been studied to depict the transport properties in the conjugated organic molecules. We computed, large homo transfer integral and IP value leading to high hole mobility (4.46 cm2/V sec). However, the electron reorganization energy (0.34 eV) and the electron mobility of 1.62 cm2/V sec, infers that the DMBDF organic molecule bears an ambipolar character.
Surface charge accumulation of particles containing radionuclides in open air
Kim, Yong-ha; Yiacoumi, Sotira; Tsouris, Costas
2015-05-01
Radioactivity can induce charge accumulation on radioactive particles. But, electrostatic interactions caused by radioactivity are typically neglected in transport modeling of radioactive plumes because it is assumed that ionizing radiation leads to charge neutralization. The assumption that electrostatic interactions caused by radioactivity are negligible is evaluated here by examining charge accumulation and neutralization on particles containing radionuclides in open air. Moreover, a charge-balance model is employed to predict charge accumulation on radioactive particles. It is shown that particles containing short-lived radionuclides can be charged with multiple elementary charges through radioactive decay. The presence of radioactive particles can significantly modify themore » particle charge distribution in open air and yield an asymmetric bimodal charge distribution, suggesting that strong electrostatic particle interactions may occur during short- and long-range transport of radioactive particles. Possible effects of transported radioactive particles on electrical properties of the local atmosphere are reported. Our study offers insight into transport characteristics of airborne radionuclides. Results are useful in atmospheric transport modeling of radioactive plumes.« less
Code of Federal Regulations, 2010 CFR
2010-07-01
... Contracts and Property Management Federal Property Management Regulations System (Continued) FEDERAL MANAGEMENT REGULATION TRANSPORTATION 118-TRANSPORTATION PAYMENT AND AUDIT Claims and Appeal Procedures... 41 Public Contracts and Property Management 3 2010-07-01 2010-07-01 false What are my agency's...
Charge transport in organic semiconductors.
Bässler, Heinz; Köhler, Anna
2012-01-01
Modern optoelectronic devices, such as light-emitting diodes, field-effect transistors and organic solar cells require well controlled motion of charges for their efficient operation. The understanding of the processes that determine charge transport is therefore of paramount importance for designing materials with improved structure-property relationships. Before discussing different regimes of charge transport in organic semiconductors, we present a brief introduction into the conceptual framework in which we interpret the relevant photophysical processes. That is, we compare a molecular picture of electronic excitations against the Su-Schrieffer-Heeger semiconductor band model. After a brief description of experimental techniques needed to measure charge mobilities, we then elaborate on the parameters controlling charge transport in technologically relevant materials. Thus, we consider the influences of electronic coupling between molecular units, disorder, polaronic effects and space charge. A particular focus is given to the recent progress made in understanding charge transport on short time scales and short length scales. The mechanism for charge injection is briefly addressed towards the end of this chapter.
Unique magnetic and thermoelectric properties of chemically functionalized narrow carbon polymers.
Zberecki, K; Wierzbicki, M; Swirkowicz, R; Barnaś, J
2017-02-01
We analyze magnetic, transport and thermoelectric properties of narrow carbon polymers, which are chemically functionalized with nitroxide groups. Numerical calculations of the electronic band structure and the corresponding transmission function are based on density functional theory. Transport and thermoelectric parameters are calculated in the linear response regime, with particular interest in charge and spin thermopowers (charge and spin Seebeck effects). Such nanoribbons are shown to have thermoelectric properties described by large thermoelectric efficiency, which makes these materials promising from the application point of view.
Tunable charge transfer properties in metal-phthalocyanine heterojunctions.
Siles, P F; Hahn, T; Salvan, G; Knupfer, M; Zhu, F; Zahn, D R T; Schmidt, O G
2016-04-28
Organic materials such as phthalocyanine-based systems present a great potential for organic device applications due to the possibility of integrating films of different organic materials to create organic heterostructures which combine the electrical capabilities of each material. This opens the possibility to precisely engineer and tune new electrical properties. In particular, similar transition metal phthalocyanines demonstrate hybridization and charge transfer properties which could lead to interesting physical phenomena. Although, when considering device dimensions, a better understanding and control of the tuning of the transport properties still remain in the focus of research. Here, by employing conductive atomic force microscopy techniques, we provide an insight about the nanoscale electrical properties and transport mechanisms of MnPc and fluorinated phthalocyanines such as F16CuPc and F16CoPc. We report a transition from typical diode-like transport mechanisms for pure MnPc thin films to space-charge-limited current transport regime (SCLC) for Pc-based heterostructures. The controlled addition of fluorinated phthalocyanine also provides highly uniform and symmetric-polarized transport characteristics with conductance enhancements up to two orders of magnitude depending on the polarization. We present a method to spatially map the mobility of the MnPc/F16CuPc structures with a nanoscale resolution and provide theoretical calculations to support our experimental findings. This well-controlled nanoscale tuning of the electrical properties for metal transition phthalocyanine junctions stands as key step for future phthalocyanine-based electronic devices, where the low dimension charge transfer, mediated by transition metal atoms could be intrinsically linked to a transfer of magnetic moment or spin.
Low Band Gap Thiophene-Perylene Diimide Systems with Tunable Charge Transport Properties
DOE Office of Scientific and Technical Information (OSTI.GOV)
Balaji, Ganapathy; Kale, Tejaswini S.; Keerthi, Ashok
2011-01-07
Perylenediimide-pentathiophene systems with varied architecture of thiophene units were synthesized. The photophysical, electrochemical, and charge transport behavior of the synthesized compounds were studied. Both molecules showed a low band gap of ~1.4 eV. Surprisingly, the molecule with pentathiophene attached via β-position to the PDI unit upon annealing showed a predominant hole mobility of 1 × 10 -4 cm 2 V -1 s -1 whereas the compound with branched pentathiophene attached via β-position showed an electron mobility of 9.8 × 10 -7 cm 2 V -1 s -1. This suggests that charge transport properties can be tuned by simply varying themore » architecture of pentathiophene units.« less
NASA Astrophysics Data System (ADS)
Jia, Xu-Bo; Wei, Hui-Ling; Shi, Ya-Ting; Shi, Ya-Rui; Liu, Yu-Fang
2017-12-01
In this work, the charge transport properties of Isoindigo (II) and its derivatives which have the same hexyl chain were theoretically investigated by the Marcus-Hush theory combined with density functional theory (DFT). Here we demonstrate that the changes of benzene and thiophene groups in molecular structure have an important influence on the charge transport properties of organic semiconductor. The benzene rings of II are replaced by thiophenes to form the thienoisoindigo (TII), and the addition of benzene rings to the TII form the benzothienoisoindigo (BTII). The results show that benzene rings and thiophenes change the chemical structure of crystal molecules, which lead to different molecule stacking, thus, the length of hydrogen bond was changed. A shorter intermolecular hydrogen bond lead to tighter molecular stacking, which reduces the center-to-center distance and enhances the ability of charge transfer. At the same time, we theoretically demonstrated that II and BTII are the ambipolar organic semiconductor. BTII has better carrier mobility. The hole mobility far greater than electron mobility in TII, which is p-type organic semiconductor. Among all hopping path, we find that the distance of face-to-face stacking in II is the shortest and the electron-transport electronic coupling Ve is the largest, but II has not a largest anisotropic mobility, because the reorganization energy has a greater influence on the mobility than the electronic coupling. This work is helpful for designing ambipolar organic semiconductor materials with higher charge transport properties by introducing benzene ring and thiophene.
NASA Astrophysics Data System (ADS)
Dharmapurikar, Satej S.; Chithiravel, Sundaresan; Mane, Manoj V.; Deshmukh, Gunvant; Krishnamoorthy, Kothandam
2018-03-01
Diketopyrrolopyrrole (DPP) and i-Indigo (i-Ind) are two monomers that are widely explored as active materials in organic field effect transistor and solar cells. These two molecules showed impressive charge carrier mobility due to better packing that are facilitated by quadrupoles. We hypothesized that the copolymers of these monomers would also exhibit high charge carrier mobility. However, we envisioned that the dihedral angle at the connecting point between the monomers will play a crucial role in packing as well as charge transport. To understand the impact of dihedral angle on charge transport, we synthesized three copolymers, wherein the DPP was sandwiched between benzenes, thiophenes and furans. The copolymer of i-Indigo and furan comprising DPP showed a band gap of 1.4 eV with a very high dihedral angle of 179°. The polymer was found to pack better and the coherence length was found to be 112 Å. The hole carrier mobility of these polymer was found to be highest among the synthesized polymer i.e. 0.01 cm2/vs. The copolymer comprising benzene did not transport hole and electrons. The dihedral angle at the connecting point between i and Indigo and benzene DPP was 143 Å, which the packing and consequently charge transport properties.
Shin, Jaeho; Gu, Kyungyeol; Yang, Seunghoon; Lee, Chul-Ho; Lee, Takhee; Jang, Yun Hee; Wang, Gunuk
2018-06-25
Molecular conformation, intermolecular interaction, and electrode-molecule contacts greatly affect charge transport in molecular junctions and interfacial properties of organic devices by controlling the molecular orbital alignment. Here, we statistically investigated the charge transport in molecular junctions containing self-assembled oligophenylene molecules sandwiched between an Au probe tip and graphene according to various tip-loading forces ( F L ) that can control the molecular-tilt configuration and the van der Waals (vdW) interactions. In particular, the molecular junctions exhibited two distinct transport regimes according to the F L dependence (i.e., F L -dependent and F L -independent tunneling regimes). In addition, the charge-injection tunneling barriers at the junction interfaces are differently changed when the F L ≤ 20 nN. These features are associated to the correlation effects between the asymmetry-coupling factor (η), the molecular-tilt angle (θ), and the repulsive intermolecular vdW force ( F vdW ) on the molecular-tunneling barriers. A more-comprehensive understanding of these charge transport properties was thoroughly developed based on the density functional theory calculations in consideration of the molecular-tilt configuration and the repulsive vdW force between molecules.
Magnetoresistance and charge transport in graphene governed by nitrogen dopants.
Rein, Markus; Richter, Nils; Parvez, Khaled; Feng, Xinliang; Sachdev, Hermann; Kläui, Mathias; Müllen, Klaus
2015-02-24
We identify the influence of nitrogen-doping on charge- and magnetotransport of single layer graphene by comparing doped and undoped samples. Both sample types are grown by chemical vapor deposition (CVD) and transferred in an identical process onto Si/SiO2 wafers. We characterize the samples by Raman spectroscopy as well as by variable temperature magnetotransport measurements. Over the entire temperature range, the charge transport properties of all undoped samples are in line with literature values. The nitrogen doping instead leads to a 6-fold increase in the charge carrier concentration up to 4 × 10(13) cm(-2) at room temperature, indicating highly effective doping. Additionally it results in the opening of a charge transport gap as revealed by the temperature dependence of the resistance. The magnetotransport exhibits a conspicuous sign change from positive Lorentz magnetoresistance (MR) in undoped to large negative MR that we can attribute to the doping induced disorder. At low magnetic fields, we use quantum transport signals to quantify the transport properties. Analyses based on weak localization models allow us to determine an orders of magnitude decrease in the phase coherence and scattering times for doped samples, since the dopants act as effective scattering centers.
Ferrell, Nicholas; Cameron, Kathleen O; Groszek, Joseph J; Hofmann, Christina L; Li, Lingyan; Smith, Ross A; Bian, Aihua; Shintani, Ayumi; Zydney, Andrew L; Fissell, William H
2013-04-02
Molecular transport through the basement membrane is important for a number of physiological functions, and dysregulation of basement membrane architecture can have serious pathological consequences. The structure-function relationships that govern molecular transport in basement membranes are not fully understood. The basement membrane from the lens capsule of the eye is a collagen IV-rich matrix that can easily be extracted and manipulated in vitro. As such, it provides a convenient model for studying the functional relationships that govern molecular transport in basement membranes. Here we investigate the effects of increased transmembrane pressure and solute electrical charge on the transport properties of the lens basement membrane (LBM) from the bovine eye. Pressure-permeability relationships in LBM transport were governed primarily by changes in diffusive and convective contributions to solute flux and not by pressure-dependent changes in intrinsic membrane properties. The solute electrical charge had a minimal but statistically significant effect on solute transport through the LBM that was opposite of the expected electrokinetic behavior. The observed transport characteristics of the LBM are discussed in the context of established membrane transport modeling and previous work on the effects of pressure and electrical charge in other basement membrane systems. Copyright © 2013 Biophysical Society. Published by Elsevier Inc. All rights reserved.
Charge carrier transport properties in thallium bromide crystalls used as radiation detectors
DOE Office of Scientific and Technical Information (OSTI.GOV)
Olschner, F.; Toledo-Quinones, M.; Shah, K.S.
1990-06-01
Thallium bromide (TlBr) is an attractive material for use in radiation detectors because of its wide bandgap (2.68 eV) and very high atomic number. Usefulness as a semiconductor detector material, however, also requires good charge carrier transport properties in order to maximize the magnitude of the signal from the detector. The authors report on measurements of the two most important transport parameters; the mobility {mu} and the mean trapping time {tau} for electrons and holes in TlBr crystals prepared in the laboratory.
Surface charge accumulation of particles containing radionuclides in open air.
Kim, Yong-Ha; Yiacoumi, Sotira; Tsouris, Costas
2015-05-01
Radioactivity can induce charge accumulation on radioactive particles. However, electrostatic interactions caused by radioactivity are typically neglected in transport modeling of radioactive plumes because it is assumed that ionizing radiation leads to charge neutralization. The assumption that electrostatic interactions caused by radioactivity are negligible is evaluated here by examining charge accumulation and neutralization on particles containing radionuclides in open air. A charge-balance model is employed to predict charge accumulation on radioactive particles. It is shown that particles containing short-lived radionuclides can be charged with multiple elementary charges through radioactive decay. The presence of radioactive particles can significantly modify the particle charge distribution in open air and yield an asymmetric bimodal charge distribution, suggesting that strong electrostatic particle interactions may occur during short- and long-range transport of radioactive particles. Possible effects of transported radioactive particles on electrical properties of the local atmosphere are reported. The study offers insight into transport characteristics of airborne radionuclides. Results are useful in atmospheric transport modeling of radioactive plumes. Copyright © 2015 Elsevier Ltd. All rights reserved.
2D coherent charge transport in highly ordered conducting polymers doped by solid state diffusion
NASA Astrophysics Data System (ADS)
Kang, Keehoon; Watanabe, Shun; Broch, Katharina; Sepe, Alessandro; Brown, Adam; Nasrallah, Iyad; Nikolka, Mark; Fei, Zhuping; Heeney, Martin; Matsumoto, Daisuke; Marumoto, Kazuhiro; Tanaka, Hisaaki; Kuroda, Shin-Ichi; Sirringhaus, Henning
2016-08-01
Doping is one of the most important methods to control charge carrier concentration in semiconductors. Ideally, the introduction of dopants should not perturb the ordered microstructure of the semiconducting host. In some systems, such as modulation-doped inorganic semiconductors or molecular charge transfer crystals, this can be achieved by spatially separating the dopants from the charge transport pathways. However, in conducting polymers, dopants tend to be randomly distributed within the conjugated polymer, and as a result the transport properties are strongly affected by the resulting structural and electronic disorder. Here, we show that in the highly ordered lamellar microstructure of a regioregular thiophene-based conjugated polymer, a small-molecule p-type dopant can be incorporated by solid state diffusion into the layers of solubilizing side chains without disrupting the conjugated layers. In contrast to more disordered systems, this allows us to observe coherent, free-electron-like charge transport properties, including a nearly ideal Hall effect in a wide temperature range, a positive magnetoconductance due to weak localization and the Pauli paramagnetic spin susceptibility.
Keum, Chang-Min; Liu, Shiyi; Al-Shadeedi, Akram; Kaphle, Vikash; Callens, Michiel Koen; Han, Lu; Neyts, Kristiaan; Zhao, Hongping; Gather, Malte C; Bunge, Scott D; Twieg, Robert J; Jakli, Antal; Lüssem, Björn
2018-01-15
Liquid-crystalline organic semiconductors exhibit unique properties that make them highly interesting for organic optoelectronic applications. Their optical and electrical anisotropies and the possibility to control the alignment of the liquid-crystalline semiconductor allow not only to optimize charge carrier transport, but to tune the optical property of organic thin-film devices as well. In this study, the molecular orientation in a liquid-crystalline semiconductor film is tuned by a novel blading process as well as by different annealing protocols. The altered alignment is verified by cross-polarized optical microscopy and spectroscopic ellipsometry. It is shown that a change in alignment of the liquid-crystalline semiconductor improves charge transport in single charge carrier devices profoundly. Comparing the current-voltage characteristics of single charge carrier devices with simulations shows an excellent agreement and from this an in-depth understanding of single charge carrier transport in two-terminal devices is obtained. Finally, p-i-n type organic light-emitting diodes (OLEDs) compatible with vacuum processing techniques used in state-of-the-art OLEDs are demonstrated employing liquid-crystalline host matrix in the emission layer.
Electronic and transport properties of Cobalt-based valence tautomeric molecules and polymers
NASA Astrophysics Data System (ADS)
Chen, Yifeng; Calzolari, Arrigo; Buongiorno Nardelli, Marco
2011-03-01
The advancement of molecular spintronics requires further understandings of the fundamental electronic structures and transport properties of prototypical spintronics molecules and polymers. Here we present a density functional based theoretical study of the electronic structures of Cobalt-based valence tautomeric molecules Co III (SQ)(Cat)L Co II (SQ)2 L and their polymers, where SQ refers to the semiquinone ligand, and Cat the catecholate ligand, while L is a redox innocent backbone ligand. The conversion from low-spin Co III ground state to high-spin Co II excited state is realized by imposing an on-site potential U on the Co atom and elongating the Co-N bond. Transport properties are subsequently calculated by extracting electronic Wannier functions from these systems and computing the charge transport in the ballistic regime using a Non-Equilibrium Green's Function (NEGF) approach. Our transport results show distinct charge transport properties between low-spin ground state and high-spin excited state, hence suggesting potential spintronics devices from these molecules and polymers such as spin valves.
41 CFR 302-7.100 - How are the charges of transporting HHG, and temporary storage calculated?
Code of Federal Regulations, 2010 CFR
2010-07-01
... transporting HHG, and temporary storage calculated? 302-7.100 Section 302-7.100 Public Contracts and Property Management Federal Travel Regulation System RELOCATION ALLOWANCES TRANSPORTATION AND STORAGE OF PROPERTY 7-TRANSPORTATION AND TEMPORARY STORAGE OF HOUSEHOLD GOODS AND PROFESSIONAL BOOKS, PAPERS, AND EQUIPMENT (PBP&E...
DOE Office of Scientific and Technical Information (OSTI.GOV)
Meusel, O., E-mail: o.meusel@iap.uni-frankfurt.de; Droba, M.; Noll, D.
The transport of intense ion beams is affected by the collective behavior of this kind of multi-particle and multi-species system. The space charge expressed by the generalized perveance dominates the dynamical process of thermalisation, which leads to emittance growth. To prevent changes of intrinsic beam properties and to reduce the intensity dependent focusing forces, space charge compensation seems to be an adequate solution. In the case of positively charged ion beams, electrons produced by residual gas ionization and secondary electrons provide the space charge compensation. The influence of the compensation particles on the beam transport and the local degree ofmore » space charge compensation is given by different beam properties as well as the ion beam optics. Especially for highly charged ion beams, space charge compensation in combination with poor vacuum conditions leads to recombination processes and therefore increased beam losses. Strategies for providing a compensation-electron reservoir at very low residual gas pressures will be discussed.« less
NASA Astrophysics Data System (ADS)
Shukri, Seyfan Kelil
2017-01-01
We have done Kinetic Monte Carlo (KMC) simulations to investigate the effect of charge carrier density on the electrical conductivity and carrier mobility in disordered organic semiconductors using a lattice model. The density of state (DOS) of the system are considered to be Gaussian and exponential. Our simulations reveal that the mobility of the charge carrier increases with charge carrier density for both DOSs. In contrast, the mobility of charge carriers decreases as the disorder increases. In addition the shape of the DOS has a significance effect on the charge transport properties as a function of density which are clearly seen. On the other hand, for the same distribution width and at low carrier density, the change occurred on the conductivity and mobility for a Gaussian DOS is more pronounced than that for the exponential DOS.
Using FT-IR Spectroscopy to Measure Charge Organization in Ionic Liquids
Burba, Christopher M.; Janzen, Jonathan; Butson, Eric D.; Coltrain, Gage L.
2013-01-01
A major goal in the field of ionic liquids is correlating transport property trends with the underlying liquid structure of the compounds, such as the degree of charge organization among the constituent ions. Traditional techniques for experimentally assessing charge organization are specialized and not readily available for routine measurements. This represents a significant roadblock in elucidating these correlations. We use a combination of transmission and polarized-ATR infrared spectroscopy to measure the degree of charge organization for ionic liquids. The technique is illustrated with a family of 1-alkyl-3-methylimidazolium trifluoromethansulfonate ionic liquids at 30°C. As expected, the amount of charge organization decreases as the alkyl side chain is lengthened, highlighting the important role of short-range repulsive interactions in defining quasilattice structure. Inherent limitations of the method are identified and discussed. The quantitative measurements of charge organization are then correlated with trends in the transport properties of the compounds to highlight the relationship between charge and momentum transport and the underlying liquid structure. Most research laboratories possess infrared spectrometers capable of conducting these measurements, thus, the proposed method may represent a cost-effective solution for routinely measuring charge organization in ionic liquids. PMID:23781877
DOE Office of Scientific and Technical Information (OSTI.GOV)
Han, Sung Su
1993-09-01
Ion-induced conductivity has been used to investigate the detector characteristics of diamond detectors. Both integrated-charge, and time-resolved current measurements were performed to examine the mean carrier transport properties of diamond and the dynamics of charge collection under highly-localized and high-density excitation conditions. The integrated-charge measurements were conducted with a standard pulse-counting system with 241Am radioactivity as the excitation source for the detectors. The time-resolved current measurements were performed using a 70 GHz random sampling oscilloscope with the detectors incorporated into high-speed microstrip transmission lines and the excitation source for these measurements was an ion beam of either 5-MeV He +more » or 10-MeV Si 3+. The detectors used in both experiments can be described as metal-semiconductor-metal (MSM) devices where a volume of the detector material is sandwiched between two metal plates. A charge collection model was developed to interpret the integrated-charge measurements which enabled estimation of the energy required to produce an electron-hole pair (ϵ di) and the mean carrier transport properties in diamond, such as carrier mobility and lifetime, and the behavior of the electrical contacts to diamond.« less
Effect of Surface Termination on the Electonic Properties of LaNiO₃ Films
Kumah, Divine P.; Malashevich, Andrei; Disa, Ankit S.; ...
2014-11-06
The electronic and structural properties of thin LaNiO₃ films grown by using molecular beam epitaxy are studied as a function of the net ionic charge of the surface terminating layer. We demonstrate that electronic transport in nickelate heterostructures can be manipulated through changes in the surface termination due to a strong coupling of the surface electrostatic properties to the structural properties of the Ni—O bonds that govern electronic conduction. We observe experimentally and from first-principles theory an asymmetric response of the structural properties of the films to the sign of the surface charge, which results from a strong interplay betweenmore » electrostatic and mechanical boundary conditions governing the system. The structural response results in ionic buckling in the near-surface NiO₂ planes for films terminated with negatively charged NiO₂ and bulklike NiO₂ planes for films terminated with positively charged LaO planes. The ability to modify transport properties by the deposition of a single atomic layer can be used as a guiding principle for nanoscale device fabrication.« less
NASA Astrophysics Data System (ADS)
Olivero, P.; Manfredotti, C.; Vittone, E.; Fizzotti, F.; Paolini, C.; Lo Giudice, A.; Barrett, R.; Tucoulou, R.
2004-10-01
Tracking detectors have become an important ingredient in high-energy physics experiments. In order to survive the harsh detection environment of the large hadron collider (LHC), trackers need to have special properties. They must be radiation hard, provide fast collection of charge, be as thin as possible and remove heat from readout electronics. The unique properties of diamond allow it to fulfill these requirements. In this work we present an investigation of the charge transport and luminescence properties of "detector grade" artificial chemical vapour deposition (CVD) diamond devices developed within the CERN RD42 collaboration, performed by means of X-ray micro-beam induced current collection (XBICC) and X-ray micro-beam induced luminescence (XBIL) techniques. XBICC technique allows quantitative estimates of the transport parameters of the material to be evaluated and mapped with micrometric spatial resolution. In particular, the high resolution and sensitivity of the technique has allowed a quantitative study of the inhomogeneity of the charge transport parameter defined as the product of mobility and lifetime for both electron and holes. XBIL represents a technique complementary to ion beam induced luminescence (IBIL), which has already been used by our group, since X-ray energy loss profile in the material is different from that of MeV ions. X-ray induced luminescence maps have been performed simultaneously with induced photocurrent maps, to correlate charge transport and induced luminescence properties of diamond. Simultaneous XBICC and XBIL maps exhibit features of partial complementarity that have been interpreted on the basis of considerations on radiative and non-radiative recombination processes which compete with charge transport efficiency.
Structure/property relationships in polymer membranes for water purification and energy applications
NASA Astrophysics Data System (ADS)
Geise, Geoffrey
Providing sustainable supplies of purified water and energy is a critical global challenge for the future, and polymer membranes will play a key role in addressing these clear and pressing global needs for water and energy. Polymer membrane-based processes dominate the desalination market, and polymer membranes are crucial components in several rapidly developing power generation and storage applications that rely on membranes to control rates of water and/or ion transport. Much remains unknown about the influence of polymer structure on intrinsic water and ion transport properties, and these relationships must be developed to design next generation polymer membrane materials. For desalination applications, polymers with simultaneously high water permeability and low salt permeability are desirable in order to prepare selective membranes that can efficiently desalinate water, and a tradeoff relationship between water/salt selectivity and water permeability suggests that attempts to prepare such materials should rely on approaches that do more than simply vary polymer free volume. One strategy is to functionalize hydrocarbon polymers with fixed charge groups that can ionize upon exposure to water, and the presence of charged groups in the polymer influences transport properties. Additionally, in many emerging energy applications, charged polymers are exposed to ions that are very different from sodium and chloride. Specific ion effects have been observed in charged polymers, and these effects must be understood to prepare charged polymers that will enable emerging energy technologies. This presentation discusses research aimed at further understanding fundamental structure/property relationships that govern water and ion transport in charged polymer films considered for desalination and electric potential field-driven applications that can help address global needs for clean water and energy.
Shi, Jiangjian; Li, Dongmei; Luo, Yanhong; Wu, Huijue; Meng, Qingbo
2016-12-01
An opto-electro-modulated transient photovoltage/photocurrent system has been developed to probe microscopic charge processes of a solar cell in its adjustable operating conditions. The reliability of this system is carefully determined by electric circuit simulations and experimental measurements. Using this system, the charge transport, recombination and storage properties of a conventional multicrystalline silicon solar cell under different steady-state bias voltages, and light illumination intensities are investigated. This system has also been applied to study the influence of the hole transport material layer on charge extraction and the microscopic charge processes behind the widely considered photoelectric hysteresis in perovskite solar cells.
Zhu, Huayang; Ricote, Sandrine; Coors, W Grover; Kee, Robert J
2015-01-01
A model-based interpretation of measured equilibrium conductivity and conductivity relaxation is developed to establish thermodynamic, transport, and kinetics parameters for multiple charged defect conducting (MCDC) ceramic materials. The present study focuses on 10% yttrium-doped barium zirconate (BZY10). In principle, using the Nernst-Einstein relationship, equilibrium conductivity measurements are sufficient to establish thermodynamic and transport properties. However, in practice it is difficult to establish unique sets of properties using equilibrium conductivity alone. Combining equilibrium and conductivity-relaxation measurements serves to significantly improve the quantitative fidelity of the derived material properties. The models are developed using a Nernst-Planck-Poisson (NPP) formulation, which enables the quantitative representation of conductivity relaxations caused by very large changes in oxygen partial pressure.
Würfel, Uli; Neher, Dieter; Spies, Annika; Albrecht, Steve
2015-01-01
This work elucidates the impact of charge transport on the photovoltaic properties of organic solar cells. Here we show that the analysis of current–voltage curves of organic solar cells under illumination with the Shockley equation results in values for ideality factor, photocurrent and parallel resistance, which lack physical meaning. Drift-diffusion simulations for a wide range of charge-carrier mobilities and illumination intensities reveal significant carrier accumulation caused by poor transport properties, which is not included in the Shockley equation. As a consequence, the separation of the quasi Fermi levels in the organic photoactive layer (internal voltage) differs substantially from the external voltage for almost all conditions. We present a new analytical model, which considers carrier transport explicitly. The model shows excellent agreement with full drift-diffusion simulations over a wide range of mobilities and illumination intensities, making it suitable for realistic efficiency predictions for organic solar cells. PMID:25907581
Low intrinsic carrier density LSMO/Alq3/AlOx/Co organic spintronic devices
NASA Astrophysics Data System (ADS)
Riminucci, Alberto; Graziosi, Patrizio; Calbucci, Marco; Cecchini, Raimondo; Prezioso, Mirko; Borgatti, Francesco; Bergenti, Ilaria; Dediu, Valentin Alek
2018-04-01
The understanding of spin injection and transport in organic spintronic devices is still incomplete, with some experiments showing magnetoresistance and others not detecting it. We have investigated the transport properties of a large number of tris-(8-hydroxyquinoline)aluminum-based organic spintronic devices with an electrical resistance greater than 5 MΩ that did not show magnetoresistance. Their transport properties could be described satisfactorily by known models for organic semiconductors. At high voltages (>2 V), the results followed the model of space charge limited current with a Poole-Frenkel mobility. At low voltages (˜0.1 V), that are those at which the spin valve behavior is usually observed, the charge transport was modelled by nearest neighbor hopping in intra-gap impurity levels, with a charge carrier density of n0 = (1.44 ± 0.21) × 1015 cm-3 at room temperature. Such a low carrier density can explain why no magnetoresistance was observed.
Charge transport in metal oxide nanocrystal-based materials
NASA Astrophysics Data System (ADS)
Runnerstrom, Evan Lars
There is probably no class of materials more varied, more widely used, or more ubiquitous than metal oxides. Depending on their composition, metal oxides can exhibit almost any number of properties. Of particular interest are the ways in which charge is transported in metal oxides: devices such as displays, touch screens, and smart windows rely on the ability of certain metal oxides to conduct electricity while maintaining visible transparency. Smart windows, fuel cells, and other electrochemical devices additionally rely on efficient transport of ionic charge in and around metal oxides. Colloidal synthesis has enabled metal oxide nanocrystals to emerge as a relatively new but highly tunable class of materials. Certain metal oxide nanocrystals, particularly highly doped metal oxides, have been enjoying rapid development in the last decade. As in myriad other materials systems, structure dictates the properties of metal oxide nanocrystals, but a full understanding of how nanocrystal synthesis, the processing of nanocrystal-based materials, and the structure of nanocrystals relate to the resulting properties of nanocrystal-based materials is still nascent. Gaining a fundamental understanding of and control over these structure-property relationships is crucial to developing a holistic understanding of metal oxide nanocrystals. The unique ability to tune metal oxide nanocrystals by changing composition through the introduction of dopants or by changing size and shape affords a way to study the interplay between structure, processing, and properties. This overall goal of this work is to chemically synthesize colloidal metal oxide nanocrystals, process them into useful materials, characterize charge transport in materials based on colloidal metal oxide nanocrystals, and develop ways to manipulate charge transport. In particular, this dissertation characterizes how the charge transport properties of metal oxide nanocrystal-based materials depend on their processing and structure. Charge transport can obviously be taken to mean the conduction of electrons, but it also refers to the motion of ions, such as lithium ions and protons. In many cases, the transport of ions is married to the motion of electrons as well, either through an external electrical circuit, or within the same material in the case of mixed ionic electronic conductors. The collective motion of electrons over short length scales, that is, within single nanocrystals, is also a subject of study as it pertains to plasmonic nanocrystals. Finally, charge transport can also be coupled to or result from the formation of defects in metal oxides. All of these modes of charge transport in metal oxides gain further complexity when considered in nanocrystalline systems, where the introduction of numerous surfaces can change the character of charge transport relative to bulk systems, providing opportunities to exploit new physical phenomena. Part I of this dissertation explores the combination of electronic and ionic transport in electrochromic devices based on nanocrystals. Colloidal chemistry and solution processing are used to fabricate nanocomposites based on electrochromic tin-doped indium oxide (ITO) nanocrystals. The nanocomposites, which are completely synthesized using solution processing, consist of ITO nanocrystals and lithium bis(trifluoromethylsulfonyl)amide (LiTFSI) salt dispersed in a lithium ion-conducting polymer matrix of either poly(ethylene oxide) (PEO) or poly(methyl methacrylate) (PMMA). ITO nanocrystals are prepared by colloidal synthetic methods and the nanocrystal surface chemistry is modified to achieve favorable nanocrystal-polymer interactions. Homogeneous solutions containing polymer, ITO nanocrystals, and lithium salt are thus prepared and deposited by spin casting. Characterization by DC electronic measurements, microscopy, and x-ray scattering techniques show that the ITO nanocrystals form a complete, connected electrode within a polymer electrolyte matrix, and that the morphology and properties of the nanocomposites can be manipulated by changing the chemical composition of the deposition solution. Careful application of AC impedance spectroscopy techniques and DC measurements are used to show that the nanocomposites exhibit mixed ionic and electronic conductivity, where electronic charge is transported through the ITO nanocrystal phase, and ionic charge is transported through the polymer matrix phase. The synthetic methods developed here and understanding of charge transport ultimately lead to the fabrication of a solid state nanocomposite electrochromic device based on nanocrystals of ITO and cerium oxide. Part II of this dissertation considers electron transport within individual metal oxide nanocrystals themselves. It primarily examines relationships between synthetic chemistry, doping mechanisms in metal oxides, and the accompanying physics of free carrier scattering within the interior of highly doped metal oxide nanocrystals, with particular mind paid to ITO nanocrystals. Additionally, synthetic methods as well as metal oxide defect chemistry influences the balance between activation and compensation of dopants, which limits the nanocrystals' free carrier concentration. Furthermore, because of ionized impurity scattering of the oscillating electrons by dopant ions, scattering must be treated in a fundamentally different way in semiconductor metal oxide materials when compared with conventional metals. (Abstract shortened by ProQuest.).
Code of Federal Regulations, 2011 CFR
2011-10-01
... Other Regulations Relating to Transportation (Continued) FEDERAL MOTOR CARRIER SAFETY ADMINISTRATION, DEPARTMENT OF TRANSPORTATION FEDERAL MOTOR CARRIER SAFETY REGULATIONS PAYMENT OF TRANSPORTATION CHARGES... transportation of property under Federal Motor Carrier Safety Administration regulation by motor carriers and...
Code of Federal Regulations, 2010 CFR
2010-10-01
... Other Regulations Relating to Transportation (Continued) FEDERAL MOTOR CARRIER SAFETY ADMINISTRATION, DEPARTMENT OF TRANSPORTATION FEDERAL MOTOR CARRIER SAFETY REGULATIONS PAYMENT OF TRANSPORTATION CHARGES... transportation of property under Federal Motor Carrier Safety Administration regulation by motor carriers and...
NASA Astrophysics Data System (ADS)
Hutchison, Geoffrey Rogers
Theoretical studies on a variety of oligo- and polyheterocycles elucidate their optical and charge transport properties, suggesting new, improved transparent conductive polymers. First-principles calculations provide accurate methodologies for predicting both optical band gaps of neutral and cationic oligomers and intrinsic charge transfer rates. Multidimensional analysis reveals important motifs in chemical tailorability of oligoheterocycle optical and charge transport properties. The results suggest new directions for design of novel materials. Using both finite oligomer and infinite polymer calculations, the optical band gaps in polyheterocycles follow a modified particle-in-a-box formalism, scaling approximately as 1/N (where N is the number of monomer units) in short chains, saturating for long chains. Calculations demonstrate that band structure changes upon heteroatom substitution, (e.g., from polythiophene to polypyrrole) derive from heteroatom electron affinity. Further investigation of chemical variability in substituted oligoheterocycles using multidimensional statistics reveals the interplay between heteroatom and substituent in correlations between structure and redox/optical properties of neutral and cationic species. A linear correlation between band gaps of neutral and cationic species upon oxidation of conjugated oligomers, shows redshifts of optical absorption for most species and blueshifts for small band gap species. Interstrand charge-transport studies focus on two contributors to hopping-style charge transfer rates: internal reorganization energy and the electronic coupling matrix element. Statistical analysis of chemical variability of reorganization energies in oligoheterocycles proves the importance of reorganization energy in determining intrinsic charge transfer rates (e.g., charge mobility in unsubstituted oligothiophenes). Computed bandwidths across several oligothiophene crystal packing motifs show similar electron and hole bandwidths, and show that well-known tilted and herringbone motifs in oligothiophenes are driven by electrostatic repulsion. Tilted stacks exhibit intrinsic charge-transfer rates smaller than cofacial stacks, but with lower packing energy. Given similar electron and hole bandwidths, a charge injection model explains substitution-modulated majority carrier changes in n- and p-type oligothiophene field-effect transistors.
NASA Astrophysics Data System (ADS)
Qian, Lei; Bera, Debasis; Jin, Zhen-Sheng; Du, Zu-Liang; Xu, Zheng; Teng, Feng; Liu, Wei
2007-09-01
In this paper, we discuss the influence of dehydrated nanotubed titanic acid (DNTA) on charge transport and luminescent properties of polymer light-emitting diodes (PLEDs) doped with fluorescent dye. Photoluminescence results confirm the efficient energy transfer from PVK to 4-(dicyanom-ethylene)-2- t-butyl-6-(1,1,7,7-tetramethyljulolidyl-9-enyl)-4H-pyran (DCJTB) and tris-(8-hydroxtquinoline) aluminum (Alq 3) in a DNTA-doped device. The device showed lower turn-on voltages and higher charge current by doping with DNTA, which also caused a shift in the exciton's recombination region.
Temperature dependent charge transport in poly(3-hexylthiophene) diodes
NASA Astrophysics Data System (ADS)
Rahaman, Abdulla Bin; Sarkar, Atri; Banerjee, Debamalya
2018-04-01
In this work, we present charge transport properties of poly(3-hexylthiophene) (P3HT) diodes under dark conditions. Temperature dependent current-voltage (J-V) characteristics shows that charge transport represents a transition from ohomic to trap limited current. The forward current density obeys a power law J˜Vm, m>2 represents the space charge limited current region in presence of traps within the band gap. Frequency dependent conductivity has been studied in a temperature range 150K-473K. The dc conductivity values show Arrhenius like behavior and it gives conductivity activation energy 223 meV. Temperature dependent conductivity indicates a thermodynamic transition of our system.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rahmi, Kinanti Aldilla, E-mail: kinanti.aldilla@ui.ac.id; Yudiarsah, Efta
By using tight binding Hamiltonian model, charge transport properties of poly(dA)-poly(dT) DNA in variation of backbone disorder and amplitude of base-pair twisting motion is studied. The DNA chain used is 32 base pairs long poly(dA)-poly(dT) molecule. The molecule is contacted to electrode at both ends. The influence of environment on charge transport in DNA is modeled as variation of backbone disorder. The twisting motion amplitude is taking into account by assuming that the twisting angle distributes following Gaussian distribution function with zero average and standard deviation proportional to square root of temperature and inversely proportional to the twisting motion frequency.more » The base-pair twisting motion influences both the onsite energy of the bases and electron hopping constant between bases. The charge transport properties are studied by calculating current using Landauer-Buttiker formula from transmission probabilities which is calculated by transfer matrix methods. The result shows that as the backbone disorder increases, the maximum current decreases. By decreasing the twisting motion frequency, the current increases rapidly at low voltage, but the current increases slower at higher voltage. The threshold voltage can increase or decrease with increasing backbone disorder and increasing twisting frequency.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhang, Xuning; Zuo, Xiaobing; Xie, Shenkun
Photovoltaic characteristics, recombination and charge transport properties are investigated. The determined recombination reduction factor can reconcile the supreme device performance in organic solar cells using non-fullerene ITIC acceptor and severe carrier losses in all-polymer devices with P(NDI2OD-T2).
Hori, Tetsuro; Moritou, Hiroki; Fukuoka, Naoki; Sakamoto, Junki; Fujii, Akihiko; Ozaki, Masanori
2010-01-01
Organic thin-film solar cells with a conducting polymer (CP)/fullerene (C60) interpenetrating heterojunction structure, fabricated by spin-coating a CP onto a C60 deposit thin film, have been investigated and demonstrated to have high efficiency. The photovoltaic properties of solar cells with a structure of indium-tin-oxide/C60/poly(3-hexylthiophene) (PAT6)/Au have been improved by the insertion of molybdenum trioxide (VI) (MoO3) and zinc oxide charge transport buffer layers. The enhanced photovoltaic properties have been discussed, taking into consideration the ground-state charge transfer between PAT6 and MoO3 by measurement of the differential absorption spectra and the suppressed contact resistance at the interface between the organic and buffer layers. PMID:28883360
Local Thermometry of Neutral Modes on the Quantum Hall Edge
NASA Astrophysics Data System (ADS)
Hart, Sean; Venkatachalam, Vivek; Pfeiffer, Loren; West, Ken; Yacoby, Amir
2012-02-01
A system of electrons in two dimensions and strong magnetic fields can be tuned to create a gapped 2D system with one dimensional channels along the edge. Interactions among these edge modes can lead to independent transport of charge and heat, even in opposite directions. Measuring the chirality and transport properties of these charge and heat modes can reveal otherwise hidden structure in the edge. Here, we heat the outer edge of such a quantum Hall system using a quantum point contact. By placing quantum dots upstream and downstream along the edge of the heater, we can measure both the chemical potential and temperature of that edge to study charge and heat transport, respectively. We find that charge is transported exclusively downstream, but heat can be transported upstream when the edge has additional structure related to fractional quantum Hall physics.
Exploring the Charge Transport in Conjugated Polymers.
Xu, Yong; Sun, Huabin; Li, Wenwu; Lin, Yen-Fu; Balestra, Francis; Ghibaudo, Gerard; Noh, Yong-Young
2017-11-01
Conjugated polymers came to an unprecedented epoch that the charge transport is limited only by small disorder within aggregated domains. Accurate evaluation of transport performance is thus vital to optimizing further molecule design. Yet, the routine method by means of the conventional field-effect transistors may not satisfy such a requirement. Here, it is shown that the extrinsic effects of Schottky barrier, access transport through semiconductor bulk, and concurrent ambipolar conduction seriously influence transport analysis. The planar transistors incorporating ohmic contacts free of access and ambipolar conduction afford an ideal access to charge transport. It is found, however, that only the planar transistors operating in low-field regime are reliable to explore the inherent transport properties due to the energetic disorder lowering by the lateral field induced by high drain voltage. This work opens up a robust approach to comprehend the delicate charge transport in conjugated polymers so as to develop high-performance semiconducting polymers for promising plastic electronics. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Impact of the titania nanostructure on charge transport and its application in hybrid solar cells
NASA Astrophysics Data System (ADS)
Koffman-Frischknecht, Alejandro; Gonzalez, Fernando; Plá, Juan; Violi, Ianina; Soler-Illia, Galo J. A. A.; Perez, M. Dolores
2018-02-01
Porous titania films are widely studied in a number of optoelectronic applications due to its favorable optical and electronic characteristics. Mesoporous titania thin films (MTTFs) with tunable pore size, pore order, accessibility and crystallinity are of interest in electronic devices due to the potential for optimization of the desired characteristics for charge separation and carrier transport. In this work, several MTTFs were prepared by sol-gel chemistry with different structural properties tuned by post-synthesis thermal treatment. The effect of the structural properties (pore diameter, order and accessibility) on the electrical properties of the material was studied by films fabrication onto a transparent conducting electrode, ITO, such that it enables optoelectronic applications. The performance as photoanode was explored by the fabrication of hybrid polymer (P3HT): titania solar cells. Not only does structural properties affect polymer impregnation inside the titania pores as expected and hence impacts charge separation at the interface, but also the thermal treatment affects crystallinity and the films electronic properties. A more complete picture about the electronic properties of the different MTTFs prepared in this work was studied by mobility measurement by space charge limited current and impedance spectroscopy.
NASA Astrophysics Data System (ADS)
Gavvalapalli, Nagarjuna
All-polymer solar cells (APSC) are a class of organic solar cells in which hole and electron transporting phases are made of conjugated polymers. Unlike polymer/fullerene solar cell, photoactive material of APSC can be designed to have hole and electron transporting polymers with complementary absorption range and proper frontier energy level offset. However, the highest reported PCE of APSC is 5 times less than that of polymer/fullerene solar cell. The low PCE of APSC is mainly due to: i) low charge separation efficiency; and ii) lack of optimal morphology to facilitate charge transfer and transport; and iii) lack of control over the exciton and charge transport in each phase. My research work is focused towards addressing these issues. The charge separation efficiency of APSC can be enhanced by designing novel electron transporting polymers with: i) broad absorption range; ii) high electron mobility; and iii) high dielectric constant. In addition to with the above parameters chemical and electronic structure of the repeating unit of conjugated polymer also plays a role in charge separation efficiency. So far only three classes of electron transporting polymers, CN substituted PPV, 2,1,3-benzothiadiazole derived polymers and rylene diimide derived polymers, are used in APSC. Thus to enhance the charge separation efficiency new classes of electron transporting polymers with the above characteristics need to be synthesized. I have developed a new straightforward synthetic strategy to rapidly generate new classes of electron transporting polymers with different chemical and electronic structure, broad absorption range, and high electron mobility from readily available electron deficient monomers. In APSCs due to low entropy of mixing, polymers tend to micro-phase segregate rather than forming the more useful nano-phase segregation. Optimizing the polymer blend morphology to obtain nano-phase segregation is specific to the system under study, time consuming, and not trivial. Thus to avoid micro-phase segregation, nanoparticles of hole and electron transporters are synthesized and blended. But the PCE of nanoparticle blends are far less than those of polymer blends. This is mainly due to the: i) lack of optimal assembly of nanoparticles to facilitate charge transfer and transport processes; and ii) lack of control over the exciton and charge transport properties within the nanoparticles. Polymer packing within the nanoparticle controls the optoelectronic and charge transport properties of the nanoparticle. In this work I have shown that the solvent used to synthesize nanoparticles plays a crucial role in determining the assembly of polymer chains inside the nanoparticle there by affecting its exciton and charge transport processes. To obtain the optimal morphology for better charge transfer and transport, we have also synthesized nanoparticles of different radius with surfactants of opposite charge. We propose that depending on the radius and/or Coulombic interactions these nanoparticles can be assembled into mineral structure-types that are useful for photovoltaic devices.
Basconi, Joseph E; Carta, Giorgio; Shirts, Michael R
2015-04-14
Multiscale simulation is used to study the adsorption of lysozyme onto ion exchangers obtained by grafting charged polymers into a porous matrix, in systems with various polymer properties and strengths of electrostatic interaction. Molecular dynamics simulations show that protein partitioning into the polymer-filled pore space increases with the overall charge content of the polymers, while the diffusivity in the pore space decreases. However, the combination of greatly increased partitioning and modestly decreased diffusion results in macroscopic transport rates that increase as a function of charge content, as the large concentration driving force due to enhanced pore space partitioning outweighs the reduction in the pore space diffusivity. Matrices having greater charge associated with the grafted polymers also exhibit more diffuse intraparticle concentration profiles during transient adsorption. In systems with a high charge content per polymer and a low protein loading, the polymers preferentially partition toward the surface due to favorable interactions with the surface-bound protein. These results demonstrate the potential of multiscale modeling to illuminate qualitative trends between molecular properties and the adsorption equilibria and kinetic properties observable on macroscopic scales.
Understanding and predicting the fate and transport of nano-materials in the environment requires a detailed characterization of the chemical and physical properties that control fate and transport. In the current study, we have evaluated the surface charge, aggregation potentia...
Kim, Jae-Keun; Cho, Kyungjune; Kim, Tae-Young; Pak, Jinsu; Jang, Jingon; Song, Younggul; Kim, Youngrok; Choi, Barbara Yuri; Chung, Seungjun; Hong, Woong-Ki; Lee, Takhee
2016-01-01
We investigated the trap-mediated electronic transport properties of pentacene/molybdenum disulphide (MoS2) p-n heterojunction devices. We observed that the hybrid p-n heterojunctions were gate-tunable and were strongly affected by trap-assisted tunnelling through the van der Waals gap at the heterojunction interfaces between MoS2 and pentacene. The pentacene/MoS2 p-n heterojunction diodes had gate-tunable high ideality factor, which resulted from trap-mediated conduction nature of devices. From the temperature-variable current-voltage measurement, a space-charge-limited conduction and a variable range hopping conduction at a low temperature were suggested as the gate-tunable charge transport characteristics of these hybrid p-n heterojunctions. Our study provides a better understanding of the trap-mediated electronic transport properties in organic/2-dimensional material hybrid heterojunction devices. PMID:27829663
NASA Astrophysics Data System (ADS)
Kim, Jae-Keun; Cho, Kyungjune; Kim, Tae-Young; Pak, Jinsu; Jang, Jingon; Song, Younggul; Kim, Youngrok; Choi, Barbara Yuri; Chung, Seungjun; Hong, Woong-Ki; Lee, Takhee
2016-11-01
We investigated the trap-mediated electronic transport properties of pentacene/molybdenum disulphide (MoS2) p-n heterojunction devices. We observed that the hybrid p-n heterojunctions were gate-tunable and were strongly affected by trap-assisted tunnelling through the van der Waals gap at the heterojunction interfaces between MoS2 and pentacene. The pentacene/MoS2 p-n heterojunction diodes had gate-tunable high ideality factor, which resulted from trap-mediated conduction nature of devices. From the temperature-variable current-voltage measurement, a space-charge-limited conduction and a variable range hopping conduction at a low temperature were suggested as the gate-tunable charge transport characteristics of these hybrid p-n heterojunctions. Our study provides a better understanding of the trap-mediated electronic transport properties in organic/2-dimensional material hybrid heterojunction devices.
Kim, Jae-Keun; Cho, Kyungjune; Kim, Tae-Young; Pak, Jinsu; Jang, Jingon; Song, Younggul; Kim, Youngrok; Choi, Barbara Yuri; Chung, Seungjun; Hong, Woong-Ki; Lee, Takhee
2016-11-10
We investigated the trap-mediated electronic transport properties of pentacene/molybdenum disulphide (MoS 2 ) p-n heterojunction devices. We observed that the hybrid p-n heterojunctions were gate-tunable and were strongly affected by trap-assisted tunnelling through the van der Waals gap at the heterojunction interfaces between MoS 2 and pentacene. The pentacene/MoS 2 p-n heterojunction diodes had gate-tunable high ideality factor, which resulted from trap-mediated conduction nature of devices. From the temperature-variable current-voltage measurement, a space-charge-limited conduction and a variable range hopping conduction at a low temperature were suggested as the gate-tunable charge transport characteristics of these hybrid p-n heterojunctions. Our study provides a better understanding of the trap-mediated electronic transport properties in organic/2-dimensional material hybrid heterojunction devices.
NASA Astrophysics Data System (ADS)
Nägele, G.; Heinen, M.; Banchio, A. J.; Contreras-Aburto, C.
2013-11-01
Dynamic processes in dispersions of charged spherical particles are of importance both in fundamental science, and in technical and bio-medical applications. There exists a large variety of charged-particles systems, ranging from nanometer-sized electrolyte ions to micron-sized charge-stabilized colloids. We review recent advances in theoretical methods for the calculation of linear transport coefficients in concentrated particulate systems, with the focus on hydrodynamic interactions and electrokinetic effects. Considered transport properties are the dispersion viscosity, self- and collective diffusion coefficients, sedimentation coefficients, and electrophoretic mobilities and conductivities of ionic particle species in an external electric field. Advances by our group are also discussed, including a novel mode-coupling-theory method for conduction-diffusion and viscoelastic properties of strong electrolyte solutions. Furthermore, results are presented for dispersions of solvent-permeable particles, and particles with non-zero hydrodynamic surface slip. The concentration-dependent swelling of ionic microgels is discussed, as well as a far-reaching dynamic scaling behavior relating colloidal long- to short-time dynamics.
Emergent ultrafast phenomena in correlated oxides and heterostructures
NASA Astrophysics Data System (ADS)
Gandolfi, M.; Celardo, G. L.; Borgonovi, F.; Ferrini, G.; Avella, A.; Banfi, F.; Giannetti, C.
2017-03-01
The possibility of investigating the dynamics of solids on timescales faster than the thermalization of the internal degrees of freedom has disclosed novel non-equilibrium phenomena that have no counterpart at equilibrium. Transition metal oxides (TMOs) provide an interesting playground in which the correlations among the charges in the metal d-orbitals give rise to a wealth of intriguing electronic and thermodynamic properties involving the spin, charge, lattice and orbital orders. Furthermore, the physical properties of TMOs can be engineered at the atomic level, thus providing the platform to investigate the transport phenomena on timescales of the order of the intrinsic decoherence time of the charge excitations. Here, we review and discuss three paradigmatic examples of transient emerging properties that are expected to open new fields of research: (i) the creation of non-thermal magnetic states in spin-orbit Mott insulators; (ii) the possible exploitation of quantum paths for the transport and collection of charge excitations in heterostructures; (iii) the transient wave-like behavior of the temperature field in strongly anisotropic TMOs.
Jeong, Jae Won; Jo, Gyounglyul; Choi, Solip; Kim, Yoong Ahm; Yoon, Hyeonseok; Ryu, Sang-Wan; Jung, Jaehan; Chang, Mincheol
2018-05-30
Charge transport in π-conjugated polymer films involves π-π interactions within or between polymer chains. Here, we demonstrate a facile solution processing strategy that provides enhanced intra- and interchain π-π interactions of the resultant polymer films using a good solvent additive with low volatility. These increased interactions result in enhanced charge transport properties. The effect of the good solvent additive on the intra- and intermolecular interactions, morphologies, and charge transport properties of poly(3-hexylthiophene) (P3HT) films is systematically investigated. We found that the good solvent additive facilitates the self-assembly of P3HT chains into crystalline fibrillar nanostructures by extending the solvent drying time during thin-film formation. As compared to the prior approach using a nonsolvent additive with low volatility, the solvent blend system containing a good solvent additive results in enhanced charge transport in P3HT organic field-effect transistor (OFET) devices [from ca. 1.7 × 10 -2 to ca. 8.2 × 10 -2 cm 2 V -1 s -1 for dichlorobenzene (DCB) versus 4.4 × 10 -2 cm 2 V -1 s -1 for acetonitrile]. The mobility appears to be maximized over a broad spectrum of additive concentrations (1-7 vol %), indicative of a wide processing window. Detailed analysis results regarding the charge injection and transport characteristics of the OFET devices reveal that a high-boiling-point solvent additive decreases both the contact resistance ( R c ) and channel resistance ( R ch ), contributing to the mobility enhancement of the devices. Finally, the platform presented here is proven to be applicable to alternative good solvent additives with low volatility, such as chlorobenzene (CB) and trichlorobenzene (TCB). Specifically, the mobility enhancement of the resultant P3HT films increases in the order CB (bp 131 °C) < DCB (bp 180 °C) < TCB (bp 214 °C), suggesting that solvent additives with higher boiling points provide resultant films with preferable molecular ordering and morphologies for efficient charge transport.
Charge transport in highly efficient iridium cored electrophosphorescent dendrimers
NASA Astrophysics Data System (ADS)
Markham, Jonathan P. J.; Samuel, Ifor D. W.; Lo, Shih-Chun; Burn, Paul L.; Weiter, Martin; Bässler, Heinz
2004-01-01
Electrophosphorescent dendrimers are promising materials for highly efficient light-emitting diodes. They consist of a phosphorescent core onto which dendritic groups are attached. Here, we present an investigation into the optical and electronic properties of highly efficient phosphorescent dendrimers. The effect of dendrimer structure on charge transport and optical properties is studied using temperature-dependent charge-generation-layer time-of-flight measurements and current voltage (I-V) analysis. A model is used to explain trends seen in the I-V characteristics. We demonstrate that fine tuning the mobility by chemical structure is possible in these dendrimers and show that this can lead to highly efficient bilayer dendrimer light-emitting diodes with neat emissive layers. Power efficiencies of 20 lm/W were measured for devices containing a second-generation (G2) Ir(ppy)3 dendrimer with a 1,3,5-tris(2-N-phenylbenzimidazolyl)benzene electron transport layer.
Temperature evolution of the charge and spin transport in Cu/Nb interface
NASA Astrophysics Data System (ADS)
Ishitaki, Masayuki; Ohnishi, Kohei; Kimura, Takashi
2018-06-01
The transport properties for the charge and spin currents in a normal-metal/superconductor interface have been investigated by using a nano-pillar based lateral spin valve. Owing to the efficient reduction of the Joule heating, we were able to observe the temperature and bias-current dependences of the spin transport in the Cu/Nb bilayer system. From the temperature dependence of the spin signal, the superconducting gap of the Nb in contact with Cu was found to open gradually with decreasing the temperature. We also found that the inhomogeneous superconducting property produces the significant temperature and field dependences of the background signal in the nonlocal measurement around the transition temperature.
Natural organic matter (NOM) affects the stability and transport of nanoparticles (NPs) in natural waters by modifying their physiochemical properties. Source location, and seasonal variations, influence their molecular, physical and electrical charge properties. To understand th...
Singh, Surendra; Freeland, J. W.; Fitzsimmons, Michael R.; ...
2016-07-27
Mixed-valence manganese oxides present striking properties like the colossal magnetoresistance, metal-insulator transition (MIT) that may result from coexistence of ferromagnetic, metallic and insulating phases. Percolation of such phase coexistence in the vicinity of MIT leads to first-order transition in these manganites. However the length scales over which the electronic and magnetic phases are separated across MIT which appears compelling for bulk systems has been elusive in (La 1-yPr y) 1-xCaxMnO 3 films. Here we show the in-plane length scale over which charge and magnetism are correlated in (La 0.4Pr 0.6) 1-xCaxMnO3 films with x = 0.33 and 0.375, across themore » MIT temperature. We combine electrical transport (resistance) measurements, x-ray absorption spectroscopy (XAS), x-ray magnetic circular dichroism (XMCD), and specular/off-specular x-ray resonant magnetic scattering (XRMS) measurements as a function of temperature to elucidate relationships between electronic, magnetic and morphological structure of the thin films. Using off-specular XRMS we obtained the charge-charge and charge-magnetic correlation length of these LPCMO films across the MIT. We observed different charge-magnetic correlation length for two films which increases below the MIT. The different correlation length shown by two films may be responsible for different macroscopic (transport and magnetic) properties.« less
NASA Astrophysics Data System (ADS)
Szymanski, Marek Z.; Kulszewicz-Bajer, Irena; Faure-Vincent, Jérôme; Djurado, David
2012-08-01
We have studied hole transport in triarylamine based dendrimer using space-charge-limited current transient technique. A mobility of 8 × 10-6 cm2/(V s) and a characteristic detrapping time of about 100 ms have been obtained. We found that quasi-ohmic contact is formed with gold. The obtained mobility differs from the apparent one given by the analysis of stationary current-voltage characteristics because of a limited contact efficiency. The comparison between transients obtained from fresh and aged samples reveals no change in mobility with aging. The deterioration of electrical properties is exclusively caused by trap formation and accumulation of ionic conducting impurities. Finally, repeated transient measurements have been applied to analyze the dynamics of charge trapping process.
Unity quantum yield of photogenerated charges and band-like transport in quantum-dot solids.
Talgorn, Elise; Gao, Yunan; Aerts, Michiel; Kunneman, Lucas T; Schins, Juleon M; Savenije, T J; van Huis, Marijn A; van der Zant, Herre S J; Houtepen, Arjan J; Siebbeles, Laurens D A
2011-09-25
Solid films of colloidal quantum dots show promise in the manufacture of photodetectors and solar cells. These devices require high yields of photogenerated charges and high carrier mobilities, which are difficult to achieve in quantum-dot films owing to a strong electron-hole interaction and quantum confinement. Here, we show that the quantum yield of photogenerated charges in strongly coupled PbSe quantum-dot films is unity over a large temperature range. At high photoexcitation density, a transition takes place from hopping between localized states to band-like transport. These strongly coupled quantum-dot films have electrical properties that approach those of crystalline bulk semiconductors, while retaining the size tunability and cheap processing properties of colloidal quantum dots.
NASA Astrophysics Data System (ADS)
Das, Kalipada
2017-10-01
In our present study, we address in detail the magnetic and magneto-transport properties of ferromagnetic-charge ordered core-shell nanostructures. In these core-shell nanostructures, well-known half metallic La0.67Sr0.33MnO3 nanoparticles (average particle size, ˜20 nm) are wrapped by the charge ordered antiferromagnetic Pr0.67Ca0.33MnO3 (PCMO) matrix. The intrinsic properties of PCMO markedly modify it into such a core-shell form. The robustness of the PCMO matrix becomes fragile and melts at an external magnetic field (H) of ˜20 kOe. The analysis of magneto-transport data indicates the systematic reduction of the electron-electron and electron-magnon interactions in the presence of an external magnetic field in these nanostructures. The pronounced training effect appears in this phase separated compound, which was analyzed by considering the second order tunneling through the grain boundaries of the nanostructures. Additionally, the analysis of low field magnetoconductance data supports the second order tunneling and shows the close value of the universal limit (˜1.33).
NASA Astrophysics Data System (ADS)
Lim, Hwain; Lee, Kyu Seung; Liu, Yang; Kim, Hak Yong; Son, Dong Ick
2018-05-01
We report the synthesis and characterization of the carbon quantum dots (C-dots) easily obtained from citric acid and ethanediamine, and also investigated structural, optical and electrical properties. The C-dots have extraordinary optical and electrical features such as absorption of ultraviolet range and effective interface for charge separation and transport in active layer, which make them attractive materials for applications in photovoltaic devices (PV). The C-dots play important roles in charge extraction in the PV structures, they can be synthesized by a simple method and used to insert in active layer of polymer solar cells. In this study, we demonstrate that improve charge transport properties of inverted polymer solar cells (iPSCs) with C-dots and structural, optical and electrical properties of C-dots. As a result, iPSCs with C-dots showed enhancement of more than 30% compared with that of the contrast device in power conversion efficiency.
Noriega, Rodrigo; Salleo, Alberto; Spakowitz, Andrew J.
2013-01-01
Existing models for the electronic properties of conjugated polymers do not capture the spatial arrangement of the disordered macromolecular chains over which charge transport occurs. Here, we present an analytical and computational description in which the morphology of individual polymer chains is dictated by well-known statistical models and the electronic coupling between units is determined using Marcus theory. The multiscale transport of charges in these materials (high mobility at short length scales, low mobility at long length scales) is naturally described with our framework. Additionally, the dependence of mobility with electric field and temperature is explained in terms of conformational variability and spatial correlation. Our model offers a predictive approach to connecting processing conditions with transport behavior. PMID:24062459
Noriega, Rodrigo; Salleo, Alberto; Spakowitz, Andrew J
2013-10-08
Existing models for the electronic properties of conjugated polymers do not capture the spatial arrangement of the disordered macromolecular chains over which charge transport occurs. Here, we present an analytical and computational description in which the morphology of individual polymer chains is dictated by well-known statistical models and the electronic coupling between units is determined using Marcus theory. The multiscale transport of charges in these materials (high mobility at short length scales, low mobility at long length scales) is naturally described with our framework. Additionally, the dependence of mobility with electric field and temperature is explained in terms of conformational variability and spatial correlation. Our model offers a predictive approach to connecting processing conditions with transport behavior.
Petrović, Miloš; Ye, Tao; Chellappan, Vijila; Ramakrishna, Seeram
2017-12-13
Low-temperature optoelectrical studies of perovskite solar cells using MAPbI 3 and mixed-perovskite absorbers implemented into planar and mesoporous architectures reveal fundamental charge transporting properties in fully assembled devices operating under light bias. Both types of devices exhibit inverse correlation of charge carrier lifetime as a function of temperature, extending carrier lifetimes upon temperature reduction, especially after exposure to high optical biases. Contribution of bimolecular channels to the overall recombination process should not be overlooked because the density of generated charge surpasses trap-filling concentration requirements. Bimolecular charge recombination coefficient in both device types is smaller than Langevin theory prediction, and its mean value is independent of the applied illumination intensity. In planar devices, charge extraction declines upon MAPbI 3 transition from a tetragonal to an orthorhombic phase, indicating a connection between the trapping/detrapping mechanism and temperature. Studies on charge extraction by linearly increasing voltage further support this assertion, as charge carrier mobility dependence on temperature follows multiple-trapping predictions for both device structures. The monotonously increasing trend following the rise in temperature opposes the behavior observed in neat perovskite films and indicates the importance of transporting layers and the effect they have on charge transport in fully assembled solar cells. Low-temperature phase transition shows no pattern of influence on thermally activated electron/hole transport.
NASA Astrophysics Data System (ADS)
Hu, Bo
2015-08-01
Based on semiclassical Boltzamnn transport theory in random phase approximation, we develop a theoretical model to investigate low-temperature carrier transport properties in relatively high doped bilayer graphene. In the presence of both electron-hole puddles and band gap induced by charged impurities, we calculate low-temperature charged impurity scattering-limited conductivity in relatively high doped bilayer graphene. Our calculated conductivity results are in excellent agreement with published experimental data in all compensated gate voltage regime of study by using potential fluctuation parameter as only one free fitting parameter, indicating that both electron-hole puddles and band gap induced by charged impurities play an important role in carrier transport. More importantly, we also find that the conductivity not only depends strongly on the total charged impurity density, but also on the top layer charged impurity density, which is different from that obtained by neglecting the opening of band gap, especially for bilayer graphene with high top layer charged impurity density.
NASA Astrophysics Data System (ADS)
Maslyanchuk, O. L.; Solovan, M. M.; Brus, V. V.; Kulchynsky, V. V.; Maryanchuk, P. D.; Fodchuk, I. M.; Gnatyuk, V. A.; Aoki, T.; Potiriadis, C.; Kaissas, Y.
2017-05-01
The charge transport mechanism and spectrometric properties of the X-ray and γ-ray detectors, fabricated by the deposition of molybdenum oxide thin films onto semi-insulating p-CdTe crystals were studied. The current transport processes in the Mo-MoOx/p-CdTe/MoOx-Mo structure are well described in the scope of the carrier's generation in the space-charge region and the space-charge-limited current models. The lifetime of charge carriers, the energy of hole traps, and the density of discrete trapping centers were determined from the comparison of the experimental data and calculations. Spectrometric properties of Mo-MoOx/p-CdTe/MoOx-Mo structures were also investigated. It is shown that the investigated heterojunctions have demonstrated promising characteristics for practical application in X-ray and γ-ray detector fabrication.
