An Estimation of Hybrid Quantum Mechanical Molecular Mechanical Polarization Energies for Small Molecules Using Polarizable Force-Field Approaches

DOE Office of Scientific and Technical Information (OSTI.GOV)

Huang, Jing; Mei, Ye; König, Gerhard

Here in this work, we report two polarizable molecular mechanics (polMM) force field models for estimating the polarization energy in hybrid quantum mechanical molecular mechanical (QM/MM) calculations. These two models, named the potential of atomic charges (PAC) and potential of atomic dipoles (PAD), are formulated from the ab initio quantum mechanical (QM) response kernels for the prediction of the QM density response to an external molecular mechanical (MM) environment (as described by external point charges). The PAC model is similar to fluctuating charge (FQ) models because the energy depends on external electrostatic potential values at QM atomic sites; the PADmore » energy depends on external electrostatic field values at QM atomic sites, resembling induced dipole (ID) models. To demonstrate their uses, we apply the PAC and PAD models to 12 small molecules, which are solvated by TIP3P water. The PAC model reproduces the QM/MM polarization energy with a R 2 value of 0.71 for aniline (in 10,000 TIP3P water configurations) and 0.87 or higher for other eleven solute molecules, while the PAD model has a much better performance with R 2 values of 0.98 or higher. The PAC model reproduces reference QM/MM hydration free energies for 12 solute molecules with a RMSD of 0.59 kcal/mol. The PAD model is even more accurate, with a much smaller RMSD of 0.12 kcal/mol, with respect to the reference. Lastly, this suggests that polarization effects, including both local charge distortion and intramolecular charge transfer, can be well captured by induced dipole type models with proper parametrization.« less

Like-charge attraction and opposite-charge decomplexation between polymers and DNA molecules

NASA Astrophysics Data System (ADS)

Buyukdagli, Sahin

2017-02-01

We scrutinize the effect of polyvalent ions on polymer-DNA interactions. We extend a recently developed test-charge theory [S. Buyukdagli et al., Phys. Rev. E 94, 042502 (2016), 10.1103/PhysRevE.94.042502] to the case of a stiff polymer interacting with a DNA molecule in an electrolyte mixture. The theory accounts for one-loop level electrostatic correlation effects such as the ionic cloud deformation around the strongly charged DNA molecule as well as image-charge forces induced by the low DNA permittivity. Our model can reproduce and explain various characteristics of the experimental phase diagrams for polymer solutions. First, the addition of polyvalent cations to the electrolyte solution results in the attraction of the negatively charged polymer by the DNA molecule. The glue of the like-charge attraction is the enhanced shielding of the polymer charges by the dense counterion layer at the DNA surface. Second, through the shielding of the DNA-induced electrostatic potential, mono- and polyvalent cations of large concentration both suppress the like-charge attraction. Within the same formalism, we also predict a new opposite-charge repulsion effect between the DNA molecule and a positively charged polymer. In the presence of polyvalent anions such as sulfate or phosphate, their repulsion by the DNA charges leads to the charge screening deficiency of the region around the DNA molecule. This translates into a repulsive force that results in the decomplexation of the polymer from DNA. This opposite-charge repulsion phenomenon can be verified by current experiments and the underlying mechanism can be beneficial to gene therapeutic applications where the control over polymer-DNA interactions is the key factor.

Geometry-dependent distributed polarizability models for the water molecule

DOE Office of Scientific and Technical Information (OSTI.GOV)

Loboda, Oleksandr; Ingrosso, Francesca; Ruiz-López, Manuel F.

2016-01-21

Geometry-dependent distributed polarizability models have been constructed by fits to ab initio calculations at the coupled cluster level of theory with up to noniterative triple excitations in an augmented triple-zeta quality basis set for the water molecule in the field of a point charge. The investigated models include (i) charge-flow polarizabilities between chemically bonded atoms, (ii) isotropic or anisotropic dipolar polarizabilities on oxygen atom or on all atoms, and (iii) combinations of models (i) and (ii). For each model, the polarizability parameters have been optimized to reproduce the induction energy of a water molecule polarized by a point charge successivelymore » occupying a grid of points surrounding the molecule. The quality of the models is ascertained by examining their ability to reproduce these induction energies as well as the molecular dipolar and quadrupolar polarizabilities. The geometry dependence of the distributed polarizability models has been explored by changing bond lengths and HOH angle to generate 125 molecular structures (reduced to 75 symmetry-unique ones). For each considered model, the distributed polarizability components have been fitted as a function of the geometry by a Taylor expansion in monomer coordinate displacements up to the sum of powers equal to 4.« less

Quantum theory of atoms in molecules charge-charge flux-dipole flux models for the infrared intensities of X(2)CY (X = H, F, Cl; Y = O, S) molecules.

PubMed

Faria, Sergio H D M; da Silva, João Viçozo; Haiduke, Roberto L A; Vidal, Luciano N; Vazquez, Pedro A M; Bruns, Roy E

2007-08-16

The molecular dipole moments, their derivatives, and the fundamental IR intensities of the X2CY (X = H, F, Cl; Y = O, S) molecules are determined from QTAIM atomic charges and dipoles and their fluxes at the MP2/6-311++G(3d,3p) level. Root-mean-square errors of +/-0.03 D and +/-1.4 km mol(-1) are found for the molecular dipole moments and fundamental IR intensities calculated using quantum theory of atoms in molecules (QTAIM) parameters when compared with those obtained directly from the MP2/6-311++G(3d,3p) calculations and +/-0.05 D and 51.2 km mol(-1) when compared with the experimental values. Charge (C), charge flux (CF), and dipole flux (DF) contributions are reported for all the normal vibrations of these molecules. A large negative correlation coefficient of -0.83 is calculated between the charge flux and dipole flux contributions and indicates that electronic charge transfer from one side of the molecule to the other during vibrations is accompanied by a relaxation effect with electron density polarization in the opposite direction. The characteristic substituent effect that has been observed for experimental infrared intensity parameters and core electron ionization energies has been applied to the CCFDF/QTAIM parameters of F2CO, Cl2CO, F2CS, and Cl2CS. The individual atomic charge, atomic charge flux, and atomic dipole flux contributions are seen to obey the characteristic substituent effect equation just as accurately as the total dipole moment derivative. The CH, CF, and CCl stretching normal modes of these molecules are shown to have characteristic sets of charge, charge flux, and dipole flux contributions.

Screening of charged impurities as a possible mechanism for conductance change in graphene gas sensing

NASA Astrophysics Data System (ADS)

Liang, Sang-Zi; Chen, Gugang; Harutyunyan, Avetik R.; Sofo, Jorge O.

2014-09-01

In carbon nanotube and graphene gas sensing, the measured conductance change after the sensor is exposed to target molecules has been traditionally attributed to carrier density change due to charge transfer between the sample and the adsorbed molecule. However, this explanation has many problems when it is applied to graphene: The increased amount of Coulomb impurities should lead to decrease in carrier mobility which was not observed in many experiments, carrier density is controlled by the gate voltage in the experimental setup, and there are inconsistencies in the energetics of the charge transfer. In this paper we explore an alternative mechanism. Charged functional groups and dipolar molecules on the surface of graphene may counteract the effect of charged impurities on the substrate. Because scattering of electrons with these charged impurities has been shown to be the limiting factor in graphene conductivity, this leads to significant changes in the transport behavior. A model for the conductivity is established using the random phase approximation dielectric function of graphene and the first-order Born approximation for scattering. The model predicts optimal magnitudes for the charge and dipole moment which maximally screen a given charged impurity. The dipole screening is shown to be generally weaker than the charge screening although the former becomes more effective with higher gate voltage away from the charge neutrality point. The model also predicts that with increasing amount of adsorbates, the charge impurities eventually become saturated and additional adsorption always lead to decreasing conductivity.

Vibronic dephasing model for coherent-to-incoherent crossover in DNA

NASA Astrophysics Data System (ADS)

Karasch, Patrick; Ryndyk, Dmitry A.; Frauenheim, Thomas

2018-05-01

In this paper, we investigate the interplay between coherent and incoherent charge transport in cytosine-guanine (GC-) rich DNA molecules. Our objective is to introduce a physically grounded approach to dephasing in large molecules and to understand the length-dependent charge transport characteristics, and especially the crossover from the coherent tunneling to incoherent hopping regime at different temperatures. Therefore, we apply the vibronic dephasing model and compare the results to the Büttiker probe model which is commonly used to describe decoherence effects in charge transport. Using the full ladder model and simplified one-dimensional model of DNA, we consider molecular junctions with alternating and stacked GC sequences and compare our results to recent experimental measurements.

The structure and properties of a simple model mixture of amphiphilic molecules and ions at a solid surface

NASA Astrophysics Data System (ADS)

Pizio, O.; Sokołowski, S.; Sokołowska, Z.

2014-05-01

We investigate microscopic structure, adsorption, and electric properties of a mixture that consists of amphiphilic molecules and charged hard spheres in contact with uncharged or charged solid surfaces. The amphiphilic molecules are modeled as spheres composed of attractive and repulsive parts. The electrolyte component of the mixture is considered in the framework of the restricted primitive model (RPM). The system is studied using a density functional theory that combines fundamental measure theory for hard sphere mixtures, weighted density approach for inhomogeneous charged hard spheres, and a mean-field approximation to describe anisotropic interactions. Our principal focus is in exploring the effects brought by the presence of ions on the distribution of amphiphilic particles at the wall, as well as the effects of amphiphilic molecules on the electric double layer formed at solid surface. In particular, we have found that under certain thermodynamic conditions a long-range translational and orientational order can develop. The presence of amphiphiles produces changes of the shape of the differential capacitance from symmetric or non-symmetric bell-like to camel-like. Moreover, for some systems the value of the potential of the zero charge is non-zero, in contrast to the RPM at a charged surface.

A simple model of solvent-induced symmetry-breaking charge transfer in excited quadrupolar molecules

NASA Astrophysics Data System (ADS)

Ivanov, Anatoly I.; Dereka, Bogdan; Vauthey, Eric

2017-04-01

A simple model has been developed to describe the symmetry-breaking of the electronic distribution of AL-D-AR type molecules in the excited state, where D is an electron donor and AL and AR are identical acceptors. The origin of this process is usually associated with the interaction between the molecule and the solvent polarization that stabilizes an asymmetric and dipolar state, with a larger charge transfer on one side than on the other. An additional symmetry-breaking mechanism involving the direct Coulomb interaction of the charges on the acceptors is proposed. At the same time, the electronic coupling between the two degenerate states, which correspond to the transferred charge being localised either on AL or AR, favours a quadrupolar excited state with equal amount of charge-transfer on both sides. Because of these counteracting effects, symmetry breaking is only feasible when the electronic coupling remains below a threshold value, which depends on the solvation energy and the Coulomb repulsion energy between the charges located on AL and AR. This model allows reproducing the solvent polarity dependence of the symmetry-breaking reported recently using time-resolved infrared spectroscopy.

Accuracy of free energies of hydration using CM1 and CM3 atomic charges.

PubMed

Udier-Blagović, Marina; Morales De Tirado, Patricia; Pearlman, Shoshannah A; Jorgensen, William L

2004-08-01

Absolute free energies of hydration (DeltaGhyd) have been computed for 25 diverse organic molecules using partial atomic charges derived from AM1 and PM3 wave functions via the CM1 and CM3 procedures of Cramer, Truhlar, and coworkers. Comparisons are made with results using charges fit to the electrostatic potential surface (EPS) from ab initio 6-31G* wave functions and from the OPLS-AA force field. OPLS Lennard-Jones parameters for the organic molecules were used together with the TIP4P water model in Monte Carlo simulations with free energy perturbation theory. Absolute free energies of hydration were computed for OPLS united-atom and all-atom methane by annihilating the solutes in water and in the gas phase, and absolute DeltaGhyd values for all other molecules were computed via transformation to one of these references. Optimal charge scaling factors were determined by minimizing the unsigned average error between experimental and calculated hydration free energies. The PM3-based charge models do not lead to lower average errors than obtained with the EPS charges for the subset of 13 molecules in the original study. However, improvement is obtained by scaling the CM1A partial charges by 1.14 and the CM3A charges by 1.15, which leads to average errors of 1.0 and 1.1 kcal/mol for the full set of 25 molecules. The scaled CM1A charges also yield the best results for the hydration of amides including the E/Z free-energy difference for N-methylacetamide in water. Copyright 2004 Wiley Periodicals, Inc.

Interfacial charge transfer absorption: Application to metal molecule assemblies

NASA Astrophysics Data System (ADS)

Creutz, Carol; Brunschwig, Bruce S.; Sutin, Norman

2006-05-01

Optically induced charge transfer between adsorbed molecules and a metal electrode was predicted by Hush to lead to new electronic absorption features, but has been only rarely observed experimentally. Interfacial charge transfer absorption (IFCTA) provides information concerning the barriers to charge transfer between molecules and the metal/semiconductor and the magnitude of the electronic coupling and could thus provide a powerful tool for understanding interfacial charge-transfer kinetics. Here, we utilize a previously published model [C. Creutz, B.S. Brunschwig, N. Sutin, J. Phys. Chem. B 109 (2005) 10251] to predict IFCTA spectra of metal-molecule assemblies and compare the literature observations to these predictions. We conclude that, in general, the electronic coupling between molecular adsorbates and the metal levels is so small that IFCTA is not detectable. However, few experiments designed to detect IFCTA have been done. We suggest approaches to optimizing the conditions for observing the process.

Geometry-dependent atomic multipole models for the water molecule.

PubMed

Loboda, O; Millot, C

2017-10-28

Models of atomic electric multipoles for the water molecule have been optimized in order to reproduce the electric potential around the molecule computed by ab initio calculations at the coupled cluster level of theory with up to noniterative triple excitations in an augmented triple-zeta quality basis set. Different models of increasing complexity, from atomic charges up to models containing atomic charges, dipoles, and quadrupoles, have been obtained. The geometry dependence of these atomic multipole models has been investigated by changing bond lengths and HOH angle to generate 125 molecular structures (reduced to 75 symmetry-unique ones). For several models, the atomic multipole components have been fitted as a function of the geometry by a Taylor series of fourth order in monomer coordinate displacements.

Geometry-dependent atomic multipole models for the water molecule

NASA Astrophysics Data System (ADS)

Loboda, O.; Millot, C.

2017-10-01

Models of atomic electric multipoles for the water molecule have been optimized in order to reproduce the electric potential around the molecule computed by ab initio calculations at the coupled cluster level of theory with up to noniterative triple excitations in an augmented triple-zeta quality basis set. Different models of increasing complexity, from atomic charges up to models containing atomic charges, dipoles, and quadrupoles, have been obtained. The geometry dependence of these atomic multipole models has been investigated by changing bond lengths and HOH angle to generate 125 molecular structures (reduced to 75 symmetry-unique ones). For several models, the atomic multipole components have been fitted as a function of the geometry by a Taylor series of fourth order in monomer coordinate displacements.

Polarizable Force Fields and Polarizable Continuum Model: A Fluctuating Charges/PCM Approach. 1. Theory and Implementation.

PubMed

Lipparini, Filippo; Barone, Vincenzo

2011-11-08

We present a combined fluctuating charges-polarizable continuum model approach to describe molecules in solution. Both static and dynamic approaches are discussed: analytical first and second derivatives are shown as well as an extended lagrangian for molecular dynamics simluations. In particular, we use the polarizable continuum model to provide nonperiodic boundary conditions for molecular dynamics simulations of aqueous solutions. The extended lagrangian method is extensively discussed, with specific reference to the fluctuating charge model, from a numerical point of view by means of several examples, and a rationalization of the behavior found is presented. Several prototypical applications are shown, especially regarding solvation of ions and polar molecules in water.

A theoretical-electron-density databank using a model of real and virtual spherical atoms.

PubMed

Nassour, Ayoub; Domagala, Slawomir; Guillot, Benoit; Leduc, Theo; Lecomte, Claude; Jelsch, Christian

2017-08-01

A database describing the electron density of common chemical groups using combinations of real and virtual spherical atoms is proposed, as an alternative to the multipolar atom modelling of the molecular charge density. Theoretical structure factors were computed from periodic density functional theory calculations on 38 crystal structures of small molecules and the charge density was subsequently refined using a density model based on real spherical atoms and additional dummy charges on the covalent bonds and on electron lone-pair sites. The electron-density parameters of real and dummy atoms present in a similar chemical environment were averaged on all the molecules studied to build a database of transferable spherical atoms. Compared with the now-popular databases of transferable multipolar parameters, the spherical charge modelling needs fewer parameters to describe the molecular electron density and can be more easily incorporated in molecular modelling software for the computation of electrostatic properties. The construction method of the database is described. In order to analyse to what extent this modelling method can be used to derive meaningful molecular properties, it has been applied to the urea molecule and to biotin/streptavidin, a protein/ligand complex.

Photoinduced charge transfer from vacuum-deposited molecules to single-layer transition metal dichalcogenides

NASA Astrophysics Data System (ADS)

Osada, Kazuki; Tanaka, Masatoshi; Ohno, Shinya; Suzuki, Takanori

2016-06-01

Variations of photoluminescence (PL) and Raman spectra of single-layer MoS2, MoSe2, WS2, and WSe2 due to the vacuum deposition of C60 or copper phthalocyanine (CuPc) molecules have been investigated. PL spectra are decomposed into two competitive components, an exciton and a charged exciton (trion), depending on carrier density. The variation of PL spectra is interpreted in terms of charge transfer across the interfaces between transition metal dichalcogenides (TMDs) and dopant molecules. We find that deposited C60 molecules inject photoexcited electrons into MoS2, MoSe2, and WS2 or holes into WSe2. CuPc molecules also inject electrons into MoS2, MoSe2, and WS2, while holes are depleted from WSe2 to CuPc. We then propose a band alignment between TMDs and dopant molecules. Peak shifts of Raman spectra and doped carrier density estimated using a three-level model also support the band alignment. We thus demonstrate photoinduced charge transfer from dopant molecules to single-layer TMDs.

Influence of charge on encapsulation and release behavior of small molecules in self-assembled layer-by-layer microcapsules.

PubMed

Mandapalli, Praveen K; Labala, Suman; Vanamala, Deekshith; Koranglekar, Manali P; Sakimalla, Lakshmi A; Venuganti, Venkata Vamsi K

2014-12-01

The objective of this study is to investigate the influence of charge of model small molecules on their encapsulation and release behavior in layer-by-layer microcapsules (LbL-MC). Poly(styrene sulfonate) and poly(ethylene imine) were sequentially adsorbed on calcium carbonate sacrificial templates to prepare LbL-MC. Model molecules with varying charge, anionic - ascorbic acid, cationic - imatinib mesylate (IM) and neutral - 5-fluorouracil were encapsulated in LbL-MC. Free and encapsulated LbL-MC were characterized using zetasizer, FTIR spectroscope and differential scanning calorimeter. The influence of IM-loaded LbL-MC on cell viability was studied in B16F10 murine melanoma cells. Furthermore, biodistribution of IM-loaded LbL-MC with and without PEGylation was studied in BALB/c mice. Results showed spherical LbL-MC of 3.0 ± 0.4 μm diameter. Encapsulation efficiency of LbL-MC increased linearly (R(2 )= 0.89-0.99) with the increase in solute concentration. Increase in pH from 2 to 6 increased the encapsulation of charged molecules in LbL-MC. Charged molecules showed greater encapsulation efficiency in LbL-MC compared with neutral molecule. In vitro release kinetics showed Fickian and non-Fickian diffusion of small molecules, depending on the nature of molecular interactions with LbL-MC. At 50 μM concentration, free IM showed significantly (p < 0.05) more cytotoxicity compared with IM-loaded LbL-MC. Biodistribution studies showed that PEGylation of LbL-MC decreased the liver and spleen uptake of IM-encapsulated LbL-MC. In conclusion, LbL-MC can be developed as a potential carrier for small molecules depending on their physical and chemical properties.

Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

NASA Astrophysics Data System (ADS)

Sinurat, E. N.; Yudiarsah, E.

2017-07-01

The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

Calculating Henry’s Constants of Charged Molecules Using SPARC

EPA Science Inventory

SPARC Performs Automated Reasoning in Chemistry is a computer program designed to model physical and chemical properties of molecules solely based on thier chemical structure. SPARC uses a toolbox of mechanistic perturbation models to model intermolecular interactions. SPARC has ...

Communication: Modeling of concentration dependent water diffusivity in ionic solutions: Role of intermolecular charge transfer

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yao, Yi; Berkowitz, Max L., E-mail: maxb@unc.edu, E-mail: ykanai@unc.edu; Kanai, Yosuke, E-mail: maxb@unc.edu, E-mail: ykanai@unc.edu

2015-12-28

The translational diffusivity of water in solutions of alkali halide salts depends on the identity of ions, exhibiting dramatically different behavior even in solutions of similar salts of NaCl and KCl. The water diffusion coefficient decreases as the salt concentration increases in NaCl. Yet, in KCl solution, it slightly increases and remains above bulk value as salt concentration increases. Previous classical molecular dynamics simulations have failed to describe this important behavior even when polarizable models were used. Here, we show that inclusion of dynamical charge transfer among water molecules produces results in a quantitative agreement with experiments. Our results indicatemore » that the concentration-dependent diffusivity reflects the importance of many-body effects among the water molecules in aqueous ionic solutions. Comparison with quantum mechanical calculations shows that a heterogeneous and extended distribution of charges on water molecules around the ions due to ion-water and also water-water charge transfer plays a very important role in controlling water diffusivity. Explicit inclusion of the charge transfer allows us to model accurately the difference in the concentration-dependent water diffusivity between Na{sup +} and K{sup +} ions in simulations, and it is likely to impact modeling of a wide range of systems for medical and technological applications.« less

Preserving Charge and Oxidation State of Au(III) Ions in an Agent-Functionalized Nanocrystal Model System

PubMed Central

2011-01-01

Supporting functional molecules on crystal facets is an established technique in nanotechnology. To preserve the original activity of ionic metallorganic agents on a supporting template, conservation of the charge and oxidation state of the active center is indispensable. We present a model system of a metallorganic agent that, indeed, fulfills this design criterion on a technologically relevant metal support with potential impact on Au(III)-porphyrin-functionalized nanoparticles for an improved anticancer-drug delivery. Employing scanning tunneling microscopy and -spectroscopy in combination with photoemission spectroscopy, we clarify at the single-molecule level the underlying mechanisms of this exceptional adsorption mode. It is based on the balance between a high-energy oxidation state and an electrostatic screening-response of the surface (image charge). Modeling with first principles methods reveals submolecular details of the metal–ligand bonding interaction and completes the study by providing an illustrative electrostatic model relevant for ionic metalorganic agent molecules, in general. PMID:21736315

Effects of Acids, Bases, and Heteroatoms on Proximal Radial Distribution Functions for Proteins.

PubMed

Nguyen, Bao Linh; Pettitt, B Montgomery

2015-04-14

The proximal distribution of water around proteins is a convenient method of quantifying solvation. We consider the effect of charged and sulfur-containing amino acid side-chain atoms on the proximal radial distribution function (pRDF) of water molecules around proteins using side-chain analogs. The pRDF represents the relative probability of finding any solvent molecule at a distance from the closest or surface perpendicular protein atom. We consider the near-neighbor distribution. Previously, pRDFs were shown to be universal descriptors of the water molecules around C, N, and O atom types across hundreds of globular proteins. Using averaged pRDFs, a solvent density around any globular protein can be reconstructed with controllable relative error. Solvent reconstruction using the additional information from charged amino acid side-chain atom types from both small models and protein averages reveals the effects of surface charge distribution on solvent density and improves the reconstruction errors relative to simulation. Solvent density reconstructions from the small-molecule models are as effective and less computationally demanding than reconstructions from full macromolecular models in reproducing preferred hydration sites and solvent density fluctuations.

On contribution of known atomic partial charges of protein backbone in electrostatic potential density maps.

PubMed

Wang, Jimin

2017-06-01

Partial charges of atoms in a molecule and electrostatic potential (ESP) density for that molecule are known to bear a strong correlation. In order to generate a set of point-field force field parameters for molecular dynamics, Kollman and coworkers have extracted atomic partial charges for each of all 20 amino acids using restrained partial charge-fitting procedures from theoretical ESP density obtained from condensed-state quantum mechanics. The magnitude of atomic partial charges for neutral peptide backbone they have obtained is similar to that of partial atomic charges for ionized carboxylate side chain atoms. In this study, the effect of these known atomic partial charges on ESP is examined using computer simulations and compared with the experimental ESP density recently obtained for proteins using electron microscopy. It is found that the observed ESP density maps are most consistent with the simulations that include atomic partial charges of protein backbone. Therefore, atomic partial charges are integral part of atomic properties in protein molecules and should be included in model refinement. © 2017 The Protein Society.

Insulator charging limits direct current across tunneling metal-insulator-semiconductor junctions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vilan, Ayelet

Molecular electronics studies how the molecular nature affects the probability of charge carriers to tunnel through the molecules. Nevertheless, transport is also critically affected by the contacts to the molecules, an aspect that is often overlooked. Specifically, the limited ability of non-metallic contacts to maintain the required charge balance across the fairly insulating molecule often have dramatic effects. This paper shows that in the case of lead/organic monolayer-silicon junctions, a charge balance is responsible for an unusual current scaling, with the junction diameter (perimeter), rather than its area. This is attributed to the balance between the 2D charging at themore » metal/insulator interface and the 3D charging of the semiconductor space-charge region. A derivative method is developed to quantify transport across tunneling metal-insulator-semiconductor junctions; this enables separating the tunneling barrier from the space-charge barrier for a given current-voltage curve, without complementary measurements. The paper provides practical tools to analyze specific molecular junctions compatible with existing silicon technology, and demonstrates the importance of contacts' physics in modeling charge transport across molecular junctions.« less

Directional rolling of positively charged nanoparticles along a flexibility gradient on long DNA molecules.

PubMed

Park, Suehyun; Joo, Heesun; Kim, Jun Soo

2018-01-31

Directing the motion of molecules/colloids in any specific direction is of great interest in many applications of chemistry, physics, and biological sciences, where regulated positioning or transportation of materials is highly desired. Using Brownian dynamics simulations of coarse-grained models of a long, double-stranded DNA molecule and positively charged nanoparticles, we observed that the motion of a single nanoparticle bound to and wrapped by the DNA molecule can be directed along a gradient of DNA local flexibility. The flexibility gradient is constructed along a 0.8 kilobase-pair DNA molecule such that local persistence length decreases gradually from 50 nm to 40 nm, mimicking a gradual change in sequence-dependent flexibility. Nanoparticles roll over a long DNA molecule from less flexible regions towards more flexible ones as a result of the decreasing energetic cost of DNA bending and wrapping. In addition, the rolling becomes slightly accelerated as the positive charge of nanoparticles decreases due to a lower free energy barrier of DNA detachment from charged nanoparticle for processive rolling. This study suggests that the variation in DNA local flexibility can be utilized in constructing and manipulating supramolecular assemblies of DNA molecules and nanoparticles in structural DNA nanotechnology.

The R.E.D. tools: advances in RESP and ESP charge derivation and force field library building.

PubMed

Dupradeau, François-Yves; Pigache, Adrien; Zaffran, Thomas; Savineau, Corentin; Lelong, Rodolphe; Grivel, Nicolas; Lelong, Dimitri; Rosanski, Wilfried; Cieplak, Piotr

2010-07-28

Deriving atomic charges and building a force field library for a new molecule are key steps when developing a force field required for conducting structural and energy-based analysis using molecular mechanics. Derivation of popular RESP charges for a set of residues is a complex and error prone procedure because it depends on numerous input parameters. To overcome these problems, the R.E.D. Tools (RESP and ESP charge Derive, ) have been developed to perform charge derivation in an automatic and straightforward way. The R.E.D. program handles chemical elements up to bromine in the periodic table. It interfaces different quantum mechanical programs employed for geometry optimization and computing molecular electrostatic potential(s), and performs charge fitting using the RESP program. By defining tight optimization criteria and by controlling the molecular orientation of each optimized geometry, charge values are reproduced at any computer platform with an accuracy of 0.0001 e. The charges can be fitted using multiple conformations, making them suitable for molecular dynamics simulations. R.E.D. allows also for defining charge constraints during multiple molecule charge fitting, which are used to derive charges for molecular fragments. Finally, R.E.D. incorporates charges into a force field library, readily usable in molecular dynamics computer packages. For complex cases, such as a set of homologous molecules belonging to a common family, an entire force field topology database is generated. Currently, the atomic charges and force field libraries have been developed for more than fifty model systems and stored in the RESP ESP charge DDataBase. Selected results related to non-polarizable charge models are presented and discussed.

On the origin of the electrostatic potential difference at a liquid-vacuum interface.

PubMed

Harder, Edward; Roux, Benoît

2008-12-21

The microscopic origin of the interface potential calculated from computer simulations is elucidated by considering a simple model of molecules near an interface. The model posits that molecules are isotropically oriented and their charge density is Gaussian distributed. Molecules that have a charge density that is more negative toward their interior tend to give rise to a negative interface potential relative to the gaseous phase, while charge densities more positive toward their interior give rise to a positive interface potential. The interface potential for the model is compared to the interface potential computed from molecular dynamics simulations of the nonpolar vacuum-methane system and the polar vacuum-water interface system. The computed vacuum-methane interface potential from a molecular dynamics simulation (-220 mV) is captured with quantitative precision by the model. For the vacuum-water interface system, the model predicts a potential of -400 mV compared to -510 mV, calculated from a molecular dynamics simulation. The physical implications of this isotropic contribution to the interface potential is examined using the example of ion solvation in liquid methane.

On contribution of known atomic partial charges of protein backbone in electrostatic potential density maps

PubMed Central

2017-01-01

Abstract Partial charges of atoms in a molecule and electrostatic potential (ESP) density for that molecule are known to bear a strong correlation. In order to generate a set of point‐field force field parameters for molecular dynamics, Kollman and coworkers have extracted atomic partial charges for each of all 20 amino acids using restrained partial charge‐fitting procedures from theoretical ESP density obtained from condensed‐state quantum mechanics. The magnitude of atomic partial charges for neutral peptide backbone they have obtained is similar to that of partial atomic charges for ionized carboxylate side chain atoms. In this study, the effect of these known atomic partial charges on ESP is examined using computer simulations and compared with the experimental ESP density recently obtained for proteins using electron microscopy. It is found that the observed ESP density maps are most consistent with the simulations that include atomic partial charges of protein backbone. Therefore, atomic partial charges are integral part of atomic properties in protein molecules and should be included in model refinement. PMID:28370507

The dynamics of charge transfer with and without a barrier: A very simplified model of cyclic voltammetry.

PubMed

Ouyang, Wenjun; Subotnik, Joseph E

2017-05-07

Using the Anderson-Holstein model, we investigate charge transfer dynamics between a molecule and a metal surface for two extreme cases. (i) With a large barrier, we show that the dynamics follow a single exponential decay as expected; (ii) without any barrier, we show that the dynamics are more complicated. On the one hand, if the metal-molecule coupling is small, single exponential dynamics persist. On the other hand, when the coupling between the metal and the molecule is large, the dynamics follow a biexponential decay. We analyze the dynamics using the Smoluchowski equation, develop a simple model, and explore the consequences of biexponential dynamics for a hypothetical cyclic voltammetry experiment.

Chirality-induced spin polarization places symmetry constraints on biomolecular interactions.

PubMed

Kumar, Anup; Capua, Eyal; Kesharwani, Manoj K; Martin, Jan M L; Sitbon, Einat; Waldeck, David H; Naaman, Ron

2017-03-07

Noncovalent interactions between molecules are key for many biological processes. Necessarily, when molecules interact, the electronic charge in each of them is redistributed. Here, we show experimentally that, in chiral molecules, charge redistribution is accompanied by spin polarization. We describe how this spin polarization adds an enantioselective term to the forces, so that homochiral interaction energies differ from heterochiral ones. The spin polarization was measured by using a modified Hall effect device. An electric field that is applied along the molecules causes charge redistribution, and for chiral molecules, a Hall voltage is measured that indicates the spin polarization. Based on this observation, we conjecture that the spin polarization enforces symmetry constraints on the biorecognition process between two chiral molecules, and we describe how these constraints can lead to selectivity in the interaction between enantiomers based on their handedness. Model quantum chemistry calculations that rigorously enforce these constraints show that the interaction energy for methyl groups on homochiral molecules differs significantly from that found for heterochiral molecules at van der Waals contact and shorter (i.e., ∼0.5 kcal/mol at 0.26 nm).

Particle transport through hydrogels is charge asymmetric.

PubMed

Zhang, Xiaolu; Hansing, Johann; Netz, Roland R; DeRouchey, Jason E

2015-02-03

Transport processes within biological polymer networks, including mucus and the extracellular matrix, play an important role in the human body, where they serve as a filter for the exchange of molecules and nanoparticles. Such polymer networks are complex and heterogeneous hydrogel environments that regulate diffusive processes through finely tuned particle-network interactions. In this work, we present experimental and theoretical studies to examine the role of electrostatics on the basic mechanisms governing the diffusion of charged probe molecules inside model polymer networks. Translational diffusion coefficients are determined by fluorescence correlation spectroscopy measurements for probe molecules in uncharged as well as cationic and anionic polymer solutions. We show that particle transport in the charged hydrogels is highly asymmetric, with diffusion slowed down much more by electrostatic attraction than by repulsion, and that the filtering capability of the gel is sensitive to the solution ionic strength. Brownian dynamics simulations of a simple model are used to examine key parameters, including interaction strength and interaction range within the model networks. Simulations, which are in quantitative agreement with our experiments, reveal the charge asymmetry to be due to the sticking of particles at the vertices of the oppositely charged polymer networks. Copyright © 2015 Biophysical Society. Published by Elsevier Inc. All rights reserved.

Adsorption of a cationic dye molecule on polystyrene microspheres in colloids: effect of surface charge and composition probed by second harmonic generation.

PubMed

Eckenrode, Heather M; Jen, Shih-Hui; Han, Jun; Yeh, An-Gong; Dai, Hai-Lung

2005-03-17

Nonlinear optical probe, second harmonic generation (SHG), of the adsorption of the dye molecule malachite green (MG), in cationic form at pH < or = 5, on polystyrene microspheres in aqueous solution is used to study the effect of surface charge and composition on molecular adsorption. Three types of polystyrene microspheres with different surface composition are investigated: (1) a sulfate terminated, anionic surface, (2) a neutral surface without any functional group termination, and (3) an amine terminated, cationic surface. The cationic dye was found to adsorb at all three surfaces, regardless of surface charge. The adsorption free energies, DeltaG's, measured for the three surfaces are -12.67, -12.39, and -10.46 kcal/mol, respectively, with the trend as expected from the charge interactions. The adsorption density on the anionic surface, where attractive charge-charge interaction dominates, is determined by the surface negative charge density. The adsorption densities on the neutral and cationic surfaces are on the other hand higher, perhaps as a result of a balance between minimizing repulsive charge interaction and maximizing attractive molecule-substrate and intermolecular interactions. The relative strength of the SH intensity per molecule, in combination of a model calculation, reveals that the C(2) axis of the MG molecule is nearly perpendicular to the surface on the anionic surface and tilts away from the surface norm when the surface is neutral and further away when cationic. Changing the pH of the solution may alter the surface charge and subsequently affect the adsorption configuration and SH intensity.

Accurate on-chip measurement of the Seebeck coefficient of high mobility small molecule organic semiconductors

NASA Astrophysics Data System (ADS)

Warwick, C. N.; Venkateshvaran, D.; Sirringhaus, H.

2015-09-01

We present measurements of the Seebeck coefficient in two high mobility organic small molecules, 2,7-dioctyl[1]benzothieno[3,2-b][1]benzothiophene (C8-BTBT) and 2,9-didecyl-dinaphtho[2,3-b:2',3'-f]thieno[3,2-b]thiophene (C10-DNTT). The measurements are performed in a field effect transistor structure with high field effect mobilities of approximately 3 cm2/V s. This allows us to observe both the charge concentration and temperature dependence of the Seebeck coefficient. We find a strong logarithmic dependence upon charge concentration and a temperature dependence within the measurement uncertainty. Despite performing the measurements on highly polycrystalline evaporated films, we see an agreement in the Seebeck coefficient with modelled values from Shi et al. [Chem. Mater. 26, 2669 (2014)] at high charge concentrations. We attribute deviations from the model at lower charge concentrations to charge trapping.

Charge transfer in dissociating iodomethane and fluoromethane molecules ionized by intense femtosecond X-ray pulses

PubMed Central

Boll, Rebecca; Erk, Benjamin; Coffee, Ryan; Trippel, Sebastian; Kierspel, Thomas; Bomme, Cédric; Bozek, John D.; Burkett, Mitchell; Carron, Sebastian; Ferguson, Ken R.; Foucar, Lutz; Küpper, Jochen; Marchenko, Tatiana; Miron, Catalin; Patanen, Minna; Osipov, Timur; Schorb, Sebastian; Simon, Marc; Swiggers, Michelle; Techert, Simone; Ueda, Kiyoshi; Bostedt, Christoph; Rolles, Daniel; Rudenko, Artem

2016-01-01

Ultrafast electron transfer in dissociating iodomethane and fluoromethane molecules was studied at the Linac Coherent Light Source free-electron laser using an ultraviolet-pump, X-ray-probe scheme. The results for both molecules are discussed with respect to the nature of their UV excitation and different chemical properties. Signatures of long-distance intramolecular charge transfer are observed for both species, and a quantitative analysis of its distance dependence in iodomethane is carried out for charge states up to I21+. The reconstructed critical distances for electron transfer are in good agreement with a classical over-the-barrier model and with an earlier experiment employing a near-infrared pump pulse. PMID:27051675

Combinatorial effects of charge characteristics and hydrophobicity of silk fibroin on the sorption and release of charged dyes.

PubMed

Wongpanit, Panya; Rujiravanit, Ratana

2012-01-01

The present study was designed to examine the influence of the charge characteristics of silk fibroin on the sorption and release of charged dyes by varying the pH values of the sorption and release media as well as types of charged dyes. Negatively charged dyes (phenol red and chromotrope 2R) and positively charged dyes (crystal violet and indoine blue) were used as the model compounds. Silk fibroin films were prepared by using a solution casting technique. The prepared films were then treated with an aqueous methanol solution or annealed with water to control their conformation. The sorption behavior of the model compounds made by the methanol-treated and water-annealed silk fibroin films was investigated. Compared to the water- annealed silk fibroin films, a higher hydrophobicity of the methanol-treated silk fibroin films caused a higher sorption of the hydrophobic dyes. The dye molecules had a fairly high affinity to the silk fibroin film, even though the dye and the matrix possessed the same charge. However, in the presence of two charged groups in a single dye molecule, the electrostatic repulsion become more dominant. Stronger interaction was observed when the charges of the film and the dye were opposite. The results of dye sorption and release experiments showed that the degree of synergism or competition between electrostatic and hydrophobic interactions directly depended on the charges and chemical structure of the dye molecules and the environmental pH conditions of the existing silk fibroin film.

Polarization and charge transfer in the hydration of chloride ions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhao Zhen; Rogers, David M.; Beck, Thomas L.

2010-01-07

A theoretical study of the structural and electronic properties of the chloride ion and water molecules in the first hydration shell is presented. The calculations are performed on an ensemble of configurations obtained from molecular dynamics simulations of a single chloride ion in bulk water. The simulations utilize the polarizable AMOEBA force field for trajectory generation and MP2-level calculations are performed to examine the electronic structure properties of the ions and surrounding waters in the external field of more distant waters. The ChelpG method is employed to explore the effective charges and dipoles on the chloride ions and first-shell waters.more » The quantum theory of atoms in molecules (QTAIM) is further utilized to examine charge transfer from the anion to surrounding water molecules. The clusters extracted from the AMOEBA simulations exhibit high probabilities of anisotropic solvation for chloride ions in bulk water. From the QTAIM analysis, 0.2 elementary charges are transferred from the ion to the first-shell water molecules. The default AMOEBA model overestimates the average dipole moment magnitude of the ion compared to the quantum mechanical value. The average magnitude of the dipole moment of the water molecules in the first shell treated at the MP2-level, with the more distant waters handled with an AMOEBA effective charge model, is 2.67 D. This value is close to the AMOEBA result for first-shell waters (2.72 D) and is slightly reduced from the bulk AMOEBA value (2.78 D). The magnitude of the dipole moment of the water molecules in the first solvation shell is most strongly affected by the local water-water interactions and hydrogen bonds with the second solvation shell, rather than by interactions with the ion.« less

Effects of Acids, Bases, and Heteroatoms on Proximal Radial Distribution Functions for Proteins

PubMed Central

Nguyen, Bao Linh; Pettitt, B. Montgomery

2015-01-01

The proximal distribution of water around proteins is a convenient method of quantifying solvation. We consider the effect of charged and sulfur-containing amino acid side-chain atoms on the proximal radial distribution function (pRDF) of water molecules around proteins using side-chain analogs. The pRDF represents the relative probability of finding any solvent molecule at a distance from the closest or surface perpendicular protein atom. We consider the near-neighbor distribution. Previously, pRDFs were shown to be universal descriptors of the water molecules around C, N, and O atom types across hundreds of globular proteins. Using averaged pRDFs, a solvent density around any globular protein can be reconstructed with controllable relative error. Solvent reconstruction using the additional information from charged amino acid side-chain atom types from both small models and protein averages reveals the effects of surface charge distribution on solvent density and improves the reconstruction errors relative to simulation. Solvent density reconstructions from the small-molecule models are as effective and less computationally demanding than reconstructions from full macromolecular models in reproducing preferred hydration sites and solvent density fluctuations. PMID:26388706

AtomicChargeCalculator: interactive web-based calculation of atomic charges in large biomolecular complexes and drug-like molecules.

PubMed

Ionescu, Crina-Maria; Sehnal, David; Falginella, Francesco L; Pant, Purbaj; Pravda, Lukáš; Bouchal, Tomáš; Svobodová Vařeková, Radka; Geidl, Stanislav; Koča, Jaroslav

2015-01-01

Partial atomic charges are a well-established concept, useful in understanding and modeling the chemical behavior of molecules, from simple compounds, to large biomolecular complexes with many reactive sites. This paper introduces AtomicChargeCalculator (ACC), a web-based application for the calculation and analysis of atomic charges which respond to changes in molecular conformation and chemical environment. ACC relies on an empirical method to rapidly compute atomic charges with accuracy comparable to quantum mechanical approaches. Due to its efficient implementation, ACC can handle any type of molecular system, regardless of size and chemical complexity, from drug-like molecules to biomacromolecular complexes with hundreds of thousands of atoms. ACC writes out atomic charges into common molecular structure files, and offers interactive facilities for statistical analysis and comparison of the results, in both tabular and graphical form. Due to high customizability and speed, easy streamlining and the unified platform for calculation and analysis, ACC caters to all fields of life sciences, from drug design to nanocarriers. ACC is freely available via the Internet at http://ncbr.muni.cz/ACC.

Link between hopping models and percolation scaling laws for charge transport in mixtures of small molecules

DOE PAGES

Ha, Dong -Gwang; Kim, Jang -Joo; Baldo, Marc A.

2016-04-29

Mixed host compositions that combine charge transport materials with luminescent dyes offer superior control over exciton formation and charge transport in organic light emitting devices (OLEDs). Two approaches are typically used to optimize the fraction of charge transport materials in a mixed host composition: either an empirical percolative model, or a hopping transport model. We show that these two commonly-employed models are linked by an analytic expression which relates the localization length to the percolation threshold and critical exponent. The relation is confirmed both numerically and experimentally through measurements of the relative conductivity of Tris(4-carbazoyl-9-ylphenyl) amine (TCTA) :1,3-bis(3,5-dipyrid-3-yl-phenyl) benzene (BmPyPb)more » mixtures with different concentrations, where the TCTA plays a role as hole conductor and the BmPyPb as hole insulator. Furthermore, the analytic relation may allow the rational design of mixed layers of small molecules for high-performance OLEDs.« less

Link between hopping models and percolation scaling laws for charge transport in mixtures of small molecules

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ha, Dong-Gwang; Kim, Jang-Joo; Baldo, Marc A.

2016-04-01

Mixed host compositions that combine charge transport materials with luminescent dyes offer superior control over exciton formation and charge transport in organic light emitting devices (OLEDs). Two approaches are typically used to optimize the fraction of charge transport materials in a mixed host composition: either an empirical percolative model, or a hopping transport model. We show that these two commonly-employed models are linked by an analytic expression which relates the localization length to the percolation threshold and critical exponent. The relation is confirmed both numerically and experimentally through measurements of the relative conductivity of Tris(4-carbazoyl-9-ylphenyl)amine (TCTA) :1,3-bis(3,5-dipyrid-3-yl-phenyl)benzene (BmPyPb) mixtures withmore » different concentrations, where the TCTA plays a role as hole conductor and the BmPyPb as hole insulator. The analytic relation may allow the rational design of mixed layers of small molecules for high-performance OLEDs.« less

Plasmon enhanced heterogeneous electron transfer with continuous band energy model

NASA Astrophysics Data System (ADS)

Zhao, Dandan; Niu, Lu; Wang, Luxia

2017-08-01

Photoinduced charge injection from a perylene dye molecule into the conduction band of a TiO2 system decorated by a metal nanoparticles (MNP) is studied theoretically. Utilizing the density matrix theory the charge transfer dynamics is analyzed. The continuous behavior of the TiO2 conduction band is accounted for by a Legendre polynomials expansion. The simulations consider optical excitation of the dye molecule coupled to the MNP and the subsequent electron injection into the TiO2 semiconductor. Due to the energy transfer coupling between the molecule and the MNP optical excitation and subsequent charge injection into semiconductor is strongly enhanced. The respective enhancement factor can reach values larger than 103. Effects of pulse duration, coupling strength and energetic resonances are also analyzed. The whole approach offers an efficient way to increase charge injection in dye-sensitized solar cells.

Profiles of equilibrium constants for self-association of aromatic molecules

NASA Astrophysics Data System (ADS)

Beshnova, Daria A.; Lantushenko, Anastasia O.; Davies, David B.; Evstigneev, Maxim P.

2009-04-01

Analysis of the noncovalent, noncooperative self-association of identical aromatic molecules assumes that the equilibrium self-association constants are either independent of the number of molecules (the EK-model) or change progressively with increasing aggregation (the AK-model). The dependence of the self-association constant on the number of molecules in the aggregate (i.e., the profile of the equilibrium constant) was empirically derived in the AK-model but, in order to provide some physical understanding of the profile, it is proposed that the sources for attenuation of the equilibrium constant are the loss of translational and rotational degrees of freedom, the ordering of molecules in the aggregates and the electrostatic contribution (for charged units). Expressions are derived for the profiles of the equilibrium constants for both neutral and charged molecules. Although the EK-model has been widely used in the analysis of experimental data, it is shown in this work that the derived equilibrium constant, KEK, depends on the concentration range used and hence, on the experimental method employed. The relationship has also been demonstrated between the equilibrium constant KEK and the real dimerization constant, KD, which shows that the value of KEK is always lower than KD.

Controlling molecular condensation/diffusion of copper phthalocyanine by local electric field induced with scanning tunneling microscope tip

NASA Astrophysics Data System (ADS)

Nagaoka, Katsumi; Yaginuma, Shin; Nakayama, Tomonobu

2018-02-01

We have discovered the condensation/diffusion phenomena of copper phthalocyanine (CuPc) molecules controlled with a pulsed electric field induced by the scanning tunneling microscope tip. This behavior is not explained by the conventional induced dipole model. In order to understand the mechanism, we have measured the electronic structure of the molecule by tunneling spectroscopy and also performed theoretical calculations on molecular orbitals. These data clearly indicate that the molecule is positively charged owing to charge transfer to the substrate, and that hydrogen bonding exists between CuPc molecules, which makes the molecular island stable.

Simple Model for the Benzene Hexafluorobenzene Interaction

DOE PAGES

Tillack, Andreas F.; Robinson, Bruce H.

2017-06-05

While the experimental intermolecular distance distribution functions of pure benzene and pure hexafluorobenzene are well described by transferable all-atom force fields, the interaction between the two molecules (in a 1:1 mixture) is not well simulated. We demonstrate that the parameters of the transferable force fields are adequate to describe the intermolecular distance distribution if the charges are replaced by a set of charges that are not located at the atoms. Here, the simplest model that well describes the experimental distance distribution, between benzene and hexafluorobenzene, is that of a single ellipsoid for each molecule, representing the van der Waals interactions,more » and a set of three point charges (on the axis perpendicular to the arene plane) which give the same quadrupole moment as do the all atom charges from the transferable force fields.« less

Simple Model for the Benzene Hexafluorobenzene Interaction

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tillack, Andreas F.; Robinson, Bruce H.

While the experimental intermolecular distance distribution functions of pure benzene and pure hexafluorobenzene are well described by transferable all-atom force fields, the interaction between the two molecules (in a 1:1 mixture) is not well simulated. We demonstrate that the parameters of the transferable force fields are adequate to describe the intermolecular distance distribution if the charges are replaced by a set of charges that are not located at the atoms. Here, the simplest model that well describes the experimental distance distribution, between benzene and hexafluorobenzene, is that of a single ellipsoid for each molecule, representing the van der Waals interactions,more » and a set of three point charges (on the axis perpendicular to the arene plane) which give the same quadrupole moment as do the all atom charges from the transferable force fields.« less

Computational modeling of chemical reactions and interstitial growth and remodeling involving charged solutes and solid-bound molecules

PubMed Central

Nims, Robert J.; Maas, Steve; Weiss, Jeffrey A.

2014-01-01

Mechanobiological processes are rooted in mechanics and chemistry, and such processes may be modeled in a framework that couples their governing equations starting from fundamental principles. In many biological applications, the reactants and products of chemical reactions may be electrically charged, and these charge effects may produce driving forces and constraints that significantly influence outcomes. In this study, a novel formulation and computational implementation are presented for modeling chemical reactions in biological tissues that involve charged solutes and solid-bound molecules within a deformable porous hydrated solid matrix, coupling mechanics with chemistry while accounting for electric charges. The deposition or removal of solid-bound molecules contributes to the growth and remodeling of the solid matrix; in particular, volumetric growth may be driven by Donnan osmotic swelling, resulting from charged molecular species fixed to the solid matrix. This formulation incorporates the state of strain as a state variable in the production rate of chemical reactions, explicitly tying chemistry with mechanics for the purpose of modeling mechanobiology. To achieve these objectives, this treatment identifies the specific theoretical and computational challenges faced in modeling complex systems of interacting neutral and charged constituents while accommodating any number of simultaneous reactions where reactants and products may be modeled explicitly or implicitly. Several finite element verification problems are shown to agree with closed-form analytical solutions. An illustrative tissue engineering analysis demonstrates tissue growth and swelling resulting from the deposition of chondroitin sulfate, a charged solid-bound molecular species. This implementation is released in the open-source program FEBio (www.febio.org). The availability of this framework may be particularly beneficial to optimizing tissue engineering culture systems by examining the influence of nutrient availability on the evolution of inhomogeneous tissue composition and mechanical properties, the evolution of construct dimensions with growth, the influence of solute and solid matrix electric charge on the transport of cytokines, the influence of binding kinetics on transport, the influence of loading on binding kinetics, and the differential growth response to dynamically loaded versus free-swelling culture conditions. PMID:24558059

Computational modeling of chemical reactions and interstitial growth and remodeling involving charged solutes and solid-bound molecules.

PubMed

Ateshian, Gerard A; Nims, Robert J; Maas, Steve; Weiss, Jeffrey A

2014-10-01

Mechanobiological processes are rooted in mechanics and chemistry, and such processes may be modeled in a framework that couples their governing equations starting from fundamental principles. In many biological applications, the reactants and products of chemical reactions may be electrically charged, and these charge effects may produce driving forces and constraints that significantly influence outcomes. In this study, a novel formulation and computational implementation are presented for modeling chemical reactions in biological tissues that involve charged solutes and solid-bound molecules within a deformable porous hydrated solid matrix, coupling mechanics with chemistry while accounting for electric charges. The deposition or removal of solid-bound molecules contributes to the growth and remodeling of the solid matrix; in particular, volumetric growth may be driven by Donnan osmotic swelling, resulting from charged molecular species fixed to the solid matrix. This formulation incorporates the state of strain as a state variable in the production rate of chemical reactions, explicitly tying chemistry with mechanics for the purpose of modeling mechanobiology. To achieve these objectives, this treatment identifies the specific theoretical and computational challenges faced in modeling complex systems of interacting neutral and charged constituents while accommodating any number of simultaneous reactions where reactants and products may be modeled explicitly or implicitly. Several finite element verification problems are shown to agree with closed-form analytical solutions. An illustrative tissue engineering analysis demonstrates tissue growth and swelling resulting from the deposition of chondroitin sulfate, a charged solid-bound molecular species. This implementation is released in the open-source program FEBio ( www.febio.org ). The availability of this framework may be particularly beneficial to optimizing tissue engineering culture systems by examining the influence of nutrient availability on the evolution of inhomogeneous tissue composition and mechanical properties, the evolution of construct dimensions with growth, the influence of solute and solid matrix electric charge on the transport of cytokines, the influence of binding kinetics on transport, the influence of loading on binding kinetics, and the differential growth response to dynamically loaded versus free-swelling culture conditions.