Organic nanoparticles for photovoltaic and sensing applications
NASA Astrophysics Data System (ADS)
Venkatraman, B. Harihara
2011-12-01
Can organic semiconducting nanoparticles be used as building blocks for fabricating electronic devices? The first half of this dissertation focuses on addressing this question and the associated research challenges for attaining morphological control pertaining to organic photovoltaic devices by nanoparticle assembly. Conjugated polymer nanoparticles were synthesized using miniemulsion technique and their optical, charge transfer and charge transport properties were studied. Some degree of control in polymer chain packing within the nanoparticle was also demonstrated. The optical, charge transfer and charge transport properties of these nanoparticles were found to be similar to that of parent conjugated polymer irrespective of the surface charge. From the initial photovoltaic measurements, it is shown that these nanoparticles are potential candidates for fabricating future photovoltaic devices. The second half of this dissertation is focused on developing a novel and viable strategy for sensing aqueous based nitroaromatic compounds. Nitroaromatic compounds are commonly used as explosives and possess serious health hazards. Thiophene-based conjugated polymer nanoparticles were synthesized and were shown to effectively detect aqueous based nitroaromatic explosives.
Mei, Yaochuan; Diemer, Peter J.; Niazi, Muhammad R.; Hallani, Rawad K.; Jarolimek, Karol; Day, Cynthia S.; Risko, Chad; Anthony, John E.; Amassian, Aram
2017-01-01
The temperature dependence of the charge-carrier mobility provides essential insight into the charge transport mechanisms in organic semiconductors. Such knowledge imparts critical understanding of the electrical properties of these materials, leading to better design of high-performance materials for consumer applications. Here, we present experimental results that suggest that the inhomogeneous strain induced in organic semiconductor layers by the mismatch between the coefficients of thermal expansion (CTE) of the consecutive device layers of field-effect transistors generates trapping states that localize charge carriers. We observe a universal scaling between the activation energy of the transistors and the interfacial thermal expansion mismatch, in which band-like transport is observed for similar CTEs, and activated transport otherwise. Our results provide evidence that a high-quality semiconductor layer is necessary, but not sufficient, to obtain efficient charge-carrier transport in devices, and underline the importance of holistic device design to achieve the intrinsic performance limits of a given organic semiconductor. We go on to show that insertion of an ultrathin CTE buffer layer mitigates this problem and can help achieve band-like transport on a wide range of substrate platforms. PMID:28739934
Molecular Photovoltaics in Nanoscale Dimension
Burtman, Vladimir; Zelichonok, Alexander; Pakoulev, Andrei V.
2011-01-01
This review focuses on the intrinsic charge transport in organic photovoltaic (PVC) devices and field-effect transistors (SAM-OFETs) fabricated by vapor phase molecular self-assembly (VP-SAM) method. The dynamics of charge transport are determined and used to clarify a transport mechanism. The 1,4,5,8-naphthalene-tetracarboxylic diphenylimide (NTCDI) SAM devices provide a useful tool to study the fundamentals of polaronic transport at organic surfaces and to discuss the performance of organic photovoltaic devices in nanoscale. Time-resolved photovoltaic studies allow us to separate the charge annihilation kinetics in the conductive NTCDI channel from the overall charge kinetic in a SAM-OFET device. It has been demonstrated that tuning of the type of conductivity in NTCDI SAM-OFET devices is possible by changing Si substrate doping. Our study of the polaron charge transfer in organic materials proposes that a cation-radical exchange (redox) mechanism is the major transport mechanism in the studied SAM-PVC devices. The role and contribution of the transport through delocalized states of redox active surface molecular aggregates of NTCDI are exposed and investigated. This example of technological development is used to highlight the significance of future technological development of nanotechnologies and to appreciate a structure-property paradigm in organic nanostructures. PMID:21339983
Mei, Yaochuan; Diemer, Peter J; Niazi, Muhammad R; Hallani, Rawad K; Jarolimek, Karol; Day, Cynthia S; Risko, Chad; Anthony, John E; Amassian, Aram; Jurchescu, Oana D
2017-08-15
The temperature dependence of the charge-carrier mobility provides essential insight into the charge transport mechanisms in organic semiconductors. Such knowledge imparts critical understanding of the electrical properties of these materials, leading to better design of high-performance materials for consumer applications. Here, we present experimental results that suggest that the inhomogeneous strain induced in organic semiconductor layers by the mismatch between the coefficients of thermal expansion (CTE) of the consecutive device layers of field-effect transistors generates trapping states that localize charge carriers. We observe a universal scaling between the activation energy of the transistors and the interfacial thermal expansion mismatch, in which band-like transport is observed for similar CTEs, and activated transport otherwise. Our results provide evidence that a high-quality semiconductor layer is necessary, but not sufficient, to obtain efficient charge-carrier transport in devices, and underline the importance of holistic device design to achieve the intrinsic performance limits of a given organic semiconductor. We go on to show that insertion of an ultrathin CTE buffer layer mitigates this problem and can help achieve band-like transport on a wide range of substrate platforms.
Le, Thi Huong; Dao, Quang-Duy; Nghiêm, Mai-Phuong; Péralta, Sébastien; Guillot, Regis; Pham, Quoc Nghi; Fujii, Akihiko; Ozaki, Masanori; Goubard, Fabrice; Bui, Thanh-Tuân
2018-04-25
Two readily accessible thienothiophene-triphenylamine charge-transport materials have been synthesized by simply varying the substitution pattern of the triphenylamine groups on a central thienothiophene π-linker. The impact of the substitution pattern on the thermal, photoelectrochemical, and photovoltaic properties of these materials was evaluated and, based on theoretical and experimental studies, we found that the isomer in which the triphenylamine groups were located at the 2,5-positions of the thienothiophene core (TT-2,5-TPA) had better π-conjugation than the 3,6-isomer (TT-3,6-TPA). Whilst the thermal, morphological, and hydrophobic properties of the two materials were similar, their optoelectrochemical and photovoltaic properties were noticeably impacted. When applied as hole-transport materials in hybrid perovskite solar cells, the 2,5-isomer exhibited a power-conversion efficiency of 13.6 %, much higher than that of its 3,6-counterpart (0.7 %) under the same standard conditions. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Grain Boundary Effect on Charge Transport in Pentacene Thin Films
NASA Astrophysics Data System (ADS)
Weis, Martin; Gmucová, Katarína; Nádaždy, Vojtech; Majková, Eva; Haško, Daniel; Taguchi, Dai; Manaka, Takaaki; Iwamoto, Mitsumasa
2011-04-01
We report on charge transport properties of polycrystalline pentacene films with variable average grain size in the range from 0.1 to 0.3 µm controlled by the preparation technology. We illustrate with the organic field-effect transistors decrease of the effective mobility and presence of traps with decrease of the grain size. Analysis of the charge transfer excitons reveals decrease of the mobile charge density and the steady-state voltammetry showed significant increase of oxygen- and hydrogen-related defects. We also briefly discuss accumulation of the defects on the grain boundary and show relation between the defect density and grain boundary length.
NASA Astrophysics Data System (ADS)
Jen, Alex
2010-03-01
The performance of polymer solar cells are strongly dependent on the efficiency of light harvesting, exciton dissociation, charge transport, and charge collection at the metal/organic, metal/metal oxide, and organic/metal oxide interfaces. To improve the device performance, two parallel approaches were used: 1) developing novel low band gap conjugated polymers with good charge-transporting properties and 2) modifying the interfaces between the organic/metal oxide and organic/metal layers with functional self-assembling monolayers to tune their energy barriers. Moreover, the molecule engineering approach was also used to tune the energy level, charge mobility, and morphology of organic semiconductors.
Charge-transport anisotropy in black phosphorus: critical dependence on the number of layers.
Banerjee, Swastika; Pati, Swapan K
2016-06-28
Phosphorene is a promising candidate for modern electronics because of the anisotropy associated with high electron-hole mobility. Additionally, superior mechanical flexibility allows the strain-engineering of various properties including the transport of charge carriers in phosphorene. In this work, we have shown the criticality of the number of layers to dictate the transport properties of black phosphorus. Trilayer black phosphorus (TBP) has been proposed as an excellent anisotropic material, based on the transport parameters using Boltzmann transport formalisms coupled with density functional theory. The mobilities of both the electron and the hole are found to be higher along the zigzag direction (∼10(4) cm(2) V(-1) s(-1) at 300 K) compared to the armchair direction (∼10(2) cm(2) V(-1) s(-1)), resulting in the intrinsic directional anisotropy. Application of strain leads to additional electron-hole anisotropy with 10(3) fold higher mobility for the electron compared to the hole. Critical strain for maximum anisotropic response has also been determined. Whether the transport anisotropy is due to the spatial or charge-carrier has been determined through analyses of the scattering process of electrons and holes, and their recombination as well as relaxation dynamics. In this context, we have derived two descriptors (S and F(k)), which are general enough for any 2D or quasi-2D systems. Information on the scattering involving purely the carrier states also helps to understand the layer-dependent photoluminescence and electron (hole) relaxation in black phosphorus. Finally, we justify trilayer black phosphorus (TBP) as the material of interest with excellent transport properties.
Effects of pH on transport properties of articular cartilages.
Loret, Benjamin; Simões, Fernando M F
2010-02-01
Articular cartilages swell and shrink depending on the ionic strength of the electrolyte they are in contact with. This electro-chemo-mechanical coupling is due to the presence of fixed electrical charges on proteoglycans (PGs). In addition, at nonphysiological pH, collagen fibers become charged. Therefore, variation of the pH of the electrolyte has strong implications on the electrical charge of cartilages and, by the same token, on their transport and mechanical properties. Articular cartilages are viewed as three-phase multi-species porous media. The constitutive framework is phrased in the theory of thermodynamics of porous media. Acid-base reactions, as well as calcium binding, are embedded in this framework. Although macroscopic in nature, the model accounts for a number of biochemical details defining collagen and PGs. The change of the electrical charge is due to the binding of hydrogen ions on specific sites of PGs and collagen. Simulations are performed mimicking laboratory experiments where either the ionic strength or the pH of the bath, the cartilage piece is in contact with, is varied. They provide the evolutions of the chemical compositions of mobile ions, of the sites of acid-base reactions and calcium binding, and of the charges of collagen and glycosaminoglycans, at constant volume fraction of water. Emphasis is laid on the effects of pH, ionic strength and calcium binding on the transport properties of cartilages, and, in particular, on the electrical conductivity and electro-osmotic coefficient.
Intrinsic and extrinsic electrical and thermal transport of bulk black phosphorus
NASA Astrophysics Data System (ADS)
Hu, Sile; Xiang, Junsen; Lv, Meng; Zhang, Jiahao; Zhao, Hengcan; Li, Chunhong; Chen, Genfu; Wang, Wenhong; Sun, Peijie
2018-01-01
We report a comprehensive investigation of the electrical, thermal, and thermoelectric transport properties of bulk single-crystalline black phosphorus in wide temperature (2-300 K) and field (0-9 T) ranges. Electrical transport below T ≈ 250 K is found to be dominated by extrinsic hole-type charge carriers with large mobility exceeding 104 cm2/V s at low temperatures. While thermal transport measurements reveal an enhanced in-plane thermal conductivity maximum κ = 180 W/m K at T ≈ 25 K, it appears still to be largely constrained by extrinsic phonon scattering processes, e.g., the electron-phonon process, in addition to intrinsic umklapp scattering. The thermoelectric power and Nernst effect seem to be strongly influenced by ambipolar transport of charge carriers with opposite signs in at least the high-temperature region above 200 K, which diminishes the thermoelectric power factor of this material. Our results provide a timely update to the transport properties of bulk black phosphorus for future fundamental and applied research.
An alternative approach to charge transport in semiconducting electrodes
NASA Technical Reports Server (NTRS)
Thomchick, J.; Buoncristiani, A. M.
1980-01-01
The excess-carrier charge transport through the space-charge region of a semiconducting electrode is analyzed by a technique known as the flux method. In this approach reflection and transmission coefficients appropriate for a sheet of uniform semiconducting material describe its transport properties. A review is presented of the flux method showing that the results for a semiconductor electrode reduce in a limiting case to those previously found by Gaertner if the depletion layer is treated as a perfectly transmitting medium in which scattering and recombination are ignored. Then, in the framework of the flux method the depletion layer is considered more realistically by explicitly taking into account scattering and recombination processes which occur in this region.
Electronic structure and charge transport in nonstoichiometric tantalum oxide
NASA Astrophysics Data System (ADS)
Perevalov, T. V.; Gritsenko, V. A.; Gismatulin, A. A.; Voronkovskii, V. A.; Gerasimova, A. K.; Aliev, V. Sh; Prosvirin, I. A.
2018-06-01
The atomic and electronic structure of nonstoichiometric oxygen-deficient tantalum oxide TaO x<2.5 grown by ion beam sputtering deposition was studied. The TaO x film content was analyzed by x-ray photoelectron spectroscopy and by quantum-chemistry simulation. TaO x is composed of Ta2O5, metallic tantalum clusters and tantalum suboxides. A method for evaluating the stoichiometry parameter of TaO x from the comparison of experimental and theoretical photoelectron valence band spectra is proposed. The charge transport properties of TaO x were experimentally studied and the transport mechanism was quantitatively analyzed with four theoretical dielectric conductivity models. It was found that the charge transport in almost stoichiometric and nonstoichiometric tantalum oxide can be consistently described by the phonon-assisted tunneling between traps.
NASA Astrophysics Data System (ADS)
Ishii, Hiroyuki; Kobayashi, Nobuhiko; Hirose, Kenji
2017-01-01
We present a wave-packet dynamical approach to charge transport using maximally localized Wannier functions based on density functional theory including van der Waals interactions. We apply it to the transport properties of pentacene and rubrene single crystals and show the temperature-dependent natures from bandlike to thermally activated behaviors as a function of the magnitude of external static disorder. We compare the results with those obtained by the conventional band and hopping models and experiments.
NASA Astrophysics Data System (ADS)
Lee, Keanchuan; Weis, Martin; Taguchi, Dai; Manaka, Takaaki; Iwamoto, Mitsumasa
2013-08-01
We investigated the injection and transport properties of pentacene organic field-effect transistors (OFETs) with inclined and lamellar pentacene grains at various mutual ratios. Although the threshold voltage was conserved and no additional trapping on grain boundaries was suggested from the current-voltage measurements, the contact resistance and mobility increased linearly with the lamellar phase content. We showed that a model based on the coupling between both transport and injection properties via a space charge field caused by injected and trapped carriers accounts for these results.
Yun, Jae Hoon; Park, Sungmin; Heo, Jin Hyuck; Lee, Hyo-Sang; Yoon, Seongwon; Kang, Jinback; Im, Sang Hyuk; Kim, Hyunjung; Lee, Wonmok; Kim, BongSoo; Ko, Min Jae; Chung, Dae Sung; Son, Hae Jung
2016-11-01
We prepared a series of small molecules based on 7,7'-(4,4-bis(2-ethylhexyl)-4 H -silolo[3,2- b :4,5- b ']dithiophene-2,6-diyl)bis(4-(5'-hexyl-[2,2'-bithiophene]-5-yl)benzo[ c ][1,2,5]thiadiazole) with different fluorine substitution patterns ( 0F-4F ). Depending on symmetricity and numbers of fluorine atoms incorporated in the benzo[ c ][1,2,5]thiadiazole unit, they show very different optical and morphological properties in a film. 2F and 4F , which featured symmetric and even-numbered fluorine substitution patterns, display improved molecular packing structures and higher crystalline properties in a film compared with 1F and 3F and thus, 2F achieved the highest OTFT mobility, which is followed by 4F . In the bulk heterojunction solar cell fabricated with PC 71 BM, 2F achieves the highest photovoltaic performance with an 8.14% efficiency and 0F shows the lowest efficiency of 1.28%. Moreover, the planar-type perovskite solar cell (PSC) prepared with 2F as a dopant-free hole transport material shows a high power conversion efficiency of 14.5% due to its high charge transporting properties, which were significantly improved compared with the corresponding PSC device obtained from 0F (8.5%). From the studies, it is demonstrated that low variation in the local dipole moment and the narrow distribution of 2F conformers make intermolecular interactions favorable, which may effectively drive crystal formations in the solid state and thus, higher charge transport properties compared with 1F and 3F .
Electronic spin transport in gate-tunable black phosphorus spin valves
NASA Astrophysics Data System (ADS)
Liu, Jiawei; Avsar, Ahmet; Tan, Jun You; Oezyilmaz, Barbaros
High charge mobility, the electric field effect and small spin-orbit coupling make semiconducting black phosphorus (BP) a promising material for spintronics device applications requiring long spin distance spin communication with all rectification and amplification actions. Towards this, we study the all electrical spin injection, transport and detection under non-local spin valve geometry in fully encapsulated ultra-thin BP devices. We observe spin relaxation times as high as 4 ns, with spin relaxation lengths exceeding 6 μm. These values are an order of magnitude higher than what have been measured in typical graphene spin valve devices. Moreover, the spin transport depends strongly on charge carrier concentration and can be manipulated in a spin transistor-like manner by controlling electric field. This behaviour persists even at room temperature. Finally, we will show that similar to its electrical and optical properties, spin transport property is also strongly anisotropic.
A New Poisson-Nernst-Planck Model with Ion-Water Interactions for Charge Transport in Ion Channels.
Chen, Duan
2016-08-01
In this work, we propose a new Poisson-Nernst-Planck (PNP) model with ion-water interactions for biological charge transport in ion channels. Due to narrow geometries of these membrane proteins, ion-water interaction is critical for both dielectric property of water molecules in channel pore and transport dynamics of mobile ions. We model the ion-water interaction energy based on realistic experimental observations in an efficient mean-field approach. Variation of a total energy functional of the biological system yields a new PNP-type continuum model. Numerical simulations show that the proposed model with ion-water interaction energy has the new features that quantitatively describe dielectric properties of water molecules in narrow pores and are possible to model the selectivity of some ion channels.
NASA Astrophysics Data System (ADS)
Vinodha, M.; Senthilkumar, K.
2018-05-01
The structure-activity relationship of fused π-conjugated imidazolium cation with three counter anion molecules, BF4-, CF3SO3- and (CF3SO2)2N-, was studied using electronic structure calculations. The structural, opto-electronic and charge transport properties of these complexes were studied. The charge transfer from π-conjugated imidazolium(I) to counter anion was confirmed in all the studied complexes. Interaction energy varies significantly depending on the counter anion and the stability was found higher for I-BF4 complex than both I-CF3SO3 and I-(CF3SO2)2N complexes. The strong (C-H)+...F- hydrogen bond of length 1.95 Å between fused π-conjugated imidazolium and BF-4 anion is the driving force for the strongest interaction energy in I-BF4 complex. The energy decomposition analysis confirms that the interaction between imidazolium and counter anion is mainly driven by electrostatic and orbital interaction. It has been observed that the absorption spectra of the complex are independent of anion nature but the influence of anion character is observed on frontier molecular orbital pattern. The charge transport property of I-BF4 complex was studied by using tight-binding Hamiltonian approach and found that the hole mobility in I-BF4 is 1.13 × 10-4 cm2 V-1 s-1.
Characterization of pi-Conjugated Polymers for Transistor and Photovoltaic Applications
NASA Astrophysics Data System (ADS)
Paulsen, Bryan D.
pi-Conjugated polymers represent a unique class of optoelectronic materials. Being polymers, they are solution processable and inherently "soft" materials. This makes them attractive candidates for the production of roll-to-roll printed electronic devices on flexible substrates. The optical and electronic properties of pi-conjugated polymers are synthetically tunable allowing material sets to be tailored to specific applications. Two of the most heavily researched applications are the thin film transistor, the building block of electronic circuits, and the bulk heterojunction solar cell, which holds great potential as a renewable energy source. Key to developing commercially feasible pi-conjugated polymer devices is a thorough understanding of the electronic structure and charge transport behavior of these materials in relationship with polymer structure. Here this structure property relationship has been investigated through electrical and electrochemical means in concert with a variety of other characterization techniques and device test beds. The tunability of polymer optical band gap and frontier molecular orbital energy level was investigated in systems of vinyl incorporating statistical copolymers. Energy levels and band gaps are crucial parameters in developing efficient photovoltaic devices, with control of these parameters being highly desirable. Additionally, charge transport and density of electronic states were investigated in pi-conjugated polymers at extremely high electrochemically induced charge density. Finally, the effects of molecular weight on pi-conjugated polymer optical properties, energy levels, charge transport, morphology, and photovoltaic device performance was examined.
Ion transport in a pH-regulated nanopore.
Yeh, Li-Hsien; Zhang, Mingkan; Qian, Shizhi
2013-08-06
Fundamental understanding of ion transport phenomena in nanopores is crucial for designing the next-generation nanofluidic devices. Due to surface reactions of dissociable functional groups on the nanopore wall, the surface charge density highly depends upon the proton concentration on the nanopore wall, which in turn affects the electrokinetic transport of ions, fluid, and particles within the nanopore. Electrokinetic ion transport in a pH-regulated nanopore, taking into account both multiple ionic species and charge regulation on the nanopore wall, is theoretically investigated for the first time. The model is verified by the experimental data of nanopore conductance available in the literature. The results demonstrate that the spatial distribution of the surface charge density at the nanopore wall and the resulting ion transport phenomena, such as ion concentration polarization (ICP), ion selectivity, and conductance, are significantly affected by the background solution properties, such as the pH and salt concentration.
Investigating anomalous transport of electrolytes in charged porous media
NASA Astrophysics Data System (ADS)
Skjøde Bolet, Asger Johannes; Mathiesen, Joachim
2017-04-01
Surface charge is know to play an important role in microfluidics devices when dealing with electrolytes and their transport properties. Similarly, surface charge could play a role for transport in porous rock with submicron pore sizes. Estimates of the streaming potentials and electro osmotic are mostly considered in simple geometries both using analytic and numerical tools, however it is unclear at present how realistic complex geometries will modify the dynamics. Our work have focused on doing numerical studies of the full three-dimensional Stokes-Poisson-Nernst-Planck problem for electrolyte transport in porous rock. As the numerical implementation, we have used a finite element solver made using the FEniCS project code base, which can both solve for a steady state configuration and the full transient. In the presentation, we will show our results on anomalous transport due to electro kinetic effects such as the streaming potential or the electro osmotic effect.
Charge Transport and the Nature of Traps in Oxygen Deficient Tantalum Oxide.
Gritsenko, Vladimir A; Perevalov, Timofey V; Voronkovskii, Vitalii A; Gismatulin, Andrei A; Kruchinin, Vladimir N; Aliev, Vladimir Sh; Pustovarov, Vladimir A; Prosvirin, Igor P; Roizin, Yakov
2018-01-31
Optical and transport properties of nonstoichiometric tantalum oxide thin films grown by ion beam deposition were investigated in order to understand the dominant charge transport mechanisms and reveal the nature of traps. The TaO x films composition was analyzed by X-ray photoelectron spectroscopy and by quantum-chemistry simulation. From the optical absorption and photoluminescence measurements and density functional theory simulations, it was concluded that the 2.75 eV blue luminescence excited in a TaO x by 4.45 eV photons, originates from oxygen vacancies. These vacancies are also responsible for TaO x conductivity. The thermal trap energy of 0.85 eV determined from the transport experiments coincides with the half of the Stokes shift of the blue luminescence band. It is argued that the dominant charge transport mechanism in TaO x films is phonon-assisted tunneling between the traps.
Lan, Chunfeng; Luo, Jingting; Lan, Huabin; Fan, Bo; Peng, Huanxin; Zhao, Jun; Sun, Huibin; Zheng, Zhuanghao; Liang, Guangxing; Fan, Ping
2018-02-28
We provided a new method to improve the efficiency of Sb₂S₃ thin film solar cells. The TiO₂ electron transport layers were doped by lithium to improve their charge extraction properties for the thermal-evaporated Sb₂S₃ solar cells. The Mott-Schottky curves suggested a change of energy band and faster charge transport in the Li-doped TiO₂ films. Compared with the undoped TiO₂, Li-doped mesoporous TiO₂ dramatically improved the photo-voltaic performance of the thermal-evaporated Sb₂S₃ thin film solar cells, with the average power conversion efficiency ( PCE ) increasing from 1.79% to 4.03%, as well as the improved open-voltage ( V oc ), short-circuit current ( J sc ) and fill factors. The best device based on Li-doped TiO₂ achieved a power conversion efficiency up to 4.42% as well as a V oc of 0.645 V, which are the highest values among the reported thermal-evaporated Sb₂S₃ solar cells. This study showed that Li-doping on TiO₂ can effectively enhance the charge extraction properties of electron transport layers, offering a new strategy to improve the efficiency of Sb₂S₃-based solar cells.
Charge delocalization characteristics of regioregular high mobility polymers
Coughlin, J. E.; Zhugayevych, A.; Wang, M.; ...
2017-01-01
Controlling the regioregularity among the structural units of narrow bandgap conjugated polymer backbones has led to improvements in optoelectronic properties, for example in the mobilities observed in field effect transistor devices. To investigate how the regioregularity affects quantities relevant to hole transport, regioregular and regiorandom oligomers representative of polymeric structures were studied using density functional theory. Several structural and electronic characteristics of the oligomers were compared, including chain planarity, cation spin density, excess charges on molecular units and internal reorganizational energy. The main difference between the regioregular and regiorandom oligomers is found to be the conjugated backbone planarity, while themore » reorganizational energies calculated are quite similar across the molecular family. Lastly, this work constitutes the first step on understanding the complex interplay of atomistic changes and an oligomer backbone structure toward modeling the charge transport properties.« less
Quantum dots in single electron transistors with ultrathin silicon-on-insulator structures
NASA Astrophysics Data System (ADS)
Ihara, S.; Andreev, A.; Williams, D. A.; Kodera, T.; Oda, S.
2015-07-01
We report on fabrication and transport properties of lithographically defined single quantum dots (QDs) in single electron transistors with ultrathin silicon-on-insulator (SOI) substrate. We observed comparatively large charging energy E C ˜ 20 meV derived from the stability diagram at a temperature of 4.2 K. We also carried out three-dimensional calculations of the capacitance matrix and transport properties through the QD for the real structure geometry and found an excellent quantitative agreement with experiment of the calculated main parameters of stability diagram (charging energy, period of Coulomb oscillations, and asymmetry of the diamonds). The obtained results confirm fabrication of well-defined integrated QDs as designed with ultrathin SOI that makes it possible to achieve relatively large QD charging energies, which is useful for stable and high temperature operation of single electron devices.
Dielectric Characterization of a Nonlinear Optical Material
Lunkenheimer, P.; Krohns, S.; Gemander, F.; Schmahl, W. W.; Loidl, A.
2014-01-01
Batisite was reported to be a nonlinear optical material showing second harmonic generation. Using dielectric spectroscopy and polarization measurements, we provide a thorough investigation of the dielectric and charge-transport properties of this material. Batisite shows the typical characteristics of a linear lossy dielectric. No evidence for ferro- or antiferroelectric polarization is found. As the second-harmonic generation observed in batisite points to a non-centrosymmetric structure, this material is piezoelectric, but most likely not ferroelectric. In addition, we found evidence for hopping charge transport of localized charge carriers and a relaxational process at low temperatures. PMID:25109553
Nag, Angshuman; Chung, Dae Sung; Dolzhnikov, Dmitriy S; Dimitrijevic, Nada M; Chattopadhyay, Soma; Shibata, Tomohiro; Talapin, Dmitri V
2012-08-22
Colloidal semiconductor nanocrystals (NCs) provide convenient "building blocks" for solution-processed solar cells, light-emitting devices, photocatalytic systems, etc. The use of inorganic ligands for colloidal NCs dramatically improved inter-NC charge transport, enabling fast progress in NC-based devices. Typical inorganic ligands (e.g., Sn(2)S(6)(4-), S(2-)) are represented by negatively charged ions that bind covalently to electrophilic metal surface sites. The binding of inorganic charged species to the NC surface provides electrostatic stabilization of NC colloids in polar solvents without introducing insulating barriers between NCs. In this work we show that cationic species needed for electrostatic balance of NC surface charges can also be employed for engineering almost every property of all-inorganic NCs and NC solids, including photoluminescence efficiency, electron mobility, doping, magnetic susceptibility, and electrocatalytic performance. We used a suite of experimental techniques to elucidate the impact of various metal ions on the characteristics of all-inorganic NCs and developed strategies for engineering and optimizing NC-based materials.
Guo, Changhe; Lee, Youngmin; Lin, Yen -Hao; ...
2016-06-15
The electronic properties of organic semiconductors are strongly influenced by intermolecular packing. When cast as thin films, crystalline π-conjugated molecules are strongly textured, potentially leading to anisotropic charge transport. Consequently, it is hypothesized that the orientation of crystallites in the active layer plays an important role in charge extraction and organic photovoltaic device performance. Here we demonstrate orientation control of molecular packing from mostly face-on to edge-on configurations in the active layer of P3HT- b-PFTBT block copolymer photovoltaics using 1-chloronaphthalene as a solvent additive. The effect of molecular orientations in P3HT crystals on charge transport and solar cell performance ismore » examined. We find that optimized photovoltaic device performance is independent of the crystalline texture of P3HT. Our observations provide further insights into the molecular organization required for efficient charge transport and overall device efficiencies. That is, the dominant crystal orientation, whether face-on or edge-on, is not critical to organic solar cells. Furthermore, a broad distribution of crystallite orientations ensures pathways for charge transport in any direction and enables efficient charge extraction in photovoltaic devices.« less
Electrolyte transport in neutral polymer gels embedded with charged inclusions
NASA Astrophysics Data System (ADS)
Hill, Reghan
2005-11-01
Ion permeable membranes are the basis of a variety of molecular separation technologies, including ion exchange, gel electrophoresis and dialysis. This work presents a theoretical model of electrolyte transport in membranes comprised of a continuous polymer gel embedded with charged spherical inclusions, e.g., biological cells and synthetic colloids. The microstructure mimics immobilized cell cultures, where electric fields have been used to promote nutrient transport. Because several important characteristics can, in principle, be carefully controlled, the theory provides a quantitative framework to help tailor the bulk properties for enhanced molecular transport, microfluidic pumping, and physicochemical sensing applications. This talk focuses on the electroosmotic flow driven by weak electric fields and electrolyte concentration gradients. Also of importance is the influence of charge on the effective ion diffusion coefficients, bulk electrical conductivity, and membrane diffusion potential.
Oxide semiconductors for organic opto-electronic devices
NASA Astrophysics Data System (ADS)
Sigdel, Ajaya K.
In this dissertation, I have introduced various concepts on the modulations of various surface, interface and bulk opto-electronic properties of ZnO based semiconductor for charge transport, charge selectivity and optimal device performance. I have categorized transparent semiconductors into two sub groups depending upon their role in a device. Electrodes, usually 200 to 500 nm thick, optimized for good transparency and transporting the charges to the external circuit. Here, the electrical conductivity in parallel direction to thin film, i.e bulk conductivity is important. And contacts, usually 5 to 50 nm thick, are optimized in case of solar cells for providing charge selectivity and asymmetry to manipulate the built in field inside the device for charge separation and collection. Whereas in Organic LEDs (OLEDs), contacts provide optimum energy level alignment at organic oxide interface for improved charge injections. For an optimal solar cell performance, transparent electrodes are designed with maximum transparency in the region of interest to maximize the light to pass through to the absorber layer for photo-generation, plus they are designed for minimum sheet resistance for efficient charge collection and transport. As such there is need for material with high conductivity and transparency. Doping ZnO with some common elements such as B, Al, Ga, In, Ge, Si, and F result in n-type doping with increase in carriers resulting in high conductivity electrode, with better or comparable opto-electronic properties compared to current industry-standard indium tin oxide (ITO). Furthermore, improvement in mobility due to improvement on crystallographic structure also provide alternative path for high conductivity ZnO TCOs. Implementing these two aspects, various studies were done on gallium doped zinc oxide (GZO) transparent electrode, a very promising indium free electrode. The dynamics of the superimposed RF and DC power sputtering was utilized to improve the microstructure during the thin films growth, resulting in GZO electrode with conductivity greater than 4000 S/cm and transparency greater than ˜ 90%. Similarly, various studies on research and development of Indium Zinc Tin Oxide and Indium Zinc Oxide thin films which can be applied to flexible substrates for next generation solar cells application is presented. In these new TCO systems, understanding the role of crystallographic structure ranging from poly-crystalline to amorphous phase and the influence on the charge transport and optical transparency as well as important surface passivation and surface charge transport properties. Implementation of these electrode based on ZnO on opto-electronics devices such as OLED and OPV is complicated due to chemical interaction over time with the organic layer or with ambient. The problem of inefficient charge collection/injection due to poor understanding of interface and/or bulk property of oxide electrode exists at several oxide-organic interfaces. The surface conductivity, the work function, the formation of dipoles and the band-bending at the interfacial sites can positively or negatively impact the device performance. Detailed characterization of the surface composition both before and after various chemicals treatment of various oxide electrode can therefore provide insight into optimization of device performance. Some of the work related to controlling the interfacial chemistry associated with charge transport of transparent electrodes are discussed. Thus, the role of various pre-treatment on poly-crystalline GZO electrode and amorphous indium zinc oxide (IZO) electrode is compared and contrasted. From the study, we have found that removal of defects and self passivating defects caused by accumulation of hydroxides in the surface of both poly-crystalline GZO and amorphous IZO, are critical for improving the surface conductivity and charge transport. Further insight on how these insulating and self-passivating defects cause charge accumulation and recombination in an device is discussed. (Abstract shortened by UMI.)
Amin, Ruhul; Chiang, Yet -Ming
2016-05-13
Despite the extensive commercial use of Li 1-xNi 1-y-zMn zCo yO 2 (NMC) as the positive electrode in Li-ion batteries, and its long research history, its fundamental transport properties are poorly understood. These properties are crucial for designing high energy density and high power Li-ion batteries. Here, the transport properties of NMC 333 and NMC 523 are investigated using impedance spectroscopy and DC polarization and depolarization techniques. The electronic conductivity is found to increase with decreasing Li-content (increasing state-of-charge) from ~10 –7 Scm –1 to ~10 –2 Scm –1 over Li concentrations x = 0.00 to 0.75, corresponding to anmore » upper charge voltage of 4.8 V with respect to Li/Li +. The lithium ion diffusivity is at least one order of magnitude lower, and decreases with increasing x to at x = ~0.5. As a result, the ionic conductivity and diffusivity obtained from the two measurements techniques (EIS and DC) are in good agreement, and chemical diffusion is limited by lithium transport over a wide state-of-charge range.« less
Electromechanical Properties and Spontaneous Response of the Current in InAsP Nanowires.
Lee, Jong Hoon; Pin, Min Wook; Choi, Su Ji; Jo, Min Hyeok; Shin, Jae Cheol; Hong, Seong-Gu; Lee, Seung Mi; Cho, Boklae; Ahn, Sang Jung; Song, Nam Woong; Yi, Seong-Hoon; Kim, Young Heon
2016-11-09
The electromechanical properties of ternary InAsP nanowires (NWs) were investigated by applying a uniaxial tensile strain in a transmission electron microscope (TEM). The electromechanical properties in our examined InAsP NWs were governed by the piezoresistive effect. We found that the electronic transport of the InAsP NWs is dominated by space-charge-limited transport, with a I ∞ V 2 relation. Upon increasing the tensile strain, the electrical current in the NWs increases linearly, and the piezoresistance gradually decreases nonlinearly. By analyzing the space-charge-limited I-V curves, we show that the electromechanical response is due to a mobility that increases with strain. Finally, we use dynamical measurements to establish an upper limit on the time scale for the electromechanical response.
A multichannel model for the self-consistent analysis of coherent transport in graphene nanoribbons.
Mencarelli, Davide; Pierantoni, Luca; Farina, Marco; Di Donato, Andrea; Rozzi, Tullio
2011-08-23
In this contribution, we analyze the multichannel coherent transport in graphene nanoribbons (GNRs) by a scattering matrix approach. We consider the transport properties of GNR devices of a very general form, involving multiple bands and multiple leads. The 2D quantum transport over the whole GNR surface, described by the Schrödinger equation, is strongly nonlinear as it implies calculation of self-generated and externally applied electrostatic potentials, solutions of the 3D Poisson equation. The surface charge density is computed as a balance of carriers traveling through the channel at all of the allowed energies. Moreover, formation of bound charges corresponding to a discrete modal spectrum is observed and included in the model. We provide simulation examples by considering GNR configurations typical for transistor devices and GNR protrusions that find an interesting application as cold cathodes for X-ray generation. With reference to the latter case, a unified model is required in order to couple charge transport and charge emission. However, to a first approximation, these could be considered as independent problems, as in the example. © 2011 American Chemical Society
Spiro-OMeTAD single crystals: Remarkably enhanced charge-carrier transport via mesoscale ordering
Shi, Dong; Qin, Xiang; Li, Yuan; He, Yao; Zhong, Cheng; Pan, Jun; Dong, Huanli; Xu, Wei; Li, Tao; Hu, Wenping; Brédas, Jean-Luc; Bakr, Osman M.
2016-01-01
We report the crystal structure and hole-transport mechanism in spiro-OMeTAD [2,2′,7,7′-tetrakis(N,N-di-p-methoxyphenyl-amine)9,9′-spirobifluorene], the dominant hole-transporting material in perovskite and solid-state dye-sensitized solar cells. Despite spiro-OMeTAD’s paramount role in such devices, its crystal structure was unknown because of highly disordered solution-processed films; the hole-transport pathways remained ill-defined and the charge carrier mobilities were low, posing a major bottleneck for advancing cell efficiencies. We devised an antisolvent crystallization strategy to grow single crystals of spiro-OMeTAD, which allowed us to experimentally elucidate its molecular packing and transport properties. Electronic structure calculations enabled us to map spiro-OMeTAD’s intermolecular charge-hopping pathways. Promisingly, single-crystal mobilities were found to exceed their thin-film counterparts by three orders of magnitude. Our findings underscore mesoscale ordering as a key strategy to achieving breakthroughs in hole-transport material engineering of solar cells. PMID:27152342
NASA Astrophysics Data System (ADS)
Chen, Zhuoying; Bird, Matthew; Lemaur, Vincent; Radtke, Guillaume; Cornil, Jérôme; Heeney, Martin; McCulloch, Iain; Sirringhaus, Henning
2011-09-01
Understanding the mechanisms limiting ambipolar transport in conjugated polymer field-effect transistors (FETs) is of both fundamental and practical interest. Here, we present a systematic study comparing hole and electron charge transport in an ambipolar conjugated polymer, semicrystalline poly(3,3''-di-n-decylterselenophene) (PSSS). Starting from a detailed analysis of the device characteristics and temperature/charge-density dependence of the mobility, we interpret the difference between hole and electron transport through both the Vissenberg-Matters and the mobility-edge model. To obtain microscopic insight into the quantum mechanical wave function of the charges at a molecular level, we combine charge modulation spectroscopy (CMS) measuring the charge-induced absorption signatures from positive and negative polarons in these ambipolar FETs with corresponding density functional theory (DFT) calculations. We observe a significantly higher switch-on voltage for electrons than for holes due to deep electron trap states, but also a higher activation energy of the mobility for mobile electrons. The CMS spectra reveal that the electrons that remain mobile and contribute to the FET current have a wave function that is more localized onto a single polymer chain than that of holes, which is extended over several polymer chains. We interpret this as evidence that the transport properties of the mobile electrons in PSSS are still affected by the presence of deep electron traps. The more localized electron state could be due to the mobile electrons interacting with shallow trap states in the vicinity of a chemical, potentially water-related, impurity that might precede the capture of the electron into a deeply trapped state.
Schmaltz, Thomas; Gothe, Bastian; Krause, Andreas; Leitherer, Susanne; Steinrück, Hans-Georg; Thoss, Michael; Clark, Timothy; Halik, Marcus
2017-09-26
Self-assembled monolayer field-effect transistors (SAMFETs) are not only a promising type of organic electronic device but also allow detailed analyses of structure-property correlations. The influence of the morphology on the charge transport is particularly pronounced, due to the confined monolayer of 2D-π-stacked organic semiconductor molecules. The morphology, in turn, is governed by relatively weak van-der-Waals interactions and is thus prone to dynamic structural fluctuations. Accordingly, combining electronic and physical characterization and time-averaged X-ray analyses with the dynamic information available at atomic resolution from simulations allows us to characterize self-assembled monolayer (SAM) based devices in great detail. For this purpose, we have constructed transistors based on SAMs of two molecules that consist of the organic p-type semiconductor benzothieno[3,2-b][1]benzothiophene (BTBT), linked to a C 11 or C 12 alkylphosphonic acid. Both molecules form ordered SAMs; however, our experiments show that the size of the crystalline domains and the charge-transport properties vary considerably in the two systems. These findings were confirmed by molecular dynamics (MD) simulations and semiempirical molecular-orbital electronic-structure calculations, performed on snapshots from the MD simulations at different times, revealing, in atomistic detail, how the charge transport in organic semiconductors is influenced and limited by dynamic disorder.
Nanoscale measurement of Nernst effect in two-dimensional charge density wave material 1T-TaS 2
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wu, Stephen M.; Luican-Mayer, Adina; Bhattacharya, Anand
Advances in nanoscale material characterization on two-dimensional van der Waals layered materials primarily involve their optical and electronic properties. The thermal properties of these materials are harder to access due to the difficulty of thermal measurements at the nanoscale. In this work, we create a nanoscale magnetothermal device platform to access the basic out-of-plane magnetothermal transport properties of ultrathin van der Waals materials. Specifically, the Nernst effect in the charge density wave transition metal dichalcogenide 1T-TaS 2 is examined on nano-thin flakes in a patterned device structure. It is revealed that near the commensurate charge density wave (CCDW) to nearlymore » commensurate charge density wave (NCCDW) phase transition, the polarity of the Nernst effect changes. Since the Nernst effect is especially sensitive to changes in the Fermi surface, this suggests that large changes are occurring in the out-of-plane electronic structure of 1T-TaS 2, which are otherwise unresolved in just in-plane electronic transport measurements. This may signal a coherent evolution of out-of-plane stacking in the CCDW! NCCDW transition.« less
Organic Donor-Acceptor Complexes as Novel Organic Semiconductors.
Zhang, Jing; Xu, Wei; Sheng, Peng; Zhao, Guangyao; Zhu, Daoben
2017-07-18
Organic donor-acceptor (DA) complexes have attracted wide attention in recent decades, resulting in the rapid development of organic binary system electronics. The design and synthesis of organic DA complexes with a variety of component structures have mainly focused on metallicity (or even superconductivity), emission, or ferroelectricity studies. Further efforts have been made in high-performance electronic investigations. The chemical versatility of organic semiconductors provides DA complexes with a great number of possibilities for semiconducting applications. Organic DA complexes extend the semiconductor family and promote charge separation and transport in organic field-effect transistors (OFETs) and organic photovoltaics (OPVs). In OFETs, the organic complex serves as an active layer across extraordinary charge pathways, ensuring the efficient transport of induced charges. Although an increasing number of organic semiconductors have been reported to exhibit good p- or n-type properties (mobilities higher than 1 or even 10 cm 2 V -1 s -1 ), critical scientific challenges remain in utilizing the advantages of existing semiconductor materials for more and wider applications while maintaining less complicated synthetic or device fabrication processes. DA complex materials have revealed new insight: their unique molecular packing and structure-property relationships. The combination of donors and acceptors could offer practical advantages compared with their unimolecular materials. First, growing crystals of DA complexes with densely packed structures will reduce impurities and traps from the self-assembly process. Second, complexes based on the original structural components could form superior mixture stacking, which can facilitate charge transport depending on the driving force in the coassembly process. Third, the effective use of organic semiconductors can lead to tunable band structures, allowing the operation mode (p- or n-type) of the transistor to be systematically controlled by changing the components. Finally, theoretical calculations based on cocrystals with unique stacking could widen our understanding of structure-property relationships and in turn help us design high-performance semiconductors based on DA complexes. In this Account, we focus on discussing organic DA complexes as a new class of semiconducting materials, including their design, growth methods, packing modes, charge-transport properties, and structure-property relationships. We have also fabricated and investigated devices based on these binary crystals. This interdisciplinary work combines techniques from the fields of self-assembly, crystallography, condensed-matter physics, and theoretical chemistry. Researchers have designed new complex systems, including donor and acceptor compounds that self-assemble in feasible ways into highly ordered cocrystals. We demonstrate that using this crystallization method can easily realize ambipolar or unipolar transport. To further improve device performance, we propose several design strategies, such as using new kinds of donors and acceptors, modulating the energy alignment of the donor (ionization potential, IP) and acceptor (electron affinity, EA) components, and extending the π-conjugated backbones. In addition, we have found that when we use molecular "doping" (2:1 cocrystallization), the charge-transport nature of organic semiconductors can be switched from hole-transport-dominated to electron-transport-dominated. We expect that the formation of cocrystals through the complexation of organic donor and acceptor species will serve as a new strategy to develop semiconductors for organic electronics with superior performances over their corresponding individual components.
Spectroscopy of Charge Carriers and Traps in Field-Doped Single Crystal Organic Semiconductors
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhu, Xiaoyang
2014-12-10
The proposed research aims to achieve quantitative, molecular level understanding of charge carriers and traps in field-doped crystalline organic semiconductors via in situ linear and nonlinear optical spectroscopy, in conjunction with transport measurements and molecular/crystal engineering. Organic semiconductors are emerging as viable materials for low-cost electronics and optoelectronics, such as organic photovoltaics (OPV), organic field effect transistors (OFETs), and organic light emitting diodes (OLEDs). Despite extensive studies spanning many decades, a clear understanding of the nature of charge carriers in organic semiconductors is still lacking. It is generally appreciated that polaron formation and charge carrier trapping are two hallmarks associatedmore » with electrical transport in organic semiconductors; the former results from the low dielectric constants and weak intermolecular electronic overlap while the latter can be attributed to the prevalence of structural disorder. These properties have lead to the common observation of low charge carrier mobilities, e.g., in the range of 10-5 - 10-3 cm2/Vs, particularly at low carrier concentrations. However, there is also growing evidence that charge carrier mobility approaching those of inorganic semiconductors and metals can exist in some crystalline organic semiconductors, such as pentacene, tetracene and rubrene. A particularly striking example is single crystal rubrene (Figure 1), in which hole mobilities well above 10 cm2/Vs have been observed in OFETs operating at room temperature. Temperature dependent transport and spectroscopic measurements both revealed evidence of free carriers in rubrene. Outstanding questions are: what are the structural features and physical properties that make rubrene so unique? How do we establish fundamental design principles for the development of other organic semiconductors of high mobility? These questions are critically important but not comprehensive, as the nature of charge carriers is known to evolve as the carrier concentration increases, due to the presence of intrinsic disorder in organic semiconductors. Thus, a complementary question is: how does the nature of charge transport change as a function of carrier concentration?« less
NASA Astrophysics Data System (ADS)
Shi, Yarui; Wei, Huiling; Liu, Yufang
2015-03-01
Tetraazaperopyrenes (TAPPs) derivatives are high-performance n-type organic semiconductor material families with the remarkable long-term stabilities. The charge carrier mobilities in TAPPs derivatives crystals were calculated by the density functional theory (DFT) method combined with the Marcus-Hush electron-transfer theory. The existence of considerable C-H…F-C bonding defines the conformation of the molecular structure and contributes to its stability. We illustrated how it is possible to control the electronic and charge-transport parameters of TAPPs derivatives as a function of the positions, a type of the substituents. It is found that the core substitution of TAPPs has a drastic influence on the charge-transport mobilities. The maximum electron mobility value of the core-brominated 2,9-bis (perfluoroalkyl)-substituted TAPPs is 0.521 cm2 V-1 s-1, which appear in the orientation angle 95° and 275°. The results demonstrate that the TAPPs with bromine substituents in ortho positions exhibit the best charge-transfer efficiency among the four different TAPP derivatives.
Dominant source of disorder in graphene: charged impurities or ripples?
NASA Astrophysics Data System (ADS)
Fan, Zheyong; Uppstu, Andreas; Harju, Ari
2017-06-01
Experimentally produced graphene sheets exhibit a wide range of mobility values. Both extrinsic charged impurities and intrinsic ripples (corrugations) have been suggested to induce long-range disorder in graphene and could be a candidate for the dominant source of disorder. Here, using large-scale molecular dynamics and quantum transport simulations, we find that the hopping disorder and the gauge and scalar potentials induced by the ripples are short-ranged, in strong contrast with predictions by continuous models, and the transport fingerprints of the ripple disorder are very different from those of charged impurities. We conclude that charged impurities are the dominant source of disorder in most graphene samples, whereas scattering by ripples is mainly relevant in the high carrier density limit of ultraclean graphene samples (with a charged impurity concentration less than about 10 ppm) at room and higher temperatures. Our finding is valuable to theoretical modelling of transport properties of not only graphene, but also other two-dimensional materials, as the thermal ripples are universal.
The surface properties of microorganisms play an important role in attachment and detachment in the environment. The change in surface charge can effect coagulation, disinfection, adhesion to surfaces, uptake of chemicals, and environmental transport. In aqueous solution, cell s...
NASA Astrophysics Data System (ADS)
Han, Deming; Gong, Ping; Lv, Shuhui; Zhao, Lihui; Zhao, Henan
2018-05-01
The photophysical properties of four Ir(III) complexes have been investigated by means of the density functional theory/time-dependent density functional theory (DFT/TDDFT). The effect of the electron-withdrawing and electron-donating substituents on charge injection, transport, absorption and phosphorescent properties has been studied. The theoretical calculation shows that the lowest-lying singlet absorptions for complexes 1-4 are located at 387, 385, 418 and 386 nm, respectively. For 1-4, the phosphorescence at 465, 485, 494 and 478 nm is mainly attributed to the LUMO → HOMO and LUMO → HOMO-1 transition configurations characteristics. In addition, ionisation potential (IP), electron affinities (EAs) and reorganisation energy have been investigated to evaluate the charge transfer and balance properties between hole and electron. The balance of the reorganisation energies for complex 3 is better than others. The difference between hole transport and electron transport for complex 3 is the smallest among these complexes, which is beneficial to achieve the hole and electron transfer balance in emitting layer.
Gu, Da Hwi; Jo, Seungki; Jeong, Hyewon; Ban, Hyeong Woo; Park, Sung Hoon; Heo, Seung Hwae; Kim, Fredrick; Jang, Jeong In; Lee, Ji Eun; Son, Jae Sung
2017-06-07
Electronically doped nanoparticles formed by incorporation of impurities have been of great interest because of their controllable electrical properties. However, the development of a strategy for n-type or p-type doping on sub-10 nm-sized nanoparticles under the quantum confinement regime is very challenging using conventional processes, owing to the difficulty in synthesis. Herein, we report the colloidal chemical synthesis of sub-10 nm-sized tellurium (Te)-doped Bismuth (Bi) nanoparticles with precisely controlled Te content from 0 to 5% and systematically investigate their low-temperature charge transport and thermoelectric properties. Microstructural characterization of nanoparticles demonstrates that Te ions are successfully incorporated into Bi nanoparticles rather than remaining on the nanoparticle surfaces. Low-temperature Hall measurement results of the hot-pressed Te-doped Bi-nanostructured materials, with grain sizes ranging from 30 to 60 nm, show that the charge transport properties are governed by the doping content and the related impurity and nanoscale grain boundary scatterings. Furthermore, the low-temperature thermoelectric properties reveal that the electrical conductivity and Seebeck coefficient expectedly change with the Te content, whereas the thermal conductivity is significantly reduced by Te doping because of phonon scattering at the sites arising from impurities and nanoscale grain boundaries. Accordingly, the 1% Te-doped Bi sample exhibits a higher figure-of-merit ZT by ∼10% than that of the undoped sample. The synthetic strategy demonstrated in this study offers the possibility of electronic doping of various quantum-confined nanoparticles for diverse applications.
Zheng, Yu-Qing; Yao, Ze-Fan; Lei, Ting; Dou, Jin-Hu; Yang, Chi-Yuan; Zou, Lin; Meng, Xiangyi; Ma, Wei; Wang, Jie-Yu; Pei, Jian
2017-11-01
Polymer self-assembly in solution prior to film fabrication makes solution-state structures critical for their solid-state packing and optoelectronic properties. However, unraveling the solution-state supramolecular structures is challenging, not to mention establishing a clear relationship between the solution-state structure and the charge-transport properties in field-effect transistors. Here, for the first time, it is revealed that the thin-film morphology of a conjugated polymer inherits the features of its solution-state supramolecular structures. A "solution-state supramolecular structure control" strategy is proposed to increase the electron mobility of a benzodifurandione-based oligo(p-phenylene vinylene) (BDOPV)-based polymer. It is shown that the solution-state structures of the BDOPV-based conjugated polymer can be tuned such that it forms a 1D rod-like structure in good solvent and a 2D lamellar structure in poor solvent. By tuning the solution-state structure, films with high crystallinity and good interdomain connectivity are obtained. The electron mobility significantly increases from the original value of 1.8 to 3.2 cm 2 V -1 s -1 . This work demonstrates that "solution-state supramolecular structure" control is critical for understanding and optimization of the thin-film morphology and charge-transport properties of conjugated polymers. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
NASA Astrophysics Data System (ADS)
Tse, S. C.; So, S. K.; Yeung, M. Y.; Lo, C. F.; Wen, S. W.; Chen, C. H.
2006-01-01
The charge transport properties of three tertiary-butyl (t-Bu) substituted anthracene derivatives (ADN), critical blue host materials for organic light-emitting diodes (OLEDs), have been investigated experimentally and computationally. From time-of-flight (TOF) measurements, all ADN compounds exhibit ambipolar characters. The hole and electron mobilities are in the range (1--5)× 10-7 cm2 V-1 s-1 under an external applied field of about 1 MV cm-1. Un-substituted ADN has the highest carrier mobilities while heavily t-Bu substituted ADN has the least. The electron and hole conducting properties of are consistent with ab initio calculation, which indicates that the frontier orbitals are localized mainly on the anthracene moiety. t-Bu substitutions in ADN increase the hopping path lengths among the molecules and hence reduce the electron and hole mobilities. The results demonstrate that t-Bu substitution is an effective means of engineering the conductivity of organic charge transporter for OLED applications.
Pelzer, Kenley M.; Vázquez-Mayagoitia, Álvaro; Ratcliff, Laura E.; ...
2017-01-01
Organic photovoltaics (OPVs) are a promising carbon-neutral energy conversion technology, with recent improvements pushing power conversion efficiencies over 10%. A major factor limiting OPV performance is inefficiency of charge transport in organic semiconducting materials (OSCs). Due to strong coupling with lattice degrees of freedom, the charges form polarons, localized quasi-particles comprised of charges dressed with phonons. These polarons can be conceptualized as pseudo-atoms with a greater effective mass than a bare charge. Here we propose that due to this increased mass, polarons can be modeled with Langevin molecular dynamics (LMD), a classical approach with a computational cost much lower thanmore » most quantum mechanical methods. Here we present LMD simulations of charge transfer between a pair of fullerene molecules, which commonly serve as electron acceptors in OSCs. We find transfer rates consistent with experimental measurements of charge mobility, suggesting that this method may provide quantitative predictions of efficiency when used to simulate materials on the device scale. Our approach also offers information that is not captured in the overall transfer rate or mobility: in the simulation data, we observe exactly when and why intermolecular transfer events occur. In addition, we demonstrate that these simulations can shed light on the properties of polarons in OSCs. In conclusion, much remains to be learned about these quasi-particles, and there are no widely accepted methods for calculating properties such as effective mass and friction. Lastly, our model offers a promising approach to exploring mass and friction as well as providing insight into the details of polaron transport in OSCs.« less
NASA Astrophysics Data System (ADS)
Sinurat, E. N.; Yudiarsah, E.
2017-07-01
The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.
NASA Astrophysics Data System (ADS)
Li, Jinfeng; Zhang, Xinyuan; Liu, Chunyu; Li, Zhiqi; He, Yeyuan; Zhang, Zhihui; Shen, Liang; Guo, Wenbin; Ruan, Shengping
2017-07-01
In this work, poly(9,9-dioctylfluorene)-co-(4,7-di-2-thienyl-2,1,3-benzothiadiazole) (PF-5DTBT) and copolymer poly(styrene-co-maleic anhydride) (PSMA) dots were prepared as additive for active layer doping to enhance the power conversion efficiency (PCE) of organic solar cells (OSCs), which based on poly[N-9″-hepta-decanyl-2,7-carbazole-alt-5,5-(4‧,7‧-di-2-thienyl-2‧,1‧,3‧-benzothiadiazole) (PCDTBT) and [6,6]-phenyl C71 butyric acid methyl-ester (PC71BM). A high efficiency of 7.40% was achieved due to increase of short-circuit current (Jsc) and fill factor (FF). The operation mechanism of OSCs doping with polymer dots was investigated, which demonstrated that the efficiency enhancement ascribes to improvement of electrical properties, such as exciton generation, exction dissociation, charge transport, and charge collection.
Charge Transport in Hybrid Halide Perovskite Field-Effect Transistors
NASA Astrophysics Data System (ADS)
Jurchescu, Oana
Hybrid organic-inorganic trihalide perovskite (HTP) materials exhibit a strong optical absorption, tunable band gap, long carrier lifetimes and fast charge carrier transport. These remarkable properties, coupled with their reduced complexity processing, make the HTPs promising contenders for large scale, low-cost thin film optoelectronic applications. But in spite of the remarkable demonstrations of high performance solar cells, light-emitting diodes and field-effect transistor devices, all of which took place in a very short time period, numerous questions related to the nature and dynamics of the charge carriers and their relation to device performance, stability and reliability still remain. This presentation describes the electrical properties of HTPs evaluated from field-effect transistor measurements. The electrostatic gating of provides an unique platform for the study of intrinsic charge transport in these materials, and, at the same time, expand the use of HTPs towards switching electronic devices, which have not been explored previously. We fabricated FETs on SiO2 and polymer dielectrics from spin coating, thermal evaporation and spray deposition and compare their properties. CH3NH3PbI3-xClx can reach balanced electron and hole mobilities of 10 cm2/Vs upon tuning the thin-film microstructure, injection and the defect density at the semiconductor/dielectric interface. The work was performed in collaboration with Yaochuan Mei (Wake Forest University), Chuang Zhang, and Z. Valy Vardeny (University of Utah). The work is supported by ONR Grant N00014-15-1-2943.
Shi, Wen; Zhao, Tianqi; Xi, Jinyang; Wang, Dong; Shuai, Zhigang
2015-10-14
Tuning carrier concentration via chemical doping is the most successful strategy to optimize the thermoelectric figure of merit. Nevertheless, how the dopants affect charge transport is not completely understood. Here we unravel the doping effects by explicitly including the scattering of charge carriers with dopants on thermoelectric properties of poly(3,4-ethylenedioxythiophene), PEDOT, which is a p-type thermoelectric material with the highest figure of merit reported. We corroborate that the PEDOT exhibits a distinct transition from the aromatic to quinoid-like structure of backbone, and a semiconductor-to-metal transition with an increase in the level of doping. We identify a close-to-unity charge transfer from PEDOT to the dopant, and find that the ionized impurity scattering dominates over the acoustic phonon scattering in the doped PEDOT. By incorporating both scattering mechanisms, the doped PEDOT exhibits mobility, Seebeck coefficient and power factors in very good agreement with the experimental data, and the lightly doped PEDOT exhibits thermoelectric properties superior to the heavily doped one. We reveal that the thermoelectric transport is highly anisotropic in ordered crystals, and suggest to utilize large power factors in the direction of polymer backbone and low lattice thermal conductivity in the stacking and lamellar directions, which is viable in chain-oriented amorphous nanofibers.
NASA Astrophysics Data System (ADS)
Wang, Xiaowei; Wang, Rui; Wang, Shengnan; Zhang, Dongdong; Jiang, Xingbin; Cheng, Zhihai; Qiu, Xiaohui
2018-01-01
The electron transport characteristics of graphene can be finely tuned using local electrostatic fields. Here, we use a scanning probe technique to construct a statically charged electret gate that enables in-situ fabrication of graphene devices with precisely designed potential landscapes, including p-type and n-type unipolar graphene transistors and p-n junctions. Electron dynamic simulation suggests that electron beam collimation and focusing in graphene can be achieved via periodic charge lines and concentric charge circles. This approach to spatially manipulating carrier density distribution may offer an efficient way to investigate the novel electronic properties of graphene and other low-dimensional materials.
Probing the intrinsic charge transport in indacenodithiophene-co-benzothiadiazole thin films
NASA Astrophysics Data System (ADS)
Wang, Wenhe; Tang, Wei; Zhao, Jiaqing; Bao, Bei; Xing, Hui; Guo, Xiaojun; Wang, Shun; Liu, Ying
2017-12-01
Indacenodithiophene-co-benzothiadiazole (IDTBT) belongs to a class of donor-acceptor polymers, exhibiting high electronic mobility and low energetic disorder. Applying vacuum as dielectric enables us to investigate the intrinsic charge transport properties in IDTBT. Vacuum-gap IDTBT field-effect transistors (FET) show high mobilites approaching 1 cm2V-1s-1. In addition, with increasing dielectric constant of the gate insulators, the mobilites of IDTBT transistors first increase and then decrease. The reason could be attributed to effect of both charge carrier accumulation and the presence of dipolar disorder at the semiconductor/insulator interface induced by polar insulator layer.
Study of charge transport in composite blend of P3HT and PCBM
NASA Astrophysics Data System (ADS)
Kumar, Manoj; Kumar, Sunil; Upadhyaya, Aditi; Yadav, Anjali; Gupta, Saral K.; Singh, Amarjeet
2018-05-01
Poly (3-hexylthiophene-2,5diyl) (P3HT) as donor and [6,6]-phenyl C61 butyric acid methyl ester (PCBM) as acceptor are mostly used as active medium in polymeric electronic device. In this paper we have prepare the P3HT - PCBM based bulk hetero junction thin films by spin coating technique. The charge transport properties of P3HT:PCBM blends are investigated by the current-voltage measurements using Ag as an electron injecting electrode and ITO as a hole injecting contact. The current density v/s voltage relationships are analyzed in the backdrop of Schottky and Space charge limited current model.
NASA Astrophysics Data System (ADS)
Datta, Joydeep; Das, Mrinmay; Dey, Arka; Halder, Soumi; Sil, Sayantan; Ray, Partha Pratim
2017-10-01
ZnCdS is an intermediate ternary alloy type semiconducting material which has huge tunable structural, optical and electrical properties. Here, we have synthesized Zn1-xCdxS compound and characterized its structural, optical and charge transport properties. It is seen that the particle size is greatly influenced by the amount of alloy concentration of cadmium. The performance of semiconductor device such as Schottky diode depends mainly on the charge transportation through the metal-semiconductor junction. So, we have fabricated Al/Zn1-xCdxS/ITO device and investigated the bias dependent impedance properties through equivalent circuit network analysis to study the electron lifetime and interfacial region resistance. The result of network analysis indicates that the charge transportation through Al- Zn0.6Cd0.4S is better than the other fabricated devices. For further explanation, we have studied the capacitance-voltage (C-V) characteristic under dark and current-voltage (I-V) characteristic under dark and light. We have investigated barrier height, depletion layer width and employed SCLC (space charge limited current) theory in I-V characteristics to determine mobility, transit time and diffusion length. The mobility and diffusion length for Zn0.6Cd0.4S fabricated device are derived as 23.01 m2 V-1 s-1 and 4.4 μm respectively while both the values are less for the other devices. These values are enhanced upon illumination for all the devices but superiority comes from the Al/Zn0.6Cd0.4S/ITO device and it leads us to measure the photosensitivity, responsivity, specific detectivity. As expected, the photosensing parameters are enhanced for the Zn0.6Cd0.4S fabricated device. So, this literature not only explores the metal semiconductor charge transportation using impedance spectroscopy (IS) network analysis and SCLC theory but also explain it from the structural point of view.
Spin Dependent Transport Properties of Metallic and Semiconducting Nanostructures
NASA Astrophysics Data System (ADS)
Sapkota, Keshab R.
Present computing and communication devices rely on two different classes of technologies; information processing devices are based on electrical charge transport in semiconducting materials while information storage devices are based on orientation of electron spins in magnetic materials. A realization of a hybrid-type device that is based on charge as well as spin properties of electrons would perform both of these actions thereby enhancing computation power to many folds and reducing power consumptions. This dissertation focuses on the fabrication of such spin-devices based on metallic and semiconducting nanostructures which can utilize spin as well as charge properties of electrons. A simplified design of the spin-device consists of a spin injector, a semiconducting or metallic channel, and a spin detector. The channel is the carrier of the spin signal from the injector to the detector and therefore plays a crucial role in the manipulation of spin properties in the device. In this work, nanostructures like nanowires and nanostripes are used to function the channel in the spin-device. Methods like electrospinning, hydrothermal, and wet chemical were used to synthesize nanowires while physical vapor deposition followed by heat treatment in controlled environment was used to synthesis nanostripes. Spin-devices fabrication of the synthesized nanostructures were carried out by electron beam lithography process. The details of synthesis of nanostructures, device fabrication procedures and measurement techniques will be discussed in the thesis. We have successfully fabricated the spin-devices of tellurium nanowire, indium nanostripe, and indium oxide nanostripe and studied their spin transport properties for the first time. These spin-devices show large spin relaxation length compared to normal metals like copper and offer potentials for the future technologies. Further, Heusler alloys nanowires like nanowires of Co 2FeAl were synthesized and studied for electrical transport properties since such systems are halfmetallic in nature and promise the possibilities of spin injection and detection. The study was extended to dilute magnetic semiconducting nanowire system of Cd1-xMnxTe which possess both magnetic and semiconducting properties. In summary, the studies made in this thesis will offer a new understanding of spin transport behavior for future technology.
Bandgap Tuning of Silicon Quantum Dots by Surface Functionalization with Conjugated Organic Groups.
Zhou, Tianlei; Anderson, Ryan T; Li, Huashan; Bell, Jacob; Yang, Yongan; Gorman, Brian P; Pylypenko, Svitlana; Lusk, Mark T; Sellinger, Alan
2015-06-10
The quantum confinement and enhanced optical properties of silicon quantum dots (SiQDs) make them attractive as an inexpensive and nontoxic material for a variety of applications such as light emitting technologies (lighting, displays, sensors) and photovoltaics. However, experimental demonstration of these properties and practical application into optoelectronic devices have been limited as SiQDs are generally passivated with covalently bound insulating alkyl chains that limit charge transport. In this work, we show that strategically designed triphenylamine-based surface ligands covalently bonded to the SiQD surface using conjugated vinyl connectivity results in a 70 nm red-shifted photoluminescence relative to their decyl-capped control counterparts. This suggests that electron density from the SiQD is delocalized into the surface ligands to effectively create a larger hybrid QD with possible macroscopic charge transport properties.
Transport and Reactivity of Engineered Nanoparticles in Partially Saturated Porous Media
NASA Astrophysics Data System (ADS)
Dror, I.; Yecheskel, Y.; Berkowitz, B.