Thermoelectric effect and its dependence on molecular length and sequence in single DNA molecules.

PubMed

Li, Yueqi; Xiang, Limin; Palma, Julio L; Asai, Yoshihiro; Tao, Nongjian

2016-04-15

Studying the thermoelectric effect in DNA is important for unravelling charge transport mechanisms and for developing relevant applications of DNA molecules. Here we report a study of the thermoelectric effect in single DNA molecules. By varying the molecular length and sequence, we tune the charge transport in DNA to either a hopping- or tunnelling-dominated regimes. The thermoelectric effect is small and insensitive to the molecular length in the hopping regime. In contrast, the thermoelectric effect is large and sensitive to the length in the tunnelling regime. These findings indicate that one may control the thermoelectric effect in DNA by varying its sequence and length. We describe the experimental results in terms of hopping and tunnelling charge transport models.

Thermoelectric effect and its dependence on molecular length and sequence in single DNA molecules

PubMed Central

Li, Yueqi; Xiang, Limin; Palma, Julio L.; Asai, Yoshihiro; Tao, Nongjian

2016-01-01

Studying the thermoelectric effect in DNA is important for unravelling charge transport mechanisms and for developing relevant applications of DNA molecules. Here we report a study of the thermoelectric effect in single DNA molecules. By varying the molecular length and sequence, we tune the charge transport in DNA to either a hopping- or tunnelling-dominated regimes. The thermoelectric effect is small and insensitive to the molecular length in the hopping regime. In contrast, the thermoelectric effect is large and sensitive to the length in the tunnelling regime. These findings indicate that one may control the thermoelectric effect in DNA by varying its sequence and length. We describe the experimental results in terms of hopping and tunnelling charge transport models. PMID:27079152

Atomic charge transfer-counter polarization effects determine infrared CH intensities of hydrocarbons: a quantum theory of atoms in molecules model.

PubMed

Silva, Arnaldo F; Richter, Wagner E; Meneses, Helen G C; Bruns, Roy E

2014-11-14

Atomic charge transfer-counter polarization effects determine most of the infrared fundamental CH intensities of simple hydrocarbons, methane, ethylene, ethane, propyne, cyclopropane and allene. The quantum theory of atoms in molecules/charge-charge flux-dipole flux model predicted the values of 30 CH intensities ranging from 0 to 123 km mol(-1) with a root mean square (rms) error of only 4.2 km mol(-1) without including a specific equilibrium atomic charge term. Sums of the contributions from terms involving charge flux and/or dipole flux averaged 20.3 km mol(-1), about ten times larger than the average charge contribution of 2.0 km mol(-1). The only notable exceptions are the CH stretching and bending intensities of acetylene and two of the propyne vibrations for hydrogens bound to sp hybridized carbon atoms. Calculations were carried out at four quantum levels, MP2/6-311++G(3d,3p), MP2/cc-pVTZ, QCISD/6-311++G(3d,3p) and QCISD/cc-pVTZ. The results calculated at the QCISD level are the most accurate among the four with root mean square errors of 4.7 and 5.0 km mol(-1) for the 6-311++G(3d,3p) and cc-pVTZ basis sets. These values are close to the estimated aggregate experimental error of the hydrocarbon intensities, 4.0 km mol(-1). The atomic charge transfer-counter polarization effect is much larger than the charge effect for the results of all four quantum levels. Charge transfer-counter polarization effects are expected to also be important in vibrations of more polar molecules for which equilibrium charge contributions can be large.

Physical Investigations of Small Particles: (I) Aerosol Particle Charging and Flux Enhancement and (II) Whispering Gallery Mode Sensing

NASA Astrophysics Data System (ADS)

Lopez-Yglesias, Xerxes

Part I: Particles are a key feature of planetary atmospheres. On Earth they represent the greatest source of uncertainty in the global energy budget. This uncertainty can be addressed by making more measurement, by improving the theoretical analysis of measurements, and by better modeling basic particle nucleation and initial particle growth within an atmosphere. This work will focus on the latter two methods of improvement. Uncertainty in measurements is largely due to particle charging. Accurate descriptions of particle charging are challenging because one deals with particles in a gas as opposed to a vacuum, so different length scales come into play. Previous studies have considered the effects of transition between the continuum and kinetic regime and the effects of two and three body interactions within the kinetic regime. These studies, however, use questionable assumptions about the charging process which resulted in skewed observations, and bias in the proposed dynamics of aerosol particles. These assumptions affect both the ions and particles in the system. Ions are assumed to be point monopoles that have a single characteristic speed rather than follow a distribution. Particles are assumed to be perfect conductors that have up to five elementary charges on them. The effects of three body interaction, ion-molecule-particle, are also overestimated. By revising this theory so that the basic physical attributes of both ions and particles and their interactions are better represented, we are able to make more accurate predictions of particle charging in both the kinetic and continuum regimes. The same revised theory that was used above to model ion charging can also be applied to the flux of neutral vapor phase molecules to a particle or initial cluster. Using these results we can model the vapor flux to a neutral or charged particle due to diffusion and electromagnetic interactions. In many classical theories currently applied to these models, the finite size of the molecule and the electromagnetic interaction between the molecule and particle, especially for the neutral particle case, are completely ignored, or, as is often the case for a permanent dipole vapor species, strongly underestimated. Comparing our model to these classical models we determine an "enhancement factor" to characterize how important the addition of these physical parameters and processes is to the understanding of particle nucleation and growth. Part II: Whispering gallery mode (WGM) optical biosensors are capable of extraordinarily sensitive specific and non-specific detection of species suspended in a gas or fluid. Recent experimental results suggest that these devices may attain single-molecule sensitivity to protein solutions in the form of stepwise shifts in their resonance wavelength, lambdaR, but present sensor models predict much smaller steps than were reported. This study examines the physical interaction between a WGM sensor and a molecule adsorbed to its surface, exploring assumptions made in previous efforts to model WGM sensor behavior, and describing computational schemes that model the experiments for which single protein sensitivity was reported. The resulting model is used to simulate sensor performance, within constraints imposed by the limited material property data. On this basis, we conclude that nonlinear optical effects would be needed to attain the reported sensitivity, and that, in the experiments for which extreme sensitivity was reported, a bound protein experiences optical energy fluxes too high for such effects to be ignored.

Application of double-hybrid density functionals to charge transfer in N-substituted pentacenequinones.

PubMed

Sancho-García, J C

2012-05-07

A set of N-heteroquinones, deriving from oligoacenes, have been recently proposed as n-type organic semiconductors with high electron mobilities in thin-film transistors. Generally speaking, this class of compounds self-assembles in neighboring π-stacks linked by weak hydrogen bonds. We aim at theoretically characterizing here the sequential charge transport (hopping) process expected to take place across these arrays of molecules. To do so, we need to accurately address the preferred packing of these materials simultaneously to single-molecule properties related to charge-transfer events, carefully employing dispersion-corrected density functional theory methods to accurately extract the key molecular parameters governing this phenomenon at the nanoscale. This study confirms the great deal of interest around these compounds, since controlled functionalization of model molecules (i.e., pentacene) allows to efficiently tune the corresponding charge mobilities, and the capacity of modern quantum-chemical methods to predict it after rationalizing the underlying structure-property relationships.

Cumulative atomic multipole moments complement any atomic charge model to obtain more accurate electrostatic properties

NASA Technical Reports Server (NTRS)

Sokalski, W. A.; Shibata, M.; Ornstein, R. L.; Rein, R.

1992-01-01

The quality of several atomic charge models based on different definitions has been analyzed using cumulative atomic multipole moments (CAMM). This formalism can generate higher atomic moments starting from any atomic charges, while preserving the corresponding molecular moments. The atomic charge contribution to the higher molecular moments, as well as to the electrostatic potentials, has been examined for CO and HCN molecules at several different levels of theory. The results clearly show that the electrostatic potential obtained from CAMM expansion is convergent up to R-5 term for all atomic charge models used. This illustrates that higher atomic moments can be used to supplement any atomic charge model to obtain more accurate description of electrostatic properties.

A DIM model for sodium cluster-ions interacting with a charged conducting sphere

NASA Astrophysics Data System (ADS)

Kuntz, P. J.

A diatomics-in-molecules (DIM) model for the energy, shape and charge distribution of metal cluster ions in the presence of a charged insulated conducting sphere is presented. The electrostatic interaction between the sphere and the cluster-ion is introduced in a self-consistent manner which allows the sphere to be polarized by the ion and the ion by the sphere. This interaction appears in the diagonal elements of the model Hamiltonian matrix in such a way that the lowest eigenvalue includes the correct electrostatic energy for the charge distribution in the ground state. The model is applied to the calculation of fusion barriers for Na+2 and Na+3 ions. When both the charge distribution and the geometric configuration of the cluster-ion are allowed to relax freely, the energy as a function of distance from the sphere is nearly the same as that calculated from the electrostatic energy alone, which implies that details of the molecular structure of the cluster-ion can be neglected in calculating fusion barriers from charge polarization alone. That the fusion barriers lie sufficiently far away from the sphere so that the molecule does not dissociate under the influence of the Coulomb interaction confirms that it is meaningful to speak of two separate entities at the barrier position.

Theory of Spin States of Quantum Dot Molecules

NASA Astrophysics Data System (ADS)

Ponomarev, I. V.; Reinecke, T. L.; Scheibner, M.; Stinaff, E. A.; Bracker, A. S.; Doty, M. F.; Gammon, D.; Korenev, V. L.

2007-04-01

The photoluminescence spectrum of an asymmetric pair of coupled InAs quantum dots in an applied electric field shows a rich pattern of level anticrossings, crossings and fine structure that can be understood as a superposition of charge and spin configurations. We present a theoretical model that provides a description of the energy positions and intensities of the optical transitions in exciton, biexciton and charged exciton states of coupled quantum dots molecules.

How Many States Can the Motor Molecule, Prestin, Assume in an Electric Field?

PubMed Central

Scherer, Marc P.; Gummer, Anthony W.

2005-01-01

By using an analogy between the magnetization of a paramagnetic material in an external magnetic field and the electric polarization of the lateral wall of outer hair cells in response to the transmembrane potential, we show that, based on experimental data on the charge transfer across the membrane, it is impossible to make a statement about the number of possible conformational states of the motor molecule, prestin. Although the choice of model affects the values of derived parameters, such as total charge and motor charge, this is frequently overlooked in the literature. PMID:15764650

Model for screened, charge-regulated electrostatics of an eye lens protein: Bovine gammaB-crystallin

PubMed Central

Wahle, Christopher W.; Martini, K. Michael; Hollenbeck, Dawn M.; Langner, Andreas; Ross, David S.; Hamilton, John F.; Thurston, George M.

2018-01-01

We model screened, site-specific charge regulation of the eye lens protein bovine gammaB-crystallin (γ B) and study the probability distributions of its proton occupancy patterns. Using a simplified dielectric model, we solve the linearized Poisson-Boltzmann equation to calculate a 54 × 54 work-of-charging matrix, each entry being the modeled voltage at a given titratable site, due to an elementary charge at another site. The matrix quantifies interactions within patches of sites, including γB charge pairs. We model intrinsic pK values that would occur hypothetically in the absence of other charges, with use of experimental data on the dependence of pK values on aqueous solution conditions, the dielectric model, and literature values. We use Monte Carlo simulations to calculate a model grand-canonical partition function that incorporates both the work-of-charging and the intrinsic pK values for isolated γB molecules and we calculate the probabilities of leading proton occupancy configurations, for 4 < pH < 8 and Debye screening lengths from 6 to 20 Å. We select the interior dielectric value to model γB titration data. At pH 7.1 and Debye length 6.0 Å, on a given γB molecule the predicted top occupancy pattern is present nearly 20% of the time, and 90% of the time one or another of the first 100 patterns will be present. Many of these occupancy patterns differ in net charge sign as well as in surface voltage profile. We illustrate how charge pattern probabilities deviate from the multinomial distribution that would result from use of effective pK values alone and estimate the extents to which γB charge pattern distributions broaden at lower pH and narrow as ionic strength is lowered. These results suggest that for accurate modeling of orientation-dependent γB-γB interactions, consideration of numerous pairs of proton occupancy patterns will be needed. PMID:29346981

Model for screened, charge-regulated electrostatics of an eye lens protein: Bovine gammaB-crystallin.

PubMed

Wahle, Christopher W; Martini, K Michael; Hollenbeck, Dawn M; Langner, Andreas; Ross, David S; Hamilton, John F; Thurston, George M

2017-09-01

We model screened, site-specific charge regulation of the eye lens protein bovine gammaB-crystallin (γB) and study the probability distributions of its proton occupancy patterns. Using a simplified dielectric model, we solve the linearized Poisson-Boltzmann equation to calculate a 54×54 work-of-charging matrix, each entry being the modeled voltage at a given titratable site, due to an elementary charge at another site. The matrix quantifies interactions within patches of sites, including γB charge pairs. We model intrinsic pK values that would occur hypothetically in the absence of other charges, with use of experimental data on the dependence of pK values on aqueous solution conditions, the dielectric model, and literature values. We use Monte Carlo simulations to calculate a model grand-canonical partition function that incorporates both the work-of-charging and the intrinsic pK values for isolated γB molecules and we calculate the probabilities of leading proton occupancy configurations, for 4

Model for screened, charge-regulated electrostatics of an eye lens protein: Bovine gammaB-crystallin

NASA Astrophysics Data System (ADS)

Wahle, Christopher W.; Martini, K. Michael; Hollenbeck, Dawn M.; Langner, Andreas; Ross, David S.; Hamilton, John F.; Thurston, George M.

2017-09-01

We model screened, site-specific charge regulation of the eye lens protein bovine gammaB-crystallin (γ B ) and study the probability distributions of its proton occupancy patterns. Using a simplified dielectric model, we solve the linearized Poisson-Boltzmann equation to calculate a 54 ×54 work-of-charging matrix, each entry being the modeled voltage at a given titratable site, due to an elementary charge at another site. The matrix quantifies interactions within patches of sites, including γ B charge pairs. We model intrinsic p K values that would occur hypothetically in the absence of other charges, with use of experimental data on the dependence of p K values on aqueous solution conditions, the dielectric model, and literature values. We use Monte Carlo simulations to calculate a model grand-canonical partition function that incorporates both the work-of-charging and the intrinsic p K values for isolated γ B molecules and we calculate the probabilities of leading proton occupancy configurations, for 4

Quantum transport through a deformable molecular transistor

NASA Astrophysics Data System (ADS)

Cornaglia, P. S.; Grempel, D. R.; Ness, H.

2005-02-01

The linear transport properties of a model molecular transistor with electron-electron and electron-phonon interactions were investigated analytically and numerically. The model takes into account phonon modulation of the electronic energy levels and of the tunneling barrier between the molecule and the electrodes. When both effects are present they lead to asymmetries in the dependence of the conductance on gate voltage. The Kondo effect is observed in the presence of electron-phonon interactions. There are important qualitative differences between the cases of weak and strong coupling. In the first case the standard Kondo effect driven by spin fluctuations occurs. In the second case, it is driven by charge fluctuations. The Fermi-liquid relation between the spectral density of the molecule and its charge is altered by electron-phonon interactions. Remarkably, the relation between the zero-temperature conductance and the charge remains unchanged. Therefore, there is perfect transmission in all regimes whenever the average number of electrons in the molecule is an odd integer.

How ions affect the structure of water.

PubMed

Hribar, Barbara; Southall, Noel T; Vlachy, Vojko; Dill, Ken A

2002-10-16

We model ion solvation in water. We use the MB model of water, a simple two-dimensional statistical mechanical model in which waters are represented as Lennard-Jones disks having Gaussian hydrogen-bonding arms. We introduce a charge dipole into MB waters. We perform (NPT) Monte Carlo simulations to explore how water molecules are organized around ions and around nonpolar solutes in salt solutions. The model gives good qualitative agreement with experiments, including Jones-Dole viscosity B coefficients, Samoilov and Hirata ion hydration activation energies, ion solvation thermodynamics, and Setschenow coefficients for Hofmeister series ions, which describe the salt concentration dependence of the solubilities of hydrophobic solutes. The two main ideas captured here are (1) that charge densities govern the interactions of ions with water, and (2) that a balance of forces determines water structure: electrostatics (water's dipole interacting with ions) and hydrogen bonding (water interacting with neighboring waters). Small ions (kosmotropes) have high charge densities so they cause strong electrostatic ordering of nearby waters, breaking hydrogen bonds. In contrast, large ions (chaotropes) have low charge densities, and surrounding water molecules are largely hydrogen bonded.

A New Poisson-Nernst-Planck Model with Ion-Water Interactions for Charge Transport in Ion Channels.

PubMed

Chen, Duan

2016-08-01

In this work, we propose a new Poisson-Nernst-Planck (PNP) model with ion-water interactions for biological charge transport in ion channels. Due to narrow geometries of these membrane proteins, ion-water interaction is critical for both dielectric property of water molecules in channel pore and transport dynamics of mobile ions. We model the ion-water interaction energy based on realistic experimental observations in an efficient mean-field approach. Variation of a total energy functional of the biological system yields a new PNP-type continuum model. Numerical simulations show that the proposed model with ion-water interaction energy has the new features that quantitatively describe dielectric properties of water molecules in narrow pores and are possible to model the selectivity of some ion channels.

Incorporation of the TIP4P water model into a continuum solvent for computing solvation free energy

NASA Astrophysics Data System (ADS)

Yang, Pei-Kun

2014-10-01

The continuum solvent model is one of the commonly used strategies to compute solvation free energy especially for large-scale conformational transitions such as protein folding or to calculate the binding affinity of protein-protein/ligand interactions. However, the dielectric polarization for computing solvation free energy from the continuum solvent is different than that obtained from molecular dynamic simulations. To mimic the dielectric polarization surrounding a solute in molecular dynamic simulations, the first-shell water molecules was modeled using a charge distribution of TIP4P in a hard sphere; the time-averaged charge distribution from the first-shell water molecules were estimated based on the coordination number of the solute, and the orientation distribution of the first-shell waters and the intermediate water molecules were treated as that of a bulk solvent. Based on this strategy, an equation describing the solvation free energy of ions was derived.

Polarizable six-point water models from computational and empirical optimization.

PubMed

Tröster, Philipp; Lorenzen, Konstantin; Tavan, Paul

2014-02-13

Tröster et al. (J. Phys. Chem B 2013, 117, 9486-9500) recently suggested a mixed computational and empirical approach to the optimization of polarizable molecular mechanics (PMM) water models. In the empirical part the parameters of Buckingham potentials are optimized by PMM molecular dynamics (MD) simulations. The computational part applies hybrid calculations, which combine the quantum mechanical description of a H2O molecule by density functional theory (DFT) with a PMM model of its liquid phase environment generated by MD. While the static dipole moments and polarizabilities of the PMM water models are fixed at the experimental gas phase values, the DFT/PMM calculations are employed to optimize the remaining electrostatic properties. These properties cover the width of a Gaussian inducible dipole positioned at the oxygen and the locations of massless negative charge points within the molecule (the positive charges are attached to the hydrogens). The authors considered the cases of one and two negative charges rendering the PMM four- and five-point models TL4P and TL5P. Here we extend their approach to three negative charges, thus suggesting the PMM six-point model TL6P. As compared to the predecessors and to other PMM models, which also exhibit partial charges at fixed positions, TL6P turned out to predict all studied properties of liquid water at p0 = 1 bar and T0 = 300 K with a remarkable accuracy. These properties cover, for instance, the diffusion constant, viscosity, isobaric heat capacity, isothermal compressibility, dielectric constant, density, and the isobaric thermal expansion coefficient. This success concurrently provides a microscopic physical explanation of corresponding shortcomings of previous models. It uniquely assigns the failures of previous models to substantial inaccuracies in the description of the higher electrostatic multipole moments of liquid phase water molecules. Resulting favorable properties concerning the transferability to other temperatures and conditions like the melting of ice are also discussed.

Second harmonic generation study of malachite green adsorption at the interface between air and an electrolyte solution: observing the effect of excess electrical charge density at the interface.

PubMed

Song, Jinsuk; Kim, Mahn Won

2010-03-11

Understanding the differential adsorption of ions at the interface of an electrolyte solution is very important because it is closely related, not only to the fundamental aspects of biological systems, but also to many industrial applications. We have measured the excess interfacial negative charge density at air-electrolyte solution interfaces by using resonant second harmonic generation of oppositely charged probe molecules. The excess charge density increased with the square root of the bulk electrolyte concentration. A new adsorption model that includes the electrostatic interaction between adsorbed molecules is proposed to explain the measured adsorption isotherm, and it is in good agreement with the experimental results.

Molecular simulation of a model of dissolved organic matter.

PubMed

Sutton, Rebecca; Sposito, Garrison; Diallo, Mamadou S; Schulten, Hans-Rolf

2005-08-01

A series of atomistic simulations was performed to assess the ability of the Schulten dissolved organic matter (DOM) molecule, a well-established model humic molecule, to reproduce the physical and chemical behavior of natural humic substances. The unhydrated DOM molecule had a bulk density value appropriate to humic matter, but its Hildebrand solubility parameter was lower than the range of current experimental estimates. Under hydrated conditions, the DOM molecule went through conformational adjustments that resulted in disruption of intramolecular hydrogen bonds (H-bonds), although few water molecules penetrated the organic interior. The radius of gyration of the hydrated DOM molecule was similar to those measured for aquatic humic substances. To simulate humic materials under aqueous conditions with varying pH levels, carboxyl groups were deprotonated, and hydrated Na+ or Ca2+ were added to balance the resulting negative charge. Because of intrusion of the cation hydrates, the model metal-humic structures were more porous, had greater solvent-accessible surface areas, and formed more H-bonds with water than the protonated, hydrated DOM molecule. Relative to Na+, Ca2+ was both more strongly bound to carboxylate groups and more fully hydrated. This difference was attributed to the higher charge of the divalent cation. The Ca-DOM hydrate, however, featured fewer H-bonds than the Na-DOM hydrate, perhaps because of the reduced orientational freedom of organic moieties and water molecules imposed by Ca2+. The present work is, to our knowledge, the first rigorous computational exploration regarding the behavior of a model humic molecule under a range of physical conditions typical of soil and water systems.

Formation mechanism of human serum albumin monolayers on positively charged polymer microparticles.

PubMed

Nattich-Rak, Małgorzata; Sadowska, Marta; Adamczyk, Zbigniew; Cieśla, Michał; Kąkol, Małgorzata

2017-11-01

Human serum albumin (HSA) adsorption on positively and negatively charged polystyrene microparticles was studied at various pHs and NaCl concentrations. Thorough electrophoretic mobility measurements were carried out that enabled to monitor in situ the progress of protein adsorption. The maximum coverage of irreversibly adsorbed HSA on microparticles was determined by different concentration depletion methods, one of them involving AFM imaging of residual molecules. An anomalous adsorption of HSA on the positive microparticles was observed at pH 3.5 where the maximum coverage attained 1.0mgm -2 for NaCl concentrations of 0.05M despite that the molecules were on average positively charged. For comparison, the maximum coverage of HSA on negatively charged microparticles was equal to 1.3mgm -2 at this pH and NaCl concentration. At pH 7.4 the maximum coverage on positive microparticles was equal to 2.1mgm -2 for 0.05M NaCl concentration. On the other hand, for negative microparticles, negligible adsorption of HSA was observed at pH 7.4 and 9.7. These experimental data were adequately interpreted in terms of the random sequential adsorption approach exploiting the bead model of the HSA molecule. Different orientations of adsorbed molecules, inert alia, the edge-on orientation prevailing for positively charged microparticles at pH 7.4, were confirmed. This was explained in terms of a heterogeneous charge distribution over the HSA molecule prevailing for a wide range of pHs. Copyright © 2017 Elsevier B.V. All rights reserved.

QTAIM charge-charge flux-dipole flux interpretation of electronegativity and potential models of the fluorochloromethane mean dipole moment derivatives.

PubMed

Silva, Arnaldo F; da Silva, João V; Haiduke, R L A; Bruns, Roy E

2011-11-17

Infrared fundamental vibrational intensities and quantum theory atoms in molecules (QTAIM) charge-charge flux-dipole flux (CCFDF) contributions to the polar tensors of the fluorochloromethanes have been calculated at the QCISD/cc-pVTZ level. A root-mean-square error of 20.0 km mol(-1) has been found compared to an experimental error estimate of 14.4 and 21.1 km mol(-1) for MP2/6-311++G(3d,3p) results. The errors in the QCISD polar tensor elements and mean dipole moment derivatives are 0.059 e when compared with the experimental values. Both theoretical levels provide results showing that the dynamical charge and dipole fluxes provide significant contributions to the mean dipole moment derivatives and tend to be of opposite signs canceling one another. Although the experimental mean dipole moment derivative values suggest that all the fluorochloromethane molecules have electronic structures consistent with a simple electronegativity model with transferable atomic charges for their terminal atoms, the QTAIM/CCFDF models confirm this only for the fluoromethanes. Whereas the fluorine atom does not suffer a saturation effect in its capacity to drain electronic charge from carbon atoms that are attached to other fluorine and chlorine atoms, the zero flux electronic charge of the chlorine atom depends on the number and kind of the other substituent atoms. Both the QTAIM carbon charges (r = 0.990) and mean dipole moment derivatives (r = 0.996) are found to obey Siegbahn's potential model for carbon 1s electron ionization energies at the QCISD/cc-pVTZ level. The latter is a consequence of the carbon mean derivatives obeying the electronegativity model and not necessarily to their similarities with atomic charges. Atomic dipole contributions to the neighboring atom electrostatic potentials of the fluorochloromethanes are found to be of comparable size to the atomic charge contributions and increase the accuracy of Siegbahn's model for the QTAIM charge model results. Substitution effects of the hydrogen, fluorine, and chlorine atoms on the charge and dipole flux QTAIM contributions are found to be additive for the mean dipole derivatives of the fluorochloromethanes.

Quantum Theory of Atoms in Molecules Charge-Charge Transfer-Dipolar Polarization Classification of Infrared Intensities.

PubMed

Duarte, Leonardo J; Richter, Wagner E; Silva, Arnaldo F; Bruns, Roy E

2017-10-26

Fundamental infrared vibrational transition intensities of gas-phase molecules are sensitive probes of changes in electronic structure accompanying small molecular distortions. Models containing charge, charge transfer, and dipolar polarization effects are necessary for a successful classification of the C-H, C-F, and C-Cl stretching and bending intensities. C-H stretching and in-plane bending vibrations involving sp 3 carbon atoms have small equilibrium charge contributions and are accurately modeled by the charge transfer-counterpolarization contribution and its interaction with equilibrium charge movement. Large C-F and C═O stretching intensities have dominant equilibrium charge movement contributions compared to their charge transfer-dipolar polarization ones and are accurately estimated by equilibrium charge and the interaction contribution. The C-F and C-Cl bending modes have charge and charge transfer-dipolar polarization contribution sums that are of similar size but opposite sign to their interaction values resulting in small intensities. Experimental in-plane C-H bends have small average intensities of 12.6 ± 10.4 km mol -1 owing to negligible charge contributions and charge transfer-counterpolarization cancellations, whereas their average out-of-plane experimental intensities are much larger, 65.7 ± 20.0 km mol -1 , as charge transfer is zero and only dipolar polarization takes place. The C-F bending intensities have large charge contributions but very small intensities. Their average experimental out-of-plane intensity of 9.9 ± 12.6 km mol -1 arises from the cancellation of large charge contributions by dipolar polarization contributions. The experimental average in-plane C-F bending intensity, 5.8 ± 7.3 km mol -1 , is also small owing to charge and charge transfer-counterpolarization sums being canceled by their interaction contributions. Models containing only atomic charges and their fluxes are incapable of describing electronic structure changes for simple molecular distortions that are of interest in classifying infrared intensities. One can expect dipolar polarization effects to also be important for larger distortions of chemical interest.

Generalized Breit-Wigner treatment of molecular transport: Charging effects in a single decanedithiol molecule

NASA Astrophysics Data System (ADS)

Cabrera-Tinoco, Hugo Andres; Moreira, Augusto C. L.; de Melo, Celso P.

2018-05-01

We examine the relative contribution of ballistic and elastic cotunneling mechanisms to the charge transport through a single decanedithiol molecule linked to two terminal clusters of gold atoms. For this, we first introduced a conceptual model that permits a generalization of the Breit-Wigner scattering formalism where the cation, anion, and neutral forms of the molecule can participate with different probabilities of the charge transfer process, but in a simultaneous manner. We used a density functional theory treatment and considered the fixed geometry of each charge state to calculate the corresponding eigenvalues and eigenvectors of the extended system for different values of the external electric field. We have found that for the ballistic transport the HOMO and LUMO of the neutral species play a key role, while the charged states give a negligible contribution. On the other hand, an elastic cotunneling charge transfer can occur whenever a molecular orbital (MO) of the cation or anion species, even if localized in just one side of the molecule-gold clusters complex, has energy close to that of a delocalized MO of the neutral species. Under these conditions, a conduction channel is formed throughout the entire system, in a process that is controlled by the degree of resonance between the MOs involved. Our results indicate that while different charge transfer mechanisms contribute to the overall charge transport, quantum effects such as avoided-crossing situations between relevant frontier MOs can be of special importance. In these specific situations, the interchange of spatial localization of two MOs involved in the crossing can open a new channel of charge transfer that otherwise would not be available.

Sequential water molecule binding enthalpies for aqueous nanodrops containing a mono-, di- or trivalent ion and between 20 and 500 water molecules† †Electronic supplementary information (ESI) available: Detailed description of the experimental and computational modeling methods. Isolation, BIRD and UVPD sequence for [Ru(NH3)6]3+·(H2O)169–171, nanoESI spectra for 2+ and 3+ ions. Detailed description of the isotope distribution simulation program. Comparison between experimental and simulated 1+, 2+ and 3+ ion isotope distributions. Wavelength dependence of the deduced sequential binding enthalpies. Comparison of experimental UVPD binding enthalpies to the liquid drop model at different temperatures. Complete list of binding enthalpies and average number of water molecules lost upon UVPD. See DOI: 10.1039/c6sc04957e Click here for additional data file.

PubMed Central

Heiles, Sven; Cooper, Richard J.; DiTucci, Matthew J.

2017-01-01

Sequential water molecule binding enthalpies, ΔH n,n–1, are important for a detailed understanding of competitive interactions between ions, water and solute molecules, and how these interactions affect physical properties of ion-containing nanodrops that are important in aerosol chemistry. Water molecule binding enthalpies have been measured for small clusters of many different ions, but these values for ion-containing nanodrops containing more than 20 water molecules are scarce. Here, ΔH n,n–1 values are deduced from high-precision ultraviolet photodissociation (UVPD) measurements as a function of ion identity, charge state and cluster size between 20–500 water molecules and for ions with +1, +2 and +3 charges. The ΔH n,n–1 values are obtained from the number of water molecules lost upon photoexcitation at a known wavelength, and modeling of the release of energy into the translational, rotational and vibrational motions of the products. The ΔH n,n–1 values range from 36.82 to 50.21 kJ mol–1. For clusters containing more than ∼250 water molecules, the binding enthalpies are between the bulk heat of vaporization (44.8 kJ mol–1) and the sublimation enthalpy of bulk ice (51.0 kJ mol–1). These values depend on ion charge state for clusters with fewer than 150 water molecules, but there is a negligible dependence at larger size. There is a minimum in the ΔH n,n–1 values that depends on the cluster size and ion charge state, which can be attributed to the competing effects of ion solvation and surface energy. The experimental ΔH n,n–1 values can be fit to the Thomson liquid drop model (TLDM) using bulk ice parameters. By optimizing the surface tension and temperature change of the logarithmic partial pressure for the TLDM, the experimental sequential water molecule binding enthalpies can be fit with an accuracy of ±3.3 kJ mol–1 over the entire range of cluster sizes. PMID:28451364

R.E.DD.B.: A database for RESP and ESP atomic charges, and force field libraries

PubMed Central

Dupradeau, François-Yves; Cézard, Christine; Lelong, Rodolphe; Stanislawiak, Élodie; Pêcher, Julien; Delepine, Jean Charles; Cieplak, Piotr

2008-01-01

The web-based RESP ESP charge DataBase (R.E.DD.B., http://q4md-forcefieldtools.org/REDDB) is a free and new source of RESP and ESP atomic charge values and force field libraries for model systems and/or small molecules. R.E.DD.B. stores highly effective and reproducible charge values and molecular structures in the Tripos mol2 file format, information about the charge derivation procedure, scripts to integrate the charges and molecular topology in the most common molecular dynamics packages. Moreover, R.E.DD.B. allows users to freely store and distribute RESP or ESP charges and force field libraries to the scientific community, via a web interface. The first version of R.E.DD.B., released in January 2006, contains force field libraries for molecules as well as molecular fragments for standard residues and their analogs (amino acids, monosaccharides, nucleotides and ligands), hence covering a vast area of relevant biological applications. PMID:17962302

A group electronegativity equalization scheme including external potential effects.

PubMed

Leyssens, Tom; Geerlings, Paul; Peeters, Daniel

2006-07-20

By calculating the electron affinity and ionization energy of different functional groups, CCSD electronegativity values are obtained, which implicitly account for the effect of the molecular environment. This latter is approximated using a chemically justified point charge model. On the basis of Sanderson's electronegativity equalization principle, this approach is shown to lead to reliable "group in molecule" electronegativities. Using a slight adjustment of the modeled environment and first-order principles, an electronegativity equalization scheme is obtained, which implicitly accounts for the major part of the external potential effect. This scheme can be applied in a predictive manner to estimate the charge transfer between two functional groups, without having to rely on cumbersome calibrations. A very satisfactory correlation is obtained between these charge transfers and those obtained from an ab initio calculation of the entire molecule.

Specificity and mechanism of action of alpha-helical membrane-active peptides interacting with model and biological membranes by single-molecule force spectroscopy.

PubMed

Sun, Shiyu; Zhao, Guangxu; Huang, Yibing; Cai, Mingjun; Shan, Yuping; Wang, Hongda; Chen, Yuxin

2016-07-01

In this study, to systematically investigate the targeting specificity of membrane-active peptides on different types of cell membranes, we evaluated the effects of peptides on different large unilamellar vesicles mimicking prokaryotic, normal eukaryotic, and cancer cell membranes by single-molecule force spectroscopy and spectrum technology. We revealed that cationic membrane-active peptides can exclusively target negatively charged prokaryotic and cancer cell model membranes rather than normal eukaryotic cell model membranes. Using Acholeplasma laidlawii, 3T3-L1, and HeLa cells to represent prokaryotic cells, normal eukaryotic cells, and cancer cells in atomic force microscopy experiments, respectively, we further studied that the single-molecule targeting interaction between peptides and biological membranes. Antimicrobial and anticancer activities of peptides exhibited strong correlations with the interaction probability determined by single-molecule force spectroscopy, which illustrates strong correlations of peptide biological activities and peptide hydrophobicity and charge. Peptide specificity significantly depends on the lipid compositions of different cell membranes, which validates the de novo design of peptide therapeutics against bacteria and cancers.

The impact of chemical structure and molecular packing on the electronic polarisation of fullerene arrays.

PubMed

Few, Sheridan; Chia, Cleaven; Teo, Daniel; Kirkpatrick, James; Nelson, Jenny

2017-07-19

Electronic polarisation contributes to the electronic landscape as seen by separating charges in organic materials. The nature of electronic polarisation depends on the polarisability, density, and arrangement of polarisable molecules. In this paper, we introduce a microscopic, coarse-grained model in which we treat each molecule as a polarisable site, and use an array of such polarisable dipoles to calculate the electric field and associated energy of any arrangement of charges in the medium. The model incorporates chemical structure via the molecular polarisability and molecular packing patterns via the structure of the array. We use this model to calculate energies of charge pairs undergoing separation in finite fullerene lattices of different chemical and crystal structures. The effective dielectric constants that we estimate from this approach are in good quantitative agreement with those measured experimentally in C 60 and phenyl-C 61 -butyric acid methyl ester (PCBM) films, but we find significant differences in dielectric constant depending on packing and on direction of separation, which we rationalise in terms of density of polarisable fullerene cages in regions of high field. In general, we find lattices containing molecules of more isotropic polarisability tensors exhibit higher dielectric constants. By exploring several model systems we conclude that differences in molecular polarisability (and therefore, chemical structure) appear to be less important than differences in molecular packing and separation direction in determining the energetic landscape for charge separation. We note that the results are relevant for finite lattices, but not necessarily for infinite systems. We propose that the model could be used to design molecular systems for effective electronic screening.

A general intermolecular force field based on tight-binding quantum chemical calculations

NASA Astrophysics Data System (ADS)

Grimme, Stefan; Bannwarth, Christoph; Caldeweyher, Eike; Pisarek, Jana; Hansen, Andreas

2017-10-01

A black-box type procedure is presented for the generation of a molecule-specific, intermolecular potential energy function. The method uses quantum chemical (QC) information from our recently published extended tight-binding semi-empirical scheme (GFN-xTB) and can treat non-covalently bound complexes and aggregates with almost arbitrary chemical structure. The necessary QC information consists of the equilibrium structure, Mulliken atomic charges, charge centers of localized molecular orbitals, and also of frontier orbitals and orbital energies. The molecular pair potential includes model density dependent Pauli repulsion, penetration, as well as point charge electrostatics, the newly developed D4 dispersion energy model, Drude oscillators for polarization, and a charge-transfer term. Only one element-specific and about 20 global empirical parameters are needed to cover systems with nuclear charges up to radon (Z = 86). The method is tested for standard small molecule interaction energy benchmark sets where it provides accurate intermolecular energies and equilibrium distances. Examples for structures with a few hundred atoms including charged systems demonstrate the versatility of the approach. The method is implemented in a stand-alone computer code which enables rigid-body, global minimum energy searches for molecular aggregation or alignment.

Biomolecular Force Field Parameterization via Atoms-in-Molecule Electron Density Partitioning.

PubMed

Cole, Daniel J; Vilseck, Jonah Z; Tirado-Rives, Julian; Payne, Mike C; Jorgensen, William L

2016-05-10

Molecular mechanics force fields, which are commonly used in biomolecular modeling and computer-aided drug design, typically treat nonbonded interactions using a limited library of empirical parameters that are developed for small molecules. This approach does not account for polarization in larger molecules or proteins, and the parametrization process is labor-intensive. Using linear-scaling density functional theory and atoms-in-molecule electron density partitioning, environment-specific charges and Lennard-Jones parameters are derived directly from quantum mechanical calculations for use in biomolecular modeling of organic and biomolecular systems. The proposed methods significantly reduce the number of empirical parameters needed to construct molecular mechanics force fields, naturally include polarization effects in charge and Lennard-Jones parameters, and scale well to systems comprised of thousands of atoms, including proteins. The feasibility and benefits of this approach are demonstrated by computing free energies of hydration, properties of pure liquids, and the relative binding free energies of indole and benzofuran to the L99A mutant of T4 lysozyme.

Role of coherence and delocalization in photo-induced electron transfer at organic interfaces

NASA Astrophysics Data System (ADS)

Abramavicius, V.; Pranculis, V.; Melianas, A.; Inganäs, O.; Gulbinas, V.; Abramavicius, D.

2016-09-01

Photo-induced charge transfer at molecular heterojunctions has gained particular interest due to the development of organic solar cells (OSC) based on blends of electron donating and accepting materials. While charge transfer between donor and acceptor molecules can be described by Marcus theory, additional carrier delocalization and coherent propagation might play the dominant role. Here, we describe ultrafast charge separation at the interface of a conjugated polymer and an aggregate of the fullerene derivative PCBM using the stochastic Schrödinger equation (SSE) and reveal the complex time evolution of electron transfer, mediated by electronic coherence and delocalization. By fitting the model to ultrafast charge separation experiments, we estimate the extent of electron delocalization and establish the transition from coherent electron propagation to incoherent hopping. Our results indicate that even a relatively weak coupling between PCBM molecules is sufficient to facilitate electron delocalization and efficient charge separation at organic interfaces.

Phase transitions of a water overlayer on charged graphene: from electromelting to electrofreezing.

PubMed

Zhu, Xueyan; Yuan, Quanzi; Zhao, Ya-Pu

2014-05-21

We show by using molecular dynamics simulations that a water overlayer on charged graphene experiences first-order ice-to-liquid (electromelting), and then liquid-to-ice (electrofreezing) phase transitions with the increase of the charge value. Corresponding to the ice-liquid-ice transition, the variations of the order parameters indicate an order-disorder-order transition. The key to this novel phenomenon is the surface charge induced change of the orientations of water dipoles, which leads to the change of the water-water interactions from being attractive to repulsive at a critical charge value qc. To further uncover how the orientations of water dipoles influence the interaction strength between water molecules, a theoretical model considering both the Coulomb and van der Waals interactions is established. The results show that with the increase of the charge value, the interaction strength between water molecules decreases below qc, then increases above qc. These two inverse processes lead to electromelting and electrofreezing, respectively. Combining this model with the Eyring equation, the diffusion coefficient is obtained, the variation of which is in qualitative agreement with the simulation results. Our findings not only expand our knowledge of the graphene-water interface, but related analyses could also help recognize the controversial role of the surface charge or electric field in promoting phase transitions of water.

Penetration of analogues of H2O and CO2 in proteins studied by room temperature phosphorescence of tryptophan.

PubMed

Wright, W W; Owen, C S; Vanderkooi, J M

1992-07-21

The influence of the protein matrix on the reactivity of external molecules with a species buried within the protein interior is considered in two general ways: (1) there may be structural fluctuations that allow for the diffusive penetration of the small molecules and/or (2) the external molecule may react over a distance. As a means to study the protein matrix, a reactive species within the protein can be formed by exciting tryptophan to the triplet state, and then the reaction of the triplet-state molecule with an external molecule can be monitored by a decrease in phosphorescence. In this work, the quenching ability (i.e., reactivity) was examined for H2S, CS2, and NO2- acting on tryptophan phosphorescence in parvalbumin, azurin, horse liver alcohol dehydrogenase, and alkaline phosphatase. A comparison of charged versus uncharged quenchers (H2S vs SH- and CS2 vs NO2-) reveals that the uncharged molecules are much more effective than charged species in quenching the phosphorescence of fully buried tryptophan, whereas the quenching for exposed tryptophan is relatively independent of the charge of the quencher. This is consistent with the view that uncharged triatomic molecules can penetrate the protein matrix to some extent. The energies of activation of the quenching reaction are low for the charged quenchers and higher for the uncharged CS2. A model is presented in which the quenchability of a buried tryptophan is inversely related to the distance from the surface when diffusion through the protein is the rate-limiting step.(ABSTRACT TRUNCATED AT 250 WORDS)

Counterion accumulation effects on a suspension of DNA molecules: Equation of state and pressure-driven denaturation

NASA Astrophysics Data System (ADS)

Nicasio-Collazo, Luz Adriana; Delgado-González, Alexandra; Hernández-Lemus, Enrique; Castañeda-Priego, Ramón

2017-04-01

The study of the effects associated with the electrostatic properties of DNA is of fundamental importance to understand both its molecular properties at the single molecule level, like the rigidity of the chain, and its interaction with other charged bio-molecules, including other DNA molecules; such interactions are crucial to maintain the thermodynamic stability of the intra-cellular medium. In the present work, we combine the Poisson-Boltzmann mean-field theory with an irreversible thermodynamic approximation to analyze the effects of counterion accumulation inside DNA on both the denaturation profile of the chain and the equation of state of the suspension. To this end, we model the DNA molecule as a porous charged cylinder immersed in an aqueous solution. These thermo-electrostatic effects are explicitly studied in the particular case of some genes for which damage in their sequence is associated with diffuse large B-cell lymphoma.

Agglutination of like-charged red blood cells induced by binding of beta2-glycoprotein I to outer cell surface.

PubMed

Lokar, Marusa; Urbanija, Jasna; Frank, Mojca; Hägerstrand, Henry; Rozman, Blaz; Bobrowska-Hägerstrand, Malgorzata; Iglic, Ales; Kralj-Iglic, Veronika

2008-08-01

Plasma protein-mediated attractive interaction between membranes of red blood cells (RBCs) and phospholipid vesicles was studied. It is shown that beta(2)-glycoprotein I (beta(2)-GPI) may induce RBC discocyte-echinocyte-spherocyte shape transformation and subsequent agglutination of RBCs. Based on the observed beta(2)-GPI-induced RBC cell shape transformation it is proposed that the hydrophobic portion of beta(2)-GPI molecule protrudes into the outer lipid layer of the RBC membrane and increases the area of this layer. It is also suggested that the observed agglutination of RBCs is at least partially driven by an attractive force which is of electrostatic origin and depends on the specific molecular shape and internal charge distribution of membrane-bound beta(2)-GPI molecules. The suggested beta(2)-GPI-induced attractive electrostatic interaction between like-charged RBC membrane surfaces is qualitatively explained by using a simple mathematical model within the functional density theory of the electric double layer, where the electrostatic attraction between the positively charged part of the first domains of bound beta(2)-GPI molecules and negatively charged glycocalyx of the adjacent RBC membrane is taken into account.

Molecules Without Atoms

NASA Astrophysics Data System (ADS)

Ruth, Anthony; Collins, Laura; Gomes, Kenjiro; Janko, Boldizsar

We present a real-space representation of molecules which results in the normal bonding rules and electronic structure of chemistry without atom-centered coulomb potentials. Using a simple mapping, we can generate atomless molecules from the structure of real molecules. Additionally, molecules without atoms show similar covalent bonding energies and transfer of charge in ionic bonds as real molecules. The atomless molecules contain only the valence and conduction electronic structure of the real molecule. Using the framework of the Atoms in Molecules (AIM) theory of Bader, we prove that the topological features of the valence charge distribution of molecules without atoms are identical to that of real molecules. In particular, the charge basins of atomless molecules show identical location and quantities of representative charge. We compare the accuracy, computational cost, and intuition gained from electronic structure calculations of molecules without atoms with the use of pseudopotentials to represent atomic cores in density functional theory. A. R. acknowledges support from a NASA Space Technology Research Fellowship.

Micro injector sample delivery system for charged molecules

DOEpatents

Davidson, James C.; Balch, Joseph W.

1999-11-09

A micro injector sample delivery system for charged molecules. The injector is used for collecting and delivering controlled amounts of charged molecule samples for subsequent analysis. The injector delivery system can be scaled to large numbers (>96) for sample delivery to massively parallel high throughput analysis systems. The essence of the injector system is an electric field controllable loading tip including a section of porous material. By applying the appropriate polarity bias potential to the injector tip, charged molecules will migrate into porous material, and by reversing the polarity bias potential the molecules are ejected or forced away from the tip. The invention has application for uptake of charged biological molecules (e.g. proteins, nucleic acids, polymers, etc.) for delivery to analytical systems, and can be used in automated sample delivery systems.

Single-molecule DNA detection with an engineered MspA protein nanopore

PubMed Central

Butler, Tom Z.; Pavlenok, Mikhail; Derrington, Ian M.; Niederweis, Michael; Gundlach, Jens H.

2008-01-01

Nanopores hold great promise as single-molecule analytical devices and biophysical model systems because the ionic current blockades they produce contain information about the identity, concentration, structure, and dynamics of target molecules. The porin MspA of Mycobacterium smegmatis has remarkable stability against environmental stresses and can be rationally modified based on its crystal structure. Further, MspA has a short and narrow channel constriction that is promising for DNA sequencing because it may enable improved characterization of short segments of a ssDNA molecule that is threaded through the pore. By eliminating the negative charge in the channel constriction, we designed and constructed an MspA mutant capable of electronically detecting and characterizing single molecules of ssDNA as they are electrophoretically driven through the pore. A second mutant with additional exchanges of negatively-charged residues for positively-charged residues in the vestibule region exhibited a factor of ≈20 higher interaction rates, required only half as much voltage to observe interaction, and allowed ssDNA to reside in the vestibule ≈100 times longer than the first mutant. Our results introduce MspA as a nanopore for nucleic acid analysis and highlight its potential as an engineerable platform for single-molecule detection and characterization applications. PMID:19098105

Balancing charge in the complementarity-determining regions of humanized mAbs without affecting pI reduces non-specific binding and improves the pharmacokinetics.

PubMed

Datta-Mannan, Amita; Thangaraju, Arunkumar; Leung, Donmienne; Tang, Ying; Witcher, Derrick R; Lu, Jirong; Wroblewski, Victor J

2015-01-01

Lowering the isoelectric point (pI) through engineering the variable region or framework of an IgG can improve its exposure and half-life via a reduction in clearance mediated through non-specific interactions. As such, net charge is a potentially important property to consider in developing therapeutic IgG molecules having favorable pharmaceutical characteristics. Frequently, it may not be possible to shift the pI of monoclonal antibodies (mAbs) dramatically without the introduction of other liabilities such as increased off-target interactions or reduced on-target binding properties. In this report, we explored the influence of more subtle modifications of molecular charge on the in vivo properties of an IgG1 and IgG4 monoclonal antibody. Molecular surface modeling was used to direct residue substitutions in the complementarity-determining regions (CDRs) to disrupt positive charge patch regions, resulting in a reduction in net positive charge without affecting the overall pI of the mAbs. The effect of balancing the net positive charge on non-specific binding was more significant for the IgG4 versus the IgG1 molecule that we examined. This differential effect was connected to the degree of influence on cellular degradation in vitro and in vivo clearance, distribution and metabolism in mice. In the more extreme case of the IgG4, balancing the charge yielded an ∼7-fold improvement in peripheral exposure, as well as significantly reduced tissue catabolism and subsequent excretion of proteolyzed products in urine. Balancing charge on the IgG1 molecule had a more subtle influence on non-specific binding and yielded only a modest alteration in clearance, distribution and elimination. These results suggest that balancing CDR charge without affecting the pI can lead to improved mAb pharmacokinetics, the magnitude of which is likely dependent on the relative influence of charge imbalance and other factors affecting the molecule's disposition.