2015-12-01
Engineered nanoparticles (ENPs) are being produced in increasing amounts and have numerous applications in a variety of products and industrial processes. The same properties that make these substances so appealing may also cause them to act as persistent and toxic pollutants. The post-use release of ENPs to the environment is inevitable and soil appears to be one of the largest sinks of these potential contaminants. To date, despite the significant attention that ENP behavior in the environment has received, only a few studies have considered the fate and transport of ENPs in partially saturated systems. Here, we report measurements on the transport and fate of three commonly used ENPs - silver (Ag), gold (Au) and zinc oxide (ZnO) - in partially saturated porous media. The results show that ENP interactions with the solid matrix and solution components affect the fate of the ENPs and their transport. The negatively charged ENPs (AgNPs and AuNPs) are shown to be mobile in sand (which is also negatively charged) under various conditions, including water saturation levels and inlet concentration, with transport behavior resembling conservative tracer movement. Various aging scenarios were considered and the interaction of AgNPs with sulfides, chlorides, and calcium ions, all of which are known to interact and change AgNP properties, are shown to affect AgNP fate; however, in some cases, the changed particles remained suspended in solution and mobile. The positively charged ZnO showed very low mobility, but when humic acid was present in the inlet solution, interactions leading to enhanced mobility were observed. The presence of humic acid also changes ENP size and surface charge, transforming them to negatively charged larger aggregates that can be transported through the sand. Finally, remobilization of particles that were retained in the porous media was also demonstrated for ZnO ENPs, indicating possible release of entrapped ENPs upon changes in solution chemistry.
Lan, Chunfeng; Luo, Jingting; Lan, Huabin; Fan, Bo; Peng, Huanxin; Zhao, Jun; Sun, Huibin; Zheng, Zhuanghao; Liang, Guangxing; Fan, Ping
2018-01-01
We provided a new method to improve the efficiency of Sb2S3 thin film solar cells. The TiO2 electron transport layers were doped by lithium to improve their charge extraction properties for the thermal-evaporated Sb2S3 solar cells. The Mott-Schottky curves suggested a change of energy band and faster charge transport in the Li-doped TiO2 films. Compared with the undoped TiO2, Li-doped mesoporous TiO2 dramatically improved the photo-voltaic performance of the thermal-evaporated Sb2S3 thin film solar cells, with the average power conversion efficiency (PCE) increasing from 1.79% to 4.03%, as well as the improved open-voltage (Voc), short-circuit current (Jsc) and fill factors. The best device based on Li-doped TiO2 achieved a power conversion efficiency up to 4.42% as well as a Voc of 0.645 V, which are the highest values among the reported thermal-evaporated Sb2S3 solar cells. This study showed that Li-doping on TiO2 can effectively enhance the charge extraction properties of electron transport layers, offering a new strategy to improve the efficiency of Sb2S3-based solar cells. PMID:29495612
Tian, Ye; Wen, Liping; Hou, Xu; Hou, Guanglei; Jiang, Lei
2012-07-16
Biological ion channels are able to control ion-transport processes precisely because of their intriguing properties, such as selectivity, rectification, and gating. Learning from nature, scientists have developed a promising system--solid-state single nanochannels--to mimic biological ion-transport properties. These nanochannels have many impressive properties, such as excess surface charge, making them selective; the ability to be produced or modified asymmetrically, endowing them with rectification; and chemical reactivity of the inner surface, imparting them with desired gating properties. Based on these unique characteristics, solid-state single nanochannels have been explored in various applications, such as sensing. In this context, we summarize recent developments of bioinspired solid-state single nanochannels with ion-transport properties that resemble their biological counterparts, including selectivity, rectification, and gating; their applications in sensing are also introduced briefly. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Absence of ballistic charge transport in the half-filled 1D Hubbard model
NASA Astrophysics Data System (ADS)
Carmelo, J. M. P.; Nemati, S.; Prosen, T.
2018-05-01
Whether in the thermodynamic limit of lattice length L → ∞, hole concentration mηz = - 2 Sηz/L = 1 -ne → 0, nonzero temperature T > 0, and U / t > 0 the charge stiffness of the 1D Hubbard model with first neighbor transfer integral t and on-site repulsion U is finite or vanishes and thus whether there is or there is no ballistic charge transport, respectively, remains an unsolved and controversial issue, as different approaches yield contradictory results. (Here Sηz = - (L -Ne) / 2 is the η-spin projection and ne =Ne / L the electronic density.) In this paper we provide an upper bound on the charge stiffness and show that (similarly as at zero temperature), for T > 0 and U / t > 0 it vanishes for mηz → 0 within the canonical ensemble in the thermodynamic limit L → ∞. Moreover, we show that at high temperature T → ∞ the charge stiffness vanishes as well within the grand-canonical ensemble for L → ∞ and chemical potential μ →μu where (μ -μu) ≥ 0 and 2μu is the Mott-Hubbard gap. The lack of charge ballistic transport indicates that charge transport at finite temperatures is dominated by a diffusive contribution. Our scheme uses a suitable exact representation of the electrons in terms of rotated electrons for which the numbers of singly occupied and doubly occupied lattice sites are good quantum numbers for U / t > 0. In contrast to often less controllable numerical studies, the use of such a representation reveals the carriers that couple to the charge probes and provides useful physical information on the microscopic processes behind the exotic charge transport properties of the 1D electronic correlated system under study.
Hole-phonon coupling effect on the band dispersion of organic molecular semiconductors.
Bussolotti, F; Yang, J; Yamaguchi, T; Yonezawa, K; Sato, K; Matsunami, M; Tanaka, K; Nakayama, Y; Ishii, H; Ueno, N; Kera, S
2017-08-02
The dynamic interaction between the traveling charges and the molecular vibrations is critical for the charge transport in organic semiconductors. However, a direct evidence of the expected impact of the charge-phonon coupling on the band dispersion of organic semiconductors is yet to be provided. Here, we report on the electronic properties of rubrene single crystal as investigated by angle resolved ultraviolet photoelectron spectroscopy. A gap opening and kink-like features in the rubrene electronic band dispersion are observed. In particular, the latter results in a large enhancement of the hole effective mass (> 1.4), well above the limit of the theoretical estimations. The results are consistent with the expected modifications of the band structures in organic semiconductors as introduced by hole-phonon coupling effects and represent an important experimental step toward the understanding of the charge localization phenomena in organic materials.The charge transport properties in organic semiconductors are affected by the impact of molecular vibrations, yet it has been challenging to quantify them to date. Here, Bussolotti et al. provide direct experimental evidence on the band dispersion modified by molecular vibrations in a rubrene single crystal.
Piaggio, Maria V; Peirotti, Marta B; Deiber, Julio A
2010-08-01
Peptide electrophoretic mobility data are interpreted through a physicochemical CZE model, providing estimates of the equivalent hydrodynamic radius, hydration, effective and total charge numbers, actual ionizing pK, pH-near molecule and electrical permittivity of peptide domain, among other basic properties. In this study, they are used to estimate some peptide global structural properties proposed, providing thus a distinction among different peptides. Therefore, the solvent drag on the peptide is obtained through a characteristic friction power coefficient of the number of amino acid residues, defined from the global chain conformation in solution. As modeling of the effective electrophoretic mobility of peptides is carried out in terms of particle hydrodynamic size and shape coupled to hydration and effective charge, a packing dimension related to chain conformation within the peptide domain may be defined. In addition, the effective and total charge number fractions of peptides provide some clues on the interpretation of chain conformations within the framework of scaling laws. Furthermore, the model estimates transport properties, such as sedimentation, friction and diffusion coefficients. As the relative numbers of ionizing, polar and non-polar amino acid residues vary in peptides, their global structural properties defined here change appreciably. Needs for further research are also discussed.
Zhang, Xinyuan; Li, Zhiqi; Liu, Chunyu; Guo, Jiaxin; Shen, Liang; Guo, Wenbin
2018-03-15
The charge transfer and separation are significantly affected by the electron properties of the interface between the electron-donor layer and the carrier-transporting layer in polymer solar cells (PSCs). In this study, we investigate the electron extraction mechanism of PSCs with a low temperature solution-processed ZnO/PEI as electron transport layer. The incorporation of PEI layer can decrease the work function of ZnO and reduce interfacial barrier, which facilitates electron extraction and suppresses bimolecular recombination, leading to a significant performance enhancement. Furthermore, PEI layer can induce phase separation and passivite inorganic surface trap states as well as shift the interfacial energy offset between metal oxide and organic materials. This work offers a simple and effective way to improve the charge transporting property of organic photovoltaic devices. Copyright © 2017 Elsevier Inc. All rights reserved.
Effect of d-wave pairing symmetry in transport properties of silicene-based superconductor junction
NASA Astrophysics Data System (ADS)
Vosoughi-nia, S.; Rashedi, G.; hajati, Y.
2018-06-01
We theoretically study the tunneling conductance of a normal/d-wave superconductor silicene junction using Blonder-Tinkham-Klapwijk (BTK) formalism. We discuss how the conductance spectra are affected by changing the chemical potential (μN) in the normal silicene region. It is obtained that the amplitude of the spin/valley-dependent Andreev reflection (AR) and charge conductance (G) of the junction can be strongly modulated by the orientation angle of superconductive gap (β) and perpendicular electric field (Ez). We demonstrate that the charge conductance exhibits an oscillatory behavior as a function of β by a period of π/2. Remarkably, variation of μN strongly modifies the amplitude of the oscillations and periodically there are transport gaps in the G - β oscillations for a range of μN. These findings suggest that one may experimentally tune the transport properties of the junction through changing β, Ez and μN.
Villanueva-Cab, J; Anta, J A; Oskam, G
2016-01-28
We report on the commonly unaccounted for process of recombination under short-circuit conditions in nanostructured photoelectrodes with special attention to the charge collection efficiency. It is observed that when recombination under short circuit conditions is significant, small perturbation methods overestimate the charge-collection efficiency, which is related to the inaccurate determination of the electron diffusion coefficient and diffusion length.
Spatial Variation in Mobility-Lifetime Product in Bulk TlBr and CZT
NASA Astrophysics Data System (ADS)
Phillips, David; Haegel, Nancy; Blaine, Kevin; Kim, Hadong; Ciampi, Guido; Cirignano, Len
2012-02-01
The energy resolution of a semiconductor radiation detector depends on the charge transport properties of the semiconductor, and the mobility-lifetime (μτ) product is a key figure of merit for charge transport. In this work, we investigate the effects of two impurities, Na and Cu, on the μτ product in bulk thallium bromide (TlBr) using cathodoluminescence (CL) and transport imaging. Transport imaging uses a scanning electron microscope to generate a line of charge carriers on the surface of a bulk sample, and the intensity and spatial distribution of the recombination luminescence are recorded. A Green's function approach is used to model the generation, diffusion, and recombination of charge carriers under steady-state conditions. The luminescence distribution is fit to the model to extract the ambipolar diffusion length and the μτ product, providing a high-resolution correlation between the luminescence variations due to dopants/defects and the quantitative transport behavior. The μτ product has been mapped across a 40 μm segment of TlBr at a resolution of 2 μm. Additionally, this approach has been used to locally map variations in ambipolar diffusion length and μτ product due to extended defects in cadmium zinc telluride (CZT).
Ion transport and softening in a polymerized ionic liquid
Kumar, Rajeev; Bocharova, Vera; Strelcov, Evgheni; ...
2014-11-13
Polymerized ionic liquids (PolyILs) are promising materials for various solid state electronic applications such as dye-sensitized solar cells, lithium batteries, actuators, field-effect transistors, light emitting electrochemical cells, and electrochromic devices. However, fundamental understanding of interconnection between ionic transport and mechanical properties in PolyILs is far from complete. In this paper, local charge transport and structural changes in films of a PolyIL are studied using an integrated experiment-theory based approach. Experimental data for the kinetics of charging and steady state current–voltage relations can be explained by taking into account the dissociation of ions under an applied electric field (known as themore » Wien effect). Onsager's theory of the Wien effect coupled with the Poisson–Nernst–Planck formalism for the charge transport is found to be in excellent agreement with the experimental results. The agreement between the theory and experiments allows us to predict structural properties of the PolyIL films. We have observed significant softening of the PolyIL films beyond certain threshold voltages and formation of holes under a scanning probe microscopy (SPM) tip, through which an electric field was applied. Finally, the observed softening is explained by the theory of depression in glass transition temperature resulting from enhanced dissociation of ions with an increase in applied electric field.« less
NASA Astrophysics Data System (ADS)
Jimenez, Mawin J. M.; Oliveira, Rafael F.; Almeida, Tiago P.; Hensel Ferreira, Rafael C.; Bufon, Carlos Cesar B.; Rodrigues, Varlei; Pereira-da-Silva, Marcelo A.; Gobbi, Ângelo L.; Piazzetta, Maria H. O.; Riul, Antonio, Jr.
2017-12-01
Graphene is a breakthrough 2D material due to its unique mechanical, electrical, and thermal properties, with considerable responsiveness in real applications. However, the coverage of large areas with pristine graphene is a challenge and graphene derivatives have been alternatively exploited to produce hybrid and composite materials that allow for new developments, considering also the handling of large areas using distinct methodologies. For electronic applications there is significant interest in the investigation of the electrical properties of graphene derivatives and related composites to determine whether the characteristic 2D charge transport of pristine graphene is preserved. Here, we report a systematic study of the charge transport mechanisms of reduced graphene oxide chemically functionalized with sodium polystyrene sulfonate (PSS), named as GPSS. GPSS was produced either as quantum dots (QDs) or nanoplatelets (NPLs), being further nanostructured with poly(diallyldimethylammonium chloride) through the layer-by-layer (LbL) assembly to produce graphene nanocomposites with molecular level control. Current-voltage (I-V) measurements indicated a meticulous growth of the LbL nanostructures onto gold interdigitated electrodes (IDEs), with a space-charge-limited current dominated by a Mott-variable range hopping mechanism. A 2D intra-planar conduction within the GPSS nanostructure was observed, which resulted in effective charge carrier mobility (μ) of 4.7 cm2 V-1 s-1 for the QDs and 34.7 cm2 V-1 s-1 for the NPLs. The LbL assemblies together with the dimension of the materials (QDs or NPLs) were favorably used for the fine tuning and control of the charge carrier mobility inside the LbL nanostructures. Such 2D charge conduction mechanism and high μ values inside an interlocked multilayered assembly containing graphene-based nanocomposites are of great interest for organic devices and functionalization of interfaces.
Vázquez-Mayagoitia, Álvaro; Ratcliff, Laura E.; Tretiak, Sergei; Bair, Raymond A.; Gray, Stephen K.; Van Voorhis, Troy; Larsen, Ross E.; Darling, Seth B.
2017-01-01
Organic photovoltaics (OPVs) are a promising carbon-neutral energy conversion technology, with recent improvements pushing power conversion efficiencies over 10%. A major factor limiting OPV performance is inefficiency of charge transport in organic semiconducting materials (OSCs). Due to strong coupling with lattice degrees of freedom, the charges form polarons, localized quasi-particles comprised of charges dressed with phonons. These polarons can be conceptualized as pseudo-atoms with a greater effective mass than a bare charge. We propose that due to this increased mass, polarons can be modeled with Langevin molecular dynamics (LMD), a classical approach with a computational cost much lower than most quantum mechanical methods. Here we present LMD simulations of charge transfer between a pair of fullerene molecules, which commonly serve as electron acceptors in OSCs. We find transfer rates consistent with experimental measurements of charge mobility, suggesting that this method may provide quantitative predictions of efficiency when used to simulate materials on the device scale. Our approach also offers information that is not captured in the overall transfer rate or mobility: in the simulation data, we observe exactly when and why intermolecular transfer events occur. In addition, we demonstrate that these simulations can shed light on the properties of polarons in OSCs. Much remains to be learned about these quasi-particles, and there are no widely accepted methods for calculating properties such as effective mass and friction. Our model offers a promising approach to exploring mass and friction as well as providing insight into the details of polaron transport in OSCs. PMID:28553494
Magneto-transport properties of a random distribution of few-layer graphene patches
DOE Office of Scientific and Technical Information (OSTI.GOV)
Iacovella, Fabrice; Mitioglu, Anatolie; Pierre, Mathieu
In this study, we address the electronic properties of conducting films constituted of an array of randomly distributed few layer graphene patches and investigate on their most salient galvanometric features in the moderate and extreme disordered limit. We demonstrate that, in annealed devices, the ambipolar behaviour and the onset of Landau level quantization in high magnetic field constitute robust hallmarks of few-layer graphene films. In the strong disorder limit, however, the magneto-transport properties are best described by a variable-range hopping behaviour. A large negative magneto-conductance is observed at the charge neutrality point, in consistency with localized transport regime.
Charge transport in doped zigzag phosphorene nanoribbons
NASA Astrophysics Data System (ADS)
Nourbakhsh, Zahra; Asgari, Reza
2018-06-01
The effects of lattice distortion and chemical disorder on charge transport properties of two-terminal zigzag phosphorene nanoribbons (zPNRs), which shows resonant tunneling behavior under an electrical applied bias, are studied. Our comprehensive study is based on ab initio quantum transport calculations on the basis of the Landauer theory. We use nitrogen and silicon substitutional dopant atoms, and employ different physical quantities such as the I -V curve, voltage drop behavior, transmission spectrum, transmission pathway, and atomic current to explore the transport mechanism of zPNR devices under a bias voltage. The calculated transmission pathways show the transition from a ballistic transport regime to a diffusive and in some particular cases to localized transport regimes. Current flowing via the chemical bonds and hopping are monitored; however, the conductance originates mainly from the charge traveling through the chemical bonds in the vicinity of the zigzag edges. Our results show that in the doped systems, the device conductance decreases and the negative differential resistance characteristic becomes weak or is eliminated. Besides, the conductance in a pure zPNR system is almost independent of the ribbon width.
Prospects of In/CdTe X- and γ-ray detectors with MoO Ohmic contacts
NASA Astrophysics Data System (ADS)
Maslyanchuk, Olena L.; Solovan, Mykhailo M.; Maistruk, Eduard V.; Brus, Viktor V.; Maryanchuk, Pavlo D.; Gnatyuk, Volodymyr A.; Aoki, Toru
2018-01-01
The present paper analyzes the charge transport mechanisms and spectrometric properties of In/CdTe/MoOx heterojunctions prepared by magnetron sputtering of indium and molybdenum oxide thin films onto semi-insulating p-type single-crystal CdTe semiconductor, produced by Acrorad Co. Ltd. Current-voltage characteristics of the detectors at different temperatures were investigated. The charge transport mechanisms in the heterostructures under investigation were determined: the generation-recombination in the space charge region (SCR) at relatively low voltages and the space charge limited currents at high voltages. The spectra of 137Cs and 241Am isotopes taken at different applied bias voltages are presented. It is shown that the In/CdTe/MoOx structures can be used as X/γ-ray detectors in the spectrometric mode.
Modeling charge transport in organic photovoltaic materials.
Nelson, Jenny; Kwiatkowski, Joe J; Kirkpatrick, James; Frost, Jarvist M
2009-11-17
The performance of an organic photovoltaic cell depends critically on the mobility of charge carriers within the constituent molecular semiconductor materials. However, a complex combination of phenomena that span a range of length and time scales control charge transport in disordered organic semiconductors. As a result, it is difficult to rationalize charge transport properties in terms of material parameters. Until now, efforts to improve charge mobilities in molecular semiconductors have proceeded largely by trial and error rather than through systematic design. However, recent developments have enabled the first predictive simulation studies of charge transport in disordered organic semiconductors. This Account describes a set of computational methods, specifically molecular modeling methods, to simulate molecular packing, quantum chemical calculations of charge transfer rates, and Monte Carlo simulations of charge transport. Using case studies, we show how this combination of methods can reproduce experimental mobilities with few or no fitting parameters. Although currently applied to material systems of high symmetry or well-defined structure, further developments of this approach could address more complex systems such anisotropic or multicomponent solids and conjugated polymers. Even with an approximate treatment of packing disorder, these computational methods simulate experimental mobilities within an order of magnitude at high electric fields. We can both reproduce the relative values of electron and hole mobility in a conjugated small molecule and rationalize those values based on the symmetry of frontier orbitals. Using fully atomistic molecular dynamics simulations of molecular packing, we can quantitatively replicate vertical charge transport along stacks of discotic liquid crystals which vary only in the structure of their side chains. We can reproduce the trends in mobility with molecular weight for self-organizing polymers using a cheap, coarse-grained structural simulation method. Finally, we quantitatively reproduce the field-effect mobility in disordered C60 films. On the basis of these results, we conclude that all of the necessary building blocks are in place for the predictive simulation of charge transport in macromolecular electronic materials and that such methods can be used as a tool toward the future rational design of functional organic electronic materials.
Interplay of Transport and Morphology in Nanostructured Ion-Containing Polymers
NASA Astrophysics Data System (ADS)
Park, Moon Jeong
The global energy crisis and an increase in environmental pollution in the recent years have drawn the attention of the scientific community to develop innovative ways to improve energy storage and find more efficient methods of transporting the energy. Polymers containing charged species that show high ionic conductivity and good mechanical integrity are the essential components of these energy storage and transport systems. In this talk, first, I will present a fundamental understanding of the thermodynamics and transport in ion-containing block copolymers with a focus on the structure-property relationships. Tailoring the intermolecular interactions between the polymer matrix and the embedded charges appeared to be vital for controlling the transport properties. Particularly, the achievement of well-defined self-assembled morphologies with three-dimensional symmetries has proven to facilitate fast ion transport by constructing less tortuous ion-conducting pathways. Examples of attained morphologies include disorder, lamellae, gyroid, Fddd, hexagonal cylinder, body-centered cubic, face-centered cubic, and A15 phases. Second, various strategies for accessing high cation transference number as well as improved ionic conductivity from ionic-containing polymers are enclosed; (1) the inclusion of terminal ionic units as a new means to control the nanoscale morphologies and the transport efficiency of block copolymer electrolytes and (2) the addition of zwitterions that offered a polar medium close to water, and accordingly increased the charge density and ionic conductivity. The obtained knowledge on polymer electrolytes could be used in a wide range of emerging nanotechnologies such as fuel cells, lithium batteries, and electro-active actuators.
Ultrafast Spectroscopic Noninvasive Probe of Vertical Carrier Transport in Heterostructure Devices
2016-03-01
where barriers, tunneling , scattering, strong polarization-induced fields, or carrier localization due to Type I or Type II quantum-well structures can... tunneling across junctions, scattering at heterointerfaces, and internal fields. For light-emitting devices, poor charge transport across multilayer...localization of holes and rapid electron tunneling .5 However, direct transport properties were Approved for public release; distribution is
New secondary batteries utilizing electronically conductive polymer cathodes
NASA Technical Reports Server (NTRS)
Martin, Charles R.; White, Ralph E.
1989-01-01
The objectives of this project are to characterize the transport properties in electronically conductive polymers and to assess the utility of these films as cathodes in lithium/polymer secondary batteries. During this research period, progress has been made in a literature survey of the historical background, methods of preparation, the physical and chemical properties, and potential technological applications of polythiophene. Progress has also been made in the characterization of polypyrrole flat films and fibrillar films. Cyclic voltammetry and potential step chronocoulometry were used to gain information on peak currents and potentials switching reaction rates, charge capacity, and charge retention. Battery charge/discharge studies were also performed.
32 CFR 644.406 - Transfers to Secretary of Transportation and the National Weather Service.
Code of Federal Regulations, 2013 CFR
2013-07-01
... National Weather Service. 644.406 Section 644.406 National Defense Department of Defense (Continued... Property and Easement Interests § 644.406 Transfers to Secretary of Transportation and the National Weather... similarly authorizes transfer of meteorological facilities, without charge, to the National Weather Service. ...
32 CFR 644.406 - Transfers to Secretary of Transportation and the National Weather Service.
Code of Federal Regulations, 2012 CFR
2012-07-01
... National Weather Service. 644.406 Section 644.406 National Defense Department of Defense (Continued... Property and Easement Interests § 644.406 Transfers to Secretary of Transportation and the National Weather... similarly authorizes transfer of meteorological facilities, without charge, to the National Weather Service. ...
32 CFR 644.406 - Transfers to Secretary of Transportation and the National Weather Service.
Code of Federal Regulations, 2010 CFR
2010-07-01
... National Weather Service. 644.406 Section 644.406 National Defense Department of Defense (Continued... Property and Easement Interests § 644.406 Transfers to Secretary of Transportation and the National Weather... similarly authorizes transfer of meteorological facilities, without charge, to the National Weather Service. ...
32 CFR 644.406 - Transfers to Secretary of Transportation and the National Weather Service.
Code of Federal Regulations, 2014 CFR
2014-07-01
... National Weather Service. 644.406 Section 644.406 National Defense Department of Defense (Continued... Property and Easement Interests § 644.406 Transfers to Secretary of Transportation and the National Weather... similarly authorizes transfer of meteorological facilities, without charge, to the National Weather Service. ...
32 CFR 644.406 - Transfers to Secretary of Transportation and the National Weather Service.
Code of Federal Regulations, 2011 CFR
2011-07-01
... National Weather Service. 644.406 Section 644.406 National Defense Department of Defense (Continued... Property and Easement Interests § 644.406 Transfers to Secretary of Transportation and the National Weather... similarly authorizes transfer of meteorological facilities, without charge, to the National Weather Service. ...
NASA Astrophysics Data System (ADS)
Griffin, Philip; Holt, Adam; Wang, Yangyang; Sokolov, Alexei
2015-03-01
Amphiphilic room temperature ionic liquids (ILs) segregate on the nanoscale, forming intricate networks of charge-rich ionic domains intercalated with charge-poor aliphatic domains. While this structural phenomenon has been well established through x-ray diffraction studies and atomistic MD simulations, the precise effects of nanophase segregation on ion transport and structural dynamics in ILs remains poorly understood. Using a combination of broadband dielectric spectroscopy, light scattering spectroscopy, and rheology, we have characterized the ionic conductivity, structural dynamics, and shear viscosity of a homologous series of quaternary ammonium ionic liquids over a wide temperature range. Upon increasing the length and volume fraction of the alkyl side chains of these quaternary ammonium ILs, ionic conductivity decreases precipitously, although no corresponding slowing of the structural dynamics is observed. Instead, we identify the dynamical signature of supramolecular aggregates. Our results directly demonstrate the role that chemical structure and ionic aggregation plays in determining the charge transport properties of amphiphilic ILs.
Structural, transport and elastic properties of LaTiO3
NASA Astrophysics Data System (ADS)
Choithrani, Renu; Bhat, Masroor Ahmad; Gaur, N. K.
2013-02-01
The thermophysical properties such as structural, transport and elastic properties of the orthorhombic perovskite-type titanate system, LaTiO3 have been explored in detail for the first time by applying extended rigid ion model (ERIM). LaTiO3 has been subject of recent interest because of the variety of attractive behaviors, including a metal-insulator transition, spin-charge-orbital ordering and high-temperature superconductivity. LaTiO3 has been suggested to have promising scientific and technological applications. The theoretically computed thermophysical properties of LaTiO3 compound are in good agreement with the available results.
Solid-State Division progress report for period ending March 31, 1983
DOE Office of Scientific and Technical Information (OSTI.GOV)
Green, P.H.; Watson, D.M.
1983-09-01
Progress and activities are reported on: theoretical solid-state physics (surfaces; electronic, vibrational, and magnetic properties; particle-solid interactions; laser annealing), surface and near-surface properties of solids (surface, plasma-material interactions, ion implantation and ion-beam mixing, pulsed-laser and thermal processing), defects in solids (radiation effects, fracture, impurities and defects, semiconductor physics and photovoltaic conversion), transport properties of solids (fast-ion conductors, superconductivity, mass and charge transport in materials), neutron scattering (small-angle scattering, lattice dynamics, magnetic properties, structure and instrumentation), and preparation and characterization of research materials (growth and preparative methods, nuclear waste forms, special materials). (DLC)
NASA Technical Reports Server (NTRS)
Miller, Jack; Heilbronn, Lawrence H.; Zeitlin, Cary J.; Wilson, John W.; Singleterry, Robert C., Jr.; Thibeault, Sheila Ann
2003-01-01
Mission crews in space outside the Earth s magnetic field will be exposed to high energy heavy charged particles in the galactic cosmic radiation (GCR). These highly ionizing particles will be a source of radiation risk to crews on extended missions to the Moon and Mars, and the biological effects of and countermeasures to the GCR have to be investigated as part of the planning of exploration-class missions. While it is impractical to shield spacecraft and planetary habitats against the entire GCR spectrum, biological and physical studies indicate that relatively modest amounts of shielding are effective at reducing the radiation dose. However, nuclear fragmentation in the shielding materials produces highly penetrating secondary particles, which complicates the problem: in some cases, some shielding is worse than none at all. Therefore the radiation transport properties of potential shielding materials need to be carefully investigated. One intriguing option for a Mars mission is the use of material from the Martian surface, in combination with chemicals carried from Earth and/or fabricated from elements found in the Martian atmosphere, to construct crew habitats. We have measured the transmission properties of epoxy-Martian regolith composites with respect to heavy charged particles characteristic of the GCR ions which bombard the Martian surface. The composites were prepared at NASA Langley Research Center using simulated Martian regolith, in the process also evaluating fabrication methods which could lead to technologies for in situ fabrication on Mars. Initial evaluation of the radiation shielding properties is made using radiation transport models developed at NASA-LaRC, and the results of these calculations are used to select the composites with the most favorable radiation transmission properties. These candidates are then evaluated at particle accelerators which produce beams of heavy charged particles representative in energy and charge of the radiation at the surface of Mars. The ultimate objective is to develop the models into a design tool for use by mission planners, flight surgeons and radiation health specialists.
Code of Federal Regulations, 2010 CFR
2010-07-01
... the property? 102-118.460 Section 102-118.460 Public Contracts and Property Management Federal Property Management Regulations System (Continued) FEDERAL MANAGEMENT REGULATION TRANSPORTATION 118... 41 Public Contracts and Property Management 3 2010-07-01 2010-07-01 false What is the time limit...
Theoretical study on the charge transport in single crystals of TCNQ, F2-TCNQ and F4-TCNQ.
Ji, Li-Fei; Fan, Jian-Xun; Zhang, Shou-Feng; Ren, Ai-Min
2018-01-31
2,5-Difluoro-7,7,8,8-tetracyanoquinodimethane (F 2 -TCNQ) was recently reported to display excellent electron transport properties in single crystal field-effect transistors (FETs). Its carrier mobility can reach 25 cm 2 V -1 s -1 in devices. However, its counterparts TCNQ and F 4 -TCNQ (tetrafluoro-7,7,8,8-tetracyanoquinodimethane) do not exhibit the same highly efficient behavior. To better understand this significant difference in charge carrier mobility, a multiscale approach combining semiclassical Marcus hopping theory, a quantum nuclear enabled hopping model and molecular dynamics simulations was performed to assess the electron mobilities of the F n -TCNQ (n = 0, 2, 4) systems in this work. The results indicated that the outstanding electron transport behavior of F 2 -TCNQ arises from its effective 3D charge carrier percolation network due to its special packing motif and the nuclear tunneling effect. Moreover, the poor transport properties of TCNQ and F 4 -TCNQ stem from their invalid packing and strong thermal disorder. It was found that Marcus theory underestimated the mobilities for all the systems, while the quantum model with the nuclear tunneling effect provided reasonable results compared to experiments. Moreover, the band-like transport behavior of F 2 -TCNQ was well described by the quantum nuclear enabled hopping model. In addition, quantum theory of atoms in molecules (QTAIM) analysis and symmetry-adapted perturbation theory (SAPT) were used to characterize the intermolecular interactions in TCNQ, F 2 -TCNQ and F 4 -TCNQ crystals. A primary understanding of various noncovalent interaction responses for crystal formation is crucial to understand the structure-property relationships in organic molecular materials.
Charge injection and transport in regioregular poly(3-hexylthiophene)-based field-effect transistors
NASA Astrophysics Data System (ADS)
Singh, Kumar Abhishek
Organic (semi)conductors are poised as never before to transform the electronics industry towards unprecedented versatility. In this thesis, we have taken an experimental approach to address the effect of nanostructure and the energy-level alignment at the metal/polymer interface on charge injection and transport in regioregular poly(3-hexylthiophene) (rr-P3HT) based field-effect transistors (FETs). We found that the mobility and contact resistance in rr-P3HT based FETs show an inverse relationship, and that both properties were affected by the nanostructure of the polymer proving that that charge injection, in addition to charge transport, is significantly affected by the bulk-transport properties of rr-P3HT. Thereafter we successfully recessed the contacts into the SiO 2 dielectric to minimize the effect of the step between the metal contacts and the dielectric on the polymer nanomorphology. The planarization of the devices resulted in a dramatic improvement of the nanomorphology of rr-P3HT reflected as an improvement in charge injection as evident from the decrease in contact resistance values. Gold contacts were also modified by treating them with self-assembled monolayers (SAMs) of aromatic thiols. Electron-poor (electron-rich) SAMs resulted in an increase (decrease) in the Au work function because of the electron-withdrawing (-donating) tendency of the polar molecules. The change in metal work-function by SAM modification also resulted in a modulation of the contact resistance. While there was a clear effect on charge injection upon modification of the contacts, either by SAMs or planarization, the mobility values improved only in the short-channel devices indicating that at longer channels the OFETs are channel-limited because of grain-boundary limited charge transport. Photoemission spectroscopy was also conducted to investigate the energy level alignment at bottom-contact (polymer-on-metal) and top-contact (metal-on-polymer) geometries for high work function metals (Au, Pt) and rr-P3HT. The Fermi energy level was found to be pinned at the polaronic energy level within the band gap of rr-P3HT resulting in barrier-less interfaces for charge injection. Photoemission spectroscopy studies of the metal-on-polymer configuration also provided insight into the chemical structure of the metal/polymer interface. Platinum was found to react with sulfur from the thiophene ring whereas Au was found to be relatively unreactive.
Evolution of structural and transport properties in Y-doped double perovskite Sr2FeIrO6
NASA Astrophysics Data System (ADS)
Kharkwal, K. C.; Pramanik, A. K.
2018-05-01
The structural and transport properties of Yttrium doped double perovskite Sr2FeIrO6 have been investigated. Structural properties have been investigated by means of x-ray diffraction measurement and Rietveld analysis. Structural transition has not been observed although lattice parameters evolve with the Yttrium doping. All samples have been found to be insulating over the whole temperature range where the resistivity increases with doping. This increase in resistivity with doping may be due to the change in charge state of transition metal.
Thermoelectric Properties of 2D Ni 3(HITP) 2 and 3D Cu 3(BTC) 2 MOFs: First-Principles Studies
He, Yuping; Talin, A. Alec; Allendorf, Mark D.
2017-08-08
Metal organic frameworks (MOFs) have recently attracted great attentions for the thermoelectric (TE) applications, owing to their intrinsic low thermal conductivity, but their TE efficiencies are still low due to the poor electronic transport properties. Here, various synthetic strategies have been designed to optimize the electronic properties of MOFs. Using a series of first principle calculations and band theory, we explore the effect of structural topology and redox matching between the metal and coordinated atoms on the TE transport properties. In conclusion, the presented results provide a fundamental guidance for optimizing electronic charge transport of existing MOFs, and for designingmore » yet to be discovered conductive MOFs for thermoelectric applications.« less
Thermoelectric Properties of 2D Ni 3(HITP) 2 and 3D Cu 3(BTC) 2 MOFs: First-Principles Studies
DOE Office of Scientific and Technical Information (OSTI.GOV)
He, Yuping; Talin, A. Alec; Allendorf, Mark D.
Metal organic frameworks (MOFs) have recently attracted great attentions for the thermoelectric (TE) applications, owing to their intrinsic low thermal conductivity, but their TE efficiencies are still low due to the poor electronic transport properties. Here, various synthetic strategies have been designed to optimize the electronic properties of MOFs. Using a series of first principle calculations and band theory, we explore the effect of structural topology and redox matching between the metal and coordinated atoms on the TE transport properties. In conclusion, the presented results provide a fundamental guidance for optimizing electronic charge transport of existing MOFs, and for designingmore » yet to be discovered conductive MOFs for thermoelectric applications.« less
Van Vooren, Antoine; Kim, Ji-Seon; Cornil, Jérôme
2008-05-16
Poly(9,9-di-n-octylfluorene-alt-benzothiadiazole) [F8BT], displays very different charge-transport properties for holes versus electrons when comparing annealed and pristine thin films and transport parallel (intrachain) and perpendicular (interchain) to the polymer axes. The present theoretical contribution focuses on the electron-transport properties of F8BT chains and compares the efficiency of intrachain versus interchain transport in the hopping regime. The theoretical results rationalize significantly lowered electron mobility in annealed F8BT thin films and the smaller mobility anisotropy (mu( parallel)/mu( perpendicular)) measured for electrons in aligned films (i.e. 5-7 compared to 10-15 for holes).
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mollinger, Sonya A.; Salleo, Alberto; Spakowitz, Andrew J.
While transport in conjugated polymers has many similarities to that in crystalline inorganic materials, several key differences reveal the unique relationship between the morphology of polymer films and the charge mobility. We develop a model that directly incorporates the molecular properties of the polymer film and correctly predicts these unique transport features. At low degree of polymerization, the increase of the mobility with the polymer chain length reveals trapping at chain ends, and saturation of the mobility at high degree of polymerization results from conformational traps within the chains. Similarly, the inverse field dependence of the mobility reveals that transportmore » on single polymer chains is characterized by the ability of the charge to navigate around kinks and loops in the chain. Lastly, these insights emphasize the connection between the polymer conformations and the transport and thereby offer a route to designing improved device morphologies through molecular design and materials processing.« less
Mollinger, Sonya A.; Salleo, Alberto; Spakowitz, Andrew J.
2016-11-10
While transport in conjugated polymers has many similarities to that in crystalline inorganic materials, several key differences reveal the unique relationship between the morphology of polymer films and the charge mobility. We develop a model that directly incorporates the molecular properties of the polymer film and correctly predicts these unique transport features. At low degree of polymerization, the increase of the mobility with the polymer chain length reveals trapping at chain ends, and saturation of the mobility at high degree of polymerization results from conformational traps within the chains. Similarly, the inverse field dependence of the mobility reveals that transportmore » on single polymer chains is characterized by the ability of the charge to navigate around kinks and loops in the chain. Lastly, these insights emphasize the connection between the polymer conformations and the transport and thereby offer a route to designing improved device morphologies through molecular design and materials processing.« less
Controllability of the Coulomb charging energy in close-packed nanoparticle arrays.
Duan, Chao; Wang, Ying; Sun, Jinling; Guan, Changrong; Grunder, Sergio; Mayor, Marcel; Peng, Lianmao; Liao, Jianhui
2013-11-07
We studied the electronic transport properties of metal nanoparticle arrays, particularly focused on the Coulomb charging energy. By comparison, we confirmed that it is more reasonable to estimate the Coulomb charging energy using the activation energy from the temperature-dependent zero-voltage conductance. Based on this, we systematically and comprehensively investigated the parameters that could be used to tune the Coulomb charging energy in nanoparticle arrays. We found that four parameters, including the particle core size, the inter-particle distance, the nearest neighboring number, and the dielectric constant of ligand molecules, could significantly tune the Coulomb charging energy.
NASA Astrophysics Data System (ADS)
Li, Qian; Li, Shilong; Yang, Dehua; Su, Wei; Wang, Yanchun; Zhou, Weiya; Liu, Huaping; Xie, Sishen
2017-10-01
The electrical characteristics of carbon nanotube (CNT) thin-film transistors (TFTs) strongly depend on the properties of the gate dielectric that is in direct contact with the semiconducting CNT channel materials. Here, we systematically investigated the dielectric effects on the electrical characteristics of fully printed semiconducting CNT-TFTs by introducing the organic dielectrics of poly(methyl methacrylate) (PMMA) and octadecyltrichlorosilane (OTS) to modify SiO2 dielectric. The results showed that the organic-modified SiO2 dielectric formed a favorable interface for the efficient charge transport in s-SWCNT-TFTs. Compared to single-layer SiO2 dielectric, the use of organic-inorganic hybrid bilayer dielectrics dramatically improved the performances of SWCNT-TFTs such as mobility, threshold voltage, hysteresis and on/off ratio due to the suppress of charge scattering, gate leakage current and charge trapping. The transport mechanism is related that the dielectric with few charge trapping provided efficient percolation pathways for charge carriers, while reduced the charge scattering. High density of charge traps which could directly act as physical transport barriers and significantly restrict the charge carrier transport and, thus, result in decreased mobile carriers and low device performance. Moreover, the gate leakage phenomenon is caused by conduction through charge traps. So, as a component of TFTs, the gate dielectric is of crucial importance to the manufacture of high quality TFTs from the aspects of affecting the gate leakage current and device operation voltage, as well as the charge carrier transport. Interestingly, the OTS-modified SiO2 allows to directly print horizontally aligned CNT film, and the corresponding devices exhibited a higher mobility than that of the devices with the hybrid PMMA/SiO2 dielectric although the thickness of OTS layer is only ˜2.5 nm. Our present result may provide key guidance for the further development of printed nanomaterial electronics.
100-Fold Enhancement of Charge Transport in Uniaxially Oriented Mesoporous Anatase TiO 2 Films
Li, Ke; Liu, Jie; Sheng, Xia; ...
2017-12-04
Mesoporous semiconductor films are of considerable interest for applications in photoelectrochemical devices, however, despite intensive research till now, their charge transport properties remain significantly lower than their single-crystal counterparts. Herein, we report a novel low-temperature template-free technique for growing high surface area mesoporous anatase TiO2 films with a preferred [001] crystalline-orientation on FTO-coated glass substrate. Compared to mesoporous films that comprised of randomly oriented crystallites, the uniaxial orientation enables a 100-fold increase in the rate of electron transport. The uniaxially oriented mesoporous anatase TiO2 films exhibit should greatly facilitate the development and application of photoelectrochemical and electrochemical devices.
Electronic and transport properties of a molecular junction with asymmetric contacts.
Tsai, M-H; Lu, T-H
2010-02-10
Asymmetric molecular junctions have been shown experimentally to exhibit a dual-conductance transport property with a pulse-like current-voltage characteristic, by Reed and co-workers. Using a recently developed first-principles integrated piecewise thermal equilibrium current calculation method and a gold-benzene-1-olate-4-thiolate-gold model molecular junction, this unusual transport property has been reproduced. Analysis of the electrostatics and the electronic structure reveals that the high-current state results from subtle bias induced charge transfer at the electrode-molecule contacts that raises molecular orbital energies and enhances the current-contributing molecular density of states and the probabilities of resonance tunneling of conduction electrons from one electrode to another.
Composition dependence of charge and magnetic length scales in mixed valence manganite thin films
Singh, Surendra; Freeland, J. W.; Fitzsimmons, M. R.; Jeen, H.; Biswas, A.
2016-01-01
Mixed-valence manganese oxides present striking properties like the colossal magnetoresistance, metal-insulator transition (MIT) that may result from coexistence of ferromagnetic, metallic and insulating phases. Percolation of such phase coexistence in the vicinity of MIT leads to first-order transition in these manganites. However the length scales over which the electronic and magnetic phases are separated across MIT which appears compelling for bulk systems has been elusive in (La1−yPry)1−xCaxMnO3 films. Here we show the in-plane length scale over which charge and magnetism are correlated in (La0.4Pr0.6)1−xCaxMnO3 films with x = 0.33 and 0.375, across the MIT temperature. We combine electrical transport (resistance) measurements, x-ray absorption spectroscopy (XAS), x-ray magnetic circular dichroism (XMCD), and specular/off-specular x-ray resonant magnetic scattering (XRMS) measurements as a function of temperature to elucidate relationships between electronic, magnetic and morphological structure of the thin films. Using off-specular XRMS we obtained the charge-charge and charge-magnetic correlation length of these LPCMO films across the MIT. We observed different charge-magnetic correlation length for two films which increases below the MIT. The different correlation length shown by two films may be responsible for different macroscopic (transport and magnetic) properties. PMID:27461993
Numerical Simulation of Ion Transport in a Nano-Electrospray Ion Source at Atmospheric Pressure
NASA Astrophysics Data System (ADS)
Wang, Wei; Bajic, Steve; John, Benzi; Emerson, David R.
2018-03-01
Understanding ion transport properties from the ion source to the mass spectrometer (MS) is essential for optimizing device performance. Numerical simulation helps in understanding of ion transport properties and, furthermore, facilitates instrument design. In contrast to previously reported numerical studies, ion transport simulations in a continuous injection mode whilst considering realistic space-charge effects have been carried out. The flow field was solved using Reynolds-averaged Navier-Stokes (RANS) equations, and a particle-in-cell (PIC) method was applied to solve a time-dependent electric field with local charge density. A series of ion transport simulations were carried out at different cone gas flow rates, ion source currents, and capillary voltages. A force evaluation analysis reveals that the electric force, the drag force, and the Brownian force are the three dominant forces acting on the ions. Both the experimental and simulation results indicate that cone gas flow rates of ≤250 slph (standard liter per hour) are important for high ion transmission efficiency, as higher cone gas flow rates reduce the ion signal significantly. The simulation results also show that the ion transmission efficiency reduces exponentially with an increased ion source current. Additionally, the ion loss due to space-charge effects has been found to be predominant at a higher ion source current, a lower capillary voltage, and a stronger cone gas counterflow. The interaction of the ion driving force, ion opposing force, and ion dispersion is discussed to illustrate ion transport mechanism in the ion source at atmospheric pressure. [Figure not available: see fulltext.
Numerical Simulation of Ion Transport in a Nano-Electrospray Ion Source at Atmospheric Pressure.
Wang, Wei; Bajic, Steve; John, Benzi; Emerson, David R
2018-03-01
Understanding ion transport properties from the ion source to the mass spectrometer (MS) is essential for optimizing device performance. Numerical simulation helps in understanding of ion transport properties and, furthermore, facilitates instrument design. In contrast to previously reported numerical studies, ion transport simulations in a continuous injection mode whilst considering realistic space-charge effects have been carried out. The flow field was solved using Reynolds-averaged Navier-Stokes (RANS) equations, and a particle-in-cell (PIC) method was applied to solve a time-dependent electric field with local charge density. A series of ion transport simulations were carried out at different cone gas flow rates, ion source currents, and capillary voltages. A force evaluation analysis reveals that the electric force, the drag force, and the Brownian force are the three dominant forces acting on the ions. Both the experimental and simulation results indicate that cone gas flow rates of ≤250 slph (standard liter per hour) are important for high ion transmission efficiency, as higher cone gas flow rates reduce the ion signal significantly. The simulation results also show that the ion transmission efficiency reduces exponentially with an increased ion source current. Additionally, the ion loss due to space-charge effects has been found to be predominant at a higher ion source current, a lower capillary voltage, and a stronger cone gas counterflow. The interaction of the ion driving force, ion opposing force, and ion dispersion is discussed to illustrate ion transport mechanism in the ion source at atmospheric pressure. Graphical Abstract.
Using DNA-labelled nano- and microparticles to track particle transport in the environment
NASA Astrophysics Data System (ADS)
McNew, Coy; Wang, Chaozi; Dahlke, Helen; Lyon, Steve; Walter, Todd
2017-04-01
By utilizing bio-molecular nanotechnology developed for nano-medicines and drug delivery, we are able to produce DNA-labelled nano- and microparticle tracers for use in a myriad of environmental systems. The use of custom sequenced DNA allows for the fabrication of an enormous number of uniquely labelled tracers with identical transport properties (approximately 1.61 x 1060 unique sequences), each independently quantifiable, that can be applied simultaneously in any hydrologic system. By controlling the fabrication procedure to produce particles of custom size and charge, we are able to tag each size-charge combination uniquely in order to directly probe the effect of these variables on the transport properties of the particles. Here we present our methods for fabrication, extraction, and analysis of the DNA nano- and microparticle tracers, along with results from several successful applications of the tracers, including transport and retention analysis at the lab, continuum, and field scales. To date, our DNA-labelled nano- and microparticle tracers have proved useful in surface and subsurface water applications, soil retention, and even subglacial flow pathways. The range of potential applications continue to prove nearly limitless.
Interactions in charged colloidal suspensions: A molecular dynamics simulation study
NASA Astrophysics Data System (ADS)
Padidela, Uday Kumar; Behera, Raghu Nath
2017-07-01
Colloidal suspensions are extensively used in everyday life and find several applications in the pharmaceutical, chemical, food industries, etc. We present the classical molecular dynamics simulation results of the structural and transport properties of charged colloidal suspensions as a function of its size, charge and concentration. The system is viewed as a two-component (colloids and counterions) primitive model consisting of spherical colloid particle (macroion) and the counterions (micro-particles), which are treated explicitly. The solvent is treated as dielectric continuum. A systematic trend in the radial distribution functions g(r), potential of mean force W(r), different thermodynamic properties and diffusion coefficients is obtained as a function of colloid charge, size and concentration. An attractive minimum in W(r) is obtained at short interparticle distance.
NASA Astrophysics Data System (ADS)
Kim, Jin-Hoon; Triambulo, Ross E.; Park, Jin-Woo
2017-03-01
We investigated the charge injection properties of silver nanowire networks (AgNWs) in a composite-like structure with poly(2,3-dihydrothieno-1,4-dioxin)-poly(styrenesulfonate) (PEDOT:PSS). The composite films acted as the anodes and hole transport layers (HTLs) in organic light-emitting diodes (OLEDs). The current density (J)-voltage (V)-luminance (L) characteristics and power efficiency (ɛ) of the OLEDs were measured to determine their electrical and optical properties. The charge injection properties of the AgNWs in the OLEDs during operation were characterized via impedance spectroscopy (IS) by determining the variations in the capacitances (C) of the devices with respect to the applied V and the corresponding frequency (f). All measured results were compared with results for OLEDs fabricated on indium tin oxide (ITO) anodes. The OLEDs on AgNWs showed lower L and ɛ values than the OLEDs on ITO. It was also observed that AgNWs exhibit excellent charge injection properties and that the interfaces between the AgNWs and the HTL have very small charge injection barriers, resulting in an absence of charge carrier traps when charges move across these interfaces. However, in the AgNW-based OLED, there was a large mismatch in the number of injected holes and electrons. Furthermore, the highly conductive electrical paths of the AgNWs in the composite-like AgNW and PEDOT:PSS structure allowed a large leakage current of holes that did not participate in radiative recombination with the electrons; consequently, a lower ɛ was observed for the AgNW-based OLEDs than for the ITO-based OLEDs. To match the injection of electrons by the electron transport layer (ETL) in the AgNW-based OLED with that of holes by the AgNW/PEDOT:PSS composite anode, the electron injection barrier of the ETL was decreased by using the low work function polyethylenimine ethoxylated (PEIE) doped with n-type cesium carbonate (Cs2CO3). With the doped-PEIE, the performance of the AgNW-based OLED was significantly enhanced through the balanced injection of holes and electrons, which clearly verified our analysis results by IS.
Lee, Seung-Hoon; Xu, Yong; Khim, Dongyoon; Park, Won-Tae; Kim, Dong-Yu; Noh, Yong-Young
2016-11-30
Charge transport in carbon nanotube network transistors strongly depends on the properties of the gate dielectric that is in direct contact with the semiconducting carbon nanotubes. In this work, we investigate the dielectric effects on charge transport in polymer-sorted semiconducting single-walled carbon nanotube field-effect transistors (s-SWNT-FETs) by using three different polymer insulators: A low-permittivity (ε r ) fluoropolymer (CYTOP, ε r = 1.8), poly(methyl methacrylate) (PMMA, ε r = 3.3), and a high-ε r ferroelectric relaxor [P(VDF-TrFE-CTFE), ε r = 14.2]. The s-SWNT-FETs with polymer dielectrics show typical ambipolar charge transport with high ON/OFF ratios (up to ∼10 5 ) and mobilities (hole mobility up to 6.77 cm 2 V -1 s -1 for CYTOP). The s-SWNT-FET with the lowest-k dielectric, CYTOP, exhibits the highest mobility owing to formation of a favorable interface for charge transport, which is confirmed by the lowest activation energies, evaluated by the fluctuation-induced tunneling model (FIT) and the traditional Arrhenius model (E aFIT = 60.2 meV and E aArr = 10 meV). The operational stability of the devices showed a good agreement with the activation energies trend (drain current decay ∼14%, threshold voltage shift ∼0.26 V in p-type regime of CYTOP devices). The poor performance in high-ε r devices is accounted for by a large energetic disorder caused by the randomly oriented dipoles in high-k dielectrics. In conclusion, the low-k dielectric forms a favorable interface with s-SWNTs for efficient charge transport in s-SWNT-FETs.
NASA Astrophysics Data System (ADS)
Cao, Yang; Kobayashi, Nobukiyo; Zhang, Yi-Wen; Ohnuma, Shigehiro; Masumoto, Hiroshi
2017-10-01
Spin-dependent charge transport behavior involving the recently discovered tunnel-type magneto-dielectric (TMD) and magnetoresistance (TMR) effects was studied in Co-(Al-fluoride) granular nanocomposites. By setting a changeable partition height (t = 1-4 cm) on a substrate holder in a conventional co-sputtering (CS) deposition system, we developed a co-separate sputtering (CSS) method to fabricate Co-(Al-F) granular nanocomposites. XPS analysis shows that the Al content remains balanced between the Al metal and Al-F compounds by controlling t. This phenomenon can be attributed to the magnetron plasma interference from the two target sources. Fittings between TMR and normalized magnetization suggest that the CSS films with clear granular structures may have high spin polarization. Compared with the CS samples (t = 0 cm), the CSS films with t = 4 cm show enhanced charge transport properties with a maximum TMD ratio (0.5%) and TMR ratio (7.2%) under a magnetic field of H = 10 kOe. This study demonstrates that the Al-F tunnel barrier between Co granules plays an essential role in controlling the charge transport behavior and will be of significance for applications in field sensors and impedance-tunable devices with large magnetic-field response.
Carrier transport performance of Cd0.9Zn0.1Te detector by direct current photoconductive technology
NASA Astrophysics Data System (ADS)
Ling, Yunpeng; Min, Jiahua; Liang, Xiaoyan; Zhang, Jijun; Yang, Liuqing; Zhang, Ying; Li, Ming; Liu, Zhaoxin; Wang, Linjun
2017-01-01
In this paper, based on the derivation of the Hecht model and Many model, we establish a new theoretical model and deduce its mathematical equation by considering an even-distributed charged center of certain concentration under constant illumination. This model helps us deeply understand the carrier transport performance of Cd0.9Zn0.1Te (CZT) under various illuminations and non-uniform distribution of the internal electric field in CZT. In our research, direct current photoconductive technology (DCPT) is applied to assess the electrical transport properties of carriers in CZT crystals, which is verified by room temperature Am-241 alpha-particle responses and charge collection efficiency test. The mobility-lifetime product ( μτ ) for carriers is extracted from fitting the Hecht model by DCPT for CZT radiated from the cathode and anode by a constant laser, respectively. Moreover, the carrier transport properties of CZT under various light intensities and during a wide range of temperatures are also taken and analyzed in detail, which enable us to develop the best performance of CZT. In addition, we figure out a method for estimating μeτe and μhτh on different positions of CZT wafer on the basis of the pixel detector that collects single polarity charge, and several corrective actions have improved the accuracy of the measurement.
Microstructural Analysis and Transport Resistances of Low-Platinum-Loaded PEFC Electrodes
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cetinbas, Firat C.; Wang, Xiaohua; Ahluwalia, Rajesh K.
In this study, we present microstructural characterization for polymer electrolyte fuel cell (PEFC) cathodes with low platinum loadings (low-PGM). The characterization results are used to quantify the contribution of mass transport resistances to cell voltage losses observed in polarization curve data. Three-dimensional pore morphology and ionomer distribution are resolved using nano-scale X-ray computed tomography (nano-CT). Electrode structural properties are reported along with analysis of the impact of microstructure on the effective charge and reactant transport properties. These characterizations are incorporated with a two-dimensional multi-physics model that accounts for energy, charge, and mass transport along with the effect of liquid watermore » flooding. Defining a total mass transport resistance for the whole polarization curve, contributions of transport mechanisms are identified. Analysis of the experimental polarization curves at different operating pressures and temperatures indicates that the mass transport resistance in the cathode is dominated by the transport processes in the electrode. It is shown that flooding in the electrode is a major contributor to transport losses especially at elevated operating pressures while the pressure-independent resistance at the catalyst surface due to transport through the ionomer film plays a significant role, especially at low temperatures and low catalyst loading. In addition, by performing a parametric study for varying catalyst loadings, the importance of electrode roughness (i.e, electrochemically-active surface area/geometric electrode area) in determining the mass transport losses is highlighted.« less
Microstructural Analysis and Transport Resistances of Low-Platinum-Loaded PEFC Electrodes
Cetinbas, Firat C.; Wang, Xiaohua; Ahluwalia, Rajesh K.; ...
2017-12-09
In this study, we present microstructural characterization for polymer electrolyte fuel cell (PEFC) cathodes with low platinum loadings (low-PGM). The characterization results are used to quantify the contribution of mass transport resistances to cell voltage losses observed in polarization curve data. Three-dimensional pore morphology and ionomer distribution are resolved using nano-scale X-ray computed tomography (nano-CT). Electrode structural properties are reported along with analysis of the impact of microstructure on the effective charge and reactant transport properties. These characterizations are incorporated with a two-dimensional multi-physics model that accounts for energy, charge, and mass transport along with the effect of liquid watermore » flooding. Defining a total mass transport resistance for the whole polarization curve, contributions of transport mechanisms are identified. Analysis of the experimental polarization curves at different operating pressures and temperatures indicates that the mass transport resistance in the cathode is dominated by the transport processes in the electrode. It is shown that flooding in the electrode is a major contributor to transport losses especially at elevated operating pressures while the pressure-independent resistance at the catalyst surface due to transport through the ionomer film plays a significant role, especially at low temperatures and low catalyst loading. In addition, by performing a parametric study for varying catalyst loadings, the importance of electrode roughness (i.e, electrochemically-active surface area/geometric electrode area) in determining the mass transport losses is highlighted.« less
Durand, Corentin; Zhang, Xiaoguang; Fowlkes, Jason; ...
2015-01-16
We study the electrical transport properties of atomically thin individual crystalline grains of MoS 2 with four-probe scanning tunneling microscopy. The monolayer MoS 2 domains are synthesized by chemical vapor deposition on SiO 2/Si substrate. Temperature dependent measurements on conductance and mobility show that transport is dominated by an electron charge trapping and thermal release process with very low carrier density and mobility. The effects of electronic irradiation are examined by exposing the film to electron beam in the scanning electron microscope in an ultrahigh vacuum environment. The irradiation process is found to significantly affect the mobility and the carriermore » density of the material, with the conductance showing a peculiar time-dependent relaxation behavior. It is suggested that the presence of defects in active MoS 2 layer and dielectric layer create charge trapping sites, and a multiple trapping and thermal release process dictates the transport and mobility characteristics. The electron beam irradiation promotes the formation of defects and impact the electrical properties of MoS 2. Finally, our study reveals the important roles of defects and the electron beam irradiation effects in the electronic properties of atomic layers of MoS 2.« less
Charge carrier thermalization in organic diodes
van der Kaap, N. J.; Koster, L. J. A.
2016-01-01
Charge carrier mobilities of organic semiconductors are often characterized using steady-state measurements of space charge limited diodes. These measurements assume that charge carriers are in a steady-state equilibrium. In reality, however, energetically hot carriers are introduces by photo-excitation and injection into highly energetic sites from the electrodes. These carriers perturb the equilibrium density of occupied states, and therefore change the overall charge transport properties. In this paper, we look into the effect of energetically hot carriers on the charge transport in organic semiconductors using steady state kinetic Monte Carlo simulations. For injected hot carriers in a typical organic semiconductor, rapid energetic relaxation occurs in the order of tens of nanoseconds, which is much faster than the typical transit time of a charge carrier throught the device. Furthermore, we investigate the impact of photo-generated carriers on the steady-state mobility. For a typical organic voltaic material, an increase in mobility of a factor of 1.1 is found. Therefore, we conclude that the impact of energetically hot carriers on normal device operation is limited. PMID:26791095
Electrical properties of polycrystalline olivine: evidence for grain boundary transport
NASA Astrophysics Data System (ADS)
Ten Grotenhuis, S. M.; Drury, M. R.; Peach, C. J.; Spiers, C. J.
2003-12-01
The physical and chemical properties of grain boundaries are known to play an important role in determining the electrical properties of polycrystalline oxides. Grain boundaries can either enhance conductivity if the transport of charge carriers along the grain boundaries is faster than through the lattice, or grain boundaries can reduce conductivity if the grain boundaries block the transport of charge carriers. The purpose of the experiments presented here is to deduce the mechanisms responsible for electrical conductivity in fine-grained forsterite, the Mg-end member of olivine, in order to get a better understanding of the contribution of grain boundary transport, of the properties of the grain boundaries, and to determine any relation between grain size and conductivity. A relationship between grain size and conductivity at high temperature could potentially be used to interpret zones of anomalous conductivity in the upper mantle. The materials studied consist of fine-grained forsterite (Mg2SiO4) with a minor amount (5%) of enstatite (MgSiO3) added. The electrical conductivity of three melt-free synthetic polycrystalline samples, with grain sizes between 1.1 and 4.7 mm, was measured at temperatures up to 1470° C. The complex impedance plots display one clear arc, indicating a single dominant conduction mechanism. Bulk conductivity is inversely proportional to the grain size of the different samples. This relation suggests that grain boundary diffusion of the charge carriers is controlling the electrical conductivity of the samples. The activation energy for diffusion of the charge carriers lies between 315 and 323 kJ/mol. This resembles previous data on grain boundary diffusion of Mg in forsterite and grain boundary diffusion creep. A geometrical model of less conducting cubic grains and more conducting grain boundaries agrees well with the experimental data. This model is applied to a natural mantle shear zone to predict the conductivity contrast between fine-grained shear zones and less deformed regions in the lithosphere. Upper mantle shear zones are predicted to have 1.5 to 2 orders of magnitude higher conductivity than less deformed regions in the lithosphere. This may mean that fine-grained shear zones can be detected using magnetotelluric methods.
Tsutsui, Yusuke; Schweicher, Guillaume; Chattopadhyay, Basab; Sakurai, Tsuneaki; Arlin, Jean-Baptiste; Ruzié, Christian; Aliev, Almaz; Ciesielski, Artur; Colella, Silvia; Kennedy, Alan R; Lemaur, Vincent; Olivier, Yoann; Hadji, Rachid; Sanguinet, Lionel; Castet, Frédéric; Osella, Silvio; Dudenko, Dmytro; Beljonne, David; Cornil, Jérôme; Samorì, Paolo; Seki, Shu; Geerts, Yves H
2016-09-01
The structural and electronic properties of four isomers of didodecyl[1]-benzothieno[3,2-b][1]benzothiophene (C12-BTBT) have been investigated. Results show the strong impact of the molecular packing on charge carrier transport and electronic polarization properties. Field-induced time-resolved microwave conductivity measurements unravel an unprecedented high average interfacial mobility of 170 cm(2) V(-1) s(-1) for the 2,7-isomer, holding great promise for the field of organic electronics. © 2016 The Authors. Published by WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Transport properties of ultrathin black phosphorus on hexagonal boron nitride
DOE Office of Scientific and Technical Information (OSTI.GOV)
Doganov, Rostislav A.; Özyilmaz, Barbaros; Department of Physics, National University of Singapore, 2 Science Drive 3, 117542 Singapore
2015-02-23
Ultrathin black phosphorus, or phosphorene, is a two-dimensional material that allows both high carrier mobility and large on/off ratios. Similar to other atomic crystals, like graphene or layered transition metal dichalcogenides, the transport behavior of few-layer black phosphorus is expected to be affected by the underlying substrate. The properties of black phosphorus have so far been studied on the widely utilized SiO{sub 2} substrate. Here, we characterize few-layer black phosphorus field effect transistors on hexagonal boron nitride—an atomically smooth and charge trap-free substrate. We measure the temperature dependence of the field effect mobility for both holes and electrons and explainmore » the observed behavior in terms of charged impurity limited transport. We find that in-situ vacuum annealing at 400 K removes the p-doping of few-layer black phosphorus on both boron nitride and SiO{sub 2} substrates and reduces the hysteresis at room temperature.« less
Influence of functional groups on charge transport in molecular junctions
NASA Astrophysics Data System (ADS)
Mowbray, D. J.; Jones, G.; Thygesen, K. S.
2008-03-01
Using density functional theory (DFT), we analyze the influence of five classes of functional groups, as exemplified by NO2, OCH3, CH3, CCl3, and I, on the transport properties of a 1,4-benzenedithiolate (BDT) and 1,4-benzenediamine (BDA) molecular junction with gold electrodes. Our analysis demonstrates how ideas from functional group chemistry may be used to engineer a molecule's transport properties, as was shown experimentally and using a semiempirical model for BDA [Nano Lett. 7, 502 (2007)]. In particular, we show that the qualitative change in conductance due to a given functional group can be predicted from its known electronic effect (whether it is σ /π donating/withdrawing). However, the influence of functional groups on a molecule's conductance is very weak, as was also found in the BDA experiments. The calculated DFT conductances for the BDA species are five times larger than the experimental values, but good agreement is obtained after correcting for self-interaction and image charge effects.
NASA Technical Reports Server (NTRS)
Baldwin, Richard S.
1987-01-01
The overall energy conversion efficiency of a hydrogen-bromine energy storage system is highly dependent upon the characteristics and performance of the ion-exchange membrane utilized as a half-cell separator. The electrochemical performance and transport properties of a duPont Nafion membrane in an aqueous HBr-Br2 environment were investigated. Membrane conductivity data are presented as a function of HBr concentration and temperature for the determination of ohmic voltage losses across the membrane in an operational cell. Diffusion-controlled bromine permeation rates and permeabilities are presented as functions of solution composition and temperature. Relationships between the degree of membrane hydration and the membrane transport characteristics are discussed. The solution chemistry of an operational hydrogen-bromine cell undergoing charge from 45% HBr to 5% HBr is discussed, and, based upon the experimentally observed bromine permeation behavior, predicted cell coulombic losses due to bromine diffusion through the membrane are presented as a function of the cell state-of-charge.
CONJUGATED POLYMERS AND POLYELECTROLYTES IN SOLAR PHOTOCONVERSION, Final Technical Report
DOE Office of Scientific and Technical Information (OSTI.GOV)
Schanze, Kirk S
2014-08-05
This DOE-supported program investigated the fundamental properties of conjugated polyelectrolytes, with emphasis placed on studies of excited state energy transport, self-assembly into conjugated polyelectroyte (CPE) based films and colloids, and exciton transport and charge injection in CPE films constructed atop wide bandgap semiconductors. In the most recent grant period we have also extended efforts to examine the properties of low-bandgap donor-acceptor conjugated polyelectrolytes that feature strong visible light absorption and the ability to adsorb to metal-oxide interfaces.