Balancing charge in the complementarity-determining regions of humanized mAbs without affecting pI reduces non-specific binding and improves the pharmacokinetics

PubMed Central

Datta-Mannan, Amita; Thangaraju, Arunkumar; Leung, Donmienne; Tang, Ying; Witcher, Derrick R; Lu, Jirong; Wroblewski, Victor J

2015-01-01

Lowering the isoelectric point (pI) through engineering the variable region or framework of an IgG can improve its exposure and half-life via a reduction in clearance mediated through non-specific interactions. As such, net charge is a potentially important property to consider in developing therapeutic IgG molecules having favorable pharmaceutical characteristics. Frequently, it may not be possible to shift the pI of monoclonal antibodies (mAbs) dramatically without the introduction of other liabilities such as increased off-target interactions or reduced on-target binding properties. In this report, we explored the influence of more subtle modifications of molecular charge on the in vivo properties of an IgG1 and IgG4 monoclonal antibody. Molecular surface modeling was used to direct residue substitutions in the complementarity-determining regions (CDRs) to disrupt positive charge patch regions, resulting in a reduction in net positive charge without affecting the overall pI of the mAbs. The effect of balancing the net positive charge on non-specific binding was more significant for the IgG4 versus the IgG1 molecule that we examined. This differential effect was connected to the degree of influence on cellular degradation in vitro and in vivo clearance, distribution and metabolism in mice. In the more extreme case of the IgG4, balancing the charge yielded an ∼7-fold improvement in peripheral exposure, as well as significantly reduced tissue catabolism and subsequent excretion of proteolyzed products in urine. Balancing charge on the IgG1 molecule had a more subtle influence on non-specific binding and yielded only a modest alteration in clearance, distribution and elimination. These results suggest that balancing CDR charge without affecting the pI can lead to improved mAb pharmacokinetics, the magnitude of which is likely dependent on the relative influence of charge imbalance and other factors affecting the molecule's disposition. PMID:25695748

Interstellar Chemistry Gets More Complex With New Charged-Molecule Discovery

NASA Astrophysics Data System (ADS)

2007-07-01

Astronomers using data from the National Science Foundation's Robert C. Byrd Green Bank Telescope (GBT) have found the largest negatively-charged molecule yet seen in space. The discovery of the third negatively-charged molecule, called an anion, in less than a year and the size of the latest anion will force a drastic revision of theoretical models of interstellar chemistry, the astronomers say. Molecule formation Formation Process of Large, Negatively-Charged Molecule in Interstellar Space CREDIT: Bill Saxton, NRAO/AUI/NSF Click on image for page of graphics and detailed information "This discovery continues to add to the diversity and complexity that is already seen in the chemistry of interstellar space," said Anthony J. Remijan of the National Radio Astronomy Observatory (NRAO). "It also adds to the number of paths available for making the complex organic molecules and other large molecular species that may be precursors to life in the giant clouds from which stars and planets are formed," he added. Two teams of scientists found negatively-charged octatetraynyl, a chain of eight carbon atoms and one hydrogen atom, in the envelope of gas around an old, evolved star and in a cold, dark cloud of molecular gas. In both cases, the molecule had an extra electron, giving it a negative charge. About 130 neutral and about a dozen positively-charged molecules have been discovered in space, but the first negatively-charged molecule was not discovered until late last year. The largest previously-discovered negative ion found in space has six carbon atoms and one hydrogen atom. "Until recently, many theoretical models of how chemical reactions evolve in interstellar space have largely neglected the presence of anions. This can no longer be the case, and this means that there are many more ways to build large organic molecules in cosmic environments than have been explored," said Jan M. Hollis of NASA's Goddard Space Flight Center (GSFC). Ultraviolet light from stars can knock an electron off a molecule, creating a positively-charged ion. Astronomers had thought that molecules would not be able to retain an extra electron, and thus a negative charge, in interstellar space for a significant time. "That obviously is not the case," said Mike McCarthy of the Harvard-Smithsonian Center for Astrophysics. "Anions are surprisingly abundant in these regions." Remijan and his colleagues found the octatetraynyl anions in the envelope of the evolved giant star IRC +10 216, about 550 light-years from Earth in the constellation Leo. They found radio waves emitted at specific frequencies characteristic of the charged molecule by searching archival data from the GBT, the largest fully-steerable radio telescope in the world. Another team from the Harvard-Smithsonian Center for Astrophysics (CfA) found the same characteristic emission when they observed a cold cloud of molecular gas called TMC-1 in the constellation Taurus. These observations also were done with the GBT. In both cases, preceding laboratory experiments by the CfA team showed which radio frequencies actually are emitted by the molecule, and thus told the astronomers what to look for. "It is essential that likely interstellar molecule candidates are first studied in laboratory experiments so that the radio frequencies they can emit are known in advance of an astronomical observation," said Frank Lovas of the National Institute of Standards and Technology (NIST). Both teams announced their results in the July 20 edition of the Astrophysical Journal Letters. "With three negatively-charged molecules now found in a short period of time, and in very different environments, it appears that many more probably exist. We believe that we can discover more new species using very sensitive and advanced radio telescopes such as the GBT, once they have been characterized in the laboratory," said Sandra Bruenken of the CfA. "Further detailed studies of anions, including astronomical observations, laboratory studies, and theoretical calculations, will allow us to use them to reveal new information about the physical and chemical processes going on in interstellar space," said Martin Cordiner, of Queen's University in Belfast, Northern Ireland. "The GBT continues to take a leading role in discovering, identifying and mapping the distribution of the largest molecules ever found in astronomical environments and will continue to do so for the next several decades," said Phil Jewell of NRAO. In addition to Hollis, Lovas, Cordiner and Jewell, Remijan worked with Tom Millar of Queen's University in Belfast, Northern Ireland, and Andrew Markwick-Kemper of the University of Manchester in the UK. Bruenken worked with McCarthy, Harshal Gupta, Carl Gottlieb, and Patrick Thaddeus, all of the Harvard-Smithsonian Center for Astrophysics. The National Radio Astronomy Observatory is a facility of the National Science Foundation, operated under cooperative agreement by Associated Universities, Inc. Headquartered in Cambridge, Mass., the Harvard-Smithsonian Center for Astrophysics is a joint collaboration between the Smithsonian Astrophysical Observatory and the Harvard College Observatory. CfA scientists, organized into six research divisions, study the origin, evolution and ultimate fate of the universe.

A scale-bridging modeling approach for anisotropic organic molecules at patterned semiconductor surfaces

NASA Astrophysics Data System (ADS)

Kleppmann, Nicola; Klapp, Sabine H. L.

2015-02-01

Hybrid systems consisting of organic molecules at inorganic semiconductor surfaces are gaining increasing importance as thin film devices for optoelectronics. The efficiency of such devices strongly depends on the collective behavior of the adsorbed molecules. In the present paper, we propose a novel, coarse-grained model addressing the condensed phases of a representative hybrid system, that is, para-sexiphenyl (6P) at zinc-oxide (ZnO). Within our model, intermolecular interactions are represented via a Gay-Berne potential (describing steric and van-der-Waals interactions) combined with the electrostatic potential between two linear quadrupoles. Similarly, the molecule-substrate interactions include a coupling between a linear molecular quadrupole to the electric field generated by the line charges characterizing ZnO(10-10). To validate our approach, we perform equilibrium Monte Carlo simulations, where the lateral positions are fixed to a 2D lattice, while the rotational degrees of freedom are continuous. We use these simulations to investigate orientational ordering in the condensed state. We reproduce various experimentally observed features such as the alignment of individual molecules with the line charges on the surface, the formation of a standing uniaxial phase with a herringbone structure, as well as the formation of a lying nematic phase.

A simple, efficient polarizable coarse-grained water model for molecular dynamics simulations.

PubMed

Riniker, Sereina; van Gunsteren, Wilfred F

2011-02-28

The development of coarse-grained (CG) models that correctly represent the important features of compounds is essential to overcome the limitations in time scale and system size currently encountered in atomistic molecular dynamics simulations. Most approaches reported in the literature model one or several molecules into a single uncharged CG bead. For water, this implicit treatment of the electrostatic interactions, however, fails to mimic important properties, e.g., the dielectric screening. Therefore, a coarse-grained model for water is proposed which treats the electrostatic interactions between clusters of water molecules explicitly. Five water molecules are embedded in a spherical CG bead consisting of two oppositely charged particles which represent a dipole. The bond connecting the two particles in a bead is unconstrained, which makes the model polarizable. Experimental and all-atom simulated data of liquid water at room temperature are used for parametrization of the model. The experimental density and the relative static dielectric permittivity were chosen as primary target properties. The model properties are compared with those obtained from experiment, from clusters of simple-point-charge water molecules of appropriate size in the liquid phase, and for other CG water models if available. The comparison shows that not all atomistic properties can be reproduced by a CG model, so properties of key importance have to be selected when coarse graining is applied. Yet, the CG model reproduces the key characteristics of liquid water while being computationally 1-2 orders of magnitude more efficient than standard fine-grained atomistic water models.

A second generation distributed point polarizable water model.

PubMed

Kumar, Revati; Wang, Fang-Fang; Jenness, Glen R; Jordan, Kenneth D

2010-01-07

A distributed point polarizable model (DPP2) for water, with explicit terms for charge penetration, induction, and charge transfer, is introduced. The DPP2 model accurately describes the interaction energies in small and large water clusters and also gives an average internal energy per molecule and radial distribution functions of liquid water in good agreement with experiment. A key to the success of the model is its accurate description of the individual terms in the n-body expansion of the interaction energies.

Differential geometry based solvation model. III. Quantum formulation

PubMed Central

Chen, Zhan; Wei, Guo-Wei

2011-01-01

Solvation is of fundamental importance to biomolecular systems. Implicit solvent models, particularly those based on the Poisson-Boltzmann equation for electrostatic analysis, are established approaches for solvation analysis. However, ad hoc solvent-solute interfaces are commonly used in the implicit solvent theory. Recently, we have introduced differential geometry based solvation models which allow the solvent-solute interface to be determined by the variation of a total free energy functional. Atomic fixed partial charges (point charges) are used in our earlier models, which depends on existing molecular mechanical force field software packages for partial charge assignments. As most force field models are parameterized for a certain class of molecules or materials, the use of partial charges limits the accuracy and applicability of our earlier models. Moreover, fixed partial charges do not account for the charge rearrangement during the solvation process. The present work proposes a differential geometry based multiscale solvation model which makes use of the electron density computed directly from the quantum mechanical principle. To this end, we construct a new multiscale total energy functional which consists of not only polar and nonpolar solvation contributions, but also the electronic kinetic and potential energies. By using the Euler-Lagrange variation, we derive a system of three coupled governing equations, i.e., the generalized Poisson-Boltzmann equation for the electrostatic potential, the generalized Laplace-Beltrami equation for the solvent-solute boundary, and the Kohn-Sham equations for the electronic structure. We develop an iterative procedure to solve three coupled equations and to minimize the solvation free energy. The present multiscale model is numerically validated for its stability, consistency and accuracy, and is applied to a few sets of molecules, including a case which is difficult for existing solvation models. Comparison is made to many other classic and quantum models. By using experimental data, we show that the present quantum formulation of our differential geometry based multiscale solvation model improves the prediction of our earlier models, and outperforms some explicit solvation model. PMID:22112067

The role of the tunneling matrix element and nuclear reorganization in the design of quantum-dot cellular automata molecules

NASA Astrophysics Data System (ADS)

Henry, Jackson; Blair, Enrique P.

2018-02-01

Mixed-valence molecules provide an implementation for a high-speed, energy-efficient paradigm for classical computing known as quantum-dot cellular automata (QCA). The primitive device in QCA is a cell, a structure with multiple quantum dots and a few mobile charges. A single mixed-valence molecule can function as a cell, with redox centers providing quantum dots. The charge configuration of a molecule encodes binary information, and device switching occurs via intramolecular electron transfer between dots. Arrays of molecular cells adsorbed onto a substrate form QCA logic. Individual cells in the array are coupled locally via the electrostatic electric field. This device networking enables general-purpose computing. Here, a quantum model of a two-dot molecule is built in which the two-state electronic system is coupled to the dominant nuclear vibrational mode via a reorganization energy. This model is used to explore the effects of the electronic inter-dot tunneling (coupling) matrix element and the reorganization energy on device switching. A semi-classical reduction of the model also is made to investigate the competition between field-driven device switching and the electron-vibrational self-trapping. A strong electron-vibrational coupling (high reorganization energy) gives rise to self-trapping, which inhibits the molecule's ability to switch. Nonetheless, there remains an expansive area in the tunneling-reorganization phase space where molecules can support adequate tunneling. Thus, the relationship between the tunneling matrix element and the reorganization energy affords significant leeway in the design of molecules viable for QCA applications.

Calculation of total cross sections for charge exchange in molecular collisions

NASA Technical Reports Server (NTRS)

Ioup, J.

1979-01-01

Areas of investigation summarized include nitrogen ion-nitrogen molecule collisions; molecular collisions with surfaces; molecular identification from analysis of cracking patterns of selected gases; computer modelling of a quadrupole mass spectrometer; study of space charge in a quadrupole; transmission of the 127 deg cylindrical electrostatic analyzer; and mass spectrometer data deconvolution.

Self-Optimized Biological Channels in Facilitating the Transmembrane Movement of Charged Molecules

PubMed Central

Huyen, V. T. N.; Lap, Vu Cong; Nguyen, V. Lien

2016-01-01

We consider an anisotropically two-dimensional diffusion of a charged molecule (particle) through a large biological channel under an external voltage. The channel is modeled as a cylinder of three structure parameters: radius, length, and surface density of negative charges located at the channel interior-lining. These charges induce inside the channel a potential that plays a key role in controlling the particle current through the channel. It was shown that to facilitate the transmembrane particle movement the channel should be reasonably self-optimized so that its potential coincides with the resonant one, resulting in a large particle current across the channel. Observed facilitation appears to be an intrinsic property of biological channels, regardless of the external voltage or the particle concentration gradient. This facilitation is very selective in the sense that a channel of definite structure parameters can facilitate the transmembrane movement of only particles of proper valence at corresponding temperatures. Calculations also show that the modeled channel is nonohmic with the ion conductance which exhibits a resonance at the same channel potential as that identified in the current. PMID:27022394

Theoretical evidence of charge transfer interaction between SO₂ and deep eutectic solvents formed by choline chloride and glycerol.

PubMed

Li, Hongping; Chang, Yonghui; Zhu, Wenshuai; Wang, Changwei; Wang, Chao; Yin, Sheng; Zhang, Ming; Li, Huaming

2015-11-21

The nature of the interaction between deep eutectic solvents (DESs), formed by ChCl and glycerol, and SO2 has been systematically investigated using the M06-2X density functional combined with cluster models. Block-localized wave function energy decomposition (BLW-ED) analysis shows that the interaction between SO2 and DESs is dominated by a charge transfer interaction. After this interaction, the SO2 molecule becomes negatively charged, whereas the ChCl-glycerol molecule is positively charged, which is the result of Lewis acid-base interaction. The current result affords a theoretical proof that it is highly useful and efficient to manipulate the Lewis acidity of absorbents for SO2 capture. Moreover, hydrogen bonding as well as electrostatic interactions may also contribute to the stability of the complex. Structure analysis shows that solvent molecules will adjust their geometries to interact with SO2. In addition, the structure of SO2 is barely changed after interaction. The interaction energy between different cluster models and SO2 ranges from -6.8 to -14.4 kcal mol(-1). It is found that the interaction energy is very sensitive to the solvent structure. The moderate interaction between ChCl-glycerol and SO2 is consistent with the concept that highly efficient solvents for SO2 absorption should not only be solvable but also regenerable.

Geoengineering with Charged Droplets

NASA Astrophysics Data System (ADS)

Gokturk, H.

2011-12-01

Water molecules in a droplet are held together by intermolecular forces generated by hydrogen bonding which has a bonding energy of only about 0.2 eV. One can create a more rugged droplet by using an ion as a condensation nucleus. In that case, water molecules are held together by the interaction between the ion and the dipole moments of the water molecules surrounding the ion, in addition to any hydrogen bonding. In this research, properties of such charged droplets were investigated using first principle quantum mechanical calculations. A molecule which exhibits positive electron affinity is a good candidate to serve as the ionic condensation nucleus, because addition of an electron to such a molecule creates an energetically more stable state than the neutral molecule. A good example is the oxygen molecule (O2) where energy of O2 negative (O2-) ion is lower than that of the neutral O2 by about 0.5 eV. Examples of other molecules which have positive electron affinity include ozone (O3), nitrogen dioxide (NO2) and sulfur oxides (SOx, x=1-3). Atomic models used in the calculations consisted of a negative ion of one of the molecules mentioned above surrounded by water molecules. Calculations were performed using the DFT method with B3LYP hybrid functional and Pople type basis sets with polarization and diffuse functions. Energy of interaction between O2- ion and the water molecule was found to be ~0.7 eV. This energy is an order of magnitude greater than the thermal energy of even the highest temperatures encountered in the atmosphere. Once created, charged rugged droplets can survive in hot and dry climates where they can be utilized to create humidity and precipitation. The ion which serves as the nucleus of the droplet can attract not only water molecules but also other dipolar gases in the atmosphere. Such dipolar gases include industrial pollutants, for example nitrogen dioxide (NO2) or sulfur dioxide (SO2). Energy of interaction between O2- ion and pollutant molecules was calculated to be ~0.5 eV for NO2 and ~0.9 eV for SO2. These values are comparable to that of water, hence charged droplets have the potential to serve as scavengers of pollutants in the atmosphere. The charged droplet can also interact with quadrupolar gases depending on the charge distribution of the gas. A quadrupole of interest is carbon dioxide (CO2) where oxygens are slightly negative and carbon is slightly positive in a neutral molecule. When CO2 is in the vicinity of a negative ion, the carbon atom gets attracted to the ion, whereas oxygens are repelled from it. This interaction distorts the linear geometry of CO2, turning it into a small dipole. Energy of interaction between O2- ion and CO2 was calculated to be ~0.3 eV which is smaller than those of the above mentioned dipoles, but still significantly greater than the typical thermal energy at 25 C (~0.03 eV). One can expect the diffusion of atmospheric CO2 into the droplets to be enhanced due to the charge. Hence such droplets can help capture the CO2 in the atmosphere and sequester it simply as rain. Charged droplets can be created using electrical,optical, thermal or other means. A method which utilizes solar energy will be described in the presentation.

Luminescent systems based on the isolation of conjugated PI systems and edge charge compensation with polar molecules on a charged nanostructured surface

DOEpatents

Ivanov, Ilia N.; Puretzky, Alexander A.; Zhao, Bin; Geohegan, David B.; Styers-Barnett, David J.; Hu, Hui

2014-07-15

A photoluminescent or electroluminescent system and method of making a non-luminescent nanostructured material into such a luminescent system is presented. The method of preparing the luminescent system, generally, comprises the steps of modifying the surface of a nanostructured material to create isolated regions to act as luminescent centers and to create a charge imbalance on the surface; applying more than one polar molecule to the charged surface of the nanostructured material; and orienting the polar molecules to compensate for the charge imbalance on the surface of the nanostructured material. The compensation of the surface charge imbalance by the polar molecules allows the isolated regions to exhibit luminescence.

Quantum crystallographic charge density of urea

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wall, Michael E.

Standard X-ray crystallography methods use free-atom models to calculate mean unit-cell charge densities. Real molecules, however, have shared charge that is not captured accurately using free-atom models. To address this limitation, a charge density model of crystalline urea was calculated using high-level quantum theory and was refined against publicly available ultra-high-resolution experimental Bragg data, including the effects of atomic displacement parameters. The resulting quantum crystallographic model was compared with models obtained using spherical atom or multipole methods. Despite using only the same number of free parameters as the spherical atom model, the agreement of the quantum model with the datamore » is comparable to the multipole model. The static, theoretical crystalline charge density of the quantum model is distinct from the multipole model, indicating the quantum model provides substantially new information. Hydrogen thermal ellipsoids in the quantum model were very similar to those obtained using neutron crystallography, indicating that quantum crystallography can increase the accuracy of the X-ray crystallographic atomic displacement parameters. Lastly, the results demonstrate the feasibility and benefits of integrating fully periodic quantum charge density calculations into ultra-high-resolution X-ray crystallographic model building and refinement.« less

Quantum crystallographic charge density of urea

DOE PAGES

Wall, Michael E.

2016-06-08

Standard X-ray crystallography methods use free-atom models to calculate mean unit-cell charge densities. Real molecules, however, have shared charge that is not captured accurately using free-atom models. To address this limitation, a charge density model of crystalline urea was calculated using high-level quantum theory and was refined against publicly available ultra-high-resolution experimental Bragg data, including the effects of atomic displacement parameters. The resulting quantum crystallographic model was compared with models obtained using spherical atom or multipole methods. Despite using only the same number of free parameters as the spherical atom model, the agreement of the quantum model with the datamore » is comparable to the multipole model. The static, theoretical crystalline charge density of the quantum model is distinct from the multipole model, indicating the quantum model provides substantially new information. Hydrogen thermal ellipsoids in the quantum model were very similar to those obtained using neutron crystallography, indicating that quantum crystallography can increase the accuracy of the X-ray crystallographic atomic displacement parameters. Lastly, the results demonstrate the feasibility and benefits of integrating fully periodic quantum charge density calculations into ultra-high-resolution X-ray crystallographic model building and refinement.« less

Polycyclic aromatic hydrocarbons in stellar medium

NASA Astrophysics Data System (ADS)

Rastogi, Shantanu

2005-06-01

Polycyclic Aromatic Hydrocarbons (PAHs) are an important com- ponent of the Interstellar Medium (ISM). They are being used as probes for understanding of process and conditions of different astrophysical environments. The understanding of their IR spectra and its variations with PAH size and ionization state is useful in characterizing the ISM. Spectral features of model graphene sheets and also that of smaller PAH molecules are reported. The variation of intensity with charge state of the molecule shows that cations give a better correlation with observations. The relationship between changes in charge distribution with intensity changes upon ionization has been probed.

Point charge representation of multicenter multipole moments in calculation of electrostatic properties

NASA Technical Reports Server (NTRS)

Sokalski, W. A.; Shibata, M.; Ornstein, R. L.; Rein, R.

1993-01-01

Distributed Point Charge Models (PCM) for CO, (H2O)2, and HS-SH molecules have been computed from analytical expressions using multi-center multipole moments. The point charges (set of charges including both atomic and non-atomic positions) exactly reproduce both molecular and segmental multipole moments, thus constituting an accurate representation of the local anisotropy of electrostatic properties. In contrast to other known point charge models, PCM can be used to calculate not only intermolecular, but also intramolecular interactions. Comparison of these results with more accurate calculations demonstrated that PCM can correctly represent both weak and strong (intramolecular) interactions, thus indicating the merit of extending PCM to obtain improved potentials for molecular mechanics and molecular dynamics computational methods.

Probe-based measurement of lateral single-electron transfer between individual molecules

PubMed Central

Steurer, Wolfram; Fatayer, Shadi; Gross, Leo; Meyer, Gerhard

2015-01-01

The field of molecular electronics aims at using single molecules as functional building blocks for electronics components, such as switches, rectifiers or transistors. A key challenge is to perform measurements with atomistic control over the alignment of the molecule and its contacting electrodes. Here we use atomic force microscopy to examine charge transfer between weakly coupled pentacene molecules on insulating films with single-electron sensitivity and control over the atomistic details. We show that, in addition to the imaging capability, the probe tip can be used to control the charge state of individual molecules and to detect charge transfers to/from the tip, as well as between individual molecules. Our approach represents a novel route for molecular charge transfer studies with a host of opportunities, especially in combination with single atom/molecule manipulation and nanopatterning techniques. PMID:26387533

Observational aspects of polycyclic aromatic hydrocarbon charging in the Interstellar Medium

NASA Technical Reports Server (NTRS)

Bakes, E. L. O.; Tielens, Alexander G. G. M.

1995-01-01

We have investigated the charging processes which affect small carbonaceous dust grains and polycyclic aromatic hydrocarbons (PAH's). Because of their high abundance, interstellar PAH molecules can dominate the charge balance of the interstellar medium (ISM), which controls the heating and cooling interstellar gas and interstellar chemistry. We present the results of our model, which compare well with observations and suggest further applications to both laboratory measurements and data obtainable from the KAO.

First Principles Modeling and Interpretation of Ionization-Triggered Charge Migration in Molecules

NASA Astrophysics Data System (ADS)

Bruner, Adam; Hernandez, Sam; Mauger, Francois; Abanador, Paul; Gaarde, Mette; Schafer, Ken; Lopata, Ken

Modeling attosecond coherent charge migration in molecules is important for understanding initial steps of photochemistry and light harvesting processes. Ionization triggered hole migration can be difficult to characterize and interpret as the dynamics can be convoluted with excited states. Here, we introduce a real-time time-dependent density functional theory (RT-TDDFT) approach for modeling such dynamics from first principles. To isolate the specific hole dynamics from excited states, Fourier transform analysis and orbital occupations are used to provide a spatial hole representation in the frequency domain. These techniques are applied to hole transfer across a thiophene dimer as well as core-hole triggered valence motion in nitrosobenzene. This work was supported by U.S. Department of Energy, Office of Science, Office of Basic Energy Sciences, under Award No. DE-SC0012462.

Contact and Length Dependent Effects in Single-Molecule Electronics

NASA Astrophysics Data System (ADS)

Hines, Thomas

Understanding charge transport in single molecules covalently bonded to electrodes is a fundamental goal in the field of molecular electronics. In the past decade, it has become possible to measure charge transport on the single-molecule level using the STM break junction method. Measurements on the single-molecule level shed light on charge transport phenomena which would otherwise be obfuscated by ensemble measurements of groups of molecules. This thesis will discuss three projects carried out using STM break junction. In the first project, the transition between two different charge transport mechanisms is reported in a set of molecular wires. The shortest wires show highly length dependent and temperature invariant conductance behavior, whereas the longer wires show weakly length dependent and temperature dependent behavior. This trend is consistent with a model whereby conduction occurs by coherent tunneling in the shortest wires and by incoherent hopping in the longer wires. Measurements are supported with calculations and the evolution of the molecular junction during the pulling process is investigated. The second project reports controlling the formation of single-molecule junctions by means of electrochemically reducing two axial-diazonium terminal groups on a molecule, thereby producing direct Au-C covalent bonds in-situ between the molecule and gold electrodes. Step length analysis shows that the molecular junction is significantly more stable, and can be pulled over a longer distance than a comparable junction created with amine anchoring bonds. The stability of the junction is explained by the calculated lower binding energy associated with the direct Au-C bond compared with the Au-N bond. Finally, the third project investigates the role that molecular conformation plays in the conductance of oligothiophene single-molecule junctions. Ethyl substituted oligothiophenes were measured and found to exhibit temperature dependent conductance and transition voltage for molecules with between two and six repeat units. While the molecule with only one repeat unit shows temperature invariant behavior. Density functional theory calculations show that at higher temperatures the oligomers with multiple repeat units assume a more planar conformation, which increases the conjugation length and decreases the effective energy barrier of the junction.

Elimination of Spurious Fractional Charges in Dissociating Molecules by Correcting the Shape of Approximate Kohn-Sham Potentials.

PubMed

Komsa, Darya N; Staroverov, Viktor N

2016-11-08

Standard density-functional approximations often incorrectly predict that heteronuclear diatomic molecules dissociate into fractionally charged atoms. We demonstrate that these spurious charges can be eliminated by adapting the shape-correction method for Kohn-Sham potentials that was originally introduced to improve Rydberg excitation energies [ Phys. Rev. Lett. 2012 , 108 , 253005 ]. Specifically, we show that if a suitably determined fraction of electron charge is added to or removed from a frontier Kohn-Sham orbital level, the approximate Kohn-Sham potential of a stretched molecule self-corrects by developing a semblance of step structure; if this potential is used to obtain the electron density of the neutral molecule, charge delocalization is blocked and spurious fractional charges disappear beyond a certain internuclear distance.

Salinity Effects on the Adsorption of Nucleic Acid Compounds on Na-Montmorillonite: a Prebiotic Chemistry Experiment

NASA Astrophysics Data System (ADS)

Villafañe-Barajas, Saúl A.; Baú, João Paulo T.; Colín-García, María; Negrón-Mendoza, Alicia; Heredia-Barbero, Alejandro; Pi-Puig, Teresa; Zaia, Dimas A. M.

2018-02-01

Any proposed model of Earth's primitive environments requires a combination of geochemical variables. Many experiments are prepared in aqueous solutions and in the presence of minerals. However, most sorption experiments are performed in distilled water, and just a few in seawater analogues, mostly inconsistent with a representative primitive ocean model. Therefore, it is necessary to perform experiments that consider the composition and concentration of dissolved salts in the early ocean to understand how these variables could have affected the absorption of organic molecules into minerals. In this work, the adsorption of adenine, adenosine, and 5'AMP onto Na+montmorillonite was studied using a primitive ocean analog (4.0 Ga) from experimental and computational approaches. The order of sorption of the molecules was: 5'AMP > adenine > adenosine. Infrared spectra showed that the interaction between these molecules and montmorillonite occurs through the NH2 group. In addition, electrostatic interaction between negatively charged montmorillonite and positively charge N1 of these molecules could occur. Results indicate that dissolved salts affect the sorption in all cases; the size and structure of each organic molecule influence the amount sorbed. Specifically, the X-ray diffraction patterns show that dissolved salts occupy the interlayer space in Na-montmorillonite and compete with organic molecules for available sites. The adsorption capacity is clearly affected by dissolved salts in thermodynamic terms as deduced by isotherm models. Indeed, molecular dynamic models suggest that salts are absorbed in the interlamellar space and can interact with oxygen atoms exposed in the edges of clay or in its surface, reducing the sorption of the organic molecules. This research shows that the sorption process could be affected by high concentration of salts, since ions and organic molecules may compete for available sites on inorganic surfaces. Salt concentration in primitive oceans may have strongly affected the sorption, and hence the concentration processes of organic molecules on minerals.

Ionic scattering factors of atoms that compose biological molecules

PubMed Central

Matsuoka, Rei; Yamashita, Yoshiki; Yamane, Tsutomu; Kidera, Akinori; Maki-Yonekura, Saori

2018-01-01

Ionic scattering factors of atoms that compose biological molecules have been computed by the multi-configuration Dirac–Fock method. These ions are chemically unstable and their scattering factors had not been reported except for O−. Yet these factors are required for the estimation of partial charges in protein molecules and nucleic acids. The electron scattering factors of these ions are particularly important as the electron scattering curves vary considerably between neutral and charged atoms in the spatial-resolution range explored in structural biology. The calculated X-ray and electron scattering factors have then been parameterized for the major scattering curve models used in X-ray and electron protein crystallography and single-particle cryo-EM. The X-ray and electron scattering factors and the fitting parameters are presented for future reference. PMID:29755750

Computational Modeling | Bioenergy | NREL

Science.gov Websites

molecules dissociates and an H-H pair is formed. The atomic structure of state 3 is shown in the lower inset -dissociation of the first H2 molecule. The structure and partial charge density (at the highest occupied band depicted by the illustration to the left determined the structure and binding orientation of several

Ultrafast Coulomb explosion of a diiodomethane molecule induced by an X-ray free-electron laser pulse.

PubMed

Takanashi, Tsukasa; Nakamura, Kosuke; Kukk, Edwin; Motomura, Koji; Fukuzawa, Hironobu; Nagaya, Kiyonobu; Wada, Shin-Ichi; Kumagai, Yoshiaki; Iablonskyi, Denys; Ito, Yuta; Sakakibara, Yuta; You, Daehyun; Nishiyama, Toshiyuki; Asa, Kazuki; Sato, Yuhiro; Umemoto, Takayuki; Kariyazono, Kango; Ochiai, Kohei; Kanno, Manabu; Yamazaki, Kaoru; Kooser, Kuno; Nicolas, Christophe; Miron, Catalin; Asavei, Theodor; Neagu, Liviu; Schöffler, Markus; Kastirke, Gregor; Liu, Xiao-Jing; Rudenko, Artem; Owada, Shigeki; Katayama, Tetsuo; Togashi, Tadashi; Tono, Kensuke; Yabashi, Makina; Kono, Hirohiko; Ueda, Kiyoshi

2017-08-02

Coulomb explosion of diiodomethane CH 2 I 2 molecules irradiated by ultrashort and intense X-ray pulses from SACLA, the Japanese X-ray free electron laser facility, was investigated by multi-ion coincidence measurements and self-consistent charge density-functional-based tight-binding (SCC-DFTB) simulations. The diiodomethane molecule, containing two heavy-atom X-ray absorbing sites, exhibits a rather different charge generation and nuclear motion dynamics compared to iodomethane CH 3 I with only a single heavy atom, as studied earlier. We focus on charge creation and distribution in CH 2 I 2 in comparison to CH 3 I. The release of kinetic energy into atomic ion fragments is also studied by comparing SCC-DFTB simulations with the experiment. Compared to earlier simulations, several key enhancements are made, such as the introduction of a bond axis recoil model, where vibrational energy generated during charge creation processes induces only bond stretching or shrinking. We also propose an analytical Coulomb energy partition model to extract the essential mechanism of Coulomb explosion of molecules from the computed and the experimentally measured kinetic energies of fragment atomic ions by partitioning each pair Coulomb interaction energy into two ions of the pair under the constraint of momentum conservation. Effective internuclear distances assigned to individual fragment ions at the critical moment of the Coulomb explosion are then estimated from the average kinetic energies of the ions. We demonstrate, with good agreement between the experiment and the SCC-DFTB simulation, how the more heavily charged iodine fragments and their interplay define the characteristic features of the Coulomb explosion of CH 2 I 2 . The present study also confirms earlier findings concerning the magnitude of bond elongation in the ultrashort X-ray pulse duration, showing that structural damage to all but C-H bonds does not develop to a noticeable degree in the pulse length of ∼10 fs.

Manipulating the dipole layer of polar organic molecules on metal surfaces via different charge-transfer channels

NASA Astrophysics Data System (ADS)

Lin, Meng-Kai; Nakayama, Yasuo; Zhuang, Ying-Jie; Wang, Chin-Yung; Pi, Tun-Wen; Ishii, Hisao; Tang, S.-J.

The key properties of organic films such as energy level alignment (ELA), work functions, and injection barriers are closely linked to this dipole layer. Using angle resolved photoemission spectroscopy (ARPES), we systemically investigate the coverage-dependent work functions and spectra line shapes of occupied molecular orbital states of a polar molecule, chloroaluminium phthalocyanine (ClAlPc), grown on Ag(111) to show that the orientations of the first ClAlPc layer can be manipulated via the molecule deposition rate and post annealing, causing ELA at organic-metal interface to differ for about 0.3 eV between Cl-up and Cl-down configuration. Moreover, by comparing the experimental results with the calculations based on both gas-phase model and realistic model of ClAlPc on Ag(111) , we evidence that the different orientations of ClAlPc dipole layers lead to different charge-transfer channels between ClAlPc and Ag, a key factor that controls the ELA at organic-metal interface.

Liquid Adsorption of Organic Compounds on Hematite α-Fe2O3 Using ReaxFF.

PubMed

Chia, Chung-Lim; Avendaño, Carlos; Siperstein, Flor R; Filip, Sorin

2017-10-24

ReaxFF-based molecular dynamics simulations are used in this work to study the effect of the polarity of adsorbed molecules in the liquid phase on the structure and polarization of hematite (α-Fe 2 O 3 ). We compared the adsorption of organic molecules with different polarities on a rigid hematite surface and on a flexible and polarizable surface. We show that the displacements of surface atoms and surface polarization in a flexible hematite model are proportional to the adsorbed molecule's polarity. The increase in electrostatic interactions resulting from charge transfer in the outermost solid atoms in a flexible hematite model results in better-defined adsorbed layers that are less ordered than those obtained assuming a rigid solid. These results suggest that care must be taken when parametrizing empirical transferable force fields because the calculated charges on a solid slab in vacuum may not be representative of a real system, especially when the solid is in contact with a polar liquid.

Brownian dynamics simulations of simplified cytochrome c molecules in the presence of a charged surface

NASA Astrophysics Data System (ADS)

Gorba, C.; Geyer, T.; Helms, V.

2004-07-01

Simulations were performed for up to 150 simplified spherical horse heart cytochrome c molecules in the presence of a charged surface, which serves as an approximate model for a lipid membrane. Screened electrostatic and short-ranged attractive as well as repulsive van der Waals forces for interparticle and particle-membrane interactions are utilized in the simulations. At a distance from the membrane, where particle-membrane interactions are negligible, the simulation is coupled to a noninteraction continuum analogous to a heat bath [Geyer et al., J. Chem. Phys. 120, 4573 (2004)]. From the particles' density profiles perpendicular to the planar surface binding isotherms are derived and compared to experimental results [Heimburg et al. (1999)]. Using a negatively charged structureless membrane surface a saturation effect was found for relatively large particle concentrations. Since biological membranes often contain membrane proteins, we also studied the influence of additional charges on our model membrane mimicking bacterial reaction centers. We find that the onset of the saturation occurs for much lower concentrations and is sensitive to the detailed implementation. Therefore we suggest that local distortion of membrane planarity (undulation), or lipid demixing, or the presence of charged integral membrane proteins create preferential binding sites on the membrane. Only then do we observe saturation at physiological concentrations.

A statistic-thermodynamic model for the DOM degradation in the estuary

NASA Astrophysics Data System (ADS)

Zheng, Quanan; Chen, Qin; Zhao, Haihong; Shi, Jiuxin; Cao, Yong; Wang, Dan

2008-03-01

This study aims to clarify the role of dissolved salts playing in the degradation process of terrestrial dissolved organic matter (DOM) at a scale of molecular movement. The molecular thermal movement is perpetual motion. In a multi-molecular system, this random motion also causes collision between the molecules. Seawater is a multi-molecular system consisting from water, salt, and terrestrial DOM molecules. This study attributes the DOM degradation in the estuary to the inelastic collision of DOM molecule with charged salt ions. From statistic-thermodynamic theories of molecular collision, the DOM degradation model and the DOM distribution model are derived. The models are validated by the field observations and satellite data. Thus, we conclude that the inelastic collision between the terrestrial DOM molecules and dissolved salt ions in seawater is a decisive dynamic mechanism for rapid loss of terrestrial DOM.

Excluded volume and ion-ion correlation effects on the ionic atmosphere around B-DNA: Theory, simulations, and experiments

PubMed Central

Ovanesyan, Zaven; Fenley, Marcia O.; Guerrero-García, Guillermo Iván; Olvera de la Cruz, Mónica

2014-01-01

The ionic atmosphere around a nucleic acid regulates its stability in aqueous salt solutions. One major source of complexity in biological activities involving nucleic acids arises from the strong influence of the surrounding ions and water molecules on their structural and thermodynamic properties. Here, we implement a classical density functional theory for cylindrical polyelectrolytes embedded in aqueous electrolytes containing explicit (neutral hard sphere) water molecules at experimental solvent concentrations. Our approach allows us to include ion correlations as well as solvent and ion excluded volume effects for studying the structural and thermodynamic properties of highly charged cylindrical polyelectrolytes. Several models of size and charge asymmetric mixtures of aqueous electrolytes at physiological concentrations are studied. Our results are in good agreement with Monte Carlo simulations. Our numerical calculations display significant differences in the ion density profiles for the different aqueous electrolyte models studied. However, similar results regarding the excess number of ions adsorbed to the B-DNA molecule are predicted by our theoretical approach for different aqueous electrolyte models. These findings suggest that ion counting experimental data should not be used alone to validate the performance of aqueous DNA-electrolyte models. PMID:25494770

Anisotropy of the Coulomb Interaction between Folded Proteins: Consequences for Mesoscopic Aggregation of Lysozyme

PubMed Central

Chan, Ho Yin; Lankevich, Vladimir; Vekilov, Peter G.; Lubchenko, Vassiliy

2012-01-01

Toward quantitative description of protein aggregation, we develop a computationally efficient method to evaluate the potential of mean force between two folded protein molecules that allows for complete sampling of their mutual orientation. Our model is valid at moderate ionic strengths and accounts for the actual charge distribution on the surface of the molecules, the dielectric discontinuity at the protein-solvent interface, and the possibility of protonation or deprotonation of surface residues induced by the electric field due to the other protein molecule. We apply the model to the protein lysozyme, whose solutions exhibit both mesoscopic clusters of protein-rich liquid and liquid-liquid separation; the former requires that protein form complexes with typical lifetimes of approximately milliseconds. We find the electrostatic repulsion is typically lower than the prediction of the Derjaguin-Landau-Verwey-Overbeek theory. The Coulomb interaction in the lowest-energy docking configuration is nonrepulsive, despite the high positive charge on the molecules. Typical docking configurations barely involve protonation or deprotonation of surface residues. The obtained potential of mean force between folded lysozyme molecules is consistent with the location of the liquid-liquid coexistence, but produces dimers that are too short-lived for clusters to exist, suggesting lysozyme undergoes conformational changes during cluster formation. PMID:22768950

Discrete and continuum modeling of solvent effects in a twisted intramolecular charge transfer system: The 4-N,N-dimethylaminobenzonitrile (DMABN) molecule.

PubMed

Modesto-Costa, Lucas; Borges, Itamar

2018-08-05

The 4-N,N-dimethylaminobenzonitrile (DMABN) molecule is a prototypical system displaying twisted intramolecular (TICT) charge transfer effects. The ground and the first four electronic excited states (S 1 -S 4 ) in gas phase and upon solvation were studied. Charge transfer values as function of the torsion angle between the donor group (dimethylamine) and the acceptor moiety (benzonitrile) were explicitly computed. Potential energy curves were also obtained. The algebraic diagrammatic construction method at the second-order [ADC(2)] ab initio wave function was employed. Three solvents of increased polarities (benzene, DMSO and water) were investigated using discrete (average solvent electrostatic configuration - ASEC) and continuum (conductor-like screening model - COSMO) models. The results for the S 3 and S 4 excited states and the S 1 -S 4 charge transfer curves were not previously available in the literature. Electronic gas phase and solvent vertical spectra are in good agreement with previous theoretical and experimental results. In the twisted (90°) geometry the optical oscillator strengths have negligible values even for the S 2 bright state. Potential energy curves show two distinct pairs of curves intersecting at decreasing angles or not crossing in the more polar solvents. Charge transfer and electric dipole values allowed the rationalization of these results. The former effects are mostly independent of the solvent model and polarity. Although COSMO and ASEC solvent models mostly lead to similar results, there is an important difference: some crossings of the excitation energy curves appear only in the ASEC solvation model, which has important implications to the photochemistry of DMABN. Copyright © 2018 Elsevier B.V. All rights reserved.

A Nonlinear Elasticity Model of Macromolecular Conformational Change Induced by Electrostatic Forces

PubMed Central

Zhou, Y. C.; Holst, Michael; McCammon, J. Andrew

2008-01-01

In this paper we propose a nonlinear elasticity model of macromolecular conformational change (deformation) induced by electrostatic forces generated by an implicit solvation model. The Poisson-Boltzmann equation for the electrostatic potential is analyzed in a domain varying with the elastic deformation of molecules, and a new continuous model of the electrostatic forces is developed to ensure solvability of the nonlinear elasticity equations. We derive the estimates of electrostatic forces corresponding to four types of perturbations to an electrostatic potential field, and establish the existance of an equilibrium configuration using a fixed-point argument, under the assumption that the change in the ionic strength and charges due to the additional molecules causing the deformation are sufficiently small. The results are valid for elastic models with arbitrarily complex dielectric interfaces and cavities, and can be generalized to large elastic deformation caused by high ionic strength, large charges, and strong external fields by using continuation methods. PMID:19461946

Ion mobilities in diatomic gases: measurement versus prediction with non-specular scattering models.

PubMed

Larriba, Carlos; Hogan, Christopher J

2013-05-16

Ion/electrical mobility measurements of nanoparticles and polyatomic ions are typically linked to particle/ion physical properties through either application of the Stokes-Millikan relationship or comparison to mobilities predicted from polyatomic models, which assume that gas molecules scatter specularly and elastically from rigid structural models. However, there is a discrepancy between these approaches; when specular, elastic scattering models (i.e., elastic-hard-sphere scattering, EHSS) are applied to polyatomic models of nanometer-scale ions with finite-sized impinging gas molecules, predictions are in substantial disagreement with the Stokes-Millikan equation. To rectify this discrepancy, we developed and tested a new approach for mobility calculations using polyatomic models in which non-specular (diffuse) and inelastic gas-molecule scattering is considered. Two distinct semiempirical models of gas-molecule scattering from particle surfaces were considered. In the first, which has been traditionally invoked in the study of aerosol nanoparticles, 91% of collisions are diffuse and thermally accommodating, and 9% are specular and elastic. In the second, all collisions are considered to be diffuse and accommodating, but the average speed of the gas molecules reemitted from a particle surface is 8% lower than the mean thermal speed at the particle temperature. Both scattering models attempt to mimic exchange between translational, vibrational, and rotational modes of energy during collision, as would be expected during collision between a nonmonoatomic gas molecule and a nonfrozen particle surface. The mobility calculation procedure was applied considering both hard-sphere potentials between gas molecules and the atoms within a particle and the long-range ion-induced dipole (polarization) potential. Predictions were compared to previous measurements in air near room temperature of multiply charged poly(ethylene glycol) (PEG) ions, which range in morphology from compact to highly linear, and singly charged tetraalkylammonium cations. It was found that both non-specular, inelastic scattering rules lead to excellent agreement between predictions and experimental mobility measurements (within 5% of each other) and that polarization potentials must be considered to make correct predictions for high-mobility particles/ions. Conversely, traditional specular, elastic scattering models were found to substantially overestimate the mobilities of both types of ions.

Carbon Mineralization Using Phosphate and Silicate Ions

NASA Astrophysics Data System (ADS)

Gokturk, H.

2013-12-01

Carbon dioxide (CO2) reduction from combustion of fossil fuels has become an urgent concern for the society due to marked increase in weather related natural disasters and other negative consequences of global warming. CO2 is a highly stable molecule which does not readily interact with other neutral molecules. However it is more responsive to ions due to charge versus quadrupole interaction [1-2]. Ions can be created by dissolving a salt in water and then aerosolizing the solution. This approach gives CO2 molecules a chance to interact with the hydrated salt ions over the large surface area of the aerosol. Ion containing aerosols exist in nature, an example being sea spray particles generated by breaking waves. Such particles contain singly and doubly charged salt ions including Na+, Cl-, Mg++ and SO4--. Depending on the proximity of CO2 to the ion, interaction energy can be significantly higher than the thermal energy of the aerosol. For example, an interaction energy of 0.6 eV is obtained with the sulfate (SO4--) ion when CO2 is the nearest neighbor [2]. In this research interaction between CO2 and ions which carry higher charges are investigated. The molecules selected for the study are triply charged phosphate (PO4---) ions and quadruply charged silicate (SiO4----) ions. Examples of salts which contain such molecules are potassium phosphate (K3PO4) and sodium orthosilicate (Na4SiO4). The research has been carried out with first principle quantum mechanical calculations using the Density Functional Theory method with B3LYP functional and Pople type basis sets augmented with polarization and diffuse functions. Atomic models consist of the selected ions surrounded by water and CO2 molecules. Similar to the results obtained with singly and doubly charged ions [1-2], phosphate and silicate ions attract CO2 molecules. Energy of interaction between the ion and CO2 is 1.6 eV for the phosphate ion and 3.3 eV for the silicate ion. Hence one can expect that the selected ions would enhance the absorption of CO2 into the aerosol even more than the singly or doubly charged ions. Ion containing aerosols also help to catalyze reactions between water and CO2. Hydrated phosphate and silicate ions tend to attract hydrogen atoms from neighboring water molecules to reduce the charged state. When there is CO2 in the vicinity of the ion, the remainder of the water molecule which loses the hydrogen(s) reacts with CO2 to form carbonates. (PO4---) + H2O + CO2 -> (HPO3--) + (HCO3-) (SiO4----) + H2O + CO2 -> (HSiO4---) + (HCO3-) (SiO4----) + H2O + CO2 -> (H2SiO4--) + (CO3--) In conclusion, highly charged phosphate and silicate ions dissolved in water and aerosolized into small droplets can facilitate both the capture and the mineralization of CO2. This method would be especially effective in a CO2 rich environment such as the exhaust gas of a combustion process. [1] H. Gokturk, "Geoengineering with Charged Droplets," AGU Fall Meeting, San Francisco 2011 [2] H. Gokturk, "Atomistic Simulation of Sea Spray Particles," AGU Fall Meeting, San Francisco 2012

Hot kinetic model as a guide to improve organic photovoltaic materials.

PubMed

Sosorev, Andrey Yu; Godovsky, Dmitry Yu; Paraschuk, Dmitry Yu

2018-01-31

The modeling of organic solar cells (OSCs) can provide a roadmap for their further improvement. Many OSC models have been proposed in recent years; however, the impact of the key intermediates from photons to electricity-hot charge-transfer (CT) states-on the OSC efficiency is highly ambiguous. In this study, we suggest an analytical kinetic model for OSC that considers a two-step charge generation via hot CT states. This hot kinetic model allowed us to evaluate the impact of different material parameters on the OSC performance: the driving force for charge separation, optical bandgap, charge mobility, geminate recombination rate, thermalization rate, average electron-hole separation distance in the CT state, dielectric permittivity, reorganization energy and charge delocalization. In contrast to a widespread trend of lowering the material bandgap, the model predicts that this approach is only efficient along with improvement of the other material properties. The most promising ways to increase the OSC performance are decreasing the reorganization energy, i.e., an energy change accompanying CT from the donor molecule to the acceptor, increasing the dielectric permittivity and charge delocalization. The model suggests that there are no fundamental limitations that can prevent achieving the OSC efficiency above 20%.

Charge Transport Processes in Molecular Junctions

NASA Astrophysics Data System (ADS)

Smith, Christopher Eugene

Molecular electronics (ME) has evolved into a rich area of exploration that combines the fields of chemistry, materials, electronic engineering and computational modeling to explore the physics behind electronic conduction at the molecular level. Through studying charge transport properties of single molecules and nanoscale molecular materials the field has gained the potential to bring about new avenues for the miniaturization of electrical components where quantum phenomena are utilized to achieve solid state molecular device functionality. Molecular junctions are platforms that enable these studies and consist of a single molecule or a small group of molecules directly connected to electrodes. The work presented in this thesis has built upon the current understanding of the mechanisms of charge transport in ordered junctions using self-assembled monolayer (SAM) molecular thin films. Donor and acceptor compounds were synthesized and incorporated into SAMs grown on metal substrates then the transport properties were measured with conducting probe atomic force microscopy (CP-AFM). In addition to experimentally measured current-voltage (I-V) curves, the transport properties were addressed computationally and modeled theoretically. The key objectives of this project were to 1) investigate the impact of molecular structure on hole and electron charge transport, 2) understand the nature of the charge carriers and their structure-transport properties through long (<4 nm) conjugated molecular wires, and 3) quantitatively extract interfacial properties characteristic to macroscopic junctions, such as energy level alignment and molecule-contact electronic coupling from experimental I-V curves. Here, we lay ground work for creating a more complete picture of charge transport in macroscopically ordered molecular junctions of controlled architecture, length and charge carrier. The polaronic nature of hopping transport has been predicted in long, conjugated molecular wires. Using quantum-based calculations, we modeled 'p-type' polaron transport through oligophenylenethiophene (OPTI) wires and assigned transport activation energies to specific modes of nuclear motion. We also show control over 'n-type', LUMO-mediated transport in short ( 2 nm) redox-active perylenediimide (PDI) SAMs bound to contacts through isocyano linkers. By changing the contact work function (φ) and temperature, we were able to verify thermally-assisted LUMO transport. Transition voltage spectroscopy and the single level model was employed to fit the experimental I-V curves and extract the electronic coupling (epsilon) and the EF-LUMO offset (epsilonl). It was found that epsilonl does not change with φ (LUMO pinning), while Gamma changes with both φ and temperature. Further, the PDI SAMs could be reversibly chemically gated to modulate the transport. These results help advance our understanding of transport behavior in semiconducting molecular thin films, and open opportunities to engineer improved electronic functionality into molecular devices.

Reduced Point Charge Models of Proteins: Effect of Protein-Water Interactions in Molecular Dynamics Simulations of Ubiquitin Systems.

PubMed

Leherte, Laurence; Vercauteren, Daniel P

2017-10-26

We investigate the influence of various solvent models on the structural stability and protein-water interface of three ubiquitin complexes (PDB access codes: 1Q0W , 2MBB , 2G3Q ) modeled using the Amber99sb force field (FF) and two different point charge distributions. A previously developed reduced point charge model (RPCM), wherein each amino acid residue is described by a limited number of point charges, is tested and compared to its all-atom (AA) version. The complexes are solvated in TIP4P-Ew or TIP3P type water molecules, involving either the scaling of the Lennard-Jones protein-O water interaction parameters, or the coarse-grain (CG) SIRAH water description. The best agreements between the RPCM and AA models were obtained for structural, protein-water, and ligand-ubiquitin properties when using the TIP4P-Ew water FF with a scaling factor γ of 0.7. At the RPCM level, a decrease in γ, or the inclusion of SIRAH particles, allows weakening of the protein-water interactions. It results in a slight collapse of the protein structure and a less compact hydration shell and, thus, in a decrease in the number of protein-water and water-water H-bonds. The dynamics of the surface protein atoms and of the water shell molecules are also slightly refrained, which allow the generation of stable RPCM trajectories.

Electron (charge) density studies of cellulose models

USDA-ARS?s Scientific Manuscript database

Introductory material first describes electron density approaches and demonstrates visualization of electron lone pairs and bonding as concentrations of electron density. Then it focuses on the application of Bader’s Quantum Theory of Atoms-in-Molecules (AIM) to cellulose models. The purpose of the ...

Inductive electronegativity scale. Iterative calculation of inductive partial charges.

PubMed

Cherkasov, Artem

2003-01-01

A number of novel QSAR descriptors have been introduced on the basis of the previously elaborated models for steric and inductive effects. The developed "inductive" parameters include absolute and effective electronegativity, atomic partial charges, and local and global chemical hardness and softness. Being based on traditional inductive and steric substituent constants these 3D descriptors provide a valuable insight into intramolecular steric and electronic interactions and can find broad application in structure-activity studies. Possible interpretation of physical meaning of the inductive descriptors has been suggested by considering a neutral molecule as an electrical capacitor formed by charged atomic spheres. This approximation relates inductive chemical softness and hardness of bound atom(s) with the total area of the facings of electrical capacitor formed by the atom(s) and the rest of the molecule. The derived full electronegativity equalization scheme allows iterative calculation of inductive partial charges on the basis of atomic electronegativities, covalent radii, and intramolecular distances. A range of inductive descriptors has been computed for a variety of organic compounds. The calculated inductive charges in the studied molecules have been validated by experimental C-1s Electron Core Binding Energies and molecular dipole moments. Several semiempirical chemical rules, such as equalized electronegativity's arithmetic mean, principle of maximum hardness, and principle of hardness borrowing could be explicitly illustrated in the framework of the developed approach.

Density functional theory and molecular dynamics study of the uranyl ion (UO₂)²⁺.

PubMed

Rodríguez-Jeangros, Nicolás; Seminario, Jorge M

2014-03-01

The detection of uranium is very important, especially in water and, more importantly, in the form of uranyl ion (UO₂)²⁺, which is one of its most abundant moieties. Here, we report analyses and simulations of uranyl in water using ab initio modified force fields for water with improved parameters and charges of uranyl. We use a TIP4P model, which allows us to obtain accurate water properties such as the boiling point and the second and third shells of water molecules in the radial distribution function thanks to a fictitious charge that corrects the 3-point models by reproducing the exact dipole moment of the water molecule. We also introduced non-bonded interaction parameters for the water-uranyl intermolecular force field. Special care was taken in testing the effect of a range of uranyl charges on the structure of uranyl-water complexes. Atomic charges of the solvated ion in water were obtained using density functional theory (DFT) calculations taking into account the presence of nitrate ions in the solution, forming a neutral ensemble. DFT-based force fields were calculated in such a way that water properties, such as the boiling point or the pair distribution function stand. Finally, molecular dynamics simulations of a water box containing uranyl cations and nitrate anions are performed at room temperature. The three peaks in the oxygen-oxygen radial distribution function for water were found to be kept in the presence of uranyl thanks to the improvement of interaction parameters and charges. Also, we found three shells of water molecules surrounding the uranyl ion instead of two as was previously thought.

Spatial variation of permittivity of an electrolyte solution in contact with a charged metal surface: a mini review

PubMed Central

Gongadze, E.; van Rienen, U.; Kralj-Iglič, V.; Iglič, A.

2012-01-01

Contact between a charged metal surface and an electrolyte implies a particular ion distribution near the charged surface, i.e. the electrical double layer. In this mini review, different mean-field models of relative (effective) permittivity are described within a simple lattice model, where the orientational ordering of water dipoles in the saturation regime is taken into account. The Langevin-Poisson-Boltzmann (LPB) model of spatial variation of the relative permittivity for point-like ions is described and compared to a more general Langevin-Bikerman (LB) model of spatial variation of permittivity for finite-sized ions. The Bikerman model and the Poisson-Boltzmann model are derived as limiting cases. It is shown that near the charged surface, the relative permittivity decreases due to depletion of water molecules (volume-excluded effect) and orientational ordering of water dipoles (saturation effect). At the end, the LPB and LB models are generalised by also taking into account the cavity field. PMID:22263808

Transient photocurrent in molecular junctions: singlet switching on and triplet blocking.

PubMed

Petrov, E G; Leonov, V O; Snitsarev, V

2013-05-14

The kinetic approach adapted to describe charge transmission in molecular junctions, is used for the analysis of the photocurrent under conditions of moderate light intensity of the photochromic molecule. In the framework of the HOMO-LUMO model for the single electron molecular states, the analytic expressions describing the temporary behavior of the transient and steady state sequential (hopping) as well as direct (tunnel) current components have been derived. The conditions at which the current components achieve their maximal values are indicated. It is shown that if the rates of charge transmission in the unbiased molecular diode are much lower than the intramolecular singlet-singlet excitation/de-excitation rate, and the threefold degenerated triplet excited state of the molecule behaves like a trap blocking the charge transmission, a possibility of a large peak-like transient switch-on photocurrent arises.

Crystallochromy of perylene pigments: Interference between Frenkel excitons and charge-transfer states

NASA Astrophysics Data System (ADS)

Gisslén, Linus; Scholz, Reinhard

2009-09-01

The optical properties of perylene-based pigments are arising from the interplay between neutral molecular excitations and charge transfer between adjacent molecules. In the crystalline phase, these excitations are coupled via electron and hole transfer, two quantities relating directly to the width of the conduction and valence band in the crystalline phase. Based on the crystal structure determined by x-ray diffraction, density-functional theory (DFT) and Hartree-Fock are used for the calculation of the electronic states of a dimer of stacked molecules. The resulting transfer parameters for electron and hole are used in an exciton model for the coupling between Frenkel excitons and charge-transfer states. The deformation of the positively or negatively charged molecular ions with respect to the neutral ground state is calculated with DFT and the geometry in the optically excited state is deduced from time-dependent DFT and constrained DFT. All of these deformations are interpreted in terms of the elongation of an effective internal vibration which is used subsequently in the exciton model for the crystalline phase. A comparison between the calculated dielectric function and the observed optical spectra allows to deduce the relative energetic position of Frenkel excitons and the charge-transfer state involving stack neighbors, a key parameter for various electronic and optoelectronic device applications. For five out of six perylene pigments studied in the present work, this exciton model results in excellent agreement between calculated and observed optical properties.

Prediction of potency of protease inhibitors using free energy simulations with polarizable quantum mechanics-based ligand charges and a hybrid water model.

PubMed

Das, Debananda; Koh, Yasuhiro; Tojo, Yasushi; Ghosh, Arun K; Mitsuya, Hiroaki

2009-12-01

Reliable and robust prediction of the binding affinity for drug molecules continues to be a daunting challenge. We simulated the binding interactions and free energy of binding of nine protease inhibitors (PIs) with wild-type and various mutant proteases by performing GBSA simulations in which each PI's partial charge was determined by quantum mechanics (QM) and the partial charge accounts for the polarization induced by the protease environment. We employed a hybrid solvation model that retains selected explicit water molecules in the protein with surface-generalized Born (SGB) implicit solvent. We examined the correlation of the free energy with the antiviral potency of PIs with regard to amino acid substitutions in protease. The GBSA free energy thus simulated showed strong correlations (r > 0.75) with antiviral IC(50) values of PIs when amino acid substitutions were present in the protease active site. We also simulated the binding free energy of PIs with P2-bis-tetrahydrofuranylurethane (bis-THF) or related cores, utilizing a bis-THF-containing protease crystal structure as a template. The free energy showed a strong correlation (r = 0.93) with experimentally determined anti-HIV-1 potency. The present data suggest that the presence of selected explicit water in protein and protein polarization-induced quantum charges for the inhibitor, compared to lack of explicit water and a static force-field-based charge model, can serve as an improved lead optimization tool and warrants further exploration.

Controlled synthesis and inclusion ability of a hyaluronic acid derivative bearing beta-cyclodextrin molecules.

PubMed

Charlot, Aurélia; Heyraud, Alain; Guenot, Pierre; Rinaudo, Marguerite; Auzély-Velty, Rachel

2006-03-01

A new synthetic route to beta-cyclodextrin-linked hyaluronic acid (HA-CD) was developed. This was based on the preparation of a HA derivative selectively modified with adipic dihydrazide (HA-ADH) and a beta-cyclodextrin derivative possessing an aldehyde function on the primary face, followed by their coupling by a reductive amination-type reaction. The CD-polysaccharide was fully characterized in terms of chemical integrity and purity by high-resolution NMR spectroscopy. The complexation ability of the grafted CD was further demonstrated by isothermal titration calorimetry using sodium adamantane acetate (ADAc) and Ibuprofen as model guest molecules. The thermodynamic parameters for the complexation of these negatively charged guest molecules by the beta-CD grafted on negatively charged HA were shown to be largely influenced by the ionic strength of the aqueous medium.

Limiting assumptions in molecular modeling: electrostatics.

PubMed

Marshall, Garland R

2013-02-01

Molecular mechanics attempts to represent intermolecular interactions in terms of classical physics. Initial efforts assumed a point charge located at the atom center and coulombic interactions. It is been recognized over multiple decades that simply representing electrostatics with a charge on each atom failed to reproduce the electrostatic potential surrounding a molecule as estimated by quantum mechanics. Molecular orbitals are not spherically symmetrical, an implicit assumption of monopole electrostatics. This perspective reviews recent evidence that requires use of multipole electrostatics and polarizability in molecular modeling.

Theoretical Modeling of Hydrogen Bonding in omolecular Solutions: The Combination of Quantum Mechanics and Molecular Mechanics

NASA Astrophysics Data System (ADS)

Ma, Jing; Jiang, Nan; Li, Hui

Hydrogen bonding interaction takes an important position in solutions. The non-classic nature of hydrogen bonding requires the resource-demanding quantum mechanical (QM) calculations. The molecular mechanics (MM) method, with much lower computational load, is applicable to the large-sized system. The combination of QM and MM is an efficient way in the treatment of solution. Taking advantage of the low-cost energy-based fragmentation QM approach (in which the o-molecule is divided into several subsystems, and QM calculation is carried out on each subsystem that is embedded in the environment of background charges of distant parts), the fragmentation-based QM/MM and polarization models have been implemented for the modeling of o-molecule in aqueous solutions, respectively. Within the framework of the fragmentation-based QM/MM hybrid model, the solute is treated by the fragmentation QM calculation while the numerous solvent molecules are described by MM. In the polarization model, the polarizability is considered by allowing the partial charges and fragment-centered dipole moments to be variables, with values coming from the energy-based fragmentation QM calculations. Applications of these two methods to the solvated long oligomers and cyclic peptides have demonstrated that the hydrogen bonding interaction affects the dynamic change in chain conformations of backbone.

Development of a Simple Electron Transfer and Polarization Model and Its Application to Biological Systems.

PubMed

Diller, David J

2017-01-10

Here we present a new method for point charge calculation which we call Q ET (charges by electron transfer). The intent of this work is to develop a method that can be useful for studying charge transfer in large biological systems. It is based on the intuitive framework of the Q EQ method with the key difference being that the Q ET method tracks all pairwise electron transfers by augmenting the Q EQ pseudoenergy function with a distance dependent cost function for each electron transfer. This approach solves the key limitation of the Q EQ method which is its handling of formally charged groups. First, we parametrize the Q ET method by fitting to electrostatic potentials calculated using ab initio quantum mechanics on over 11,000 small molecules. On an external test set of over 2500 small molecules the Q ET method achieves a mean absolute error of 1.37 kcal/mol/electron when compared to the ab initio electrostatic potentials. Second, we examine the conformational dependence of the charges on over 2700 tripeptides. With the tripeptide data set, we show that the conformational effects account for approximately 0.4 kcal/mol/electron on the electrostatic potentials. Third, we test the Q ET method for its ability to reproduce the effects of polarization and electron transfer on 1000 water clusters. For the water clusters, we show that the Q ET method captures about 50% of the polarization and electron transfer effects. Finally, we examine the effects of electron transfer and polarizability on the electrostatic interaction between p38 and 94 small molecule ligands. When used in conjunction with the Generalized-Born continuum solvent model, polarization and electron transfer with the Q ET model lead to an average change of 17 kcal/mol on the calculated electrostatic component of ΔG.

Femtosecond response of polyatomic molecules to ultra-intense hard X-rays.

PubMed

Rudenko, A; Inhester, L; Hanasaki, K; Li, X; Robatjazi, S J; Erk, B; Boll, R; Toyota, K; Hao, Y; Vendrell, O; Bomme, C; Savelyev, E; Rudek, B; Foucar, L; Southworth, S H; Lehmann, C S; Kraessig, B; Marchenko, T; Simon, M; Ueda, K; Ferguson, K R; Bucher, M; Gorkhover, T; Carron, S; Alonso-Mori, R; Koglin, J E; Correa, J; Williams, G J; Boutet, S; Young, L; Bostedt, C; Son, S-K; Santra, R; Rolles, D

2017-06-01

X-ray free-electron lasers enable the investigation of the structure and dynamics of diverse systems, including atoms, molecules, nanocrystals and single bioparticles, under extreme conditions. Many imaging applications that target biological systems and complex materials use hard X-ray pulses with extremely high peak intensities (exceeding 10 20 watts per square centimetre). However, fundamental investigations have focused mainly on the individual response of atoms and small molecules using soft X-rays with much lower intensities. Studies with intense X-ray pulses have shown that irradiated atoms reach a very high degree of ionization, owing to multiphoton absorption, which in a heteronuclear molecular system occurs predominantly locally on a heavy atom (provided that the absorption cross-section of the heavy atom is considerably larger than those of its neighbours) and is followed by efficient redistribution of the induced charge. In serial femtosecond crystallography of biological objects-an application of X-ray free-electron lasers that greatly enhances our ability to determine protein structure-the ionization of heavy atoms increases the local radiation damage that is seen in the diffraction patterns of these objects and has been suggested as a way of phasing the diffraction data. On the basis of experiments using either soft or less-intense hard X-rays, it is thought that the induced charge and associated radiation damage of atoms in polyatomic molecules can be inferred from the charge that is induced in an isolated atom under otherwise comparable irradiation conditions. Here we show that the femtosecond response of small polyatomic molecules that contain one heavy atom to ultra-intense (with intensities approaching 10 20 watts per square centimetre), hard (with photon energies of 8.3 kiloelectronvolts) X-ray pulses is qualitatively different: our experimental and modelling results establish that, under these conditions, the ionization of a molecule is considerably enhanced compared to that of an individual heavy atom with the same absorption cross-section. This enhancement is driven by ultrafast charge transfer within the molecule, which refills the core holes that are created in the heavy atom, providing further targets for inner-shell ionization and resulting in the emission of more than 50 electrons during the X-ray pulse. Our results demonstrate that efficient modelling of X-ray-driven processes in complex systems at ultrahigh intensities is feasible.

Femtosecond response of polyatomic molecules to ultra-intense hard X-rays

DOE PAGES

Rudenko, A.; Inhester, L.; Hanasaki, K.; ...

2017-05-31

We report x-ray free-electron lasers enable the investigation of the structure and dynamics of diverse systems, including atoms, molecules, nanocrystals and single bioparticles, under extreme conditions. Many imaging applications that target biological systems and complex materials use hard X-ray pulses with extremely high peak intensities (exceeding 10 20 watts per square centimetre). However, fundamental investigations have focused mainly on the individual response of atoms and small molecules using soft X-rays with much lower intensities. Studies with intense X-ray pulses have shown that irradiated atoms reach a very high degree of ionization, owing to multiphoton absorption, which in a heteronuclear molecularmore » system occurs predominantly locally on a heavy atom (provided that the absorption cross-section of the heavy atom is considerably larger than those of its neighbours) and is followed by efficient redistribution of the induced charge. In serial femtosecond crystallography of biological objects—an application of X-ray free-electron lasers that greatly enhances our ability to determine protein structure—the ionization of heavy atoms increases the local radiation damage that is seen in the diffraction patterns of these objects and has been suggested as a way of phasing the diffraction data. On the basis of experiments using either soft or less-intense hard X-rays, it is thought that the induced charge and associated radiation damage of atoms in polyatomic molecules can be inferred from the charge that is induced in an isolated atom under otherwise comparable irradiation conditions. Here we show that the femtosecond response of small polyatomic molecules that contain one heavy atom to ultra-intense (with intensities approaching 10 20 watts per square centimetre), hard (with photon energies of 8.3 kiloelectronvolts) X-ray pulses is qualitatively different: our experimental and modelling results establish that, under these conditions, the ionization of a molecule is considerably enhanced compared to that of an individual heavy atom with the same absorption cross-section. This enhancement is driven by ultrafast charge transfer within the molecule, which refills the core holes that are created in the heavy atom, providing further targets for inner-shell ionization and resulting in the emission of more than 50 electrons during the X-ray pulse. Fnally, our results demonstrate that efficient modelling of X-ray-driven processes in complex systems at ultrahigh intensities is feasible.« less

Femtosecond response of polyatomic molecules to ultra-intense hard X-rays

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rudenko, A.; Inhester, L.; Hanasaki, K.

We report x-ray free-electron lasers enable the investigation of the structure and dynamics of diverse systems, including atoms, molecules, nanocrystals and single bioparticles, under extreme conditions. Many imaging applications that target biological systems and complex materials use hard X-ray pulses with extremely high peak intensities (exceeding 10 20 watts per square centimetre). However, fundamental investigations have focused mainly on the individual response of atoms and small molecules using soft X-rays with much lower intensities. Studies with intense X-ray pulses have shown that irradiated atoms reach a very high degree of ionization, owing to multiphoton absorption, which in a heteronuclear molecularmore » system occurs predominantly locally on a heavy atom (provided that the absorption cross-section of the heavy atom is considerably larger than those of its neighbours) and is followed by efficient redistribution of the induced charge. In serial femtosecond crystallography of biological objects—an application of X-ray free-electron lasers that greatly enhances our ability to determine protein structure—the ionization of heavy atoms increases the local radiation damage that is seen in the diffraction patterns of these objects and has been suggested as a way of phasing the diffraction data. On the basis of experiments using either soft or less-intense hard X-rays, it is thought that the induced charge and associated radiation damage of atoms in polyatomic molecules can be inferred from the charge that is induced in an isolated atom under otherwise comparable irradiation conditions. Here we show that the femtosecond response of small polyatomic molecules that contain one heavy atom to ultra-intense (with intensities approaching 10 20 watts per square centimetre), hard (with photon energies of 8.3 kiloelectronvolts) X-ray pulses is qualitatively different: our experimental and modelling results establish that, under these conditions, the ionization of a molecule is considerably enhanced compared to that of an individual heavy atom with the same absorption cross-section. This enhancement is driven by ultrafast charge transfer within the molecule, which refills the core holes that are created in the heavy atom, providing further targets for inner-shell ionization and resulting in the emission of more than 50 electrons during the X-ray pulse. Fnally, our results demonstrate that efficient modelling of X-ray-driven processes in complex systems at ultrahigh intensities is feasible.« less

Modeling light-induced charge transfer dynamics across a metal-molecule-metal junction: Bridging classical electrodynamics and quantum dynamics

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hu, Zixuan; Ratner, Mark A.; Seideman, Tamar, E-mail: t-seideman@northwestern.edu

2014-12-14

We develop a numerical approach for simulating light-induced charge transport dynamics across a metal-molecule-metal conductance junction. The finite-difference time-domain method is used to simulate the plasmonic response of the metal structures. The Huygens subgridding technique, as adapted to Lorentz media, is used to bridge the vastly disparate length scales of the plasmonic metal electrodes and the molecular system, maintaining accuracy. The charge and current densities calculated with classical electrodynamics are transformed to an electronic wavefunction, which is then propagated through the molecular linker via the Heisenberg equations of motion. We focus mainly on development of the theory and exemplify ourmore » approach by a numerical illustration of a simple system consisting of two silver cylinders bridged by a three-site molecular linker. The electronic subsystem exhibits fascinating light driven dynamics, wherein the charge density oscillates at the driving optical frequency, exhibiting also the natural system timescales, and a resonance phenomenon leads to strong conductance enhancement.« less

Spectrally resolved single-molecule electrometry

NASA Astrophysics Data System (ADS)

Ruggeri, F.; Krishnan, M.

2018-03-01

Escape-time electrometry is a recently developed experimental technique that offers the ability to measure the effective electrical charge of a single biomolecule in solution with sub-elementary charge precision. The approach relies on measuring the average escape-time of a single charged macromolecule or molecular species transiently confined in an electrostatic fluidic trap. Comparing the experiments with the predictions of a mean-field model of molecular electrostatics, we have found that the measured effective charge even reports on molecular conformation, e.g., folded or disordered state, and non-uniform charge distribution in disordered proteins or polyelectrolytes. Here we demonstrate the ability to use the spectral dimension to distinguish minute differences in electrical charge between individual molecules or molecular species in a single simultaneous measurement, under identical experimental conditions. Using one spectral channel for referenced measurement, this kind of photophysical distinguishability essentially eliminates the need for accurate knowledge of key experimental parameters, otherwise obtained through intensive characterization of the experimental setup. As examples, we demonstrate the ability to detect small differences (˜5%) in the length of double-stranded DNA fragments as well as single amino acid exchange in an intrinsically disordered protein, prothymosin α.

Mechanism of charge transfer and its impacts on Fermi-level pinning for gas molecules adsorbed on monolayer WS2.

PubMed

Zhou, Changjie; Yang, Weihuang; Zhu, Huili

2015-06-07

Density functional theory calculations were performed to assess changes in the geometric and electronic structures of monolayer WS2 upon adsorption of various gas molecules (H2, O2, H2O, NH3, NO, NO2, and CO). The most stable configuration of the adsorbed molecules, the adsorption energy, and the degree of charge transfer between adsorbate and substrate were determined. All evaluated molecules were physisorbed on monolayer WS2 with a low degree of charge transfer and accept charge from the monolayer, except for NH3, which is a charge donor. Band structure calculations showed that the valence and conduction bands of monolayer WS2 are not significantly altered upon adsorption of H2, H2O, NH3, and CO, whereas the lowest unoccupied molecular orbitals of O2, NO, and NO2 are pinned around the Fermi-level when these molecules are adsorbed on monolayer WS2. The phenomenon of Fermi-level pinning was discussed in light of the traditional and orbital mixing charge transfer theories. The impacts of the charge transfer mechanism on Fermi-level pinning were confirmed for the gas molecules adsorbed on monolayer WS2. The proposed mechanism governing Fermi-level pinning is applicable to the systems of adsorbates on recently developed two-dimensional materials, such as graphene and transition metal dichalcogenides.

Understanding the influence of external perturbation on aziridinium ion formation

NASA Astrophysics Data System (ADS)

Sinha, Sourab; Bhattacharyya, Pradip Kr

2018-01-01

A density functional theory study is performed to understand the effect of discrete water molecules during Az+ ion formation in nitrogen mustards. A comparative study in gas phase, and implicit and explicit solvation models of three drug molecules (mustine, chlorambucil and melphalan) is reported. Noteworthy changes in the structure and C-N stretching frequencies of the transition states have been observed in the presence of explicit water molecules. Presence of explicit water molecules reduces the positive charge around the tricyclic Az+ ring, and hence stabilising it. Both activation energy and rate constants are seen to be significantly affected in the presence of discrete water molecules.

Isolated effects of external bath osmolality, solute concentration, and electrical charge on solute transport across articular cartilage.

PubMed

Pouran, Behdad; Arbabi, Vahid; Zadpoor, Amir A; Weinans, Harrie

2016-12-01

The metabolic function of cartilage primarily depends on transport of solutes through diffusion mechanism. In the current study, we use contrast enhanced micro-computed tomography to determine equilibrium concentration of solutes through different cartilage zones and solute flux in the cartilage, using osteochondral plugs from equine femoral condyles. Diffusion experiments were performed with two solutes of different charge and approximately equal molecular weight, namely iodixanol (neutral) and ioxaglate (charge=-1) in order to isolate the effects of solute's charge on diffusion. Furthermore, solute concentrations as well as bath osmolality were changed to isolate the effects of steric hindrance on diffusion. Bath concentration and bath osmolality only had minor effects on the diffusion of the neutral solute through cartilage at the surface, middle and deep zones, indicating that the diffusion of the neutral solute was mainly Fickian. The negatively charged solute diffused considerably slower through cartilage than the neutral solute, indicating a large non-Fickian contribution in the diffusion of charged molecules. The numerical models determined maximum solute flux in the superficial zone up to a factor of 2.5 lower for the negatively charged solutes (charge=-1) as compared to the neutral solutes confirming the importance of charge-matrix interaction in diffusion of molecules across cartilage. Copyright © 2016 IPEM. Published by Elsevier Ltd. All rights reserved.

Enhancing SERS by Means of Supramolecular Charge Transfer

NASA Technical Reports Server (NTRS)

Wong, Eric; Flood, Amar; Morales, Alfredo

2009-01-01

In a proposed method of sensing small quantities of molecules of interest, surface enhanced Raman scattering (SERS) spectroscopy would be further enhanced by means of intermolecular or supramolecular charge transfer. There is a very large potential market for sensors based on this method for rapid detection of chemical and biological hazards. In SERS, the Raman signals (vibrational spectra) of target molecules become enhanced by factors of the order of 108 when those molecules are in the vicinities of nanostructured substrate surfaces that have been engineered to have plasmon resonances that enhance local electric fields. SERS, as reported in several prior NASA Tech Briefs articles and elsewhere, has remained a research tool and has not yet been developed into a practical technique for sensing of target molecules: this is because the short range (5 to 20 nm) of the field enhancement necessitates engineering of receptor molecules to attract target molecules to the nanostructured substrate surfaces and to enable reliable identification of the target molecules in the presence of interferants. Intermolecular charge-transfer complexes have been used in fluorescence-, photoluminescence-, and electrochemistry-based techniques for sensing target molecules, but, until now, have not been considered for use in SERS-based sensing. The basic idea of the proposed method is to engineer receptor molecules that would be attached to nanostructured SERS substrates and that would interact with the target molecules to form receptor-target supramolecular charge-transfer complexes wherein the charge transfer could be photoexcited.

Measurement of a linear free energy relationship one molecule at a time

PubMed Central

Rao, B. V.; Kwon, K.-Y.; Liu, A.; Bartels, L.

2004-01-01

A systematic study of the dehydrogenation of substituted thiophenols by controlled charge injection from the tip of a scanning tunneling microscope (STM) reveals a pronounced dependence of the reaction yield on the position and the chemical nature of the substituent. We evaluate the dehydrogenation rate of para-halo-substituted species within a linear free energy relationship, namely the Hammett equation. The resultant ρ value of 1.4 can faithfully predict the reaction rates of molecules that are meta-halo-substituted or para-methyl-substituted. The positive sign of ρ suggests a negatively charged transition state at the core of the STM-induced process, and the magnitude of the ρ value indicates that the presence of the substrate does not preclude substantial substituent effects. The applicability of the Hammett equation to single-molecule chemistry offers facile prediction of the rate of STM-based single-molecule chemistry in a field, which so far has been addressed by focusing on involved quantum-mechanical modeling of its underlying processes. PMID:15601774

Measurement of a linear free energy relationship one molecule at a time.

PubMed

Rao, B V; Kwon, K-Y; Liu, A; Bartels, L

2004-12-28

A systematic study of the dehydrogenation of substituted thiophenols by controlled charge injection from the tip of a scanning tunneling microscope (STM) reveals a pronounced dependence of the reaction yield on the position and the chemical nature of the substituent. We evaluate the dehydrogenation rate of para-halo-substituted species within a linear free energy relationship, namely the Hammett equation. The resultant rho value of 1.4 can faithfully predict the reaction rates of molecules that are meta-halo-substituted or para-methyl-substituted. The positive sign of rho suggests a negatively charged transition state at the core of the STM-induced process, and the magnitude of the rho value indicates that the presence of the substrate does not preclude substantial substituent effects. The applicability of the Hammett equation to single-molecule chemistry offers facile prediction of the rate of STM-based single-molecule chemistry in a field, which so far has been addressed by focusing on involved quantum-mechanical modeling of its underlying processes.

Quantum theory of atoms in molecules/charge-charge flux-dipole flux models for fundamental vibrational intensity changes on H-bond formation of water and hydrogen fluoride

DOE Office of Scientific and Technical Information (OSTI.GOV)

Silva, Arnaldo F.; Richter, Wagner E.; Bruns, Roy E., E-mail: bruns@iqm.unicamp.br

The Quantum Theory of Atoms In Molecules/Charge-Charge Flux-Dipole Flux (QTAIM/CCFDF) model has been used to investigate the electronic structure variations associated with intensity changes on dimerization for the vibrations of the water and hydrogen fluoride dimers as well as in the water-hydrogen fluoride complex. QCISD/cc-pVTZ wave functions applied in the QTAIM/CCFDF model accurately provide the fundamental band intensities of water and its dimer predicting symmetric and antisymmetric stretching intensity increases for the donor unit of 159 and 47 km mol{sup −1} on H-bond formation compared with the experimental values of 141 and 53 km mol{sup −1}. The symmetric stretching ofmore » the proton donor water in the dimer has intensity contributions parallel and perpendicular to its C{sub 2v} axis. The largest calculated increase of 107 km mol{sup −1} is perpendicular to this axis and owes to equilibrium atomic charge displacements on vibration. Charge flux decreases occurring parallel and perpendicular to this axis result in 42 and 40 km mol{sup −1} total intensity increases for the symmetric and antisymmetric stretches, respectively. These decreases in charge flux result in intensity enhancements because of the interaction contributions to the intensities between charge flux and the other quantities. Even though dipole flux contributions are much smaller than the charge and charge flux ones in both monomer and dimer water they are important for calculating the total intensity values for their stretching vibrations since the charge-charge flux interaction term cancels the charge and charge flux contributions. The QTAIM/CCFDF hydrogen-bonded stretching intensity strengthening of 321 km mol{sup −1} on HF dimerization and 592 km mol{sup −1} on HF:H{sub 2}O complexation can essentially be explained by charge, charge flux and their interaction cross term. Atomic contributions to the intensities are also calculated. The bridge hydrogen atomic contributions alone explain 145, 237, and 574 km mol{sup −1} of the H-bond stretching intensity enhancements for the water and HF dimers and their heterodimer compared with total increments of 149, 321, and 592 km mol{sup −1}, respectively.« less

A multiscale model for charge inversion in electric double layers

NASA Astrophysics Data System (ADS)

Mashayak, S. Y.; Aluru, N. R.

2018-06-01

Charge inversion is a widely observed phenomenon. It is a result of the rich statistical mechanics of the molecular interactions between ions, solvent, and charged surfaces near electric double layers (EDLs). Electrostatic correlations between ions and hydration interactions between ions and water molecules play a dominant role in determining the distribution of ions in EDLs. Due to highly polar nature of water, near a surface, an inhomogeneous and anisotropic arrangement of water molecules gives rise to pronounced variations in the electrostatic and hydration energies of ions. Classical continuum theories fail to accurately describe electrostatic correlations and molecular effects of water in EDLs. In this work, we present an empirical potential based quasi-continuum theory (EQT) to accurately predict the molecular-level properties of aqueous electrolytes. In EQT, we employ rigorous statistical mechanics tools to incorporate interatomic interactions, long-range electrostatics, correlations, and orientation polarization effects at a continuum-level. Explicit consideration of atomic interactions of water molecules is both theoretically and numerically challenging. We develop a systematic coarse-graining approach to coarse-grain interactions of water molecules and electrolyte ions from a high-resolution atomistic scale to the continuum scale. To demonstrate the ability of EQT to incorporate the water orientation polarization, ion hydration, and electrostatic correlations effects, we simulate confined KCl aqueous electrolyte and show that EQT can accurately predict the distribution of ions in a thin EDL and also predict the complex phenomenon of charge inversion.

A COMPUTER MODELING STUDY OF BINDING PROPERTIES OF CHIRAL NUCLEOPEPTIDE FOR BIOMEDICAL APPLICATIONS.

PubMed

Pirtskhalava, M; Egoyan, A; Mirtskhulava, M; Roviello, G

2017-12-01

Nucleopeptides often show interesting properties of molecular binding that render them good candidates for development of innovative drugs for anticancer and antiviral therapies. In this work we present results of computer modeling of interactions between the molecules of hexathymine nucleopeptide (T6) and poly rA RNA (A18). The results of geometry optimization calculated using Hyperchem software and our own computer program for molecular docking show that molecules establish stable complexes due to the complementary-nucleobase interaction and the electrostatic interaction between the negative phosphate group of poly rA and the positively-charged residues present in the cationic nucleopeptide structure. Computer modeling makes it possible to find the optimal binding configuration of the molecules of a nucleopeptide and poly rA RNA and to estimate the binding energy between the molecules.

Double layer of platinum electrodes: Non-monotonic surface charging phenomena and negative double layer capacitance

NASA Astrophysics Data System (ADS)

Huang, Jun; Zhou, Tao; Zhang, Jianbo; Eikerling, Michael

2018-01-01

In this study, a refined double layer model of platinum electrodes accounting for chemisorbed oxygen species, oriented interfacial water molecules, and ion size effects in solution is presented. It results in a non-monotonic surface charging relation and a peculiar capacitance vs. potential curve with a maximum and possibly negative values in the potential regime of oxide-formation.

Trivalent Ions under Charged Langmuir Monolayers: Nanoscale Mechanisms for Charge Inversion and Liquid-Liquid Extraction

NASA Astrophysics Data System (ADS)

Miller, Mitchell

Ions dissolved in solution are known to interact in remarkable ways with charged Langmuir monolayers. The organic monolayer can be used as a molecular template for ordered nucleation of inorganic crystals (biomineralization) and functional nanoparticles. However, the clear majority of experiments demonstrating these behaviors have been performed with divalent ions. Trivalent ions are present in several important processes that are unique from previously studied divalent systems. We will demonstrate that trivalent ions under floating monolayers can model two important systems: charge inversion and liquid-liquid solvent extraction. Using in situ synchrotron x-ray scattering and emission methods, we can make direct, nanoscale observations of the interactions between ion and monolayer. Charge inversion is a fascinating phenomenon in which small ions of an opposite charge to some large object (colloidal particle, DNA molecule, etc.) will attach to and reverse the object's charge, rather than simply neutralizing it. There are many experimental systems demonstrating this behavior and an enormous body of theoretical work to explain it. Two classes of explanation exist for how charge inversion may occur, "chemical" and "physical" mechanism. Using grazing incidence diffraction (GID), we have found that ions can form an ordered lattice which is incommensurate to a floating, charged monolayer. Because the ions are incommensurate, they cannot be specifically attached to molecules in the monolayer and must be, therefore, held in place by "physical" means. Solvent extraction can be an extremely complex procedure, so our approach to studying it is to simplify the system into a basic model. Ordinarily, two immiscible liquids--an aqueous phase containing some desired species and other impurities and an organic phase, which sometimes contains extractant molecules that improve efficiency--are mixed together and allowed to separate again. While the liquids are being mixed together, the target species from the aqueous phase is pulled across the interface into the organic phase. The mechanism by which the transfer occurs is very poorly understood and very difficult to study directly since it is a very dynamic process and obscured by the bulk of the liquids. Here we propose that the air-water interface is a model of the liquid-liquid interface; in our model, the hydrophobic "organic" phase is the air above the water. This lets us make direct observations of the interactions between ions dissolved in the aqueous phase and the extractant molecules in the organic phase with x-rays, something which would be impossible in an ordinary solvent extraction experiment. We observed a sharp transition in ordering as the atomic weight of the ion dissolved in solution is increased. One would expect a continuous variation, since the size of the ions varies continuously. Second, using x-ray fluorescence, we find that heavier lanthanides are much more strongly attracted to the monolayer than light ones. The unexpected nature of our results emphasizes the need for bottom-up approaches to understanding these systems rather than the top-down method used for the last century. In addition, our results demonstrate that it is, indeed, possible to overcome the experimental difficulties and make the types of measurements necessary for this approach.

Carbon Nanotube Devices Engineered by Atomic Force Microscopy

NASA Astrophysics Data System (ADS)

Prisbrey, Landon

This dissertation explores the engineering of carbon nanotube electronic devices using atomic force microscopy (AFM) based techniques. A possible application for such devices is an electronic interface with individual biological molecules. This single molecule biosensing application is explored both experimentally and with computational modeling. Scanning probe microscopy techniques, such as AFM, are ideal to study nanoscale electronics. These techniques employ a probe which is raster scanned above a sample while measuring probe-surface interactions as a function of position. In addition to topographical and electrostatic/magnetic surface characterization, the probe may also be used as a tool to manipulate and engineer at the nanoscale. Nanoelectronic devices built from carbon nanotubes exhibit many exciting properties including one-dimensional electron transport. A natural consequence of onedimensional transport is that a single perturbation along the conduction channel can have extremely large effects on the device's transport characteristics. This property may be exploited to produce electronic sensors with single-molecule resolution. Here we use AFM-based engineering to fabricate atomic-sized transistors from carbon nanotube network devices. This is done through the incorporation of point defects into the carbon nanotube sidewall using voltage pulses from an AFM probe. We find that the incorporation of an oxidative defect leads to a variety of possible electrical signatures including sudden switching events, resonant scattering, and breaking of the symmetry between electron and hole transport. We discuss the relationship between these different electronic signatures and the chemical structure/charge state of the defect. Tunneling through a defect-induced Coulomb barrier is modeled with numerical Verlet integration of Schrodinger's equation and compared with experimental results. Atomic-sized transistors are ideal for single-molecule applications due to their sensitivity to electric fields with very small detection volumes. In this work we demonstrate these devices as single-molecule sensors to detect individual N-(3-Dimethylaminopropyl)- N'-ethylcarbodiimide (EDC) molecules in an aqueous environment. An exciting application of these sensors is to study individual macromolecules participating in biological reactions, or undergoing conformational change. However, it is unknown whether the associated electrostatic signals exceed detection limits. We report calculations which reveal that enzymatic processes, such as substrate binding and internal protein dynamics, are detectable at the single-molecule level using existing atomic-sized transistors. Finally, we demonstrate the use of AFM-based engineering to control the function of nanoelectronic devices without creating a point defect in the sidewall of the nanotube. With a biased AFM probe we write charge patterns on a silicon dioxide surface in close proximity to a carbon nanotube device. The written charge induces image charges in the nearby electronics, and can modulate the Fermi level in a nanotube by +/-1 eV. We use this technique to induce a spatially controlled doping charge pattern in the conduction channel, and thereby reconfigure a field-effect transistor into a pn junction. Other simple charge patterns could be used to create other devices. The doping charge persists for days and can be erased and rewritten, offering a new tool for prototyping nanodevices and optimizing electrostatic doping profiles.

Metal oxide charge transport material doped with organic molecules

DOEpatents

Forrest, Stephen R.; Lassiter, Brian E.

2016-08-30

Doping metal oxide charge transport material with an organic molecule lowers electrical resistance while maintaining transparency and thus is optimal for use as charge transport materials in various organic optoelectronic devices such as organic photovoltaic devices and organic light emitting devices.

Modular Electron Donor Group Tuning Of Frontier Energy Levels In Diarylaminofluorenone Push-Pull Molecules

DOE Office of Scientific and Technical Information (OSTI.GOV)

Homnick, Paul J.; Lahti, P. M.

2012-01-01

Push–pull organic molecules composed of electron donor diarylamines at the 2- and 2,7-positions of fluorenone exhibit intramolecular charge-transfer behaviour in static absorption and emission spectra. Electrochemical and spectral data combined in a modular electronic analysis model show how the donor HOMO and acceptor LUMO act as major determinants of the frontier molecular orbital energy levels.

Where to place the positive muon in the Periodic Table?

PubMed

Goli, Mohammad; Shahbazian, Shant

2015-03-14

In a recent study it was suggested that the positively charged muon is capable of forming its own "atoms in molecules" (AIM) in the muonic hydrogen-like molecules, composed of two electrons, a muon and one of the hydrogen's isotopes, thus deserves to be placed in the Periodic Table [Phys. Chem. Chem. Phys., 2014, 16, 6602]. In the present report, the capacity of the positively charged muon in forming its own AIM is considered in a large set of molecules replacing muons with all protons in the hydrides of the second and third rows of the Periodic Table. Accordingly, in a comparative study the wavefunctions of both sets of hydrides and their muonic congeners are first derived beyond the Born-Oppenheimer (BO) paradigm, assuming protons and muons as quantum waves instead of clamped particles. Then, the non-BO wavefunctions are used to derive the AIM structures of both hydrides and muonic congeners within the context of the multi-component quantum theory of atoms in molecules. The results of the analysis demonstrate that muons are generally capable of forming their own atomic basins and the properties of these basins are not fundamentally different from those AIM containing protons. Particularly, the bonding modes in the muonic species seem to be qualitatively similar to their congener hydrides and no new bonding model is required to describe the bonding of muons to a diverse set of neighboring atoms. All in all, the positively charged muon is similar to a proton from the structural and bonding viewpoint and deserves to be placed in the same box of hydrogen in the Periodic Table. This conclusion is in line with a large body of studies on the chemical kinetics of the muonic molecules portraying the positively charged muon as a lighter isotope of hydrogen.

Coarse-Grained Model for Water Involving a Virtual Site.

PubMed

Deng, Mingsen; Shen, Hujun

2016-02-04

In this work, we propose a new coarse-grained (CG) model for water by combining the features of two popular CG water models (BMW and MARTINI models) as well as by adopting a topology similar to that of the TIP4P water model. In this CG model, a CG unit, representing four real water molecules, consists of a virtual site, two positively charged particles, and a van der Waals (vdW) interaction center. Distance constraint is applied to the bonds formed between the vdW interaction center and the positively charged particles. The virtual site, which carries a negative charge, is determined by the locations of the two positively charged particles and the vdW interaction center. For the new CG model of water, we coined the name "CAVS" (charge is attached to a virtual site) due to the involvment of the virtual site. After being tested in molecular dynamic (MD) simulations of bulk water at various time steps, under different temperatures and in different salt (NaCl) concentrations, the CAVS model offers encouraging predictions for some bulk properties of water (such as density, dielectric constant, etc.) when compared to experimental ones.

Efficient approach to include molecular polarizations using charge and atom dipole response kernels to calculate free energy gradients in the QM/MM scheme.

PubMed

Asada, Toshio; Ando, Kanta; Sakurai, Koji; Koseki, Shiro; Nagaoka, Masataka

2015-10-28

An efficient approach to evaluate free energy gradients (FEGs) within the quantum mechanical/molecular mechanical (QM/MM) framework has been proposed to clarify reaction processes on the free energy surface (FES) in molecular assemblies. The method is based on response kernel approximations denoted as the charge and the atom dipole response kernel (CDRK) model that include explicitly induced atom dipoles. The CDRK model was able to reproduce polarization effects for both electrostatic interactions between QM and MM regions and internal energies in the QM region obtained by conventional QM/MM methods. In contrast to charge response kernel (CRK) models, CDRK models could be applied to various kinds of molecules, even linear or planer molecules, without using imaginary interaction sites. Use of the CDRK model enabled us to obtain FEGs on QM atoms in significantly reduced computational time. It was also clearly demonstrated that the time development of QM forces of the solvated propylene carbonate radical cation (PC˙(+)) provided reliable results for 1 ns molecular dynamics (MD) simulation, which were quantitatively in good agreement with expensive QM/MM results. Using FEG and nudged elastic band (NEB) methods, we found two optimized reaction paths on the FES for decomposition reactions to generate CO2 molecules from PC˙(+), whose reaction is known as one of the degradation mechanisms in the lithium-ion battery. Two of these reactions proceed through an identical intermediate structure whose molecular dipole moment is larger than that of the reactant to be stabilized in the solvent, which has a high relative dielectric constant. Thus, in order to prevent decomposition reactions, PC˙(+) should be modified to have a smaller dipole moment along two reaction paths.

Electrical passivation of nonselective bio molecules in carbon nanotubes: Effect of pulse train in serum

NASA Astrophysics Data System (ADS)

Kim, Seok Hyang; Woo, Jun-Myung; Choi, Seongwook; Park, Young June

2015-06-01

We present an experimental and simulation study about a desorption of albumin, a representative nonselective molecules in serum, on carbon nanotube (CNT) surface as an electrical bio sensing channel under the pulse train condition. The motivation of the study on binding kinetics between CNT surface and albumin is to suppress the adsorption of nonselective proteins in blood such as albumin, thereby enhancing the selectivity of the electrical biosensor. To theoretically model the behavior of molecules and ions under the step pulse bias, the physics on the reaction rate, mass transport, and the resulting surface pH-value are considered using the Poisson and drift-diffusion equations. For the simulation model, the phosphate buffered saline is considered as the electrolyte solution and albumin is considered as a representative charged molecule for nonspecific binding in serum. Both the transient simulation and experimental result indicate that the suppression of the nonspecific binding under the pulse train is due to the unsymmetrical field force experienced by the protein during the pulse transitions (high to low and low to high) and the non-symmetry is caused by the different transient times between the electric field and the charge/discharge of the protein according to the surface pH modulation in serum. The experimental and simulation results clearly indicate that the pulse bias suppresses the nonselective bio molecules adsorption at the CNT surface so that the selectivity of the electrical biosensor for detecting the target molecules can be enhanced.

Macroscopic modeling and simulations of supercoiled DNA with bound proteins

NASA Astrophysics Data System (ADS)

Huang, Jing; Schlick, Tamar

2002-11-01

General methods are presented for modeling and simulating DNA molecules with bound proteins on the macromolecular level. These new approaches are motivated by the need for accurate and affordable methods to simulate slow processes (on the millisecond time scale) in DNA/protein systems, such as the large-scale motions involved in the Hin-mediated inversion process. Our approaches, based on the wormlike chain model of long DNA molecules, introduce inhomogeneous potentials for DNA/protein complexes based on available atomic-level structures. Electrostatically, treat those DNA/protein complexes as sets of effective charges, optimized by our discrete surface charge optimization package, in which the charges are distributed on an excluded-volume surface that represents the macromolecular complex. We also introduce directional bending potentials as well as non-identical bead hydrodynamics algorithm to further mimic the inhomogeneous effects caused by protein binding. These models thus account for basic elements of protein binding effects on DNA local structure but remain computational tractable. To validate these models and methods, we reproduce various properties measured by both Monte Carlo methods and experiments. We then apply the developed models to study the Hin-mediated inversion system in long DNA. By simulating supercoiled, circular DNA with or without bound proteins, we observe significant effects of protein binding on global conformations and long-time dynamics of the DNA on the kilo basepair length.

Molecules on si: electronics with chemistry.

PubMed

Vilan, Ayelet; Yaffe, Omer; Biller, Ariel; Salomon, Adi; Kahn, Antoine; Cahen, David

2010-01-12

Basic scientific interest in using a semiconducting electrode in molecule-based electronics arises from the rich electrostatic landscape presented by semiconductor interfaces. Technological interest rests on the promise that combining existing semiconductor (primarily Si) electronics with (mostly organic) molecules will result in a whole that is larger than the sum of its parts. Such a hybrid approach appears presently particularly relevant for sensors and photovoltaics. Semiconductors, especially Si, present an important experimental test-bed for assessing electronic transport behavior of molecules, because they allow varying the critical interface energetics without, to a first approximation, altering the interfacial chemistry. To investigate semiconductor-molecule electronics we need reproducible, high-yield preparations of samples that allow reliable and reproducible data collection. Only in that way can we explore how the molecule/electrode interfaces affect or even dictate charge transport, which may then provide a basis for models with predictive power.To consider these issues and questions we will, in this Progress Report, review junctions based on direct bonding of molecules to oxide-free Si.describe the possible charge transport mechanisms across such interfaces and evaluate in how far they can be quantified.investigate to what extent imperfections in the monolayer are important for transport across the monolayer.revisit the concept of energy levels in such hybrid systems.

Exact wave packet dynamics of singlet fission in unsubstituted and substituted polyene chains within long-range interacting models

NASA Astrophysics Data System (ADS)

Prodhan, Suryoday; Ramasesha, S.

2017-08-01

Singlet fission (SF) is a potential pathway for significant enhancement of efficiency in organic solar cells (OSC). In this paper, we study singlet fission in a pair of polyene molecules in two different stacking arrangements employing exact many-body wave packet dynamics. In the noninteracting model, the SF yield is absent. The individual molecules are treated within Hubbard and Pariser-Parr-Pople (PPP) models and the interaction between them involves transfer terms, intersite electron repulsions, and site-charge-bond-charge repulsion terms. Initial wave packet is constructed from excited singlet state of one molecule and ground state of the other. Time development of this wave packet under the influence of intermolecular interactions is followed within the Schrödinger picture by an efficient predictor-corrector scheme. In unsubstituted Hubbard and PPP chains, 2 1A excited singlet state leads to significant SF yield while the 1 1B state gives negligible fission yield. On substitution by donor-acceptor groups of moderate strength, the lowest excited state will have sufficient 2 1A character and hence results in significant SF yield. Because of rapid internal conversion, the nature of the lowest excited singlet will determine the SF contribution to OSC efficiency. Furthermore, we find the fission yield depends considerably on the stacking arrangement of the polyene molecules.

DNA Immobilization and Hybridization Detection by the Intrinsic Molecular Charge Using Capacitive Field-Effect Sensors Modified with a Charged Weak Polyelectrolyte Layer.

PubMed

Bronder, Thomas S; Poghossian, Arshak; Scheja, Sabrina; Wu, Chunsheng; Keusgen, Michael; Mewes, Dieter; Schöning, Michael J

2015-09-16

Miniaturized setup, compatibility with advanced micro- and nanotechnologies, and ability to detect biomolecules by their intrinsic molecular charge favor the semiconductor field-effect platform as one of the most attractive approaches for the development of label-free DNA chips. In this work, a capacitive field-effect EIS (electrolyte-insulator-semiconductor) sensor covered with a layer-by-layer prepared, positively charged weak polyelectrolyte layer of PAH (poly(allylamine hydrochloride)) was used for the label-free electrical detection of DNA (deoxyribonucleic acid) immobilization and hybridization. The negatively charged probe single-stranded DNA (ssDNA) molecules were electrostatically adsorbed onto the positively charged PAH layer, resulting in a preferentially flat orientation of the ssDNA molecules within the Debye length, thus yielding a reduced charge-screening effect and a higher sensor signal. Each sensor-surface modification step (PAH adsorption, probe ssDNA immobilization, hybridization with complementary target DNA (cDNA), reducing an unspecific adsorption by a blocking agent, incubation with noncomplementary DNA (ncDNA) solution) was monitored by means of capacitance-voltage and constant-capacitance measurements. In addition, the surface morphology of the PAH layer was studied by atomic force microscopy and contact-angle measurements. High hybridization signals of 34 and 43 mV were recorded in low-ionic strength solutions of 10 and 1 mM, respectively. In contrast, a small signal of 4 mV was recorded in the case of unspecific adsorption of fully mismatched ncDNA. The density of probe ssDNA and dsDNA molecules as well as the hybridization efficiency was estimated using the experimentally measured DNA immobilization and hybridization signals and a simplified double-layer capacitor model. The results of field-effect experiments were supported by fluorescence measurements, verifying the DNA-immobilization and hybridization event.

An Experimental and Finite Element Protocol to Investigate the Transport of Neutral and Charged Solutes across Articular Cartilage.

PubMed

Arbabi, Vahid; Pouran, Behdad; Zadpoor, Amir A; Weinans, Harrie

2017-04-23

Osteoarthritis (OA) is a debilitating disease that is associated with degeneration of articular cartilage and subchondral bone. Degeneration of articular cartilage impairs its load-bearing function substantially as it experiences tremendous chemical degradation, i.e. proteoglycan loss and collagen fibril disruption. One promising way to investigate chemical damage mechanisms during OA is to expose the cartilage specimens to an external solute and monitor the diffusion of the molecules. The degree of cartilage damage (i.e. concentration and configuration of essential macromolecules) is associated with collisional energy loss of external solutes while moving across articular cartilage creates different diffusion characteristics compared to healthy cartilage. In this study, we introduce a protocol, which consists of several steps and is based on previously developed experimental micro-Computed Tomography (micro-CT) and finite element modeling. The transport of charged and uncharged iodinated molecules is first recorded using micro-CT, which is followed by applying biphasic-solute and multiphasic finite element models to obtain diffusion coefficients and fixed charge densities across cartilage zones.

Probing the effect of charge transfer enhancement in off resonance mode SERS via conjugation of the probe dye between silver nanoparticles and metal substrates.

PubMed

Selvakannan, Pr; Ramanathan, Rajesh; Plowman, Blake J; Sabri, Ylias M; Daima, Hemant K; O'Mullane, Anthony P; Bansal, Vipul; Bhargava, Suresh K

2013-08-21

The charge transfer-mediated surface enhanced Raman scattering (SERS) of crystal violet (CV) molecules that were chemically conjugated between partially polarized silver nanoparticles and optically smooth gold and silver substrates has been studied under off-resonant conditions. Tyrosine molecules were used as a reducing agent to convert silver ions into silver nanoparticles where oxidised tyrosine caps the silver nanoparticle surface with its semiquinone group. This binding through the quinone group facilitates charge transfer and results in partially oxidised silver. This establishes a chemical link between the silver nanoparticles and the CV molecules, where the positively charged central carbon of CV molecules can bind to the terminal carboxylate anion of the oxidised tyrosine molecules. After drop casting Ag nanoparticles bound with CV molecules it was found that the free terminal amine groups tend to bind with the underlying substrates. Significantly, only those CV molecules that were chemically conjugated between the partially polarised silver nanoparticles and the underlying gold or silver substrates were found to show SERS under off-resonant conditions. The importance of partial charge transfer at the nanoparticle/capping agent interface and the resultant conjugation of CV molecules to off resonant SERS effects was confirmed by using gold nanoparticles prepared in a similar manner. In this case the capping agent binds to the nanoparticle through the amine group which does not facilitate charge transfer from the gold nanoparticle and under these conditions SERS enhancement in the sandwich configuration was not observed.