Charge Transport and Thermoelectric Properties of (Nd1- z Yb z ) y Fe4- x Co x Sb12 Skutterudites
NASA Astrophysics Data System (ADS)
Shin, Dong-Kil; Jang, Kyung-Wook; Choi, Soon-Mok; Lee, Soonil; Seo, Won-Seon; Kim, Il-Ho
2018-06-01
Partially double-filled (Nd1- z Yb z ) y Fe4- x Co x Sb12 ( z = 0.25, 0.75, y = 0.8, and x = 0, 0.5, 1.0) skutterudites were prepared by encapsulated melting, annealing, and hot pressing, and the effects of Nd/Yb partial double filling and Co charge compensation on the microstructure, charge transport, and thermoelectric properties were investigated. All the specimens were transformed to the skutterudite phase together with a few secondary phases such as FeSb2, but FeSb2 formation was suppressed on increasing Co content. Nd and Yb were successfully double-filled in the voids of the skutterudite lattice and Co was well substituted at Fe sites, as indicated by changes in the lattice constant with Nd/Yb filling and Fe/Co substitution. All the specimens showed p-type conduction and exhibited degenerate semiconductor characteristics at temperatures from 323 K to 823 K, and the charge transport properties depended on the filling ratio of Nd and Yb because of the difference between the valencies of Nd and Yb. The electrical conductivity decreased and the Seebeck coefficient increased owing to a decrease in the carrier concentration with increasing Co content. The lattice thermal conductivity decreased because phonon scattering was enhanced by Nd and Yb partial double filling, but partially double-filled specimens did not exhibit a further significant reduction in the lattice thermal conductivity compared with the completely double-filled specimens. A maximum ZT of 0.83 was obtained for (Nd0.75Yb0.25)0.8Fe3CoSb12 at 723 K.
Noise And Charge Transport In Carbon Nanotube Devices
NASA Astrophysics Data System (ADS)
Reza, Shahed; Huynh, Quyen T.; Bosman, Gijs; Sippel, Jennifer; Rinzler, Andrew G.
2005-11-01
The charge transport and noise properties of three terminal, gated devices containing multiple, single wall, metallic and semiconductor carbon nanotubes have been measured as a function of gate and drain bias at 300K. Using pulsed bias the metallic tubes could be burned sequentially enabling the separation of measured conductance and low frequency excess noise into metallic and semiconductor contributions. The relative low frequency excess noise of the metallic tubes was about a factor 100 lower than that of the semiconductor tubes, whereas the conductance of the metallic tubes was significantly higher (10 to 50 times) than that of the semiconductor tubes.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Dincă, Mircea; Léonard, François
Metal–organic frameworks (MOFs), with their crystalline nanoporous three-dimensional structures, have emerged as unique multifunctional materials that combine high porosity with catalytic, photophysical, or other properties to reveal new fundamental science and applications. Because MOFs are composed of organic molecules linking metal centers in ways that are not usually conducive to the formation of free-charge carriers or low-energy charge-transport pathways, they are typically insulators. Accordingly, applications so far have harnessed the unique structural properties and porosity of MOFs, which depend only to a small extent on the ability to manipulate their electronic structure. An exciting new area has emerged due tomore » the recent demonstration of MOFs with controlled electronic and optical properties, which is enabling new fundamental science and opens up the possibility of applications in electronics and photonics. This article presents an overview of the fundamental science issues related to controlling electronic and optical properties of MOFs, and how research groups worldwide have been exploring such properties for electronics, thermoelectrics, photophysics, and charge storage.« less
Conduction properties of thin films from a water soluble carbon nanotube/hemicellulose complex
NASA Astrophysics Data System (ADS)
Shao, Dongkai; Yotprayoonsak, Peerapong; Saunajoki, Ville; Ahlskog, Markus; Virtanen, Jorma; Kangas, Veijo; Volodin, Alexander; Van Haesendonck, Chris; Burdanova, Maria; Mosley, Connor D. W.; Lloyd-Hughes, James
2018-04-01
We have examined the conductive properties of carbon nanotube based thin films, which were prepared via dispersion in water by non-covalent functionalization of the nanotubes with xylan, a type of hemicellulose. Measurements of low temperature conductivity, Kelvin probe force microscopy, and high frequency (THz) conductivity elucidated the intra-tube and inter-tube charge transport processes in this material. The measurements show excellent conductive properties of the as prepared thin films, with bulk conductivity up to 2000 S cm-1. The transport results demonstrate that the hemicellulose does not seriously interfere with the inter-tube conductance.
Electronic Transport in Two-Dimensional Materials
NASA Astrophysics Data System (ADS)
Sangwan, Vinod K.; Hersam, Mark C.
2018-04-01
Two-dimensional (2D) materials have captured the attention of the scientific community due to the wide range of unique properties at nanometer-scale thicknesses. While significant exploratory research in 2D materials has been achieved, the understanding of 2D electronic transport and carrier dynamics remains in a nascent stage. Furthermore, because prior review articles have provided general overviews of 2D materials or specifically focused on charge transport in graphene, here we instead highlight charge transport mechanisms in post-graphene 2D materials, with particular emphasis on transition metal dichalcogenides and black phosphorus. For these systems, we delineate the intricacies of electronic transport, including band structure control with thickness and external fields, valley polarization, scattering mechanisms, electrical contacts, and doping. In addition, electronic interactions between 2D materials are considered in the form of van der Waals heterojunctions and composite films. This review concludes with a perspective on the most promising future directions in this fast-evolving field.
NASA Astrophysics Data System (ADS)
Allen, Jonathan Robert
This dissertation details work done on two different descriptions of charge transport. The first topic is energetic disorder in organic semiconductors, and its effect on charge transport. This is motivated primarily by solar cells, which can be broadly classified as either inorganic or organic. The inorganic class of solar cells is older, and more well-developed, with the most common type being constructed from crystalline silicon. The large silicon crystals required for these cells are expensive to manufacture, which gave rise to interest in photovoltaic cells made from much less costly organic polymers. These organic materials are also less efficient than their silicon counterparts, due to a large degree of spatial and energetic disorder. In this document, the sources and structure of energetic disorder in organic semiconductors are explored, with an emphasis on spatial correlations in energetic disorder. In order for an organic photovoltaic device to function, there must be photogeneration of an exciton (a bound electron-hole pair), exciton transport, exciton dissociation, and transport of the individual charges to their respective terminals. In the case of this thesis, the main focus is exciton dissociation. The effects of correlation on exciton dissociation are examined through computer simulation, and compared to the theory and simulations of previous researchers. We conclude that energetic disorder in organic semiconductors is spatially correlated, and that this correlation improves the ability of excitons to dissociate. The second topic of this dissertation is the Fragment Hamiltonian model. This is a model currently in development as a means of describing charge transport across a range of systems. Currently there are many different systems which exhibit various charge transport behaviors, which are described by several different models. The overarching goal of the Fragment Hamiltonian model is to construct a description of charge transport which accurately describes the behavior of multiple different materials (i.e. metallic conductors or ceramic insulators) in the appropriate limits. The Fragment Hamiltonian model is explored in the context of the tight-binding model, and properties such as the conductivity of several different systems are deduced.
Charged and uncharged vortices in quasiclassical theory
NASA Astrophysics Data System (ADS)
Masaki, Yusuke; Kato, Yusuke
2018-03-01
The charging effect of a superconducting vortex core is very important for transport properties of superconducting vortices. The chiral p-wave superconductor, known as a topological superconductor (SC), has a Majorana fermion in a vortex core and the charging effect has been studied using microscopic Bogoliubov{de Gennes (BdG) theory. According to calculations based on the BdG theory, one type of the vortex is charged as well as the vortex of the s-wave SC, while the other is uncharged. We reproduce this interesting charging effect using an augmented quasiclassical theory in chiral p-wave SCs, by which we can deal with particle-hole asymmetry in the quasiclassical approximation.
E. coli Surface Properties Differ between Stream Water and Sediment Environments.
Liang, Xiao; Liao, Chunyu; Thompson, Michael L; Soupir, Michelle L; Jarboe, Laura R; Dixon, Philip M
2016-01-01
The importance of E. coli as an indicator organism in fresh water has led to numerous studies focusing on cell properties and transport behavior. However, previous studies have been unable to assess if differences in E. coli cell surface properties and genomic variation are associated with different environmental habitats. In this study, we investigated the variation in characteristics of E. coli obtained from stream water and stream bottom sediments. Cell properties were measured for 77 genomically different E. coli strains (44 strains isolated from sediments and 33 strains isolated from water) under common stream conditions in the Upper Midwestern United States: pH 8.0, ionic strength 10 mM and 22°C. Measured cell properties include hydrophobicity, zeta potential, net charge, total acidity, and extracellular polymeric substance (EPS) composition. Our results indicate that stream sediment E. coli had significantly greater hydrophobicity, greater EPS protein content and EPS sugar content, less negative net charge, and higher point of zero charge than stream water E. coli . A significant positive correlation was observed between hydrophobicity and EPS protein for stream sediment E. coli but not for stream water E. coli . Additionally, E. coli surviving in the same habitat tended to have significantly larger (GTG) 5 genome similarity. After accounting for the intrinsic impact from the genome, environmental habitat was determined to be a factor influencing some cell surface properties, such as hydrophobicity. The diversity of cell properties and its resulting impact on particle interactions should be considered for environmental fate and transport modeling of aquatic indicator organisms such as E. coli .
Charge-transport in tin-iodide perovskite CH3NH3SnI3: origin of high conductivity.
Takahashi, Yukari; Obara, Rena; Lin, Zheng-Zhong; Takahashi, Yukihiro; Naito, Toshio; Inabe, Tamotsu; Ishibashi, Shoji; Terakura, Kiyoyuki
2011-05-28
The structural and electrical properties of a metal-halide cubic perovskite, CH(3)NH(3)SnI(3), have been examined. The band structure, obtained using first-principles calculation, reveals a well-defined band gap at the Fermi level. However, the temperature dependence of the single-crystal electrical conductivity shows metallic behavior down to low temperatures. The temperature dependence of the thermoelectric power is also metallic over the whole temperature range, and the large positive value indicates that charge transport occurs with a low concentration of hole carriers. The metallic properties of this as-grown crystal are thus suggested to result from spontaneous hole-doping in the crystallization process, rather than the semi-metal electronic structure. The present study shows that artificial hole doping indeed enhances the conductivity.
Chalcogenide Perovskites for Solar Energy Harvesting
NASA Astrophysics Data System (ADS)
Perera, Samanthe
Methylammonium Lead halide perovskites have recently emerged as a promising candidate for realizing high efficient low cost photovoltaic modules. Charge transport properties of the solution processed halide perovskites are comparable to some of the existing absorbers used in the current PV industry which require sophisticated processing techniques. Due to this simple processing required to achieve high efficiencies, halide perovskites have become an active field of research. As a result, perovskite solar cells are rapidly reaching towards theoretical efficiency limit of close to 30%. It's believed that ionicity inherent to perovskite materials is one of the contributing factors for the excellent charge transport properties of perovskites. Despite the growing interest for solar energy harvesting purposes, these halide perovskites have serious limitations such as toxicity and instability that need to be addressed in order to commercialize the solar cells incorporating them. This dissertation focuses on a new class of ionic semiconductors, chalcogenide perovskites for solar energy harvesting purposes. Coming from the family perovskites they are expected to have same excellent charge transport properties inherent to perovskites due to the ionicity. Inspired by few theoretical studies on chalcogenide perovskites, BaZrS3 and its Ti alloys were synthesized by sulfurizing the oxide counterpart. Structural characterizations have confirmed the predicted distorted perovskite phase. Optical characterizations have verified the direct band gap suitable for thin film single junction solar cells. Anion alloying was demonstrated by synthesizing oxysulfides with widely tunable band gap suitable for applications such as solid state lighting and sensing.
Optical properties of two-dimensional charge density wave materials
NASA Astrophysics Data System (ADS)
Sayers, Charles; Karbassi, Sara; Friedemann, Sven; da Como, Enrico
Titanium diselenide (TiSe2) is a member of the layered transition metal dichalcogenide (TMD) materials. It exhibits unusual chiral charge ordering below 190 K after undergoing an initial phase transition to a commensurate (2 x 2 x 2) charge density wave (CDW) at 200 K which is enhanced further in the monolayer. Recently, the first evidence of chirality in a CDW system was discovered in this material by scanning tunneling microscopy and time-resolved reflectivity experiments, where separate left and right handed charge-ordered domains were found to exist within a single sample. We have prepared single crystals of 1T-TiSe2 using iodine vapour transport, and confirmed their quality by x-ray analysis and charge transport measurements. Using a combination of polarised optical spectroscopy techniques in the mid to far infrared (4 to 700 meV photon energy), we have measured an anisotropy relating to the CDW gap. We discuss the results on the basis of chiral domains with different handedness and the nature of the CDW transition.
NASA Astrophysics Data System (ADS)
Rajamanickam, Govindaraj; Narendhiran, Santhosh; Muthu, Senthil Pandian; Mukhopadhyay, Sumita; Perumalsamy, Ramasamy
2017-12-01
Titanium dioxide is a promising wide band gap semiconducting material for dye-sensitized solar cell. The poor electron transport properties still remain a challenge with conventional nanoparticles. Here, we synthesized TiO2 nanorods/nanoparticles by hydrothermal method to improve the charge transport properties. The structural and morphological information of the prepared nanorods/nanoparticles was analysed with X-ray diffraction and electron microscopy analysis, respectively. A high power conversion efficiency of 7.7% is achieved with nanorods/nanoparticles employed device under 100 mW/cm2. From the electrochemical impedance analysis, superior electron transport properties have been found for synthesized TiO2 nanorods/nanoparticles employed device than commercial P25 nanoparticles based device.
Electrical transport properties of single-crystal CaB 6 , SrB 6 , and BaB 6
Stankiewicz, Jolanta; Rosa, Priscila F. S.; Schlottmann, Pedro; ...
2016-09-22
We measure the electrical resistivity and Hall effect of alkaline-earth-metal hexaboride single crystals as a function of temperature, hydrostatic pressure, and magnetic field. The transport properties vary weakly with the external parameters and are modeled in terms of intrinsic variable-valence defects. These defects can stay either in (1) delocalized shallow levels or in (2) localized levels resonant with the conduction band, which can be neutral or negatively charged. Satisfactory agreement is obtained for electronic transport properties in a broad temperature and pressure range, though fitting the magnetoresistance is less straightforward and a combination of various mechanisms is needed to explainmore » the field and temperature dependences.« less
Electrical transport properties of single-crystal CaB 6 , SrB 6 , and BaB 6
DOE Office of Scientific and Technical Information (OSTI.GOV)
Stankiewicz, Jolanta; Rosa, Priscila F. S.; Schlottmann, Pedro
We measure the electrical resistivity and Hall effect of alkaline-earth-metal hexaboride single crystals as a function of temperature, hydrostatic pressure, and magnetic field. The transport properties vary weakly with the external parameters and are modeled in terms of intrinsic variable-valence defects. These defects can stay either in (1) delocalized shallow levels or in (2) localized levels resonant with the conduction band, which can be neutral or negatively charged. Satisfactory agreement is obtained for electronic transport properties in a broad temperature and pressure range, though fitting the magnetoresistance is less straightforward and a combination of various mechanisms is needed to explainmore » the field and temperature dependences.« less
36 CFR 5.6 - Commercial vehicles.
Code of Federal Regulations, 2013 CFR
2013-07-01
... 36 Parks, Forests, and Public Property 1 2013-07-01 2013-07-01 false Commercial vehicles. 5.6... COMMERCIAL AND PRIVATE OPERATIONS § 5.6 Commercial vehicles. (a) The term “Commercial vehicle” as used in... other vehicles when used in transporting movable property for a fee or profit, either as a direct charge...
36 CFR 5.6 - Commercial vehicles.
Code of Federal Regulations, 2011 CFR
2011-07-01
... 36 Parks, Forests, and Public Property 1 2011-07-01 2011-07-01 false Commercial vehicles. 5.6... COMMERCIAL AND PRIVATE OPERATIONS § 5.6 Commercial vehicles. (a) The term “Commercial vehicle” as used in... other vehicles when used in transporting movable property for a fee or profit, either as a direct charge...
36 CFR 5.6 - Commercial vehicles.
Code of Federal Regulations, 2010 CFR
2010-07-01
... 36 Parks, Forests, and Public Property 1 2010-07-01 2010-07-01 false Commercial vehicles. 5.6... COMMERCIAL AND PRIVATE OPERATIONS § 5.6 Commercial vehicles. (a) The term “Commercial vehicle” as used in... other vehicles when used in transporting movable property for a fee or profit, either as a direct charge...
36 CFR 5.6 - Commercial vehicles.
Code of Federal Regulations, 2012 CFR
2012-07-01
... 36 Parks, Forests, and Public Property 1 2012-07-01 2012-07-01 false Commercial vehicles. 5.6... COMMERCIAL AND PRIVATE OPERATIONS § 5.6 Commercial vehicles. (a) The term “Commercial vehicle” as used in... other vehicles when used in transporting movable property for a fee or profit, either as a direct charge...
36 CFR 5.6 - Commercial vehicles.
Code of Federal Regulations, 2014 CFR
2014-07-01
... 36 Parks, Forests, and Public Property 1 2014-07-01 2014-07-01 false Commercial vehicles. 5.6... COMMERCIAL AND PRIVATE OPERATIONS § 5.6 Commercial vehicles. (a) The term “Commercial vehicle” as used in... other vehicles when used in transporting movable property for a fee or profit, either as a direct charge...
75 FR 6032 - Property Obtained Through the Use of Charge Cards; Notice of GSA Bulletin FMR B-25
Federal Register 2010, 2011, 2012, 2013, 2014
2010-02-05
...: Notice of a bulletin. SUMMARY: This notice announces GSA Federal Management Regulation (FMR) Bulletin B... Policy, Office of Travel, Transportation and Asset Management, at (202) 501- 1777. Please cite Bulletin... streamlining procurement of needed items, the property obtained in this way presents special management and...
Electrostatic Charging of Lunar Dust by UV Photoelectric Emissions and Solar Wind Electrons
NASA Technical Reports Server (NTRS)
Abbas, Mian M.; Tankosic, Dragana; Spann, James f.; LeClair, Andre C.; Dube, Michael J.
2008-01-01
The ubiquitous presence of dust in the lunar environment with its high adhesive characteristics has been recognized to be a major safety issue that must be addressed in view of its hazardous effects on robotic and human exploration of the Moon. The reported observations of a horizon glow and streamers at the lunar terminator during the Apollo missions are attributed to the sunlight scattered by the levitated lunar dust. The lunar surface and the dust grains are predominantly charged positively by the incident UV solar radiation on the dayside and negatively by the solar wind electrons on the night-side. The charged dust grains are levitated and transported over long distances by the established electric fields. A quantitative understanding of the lunar dust phenomena requires development of global dust distribution models, based on an accurate knowledge of lunar dust charging properties. Currently available data of lunar dust charging is based on bulk materials, although it is well recognized that measurements on individual dust grains are expected to be substantially different from the bulk measurements. In this paper we present laboratory measurements of charging properties of Apollo 11 & 17 dust grains by UV photoelectric emissions and by electron impact. These measurements indicate substantial differences of both qualitative and quantitative nature between dust charging properties of individual micron/submicron sized dust grains and of bulk materials. In addition, there are no viable theoretical models available as yet for calculation of dust charging properties of individual dust grains for both photoelectric emissions and electron impact. It is thus of paramount importance to conduct comprehensive measurements for charging properties of individual dust grains in order to develop realistic models of dust processes in the lunar atmosphere, and address the hazardous issues of dust on lunar robotic and human missions.
Ferroelectric self-assembled molecular materials showing both rectifying and switchable conductivity
Gorbunov, Andrey V.; Garcia Iglesias, Miguel; Guilleme, Julia; Cornelissen, Tim D.; Roelofs, W. S. Christian; Torres, Tomas; González-Rodríguez, David; Meijer, E. W.; Kemerink, Martijn
2017-01-01
Advanced molecular materials that combine two or more physical properties are typically constructed by combining different molecules, each being responsible for one of the properties required. Ideally, single molecules could take care of this combined functionality, provided they are self-assembled correctly and endowed with different functional subunits whose strong electronic coupling may lead to the emergence of unprecedented and exciting properties. We present a class of disc-like semiconducting organic molecules that are functionalized with strong dipolar side groups. Supramolecular organization of these materials provides long-range polar order that supports collective ferroelectric behavior of the side groups as well as charge transport through the stacked semiconducting cores. The ferroelectric polarization in these supramolecular polymers is found to couple to the charge transport and leads to a bulk conductivity that is both switchable and rectifying. An intuitive model is developed and found to quantitatively reproduce the experimental observations. In a larger perspective, these results highlight the possibility of modulating material properties using the large electric fields associated with ferroelectric polarization. PMID:28975150
Lopez-Bezanilla, Alejandro
2016-01-20
By means of a multi-scale first-principles approach, a description of the local electronic structure of 2D and narrow phosphorene sheets with various types of modifications is presented. Firtly, a rational argument based on the geometry of the pristine and modified P network, and supported by the Wannier functions formalism is introduced to describe a hybridization model of the P atomic orbitals. Ab initio calculations show that non-isoelectronic foreign atoms form quasi-bound states at varying energy levels and create different polarization states depending on the number of valence electrons between P and the doping atom. The quantum transport properties of modifiedmore » phosphorene ribbons are further described with great accuracy. The distortions on the electronic bands induced by the external species lead to strong backscattering effects on the propagating charge carriers. Depending on the energy of the charge carrier and the type of doping, the conduction may range from the diffusive to the localized regime. Interstitial defects at vacant sites lead to homogeneous transport fingerprints across different types of doping atoms. We suggest that the relatively low values of charge mobility reported in experimental measurements may have its origin in the presence of defects.« less
Electron Transport Modeling of Molecular Nanoscale Bridges Used in Energy Conversion Schemes
DOE Office of Scientific and Technical Information (OSTI.GOV)
Dunietz, Barry D
2016-08-09
The goal of the research program is to reliably describe electron transport and transfer processes at the molecular level. Such insight is essential for improving molecular applications of solar and thermal energy conversion. We develop electronic structure models to study (1) photoinduced electron transfer and transport processes in organic semiconducting materials, and (2) charge and heat transport through molecular bridges. We seek fundamental understanding of key processes, which lead to design new experiments and ultimately to achieve systems with improved properties.
Laboratory Measurements of Charging of Apollo 17 Lunar Dust Grains by Low Energy Electrons
NASA Technical Reports Server (NTRS)
Abbas, Mian M.; Tankosic, Dragana; Spann, James F.; Dube, Michael J.; Gaskin, Jessica
2007-01-01
It is well recognized that the charging properties of individual micron/sub-micron size dust grains by various processes are expected to be substantially different from the currently available measurements made on bulk materials. Solar UV radiation and the solar wind plasma charge micron size dust grains on the lunar surface with virtually no atmosphere. The electrostatically charged dust grains are believed to be levitated and transported long distances over the lunar terminator from the day to the night side. The current models do not fully explain the lunar dust phenomena and laboratory measurements are needed to experimentally determine the charging properties of lunar dust grains. An experimental facility has been developed in the Dusty Plasma Laboratory at NASA Marshall Space Flight Center MSFC for investigating the charging properties of individual micron/sub-micron size positively or negatively charged dust grains by levitating them in an electrodynamic balance in simulated space environments. In this paper, we present laboratory measurements on charging of Apollo 17 individual lunar dust grains by low energy electron beams in the 5-100 eV energy range. The measurements are made by levitating Apollo 17 dust grains of 0.2 to 10 micrometer diameters, in an electrodynamic balance and exposing them to mono-energetic electron beams. The charging rates and the equilibrium potentials produced by direct electron impact and by secondary electron emission processes are discussed.
Zhang, Lei; Colella, Nicholas S; Liu, Feng; Trahan, Stephan; Baral, Jayanta K; Winter, H Henning; Mannsfeld, Stefan C B; Briseno, Alejandro L
2013-01-16
Monodispersed conjugated oligothiophenes are receiving attention in fundamental and applied science due to their interesting optical, optoelectronic, and charge transport properties. These "low molecular weight" polymers serve as model structures for the corresponding polymer analogues, which are inherently polydispersed. Here we report the synthesis, electronic structure, molecular packing/morphology, and charge transport properties of monodispersed oligothiophenes with up to six didodecylquaterthiophene (DDQT) building block repeat units (i.e., 24 thiophene units). At the point where the effective conjugation length is reached, the electronic structure showed convergence behavior to the corresponding polymer, poly(3,3"-didodecyl-quaterthiophene) (PQT-12). X-ray crystal structure analysis of the dimer (DDQT-2) showed that terminal thiophenes exhibit syn-conformations, similar to the terminal syn-conformations observed in the trimer (DDQT-3). The dimer also exhibits a rare bending of the terminal alkyl side chains in order to prevent steric hindrance with neighboring hydrogens attached to core thiophenes. Grazing incidence X-ray scattering measurements revealed a morphology evolution from small molecule-like packing to polymer-like packing in thin films, with a morphology transition occurring near the effective conjugation length. Charge transport measurements showed a mobility increase with decreasing chain length. We correlated the molecular packing and morphology to charge transport and determined that carrier mobilities are most sensitive to crystallinity and crystal grain misorientation. This indicates that molecular weight is not a decisive factor for improved carrier mobility in the low molecular weight region, but rather the degree in crystallinity and in-plane crystal orientation. These results represent a fundamental advancement in understanding the relationship between conjugation length and carrier mobilities in oligothiophene semiconductors.
NASA Technical Reports Server (NTRS)
Gupta, Roop N.; Yos, Jerrold M.; Thompson, Richard A.; Lee, Kam-Pui
1990-01-01
Reaction rate coefficients and thermodynamic and transport properties are reviewed and supplemented for the 11-species air model which can be used for analyzing flows in chemical and thermal nonequilibrium up to temperatures of 3000 K. Such flows will likely occur around currently planned and future hypersonic vehicles. Guidelines for determining the state of the surrounding environment are provided. Curve fits are given for the various species properties for their efficient computation in flowfield codes. Approximate and more exact formulas are provided for computing the properties of partially ionized air mixtures in a high energy environment. Limitations of the approximate mixing laws are discussed for a mixture of ionized species. An electron number-density correction for the transport properties of the charged species is obtained. This correction has been generally ignored in the literature.
NASA Astrophysics Data System (ADS)
Rambabu, Y.; Jaiswal, Manu; Roy, Somnath C.
2017-10-01
Hierarchically structured nanomaterials play an important role in both light absorption and separation of photo-generated charges. In the present study, hierarchically branched TiO2 nanostructures (HB-MLNTs) are obtained through hydrothermal transformation of electrochemically anodized TiO2 multi-leg nanotubes (MLNT) arrays. Photo-anodes based on HB-MLNTs demonstrated 5 fold increase in applied bias to photo-conversion efficiency (%ABPE) over that of TiO2 MLNTs without branches. Further, such nanostructures are wrapped with reduced graphene oxide (rGO) films to enhance the charge separation, which resulted in ∼6.5 times enhancement in %ABPE over that of bare MLNTs. We estimated charge transport (η tr) and charge transfer (η ct) efficiencies by analyzing the photo-current data. The ultra-fine nano branches grown on the MLNTs are effective in increasing light absorption through multiple scattering and improving charge transport/transfer efficiencies by enlarging semiconductor/electrolyte interface area. The charge transfer resistance, interfacial capacitance and electron decay time have been estimated through electrochemical impedance measurements which correlate with the results obtained from photocurrent measurements.
NASA Astrophysics Data System (ADS)
Freeland, J. W.; Chakhalian, J.; Boris, A. V.; Tonnerre, J.-M.; Kavich, J. J.; Yordanov, P.; Grenier, S.; Zschack, P.; Karapetrova, E.; Popovich, P.; Lee, H. N.; Keimer, B.
2010-03-01
A combination of spectroscopic probes was used to develop a detailed experimental description of the transport and magnetic properties of superlattices composed of the paramagnetic metal CaRuO3 and the antiferromagnetic insulator CaMnO3 . The charge-carrier density and Ru valence state in the superlattices are not significantly different from those of bulk CaRuO3 . The small charge transfer across the interface implied by these observations confirms predictions derived from density-functional calculations. However, a ferromagnetic polarization due to canted Mn spins penetrates 3-4 unit cells into CaMnO3 , far exceeding the corresponding predictions. The discrepancy may indicate the formation of magnetic polarons at the interface.
NASA Astrophysics Data System (ADS)
Galliani, Daniela; Battiston, Simone; Ruffo, Riccardo; Trabattoni, Silvia; Narducci, Dario
2018-01-01
Conjugated polymer poly(3,4-dioxyethylenthiofene) (PEDOT) has recently gained attention for room-temperature thermoelectric applications due to its low cost, safety and the possibility of easy processing. This makes it an interesting prospective alternative to tellurides commonly used around room temperature. Still, low thermoelectric efficiencies of polymers might be more easily increased, were a model of its transport properties available. The aim of this paper is to validate a model recently reported, making use of the concept of transport energy to frame the onset of transport properties reported over the last few years in the literature. To this aim, PEDOT and PEDOT-based nanocomposites embedding CuO nanoplatelets were prepared and analysed. We found that the model adequately fits the trends observed in pure PEDOT and in its nanocomposites. Transport and Fermi energy were verified to depend on the polymer oxidation level only,while the transport coefficient was found to be sensitive to PEDOT stacking and was modulated by the introduction of CuO nanoplatelets.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Borreguero, Jose M.; Pincus, Philip A.; Sumpter, Bobby G.
Structure–property relationships of ionic block copolymer (BCP) surfactant complexes are critical toward the progress of favorable engineering design of efficient charge-transport materials. In this paper, molecular dynamics simulations are used to understand the dynamics of charged-neutral BCP and surfactant complexes. The dynamics are examined for two different systems: charged-neutral double-hydrophilic and hydrophobic–hydrophilic block copolymers with oppositely charged surfactant moieties. The dynamics of the surfactant head, tails, and charges are studied for five different BCP volume fractions. We observe that the dynamics of the different species solely depend on the balance between electrostatic and entropic interactions between the charged species andmore » the neutral monomers. The favorable hydrophobic–hydrophobic interactions and the unfavorable hydrophobic–hydrophilic interactions determine the mobilities of the monomers. The dynamical properties of the charge species influence complex formation. Structural relaxations exhibit length-scale dependent behavior, with slower relaxation at the radius of gyration length-scale and faster relaxation at the segmental length-scale, consistent with previous results. The dynamical analysis correlates ion-exchange kinetics to the self-assembly behavior of the complexes.« less
Electron and hole transport in the organic small molecule α-NPD
NASA Astrophysics Data System (ADS)
Rohloff, R.; Kotadiya, N. B.; Crǎciun, N. I.; Blom, P. W. M.; Wetzelaer, G. A. H.
2017-02-01
Electron and hole transport properties of the organic small molecule N,N'-Di(1-naphthyl)-N,N'-diphenyl-(1,1'-biphenyl)-4,4'-diamine are investigated by space-charge-limited current measurements. The hole transport shows trap-free behavior with a mobility of 2.3 × 10-8 m2/Vs at vanishing carrier density and electric field. The electron transport, on the other hand, shows heavily trap-limited behavior, which leads to highly unbalanced transport. A trap concentration of 1.3 × 1024 m-3 was found by modeling the electron currents, similar to the universal trap concentration found in conjugated polymers. This indicates that electron trapping is a generic property of organic semiconductors, ranging from vacuum-deposited small-molecules to solution-processed conjugated polymers.
Impact of the Topological Surface State on the Thermoelectric Transport in Sb2Te3 Thin Films.
Hinsche, Nicki F; Zastrow, Sebastian; Gooth, Johannes; Pudewill, Laurens; Zierold, Robert; Rittweger, Florian; Rauch, Tomáš; Henk, Jürgen; Nielsch, Kornelius; Mertig, Ingrid
2015-04-28
Ab initio electronic structure calculations based on density functional theory and tight-binding methods for the thermoelectric properties of p-type Sb2Te3 films are presented. The thickness-dependent electrical conductivity and the thermopower are computed in the diffusive limit of transport based on the Boltzmann equation. Contributions of the bulk and the surface to the transport coefficients are separated, which enables to identify a clear impact of the topological surface state on the thermoelectric properties. When the charge carrier concentration is tuned, a crossover between a surface-state-dominant and a Fuchs-Sondheimer transport regime is achieved. The calculations are corroborated by thermoelectric transport measurements on Sb2Te3 films grown by atomic layer deposition.
Amat, Anna; Mosconi, Edoardo; Ronca, Enrico; Quarti, Claudio; Umari, Paolo; Nazeeruddin, Md K; Grätzel, Michael; De Angelis, Filippo
2014-06-11
Organohalide lead perovskites have revolutionized the scenario of emerging photovoltaic technologies. The prototype MAPbI3 perovskite (MA = CH3NH3(+)) has dominated the field, despite only harvesting photons above 750 nm (∼1.6 eV). Intensive research efforts are being devoted to find new perovskites with red-shifted absorption onset, along with good charge transport properties. Recently, a new perovskite based on the formamidinium cation ((NH2)2CH(+) = FA) has shown potentially superior properties in terms of band gap and charge transport compared to MAPbI3. The results have been interpreted in terms of the cation size, with the larger FA cation expectedly delivering reduced band-gaps in Pb-based perovskites. To provide a full understanding of the interplay among size, structure, and organic/inorganic interactions in determining the properties of APbI3 perovskites, in view of designing new materials and fully exploiting them for solar cells applications, we report a fully first-principles investigation on APbI3 perovskites with A = Cs(+), MA, and FA. Our results evidence that the tetragonal-to-quasi cubic structural evolution observed when moving from MA to FA is due to the interplay of size effects and enhanced hydrogen bonding between the FA cations and the inorganic matrix altering the covalent/ionic character of Pb-I bonds. Most notably, the observed cation-induced structural variability promotes markedly different electronic and optical properties in the MAPbI3 and FAPbI3 perovskites, mediated by the different spin-orbit coupling, leading to improved charge transport and red-shifted absorption in FAPbI3 and in general in pseudocubic structures. Our theoretical model constitutes the basis for the rationale design of new and more efficient organohalide perovskites for solar cells applications.
Charge distribution and transport properties in reduced ceria phases: A review
NASA Astrophysics Data System (ADS)
Shoko, E.; Smith, M. F.; McKenzie, Ross H.
2011-12-01
The question of the charge distribution in reduced ceria phases (CeO2-x) is important for understanding the microscopic physics of oxygen storage capacity, and the electronic and ionic conductivities in these materials. All these are key properties in the application of these materials in catalysis and electrochemical devices. Several approaches have been applied to study this problem, including ab initio methods. Recently [1], we applied the bond valence model (BVM) to discuss the charge distribution in several different crystallographic phases of reduced ceria. Here, we compare the BVM results to those from atomistic simulations to determine if there is consistency in the predictions of the two approaches. Our analysis shows that the two methods give a consistent picture of the charge distribution around oxygen vacancies in bulk reduced ceria phases. We then review the transport theory applicable to reduced ceria phases, providing useful relationships which enable comparison of experimental results obtained by different techniques. In particular, we compare transport parameters obtained from the observed optical absorption spectrum, α(ω), dc electrical conductivity with those predicted by small polaron theory and the Harrison method. The small polaron energy is comparable to that estimated from α(ω). However, we found a discrepancy between the value of the electron hopping matrix element, t, estimated from the Marcus-Hush formula and that obtained by the Harrison method. Part of this discrepancy could be attributed to the system lying in the crossover region between adiabatic and nonadiabatic whereas our calculations assumed the system to be nonadiabatic. Finally, by considering the relationship between the charge distribution and electronic conductivity, we suggest the possibility of low temperature metallic conductivity for intermediate phases, i.e., x˜0.3. This has not yet been experimentally observed.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Navarro, Amparo, E-mail: anavarro@ujaen.es; Fernández-Liencres, M. Paz; Peña-Ruiz, Tomás
2016-08-07
Density functional theory calculations were carried out to investigate the evolvement of charge transport properties of a set of new discotic systems as a function of ring and heteroatom (B, Si, S, and Se) substitution on the basic structure of perylene. The replacement of six-membered rings by five-membered rings in the reference compound has shown a prominent effect on the electron reorganization energy that decreases ∼0.2 eV from perylene to the new carbon five-membered ring derivative. Heteroatom substitution with boron also revealed to lower the LUMO energy level and increase the electron affinity, therefore lowering the electron injection barrier comparedmore » to perylene. Since the rate of the charge transfer between two molecules in columnar discotic systems is strongly dependent on the orientation of the stacked cores, the total energy and transfer integral of a dimer as a disc is rotated with respect to the other along the stacking axis have been predicted. Aimed at obtaining a more realistic approach to the bulk structure, the molecular geometry of clusters made up of five discs was fully optimized, and charge transfer rate and mobilities were estimated for charge transport along a one dimensional pathway. Heteroatom substitution with selenium yields electron transfer integral values ∼0.3 eV with a relative disc orientation of 25°, which is the preferred angle according to the dimer energy profile. All the results indicate that the tetraselenium-substituted derivative, not synthetized so far, could be a promising candidate among those studied in this work for the fabrication of n-type semiconductors based on columnar discotic liquid crystals materials.« less
Navarro, Amparo; Fernández-Liencres, M Paz; Peña-Ruiz, Tomás; García, Gregorio; Granadino-Roldán, José M; Fernández-Gómez, Manuel
2016-08-07
Density functional theory calculations were carried out to investigate the evolvement of charge transport properties of a set of new discotic systems as a function of ring and heteroatom (B, Si, S, and Se) substitution on the basic structure of perylene. The replacement of six-membered rings by five-membered rings in the reference compound has shown a prominent effect on the electron reorganization energy that decreases ∼0.2 eV from perylene to the new carbon five-membered ring derivative. Heteroatom substitution with boron also revealed to lower the LUMO energy level and increase the electron affinity, therefore lowering the electron injection barrier compared to perylene. Since the rate of the charge transfer between two molecules in columnar discotic systems is strongly dependent on the orientation of the stacked cores, the total energy and transfer integral of a dimer as a disc is rotated with respect to the other along the stacking axis have been predicted. Aimed at obtaining a more realistic approach to the bulk structure, the molecular geometry of clusters made up of five discs was fully optimized, and charge transfer rate and mobilities were estimated for charge transport along a one dimensional pathway. Heteroatom substitution with selenium yields electron transfer integral values ∼0.3 eV with a relative disc orientation of 25°, which is the preferred angle according to the dimer energy profile. All the results indicate that the tetraselenium-substituted derivative, not synthetized so far, could be a promising candidate among those studied in this work for the fabrication of n-type semiconductors based on columnar discotic liquid crystals materials.
Vacancy effects on the electronic and structural properties pentacene
NASA Astrophysics Data System (ADS)
Laraib, Iflah; Janotti, Anderson
Defects in organic crystals are likely to affect charge transport in organic electronic devices. Vacancies can create lattice distortions and modify electronic states associated with the molecules in its surrounding. Spectroscopy experiments indicate that molecular vacancies trap charge carriers. Experimental characterization of individual defects is challenging and unambiguous. Here we use density functional calculations including van der Waals interactions in a supercell approach to study the single vacancy in pentacene, a prototype organic semiconductor. We determine formation energies, local lattice relaxations, and discuss how vacancies locally distort the lattice and affect the electronic properties of the host organic semiconductor.
Electronic Properties, Screening, and Efficient Carrier Transport in NaSbS 2
Sun, Jifeng; Singh, David J.
2017-02-13
NaSbS 2 is a semiconductor that was recently shown to have remarkable efficacy as a solar absorber indicating efficient charge collection even in material containing defects. We report first-principles calculations of properties that show (1) an indirect gap only slightly smaller than the direct gap, which may impede the recombination of photoexcited carriers, (2) highly anisotropic electronic and optical properties reflecting a layered crystal structure, (3) a pushed-up valence-band maximum due to repulsion from the Sb 5s states, and (4) cross-gap hybridization between the S p—derived valence bands and the Sb 5p states. This latter feature leads to enhanced Bornmore » effective charges that can provide local screening and, therefore, defect tolerance. Finally, these features are discussed in relation to the performance of the compound as a semiconductor with efficient charge collection.« less
Effect of electronic coupling of Watson-Crick hopping in DNA poly(dA)-poly(dT)
NASA Astrophysics Data System (ADS)
Risqi, A. M.; Yudiarsah, E.
2017-07-01
Charge transport properties of poly(dA)-poly(dT) DNA has been studied by using thigh binding Hamiltonian approach. Molecule DNA that we use consist of 32 base pair of adenine (A) and thymine (T) and backbone is consist of phosphate and sugar. The molecule DNA is contacted electrode at both ends. Charge transport in molecule DNA depend on the environment, we studied the effect of electronic coupling of Watson-Crick hopping in poly(dA)-poly(dT) DNA to transmission probability and characteristic I-V. The electronic coupling constant influence charge transport between adenine-thymine base pairs at the same site. Transmission probability is studied by using transfer matrix and scattering matrix method, and the result of transmission probability is used to calculate the characteristic I-V by using formula Landauer Buttiker. The result shows that when the electronic coupling increase then transmission probability and characteristic I-V increase slightly.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Paul, Sanjoy; Ellman, Brett, E-mail: bellman@kent.edu; Singh, Gautam
We describe a tool for studying the two-dimensional spatial variation in electronic properties of organic semiconductors: the scanning time-of-flight microscope (STOFm). The STOFm simultaneously measures the transmittance of polarized light and time-of-flight current transients with a pixel size <30 μm, making it especially valuable for studies of the correlations of structure with charge generation and transport in liquid crystalline organic semiconductors (LC OSCs). Adapting a previously developed photopolymerization technique, we characterize the instrument using patterned samples of a LC OSC bounded by a non-semiconducting polymer matrix.
Effects of sub-bandgap illumination on electrical properties and detector performances of CdZnTe:In
DOE Office of Scientific and Technical Information (OSTI.GOV)
Xu, Lingyan; Jie, Wanqi, E-mail: jwq@nwpu.edu.cn; Zha, Gangqiang, E-mail: zha-gq@hotmail.com
2014-06-09
The effects of sub-bandgap illumination on electrical properties of CdZnTe:In crystals and spectroscopic performances of the fabricated detectors were discussed. The excitation process of charge carriers through thermal and optical transitions at the deep trap could be described by the modified Shockley-Read-Hall model. The ionization probability of the deep donor shows an increase under illumination, which should be responsible for the variation of electrical properties within CdZnTe bulk materials with infrared (IR) irradiation. By applying Ohm's law, diffusion model and interfacial layer-thermionic-diffusion theory, we obtain the decrease of bulk resistivity and the increase of space charge density in the illuminatedmore » crystals. Moreover, the illumination induced ionization will further contribute to improving carrier transport property and charge collection efficiency. Consequently, the application of IR irradiation in the standard working environment is of great significance to improve the spectroscopic characteristics of CdZnTe radiation detectors.« less
NASA Astrophysics Data System (ADS)
Smieska, Louisa Marion
Organic semiconductors could have wide-ranging applications in lightweight, efficient electronic circuits. However, several fundamental questions regarding organic electronic device behavior have not yet been fully addressed, including the nature of chemical charge traps, and robust models for injection and transport. Many studies focus on engineering devices through bulk transport measurements, but it is not always possible to infer the microscopic behavior leading to the observed measurements. In this thesis, we present scanning-probe microscope studies of organic semiconductor devices in an effort to connect local properties with local device behavior. First, we study the chemistry of charge trapping in pentacene transistors. Working devices are doped with known pentacene impurities and the extent of charge trap formation is mapped across the transistor channel. Trap-clearing spectroscopy is employed to measure an excitation of the pentacene charge trap species, enabling identification of the degradationrelated chemical trap in pentacene. Second, we examine transport and trapping in peryelene diimide (PDI) transistors. Local mobilities are extracted from surface potential profiles across a transistor channel, and charge injection kinetics are found to be highly sensitive to electrode cleanliness. Trap-clearing spectra generally resemble PDI absorption spectra, but one derivative yields evidence indicating variation in trap-clearing mechanisms for different surface chemistries. Trap formation rates are measured and found to be independent of surface chemistry, contradicting a proposed silanol trapping mechanism. Finally, we develop a variation of scanning Kelvin probe microscopy that enables measurement of electric fields through a position modulation. This method avoids taking a numeric derivative of potential, which can introduce high-frequency noise into the electric field signal. Preliminary data is presented, and the theoretical basis for electric field noise in both methods is examined.
Transport properties of an asymmetric mixture in the dense plasma regime
Ticknor, Christopher; Kress, Joel David; Collins, Lee A.; ...
2016-06-23
Here, we study how concentration changes ionic transport properties along isobars-isotherms for a mixture of hydrogen and silver, representative of turbulent layers relevant to inertial confinement fusion and astrophysics. Hydrogen will typically be fully ionized while silver will be only partially ionized but can have a large effective charge. This will lead to very different physical conditions for the H and Ag. Large first principles orbital free molecular dynamics simulations are performed and the resulting transport properties are analyzed. Comparisons are made with transport theory in the kinetic regime and in the coupled regime. The addition of a small amountmore » of heavy element in a light material has a dramatic effect on viscosity and diffusion of the mixture. This effect is explained through kinetic theory as a manifestation of a crossover between classical diffusion and Lorentz diffusion.« less
Kwon, Hyeok-Chan; Yang, Wooseok; Lee, Daehee; Ahn, Jihoon; Lee, Eunsong; Ma, Sunihl; Kim, Kyungmi; Yun, Seong-Cheol; Moon, Jooho
2018-05-22
Organometal halide perovskite materials have become an exciting research topic as manifested by intense development of thin film solar cells. Although high-performance solar-cell-based planar and mesoscopic configurations have been reported, one-dimensional (1-D) nanostructured perovskite solar cells are rarely investigated despite their expected promising optoelectrical properties, such as enhanced charge transport/extraction. Herein, we have analyzed the 1-D nanostructure effects of organometal halide perovskite (CH 3 NH 3 PbI 3- x Cl x ) on recombination and charge carrier dynamics by utilizing a nanoporous anodized alumina oxide scaffold to fabricate a vertically aligned 1-D nanopillared array with controllable diameters. It was observed that the 1-D perovskite exhibits faster charge transport/extraction characteristics, lower defect density, and lower bulk resistance than the planar counterpart. As the aspect ratio increases in the 1-D structures, in addition, the charge transport/extraction rate is enhanced and the resistance further decreases. However, when the aspect ratio reaches 6.67 (diameter ∼30 nm), the recombination rate is aggravated due to high interface-to-volume ratio-induced defect generation. To obtain the full benefits of 1-D perovskite nanostructuring, our study provides a design rule to choose the appropriate aspect ratio of 1-D perovskite structures for improved photovoltaic and other optoelectrical applications.
Sancho-García, J C
2012-05-07
A set of N-heteroquinones, deriving from oligoacenes, have been recently proposed as n-type organic semiconductors with high electron mobilities in thin-film transistors. Generally speaking, this class of compounds self-assembles in neighboring π-stacks linked by weak hydrogen bonds. We aim at theoretically characterizing here the sequential charge transport (hopping) process expected to take place across these arrays of molecules. To do so, we need to accurately address the preferred packing of these materials simultaneously to single-molecule properties related to charge-transfer events, carefully employing dispersion-corrected density functional theory methods to accurately extract the key molecular parameters governing this phenomenon at the nanoscale. This study confirms the great deal of interest around these compounds, since controlled functionalization of model molecules (i.e., pentacene) allows to efficiently tune the corresponding charge mobilities, and the capacity of modern quantum-chemical methods to predict it after rationalizing the underlying structure-property relationships.
Transport properties of β-FeSi2
NASA Astrophysics Data System (ADS)
Arushanov, Ernest; Lisunov, Konstantin G.
2015-07-01
The aim of this paper is to summarize considerable experimental efforts undertaken within the last decades in the investigations of transport properties of β-FeSi2. The β-FeSi2 compound is the most investigated among a family of semiconducting silicides. This material has received considerable attention as an attractive material for optoelectronic, photonics, photovoltaics and thermoelectric applications. Previous reviews of the transport properties of β-FeSi2 have been given by Lange and Ivanenko et al. about 15 years ago. The Hall effect, the conductivity, the mobility and the magnetoresistance data are presented. Main attention is paid to the discussion of the impurity (defect) band conductivity, the anomalous Hall effect, the scattering mechanisms of charge carriers, as well as to the hopping conduction and the magnetoresistance.
Luminescence and related properties of nanocrystalline porous silicon
NASA Astrophysics Data System (ADS)
Koshida, N.
This document is part of subvolume C3 'Optical Properties' of volume 34 'Semiconductor quantum structures' of Landolt-Börnstein, Group III, Condensed Matter, on the optical properties of quantum structures based on group IV semiconductors. It discusses luminescence and related properties of nanocrystalline porous silicon. Topics include an overview of nanostructured silicon, its fabrication technology, and properties of nanocrystalline porous silicon such as confinement effects, photoluminescence, electroluminesce, carrier charging effects, ballistic transport and emission, and thermally induced acoustic emission.
Scanning tunneling spectroscopy of molecular thin films and semiconductor nanostructures
NASA Astrophysics Data System (ADS)
Gaan, Sandeep
Work presented in this thesis mostly deals with nano-scale study of electronic properties of organic semiconducting molecules using pentacene (Pn) as a model system and compared with various SiC surfaces to gain more insight into physical processes at nano-scale. In addition, InAs quantum dots (QDs) in a GaAs matrix are studied to probe electronic states of individual QDs. Scanning tunneling microscopy (STM) and spectroscopy (STS) are the primary experimental techniques used to probe local electronic properties on the nano-scale. Vacuum sublimated Pn thin films were deposited onto SiC substrates for STM/STS experiments. STM studies show high quality ordered Pn films. Atomic force microscopy (AFM) images reveal dendritic growth pattern of these films. Local density of states (LDOS) measurements using STS reveals a HOMO-LUMO bandgap. In order to study charge transport properties of Pn films, different amount of charge were injected into the sample by systematically changing the tip-sample separation. Saturation of the tunnel current was observed at positive sample voltages (LUMO states). This effect was attributed to a transport/space charge limitation in tunnel current by treating it as a situation analogous to charge injection into insulators which gives rise to space charge limited current (also previously observed in the case of organic semiconductors). Using a simple model we were able to derive a hopping rate that characterizes nano-scale transport in Pn films at least in the vicinity of the STM probe-tip. We have studied effect of transport limitation in the tunnel current for various semiconductor surfaces. In order to probe surfaces of varying conductivities, we have used Si-rich SiC surfaces such as 3x3 and 3x3 -R30° (both Mott-Hubbard insulators) as well as a highly conducting C-rich graphene surface, and compared those results with the data obtained from Pn. We observe variation of the decay constant kappa (which characterizes the tunneling process) on these surfaces of varying conductivities. The graphene surface shows no transport limitation in the tunnel current, as evidenced by only small changes in kappa as a function of tunnel current for these surfaces. This result is in sharp contrast to the case of Pn where kappa rapidly decays to zero with increasing tunnel current due to transport/space charge limited effects in the semiconductor. Thus, the change is kappa value in STM experiments is reflective of non-ideal behavior of the tunneling. As a specific case of transport limitation on the nano-scale we have also studied InAs QDs grown in a GaAs matrix. We observe that the occupation of discrete quantized states in the dots with electrons has a significant effect on tunneling spectra. When the QD state is occupied by an electron the potential in the dot is modified such that this state does not contribute to the tunnel current. The state then remains "invisible" in the tunneling spectra. Only in presence of transport channels in the vicinity of the dots can the electron localized in the QD state leak out to the substrate, and only then does the state appears in the spectrum. In our experiments these transport channels arise from steps which form as a result of in situ cleaving process for cross-sectional STM (XSTM) measurements.
Advances in TlBr detector development
NASA Astrophysics Data System (ADS)
Hitomi, Keitaro; Shoji, Tadayoshi; Ishii, Keizo
2013-09-01
Thallium bromide (TlBr) is a promising compound semiconductor for fabrication of gamma-ray detectors. The attractive physical properties of TlBr lie in its high photon stopping power, high resistivity and good charge transport properties. Gamma-ray detectors fabricated from TlBr crystals have exhibited excellent spectroscopic performance. In this paper, advances in TlBr radiation detector development are reviewed with emphasis on crystal growth, detector fabrication, physical properties and detector performance.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Borreguero, Jose M.; Pincus, Philip A.; Sumpter, Bobby G.
Structure–property relationships of ionic block copolymer (BCP) surfactant complexes are critical toward the progress of favorable engineering design of efficient charge-transport materials. In this paper, molecular dynamics simulations are used to understand the dynamics of charged-neutral BCP and surfactant complexes. The dynamics are examined for two different systems: charged-neutral double-hydrophilic and hydrophobic–hydrophilic block copolymers with oppositely charged surfactant moieties. The dynamics of the surfactant head, tails, and charges are studied for five different BCP volume fractions. We observe that the dynamics of the different species solely depend on the balance between electrostatic and entropic interactions between the charged species andmore » the neutral monomers. The favorable hydrophobic–hydrophobic interactions and the unfavorable hydrophobic–hydrophilic interactions determine the mobilities of the monomers. The dynamical properties of the charge species influence complex formation. Structural relaxations exhibit length-scale dependent behavior, with slower relaxation at the radius of gyration length-scale and faster relaxation at the segmental length-scale, consistent with previous results. The dynamical analysis correlates ion-exchange kinetics to the self-assembly behavior of the complexes.« less
NASA Technical Reports Server (NTRS)
Tankosic, D.; Abbas, M. M.
2012-01-01
Observations made during Apollo missions, as well as theoretical models indicate that the lunar surface and dust grains are electrostatically charged, levitated and transported. Lunar dust grains are charged by UV photoelectric emissions on the lunar dayside and by the impact of the solar wind electrons on the nightside. The knowledge of charging properties of individual lunar dust grains is important for developing appropriate theoretical models and mitigating strategies. Currently, very limited experimental data are available for charging of individual micron-size size lunar dust grains in particular by low energy electron impact. However, experimental results based on extensive laboratory measurements on the charging of individual 0.2-13 micron size lunar dust grains by the secondary electron emissions (SEE) have been presented in a recent publication. The SEE process of charging of micron-size dust grains, however, is found to be very complex phenomena with strong particle size dependence. In this paper we present some examples of the complex nature of the SEE properties of positively charged individual lunar dust grains levitated in an electrodynamic balance (EDB), and show that they remain unaffected by the variation of the AC field employed in the above mentioned measurements.
Borreguero, Jose M.; Pincus, Philip A.; Sumpter, Bobby G.; ...
2017-06-21
Structure–property relationships of ionic block copolymer (BCP) surfactant complexes are critical toward the progress of favorable engineering design of efficient charge-transport materials. In this paper, molecular dynamics simulations are used to understand the dynamics of charged-neutral BCP and surfactant complexes. The dynamics are examined for two different systems: charged-neutral double-hydrophilic and hydrophobic–hydrophilic block copolymers with oppositely charged surfactant moieties. The dynamics of the surfactant head, tails, and charges are studied for five different BCP volume fractions. We observe that the dynamics of the different species solely depend on the balance between electrostatic and entropic interactions between the charged species andmore » the neutral monomers. The favorable hydrophobic–hydrophobic interactions and the unfavorable hydrophobic–hydrophilic interactions determine the mobilities of the monomers. The dynamical properties of the charge species influence complex formation. Structural relaxations exhibit length-scale dependent behavior, with slower relaxation at the radius of gyration length-scale and faster relaxation at the segmental length-scale, consistent with previous results. The dynamical analysis correlates ion-exchange kinetics to the self-assembly behavior of the complexes.« less
Simulation of Martian surface conditions and dust transport
NASA Astrophysics Data System (ADS)
Nørnberg, P.; Merrison, J. P.; Finster, K.; Folkmann, F.; Gunnlaugsson, H. P.; Hansen, A.; Jensen, J.; Kinch, K.; Lomstein, B. Aa.; Mugford, R.
2002-11-01
The suspended atmospheric dust which is also found deposited over most of the Martian globe plays an important (possibly vital) role in shaping the surface environment. It affects the weather (solar flux), water transport and possibly also the electrical properties at the surface. The simulation facilities at Aarhus provide excellent tools for studying the properties of this Martian environment. Much can be learned from such simulations, supporting and often inspiring new investigations of the planet. Electrical charging of a Mars analogue dust is being studied within a wind tunnel simulation aerosol. Here electric fields are used to extract dust from suspension. Although preliminary the results indicate that a large fraction of the dust is charged to a high degree, sufficient to dominate adhesion/cohesion processes. A Mars analogue dust layer has been shown to be an excellent trap for moisture, causing increased humidity in the soil below. This allows the possibility for liquid water to be stable close to the surface (less than 10 cm). This is being investigated in an environment simulator where heat and moisture transport can be studied through layers of Mars analogue dust.
Jin, Ruifa; Wang, Kai
2015-01-01
A series of diketopyrrolopyrrole-based small molecules have been designed to explore their optical, electronic, and charge transport properties as organic solar cell (OSCs) materials. The calculation results showed that the designed molecules can lower the band gap and extend the absorption spectrum towards longer wavelengths. The designed molecules own the large longest wavelength of absorption spectra, the oscillator strength, and absorption region values. The optical, electronic, and charge transport properties of the designed molecules are affected by the introduction of different π-bridges and end groups. We have also predicted the mobility of the designed molecule with the lowest total energies. Our results reveal that the designed molecules are expected to be promising candidates for OSC materials. Additionally, the designed molecules are expected to be promising candidates for electron and/or hole transport materials. On the basis of our results, we suggest that molecules under investigation are suitable donors for [6,6]-phenyl-C61-butyric acid methyl ester (PCBM) and its derivatives as acceptors of OSCs. PMID:26343640
DOE Office of Scientific and Technical Information (OSTI.GOV)
Boone, C. T.; Shaw, J. M.; Nembach, H. T.
2015-06-14
We determined the spin-transport properties of Pd and Pt thin films by measuring the increase in ferromagnetic resonance damping due to spin-pumping in ferromagnetic (FM)-nonferromagnetic metal (NM) multilayers with varying NM thicknesses. The increase in damping with NM thickness depends strongly on both the spin- and charge-transport properties of the NM, as modeled by diffusion equations that include both momentum- and spin-scattering parameters. We use the analytical solution to the spin-diffusion equations to obtain spin-diffusion lengths for Pt and Pd. By measuring the dependence of conductivity on NM thickness, we correlate the charge- and spin-transport parameters, and validate the applicabilitymore » of various models for momentum-scattering and spin-scattering rates in these systems: constant, inverse-proportional (Dyakanov-Perel), and linear-proportional (Elliot-Yafet). We confirm previous reports that the spin-scattering time appears to be shorter than the momentum scattering time in Pt, and the Dyakanov-Perel-like model is the best fit to the data.« less
Pingitore, V; Miriello, D; Drioli, E; Gugliuzza, A
2015-06-14
This work describes some single walled carboxylic carbon nanotubes with outstanding transport properties when assembled in a 3D microarray working like a humidity membrane-sensor and an adjustable moisture regulator. Combined nano-assembly approaches are used to build up a better quality pathway through which assisted-charge and mass transport synchronically takes place. The structure-electrical response relationship is found, while controllable and tunable donor-acceptor interactions established at material interfaces are regarded as key factors for the accomplishment of charge transportation, enhanced electrical responses and adjustable moisture exchange. Raman and infrared spectroscopy provides indications about the fine structural and chemical features of the hybrid-composite membranes, resulting in perfect agreement with related morphology and electrical properties. Enhanced and modular electrical response to changes in the surrounding atmosphere is concerned with doping events, while assisted moisture regulation is discussed in relation to swelling and hopping actions. The electro-activated hybrid-composite membrane proposed in this work can be regarded as an attractive 'sense-to-act' precursor for smart long-distance monitoring systems with capability to adapt itself and provide local comfortable microenvironments.
Thermally induced texture flip in semiconducting polymer stabilized by epitaxial relationship
NASA Astrophysics Data System (ADS)
O'Hara, Kathryn A.; Pokuri, Balaji S. S.; Takacs, Christopher J.; Beaujuge, Pierre M.; Ganapathysubramanian, Baskar; Chabinyc, Michael L.
The morphology of semiconducting polymer films has a large effect on the charge transport properties. Charges can move easily along the conjugated backbone and in the pi-pi stacking direction. However, transport through the film is determined by the connectivity between domains, which is not well understood. We previously observed quadrites in the polymer, PSBTBT, and proposed that the preferential overlap between lamellae may improve connectivity and provide an additional conduction pathway. Now, the presence of quadrites is revealed in another successful donor polymer, PBDTTPD, using high resolution transmission electron microscopy (HRTEM). A study of how side-chain substitution affects the epitaxial crossing is conducted by examining several PBDTTPD derivatives. The stability of the film texture with annealing is also examined as a function of quadrite formation. It has been shown that heating some semicrystalline polymers above the melting temperature and slow cooling can flip the lamellar texture from face-on to edge-on. We hypothesize that the orientation of lamellar crystallites in PBDTTPD films is stabilized by the epitaxial overlap between adjacent crystalline domains. This may have important implications for the electronic transport properties.
Measurements of Photoelectric Yield and Physical Properties of Individual Lunar Dust Grains
NASA Technical Reports Server (NTRS)
Abbas, M. M.; Tankosic, D.; Craven, P. D.; Spann, J. F.; LeClair, A.; West, F. A.; Taylor, L.; Hoover, R.
2005-01-01
Micron size dust grains levitated and transported on the lunar surface constitute a major problem for the robotic and human habitat missions for the Moon. It is well known since the Apollo missions that the lunar surface is covered with a thick layer of micron/sub-micron size dust grains. Transient dust clouds over the lunar horizon were observed by experiments during the Apollo 17 mission. Theoretical models suggest that the dust grains on the lunar surface are charged by the solar UV radiation as well as the solar wind. Even without any physical activity, the dust grains are levitated by electrostatic fields and transported away from the surface in the near vacuum environment of the Moon. The current dust charging and the levitation models, however, do not fully explain the observed phenomena. Since the abundance of dust on the Moon's surface with its observed adhesive characteristics is believed to have a severe impact on the human habitat and the lifetime and operations of a variety of equipment, it is necessary to investigate the phenomena and the charging properties of the lunar dust in order to develop appropriate mitigating strategies. We will present results of some recent laboratory experiments on individual micro/sub-micron size dust grains levitated in electrodynamic balance in simulated space environments. The experiments involve photoelectric emission measurements of individual micron size lunar dust grains illuminated with UV radiation in the 120-160 nm wavelength range. The photoelectric yields are required to determine the charging properties of lunar dust illuminated by solar UV radiation. We will present some recent results of laboratory measurement of the photoelectric yields and the physical properties of individual micron size dust grains from the Apollo and Luna-24 sample returns as well as the JSC-1 lunar simulants.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Freeland, J. W.; Chakhalian, J.; Boris, A. V.
2010-01-01
A combination of spectroscopic probes was used to develop a detailed experimental description of the transport and magnetic properties of superlattices composed of the paramagnetic metal CaRuO3 and the antiferromagnetic insulator CaMnO3. The charge carrier density and Ru valence state in the superlattices are not significantly different from those of bulk CaRuO3. The small charge transfer across the interface implied by these observations confirms predictions derived from density functional calculations. However, a ferromagnetic polarization due to canted Mn spins penetrates 3-4 unit cells into CaMnO3, far exceeding the corresponding predictions. The discrepancy may indicate the formation of magnetic polarons atmore » the interface.« less
Pierucci, Debora; Brumme, Thomas; Girard, Jean-Christophe; Calandra, Matteo; Silly, Mathieu G; Sirotti, Fausto; Barbier, Antoine; Mauri, Francesco; Ouerghi, Abdelkarim
2016-09-15
The transport properties of few-layer graphene are the directly result of a peculiar band structure near the Dirac point. Here, for epitaxial graphene grown on SiC, we determine the effect of charge transfer from the SiC substrate on the local density of states (LDOS) of trilayer graphene using scaning tunneling microscopy/spectroscopy and angle resolved photoemission spectroscopy (ARPES). Different spectra are observed and are attributed to the existence of two stable polytypes of trilayer: Bernal (ABA) and rhomboedreal (ABC) staking. Their electronic properties strongly depend on the charge transfer from the substrate. We show that the LDOS of ABC stacking shows an additional peak located above the Dirac point in comparison with the LDOS of ABA stacking. The observed LDOS features, reflecting the underlying symmetry of the two polytypes, were reproduced by explicit calculations within density functional theory (DFT) including the charge transfer from the substrate. These findings demonstrate the pronounced effect of stacking order and charge transfer on the electronic structure of trilayer or few layer graphene. Our approach represents a significant step toward understand the electronic properties of graphene layer under electrical field.
NASA Astrophysics Data System (ADS)
Mäckel, Helmut; MacKenzie, Roderick C. I.
2018-03-01
Charge-carrier mobility is a fundamental material parameter, which plays an important role in determining solar-cell efficiency. The higher the mobility, the less time a charge carrier will spend in a device and the less likely it is that it will be lost to recombination. Despite the importance of this physical property, it is notoriously difficult to measure accurately in disordered thin-film solar cells under operating conditions. We, therefore, investigate a method previously proposed in the literature for the determination of mobility as a function of current density. The method is based on a simple analytical model that relates the mobility to carrier density and transport resistance. By revising the theoretical background of the method, we clearly demonstrate what type of mobility can be extracted (constant mobility or effective mobility of electrons and holes). We generalize the method to any combination of measurements that is able to determine the mean electron and hole carrier density, and the transport resistance at a given current density. We explore the robustness of the method by simulating typical organic solar-cell structures with a variety of physical properties, including unbalanced mobilities, unbalanced carrier densities, and for high or low carrier trapping rates. The simulations reveal that near VOC and JSC , the method fails due to the limitation of determining the transport resistance. However, away from these regions (and, importantly, around the maximum power point), the method can accurately determine charge-carrier mobility. In the presence of strong carrier trapping, the method overestimates the effective mobility due to an underestimation of the carrier density.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Printz, Adam D.; Lipomi, Darren J., E-mail: dlipomi@ucsd.edu
The primary goal of the field concerned with organic semiconductors is to produce devices with performance approaching that of silicon electronics, but with the deformability—flexibility and stretchability—of conventional plastics. However, an inherent competition between deformability and charge transport has long been observed in these materials, and achieving the extreme (or even moderate) deformability implied by the word “plastic” concurrently with high charge transport may be elusive. This competition arises because the properties needed for high carrier mobilities—e.g., rigid chains in π-conjugated polymers and high degrees of crystallinity in the solid state—are antithetical to deformability. On the device scale, this competitionmore » can lead to low-performance yet mechanically robust devices, or high-performance devices that fail catastrophically (e.g., cracking, cohesive failure, and delamination) under strain. There are, however, some observations that contradict the notion of the mutual exclusivity of electronic and mechanical performances. These observations suggest that this problem may not be a fundamental trade-off, but rather an inconvenience that may be negotiated by a logical selection of materials and processing conditions. For example, the selection of the poly(3-alkylthiophene) with a critical side-chain length—poly(3-heptylthiophene) (n = 7)—marries the high deformability of poly(3-octylthiophene) (n = 8) with the high electronic performance (as manifested in photovoltaic efficiency) of poly(3-hexylthiophene) (n = 6). This review explores the relationship between deformability and charge transport in organic semiconductors. The principal conclusions are that reducing the competition between these two parameters is in fact possible, with two demonstrated routes being: (1) incorporation of softer, insulating material into a stiffer, semiconducting material and (2) increasing disorder in a highly ordered film, but not enough to disrupt charge transport pathways. The aim of this review is to provide a bridge between the fields interested in electronic properties and mechanical properties of conjugated polymers. We provide a high-level introduction to some of the important electronic and mechanical properties and measurement techniques for organic electronic devices, demonstrate an apparent competition between good electronic performance and mechanical deformability, and highlight potential strategies for overcoming this undesirable competition. A marriage of these two fields would allow for rational design of materials for applications requiring large-area, low-cost, printable devices that are ultra-flexible or stretchable, such as organic photovoltaic devices and wearable, conformable, or implantable sensors.« less
Transport and thermoelectric properties of the LaAlO3/SrTiO3 interface
NASA Astrophysics Data System (ADS)
Jost, A.; Guduru, V. K.; Wiedmann, S.; Maan, J. C.; Zeitler, U.; Wenderich, S.; Brinkman, A.; Hilgenkamp, H.