Charge transport network dynamics in molecular aggregates

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jackson, Nicholas E.; Chen, Lin X.; Ratner, Mark A.

2016-07-20

Due to the nonperiodic nature of charge transport in disordered systems, generating insight into static charge transport networks, as well as analyzing the network dynamics, can be challenging. Here, we apply time-dependent network analysis to scrutinize the charge transport networks of two representative molecular semiconductors: a rigid n-type molecule, perylenediimide, and a flexible p-type molecule, bBDT(TDPP)2. Simulations reveal the relevant timescale for local transfer integral decorrelation to be ~100 fs, which is shown to be faster than that of a crystalline morphology of the same molecule. Using a simple graph metric, global network changes are observed over timescales competitive withmore » charge carrier lifetimes. These insights demonstrate that static charge transport networks are qualitatively inadequate, whereas average networks often overestimate network connectivity. Finally, a simple methodology for tracking dynamic charge transport properties is proposed.« less

Optical Spectroscopy Of Charged Quantum Dot Molecules

NASA Astrophysics Data System (ADS)

Scheibner, M.; Bracker, A. S.; Stinaff, E. A.; Doty, M. F.; Gammon, D.; Ponomarev, I. V.; Reinecke, T. L.; Korenev, V. L.

2007-04-01

Coupling between two closely spaced quantum dots is observed by means of photoluminescence spectroscopy. Hole coupling is realized by rational crystal growth and heterostructure design. We identify molecular resonances of different excitonic charge states, including the important case of a doubly charged quantum dot molecule.

Structure and dynamics of the peptide strand KRFK from the thrombospondin TSP-1 in water.

PubMed

Taleb Bendiab, W; Benomrane, B; Bounaceur, B; Dauchez, M; Krallafa, A M

2018-02-14

Theoretical investigations of a solute in liquid water at normal temperature and pressure can be performed at different levels of theory. Static quantum calculations as well as classical and ab initio molecular dynamics are used to completely explore the conformational space for large solvated molecular systems. In the classical approach, it is essential to describe all of the interactions of the solute and the solvent in detail. Water molecules are very often described as rigid bodies when the most commonly used interaction potentials, such as the SPCE and the TIP4P models, are employed. Recently, a physical model based upon a cluster of rigid water molecules with a tetrahedral architecture (AB 4 ) was proposed that describes liquid water as a mixture of both TIP4P and SPCE molecular species that occur in the proportions implied by the tetrahedral architecture (one central molecule versus four outer molecules; i.e., 20% TIP4P versus 80% SPCE molecules). In this work, theoretical spectroscopic data for a peptide strand were correlated with the structural properties of the peptide strand solvated in water, based on data calculated using different theoretical approaches and physical models. We focused on a particular peptide strand, KRFK (lysine-arginine-phenylalanine-lysine), found in the thrombospondin TSP-1, due to its interesting properties. As the activity and electronic structure of this system is strongly linked to its structure, we correlated its structure with charge-density maps obtained using different semi-empirical charge Q eq equations. The structural and thermodynamic properties obtained from classical simulations were correlated with ab initio molecular dynamics (AIMD) data. Structural changes in the peptide strand were rationalized in terms of the motions of atoms and groups of atoms. To achieve this, conformational changes were investigated using calculated infrared spectra for the peptide in the gas phase and in water solvent. The calculated AIMD infrared spectrum for the peptide was correlated with static quantum calculations of the molecular system based on a harmonic approach as well as the VDOS (vibrational density of states) spectra obtained using various classical solvent models (SPCE, TIP4P, and AB 4 ) and charge maps.

Partial Ionic Character beyond the Pauling Paradigm: Metal Nanoparticles

DOE PAGES

Duanmu, Kaining; Truhlar, Donald G.

2014-11-12

A canonical perspective on the chemical bond is the Pauling paradigm: a bond in a molecule containing only identical atoms has no ionic character. However, we show that homonuclear silver clusters have very uneven charge distributions (for example, the C 2v structure of Ag 4 has a larger dipole moment than formaldehyde or acetone), and we show how to predict the charge distribution from coordination numbers and Hirshfeld charges. The new charge model is validated against Kohn–Sham calculations of dipole moments with four approximations for the exchange–correlation functional. We report Kohn–Sham studies of the binding energies of CO on silvermore » monomer and silver clusters containing 2–18 atoms. We also find that an accurate charge model is essential for understanding the site dependence of binding. In particular we find that atoms with more positive charges tend to have higher binding energies, which can be used for guidance in catalyst modeling and design. Furthermore, the nonuniform charge distribution of silver clusters predisposes the site preference of binding of carbon monoxide, and we conclude that nonuniform charge distributions are an important property for understanding binding of metal nanoparticles in general.« less

Molecular microelectrostatic view on electronic states near pentacene grain boundaries

NASA Astrophysics Data System (ADS)

Verlaak, Stijn; Heremans, Paul

2007-03-01

Grain boundaries are the most inevitable and pronounced structural defects in pentacene films. To study the effect of those structural defects on the electronic state distribution, the energy levels of a hole on molecules at and near the defect have been calculated using a submolecular self-consistent-polarization-field approach in combination with atomic charge-quadrupole interaction energy calculations. This method has been benchmarked prior to application on four idealized grain boundaries: a grain boundary void, a void with molecules squeezed in between two grains, a boundary between two grains with different crystallographic orientations, and a grain boundary void in which a permanent dipole (e.g., a water molecule) has nested. While idealized, those views highlight different aspects of real grain boundaries. Implications on macroscopic charge transport models are discussed, as well as some relation between growth conditions and the formation of the grain boundary.

Multifunctional Fe3O4@SiO2-Au Satellite Structured SERS Probe for Charge Selective Detection of Food Dyes.

PubMed

Sun, Zhenli; Du, Jingjing; Yan, Li; Chen, Shu; Yang, Zhilin; Jing, Chuanyong

2016-02-10

Nanofabrication of multifunctional surface-enhanced Raman scattering (SERS) substrates is strongly desirable but currently remains a challenge. The motivation of this study was to design such a substrate, a versatile core-satellite Fe3O4@SiO2-Au (FA) hetero-nanostructure, and demonstrate its use for charge-selective detection of food dye molecules as an exemplary application. Our experimental results and three-dimensional finite difference time domain (FDTD) simulation suggest that tuning the Au nanoparticle (NP) gap to sub-10 nm, which could be readily accomplished, substantially enhanced the Raman signals. Further layer-by-layer deposition of a charged polyelectrolyte on this magnetic SERS substrate induced active adsorption and selective detection of food dye molecules of opposite charge on the substrates. Molecular dynamics (MD) simulations suggest that the selective SERS enhancement could be attributed to the high affinity and close contact (within a 20 Å range) between the substrate and molecules. Density function theory (DFT) calculations confirm the charge transfer from food dye molecules to Au NPs via the polyelectrolytes. This multifunctional SERS platform provides easy separation and selective detection of charged molecules from complex chemical mixtures.

Continuous distribution of emission states from single CdSe/ZnS quantum dots.

PubMed

Zhang, Kai; Chang, Hauyee; Fu, Aihua; Alivisatos, A Paul; Yang, Haw

2006-04-01

The photoluminescence dynamics of colloidal CdSe/ZnS/streptavidin quantum dots were studied using time-resolved single-molecule spectroscopy. Statistical tests of the photon-counting data suggested that the simple "on/off" discrete state model is inconsistent with experimental results. Instead, a continuous emission state distribution model was found to be more appropriate. Autocorrelation analysis of lifetime and intensity fluctuations showed a nonlinear correlation between them. These results were consistent with the model that charged quantum dots were also emissive, and that time-dependent charge migration gave rise to the observed photoluminescence dynamics.

An image-based reaction field method for electrostatic interactions in molecular dynamics simulations of aqueous solutions

NASA Astrophysics Data System (ADS)

Lin, Yuchun; Baumketner, Andrij; Deng, Shaozhong; Xu, Zhenli; Jacobs, Donald; Cai, Wei

2009-10-01

In this paper, a new solvation model is proposed for simulations of biomolecules in aqueous solutions that combines the strengths of explicit and implicit solvent representations. Solute molecules are placed in a spherical cavity filled with explicit water, thus providing microscopic detail where it is most needed. Solvent outside of the cavity is modeled as a dielectric continuum whose effect on the solute is treated through the reaction field corrections. With this explicit/implicit model, the electrostatic potential represents a solute molecule in an infinite bath of solvent, thus avoiding unphysical interactions between periodic images of the solute commonly used in the lattice-sum explicit solvent simulations. For improved computational efficiency, our model employs an accurate and efficient multiple-image charge method to compute reaction fields together with the fast multipole method for the direct Coulomb interactions. To minimize the surface effects, periodic boundary conditions are employed for nonelectrostatic interactions. The proposed model is applied to study liquid water. The effect of model parameters, which include the size of the cavity, the number of image charges used to compute reaction field, and the thickness of the buffer layer, is investigated in comparison with the particle-mesh Ewald simulations as a reference. An optimal set of parameters is obtained that allows for a faithful representation of many structural, dielectric, and dynamic properties of the simulated water, while maintaining manageable computational cost. With controlled and adjustable accuracy of the multiple-image charge representation of the reaction field, it is concluded that the employed model achieves convergence with only one image charge in the case of pure water. Future applications to pKa calculations, conformational sampling of solvated biomolecules and electrolyte solutions are briefly discussed.

Electrostatic Return of Contaminants

NASA Technical Reports Server (NTRS)

Rantanen, R.; Gordon, T.

2003-01-01

A Model has been developed capable of calculating the electrostatic return of spacecraft-emitted molecules that are ionized and attracted back to the spacecraft by the spacecraft electric potential on its surfaces. The return of ionized contaminant molecules to charged spacecraft surfaces is very important to all altitudes. It is especially important at geosynchronous and interplanetary environments, since it may be the only mechanism by which contaminants can degrade a surface. This model is applicable to all altitudes and spacecraft geometries. In addition to results of the model will be completed to cover a wide range of potential space systems.

Charge transport properties of poly(dA)-poly(dT) DNA in variation of backbone disorder and amplitude of base-pair twisting motion

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rahmi, Kinanti Aldilla, E-mail: kinanti.aldilla@ui.ac.id; Yudiarsah, Efta

By using tight binding Hamiltonian model, charge transport properties of poly(dA)-poly(dT) DNA in variation of backbone disorder and amplitude of base-pair twisting motion is studied. The DNA chain used is 32 base pairs long poly(dA)-poly(dT) molecule. The molecule is contacted to electrode at both ends. The influence of environment on charge transport in DNA is modeled as variation of backbone disorder. The twisting motion amplitude is taking into account by assuming that the twisting angle distributes following Gaussian distribution function with zero average and standard deviation proportional to square root of temperature and inversely proportional to the twisting motion frequency.more » The base-pair twisting motion influences both the onsite energy of the bases and electron hopping constant between bases. The charge transport properties are studied by calculating current using Landauer-Buttiker formula from transmission probabilities which is calculated by transfer matrix methods. The result shows that as the backbone disorder increases, the maximum current decreases. By decreasing the twisting motion frequency, the current increases rapidly at low voltage, but the current increases slower at higher voltage. The threshold voltage can increase or decrease with increasing backbone disorder and increasing twisting frequency.« less

Analyte concentration at the tip of a nanopipette.

PubMed

Calander, Nils

2009-10-15

Concentration of molecules within the tips of nanopipettes when applying a DC voltage is herein investigated using finite-element simulations. The ion concentrations and fluxes due to diffusion, electro-migration, and electro-osmotic flow, and the electric potential are determined by the simultaneous solution of the Nernst-Planck, Poisson, and Navier-Stokes equations within the water solution containing sodium and chloride ions and negatively charged molecules. The electric potential within the pipette glass wall is at the same time determined by the Poisson equation together with appropriate boundary conditions and accounts for a field effect through the wall. Fixed negative surface charge on both the internal and external glass surfaces of the nanopipette is included together with the field effect through the glass wall to account for the electric double layer and the electro-osmosis. The inclusion of the field effect through the pipette wall is new compared to previous modeling of similar structures and is shown to be crucial for the behavior at the tip. It is demonstrated that the concentration of molecules is a consequence of ionic charge accumulation at the tip screening the electric field, thereby slowing down the electrophoretic motion of the molecules, which is further slowed down or stopped by the oppositely directed electro-osmosis. It is also shown that the trapping is very sensitive to the properties of the molecule, that is, its electrophoretic mobility and diffusion coefficient, the properties of the pipette, the ionic strength of the solution, and the applied electric field.

A self-consistent transport model for molecular conduction based on extended Hückel theory with full three-dimensional electrostatics

NASA Astrophysics Data System (ADS)

Zahid, F.; Paulsson, M.; Polizzi, E.; Ghosh, A. W.; Siddiqui, L.; Datta, S.

2005-08-01

We present a transport model for molecular conduction involving an extended Hückel theoretical treatment of the molecular chemistry combined with a nonequilibrium Green's function treatment of quantum transport. The self-consistent potential is approximated by CNDO (complete neglect of differential overlap) method and the electrostatic effects of metallic leads (bias and image charges) are included through a three-dimensional finite element method. This allows us to capture spatial details of the electrostatic potential profile, including effects of charging, screening, and complicated electrode configurations employing only a single adjustable parameter to locate the Fermi energy. As this model is based on semiempirical methods it is computationally inexpensive and flexible compared to ab initio models, yet at the same time it is able to capture salient qualitative features as well as several relevant quantitative details of transport. We apply our model to investigate recent experimental data on alkane dithiol molecules obtained in a nanopore setup. We also present a comparison study of single molecule transistors and identify electronic properties that control their performance.

Atomic Radius and Charge Parameter Uncertainty in Biomolecular Solvation Energy Calculations

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yang, Xiu; Lei, Huan; Gao, Peiyuan

Atomic radii and charges are two major parameters used in implicit solvent electrostatics and energy calculations. The optimization problem for charges and radii is under-determined, leading to uncertainty in the values of these parameters and in the results of solvation energy calculations using these parameters. This paper presents a method for quantifying this uncertainty in solvation energies using surrogate models based on generalized polynomial chaos (gPC) expansions. There are relatively few atom types used to specify radii parameters in implicit solvation calculations; therefore, surrogate models for these low-dimensional spaces could be constructed using least-squares fitting. However, there are many moremore » types of atomic charges; therefore, construction of surrogate models for the charge parameter space required compressed sensing combined with an iterative rotation method to enhance problem sparsity. We present results for the uncertainty in small molecule solvation energies based on these approaches. Additionally, we explore the correlation between uncertainties due to radii and charges which motivates the need for future work in uncertainty quantification methods for high-dimensional parameter spaces.« less

Conformational and functional similarities between glutaredoxin and thioredoxins.

PubMed Central

Eklund, H; Cambillau, C; Sjöberg, B M; Holmgren, A; Jörnvall, H; Höög, J O; Brändén, C I

1984-01-01

The tertiary structures of thioredoxin from Escherichia coli and bacteriophage T4 have been compared and aligned giving a common fold of 68 C alpha atoms with a root mean square difference of 2.6 A. The amino acid sequence of glutaredoxin has been aligned to those of the thioredoxins assuming that glutaredoxin has the same common fold. A model of the glutaredoxin molecule was built on a vector display using this alignment and the T4 thioredoxin tertiary structure. By comparison of the model with those of the thioredoxins, we have identified a molecular surface area on one side of the redox-active S-S bridge which we suggest is the binding area of these molecules for redox interactions with other proteins. This area comprises residues 33-34, 75-76 and 91-93 in E. coli thioredoxin; 15-16, 65-66 and 76-78 in T4 thioredoxin and 12-13, 59-60 and 69-71 in glutaredoxin. In all three molecules, this part of the surface is flat and hydrophobic. Charged groups are completely absent. In contrast, there is a cluster of charged groups on the other side of the S-S bridge which we suggest participates in the mechanisms of the redox reactions. In particular, a lysine residue close to an aromatic ring is conserved in all molecules. PMID:6378624

Electric field-induced reorganization of two-component supported bilayer membranes

PubMed Central

Groves, Jay T.; Boxer, Steven G.; McConnell, Harden M.

1997-01-01

Application of electric fields tangent to the plane of a confined patch of fluid bilayer membrane can create lateral concentration gradients of the lipids. A thermodynamic model of this steady-state behavior is developed for binary systems and tested with experiments in supported lipid bilayers. The model uses Flory’s approximation for the entropy of mixing and allows for effects arising when the components have different molecular areas. In the special case of equal area molecules the concentration gradient reduces to a Fermi–Dirac distribution. The theory is extended to include effects from charged molecules in the membrane. Calculations show that surface charge on the supporting substrate substantially screens electrostatic interactions within the membrane. It also is shown that concentration profiles can be affected by other intermolecular interactions such as clustering. Qualitative agreement with this prediction is provided by comparing phosphatidylserine- and cardiolipin-containing membranes. PMID:9391034

Electric field-induced reorganization of two-component supported bilayer membranes.

PubMed

Groves, J T; Boxer, S G; McConnell, H M

1997-12-09

Application of electric fields tangent to the plane of a confined patch of fluid bilayer membrane can create lateral concentration gradients of the lipids. A thermodynamic model of this steady-state behavior is developed for binary systems and tested with experiments in supported lipid bilayers. The model uses Flory's approximation for the entropy of mixing and allows for effects arising when the components have different molecular areas. In the special case of equal area molecules the concentration gradient reduces to a Fermi-Dirac distribution. The theory is extended to include effects from charged molecules in the membrane. Calculations show that surface charge on the supporting substrate substantially screens electrostatic interactions within the membrane. It also is shown that concentration profiles can be affected by other intermolecular interactions such as clustering. Qualitative agreement with this prediction is provided by comparing phosphatidylserine- and cardiolipin-containing membranes.

Anions in Cometary Comae

NASA Technical Reports Server (NTRS)

Charnley, Steven B.

2011-01-01

The presence of negative ions (anions) in cometary comae is known from Giotto mass spectrometry of IP/Halley. The anions 0-, OH-, C-, CH- and CN- have been detected, as well as unidentified anions with masses 22-65 and 85-110 amu (Chaizy et al. 1991). Organic molecular anions are known to have a significant impact on the charge balance of interstellar clouds and circumstellar envelopes and have been shown to act as catalysts for the gas-phase synthesis of larger hydrocarbon molecules in the ISM, but their importance in cometary comae has not yet been explored. We present details of the first attempt to model the chemistry of anions in cometary comae. Based on the combined chemical and hydro dynamical model of Rodgers & Charnley (2002), we investigate the role of large carbon-chain anions in cometary coma chemistry. We calculate the effects of these anions on coma thermodynamics, charge balance and examine their impact on molecule formation.

The role of charge and multiple faces of the CD8 alpha/alpha homodimer in binding to major histocompatibility complex class I molecules: support for a bivalent model.

PubMed

Giblin, P A; Leahy, D J; Mennone, J; Kavathas, P B

1994-03-01

The CD8 dimer interacts with the alpha 3 domain of major histocompatibility complex class I molecules through two immunoglobulin variable-like domains. In this study a crystal structure-informed mutational analysis has been performed to identify amino acids in the CD8 alpha/alpha homodimer that are likely to be involved in binding to class I. Several key residues are situated on the top face of the dimer within loops analogous to the complementarity-determining regions (CDRs) of immunoglobulin. In addition, other important amino acids are located in the A and B beta-strands on the sides of the dimer. The potential involvement of amino acids on both the top and the side faces of the molecule is consistent with a bivalent model for the interaction between a single CD8 alpha/alpha homodimer and two class I molecules and may have important implications for signal transduction in class I-expressing cells. This study also demonstrates a role for the positive surface potential of CD8 in class I binding and complements previous work demonstrating the importance of a negatively charged loop on the alpha 3 domain of class I for CD8 alpha/alpha-class I interaction. We propose a model whereby residues located on the CDR-like loops of the CD8 homodimer interact with the alpha 3 domain of MHC class I while amino acids on the side of the molecule containing the A and B beta-strands contact the alpha 2 domain of class I.

Vibrational properties of the amide group in acetanilide: A molecular-dynamics study

NASA Astrophysics Data System (ADS)

Campa, Alessandro; Giansanti, Andrea; Tenenbaum, Alexander

1987-09-01

A simplified classical model of acetanilide crystal is built in order to study the mechanisms of vibrational energy transduction in a hydrogen-bonded solid. The intermolecular hydrogen bond is modeled by an electrostatic interaction between neighboring excess charges on hydrogen and oxygen atoms. The intramolecular interaction in the peptide group is provided by a dipole-charge interaction. Forces are calculated up to second-order terms in the atomic displacements from equilibrium positions; the model is thus a chain of nonlinear coupled oscillators. Numerical molecular-dynamics experiments are performed on chain segments of five molecules. The dynamics is ordered, at all temperatures. Energy is widely exchanged between the stretching and the bending of the N-H bond, with characteristic times of the order of 0.2 ps. Energy transduction through the H bond is somewhat slower and of smaller amplitude, and is strongly reduced when the energies of the two bound molecules are very different: This could reduce the dissipation of localized energy fluctuations.

Adsorption of insulin peptide on charged single-walled carbon nanotubes: significant role of ordered water molecules.

PubMed

Shen, Jia-Wei; Wu, Tao; Wang, Qi; Kang, Yu; Chen, Xin

2009-06-02

Ordered hydration shells: The more ordered hydration shells outside the charged CNT surfaces prevent more compact adsorption of the peptide in the charged CNT systems [picture: see text], but peptide binding strengths on the charged CNT surfaces are stronger due to the electrostatic interaction.Studies of adsorption dynamics and stability for peptides/proteins on single-walled carbon nanotubes (SWNTs) are of great importance for a better understanding of the properties and nature of nanotube-based biosystems. Herein, the dynamics and mechanism of the adsorption of the insulin chain B peptide on different charged SWNTs are investigated by explicit solvent molecular dynamics simulations. The results show that all types of surfaces effectively attract the model peptide. Water molecules play a significant role in peptide adsorption on the surfaces of charged carbon nanotubes (CNTs). Compared to peptide adsorption on neutral CNT surfaces, the more ordered hydration shells outside the tube prevent more compact adsorption of the peptide in charged CNT systems. This shield effect leads to a smaller conformational change and van der Waals interaction between the peptide and surfaces, but peptide binding strengths on charged CNT surfaces are stronger than those on the neutral CNT surface due to the strong electrostatic interaction. The result of these simulations implies the possibility of improving the binding strength of peptides/proteins on CNT surfaces, as well as keeping the integrity of the peptide/protein conformation in peptide/protein-CNT complexes by charging the CNTs.

Utilization of photoinduced charge-separated state of donor-acceptor-linked molecules for regulation of cell membrane potential and ion transport.

PubMed

Numata, Tomohiro; Murakami, Tatsuya; Kawashima, Fumiaki; Morone, Nobuhiro; Heuser, John E; Takano, Yuta; Ohkubo, Kei; Fukuzumi, Shunichi; Mori, Yasuo; Imahori, Hiroshi

2012-04-11

The control of ion transport across cell membranes by light is an attractive strategy that allows targeted, fast control of precisely defined events in the biological membrane. Here we report a novel general strategy for the control of membrane potential and ion transport by using charge-separation molecules and light. Delivery of charge-separation molecules to the plasma membrane of PC12 cells by a membranous nanocarrier and subsequent light irradiation led to depolarization of the membrane potential as well as inhibition of the potassium ion flow across the membrane. Photoregulation of the cell membrane potential and ion transport by using charge-separation molecules is highly promising for control of cell functions. © 2012 American Chemical Society

The Case Against Charge Transfer Interactions in Dissolved Organic Matter Photophysics.

PubMed

McKay, Garrett; Korak, Julie A; Erickson, Paul R; Latch, Douglas E; McNeill, Kristopher; Rosario-Ortiz, Fernando L

2018-01-16

The optical properties of dissolved organic matter influence chemical and biological processes in all aquatic ecosystems. Dissolved organic matter optical properties have been attributed to a charge-transfer model in which donor-acceptor complexes play a primary role. This model was evaluated by measuring the absorbance and fluorescence response of organic matter isolates to changes in solvent temperature, viscosity, and polarity, which affect the position and intensity of spectra for known donor-acceptor complexes of organic molecules. Absorbance and fluorescence spectral shape were largely unaffected by these changes, indicating that the distribution of absorbing and emitting species was unchanged. Overall, these results call into question the wide applicability of the charge-transfer model for explaining organic matter optical properties and suggest that future research should explore other models for dissolved organic matter photophysics.

A method to obtain static potential for electron-molecule scattering

NASA Astrophysics Data System (ADS)

Srivastava, Rajesh; Das, Tapasi; Stauffer, Allan

2014-05-01

Electron scattering from molecules is complicated by the fact that molecules are a multi-centered target with the nuclei of the constituent atoms being a center of charge. One of the most important parts of a scattering calculation is to obtain the static potential which represents the interaction of the incident electron with the unperturbed charge distribution of the molecule. A common way to represent the charge distribution of molecules is with Gaussian orbitals centered on the various nuclei. We have derived a way to calculate spherically-averaged molecular static potentials using this form of molecular wave function which is mostly analytic. This method has been applied to elastic electron scattering from water molecules and we obtained differential cross sections which are compared with previous experimental and theoretical results. The method can be extended to more complex molecules. One of us (RS) is thankful to IAEA, Vienna, Austria and DAE-BRNS, Mumbai, India for financial support.

The Role of Nanoparticle Surface Functionality in the Disruption of Model Cell Membranes

PubMed Central

Moghadam, Babak Y.; Hou, Wen-Che; Corredor, Charlie; Westerhoff, Paul; Posner, Jonathan D.

2012-01-01

Lipid bilayers are biomembranes common to cellular life and constitute a continuous barrier between cells and their environment. Understanding the interaction of engineered nanomaterials (ENMs) with lipid bilayers is an important step toward predicting subsequent biological effects. In this study, we assess the effect of varying the surface functionality and concentration of 10 nm-diameter gold (Au) and titanium dioxide (TiO2) ENMs on the disruption of negatively charged lipid bilayer vesicles (liposomes) using a dye leakage assay. Our findings show that Au ENMs having both positive and negative surface charge induce leakage that reaches a steady state after several hours. Positively charged particles with identical surface functionality and different core composition show similar leakage effects and result in faster and greater leakage than negatively charged particles, which suggests that surface functionality, not particle core composition, is a critical factor in determining the interaction between ENMs and lipid bilayers. The results suggest that particles permanently adsorb to bilayers and that only one positively charged particle is required to disrupt a liposome and trigger leakage of its entire contents in contrast to mellitin molecules, the most widely studied membrane lytic peptide, which requires hundred of molecules to generate leakage. PMID:22921268

The importance of the external potential on group electronegativity.

PubMed

Leyssens, Tom; Geerlings, Paul; Peeters, Daniel

2005-11-03

The electronegativity of groups placed in a molecular environment is obtained using CCSD calculations of the electron affinity and ionization energy. A point charge model is used as an approximation of the molecular environment. The electronegativity values obtained in the presence of a point charge model are compared to the isolated group property to estimate the importance of the external potential on the group's electronegativity. The validity of the "group in molecule" electronegativities is verified by comparing EEM (electronegativity equalization method) charge transfer values to the explicitly calculated natural population analysis (NPA) ones, as well as by comparing the variation in electronegativity between the isolated functional group and the functional group in the presence of a modeled environment with the variation based on a perturbation expansion of the chemical potential.

Surface charge sensing by altering the phase transition in VO2

NASA Astrophysics Data System (ADS)

Kumar, S.; Esfandyarpour, R.; Davis, R.; Nishi, Y.

2014-08-01

Detection of surface charges has various applications in medicine, electronics, biotechnology, etc. The source of surface charge induction may range from simple charge-polarized molecules like water to complicated proteins. It was recently discovered that surface charge accumulation can alter the temperature at which VO2 undergoes a Mott transition. Here, we deposited polar molecules onto the surface of two-terminal thin-film VO2 lateral devices and monitored the joule-heating-driven Mott transition, or conductance switching. We observed that the power required to induce the conductance switching reduced upon treatment with polar molecules and, using in-situ blackbody-emission direct measurement of local temperature, we show that this reduction in power was accompanied by reduction in the Mott transition temperature. Further evidence suggested that this effect has specificity to the nature of the species used to induce surface charges. Using x-ray absorption spectroscopy, we also show that there is no detectable change in oxidation state of vanadium or structural phase in the bulk of the 40 nm VO2 thin-film even as the phase transition temperature is reduced by up to 20 K by the polar molecules. The ability to alter the phase transition parameters by depositing polar molecules suggests a potential application in sensing surface charges of different origins and this set of results also highlights interesting aspects of the phase transition in VO2.

Signature of charge migration in modulations of double ionization

NASA Astrophysics Data System (ADS)

Mauger, François; Abanador, Paul M.; Bruner, Adam; Sissay, Adonay; Gaarde, Mette B.; Lopata, Kenneth; Schafer, Kenneth J.

2018-04-01

We present a theoretical investigation of charge migration following strong-field ionization in a multielectron system. We study a model homonuclear molecule with two electrons, each restricted to one dimension (1 +1 D ), interacting with a strong, static electric field. We show that in this system charge migration results from the interplay between multiple ionization channels that overlap in space, creating a coherent electron-hole wave packet in the cation. We also find that, in our case, charge migration following the first ionization manifests as a modulation of the subsequent double-ionization signal. We derive a parametrized semiclassical model from the full multielectron system and we discuss the importance of the choice of cation electronic-structure basis for the efficacy of the semiclassical representation. We use the ab initio solution of the full 1 +1 D system as a reference for the qualitative and quantitative results of the parametrized semiclassical model. We discuss the extension of our model to long-wavelength time-dependent fields with full-dimension, many-electron targets.

Molecule-specific determination of atomic polarizabilities with the polarizable atomic multipole model.

PubMed

Woo Kim, Hyun; Rhee, Young Min

2012-07-30

Recently, many polarizable force fields have been devised to describe induction effects between molecules. In popular polarizable models based on induced dipole moments, atomic polarizabilities are the essential parameters and should be derived carefully. Here, we present a parameterization scheme for atomic polarizabilities using a minimization target function containing both molecular and atomic information. The main idea is to adopt reference data only from quantum chemical calculations, to perform atomic polarizability parameterizations even when relevant experimental data are scarce as in the case of electronically excited molecules. Specifically, our scheme assigns the atomic polarizabilities of any given molecule in such a way that its molecular polarizability tensor is well reproduced. We show that our scheme successfully works for various molecules in mimicking dipole responses not only in ground states but also in valence excited states. The electrostatic potential around a molecule with an externally perturbing nearby charge also exhibits a near-quantitative agreement with the reference data from quantum chemical calculations. The limitation of the model with isotropic atoms is also discussed to examine the scope of its applicability. Copyright © 2012 Wiley Periodicals, Inc.

Computer simulations and theoretical aspects of the depletion interaction in protein-oligomer mixtures.

PubMed

Boncina, M; Rescic, J; Kalyuzhnyi, Yu V; Vlachy, V

2007-07-21

The depletion interaction between proteins caused by addition of either uncharged or partially charged oligomers was studied using the canonical Monte Carlo simulation technique and the integral equation theory. A protein molecule was modeled in two different ways: either as (i) a hard sphere of diameter 30.0 A with net charge 0, or +5, or (ii) as a hard sphere with discrete charges (depending on the pH of solution) of diameter 45.4 A. The oligomers were pictured as tangentially jointed, uncharged, or partially charged, hard spheres. The ions of a simple electrolyte present in solution were represented by charged hard spheres distributed in the dielectric continuum. In this study we were particularly interested in changes of the protein-protein pair-distribution function, caused by addition of the oligomer component. In agreement with previous studies we found that addition of a nonadsorbing oligomer reduces the phase stability of solution, which is reflected in the shape of the protein-protein pair-distribution function. The value of this function in protein-protein contact increases with increasing oligomer concentration, and is larger for charged oligomers. The range of the depletion interaction and its strength also depend on the length (number of monomer units) of the oligomer chain. The integral equation theory, based on the Wertheim Ornstein-Zernike approach applied in this study, was found to be in fair agreement with Monte Carlo results only for very short oligomers. The computer simulations for a model mimicking the lysozyme molecule (ii) are in qualitative agreement with small-angle neutron experiments for lysozyme-dextran mixtures.

Single molecule-level study of donor-acceptor interactions and nanoscale environment in blends

NASA Astrophysics Data System (ADS)

Quist, Nicole; Grollman, Rebecca; Rath, Jeremy; Robertson, Alex; Haley, Michael; Anthony, John; Ostroverkhova, Oksana

2017-02-01

Organic semiconductors have attracted considerable attention due to their applications in low-cost (opto)electronic devices. The most successful organic materials for applications that rely on charge carrier generation, such as solar cells, utilize blends of several types of molecules. In blends, the local environment strongly influences exciton and charge carrier dynamics. However, relationship between nanoscale features and photophysics is difficult to establish due to the lack of necessary spatial resolution. We use functionalized fluorinated pentacene (Pn) molecule as single molecule probes of intermolecular interactions and of the nanoscale environment in blends containing donor and acceptor molecules. Single Pn donor (D) molecules were imaged in PMMA in the presence of acceptor (A) molecules using wide-field fluorescence microscopy. Two sample configurations were realized: (i) a fixed concentration of Pn donor molecules, with increasing concentration of acceptor molecules (functionalized indenflouorene or PCBM) and (ii) a fixed concentration of acceptor molecules with an increased concentration of the Pn donor. The D-A energy transfer and changes in the donor emission due to those in the acceptor- modified polymer morphology were quantified. The increase in the acceptor concentration was accompanied by enhanced photobleaching and blinking of the Pn donor molecules. To better understand the underlying physics of these processes, we modeled photoexcited electron dynamics using Monte Carlo simulations. The simulated blinking dynamics were then compared to our experimental data, and the changes in the transition rates were related to the changes in the nanoscale environment. Our study provides insight into evolution of nanoscale environment during the formation of bulk heterojunctions.

Effect of molecular properties on the performance of polymer light-emitting diodes

NASA Astrophysics Data System (ADS)

Ramos, Marta M. D.; Almeida, A. M.; Correia, Helena M. G.; Ribeiro, R. Mendes; Stoneham, A. M.

2004-11-01

The performance of a single layer polymer light-emitting diode depends on several interdependent factors, although recombination between electrons and holes within the polymer layer is believed to play an important role. Our aim is to carry out computer experiments in which bipolar charge carriers are injected in polymer networks made of poly(p-phenylene vinylene) chains randomly oriented. In these simulations, we follow the charge evolution in time from some initial state to the steady state. The intra-molecular properties of the polymer molecules obtained from self-consistent quantum molecular dynamics calculations are used in the mesoscopic model. The purpose of the present work is to clarify the effects of intra-molecular charge mobility and energy disorder on recombination efficiency. In particular, we find that charge mobility along the polymer chains has a serious influence on recombination within the polymer layer. Our results also show that energy disorder due to differences in ionization potential and electron affinity of neighbouring molecules affects mainly recombinations that occur near the electrodes at polymer chains parallel to them.

Detailed solvent, structural, quantum chemical study and antimicrobial activity of isatin Schiff base

NASA Astrophysics Data System (ADS)

Brkić, Dominik R.; Božić, Aleksandra R.; Marinković, Aleksandar D.; Milčić, Miloš K.; Prlainović, Nevena Ž.; Assaleh, Fathi H.; Cvijetić, Ilija N.; Nikolić, Jasmina B.; Drmanić, Saša Ž.

2018-05-01

The ratios of E/Z isomers of sixteen synthesized 1,3-dihydro-3-(substituted phenylimino)-2H-indol-2-one were studied using experimental and theoretical methodology. Linear solvation energy relationships (LSER) rationalized solvent influence of the solvent-solute interactions on the UV-Vis absorption maxima shifts (νmax) of both geometrical isomers using the Kamlet-Taft equation. Linear free energy relationships (LFER) in the form of single substituent parameter equation (SSP) was used to analyze substituent effect on pKa, NMR chemical shifts and νmax values. Electron charge density was obtained by the use of Quantum Theory of Atoms in Molecules, i.e. Bader's analysis. The substituent and solvent effect on intramolecular charge transfer (ICT) were interpreted with the aid of time-dependent density functional (TD-DFT) method. Additionally, the results of TD-DFT calculations quantified the efficiency of ICT from the calculated charge-transfer distance (DCT) and amount of transferred charge (QCT). The antimicrobial activity was evaluated using broth microdilution method. 3D QSAR modeling was used to demonstrate the influence of substituents effect as well as molecule geometry on antimicrobial activity.

Size-Induced Segregation in the Stepwise Microhydration of Hydantoin and Its Role in Proton-Induced Charge Transfer

NASA Astrophysics Data System (ADS)

Calvo, Florent; Bacchus-Montabonel, Marie-Christine

2018-01-01

Recent photochemistry experiments provided evidence for the formation of hydantoin by irradiation of interstellar ice analogues. The significance of these results and the importance of hydantoin in prebiotic chemistry and polypeptide synthesis motivate the present theoretical investigation, in which we analyzed the effects of stepwise hydration on the electronic and thermodynamical properties of the structure of microhydrated hydantoin using a variety of computational approaches. We generally find microhydration to proceed around the hydantoin heterocycle until 5 water molecules are reached, at which stage hydration becomes segregated with a water cluster forming aside the heterocycle. The reactivity of microhydrated hydantoin caused by an impinging proton was evaluated through charge transfer collision cross sections for microhydrated compounds but also for hydantoin on icy grains modeled using a cluster approach mimicking the true hexagonal ice surface. The effects of hydration on charge transfer efficiency are mostly significant when few water molecules are present, and they progressively weaken and stabilize in larger clusters. On the ice substrate, charge transfer essentially contributes to a global increase in the cross sections.

Molecular layers of ZnPc and FePc on Au(111) surface: Charge transfer and chemical interaction

NASA Astrophysics Data System (ADS)

Ahmadi, Sareh; Shariati, M. Nina; Yu, Shun; Göthelid, Mats

2012-08-01

We have studied zinc phthalocyanine (ZnPc) and iron phthalocyanine (FePc) thick films and monolayers on Au(111) using photoelectron spectroscopy and x-ray absorption spectroscopy. Both molecules are adsorbed flat on the surface at monolayer. ZnPc keeps this orientation in all investigated coverages, whereas FePc molecules stand up in the thick film. The stronger inter-molecular interaction of FePc molecules leads to change of orientation, as well as higher conductivity in FePc layer in comparison with ZnPc, which is reflected in thickness-dependent differences in core-level shifts. Work function changes indicate that both molecules donate charge to Au; through the π-system. However, the Fe3d derived lowest unoccupied molecular orbital receives charge from the substrate when forming an interface state at the Fermi level. Thus, the central atom plays an important role in mediating the charge, but the charge transfer as a whole is a balance between the two different charge transfer channels; π-system and the central atom.

Using a water-confined carbon nanotube to probe the electricity of sequential charged segments of macromolecules

NASA Astrophysics Data System (ADS)

Wang, Yu; Zhao, Yan-Jiao; Huang, Ji-Ping

2012-07-01

The detection of macromolecular conformation is particularly important in many physical and biological applications. Here we theoretically explore a method for achieving this detection by probing the electricity of sequential charged segments of macromolecules. Our analysis is based on molecular dynamics simulations, and we investigate a single file of water molecules confined in a half-capped single-walled carbon nanotube (SWCNT) with an external electric charge of +e or -e (e is the elementary charge). The charge is located in the vicinity of the cap of the SWCNT and along the centerline of the SWCNT. We reveal the picosecond timescale for the re-orientation (namely, from one unidirectional direction to the other) of the water molecules in response to a switch in the charge signal, -e → +e or +e → -e. Our results are well understood by taking into account the electrical interactions between the water molecules and between the water molecules and the external charge. Because such signals of re-orientation can be magnified and transported according to Tu et al. [2009 Proc. Natl. Acad. Sci. USA 106 18120], it becomes possible to record fingerprints of electric signals arising from sequential charged segments of a macromolecule, which are expected to be useful for recognizing the conformations of some particular macromolecules.

Nonlinearity, resonance, charging, and motion at the atomic scale studied with scanning tunneling microscopes

NASA Astrophysics Data System (ADS)

Tu, Xiuwen

2008-10-01

Several novel phenomena at the single-atom and single-molecule level occurring on the surfaces of single crystals were studied with home-built low temperature scanning tunneling microscopes. The results revealed intriguing properties of single atoms and single molecules, including nonlinearity, resonance, charging, and motion. First, negative differential resistance (NDR) was observed in the dI/dV spectra for single copper-phthalocyanine (CuPc) molecules adsorbed on one- and two-layer sodium bromide (NaBr), but not for single CuPc molecules adsorbed on three-layer NaBr, all grown on a NiAl(110) surface. This transition from NDR to the absence of NDR was explained as the result of competing effects in the double-barrier tunnel junction (DBTJ) and was reproduced in a calculation based on a resonant-tunneling model. Second, the nonlinearity of the STM junction due to a single manganese (Mn) atom or MnCO molecule adsorbed on a NiAl(110) surface was used to rectify microwave irradiation. The resulting rectification current was shown to be sensitive to the spin-splitting of the electronic states of the Mn atom and to the vibrations of the MnCO molecule. Next, the ordering of cesium (Cs) atoms adsorbed on a Au(111) surface and a NiAl(110) surface was imaged in real space. Because of charge transfer to the substrates, Cs adatoms were positively charged on both surfaces. Even at 12 K, Cs adatoms were able to move and adjust according to coverage. On Au(111), the Cs first layer had a quasi-hexagonal lattice and islands of the second Cs layer did not appear until the first was completed. On NiAl(110), a locally disordered Cs first layer was observed before a locally ordered layer appeared at higher coverages. The cation-pi interactions were then studied at the single molecular level. We were able to form cation-pi complexes such as Cs···DSB, Cs···DSB···Cs, Rb···DSB, and Rb···ZnEtiol controllably by manipulation with the STM tip. We could also separate these complexes controllably by voltage pulses. STM imaging and spectroscopy revealed precise information about the atomic and electronic structure of these cation-pi complexes. Finally, electron transport through single atoms and molecules in a double-barrier tunnel junction (DBTJ) was examined. Charge bistability was observed for single ZnEtioI molecules adsorbed in several different conformations on ultrathin aluminum oxide. A sudden decrease in local apparent barrier height (LABH) was observed at the onset of an adsorbate electronic orbital for single ZnEtioI molecules and Cs atoms supported by the ultrathin aluminum oxide. The resonant-tunneling model, which was proposed to explain the transition from NDR to the absence of NDR, was found useful in explaining the sudden decrease in LABH, too. NDR, bipolar tunneling, and vibronic states were also observed and discussed in the context of DBTJ.

Ambipolar nature of dimethyl benzo difuran (DMBDF) molecule: A charge transport study

NASA Astrophysics Data System (ADS)

Sahoo, Smruti Ranjan; Sahu, Sridhar

2017-05-01

We describe a theoretical study of the charge transport properties of the organic dimethyl benzo difuran (DMBDF) molecule based on density functional theory (DFT). Reorganization energy, ionization potential (IP), electron affinity (EA), energy gaps, transfer integral (t) and charge mobility (μ) has been studied to depict the transport properties in the conjugated organic molecules. We computed, large homo transfer integral and IP value leading to high hole mobility (4.46 cm2/V sec). However, the electron reorganization energy (0.34 eV) and the electron mobility of 1.62 cm2/V sec, infers that the DMBDF organic molecule bears an ambipolar character.

Hydration of a Large Anionic Charge Distribution - Naphthalene-Water Cluster Anions

NASA Astrophysics Data System (ADS)

Weber, J. Mathias; Adams, Christopher L.

2010-06-01

We report the infrared spectra of anionic clusters of naphthalene with up to three water molecules. Comparison of the experimental infrared spectra with theoretically predicted spectra from quantum chemistry calculations allow conclusions regarding the structures of the clusters under study. The first water molecule forms two hydrogen bonds with the π electron system of the naphthalene moiety. Subsequent water ligands interact with both the naphthalene and the other water ligands to form hydrogen bonded networks, similar to other hydrated anion clusters. Naphthalene-water anion clusters illustrate how water interacts with negative charge delocalized over a large π electron system. The clusters are interesting model systems that are discussed in the context of wetting of graphene surfaces and polyaromatic hydrocarbons.

Triphenylamine-Based Push–Pull Molecule for Photovoltaic Applications: From Synthesis to Ultrafast Device Photophysics

PubMed Central

2017-01-01

Small push–pull molecules attract much attention as prospective donor materials for organic solar cells (OSCs). By chemical engineering, it is possible to combine a number of attractive properties such as broad absorption, efficient charge separation, and vacuum and solution processabilities in a single molecule. Here we report the synthesis and early time photophysics of such a molecule, TPA-2T-DCV-Me, based on the triphenylamine (TPA) donor core and dicyanovinyl (DCV) acceptor end group connected by a thiophene bridge. Using time-resolved photoinduced absorption and photoluminescence, we demonstrate that in blends with [70]PCBM the molecule works both as an electron donor and hole acceptor, thereby allowing for two independent channels of charge generation. The charge-generation process is followed by the recombination of interfacial charge transfer states that takes place on the subnanosecond time scale as revealed by time-resolved photoluminescence and nongeminate recombination as follows from the OSC performance. Our findings demonstrate the potential of TPA-DCV-based molecules as donor materials for both solution-processed and vacuum-deposited OSCs. PMID:28413568

Topological defects in mixtures of superconducting condensates with different charges

NASA Astrophysics Data System (ADS)

Garaud, Julien; Babaev, Egor

2014-06-01

We investigate the topological defects in phenomenological models describing mixtures of charged condensates with commensurate electric charges. Such situations are expected to appear for example in liquid metallic deuterium. This is modeled by a multicomponent Ginzburg-Landau theory where the condensates are coupled to the same gauge field by different coupling constants whose ratio is a rational number. We also briefly discuss the case where electric charges are incommensurate. Flux quantization and finiteness of the energy per unit length dictate that the different condensates have different winding and thus different number of (fractional) vortices. Competing attractive and repulsive interactions lead to molecule-like bound states between fractional vortices. Such bound states have finite energy and carry integer flux quanta. These can be characterized by the CP1 topological invariant that motivates their denomination as skyrmions.

Simple method of DNA stretching on glass substrate for fluorescence image and spectroscopy

NASA Astrophysics Data System (ADS)

Neupane, Guru P.; Dhakal, Krishna P.; Lee, Hyunsoo; Guthold, Martin; Joseph, Vincent S.; Hong, Jong-Dal; Kim, Jeongyong

2013-05-01

Study of biological molecule DNA has contributed to developing many breaking thoughts and wide applications in multidisciplinary fields, such as genomic, medical, sensing and forensic fields. Stretching of DNA molecules is an important supportive tool for AFM or spectroscopic studies of DNA in a single molecular level. In this article, we established a simple method of DNA stretching (to its full length) that occurred on a rotating negatively-charged surface of glass substrate. The isolation of a single DNA molecule was attained by the two competitive forces on DNA molecules, that is, the electrostatic attraction developed between the positively charged YOYO-1 stained DNA and the negatively charged substrate, and the centrifugal force of the rotating substrate, which separates the DNA aggregates into the single molecule. Density of stretched DNA molecules was controlled by selecting the specific parameters such as spinning time and rates, loading volume of DNA-dye complex solution etc. The atomic force microscopy image exhibited a single DNA molecule on the negatively-charged substrate in an isolated state. Further, the photoluminescence spectra of a single DNA molecule stained with YOYO-1 were achieved using the method developed in the present study, which is strongly believed to effectively support the spectroscopic analysis of DNA in a single molecular level.

Charge transport in single photochromic molecular junctions

NASA Astrophysics Data System (ADS)

Kim, Youngsang; Pietsch, T.; Scheer, Elke; Hellmuth, T.; Pauly, F.; Sysoiev, D.; Huhn, T.; Exner, T.; Groth, U.; Steiner, U.; Erbe, A.

2012-02-01

Recently, photoswitchable molecules, i.e. diarylethene, gained significant interest due to their applicability in data storage media, as optical switches, and in novel logic circuits [1]. Diarylethene-derivative molecules are the most promising candidates to design electronic functional elements, because of their excellent thermal stability, high fatigue resistance, and negligible change upon switching [1]. Here, we present the preferential conductance of specifically designed sulfur-free diarylethene molecules [2] bridging the mechanically controlled break-junctions at low temperatures [3]. The molecular energy levels and electrode couplings are obtained by evaluating the current-voltage characteristics using the single-level model [4]. The charge transport mechanism of different types of diarylethene molecules is investigated, and the results are discussed within the framework of novel theoretical predictions. [4pt] [1] M. Del Valle etal., Nat Nanotechnol 2, 176 (2007) S. J. van der Molen etal., Nano. Lett. 9, 76 (2009).[0pt] [2] D. Sysoiev etal., Chem. Eur. J. 17, 6663 (2011).[0pt] [3] Y. Kim etal., Phys. Rev. Lett. 106, 196804 (2011).[0pt] [4] Y. Kim etal., Nano Lett. 11, 3734 (2011). L. Zotti etal., Small 6, 1529 (2010).

Implication of the solvent effect, metal ions and topology in the electronic structure and hydrogen bonding of human telomeric G-quadruplex DNA.

PubMed

Poudel, Lokendra; Steinmetz, Nicole F; French, Roger H; Parsegian, V Adrian; Podgornik, Rudolf; Ching, Wai-Yim

2016-08-03

We present a first-principles density functional study elucidating the effects of solvent, metal ions and topology on the electronic structure and hydrogen bonding of 12 well-designed three dimensional G-quadruplex (G4-DNA) models in different environments. Our study shows that the parallel strand structures are more stable in dry environments and aqueous solutions containing K(+) ions within the tetrad of guanine but conversely, that the anti-parallel structure is more stable in solutions containing the Na(+) ions within the tetrad of guanine. The presence of metal ions within the tetrad of the guanine channel always enhances the stability of the G4-DNA models. The parallel strand structures have larger HOMO-LUMO gaps than antiparallel structures, which are in the range of 0.98 eV to 3.11 eV. Partial charge calculations show that sugar and alkali ions are positively charged whereas nucleobases, PO4 groups and water molecules are all negatively charged. Partial charges on each functional group with different signs and magnitudes contribute differently to the electrostatic interactions involving G4-DNA and favor the parallel structure. A comparative study between specific pairs of different G4-DNA models shows that the Hoogsteen OH and NH hydrogen bonds in the guanine tetrad are significantly influenced by the presence of metal ions and water molecules, collectively affecting the structure and the stability of G4-DNA.

Determination of the microenvironment-pH and charge and size characteristics of amino acids through their electrophoretic mobilities determined by CZE.

PubMed

Piaggio, Maria V; Peirotti, Marta B; Deiber, Julio A

2007-10-01

Effective electrophoretic mobility data of 20 amino acids reported in the literature are analyzed and interpreted through simple physicochemical models, which are able to provide estimates of coupled quantities like hydrodynamic shape factor, equivalent hydrodynamic radius (size), net charge, actual pK values of ionizing groups, partial charges of ionizing groups, hydration number, and pH near molecule (microenvironment-pH of the BGE). It is concluded that the modeling of the electrophoretic mobility of these analytes requires a careful consideration of hydrodynamic shape coupled to hydration. In the low range of pH studied here, distinctive hydrodynamic behaviors of amino acids are found. For instance, amino acids with basic polar and ionizing side chain remain with prolate shape for pH values varying from 1.99 to 3.2. It is evident that as the pH increases from low values, amino acids get higher hydrations as a consequence each analyte total charge also increases. This result is consistent with the monotonic increase of the hydrodynamic radius, which accounts for both the analyte and the quite immobilized water molecules defining the electrophoretic kinematical unit. It is also found that the actual or effective pK value of the alpha-carboxylic ionizing group of amino acids increases when the pH is changed from 1.99 to 3.2. Several limitations concerning the simple modeling of the electrophoretic mobility of amino acids are presented for further research.