2015-01-01
The transport and thermoelectric properties of the interface between SrTiO3 and a 26-monolayer-thick LaAlO3 layer grown at high oxygen pressure have been investigated at temperatures from 4.2 to 100 K and in magnetic fields up to 18 T. For T >4.2 K , two different electronlike charge carriers originating from two electron channels which contribute to transport are observed. We probe the contributions of a degenerate and a nondegenerate band to the thermoelectric power and develop a consistent model to describe the temperature dependence of the thermoelectric tensor. Anomalies in the data point to an additional magnetic field dependent scattering.
Unconventional Current Scaling and Edge Effects for Charge Transport through Molecular Clusters
2017-01-01
Metal–molecule–metal junctions are the key components of molecular electronics circuits. Gaining a microscopic understanding of their conducting properties is central to advancing the field. In the present contribution, we highlight the fundamental differences between single-molecule and ensemble junctions focusing on the fundamentals of transport through molecular clusters. In this way, we elucidate the collective behavior of parallel molecular wires, bridging the gap between single molecule and large-area monolayer electronics, where even in the latter case transport is usually dominated by finite-size islands. On the basis of first-principles charge-transport simulations, we explain why the scaling of the conductivity of a junction has to be distinctly nonlinear in the number of molecules it contains. Moreover, transport through molecular clusters is found to be highly inhomogeneous with pronounced edge effects determined by molecules in locally different electrostatic environments. These effects are most pronounced for comparably small clusters, but electrostatic considerations show that they prevail also for more extended systems. PMID:29043825
Ultraflat Au nanoplates as a new building block for molecular electronics.
Jeong, Wooseok; Lee, Miyeon; Lee, Hyunsoo; Lee, Hyoban; Kim, Bongsoo; Park, Jeong Young
2016-05-27
We demonstrate the charge transport properties of a self-assembled organic monolayer on Au nanoplates with conductive probe atomic force microscopy (CP-AFM). Atomically flat Au nanoplates, a few hundred micrometers on each side, that have only (111) surfaces, were synthesized using the chemical vapor transport method; these nanoplates were employed as the substrates for hexadecanethiol (HDT) self-assembled monolayers (SAMs). Atomic-scale high-resolution images show (√3 x √3) R30° molecular periodicity, indicating a well-ordered structure of the HDT on the Au nanoplates. We observed reduced friction and adhesion forces on the HDT SAMs on Au nanoplates, compared with Si substrates, which is consistent with the lubricating nature of HDT SAMs. The electrical properties, such as I-V characteristics and current as a function of load, were measured using CP-AFM. We obtained a tunneling decay constant (β) of 0.57 Å(-1), including through-bond (βtb = 0.99 Å(-1)) and through-space (βts = 1.36 Å(-1)) decay constants for the two-pathway model. This indicates that the charge transport properties of HDT SAMs on Au nanoplates are consistent with those on a Au (111) film, suggesting that SAMs on nanoplates can provide a new building block for molecular electronics.
NASA Astrophysics Data System (ADS)
Mishra, A. K.; Catalan, Jorge; Camacho, Diana; Martinez, Miguel; Hodges, D.
2017-08-01
Solution processed organic-inorganic metal halide perovskite based solar cells are emerging as a new cost effective photovoltaic technology. In the context of increasing the power conversion efficiency (PCE) and sustainability of perovskite solar cells (PSC) devices, we comprehensively analyzed a physics-based numerical modelling for doped and un-doped PSC devices. Our analytics emphasized the role of different charge carrier layers from the view point of interfacial adhesion and its influence on charge extraction rate and charge recombination mechanism. Morphological and charge transport properties of perovskite thin film as a function of device architecture are also considered to investigate the photovoltaic properties of PSC. We observed that photocurrent is dominantly influenced by interfacial recombination process and photovoltage has functional relationship with defect density of perovskite absorption layer. A novel contour mapping method to understand the characteristics of current density-voltage (J-V) curves for each device as a function of perovskite layer thickness provide an important insight about the distribution spectrum of photovoltaic properties. Functional relationship of device efficiency and fill factor with absorption layer thickness are also discussed.
Functional electronic inversion layers at ferroelectric domain walls
NASA Astrophysics Data System (ADS)
Mundy, J. A.; Schaab, J.; Kumagai, Y.; Cano, A.; Stengel, M.; Krug, I. P.; Gottlob, D. M.; Doğanay, H.; Holtz, M. E.; Held, R.; Yan, Z.; Bourret, E.; Schneider, C. M.; Schlom, D. G.; Muller, D. A.; Ramesh, R.; Spaldin, N. A.; Meier, D.
2017-06-01
Ferroelectric domain walls hold great promise as functional two-dimensional materials because of their unusual electronic properties. Particularly intriguing are the so-called charged walls where a polarity mismatch causes local, diverging electrostatic potentials requiring charge compensation and hence a change in the electronic structure. These walls can exhibit significantly enhanced conductivity and serve as a circuit path. The development of all-domain-wall devices, however, also requires walls with controllable output to emulate electronic nano-components such as diodes and transistors. Here we demonstrate electric-field control of the electronic transport at ferroelectric domain walls. We reversibly switch from resistive to conductive behaviour at charged walls in semiconducting ErMnO3. We relate the transition to the formation--and eventual activation--of an inversion layer that acts as the channel for the charge transport. The findings provide new insight into the domain-wall physics in ferroelectrics and foreshadow the possibility to design elementary digital devices for all-domain-wall circuitry.
Grave, Daniel A; Yatom, Natav; Ellis, David S; Toroker, Maytal Caspary; Rothschild, Avner
2018-03-05
In recent years, hematite's potential as a photoanode material for solar hydrogen production has ignited a renewed interest in its physical and interfacial properties, which continues to be an active field of research. Research on hematite photoanodes provides new insights on the correlations between electronic structure, transport properties, excited state dynamics, and charge transfer phenomena, and expands our knowledge on solar cell materials into correlated electron systems. This research news article presents a snapshot of selected theoretical and experimental developments linking the electronic structure to the photoelectrochemical performance, with particular focus on optoelectronic properties and charge carrier dynamics. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Joshi, Ankita; Ramachandran, C N
2018-05-23
Using the dispersion-corrected density functional B97D and 6-31g(d,p) basis set, the structural, stability, electronic, optical and charge transport properties of the complexes formed by encapsulating indigo inside carbon nanotubes (CNTs) of varying diameters are investigated. Based on the stabilization energy of the complexes indigo@(n,n)CNT (where n = 6, 7 and 8), indigo@(7,7)CNT is shown to be the most stable owing to the ideal diameter of (7,7)CNT for encapsulating indigo. The nature of the interaction between the guest and the host is investigated by means of energy decomposition analysis employing the symmetry adapted perturbation theory. Electronic properties such as the ionization energy, the electron affinity and the energy gap between the highest occupied and lowest unoccupied molecular orbitals (ΔEH-L) of the complexes are determined. The low values of ΔEH-L (<1 eV) for the complexes suggest that they can act as narrow energy gap semiconductors. All the complexes exhibit high hole and electron mobilities which vary inversely with respect to the diameter of the CNT. Using the time-dependent density functional theoretical method, the absorption properties are predicted for the most stable complex indigo@(7,7)CNT. The presence of charge transfer peaks in the visible and near-infrared regions of the electromagnetic spectrum suggests that the complexes are suitable for optoelectronic devices such as solar cells.
Understanding polymorphism in organic semiconductor thin films through nanoconfinement.
Diao, Ying; Lenn, Kristina M; Lee, Wen-Ya; Blood-Forsythe, Martin A; Xu, Jie; Mao, Yisha; Kim, Yeongin; Reinspach, Julia A; Park, Steve; Aspuru-Guzik, Alán; Xue, Gi; Clancy, Paulette; Bao, Zhenan; Mannsfeld, Stefan C B
2014-12-10
Understanding crystal polymorphism is a long-standing challenge relevant to many fields, such as pharmaceuticals, organic semiconductors, pigments, food, and explosives. Controlling polymorphism of organic semiconductors (OSCs) in thin films is particularly important given that such films form the active layer in most organic electronics devices and that dramatic changes in the electronic properties can be induced even by small changes in the molecular packing. However, there are very few polymorphic OSCs for which the structure-property relationships have been elucidated so far. The major challenges lie in the transient nature of metastable forms and the preparation of phase-pure, highly crystalline thin films for resolving the crystal structures and evaluating the charge transport properties. Here we demonstrate that the nanoconfinement effect combined with the flow-enhanced crystal engineering technique is a powerful and likely material-agnostic method to identify existing polymorphs in OSC materials and to prepare the individual pure forms in thin films at ambient conditions. With this method we prepared high quality crystal polymorphs and resolved crystal structures of 6,13-bis(triisopropylsilylethynyl)pentacene (TIPS-pentacene), including a new polymorph discovered via in situ grazing incidence X-ray diffraction and confirmed by molecular mechanic simulations. We further correlated molecular packing with charge transport properties using quantum chemical calculations and charge carrier mobility measurements. In addition, we applied our methodology to a [1]benzothieno[3,2-b][1]1benzothiophene (BTBT) derivative and successfully stabilized its metastable form.
Zhang, Fengjiao; Mohammadi, Erfan; Luo, Xuyi; ...
2017-10-02
It is well-known that substrate surface properties have a profound impact on morphology of thin films solution coated atop and the resulting solid-state properties. However, design rules for guiding the substrate selection have not yet been established. Such design rules are particularly important for solution coated semiconducting polymers, as the substratedirected thin film morphology can impact charge transport properties by orders of magnitude. We hypothesize that substrate surface energies dictate the thin film morphology by modulating the free energy barrier to heterogeneous nucleation. To test this hypothesis, we systematically vary the substrate surface energy via surface functionalization techniques. We performmore » in-depth morphology and device characterizations to establish the relationship between substrate surface energy, thin film morphology and charge transport properties, employing a donor-accepter (D-A) conjugated polymer. Here, we find that decreasing the substrate surface energy progressively increases thin film crystallinity, degree of molecular ordering and extent of domain alignment. Notably, the enhanced morphology on the lowest surface energy substrate lead to a 10-fold increase in the charge carrier mobility. We further develop a free energy model relating the substrate surface energy to the penalty of heterogeneous nucleation from solution in the thin film geometry. The model correctly predicts the experimental trend, thereby validating our hypothesis. This work is a significant step towards establishing design rules and understanding the critical role of substrates in determining morphology of solution coated thin films.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhang, Fengjiao; Mohammadi, Erfan; Luo, Xuyi
It is well-known that substrate surface properties have a profound impact on morphology of thin films solution coated atop and the resulting solid-state properties. However, design rules for guiding the substrate selection have not yet been established. Such design rules are particularly important for solution coated semiconducting polymers, as the substratedirected thin film morphology can impact charge transport properties by orders of magnitude. We hypothesize that substrate surface energies dictate the thin film morphology by modulating the free energy barrier to heterogeneous nucleation. To test this hypothesis, we systematically vary the substrate surface energy via surface functionalization techniques. We performmore » in-depth morphology and device characterizations to establish the relationship between substrate surface energy, thin film morphology and charge transport properties, employing a donor-accepter (D-A) conjugated polymer. Here, we find that decreasing the substrate surface energy progressively increases thin film crystallinity, degree of molecular ordering and extent of domain alignment. Notably, the enhanced morphology on the lowest surface energy substrate lead to a 10-fold increase in the charge carrier mobility. We further develop a free energy model relating the substrate surface energy to the penalty of heterogeneous nucleation from solution in the thin film geometry. The model correctly predicts the experimental trend, thereby validating our hypothesis. This work is a significant step towards establishing design rules and understanding the critical role of substrates in determining morphology of solution coated thin films.« less
Kowsari, Mohammad H; Ebrahimi, Soraya
2018-05-16
Comprehensive molecular dynamics simulations are performed to study the average single-particle dynamics and the transport properties of 1-butyl-3-methylimidazolium hexafluorophosphate, [bmim][PF6], and 1-butyl-3-methylimidazolium tris(pentafluoroethyl)trifluorophosphate, [bmim][FAP], ionic liquids (ILs) at 400 K. We applied one of the most widely used nonpolarizable all-atom force fields for ILs, both with the original unit (±1) charges on each ion and with the partial charges uniformly scaled to 80-85%, taking into account the average polarizability and tracing the experimentally compatible transport properties. In all simulations, [bmim]+ was considered to be flexible, while the effect of a flexible vs. rigid structure of the anions and the effect of two applied charge sets on the calculated properties were separately investigated in detail. The simulation results showed that replacing [PF6]- with [FAP]-, considering anion flexibility, and applying the charge-scaled model significantly enhanced the ionic self-diffusion, ionic conductivity, inverse viscosity, and hyper anion preference (HAP). Both of the calculated self-diffusion coefficients from the long-time linear slope of the mean-square displacement (MSD) and from the integration of the velocity autocorrelation function (VACF) for the centers of mass of the ions were used for evaluation of the ionic transference number, HAP, ideal Nernst-Einstein ionic conductivity (σNE), and the Stokes-Einstein viscosity. In addition, for quantification of the degree of complicated ionic association (known as the Nernst-Einstein deviation parameter, Δ) and ionicity phenomena in the two studied ILs, the ionic conductivity was determined more rigorously by the Green-Kubo integral of the electric-current autocorrelation function (ECACF), and then the σGK/σNE ratio was evaluated. It was found that the correlated motion of the (cationanion) neighbors in [bmim][FAP] is smaller than in [bmim][PF6]. The relaxation times of the normalized reorientational autocorrelation functions were computed to gain a deep, molecular-level insight into the rotational motion of the ions. The geometric shape of the ion is a key factor in determining its reorientational dynamics. [bmim]+ shows faster translational and slower rotational dynamics in contrast to [PF6]-.
Oh, Yunjung; Yang, Wooseok; Tan, Jeiwan; Lee, Hyungsoo; Park, Jaemin; Moon, Jooho
2018-02-22
Although a unique light-harvesting property was recently demonstrated in a photocathode based on 2-dimensional (2D) opals of CuFeO 2 -shelled SiO 2 microspheres, the performance of a monolayer of ultra-thin CuFeO 2 -shelled microspheres is limited by ineffective charge separation. Herein, we propose an innovative design rule, in which an inner CuFeO 2 /outer CuAlO 2 double-shelled heterojunction is formed on each partially etched microsphere to obtain a hexagonally assembled 2D opal photoelectrode. Our Cu-delafossite double-shelled photocathode shows a dramatically improved charge separation capability, with a 9-fold increase in the photocurrent compared to that of the single-shelled counterpart. Electrochemical impedance spectroscopy clearly confirms the reduced charge transport/transfer resistance associated with the Cu-delafossite double-shelled photocathode, while surface photovoltage spectra reveal enhanced polarization of the photogenerated carrier, indicating improved charge separation capability with the aid of the heterojunction. Our finding sheds light on the importance of heterojunction interfaces in achieving optimal charge separation in opal architectures as well as the inner-shell/electrolyte interface to expedite charge separation/transport.
Measurements of Electrical and Electron Emission Properties of Highly Insulating Materials
NASA Technical Reports Server (NTRS)
Dennison, J. R.; Brunson, Jerilyn; Hoffman, Ryan; Abbott, Jonathon; Thomson, Clint; Sim, Alec
2005-01-01
Highly insulating materials often acquire significant charges when subjected to fluxes of electrons, ions, or photons. This charge can significantly modify the materials properties of the materials and have profound effects on the functionality of the materials in a variety of applications. These include charging of spacecraft materials due to interactions with the severe space environment, enhanced contamination due to charging in Lunar of Martian environments, high power arching of cables and sources, modification of tethers and ion thrusters for propulsion, and scanning electron microscopy, to name but a few examples. This paper describes new techniques and measurements of the electron emission properties and resistivity of highly insulating materials. Electron yields are a measure of the number of electrons emitted from a material per incident particle (electron, ion or photon). Electron yields depend on incident species, energy and angle, and on the material. They determine the net charge acquired by a material subject to a give incident flu. New pulsed-beam techniques will be described that allow accurate measurement of the yields for uncharged insulators and measurements of how the yields are modified as charge builds up in the insulator. A key parameter in modeling charge dissipation is the resistivity of insulating materials. This determines how charge will accumulate and redistribute across an insulator, as well as the time scale for charge transport and dissipation. Comparison of new long term constant-voltage methods and charge storage methods for measuring resistivity of highly insulating materials will be compared to more commonly used, but less accurate methods.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Abbas, M. M.; Craven, P. D.; LeClair, A. C.
2010-08-01
Dust grains in various astrophysical environments are generally charged electrostatically by photoelectric emissions with radiation from nearby sources, or by electron/ion collisions by sticking or secondary electron emissions (SEEs). The high vacuum environment on the lunar surface leads to some unusual physical and dynamical phenomena involving dust grains with high adhesive characteristics, and levitation and transportation over long distances. Knowledge of the dust grain charges and equilibrium potentials is important for understanding a variety of physical and dynamical processes in the interstellar medium, and heliospheric, interplanetary/planetary, and lunar environments. It has been well recognized that the charging properties of individualmore » micron-/submicron-size dust grains are expected to be substantially different from the corresponding values for bulk materials. In this paper, we present experimental results on the charging of individual 0.2-13 {mu}m size dust grains selected from Apollo 11 and 17 dust samples, and spherical silica particles by exposing them to mono-energetic electron beams in the 10-200 eV energy range. The dust charging process by electron impact involving the SEEs discussed is found to be a complex charging phenomenon with strong particle size dependence. The measurements indicate substantial differences between the polarity and magnitude of the dust charging rates of individual small-size dust grains, and the measurements and model properties of corresponding bulk materials. A more comprehensive plan of measurements of the charging properties of individual dust grains for developing a database for realistic models of dust charging in astrophysical and lunar environments is in progress.« less
NASA Technical Reports Server (NTRS)
Abbas, M. M.; Tankosic, D.; Crave, P. D.; LeClair, A.; Spann, J. F.
2010-01-01
Dust grains in various astrophysical environments are generally charged electrostatically by photoelectric emissions with radiation from nearby sources, or by electron/ion collisions by sticking or secondary electron emissions (SEES). The high vacuum environment on the lunar surface leads to some unusual physical and dynamical phenomena involving dust grains with high adhesive characteristics, and levitation and transportation over long distances. Knowledge of the dust grain charges and equilibrium potentials is important for understanding a variety of physical and dynamical processes in the interstellar medium, and heliospheric, interplanetary/ planetary, and lunar environments. It has been well recognized that the charging properties of individual micron-/submicron-size dust grains are expected to be substantially different from the corresponding values for bulk materials. In this paper, we present experimental results on the charging of individual 0.2-13 m size dust grains selected from Apollo 11 and 17 dust samples, and spherical silica particles by exposing them to mono-energetic electron beams in the 10-200 eV energy range. The dust charging process by electron impact involving the SEES discussed is found to be a complex charging phenomenon with strong particle size dependence. The measurements indicate substantial differences between the polarity and magnitude of the dust charging rates of individual small-size dust grains, and the measurements and model properties of corresponding bulk materials. A more comprehensive plan of measurements of the charging properties of individual dust grains for developing a database for realistic models of dust charging in astrophysical and lunar environments is in progress.
NASA Astrophysics Data System (ADS)
Mante, Pierre-Adrien; Stoumpos, Constantinos C.; Kanatzidis, Mercouri G.; Yartsev, Arkady
2017-02-01
Despite the great amount of attention CH3NH3PbI3 has received for its solar cell application, intrinsic properties of this material are still largely unknown. Mobility of charges is a quintessential property in this aspect; however, there is still no clear understanding of electron transport, as reported values span over three orders of magnitude. Here we develop a method to measure the electron and hole deformation potentials using coherent acoustic phonons generated by femtosecond laser pulses. We apply this method to characterize a CH3NH3PbI3 single crystal. We measure the acoustic phonon properties and characterize electron-acoustic phonon scattering. Then, using the deformation potential theory, we calculate the carrier intrinsic mobility and compare it to the reported experimental and theoretical values. Our results reveal high electron and hole mobilities of 2,800 and 9,400 cm2 V-1 s-1, respectively. Comparison with literature values of mobility demonstrates the potential role played by polarons in charge transport in CH3NH3PbI3.
Magneto-transport properties of proposed triply degenerate topological semimetal Pd3Bi2S2
NASA Astrophysics Data System (ADS)
Roy, Shubhankar; Pariari, Arnab; Singha, Ratnadwip; Satpati, Biswarup; Mandal, Prabhat
2018-04-01
We report transport properties of single-crystalline Pd3Bi2S2, which has been predicted to host an unconventional electronic phase of matter beyond three-dimensional Dirac and Weyl semimetals. Similar to several topological systems, the resistivity shows field-induced metal to semiconductor-like crossover at low temperature. Large, anisotropic, and non-saturating magnetoresistance has been observed in the transverse experimental configuration. At 2 K and 9 T, the MR value reaches as high as ˜1.1 × 103%. Hall resistivity reveals the presence of two types of charge carriers and has been analyzed using the two-band model. In spite of the large density (>1021 cm-3), the mobility of charge carriers is found to be quite high (˜ 0.75 × 104 cm2 V-1 s-1 for the hole and ˜ 0.3 × 104 cm2 V-1 s-1 for the electron). The observed magneto-electrical properties indicate that Pd3Bi2S2 may be a new member of the topological semimetal family, which can have a significant impact in technological applications.
A Cation-containing Polymer Anion Exchange Membrane based on Poly(norbornene)
NASA Astrophysics Data System (ADS)
Beyer, Frederick; Price, Samuel; Ren, Xiaoming; Savage, Alice
Cation-containing polymers are being studied widely for use as anion exchange membranes (AEMs) in alkaline fuel cells (AFCs) because AEMs offer a number of potential benefits including allowing a solid state device and elimination of the carbonate poisoning problem. The successful AEM will combine high performance from several orthogonal properties, having robust mechanical strength even when wet, high hydroxide conductivity, and the high chemical stability required for long device lifetimes. In this study, we have synthesized a model cationic polymer that combines three of the key advantages of Nafion. The polymer backbone based on semicrystalline atactic poly(norbornene) offers good mechanical properties. A flexible, ether-based tether between the backbone and fixed cation charged species (quaternary ammonium) should provide the low-Tg, hydrophilic environment required to facilitate OH- transport. Finally, methyl groups have been added at the beta position relative to the quaternary ammonium cation to prevent Hoffman elimination, one mechanism by which AEMs are neutralized in a high pH environment. In this poster, we will present our findings on mechanical properties, morphology, charge transport, and chemical stability of this material.
Zhang, Yuhan; Qiao, Jingsi; Gao, Si; Hu, Fengrui; He, Daowei; Wu, Bing; Yang, Ziyi; Xu, Bingchen; Li, Yun; Shi, Yi; Ji, Wei; Wang, Peng; Wang, Xiaoyong; Xiao, Min; Xu, Hangxun; Xu, Jian-Bin; Wang, Xinran
2016-01-08
One of the basic assumptions in organic field-effect transistors, the most fundamental device unit in organic electronics, is that charge transport occurs two dimensionally in the first few molecular layers near the dielectric interface. Although the mobility of bulk organic semiconductors has increased dramatically, direct probing of intrinsic charge transport in the two-dimensional limit has not been possible due to excessive disorders and traps in ultrathin organic thin films. Here, highly ordered single-crystalline mono- to tetralayer pentacene crystals are realized by van der Waals (vdW) epitaxy on hexagonal BN. We find that the charge transport is dominated by hopping in the first conductive layer, but transforms to bandlike in subsequent layers. Such an abrupt phase transition is attributed to strong modulation of the molecular packing by interfacial vdW interactions, as corroborated by quantitative structural characterization and density functional theory calculations. The structural modulation becomes negligible beyond the second conductive layer, leading to a mobility saturation thickness of only ∼3 nm. Highly ordered organic ultrathin films provide a platform for new physics and device structures (such as heterostructures and quantum wells) that are not possible in conventional bulk crystals.
NASA Astrophysics Data System (ADS)
Zhang, Yuhan; Qiao, Jingsi; Gao, Si; Hu, Fengrui; He, Daowei; Wu, Bing; Yang, Ziyi; Xu, Bingchen; Li, Yun; Shi, Yi; Ji, Wei; Wang, Peng; Wang, Xiaoyong; Xiao, Min; Xu, Hangxun; Xu, Jian-Bin; Wang, Xinran
2016-01-01
One of the basic assumptions in organic field-effect transistors, the most fundamental device unit in organic electronics, is that charge transport occurs two dimensionally in the first few molecular layers near the dielectric interface. Although the mobility of bulk organic semiconductors has increased dramatically, direct probing of intrinsic charge transport in the two-dimensional limit has not been possible due to excessive disorders and traps in ultrathin organic thin films. Here, highly ordered single-crystalline mono- to tetralayer pentacene crystals are realized by van der Waals (vdW) epitaxy on hexagonal BN. We find that the charge transport is dominated by hopping in the first conductive layer, but transforms to bandlike in subsequent layers. Such an abrupt phase transition is attributed to strong modulation of the molecular packing by interfacial vdW interactions, as corroborated by quantitative structural characterization and density functional theory calculations. The structural modulation becomes negligible beyond the second conductive layer, leading to a mobility saturation thickness of only ˜3 nm . Highly ordered organic ultrathin films provide a platform for new physics and device structures (such as heterostructures and quantum wells) that are not possible in conventional bulk crystals.
Hybrid Organic–Inorganic Perovskites on the Move
2016-01-01
Conspectus Hybrid organic–inorganic perovskites (HOIPs) are crystals with the structural formula ABX3, where A, B, and X are organic and inorganic ions, respectively. While known for several decades, HOIPs have only in recent years emerged as extremely promising semiconducting materials for solar energy applications. In particular, power-conversion efficiencies of HOIP-based solar cells have improved at a record speed and, after only little more than 6 years of photovoltaics research, surpassed the 20% threshold, which is an outstanding result for a solution-processable material. It is thus of fundamental importance to reveal physical and chemical phenomena that contribute to, or limit, these impressive photovoltaic efficiencies. To understand charge-transport and light-absorption properties of semiconducting materials, one often invokes a lattice of ions displaced from their static positions only by harmonic vibrations. However, a preponderance of recent studies suggests that this picture is not sufficient for HOIPs, where a variety of structurally dynamic effects, beyond small harmonic vibrations, arises already at room temperature. In this Account, we focus on these effects. First, we review structure and bonding in HOIPs and relate them to the promising charge-transport and absorption properties of these materials, in terms of favorable electronic properties. We point out that HOIPs are much “softer” mechanically, compared to other efficient solar-cell materials, and that this can result in large ionic displacements at room temperature. We therefore focus next on dynamic structural effects in HOIPs, going beyond a static band-structure picture. Specifically, we discuss pertinent experimental and theoretical findings as to phase-transition behavior and molecular/octahedral rearrangements. We then discuss atomic diffusion phenomena in HOIPs, with an emphasis on the migration of intrinsic and extrinsic ionic species. From this combined perspective, HOIPs appear as highly dynamic materials, in which structural fluctuations and long-range ionic motion have an unusually strong impact on charge-transport and optical properties. We highlight the potential implications of these effects for several intriguing phenomenological observations, ranging from scattering mechanisms and lifetimes of charge carriers to light-induced structural effects and ionic conduction. PMID:26878152
47 CFR 69.111 - Tandem-switched transport and tandem charge.
Code of Federal Regulations, 2011 CFR
2011-10-01
... 47 Telecommunication 3 2011-10-01 2011-10-01 false Tandem-switched transport and tandem charge. 69... SERVICES (CONTINUED) ACCESS CHARGES Computation of Charges § 69.111 Tandem-switched transport and tandem...-switched transport shall consist of two rate elements, a transmission charge and a tandem switching charge...
NASA Astrophysics Data System (ADS)
McNew, C.; Wang, C.; Kocis, T. N.; Murphy, N. P.; Dahlke, H. E.
2017-12-01
Though our understanding of contaminant behavior in the subsurface has improved, our ability to measure and predict complex contaminant transport pathways at hillslope to watershed scales is still lacking. By utilizing bio-molecular nanotechnology developed for nano-medicines and drug delivery, we are able to produce DNA-labeled micro- and nanoparticles for use in a myriad of environmental systems. Control of the fabrication procedure allows us to produce particles of custom size, charge, and surface functionality to mimic the transport properties of the particulate contaminant or colloid of interest. The use of custom sequenced DNA allows for the fabrication of an enormous number of unique particle labels (approximately 1.61 x 1060 unique sequences) and the ability to discern between varied spatial and temporal applications, or the transport effect of varied particle size, charge, or surface properties. To date, this technology has been utilized to study contaminant transport from lab to field scales, including surface and open channel flow applications, transport in porous media, soil retention, and even subglacial flow pathways. Here, we present the technology for production and detection of the DNA-labeled particles along with the results from a current hillslope study at the Sierra Foothills Research and Extension Center (SFREC). This field study utilizes spatial and temporal variations in DNA-labeled particle applications to identify subsurface pollutant transport pathways through the four distinct soil horizons present at the SFREC site. Results from this and previous studies highlight the tremendous potential of the DNA-labeled particle technology for studying contaminant transport through the subsurface.
NASA Technical Reports Server (NTRS)
Stallcop, James R.; Partridge, Harry; Levin, Eugene
1991-01-01
N2(+) and O2(+) potential energy curves have been constructed by combining measured data with the results from electronic structure calculations. These potential curves have been employed to determine accurate charge exchange cross sections, transport cross sections, and collision integrals for ground state N(+)-N and O(+)-O interactions. The cross sections have been calculated from a semiclassical approximation to the scattering using a computer code that fits a spline curve through the discrete potential data and incorporates the proper long-range behavior of the interactions forces. The collision integrals are tabulated for a broad range of temperatures 250-100,000 K and are intended to reduce the uncertainty in the values of the transport properties of nonequilibrium air, particularly at high temperatures.
Yoo-Kong, Sikarin; Liewrian, Watchara
2015-12-01
We report on a theoretical investigation concerning the polaronic effect on the transport properties of a charge carrier in a one-dimensional molecular chain. Our technique is based on the Feynman's path integral approach. Analytical expressions for the frequency-dependent mobility and effective mass of the carrier are obtained as functions of electron-phonon coupling. The result exhibits the crossover from a nearly free particle to a heavily trapped particle. We find that the mobility depends on temperature and decreases exponentially with increasing temperature at low temperature. It exhibits large polaronic-like behaviour in the case of weak electron-phonon coupling. These results agree with the phase transition (A.S. Mishchenko et al., Phys. Rev. Lett. 114, 146401 (2015)) of transport phenomena related to polaron motion in the molecular chain.
Advances in NO2 sensing with individual single-walled carbon nanotube transistors.
Chikkadi, Kiran; Muoth, Matthias; Roman, Cosmin; Haluska, Miroslav; Hierold, Christofer
2014-01-01
The charge carrier transport in carbon nanotubes is highly sensitive to certain molecules attached to their surface. This property has generated interest for their application in sensing gases, chemicals and biomolecules. With over a decade of research, a clearer picture of the interactions between the carbon nanotube and its surroundings has been achieved. In this review, we intend to summarize the current knowledge on this topic, focusing not only on the effect of adsorbates but also the effect of dielectric charge traps on the electrical transport in single-walled carbon nanotube transistors that are to be used in sensing applications. Recently, contact-passivated, open-channel individual single-walled carbon nanotube field-effect transistors have been shown to be operational at room temperature with ultra-low power consumption. Sensor recovery within minutes through UV illumination or self-heating has been shown. Improvements in fabrication processes aimed at reducing the impact of charge traps have reduced the hysteresis, drift and low-frequency noise in carbon nanotube transistors. While open challenges such as large-scale fabrication, selectivity tuning and noise reduction still remain, these results demonstrate considerable progress in transforming the promise of carbon nanotube properties into functional ultra-low power, highly sensitive gas sensors.
Chávez, Patricia; Bulut, Ibrahim; Fall, Sadiara; Ibraikulov, Olzhas A; Chochos, Christos L; Bartringer, Jérémy; Heiser, Thomas; Lévêque, Patrick; Leclerc, Nicolas
2018-05-25
In this work, a new n -type polymer based on a thiazole-diketopyrrolopyrrole unit has been synthesized through direct (hetero)arylation polycondensation. The molar mass has been optimized by systematic variation of the the monomer concentration. Optical and electrochemical properties have been studied. They clearly suggested that this polymer possess a high electron affinity together with a very interesting absorption band, making it a good non-fullerene acceptor candidate. As a consequence, its charge transport and photovoltaic properties in a blend with the usual P3HT electron-donating polymer have been investigated.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wu, Ning
Independent of the methods of nuclear waste disposal, the degradation of packaging materials could lead to mobilization and transport of radionuclides into the geosphere. This process can be significantly accelerated due to the association of radionuclides with the backfill materials or mobile colloids in groundwater. The transport of these colloids is complicated by the inherent coupling of physical and chemical heterogeneities (e.g., pore space geometry, grain size, charge heterogeneity, and surface hydrophobicity) in natural porous media that can exist on the length scale of a few grains. In addition, natural colloids themselves are often heterogeneous in their surface properties (e.g.,more » clay platelets possess opposite charges on the surface and along the rim). Both physical and chemical heterogeneities influence the transport and retention of radionuclides under various groundwater conditions. However, the precise mechanisms how these coupled heterogeneities influence colloidal transport are largely elusive. This knowledge gap is a major source of uncertainty in developing accurate models to represent the transport process and to predict distribution of radionuclides in the geosphere.« less
Central charge from adiabatic transport of cusp singularities in the quantum Hall effect
NASA Astrophysics Data System (ADS)
Can, Tankut
2017-04-01
We study quantum Hall (QH) states on a punctured Riemann sphere. We compute the Berry curvature under adiabatic motion in the moduli space in the large N limit. The Berry curvature is shown to be finite in the large N limit and controlled by the conformal dimension of the cusp singularity, a local property of the mean density. Utilizing exact sum rules obtained from a Ward identity, we show that for the Laughlin wave function, the dimension of a cusp singularity is given by the central charge, a robust geometric response coefficient in the QHE. Thus, adiabatic transport of curvature singularities can be used to determine the central charge of QH states. We also consider the effects of threaded fluxes and spin-deformed wave functions. Finally, we give a closed expression for all moments of the mean density in the integer QH state on a punctured disk.
Guzelturk, Burak; Belisle, Rebecca A; Smith, Matthew D; Bruening, Karsten; Prasanna, Rohit; Yuan, Yakun; Gopalan, Venkatraman; Tassone, Christopher J; Karunadasa, Hemamala I; McGehee, Michael D; Lindenberg, Aaron M
2018-03-01
Unusual photophysical properties of organic-inorganic hybrid perovskites have not only enabled exceptional performance in optoelectronic devices, but also led to debates on the nature of charge carriers in these materials. This study makes the first observation of intense terahertz (THz) emission from the hybrid perovskite methylammonium lead iodide (CH 3 NH 3 PbI 3 ) following photoexcitation, enabling an ultrafast probe of charge separation, hot-carrier transport, and carrier-lattice coupling under 1-sun-equivalent illumination conditions. Using this approach, the initial charge separation/transport in the hybrid perovskites is shown to be driven by diffusion and not by surface fields or intrinsic ferroelectricity. Diffusivities of the hot and band-edge carriers along the surface normal direction are calculated by analyzing the emitted THz transients, with direct implications for hot-carrier device applications. Furthermore, photogenerated carriers are found to drive coherent terahertz-frequency lattice distortions, associated with reorganizations of the lead-iodide octahedra as well as coupled vibrations of the organic and inorganic sublattices. This strong and coherent carrier-lattice coupling is resolved on femtosecond timescales and found to be important both for resonant and far-above-gap photoexcitation. This study indicates that ultrafast lattice distortions play a key role in the initial processes associated with charge transport. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Guzelturk, Burak; Belisle, Rebecca A.; Smith, Matthew D.; ...
2018-01-23
Unusual photophysical properties of organic–inorganic hybrid perovskites have not only enabled exceptional performance in optoelectronic devices, but also led to debates on the nature of charge carriers in these materials. This study makes the first observation of intense terahertz (THz) emission from the hybrid perovskite methylammonium lead iodide (CH 3NH 3PbI 3) following photoexcitation, enabling an ultrafast probe of charge separation, hot–carrier transport, and carrier–lattice coupling under 1–sun–equivalent illumination conditions. Using this approach, the initial charge separation/transport in the hybrid perovskites is shown to be driven by diffusion and not by surface fields or intrinsic ferroelectricity. Diffusivities of the hotmore » and band–edge carriers along the surface normal direction are calculated by analyzing the emitted THz transients, with direct implications for hot–carrier device applications. Furthermore, photogenerated carriers are found to drive coherent terahertz–frequency lattice distortions, associated with reorganizations of the lead–iodide octahedra as well as coupled vibrations of the organic and inorganic sublattices. This strong and coherent carrier–lattice coupling is resolved on femtosecond timescales and found to be important both for resonant and far–above–gap photoexcitation. As a result, this study indicates that ultrafast lattice distortions play a key role in the initial processes associated with charge transport.« less
Jung, Jae Woong; Chueh, Chu-Chen; Jen, Alex K. -Y.
2015-10-20
The promising photophysical properties of the emerging organometallic halide perovskites, such as intense broadband absorption, high charge carrier mobility, and long charge diffusion length, have enabled the rapid development in solar cells reaching over 20% power conversion effi ciency (PCE) recently. Especially, the low material cost and facile solution processability of perovskites are very attractive as next-generation photovoltaic materials for sustainable energy.
Correlation of transarterial transport of various dextrans with their physicochemical properties.
Elmalak, O; Lovich, M A; Edelman, E
2000-11-01
Local vascular drug delivery provides elevated concentrations of drug in the target tissue while minimizing systemic side effects. To better characterize local pharmacokinetics we examined the arterial transport of locally applied dextran and dextran derivatives in vivo. Using a two-compartment pharmacokinetic model to correct the measured transmural flux of these compounds for systemic redistribution and elimination as delivered from a photopolymerizable hydrogel surrounding rat carotid arteries, we found that the diffusivities and the transendothelial permeabilities were strongly dependent on molecular weight and charge. For neutral dextrans, the effective diffusive resistance in the media increased with molecular weight approximately 4.1-fold between the molecular weights of 10 and 282 kDa. Similarly, endothelial resistance increased 28-fold over the same molecular weight range. The effective medial diffusive resistance was unaffected by cationic charge as such molecules moved identically to neutral compounds, but increased approximately 40% when dextrans were negatively charged. Transendothelial resistance was 20-fold lower for the cationic dextrans, and 11-fold higher for the anionic dextrans, when both were compared to neutral counterparts. These results suggest that, while low molecular weight drugs will rapidly traverse the arterial wall with the endothelium posing a minimal barrier, the reverse is true for high molecular weight agents. With these data, the deposition and distribution of locally released vasotherapeutic compounds might be predicted based upon chemical properties, such as molecular weight and charge.
Tuning electronic transport in epitaxial graphene-based van der Waals heterostructures
NASA Astrophysics Data System (ADS)
Lin, Yu-Chuan; Li, Jun; de La Barrera, Sergio C.; Eichfeld, Sarah M.; Nie, Yifan; Addou, Rafik; Mende, Patrick C.; Wallace, Robert M.; Cho, Kyeongjae; Feenstra, Randall M.; Robinson, Joshua A.
2016-04-01
Two-dimensional tungsten diselenide (WSe2) has been used as a component in atomically thin photovoltaic devices, field effect transistors, and tunneling diodes in tandem with graphene. In some applications it is necessary to achieve efficient charge transport across the interface of layered WSe2-graphene, a semiconductor to semimetal junction with a van der Waals (vdW) gap. In such cases, band alignment engineering is required to ensure a low-resistance, ohmic contact. In this work, we investigate the impact of graphene electronic properties on the transport at the WSe2-graphene interface. Electrical transport measurements reveal a lower resistance between WSe2 and fully hydrogenated epitaxial graphene (EGFH) compared to WSe2 grown on partially hydrogenated epitaxial graphene (EGPH). Using low-energy electron microscopy and reflectivity on these samples, we extract the work function difference between the WSe2 and graphene and employ a charge transfer model to determine the WSe2 carrier density in both cases. The results indicate that WSe2-EGFH displays ohmic behavior at small biases due to a large hole density in the WSe2, whereas WSe2-EGPH forms a Schottky barrier junction.Two-dimensional tungsten diselenide (WSe2) has been used as a component in atomically thin photovoltaic devices, field effect transistors, and tunneling diodes in tandem with graphene. In some applications it is necessary to achieve efficient charge transport across the interface of layered WSe2-graphene, a semiconductor to semimetal junction with a van der Waals (vdW) gap. In such cases, band alignment engineering is required to ensure a low-resistance, ohmic contact. In this work, we investigate the impact of graphene electronic properties on the transport at the WSe2-graphene interface. Electrical transport measurements reveal a lower resistance between WSe2 and fully hydrogenated epitaxial graphene (EGFH) compared to WSe2 grown on partially hydrogenated epitaxial graphene (EGPH). Using low-energy electron microscopy and reflectivity on these samples, we extract the work function difference between the WSe2 and graphene and employ a charge transfer model to determine the WSe2 carrier density in both cases. The results indicate that WSe2-EGFH displays ohmic behavior at small biases due to a large hole density in the WSe2, whereas WSe2-EGPH forms a Schottky barrier junction. Electronic supplementary information (ESI) available. See DOI: 10.1039/c6nr01902a
NASA Astrophysics Data System (ADS)
MacDonald, Gordon Alex
This dissertation focuses on characterizing the nanoscale and surface averaged electrical properties of transparent conducting oxide electrodes such as indium tin oxide (ITO) and transparent metal-oxide (MO) electron selective interlayers (ESLs), such as zinc oxide (ZnO), the ability of these materials to rapidly extract photogenerated charges from organic semiconductors (OSCs) used in organic photovoltaic (OPV) cells, and evaluating their impact on the power conversion efficiency (PCE) of OPV devices. In Chapter 1, we will introduce the fundamental principles, benefits, and the key innovations that have advanced this technology. In Chapter 2 of this dissertation, we demonstrate an innovative application of conductive probe atomic force microscopy (CAFM) to map the nanoscale electrical heterogeneity at the interface between ITO, and a well-studied OSC, copper phthalocyanine (CuPc).(MacDonald et al. (2012) ACS Nano, 6, p. 9623) In this work we collected arrays of current-voltage (J-V) curves, using a CAFM probe as the top contact of CuPc/ITO systems, to map the local J-V responses. By comparing J-V responses to known models for charge transport, we were able to determine if the local rate-limiting-step for charge transport is through the OSC (ohmic) or the CuPc/ITO interface (non-ohmic). Chapter 3 focus on the electrical property characterization of RF-magnetron sputtered ZnO (sp-ZnO) ESL films on ITO substrates. We have shown that the energetic alignment of ESLs and the OSC active materials plays a critical role in determining the PCE of OPV devices and UV light soaking sensitivity. We have used a combination of device testing, modeling, and impedance spectroscopy to characterize the effects that energetic alignment has on the charge carrier transport and distribution within the OPV device. In Chapter 4 we demonstrate that the local properties of sp-ZnO films varies as a function of the underlying ITO crystal face. We show that the local ITO crystal face determines the local nucleation and growth of the sp-ZnO films and, in turn, affects the nanoscale distribution of electrical and chemical properties. These studies have contributed to a detailed understanding of the role that electrical heterogeneity, insulating barriers and energetic alignment at MO/OSC interfaces play in OPV PCE.
Influence of natural organic matter in porous media on fine particle transport.
Zhou, Yuhong; Cheng, Tao
2018-06-15
Although extensive research has been conducted to understand the effects of dissolved organic matter (DOM) on fine particle transport, less attention has been paid to natural organic matter (NOM) in the transport medium (i.e., immobile rock and sediment grains). The objective of this study is to elucidate the roles of NOM in the transport medium in mediating particle transport. We conducted experimental and modelling study on the transport of nanoscale titanium dioxide (nTiO 2 ) and illite colloid in columns packed with quartz sand under water-saturated conditions. Peat moss was used as an example NOM and packed in some of the columns to investigate its influence on particle transport. Experimental results showed that NOM may either increase or decrease particle transport depending on the specific conditions. NOM in the transport medium was found to attract particles and reduce particle mobility when the energy barrier between particle and NOM is low or non-existent. NOM also adsorb to Fe and Al oxyhydroxides and promote the transport of negatively-charged particles at low pH. Partial dissolution of NOM releases DOM, and the DOM adsorbs to and increases the transport of positively-charged particles. Additionally, NOM changes pore water pH, which influences particle mobility by affecting the interaction energy between the particle and transport medium. Modelling results showed that the deposition sites provided by peat moss are very heterogeneous, and the NOM from peat moss may reduce particle deposition rate by adsorbing to the particle and/or transport medium. Findings from this study demonstrate that NOM in the transport medium not only changes property of the medium, but also may alter water chemistry. Therefore, the role of NOM in mediating particle transport is complicated and dependent on the property of the particle, NOM, and mineralogical composition of the medium. Copyright © 2018 Elsevier B.V. All rights reserved.
NASA Astrophysics Data System (ADS)
Androulaki, Eleni; Vergadou, Niki; Ramos, Javier; Economou, Ioannis G.
2012-06-01
Molecular dynamics (MD) simulations have been performed in order to investigate the properties of [C n mim+][Tf2N-] (n = 4, 8, 12) ionic liquids (ILs) in a wide temperature range (298.15-498.15 K) and at atmospheric pressure (1 bar). A previously developed methodology for the calculation of the charge distribution that incorporates ab initio quantum mechanical calculations based on density functional theory (DFT) was used to calculate the partial charges for the classical molecular simulations. The wide range of time scales that characterize the segmental dynamics of these ILs, especially at low temperatures, required very long MD simulations, on the order of several tens of nanoseconds, to calculate the thermodynamic (density, thermal expansion, isothermal compressibility), structural (radial distribution functions between the centers of mass of ions and between individual sites, radial-angular distribution functions) and dynamic (relaxation times of the reorientation of the bonds and the torsion angles, self-diffusion coefficients, shear viscosity) properties. The influence of the temperature and the cation's alkyl chain length on the above-mentioned properties was thoroughly investigated. The calculated thermodynamic (primary and derivative) and structural properties are in good agreement with the experimental data, while the extremely sluggish dynamics of the ILs under study renders the calculation of their transport properties a very complicated and challenging task, especially at low temperatures.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yan, Zhequan; Chen, Liang; Yoon, Mina
2016-11-08
In this paper, we investigate the role of interfacial electronic properties on the phonon transport in two-dimensional MoS 2 adsorbed on metal substrates (Au and Sc) using first-principles density functional theory and the atomistic Green’s function method. Our study reveals that the different degree of orbital hybridization and electronic charge distribution between MoS 2 and metal substrates play a significant role in determining the overall phonon–phonon coupling and phonon transmission. The charge transfer caused by the adsorption of MoS 2 on Sc substrate can significantly weaken the Mo–S bond strength and change the phonon properties of MoS 2, which resultmore » in a significant change in thermal boundary conductance (TBC) from one lattice-stacking configuration to another for same metallic substrate. In a lattice-stacking configuration of MoS 2/Sc, weakening of the Mo–S bond strength due to charge redistribution results in decrease in the force constant between Mo and S atoms and substantial redistribution of phonon density of states to low-frequency region which affects overall phonon transmission leading to 60% decrease in TBC compared to another configuration of MoS 2/Sc. Strong chemical coupling between MoS 2 and the Sc substrate leads to a significantly (~19 times) higher TBC than that of the weakly bound MoS 2/Au system. Our findings demonstrate the inherent connection among the interfacial electronic structure, the phonon distribution, and TBC, which helps us understand the mechanism of phonon transport at the MoS 2/metal interfaces. Finally, the results provide insights for the future design of MoS 2-based electronics and a way of enhancing heat dissipation at the interfaces of MoS 2-based nanoelectronic devices.« less
NASA Astrophysics Data System (ADS)
Wang, Xin; Liang, Shi-Dong
2013-02-01
We explore the charge transfer in the telomere G-Quadruplex (TG4) DNA theoretically by the nonequilibrium Green's function method, and reveal the topological effect of the charge transport in TG4 DNA. The consecutive TG4 (CTG4) is semiconducting with 0.2 0.3 eV energy gap. Charges transfer favorably in the CTG4, but are trapped in the nonconsecutive TG4 (NCTG4). The global conductance is inversely proportional to the local conductance for NCTG4. The topological structure transition from NCTG4 to CTG4 induces abruptly 3nA charge current, which provide a microscopic clue to understand the telomerase activated or inhibited by TG4. Our findings reveal the fundamental property of charge transfer in TG4 and its relationship with the topological structure of TG4.
Ye, Fengbin; Baldursdottir, Stefania; Hvidt, Søren; Jensen, Henrik; Larsen, Susan W; Yaghmur, Anan; Larsen, Claus; Østergaard, Jesper
2016-03-07
In the field of drug delivery to the articular cartilage, it is advantageous to apply artificial tissue models as surrogates of cartilage for investigating drug transport and release properties. In this study, artificial cartilage models consisting of 0.5% (w/v) agarose gel containing 0.5% (w/v) chondroitin sulfate or 0.5% (w/v) hyaluronic acid were developed, and their rheological and morphological properties were characterized. UV imaging was utilized to quantify the transport properties of the following four model compounds in the agarose gel and in the developed artificial cartilage models: H-Ala-β-naphthylamide, H-Lys-Lys-β-naphthylamide, lysozyme, and α-lactalbumin. The obtained results showed that the incorporation of the polyelectrolytes chondroitin sulfate or hyaluronic acid into agarose gel induced a significant reduction in the apparent diffusivities of the cationic model compounds as compared to the pure agarose gel. The decrease in apparent diffusivity of the cationic compounds was not caused by a change in the gel structure since a similar reduction in apparent diffusivity was not observed for the net negatively charged protein α-lactalbumin. The apparent diffusivity of the cationic compounds in the negatively charged hydrogels was highly dependent on the ionic strength, pointing out the importance of electrostatic interactions between the diffusant and the polyelectrolytes. Solution based affinity studies between the model compounds and the two investigated polyelectrolytes further confirmed the electrostatic nature of their interactions. The results obtained from the UV imaging diffusion studies are important for understanding the effect of drug physicochemical properties on the transport in articular cartilage. The extracted information may be useful in the development of hydrogels for in vitro release testing having features resembling the articular cartilage.
Hu, Yuanyuan; Berdunov, Nikolai; Di, Chong-an; Nandhakumar, Iris; Zhang, Fengjiao; Gao, Xike; Zhu, Daoben; Sirringhaus, Henning
2014-07-22
We have investigated the influence of the symmetry of the side chain substituents in high-mobility, solution processable n-type molecular semiconductors on the performance of organic field-effect transistors (OFETs). We compare two molecules with the same conjugated core, but either symmetric or asymmetric side chain substituents, and investigate the transport properties and thin film growth mode using scanning Kelvin probe microscopy (SKPM) and atomic force microscopy (AFM). We find that asymmetric side chains can induce a favorable two-dimensional growth mode with a bilayer structure, which enables ultrathin films with a single bilayer to exhibit excellent transport properties, while the symmetric molecules adopt an unfavorable three-dimensional growth mode in which transport in the first monolayer at the interface is severely hindered by high-resistance grain boundaries.
Oliveira, Hélder; Wu, Nao; Zhang, Qian; Wang, Jingyi; Oliveira, Joana; de Freitas, Victor; Mateus, Nuno; He, Jingren; Fernandes, Iva
2016-05-18
In this study, the gastric transport efficiency of malvidin-3-glucoside and several derivatives was assayed on the MKN-28 cell model. The transport efficiency was found to increase for all compounds with the incubation time. Pyranoanthocyanins may slightly impair transport efficiency levels in comparison with native anthocyanins. Among the pyranoanthocyanin derivatives the presence of the carbonyl group and the absence of charge were important for the transport efficiency percentage of oxovitisin and apparently compensated the negative effect associated with the additional ring. Moreover, the antiproliferative properties of these compounds in the MCF-7 cancer cell line were assayed, oxovitisin being the most effective compound in inhibiting the proliferation of MCF-7 cells. Also, a kinetic incorporation of oxovitisin was assayed revealing that this pyranoanthocyanin is quickly incorporated into cells. This study confirms the importance of the natural micro-oxidative processes that occur during the ageing of anthocyanin-containing food and their impact on their bioavailability and bioactivity properties.
Milotti, Valeria; Pietsch, Manuel; Strunk, Karl-Philipp; Melzer, Christian
2018-01-01
We report a Kelvin-probe method to investigate the lateral charge-transport properties of semiconductors, most notably the charge-carrier mobility. The method is based on successive charging and discharging of a pre-biased metal-insulator-semiconductor stack by an alternating voltage applied to one edge of a laterally confined semiconductor layer. The charge carriers spreading along the insulator-semiconductor interface are directly measured by a Kelvin-probe, following the time evolution of the surface potential. A model is presented, describing the device response for arbitrary applied biases allowing the extraction of the lateral charge-carrier mobility from experimentally measured surface potentials. The method is tested using the organic semiconductor poly(3-hexylthiophene), and the extracted mobilities are validated through current voltage measurements on respective field-effect transistors. Our widely applicable approach enables robust measurements of the lateral charge-carrier mobility in semiconductors with weak impact from the utilized contact materials.
NASA Astrophysics Data System (ADS)
Milotti, Valeria; Pietsch, Manuel; Strunk, Karl-Philipp; Melzer, Christian
2018-01-01
We report a Kelvin-probe method to investigate the lateral charge-transport properties of semiconductors, most notably the charge-carrier mobility. The method is based on successive charging and discharging of a pre-biased metal-insulator-semiconductor stack by an alternating voltage applied to one edge of a laterally confined semiconductor layer. The charge carriers spreading along the insulator-semiconductor interface are directly measured by a Kelvin-probe, following the time evolution of the surface potential. A model is presented, describing the device response for arbitrary applied biases allowing the extraction of the lateral charge-carrier mobility from experimentally measured surface potentials. The method is tested using the organic semiconductor poly(3-hexylthiophene), and the extracted mobilities are validated through current voltage measurements on respective field-effect transistors. Our widely applicable approach enables robust measurements of the lateral charge-carrier mobility in semiconductors with weak impact from the utilized contact materials.
NASA Astrophysics Data System (ADS)
Mendels, Dan; Tessler, Nir
2016-07-01
Organic semiconductors constitute one of the main components underlying present-day paradigm shifting optoelectronic applications. Among them, polymer based semiconductors are deemed particularly favorable due to their natural compatibility with low-cost device fabrication techniques. In light of recent advances in the syntheses of these classes of materials, yielding systems exhibiting charge mobilities comparable with those found in organic crystals, a comprehensive study of their charge transport properties is presented. Among a plethora of effects arising from these systems morphological and non morphological attributes, it is shown that a favorable presence of several of these attributes, including that of rapid on-chain carrier propagation and the presence of elongated conjugation segments, can lead to an enhancement of the system’s mobility by more than 5 orders of magnitude with respect to ‘standard’ amorphous organic semiconductors. New insight for the formulation of new engineering strategies for next generation polymer based semiconductors is thus gathered.
Tuning the metal-insulator crossover and magnetism in SrRuO 3 by ionic gating
Yi, Hee Taek; Gao, Bin; Xie, Wei; ...
2014-10-13
Reversible control of charge transport and magnetic properties without degradation is a key for device applications of transition metal oxides. Chemical doping during the growth of transition metal oxides can result in large changes in physical properties, but in most of the cases irreversibility is an inevitable constraint. We report a reversible control of charge transport, metal-insulator crossover and magnetism in field-effect devices based on ionically gated archetypal oxide system - SrRuO 3. In these thin-film devices, the metal-insulator crossover temperature and the onset of magnetoresistance can be continuously and reversibly tuned in the range 90–250 K and 70–100 K,more » respectively, by application of a small gate voltage. We infer that a reversible diffusion of oxygen ions in the oxide lattice dominates the response of these materials to the gate electric field. These findings provide critical insights into both the understanding of ionically gated oxides and the development of novel applications.« less
Bulk-edge correspondence in topological transport and pumping
NASA Astrophysics Data System (ADS)
Imura, Ken-Ichiro; Yoshimura, Yukinori; Fukui, Takahiro; Hatsugai, Yasuhiro
2018-03-01
The bulk-edge correspondence (BEC) refers to a one-to-one relation between the bulk and edge properties ubiquitous in topologically nontrivial systems. Depending on the setup, BEC manifests in different forms and govern the spectral and transport properties of topological insulators and semimetals. Although the topological pump is theoretically old, BEC in the pump has been established just recently [1] motivated by the state-of-the-art experiments using cold atoms [2, 3]. The center of mass (CM) of a system with boundaries shows a sequence of quantized jumps in the adiabatic limit associated with the edge states. Despite that the bulk is adiabatic, the edge is inevitably non-adiabatic in the experimental setup or in any numerical simulations. Still the pumped charge is quantized and carried by the bulk. Its quantization is guaranteed by a compensation between the bulk and edges. We show that in the presence of disorder the pumped charge continues to be quantized despite the appearance of non-quantized jumps.
Tuning the metal-insulator crossover and magnetism in SrRuO₃ by ionic gating.
Yi, Hee Taek; Gao, Bin; Xie, Wei; Cheong, Sang-Wook; Podzorov, Vitaly
2014-10-13
Reversible control of charge transport and magnetic properties without degradation is a key for device applications of transition metal oxides. Chemical doping during the growth of transition metal oxides can result in large changes in physical properties, but in most of the cases irreversibility is an inevitable constraint. Here we report a reversible control of charge transport, metal-insulator crossover and magnetism in field-effect devices based on ionically gated archetypal oxide system - SrRuO₃. In these thin-film devices, the metal-insulator crossover temperature and the onset of magnetoresistance can be continuously and reversibly tuned in the range 90-250 K and 70-100 K, respectively, by application of a small gate voltage. We infer that a reversible diffusion of oxygen ions in the oxide lattice dominates the response of these materials to the gate electric field. These findings provide critical insights into both the understanding of ionically gated oxides and the development of novel applications.
Comparing Charge Transport in Oligonucleotides: RNA:DNA Hybrids and DNA Duplexes.
Li, Yuanhui; Artés, Juan M; Qi, Jianqing; Morelan, Ian A; Feldstein, Paul; Anantram, M P; Hihath, Joshua
2016-05-19
Understanding the electronic properties of oligonucleotide systems is important for applications in nanotechnology, biology, and sensing systems. Here the charge-transport properties of guanine-rich RNA:DNA hybrids are compared to double-stranded DNA (dsDNA) duplexes with identical sequences. The conductance of the RNA:DNA hybrids is ∼10 times higher than the equivalent dsDNA, and conformational differences are determined to be the primary reason for this difference. The conductance of the RNA:DNA hybrids is also found to decrease more rapidly than dsDNA when the length is increased. Ab initio electronic structure and Green's function-based density of states calculations demonstrate that these differences arise because the energy levels are more spatially distributed in the RNA:DNA hybrid but that the number of accessible hopping sites is smaller. These combination results indicate that a simple hopping model that treats each individual guanine as a hopping site is insufficient to explain both a higher conductance and β value for RNA:DNA hybrids, and larger delocalization lengths must be considered.
The nature of free-carrier transport in organometal halide perovskites
Hakamata, Tomoya; Shimamura, Kohei; Shimojo, Fuyuki; Kalia, Rajiv K.; Nakano, Aiichiro; Vashishta, Priya
2016-01-01
Organometal halide perovskites are attracting great attention as promising material for solar cells because of their high power conversion efficiency. The high performance has been attributed to the existence of free charge carriers and their large diffusion lengths, but the nature of carrier transport at the atomistic level remains elusive. Here, nonadiabatic quantum molecular dynamics simulations elucidate the mechanisms underlying the excellent free-carrier transport in CH3NH3PbI3. Pb and I sublattices act as disjunct pathways for rapid and balanced transport of photoexcited electrons and holes, respectively, while minimizing efficiency-degrading charge recombination. On the other hand, CH3NH3 sublattice quickly screens out electrostatic electron-hole attraction to generate free carriers within 1 ps. Together this nano-architecture lets photoexcited electrons and holes dissociate instantaneously and travel far away to be harvested before dissipated as heat. This work provides much needed structure-property relationships and time-resolved information that potentially lead to rational design of efficient solar cells. PMID:26781627
NASA Astrophysics Data System (ADS)
Raguette, Lauren Elizabeth
Rechargeable lithium-ion battery technology is providing a revolution in energy storage. However, in order to fully realize this revolution, a better understanding is required of both the bulk properties of battery materials and their interfaces. This work endeavors to use classical molecular dynamics (MD) to investigate the electrochemical interfaces present in lithium-ion batteries to understand the impact of chemical reactions on ion transport. When batteries containing cyclic carbonates and lithium salts are charge cycled, both species can react with the electrodes to form complex solid mixtures at the electrode/electrolyte interface, known as a solid electrolyte interphase (SEI). While decades of experiments have yielded significant insights into the structure of these films and their chemical composition, there remains a lack of connection between the properties of the films and observed ion transport when interfaced with the electrolyte. A combination of MD and enhanced sampling methods will be presented to elucidate the link between the SEI, containing mixtures of dilithium ethylene dicarbonate (Li2EDC), lithium fluoride, and lithium carbonate, and battery performance. By performing extensive free energy calculations, clarity is provided to the impact of ion desolvation on the measured resistance to ion transport within lithium ion batteries.
NASA Astrophysics Data System (ADS)
Kwapiński, Tomasz
2017-03-01
The electron transport properties of a linear atomic chain are studied theoretically within the tight-binding Hamiltonian and the Green’s function method. Variations of the local density of states (DOS) along the chain are investigated. They are crucial in scanning tunnelling experiments and give important insight into the electron transport mechanism and charge distribution inside chains. It is found that depending on the chain parity the local DOS at the Fermi level can form cone-like structures (DOS cones) along the chain. The general condition for the local DOS oscillations is obtained and the linear behaviour of the local density function is confirmed analytically. DOS cones are characterized by a linear decay towards the chain which is in contrast to the propagation properties of charge density waves, end states and Friedel oscillations in one-dimensional systems. We find that DOS cones can appear due to non-resonant electron transport, the spin-orbit scattering or for chains fabricated on a substrate with localized electrons. It is also shown that for imperfect chains (e.g. with a reduced coupling strength between two neighboring sites) a diamond-like structure of the local DOS along the chain appears.
ZnO nanoparticles modulate the ionic transport and voltage regulation of lysenin nanochannels.
Bryant, Sheenah L; Eixenberger, Josh E; Rossland, Steven; Apsley, Holly; Hoffmann, Connor; Shrestha, Nisha; McHugh, Michael; Punnoose, Alex; Fologea, Daniel
2017-12-16
The insufficient understanding of unintended biological impacts from nanomaterials (NMs) represents a serious impediment to their use for scientific, technological, and medical applications. While previous studies have focused on understanding nanotoxicity effects mostly resulting from cellular internalization, recent work indicates that NMs may interfere with transmembrane transport mechanisms, hence enabling contributions to nanotoxicity by affecting key biological activities dependent on transmembrane transport. In this line of inquiry, we investigated the effects of charged nanoparticles (NPs) on the transport properties of lysenin, a pore-forming toxin that shares fundamental features with ion channels such as regulation and high transport rate. The macroscopic conductance of lysenin channels greatly diminished in the presence of cationic ZnO NPs. The inhibitory effects were asymmetrical relative to the direction of the electric field and addition site, suggesting electrostatic interactions between ZnO NPs and a binding site. Similar changes in the macroscopic conductance were observed when lysenin channels were reconstituted in neutral lipid membranes, implicating protein-NP interactions as the major contributor to the reduced transport capabilities. In contrast, no inhibitory effects were observed in the presence of anionic SnO 2 NPs. Additionally, we demonstrate that inhibition of ion transport is not due to the dissolution of ZnO NPs and subsequent interactions of zinc ions with lysenin channels. We conclude that electrostatic interactions between positively charged ZnO NPs and negative charges within the lysenin channels are responsible for the inhibitory effects on the transport of ions. These interactions point to a potential mechanism of cytotoxicity, which may not require NP internalization.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Akande, Akinlolu, E-mail: akandea@tcd.ie; Bhattacharya, Sandip; Cathcart, Thomas
2014-02-21
We investigate with state of the art density functional theory the structural, electronic, and transport properties of a class of recently synthesized nanostructures based on triarylamine derivatives. First, we consider the single molecule precursors in the gas phase and calculate their static properties, namely (i) the geometrical structure of the neutral and cationic ions, (ii) the electronic structure of the frontier molecular orbitals, and (iii) the ionization potential, hole extraction potential, and internal reorganization energy. This initial study does not evidence any direct correlation between the properties of the individual molecules and their tendency to self-assembly. Subsequently, we investigate themore » charge transport characteristics of the triarylamine derivatives nanowires, by using Marcus theory. For one derivative we further construct an effective Hamiltonian including intermolecular vibrations and evaluate the mobility from the Kubo formula implemented with Monte Carlo sampling. These two methods, valid respectively in the sequential hopping and polaronic band limit, give us values for the room-temperature mobility in the range 0.1–12 cm{sup 2}/Vs. Such estimate confirms the superior transport properties of triarylamine-based nanowires, and make them an attracting materials platform for organic electronics.« less
Brueckner, Mandy; Jankuhn, Steffen; Jülke, Eva-Maria; Reibetanz, Uta
2018-01-01
Drug delivery systems (DDS) and their interaction with cells are a controversial topic in the development of therapeutic concepts and approaches. On one hand, DDS are very useful for protected and targeted transport of defined dosages of active agents. On the other hand, their physicochemical properties such as material, size, shape, charge, or stiffness have a huge impact on cellular uptake and intracellular processing. Additionally, even identical DDS can undergo a completely diverse interaction with different cell types. However, quite often in in vitro DDS/cell interaction experiments, those aspects are not considered and DDS and cells are randomly chosen. Hence, our investigations provide an insight into layer-by-layer designed microcarriers with modifications of only some of the most important parameters (surface charge, stiffness, and applied microcarrier/cell ratio) and their influence on cellular uptake and viability. We also considered the interaction of these differently equipped DDS with several cell types and investigated professional phagocytes (neutrophil granulocytes; macrophages) as well as non-professional phagocytes (epithelial cells) under comparable conditions. We found that even small modifications such as layer-by-layer (LbL)-microcarriers with positive or negative surface charge, or LbL-microcarriers with solid core or as hollow capsules but equipped with the same surface properties, show significant differences in interaction and viability, and several cell types react very differently to the offered DDS. As a consequence, the properties of the DDS have to be carefully chosen with respect to the addressed cell type with the aim to efficiently transport a desired agent.
First-principles molecular transport calculation for the benzenedithiolate molecule
NASA Astrophysics Data System (ADS)
Rumetshofer, M.; Dorn, G.; Boeri, L.; Arrigoni, E.; von der Linden, W.
2017-10-01
A first-principles approach based on density functional theory and non-equilibrium Green’s functions is used to study the molecular transport system consisting of benzenedithiolate connected with monoatomic gold and platinum electrodes. Using symmetry arguments we explain why the conductance mechanism is different for gold and platinum electrodes. We present the charge stability diagram for the benzenedithiolate connected with monoatomic platinum electrodes including many-body effects in terms of an extended Hubbard Hamiltonian and discuss how the electrodes and the many-body effects influence the transport properties of the system.
High-fidelity plasma codes for burn physics
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cooley, James; Graziani, Frank; Marinak, Marty
Accurate predictions of equation of state (EOS), ionic and electronic transport properties are of critical importance for high-energy-density plasma science. Transport coefficients inform radiation-hydrodynamic codes and impact diagnostic interpretation, which in turn impacts our understanding of the development of instabilities, the overall energy balance of burning plasmas, and the efficacy of self-heating from charged-particle stopping. Important processes include thermal and electrical conduction, electron-ion coupling, inter-diffusion, ion viscosity, and charged particle stopping. However, uncertainties in these coefficients are not well established. Fundamental plasma science codes, also called high-fidelity plasma codes, are a relatively recent computational tool that augments both experimental datamore » and theoretical foundations of transport coefficients. This paper addresses the current status of HFPC codes and their future development, and the potential impact they play in improving the predictive capability of the multi-physics hydrodynamic codes used in HED design.« less
Quantum Hall Effect near the Charge Neutrality Point in a Two-Dimensional Electron-Hole System
NASA Astrophysics Data System (ADS)
Gusev, G. M.; Olshanetsky, E. B.; Kvon, Z. D.; Mikhailov, N. N.; Dvoretsky, S. A.; Portal, J. C.
2010-04-01
We study the transport properties of HgTe-based quantum wells containing simultaneously electrons and holes in a magnetic field B. At the charge neutrality point (CNP) with nearly equal electron and hole densities, the resistance is found to increase very strongly with B while the Hall resistivity turns to zero. This behavior results in a wide plateau in the Hall conductivity σxy≈0 and in a minimum of diagonal conductivity σxx at ν=νp-νn=0, where νn and νp are the electron and hole Landau level filling factors. We suggest that the transport at the CNP point is determined by electron-hole “snake states” propagating along the ν=0 lines. Our observations are qualitatively similar to the quantum Hall effect in graphene as well as to the transport in a random magnetic field with a zero mean value.
Two superconducting transitions in single-crystal La 2 - x Ba x CuO 4
Tee, X. Y.; Ito, T.; Ushiyama, T.; ...
2017-02-27
Here, we use spatially-resolved transport techniques to investigate the superconducting properties of single crystals La 2-xBa xCuO 4. We also found a superconducting transition temperature T cs associated with the ab-plane surface region which is considerably higher than the bulk T c. This effect is pronounced in the region of charge carrier doping x with strong spin-charge stripe correlations, reaching T cs = 36 K or 1.64T c.
Space charge induced surface stresses: implications in ceria and other ionic solids.
Sheldon, Brian W; Shenoy, Vivek B
2011-05-27
Volume changes associated with point defects in space charge layers can produce strains that substantially alter thermodynamic equilibrium near surfaces in ionic solids. For example, near-surface compressive stresses exceeding -10 GPa are predicted for ceria. The magnitude of this effect is consistent with anomalous lattice parameter increases that occur in ceria nanoparticles. These stresses should significantly alter defect concentrations and key transport properties in a wide range of materials (e.g., ceria electrolytes in fuel cells). © 2011 American Physical Society
Jiang, Hui; Ye, Jun; Hu, Peng; Wei, Fengxia; Du, Kezhao; Wang, Ning; Ba, Te; Feng, Shuanglong; Kloc, Christian
2014-01-01
The fluorination of p-type metal phthalocyanines produces n-type semiconductors, allowing the design of organic electronic circuits that contain inexpensive heterojunctions made from chemically and thermally stable p- and n-type organic semiconductors. For the evaluation of close to intrinsic transport properties, high-quality centimeter-sized single crystals of F16CuPc, F16CoPc and F16ZnPc have been grown. New crystal structures of F16CuPc, F16CoPc and F16ZnPc have been determined. Organic single-crystal field-effect transistors have been fabricated to study the effects of the central metal atom on their charge transport properties. The F16ZnPc has the highest electron mobility (~1.1 cm2 V−1 s−1). Theoretical calculations indicate that the crystal structure and electronic structure of the central metal atom determine the transport properties of fluorinated metal phthalocyanines. PMID:25524460
Gating Charge Calculations by Computational Electrophysiology Simulations.
Machtens, Jan-Philipp; Briones, Rodolfo; Alleva, Claudia; de Groot, Bert L; Fahlke, Christoph
2017-04-11
Electrical cell signaling requires adjustment of ion channel, receptor, or transporter function in response to changes in membrane potential. For the majority of such membrane proteins, the molecular details of voltage sensing remain insufficiently understood. Here, we present a molecular dynamics simulation-based method to determine the underlying charge movement across the membrane-the gating charge-by measuring electrical capacitor properties of membrane-embedded proteins. We illustrate the approach by calculating the charge transfer upon membrane insertion of the HIV gp41 fusion peptide, and validate the method on two prototypical voltage-dependent proteins, the Kv1.2 K + channel and the voltage sensor of the Ciona intestinalis voltage-sensitive phosphatase, against experimental data. We then use the gating charge analysis to study how the T1 domain modifies voltage sensing in Kv1.2 channels and to investigate the voltage dependence of the initial binding of two Na + ions in Na + -coupled glutamate transporters. Our simulation approach quantifies various mechanisms of voltage sensing, enables direct comparison with experiments, and supports mechanistic interpretation of voltage sensitivity by fractional amino acid contributions. Copyright © 2017 Biophysical Society. Published by Elsevier Inc. All rights reserved.
Single-Molecule Electronics: Chemical and Analytical Perspectives.
Nichols, Richard J; Higgins, Simon J
2015-01-01
It is now possible to measure the electrical properties of single molecules using a variety of techniques including scanning probe microcopies and mechanically controlled break junctions. Such measurements can be made across a wide range of environments including ambient conditions, organic liquids, ionic liquids, aqueous solutions, electrolytes, and ultra high vacuum. This has given new insights into charge transport across molecule electrical junctions, and these experimental methods have been complemented with increasingly sophisticated theory. This article reviews progress in single-molecule electronics from a chemical perspective and discusses topics such as the molecule-surface coupling in electrical junctions, chemical control, and supramolecular interactions in junctions and gating charge transport. The article concludes with an outlook regarding chemical analysis based on single-molecule conductance.
Huang, Qinglan; Evmenenko, Guennadi; Dutta, Pulak; Marks, Tobin J
2003-12-03
Molecule-scale structure effects at organic light-emitting diodes (OLED) anode-organic transport layer interfaces are probed via a self-assembly approach. A series of ITO anode-linked silyltriarylamine molecules differing in aryl group and linker density are synthesized for this purpose and used to probe the relationship between nanoscale interfacial chemical structure, charge injection and electroluminescence properties. Dramatic variations in hole injection magnitude and OLED performance can be correlated with the molecular structures and electrochemically derived heterogeneous electron-transfer rates of such triarylamine fragments, placed precisely at the anode-hole transport layer interface. Very bright and efficient ( approximately 70 000 cd/m2 and approximately 2.5% forward external quantum efficiency) OLEDs have thereby been fabricated.
Measurements of Charging of Apollo 17 Lunar Dust Grains by Electron Impact
NASA Technical Reports Server (NTRS)
Abbas, Mian M.; Tankosic, Dragana; Spann, James F.; Dube, Michael J.
2008-01-01
It is well known since the Apollo missions that the lunar surface is covered with a thick layer of micron size dust grains with unusually high adhesive characteristics. The dust grains observed to be levitated and transported on the lunar surface are believed to have a hazardous impact on the robotic and human missions to the Moon. The observed dust phenomena are attributed to the lunar dust being charged positively during the day by UV photoelectric emissions, and negatively during the night by the solar wind electrons. The current dust charging and the levitation models, however, do not fully explain the observed phenomena, with the uncertainty of dust charging processes and the equilibrium potentials of the individual dust grains. It is well recognized that the charging properties of individual dust grains are substantially different from those determined from measurements made on bulk materials that are currently available. An experimental facility has been developed in the Dusty Plasma Laboratory at MSFC for investigating the charging and optical properties of individual micron/sub-micron size positively or negatively charged dust grains by levitating them in an electrodynamic balance in simulated space environments. In this paper, we present the laboratory measurements on charging of Apollo 17 individual lunar dust grains by a low energy electron beam. The charging rates and the equilibrium potentials produced by direct electron impact and by secondary electron emission process are discussed.
Wang, Gang; Huang, Wei; Eastham, Nicholas D.; Fabiano, Simone; Manley, Eric F.; Zeng, Li; Wang, Binghao; Zhang, Xinan; Chen, Zhihua; Li, Ran; Chang, Robert P. H.; Chen, Lin X.; Bedzyk, Michael J.; Melkonyan, Ferdinand S.; Facchetti, Antonio; Marks, Tobin J.
2017-01-01
Shear-printing is a promising processing technique in organic electronics for microstructure/charge transport modification and large-area film fabrication. Nevertheless, the mechanism by which shear-printing can enhance charge transport is not well-understood. In this study, a printing method using natural brushes is adopted as an informative tool to realize direct aggregation control of conjugated polymers and to investigate the interplay between printing parameters, macromolecule backbone alignment and aggregation, and charge transport anisotropy in a conjugated polymer series differing in architecture and electronic structure. This series includes (i) semicrystalline hole-transporting P3HT, (ii) semicrystalline electron-transporting N2200, (iii) low-crystallinity hole-transporting PBDTT-FTTE, and (iv) low-crystallinity conducting PEDOT:PSS. The (semi-)conducting films are characterized by a battery of morphology and microstructure analysis techniques and by charge transport measurements. We report that remarkably enhanced mobilities/conductivities, as high as 5.7×/3.9×, are achieved by controlled growth of nanofibril aggregates and by backbone alignment, with the adjusted R2 (R2adj) correlation between aggregation and charge transport as high as 95%. However, while shear-induced aggregation is important for enhancing charge transport, backbone alignment alone does not guarantee charge transport anisotropy. The correlations between efficient charge transport and aggregation are clearly shown, while mobility and degree of orientation are not always well-correlated. These observations provide insights into macroscopic charge transport mechanisms in conjugated polymers and suggest guidelines for optimization. PMID:29109282
Tiazkis, Robertas; Paek, Sanghyun; Daskeviciene, Maryte; Malinauskas, Tadas; Saliba, Michael; Nekrasovas, Jonas; Jankauskas, Vygintas; Ahmad, Shahzada; Getautis, Vytautas; Khaja Nazeeruddin, Mohammad
2017-03-10
The molecular structure of the hole transporting material (HTM) play an important role in hole extraction in a perovskite solar cells. It has a significant influence on the molecular planarity, energy level, and charge transport properties. Understanding the relationship between the chemical structure of the HTM's and perovskite solar cells (PSCs) performance is crucial for the continued development of the efficient organic charge transporting materials. Using molecular engineering approach we have constructed a series of the hole transporting materials with strategically placed aliphatic substituents to investigate the relationship between the chemical structure of the HTMs and the photovoltaic performance. PSCs employing the investigated HTMs demonstrate power conversion efficiency values in the range of 9% to 16.8% highlighting the importance of the optimal molecular structure. An inappropriately placed side group could compromise the device performance. Due to the ease of synthesis and moieties employed in its construction, it offers a wide range of possible structural modifications. This class of molecules has a great potential for structural optimization in order to realize simple and efficient small molecule based HTMs for perovskite solar cells application.
Charge doping and large lattice expansion in oxygen-deficient heteroepitaxial WO3
NASA Astrophysics Data System (ADS)
Mattoni, Giordano; Filippetti, Alessio; Manca, Nicola; Zubko, Pavlo; Caviglia, Andrea D.
2018-05-01
Tungsten trioxide (WO3) is a versatile material with widespread applications ranging from electrochromics and optoelectronics to water splitting and catalysis of chemical reactions. For technological applications, thin films of WO3 are particularly appealing, taking advantage from a high surface-to-volume ratio and tunable physical properties. However, the growth of stoichiometric crystalline thin films is challenging because the deposition conditions are very sensitive to the formation of oxygen vacancies. In this paper, we show how background oxygen pressure during pulsed laser deposition can be used to tune the structural and electronic properties of WO3 thin films. By performing x-ray diffraction and low-temperature electrical transport measurements, we find changes in the WO3 lattice volume of up to 10% concomitantly with a resistivity drop of more than five orders of magnitude at room temperature as a function of increased oxygen deficiency. We use advanced ab initio calculations to describe in detail the properties of the oxygen vacancy defect states and their evolution in terms of excess charge concentration. Our results depict an intriguing scenario where structural, electronic, optical, and transport properties of WO3 single-crystal thin films can all be purposely tuned by controlling the oxygen vacancy formation during growth.
41 CFR 101-39.406 - Responsibility for damages.
Code of Federal Regulations, 2012 CFR
2012-07-01
... Management Regulations System FEDERAL PROPERTY MANAGEMENT REGULATIONS AVIATION, TRANSPORTATION, AND MOTOR... total cost of all damages resulting from neglect or abuse of assigned or issued GSA IFMS vehicles. (c... charge all costs to that agency, including fair market value of the vehicle less any salvage value. Upon...
41 CFR 101-39.406 - Responsibility for damages.
Code of Federal Regulations, 2014 CFR
2014-07-01
... Management Regulations System FEDERAL PROPERTY MANAGEMENT REGULATIONS AVIATION, TRANSPORTATION, AND MOTOR... total cost of all damages resulting from neglect or abuse of assigned or issued GSA IFMS vehicles. (c... charge all costs to that agency, including fair market value of the vehicle less any salvage value. Upon...
41 CFR 101-39.406 - Responsibility for damages.
Code of Federal Regulations, 2013 CFR
2013-07-01
... Management Regulations System FEDERAL PROPERTY MANAGEMENT REGULATIONS AVIATION, TRANSPORTATION, AND MOTOR... total cost of all damages resulting from neglect or abuse of assigned or issued GSA IFMS vehicles. (c... charge all costs to that agency, including fair market value of the vehicle less any salvage value. Upon...
19 CFR 351.515 - Internal transport and freight charges for export shipments.
Code of Federal Regulations, 2011 CFR
2011-04-01
... 19 Customs Duties 3 2011-04-01 2011-04-01 false Internal transport and freight charges for export... Internal transport and freight charges for export shipments. (a) Benefit—(1) In general. In the case of internal transport and freight charges on export shipments, a benefit exists to the extent that the charges...
Gonnelli, R. S.; Paolucci, F.; Piatti, E.; Sharda, Kanudha; Sola, A.; Tortello, M.; Nair, Jijeesh R.; Gerbaldi, C.; Bruna, M.; Borini, S.
2015-01-01
The temperature dependence of electric transport properties of single-layer and few-layer graphene at large charge doping is of great interest both for the study of the scattering processes dominating the conductivity at different temperatures and in view of the theoretically predicted possibility to reach the superconducting state in such extreme conditions. Here we present the results obtained in 3-, 4- and 5-layer graphene devices down to 3.5 K, where a large surface charge density up to about 6.8·1014 cm−2 has been reached by employing a novel polymer electrolyte solution for the electrochemical gating. In contrast with recent results obtained in single-layer graphene, the temperature dependence of the sheet resistance between 20 K and 280 K shows a low-temperature dominance of a T2 component – that can be associated with electron-electron scattering – and, at about 100 K, a crossover to the classic electron-phonon regime. Unexpectedly, this crossover does not show any dependence on the induced charge density, i.e. on the large tuning of the Fermi energy. PMID:25906088
Tailoring the charge carrier in few layers MoS2 field-effect transistors by Au metal adsorbate
NASA Astrophysics Data System (ADS)
Singh, Arun Kumar; Pandey, Rajiv K.; Prakash, Rajiv; Eom, Jonghwa
2018-04-01
It is an essential to tune the charge carrier concentrations in semiconductor in order to approach high-performance of the electronic and optoelectronic devices. Here, we report the effect of thin layer of gold (Au) metal on few layer (FL) molybdenum disulfide (MoS2) by atomic force microscopy (AFM), Raman spectroscopy and electrical charge transport measurements. The Raman spectra and charge transport measurements show that Au thin layer affect the electronic properties of the FL MoS2. After deposition of Au thin layer, the threshold voltages of FL MoS2 field-effect transistors (FETs) shift towards positive gate voltages, this reveal the p-doping in FL MoS2 nanosheets. The shift of peak frequencies of the Raman bands are also analyzed after the deposition of Au metal films of different thickness on FL MoS2 nanosheets. The surface morphology of Au metal on FL MoS2 is characterized by AFM and shows the smoother and denser film in comparison to Au metal on SiO2.
Gadani, Keval; Keshvani, M J; Rajyaguru, Bhargav; Dhruv, Davit; Kataria, B R; Joshi, A D; Asokan, K; Shah, N A; Solanki, P S
2017-11-08
In this communication, we report results of the electrical transport properties across the interface of composites consisting of n-type LaMnO 3-δ (LMO) and p-type La 0.7 Ca 0.3 MnO 3 (LCMO) manganites grown on LaAlO 3 (LAO) single crystalline substrates using low cost wet chemical solution deposition (CSD) and sophisticated, well-controlled dry chemical vapor deposition (CVD) chemical techniques. The XRD ϕ-scan studies reveal the single crystalline nature of both bilayered composites, with parallel epitaxial growth of LMO and LCMO layers onto the LAO substrate. The valence states of Mn ions in both layers of both composites were identified by performing X-ray photoelectron spectroscopy (XPS). The I-V characteristics of the LMO/LCMO interfaces show strong backward diode-like behavior at higher applied voltages well above the crossover voltage (V NB ). Below V NB , the interfaces demonstrate normal diode-like characteristics throughout the studied temperature range. The electric field-induced modulation of the LMO/LCMO junction resistance of the interfaces has been observed. Electric field-dependent electroresistance (ER) modifications at different temperatures have also been studied. The electrical transport properties have been discussed in the context of various mechanisms, such as charge injection, tunneling, depletion region modification and thermal processes across the interface. The effects of structurally and chemically developed sharp interfaces between the LMO and LCMO layers on the transport properties of the presently studied bilayered thin film composites have been discussed on the basis of correlation between the physicochemical characterization and charge transport behavior. A comparison of different aspects of the transport properties has been presented in the context of the structural strain and crystallinity of the composites grown using both wet and dry chemical techniques.
Moerman, D; Sebaihi, N; Kaviyil, S E; Leclère, P; Lazzaroni, R; Douhéret, O
2014-09-21
In this work, conductive atomic force microscopy (C-AFM) is used to study the local electrical properties in thin films of self-organized fibrillate poly(3-hexylthiophene) (P3HT), as a reference polymer semiconductor. Depending on the geometrical confinement in the transport channel, the C-AFM current is shown to be governed either by the charge transport in the film or by the carrier injection at the tip-sample contact, leading to either bulk or local electrical characterization of the semiconducting polymer, respectively. Local I-V profiles allow discrimination of the different dominating electrical mechanisms, i.e., resistive in the transport regime and space charge limited current (SCLC) in the local regime. A modified Mott-Gurney law is analytically derived for the contact regime, taking into account the point-probe geometry of the contact and the radial injection of carriers. Within the SCLC regime, the probed depth is shown to remain below 12 nm with a lateral electrical resolution below 5 nm. This confirms that high resolution is reached in those C-AFM measurements, which therefore allows for the analysis of single organic semiconducting nanostructures. The carrier density and mobility in the volume probed under the tip under steady-state conditions are also determined in the SCLC regime.
Electron transfer across a thermal gradient
Craven, Galen T.
2016-01-01
Charge transfer is a fundamental process that underlies a multitude of phenomena in chemistry and biology. Recent advances in observing and manipulating charge and heat transport at the nanoscale, and recently developed techniques for monitoring temperature at high temporal and spatial resolution, imply the need for considering electron transfer across thermal gradients. Here, a theory is developed for the rate of electron transfer and the associated heat transport between donor–acceptor pairs located at sites of different temperatures. To this end, through application of a generalized multidimensional transition state theory, the traditional Arrhenius picture of activation energy as a single point on a free energy surface is replaced with a bithermal property that is derived from statistical weighting over all configurations where the reactant and product states are equienergetic. The flow of energy associated with the electron transfer process is also examined, leading to relations between the rate of heat exchange among the donor and acceptor sites as functions of the temperature difference and the electronic driving bias. In particular, we find that an open electron transfer channel contributes to enhanced heat transport between sites even when they are in electronic equilibrium. The presented results provide a unified theory for charge transport and the associated heat conduction between sites at different temperatures. PMID:27450086
He, Daowei; Qiao, Jingsi; Zhang, Linglong; Wang, Junya; Lan, Tu; Qian, Jun; Li, Yun; Shi, Yi; Chai, Yang; Lan, Wei; Ono, Luis K; Qi, Yabing; Xu, Jian-Bin; Ji, Wei; Wang, Xinran
2017-09-01
Organic thin-film transistors (OTFTs) with high mobility and low contact resistance have been actively pursued as building blocks for low-cost organic electronics. In conventional solution-processed or vacuum-deposited OTFTs, due to interfacial defects and traps, the organic film has to reach a certain thickness for efficient charge transport. Using an ultimate monolayer of 2,7-dioctyl[1]benzothieno[3,2- b ][1]benzothiophene (C 8 -BTBT) molecules as an OTFT channel, we demonstrate remarkable electrical characteristics, including intrinsic hole mobility over 30 cm 2 /Vs, Ohmic contact with 100 Ω · cm resistance, and band-like transport down to 150 K. Compared to conventional OTFTs, the main advantage of a monolayer channel is the direct, nondisruptive contact between the charge transport layer and metal leads, a feature that is vital for achieving low contact resistance and current saturation voltage. On the other hand, bilayer and thicker C 8 -BTBT OTFTs exhibit strong Schottky contact and much higher contact resistance but can be improved by inserting a doped graphene buffer layer. Our results suggest that highly crystalline molecular monolayers are promising form factors to build high-performance OTFTs and investigate device physics. They also allow us to precisely model how the molecular packing changes the transport and contact properties.
He, Daowei; Qiao, Jingsi; Zhang, Linglong; Wang, Junya; Lan, Tu; Qian, Jun; Li, Yun; Shi, Yi; Chai, Yang; Lan, Wei; Ono, Luis K.; Qi, Yabing; Xu, Jian-Bin; Ji, Wei; Wang, Xinran
2017-01-01
Organic thin-film transistors (OTFTs) with high mobility and low contact resistance have been actively pursued as building blocks for low-cost organic electronics. In conventional solution-processed or vacuum-deposited OTFTs, due to interfacial defects and traps, the organic film has to reach a certain thickness for efficient charge transport. Using an ultimate monolayer of 2,7-dioctyl[1]benzothieno[3,2-b][1]benzothiophene (C8-BTBT) molecules as an OTFT channel, we demonstrate remarkable electrical characteristics, including intrinsic hole mobility over 30 cm2/Vs, Ohmic contact with 100 Ω · cm resistance, and band-like transport down to 150 K. Compared to conventional OTFTs, the main advantage of a monolayer channel is the direct, nondisruptive contact between the charge transport layer and metal leads, a feature that is vital for achieving low contact resistance and current saturation voltage. On the other hand, bilayer and thicker C8-BTBT OTFTs exhibit strong Schottky contact and much higher contact resistance but can be improved by inserting a doped graphene buffer layer. Our results suggest that highly crystalline molecular monolayers are promising form factors to build high-performance OTFTs and investigate device physics. They also allow us to precisely model how the molecular packing changes the transport and contact properties. PMID:28913429
NASA Astrophysics Data System (ADS)
McCold, Cliff E.; Fu, Qiang; Howe, Jane Y.; Hihath, Joshua
2015-09-01
Composite molecule-nanoparticle hybrid systems have recently emerged as important materials for applications ranging from chemical sensing to nanoscale electronics. However, creating reproducible and repeatable composite materials with precise properties has remained one of the primary challenges to the implementation of these technologies. Understanding the sources of variation that dominate the assembly and transport behavior is essential for the advancement of nanoparticle-array based devices. In this work, we use a combination of charge-transport measurements, electron microscopy, and optical characterization techniques to determine the role of morphology and structure on the charge transport properties of 2-dimensional monolayer arrays of molecularly-interlinked Au nanoparticles. Using these techniques we are able to determine the role of both assembly-dependent and particle-dependent defects on the conductivities of the films. These results demonstrate that assembly processes dominate the dispersion of conductance values, while nanoparticle and ligand features dictate the mean value of the conductance. By performing a systematic study of the conductance of these arrays as a function of nanoparticle size we are able to extract the carrier mobility for specific molecular ligands. We show that nanoparticle polydispersity correlates with the void density in the array, and that because of this correlation it is possible to accurately determine the void density within the array directly from conductance measurements. These results demonstrate that conductance-based measurements can be used to accurately and non-destructively determine the morphological and structural properties of these hybrid arrays, and thus provide a characterization platform that helps move 2-dimensional nanoparticle arrays toward robust and reproducible electronic systems.Composite molecule-nanoparticle hybrid systems have recently emerged as important materials for applications ranging from chemical sensing to nanoscale electronics. However, creating reproducible and repeatable composite materials with precise properties has remained one of the primary challenges to the implementation of these technologies. Understanding the sources of variation that dominate the assembly and transport behavior is essential for the advancement of nanoparticle-array based devices. In this work, we use a combination of charge-transport measurements, electron microscopy, and optical characterization techniques to determine the role of morphology and structure on the charge transport properties of 2-dimensional monolayer arrays of molecularly-interlinked Au nanoparticles. Using these techniques we are able to determine the role of both assembly-dependent and particle-dependent defects on the conductivities of the films. These results demonstrate that assembly processes dominate the dispersion of conductance values, while nanoparticle and ligand features dictate the mean value of the conductance. By performing a systematic study of the conductance of these arrays as a function of nanoparticle size we are able to extract the carrier mobility for specific molecular ligands. We show that nanoparticle polydispersity correlates with the void density in the array, and that because of this correlation it is possible to accurately determine the void density within the array directly from conductance measurements. These results demonstrate that conductance-based measurements can be used to accurately and non-destructively determine the morphological and structural properties of these hybrid arrays, and thus provide a characterization platform that helps move 2-dimensional nanoparticle arrays toward robust and reproducible electronic systems. Electronic supplementary information (ESI) available: Temperature dependent measurements, activation energies, particle size distributions, void density-polydispersity relation, and DLS data. See DOI: 10.1039/c5nr04460j
TiO2 nanoparticle induced space charge decay in thermal aged transformer oil
NASA Astrophysics Data System (ADS)
Lv, Yuzhen; Du, Yuefan; Li, Chengrong; Qi, Bo; Zhong, Yuxiang; Chen, Mutian
2013-04-01
TiO2 nanoparticle with good dispersibility and stability in transformer oil was prepared and used to modify insulating property of aged oil. It was found that space charge decay rate in the modified aged oil can be significantly enhanced to 1.57 times of that in the aged oil at first 8 s after polarization voltage was removed. The results of trap characteristics reveal that the modification of nanoparticle can not only greatly lower the shallow trap energy level in the aged oil but also increase the trap density, resulting in improved charge transportation via trapping and de-trapping process in shallower traps.
Spin and charge currents and current rectification in Luttinger liquids
NASA Astrophysics Data System (ADS)
Braunecker, B.; Feldman, D. E.; Marston, J. B.
2006-03-01
Asymmetries in spin and charge transport properties are of great interest for spintronic and electronic applications. We show that externally-driven spin and charge currents in a Luttinger liquid model of a one-dimensional quantum wire are strongly modified by the presence of a localized magnetic or nonmagnetic scatterer. A diode effect appears at low voltages when this scatterer is spatially asymmetric, and a non-monotonous dependence of the current on the voltage is possible. D.E. Feldman, S. Scheidl, and V. M. Vinokur, Phys. Rev. Lett. 94, 186809 (2005); B. Braunecker, D. E. Feldman, and J. B. Marston, Phys. Rev. B 72, 125311 (2005)
Mante, Pierre-Adrien; Stoumpos, Constantinos C.; Kanatzidis, Mercouri G.; ...
2017-02-08
The intrinsic properties of CH 3NH 3PbI 3 are still largely unknown in spite of the great amount of attention it has received for its solar cell application. Mobility of charges is a quintessential property in this aspect; however, there is still no clear understanding of electron transport, as reported values span over three orders of magnitude. Here we develop a method to measure the electron and hole deformation potentials using coherent acoustic phonons generated by femtosecond laser pulses. Furthermore, we apply this method to characterize a CH 3NH 3PbI 3 single crystal.We measure the acoustic phonon properties and characterizemore » electron-acoustic phonon scattering. Then, using the deformation potential theory, we calculate the carrier intrinsic mobility and compare it to the reported experimental and theoretical values. These results reveal high electron and hole mobilities of 2,800 and 9,400 cm 2V -1 s -1 , respectively. Comparison with literature values of mobility demonstrates the potential role played by polarons in charge transport in CH 3NH 3PbI 3.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mante, Pierre-Adrien; Stoumpos, Constantinos C.; Kanatzidis, Mercouri G.
The intrinsic properties of CH 3NH 3PbI 3 are still largely unknown in spite of the great amount of attention it has received for its solar cell application. Mobility of charges is a quintessential property in this aspect; however, there is still no clear understanding of electron transport, as reported values span over three orders of magnitude. Here we develop a method to measure the electron and hole deformation potentials using coherent acoustic phonons generated by femtosecond laser pulses. Furthermore, we apply this method to characterize a CH 3NH 3PbI 3 single crystal.We measure the acoustic phonon properties and characterizemore » electron-acoustic phonon scattering. Then, using the deformation potential theory, we calculate the carrier intrinsic mobility and compare it to the reported experimental and theoretical values. These results reveal high electron and hole mobilities of 2,800 and 9,400 cm 2V -1 s -1 , respectively. Comparison with literature values of mobility demonstrates the potential role played by polarons in charge transport in CH 3NH 3PbI 3.« less
Lo, Kin Cheung; Hau, King In; Chan, Wai Kin
2018-04-05
Functional polymer/carbon nanotube (CNT) hybrid materials can serve as a good model for light harvesting systems based on CNTs. This paper presents the synthesis of block copolymer/CNT hybrids and the characterization of their photocurrent responses by both experimental and computational approaches. A series of functional diblock copolymers was synthesized by reversible addition-fragmentation chain transfer polymerizations for the dispersion and functionalization of CNTs. The block copolymers contain photosensitizing ruthenium complexes and modified pyrene-based anchoring units. The photocurrent responses of the polymer/CNT hybrids were measured by photoconductive atomic force microscopy (PCAFM), from which the experimental data were analyzed by vigorous statistical models. The difference in photocurrent response among different hybrids was correlated to the conformations of the hybrids, which were elucidated by molecular dynamics simulations, and the electronic properties of polymers. The photoresponse of the block copolymer/CNT hybrids can be enhanced by introducing an electron-accepting block between the photosensitizing block and the CNT. We have demonstrated that the application of a rigorous statistical methodology can unravel the charge transport properties of these hybrid materials and provide general guidelines for the design of molecular light harvesting systems.
Hoang, Tuan; Matovic, Tijana; Parker, James; Smith, Matthew D; Jelokhani-Niaraki, Masoud
2015-04-14
Residing at the inner mitochondrial membrane, uncoupling protein-2 (UCP2) mediates proton transport from the intermembrane space (IMS) to the mitochondrial matrix and consequently reduces the rate of ATP synthesis in the mitochondria. The ubiquitous expression of UCP2 in humans can be attributed to the protein's multiple physiological roles in tissues, including its involvement in protective mechanisms against oxidative stress, as well as glucose and lipid metabolisms. Currently, the structural properties and ion transport mechanism of UCP2 and other UCP homologues remain poorly understood. UCP2-mediated proton transport is activated by fatty acids and inhibited by di- and triphosphate purine nucleotides. UCP2 also transports chloride and some other small anions. Identification of key amino acid residues of UCP2 in its ion transport pathway can shed light on the protein's ion transport function. On the basis of our previous studies, the second transmembrane helix segment (TM2) of UCP2 exhibited chloride channel activity. In addition, it was suggested that the positively charged residues on TM2 domains of UCPs 1 and 2 were important for their chloride transport activity. On this basis, to further understand the role of these positively charged residues on the ion transport activity of UCP2, we recombinantly expressed four TM2 mutants: R76Q, R88Q, R96Q, and K104Q. The wild type UCP2 and its mutants were purified and reconstituted into liposomes, and their conformation and ion (proton and chloride) transport activity were studied. TM2 Arg residues at the matrix interface of UCP2 proved to be crucial for the protein's anion transport function, and their absence resulted in highly diminished Cl(-) transport rates. On the other hand, the two other positively charged residues of TM2, located at the UCP2-IMS interface, could participate in the salt-bridge formation in the protein and promote the interhelical tight packing in the UCP2. Absence of these residues did not influence Cl(-) transport rates, but disturbed the dense packing in UCP2 and resulted in higher UCP2-mediated proton transport rates in the presence of long chain fatty acids. Overall, the outcome of this study provides a deeper and more detailed molecular image of UCP2's ion transport mechanism.
Space charge neutralization by electron-transparent suspended graphene
Srisonphan, Siwapon; Kim, Myungji; Kim, Hong Koo
2014-01-01
Graphene possesses many fascinating properties originating from the manifold potential for interactions at electronic, atomic, or molecular levels. Here we report measurement of electron transparency and hole charge induction response of a suspended graphene anode on top of a void channel formed in a SiO2/Si substrate. A two-dimensional (2D) electron gas induced at the oxide interface emits into air and makes a ballistic transport toward the suspended graphene. A small fraction (>~0.1%) of impinging electrons are captured at the edge of 2D hole system in graphene, demonstrating good transparency to very low energy (<3 eV) electrons. The hole charges induced in the suspended graphene anode have the effect of neutralizing the electron space charge in the void channel. This charge compensation dramatically enhances 2D electron gas emission at cathode to the level far surpassing the Child-Langmuir's space-charge-limited emission. PMID:24441774
Creating and optimizing interfaces for electric-field and photon-induced charge transfer.
Park, Byoungnam; Whitham, Kevin; Cho, Jiung; Reichmanis, Elsa
2012-11-27
We create and optimize a structurally well-defined electron donor-acceptor planar heterojunction interface in which electric-field and/or photon-induced charge transfer occurs. Electric-field-induced charge transfer in the dark and exciton dissociation at a pentacene/PCBM interface were probed by in situ thickness-dependent threshold voltage shift measurements in field-effect transistor devices during the formation of the interface. Electric-field-induced charge transfer at the interface in the dark is correlated with development of the pentacene accumulation layer close to PCBM, that is, including interface area, and dielectric relaxation time in PCBM. Further, we demonstrate an in situ test structure that allows probing of both exciton diffusion length and charge transport properties, crucial for optimizing optoelectronic devices. Competition between the optical absorption length and the exciton diffusion length in pentacene governs exciton dissociation at the interface. Charge transfer mechanisms in the dark and under illumination are detailed.
N(+)-N and O(+)-O interaction energies, dipole transition moments, and transport cross sections
NASA Technical Reports Server (NTRS)
Partridge, H.; Stallcop, J. R.
1986-01-01
Complete sets of ion-atom interaction energies have been computed for nitrogen and oxygen with accurate large scale structure calculations. The computed energies agree well with the accurate potential curves available from spectroscopic measurement. The state functions from the nitrogen calculations have been applied to determine the transition moment for all allowed dipole transitions. These results can be combined to compute a detailed radiation spectrum such as that required to define the highly nonequilibrium environment of aeroassisted orbital transfer vehicle (AOTV). The long-range interaction energies have been used to determine the ion-atom resonance charge exchange cross sections that are important for transport processes such as diffusion. A calculation to determine reliable transport properties for energies that include the AOTV temperature range from these computed properties is described.
NASA Astrophysics Data System (ADS)
Humed Yusuf, Mohammed; Gura, Anna; Du, Xu; Dawber, Matthew
2017-06-01
We exploit nanoscale mechanically induced switching of an artificially layered ferroelectric material, used as an active substrate, to achieve the local manipulation of the electrical transport properties of graphene. In Graphene Ferroelectric Field Effect Transistors (GFeFETs), the graphene channel’s charge state is controlled by an underlying ferroelectric layer. The tip of an atomic force microscope (AFM) can be used to mechanically ‘write’ nanoscale regions of the graphene channel and ‘read’ off the modulation in the transport behavior. The written features associated with the switching of ferroelectric domains remain polarized until an electrical reset operation is carried out. Our result provides a method for flexible and reversible nano-scale manipulation of the transport properties of a broad class of 2D materials.
Advances in NO2 sensing with individual single-walled carbon nanotube transistors
Muoth, Matthias; Roman, Cosmin; Haluska, Miroslav; Hierold, Christofer
2014-01-01
Summary The charge carrier transport in carbon nanotubes is highly sensitive to certain molecules attached to their surface. This property has generated interest for their application in sensing gases, chemicals and biomolecules. With over a decade of research, a clearer picture of the interactions between the carbon nanotube and its surroundings has been achieved. In this review, we intend to summarize the current knowledge on this topic, focusing not only on the effect of adsorbates but also the effect of dielectric charge traps on the electrical transport in single-walled carbon nanotube transistors that are to be used in sensing applications. Recently, contact-passivated, open-channel individual single-walled carbon nanotube field-effect transistors have been shown to be operational at room temperature with ultra-low power consumption. Sensor recovery within minutes through UV illumination or self-heating has been shown. Improvements in fabrication processes aimed at reducing the impact of charge traps have reduced the hysteresis, drift and low-frequency noise in carbon nanotube transistors. While open challenges such as large-scale fabrication, selectivity tuning and noise reduction still remain, these results demonstrate considerable progress in transforming the promise of carbon nanotube properties into functional ultra-low power, highly sensitive gas sensors. PMID:25551046
NASA Astrophysics Data System (ADS)
Riera, Jose
2014-03-01
Motivated by emergent phenomena at oxide surfaces and heterostructures, particularly those involving transition metal oxides with perovskite crystal structure such as LaTiO3/SrTiO3, we examine the Kondo lattice model in the presence of a Rashba spin-orbit coupling (RSOC). Using an array of numerical techniques, under the assumption that the electrons on localized orbitals may be treated as classical continuum spins, we compute various charge, spin and transport properties on square clusters and on ladders at zero and finite temperatures. The main goal is to determine magnetic and transport signatures due to the RSOC. The same model can be used to study at an effective level the combined effect on magnetic and transport properties of Rashba and ferromagnetic moments, such as the ones present at LMnO3/SrMnO3 interfaces. Support from CONICET (ARGENTINA).
Effect of Molecular Rotation on Charge Transport Phenomena
NASA Astrophysics Data System (ADS)
Garg, O. P.; Lamba, Vijay Kr; Kaushik, D. K.
2015-12-01
The study of electron transport properties of molecular systems could be explained on the basis of the Landauer formalism. Unfortunately, due to the complexity of the experimental setup, most of these measurements have no control over the details of the electrode geometry, rotation of molecules, variation in angle of contacts, effect of fano resonances associated with side groups attached to rigid backbones, which results in a spectrum of IV-characteristics. Theoretical models can therefore help to understand and helps to develop new applications such as molecular sensors, etc. Thus we used simulation methods that generate the required structural ensemble, which is then analyzed with Green’s function methods to characterize the electronic transport properties. In present work we had discussed applications of this approach to understand the conductance in molecular system in the direction of controlling electron transport through molecules and studied the effect of rotation of sandwiched molecule.
Formation and electrical transport properties of pentacene nanorod crystal.
Akai-Kasaya, M; Ohmori, C; Kawanishi, T; Nashiki, M; Saito, A; Aono, M; Kuwahara, Y
2010-09-10
The monophasic formation of an uncharted pentacene crystal, the pentacene nanorod, has been investigated. The restricted formation of the pentacene nanorod on a bare mica surface reveals a peculiar surface catalytic crystal growth mode of the pentacene. We demonstrated the charge transport measurements through a single pentacene nanorod and analyzed the data using a periodic hopping conduction model. The results revealed that the pentacene nanorod has a periodic conductive node within their one-dimensional crystal.
49 CFR 174.102 - Forbidden mixed loading and storage.
Code of Federal Regulations, 2014 CFR
2014-10-01
... same rail car. Additionally, they may not be transported or loaded in the same rail car or stored on carrier property with charged electric storage batteries or with any hazardous material for which a... (explosive) materials or any other material in a placarded and certified car containing a shipment of...
49 CFR 174.102 - Forbidden mixed loading and storage.
Code of Federal Regulations, 2012 CFR
2012-10-01
... same rail car. Additionally, they may not be transported or loaded in the same rail car or stored on carrier property with charged electric storage batteries or with any hazardous material for which a... (explosive) materials or any other material in a placarded and certified car containing a shipment of...
49 CFR 174.102 - Forbidden mixed loading and storage.
Code of Federal Regulations, 2013 CFR
2013-10-01
... same rail car. Additionally, they may not be transported or loaded in the same rail car or stored on carrier property with charged electric storage batteries or with any hazardous material for which a... (explosive) materials or any other material in a placarded and certified car containing a shipment of...
49 CFR 174.102 - Forbidden mixed loading and storage.
Code of Federal Regulations, 2010 CFR
2010-10-01
... same rail car. Additionally, they may not be transported or loaded in the same rail car or stored on carrier property with charged electric storage batteries or with any hazardous material for which a... (explosive) materials or any other material in a placarded and certified car containing a shipment of...
49 CFR 174.102 - Forbidden mixed loading and storage.
Code of Federal Regulations, 2011 CFR
2011-10-01
... same rail car. Additionally, they may not be transported or loaded in the same rail car or stored on carrier property with charged electric storage batteries or with any hazardous material for which a... (explosive) materials or any other material in a placarded and certified car containing a shipment of...
Code of Federal Regulations, 2014 CFR
2014-04-01
... actual cost of the project plus any applicable fees and charges authorized at § 201.25(b), up to the... property improvement loans—$60,000 or an average of $12,000 per dwelling unit, whichever is less. (iii... detailed in the manufacturer's invoice; (iii) The actual dealer's cost of transportation to the homesite...
NASA Astrophysics Data System (ADS)
Gao, Shengjie; Wang, Yixiu; Wang, Ruoxing; Wu, Wenzhuo
2017-10-01
Emerging technologies in wearable systems demand that functional devices can adaptively interact with the human body, where mechanical stimuli are ubiquitous and abundant. However, the electrical manipulation of charge carriers underpins the operations of state-of-the-art devices, and the effective control of interfacial energetics for charge carriers by the dynamic mechanical stimuli is still a relatively unexplored degree of freedom for semiconductor nanodevices. Piezotronic effect in nanostructured piezoelectric semiconductors offers exciting opportunities in addressing the above challenges. Here we report the first experimental exploration of piezotronic effect in 1D van der Waals solid of p-type tellurium nanobelt and systematically investigate the strain-gated charge carriers transport properties. The strain-induced polarization charges at the [10\\bar{1}0] surfaces of Te nanobelt can modulate the electronic transport through the interfacial effect on the Schottky contacts and the volumetric effect on the conducting channel. The competing phenomenon between interfacial and volumetric effects has been studied for the first time in piezotronics. Our research allows the access to a broad range of characterization and application of Te nanomaterials for piezotronics and could guide the future study of piezotronic effect in other materials. This progress in piezotronics, together with emerging methods for deterministic production and assembly of nanomaterials, leads to compelling opportunities for research from basic studies of piezoelectricity and semiconductor properties in functional nanomaterials to the development of ‘smarter’ electronics and optoelectronics.
Trapping effect of metal nanoparticle mono- and multilayer in the organic field-effect transistor
NASA Astrophysics Data System (ADS)
Lee, Keanchuan; Weis, Martin; Lin, Jack; Taguchi, Dai; Majková, Eva; Manaka, Takaaki; Iwamoto, Mitsumasa
2011-03-01
The effect of silver nanoparticles self-assembled monolayer (Ag NPs SAM) on charge transport in pentacene organic field-effect transistors (OFET) was investigated by both steady-state and transient-state methods, which are current-voltage measurements in steady-state and time-resolved microscopic (TRM) second harmonic generation (SHG) in transient-state, respectively. The analysis of electronic properties revealed that OFET with SAM exhibited significant charge trapping effect due to the space-charge field formed by immobile charges. Lower transient-state mobility was verified by the direct probing of carrier motion by TRM-SHG technique. It was shown that the trapping effect rises together with increase of SAM layers suggesting the presence of traps in the bulk of NP films. The model based on the electrostatic charge barrier is suggested to explain the phenomenon.
Xiao, Zhengguo; Yuan, Yongbo; Wang, Qi; ...
2016-02-19
Organolead trihalide perovskites (OTPs) are arising as a new generation of low-cost active materials for solar cells with efficiency rocketing from 3.5% to over 20% within only five years. From “dye” in dye sensitized solar cells to “hole conductors” and “electron conductors” in mesoscopic heterojunction solar cells, there has been a dramatic conceptual evolution on the function of OTPs in photovoltaic devices. OTPs were originally used as dyes in Gratzel cells, achieving a high efficiency above 15% which, however, did not manifest the excellent charge transport properties of OTPs. An analogy of OTPs to traditional semiconductors was drawn after themore » demonstration of highly efficient planar heterojunction structure OTP devices and the observation of their excellent bipolar transport properties with a large diffusion length exceeding 100 nm in CH 3NH 3PbI 3 (MAPbI 3) polycrystalline thin films. Here, this review aims to provide the most recent advances in the understanding of the origin of the high OTP device efficiency. Specifically we will focus on reviewing the progress in understanding 1) the characterization of fantastic optoelectronic property of OTPs, 2) the unusual defect physics that originate the optoelectronic property; 3) morphology control of the perovskite film from fabrication process and film post-treatment, and 4) device interface and charge transport layers that dramatically impact device efficiency in the OTP thin film devices; 5) photocurrent hysteresis; 6) tandem solar cells; 7) stability of the perovskite materials and solar cell devices.« less
Position-dependent effects of polylysine on Sec protein transport.
Liang, Fu-Cheng; Bageshwar, Umesh K; Musser, Siegfried M
2012-04-13
The bacterial Sec protein translocation system catalyzes the transport of unfolded precursor proteins across the cytoplasmic membrane. Using a recently developed real time fluorescence-based transport assay, the effects of the number and distribution of positive charges on the transport time and transport efficiency of proOmpA were examined. As expected, an increase in the number of lysine residues generally increased transport time and decreased transport efficiency. However, the observed effects were highly dependent on the polylysine position in the mature domain. In addition, a string of consecutive positive charges generally had a more significant effect on transport time and efficiency than separating the charges into two or more charged segments. Thirty positive charges distributed throughout the mature domain resulted in effects similar to 10 consecutive charges near the N terminus of the mature domain. These data support a model in which the local effects of positive charge on the translocation kinetics dominate over total thermodynamic constraints. The rapid translocation kinetics of some highly charged proOmpA mutants suggest that the charge is partially shielded from the electric field gradient during transport, possibly by the co-migration of counter ions. The transport times of precursors with multiple positively charged sequences, or "pause sites," were fairly well predicted by a local effect model. However, the kinetic profile predicted by this local effect model was not observed. Instead, the transport kinetics observed for precursors with multiple polylysine segments support a model in which translocation through the SecYEG pore is not the rate-limiting step of transport.
Position-dependent Effects of Polylysine on Sec Protein Transport*
Liang, Fu-Cheng; Bageshwar, Umesh K.; Musser, Siegfried M.
2012-01-01
The bacterial Sec protein translocation system catalyzes the transport of unfolded precursor proteins across the cytoplasmic membrane. Using a recently developed real time fluorescence-based transport assay, the effects of the number and distribution of positive charges on the transport time and transport efficiency of proOmpA were examined. As expected, an increase in the number of lysine residues generally increased transport time and decreased transport efficiency. However, the observed effects were highly dependent on the polylysine position in the mature domain. In addition, a string of consecutive positive charges generally had a more significant effect on transport time and efficiency than separating the charges into two or more charged segments. Thirty positive charges distributed throughout the mature domain resulted in effects similar to 10 consecutive charges near the N terminus of the mature domain. These data support a model in which the local effects of positive charge on the translocation kinetics dominate over total thermodynamic constraints. The rapid translocation kinetics of some highly charged proOmpA mutants suggest that the charge is partially shielded from the electric field gradient during transport, possibly by the co-migration of counter ions. The transport times of precursors with multiple positively charged sequences, or “pause sites,” were fairly well predicted by a local effect model. However, the kinetic profile predicted by this local effect model was not observed. Instead, the transport kinetics observed for precursors with multiple polylysine segments support a model in which translocation through the SecYEG pore is not the rate-limiting step of transport. PMID:22367204
Thermoelectric transport properties of high mobility organic semiconductors
NASA Astrophysics Data System (ADS)
Venkateshvaran, Deepak; Broch, Katharina; Warwick, Chris N.; Sirringhaus, Henning
2016-09-01
Transport in organic semiconductors has traditionally been investigated using measurements of the temperature and gate voltage dependent mobility of charge carriers within the channel of organic field-effect transistors (OFETs). In such measurements, the behavior of charge carrier mobility with temperature and gate voltage, studied together with carrier activation energies, provide a metric to quantify the extent of disorder within these van der Waals bonded materials. In addition to the mobility and activation energy, another potent but often-overlooked transport coefficient useful in understanding disorder is the Seebeck coefficient (also known as thermoelectric power). Fundamentally, the Seebeck coefficient represents the entropy per charge carrier in the solid state, and thus proves powerful in distinguishing materials in which charge carriers move freely from those where a high degree of disorder causes the induced carriers to remain trapped. This paper briefly covers the recent highlights in the field of organic thermoelectrics, showing how significant strides have been made both from an applied standpoint as well as from a viewpoint of fundamental thermoelectric transport physics. It shall be illustrated how thermoelectric transport parameters in organic semiconductors can be tuned over a significant range, and how this tunability facilitates an enhanced performance for heat-to-electricity conversion as well as quantifies energetic disorder and the nature of the density of states (DOS). The work of the authors shall be spotlighted in this context, illustrating how Seebeck coefficient measurements in the polymer indacenodithiophene-co-benzothiadiazole (IDTBT) known for its ultra-low degree of torsion within the polymer backbone, has a trend consistent with low disorder. 1 Finally, using examples of the small molecules C8-BTBT and C10-DNTT, it shall be discussed how the Seebeck coefficient can aid the estimation of the density and distribution of trap states within these materials. 2, 3
Jang, Woosun; Lee, Jiwoo; In, Chihun; Choi, Hyunyong; Soon, Aloysius
2017-12-06
Despite the ubiquitous nature of the Peltier effect in low-dimensional thermoelectric devices, the influence of finite temperature on the electronic structure and transport in the Dirac heterointerfaces of the few-layer graphene and layered tetradymite, Sb 2 Te 3 (which coincidently have excellent thermoelectric properties) are not well understood. In this work, using the first-principles density-functional theory calculations, we investigate the detailed atomic and electronic structure of these Dirac heterointerfaces of graphene and Sb 2 Te 3 and further re-examine the effect of finite temperature on the electronic band structures using a phenomenological temperature-broadening model based on Fermi-Dirac statistics. We then proceed to understand the underlying charge redistribution process in this Dirac heterointerfaces and through solving the Boltzmann transport equation, we present the theoretical evidence of electron-hole asymmetry in its electrical conductivity as a consequence of this charge redistribution mechanism. We finally propose that the hexagonal-stacked Dirac heterointerfaces are useful as efficient p-n junction building blocks in the next-generation thermoelectric devices where the electron-hole asymmetry promotes the thermoelectric transport by "hot" excited charge carriers.
Majorana-assisted nonlocal electron transport through a floating topological superconductor
NASA Astrophysics Data System (ADS)
Ulrich, Jascha; Hassler, Fabian
2015-08-01
The nonlocal nature of the fermionic mode spanned by a pair of Majorana bound states in a one-dimensional topological superconductor has inspired many proposals aiming at demonstrating this property in transport. In particular, transport through the mode from a lead attached to the left bound state to a lead attached to the right will result in current cross correlations. For ideal zero modes on a grounded superconductor, the cross correlations are however completely suppressed in favor of purely local Andreev reflection. In order to obtain a nonvanishing cross correlation, previous studies have required the presence of an additional global charging energy. Adding nonlocal terms in the form of a global charging energy to the Hamiltonian when testing the intrinsic nonlocality of the Majorana modes seems to be conceptually troublesome. Here, we show that a floating superconductor allows observing nonlocal current correlations in the absence of charging energy. We show that the noninteracting and the Coulomb-blockade regime have the same peak conductance e2/h but different shot-noise power; whereas the shot noise is sub-Poissonian in the Coulomb-blockade regime in the large-bias limit, Poissonian shot noise is generically obtained in the noninteracting case.
Tuning electronic transport via hepta-alanine peptides junction by tryptophan doping.
Guo, Cunlan; Yu, Xi; Refaely-Abramson, Sivan; Sepunaru, Lior; Bendikov, Tatyana; Pecht, Israel; Kronik, Leeor; Vilan, Ayelet; Sheves, Mordechai; Cahen, David
2016-09-27
Charge migration for electron transfer via the polypeptide matrix of proteins is a key process in biological energy conversion and signaling systems. It is sensitive to the sequence of amino acids composing the protein and, therefore, offers a tool for chemical control of charge transport across biomaterial-based devices. We designed a series of linear oligoalanine peptides with a single tryptophan substitution that acts as a "dopant," introducing an energy level closer to the electrodes' Fermi level than that of the alanine homopeptide. We investigated the solid-state electron transport (ETp) across a self-assembled monolayer of these peptides between gold contacts. The single tryptophan "doping" markedly increased the conductance of the peptide chain, especially when its location in the sequence is close to the electrodes. Combining inelastic tunneling spectroscopy, UV photoelectron spectroscopy, electronic structure calculations by advanced density-functional theory, and dc current-voltage analysis, the role of tryptophan in ETp is rationalized by charge tunneling across a heterogeneous energy barrier, via electronic states of alanine and tryptophan, and by relatively efficient direct coupling of tryptophan to a Au electrode. These results reveal a controlled way of modulating the electrical properties of molecular junctions by tailor-made "building block" peptides.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kocharian, Armen N.; Fernando, Gayanath W.; Fang, Kun
Rashba spin-orbit effects and electron correlations in the two-dimensional cylindrical lattices of square geometries are assessed using mesoscopic two-, three- and four-leg ladder structures. Here the electron transport properties are systematically calculated by including the spin-orbit coupling in tight binding and Hubbard models threaded by a magnetic flux. These results highlight important aspects of possible symmetry breaking mechanisms in square ladder geometries driven by the combined effect of a magnetic gauge field spin-orbit interaction and temperature. The observed persistent current, spin and charge polarizations in the presence of spin-orbit coupling are driven by separation of electron and hole charges andmore » opposite spins in real-space. The modeled spin-flip processes on the pairing mechanism induced by the spin-orbit coupling in assembled nanostructures (as arrays of clusters) engineered in various two-dimensional multi-leg structures provide an ideal playground for understanding spatial charge and spin density inhomogeneities leading to electron pairing and spontaneous phase separation instabilities in unconventional superconductors. Such studies also fall under the scope of current challenging problems in superconductivity and magnetism, topological insulators and spin dependent transport associated with numerous interfaces and heterostructures.« less
Steyrleuthner, Robert; Di Pietro, Riccardo; Collins, Brian A; Polzer, Frank; Himmelberger, Scott; Schubert, Marcel; Chen, Zhihua; Zhang, Shiming; Salleo, Alberto; Ade, Harald; Facchetti, Antonio; Neher, Dieter
2014-03-19
We investigated the correlation between the polymer backbone structural regularity and the charge transport properties of poly{[N,N'-bis(2-octyldodecyl)-1,4,5,8-naphthalenediimide-2,6-diyl]-alt-5,5'-(2,2'-bithiophene)} [P(NDI2OD-T2)], a widely studied semiconducting polymer exhibiting high electron mobility and an unconventional micromorphology. To understand the influence of the chemical structure and crystal packing of conventional regioregular P(NDI2OD-T2) [RR-P(NDI2OD-T2)] on the charge transport, the corresponding regioirregular polymer RI-P(NDI2OD-T2) was synthesized. By combining optical, X-ray, and transmission electron microscopy data, we quantitatively characterized the aggregation, crystallization, and backbone orientation of all of the polymer films, which were then correlated to the electron mobilities in electron-only diodes. By carefully selecting the preparation conditions, we were able to obtain RR-P(NDI2OD-T2) films with similar crystalline structure along the three crystallographic axes but with different orientations of the polymer chains with respect to the substrate surface. RI-P(NDI2OD-T2), though exhibiting a rather similar LUMO structure and energy compared with the regioregular counterpart, displayed a very different packing structure characterized by the formation of ordered stacks along the lamellar direction without detectible π-stacking. Vertical electron mobilities were extracted from the space-charge-limited currents in unipolar devices. We demonstrate the anisotropy of the charge transport along the different crystallographic directions and how the mobility depends on π-stacking but is insensitive to the degree or coherence of lamellar stacking. The comparison between the regioregular and regioirregular polymers also shows how the use of large planar functional groups leads to improved charge transport, with mobilities that are less affected by chemical and structural disorder with respect to classic semicrystalline polymers such as poly(3-hexylthiophene).
Zhu, Huimin; Johansson, Malin B; Johansson, Erik M J
2018-03-22
The photovoltaic characteristics of CsBi 3 I 10 -based solar cells with three dopant-free hole-conducting polymers are investigated. The effect on charge generation and charge recombination in the solar cells using the different polymers is studied and the results indicate that the choice of polymer strongly affects the device properties. Interestingly, for the solar cell with poly[[2,3-bis(3-octyloxyphenyl)-5,8-quinoxalinediyl]-2,5-thiophenediyl] (TQ1), the photon-to-current conversion spectrum is highly improved in the red wavelength region, suggesting that the polymer also contributes to the photocurrent generation in this case. This report provides a new direction for further optimization of Bi-halide solar cells by using dopant-free hole-transporting polymers and shows that the energy levels and the interaction between the Bi-halide and the conducting polymers are very important for solar cell performance. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Quantum transport through a deformable molecular transistor
NASA Astrophysics Data System (ADS)
Cornaglia, P. S.; Grempel, D. R.; Ness, H.
2005-02-01
The linear transport properties of a model molecular transistor with electron-electron and electron-phonon interactions were investigated analytically and numerically. The model takes into account phonon modulation of the electronic energy levels and of the tunneling barrier between the molecule and the electrodes. When both effects are present they lead to asymmetries in the dependence of the conductance on gate voltage. The Kondo effect is observed in the presence of electron-phonon interactions. There are important qualitative differences between the cases of weak and strong coupling. In the first case the standard Kondo effect driven by spin fluctuations occurs. In the second case, it is driven by charge fluctuations. The Fermi-liquid relation between the spectral density of the molecule and its charge is altered by electron-phonon interactions. Remarkably, the relation between the zero-temperature conductance and the charge remains unchanged. Therefore, there is perfect transmission in all regimes whenever the average number of electrons in the molecule is an odd integer.
DNA Charge Transport: From Chemical Principles to the Cell
Arnold, Anna R.; Grodick, Michael A.; Barton, Jacqueline K.
2016-01-01
The DNA double helix has captured the imagination of many, bringing it to the forefront of biological research. DNA has unique features that extend our interest into areas of chemistry, physics, material science and engineering. Our laboratory has focused on studies of DNA charge transport (CT), wherein charges can efficiently travel long molecular distances through the DNA helix while maintaining an exquisite sensitivity to base pair π-stacking. Because DNA CT chemistry reports on the integrity of the DNA duplex, this property may be exploited to develop electrochemical devices to detect DNA lesions and DNA-binding proteins. Furthermore, studies now indicate that DNA CT may also be used in the cell by, for example, DNA repair proteins, as a cellular diagnostic, in order to scan the genome to localize efficiently to damage sites. In this review, we describe this evolution of DNA CT chemistry from the discovery of fundamental chemical principles to applications in diagnostic strategies and possible roles in biology. PMID:26933744
NASA Astrophysics Data System (ADS)
Hager, William W.; Feng, Wei
2013-09-01
An intracloud flash near Langmuir Laboratory is analyzed to determine the net rearrangement of charge. The analysis employed data from a balloon borne electric field sensor, or Esonde, that was within a few hundred meters of the lightning channel, data from a similar Esonde on a mountain about 6.4 km from the balloon, and data from the New Mexico Institute of Mining and Technology Lightning Mapping Array (LMA). The recovery of the charge transport required the solution of Poisson's equation over the mountainous terrain surrounding Langmuir Laboratory and the solution of a vastly under‒determined system of equations. The charge movement is analyzed using a new smooth charge transport model that incorporates constraints in the least squares fitting process through the use of penalty terms to smooth the charge movement and prevent data overfitting. The electric field measurements were consistent with about 26% of the negative charge being transported to the end of the channel, 36% deposited along the channel in the positive region, 8% deposited near the start of the channel in the positive region, and 30% deposited in another positive region several kilometers beneath the main channel. The transport of negative charge to a lower positive region occurred during the K‒processes when some negative charge was also deposited along the main channel in the upper positive region. Hence, the charge transport process during the K‒processes amounted to a tripolar charge rearrangement where the charge from the negative region was transported to two distinct positive regions, the positive region along the main channel and a lower positive region beneath the main channel. High altitude, widely scattered LMA sources beyond the end of the main channel could indicate the existence of streamers which transported the end‒of‒channel charge into the surrounding volume. Although the LMA showed the development of two upper channels, the charge transport analysis showed that measurable charge transport only occurred on one of the channels. The channel that did not transport charge was missing the high altitude, widely scattered LMA sources seen at the end of the channel that carried charge.
Electrocatalysis in DNA Sensors
Furst, Ariel; Hill, Michael G.; Barton, Jacqueline K.
2014-01-01
Electrocatalysis is often thought of solely in the inorganic realm, most often applied to energy conversion in fuel cells. However, the ever-growing field of bioelectrocatalysis has made great strides in advancing technology for both biofuel cells as well as biological detection platforms. Within the context of bioelectrocatalytic detection systems, DNA-based platforms are especially prevalent. One subset of these platforms, the one we have developed, takes advantage of the inherent charge transport properties of DNA. Electrocatalysis coupled with DNA-mediated charge transport has enabled specific and sensitive detection of lesions, mismatches and DNA-binding proteins. Even greater signal amplification from these platforms is now being achieved through the incorporation of a secondary electrode to the platform both for patterning DNA arrays and for detection. Here, we describe the evolution of this new DNA sensor technology. PMID:25435647
Electrocatalysis in DNA Sensors.
Furst, Ariel; Hill, Michael G; Barton, Jacqueline K
2014-12-14
Electrocatalysis is often thought of solely in the inorganic realm, most often applied to energy conversion in fuel cells. However, the ever-growing field of bioelectrocatalysis has made great strides in advancing technology for both biofuel cells as well as biological detection platforms. Within the context of bioelectrocatalytic detection systems, DNA-based platforms are especially prevalent. One subset of these platforms, the one we have developed, takes advantage of the inherent charge transport properties of DNA. Electrocatalysis coupled with DNA-mediated charge transport has enabled specific and sensitive detection of lesions, mismatches and DNA-binding proteins. Even greater signal amplification from these platforms is now being achieved through the incorporation of a secondary electrode to the platform both for patterning DNA arrays and for detection. Here, we describe the evolution of this new DNA sensor technology.
Quantized charge transport in chiral Majorana edge modes
NASA Astrophysics Data System (ADS)
Rachel, Stephan; Mascot, Eric; Cocklin, Sagen; Vojta, Matthias; Morr, Dirk K.
2017-11-01
Majorana fermions can be realized as quasiparticles in topological superconductors, with potential applications in topological quantum computing. Recently, lattices of magnetic adatoms deposited on the surface of s -wave superconductors—Shiba lattices—have been proposed as a new platform for topological superconductivity. These systems possess the great advantage that they are accessible via scanning-probe techniques and thus enable the local manipulation and detection of Majorana modes. Using a nonequilibrium Green's function technique we demonstrate that the topological Majorana edge modes of nanoscopic Shiba islands display universal electronic and transport properties. Most remarkably, these Majorana modes possess a quantized charge conductance that is proportional to the topological Chern number, C , and carry a supercurrent whose chirality reflects the sign of C . These results establish nanoscopic Shiba islands as promising components in future topology-based devices.
A theoretical study of structural and electronic properties of pentacene/Al(100) interface.
Saranya, G; Nair, Shiny; Natarajan, V; Kolandaivel, P; Senthilkumar, K
2012-09-01
The first principle calculations within the framework of density functional theory have been performed for the pentacene molecule deposited on the aluminum Al(100) substrate to study the structural and electronic properties of the pentacene/Al(100) interface. The most stable configuration was found at bridge site with 45° rotation of the pentacene molecule on Al(100) surface with a vertical distance of 3.4 Å within LDA and 3.8 Å within GGA functionals. The calculated adsorption energy reveals that the adsorption of pentacene molecule on Al(100) surface is physisorption. For the stable adsorption geometry the electronic properties such as density of states (DOS), partial density of states (PDOS), Mulliken population analysis and Schottky barrier height are studied. The analysis of atomic charge, DOS and PDOS show that the charge is transferred from the Al(100) surface to pentacene molecule, and the transferred charge is about -0.05 electrons. For the adsorbed system, the calculated Schottky barrier height for hole and electron transport is 0.27 and 1.55 eV, respectively. Copyright © 2012 Elsevier Inc. All rights reserved.
n-Channel semiconductor materials design for organic complementary circuits.