Charging and Screening in Nonpolar Solutions of Nonionizable Surfactants

NASA Astrophysics Data System (ADS)

Behrens, Sven

2010-03-01

Nonpolar liquids do not easily accommodate electric charges, but surfactant additives are often found to dramatically increase the solution conductivity and promote surface charging of suspended colloid particles. Such surfactant-mediated electrostatic effects have been associated with equilibrium charge fluctuations among reverse surfactant micelles and in some cases with the statistically rare ionization of individual surfactant molecules. Here we present experimental evidence that even surfactants without any ionizable group can mediate charging and charge screening in nonpolar oils, and that they can do so at surfactant concentrations well below the critical micelle concentration (cmc). Precision conductometry, light scattering, and Karl-Fischer titration of sorbitan oleate solutions in hexane, paired with electrophoretic mobility measurements on suspended polymer particles, reveal a distinctly electrostatic action of the surfactant. We interpret our observations in terms of a charge fluctuation model and argue that the observed charging processes are likely facilitated, but not limited, by the presence of ionizable impurities.

Learning from Synthetic Models of Extracellular Matrix; Differential Binding of Wild Type and Amyloidogenic Human Apolipoprotein A-I to Hydrogels Formed from Molecules Having Charges Similar to Those Found in Natural GAGs.

PubMed

Rosú, Silvana A; Toledo, Leandro; Urbano, Bruno F; Sanchez, Susana A; Calabrese, Graciela C; Tricerri, M Alejandra

2017-08-01

Among other components of the extracellular matrix (ECM), glycoproteins and glycosaminoglycans (GAGs) have been strongly associated to the retention or misfolding of different proteins inducing the formation of deposits in amyloid diseases. The composition of these molecules is highly diverse and a key issue seems to be the equilibrium between physiological and pathological events. In order to have a model in which the composition of the matrix could be finely controlled, we designed and synthesized crosslinked hydrophilic polymers, the so-called hydrogels varying the amounts of negative charges and hydroxyl groups that are prevalent in GAGs. We checked and compared by fluorescence techniques the binding of human apolipoprotein A-I and a natural mutant involved in amyloidosis to the hydrogel scaffolds. Our results indicate that both proteins are highly retained as long as the negative charge increases, and in addition it was shown that the mutant is more retained than the Wt, indicating that the retention of specific proteins in the ECM could be part of the pathogenicity. These results show the importance of the use of these polymers as a model to get deep insight into the studies of proteins within macromolecules.

Quantitative structure-property relationships for octanol-water partition coefficients of polybrominated diphenyl ethers.

PubMed

Li, Linnan; Xie, Shaodong; Cai, Hao; Bai, Xuetao; Xue, Zhao

2008-08-01

Theoretical molecular descriptors were tested against logK(OW) values for polybrominated diphenyl ethers (PBDEs) using the Partial Least-Squares Regression method which can be used to analyze data with many variables and few observations. A quantitative structure-property relationship (QSPR) model was successfully developed with a high cross-validated value (Q(cum)(2)) of 0.961, indicating a good predictive ability and stability of the model. The predictive power of the QSPR model was further cross-validated. The values of logK(OW) for PBDEs are mainly governed by molecular surface area, energy of the lowest unoccupied molecular orbital and the net atomic charges on the oxygen atom. All these descriptors have been discussed to interpret the partitioning mechanism of PBDE chemicals. The bulk property of the molecules represented by molecular surface area is the leading factor, and K(OW) values increase with the increase of molecular surface area. Higher energy of the lowest unoccupied molecular orbital and higher net atomic charge on the oxygen atom of PBDEs result in smaller K(OW). The energy of the lowest unoccupied molecular orbital and the net atomic charge on PBDEs oxygen also play important roles in affecting the partition of PBDEs between octanol and water by influencing the interactions between PBDEs and solvent molecules.

An ultrasensitive universal detector based on neutralizer displacement

NASA Astrophysics Data System (ADS)

Das, Jagotamoy; Cederquist, Kristin B.; Zaragoza, Alexandre A.; Lee, Paul E.; Sargent, Edward H.; Kelley, Shana O.

2012-08-01

Diagnostic technologies that can provide the simultaneous detection of nucleic acids for gene expression, proteins for host response and small molecules for profiling the human metabolome will have a significant advantage in providing comprehensive patient monitoring. Molecular sensors that report changes in the electrostatics of a sensor's surface on analyte binding have shown unprecedented sensitivity in the detection of charged biomolecules, but do not lend themselves to the detection of small molecules, which do not carry significant charge. Here, we introduce the neutralizer displacement assay that allows charge-based sensing to be applied to any class of molecule irrespective of the analyte charge. The neutralizer displacement assay starts with an aptamer probe bound to a neutralizer. When analyte binding occurs the neutralizer is displaced, which results in a dramatic change in the surface charge for all types of analytes. We have tested the sensitivity, speed and specificity of this system in the detection of a panel of molecules: (deoxy)ribonucleic acid, ribonucleic acid, cocaine, adenosine triphosphate and thrombin.

Carbon Chain Anions and the Growth of Complex Organic Molecules in Titan’s Ionosphere

NASA Astrophysics Data System (ADS)

Desai, R. T.; Coates, A. J.; Wellbrock, A.; Vuitton, V.; Crary, F. J.; González-Caniulef, D.; Shebanits, O.; Jones, G. H.; Lewis, G. R.; Waite, J. H.; Cordiner, M.; Taylor, S. A.; Kataria, D. O.; Wahlund, J.-E.; Edberg, N. J. T.; Sittler, E. C.

2017-08-01

Cassini discovered a plethora of neutral and ionized molecules in Titan’s ionosphere including, surprisingly, anions and negatively charged molecules extending up to 13,800 u q-1. In this Letter, we forward model the Cassini electron spectrometer response function to this unexpected ionospheric component to achieve an increased mass resolving capability for negatively charged species observed at Titan altitudes of 950-1300 km. We report on detections consistently centered between 25.8 and 26.0 u q-1 and between 49.0-50.1 u q-1 which are identified as belonging to the carbon chain anions, CN-/C3N- and/or C2H-/C4H-, in agreement with chemical model predictions. At higher ionospheric altitudes, detections at 73-74 u q-1 could be attributed to the further carbon chain anions C5N-/C6H- but at lower altitudes and during further encounters extend over a higher mass/charge range. This, as well as further intermediary anions detected at >100 u, provide the first evidence for efficient anion chemistry in space involving structures other than linear chains. Furthermore, at altitudes below <1100 km, the low-mass anions (<150 u q-1) were found to deplete at a rate proportional to the growth of the larger molecules, a correlation that indicates the anions are tightly coupled to the growth process. This study adds Titan to an increasing list of astrophysical environments where chain anions have been observed and shows that anion chemistry plays a role in the formation of complex organics within a planetary atmosphere as well as in the interstellar medium.

Computer simulations of the solvatochromism of betaine-30

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mente, S.R.; Maroncelli, M.

1999-09-09

Monte Carlo simulations of the pyridinium N-phenolate dye betaine-30 in 12 solvents (20 solvent representations) were performed in order to explore the molecular basis of the E{sub T}(30) scale of solvent polarity. Ab initio (HF/6-31G{sup *}) and semiempirical (AM1 and INDO/S) electronic structure calculations were used to determine the geometry and charge distribution of betaine-30 in its S{sub 0} and S{sub 1} states. The solvent effect on the betaine absorption spectrum was assumed to derive from electrostatic interactions between the effective charge distributions of solvent molecules and the charge shift brought about by the S{sub 0} {r_arrow} S{sub 1} transition.more » Two models for this charge shift, one obtained from INDO/S calculations and the other an idealized two-site model, were used for the spectral calculations. Good agreement between simulated and observed {Delta}E{sub T} shifts (E{sub T}(30) values measured relative to the nonpolar standard tetramethylsilane) was found for both charge-shift models. In water and other hydroxylic solvents, the O atom of the betaine solute was observed to form moderately strong hydrogen bonds to between one and two solvent molecules. The contribution of these specifically coordinated molecules to the {Delta}E{sub T} shift was found to be large, (30--60%) and comparable to experimental estimates. Additional simulations of acetonitrile and methanol in equilibrium with the S{sub 1} state of betaine-30 were used to determine reorganization energies in these solvents and to decide the extent to which the solvent response to the S{sub 0} {leftrightarrow} S{sub 1} transition conforms to linear response predictions. In both solvents, the spectral distributions observed in the S{sub 0} state simulations were {approximately} 15% narrower than those in the S{sub 1} simulations, indicating only a relatively small departure from linear behavior. Reorganization energies were also estimated for a number of other solvents and compared to values reported in previous experimental and theoretical studies.« less

Electronegativity equalization method: parameterization and validation for organic molecules using the Merz-Kollman-Singh charge distribution scheme.

PubMed

Jirousková, Zuzana; Vareková, Radka Svobodová; Vanek, Jakub; Koca, Jaroslav

2009-05-01

The electronegativity equalization method (EEM) was developed by Mortier et al. as a semiempirical method based on the density-functional theory. After parameterization, in which EEM parameters A(i), B(i), and adjusting factor kappa are obtained, this approach can be used for calculation of average electronegativity and charge distribution in a molecule. The aim of this work is to perform the EEM parameterization using the Merz-Kollman-Singh (MK) charge distribution scheme obtained from B3LYP/6-31G* and HF/6-31G* calculations. To achieve this goal, we selected a set of 380 organic molecules from the Cambridge Structural Database (CSD) and used the methodology, which was recently successfully applied to EEM parameterization to calculate the HF/STO-3G Mulliken charges on large sets of molecules. In the case of B3LYP/6-31G* MK charges, we have improved the EEM parameters for already parameterized elements, specifically C, H, N, O, and F. Moreover, EEM parameters for S, Br, Cl, and Zn, which have not as yet been parameterized for this level of theory and basis set, we also developed. In the case of HF/6-31G* MK charges, we have developed the EEM parameters for C, H, N, O, S, Br, Cl, F, and Zn that have not been parameterized for this level of theory and basis set so far. The obtained EEM parameters were verified by a previously developed validation procedure and used for the charge calculation on a different set of 116 organic molecules from the CSD. The calculated EEM charges are in a very good agreement with the quantum mechanically obtained ab initio charges. 2008 Wiley Periodicals, Inc.

Affine-response model of molecular solvation of ions: Accurate predictions of asymmetric charging free energies.

PubMed

Bardhan, Jaydeep P; Jungwirth, Pavel; Makowski, Lee

2012-09-28

Two mechanisms have been proposed to drive asymmetric solvent response to a solute charge: a static potential contribution similar to the liquid-vapor potential, and a steric contribution associated with a water molecule's structure and charge distribution. In this work, we use free-energy perturbation molecular-dynamics calculations in explicit water to show that these mechanisms act in complementary regimes; the large static potential (∼44 kJ/mol/e) dominates asymmetric response for deeply buried charges, and the steric contribution dominates for charges near the solute-solvent interface. Therefore, both mechanisms must be included in order to fully account for asymmetric solvation in general. Our calculations suggest that the steric contribution leads to a remarkable deviation from the popular "linear response" model in which the reaction potential changes linearly as a function of charge. In fact, the potential varies in a piecewise-linear fashion, i.e., with different proportionality constants depending on the sign of the charge. This discrepancy is significant even when the charge is completely buried, and holds for solutes larger than single atoms. Together, these mechanisms suggest that implicit-solvent models can be improved using a combination of affine response (an offset due to the static potential) and piecewise-linear response (due to the steric contribution).

Affine-response model of molecular solvation of ions: Accurate predictions of asymmetric charging free energies

PubMed Central

Bardhan, Jaydeep P.; Jungwirth, Pavel; Makowski, Lee

2012-01-01

Two mechanisms have been proposed to drive asymmetric solvent response to a solute charge: a static potential contribution similar to the liquid-vapor potential, and a steric contribution associated with a water molecule's structure and charge distribution. In this work, we use free-energy perturbation molecular-dynamics calculations in explicit water to show that these mechanisms act in complementary regimes; the large static potential (∼44 kJ/mol/e) dominates asymmetric response for deeply buried charges, and the steric contribution dominates for charges near the solute-solvent interface. Therefore, both mechanisms must be included in order to fully account for asymmetric solvation in general. Our calculations suggest that the steric contribution leads to a remarkable deviation from the popular “linear response” model in which the reaction potential changes linearly as a function of charge. In fact, the potential varies in a piecewise-linear fashion, i.e., with different proportionality constants depending on the sign of the charge. This discrepancy is significant even when the charge is completely buried, and holds for solutes larger than single atoms. Together, these mechanisms suggest that implicit-solvent models can be improved using a combination of affine response (an offset due to the static potential) and piecewise-linear response (due to the steric contribution). PMID:23020318

An ab initio study of the conformational energy map of acetylcholine

NASA Astrophysics Data System (ADS)

Segall, M. D.; Payne, M. C.; Boyes, R. N.

An ab initio density functional theory study is reported of the conformational energy map of acetylcholine, with respect to the two central dihedral angles of the molecule. The acetylcholine molecule pays a central role in neurotransmission and has been studied widely using semi-empirical computational modelling. The ab initio results are compared with a number of previous investigations and with experiment. The ab initio data indicate that the most stable conformation of acetylcholine is the trans , gauche arrangement of the central dihedral angles. Furthermore, Mulliken population analysis of the electronic structure of the molecule in this conformation indicates that the positive charge of the molecule is spread over the exterior of the cationic head of the molecule.

Poisson-Nernst-Planck-Fermi theory for modeling biological ion channels

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liu, Jinn-Liang, E-mail: jinnliu@mail.nhcue.edu.tw; Eisenberg, Bob, E-mail: beisenbe@rush.edu

2014-12-14

A Poisson-Nernst-Planck-Fermi (PNPF) theory is developed for studying ionic transport through biological ion channels. Our goal is to deal with the finite size of particle using a Fermi like distribution without calculating the forces between the particles, because they are both expensive and tricky to compute. We include the steric effect of ions and water molecules with nonuniform sizes and interstitial voids, the correlation effect of crowded ions with different valences, and the screening effect of water molecules in an inhomogeneous aqueous electrolyte. Including the finite volume of water and the voids between particles is an important new part ofmore » the theory presented here. Fermi like distributions of all particle species are derived from the volume exclusion of classical particles. Volume exclusion and the resulting saturation phenomena are especially important to describe the binding and permeation mechanisms of ions in a narrow channel pore. The Gibbs free energy of the Fermi distribution reduces to that of a Boltzmann distribution when these effects are not considered. The classical Gibbs entropy is extended to a new entropy form — called Gibbs-Fermi entropy — that describes mixing configurations of all finite size particles and voids in a thermodynamic system where microstates do not have equal probabilities. The PNPF model describes the dynamic flow of ions, water molecules, as well as voids with electric fields and protein charges. The model also provides a quantitative mean-field description of the charge/space competition mechanism of particles within the highly charged and crowded channel pore. The PNPF results are in good accord with experimental currents recorded in a 10{sup 8}-fold range of Ca{sup 2+} concentrations. The results illustrate the anomalous mole fraction effect, a signature of L-type calcium channels. Moreover, numerical results concerning water density, dielectric permittivity, void volume, and steric energy provide useful details to study a variety of physical mechanisms ranging from binding, to permeation, blocking, flexibility, and charge/space competition of the channel.« less

Dynamics of ions in a water drop using the AMOEBA polarizable force field

NASA Astrophysics Data System (ADS)

Thaunay, Florian; Ohanessian, Gilles; Clavaguéra, Carine

2017-03-01

Various ions carrying a charge from -2 to +3 were confined in a drop of 100 water molecules as a way to model coordination properties inside the cluster and at the interface. The behavior of the ions has been followed by molecular dynamics with the AMOEBA polarizable force field. Multiply charged ions and small singly charged ions are found to lie inside the droplet, while bigger monovalent ions sit near the surface. The results provide a coherent picture of average structural properties as well as residence times for which a general trend is proposed, especially for the anions.

Interplay between efficiency and device architecture for small molecule organic solar cells.

PubMed

Williams, Graeme; Sutty, Sibi; Aziz, Hany

2014-06-21

Small molecule organic solar cells (OSCs) have experienced a resurgence of interest over their polymer solar cell counterparts, owing to their improved batch-to-batch (thus, cell-to-cell) reliability. In this systematic study on OSC device architecture, we investigate five different small molecule OSC structures, including the simple planar heterojunction (PHJ) and bulk heterojunction (BHJ), as well as several planar-mixed structures. The different OSC structures are studied over a wide range of donor:acceptor mixing concentrations to gain a comprehensive understanding of their charge transport behavior. Transient photocurrent decay measurements provide crucial information regarding the interplay between charge sweep-out and charge recombination, and ultimately hint toward space charge effects in planar-mixed structures. Results show that the BHJ/acceptor architecture, comprising a BHJ layer with high C60 acceptor content, generates OSCs with the highest performance by balancing charge generation with charge collection. The performance of other device architectures is largely limited by hole transport, with associated hole accumulation and space charge effects.

Equivalent Circuit Modeling for Carbon Nanotube Schottky Barrier Modulation in Polarized Gases

NASA Technical Reports Server (NTRS)

Yamada, Toshishige

2005-01-01

We study the carbon nanotube Schottky barrier at the metallic electrode interface in polarized gases using an equivalent circuit model. The gas-nanotube interaction is often weak and very little charge transfer is expected [l]. This is the case with'oxygen, but the gas-electrode interaction is appreciable and makes the oxygen molecules negatively charged. In the closed circuit condition, screening positive charges appear in the nanotube as well as in the electrode, and the Schottky barrier is modulated due to the resultant electrostatic effects [2]. In the case of ammonia, both the gas-nanotube and gas-electrode interactions are weak, but the Schottky barrier can still be modulated since the molecules are polarized and align in the preferred orientation within the gap between the electrode and nanotube in the open circuit condition (dipole layer formation). In the closed circuit condition, an electric field appears in the gap and strengthens or weakens the preferred dipole alignment reflecting the nanotube Fermi level. The modulation is visible when the nanotube depletion mode is involved, and the required dipole density is as low as 2 x 10(exp 13) dipoles/sq cm, which is quite feasible experimentally,

Apport de la microscopie a effet tunnel a la caracterisation d'interfaces molecule-metal a fort transfert de charge

NASA Astrophysics Data System (ADS)

Bedwani, Stephane

To assess the importance of charge-transfer on the interface properties, we studied the interaction of the tetracyanoethylene (TCNE) molecule with various copper surfaces. TCNE, a highly electrophilic molecule, appears as an ideal candidate to study the influence of high charge-transfer on the electronic and structural properties of molecule-surface interfaces. Indeed, various TCNE-transition metal complexes exhibit magnetism at room temperature, which is in agreement with a very significant change of the residual charge on the TCNE molecule. The adsorption of TCNE molecules on Cu(100) and Cu(111) surfaces was studied by scanning tunneling microscopy (STM) and by density functional theory (DFT) calculations with a local density approximation (LDA). DFT-LDA calculations were performed to determine the geometric and electronic structure of the studied interfaces. Mulliken analysis was used to evaluate the partial net charge on the adsorbed species. The density of states (DOS) diagrams provided informations on the nature of the frontier orbitals involved in the charge-transfer at molecule-metal interfaces. To validate the theoretical observations, a comparative study was conducted between our simulated STM images and experimental STM images provided by our collaborators. The theoretical STM images were obtained with the SPAGS-STM software using the Landauer-Buttiker formalism with a semi-empirical Hamiltonian based on the extended Huckel theory (EHT) and parameterized using DFT calculations. During the development of the SPAGS-STM software, we have created a discretization module allowing rapid generation of STM images. This module is based on an adaptive Delaunay meshing scheme to minimize the amount of tunneling current to be computed. The general idea consists into refining the mesh, and therefore the calculations, near large contrast zones rather than over the entire image. The adapted mesh provides an STM image resolution equivalent to that obtained with a conventional Cartesian grid but with a significantly smaller number of calculated pixels. This module is independent of the solver used to compute the tunneling current and can be transposed to different imaging techniques. Our work on the adsorption of TCNE molecules on Cu(100) surfaces revealed that the molecules assemble into a 1D chain, thereby buckling excessively a few Cu atoms from the surface. The large deformations observed at the molecule-metal interface show that the Cu atoms close to the TCNE nitrile groups assist the molecular assembly and show a distinct behavior compared with other Cu atoms. A strong charge-transfer is observed at the interface leading to an almost complete occupation of the state ascribed to the lowest unoccupied molecular orbital (LUMO) of TCNE in gas phase. In addition, a back-donation of charge from the molecule to the metal via the states associated with the highest occupied molecular orbitals (HOMO) of TCNE in gas phase may be seen. The magnitude of the charge-transfer between a TCNE molecule and Cu atoms is of the same order on the Cu(111) surface but causes much less buckling than that on the Cu(100) surface. However, experimental STM images of single TCNE molecules adsorbed on Cu(111) surfaces reveal a surprising electronic multistability. In addition, scanning tunneling spectroscopy (STS) reveals that one of these states has a magnetic nature and shows a Kondo resonance. STM simulations identified the source of two non-magnetic states. DFT-LDA calculations were able to ascribe the magnetic state to the partial occupation of a state corresponding to the LUMO+2 of TCNE. Moreover, the calculations showed that additional molecular deformations to those of TCNE in adsorbed phase, such the elongation of the C=C central bond and the bend of nitrile groups toward the surface, favor this charge-transfer to the LUMO+2. This suggested the presence of a Kondo state through the vibrational excitation of the stretching mode of the C=C central bond. The main results of this thesis led to the conclusion that strong charge-transfer between adsorbed molecules on a metallic surface may induce significant buckling of the surface. This surface reconstruction mechanism that involves a bidirectional charge-transfer between the species results into a partial net charge over the molecule. This mechanism is involved in the supramolecular self-assembly process that appears similar to a coordination network. Moreover, the adsorbed molecule presents some important geometric distortions that alter its electronic structure. Additional distortions on the adsorbed molecule induced by some molecular vibration modes seem to explain a stable magnetic state that can be switch on or off by an electrical impulse. (Abstract shortened by UMI.)

Coulomb Fission in Multiply-Charged Ammonia Clusters: Accurate Measurements of the Rayleigh Instability Limit from Fragmentation Patterns.

PubMed

Harris, Christopher; Stace, Anthony J

2018-03-15

A series of experiments have been undertaken on the fragmentation of multiply charged ammonia clusters, (NH 3 ) n z+ , where z ≤ 8 and n ≤ 850, to establish Rayleigh instability limits, whereby clusters at certain critical sizes become unstable due to Coulomb repulsion between the resident charges. Experimental results on size-selected clusters are found to be in excellent agreement with theoretical predictions of Rayleigh instability limits at all values of the charge. Electrostatic theory has been used to help identify fragmentation patterns on the assumption that the clusters separate into two dielectric spheres, and the predicted Coulomb repulsion energies used to establish pathways and the sizes of cluster fragments. The results show that fragmentation is very asymmetric in terms of both the numbers of molecules involved and the amount of charge each fragment accommodates. For clusters carrying a charge ≤+4, the results show that fragmentation proceeds via the loss of small, singly charged clusters. When clusters carry a charge of +5 or more, the experimental observations suggest a marked switch in behavior. Although the laboratory measurements equate to fragmentation via the loss of a large dication cluster, electrostatic theory supports an interpretation that involves the sequential loss of two smaller, singly charged clusters possibly accompanied by the extensive evaporation of neutral molecules. It is suggested that this change in fragmentation pattern is driven by the channelling of Coulomb repulsion energy into intermolecular modes within these larger clusters. Overall, the results appear to support the ion evaporation model that is frequently used to interpret electrospray experiments.

Charge Transfer Effect on Raman and Surface Enhanced Raman Spectroscopy of Furfural Molecules.

PubMed

Wan, Fu; Shi, Haiyang; Chen, Weigen; Gu, Zhaoliang; Du, Lingling; Wang, Pinyi; Wang, Jianxin; Huang, Yingzhou

2017-08-02

The detection of furfural in transformer oil through surface enhanced Raman spectroscopy (SERS) is one of the most promising online monitoring techniques in the process of transformer aging. In this work, the Raman of individual furfural molecules and SERS of furfural-M x (M = Ag, Au, Cu) complexes are investigated through density functional theory (DFT). In the Raman spectrum of individual furfural molecules, the vibration mode of each Raman peak is figured out, and the deviation from experimental data is analyzed by surface charge distribution. In the SERS of furfural-M x complexes, the influence of atom number and species on SERS chemical enhancement factors (EFs) are studied, and are further analyzed by charge transfer effect. Our studies strengthen the understanding of charge transfer effect in the SERS of furfural molecules, which is important in the online monitoring of the transformer aging process through SERS.

Charge Transfer Effect on Raman and Surface Enhanced Raman Spectroscopy of Furfural Molecules

PubMed Central

Wan, Fu; Shi, Haiyang; Chen, Weigen; Gu, Zhaoliang; Du, Lingling; Wang, Pinyi; Wang, Jianxin

2017-01-01

The detection of furfural in transformer oil through surface enhanced Raman spectroscopy (SERS) is one of the most promising online monitoring techniques in the process of transformer aging. In this work, the Raman of individual furfural molecules and SERS of furfural-Mx (M = Ag, Au, Cu) complexes are investigated through density functional theory (DFT). In the Raman spectrum of individual furfural molecules, the vibration mode of each Raman peak is figured out, and the deviation from experimental data is analyzed by surface charge distribution. In the SERS of furfural-Mx complexes, the influence of atom number and species on SERS chemical enhancement factors (EFs) are studied, and are further analyzed by charge transfer effect. Our studies strengthen the understanding of charge transfer effect in the SERS of furfural molecules, which is important in the online monitoring of the transformer aging process through SERS. PMID:28767053

Oil Contact Angles in a Water-Decane-Silicon Dioxide System: Effects of Surface Charge

NASA Astrophysics Data System (ADS)

Xu, Shijing; Wang, Jingyao; Wu, Jiazhong; Liu, Qingjie; Sun, Chengzhen; Bai, Bofeng

2018-04-01

Oil wettability in the water-oil-rock systems is very sensitive to the evolution of surface charges on the rock surfaces induced by the adsorption of ions and other chemical agents in water flooding. Through a set of large-scale molecular dynamics simulations, we reveal the effects of surface charge on the oil contact angles in an ideal water-decane-silicon dioxide system. The results show that the contact angles of oil nano-droplets have a great dependence on the surface charges. As the surface charge density exceeds a critical value of 0.992 e/nm2, the contact angle reaches up to 78.8° and the water-wet state is very apparent. The variation of contact angles can be confirmed from the number density distributions of oil molecules. With increasing the surface charge density, the adsorption of oil molecules weakens and the contact areas between nano-droplets and silicon dioxide surface are reduced. In addition, the number density distributions, RDF distributions, and molecular orientations indicate that the oil molecules are adsorbed on the silicon dioxide surface layer-by-layer with an orientation parallel to the surface. However, the layered structure of oil molecules near the silicon dioxide surface becomes more and more obscure at higher surface charge densities.

Oil Contact Angles in a Water-Decane-Silicon Dioxide System: Effects of Surface Charge.

PubMed

Xu, Shijing; Wang, Jingyao; Wu, Jiazhong; Liu, Qingjie; Sun, Chengzhen; Bai, Bofeng

2018-04-19

Oil wettability in the water-oil-rock systems is very sensitive to the evolution of surface charges on the rock surfaces induced by the adsorption of ions and other chemical agents in water flooding. Through a set of large-scale molecular dynamics simulations, we reveal the effects of surface charge on the oil contact angles in an ideal water-decane-silicon dioxide system. The results show that the contact angles of oil nano-droplets have a great dependence on the surface charges. As the surface charge density exceeds a critical value of 0.992 e/nm 2 , the contact angle reaches up to 78.8° and the water-wet state is very apparent. The variation of contact angles can be confirmed from the number density distributions of oil molecules. With increasing the surface charge density, the adsorption of oil molecules weakens and the contact areas between nano-droplets and silicon dioxide surface are reduced. In addition, the number density distributions, RDF distributions, and molecular orientations indicate that the oil molecules are adsorbed on the silicon dioxide surface layer-by-layer with an orientation parallel to the surface. However, the layered structure of oil molecules near the silicon dioxide surface becomes more and more obscure at higher surface charge densities.

Energy level alignment at planar organic heterojunctions: influence of contact doping and molecular orientation.

PubMed

Opitz, Andreas

2017-04-05

Planar organic heterojunctions are widely used in photovoltaic cells, light-emitting diodes, and bilayer field-effect transistors. The energy level alignment in the devices plays an important role in obtaining the aspired gap arrangement. Additionally, the π-orbital overlap between the involved molecules defines e.g. the charge-separation efficiency in solar cells due to charge-transfer effects. To account for both aspects, direct/inverse photoemission spectroscopy and near edge x-ray absorption fine structure spectroscopy were used to determine the energy level landscape and the molecular orientation at prototypical planar organic heterojunctions. The combined experimental approach results in a comprehensive model for the electronic and morphological characteristics of the interface between the two investigated molecular semiconductors. Following an introduction on heterojunctions used in devices and on energy levels of organic materials, the energy level alignment of planar organic heterojunctions will be discussed. The observed energy landscape is always determined by the individual arrangement between the energy levels of the molecules and the work function of the electrode. This might result in contact doping due to Fermi level pinning at the electrode for donor/acceptor heterojunctions, which also improves the solar cell efficiency. This pinning behaviour can be observed across an unpinned interlayer and results in charge accumulation at the donor/acceptor interface, depending on the transport levels of the respective organic semiconductors. Moreover, molecular orientation will affect the energy levels because of the anisotropy in ionisation energy and electron affinity and is influenced by the structural compatibility of the involved molecules at the heterojunction. High structural compatibility leads to π-orbital stacking between different molecules at a heterojunction, which is of additional interest for photovoltaic active interfaces and for ground-state charge-transfer.

General Method to Determine the Flux of Charged Molecules through Nanopores Applied to β-Lactamase Inhibitors and OmpF.

PubMed

Ghai, Ishan; Pira, Alessandro; Scorciapino, Mariano Andrea; Bodrenko, Igor; Benier, Lorraine; Ceccarelli, Matteo; Winterhalter, Mathias; Wagner, Richard

2017-03-16

A major challenge in the discovery of the new antibiotics against Gram-negative bacteria is to achieve sufficiently fast permeation in order to avoid high doses causing toxic side effects. So far, suitable assays for quantifying the uptake of charged antibiotics into bacteria are lacking. We apply an electrophysiological zero-current assay using concentration gradients of β-lactamase inhibitors combined with single-channel conductance to quantify their flux rates through OmpF. Molecular dynamic simulations provide in addition details on the interactions between the nanopore wall and the charged solutes. In particular, the interaction barrier for three β-lactamase inhibitors is surprisingly as low as 3-5 kcal/mol and only slightly above the diffusion barrier of ions such as chloride. Within our macroscopic constant field model, we determine that at a zero-membrane potential a concentration gradient of 10 μM of avibactam, sulbactam, or tazobactam can create flux rates of roughly 620 molecules/s per OmpF trimer.

Accurate description of charged excitations in molecular solids from embedded many-body perturbation theory

NASA Astrophysics Data System (ADS)

Li, Jing; D'Avino, Gabriele; Duchemin, Ivan; Beljonne, David; Blase, Xavier

2018-01-01

We present a novel hybrid quantum/classical approach to the calculation of charged excitations in molecular solids based on the many-body Green's function G W formalism. Molecules described at the G W level are embedded into the crystalline environment modeled with an accurate classical polarizable scheme. This allows the calculation of electron addition and removal energies in the bulk and at crystal surfaces where charged excitations are probed in photoelectron experiments. By considering the paradigmatic case of pentacene and perfluoropentacene crystals, we discuss the different contributions from intermolecular interactions to electronic energy levels, distinguishing between polarization, which is accounted for combining quantum and classical polarizabilities, and crystal field effects, that can impact energy levels by up to ±0.6 eV. After introducing band dispersion, we achieve quantitative agreement (within 0.2 eV) on the ionization potential and electron affinity measured at pentacene and perfluoropentacene crystal surfaces characterized by standing molecules.

Discovery of an Unexplored Protein Structural Scaffold of Serine Protease from Big Blue Octopus (Octopus cyanea): A New Prospective Lead Molecule.

PubMed

Panda, Subhamay; Kumari, Leena

2017-01-01

Serine proteases are a group of enzymes that hydrolyses the peptide bonds in proteins. In mammals, these enzymes help in the regulation of several major physiological functions such as digestion, blood clotting, responses of immune system, reproductive functions and the complement system. Serine proteases obtained from the venom of Octopodidae family is a relatively unexplored area of research. In the present work, we tried to effectively utilize comparative composite molecular modeling technique. Our key aim was to propose the first molecular model structure of unexplored serine protease 5 derived from big blue octopus. The other objective of this study was to analyze the distribution of negatively and positively charged amino acid over molecular modeled structure, distribution of secondary structural elements, hydrophobicity molecular surface analysis and electrostatic potential analysis with the aid of different bioinformatic tools. In the present study, molecular model has been generated with the help of I-TASSER suite. Afterwards the refined structural model was validated with standard methods. For functional annotation of protein molecule we used Protein Information Resource (PIR) database. Serine protease 5 of big blue octopus was analyzed with different bioinformatical algorithms for the distribution of negatively and positively charged amino acid over molecular modeled structure, distribution of secondary structural elements, hydrophobicity molecular surface analysis and electrostatic potential analysis. The functionally critical amino acids and ligand- binding site (LBS) of the proteins (modeled) were determined using the COACH program. The molecular model data in cooperation to other pertinent post model analysis data put forward molecular insight to proteolytic activity of serine protease 5, which helps in the clear understanding of procoagulant and anticoagulant characteristics of this natural lead molecule. Our approach was to investigate the octopus venom protein as a whole or a part of their structure that may result in the development of new lead molecule. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

Modeling the binding of fulvic acid by goethite: the speciation of adsorbed FA molecules

NASA Astrophysics Data System (ADS)

Filius, Jeroen D.; Meeussen, Johannes C. L.; Lumsdon, David G.; Hiemstra, Tjisse; van Riemsdijk, Willem H.

2003-04-01

Under natural conditions, the adsorption of ions at the solid-water interface may be strongly influenced by the adsorption of organic matter. In this paper, we describe the adsorption of fulvic acid (FA) by metal(hydr)oxide surfaces with a heterogeneous surface complexation model, the ligand and charge distribution (LCD) model. The model is a self-consistent combination of the nonideal competitive adsorption (NICA) equation and the CD-MUSIC model. The LCD model can describe simultaneously the concentration, pH, and salt dependency of the adsorption with a minimum of only three adjustable parameters. Furthermore, the model predicts the coadsorption of protons accurately for an extended range of conditions. Surface speciation calculations show that almost all hydroxyl groups of the adsorbed FA molecules are involved in outer sphere complexation reactions. The carboxylic groups of the adsorbed FA molecule form inner and outer sphere complexes. Furthermore, part of the carboxylate groups remain noncoordinated and deprotonated.

A theoretical study of the molecular structures and vibrational spectra of the N 2O⋯(HF) 2

NASA Astrophysics Data System (ADS)

de Lima, Nathália B.; Ramos, Mozart N.

2012-01-01

Theoretical calculations using both the MP2 and B3LYP levels of calculation with a 6-311++G(3df,3pd) basis set have been performed to determine stable structures and molecular properties for the H-bonded complexes involving nitrous oxide (N 2O) and two HF molecules. Five complex have been characterized as minima since no imaginary frequency was found. Three complex are predicted to be relatively more stable with binding energies varying from 14 kJ mol -1 to 23 kJ mol -1 after BSSE and ZPE corrections. Our calculations have revealed that the second complexation with HF preferably occurs with the first complexed HF molecule, i.e., forming the X⋯H sbnd F⋯H sbnd F skeleton with X = O or N instead the F sbnd H⋯N sbnd N sbnd O⋯H sbnd F one. As expected, the H sbnd F chemical bonds are increased after complexation due to intermolecular charge transfer from "n" isolated pair of the X atom (X = N, O or F) to the σ ∗ anti-bonding orbital of HF. For the strongly bounded complex, the doubly complexed HF molecule acts as a bridge between the two end molecules while transferring electrons from N 2O to HF. Both possess the same amount of residual charge but with opposite signs. The H sbnd F stretching frequency of the monoprotic acid is shifted downward after complexation whereas its IR intensity is much enhanced. This increase has been adequately interpreted in terms of equilibrium hydrogen charge and charge-flux associated to the H sbnd F stretching using the CCFOM model for infrared intensities. This procedure has also allowed to analyze the new vibrational modes arising upon H-bond formation, especially those associated with the out-of-plane and in-plane HF bending modes, which are pure rotations in the HF isolated molecule.

Transport model of controlled molecular rectifier showing unusual negative differential resistance effect.

PubMed

Granhen, Ewerton Ramos; Reis, Marcos Allan Leite; Souza, Fabrício M; Del Nero, Jordan

2010-12-01

We investigate theoretically the charge accumulated Q in a three-terminal molecular device in the presence of an external electric field. Our approach is based on ab initio Hartree-Fock and density functional theory methodology contained in Gaussian package. Our main finding is a negative differential resistance (NDR) in the charge Q as a function of an external electric field. To explain this NDR effect we apply a phenomenological capacitive model based on a quite general system composed of many localized levels (that can be LUMOs of a molecule) coupled to source and drain. The capacitance accounts for charging effects that can result in Coulomb blockade (CB) in the transport. We show that this CB effect gives rise to a NDR for a suitable set of phenomenological parameters, like tunneling rates and charging energies. The NDR profile obtained in both ab initio and phenomenological methodologies are in close agreement.

Investigation of multi-state charge-storage properties of redox-active organic molecules in silicon-molecular hybrid devices for DRAM and Flash applications

NASA Astrophysics Data System (ADS)

Gowda, Srivardhan Shivappa

Molecular electronics has recently spawned a considerable amount of interest with several molecules possessing charge-conduction and charge-storage properties proposed for use in electronic devices. Hybrid silicon-molecular technology has the promise of augmenting the current silicon technology and provide for a transitional path to future molecule-only technology. The focus of this dissertation work has been on developing a class of hybrid silicon-molecular electronic devices for DRAM and Flash memory applications utilizing redox-active molecules. This work exploits the ability of molecules to store charges with single-electron precision at room temperature. The hybrid devices are fabricated by forming self-assembled monolayers of redox-active molecules on Si and oxide (SiO2 and HfO2) surfaces via formation of covalent linkages. The molecules possess discrete quantum states from which electrons can tunnel to the Si substrate at discrete applied voltages (oxidation process, cell write), leaving behind a positively charged layer of molecules. The reduction (erase) process, which is the process of electrons tunneling back from Si to the molecules, neutralizes the positively charged molecular monolayer. Hybrid silicon-molecular capacitor test structures were electrically characterized with an electrolyte gate using cyclic voltammetry (CyV) and impedance spectroscopy (CV) techniques. The redox voltages, kinetics (write/erase speeds) and charge-retention characteristics were found to be strongly dependent on the Si doping type and densities, and ambient light. It was also determined that the redox energy states in the molecules communicate with the valence band of the Si substrate. This allows tuning of write and read states by modulating minority carriers in n- and p-Si substrates. Ultra-thin dielectric tunnel barriers (SiO2, HfO2) were placed between the molecules and the Si substrate to augment charge-retention for Flash memory applications. The redox response was studied as a function of tunnel oxide thickness, dielectric permittivity and energy barrier, and modified Butler-Volmer expressions were postulated to describe the redox kinetics. The speed vs. retention performance of the devices was improved via asymmetric layered tunnel barriers. The properties of molecules can be tailored by molecular design and synthetic chemistry. In this work, it was demonstrated that an alternate route to tune/enhance the properties of the hybrid device is to engineer the substrate (silicon) component. The molecules were attached to diode surfaces to tune redox voltages and improve charge-retention characteristics. N+ pockets embedded in P-Si well were utilized to obtain multiple states from a two-state molecule. The structure was also employed as a characterization tool in investigating the intrinsic properties of the molecules such as lateral conductivity within the monolayer. Redox molecules were also incorporated on an ultra thin gate-oxide of Si MOSFETs with the intent of studying the interaction of redox states with Si MOSFETs. The discrete molecular states were manifested in the drain current and threshold voltage characteristics of the device. This work demonstrates the multi-state modulation of Si-MOSFETs' drain current via redox-active molecular monolayers. Polymeric films of redox-active molecules were incorporated to improve the charge-density (ON/OFF ratio) and these structures may be employed for multi-state, low-voltage Flash memory applications. The most critical aspect of this research effort is to build a reliable and high density solid state memory technology. To this end, efforts were directed towards replacement of the electrolytic gate, which forms an extremely thin insulating double layer (˜10 nm) at the electrolyte-molecule interface, with a combination of an ultra-thin high-K dielectric layer and a metal gate. Several interesting observations were made in the research approaches towards integration and provided valuable insights into the electrolyte-redox systems. In summary, this work provides fundamental insights into the interaction of redox-energy states with silicon substrate and realistic approaches for exploiting the unique properties of the molecules that may enable solutions for nanoscale high density, low-voltage, long retention and multiple bit memory applications.

Polyelectrolyte properties of single stranded DNA measured using SAXS and single molecule FRET: beyond the wormlike chain model

PubMed Central

Meisburger, Steve P.; Sutton, Julie L.; Chen, Huimin; Pabit, Suzette A.; Kirmizialtin, Serdal; Elber, Ron; Pollack, Lois

2013-01-01

Nucleic acids are highly charged polyelectrolytes that interact strongly with salt ions. Rigid, base-paired regions are successfully described with worm like chain models, but non base-paired single stranded regions have fundamentally different polymer properties because of their greater flexibility. Recently, attention has turned to single stranded nucleic acids due to the growing recognition of their biological importance, as well as the availability of sophisticated experimental techniques sensitive to the conformation of individual molecules. We investigate polyelectrolyte properties of poly(dT), an important and widely studied model system for flexible single stranded nucleic acids, in physiologically important mixed mono- and di-valent salt. We report measurements of the form factor and interparticle interactions using SAXS, end to end distances using smFRET, and number of excess ions using ASAXS. We present a coarse-grained model that accounts for flexibility, excluded volume, and electrostatic interactions in these systems. Predictions of the model are validated against experiment. We also discuss the state of all-atom, explicit solvent Molecular Dynamics simulations of poly(dT), the next step in understanding the complexities of ion interactions with these highly charged and flexible polymers. PMID:23606337

On the orientation of the backbone dipoles in native folds

PubMed Central

Ripoll, Daniel R.; Vila, Jorge A.; Scheraga, Harold A.

2005-01-01

The role of electrostatic interactions in determining the native fold of proteins has been investigated by analyzing the alignment of peptide bond dipole moments with the local electrostatic field generated by the rest of the molecule with and without solvent effects. This alignment was calculated for a set of 112 native proteins by using charges from a gas phase potential. Most of the peptide dipoles in this set of proteins are on average aligned with the electrostatic field. The dipole moments associated with α-helical conformations show the best alignment with the electrostatic field, followed by residues in β-strand conformations. The dipole moments associated with other secondary structure elements are on average better aligned than in randomly generated conformations. The alignment of a dipole with the local electrostatic field depends on both the topology of the native fold and the charge distribution assumed for all of the residues. The influences of (i) solvent effects, (ii) different sets of charges, and (iii) the charge distribution assumed for the whole molecule were examined with a subset of 22 proteins each of which contains <30 ionizable groups. The results show that alternative charge distribution models lead to significant differences among the associated electrostatic fields, whereas the electrostatic field is less sensitive to the particular set of the adopted charges themselves (empirical conformational energy program for peptides or parameters for solvation energy). PMID:15894608

Photoelectron wave function in photoionization: plane wave or Coulomb wave?

PubMed

Gozem, Samer; Gunina, Anastasia O; Ichino, Takatoshi; Osborn, David L; Stanton, John F; Krylov, Anna I

2015-11-19

The calculation of absolute total cross sections requires accurate wave functions of the photoelectron and of the initial and final states of the system. The essential information contained in the latter two can be condensed into a Dyson orbital. We employ correlated Dyson orbitals and test approximate treatments of the photoelectron wave function, that is, plane and Coulomb waves, by comparing computed and experimental photoionization and photodetachment spectra. We find that in anions, a plane wave treatment of the photoelectron provides a good description of photodetachment spectra. For photoionization of neutral atoms or molecules with one heavy atom, the photoelectron wave function must be treated as a Coulomb wave to account for the interaction of the photoelectron with the +1 charge of the ionized core. For larger molecules, the best agreement with experiment is often achieved by using a Coulomb wave with a partial (effective) charge smaller than unity. This likely derives from the fact that the effective charge at the centroid of the Dyson orbital, which serves as the origin of the spherical wave expansion, is smaller than the total charge of a polyatomic cation. The results suggest that accurate molecular photoionization cross sections can be computed with a modified central potential model that accounts for the nonspherical charge distribution of the core by adjusting the charge in the center of the expansion.

Dynamics of two-dimensional monolayer water confined in hydrophobic and charged environments.

PubMed

Kumar, Pradeep; Han, Sungho

2012-09-21

We perform molecular dynamics simulations to study the effect of charged surfaces on the intermediate and long time dynamics of water in nanoconfinements. Here, we use the transferable interaction potential with five points (TIP5P) model of a water molecule confined in both hydrophobic and charged surfaces. For a single molecular layer of water between the surfaces, we find that the temperature dependence of the lateral diffusion constant of water up to very high temperatures remains Arrhenius with a high activation energy. In case of charged surfaces, however, the dynamics of water in the intermediate time regime is drastically modified presumably due to the transient coupling of dipoles of water molecules with electric field fluctuations induced by charges on the confining surfaces. Specifically, the lateral mean square displacements display a distinct super-diffusive behavior at intermediate time scale, defined as the time scale between ballistic and diffusive regimes. This change in the intermediate time-scale dynamics in the charged confinement leads to the enhancement of long-time dynamics as reflected in increasing diffusion constant. We introduce a simple model for a possible explanation of the super-diffusive behavior and find it to be in good agreement with our simulation results. Furthermore, we find that confinement and the surface polarity enhance the low frequency vibration in confinement compared to bulk water. By introducing a new effective length scale of coupling between translational and orientational motions, we find that the length scale increases with the increasing strength of the surface polarity. Further, we calculate the correlation between the diffusion constant and the excess entropy and find a disordering effect of polar surfaces on the structure of water. Finally, we find that the empirical relation between the diffusion constant and the excess entropy holds for a monolayer of water in nanoconfinement.

Human fibrinogen adsorption on positively charged latex particles.

PubMed

Zeliszewska, Paulina; Bratek-Skicki, Anna; Adamczyk, Zbigniew; Cieśla, Michał

2014-09-23

Fibrinogen (Fb) adsorption on positively charged latex particles (average diameter of 800 nm) was studied using the microelectrophoretic and the concentration depletion methods based on AFM imaging. Monolayers on latex were adsorbed from diluted bulk solutions at pH 7.4 and an ionic strength in the range of 10(-3) to 0.15 M where fibrinogen molecules exhibited an average negative charge. The electrophoretic mobility of the latex after controlled fibrinogen adsorption was systematically measured. A monotonic decrease in the electrophoretic mobility of fibrinogen-covered latex was observed for all ionic strengths. The results of these experiments were interpreted according to the three-dimensional electrokinetic model. It was also determined using the concentration depletion method that fibrinogen adsorption was irreversible and the maximum coverage was equal to 0.6 mg m(-2) for ionic strength 10(-3) M and 1.3 mg m(-2) for ionic strength 0.15 M. The increase of the maximum coverage was confirmed by theoretical modeling based on the random sequential adsorption approach. Paradoxically, the maximum coverage of fibrinogen on positively charged latex particles was more than two times lower than the maximum coverage obtained for negative latex particles (3.2 mg m(-2)) at pH 7.4 and ionic strength of 0.15 M. This was interpreted as a result of the side-on adsorption of fibrinogen molecules with their negatively charged core attached to the positively charged latex surface. The stability and acid base properties of fibrinogen monolayers on latex were also determined in pH cycling experiments where it was observed that there were no irreversible conformational changes in the fibrinogen monolayers. Additionally, the zeta potential of monolayers was more positive than the zeta potential of fibrinogen in the bulk, which proves a heterogeneous charge distribution. These experimental data reveal a new, side-on adsorption mechanism of fibrinogen on positively charged surfaces and confirmed the decisive role of electrostatic interactions in this process.

The structure and dipole moment of globular proteins in solution and crystalline states: use of NMR and X-ray databases for the numerical calculation of dipole moment.

PubMed

Takashima, S

2001-04-05

The large dipole moment of globular proteins has been well known because of the detailed studies using dielectric relaxation and electro-optical methods. The search for the origin of these dipolemoments, however, must be based on the detailed knowledge on protein structure with atomic resolutions. At present, we have two sources of information on the structure of protein molecules: (1) x-ray databases obtained in crystalline state; (2) NMR databases obtained in solution state. While x-ray databases consist of only one model, NMR databases, because of the fluctuation of the protein folding in solution, consist of a number of models, thus enabling the computation of dipole moment repeated for all these models. The aim of this work, using these databases, is the detailed investigation on the interdependence between the structure and dipole moment of protein molecules. The dipole moment of protein molecules has roughly two components: one dipole moment is due to surface charges and the other, core dipole moment, is due to polar groups such as N--H and C==O bonds. The computation of surface charge dipole moment consists of two steps: (A) calculation of the pK shifts of charged groups for electrostatic interactions and (B) calculation of the dipole moment using the pK corrected for electrostatic shifts. The dipole moments of several proteins were computed using both NMR and x-ray databases. The dipole moments of these two sets of calculations are, with a few exceptions, in good agreement with one another and also with measured dipole moments.

Exploration of sensing of nitrogen dioxide and ozone molecules using novel TiO2/Stanene heterostructures employing DFT calculations

NASA Astrophysics Data System (ADS)

Abbasi, Amirali; Sardroodi, Jaber Jahanbin

2018-06-01

Based on the density functional theory (DFT) calculations, we explored the sensing capabilities and electronic structures of TiO2/Stanene heterostructures as novel and highly efficient materials for detection of toxic NO2 and O3 molecules in the environment. Studied gas molecules were positioned at different sites and orientations towards the nanocomposite, and the adsorption process was examined based on the most stable structures. We found that both of these molecules are chemically adsorbed on the TiO2/Stanene heterostructures. The calculations of the adsorption energy indicate that the fivefold coordinated titanium sites of the TiO2/Stanene are the most stable sites for the adsorption of NO2 and O3 molecules. The side oxygen atoms of the gas molecules were found to be chemically bonded to these titanium atoms. The adsorption of gas molecules is an exothermic process, and the adsorption on the pristine nanocomposite is more favorable in energy than that on the nitrogen-doped nanocomposite. The effects of van der Waals interactions were taken into account, which indicate the adsorption energies were increased for the most sable configurations. The gas sensing response and charge transfers were analyzed in detail. The pristine nanocomposites have better sensing response than the doped ones. The spin density distribution plots indicate that the magnetization was mainly located over the adsorbed gas molecules. Mulliken charge analysis reveals that both NO2 and O3 molecules behave as charge acceptors, as evidenced by the accumulation of electronic charges on the adsorbed molecules predicted by charge density difference calculations. Our DFT results provide a theoretical basis for an innovative gas sensor system designed from a sensitive TiO2/Stanene heterostructures for efficient detection of harmful air pollutants such as NO2 and O3.

Composition Formulas of Inorganic Compounds in Terms of Cluster Plus Glue Atom Model.

PubMed

Ma, Yanping; Dong, Dandan; Wu, Aimin; Dong, Chuang

2018-01-16

The present paper attempts to identify the molecule-like structural units in inorganic compounds, by applying the so-called "cluster plus glue atom model". This model, originating from metallic glasses and quasi-crystals, describes any structure in terms of a nearest-neighbor cluster and a few outer-shell glue atoms, expressed in the cluster formula [cluster](glue atoms). Similar to the case for normal molecules where the charge transfer occurs within the molecule to meet the commonly known octet electron rule, the octet state is reached after matching the nearest-neighbor cluster with certain outer-shell glue atoms. These kinds of structural units contain information on local atomic configuration, chemical composition, and electron numbers, just as for normal molecules. It is shown that the formulas of typical inorganic compounds, such as fluorides, oxides, and nitrides, satisfy a similar octet electron rule, with the total number of valence electrons per unit formula being multiples of eight.

On energetic prerequisites of attracting electrons

NASA Astrophysics Data System (ADS)

Sundholm, Dage

2014-06-01

The internal reorganization energy and the zero-point vibrational energy (ZPE) of fractionally charged molecules embedded in molecular materials are discussed. The theory for isolated open quantum systems is taken as the starting point. It is shown that for isolated molecules the internal reorganization-energy function and its slope, i.e., the chemical potential of an open molecular system are monotonically decreasing functions with respect to increasing amount of negative excess charge (q) in the range of q = [0, 1]. Calculations of the ZPE for fractionally charged molecules show that the ZPE may have a minimum for fractional occupation. The calculations show that the internal reorganization energy and changes in the ZPE are of the same order of magnitude with different behavior as a function of the excess charge. The sum of the contributions might favor molecules with fractional occupation of the molecular units and partial delocalization of the excess electrons in solid-state materials also when considering Coulomb repulsion between the excess electrons. The fractional electrons are then coherently distributed on many molecules of the solid-state material forming a condensate of attracting electrons, which is crucial for the superconducting state.