Usta, Hakan; Facchetti, Antonio; Marks, Tobin J
2011-07-19
Organic semiconductors have unique properties compared to traditional inorganic materials such as amorphous or crystalline silicon. Some important advantages include their adaptability to low-temperature processing on flexible substrates, low cost, amenability to high-speed fabrication, and tunable electronic properties. These features are essential for a variety of next-generation electronic products, including low-power flexible displays, inexpensive radio frequency identification (RFID) tags, and printable sensors, among many other applications. Accordingly, the preparation of new materials based on π-conjugated organic molecules or polymers has been a central scientific and technological research focus over the past decade. Currently, p-channel (hole-transporting) materials are the leading class of organic semiconductors. In contrast, high-performance n-channel (electron-transporting) semiconductors are relatively rare, but they are of great significance for the development of plastic electronic devices such as organic field-effect transistors (OFETs). In this Account, we highlight the advances our team has made toward realizing moderately and highly electron-deficient n-channel oligomers and polymers based on oligothiophene, arylenediimide, and (bis)indenofluorene skeletons. We have synthesized and characterized a "library" of structurally related semiconductors, and we have investigated detailed structure-property relationships through optical, electrochemical, thermal, microstructural (both single-crystal and thin-film), and electrical measurements. Our results reveal highly informative correlations between structural parameters at various length scales and charge transport properties. We first discuss oligothiophenes functionalized with perfluoroalkyl and perfluoroarene substituents, which represent the initial examples of high-performance n-channel semiconductors developed in this project. The OFET characteristics of these compounds are presented with an emphasis on structure-property relationships. We then examine the synthesis and properties of carbonyl-functionalized oligomers, which constitute second-generation n-channel oligothiophenes, in both vacuum- and solution-processed FETs. These materials have high carrier mobilities and good air stability. In parallel, exceptionally electron-deficient cyano-functionalized arylenediimide derivatives are discussed as early examples of thermodynamically air-stable, high-performance n-channel semiconductors; they exhibit record electron mobilities of up to 0.64 cm(2)/V·s. Furthermore, we provide an overview of highly soluble ladder-type macromolecular semiconductors as OFET components, which combine ambient stability with solution processibility. A high electron mobility of 0.16 cm(2)/V·s is obtained under ambient conditions for solution-processed films. Finally, examples of polymeric n-channel semiconductors with electron mobilities as high as 0.85 cm(2)/V·s are discussed; these constitute an important advance toward fully printed polymeric electronic circuitry. Density functional theory (DFT) computations reveal important trends in molecular physicochemical and semiconducting properties, which, when combined with experimental data, shed new light on molecular charge transport characteristics. Our data provide the basis for a fundamental understanding of charge transport in high-performance n-channel organic semiconductors. Moreover, our results provide a road map for developing functional, complementary organic circuitry, which requires combining p- and n-channel transistors.
Brueckner, Mandy; Jankuhn, Steffen; Jülke, Eva-Maria; Reibetanz, Uta
2018-01-01
Background Drug delivery systems (DDS) and their interaction with cells are a controversial topic in the development of therapeutic concepts and approaches. On one hand, DDS are very useful for protected and targeted transport of defined dosages of active agents. On the other hand, their physicochemical properties such as material, size, shape, charge, or stiffness have a huge impact on cellular uptake and intracellular processing. Additionally, even identical DDS can undergo a completely diverse interaction with different cell types. However, quite often in in vitro DDS/cell interaction experiments, those aspects are not considered and DDS and cells are randomly chosen. Methods and results Hence, our investigations provide an insight into layer-by-layer designed microcarriers with modifications of only some of the most important parameters (surface charge, stiffness, and applied microcarrier/cell ratio) and their influence on cellular uptake and viability. We also considered the interaction of these differently equipped DDS with several cell types and investigated professional phagocytes (neutrophil granulocytes; macrophages) as well as non-professional phagocytes (epithelial cells) under comparable conditions. We found that even small modifications such as layer-by-layer (LbL)-microcarriers with positive or negative surface charge, or LbL-microcarriers with solid core or as hollow capsules but equipped with the same surface properties, show significant differences in interaction and viability, and several cell types react very differently to the offered DDS. Conclusion As a consequence, the properties of the DDS have to be carefully chosen with respect to the addressed cell type with the aim to efficiently transport a desired agent. PMID:29670351
Surface chemical effects on colloid stability and transport through natural porous media
Puls, Robert W.; Paul, Cynthia J.; Clark, Donald A.
1993-01-01
Surface chemical effects on colloidal stability and transport through porous media were investigated using laboratory column techniques. Approximately 100 nm diameter, spherical, iron oxide particles were synthesized as the mobile colloidal phase. The column packing material was retrieved from a sand and gravel aquifer on Cape Cod, MA. Previous studies have indicated enhanced stability and transport of iron oxide particles due to specific adsorption of some inorganic anions on the iron oxide surface. This phenomenon was further evaluated with an anionic surfactant, sodium dodecyl sulfate. Surfactants constitute a significant mass of the contaminant loading at the Cape Cod site and their presence may contribute to colloidal transport as a significant transport mechanism at the site. Other studies at the site have previously demonstrated the occurrence of this transport mechanism for iron phosphate particles. Photon correlation spectroscopy, micro-electrophoretic mobility, and scanning electron microscopy were used to evaluate particle stability, mobility and size. Adsorption of negatively charged organic and inorganic species onto the surface of the iron oxide particles was shown to significantly enhance particle stability and transport through alterations of the electrokinetic properties of the particle surface. Particle breakthrough generally occurred simultaneously with tritiated water, a conservative tracer. The extent of particle breakthrough was primarily dependent upon colloidal stability and surface charge.
NASA Technical Reports Server (NTRS)
Abbas, M. M.; Tankosic, D.; Spann, J. F.; LeClair, A. C.
2010-01-01
Dust grains in various astrophysical environments are generally charged electrostatically by photoelectric emissions with radiation from nearby sources, or by electron/ion collisions by sticking or secondary electron emissions. Knowledge of the dust grain charges and equilibrium potentials is important for understanding of a variety of physical and dynamical processes in the interstellar medium (ISM), and heliospheric, interplanetary, planetary, and lunar environments. The high vacuum environment on the lunar surface leads to some unusual physical and dynamical phenomena involving dust grains with high adhesive characteristics, and levitation and transportation over long distances. It has been well recognized that the charging properties of individual micron/submicron size dust grains are expected to be substantially different from the corresponding values for bulk materials and theoretical models. In this paper we present experimental results on charging of individual dust grains selected from Apollo 11 and Apollo 17 dust samples by exposing them to mono-energetic electron beams in the 10- 400 eV energy range. The charging rates of positively and negatively charged particles of approximately 0.2 to 13 microns diameters are discussed in terms of the secondary electron emission (SEE) process, which is found to be a complex charging process at electron energies as low as 10-25 eV, with strong particle size dependence. The measurements indicate substantial differences between dust charging properties of individual small size dust grains and of bulk materials.
NASA Astrophysics Data System (ADS)
Bai, Jaeil; Ducharme, Stephen; Leonov, Alexei G.; Lu, Liu; Takacs, James M.
1999-10-01
In this report, we introduce new organic photorefractive composites consisting of charge transporting den-drimers highly doped with a stilbene nonlinear optic chromophore, The purpose of making these composites is to improve charge transport, by reducing inhomogeneity when compared to ordinary polymer-based systems. Because the structure of this material gives us freedom to control the orientation of charge transport agents synthetically, we can study the charge transport mechanism more systematically than in polymers. We discuss this point and present the characterization results for this material.
Phonon Effects on Charge Transport Through a Two State Molecule
NASA Astrophysics Data System (ADS)
Ulloa, Sergio E.; Yudiarsah, Efta
2008-03-01
We study the effect of local and non-local phonon on the transport properties of a molecule model described by two- electronic states. The local phonon interaction is tackled by means of a Lang Firsov transformation [1,2]. The interaction with non-local phonons (phonon-assisted hopping) is considered perturbatively up to the first nonzero order in the self energy. The presence of different kinds of electron-phonon interaction open new transmission channels. In addition to the polaron shift and replicas due to local phonons, non-local phonons cause the appearance of new satellite states around the initial states. In the weak coupling regime of non-local phonon and electrons, states are shifted an amount proportional to square of the interaction. However, in the strong coupling regime, the non-linear effects emerge and display more interesting features on transport properties. Additional features on transport properties due to new transmission channel are shown to appear at finite temperatures. [1] G. D. Mahan, Many-particle physics, 3rd ed. (Plenum Publishers, New York, 2000). [2] R. Gutierrez et al., Phys. Rev. B. 74, 235105 (2006).
Lattice distortion and electron charge redistribution induced by defects in graphene
Zhang, Wei; Lu, Wen -Cai; Zhang, Hong -Xing; ...
2016-09-14
Lattice distortion and electronic charge localization induced by vacancy and embedded-atom defects in graphene were studied by tight-binding (TB) calculations using the recently developed three-center TB potential model. We showed that the formation energies of the defects are strongly correlated with the number of dangling bonds and number of embedded atoms, as well as the magnitude of the graphene lattice distortion induced by the defects. Lastly, we also showed that the defects introduce localized electronic states in the graphene which would affect the electron transport properties of graphene.
Effect of CdS nanocrystals on charge transport mechanism in poly(3-hexylthiophene)
NASA Astrophysics Data System (ADS)
Khan, Mohd Taukeer; Almohammedi, Abdullah
2017-08-01
The present manuscript demonstrates the optical and electrical characteristics of poly(3-hexylthiophene) (P3HT) and cadmium sulphide (CdS) hybrid nanocomposites. Optical results suggest that there is a formation of charge transfer complex (CTC) between host P3HT and guest CdS nanocrystals (NCs). Electrical properties of P3HT and P3HT-CdS thin films have been studied in hole only device configurations at different temperatures (290 K-150 K), and results were analysed by the space charge limited conduction mechanism. Density of traps and characteristic trap energy increase on incorporation of inorganic NCs in the polymer matrix, which might be due to the additional favourable energy states created by CdS NCs in the band gap of P3HT. These additional trap states assist charge carriers to move quicker which results in enhancement of hole mobility from 7 × 10-6 to 5.5 × 10-5 cm2/V s in nanocomposites. These results suggest that the P3HT-CdS hybrid system has desirable optical and electrical properties for its applications to photovoltaics devices.
Insight into capacitive performance of polyaniline/graphene oxide composites with ecofriendly binder
NASA Astrophysics Data System (ADS)
Bilal, Salma; Fahim, Muhammad; Firdous, Irum; Ali Shah, Anwar-ul-Haq
2018-03-01
The behaviour of gold electrode modified with polyaniline/graphene oxide composites (PGO) was studied for electrochemical and charge storage properties in aqueous acidic media. The surface of gold electrode was modified with aqueous slurry of PGO by using Carboxymethyl cellulose (CMC) as binder. The intercalation of polyaniline in the GO layers, synthesized by in situ polymerization was confirmed by scanning electron microscopy (SEM). The electrochemical behaviour and charge storing properties were investigated using cyclic voltammetry (CV), galvanostatic charge discharge (GCD) and electrochemical impedance spectroscopy (EIS). A high specific capacitance of 1721 F g-1 was obtained for PGO with 69.8% retention of capacitance even after 1000 voltammetric cycles in the potential range of 0-0.9 V at 20 mV s-1. EIS indicated low charge transfer resistance (Rct) and solution resistance (Rs) values of 0.51 Ω and 0.07 Ω, respectively. This good performance of PGO coated electrode is attributed to the use of CMC binder which generate a high electrode/ electrolyte contact area and short path lengths for electronic transport and electrolyte ion.
Yang, Shuo; Schmidt, Dirk Oliver; Khetan, Abhishek; Schrader, Felix; Jakobi, Simon; Homberger, Melanie; Noyong, Michael; Paulus, Anja; Kungl, Hans; Eichel, Rüdiger-Albert; Pitsch, Heinz; Simon, Ulrich
2018-05-16
LiNi 0.5 Mn 1.5 O₄ (LNMO) spinel has been extensively investigated as one of the most promising high-voltage cathode candidates for lithium-ion batteries. The electrochemical performance of LNMO, especially its rate performance, seems to be governed by its crystallographic structure, which is strongly influenced by the preparation methods. Conventionally, LNMO materials are prepared via solid-state reactions, which typically lead to microscaled particles with only limited control over the particle size and morphology. In this work, we prepared Ni-doped LiMn₂O₄ (LMO) spinel via the polyol method. The cycling stability and rate capability of the synthesized material are found to be comparable to the ones reported in literature. Furthermore, its electronic charge transport properties were investigated by local electrical transport measurements on individual particles by means of a nanorobotics setup in a scanning electron microscope, as well as by performing DFT calculations. We found that the scarcity of Mn 3+ in the LNMO leads to a significant decrease in electronic conductivity as compared to undoped LMO, which had no obvious effect on the rate capability of the two materials. Our results suggest that the rate capability of LNMO and LMO materials is not limited by the electronic conductivity of the fully lithiated materials.
Role of charged impurities in thermoelectric transport in molybdenum disulfide monolayers
NASA Astrophysics Data System (ADS)
Patil, Sukanya B.; Sankeshwar, N. S.; Mulimani, B. G.
2017-12-01
A theoretical study of the electronic properties, namely, electrical conductivity (EC), electronic thermal conductivity (ETC) and thermoelectric power (TEP) in 2D MoS2 monolayers (MLs), over a wide range of temperatures (10 < T < 300 K), is presented employing Boltzmann transport formalism. Considering the electrons to be scattered by screened charged impurities and the acoustic, optical and remote phonons, the transport equation is solved using Ritz iterative method. Numerical calculations of EC, ETC and TEP presented for supported and free-standing MLs with high electron concentrations, as a function of temperature, bring out the relative importance of the various scattering mechanisms operative. The role of CIs, with regard to both concentration and separation from the substrate-ML interface, in determining the properties of supported MLs is demonstrated for the first time. Validity of Wiedemann-Franz law and Mott formula are examined for supported and free standing MLs. Calculations are in consonance with recent experimental data on mobility and TEP of exfoliated SiO2-supported MoS2 ML samples. In the case of TEP it is found that though the diffusion contribution is dominant the inclusion of the drag component, incorporating contributions from all relevant phonon scattering mechanisms, is needed to obtain good agreement with the data.
NASA Astrophysics Data System (ADS)
Tang, Xiao-Dan
2017-09-01
The charge transport properties of phosphapentacene (P-PEN) derivatives were systematically explored by theoretical calculation. The dehydrogenated P-PENs have reasonable frontier molecular orbital energy levels to facilitate both electron and hole injection. The reduced reorganization energies of dehydrogenated P-PENs could be intimately connected to the bonding nature of phosphorus atoms. From the idea of homology modeling, the crystal structure of TIPSE-4P-2p is constructed and fully optimized. Fascinatingly, TIPSE-4P-2p shows the intrinsic property of ambipolar transport in both hopping and band models. Thus, introducing dehydrogenated phosphorus atoms into pentacene core could be an efficient strategy for designing ambipolar material.
Electron transport in ethanol & methanol absorbed defected graphene
NASA Astrophysics Data System (ADS)
Dandeliya, Sushmita; Srivastava, Anurag
2018-05-01
In the present paper, the sensitivity of ethanol and methanol molecules on surface of single vacancy defected graphene has been investigated using density functional theory (DFT). The changes in structural and electronic properties before and after adsorption of ethanol and methanol were analyzed and the obtained results show high adsorption energy and charge transfer. High adsorption happens at the active site with monovacancy defect on graphene surface. Present work confirms that the defected graphene increases the surface reactivity towards ethanol and methanol molecules. The presence of molecules near the active site affects the electronic and transport properties of defected graphene which makes it a promising choice for designing methanol and ethanol sensor.
Investigation of transport properties of FeTe compound
NASA Astrophysics Data System (ADS)
Lodhi, Pavitra Devi; Solanki, Neha; Choudhary, K. K.; Kaurav, Netram
2018-05-01
Transport properties of FeTe parent compound has been investigated by measurements of electrical resistivity, magnetic susceptibility and Seebeck coefficient. The sample was synthesized through a standard solid state reaction route via vacuum encapsulation and characterized by x-ray diffraction, which indicated a tetragonal phase with space group P4/nmm. The parent FeTe compound does not exhibit superconductivity but shows an anomaly in the resistivity measurement at around 67 K, which corresponds to a structural phase transition along with in the vicinity of a magnetic phase transition. In the low temperature regime, Seebeck coefficient, S(T), exhibited an anomalous dip feature and negative throughout the temperature range, indicating electron-like charge carrier conduction mechanism.
NASA Astrophysics Data System (ADS)
Zahid, F.; Paulsson, M.; Polizzi, E.; Ghosh, A. W.; Siddiqui, L.; Datta, S.
2005-08-01
We present a transport model for molecular conduction involving an extended Hückel theoretical treatment of the molecular chemistry combined with a nonequilibrium Green's function treatment of quantum transport. The self-consistent potential is approximated by CNDO (complete neglect of differential overlap) method and the electrostatic effects of metallic leads (bias and image charges) are included through a three-dimensional finite element method. This allows us to capture spatial details of the electrostatic potential profile, including effects of charging, screening, and complicated electrode configurations employing only a single adjustable parameter to locate the Fermi energy. As this model is based on semiempirical methods it is computationally inexpensive and flexible compared to ab initio models, yet at the same time it is able to capture salient qualitative features as well as several relevant quantitative details of transport. We apply our model to investigate recent experimental data on alkane dithiol molecules obtained in a nanopore setup. We also present a comparison study of single molecule transistors and identify electronic properties that control their performance.
An, Yujin; Long, Dang Xuan; Kim, Yiho; Noh, Yong-Young; Yang, Changduk
2016-05-14
To determine the role played by the choice of processing solvents in governing the photophysics, microstructure, and charge carrier transport in naphthalenediimide (NDI)-based polymers, we have prepared two new NDI-bithiophene (T2)- and NDI-thienothiophene (TTh)-containing polymers with hybrid siloxane pentyl chains (SiC5) (P(NDI2SiC5-T2) and P(NDI2SiC5-TTh)). Among the various processing solvents studied here, the films prepared using chloroform exhibited far better electron mobilities (0.16 ± 0.1-0.21 ± 0.05 cm(2) V(-1) s(-1)) than the corresponding samples prepared from different solvents, exceeding one order of magnitude higher, indicating the significant influence of the processing solvent on the charge transport. Upon thin-film analysis using atomic force microscopy and grazing incidence X-ray diffraction, we discovered that molecular ordering and orientation are affected by the choice of the processing solvent, which is responsible for the change in the transport characteristics of this class of polymers.
Alternative Fuels Data Center: Georgia Transportation Data for Alternative
Atlas from the National Renewable Energy Laboratory Case Studies Video thumbnail for Municipality with a Fleet Commits to Alternative Fuels for the Long Haul Jan. 27, 2017 Video thumbnail for Workplace Facilities Charges Up Tenants and Property Managers Jan. 1, 2015 Video thumbnail for DeKalb County Turns
NASA Astrophysics Data System (ADS)
Sahoo, Smruti Ranjan; Sahu, Sridhar; Sharma, Sagar
2018-05-01
We present density functional study of the charge transport and optical properties of trifluoromethyl substituted benzodithiophene (TFMBDT) molecule. We found the hole reorganization energy, reduced by 0.354 eV compared to the electron reorganization energy, thus favoring the hole transport across the molecular barrier. We found the maximum tH and tL at the tilting angle 85°, to be 0.473 eV and 0.472 eV, respectively. Although, both tH and tL are found to equivalent, however, low λh can contribute to the larger hole mobility. In the TD-DFT calculation, the low energy electronic transition (H→L) was found to be accordance with the electronic HOMO-LUMO energy gap of the conjugated organic molecule. The calculated gas phase maximum absorption (λmax) of TFMBDT molecule was observed at 337.31 nm (3.67 eV) for B3LYP/6-311+G(d, p) level and 328.04 nm (3.77 eV) for PBE1PBE/6-311+G(d, p) level, which is mostly associated with HOMO→LUMO transition.
Ordered materials for organic electronics and photonics.
O'Neill, Mary; Kelly, Stephen M
2011-02-01
We present a critical review of semiconducting/light emitting, liquid crystalline materials and their use in electronic and photonic devices such as transistors, photovoltaics, OLEDs and lasers. We report that annealing from the mesophase improves the order and packing of organic semiconductors to produce state-of-the-art transistors. We discuss theoretical models which predict how charge transport and light emission is affected by the liquid crystalline phase. Organic photovoltaics and OLEDs require optimization of both charge transport and optical properties and we identify the various trade-offs involved for ordered materials. We report the crosslinking of reactive mesogens to give pixellated full-colour OLEDs and distributed bi-layer photovoltaics. We show how the molecular organization inherent to the mesophase can control the polarization of light-emitting devices and the gain in organic, thin-film lasers and can also provide distributed feedback in chiral nematic mirrorless lasers. We update progress on the surface alignment of liquid crystalline semiconductors to obtain monodomain devices without defects or devices with spatially varying properties. Finally the significance of all of these developments is assessed. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Thermionic field emission in gold nitride Schottky nanodiodes
NASA Astrophysics Data System (ADS)
Spyropoulos-Antonakakis, N.; Sarantopoulou, E.; Kollia, Z.; Samardžija, Z.; Kobe, S.; Cefalas, A. C.
2012-11-01
We report on the thermionic field emission and charge transport properties of gold nitride nanodomains grown by pulsed laser deposition with a molecular fluorine laser at 157 nm. The nanodomains are sandwiched between the metallic tip of a conductive atomic force microscope and a thin gold layer forming thus a metal-semiconductor-metal junction. Although the limited existing data in the literature indicate that gold nitride was synthesized previously with low efficiency, poor stability, and metallic character; in this work, it is shown that gold nitride nanodomains exhibit semiconducting behavior and the metal-semiconductor-metal contact can be modeled with the back-to-back Schottky barrier model. From the experimental I-V curves, the main charge carrier transport process is found to be thermionic field emission via electron tunneling. The rectifying, near symmetric and asymmetric current response of nanocontacts is related to the effective contact area of the gold nitride nanodomains with the metals. A lower limit for the majority charge carriers concentration at the boundaries of nanodomains is also established using the full depletion approximation, as nanodomains with thickness as low as 6 nm were found to be conductive. Current rectification and charge memory effects are also observed in "quite small" conductive nanodomains (6-10 nm) due to stored charges. Indeed, charges near the surface are identified as inversion domains in the phase shift mapping performed with electrostatic force microscopy and are attributed to charge trapping at the boundaries of the nanodomains.
NASA Astrophysics Data System (ADS)
Vargas-Barbosa, Nella M.; Roling, Bernhard
2018-05-01
The potential of zero charge (PZC) is a fundamental property that describes the electrode/electrolyte interface. The determination of the PZC at electrode/ionic liquid interfaces has been challenging due to the lack of models that fully describe these complex interfaces as well as the non-standardized approaches used to characterize them. In this work, we present a method that combines electrode immersion transient and impedance measurements for the determination of the PZC. This combined approach allows the distinction of the potential of zero free charge (pzfc), related to fast double layer charging on a millisecond timescale, from a potential of zero charge on a timescale of tens of seconds related to slower ion transport processes at the interface. Our method highlights the complementarity of these electrochemical techniques and the importance of selecting the correct timescale to execute experiments and interpret the results.
NASA Astrophysics Data System (ADS)
Zlatić, V.
2008-05-01
In the first part of these lecture notes we introduce the phenomenological equations for describing the heat and charge transport in thermoelectric samples. We discuss the solution obtained for various boundary conditions that are appropriate for the homogeneous and inhomogeneous thermoelectrics. In the second part we develop the formalism for a linear-response many-body description of the transport properties of correlated electrons. By properly determining the local heat-current operator we show that the Jonson-Mahan theorem applies to the Hamiltonians that are commonly used for the intermetallic compounds with Cerium, Europium and Ytterbium ions, so the various thermal-transport coefficient integrands are related by powers of frequency. We illustrate how to use this formalism by calculating the thermoelectric properties of the periodic Anderson model and, then, show that these results explain the experimental data on heavy fermions and valence fluctuators. Finally, we calculate the thermoelectric properties of the Falicov-Kimball model and use the results to explain the anomalous features of the intermetallic compounds in which one observes the valence-change transition.
Electronic and transport properties of BCN alloy nanoribbons
NASA Astrophysics Data System (ADS)
Darvishi Gilan, Mahdi; Chegel, Raad
2018-03-01
The dependence of the carbon (C) concentration on the electronic and transport properties of boron carbonitride (BCN) alloy nanoribbons have been investigated using surface Green's functions technique and random Hamiltonian model by considering random hopping parameters including first and second nearest neighbors. Our calculations indicate that substituting boron (nitrogen) sites with carbon atoms induces a new band close to conduction (valence) band and carbon atoms behave like a donor (acceptor) dopants. Also, while both nitrogen and boron sites are substituted randomly by carbon atoms, new bands are induced close to both valence and conduction bands. The band gap decreases with C substituting and the number of charge carriers increases in low bias voltage. Far from Fermi level in the higher range of energy, transmission coefficient and current of the system are reduced by increasing the C concentration. Based on our results, tuning the electronic and transport properties of BCN alloy nanoribbons by random carbon dopants could be applicable to design nanoelectronics devices.
Hu, Xuelu; Wang, Xiao; Fan, Peng; Li, Yunyun; Zhang, Xuehong; Liu, Qingbo; Zheng, Weihao; Xu, Gengzhao; Wang, Xiaoxia; Zhu, Xiaoli; Pan, Anlian
2018-05-09
Metal halide perovskite nanostructures have recently been the focus of intense research due to their exceptional optoelectronic properties and potential applications in integrated photonics devices. Charge transport in perovskite nanostructure is a crucial process that defines efficiency of optoelectronic devices but still requires a deep understanding. Herein, we report the study of the charge transport, particularly the drift of minority carrier in both all-inorganic CsPbBr 3 and organic-inorganic hybrid CH 3 NH 3 PbBr 3 perovskite nanoplates by electric field modulated photoluminescence (PL) imaging. Bias voltage dependent elongated PL emission patterns were observed due to the carrier drift at external electric fields. By fitting the drift length as a function of electric field, we obtained the carrier mobility of about 28 cm 2 V -1 S -1 in the CsPbBr 3 perovskite nanoplate. The result is consistent with the spatially resolved PL dynamics measurement, confirming the feasibility of the method. Furthermore, the electric field modulated PL imaging is successfully applied to the study of temperature-dependent carrier mobility in CsPbBr 3 nanoplates. This work not only offers insights for the mobile carrier in metal halide perovskite nanostructures, which is essential for optimizing device design and performance prediction, but also provides a novel and simple method to investigate charge transport in many other optoelectronic materials.
Solenoid transport of beams with current-dependent initial conditions
Harris, J. R.; Poole, B. R.; Lewellen, J. W.
2017-09-06
We present that intense charged particle beams will generally be formed with an initial correlation between their longitudinal properties, including longitudinal variations in current, and their transverse properties, including their radius and divergence. This is due to the competition between the transverse focusing fields in the beam source and the time-varying space charge forces in the beam. In DC electron guns where the current modulation is slow compared to the electron transit time, the nature of these correlations was previously shown to depend on the gun geometry, exhibiting a linear dependence of the beam radius and divergence on the beammore » current at the gun exit. Here, we extend the previous work to study the transport of beams with such correlation in uniform and periodic solenoid channels. For each transport channel configuration studied, the transverse envelope equation is used to calculate the envelope of 101 beam slices differing in their slice currents, as well as initial radius and divergence (due to their dependence on slice current). For each channel configuration, these calculations are performed 546 times, with each of these iterations considering a different degree of correlation between the radius and divergence, and the slice current. It is found that some degree of correlation between the initial radius and slice current actually aids in beam transport, and the required strength of correlation can be estimated with simple models. Finally, increasing the degree of correlation between the initial divergence and slice current is generally counterproductive, and the degree of sensitivity to such correlations depends on the design of the transport channel.« less
Solenoid transport of beams with current-dependent initial conditions
DOE Office of Scientific and Technical Information (OSTI.GOV)
Harris, J. R.; Poole, B. R.; Lewellen, J. W.
We present that intense charged particle beams will generally be formed with an initial correlation between their longitudinal properties, including longitudinal variations in current, and their transverse properties, including their radius and divergence. This is due to the competition between the transverse focusing fields in the beam source and the time-varying space charge forces in the beam. In DC electron guns where the current modulation is slow compared to the electron transit time, the nature of these correlations was previously shown to depend on the gun geometry, exhibiting a linear dependence of the beam radius and divergence on the beammore » current at the gun exit. Here, we extend the previous work to study the transport of beams with such correlation in uniform and periodic solenoid channels. For each transport channel configuration studied, the transverse envelope equation is used to calculate the envelope of 101 beam slices differing in their slice currents, as well as initial radius and divergence (due to their dependence on slice current). For each channel configuration, these calculations are performed 546 times, with each of these iterations considering a different degree of correlation between the radius and divergence, and the slice current. It is found that some degree of correlation between the initial radius and slice current actually aids in beam transport, and the required strength of correlation can be estimated with simple models. Finally, increasing the degree of correlation between the initial divergence and slice current is generally counterproductive, and the degree of sensitivity to such correlations depends on the design of the transport channel.« less
Comparative study of active plasma lenses in high-quality electron accelerator transport lines
NASA Astrophysics Data System (ADS)
van Tilborg, J.; Barber, S. K.; Benedetti, C.; Schroeder, C. B.; Isono, F.; Tsai, H.-E.; Geddes, C. G. R.; Leemans, W. P.
2018-05-01
Electrically discharged active plasma lenses (APLs) are actively pursued in compact high-brightness plasma-based accelerators due to their high-gradient, tunable, and radially symmetric focusing properties. In this manuscript, the APL is experimentally compared with a conventional quadrupole triplet, highlighting the favorable reduction in the energy dependence (chromaticity) in the transport line. Through transport simulations, it is explored how the non-uniform radial discharge current distribution leads to beam-integrated emittance degradation and a charge density reduction at focus. However, positioning an aperture at the APL entrance will significantly reduce emittance degradation without additional loss of charge in the high-quality core of the beam. An analytical model is presented that estimates the emittance degradation from a short beam driving a longitudinally varying wakefield in the APL. Optimizing laser plasma accelerator operation is discussed where emittance degradation from the non-uniform discharge current (favoring small beams inside the APL) and wakefield effects (favoring larger beam sizes) is minimized.
Comparative study of active plasma lenses in high-quality electron accelerator transport lines
DOE Office of Scientific and Technical Information (OSTI.GOV)
van Tilborg, J.; Barber, S. K.; Benedetti, C.
Electrically discharged active plasma lenses (APLs) are actively pursued in compact high-brightness plasma-based accelerators due to their high-gradient, tunable, and radially symmetric focusing properties. In this paper, the APL is experimentally compared with a conventional quadrupole triplet, highlighting the favorable reduction in the energy dependence (chromaticity) in the transport line. Through transport simulations, it is explored how the non-uniform radial discharge current distribution leads to beam-integrated emittance degradation and a charge density reduction at focus. However, positioning an aperture at the APL entrance will significantly reduce emittance degradation without additional loss of charge in the high-quality core of the beam.more » An analytical model is presented that estimates the emittance degradation from a short beam driving a longitudinally varying wakefield in the APL. Finally, optimizing laser plasma accelerator operation is discussed where emittance degradation from the non-uniform discharge current (favoring small beams inside the APL) and wakefield effects (favoring larger beam sizes) is minimized.« less
Comparative study of active plasma lenses in high-quality electron accelerator transport lines
van Tilborg, J.; Barber, S. K.; Benedetti, C.; ...
2018-03-13
Electrically discharged active plasma lenses (APLs) are actively pursued in compact high-brightness plasma-based accelerators due to their high-gradient, tunable, and radially symmetric focusing properties. In this paper, the APL is experimentally compared with a conventional quadrupole triplet, highlighting the favorable reduction in the energy dependence (chromaticity) in the transport line. Through transport simulations, it is explored how the non-uniform radial discharge current distribution leads to beam-integrated emittance degradation and a charge density reduction at focus. However, positioning an aperture at the APL entrance will significantly reduce emittance degradation without additional loss of charge in the high-quality core of the beam.more » An analytical model is presented that estimates the emittance degradation from a short beam driving a longitudinally varying wakefield in the APL. Finally, optimizing laser plasma accelerator operation is discussed where emittance degradation from the non-uniform discharge current (favoring small beams inside the APL) and wakefield effects (favoring larger beam sizes) is minimized.« less
SELF-HEALING NANOMATERIALS: MULTIMILLION-ATOM REACTIVE MOLECULAR DYNAMICS SIMULATIONS
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hakamata, Tomoya; Shimamura, Kohei; Shimojo, Fuyuki
Organometal halide perovskites are attracting great attention as promising material for solar cells because of their high power conversion efficiency. The high performance has been attributed to the existence of free charge carriers and their large diffusion lengths, but the nature of carrier transport at the atomistic level remains elusive. Here, nonadiabatic quantum molecular dynamics simulations elucidate the mechanisms underlying the excellent free-carrier transport in CH 3NH 3PbI 3. Pb and I sublattices act as disjunct pathways for rapid and balanced transport of photoexcited electrons and holes, respectively, while minimizing efficiency-degrading charge recombination. On the other hand, CH 3NH 3more » sublattice quickly screens out electrostatic electron-hole attraction to generate free carriers within 1 ps. Together this nano-architecture lets photoexcited electrons and holes dissociate instantaneously and travel far away to be harvested before dissipated as heat. As a result, this work provides much needed structure-property relationships and time-resolved information that potentially lead to rational design of efficient solar cells.« less
Miller, A; Schmidt, G; Eibl, H; Knoll, W
1985-03-14
Voltage jump-current relaxation studies have been performed with dipicrylamine-doped black membranes of binary lipid mixtures. As in the case of the carrier-mediated ion transport (Schmidt, G., Eibl, H. and Knoll, W. (1982) J. Membrane Biol. 70, 147-155) no evidence was found that the neutral lipid phosphatidylcholine (DPMPC) and the charged phosphatidic acid (DPMPA) are heterogeneously distributed in the membrane over the whole range of composition. However, besides a continuous dilution of the surface charges of DPMPA by the addition of DPMPC molecules, different structural properties of mixed membranes influence the kinetics of the dipicrylamine transport. The addition of Ca2+ to the electrolyte induces a lipid phase separation within the membrane into two fluid phases of distinctly different characteristics of the translocation of hydrophobic ions. Thus, it is possible to determine a preliminary composition phase diagram for the DPMPA/DPMPC mixtures as a function of the Ca2+ concentration.
NASA Astrophysics Data System (ADS)
Rathore, Priyanka; Mohan Singh Negi, Chandra; Singh Verma, Ajay; Singh, Amarjeet; Chauhan, Gayatri; Regis Inigo, Anto; Gupta, Saral K.
2017-08-01
Devices comprised of solution-processed poly (3-hexylthiophene) (P3HT)/multiwall carbon nanotubes (MWCNTs), with various concentrations of MWCNTs, were fabricated and characterized. The morphology of the P3HT: MWCNT nanocomposite was characterized by using field emission scanning electron microscopy (FESEM). The optical characteristics of the nanocomposite were studied by UV/VIS/NIR spectroscopy and Raman spectroscopy. The electrical properties of the fabricated devices were characterized by measuring the current density-voltage (J-V) characteristics. While the J-V characteristics of a pristine P3HT device reveal thermal injection limited charge transport, the P3HT: MWCNT nanocomposite-based devices exhibit three distinct voltage-dependent conduction regimes. The fitting curve with measured data reveals Ohmic conduction for a low voltage range, a trap-charge limited conduction (TCLC) process at an intermediate voltage range followed by a trap free space-charge limited conduction (SCLC) process at much higher voltages. A fundamental understanding of this work can assist in creating new charge transport pathways which will provide new avenues for the development of highly efficient polymer-based optoelectronic devices.
Understanding the Unique Properties of Organometal Trihalide Perovskite with Single Crystals
NASA Astrophysics Data System (ADS)
Huang, Jinsong
Organometal Trihalide Perovskite has been discovered to be all-round optoelectronic materials many types of electronic devices. The understanding of this family of materials is however limited yet due to the complicated grain structures in polycrystalline films which are generally used in most of the devices. In this contribution, I will present our recent progress in understanding the fundamental properties, including optoelectronic properties and electromechanical properties, using the high quality organometal trihalide perovskite single crystals. I will report the crystallographic orientation dependent charge transport and collection, surface and bulk charge recombination process, and direction measuring of carrier diffusion length using the lasing induced photocurrent scanning. The polarity of the organometal trihalide perovskite crystals will also be examined. We thank financial support from SunShot Initiative at Department of Energy under Award DE-EE0006709, and from National Science Foundation Grant DMR-1505535 and Grant DMR-1420645, and from Office of Naval Research under Award N00014-15-1-2713.
Charge transport properties in CdZnTe detectors grown by the vertical Bridgman technique
DOE Office of Scientific and Technical Information (OSTI.GOV)
Auricchio, N.; Caroli, E.; Marchini, L.
2011-12-15
Presently, a great amount of effort is being devoted to the development of CdTe and CdZnTe (CZT) detectors for a large variety of applications such as medical, industrial, and space research. We present the spectroscopic properties of some CZT crystals grown by the standard vertical Bridgman method and by the boron oxide encapsulated vertical Bridgman method, which has been recently implemented at IMEM-CNR (Parma, Italy). In this technique, the crystal is grown in an open quartz crucible fully encapsulated by a thin layer of liquid boron oxide. This method prevents contact between the crystal and the crucible, thereby allowing largermore » single grains with a lower dislocation density to be obtained. Several mono-electrode detectors were realized, with each having two planar gold contacts. The samples are characterized by an active area of about 7 mm x 7 mm and thicknesses ranging from 1 to 2 mm. The charge transport properties of the detectors have been studied by mobility-lifetime ({mu} x {tau}) product measurements, carried out at the European Synchrotron Radiation Facility (Grenoble, France) in the planar transverse field configuration, where the impinging beam direction is orthogonal to the collecting electric field. We have performed several fine scans between the electrodes with a beam spot of 10 {mu}m x 10 {mu}m at various energies from 60 to 400 keV. In this work, we present the test results in terms of the ({mu} x {tau}) product of both charge carriers.« less
Wang, Kun; Bießmann, Lorenz; Schwartzkopf, Matthias; Roth, Stephan V; Müller-Buschbaum, Peter
2018-06-20
The self-assembly of amphiphilic diblock copolymers yields the possibility of using them as a template for tailoring the film morphologies of sol-gel chemistry-derived inorganic electron transport materials, such as mesoporous ZnO and TiO 2 . However, additional steps including etching and backfilling are required for the common bulk heterojunction fabrication process when using insulating diblock copolymers. Here, we use the conducting diblock copolymer poly(3-hexylthiophene)- block-poly(ethylene oxide) (P3HT- b-PEO) in which P3HT acts as charge carrier transport material and light absorber, whereas PEO serves as a template for ZnO synthesis. The initial solution is subsequently spray-coated to obtain the hybrid film. Scanning electron microscopy and grazing-incidence small-angle X-ray scattering measurements reveal a significant change in the morphology of the hybrid films during deposition. Optoelectronic properties illustrate the improved charge separation and charge transfer process. Both the amount of the diblock copolymer and the annealing temperature play an important role in tuning the morphology and the optoelectronic properties. Hybrid films being sprayed from a solution with the ratio of ω ZnO , ω P3HT , and ω P3HT- b-PEO of 2:1:1 and subsequent annealing at 80 °C show the most promising morphology combined with an optimal photoluminescence quenching. Thus, the presented simple, reagent- and energy-saving fabrication method provides a promising approach for a large-scale preparation of bulk heterojunction P3HT/ZnO films on flexible substrates.
47 CFR 69.125 - Dedicated signalling transport.
Code of Federal Regulations, 2010 CFR
2010-10-01
... 47 Telecommunication 3 2010-10-01 2010-10-01 false Dedicated signalling transport. 69.125 Section... (CONTINUED) ACCESS CHARGES Computation of Charges § 69.125 Dedicated signalling transport. (a) Dedicated signalling transport shall consist of two elements, a signalling link charge and a signalling transfer point...
47 CFR 69.125 - Dedicated signalling transport.
Code of Federal Regulations, 2011 CFR
2011-10-01
... 47 Telecommunication 3 2011-10-01 2011-10-01 false Dedicated signalling transport. 69.125 Section... (CONTINUED) ACCESS CHARGES Computation of Charges § 69.125 Dedicated signalling transport. (a) Dedicated signalling transport shall consist of two elements, a signalling link charge and a signalling transfer point...
49 CFR 91.7 - Determination of compensatory charges.
Code of Federal Regulations, 2010 CFR
2010-10-01
... 49 Transportation 1 2010-10-01 2010-10-01 false Determination of compensatory charges. 91.7 Section 91.7 Transportation Office of the Secretary of Transportation INTERNATIONAL AIR TRANSPORTATION FAIR COMPETITIVE PRACTICES § 91.7 Determination of compensatory charges. (a) Upon indication by the...
47 CFR 69.125 - Dedicated signalling transport.
Code of Federal Regulations, 2012 CFR
2012-10-01
... 47 Telecommunication 3 2012-10-01 2012-10-01 false Dedicated signalling transport. 69.125 Section... (CONTINUED) ACCESS CHARGES Computation of Charges § 69.125 Dedicated signalling transport. (a) Dedicated signalling transport shall consist of two elements, a signalling link charge and a signalling transfer point...
47 CFR 69.125 - Dedicated signalling transport.
Code of Federal Regulations, 2013 CFR
2013-10-01
... 47 Telecommunication 3 2013-10-01 2013-10-01 false Dedicated signalling transport. 69.125 Section... (CONTINUED) ACCESS CHARGES Computation of Charges § 69.125 Dedicated signalling transport. (a) Dedicated signalling transport shall consist of two elements, a signalling link charge and a signalling transfer point...
Uba, Franklin I.; Pullagurla, Swathi R.; Sirasunthorn, Nichanun; Wu, Jiahao; Park, Sunggook; Chantiwas, Rattikan; Cho, Yoonkyoung; Shin, Heungjoo; Soper, Steven A.
2014-01-01
Thermoplastics have become attractive alternatives to glass/quartz for microfluidics, but the realization of thermoplastic nanofluidic devices has been slow in spite of the rather simple fabrication techniques that can be used to produce these devices. This slow transition has in part been attributed to insufficient understanding of surface charge effects on the transport properties of single molecules through thermoplastic nanochannels. We report the surface modification of thermoplastic nanochannels and an assessment of the associated surface charge density, zeta potential and electroosmotic flow (EOF). Mixed-scale fluidic networks were fabricated in poly(methylmethacrylate), PMMA. Oxygen plasma was used to generate surface-confined carboxylic acids with devices assembled using low temperature fusion bonding. Amination of the carboxylated surfaces using ethylenediamine (EDA) was accomplished via EDC coupling. XPS and ATR-FTIR revealed the presence of carboxyl and amine groups on the appropriately prepared surfaces. A modified conductance equation for nanochannels was developed to determine their surface conductance and was found to be in good agreement with our experimental results. The measured surface charge density and zeta potential of these devices were lower than glass nanofluidic devices and dependent on the surface modification adopted, as well as the size of the channel. This property, coupled to an apparent increase in fluid viscosity due to nanoconfinement, contributed to the suppression of the EOF in PMMA nanofluidic devices by an order of magnitude compared to the micro-scale devices. Carboxylated PMMA nanochannels were efficient for the transport and elongation of λ-DNA while these same DNA molecules were unable to translocate through aminated nanochannels. PMID:25369728
DOE Office of Scientific and Technical Information (OSTI.GOV)
Aloui, Walid, E-mail: alouiwalid26@yahoo.fr; Adhikari, Tham; Nunzi, Jean-Michel
2016-06-15
Highlights: • A typical structure of ITO/PEDOT: PSS/P3HT: PC{sub 70}BM/Al was fabricated. • Charge carrier diffusion and recombination have been calculated. • AFM and optical results show that thermal annealing promotes the phase separation. • The annealing process improves the transport of charges. - Abstract: The effect of thermal annealing on the optical, structural and the dielectric properties of P3HT:PC{sub 70}BM blended films were investigated. By means of atomic force microscopy, we observed the morphology evolution of the annealed P3HT:PC{sub 70}BM nanocomposites. Raman spectroscopy showed a substantial ordering in the polymer film after annealing. The absorption spectra of the annealedmore » P3HT:PC{sub 70}BM films were improved and red shifted than un-annealed samples. The results indicate that the P3HT in the nanocomposite becomes an ordered structure with annealing. The ordered P3HT facilitates the charge transport. From the photoluminescence measurements, the formation of polymer crystallites was observed upon annealing. Thus, the device efficiency reaches 2.2% after annealing at 150 °C. Impedance spectroscopy shows the classical complex plan curves; the low frequency is related to the effective lifetime of charge carriers and the high frequency corresponds to the diffusion time of these carriers. Global mobilities are in the range 3.8–4.6 × 10{sup −3} cm{sup 2} V{sup −1} s{sup −1}.« less
Uba, Franklin I; Pullagurla, Swathi R; Sirasunthorn, Nichanun; Wu, Jiahao; Park, Sunggook; Chantiwas, Rattikan; Cho, Yoon-Kyoung; Shin, Heungjoo; Soper, Steven A
2015-01-07
Thermoplastics have become attractive alternatives to glass/quartz for microfluidics, but the realization of thermoplastic nanofluidic devices has been slow in spite of the rather simple fabrication techniques that can be used to produce these devices. This slow transition has in part been attributed to insufficient understanding of surface charge effects on the transport properties of single molecules through thermoplastic nanochannels. We report the surface modification of thermoplastic nanochannels and an assessment of the associated surface charge density, zeta potential and electroosmotic flow (EOF). Mixed-scale fluidic networks were fabricated in poly(methylmethacrylate), PMMA. Oxygen plasma was used to generate surface-confined carboxylic acids with devices assembled using low temperature fusion bonding. Amination of the carboxylated surfaces using ethylenediamine (EDA) was accomplished via EDC coupling. XPS and ATR-FTIR revealed the presence of carboxyl and amine groups on the appropriately prepared surfaces. A modified conductance equation for nanochannels was developed to determine their surface conductance and was found to be in good agreement with our experimental results. The measured surface charge density and zeta potential of these devices were lower than glass nanofluidic devices and dependent on the surface modification adopted, as well as the size of the channel. This property, coupled to an apparent increase in fluid viscosity due to nanoconfinement, contributed to the suppression of the EOF in PMMA nanofluidic devices by an order of magnitude compared to the micro-scale devices. Carboxylated PMMA nanochannels were efficient for the transport and elongation of λ-DNA while these same DNA molecules were unable to translocate through aminated nanochannels.
NASA Astrophysics Data System (ADS)
Huang, Ling; Ma, Chun-Wang; Ma, Guo-Liang
2018-03-01
Because the properties of the QCD phase transition and the chiral magnetic effect (CME) depend on the number of quark flavors (Nf) and quark mass, relativistic heavy-ion collisions provide a natural environment to investigate the flavor features if quark deconfinement occurs. We introduce an initial two-flavor or three-flavor dipole charge separation into a multiphase transport (AMPT) model to investigate the flavor dependence of the CME. By taking advantage of the recent ALICE data of charge azimuthal correlations with identified hadrons, we attempt to disentangle two-flavor and three-flavor CME scenarios in Pb+Pb collisions at 2.76 TeV. We find that the experimental data show a certain potential to distinguish the two scenarios, therefore we further suggest to collect more data to clarify the possible flavor dependence in future experiments.
DOE Office of Scientific and Technical Information (OSTI.GOV)
S Kim; M Jang; H Yang
2011-12-31
Organic field-effect transistors (OFETs) are fabricated by depositing a thin film of semiconductor on the functionalized surface of a SiO{sub 2} dielectric. The chemical and morphological structures of the interface between the semiconductor and the functionalized dielectric are critical for OFET performance. We have characterized the effect of the affinity between semiconductor and functionalized dielectric on the properties of the semiconductor-dielectric interface. The crystalline microstructure/nanostructure of the pentacene semiconductor layers, grown on a dielectric substrate that had been functionalized with either poly(4-vinyl pyridine) or polystyrene (to control hydrophobicity), and grown under a series of substrate temperatures and deposition rates, weremore » characterized by X-ray diffraction, photoemission spectroscopy, and atomic force microscopy. By comparing the morphological features of the semiconductor thin films with the device characteristics (field-effect mobility, threshold voltage, and hysteresis) of the OFET devices, the effect of affinity-driven properties on charge modulation, charge trapping, and charge carrier transport could be described.« less
Baiutti, F.; Logvenov, G.; Gregori, G.; Cristiani, G.; Wang, Y.; Sigle, W.; van Aken, P. A.; Maier, J.
2015-01-01
The exploitation of interface effects turned out to be a powerful tool for generating exciting material properties. Such properties include magnetism, electronic and ionic transport and even superconductivity. Here, instead of using conventional homogeneous doping to enhance the hole concentration in lanthanum cuprate and achieve superconductivity, we replace single LaO planes with SrO dopant planes using atomic-layer-by-layer molecular beam epitaxy (two-dimensional doping). Electron spectroscopy and microscopy, conductivity measurements and zinc tomography reveal such negatively charged interfaces to induce layer-dependent superconductivity (Tc up to 35 K) in the space-charge zone at the side of the planes facing the substrate, where the strontium (Sr) profile is abrupt. Owing to the growth conditions, the other side exhibits instead a Sr redistribution resulting in superconductivity due to conventional doping. The present study represents a successful example of two-dimensional doping of superconducting oxide systems and demonstrates its power in this field. PMID:26481902
Pentacene Schottky diodes studied by impedance spectroscopy: Doping properties and trap response
NASA Astrophysics Data System (ADS)
Pahner, Paul; Kleemann, Hans; Burtone, Lorenzo; Tietze, Max L.; Fischer, Janine; Leo, Karl; Lüssem, Björn
2013-11-01
We study doping properties and charge carrier trap distributions in pentacene Schottky diodes doped by the fluorinated fullerene derivate C60F36 and 2,2'-(perdiylidene)dimalononitrile (F6-TCNNQ) upon small signal excitation. We show that the charge carrier depletion zones present in these Schottky diodes are tunable by the applied bias and temperature. Mott-Schottky evaluations yield reduced doping efficiencies and dopant activation energies between 19 and 54 meV. In the low-frequency regime, we resolve additional capacitive contributions from inherent charge carrier traps. A Gaussian distributed trap center 0.6 eV above the hole transport level with a density in the range of 1016 cm-3 depending on the material purity is found to be an intrinsic feature of the pentacene matrix. Upon doping, the deep Gaussian trap center saturates in density and broad exponentially tailing trap distributions arise. Subsequent ultraviolet photoelectron spectroscopy measurements are conducted to inspect for energetic broadening due to doping.
A model and simulation of fast space charge pulses in polymers
NASA Astrophysics Data System (ADS)
Lv, Zepeng; Rowland, Simon M.; Wu, Kai
2017-11-01
The transport of space charge packets across polyethylene and epoxy resin in high electric fields has been characterized as fast or slow depending on packet mobility. Several explanations for the formation and transport of slow space charge packets have been proposed, but the origins of fast space charge pulses, with mobilities above 10-11 m2 V-1 s-1, are unclear. In one suggested model, it is assumed that the formation of fast charge pulses is due to discontinuous electromechanical compression and charge injection at the electrode-insulation interface, and their transport is related to corresponding relaxation processes. In that model, charges travel as a pulse because of group polarization. This paper provides an alternative model based on the reduction of charge carrier activation energy due to charge density triggered polymer chain movement and subsequent chain relaxation times. The generation and transport of fast charge pulses are readily simulated by a bipolar charge transport model with three additional parameters: reduced activation energy, charge density threshold, and chain relaxation time. Such a model is shown to reproduce key features of fast space charge pulses including speed, duration, repetition rate and pulse size. This model provides the basis for a deep understanding of the physical origins of fast space charge pulses in polymers.
Nonintrinsic origin of the colossal dielectric constants in Ca Cu3 Ti4 O12
NASA Astrophysics Data System (ADS)
Lunkenheimer, P.; Fichtl, R.; Ebbinghaus, S. G.; Loidl, A.
2004-11-01
The dielectric properties of CaCu3Ti4O12 , a material showing colossal values of the dielectric constant, were investigated over a broad temperature and frequency range extending up to 1.3GHz . A detailed equivalent-circuit analysis of the results and two crucial experiments, employing different types of contacts and varying the sample thickness were performed. The results provide clear evidence that the apparently high values of the dielectric constant in CaCu3Ti4O12 are nonintrinsic and due to electrode polarization effects. The intrinsic properties of CaCu3Ti4O12 are characterized by charge transport via hopping of localized charge carriers and a relatively high dielectric constant of the order of 100.
Electrostatic modulation of the electronic properties of Dirac semimetal Na3Bi thin films
NASA Astrophysics Data System (ADS)
Hellerstedt, Jack; Yudhistira, Indra; Edmonds, Mark T.; Liu, Chang; Collins, James; Adam, Shaffique; Fuhrer, Michael S.
2017-10-01
Large-area thin films of topological Dirac semimetal Na3Bi are grown on amorphous SiO2:Si substrates to realize a field-effect transistor with the doped Si acting as a back gate. As-grown films show charge carrier mobilities exceeding 7 000 cm2/V s and carrier densities below 3 ×1018cm-3 , comparable to the best thin-film Na3Bi . An ambipolar field effect and minimum conductivity are observed, characteristic of Dirac electronic systems. The results are quantitatively understood within a model of disorder-induced charge inhomogeneity in topological Dirac semimetals. The hole mobility is significantly larger than the electron mobility in Na3Bi which we ascribe to the inverted band structure. When present, these holes dominate the transport properties.
Methods for producing thin film charge selective transport layers
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hammond, Scott Ryan; Olson, Dana C.; van Hest, Marinus Franciscus Antonius Maria
Methods for producing thin film charge selective transport layers are provided. In one embodiment, a method for forming a thin film charge selective transport layer comprises: providing a precursor solution comprising a metal containing reactive precursor material dissolved into a complexing solvent; depositing the precursor solution onto a surface of a substrate to form a film; and forming a charge selective transport layer on the substrate by annealing the film.
NASA Astrophysics Data System (ADS)
Carl, D. A.; Hess, D. W.; Lieberman, M. A.; Nguyen, T. D.; Gronsky, R.
1991-09-01
Thin (3-300-nm) oxides were grown on single-crystal silicon substrates at temperatures from 523 to 673 K in a low-pressure electron cyclotron resonance (ECR) oxygen plasma. Oxides were grown under floating, anodic or cathodic bias conditions, although only the oxides grown under floating or anodic bias conditions are acceptable for use as gate dielectrics in metal-oxide-semiconductor technology. Oxide thickness uniformity as measured by ellipsometry decreased with increasing oxidation time for all bias conditions. Oxidation kinetics under anodic conditions can be explained by negatively charged atomic oxygen, O-, transport limited growth. Constant current anodizations yielded three regions of growth: (1) a concentration gradient dominated regime for oxides thinner than 10 nm, (2) a field dominated regime with ohmic charged oxidant transport for oxide thickness in the range of 10 nm to approximately 100 nm, and (3) a space-charge limited regime for films thicker than approximately 100 nm. The relationship between oxide thickness (xox), overall potential drop (Vox) and ion current (ji) in the space-charge limited transport region was of the form: ji ∝ V2ox/x3ox. Transmission electron microscopy analysis of 5-60-nm-thick anodized films indicated that the silicon-silicon dioxide interface was indistinguishable from that of thermal oxides grown at 1123 K. High-frequency capacitance-voltage (C-V) and ramped bias current-voltage (I-V) studies performed on 5.4-30-nm gate thickness capacitors indicated that the as-grown ECR films had high levels of fixed oxide charge (≳1011 cm-2) and interface traps (≳1012 cm-2 eV-1). The fixed charge level could be reduced to ≊4×1010 cm-2 by a 20 min polysilicon gate activation anneal at 1123 K in nitrogen; the interface trap density at mid-band gap decreased to ≊(1-2)×1011 cm-2 eV-1 after this process. The mean breakdown strength for anodic oxides grown under optimum conditions was 10.87±0.83 MV cm-1. Electrical properties of the 5.4-8-nm gates compared well with thicker films and control dry thermal oxides of similar thicknesses.
A physics-based model of the electrical impedance of ionic polymer metal composites
NASA Astrophysics Data System (ADS)
Cha, Youngsu; Aureli, Matteo; Porfiri, Maurizio
2012-06-01
In this paper, we analyze the chemoelectrical behavior of ionic polymer metal composites (IPMCs) in the small voltage range with a novel hypothesis on the charge dynamics in proximity of the electrodes. In particular, we homogenize the microscopic properties of the interfacial region through a so-called composite layer which extends between the polymer membrane and the metal electrode. This layer accounts for the dissimilar properties of its constituents by describing the charge distribution via two species of charge carriers, that is, electrons and mobile counterions. We model the charge dynamics in the IPMC by adapting the multiphysics formulation based on the Poisson-Nernst-Planck (PNP) framework, which is enriched through an additional term to capture the electron transport in the composite layer. Under the hypothesis of small voltage input, we use the linearized PNP model to derive an equivalent IPMC circuit model with lumped elements. The equivalent model comprises a resistor connected in series with the parallel of a capacitor and a Warburg impedance element. These elements idealize the phenomena of charge build up in the double layer region and the faradaic impedance related to mass transfer, respectively. We validate the equivalent model through measurements on in-house fabricated samples addressing both IPMC step response and impedance, while assessing the influence of repeated plating cycles on the electrical properties of IPMCs. Experimental results are compared with theoretical findings to identify the equivalent circuit parameters. Findings from this study are compared with alternative impedance models proposed in the literature.
19 CFR 351.515 - Internal transport and freight charges for export shipments.
Code of Federal Regulations, 2010 CFR
2010-04-01
... shipments. 351.515 Section 351.515 Customs Duties INTERNATIONAL TRADE ADMINISTRATION, DEPARTMENT OF COMMERCE... Internal transport and freight charges for export shipments. (a) Benefit—(1) In general. In the case of internal transport and freight charges on export shipments, a benefit exists to the extent that the charges...
NASA Astrophysics Data System (ADS)
Wu, Yihong; Wang, Haomin; Choong, Catherine
2011-01-01
We report on a systematic electrical transport study of carbon nanowalls using both the normal metal and superconducting electrodes. The nonlinear transport and corresponding anomalous dI/dV versus bias curves below ˜2 K observed in samples with both Ti and Nb electrodes is accounted for by the formation of charge density waves due to enhanced density of states at the Fermi level at edges or extended defects. This phase competes with superconducting instability at very low temperature, as manifested by distinctive resistance-temperature behaviors and associated dV/dI characteristics observed in different samples.
NASA Astrophysics Data System (ADS)
Kondracki, Łukasz; Kulka, Andrzej; Świerczek, Konrad; Ziąbka, Magdalena; Molenda, Janina
2017-11-01
In this work a detailed operando XRD investigations of structural properties of LixMn2O4 manganese spinel are shown to be a complementary, successful method of determination of diffusion coefficient D and surface exchange coefficient k in the working electrode. Kinetics of lithium ions transport are estimated on the basis of rate of structural changes of the cathode material during a relaxation stage after a high current charge, i.e. during structural relaxation of the material. The presented approach seems to be applicable as a complementary method of determination of transport coefficients for all intercalation-type electrode materials.
Graphene-ferromagnet interfaces: hybridization, magnetization and charge transfer.
Abtew, Tesfaye; Shih, Bi-Ching; Banerjee, Sarbajit; Zhang, Peihong
2013-03-07
Electronic and magnetic properties of graphene-ferromagnet interfaces are investigated using first-principles electronic structure methods in which a single layer graphene is adsorbed on Ni(111) and Co(111) surfaces. Due to the symmetry matching and orbital overlap, the hybridization between graphene pπ and Ni (or Co) d(z(2)) states is very strong. This pd hybridization, which is both spin and k dependent, greatly affects the electronic and magnetic properties of the interface, resulting in a significantly reduced (by about 20% for Ni and 10% for Co) local magnetic moment of the top ferromagnetic layer at the interface and an induced spin polarization on the graphene layer. The calculated induced magnetic moment on the graphene layer agrees well with a recent experiment. In addition, a substantial charge transfer across the graphene-ferromagnet interfaces is observed. We also investigate the effects of thickness of the ferromagnet slab on the calculated electronic and magnetic properties of the interface. The strength of the pd hybridization and the thickness-dependent interfacial properties may be exploited to design structures with desirable magnetic and transport properties for spintronic applications.
Variation in the electrical properties of ion beam irradiated cadmium selenate nanowires
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chauhan, R. P., E-mail: chauhanrpc@gmail.com; Narula, Chetna; Panchal, Suresh
The key feature of nanowires consists in the pronounced change in properties induced by the low dimensionality and high surface to volume ratio. The study of electrical transport properties of nanowires is important for electronic device applications. Energetic ions create changes, which may be structural or chemical, in a material along their track and these changes might alter the material’s properties. The demand of the modern technology is to understand the effect of radiation on the different properties of the material for its further applications. The present study is on the high-energy Nickel ion beam (160 MeV Ni{sup +12}) induced modificationsmore » in the electrical and structural properties of the cadmium selenate nanowires. An enhancement in the electrical conductivity of irradiated wires was observed as the ion fluence was increased especially in the forward I–V characteristics. The creation of defects by ion irradiation and the synergy of the ions during their passage in the sample with the intrinsic charge carriers may be responsible for the variation in the transport properties of the irradiated nanowires.« less
Sensing Coulomb impurities with 1/f noise in 3D Topological Insulator
NASA Astrophysics Data System (ADS)
Bhattacharyya, Semonti; Banerjee, Mitali; Nhalil, Hariharan; Elizabeth, Suja; Ghosh, Arindam
2015-03-01
Electrical transport in the non-trivial surface states of bulk Topological Insulator (TI) reveal several intriguing properties ranging from bipolar field effect transistor action, weak antilocalization in quantum transport, to the recently discovered quantum anomalous Hall effect. Many of these phenomena depend crucially on the nature of disorder and its screening by the Dirac Fermions at the TI surface. We have carried out a systematic study of low-frequency 1/f noise in Bi1.6Sb0.4Te2Se1 single crystals, to explore the dominant source of scattering of surface electrons and monitor relative contributions of the surface and bulk channels. Our results reveal that while trapped coulomb impurities at the substrate-TI interface are dominating source of scattering for thin (10 nm) TI, charged crystal disorder contribute strongly in thick TI (110 nm) channels. An unexpected maximum at 25K in noise from thick TI devices indicate scattering of the surface states by a cooperative charge dynamics in the bulk of the TI, possibly associated with the Selenium vacancies. Our experiment demonstrates, for the first time, impact of the bulk charge distribution on the surface state transport in TIs that could be crucial to the implementation of these materials in electronic applications.
Gong, Youpin; Liu, Qingfeng; Wilt, Jamie Samantha; Gong, Maogang; Ren, Shenqiang; Wu, Judy
2015-01-01
Biomolecule cytochrome c (Cty c), a small molecule of a chain of amino acids with extraordinary electron transport, was helically wrapped around a semiconductive single-wall carbon nanotube (s-SWCNT) to form a molecular building block for uncooled infrared detection with two uniquely designed functionalities: exciton dissociation to free charge carriers at the heterojunction formed on the s-SWCNT/Cty c interface and charge transport along the electron conducting chain of Cty c (acceptor) and hole conducting channel through s-SWCNT (donor). Such a design aims at addressing the long-standing challenges in exciton dissociation and charge transport in an SWCNT network, which have bottlenecked development of photonic SWCNT-based infrared detectors. Using these building blocks, uncooled s-SWCNT/Cyt c thin film infrared detectors were synthesized and shown to have extraordinary photoresponsivity up to 0.77 A W−1 due to a high external quantum efficiency (EQE) in exceeding 90%, which represents a more than two orders of magnitude enhancement than the best previously reported on CNT-based infrared detectors with EQE of only 1.72%. From a broad perspective, this work on novel s-SWCNT/Cyt c nanohybrid infrared detectors has developed a successful platform of engineered carbon nanotube/biomolecule building blocks with superior properties for optoelectronic applications. PMID:26066737
Gong, Youpin; Liu, Qingfeng; Wilt, Jamie Samantha; Gong, Maogang; Ren, Shenqiang; Wu, Judy
2015-06-11
Biomolecule cytochrome c (Cty c), a small molecule of a chain of amino acids with extraordinary electron transport, was helically wrapped around a semiconductive single-wall carbon nanotube (s-SWCNT) to form a molecular building block for uncooled infrared detection with two uniquely designed functionalities: exciton dissociation to free charge carriers at the heterojunction formed on the s-SWCNT/Cty c interface and charge transport along the electron conducting chain of Cty c (acceptor) and hole conducting channel through s-SWCNT (donor). Such a design aims at addressing the long-standing challenges in exciton dissociation and charge transport in an SWCNT network, which have bottlenecked development of photonic SWCNT-based infrared detectors. Using these building blocks, uncooled s-SWCNT/Cyt c thin film infrared detectors were synthesized and shown to have extraordinary photoresponsivity up to 0.77 A W(-1) due to a high external quantum efficiency (EQE) in exceeding 90%, which represents a more than two orders of magnitude enhancement than the best previously reported on CNT-based infrared detectors with EQE of only 1.72%. From a broad perspective, this work on novel s-SWCNT/Cyt c nanohybrid infrared detectors has developed a successful platform of engineered carbon nanotube/biomolecule building blocks with superior properties for optoelectronic applications.
Metrology and Transport of Multiply Charged Ions
NASA Astrophysics Data System (ADS)
Kulkarni, Dhruva
The transport and interaction of singly- and multiply-charged ions with matter has been studied. The experiments were performed in an ultra-high vacuum environment. The low- and hyperthermal-energy ion beamline was used as a source of singly charged ions, while the CUEBIT facility was used as a source of multiply charged ions. The kinetic energy of the ion beam obtained from the CUEBIT is offset from the nominal value expected from the applied electrostatic potentials. These offsets were studied by measuring the kinetic energy of the beam using a retarding field analyzer (RFA). The offset was attributed to the space charge of the electron beam that is used to create the multiply charged ions. The charge density of the electron beam was varied by changing operational parameters of the electron beam, namely the electron beam current and the energy of the electron beam. Ion beams of Ar4+ and Ar8+ were extracted from the source and the offsets observed in the kinetic energy were related to the variation in the space charge potential of the electron beam. Measurements of these offsets, ranging from 100 eV/Q to 300 eV/Q, are significant and important for experiments that aim to utilize the potential energy of slow multiply charged ions. The transport of ions using capillaries has been studied to investigate the viability of ion-guiding as a means for a novel ion delivery mechanism. Results on transport through large bore capillaries (macrocapillaries) that probe both the geometric and ionguided mechanisms are presented. The angle- and position-dependent transport properties were found to depend on the material of the capillary (specifically, whether metal or insulator) and the geometry of the capillary. Rb+ ions at a kinetic energy of 1 keV were transmitted through metal and glass capillaries that were a few centimeters in length and a few millimeters in diameter. Oscillations were observed in the capillaries made of glass which were absent in the metal capillaries. Calculations based on the geometry of the experimental setup and kinematics of the ions showed that these oscillations could be attributed to the charge patches formed on the capillary walls. Electronic excitations in solids due to energetic ions at low kinetic energy were measured by using Schottky diodes. Hot electron currents measured at the backside of an Ag/n-Si Schottky diode due to ion bombardment on the frontside were found to depend on the kinetic energy (500 eV to 1500 eV) and angle of incidence (+/-30°) of the ion (Rb+) beam. A sharp upturn in the energy dependent yield is consistent with a kinetic emission model for electronic excitations utilizing the device Schottky barrier as determined from current-voltage characteristics. Backside currents measured for ion incident angle are strongly peaked about normal incidence. Accounting for the increased transport distance for excited charges at non-normal incidence, the mean free path for electrons in silver was found to be 5.2 +/- 1.4 nm, which is consistent with values reported in the literature.