On energetic prerequisites of attracting electrons.

PubMed

Sundholm, Dage

2014-06-21

The internal reorganization energy and the zero-point vibrational energy (ZPE) of fractionally charged molecules embedded in molecular materials are discussed. The theory for isolated open quantum systems is taken as the starting point. It is shown that for isolated molecules the internal reorganization-energy function and its slope, i.e., the chemical potential of an open molecular system are monotonically decreasing functions with respect to increasing amount of negative excess charge (q) in the range of q = [0, 1]. Calculations of the ZPE for fractionally charged molecules show that the ZPE may have a minimum for fractional occupation. The calculations show that the internal reorganization energy and changes in the ZPE are of the same order of magnitude with different behavior as a function of the excess charge. The sum of the contributions might favor molecules with fractional occupation of the molecular units and partial delocalization of the excess electrons in solid-state materials also when considering Coulomb repulsion between the excess electrons. The fractional electrons are then coherently distributed on many molecules of the solid-state material forming a condensate of attracting electrons, which is crucial for the superconducting state.

Charge effects on the hindered transport of macromolecules across the endothelial surface glycocalyx layer.

PubMed

Sugihara-Seki, Masako; Akinaga, Takeshi; O-Tani, Hideyuki

2012-01-01

A fluid mechanical and electrostatic model for the transport of solute molecules across the vascular endothelial surface glycocalyx layer (EGL) was developed to study the charge effect on the diffusive and convective transport of the solutes. The solute was assumed to be a spherical particle with a constant surface charge density, and the EGL was represented as an array of periodically arranged circular cylinders of like charge, with a constant surface charge density. By combining the fluid mechanical analyses for the flow around a solute suspended in an electrolyte solution and the electrostatic analyses for the free energy of the interaction between the solute and cylinders based on a mean field theory, we estimated the transport coefficients of the solute across the EGL. Both of diffusive and convective transports are reduced compared to those for an uncharged system, due to the stronger exclusion of the solute that results from the repulsive electrostatic interaction. The model prediction for the reflection coefficient for serum albumin agreed well with experimental observations if the charge density in the EGL is ranged from approximately -10 to -30 mEq/l.

Electronegativity Equalization Method: Parameterization and Validation for Large Sets of Organic, Organohalogene and Organometal Molecule

PubMed Central

Vařeková, Radka Svobodová; Jiroušková, Zuzana; Vaněk, Jakub; Suchomel, Šimon; Koča, Jaroslav

2007-01-01

The Electronegativity Equalization Method (EEM) is a fast approach for charge calculation. A challenging part of the EEM is the parameterization, which is performed using ab initio charges obtained for a set of molecules. The goal of our work was to perform the EEM parameterization for selected sets of organic, organohalogen and organometal molecules. We have performed the most robust parameterization published so far. The EEM parameterization was based on 12 training sets selected from a database of predicted 3D structures (NCI DIS) and from a database of crystallographic structures (CSD). Each set contained from 2000 to 6000 molecules. We have shown that the number of molecules in the training set is very important for quality of the parameters. We have improved EEM parameters (STO-3G MPA charges) for elements that were already parameterized, specifically: C, O, N, H, S, F and Cl. The new parameters provide more accurate charges than those published previously. We have also developed new parameters for elements that were not parameterized yet, specifically for Br, I, Fe and Zn. We have also performed crossover validation of all obtained parameters using all training sets that included relevant elements and confirmed that calculated parameters provide accurate charges.

Modeling solvation effects in real-space and real-time within density functional approaches

NASA Astrophysics Data System (ADS)

Delgado, Alain; Corni, Stefano; Pittalis, Stefano; Rozzi, Carlo Andrea

2015-10-01

The Polarizable Continuum Model (PCM) can be used in conjunction with Density Functional Theory (DFT) and its time-dependent extension (TDDFT) to simulate the electronic and optical properties of molecules and nanoparticles immersed in a dielectric environment, typically liquid solvents. In this contribution, we develop a methodology to account for solvation effects in real-space (and real-time) (TD)DFT calculations. The boundary elements method is used to calculate the solvent reaction potential in terms of the apparent charges that spread over the van der Waals solute surface. In a real-space representation, this potential may exhibit a Coulomb singularity at grid points that are close to the cavity surface. We propose a simple approach to regularize such singularity by using a set of spherical Gaussian functions to distribute the apparent charges. We have implemented the proposed method in the Octopus code and present results for the solvation free energies and solvatochromic shifts for a representative set of organic molecules in water.

Modeling solvation effects in real-space and real-time within density functional approaches

DOE Office of Scientific and Technical Information (OSTI.GOV)

Delgado, Alain; Centro de Aplicaciones Tecnológicas y Desarrollo Nuclear, Calle 30 # 502, 11300 La Habana; Corni, Stefano

2015-10-14

The Polarizable Continuum Model (PCM) can be used in conjunction with Density Functional Theory (DFT) and its time-dependent extension (TDDFT) to simulate the electronic and optical properties of molecules and nanoparticles immersed in a dielectric environment, typically liquid solvents. In this contribution, we develop a methodology to account for solvation effects in real-space (and real-time) (TD)DFT calculations. The boundary elements method is used to calculate the solvent reaction potential in terms of the apparent charges that spread over the van der Waals solute surface. In a real-space representation, this potential may exhibit a Coulomb singularity at grid points that aremore » close to the cavity surface. We propose a simple approach to regularize such singularity by using a set of spherical Gaussian functions to distribute the apparent charges. We have implemented the proposed method in the OCTOPUS code and present results for the solvation free energies and solvatochromic shifts for a representative set of organic molecules in water.« less

Simultaneous ion and neutral evaporation in aqueous nanodrops: experiment, theory, and molecular dynamics simulations.

PubMed

Higashi, Hidenori; Tokumi, Takuya; Hogan, Christopher J; Suda, Hiroshi; Seto, Takafumi; Otani, Yoshio

2015-06-28

We use a combination of tandem ion mobility spectrometry (IMS-IMS, with differential mobility analyzers), molecular dynamics (MD) simulations, and analytical models to examine both neutral solvent (H2O) and ion (solvated Na(+)) evaporation from aqueous sodium chloride nanodrops. For experiments, nanodrops were produced via electrospray ionization (ESI) of an aqueous sodium chloride solution. Two nanodrops were examined in MD simulations: a 2500 water molecule nanodrop with 68 Na(+) and 60 Cl(-) ions (an initial net charge of z = +8), and (2) a 1000 water molecule nanodrop with 65 Na(+) and 60 Cl(-) ions (an initial net charge of z = +5). Specifically, we used MD simulations to examine the validity of a model for the neutral evaporation rate incorporating both the Kelvin (surface curvature) and Thomson (electrostatic) influences, while both MD simulations and experimental measurements were compared to predictions of the ion evaporation rate equation of Labowsky et al. [Anal. Chim. Acta, 2000, 406, 105-118]. Within a single fit parameter, we find excellent agreement between simulated and modeled neutral evaporation rates for nanodrops with solute volume fractions below 0.30. Similarly, MD simulation inferred ion evaporation rates are in excellent agreement with predictions based on the Labowsky et al. equation. Measurements of the sizes and charge states of ESI generated NaCl clusters suggest that the charge states of these clusters are governed by ion evaporation, however, ion evaporation appears to have occurred with lower activation energies in experiments than was anticipated based on analytical calculations as well as MD simulations. Several possible reasons for this discrepancy are discussed.

Critical Dipole Length for the Wetting Transition Due to Collective Water-dipoles Interactions

PubMed Central

Wang, Chunlei; Zhou, Bo; Tu, Yusong; Duan, Manyi; Xiu, Peng; Li, Jingye; Fang, Haiping

2012-01-01

The wetting behavior of water on the solid surfaces is fundamental to various physical, chemical and biological processes. Conventionally, the surface with charges or charge dipoles is hydrophilic, whereas the non-polar surface is hydrophobic though some exceptions were recently reported. Using molecular dynamics simulations, we show that there is a critical length of the charge dipoles on the solid surface. The solid surface still exhibited hydrophobic behavior when the dipole length was less than the critical value, indicating that the water molecules on the solid surface seemed not “feel” attractive interactions from the charge dipoles on the solid surface. Those unexpected observations result from the collective interactions between the water molecules and charge dipoles on the solid surface, where the steric exclusion effect between water molecules greatly reduces the water-dipole interactions. Remarkably, the steric exclusion effect is also important for surfaces with charge dipole lengths greater than this critical length. PMID:22496954

Long-lived charge carrier generation in ordered films of a covalent perylenediimide–diketopyrrolopyrrole–perylenediimide molecule

DOE PAGES

Hartnett, Patrick E.; Dyar, Scott M.; Margulies, Eric A.; ...

2015-07-31

The photophysics of a covalently linked perylenediimide–diketopyrrolopyrrole–perylenediimide acceptor–donor–acceptor molecule (PDI–DPP–PDI, 1) were investigated and found to be markedly different in solution versus in unannealed and solvent annealed films. Photoexcitation of 1 in toluene results in quantitative charge separation in τ = 3.1 ± 0.2 ps, with charge recombination in τ = 340 ± 10 ps, while in unannealed/disordered films of 1, charge separation occurs in τ < 250 fs, while charge recombination displays a multiexponential decay in ~6 ns. The absence of long-lived, charge separation in the disordered film suggests that few free charge carriers are generated. In contrast, uponmore » CH₂Cl₂ vapor annealing films of 1, grazing-incidence X-ray scattering shows that the molecules form a more ordered structure. Photoexcitation of the ordered films results in initial formation of a spin-correlated radical ion pair (electron–hole pair) as indicated by magnetic field effects on the formation of free charge carriers which live for ~4 μs. This result has significant implications for the design of organic solar cells based on covalent donor–acceptor systems and shows that long-lived, charge-separated states can be achieved by controlling intramolecular charge separation dynamics in well-ordered systems.« less

Multiply Reduced Oligofluorenes: Their Nature and Pairing with THF-Solvated Sodium Ions

DOE PAGES

Wu, Qin; Zaikowski, Lori; Kaur, Parmeet; ...

2016-07-01

Conjugated oligofluorenes are chemically reduced up to five charges in tetrahydrofuran solvent and confirmed with clear spectroscopic evidence. Stimulated by these experimental results, we have conducted a comprehensive computational study of the electronic structure and the solvation structure of representative oligofluorene anions with a focus on the pairing between sodium ions and these multianions. In addition, using density functional theory (DFT) methods and a solvation model of both explicit solvent molecules and implicit polarizable continuum, we first elucidate the structure of tightly solvated free sodium ions, and then explore the pairing of sodium ions either in contact with reduced oligofluorenesmore » or as solvent-separated ion pairs. Computed time-dependent-DFT absorption spectra are compared with experiments to assign the dominant ion pairing structure for each multianion. Computed ion pair binding energies further support our assignment. Lastly, the availability of different length and reducing level of oligofluorenes enables us to investigate the effects of total charge and charge density on the binding with sodium ions, and our results suggest both factors play important roles in ion pairing for small molecules. However, as the oligofluorene size grows, its charge density determines the binding strength with the sodium ion.« less

Electronic structure and charge transfer excited states of endohedral fullerene containing electron donoracceptor complexes utilized in organic photovoltaics

NASA Astrophysics Data System (ADS)

Amerikheirabadi, Fatemeh

Organic Donor-Acceptor complexes form the main component of the organic photovoltaic devices (OPVs). The open circuit voltage of OPVs is directly related to the charge transfer excited state energies of these complexes. Currently a large number of different molecular complexes are being tested for their efficiency in photovoltaic devices. In this work, density functional theory as implemented in the NRLMOL code is used to investigate the electronic structure and related properties of these donor-acceptor complexes. The charge transfer excitation energies are calculated using the perturbative delta self-consistent field method recently developed in our group as the standard time dependent density functional approaches fail to accurately provide them. The model photovoltaics systems analyzed are as follows: Sc3N C 80--ZnTPP, Y3 N C80-- ZnTPP and Sc3 N C80-- ZnPc. In addition, a thorough analysis of the isolated donor and acceptor molecules is also provided. The studied acceptors are chosen from a class of fullerenes named trimetallic nitride endohedral fullerenes. These molecules have shown to possess advantages as acceptors such as long lifetimes of the charge-separated states.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wu, Qin; Zaikowski, Lori; Kaur, Parmeet

Conjugated oligofluorenes are chemically reduced up to five charges in tetrahydrofuran solvent and confirmed with clear spectroscopic evidence. Stimulated by these experimental results, we have conducted a comprehensive computational study of the electronic structure and the solvation structure of representative oligofluorene anions with a focus on the pairing between sodium ions and these multianions. In addition, using density functional theory (DFT) methods and a solvation model of both explicit solvent molecules and implicit polarizable continuum, we first elucidate the structure of tightly solvated free sodium ions, and then explore the pairing of sodium ions either in contact with reduced oligofluorenesmore » or as solvent-separated ion pairs. Computed time-dependent-DFT absorption spectra are compared with experiments to assign the dominant ion pairing structure for each multianion. Computed ion pair binding energies further support our assignment. Lastly, the availability of different length and reducing level of oligofluorenes enables us to investigate the effects of total charge and charge density on the binding with sodium ions, and our results suggest both factors play important roles in ion pairing for small molecules. However, as the oligofluorene size grows, its charge density determines the binding strength with the sodium ion.« less

A spherical electron cloud hopping model for studying product branching ratios of dissociative recombination.

PubMed

Yu, Hua-Gen

2008-05-21

A spherical electron cloud hopping (SECH) model is proposed to study the product branching ratios of dissociative recombination (DR) of polyatomic systems. In this model, the fast electron-captured process is treated as an instantaneous hopping of a cloud of uniform spherical fractional point charges onto a target M+q ion (or molecule). The sum of point charges (-1) simulates the incident electron. The sphere radius is determined by a critical distance (Rc eM) between the incoming electron (e-) and the target, at which the potential energy of the e(-)-M+q system is equal to that of the electron-captured molecule M+q(-1) in a symmetry-allowed electronic state with the same structure as M(+q). During the hopping procedure, the excess energies of electron association reaction are dispersed in the kinetic energies of M+q(-1) atoms to conserve total energy. The kinetic energies are adjusted by linearly adding atomic momenta in the direction of driving forces induced by the scattering electron. The nuclear dynamics of the resultant M+q(-1) molecule are studied by using a direct ab initio dynamics method on the adiabatic potential energy surface of M+q(-1), or together with extra adiabatic surface(s) of M+q(-1). For the latter case, the "fewest switches" surface hopping algorithm of Tully was adapted to deal with the nonadiabaticity in trajectory propagations. The SECH model has been applied to study the DR of both CH+ and H3O+(H2O)2. The theoretical results are consistent with the experiment. It was found that water molecules play an important role in determining the product branching ratios of the molecular cluster ion.

Understanding the Charge Transfer at the Interface of Electron Donors and Acceptors: TTF–TCNQ as an Example

DOE Office of Scientific and Technical Information (OSTI.GOV)

Park, Changwon; Atalla, Viktor; Smith, Sean

Charge transfer between an electron donor and an electron acceptor is widely accepted as being independent of their relative configurations if the interaction between them is weak; however, the limit of this concept for an interacting system has not yet been well established. Our study of prototypical electron donor–acceptor molecules, tetrathiafulvalene–tetracyanoquinodimethane, using density functional theory based on an advanced functional, clearly demonstrates that for interacting molecules, their configurational arrangement is as important as their individual electronic properties in the asymptotic limit to determine the charge transfer direction. For the first time, we demonstrate that by changing their relative orientation, onemore » can reverse the charge transfer direction of the pair, causing the molecules to exchange roles as donor and acceptor. In conclusion, our theory has important implications for understanding the interfacial charge-transfer mechanism of hybrid systems and related phenomena.« less

Understanding the Charge Transfer at the Interface of Electron Donors and Acceptors: TTF–TCNQ as an Example

DOE PAGES

Park, Changwon; Atalla, Viktor; Smith, Sean; ...

2017-06-16

Charge transfer between an electron donor and an electron acceptor is widely accepted as being independent of their relative configurations if the interaction between them is weak; however, the limit of this concept for an interacting system has not yet been well established. Our study of prototypical electron donor–acceptor molecules, tetrathiafulvalene–tetracyanoquinodimethane, using density functional theory based on an advanced functional, clearly demonstrates that for interacting molecules, their configurational arrangement is as important as their individual electronic properties in the asymptotic limit to determine the charge transfer direction. For the first time, we demonstrate that by changing their relative orientation, onemore » can reverse the charge transfer direction of the pair, causing the molecules to exchange roles as donor and acceptor. In conclusion, our theory has important implications for understanding the interfacial charge-transfer mechanism of hybrid systems and related phenomena.« less

Analysis of the interplay among charge, hydration and shape of proteins through the modeling of their CZE mobility data.

PubMed

Piaggio, Maria V; Peirotti, Marta B; Deiber, Julio A

2009-07-01

Electrophoretic mobility data of four proteins are analyzed and interpreted through a physicochemical CZE model, which provides estimates of quantities like equivalent hydrodynamic radius (size), effective charge number, shape orientation factor, hydration, actual pK values of ionizing groups, and pH near molecule, among others. Protein friction coefficients are simulated through the creeping flow theory of prolate spheroidal particles. The modeling of the effective electrophoretic mobility of proteins requires consideration of hydrodynamic size and shape coupled to hydration and effective charge. The model proposed predicts native protein hydration within the range of values obtained experimentally from other techniques. Therefore, this model provides consistently other physicochemical properties such as average friction and diffusion coefficients and packing fractal dimension. As the pH varies from native conditions to those that are denaturing the protein, hydration and packing fractal dimension change substantially. Needs for further research are also discussed and proposed.

Coherent electron emission beyond Young-type interference from diatomic molecules

NASA Astrophysics Data System (ADS)

Agueny, H.; Makhoute, A.; Dubois, A.; Hansen, J. P.

2016-01-01

It has been known for more than 15 years that the differential cross section of electrons emitted from diatomic molecules during interaction with energetic charged particles oscillates as a function of electron momentum. The origin of the phenomenon is two-center interference, which naturally relates it back to the Young double-slit experiment. In addition to a characteristic frequency which can be described by lowest-order perturbation theories, the observation and origin of higher-order harmonics of the basic oscillation frequency has been much discussed. Here, we show that high harmonics of the fundamental Young-type oscillation frequency observed in electron spectra in fast ion-molecule collisions can be clearly exposed in numerical solutions of the time-dependent Schrödinger equation within a one-dimensional model. Momentum distribution of the ejected electron is analyzed and shows that the phenomenon emerges when the charged particle beam collides with diatomic molecules with substantial large internuclear distance. Frequency spectra from nonperturbative calculations for electron emission from Rb2+ and Cs2+ exhibit a pronounced high-order oscillation in contrast to similar close-coupling calculations performed on H2 targets. The electron emission from these heavy molecules contains second- and third-order harmonics which are fully reproduced in an analytic model based on the Born series. Extending to triatomic molecular targets displays an increased range of harmonics. This suggests that electron emission spectra from new experiments on heavy diatomic and linear polyatomic molecular targets may provide a unique insight into competing coherent emission mechanisms and their relative strength.

Bimolecular recombination quenching in Langmuir Blodgett multilayers

NASA Astrophysics Data System (ADS)

Elliott, J. E.; Jeong, I. S.; Scott, K.; Donovan, K. J.; Wilson, E. G.

2000-11-01

A model is developed that describes bimolecular recombination of photogenerated carriers in two dimensional systems. Carriers are free to diffuse in two dimensions and undergo bimolecular recombination, while drifting under the influence of an electric field in the third dimension. The model describes a competition between carrier loss due to transiting and loss due to bimolecular recombination. This model of recombination quenching is then used to obtain information on microscopic parameters associated with photogeneration efficiency and charge transport in organic quantum wells formed from Langmuir Blodgett films of conjugated molecules. The ratio of the intralayer to interlayer tunneling rates is found along with the quantum efficiency for photocarrier generation for two bis-phthalocyanine amphiphilic molecules.

Tuning charge and correlation effects for a single molecule on a graphene device

DOE PAGES

Wickenburg, Sebastian; Lu, Jiong; Lischner, Johannes; ...

2016-11-25

The ability to understand and control the electronic properties of individual molecules in a device environment is crucial for developing future technologies at the nanometre scale and below. Achieving this, however, requires the creation of three-terminal devices that allow single molecules to be both gated and imaged at the atomic scale. We have accomplished this by integrating a graphene field effect transistor with a scanning tunnelling microscope, thus allowing gate-controlled charging and spectroscopic interrogation of individual tetrafluoro-tetracyanoquinodimethane molecules. We observe a non-rigid shift in the molecule’s lowest unoccupied molecular orbital energy (relative to the Dirac point) as a function ofmore » gate voltage due to graphene polarization effects. Our results show that electron–electron interactions play an important role in how molecular energy levels align to the graphene Dirac point, and may significantly influence charge transport through individual molecules incorporated in graphene-based nanodevices.« less

Effect of charged and excited states on the decomposition of 1,1-diamino-2,2-dinitroethylene molecules

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kimmel, Anna V.; Sushko, Peter V.; Shluger, Alexander L.

The authors have calculated the electronic structure of individual 1,1-diamino-2,2-dinitroethylene molecules (FOX-7) in the gas phase by means of density functional theory with the hybrid B3LYP functional and 6-31+G(d,p) basis set and considered their dissociation pathways. Positively and negatively charged states as well as the lowest excited states of the molecule were simulated. They found that charging and excitation can not only reduce the activation barriers for decomposition reactions but also change the dominating chemistry from endo- to exothermic type. In particular, they found that there are two competing primary initiation mechanisms of FOX-7 decomposition: C-NO{sub 2} bond fission andmore » C-NO{sub 2} to CONO isomerization. Electronic excitation or charging of FOX-7 disfavors CONO formation and, thus, terminates this channel of decomposition. However, if CONO is formed from the neutral FOX-7 molecule, charge trapping and/or excitation results in spontaneous splitting of an NO group accompanied by the energy release. Intramolecular hydrogen transfer is found to be a rare event in FOX-7 unless free electrons are available in the vicinity of the molecule, in which case HONO formation is a feasible exothermic reaction with a relatively low energy barrier. The effect of charged and excited states on other possible reactions is also studied. Implications of the obtained results to FOX-7 decomposition in condensed state are discussed.« less

Exciton-phonon coupling in diindenoperylene thin films

NASA Astrophysics Data System (ADS)

Heinemeyer, U.; Scholz, R.; Gisslén, L.; Alonso, M. I.; Ossó, J. O.; Garriga, M.; Hinderhofer, A.; Kytka, M.; Kowarik, S.; Gerlach, A.; Schreiber, F.

2008-08-01

We investigate exciton-phonon coupling and exciton transfer in diindenoperylene (DIP) thin films on oxidized Si substrates by analyzing the dielectric function determined by variable-angle spectroscopic ellipsometry. Since the molecules in the thin-film phase form crystallites that are randomly oriented azimuthally and highly oriented along the surface normal, DIP films exhibit strongly anisotropic optical properties with uniaxial symmetry. This anisotropy can be determined by multiple sample analysis. The thin-film spectrum is compared with a monomer spectrum in solution, which reveals similar vibronic subbands and a Huang-Rhys parameter of S≈0.87 for an effective internal vibration at ℏωeff=0.17eV . However, employing these parameters the observed dielectric function of the DIP films cannot be described by a pure Frenkel exciton model, and the inclusion of charge-transfer (CT) states becomes mandatory. A model Hamiltonian is parametrized with density-functional theory calculations of single DIP molecules and molecule pairs in the stacking geometry of the thin-film phase, revealing the vibronic coupling constants of DIP in its excited and charged states together with electron and hole transfer integrals along the stack. From a fit of the model calculation to the observed dielectric tensor, we find the lowest CT transition E00CT at 0.26±0.05eV above the neutral molecular excitation energy E00F , which is an important parameter for device applications.

Polarizable atomic multipole-based force field for DOPC and POPE membrane lipids

NASA Astrophysics Data System (ADS)

Chu, Huiying; Peng, Xiangda; Li, Yan; Zhang, Yuebin; Min, Hanyi; Li, Guohui

2018-04-01

A polarizable atomic multipole-based force field for the membrane bilayer models 1,2-dioleoyl-phosphocholine (DOPC) and 1-palmitoyl-2-oleoyl-phosphatidylethanolamine (POPE) has been developed. The force field adopts the same framework as the Atomic Multipole Optimized Energetics for Biomolecular Applications (AMOEBA) model, in which the charge distribution of each atom is represented by the permanent atomic monopole, dipole and quadrupole moments. Many-body polarization including the inter- and intra-molecular polarization is modelled in a consistent manner with distributed atomic polarizabilities. The van der Waals parameters were first transferred from existing AMOEBA parameters for small organic molecules and then optimised by fitting to ab initio intermolecular interaction energies between models and a water molecule. Molecular dynamics simulations of the two aqueous DOPC and POPE membrane bilayer systems, consisting of 72 model molecules, were then carried out to validate the force field parameters. Membrane width, area per lipid, volume per lipid, deuterium order parameters, electron density profile, etc. were consistent with experimental values.

Multiphasic modeling of charged solute transport across articular cartilage: Application of multi-zone finite-bath model.

PubMed

Arbabi, Vahid; Pouran, Behdad; Weinans, Harrie; Zadpoor, Amir A

2016-06-14

Charged and uncharged solutes penetrate through cartilage to maintain the metabolic function of chondrocytes and to possibly restore or further breakdown the cartilage tissue in different stages of osteoarthritis. In this study the transport of charged solutes across the various zones of cartilage was quantified, taken into account the physicochemical interactions between the solute and the cartilage constituents. A multiphasic finite-bath finite element (FE) model was developed to simulate equine cartilage diffusion experiments that used a negatively charged contrast agent (ioxaglate) in combination with serial micro-computed tomography (micro-CT) to measure the diffusion. By comparing the FE model with the experimental data both the diffusion coefficient of ioxaglate and the fixed charge density (FCD) were obtained. In the multiphasic model, cartilage was divided into multiple (three) zones to help understand how diffusion coefficient and FCD vary across cartilage thickness. The direct effects of charged solute-FCD interaction on diffusion were investigated by comparing the diffusion coefficients derived from the multiphasic and biphasic-solute models. We found a relationship between the FCD obtained by the multiphasic model and ioxaglate partitioning obtained from micro-CT experiments. Using our multi-zone multiphasic model, diffusion coefficient of the superficial zone was up to ten-fold higher than that of the middle zone, while the FCD of the middle zone was up to almost two-fold higher than that of the superficial zone. In conclusion, the developed finite-bath multiphasic model provides us with a non-destructive method by which we could obtain both diffusion coefficient and FCD of different cartilage zones. The outcomes of the current work will also help understand how charge of the bath affects the diffusion of a charged molecule and also predict the diffusion behavior of a charged solute across articular cartilage. Copyright © 2016 Elsevier Ltd. All rights reserved.

Formation and fragmentation of quadruply charged molecular ions by intense femtosecond laser pulses.

PubMed

Yatsuhashi, Tomoyuki; Nakashima, Nobuaki

2010-07-22

We investigated the formation and fragmentation of multiply charged molecular ions of several aromatic molecules by intense nonresonant femtosecond laser pulses of 1.4 mum with a 130 fs pulse duration (up to 2 x 10(14) W cm(-2)). Quadruply charged states were produced for 2,3-benzofluorene and triphenylene molecular ion in large abundance, whereas naphthalene and 1,1'-binaphthyl resulted only in up to triply charged molecular ions. The laser wavelength was nonresonant with regard to the electronic transitions of the neutral molecules, and the degree of fragmentation was strongly correlated with the absorption of the singly charged cation radical. Little fragmentation was observed for naphthalene (off-resonant with cation), whereas heavy fragmentation was observed in the case of 1,1'-binaphthyl (resonant with cation). The degree of H(2) (2H) and 2H(2) (4H) elimination from molecular ions increased as the charge states increased in all the molecules examined. A striking difference was found between triply and quadruply charged 2,3-benzofluorene: significant suppression of molecular ions with loss of odd number of hydrogen was observed in the quadruply charged ions. The Coulomb explosion of protons in the quadruply charged state and succeeding fragmentation resulted in the formation of triply charged molecular ions with an odd number of hydrogens. The hydrogen elimination mechanism in the highly charged state is discussed.

Conformational, spectroscopic and nonlinear optical properties of biologically active N,N-dimethyltryptamine molecule: A theoretical study

NASA Astrophysics Data System (ADS)

Öner, Nazmiye; Tamer, Ömer; Avcı, Davut; Atalay, Yusuf

2014-12-01

The effective psychoactive properties of N,N-dimethyltryptamine (DMT) known as the near-death molecule have encouraged the imagination of many research disciplines for several decades. Although there is no theoretical study, a number of paper composed by experimental techniques have been reported for DMT molecule. In this study, the molecular modeling of DMT was carried out using B3LYP and HSEh1PBE levels of density functional theory (DFT). Our calculations showed that the energy gap between HOMO and LUMO is low, demonstrating that DMT is a biologically active molecule. Large hyperconjugation interaction energies imply that molecular charge transfer occurs in DMT. Moreover, NLO analysis indicates that DMT can be used an effective NLO material.

Nuclear Fusion Rate Study of a Muonic Molecule via Nuclear Threshold Resonances

NASA Astrophysics Data System (ADS)

Faghihi, F.; Eskandari, M. R.

This work follows our previous calculations of the ground state binding energy, size, and the effective nuclear charge of the muonic T3 molecule, using the Born-Oppenheimer adiabatic approximation. In our past articles, we showed that the system possesses two minimum positions, the first one at the muonic distance and the second at the atomic distance. Also, the symmetric planner vibrational model assumed between the two minima and the approximated potential were calculated. Following from the previous studies, we now calculate the fusion rate of the T3 muonic molecule according to the overlap integral of the resonance nuclear compound nucleus and the molecular wave functions.

Molecular charge distribution and dispersion of electronic states in the contact layer between pentacene and Cu(119) and beyond

NASA Astrophysics Data System (ADS)

Annese, E.; Fujii, J.; Baldacchini, C.; Zhou, B.; Viol, C. E.; Vobornik, I.; Betti, M. G.; Rossi, G.

2008-05-01

The interaction of pentacene molecules in contact with the Cu(119) stepped surface has been directly imaged by scanning tunneling microscopy and analyzed by angle resolved photoemission spectroscopy. Interacting molecules, which are in contact with copper, generate dispersive electronic states associated with a perturbed electron charge density distribution of the molecular orbitals. In contrast, the electron charge density of molecules of the pentacene on top of the first layer, which is not in direct contact with the Cu surface, shows an intramolecular structure very similar to that of the free molecule. Our results indicate that the delocalization of the molecular states in the pentacene/Cu system is confined to the very first molecular layer at the interface.

Electronic structure and partial charge distribution of doxorubicin under different molecular environments

NASA Astrophysics Data System (ADS)

Poudel, Lokendra

Doxorubicin (trade name Adriamycin, abbreviated DOX) is a well-known an- thracyclic chemotherapeutic used in treating a variety of cancers including acute leukemia, lymphoma, multiple myeloma, and a range of stomach, lung, bladder, bone, breast, and ovarian cancers. The purpose of the present work is to study electronic structure, partial charge distribution and interaction energy of DOX under different environments. It provides a framework for better understanding of bioactivity of DOX with DNA. While in this work, we focus on DOX -- DNA interactions; the obtained knowledge could be translated to other drug -- target interactions or biomolecular interactions. The electronic structure and partial charge distribution of DOX in three dierent molecular environments: isolated, solvated, and intercalated into a DNA complex,were studied by rst principles density functional methods. It is shown that the addition of solvating water molecules to DOX and the proximity and interaction with DNA has a signicant impact on the electronic structure as well as the partial charge distribution. The calculated total partial charges for DOX in the three models are 0.0, +0.123 and -0.06 electrons for the isolated, solvated, and intercalated state, respectively. Furthermore, by using the more accurate ab initio partial charge values on every atom in the models, signicant improvement in estimating the DOX-DNA interaction energy is obtained in conjunction with the NAnoscale Molecular Dynamics (NAMD) code. The electronic structure of the DOX-DNA is further elucidated by resolving the total density of states (TDOS) into dierent functional groups of DOX, DNA, water, co-crystallized Spermine molecule, and Na ions. The surface partial charge distribution in the DOX-DNA is calculated and displayed graphically. We conclude that the presence of the solvent as well as the details of the interaction geometry matter greatly in the determination of the stability of the DOX complexion. Ab initio calculations on realistic models are an important step towards a more accurate description of biomolecular interaction and in the eventual understanding of long-range interactions in biomolecular systems.

Performing the Millikan experiment at the molecular scale: Determination of atomic Millikan-Thomson charges by computationally measuring atomic forces.

PubMed

Rogers, T Ryan; Wang, Feng

2017-10-28

An atomic version of the Millikan oil drop experiment is performed computationally. It is shown that for planar molecules, the atomic version of the Millikan experiment can be used to define an atomic partial charge that is free from charge flow contributions. We refer to this charge as the Millikan-Thomson (MT) charge. Since the MT charge is directly proportional to the atomic forces under a uniform electric field, it is the most relevant charge for force field developments. The MT charge shows good stability with respect to different choices of the basis set. In addition, the MT charge can be easily calculated even at post-Hartree-Fock levels of theory. With the MT charge, it is shown that for a planar water dimer, the charge transfer from the proton acceptor to the proton donor is about -0.052 e. While both planar hydrated cations and anions show signs of charge transfer, anions show a much more significant charge transfer to the hydration water than the corresponding cations. It might be important to explicitly model the ion charge transfer to water in a force field at least for the anions.

Spin dynamics in helical molecules with nonlinear interactions

NASA Astrophysics Data System (ADS)

Díaz, E.; Albares, P.; Estévez, P. G.; Cerveró, J. M.; Gaul, C.; Diez, E.; Domínguez-Adame, F.

2018-04-01

It is widely admitted that the helical conformation of certain chiral molecules may induce a sizable spin selectivity observed in experiments. Spin selectivity arises as a result of the interplay between a helicity-induced spin–orbit coupling (SOC) and electric dipole fields in the molecule. From the theoretical point of view, different phenomena might affect the spin dynamics in helical molecules, such as quantum dephasing, dissipation and the role of metallic contacts. With a few exceptions, previous studies usually neglect the local deformation of the molecule about the carrier, but this assumption seems unrealistic to describe charge transport in molecular systems. We introduce an effective model describing the electron spin dynamics in a deformable helical molecule with weak SOC. We find that the electron–lattice interaction allows the formation of stable solitons such as bright solitons with well defined spin projection onto the molecule axis. We present a thorough study of these bright solitons and analyze their possible impact on the spin dynamics in deformable helical molecules.

On energetic prerequisites of attracting electrons

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sundholm, Dage

The internal reorganization energy and the zero-point vibrational energy (ZPE) of fractionally charged molecules embedded in molecular materials are discussed. The theory for isolated open quantum systems is taken as the starting point. It is shown that for isolated molecules the internal reorganization-energy function and its slope, i.e., the chemical potential of an open molecular system are monotonically decreasing functions with respect to increasing amount of negative excess charge (q) in the range of q = [0, 1]. Calculations of the ZPE for fractionally charged molecules show that the ZPE may have a minimum for fractional occupation. The calculations showmore » that the internal reorganization energy and changes in the ZPE are of the same order of magnitude with different behavior as a function of the excess charge. The sum of the contributions might favor molecules with fractional occupation of the molecular units and partial delocalization of the excess electrons in solid-state materials also when considering Coulomb repulsion between the excess electrons. The fractional electrons are then coherently distributed on many molecules of the solid-state material forming a condensate of attracting electrons, which is crucial for the superconducting state.« less

Reshaping and linking of molecules in ion-pair traps

NASA Astrophysics Data System (ADS)

Cochrane, Bryce; Naumkin, Fedor Y.

2016-01-01

A series of insertion complexes of small molecules trapped between alkali-halide counter-ions are investigated ab initio. The molecular shape is altered inside the complexes and varies in corresponding anions. Stabilities and charge distributions are investigated. Strong charge-transfer in the alkali-halide component effectively through the almost neutral molecule results in very large dipole moments. The most stable species is used to construct a dimer significantly bound via dipole-dipole interaction. Another complex with two alkali-halide diatoms trapping the molecule represents a unit of corresponding longer oligomer. This completes the array of systems with the molecule effectively in ion-pair, ion-dipole, dipole-pair electric fields.

Influence of thermocleavable functionality on organic field-effect transistor performance of small molecules

NASA Astrophysics Data System (ADS)

Mahale, Rajashree Y.; Dharmapurikar, Satej S.; Chini, Mrinmoy Kumar; Venugopalan, Vijay

2017-06-01

Diketopyrrolopyrrole based donor-acceptor-donor conjugated small molecules using ethylene dioxythiophene as a donor was synthesized. Electron deficient diketopyrrolopyrrole unit was substituted with thermocleavable (tert-butyl acetate) side chains. The thermal treatment of the molecules at 160 °C eliminated the tert-butyl ester group results in the formation of corresponding acid. Optical and theoretical studies revealed that the molecules adopted a change in molecular arrangement after thermolysis. The conjugated small molecules possessed p-channel charge transport characteristics in organic field effect transistors. The charge carrier mobility was increased after thermolysis of tert-butyl ester group to 5.07 × 10-5 cm2/V s.

Ground-State Charge-Density Distribution in a Crystal of the Luminescent ortho-Phenylenediboronic Acid Complex with 8-Hydroxyquinoline.

PubMed

Jarzembska, Katarzyna N; Kamiński, Radosław; Durka, Krzysztof; Woźniak, Krzysztof

2018-05-10

This contribution is devoted to the first electron density studies of a luminescent oxyquinolinato boron complex in the solid state. ortho-Phenylenediboronic acid mixed with 8-hydroxyquinoline in dioxane forms high-quality single crystals via slow solvent evaporation, which allows successful high resolution data collection (sin θ/λ = 1.2 Å -1 ) and charge density distribution modeling. Particular attention has been paid to the boron-oxygen fragment connecting the two parts of the complex, and to the solvent species exhibiting anharmonic thermal motion. The experiment and theory compared rather well in terms of atomic charges and volumes, except for the boron centers. Boron atoms, as expected, constitute the most electron-deficient species in the complex molecule, whereas the neighboring oxygen and carbon atoms are the most significantly negatively charged ones. This part of the molecule appears to be very much involved in the charge transfer occurring between the acid fragment and oxyquinoline moiety leading to the observed fluorescence, as supported by the time-dependent density functional theory (TDDFT) results and the generated transition density maps. TDDFT calculations indicated that p-type atomic orbitals contributing to the HOMO-1, HOMO, and LUMO play the major role in the lowest energy transitions, and enabled further comparison with the charge density features, which is discussed in details. Furthermore, the results confirmed the known fact the Q ligand character is most important for the spectroscopic properties of this class of complexes.

Photoelectron wave function in photoionization: Plane wave or Coulomb wave? [Does photoionization of neutral targets produce Coulomb or plane waves?

DOE PAGES

Gozem, Samer; Gunina, Anastasia O.; Ichino, Takatoshi; ...

2015-10-28

The calculation of absolute total cross sections requires accurate wave functions of the photoelectron and of the initial and final states of the system. The essential information contained in the latter two can be condensed into a Dyson orbital. We employ correlated Dyson orbitals and test approximate treatments of the photoelectron wave function, that is, plane and Coulomb waves, by comparing computed and experimental photoionization and photodetachment spectra. We find that in anions, a plane wave treatment of the photoelectron provides a good description of photodetachment spectra. For photoionization of neutral atoms or molecules with one heavy atom, the photoelectronmore » wave function must be treated as a Coulomb wave to account for the interaction of the photoelectron with the +1 charge of the ionized core. For larger molecules, the best agreement with experiment is often achieved by using a Coulomb wave with a partial (effective) charge smaller than unity. This likely derives from the fact that the effective charge at the centroid of the Dyson orbital, which serves as the origin of the spherical wave expansion, is smaller than the total charge of a polyatomic cation. Finally, the results suggest that accurate molecular photoionization cross sections can be computed with a modified central potential model that accounts for the nonspherical charge distribution of the core by adjusting the charge in the center of the expansion.« less

Generalized image charge solvation model for electrostatic interactions in molecular dynamics simulations of aqueous solutions

PubMed Central

Deng, Shaozhong; Xue, Changfeng; Baumketner, Andriy; Jacobs, Donald; Cai, Wei

2013-01-01

This paper extends the image charge solvation model (ICSM) [J. Chem. Phys. 131, 154103 (2009)], a hybrid explicit/implicit method to treat electrostatic interactions in computer simulations of biomolecules formulated for spherical cavities, to prolate spheroidal and triaxial ellipsoidal cavities, designed to better accommodate non-spherical solutes in molecular dynamics (MD) simulations. In addition to the utilization of a general truncated octahedron as the MD simulation box, central to the proposed extension is an image approximation method to compute the reaction field for a point charge placed inside such a non-spherical cavity by using a single image charge located outside the cavity. The resulting generalized image charge solvation model (GICSM) is tested in simulations of liquid water, and the results are analyzed in comparison with those obtained from the ICSM simulations as a reference. We find that, for improved computational efficiency due to smaller simulation cells and consequently a less number of explicit solvent molecules, the generalized model can still faithfully reproduce known static and dynamic properties of liquid water at least for systems considered in the present paper, indicating its great potential to become an accurate but more efficient alternative to the ICSM when bio-macromolecules of irregular shapes are to be simulated. PMID:23913979

Single Molecule Spectroelectrochemistry of Interfacial Charge Transfer Dynamics In Hybrid Organic Solar Cell

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pan, Shanlin

2014-11-16

Our research under support of this DOE grant is focused on applied and fundamental aspects of model organic solar cell systems. Major accomplishments are: 1) we developed a spectroelectorchemistry technique of single molecule single nanoparticle method to study charge transfer between conjugated polymers and semiconductor at the single molecule level. The fluorescence of individual fluorescent polymers at semiconductor surfaces was shown to exhibit blinking behavior compared to molecules on glass substrates. Single molecule fluorescence excitation anisotropy measurements showed the conformation of the polymer molecules did not differ appreciably between glass and semiconductor substrates. The similarities in molecular conformation suggest thatmore » the observed differences in blinking activity are due to charge transfer between fluorescent polymer and semiconductor, which provides additional pathways between states of high and low fluorescence quantum efficiency. Similar spectroelectrochemistry work has been done for small organic dyes for understand their charge transfer dynamics on various substrates and electrochemical environments; 2) We developed a method of transferring semiconductor nanoparticles (NPs) and graphene oxide (GO) nanosheets into organic solvent for a potential electron acceptor in bulk heterojunction organic solar cells which employed polymer semiconductor as the electron donor. Electron transfer from the polymer semiconductor to semiconductor and GO in solutions and thin films was established through fluorescence spectroscopy and electroluminescence measurements. Solar cells containing these materials were constructed and evaluated using transient absorption spectroscopy and dynamic fluorescence techniques to understand the charge carrier generation and recombination events; 3) We invented a spectroelectorchemistry technique using light scattering and electroluminescence for rapid size determination and studying electrochemistry of single NPs in an electrochemical cell. For example, we are able to use this technique to track electroluminescence of single Au NPs, and the electrodeposition of individual Ag NPs in-situ. These metallic NPs are useful to enhance light harvesting in organic photovoltaic systems. The scattering at the surface of an indium tin oxide (ITO) working electrode was measured during a potential sweep. Utilizing Mie scattering theory and high resolution scanning electron microscopy (SEM), the scattering data were used to calculate current-potential curves depicting the electrodeposition of individual Ag NPs. The oxidation of individual presynthesized and electrodeposited Ag NPs was also investigated using fluorescence and DFS microscopies. Our work has produced 1 US provisional patent, 15 published manuscripts, 1 submitted and two additional in-writing manuscripts. 5 graduate students, 1 postdoctoral student, 1 visiting professor, and two undergraduate students have received research training in the area of electrochemistry and optical spectroscopy under support of this award.« less

Direct Observation of Individual Charges and Their Dynamics on Graphene by Low-Energy Electron Holography.

PubMed

Latychevskaia, Tatiana; Wicki, Flavio; Longchamp, Jean-Nicolas; Escher, Conrad; Fink, Hans-Werner

2016-09-14

Visualizing individual charges confined to molecules and observing their dynamics with high spatial resolution is a challenge for advancing various fields in science, ranging from mesoscopic physics to electron transfer events in biological molecules. We show here that the high sensitivity of low-energy electrons to local electric fields can be employed to directly visualize individual charged adsorbates and to study their behavior in a quantitative way. This makes electron holography a unique probing tool for directly visualizing charge distributions with a sensitivity of a fraction of an elementary charge. Moreover, spatial resolution in the nanometer range and fast data acquisition inherent to lens-less low-energy electron holography allows for direct visual inspection of charge transfer processes.

Atomistic and molecular effects in electric double layers at high surface charges

DOE PAGES

Templeton, Jeremy Alan; Lee, Jonathan; Mani, Ali

2015-06-16

Here, the Poisson–Boltzmann theory for electrolytes near a charged surface is known to be invalid due to unaccounted physics associated with high ion concentration regimes. In order to investigate this regime, fluids density functional theory (f-DFT) and molecular dynamics (MD) simulations were used to determine electric surface potential as a function of surface charge. Based on these detailed computations, for electrolytes with nonpolar solvent, the surface potential is shown to depend quadratically on the surface charge in the high charge limit. We demonstrate that modified Poisson–Boltzmann theories can model this limit if they are augmented with atomic packing densities providedmore » by MD. However, when the solvent is a highly polar molecule water an intermediate regime is identified in which a constant capacitance is realized. Simulation results demonstrate the mechanism underlying this regime, and for the salt water system studied here, it persists throughout the range of physically realistic surface charge densities so the potential’s quadratic surface charge dependence is not obtained.« less

Carbon Chain Anions and the Growth of Complex Organic Molecules in Titan’s Ionosphere

DOE Office of Scientific and Technical Information (OSTI.GOV)

Desai, R. T.; Coates, A. J.; Wellbrock, A.

Cassini discovered a plethora of neutral and ionized molecules in Titan’s ionosphere including, surprisingly, anions and negatively charged molecules extending up to 13,800 u q{sup −1}. In this Letter, we forward model the Cassini electron spectrometer response function to this unexpected ionospheric component to achieve an increased mass resolving capability for negatively charged species observed at Titan altitudes of 950–1300 km. We report on detections consistently centered between 25.8 and 26.0 u q{sup −1} and between 49.0–50.1 u q{sup −1} which are identified as belonging to the carbon chain anions, CN{sup −}/C{sub 3}N{sup −} and/or C{sub 2}H{sup −}/C{sub 4}H{sup −},more » in agreement with chemical model predictions. At higher ionospheric altitudes, detections at 73–74 u q{sup −1} could be attributed to the further carbon chain anions C{sub 5}N{sup −}/C{sub 6}H{sup −} but at lower altitudes and during further encounters extend over a higher mass/charge range. This, as well as further intermediary anions detected at >100 u, provide the first evidence for efficient anion chemistry in space involving structures other than linear chains. Furthermore, at altitudes below <1100 km, the low-mass anions (<150 u q{sup −1}) were found to deplete at a rate proportional to the growth of the larger molecules, a correlation that indicates the anions are tightly coupled to the growth process. This study adds Titan to an increasing list of astrophysical environments where chain anions have been observed and shows that anion chemistry plays a role in the formation of complex organics within a planetary atmosphere as well as in the interstellar medium.« less

Change of the isoelectric point of hemoglobin at the air/water interface probed by the orientational flip-flop of water molecules.

PubMed

Devineau, Stéphanie; Inoue, Ken-Ichi; Kusaka, Ryoji; Urashima, Shu-Hei; Nihonyanagi, Satoshi; Baigl, Damien; Tsuneshige, Antonio; Tahara, Tahei

2017-04-19

Elucidation of the molecular mechanisms of protein adsorption is of essential importance for further development of biotechnology. Here, we use interface-selective nonlinear vibrational spectroscopy to investigate protein charge at the air/water interface by probing the orientation of interfacial water molecules. We measured the Im χ (2) spectra of hemoglobin, myoglobin, serum albumin and lysozyme at the air/water interface in the CH and OH stretching regions using heterodyne-detected vibrational sum frequency generation (HD-VSFG) spectroscopy, and we deduced the isoelectric point of the protein by monitoring the orientational flip-flop of water molecules at the interface. Strikingly, our measurements indicate that the isoelectric point of hemoglobin is significantly lowered (by about one pH unit) at the air/water interface compared to that in the bulk. This can be predominantly attributed to the modifications of the protein structure at the air/water interface. Our results also suggest that a similar mechanism accounts for the modification of myoglobin charge at the air/water interface. This effect has not been reported for other model proteins at interfaces probed by conventional VSFG techniques, and it emphasizes the importance of the structural modifications of proteins at the interface, which can drastically affect their charge profiles in a protein-specific manner. The direct experimental approach using HD-VSFG can unveil the changes of the isoelectric point of adsorbed proteins at various interfaces, which is of major relevance to many biological applications and sheds new light on the effect of interfaces on protein charge.

Phase-Transfer Energetics of Small-Molecule Alcohols Across the Water-Hexane Interface: Molecular Dynamics Simulation Using Charge Equilibration Models

PubMed Central

Bauer, Brad A.; Zhong, Yang; Meninger, David J.; Davis, Joseph E.; Patel, Sandeep

2010-01-01

We study the water-hexane interface using molecular dynamics (MD) and polarizable charge equilibration (CHEQ) force fields. Bulk densities for TIP4P-FQ water and hexane, 1.0086±0.0002 g/cm3 and 0.6378±0.0001 g/cm3, demonstrate excellent agreement with experiment. Interfacial width and interfacial tension are consistent with previously reported values. The in-plane component of the dielectric permittivity (ε∥) for water is shown to decrease from 81.7±0.04 to unity, transitioning longitudinally from bulk water to bulk hexane. ε∥ for hexane reaches a maximum in the interface, but this term represents only a small contribution to the total dielectric constant (as expected for a non-polar species). Structurally, net orientations of the molecules arise in the interfacial region such that hexane lies slightly parallel to the interface and water reorients to maximize hydrogen bonding. Interfacial potentials due to contributions of the water and hexane are calculated to be -567.9±0.13mV and 198.7±0.01mV, respectively, giving rise to a total potential in agreement with the range of values reported from previous simulations of similar systems. Potentials of mean force (PMF) calculated for methanol, ethanol, and 1-propanol for the transfer from water to hexane indicate an interfacial free energy minimum, corresponding to the amphiphilic nature of the molecules. The magnitudes of transfer free energies were further characterized from the solvation free energies of alcohols in water and hexane using thermodynamic integration. This analysis shows that solvation free energies for alcohols in hexane are 0.2-0.3 kcal/mol too unfavorable, whereas solvation of alcohols in water is approximately 1 kcal/mol too favorable. For the pure hexane-water interfacial simulations, we observe a monotonic decrease of the water dipole moment to near-vacuum values. This suggests that the electrostatic component of the desolvation free energy is not as severe for polarizable models than for fixed-charge force fields. The implications of such behavior pertain to the modeling of polar and charged solutes in lipidic environments. PMID:21414823

Fe(+) chemical ionization of peptides.

PubMed

Speir, J P; Gorman, G S; Amster, I J

1993-02-01

Laser-desorbed peptide neutral molecules were allowed to react with Fe(+) in a Fourier transform mass spectrometer, using the technique of laser desorption/chemical ionization. The Fe(+) ions are formed by laser ablation of a steel target, as well as by dissociative charge-exchange ionization of ferrocene with Ne(+). Prior to reaction with laser-desorbed peptide molecules, Fe(+) ions undergo 20-100 thermalizin collisions with xenon to reduce the population of excited-state metal ion species. The Fe(+) ions that have not experienced thermalizing collisions undergo charge exchange with peptide molecules. Iron ions that undergo thermalizing collisions before they are allowed to react with peptides are found to undergo charge exchange and to form adduct species [M + Fe(+)] and fragment ions that result from the loss of small, stable molecules, such as H2O, CO, and CO2, from the metal ion-peptide complex.