Predictive study of charge transport in disordered semiconducting polymers.
Athanasopoulos, Stavros; Kirkpatrick, James; Martínez, Diego; Frost, Jarvist M; Foden, Clare M; Walker, Alison B; Nelson, Jenny
2007-06-01
We present a theoretical study of charge transport in disordered semiconducting polymers that relates the charge mobility to the chemical structure and the physical morphology in a novel multiscale approach. Our studies, focusing on poly(9,9-dioctylfluorene) (PFO), show that the charge mobility is dominated by pathways with the highest interchain charge-transfer rates. We also find that disorder is not always detrimental to charge transport. We find good agreement with experimental time-of-flight mobility data in highly aligned PFO films.
Deng, Rigui; Su, Xianli; Zheng, Zheng; Liu, Wei; Yan, Yonggao; Zhang, Qingjie; Dravid, Vinayak P; Uher, Ctirad; Kanatzidis, Mercouri G; Tang, Xinfeng
2018-06-01
Several prominent mechanisms for reduction in thermal conductivity have been shown in recent years to improve the figure of merit for thermoelectric materials. Such a mechanism is a hierarchical all-length-scale architecturing that recognizes the role of all microstructure elements, from atomic to nano to microscales, in reducing (lattice) thermal conductivity. In this context, there have been recent claims of remarkably low (lattice) thermal conductivity in Bi 0.5 Sb 1.5 Te 3 that are attributed to seemingly ordinary grain boundary dislocation networks. These high densities of dislocation networks in Bi 0.5 Sb 1.5 Te 3 were generated via unconventional materials processing with excess Te (which formed liquid phase, thereby facilitating sintering), followed by spark plasma sintering under pressure to squeeze out the liquid. We reproduced a practically identical microstructure, following practically identical processing strategies, but with noticeably different (higher) thermal conductivity than that claimed before. We show that the resultant microstructure is anisotropic, with notable difference of thermal and charge transport properties across and along two orthonormal directions, analogous to anisotropic crystals. Thus, we believe that grain boundary dislocation networks are not the primary cause of enhanced ZT through reduction in thermal conductivity. Instead, we can reproduce the purported high ZT through a favorable but impractical and incorrect combination of thermal conductivity measured along the pressing direction of anisotropy while charge transport measured in the direction perpendicular to the anisotropic direction. We believe that our work underscores the need for consistency in charge and thermal transport measurements for unified and verifiable measurements of thermoelectric (and related) properties and phenomena.
Spin transport in oxygen adsorbed graphene nanoribbon
NASA Astrophysics Data System (ADS)
Kumar, Vipin
2018-04-01
The spin transport properties of pristine graphene nanoribbons (GNRs) have been most widely studied using theoretical and experimental tools. The possibilities of oxidation of fabricated graphene based nano electronic devices may change the device characteristics, which motivates to further explore the properties of graphene oxide nanoribbons (GONRs). Therefore, we present a systematic computational study on the spin polarized transport in surface oxidized GNR in antiferromagnetic (AFM) spin configuration using density functional theory combined with non-equilibrium Green's function (NEGF) method. It is found that the conductance in oxidized GNRs is significantly suppressed in the valance band and the conduction band. A further reduction in the conductance profile is seen in presence of two oxygen atoms on the ribbon plane. This change in the conductance may be attributed to change in the surface topology of the ribbon basal plane due to presence of the oxygen adatoms, where the charge transfer take place between the ribbon basal plane and the oxygen atoms.
Asymmetries in the spectral density of an interaction-quenched Luttinger liquid
NASA Astrophysics Data System (ADS)
Calzona, A.; Gambetta, F. M.; Carrega, M.; Cavaliere, F.; Sassetti, M.
2018-03-01
The spectral density of an interaction-quenched one-dimensional system is investigated. Both direct and inverse quench protocols are considered and it is found that the former leads to stronger effects on the spectral density with respect to the latter. Such asymmetry is directly reflected on transport properties of the system, namely the charge and energy current flowing to the system from a tunnel coupled biased probe. In particular, the injection of particles from the probe to the right-moving channel of the system is considered. The resulting fractionalization phenomena are strongly affected by the quench protocol and display asymmetries in the case of direct and inverse quench. Transport properties therefore emerge as natural probes for the observation of this quench-induced behavior.
Wang, Dengjun; Bradford, Scott A; Harvey, Ronald W; Gao, Bin; Cang, Long; Zhou, Dongmei
2012-03-06
Hydroxyapatite nanoparticles (nHAP) have been widely used to remediate soil and wastewater contaminated with metals and radionuclides. However, our understanding of nHAP transport and fate is limited in natural environments that exhibit significant variability in solid and solution chemistry. The transport and retention kinetics of Alizarin red S (ARS)-labeled nHAP were investigated in water-saturated packed columns that encompassed a range of humic acid concentrations (HA, 0-10 mg L(-1)), fractional surface coverage of iron oxyhydroxide coatings on sand grains (λ, 0-0.75), and pH (6.0-10.5). HA was found to have a marked effect on the electrokinetic properties of ARS-nHAP, and on the transport and retention of ARS-nHAP in granular media. The transport of ARS-nHAP was found to increase with increasing HA concentration because of enhanced colloidal stability and the reduced aggregate size. When HA = 10 mg L(-1), greater ARS-nHAP attachment occurred with increasing λ because of increased electrostatic attraction between negatively charged nanoparticles and positively charged iron oxyhydroxides, although alkaline conditions (pH 8.0 and 10.5) reversed the surface charge of the iron oxyhydroxides and therefore decreased deposition. The retention profiles of ARS-nHAP exhibited a hyperexponential shape for all test conditions, suggesting some unfavorable attachment conditions. Retarded breakthrough curves occurred in sands with iron oxyhydroxide coatings because of time-dependent occupation of favorable deposition sites. Consideration of the above effects is necessary to improve remediation efficiency of nHAP for metals and actinides in soils and subsurface environments.
Efficient Long-Range Hole Transport Through G-Quadruplexes.
Wu, Jingyuan; Meng, Zhenyu; Lu, Yunpeng; Shao, Fangwei
2017-10-09
DNA offers a means of long-range charge transport for biology and electric nanodevices. Here, a series of tetra-stranded G-quadruplexes were assembled within a dendritic DNA architecture to explore oxidative charge transport (hole transport) through the G-quadruplex. Efficient charge transport was achieved over 28 Å upon UV irradiation. Over a longer G-quadruplex bridge, hole transport was escalated to a higher efficiency, which resulted in a higher yield than that of the optimal duplex DNA for charge transport, that is, the adenine tract. Efficient long-range hole transport suggests tetra-stranded G-quadruplexes, instead of an oxidation hotspot, hold better potential as an electron conduit than duplex DNA. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
NASA Astrophysics Data System (ADS)
Kee, Hooi Ling
2008-10-01
The photophysical properties of diverse tetrapyrrole chromophores as well as energy and electron transfer processes in tetrapyrrole dyads are investigated using static and time-resolved (femtoseconds to seconds) absorption and fluorescence spectroscopy. The goal of these studies is to elucidate the molecular design principals necessary to construct chromophores with the specific and tunable properties that will enhance applications in optical molecular imaging, photodynamic therapy, and solar-energy conversion. The kinetic properties of the transient intermediate P+H B- involving the bacteriopheophytin molecule HB on the normally inactive (B) cofactor branch of the bacterial photosynthetic reaction center are examined in Rhodobacter capsulatus mutants. Using nanosecond flash photolysis and F(L181)Y/Y(M208)F/L(M212)H mutant, the decay pathways and yields of P+HB- were measured, giving an overall yield of 13% for B-side charge separation P* → P+HB- → P+ QB- in this mutant. The goal of these studies is to understand the fundamental differences in the rates, yields, and mechanisms of charge separation and charge recombination along the two parallel electron-transport chains in the bacterial reaction center.
Doping effect on the thermoelectric properties of chalcopyrite CuGaTe2
NASA Astrophysics Data System (ADS)
Sharma, Sonu; Singh, Birender; Kumar, Pradeep
2018-05-01
In the present work, we have investigated the thermoelectric properties of CuGaTe2 by combining the first principle calculations with Boltzmann transport theory. CuGaTe2 is found to be a potential thermoelectric material with Seebeck coefficient 275µVK-1 at 200K. The thermoelectric properties of the compound can be further improved by doping it with p as well as n-type charge carriers. The heavily p-doped and lightly n-doped, CuGaTe2 provides power factor comparable to that of state-of-art Bi2Te3.
Charge carrier mobility and electronic properties of Al(Op)3: impact of excimer formation
Friederich, Pascal; Schäfer, Bernhard; Fattori, Valeria; Sun, Xiangnan; Strunk, Timo; Meded, Velimir; Hueso, Luis E; Wenzel, Wolfgang; Ruben, Mario
2015-01-01
Summary We have studied the electronic properties and the charge carrier mobility of the organic semiconductor tris(1-oxo-1H-phenalen-9-olate)aluminium(III) (Al(Op)3) both experimentally and theoretically. We experimentally estimated the HOMO and LUMO energy levels to be −5.93 and −3.26 eV, respectively, which were close to the corresponding calculated values. Al(Op)3 was successfully evaporated onto quartz substrates and was clearly identified in the absorption spectra of both the solution and the thin film. A structured steady state fluorescence emission was detected in solution, whereas a broad, red-shifted emission was observed in the thin film. This indicates the formation of excimers in the solid state, which is crucial for the transport properties. The incorporation of Al(Op)3 into organic thin film transistors (TFTs) was performed in order to measure the charge carrier mobility. The experimental setup detected no electron mobility, while a hole mobility between 0.6 × 10−6 and 2.1 × 10−6 cm2·V−1·s−1 was measured. Theoretical simulations, on the other hand, predicted an electron mobility of 9.5 × 10−6 cm2·V−1·s−1 and a hole mobility of 1.4 × 10−4 cm2·V−1·s−1. The theoretical simulation for the hole mobility predicted an approximately one order of magnitude higher hole mobility than was observed in the experiment, which is considered to be in good agreement. The result for the electron mobility was, on the other hand, unexpected, as both the calculated electron mobility and chemical common sense (based on the capability of extended aromatic structures to efficiently accept and delocalize additional electrons) suggest more robust electron charge transport properties. This discrepancy is explained by the excimer formation, whose inclusion in the multiscale simulation workflow is expected to bring the theoretical simulation and experiment into agreement. PMID:26171287
NASA Astrophysics Data System (ADS)
Kheirandish, E.; Hosseini, T.; Yavarishad, N.; King, S.; Kouklin, N.
2018-02-01
The current study presents the synthesis and characterization of poly-crystalline TiO2 thin-film prepared by rf-sputtering on top of a highly regimented nanoporous Au-coated Al2O3 substrate. The film’s physical and electronic properties were characterized via SEM, EDS, x-ray diffraction and RAMAN spectroscopy as well as temperature dependent photoluminescence (PL) and I-V measurements. The films feature a 1D, columnar-like structure and exhibit a medium strength, spectrally-broad light emission in the UV-visible range. PL emission shows a weak T-dependence and is attributed to interband electronic transitions and defect-assisted radiative recombinations. The charge transport is confirmed to be polaronic in nature with both thermally-assisted hopping and quantum mechanical tunneling regulating a charge flow within the columns in the intermediate temperature regime of ˜200-320 K. These results open a door to utilizing nano-textured substrates/scaffolds to produce electronic-grade anatase TiO2 by sputtering for advanced opto-electronic device applications.
Zhou, Huanyu; Cheong, Hahn-Gil; Park, Jin-Woo
2016-05-01
We investigated the electronic properties of composite-type hybrid transparent conductive electrodes (h-TCEs) based on Ag nanowire networks (AgNWs) and indium tin oxide (ITO). These h-TCEs were developed to replace ITO, and their mechanical flexibility is superior to that of ITO. However, the characteristics of charge carriers and the mechanism of charge-carrier transport through the interface between the h-TCE and an organic material are not well understood when the h-TCE is used as the anode in a flexible organic light-emitting diode (f-OLED). AgNWs were spin coated onto polymer substrates, and ITO was sputtered atop the AgNWs. The electronic energy structures of h-TCEs were investigated by ultraviolet photoelectron spectroscopy. f-OLEDs were fabricated on both h-TCEs and ITO for comparison. The chemical bond formation at the interface between the h-TCE and the organic layer in f-OLEDs was investigated by X-ray photoelectron spectroscopy. The performances of f-OLEDs were compared based on the analysis results.
2D Raman band splitting in graphene: Charge screening and lifting of the K-point Kohn anomaly.
Wang, Xuanye; Christopher, Jason W; Swan, Anna K
2017-10-19
Pristine graphene encapsulated in hexagonal boron nitride has transport properties rivalling suspended graphene, while being protected from contamination and mechanical damage. For high quality devices, it is important to avoid and monitor accidental doping and charge fluctuations. The 2D Raman double peak in intrinsic graphene can be used to optically determine charge density, with decreasing peak split corresponding to increasing charge density. We find strong correlations between the 2D 1 and 2D 2 split vs 2D line widths, intensities, and peak positions. Charge density fluctuations can be measured with orders of magnitude higher precision than previously accomplished using the G-band shift with charge. The two 2D intrinsic peaks can be associated with the "inner" and "outer" Raman scattering processes, with the counterintuitive assignment of the phonon closer to the K point in the KM direction (outer process) as the higher energy peak. Even low charge screening lifts the phonon Kohn anomaly near the K point for graphene encapsulated in hBN, and shifts the dominant intensity from the lower to the higher energy peak.
NASA Astrophysics Data System (ADS)
Ramírez, Patricio; Apel, Pavel Yu; Cervera, Javier; Mafé, Salvador
2008-08-01
We present a complete theoretical study of the relationship between the structure (tip shape and dimensions) and function (selectivity and rectification) of asymmetric nanopores on the basis of previous experimental studies. The theoretical model uses a continuum approach based on the Nernst-Planck equations. According to our results, the nanopore transport properties, such as current-voltage (I-V) characteristics, conductance, rectification ratio, and selectivity, are dictated mainly by the shape of the pore tip (we have distinguished bullet-like, conical, trumpet-like, and hybrid shapes) and the concentration of pore surface charges. As a consequence, the nanopore performance in practical applications will depend not only on the base and tip openings but also on the pore shape. In particular, we show that the pore opening dimensions estimated from the pore conductance can be very different, depending on the pore shape assumed. The results obtained can also be of practical relevance for the design of nanopores, nanopipettes, and nanoelectrodes, where the electrical interactions between the charges attached to the nanostructure and the mobile charges confined in the reduced volume of the inside solution dictate the device performance in practical applications. Because single tracks are the elementary building blocks for nanoporous membranes, the understanding and control of their individual properties should also be crucial in protein separation, water desalination, and bio-molecule detection using arrays of identical nanopores.
Ramírez, Patricio; Apel, Pavel Yu; Cervera, Javier; Mafé, Salvador
2008-08-06
We present a complete theoretical study of the relationship between the structure (tip shape and dimensions) and function (selectivity and rectification) of asymmetric nanopores on the basis of previous experimental studies. The theoretical model uses a continuum approach based on the Nernst-Planck equations. According to our results, the nanopore transport properties, such as current-voltage (I-V) characteristics, conductance, rectification ratio, and selectivity, are dictated mainly by the shape of the pore tip (we have distinguished bullet-like, conical, trumpet-like, and hybrid shapes) and the concentration of pore surface charges. As a consequence, the nanopore performance in practical applications will depend not only on the base and tip openings but also on the pore shape. In particular, we show that the pore opening dimensions estimated from the pore conductance can be very different, depending on the pore shape assumed. The results obtained can also be of practical relevance for the design of nanopores, nanopipettes, and nanoelectrodes, where the electrical interactions between the charges attached to the nanostructure and the mobile charges confined in the reduced volume of the inside solution dictate the device performance in practical applications. Because single tracks are the elementary building blocks for nanoporous membranes, the understanding and control of their individual properties should also be crucial in protein separation, water desalination, and bio-molecule detection using arrays of identical nanopores.
Electrical properties of double layer dielectric structures for space technology
NASA Astrophysics Data System (ADS)
Lian, Anqing
1993-04-01
Polymeric films such as polyimide (PI) and polyethylene terephthalate (PET) are used in space technology as thermal blankets. Thin SiO2 and SiN coatings plasma deposited onto PI and PET surfaces were proposed to protect the blanket materials against the space environment. The electrical properties of this kind of dual layer dielectric structure were investigated to understand the mechanisms for suppressing charge accumulation and flashover. Bulk and surface electrical conductivities of thin single-layer PI and PET samples and of the dual layer SiO2 and SiN combinations with PI and PET were measured in a range of applied electrical fields. The capacitance voltage (CV) technique was used for analyzing charge transport and distribution in the structures. The electric current in the bulk of the SiO2/PI and SiN/PI samples was found to depend on the polarity of the electric field. Other samples did not exhibit any such polarity effect. The polarity dependence is attributed to charge trapping at the PI/plasma deposit interface. The CV characteristics of the Al-PI-SiO2-Si structure confirm that charges which can modify the local electric field can be trapped near the interface. A model is proposed to interpret the properties of the currents in dual layer structures. This model can semi-quantitatively explain all the observed results.
NASA Astrophysics Data System (ADS)
Park, Kwan-Ho; Lee, Soonil; Seo, Won-Seon; Shin, Dong-Kil; Kim, Il-Ho
2014-03-01
Rare-earth-filled skutterudites R z Fe4- x Co x Sb12 (R: Yb, La, Ce) were prepared, and their transport and thermoelectric properties were examined. All specimens showed p-type conduction and exhibited a degenerate semiconductor behavior. R0.9Fe3CoSb12 had lower electrical conductivities and higher Seebeck coefficients than RFe4Sb12, which meant that Co led to charge compensation through electron donations. All specimens had positive Hall coefficients, and their carrier concentrations were decreased by charge compensation with increasing Co substitution. The thermal conductivities of R0.9Fe3CoSb12 were lower than those of RFe4Sb12 due to the decreased carrier concentration, as well as the lattice scattering induced by the substitution of Co for Fe. Yb-filled and La-filled skutterudites showed enhanced thermoelectric figures of merit through charge compensation with Co, but Ce-filled skutterudites did not. Yb2˜3+ and La3+ ions required charge compensation to stabilize their skutterudite phases, but Ce3˜4+ ions did not.
Transport of Charged Particles in Turbulent Magnetic Fields
NASA Astrophysics Data System (ADS)
Parashar, T.; Subedi, P.; Sonsrettee, W.; Blasi, P.; Ruffolo, D. J.; Matthaeus, W. H.; Montgomery, D.; Chuychai, P.; Dmitruk, P.; Wan, M.; Chhiber, R.
2017-12-01
Magnetic fields permeate the Universe. They are found in planets, stars, galaxies, and the intergalactic medium. The magnetic field found in these astrophysical systems are usually chaotic, disordered, and turbulent. The investigation of the transport of cosmic rays in magnetic turbulence is a subject of considerable interest. One of the important aspects of cosmic ray transport is to understand their diffusive behavior and to calculate the diffusion coefficient in the presence of these turbulent fields. Research has most frequently concentrated on determining the diffusion coefficient in the presence of a mean magnetic field. Here, we will particularly focus on calculating diffusion coefficients of charged particles and magnetic field lines in a fully three-dimensional isotropic turbulent magnetic field with no mean field, which may be pertinent to many astrophysical situations. For charged particles in isotropic turbulence we identify different ranges of particle energy depending upon the ratio of the Larmor radius of the charged particle to the characteristic outer length scale of the turbulence. Different theoretical models are proposed to calculate the diffusion coefficient, each applicable to a distinct range of particle energies. The theoretical ideas are tested against results of detailed numerical experiments using Monte-Carlo simulations of particle propagation in stochastic magnetic fields. We also discuss two different methods of generating random magnetic field to study charged particle propagation using numerical simulation. One method is the usual way of generating random fields with a specified power law in wavenumber space, using Gaussian random variables. Turbulence, however, is non-Gaussian, with variability that comes in bursts called intermittency. We therefore devise a way to generate synthetic intermittent fields which have many properties of realistic turbulence. Possible applications of such synthetically generated intermittent fields are discussed.
Baek, Ji Hyun; Kim, Byeong Jo; Han, Gill Sang; Hwang, Sung Won; Kim, Dong Rip; Cho, In Sun; Jung, Hyun Suk
2017-01-18
Coupling dissimilar oxides in heterostructures allows the engineering of interfacial, optical, charge separation/transport and transfer properties of photoanodes for photoelectrochemical (PEC) water splitting. Here, we demonstrate a double-heterojunction concept based on a BiVO 4 /WO 3 /SnO 2 triple-layer planar heterojunction (TPH) photoanode, which shows simultaneous improvements in the charge transport (∼93% at 1.23 V vs RHE) and transmittance at longer wavelengths (>500 nm). The TPH photoanode was prepared by a facile solution method: a porous SnO 2 film was first deposited on a fluorine-doped tin oxide (FTO)/glass substrate followed by WO 3 deposition, leading to the formation of a double layer of dense WO 3 and a WO 3 /SnO 2 mixture at the bottom. Subsequently, a BiVO 4 nanoparticle film was deposited by spin coating. Importantly, the WO 3 /(WO 3 +SnO 2 ) composite bottom layer forms a disordered heterojunction, enabling intimate contact, lower interfacial resistance, and efficient charge transport/transfer. In addition, the top BiVO 4 /WO 3 heterojunction layer improves light absorption and charge separation. The resultant TPH photoanode shows greatly improved internal quantum efficiency (∼80%) and PEC water oxidation performance (∼3.1 mA/cm 2 at 1.23 V vs RHE) compared to the previously reported BiVO 4 /WO 3 photoanodes. The PEC performance was further improved by a reactive-ion etching treatment and CoO x electrocatalyst deposition. Finally, we demonstrated a bias-free and stable solar water-splitting by constructing a tandem PEC device with a perovskite solar cell (STH ∼3.5%).
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bhat, Thirumaleshwara N.; Rajpalke, Mohana K.; Krupanidhi, S. B.
Phase pure wurtzite GaN films were grown on Si (100) substrates by introducing a silicon nitride layer followed by low temperature GaN growth as buffer layers. GaN films grown directly on Si (100) were found to be phase mixtured, containing both cubic ({beta}) and hexagonal ({alpha}) modifications. The x-ray diffraction (XRD), scanning electron microscopy (SEM), photoluminescence (PL) spectroscopy studies reveal that the significant enhancement in the structural as well as in the optical properties of GaN films grown with silicon nitride buffer layer grown at 800 deg. C when compared to the samples grown in the absence of silicon nitridemore » buffer layer and with silicon nitride buffer layer grown at 600 deg. C. Core-level photoelectron spectroscopy of Si{sub x}N{sub y} layers reveals the sources for superior qualities of GaN epilayers grown with the high temperature substrate nitridation process. The discussion has been carried out on the typical inverted rectification behavior exhibited by n-GaN/p-Si heterojunctions. Considerable modulation in the transport mechanism was observed with the nitridation conditions. The heterojunction fabricated with the sample of substrate nitridation at high temperature exhibited superior rectifying nature with reduced trap concentrations. Lowest ideality factors ({approx}1.5) were observed in the heterojunctions grown with high temperature substrate nitridation which is attributed to the recombination tunneling at the space charge region transport mechanism at lower voltages and at higher voltages space charge limited current conduction is the dominating transport mechanism. Whereas, thermally generated carrier tunneling and recombination tunneling are the dominating transport mechanisms in the heterojunctions grown without substrate nitridation and low temperature substrate nitridation, respectively.« less
NASA Astrophysics Data System (ADS)
McClarty, P. A.; O'Brien, A.; Pollmann, F.
2014-05-01
We consider a classical model of charges ±q on a pyrochlore lattice in the presence of long-range Coulomb interactions. This model first appeared in the early literature on charge order in magnetite [P. W. Anderson, Phys. Rev. 102, 1008 (1956), 10.1103/PhysRev.102.1008]. In the limit where the interactions become short ranged, the model has a ground state with an extensive entropy and dipolar charge-charge correlations. When long-range interactions are introduced, the exact degeneracy is broken. We study the thermodynamics of the model and show the presence of a correlated charge liquid within a temperature window in which the physics is well described as a liquid of screened charged defects. The structure factor in this phase, which has smeared pinch points at the reciprocal lattice points, may be used to detect charge ice experimentally. In addition, the model exhibits fractionally charged excitations ±q/2 which are shown to interact via a 1/r potential. At lower temperatures, the model exhibits a transition to a long-range ordered phase. We are able to treat the Coulombic charge ice model and the dipolar spin ice model on an equal footing by mapping both to a constrained charge model on the diamond lattice. We find that states of the two ice models are related by a staggering field which is reflected in the energetics of these two models. From this perspective, we can understand the origin of the spin ice and charge ice ground states as coming from a dipolar model on a diamond lattice. We study the properties of charge ice in an external electric field, finding that the correlated liquid is robust to the presence of a field in contrast to the case of spin ice in a magnetic field. Finally, we comment on the transport properties of Coulombic charge ice in the correlated liquid phase.
Electrostatic dust transport on the surfaces of airless bodies
NASA Astrophysics Data System (ADS)
Wang, X.; Schwan, J.; Hsu, H. W.; Horanyi, M.
2015-12-01
The surfaces of airless bodies are charged due to the exposure to solar wind plasma and UV radiation. Dust particles on the regolith of these surfaces can become charged, and may move and even get lofted due to electrostatic force. Electrostatic dust transport has been a long-standing problem that may be related to many observed phenomena on the surfaces of airless planetary bodies, including the lunar horizon glow, the dust ponds on asteroid Eros, the spokes in Saturn's rings, and more recently, the collection of dust particles ejected off Comet 67P, observed by Rosetta. In order to resolve these puzzles, a handful of laboratory experiments have been performed in the past and demonstrated that dust indeed moves and lifts from surfaces exposed to plasma. However, the exact mechanisms for the mobilization of dust particles still remain a mystery. Current charging models, including the so-called "shared charge model" and the charge fluctuation theory, will be discussed. It is found that neither of these models can explain the results from either laboratory experiments or in-situ observations. Recently, single dust trajectories were captured with our new dust experiments, enabling novel micro-scale investigations. The particles' initial launch speeds and size distributions are analyzed, and a new so-called "patched charge model" is proposed to explain our findings. We identify the role of plasma micro-cavities that are formed in-between neighboring dust particles. The emitted secondary or photo- electrons are proposed to be absorbed inside the micro-cavities, resulting in significant charge accumulation on the exposed patches of the surfaces of neighboring particles. The resulting enhanced Coulomb force (repulsion) between particles is likely the dominant force to mobilize and lift them off the surface. The role of other properties, including surface morphology, cohesion and photoelectron charging, will also be discussed.
Interactions of microbicide nanoparticles with a simulated vaginal fluid.
das Neves, José; Rocha, Cristina M R; Gonçalves, Maria Pilar; Carrier, Rebecca L; Amiji, Mansoor; Bahia, Maria Fernanda; Sarmento, Bruno
2012-11-05
The interaction with cervicovaginal mucus presents the potential to impact the performance of drug nanocarriers. These systems must migrate through this biological fluid in order to deliver their drug payload to the underlying mucosal surface. We studied the ability of dapivirine-loaded polycaprolactone (PCL)-based nanoparticles (NPs) to interact with a simulated vaginal fluid (SVF) incorporating mucin. Different surface modifiers were used to produce NPs with either negative (poloxamer 338 NF and sodium lauryl sulfate) or positive (cetyltrimethylammonium bromide) surface charge. Studies were performed using the mucin particle method, rheological measurements, and real-time multiple particle tracking. Results showed that SVF presented rheological properties similar to those of human cervicovaginal mucus. Analysis of NP transport indicated mild interactions with mucin and low adhesive potential. In general, negatively charged NPs underwent subdiffusive transport in SVF, i.e., hindered as compared to their diffusion in water, but faster than for positively charged NPs. These differences were increased when the pH of SVF was changed from 4.2 to 7.0. Diffusivity was 50- and 172-fold lower in SVF at pH 4.2 than in water for negatively charged and positively charged NPs, respectively. At pH 7.0, this decrease was around 20- and 385-fold, respectively. The estimated times required to cross a layer of SVF were equal to or lower than 1.7 h for negatively charged NPs, while for positively charged NPs these values were equal to or higher than 7 h. Overall, our results suggest that negatively charged PCL NPs may be suitable to be used as carriers in order to deliver dapivirine and potentially other antiretroviral drugs to the cervicovaginal mucosal lining. Also, they further reinforce the importance in characterizing the interactions of nanosystems with mucus fluids or surrogates when considering mucosal drug delivery.
Surface transport processes in charged porous media
Gabitto, Jorge; Tsouris, Costas
2017-03-03
Surface transport processes are important in chemistry, colloidal sciences, engineering, biology, and geophysics. Natural or externally produced charges on surfaces create electrical double layers (EDLs) at the solid-liquid interface. The existence of the EDLs produces several complex processes including bulk and surface transport of ions. In this work, a model is presented to simulate bulk and transport processes in homogeneous porous media comprising big pores. It is based on a theory for capacitive charging by ideally polarizable porous electrodes without Faradaic reactions or specific adsorption of ions. A volume averaging technique is used to derive the averaged transport equations inmore » the limit of thin electrical double layers. Description of the EDL between the electrolyte solution and the charged wall is accomplished using the Gouy-Chapman-Stern (GCS) model. The surface transport terms enter into the average equations due to the use of boundary conditions for diffuse interfaces. Two extra surface transports terms appear in the closed average equations. One is a surface diffusion term equivalent to the transport process in non-charged porous media. The second surface transport term is a migration term unique to charged porous media. The effective bulk and transport parameters for isotropic porous media are calculated solving the corresponding closure problems.« less
Surface transport processes in charged porous media
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gabitto, Jorge; Tsouris, Costas
Surface transport processes are important in chemistry, colloidal sciences, engineering, biology, and geophysics. Natural or externally produced charges on surfaces create electrical double layers (EDLs) at the solid-liquid interface. The existence of the EDLs produces several complex processes including bulk and surface transport of ions. In this work, a model is presented to simulate bulk and transport processes in homogeneous porous media comprising big pores. It is based on a theory for capacitive charging by ideally polarizable porous electrodes without Faradaic reactions or specific adsorption of ions. A volume averaging technique is used to derive the averaged transport equations inmore » the limit of thin electrical double layers. Description of the EDL between the electrolyte solution and the charged wall is accomplished using the Gouy-Chapman-Stern (GCS) model. The surface transport terms enter into the average equations due to the use of boundary conditions for diffuse interfaces. Two extra surface transports terms appear in the closed average equations. One is a surface diffusion term equivalent to the transport process in non-charged porous media. The second surface transport term is a migration term unique to charged porous media. The effective bulk and transport parameters for isotropic porous media are calculated solving the corresponding closure problems.« less
Metal oxide charge transport material doped with organic molecules
Forrest, Stephen R.; Lassiter, Brian E.
2016-08-30
Doping metal oxide charge transport material with an organic molecule lowers electrical resistance while maintaining transparency and thus is optimal for use as charge transport materials in various organic optoelectronic devices such as organic photovoltaic devices and organic light emitting devices.
Laser-guided, intersecting discharge channels for the final beam transport in heavy-ion fusion
NASA Astrophysics Data System (ADS)
Niemann, C.; Neff, S.; Tauschwitz, A.; Penache, D.; Birkner, R.; Constantin, C.; Knobloch, R.; Presura, R.; Rosmej, F. B.; Hoffmann, D. H. H.; Yu, S. S.
2003-06-01
Ion-beam transport in space charge neutralizing discharge channels has been proposed for the final focus and chamber transport in a heavy-ion fusion reactor. A driver scenario with two-sided target illumination requires a system of two intersecting discharges to transport beams of the same charge from opposite sides towards the fusion target. In this article we report on experiments on the creation of free-standing, intersecting high-current discharge channels. The discharges are initiated in ammonia gas (NH3) in a metallic chamber by two perpendicular CO2-laser beams, which resonantly heat and subsequently rarefy the gas along the laser paths before the breakdown. These low density channels guide the discharges along the predefined paths and also around the 90° angles without any mechanical guiding structures. In this way stable X-, T-, and L-shaped discharges with currents in excess of 40 kA, at pressures of a few mbar were created with a total length of 110 cm. An 11.4 A MeV 58Ni+12 beam from the UNILAC (Universal Linear Accelerator) linear accelerator was used to probe the line-integrated ion-optical properties of the central channel in a T-shaped discharge.
Simulation of electron transport during electron-beam-induced deposition of nanostructures
Jeschke, Harald O; Valentí, Roser
2013-01-01
Summary We present a numerical investigation of energy and charge distributions during electron-beam-induced growth of tungsten nanostructures on SiO2 substrates by using a Monte Carlo simulation of the electron transport. This study gives a quantitative insight into the deposition of energy and charge in the substrate and in the already existing metallic nanostructures in the presence of the electron beam. We analyze electron trajectories, inelastic mean free paths, and the distribution of backscattered electrons in different compositions and at different depths of the deposit. We find that, while in the early stages of the nanostructure growth a significant fraction of electron trajectories still interacts with the substrate, when the nanostructure becomes thicker the transport takes place almost exclusively in the nanostructure. In particular, a larger deposit density leads to enhanced electron backscattering. This work shows how mesoscopic radiation-transport techniques can contribute to a model that addresses the multi-scale nature of the electron-beam-induced deposition (EBID) process. Furthermore, similar simulations can help to understand the role that is played by backscattered electrons and emitted secondary electrons in the change of structural properties of nanostructured materials during post-growth electron-beam treatments. PMID:24367747
NASA Astrophysics Data System (ADS)
Oshima, Keisuke; Inoue, Junta; Sadakata, Shifumi; Shiraishi, Yukihide; Toshima, Naoki
2017-05-01
Carbon nanotubes (CNTs) have recently received much attention as thermoelectric materials. Although the carrier mobility within a single CNT is very high, the charge carrier transport between CNTs is quite slow. We have utilized nanoparticles (NPs) for promotion of the carrier transport between CNTs for improving their thermoelectric performance. Poly(vinyl chloride) (PVC) was used as a binder of the CNTs. Thus, hybrid-type organic thermoelectric materials containing the NPs were constructed from Pd NPs, CNTs, and PVC. The thermoelectric properties were slightly improved in the three-component films by only mixing the separately-prepared Pd NPs. The NPs of a polymer complex, poly(nickel 1,1,2,2-ethenetetrathiolate) (n-PETT), were also used as a charge carrier transport promoter instead of the Pd NPs to produce n-PETT/CNT/PVC hybrid films. Treatment of the three-component films with methanol produced a high thermoelectric power factor and low thermal conductivity, resulting in a high "apparent" thermoelectric performance ( ZT ˜ 0.3 near room temperature) although the thermal conductivity was measured in the through-plane direction, which is a different direction from that for the electrical conductivity.
Low-temperature transport properties of TaxN thin films (0.72 <= x <= 0.83)
NASA Astrophysics Data System (ADS)
Očko, Miroslav; Žonja, Sanja; Nelson, G. L.; Freericks, J. K.; Yu, Lei; Newman, N.
2010-11-01
We report on low-temperature (4-320 K) transport properties of TaxN thin films deposited on an amorphous SiO2 substrate. In this work, TaxN thin films were restricted to a narrow range of x: 0.72 <= x <= 0.83 yet show considerable and nonmonotonic variation of their transport properties with Ta concentration. This behaviour is consistent with a local minimum in the density of electronic states at the Fermi level, as calculated for the rock salt intermetallic Ta4N5, and a rigid band model for describing the transport. The temperature dependence of the resistivity is best fit to the unusual form exp(-T/T0). Interestingly enough, the fit parameter T0 correlates well with the temperature of the maximum of the corresponding thermopower. Both of these characteristics, the fit and the correlation with the thermopower, are consistent with the Jonson-Mahan many-body formalism for charge and thermal transport when one has a nontrivial temperature dependence of the chemical potential. At the lowest temperatures measured, we have also found that the resistivity and thermopower show signatures of electron-electron interactions. We discuss also our results in the light of some theories usually used for describing transport of thin films and to other experimental investigations that have been performed on TaxN.
Marine phages as excellent tracers for reactive colloidal transport in porous media
NASA Astrophysics Data System (ADS)
Ghanem, Nawras; Chatzinotas, Antonis; Harms, Hauke; Wick, Lukas Y.
2016-04-01
Question: Here we evaluate marine phages as specific markers of hydrological flow and reactive transport of colloidal particles in the Earth's critical zone (CZ). Marine phages and their bacterial hosts are naturally absent in the CZ, and can be detected with extremely high sensitivity. In the framework of the DFG Collaborative Research Center AquaDiva, we asked the following questions: (1) Are marine phages useful specific markers of hydrological flow and reactive transport in porous media? and (2) Which phage properties are relevant drivers for the transport of marine phages in porous media? Methods: Seven marine phages from different families (as well two commonly used terrestrial phages) were selected based on their morphology, size and physico-chemical surface properties (surface charge and hydrophobicity). Phage properties were assessed by electron microscopy, dynamic light scattering and water contact angle analysis (CA). Sand-filled laboratory percolation columns were used to study transport. The breakthrough curves of the phages were analyzed using the clean bed filtration theory and the XDLVO theory of colloid stability, respectively. Phages were quantified by a modified high- throughput plaque assay and a culture-independent particle counting method approach. Results: Our data show that most marine tested phages exhibited highly variable transport rates and deposition efficiency, yet generally high colloidal stability and viability. We find that size, morphology and hydrophobicity are key factors shaping the transport efficiency of phages. Differing deposition efficiencies of the phages were also supported by calculated XDLVO interaction energy profile. Conclusion: Marine phages have a high potential for the use as sensitive tracers in terrestrial habitats with their surface properties playing a crucial role for their transport. Marine phages however, exhibit differences in their deposition efficiency depending on their morphology, hydrophobicity and availability.
Ultrafast Microscopy of Energy and Charge Transport
NASA Astrophysics Data System (ADS)
Huang, Libai
The frontier in solar energy research now lies in learning how to integrate functional entities across multiple length scales to create optimal devices. Advancing the field requires transformative experimental tools that probe energy transfer processes from the nano to the meso lengthscales. To address this challenge, we aim to understand multi-scale energy transport across both multiple length and time scales, coupling simultaneous high spatial, structural, and temporal resolution. In my talk, I will focus on our recent progress on visualization of exciton and charge transport in solar energy harvesting materials from the nano to mesoscale employing ultrafast optical nanoscopy. With approaches that combine spatial and temporal resolutions, we have recently revealed a new singlet-mediated triplet transport mechanism in certain singlet fission materials. This work demonstrates a new triplet exciton transport mechanism leading to favorable long-range triplet exciton diffusion on the picosecond and nanosecond timescales for solar cell applications. We have also performed a direct measurement of carrier transport in space and in time by mapping carrier density with simultaneous ultrafast time resolution and 50 nm spatial precision in perovskite thin films using transient absorption microscopy. These results directly visualize long-range carrier transport of 220nm in 2 ns for solution-processed polycrystalline CH3NH3PbI3 thin films. The spatially and temporally resolved measurements reported here underscore the importance of the local morphology and establish an important first step towards discerning the underlying transport properties of perovskite materials.
Nanostructured Electron-Selective Interlayer for Efficient Inverted Organic Solar Cells.
Song, Jiyun; Lim, Jaehoon; Lee, Donggu; Thambidurai, M; Kim, Jun Young; Park, Myeongjin; Song, Hyung-Jun; Lee, Seonghoon; Char, Kookheon; Lee, Changhee
2015-08-26
We report a unique nanostructured electron-selective interlayer comprising of In-doped ZnO (ZnO:In) and vertically aligned CdSe tetrapods (TPs) for inverted polymer:fullerene bulkheterojunction (BHJ) solar cells. With dimension-controlled CdSe TPs, the direct inorganic electron transport pathway is provided, resulting in the improvement of the short circuit current and fill factor of devices. We demonstrate that the enhancement is attributed to the roles of CdSe TPs that reduce the recombination losses between the active layer and buffer layer, improve the hole-blocking as well as electron-transporting properties, and simultaneously improve charge collection characteristics. As a result, the power conversion efficiency of PTB7:PC70BM based solar cell with nanostructured CdSe TPs increases to 7.55%. We expect this approach can be extended to a general platform for improving charge extraction in organic solar cells.
Duan, Lian; Tsuboi, Taiju; Qiu, Yong; Li, Yanrui; Zhang, Guohui
2012-06-18
Tandem organic light emitting diodes (OLEDs) are ideal for lighting applications due to their low working current density at high brightness. In this work, we have studied an efficient electron transporting layer of KBH(4) doped 9,10-bis(3-(pyridin-3-yl)phenyl)anthracene (DPyPA) which is located adjacent to charge generation layer of MoO(3)/NPB. The excellent transporting property of the DPyPA:KBH(4) layer helps the tandem OLED to achieve a lower voltage than the tandem device with the widely used tris-(8-hydroxyquinoline)aluminum:Li. For the tandem white OLED with a fluorescent blue unit and a phosphorescent yellow unit, we've achieved a high current efficiency of 75 cd/A, which can be further improved to 120 cd/A by attaching a diffuser layer.
High-performance thermoelectric nanocomposites from nanocrystal building blocks
Ibáñez, Maria; Luo, Zhishan; Genç, Aziz; Piveteau, Laura; Ortega, Silvia; Cadavid, Doris; Dobrozhan, Oleksandr; Liu, Yu; Nachtegaal, Maarten; Zebarjadi, Mona; Arbiol, Jordi; Kovalenko, Maksym V.; Cabot, Andreu
2016-01-01
The efficient conversion between thermal and electrical energy by means of durable, silent and scalable solid-state thermoelectric devices has been a long standing goal. While nanocrystalline materials have already led to substantially higher thermoelectric efficiencies, further improvements are expected to arise from precise chemical engineering of nanoscale building blocks and interfaces. Here we present a simple and versatile bottom–up strategy based on the assembly of colloidal nanocrystals to produce consolidated yet nanostructured thermoelectric materials. In the case study on the PbS–Ag system, Ag nanodomains not only contribute to block phonon propagation, but also provide electrons to the PbS host semiconductor and reduce the PbS intergrain energy barriers for charge transport. Thus, PbS–Ag nanocomposites exhibit reduced thermal conductivities and higher charge carrier concentrations and mobilities than PbS nanomaterial. Such improvements of the material transport properties provide thermoelectric figures of merit up to 1.7 at 850 K. PMID:26948987
Near-field three-terminal thermoelectric heat engine
NASA Astrophysics Data System (ADS)
Jiang, Jian-Hua; Imry, Yoseph
2018-03-01
We propose a near-field inelastic thermoelectric heat engine where quantum dots are used to effectively rectify the charge flow of photocarriers. The device converts near-field heat radiation into useful electrical power. Heat absorption and inelastic transport can be enhanced by introducing two continuous spectra separated by an energy gap. The thermoelectric transport properties of the heat engine are studied in the linear-response regime. Using a small band-gap semiconductor as the absorption material, we show that the device achieves very large thermopower and thermoelectric figure of merit, as well as considerable power factor. By analyzing thermal-photocarrier generation and conduction, we reveal that the Seebeck coefficient and the figure of merit have oscillatory dependence on the thickness of the vacuum gap. Meanwhile, the power factor, the charge, and thermal conductivity are significantly improved by near-field radiation. Conditions and guiding principles for powerful and efficient thermoelectric heat engines are discussed in details.
High-performance thermoelectric nanocomposites from nanocrystal building blocks.
Ibáñez, Maria; Luo, Zhishan; Genç, Aziz; Piveteau, Laura; Ortega, Silvia; Cadavid, Doris; Dobrozhan, Oleksandr; Liu, Yu; Nachtegaal, Maarten; Zebarjadi, Mona; Arbiol, Jordi; Kovalenko, Maksym V; Cabot, Andreu
2016-03-07
The efficient conversion between thermal and electrical energy by means of durable, silent and scalable solid-state thermoelectric devices has been a long standing goal. While nanocrystalline materials have already led to substantially higher thermoelectric efficiencies, further improvements are expected to arise from precise chemical engineering of nanoscale building blocks and interfaces. Here we present a simple and versatile bottom-up strategy based on the assembly of colloidal nanocrystals to produce consolidated yet nanostructured thermoelectric materials. In the case study on the PbS-Ag system, Ag nanodomains not only contribute to block phonon propagation, but also provide electrons to the PbS host semiconductor and reduce the PbS intergrain energy barriers for charge transport. Thus, PbS-Ag nanocomposites exhibit reduced thermal conductivities and higher charge carrier concentrations and mobilities than PbS nanomaterial. Such improvements of the material transport properties provide thermoelectric figures of merit up to 1.7 at 850 K.
Electronic reconstruction of doped Mott insulator heterojunctions
NASA Astrophysics Data System (ADS)
Charlebois, M.; Hassan, S. R.; Karan, R.; Dion, M.; Senechal, D.; Tremblay, A.-M. S.
2012-02-01
Correlated electron heterostructures became a possible alternative when thin-film deposition techniques achieved structures with a sharp interface transition [1]. Soon thereafter, Okamoto & Millis introduced the concept of ``electronic reconstruction'' [2]. We study here the electronic reconstruction of doped Mott insulator heterostructures based on a Cluster Dynamical Mean Field Theory (CDMFT) calculations of the Hubbard model in the limit where electrostatic energy dominates over the kinetic energy associated with transport across layers. The grand potential of individual layers is first computed within CDMFT and then the electrostatic potential energy is taken into account in the Hartree approximation. The charge reconstruction in an ensemble of stacked planes of different nature can lead to a distribution of electron charge and to transport properties that are unique to doped-Mott insulators.[4pt] [1] J. Mannhart, D. G. Schlom, Science 327, 1607 (2010).[0pt] [2] S. Okamoto and A. J. Millis, Nature 428, 630 (2004).
DOE Office of Scientific and Technical Information (OSTI.GOV)
Guo, Peijun; Xia, Yi; Gong, Jue
Solution-processable metal-halide perovskites (MHPs) offer great promise for efficient light harvesting and emitting devices due to their long carrier lifetime and superior carrier transport characteristics. Ferroelectric effects, a hallmark of traditional oxide perovskites, was proposed to be a mechanism to suppress carrier recombination and enhance charge transport in MHPs, but the existence and influence of such polar order is still of considerable debate. Here we performed transient reflection measurements on single crystals of both inorganic and organic-inorganic (hybrid) MHPs over a range of temperatures, and demonstrate significant phonon softening in the cubic phases close to the cubic-to-tetragonal phase transition temperatures.more » Such phonon softening indicates the formation of polar domains, which grow in size upon cooling and can persist in the low-temperature tetragonal and orthorhombic phases. Our results link the extraordinary electronic properties of MHPs to the spontaneous polarizations which can contribute to more efficient charge separation and characteristics of an indirect bandgap.« less
NASA Astrophysics Data System (ADS)
He, Jiaming; Zhang, Yiran; Wen, Libin; Yang, Yusen; Liu, Jinyu; Wu, Yueshen; Lian, Hailong; Xing, Hui; Wang, Shun; Mao, Zhiqiang; Liu, Ying
2017-07-01
Ta2NiSe7 is a quasi-one-dimensional (quasi-1D) transition-metal chalcogenide with Ta and Ni chain structures. An incommensurate charge-density wave (CDW) in this quasi-1D structure was well studied previously using tunnelling spectrum, X-ray, and electron diffraction, whereas its transport property and the relation to the underlying electronic states remain to be explored. Here, we report our results of the magnetoresistance (MR) on Ta2NiSe7. A breakdown of Kohler's rule is found upon entering the CDW state. Concomitantly, a clear change in curvature in the field dependence of MR is observed. We show that the curvature change is well described by the two-band orbital MR, with the hole density being strongly suppressed in the CDW state, indicating that the p orbitals from Se atoms dominate the change in transport through CDW transition.
NASA Astrophysics Data System (ADS)
Mizoguchi, Seiya; Shimatani, Naoki; Kobayashi, Mizuki; Makino, Takaomi; Yamaoka, Yu; Kodera, Tetsuo
2018-04-01
We study hole transport properties in physically defined p-type silicon quantum dots (QDs) on a heavily doped silicon-on-insulator (SOI) substrate. We observe Coulomb diamonds using single QDs and estimate the charging energy as ∼1.6 meV. We obtain the charge stability diagram of double QDs using single QDs as a charge sensor. This is the first demonstration of charge sensing in p-type heavily doped silicon QDs. For future time-resolved measurements, we apply radio-frequency reflectometry using impedance matching of LC circuits to the device. We observe the resonance and estimate the capacitance as ∼0.12 pF from the resonant frequency. This value is smaller than that of the devices with top gates on nondoped SOI substrate. This indicates that high-frequency signals can be applied efficiently to p-type silicon QDs without top gates.
Enhanced Born Charge and Proximity to Ferroelectricity in Thallium Halides
DOE Office of Scientific and Technical Information (OSTI.GOV)
Du, Mao-Hua; Singh, David J
2010-01-01
Electronic structure and lattice dynamics calculations on thallium halides show that the Born effective charges in these compounds are more than twice larger than the nominal ionic charges. This is a result of cross-band-gap hybridization between Tl-p and halogen-p states. The large Born charges cause giant splitting between longitudinal and transverse optic phonon modes, bringing the lattice close to ferroelectric instability. Our calculations indeed show spontaneous lattice polarization upon lattice expansion starting at 2%. It is remarkable that the apparently ionic thallium halides with a simple cubic CsCl structure and large differences in electronegativity between cations and anions can bemore » very close to ferroelectricity. This can lead to effective screening of defects and impurities that would otherwise be strong carrier traps and may therefore contribute to the relatively good carrier transport properties in TlBr radiation detectors.« less
Enhanced Born charge and proximity to ferroelectricity in thallium halides
NASA Astrophysics Data System (ADS)
Du, Mao-Hua; Singh, David J.
2010-04-01
Electronic-structure and lattice-dynamics calculations on thallium halides show that the Born effective charges in these compounds are more than twice larger than the nominal ionic charges. This is a result of cross-band-gap hybridization between Tlp and halogen- p states. The large Born charges cause giant splitting between longitudinal and transverse-optic phonon modes, bringing the lattice close to ferroelectric instability. Our calculations indeed show that cubic TlBr develops ferroelectric instabilities upon lattice expansion starting at 2%. It is remarkable that the apparently ionic thallium halides with a simple cubic CsCl structure and large differences in electronegativity between cations and anions can be very close to ferroelectricity. This can lead to effective screening of defects and impurities that would otherwise be strong carrier traps and may therefore contribute to the relatively good carrier transport properties in TlBr radiation detectors.
NASA Astrophysics Data System (ADS)
Li, S.; Guérin, D.; Lenfant, S.; Lmimouni, K.
2018-02-01
Pentacene based double nano-floating gate memories (NFGM) by using gold nanoparticles (Au NPs) and reduced graphene oxide (rGO) sheets as charge trapping layers are prepared and demonstrated. Particularly, the NFGM chemically treated by 2,3,4,5,6-pentafluorobenzenethiol (PFBT) self-assembled monolayers (SAM) exhibits excellent memory performances, including high mobility of 0.23 cm2V-1s-1, the large memory window of 51 V, and the stable retention property more than 108 s. Comparing the performances of NFGM without treating with PFBT SAM, the improving performances of the memory devices by SAM modification are explained by the increase of charge injection, which could be further investigated by XPS and UPS. In particular, the results highlight the utility of SAM modulations and controlling of charge transport in the development of organic transistor memories.
Hyperbranched TiO2-CdS nano-heterostructures for highly efficient photoelectrochemical photoanodes.
Mezzetti, Alessandro; Balandeh, Mehrdad; Luo, Jingshan; Bellani, Sebastiano; Tacca, Alessandra; Divitini, Giorgio; Cheng, Chuanwei; Ducati, Caterina; Meda, Laura; Fan, Hongjin; Di Fonzo, Fabio
2018-08-17
Quasi-1D-hyperbranched TiO 2 nanostructures are grown via pulsed laser deposition and sensitized with thin layers of CdS to act as a highly efficient photoelectrochemical photoanode. The device properties are systematically investigated by optimizing the height of TiO 2 scaffold structure and thickness of the CdS sensitizing layer, achieving photocurrent values up to 6.6 mA cm -2 and reaching saturation with applied biases as low as 0.35 V RHE . The high internal conversion efficiency of these devices is to be found in the efficient charge generation and injection of the thin CdS photoactive film and in the enhanced charge transport properties of the hyperbranched TiO 2 scaffold. Hence, the proposed device represents a promising architecture for heterostructures capable of achieving high solar-to-hydrogen efficiency.
31 CFR 337.2 - Transportation charges and risks.
Code of Federal Regulations, 2014 CFR
2014-07-01
... 31 Money and Finance: Treasury 2 2014-07-01 2014-07-01 false Transportation charges and risks. 337.2 Section 337.2 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued... GOVERNING FEDERAL HOUSING ADMINISTRATION DEBENTURES Certificated Debentures § 337.2 Transportation charges...
Xue, Guobiao; Zhao, Xikang; Qu, Ge; Xu, Tianbai; Gumyusenge, Aristide; Zhang, Zhuorui; Zhao, Yan; Diao, Ying; Li, Hanying; Mei, Jianguo
2017-08-02
The selection of side chains is important in design of conjugated polymers. It not only affects their intrinsic physical properties, but also has an impact on thin film morphologies. Recent reports suggested that a face-on/edge-on bimodal orientation observed in polymer thin films may be responsible for a three-dimensional (3D) charge transport and leads to dramatically improved mobility in donor-acceptor based conjugated polymers. To achieve a bimodal orientation in thin films has been seldom explored from the aspect of molecular design. Here, we demonstrate a design strategy involving the use of asymmetric side chains that enables an isoindigo-based polymer to adopt a distinct bimodal orientation, confirmed by the grazing incidence X-ray diffraction. As a result, the polymer presents an average high mobility of 3.8 ± 0.7 cm 2 V -1 s -1 with a maximum value of 5.1 cm 2 V -1 s -1 , in comparison with 0.47 and 0.51 cm 2 V -1 s -1 obtained from the two reference polymers. This study exemplifies a new strategy to develop the next generation polymers through understanding the property-structure relationship.
Ligand-Asymmetric Janus Quantum Dots for Efficient Blue-Quantum Dot Light-Emitting Diodes.
Cho, Ikjun; Jung, Heeyoung; Jeong, Byeong Guk; Hahm, Donghyo; Chang, Jun Hyuk; Lee, Taesoo; Char, Kookheon; Lee, Doh C; Lim, Jaehoon; Lee, Changhee; Cho, Jinhan; Bae, Wan Ki
2018-06-19
We present ligand-asymmetric Janus quantum dots (QDs) to improve the device performance of quantum dot light-emitting diodes (QLEDs). Specifically, we devise blue QLEDs incorporating blue QDs with asymmetrically modified ligands, in which the bottom ligand of QDs in contact with ZnO electron-transport layer serves as a robust adhesive layer and an effective electron-blocking layer and the top ligand ensures uniform deposition of organic hole transport layers with enhanced hole injection properties. Suppressed electron overflow by the bottom ligand and stimulated hole injection enabled by the top ligand contribute synergistically to boost the balance of charge injection in blue QDs and therefore the device performance of blue QLEDs. As an ultimate achievement, the blue QLED adopting ligand-asymmetric QDs displays 2-fold enhancement in peak external quantum efficiency (EQE = 3.23%) compared to the case of QDs with native ligands (oleic acid) (peak EQE = 1.49%). The present study demonstrates an integrated strategy to control over the charge injection properties into QDs via ligand engineering that enables enhancement of the device performance of blue QLEDs and thus promises successful realization of white light-emitting devices using QDs.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zheng, X. H., E-mail: xhzheng@theory.issp.ac.cn; Hao, H.; Lan, J.
2014-08-21
The electronic transport properties of molecular bridges constructed by C{sub 60} and B{sub 80} molecules which have the same symmetry are investigated by first principles calculations combined with a non-equilibrium Green's function technique. It is found that, like C{sub 60}, monomer B{sub 80} is a good conductor arising from the charge transfer from the leads to the molecule, while the dimer (B{sub 80}){sub 2} and (C{sub 60}){sub 2} are both insulators due to the potential barrier formed at the molecule-molecule interface. Our further study shows that, although both the homogeneous dimer (B{sub 80}){sub 2} and (C{sub 60}){sub 2} display poormore » conductivity, the heterogeneous dimer B{sub 80}C{sub 60} shows a very high conductance as a result from the decreased HOMO-LUMO gap and the excess charge redistribution. Finally, we find that the conductivity of both (B{sub 80}){sub 2} and (C{sub 60}){sub 2} can be significantly improved by electron doping, for example, by doping C in (B{sub 80}){sub 2} and doping N in (C{sub 60}){sub 2}.« less
Novoa, Alexandre; Van Dorpe, Sylvia; Wynendaele, Evelien; Spetea, Mariana; Bracke, Nathalie; Stalmans, Sofie; Betti, Cecilia; Chung, Nga N; Lemieux, Carole; Zuegg, Johannes; Cooper, Matthew A; Tourwé, Dirk; De Spiegeleer, Bart; Schiller, Peter W; Ballet, Steven
2012-11-26
The influence of the side chain charges of the second and fourth amino acid residues in the peptidic μ opioid lead agonist Dmt-d-Arg-Phe-Lys-NH(2) ([Dmt(1)]-DALDA) was examined. Additionally, to increase the overall lipophilicity of [Dmt(1)]-DALDA and to investigate the Phe(3) side chain flexibility, the final amide bond was N-methylated and Phe(3) was replaced by a constrained aminobenzazepine analogue. The in vitro receptor binding and activity of the peptides, as well as their in vivo transport (brain in- and efflux and tissue biodistribution) and antinociceptive properties after peripheral administration (ip and sc) in mice were determined. The structural modifications result in significant shifts of receptor binding, activity, and transport properties. Strikingly, while [Dmt(1)]-DALDA and its N-methyl analogue, Dmt-d-Arg-Phe-NMeLys-NH(2), showed a long-lasting antinociceptive effect (>7 h), the peptides with d-Cit(2) generate potent antinociception more rapidly (maximal effect at 1h postinjection) but also lose their analgesic activity faster when compared to [Dmt(1)]-DALDA and [Dmt(1),NMeLys(4)]-DALDA.
Novoa, Alexandre; Van Dorpe, Sylvia; Wynendaele, Evelien; Spetea, Mariana; Bracke, Nathalie; Stalmans, Sofie; Betti, Cecilia; Chung, Nga N.; Lemieux, Carole; Zuegg, Johannes; Cooper, Matthew A.; Tourwé, Dirk; De Spiegeleer, Bart; Schiller, Peter W.; Ballet, Steven
2012-01-01
The influence of the side chain charges of the second and fourth amino acid residues in the peptidic μ opioid lead agonist Dmt-D-Arg-Phe-Lys-NH2 ([Dmt1]-DALDA) was examined. Additionally, to increase the overall lipophilicity of [Dmt1]-DALDA and to investigate the Phe3 side chain flexibility, the final amide bond was N-methylated and Phe3 was replaced by a constrained aminobenzazepine analogue. The in vitro receptor binding and activity of the peptides, as well as their in vivo transport (brain in- and efflux and tissue biodistribution) and antinociceptive properties after peripheral administration (i.p. and s.c.) in mice were determined. The structural modifications result in significant shifts of receptor binding, activity and transport properties. Strikingly, while [Dmt1]-DALDA and its N-methyl analogue, Dmt-D-Arg-Phe-NMeLys-NH2, showed a long-lasting antinociceptive effect (>7h), the peptides with D-Cit2 generate potent antinociception more rapidly (maximal effect at 1h post-injection) but also lose their analgesic activity faster, when compared to [Dmt1]-DALDA and [Dmt1,NMeLys4]-DALDA. PMID:23102273
Resolving dispersion and induction components for polarisable molecular simulations of ionic liquids
NASA Astrophysics Data System (ADS)
Pádua, Agílio A. H.
2017-05-01
One important development in interaction potential models, or atomistic force fields, for molecular simulation is the inclusion of explicit polarisation, which represents the induction effects of charged or polar molecules on polarisable electron clouds. Polarisation can be included through fluctuating charges, induced multipoles, or Drude dipoles. This work uses Drude dipoles and is focused on room-temperature ionic liquids, for which fixed-charge models predict too slow dynamics. The aim of this study is to devise a strategy to adapt existing non-polarisable force fields upon addition of polarisation, because induction was already contained to an extent, implicitly, due to parametrisation against empirical data. Therefore, a fraction of the van der Waals interaction energy should be subtracted so that the Lennard-Jones terms only account for dispersion and the Drude dipoles for induction. Symmetry-adapted perturbation theory is used to resolve the dispersion and induction terms in dimers and to calculate scaling factors to reduce the Lennard-Jones terms from the non-polarisable model. Simply adding Drude dipoles to an existing fixed-charge model already improves the prediction of transport properties, increasing diffusion coefficients, and lowering the viscosity. Scaling down the Lennard-Jones terms leads to still faster dynamics and densities that match experiment extremely well. The concept developed here improves the overall prediction of density and transport properties and can be adapted to other models and systems. In terms of microscopic structure of the ionic liquids, the inclusion of polarisation and the down-scaling of Lennard-Jones terms affect only slightly the ordering of the first shell of counterions, leading to small decreases in coordination numbers. Remarkably, the effect of polarisation is major beyond first neighbours, significantly weakening spatial correlations, a structural effect that is certainly related to the faster dynamics of polarisable models.
Han, Tae-Hee; Kim, Young-Hoon; Kim, Myung Hwan; Song, Wonjun; Lee, Tae-Woo
2016-03-09
We used various nondestructive analyses to investigate various host material systems in the emitting layer (EML) of simple-structured, green phosphorescent organic light-emitting diodes (OLEDs) to clarify how the host systems affect its luminous efficiency (LE) and operational stability. An OLED that has a unipolar single-host EML with conventional poly(3,4-ethylenedioxythiophene):poly(styrenesulfonate) ( PSS) showed high operating voltage, low LE (∼26.6 cd/A, 13.7 lm/W), and short lifetime (∼4.4 h @ 1000 cd/m(2)). However, the combined use of a gradient mixed-host EML and a molecularly controlled HIL that has increased surface work function (WF) remarkably decreased operating voltage and improved LE (∼68.7 cd/A, 77.0 lm/W) and lifetime (∼70.7 h @ 1000 cd/m(2)). Accumulated charges at the injecting interfaces and formation of a narrow recombination zone close to the interfaces are the major factors that accelerate degradation of charge injection/transport and electroluminescent properties of OLEDs, so achievement of simple-structured OLEDs with high efficiency and long lifetime requires facilitating charge injection and balanced transport into the EML and distributing charge carriers and excitons in EML.
Cell Surface Interference with Plasma Membrane and Transport Processes in Yeasts.
Francois, Jean Marie
2016-01-01
The wall of the yeast Saccharomyces cerevisiae is a shell of about 120 nm thick, made of two distinct layers, which surrounds the cell. The outer layer is constituted of highly glycosylated proteins and the inner layer is composed of β-glucan and chitin. These two layers are interconnected through covalent linkages leading to a supramolecular architecture that is characterized by physical and chemical properties including rigidity, porosity and biosorption. The later property results from the presence of highly negative charged phosphate and carboxylic groups of the cell wall proteins, allowing the cell wall to act as an efficient barrier to metals ions, toxins and organic compounds. An intimate connection between cell wall and plasma membrane is indicated by the fact that changes in membrane fluidity results in change in cell wall nanomechanical properties. Finally, cell wall contributes to transport processes through the use of dedicated cell wall mannoproteins, as it is the case for Fit proteins implicated in the siderophore-iron bound transport and the Tir/Dan proteins family in the uptake of sterols.
Electron-flux infrared response to varying π-bond topology in charged aromatic monomers
Álvaro Galué, Héctor; Oomens, Jos; Buma, Wybren Jan; Redlich, Britta
2016-01-01
The interaction of delocalized π-electrons with molecular vibrations is key to charge transport processes in π-conjugated organic materials based on aromatic monomers. Yet the role that specific aromatic motifs play on charge transfer is poorly understood. Here we show that the molecular edge topology in charged catacondensed aromatic hydrocarbons influences the Herzberg-Teller coupling of π-electrons with molecular vibrations. To this end, we probe the radical cations of picene and pentacene with benchmark armchair- and zigzag-edges using infrared multiple-photon dissociation action spectroscopy and interpret the recorded spectra via quantum-chemical calculations. We demonstrate that infrared bands preserve information on the dipolar π-electron-flux mode enhancement, which is governed by the dynamical evolution of vibronically mixed and correlated one-electron configuration states. Our results reveal that in picene a stronger charge π-flux is generated than in pentacene, which could justify the differences of electronic properties of armchair- versus zigzag-type families of technologically relevant organic molecules. PMID:27577323
Subbiah, Anand S.; Mahuli, Neha; Agarwal, Sumanshu; ...
2017-07-21
Hybrid perovskite photovoltaic devices heavily rely on the use of organic (rather than inorganic) charge-transport layers on top of a perovskite absorber layer because of difficulties in depositing inorganic materials on top of these fragile absorber layers. However, in comparison to the unstable and expensive organic transport materials, inorganic charge-transport layers provide improved charge transport and stability to the device architecture. Here, we report photovoltaic devices using all-inorganic transport layers in a planar p-i-n junction device configuration using formamidinium lead tribromide (FAPbBr 3) as an absorber. Efficient planar devices are obtained through atomic layer deposition of nickel oxide and sputteredmore » zinc oxide as hole- and electron-transport materials, respectively. Using only inorganic charge-transport layers resulted in planar FAPbBr 3 devices with a power conversion efficiency of 6.75% at an open-circuit voltage of 1.23 V. In conclusion, the transition of planar FAPbBr 3 devices making from all-organic towards all-inorganic charge-transport layers is studied in detail.« less