Excited State Charge Transfer reaction with dual emission from 5-(4-dimethylamino-phenyl)-penta-2,4-dienenitrile: Spectral measurement and theoretical density functional theory calculation

NASA Astrophysics Data System (ADS)

Jana, Sankar; Dalapati, Sasanka; Ghosh, Shalini; Kar, Samiran; Guchhait, Nikhil

2011-07-01

The excited state intramolecular charge transfer process in donor-chromophore-acceptor system 5-(4-dimethylamino-phenyl)-penta-2,4-dienenitrile (DMAPPDN) has been investigated by steady state absorption and emission spectroscopy in combination with Density Functional Theory (DFT) calculations. This flexible donor acceptor molecule DMAPPDN shows dual fluorescence corresponding to emission from locally excited and charge transfer state in polar solvent. Large solvatochromic emission shift, effect of variation of pH and HOMO-LUMO molecular orbital pictures support excited state intramolecular charge transfer process. The experimental findings have been correlated with the calculated structure and potential energy surfaces based on the Twisted Intramolecular Charge Transfer (TICT) model obtained at DFT level using B3LYP functional and 6-31+G( d, p) basis set. The theoretical potential energy surfaces for the excited states have been generated in vacuo and acetonitrile solvent using Time Dependent Density Functional Theory (TDDFT) and Time Dependent Density Functional Theory Polarized Continuum Model (TDDFT-PCM) method, respectively. All the theoretical results show well agreement with the experimental observations.

Single-Molecule Electronics: Chemical and Analytical Perspectives.

PubMed

Nichols, Richard J; Higgins, Simon J

2015-01-01

It is now possible to measure the electrical properties of single molecules using a variety of techniques including scanning probe microcopies and mechanically controlled break junctions. Such measurements can be made across a wide range of environments including ambient conditions, organic liquids, ionic liquids, aqueous solutions, electrolytes, and ultra high vacuum. This has given new insights into charge transport across molecule electrical junctions, and these experimental methods have been complemented with increasingly sophisticated theory. This article reviews progress in single-molecule electronics from a chemical perspective and discusses topics such as the molecule-surface coupling in electrical junctions, chemical control, and supramolecular interactions in junctions and gating charge transport. The article concludes with an outlook regarding chemical analysis based on single-molecule conductance.

Quantitative Super-Resolution Microscopy of Nanopipette-Deposited Fluorescent Patterns.

PubMed

Hennig, Simon; van de Linde, Sebastian; Bergmann, Stephan; Huser, Thomas; Sauer, Markus

2015-08-25

We describe a method for the deposition of minute amounts of fluorophore-labeled oligonucleotides with high local precision in conductive and transparent solid layers of poly(vinyl alcohol) (PVA) doped with glycerin and cysteamine (PVA-G-C layers). Deposition of negatively charged fluorescent molecules was accomplished with a setup based on a scanning ion conductance microscope (SICM) using nanopipettes with tip diameters of ∼100 nm by using the ion flux flowing between two electrodes through the nanopipette. To investigate the precision of the local deposition process, we performed in situ super-resolution microscopy by direct stochastic optical reconstruction microscopy (dSTORM). Exploiting the single-molecule sensitivity and reliability of dSTORM, we determine the number of fluorescent molecules deposited in single spots. The correlation of applied charge and number of deposited molecules enables the quantification of delivered molecules by measuring the charge during the delivery process. We demonstrate the reproducible deposition of 3-168 fluorescent molecules in single spots and the creation of fluorescent structures. The fluorescent structures are highly stable and can be reused several times.

DFT computational analysis of piracetam

NASA Astrophysics Data System (ADS)

Rajesh, P.; Gunasekaran, S.; Seshadri, S.; Gnanasambandan, T.

2014-11-01

Density functional theory calculation with B3LYP using 6-31G(d,p) and 6-31++G(d,p) basis set have been used to determine ground state molecular geometries. The first order hyperpolarizability (β0) and related properties (β, α0 and Δα) of piracetam is calculated using B3LYP/6-31G(d,p) method on the finite-field approach. The stability of molecule has been analyzed by using NBO/NLMO analysis. The calculation of first hyperpolarizability shows that the molecule is an attractive molecule for future applications in non-linear optics. Molecular electrostatic potential (MEP) at a point in the space around a molecule gives an indication of the net electrostatic effect produced at that point by the total charge distribution of the molecule. The calculated HOMO and LUMO energies show that charge transfer occurs within these molecules. Mulliken population analysis on atomic charge is also calculated. Because of vibrational analysis, the thermodynamic properties of the title compound at different temperatures have been calculated. Finally, the UV-Vis spectra and electronic absorption properties are explained and illustrated from the frontier molecular orbitals.

Ferroelectric self-assembled molecular materials showing both rectifying and switchable conductivity

PubMed Central

Gorbunov, Andrey V.; Garcia Iglesias, Miguel; Guilleme, Julia; Cornelissen, Tim D.; Roelofs, W. S. Christian; Torres, Tomas; González-Rodríguez, David; Meijer, E. W.; Kemerink, Martijn

2017-01-01

Advanced molecular materials that combine two or more physical properties are typically constructed by combining different molecules, each being responsible for one of the properties required. Ideally, single molecules could take care of this combined functionality, provided they are self-assembled correctly and endowed with different functional subunits whose strong electronic coupling may lead to the emergence of unprecedented and exciting properties. We present a class of disc-like semiconducting organic molecules that are functionalized with strong dipolar side groups. Supramolecular organization of these materials provides long-range polar order that supports collective ferroelectric behavior of the side groups as well as charge transport through the stacked semiconducting cores. The ferroelectric polarization in these supramolecular polymers is found to couple to the charge transport and leads to a bulk conductivity that is both switchable and rectifying. An intuitive model is developed and found to quantitatively reproduce the experimental observations. In a larger perspective, these results highlight the possibility of modulating material properties using the large electric fields associated with ferroelectric polarization. PMID:28975150

The ITO-capped WO3 nanowires biosensor based on field-effect transistor in label-free protein sensing

NASA Astrophysics Data System (ADS)

Shariati, Mohsen

2017-05-01

The fabrication of ITO-capped WO3 nanowires associated with their bio-sensing properties in field-effect transistor diagnostics basis as a biosensor has been reported. The bio-sensing property for manipulated nanowires elucidated that the grown nanostructures were very sensitive to protein. The ITO-capped WO3 nanowires biosensor showed an intensive bio-sensing activity against reliable protein. Polylysine strongly charged bio-molecule was applied as model system to demonstrate the implementation of materialized biosensor. The employed sensing mechanism was `label-free' and depended on bio-molecule's intrinsic charge. For nanowires synthesis, the vapor-liquid-solid mechanism was used. Nanowires were beyond a few hundred nanometers in lengths and around 15-20 nm in diameter, while the globe cap's size on the nanowires was around 15-25 nm. The indium tin oxide (ITO) played as catalyst in nanofabrication for WO3 nanowires growth and had outstanding role in bio-sensing especially for bio-molecule adherence. In applied electric field presence, the fabricated device showed the great potential to enhance medical diagnostics.

Solvation of carbonaceous molecules by para-H2 and ortho-D2 clusters. II. Fullerenes.

PubMed

Calvo, F; Yurtsever, E

2016-08-28

The coating of various fullerenes by para-hydrogen and ortho-deuterium molecules has been computationally studied as a function of the solvent amount. Rotationally averaged interaction potentials for structureless hydrogen molecules are employed to model their interaction with neutral or charged carbonaceous dopants containing between 20 and 240 atoms, occasionally comparing different fullerenes having the same size but different shapes. The solvation energy and the size of the first solvation shell obtained from path-integral molecular dynamics simulations at 2 K show only minor influence on the dopant charge and on the possible deuteration of the solvent, although the shell size is largest for ortho-D2 coating cationic fullerenes. Nontrivial finite size effects have been found with the shell size varying non-monotonically close to its completion limit. For fullerenes embedded in large hydrogen clusters, the shell size and solvation energy both follow linear scaling with the fullerene size. The shell sizes obtained for C60 (+) and C70 (+) are close to 49 and 51, respectively, and agree with mass spectrometry experiments.

Solvation of carbonaceous molecules by para-H2 and ortho-D2 clusters. II. Fullerenes

NASA Astrophysics Data System (ADS)

Calvo, F.; Yurtsever, E.

2016-08-01

The coating of various fullerenes by para-hydrogen and ortho-deuterium molecules has been computationally studied as a function of the solvent amount. Rotationally averaged interaction potentials for structureless hydrogen molecules are employed to model their interaction with neutral or charged carbonaceous dopants containing between 20 and 240 atoms, occasionally comparing different fullerenes having the same size but different shapes. The solvation energy and the size of the first solvation shell obtained from path-integral molecular dynamics simulations at 2 K show only minor influence on the dopant charge and on the possible deuteration of the solvent, although the shell size is largest for ortho-D2 coating cationic fullerenes. Nontrivial finite size effects have been found with the shell size varying non-monotonically close to its completion limit. For fullerenes embedded in large hydrogen clusters, the shell size and solvation energy both follow linear scaling with the fullerene size. The shell sizes obtained for C 60+ and C 70+ are close to 49 and 51, respectively, and agree with mass spectrometry experiments.

Adsorption of DNA to mica mediated by divalent counterions: a theoretical and experimental study.

PubMed

Pastré, David; Piétrement, Olivier; Fusil, Stéphane; Landousy, Fabrice; Jeusset, Josette; David, Marie-Odile; Hamon, Loïc; Le Cam, Eric; Zozime, Alain

2003-10-01

The adsorption of DNA molecules onto a flat mica surface is a necessary step to perform atomic force microscopy studies of DNA conformation and observe DNA-protein interactions in physiological environment. However, the phenomenon that pulls DNA molecules onto the surface is still not understood. This is a crucial issue because the DNA/surface interactions could affect the DNA biological functions. In this paper we develop a model that can explain the mechanism of the DNA adsorption onto mica. This model suggests that DNA attraction is due to the sharing of the DNA and mica counterions. The correlations between divalent counterions on both the negatively charged DNA and the mica surface can generate a net attraction force whereas the correlations between monovalent counterions are ineffective in the DNA attraction. DNA binding is then dependent on the fractional surface densities of the divalent and monovalent cations, which can compete for the mica surface and DNA neutralizations. In addition, the attraction can be enhanced when the mica has been pretreated by transition metal cations (Ni(2+), Zn(2+)). Mica pretreatment simultaneously enhances the DNA attraction and reduces the repulsive contribution due to the electrical double-layer force. We also perform end-to-end distance measurement of DNA chains to study the binding strength. The DNA binding strength appears to be constant for a fixed fractional surface density of the divalent cations at low ionic strength (I < 0.1 M) as predicted by the model. However, at higher ionic strength, the binding is weakened by the screening effect of the ions. Then, some equations were derived to describe the binding of a polyelectrolyte onto a charged surface. The electrostatic attraction due to the sharing of counterions is particularly effective if the polyelectrolyte and the surface have nearly the same surface charge density. This characteristic of the attraction force can explain the success of mica for performing single DNA molecule observation by AFM. In addition, we explain how a reversible binding of the DNA molecules can be obtained with a pretreated mica surface.

Charge-specific size-dependent separation of water-soluble organic molecules by fluorinated nanoporous networks

NASA Astrophysics Data System (ADS)

Byun, Jeehye; Patel, Hasmukh A.; Thirion, Damien; Yavuz, Cafer T.

2016-11-01

Molecular architecture in nanoscale spaces can lead to selective chemical interactions and separation of species with similar sizes and functionality. Substrate specific sorbent chemistry is well known through highly crystalline ordered structures such as zeolites, metal organic frameworks and widely available nanoporous carbons. Size and charge-dependent separation of aqueous molecular contaminants, on the contrary, have not been adequately developed. Here we report a charge-specific size-dependent separation of water-soluble molecules through an ultra-microporous polymeric network that features fluorines as the predominant surface functional groups. Treatment of similarly sized organic molecules with and without charges shows that fluorine interacts with charges favourably. Control experiments using similarly constructed frameworks with or without fluorines verify the fluorine-cation interactions. Lack of a σ-hole for fluorine atoms is suggested to be responsible for this distinct property, and future applications of this discovery, such as desalination and mixed matrix membranes, may be expected to follow.

Charge-specific size-dependent separation of water-soluble organic molecules by fluorinated nanoporous networks

PubMed Central

Byun, Jeehye; Patel, Hasmukh A.; Thirion, Damien; Yavuz, Cafer T.

2016-01-01

Molecular architecture in nanoscale spaces can lead to selective chemical interactions and separation of species with similar sizes and functionality. Substrate specific sorbent chemistry is well known through highly crystalline ordered structures such as zeolites, metal organic frameworks and widely available nanoporous carbons. Size and charge-dependent separation of aqueous molecular contaminants, on the contrary, have not been adequately developed. Here we report a charge-specific size-dependent separation of water-soluble molecules through an ultra-microporous polymeric network that features fluorines as the predominant surface functional groups. Treatment of similarly sized organic molecules with and without charges shows that fluorine interacts with charges favourably. Control experiments using similarly constructed frameworks with or without fluorines verify the fluorine-cation interactions. Lack of a σ-hole for fluorine atoms is suggested to be responsible for this distinct property, and future applications of this discovery, such as desalination and mixed matrix membranes, may be expected to follow. PMID:27830697

QSAR analyses of 3-(4-benzylpiperidin-1-yl)-N-phenylpropylamine derivatives as potent CCR5 antagonists.

PubMed

Roy, Kunal; Leonard, J Thomas

2005-01-01

CCR5 receptor binding affinity of a series of 3-(4-benzylpiperidin-1-yl)propylamine congeners was subjected to QSAR study using the linear free energy related (LFER) model of Hansch. Appropriate indicator variables encoding different group contributions and different physicochemical variables such as hydrophobicity (pi), electronic (Hammett sigma), and steric (molar refractivity, STERIMOL values) parameters of phenyl ring substituents of the compounds were used as predictor variables. The Hansch analysis explores the importance of the lipophilicity and electron-donating substituents for the binding affinity. However, this method could not give more insight into the structure-activity relationships because of the diverse molecular features in the data set. 3D-QSAR analyses of the same data set using Molecular Shape Analysis (MSA), Receptor Surface Analysis (RSA), and Molecular Field Analysis (MFA) techniques were also performed. The best model with acceptable statistical quality was derived from the MSA, which showed the importance of the relative negative charge (RNCG): substituents with a high RNCG value have more binding affinity than the unsubstituted piperidine and phenyl (R1 position) congeners. The relative negative charge surface area (RNCS) is detrimental (e.g. R2 = 3,4-Cl2) for the activity. An increase in the length of the molecule in the Z dimension (Lz) is conducive (e.g. R3 = sulfonylmorpholino), while an increase in the area of the molecular shadow in the XZ plane (Sxz) is detrimental (e.g. R1 = N-c-hexylmethyl-5-oxopyrrolidin-3-yl) for the binding affinity. The presence of a chiral center makes the molecule less active (e.g. R1 = N-methyl-5-oxopyrrolidin-3-yl). An increase in the van der Waals area, the molecular volume, and the difference between the volume of the individual molecule and the shape reference compound are conducive (e.g. R3 = (CH3)2NSO2-) for the binding affinity. Substituents with higher JursFPSA_2 values (fractional charged partial surface area) like the N-methylsulfonylpiperidin-4-yl (R1 position) group have better binding affinity than the substituents such as 4-chlorophenylamino (R1 position). Unsubstituted piperidines (R1 position) with less JursFNSA_1 values have lower binding affinity than the 4-chlorophenyl substituted compounds. The MFA derived equation shows interaction energies at different grid points, while the RSA model shows the importance of hydrophobicity and charge at different regions of the molecules. The models were validated through the leave-one-out, leave-15%-out, and leave-25%-out cross-validation techniques. The developed models were also subjected to a randomization test (99% confidence level). Although the MSA derived models had excellent statistical qualities both for the training as well as test sets, RSA and MFA results for the test sets are not comparable statistically with the MSA derived models.

Solubilization of Therapeutic Agents in Micellar Nanomedicines

PubMed Central

Vuković, Lela; Madriaga, Antonett; Kuzmis, Antonina; Banerjee, Amrita; Tang, Alan; Tao, Kevin; Shah, Neil; Král, Petr; Onyuksel, Hayat

2014-01-01

We use atomistic molecular dynamics simulations to reveal the binding mechanisms of therapeutic agents in PEG-ylated micellar nanocarriers (SSM). In our experiments, SSM in buffer solutions can solubilize either ≈ 11 small bexarotene molecules or ≈ 6 (2 in low ionic strength buffer) human vasoactive intestinal peptide (VIP) molecules. Free energy calculations reveal that molecules of the poorly water soluble drug bexarotene can reside at the micellar ionic interface of the PEG corona, with their polar ends pointing out. Alternatively, they can reside in the alkane core center, where several bexarotene molecules can self-stabilize by forming a cluster held together by a network of hydrogen bonds. We also show that highly charged molecules, such as VIP, can be stabilized at the SSM ionic interface by Coulombic coupling between their positively charged residues and the negatively charged phosphate head-groups of the lipids. The obtained results illustrate that atomistic simulations can reveal drug solubilization character in nanocarriers and be used in efficient optimization of novel nanomedicines. PMID:24283508

Dissociation of methane on the surface of charged defective carbon nanotubes

NASA Astrophysics Data System (ADS)

Guo, Z. H.; Yan, X. H.; Xiao, Y.

2010-03-01

Based on the framework of density functional theory (CASTEP and DMOL 3 codes), we simulate the dissociation of methane (CH 4) molecule on the surface of charged defective carbon nanotubes (CNTs). The results display that a charged CNT with carbon (C) and molybdenum (Mo) dopants can effectively dissociate CH 4 molecule, and the adsorption strength of H and CH 3 can be controlled by the injected negative charges. Moreover, the barrier between the transition state (TS) and the reactant is 0.1014 eV, and a single imaginary frequency of -0.3 cm is found for the transition state structure.

A study of vibrational spectra and investigations of charge transfer and chemical bonding features of 2-chloro benzimidazole based on DFT computations

NASA Astrophysics Data System (ADS)

Muthunatesan, S.; Ragavendran, V.

2015-01-01

Benzimidazoles are bicyclic heteroatomic molecules. Polycyclic heteroatomic molecules have extensive coupling of different modes leading to strong coupling of force constants associated with the various chemical bonds of the molecules. To carry out a detailed vibrational spectroscopic analysis of such a bicyclic heteroatomic molecule, FT-IR and FT-Raman spectra of 2-chloro benzimidazole (CBZ) have been recorded in the condensed phase. Density Functional Theory calculations in the B3LYP/6-31G* level have been carried out to determine the optimized geometry and vibrational frequencies. In order to obtain a close agreement between theoretical and observed frequencies and hence to perform a reliable assignment, the theoretical DFT force field was transformed from Cartesian to local symmetry co-ordinates and then scaled empirically using SQM methodology. The SQM treatment resulted in a RMS deviation of 9.4 cm-1. For visual comparison, the observed and calculated spectra are presented on a common wavenumber scale. From the NBO analysis, the electron density (ED) charge transfers in the σ* and π* antibonding orbitals and second order delocalization energies E(2) confirms the occurrence of intramolecular charge transfer (ICT) within the molecule. The calculated Homo and Lumo energies show that charge transfer occurs within the molecule. The results obtained from the vibrational, NBO and HOMO-LUMO analyses have been properly tabulated.

Altering the self-organization of dyes on titania with dyeing solvents to tune the charge-transfer dynamics of sensitized solar cells.

PubMed

Wang, Yinglin; Yang, Lin; Zhang, Jing; Li, Renzhi; Zhang, Min; Wang, Peng

2014-04-14

Herein we selected the model organic donor-acceptor dye C218 and modulated the self-organization of dye molecules on the surface of titania by changing the dyeing solvent from chlorobenzene to a mixture of acetonitrile and tert-butanol. We further unveiled the relationship between the microstructure of a dye layer and the multichannel charge-transfer dynamics that underlie the photovoltaic performance of dye-sensitized solar cells. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Charge transport with single molecules--an electrochemical approach.

PubMed

Li, Chen; Mishchenko, Artem; Pobelov, Ilya; Wandlowski, Thomas

2010-01-01

After an introduction and brief review of charge transport in nanoscale molecular systems we report on experimental studies in gold / (single) molecule / gold junctions at solid / liquid interfaces employing a scanning tunneling microscopy (STM)-based 'break junction' technique. We demonstrate attempts in developing basic relationships between molecular structure, conductance properties and nanoscale electrochemical concepts based on four case studies from our own work. In experiments with alpha, omega-alkanedithiol and biphenyldithiol molecular junctions we address the role of sulfur-gold couplings and molecular conformation, such as gauche defects in the alkyl chains and the torsion angle between two phenyl rings. Combination with quantum chemistry calculations enabled a detailed molecular-level understanding of the electronic structure and transport characteristics of both systems. Employing the concept of 'electrolyte gating' with redox-active molecules, such as thiol-terminated derivatives of viologens (HS-6V6-SH or (HS-6V6)) we demonstrate the construction of symmetric and asymmetric active molecular junctions with transistor- or diode-like behavior upon polarization in an electrochemical environment. The experimental data could be represented quantitatively by the Kutznetsov/Ulstrup model assuming a two-step electron transfer with partial vibration relaxation. Finally, we show that surface-immobilized gold nanoparticles with a diameter of (2.4 +/- 0.5) nm exhibit features of locally addressable multi-state electronic switching upon electrolyte gating, which appears to be reminiscent of a sequential charging through several 'oxidation/reduction states'.

Computational analysis of molecular properties and spectral characteristics of cyano-containing liquid crystals: role of alkyl chains.

PubMed

Praveen, P Lakshmi; Ojha, Durga P

2011-05-01

The electronic transitions in the uv-visible range of 4'-n-alkyl-4-cyanobiphenyl (nCB) with propyl, pentyl, and heptyl groups, which are of commercial and application interests, have been studied. The uv-visible and circular dichroism spectra of nCB (n = 3,5,7) molecules have been simulated using the time dependent density functional theory Becke3-Lee-Yang-Parr hybrid functional-6-31 + G (d) method. Mulliken atomic charges for each molecule have been compared with Loewdin atomic charges to analyze the molecular charge distribution and phase stability. The highest occupied molecular orbital and lowest unoccupied molecular orbital energies corresponding to the electronic transitions in the uv-visible range have been reported. Excited states have been calculated via the configuration interaction single level with a semiempirical Hamiltonian (intermediate neglect of differential overlap method, as parametrized by Zerner and co-workers). Further, two types of calculations have been performed for model systems containing single and double molecules of nCB. Furthermore, the dimer complexes during the different modes of molecular interactions have also been studied. The interaction energies of dimer complexes have been taken into consideration in order to investigate the most energetically stable configuration. These studies are helpful for understanding the role and flexibility of end chains, in particular, phase behavior and stability.

Electric-field-driven electron-transfer in mixed-valence molecules.

PubMed

Blair, Enrique P; Corcelli, Steven A; Lent, Craig S

2016-07-07

Molecular quantum-dot cellular automata is a computing paradigm in which digital information is encoded by the charge configuration of a mixed-valence molecule. General-purpose computing can be achieved by arranging these compounds on a substrate and exploiting intermolecular Coulombic coupling. The operation of such a device relies on nonequilibrium electron transfer (ET), whereby the time-varying electric field of one molecule induces an ET event in a neighboring molecule. The magnitude of the electric fields can be quite large because of close spatial proximity, and the induced ET rate is a measure of the nonequilibrium response of the molecule. We calculate the electric-field-driven ET rate for a model mixed-valence compound. The mixed-valence molecule is regarded as a two-state electronic system coupled to a molecular vibrational mode, which is, in turn, coupled to a thermal environment. Both the electronic and vibrational degrees-of-freedom are treated quantum mechanically, and the dissipative vibrational-bath interaction is modeled with the Lindblad equation. This approach captures both tunneling and nonadiabatic dynamics. Relationships between microscopic molecular properties and the driven ET rate are explored for two time-dependent applied fields: an abruptly switched field and a linearly ramped field. In both cases, the driven ET rate is only weakly temperature dependent. When the model is applied using parameters appropriate to a specific mixed-valence molecule, diferrocenylacetylene, terahertz-range ET transfer rates are predicted.

Intercalation of Li Ions into a Graphite Anode Material: Molecular Dynamics Simulations

NASA Astrophysics Data System (ADS)

Abou Hamad, Ibrahim; Novotny, Mark

2008-03-01

Large-scale molecular dynamics simulations of the anode half-cell of a lithium-ion battery are presented. The model system is composed of an anode represented by a stack of graphite sheets, an electrolyte of ethylene carbonate and propylene carbonate molecules, and lithium and hexafluorophosphate ions. The simulations are done in the NVT ensemble and at room temperature. One charging scheme explored is normal charging in which intercalation is enhanced by electric charges on the graphitic sheets. The second charging mechanism has an external applied oscillatory electric field of amplitude A and frequency f. The simulations were performed on 2.6 GHz Opteron processors, using 160 processors at a time. Our simulation results show an improvement in the intercalation time of the lithium ions for the second charging mechanism. The dependence of the intercalation time on A and f will be discussed.

Conformational, spectroscopic and nonlinear optical properties of biologically active N,N-dimethyltryptamine molecule: a theoretical study.

PubMed

Öner, Nazmiye; Tamer, Ömer; Avcı, Davut; Atalay, Yusuf

2014-12-10

The effective psychoactive properties of N,N-dimethyltryptamine (DMT) known as the near-death molecule have encouraged the imagination of many research disciplines for several decades. Although there is no theoretical study, a number of paper composed by experimental techniques have been reported for DMT molecule. In this study, the molecular modeling of DMT was carried out using B3LYP and HSEh1PBE levels of density functional theory (DFT). Our calculations showed that the energy gap between HOMO and LUMO is low, demonstrating that DMT is a biologically active molecule. Large hyperconjugation interaction energies imply that molecular charge transfer occurs in DMT. Moreover, NLO analysis indicates that DMT can be used an effective NLO material. Copyright © 2014 Elsevier B.V. All rights reserved.

The Minimum Binding Energy and Size of Doubly Muonic D3 Molecule

NASA Astrophysics Data System (ADS)

Eskandari, M. R.; Faghihi, F.; Mahdavi, M.

The minimum energy and size of doubly muonic D3 molecule, which two of the electrons are replaced by the much heavier muons, are calculated by the well-known variational method. The calculations show that the system possesses two minimum positions, one at typically muonic distance and the second at the atomic distance. It is shown that at the muonic distance, the effective charge, zeff is 2.9. We assumed a symmetric planar vibrational model between two minima and an oscillation potential energy is approximated in this region.

Inelastic cotunneling with energy-dependent contact transmission

NASA Astrophysics Data System (ADS)

Blok, S.; Agundez Mojarro, R. R.; Maduro, L. A.; Blaauboer, M.; Van Der Molen, S. J.

2017-03-01

We investigate inelastic cotunneling in a model system where the charging island is connected to the leads through molecules with energy-dependent transmission functions. To study this problem, we propose two different approaches. The first is a pragmatic approach that assumes Lorentzian-like transmission functions that determine the transmission probability to the island. Using this model, we calculate current versus voltage (IV) curves for increasing resonance level positions of the molecule. We find that shifting the resonance energy of the molecule away from the Fermi energy of the contacts leads to a decreased current at low bias, but as bias increases, this difference decreases and eventually inverses. This is markedly different from IV behavior outside the cotunneling regime. The second approach involves multiple cotunneling where also the molecules are considered to be in the Coulomb blockade regime. We find here that when Ec≫eV ,kBT , the IV behavior approaches the original cotunneling behavior proposed by Averin and Nazarov [Phys. Rev. Lett. 65, 2446-2449 (1990)].

Electrical manipulation of oligonucleotides grafted to charged surfaces.

PubMed

Rant, Ulrich; Arinaga, Kenji; Fujita, Shozo; Yokoyama, Naoki; Abstreiter, Gerhard; Tornow, Marc

2006-09-21

The electrical manipulation of short DNA molecules on surfaces offers novel functionalities with fascinating possibilities in the field of bio-interfaces. Here we present systematic investigations of the electrical interactions which govern the structure of oligonucleotides on charged gold surfaces. Successively, we address influences of the applied field strength, the role of DC electrode potentials, in particular for polycrystalline surfaces, as well as screening effects of the surrounding electrolyte solution. Data obtained for single and double stranded DNA exhibit differences which can be attributed to the dissimilar flexibility of the different molecular conformations. A comparison of the experimental results with a basic model shows how the alignment of the molecules adjusts according to a balance between electrically induced ordering and stochastic thermal motions. The presented conclusions are expected to be of general relevance for the behaviour of polyelectrolytes exposed to localized electric fields at interfaces.

A single molecule rectifier with strong push-pull coupling

NASA Astrophysics Data System (ADS)

Saraiva-Souza, Aldilene; Macedo de Souza, Fabricio; Aleixo, Vicente F. P.; Girão, Eduardo Costa; Filho, Josué Mendes; Meunier, Vincent; Sumpter, Bobby G.; Souza Filho, Antônio Gomes; Del Nero, Jordan

2008-11-01

We theoretically investigate the electronic charge transport in a molecular system composed of a donor group (dinitrobenzene) coupled to an acceptor group (dihydrophenazine) via a polyenic chain (unsaturated carbon bridge). Ab initio calculations based on the Hartree-Fock approximations are performed to investigate the distribution of electron states over the molecule in the presence of an external electric field. For small bridge lengths (n =0-3) we find a homogeneous distribution of the frontier molecular orbitals, while for n >3 a strong localization of the lowest unoccupied molecular orbital is found. The localized orbitals in between the donor and acceptor groups act as conduction channels when an external electric field is applied. We also calculate the rectification behavior of this system by evaluating the charge accumulated in the donor and acceptor groups as a function of the external electric field. Finally, we propose a phenomenological model based on nonequilibrium Green's function to rationalize the ab initio findings.

A molecular dynamics study of chloride binding by the cryptand SC24

NASA Technical Reports Server (NTRS)

Owenson, B.; MacElroy, R. D.; Pohorille, A.

1988-01-01

The capture of chloride from water by the tetraprotonated form of the spherical macrotricyclic molecule SC24 was studied using molecular dynamics simulation methods. This model ionophore represents a broad class of molecules which remove ions from water. Two binding sites for the chloride were found, one inside and one outside the ligand. These sites are separated by a potential energy barrier of approximately 20 kcal mol-1. The major contribution to this barrier comes from dehydration of the chloride. The large, unfavorable dehydration effect is compensated for by an increase in electrostatic attraction between the oppositely charged chloride and cryptand, and by energetically favorable rearrangements of water structure. Additional assistance in crossing the barrier and completing the dehydration of the ion is provided by the shift of three positively charged hydrogen atoms of the cryptand towards the chloride. This structural rigidity is partially responsible for its selectivity.

Exploring coherent electron excitation and migration dynamics by electron diffraction with ultrashort X-ray pulses.

PubMed

Yuan, Kai-Jun; Bandrauk, André D

2017-10-04

Exploring ultrafast charge migration is of great importance in biological and chemical reactions. We present a scheme to monitor attosecond charge migration in molecules by electron diffraction with spatial and temporal resolutions from ab initio numerical simulations. An ultraviolet pulse creates a coherent superposition of electronic states, after which a time-delayed attosecond X-ray pulse is used to ionize the molecule. It is found that diffraction patterns in the X-ray photoelectron spectra show an asymmetric structure, which is dependent on the time delay between the pump-probe pulses, encoding the information of molecular orbital symmetry and chemical bonding. We describe these phenomena by developing an electronic time-dependent ultrafast molecular photoionization model of a coherent superposition state. The periodical distortion of electron diffraction patterns illustrates the evolution of the electronic coherence, providing a tool for attosecond imaging of ultrafast molecular reaction processes.

Effect of multiple plasmon excitation on single, double and multiple ionizations of C60 in collisions with fast highly charged Si ions

NASA Astrophysics Data System (ADS)

Kelkar, A. H.; Kadhane, U.; Misra, D.; Kumar, A.; Tribedi, L. C.

2007-06-01

We have investigated the single and multiple ionizations of the C60 molecule in collisions with fast Siq+ projectiles for various projectile charge states (q) between q = 6 and 14. The q-dependence of the ionization cross sections and their ratios is compared with the giant dipole plasmon resonance (GDPR) model. The excellent qualitative agreement with the model in case of single and double ionizations and also a reasonable agreement with the triple (and to some extent with quadruple) ionization (without evaporation) yields signify dominant contributions of the single-, double- and triple-plasmon excitations on the single- and multiple-ionization process.

Electrotunable artificial molecules based on van der Waals heterostructures

PubMed Central

Zhang, Zhuo-Zhi; Song, Xiang-Xiang; Luo, Gang; Deng, Guang-Wei; Mosallanejad, Vahid; Taniguchi, Takashi; Watanabe, Kenji; Li, Hai-Ou; Cao, Gang; Guo, Guang-Can; Nori, Franco; Guo, Guo-Ping

2017-01-01

Quantum confinement has made it possible to detect and manipulate single-electron charge and spin states. The recent focus on two-dimensional (2D) materials has attracted significant interests on possible applications to quantum devices, including detecting and manipulating either single-electron charging behavior or spin and valley degrees of freedom. However, the most popular model systems, consisting of tunable double-quantum-dot molecules, are still extremely difficult to realize in these materials. We show that an artificial molecule can be reversibly formed in atomically thin MoS2 sandwiched in hexagonal boron nitride, with each artificial atom controlled separately by electrostatic gating. The extracted values for coupling energies at different regimes indicate a single-electron transport behavior, with the coupling strength between the quantum dots tuned monotonically. Moreover, in the low-density regime, we observe a decrease of the conductance with magnetic field, suggesting the observation of Coulomb blockade weak anti-localization. Our experiments demonstrate for the first time the realization of an artificial quantum-dot molecule in a gated MoS2 van der Waals heterostructure, which could be used to investigate spin-valley physics. The compatibility with large-scale production, gate controllability, electron-hole bipolarity, and new quantum degrees of freedom in the family of 2D materials opens new possibilities for quantum electronics and its applications. PMID:29062893

Atomic partial charges on CH{sub 3}NH{sub 3}PbI{sub 3} from first-principles electronic structure calculations

DOE Office of Scientific and Technical Information (OSTI.GOV)

Madjet, Mohamed E., E-mail: mmadjet@qf.org.qa; El-Mellouhi, Fedwa; Carignano, Marcelo A.

We calculated the partial charges in methylammonium (MA) lead-iodide perovskite CH{sub 3}NH{sub 3}PbI{sub 3} in its different crystalline phases using different first-principles electronic charge partitioning approaches, including the Bader, ChelpG, and density-derived electrostatic and chemical (DDEC) schemes. Among the three charge partitioning methods, the DDEC approach provides chemically intuitive and reliable atomic charges for this material, which consists of a mixture of transition metals, halide ions, and organic molecules. The DDEC charges are also found to be robust against the use of hybrid functionals and/or upon inclusion of spin–orbit coupling or dispersive interactions. We calculated explicitly the atomic charges withmore » a special focus on the dipole moment of the MA molecules within the perovskite structure. The value of the dipole moment of the MA is reduced with respect to the isolated molecule due to charge redistribution involving the inorganic cage. DDEC charges and dipole moment of the organic part remain nearly unchanged upon its rotation within the octahedral cavities. Our findings will be of both fundamental and practical importance, as the accurate and consistent determination of the atomic charges is important in order to understand the average equilibrium distribution of the electrons and to help in the development of force fields for larger scale atomistic simulations to describe static, dynamic, and thermodynamic properties of the material.« less

Apparatus and method of determining molecular weight of large molecules

DOEpatents

Fuerstenau, S.; Benner, W.H.; Madden, N.M.; Searles, W.

1998-06-23

A mass spectrometer determines the mass of multiply charged high molecular weight molecules. This spectrometer utilizes an ion detector which is capable of simultaneously measuring the charge z and transit time of a single ion as it passes through the detector. From this transit time, the velocity of the single ion may then be derived, thus providing the mass-to-charge ratio m/z for a single ion which has been accelerated through a known potential. Given z and m/z, the mass m of the single ion can then be calculated. Electrospray ions with masses in excess of 1 MDa and charge numbers greater than 425 e{sup {minus}} are readily detected. The on-axis single ion detection configuration enables a duty cycle of nearly 100% and extends the practical application of electrospray mass spectrometry to the analysis of very large molecules with relatively inexpensive instrumentation. 14 figs.

Apparatus and method of determining molecular weight of large molecules

DOEpatents

Fuerstenau, Stephen; Benner, W. Henry; Madden, Norman; Searles, William

1998-01-01

A mass spectrometer determines the mass of multiply charged high molecular weight molecules. This spectrometer utilizes an ion detector which is capable of simultaneously measuring the charge z and transit time of a single ion as it passes through the detector. From this transit time, the velocity of the single ion may then be derived, thus providing the mass-to-charge ratio m/z for a single ion which has been accelerated through a known potential. Given z and m/z, the mass m of the single ion can then be calculated. Electrospray ions with masses in excess of 1 MDa and charge numbers greater than 425 e.sup.- are readily detected. The on-axis single ion detection configuration enables a duty cycle of nearly 100% and extends the practical application of electrospray mass spectrometry to the analysis of very large molecules with relatively inexpensive instrumentation.

STABILITY OF A CYLINDRICAL SOLUTE-SOLVENT INTERFACE: EFFECT OF GEOMETRY, ELECTROSTATICS, AND HYDRODYNAMICS.

PubMed

Li, B O; Sun, Hui; Zhou, Shenggao

The solute-solvent interface that separates biological molecules from their surrounding aqueous solvent characterizes the conformation and dynamics of such molecules. In this work, we construct a solvent fluid dielectric boundary model for the solvation of charged molecules and apply it to study the stability of a model cylindrical solute-solvent interface. The motion of the solute-solvent interface is defined to be the same as that of solvent fluid at the interface. The solvent fluid is assumed to be incompressible and is described by the Stokes equation. The solute is modeled simply by the ideal-gas law. All the viscous force, hydrostatic pressure, solute-solvent van der Waals interaction, surface tension, and electrostatic force are balanced at the solute-solvent interface. We model the electrostatics by Poisson's equation in which the solute-solvent interface is treated as a dielectric boundary that separates the low-dielectric solute from the high-dielectric solvent. For a cylindrical geometry, we find multiple cylindrically shaped equilibrium interfaces that describe polymodal (e.g., dry and wet) states of hydration of an underlying molecular system. These steady-state solutions exhibit bifurcation behavior with respect to the charge density. For their linearized systems, we use the projection method to solve the fluid equation and find the dispersion relation. Our asymptotic analysis shows that, for large wavenumbers, the decay rate is proportional to wavenumber with the proportionality half of the ratio of surface tension to solvent viscosity, indicating that the solvent viscosity does affect the stability of a solute-solvent interface. Consequences of our analysis in the context of biomolecular interactions are discussed.

Polypeptide multilayer film co-delivers oppositely-charged drug molecules in sustained manners.

PubMed

Jiang, Bingbing; Defusco, Elizabeth; Li, Bingyun

2010-12-13

The current state-of-the-art for drug-carrying biomedical devices is mostly limited to those that release a single drug. Yet there are many situations in which more than one therapeutic agent is needed. Also, most polyelectrolyte multilayer films intended for drug delivery are loaded with active molecules only during multilayer film preparation. In this paper, we present the integration of capsules as vehicles within polypeptide multilayer films for sustained release of multiple oppositely charged drug molecules using layer-by-layer nanoassembly technology. Calcium carbonate (CaCO(3)) particles were impregnated with polyelectrolytes, shelled with polyelectrolyte multilayers, and then assembled onto polypeptide multilayer films using glutaraldehyde. Capsule-integrated polypeptide multilayer films were obtained after decomposition of CaCO(3) templates. Two oppositely charged drugs were loaded into capsules within polypeptide multilayer films postpreparation based on electrostatic interactions between the drugs and the polyelectrolytes impregnated within capsules. We determined that the developed innovative capsule-integrated polypeptide multilayer films could be used to load multiple drugs of very different properties (e.g., opposite charges) any time postpreparation (e.g., minutes before surgical implantation inside an operating room), and such capsule-integrated films allowed simultaneous delivery of two oppositely charged drug molecules and a sustained (up to two weeks or longer) and sequential release was achieved.

Polypeptide Multilayer Film Co-Delivers Oppositely-Charged Drug Molecules in Sustained Manners

PubMed Central

Jiang, Bingbing; DeFusco, Elizabeth; Li, Bingyun

2010-01-01

The current state-of-the-art for drug-carrying biomedical devices is mostly limited to those that release a single drug. Yet there are many situations in which more than one therapeutic agent is needed. Also, most polyelectrolyte multilayer films intending for drug delivery are loaded with active molecules only during multilayer film preparation. In this paper, we present the integration of capsules as vehicles within polypeptide multilayer films for sustained release of multiple oppositely-charged drug molecules using layer-by-layer nanoassembly technology. Calcium carbonate (CaCO3) particles were impregnated with polyelectrolytes, shelled with polyelectrolyte multilayers, and then assembled onto polypeptide multilayer films using glutaraldehyde. Capsule-integrated polypeptide multilayer films were obtained after decomposition of CaCO3 templates. Two oppositely-charged drugs were loaded into capsules within polypeptide multilayer films post-preparation based on electrostatic interactions between the drugs and the polyelectrolytes impregnated within capsules. We determined that the developed innovative capsule-integrated polypeptide multilayer films could be used to load multiple drugs of very different properties (e.g. opposite charges) any time post-preparation (e.g. minutes before surgical implantation inside an operating room), and such capsule-integrated films allowed simultaneous delivery of two oppositely-charged drug molecules and a sustained (up to two weeks or longer) and sequential release was achieved. PMID:21058719

Free energy of RNA-counterion interactions in a tight-binding model computed by a discrete space mapping

NASA Astrophysics Data System (ADS)

Henke, Paul S.; Mak, Chi H.

2014-08-01

The thermodynamic stability of a folded RNA is intricately tied to the counterions and the free energy of this interaction must be accounted for in any realistic RNA simulations. Extending a tight-binding model published previously, in this paper we investigate the fundamental structure of charges arising from the interaction between small functional RNA molecules and divalent ions such as Mg2+ that are especially conducive to stabilizing folded conformations. The characteristic nature of these charges is utilized to construct a discretely connected energy landscape that is then traversed via a novel application of a deterministic graph search technique. This search method can be incorporated into larger simulations of small RNA molecules and provides a fast and accurate way to calculate the free energy arising from the interactions between an RNA and divalent counterions. The utility of this algorithm is demonstrated within a fully atomistic Monte Carlo simulation of the P4-P6 domain of the Tetrahymena group I intron, in which it is shown that the counterion-mediated free energy conclusively directs folding into a compact structure.

Free energy of RNA-counterion interactions in a tight-binding model computed by a discrete space mapping.

PubMed

Henke, Paul S; Mak, Chi H

2014-08-14

The thermodynamic stability of a folded RNA is intricately tied to the counterions and the free energy of this interaction must be accounted for in any realistic RNA simulations. Extending a tight-binding model published previously, in this paper we investigate the fundamental structure of charges arising from the interaction between small functional RNA molecules and divalent ions such as Mg(2+) that are especially conducive to stabilizing folded conformations. The characteristic nature of these charges is utilized to construct a discretely connected energy landscape that is then traversed via a novel application of a deterministic graph search technique. This search method can be incorporated into larger simulations of small RNA molecules and provides a fast and accurate way to calculate the free energy arising from the interactions between an RNA and divalent counterions. The utility of this algorithm is demonstrated within a fully atomistic Monte Carlo simulation of the P4-P6 domain of the Tetrahymena group I intron, in which it is shown that the counterion-mediated free energy conclusively directs folding into a compact structure.

Structural and electron charge density studies of a nonlinear optical compound 4,4 di-methyl amino cyano biphenyl

NASA Astrophysics Data System (ADS)

Naima, Boubegra; Abdelkader, Chouaih; Mokhtaria, Drissi; Fodil, Hamzaoui

2014-01-01

The 4,4 dimethyl amino cyano biphenyl crystal (DMACB) is characterized by its nonlinear activity. The intra molecular charge transfer of this molecule results mainly from the electronic transmission of the electro-acceptor (cyano) and electro-donor (di-methyl-amino) groups. An accurate electron density distribution around the molecule has been calculated based on a high-resolution X-ray diffraction study. The data were collected at 123 K using graphite-monochromated Mo K α radiation to sin(β)/λ = 1.24 Å-1. The integrated intensities of 13796 reflections were measured and reduced to 6501 independent reflections with I >= 3σ(I). The crystal structure was refined using the experimental model of Hansen and Coppens (1978). The crystal structure has been validated and deposited at the Cambridge Crystallographic Data Centre with the deposition number CCDC 876507. In this article, we present the thermal motion and the structural analysis obtained from the least-square refinement based on F2 and the electron density distribution obtained from the multipolar model.

What Is the Structure of the Naphthalene-Benzene Heterodimer Radical Cation? Binding Energy, Charge Delocalization, and Unexpected Charge-Transfer Interaction in Stacked Dimer and Trimer Radical Cations.

PubMed

Attah, Isaac K; Platt, Sean P; Meot-Ner Mautner, Michael; El-Shall, M Samy; Peverati, Roberto; Head-Gordon, Martin

2015-04-02

The binding energy of the naphthalene(+•)(benzene) heterodimer cation has been determined to be 7.9 ± 1 kcal/mol for C10H8(+•)(C6H6) and 8.1 ± 1 kcal/mol for C10H8(+•)(C6D6) by equilibrium thermochemical measurements using the mass-selected drift cell technique. A second benzene molecule binds to the C10H8(+•)(C6D6) dimer with essentially the same energy (8.4 ± 1 kcal/mol), suggesting that the two benzene molecules are stacked on opposite sides of the naphthalene cation in the (C6D6)C10H8(+•)(C6D6) heterotrimer. The lowest-energy isomers of the C10H8(+•)(C6D6) and (C6D6)C10H8(+•)(C6D6) dimer and trimer calculated using the M11/cc-pVTZ method have parallel stacked structures with enthalpies of binding (-ΔH°) of 8.4 and 9.0 kcal/mol, respectively, in excellent agreement with the experimental values. The stacked face-to-face class of isomers is calculated to have substantial charge-transfer stabilization of about 45% of the total interaction energy despite the large difference between the ionization energies of benzene and naphthalene. Similarly, significant delocalization of the positive charge is found among all three fragments of the (C6D6)C10H8(+•)(C6D6) heterotrimer, thus leaving only 46% of the total charge on the central naphthalene moiety. This unexpectedly high charge-transfer component results in activating two benzene molecules in the naphthalene(+•)(benzene)2 heterotrimer cation to associate with a third benzene molecule at 219 K to form a benzene trimer cation and a neutral naphthalene molecule. The global minimum of the C10H8(+•)(C6H6)2 heterotrimer is found to be the one where the naphthalene cation is sandwiched between two benzene molecules. It is remarkable, and rather unusual, that the binding energy of the second benzene molecule is essentially the same as that of the first. This is attributed to the enhanced charge-transfer interaction in the stacked trimer radical cation.

Host-guest chemistry of dendrimer-drug complexes: 7. Formation of stable inclusions between acetylated dendrimers and drugs bearing multiple charges.

PubMed

Fang, Min; Zhang, Jiahai; Wu, Qinglin; Xu, Tongwen; Cheng, Yiyun

2012-03-15

Drug molecules bearing multiple charges usually form precipitates with cationic dendrimers, which presents a challenge during the preparation of dendrimer inclusions for these drugs. In the present study, fully acetylated polyamidoamine (PAMAM) dendrimers were proposed as stable vehicles for drug molecules bearing two negative charges such as Congo red and indocyanine green. NMR techniques including (1)H NMR and (1)H-(1)H NOESY were used to characterize the host-guest chemistry of acetylated dendrimer and these guest molecules. The cationic PAMAM dendrimer was found to form a precipitate with Congo red and indocyanine green, but the acetylated one avoided the formation of cross-linking structures in aqueous solutions. NOESY studies revealed the encapsulation of Congo red and indocyanine green within the interior cavities of PAMAM dendrimers at mild acidic conditions and acetylated dendrimers show much stronger ability to encapsulate the guest molecules than cationic ones. Also, UV-vis-NIR studies suggest that acetylated dendrimers significantly improve the photostability of indocyanine green and prevent the formation of indocyanine green J-aggregates in aqueous solutions. The present study provides a new insight into dendrimer-based host-guest systems, especially for those guest molecules bearing multiple charges. © 2012 American Chemical Society

Probing protein orientation near charged nanosurfaces for simulation-assisted biosensor design.

PubMed

Cooper, Christopher D; Clementi, Natalia C; Barba, Lorena A

2015-09-28

Protein-surface interactions are ubiquitous in biological processes and bioengineering, yet are not fully understood. In biosensors, a key factor determining the sensitivity and thus the performance of the device is the orientation of the ligand molecules on the bioactive device surface. Adsorption studies thus seek to determine how orientation can be influenced by surface preparation, varying surface charge, and ambient salt concentration. In this work, protein orientation near charged nanosurfaces is obtained under electrostatic effects using the Poisson-Boltzmann equation, in an implicit-solvent model. Sampling the free energy for protein G B1 D4' at a range of tilt and rotation angles with respect to the charged surface, we calculated the probability of the protein orientations and observed a dipolar behavior. This result is consistent with published experimental studies and combined Monte Carlo and molecular dynamics simulations using this small protein, validating our method. More relevant to biosensor technology, antibodies such as immunoglobulin G are still a formidable challenge to molecular simulation, due to their large size. With the Poisson-Boltzmann model, we obtained the probability distribution of orientations for the iso-type IgG2a at varying surface charge and salt concentration. This iso-type was not found to have a preferred orientation in previous studies, unlike the iso-type IgG1 whose larger dipole moment was assumed to make it easier to control. Our results show that the preferred orientation of IgG2a can be favorable for biosensing with positive charge on the surface of 0.05 C/m(2) or higher and 37 mM salt concentration. The results also show that local interactions dominate over dipole moment for this protein. Improving immunoassay sensitivity may thus be assisted by numerical studies using our method (and open-source code), guiding changes to fabrication protocols or protein engineering of ligand molecules to obtain more favorable orientations.

Probing protein orientation near charged nanosurfaces for simulation-assisted biosensor design

NASA Astrophysics Data System (ADS)

Cooper, Christopher D.; Clementi, Natalia C.; Barba, Lorena A.

2015-09-01

Protein-surface interactions are ubiquitous in biological processes and bioengineering, yet are not fully understood. In biosensors, a key factor determining the sensitivity and thus the performance of the device is the orientation of the ligand molecules on the bioactive device surface. Adsorption studies thus seek to determine how orientation can be influenced by surface preparation, varying surface charge, and ambient salt concentration. In this work, protein orientation near charged nanosurfaces is obtained under electrostatic effects using the Poisson-Boltzmann equation, in an implicit-solvent model. Sampling the free energy for protein G B1 D4' at a range of tilt and rotation angles with respect to the charged surface, we calculated the probability of the protein orientations and observed a dipolar behavior. This result is consistent with published experimental studies and combined Monte Carlo and molecular dynamics simulations using this small protein, validating our method. More relevant to biosensor technology, antibodies such as immunoglobulin G are still a formidable challenge to molecular simulation, due to their large size. With the Poisson-Boltzmann model, we obtained the probability distribution of orientations for the iso-type IgG2a at varying surface charge and salt concentration. This iso-type was not found to have a preferred orientation in previous studies, unlike the iso-type IgG1 whose larger dipole moment was assumed to make it easier to control. Our results show that the preferred orientation of IgG2a can be favorable for biosensing with positive charge on the surface of 0.05 C/m2 or higher and 37 mM salt concentration. The results also show that local interactions dominate over dipole moment for this protein. Improving immunoassay sensitivity may thus be assisted by numerical studies using our method (and open-source code), guiding changes to fabrication protocols or protein engineering of ligand molecules to obtain more favorable orientations.

[Diffusion and diffusion-osmosis models of the charged macromolecule transfer in barriers of biosystems].

PubMed

Varakin, A I; Mazur, V V; Arkhipova, N V; Serianov, Iu V

2009-01-01

Mathematical models of the transfer of charged macromolecules have been constructed on the basis of the classical equations of electromigration diffusion of Helmholtz-Smolukhovskii, Goldman, and Goldman-Hodgkin-Katz. It was shown that ion transfer in placental (mimicking lipid-protein barriers) and muscle barriers occurs by different mechanisms. In placental barriers, the electromigration diffusion occurs along lipid-protein channels formed due to the conformational deformation of phospholipid and protein molecules with the coefficients of diffusion D = (2.6-3.6) x 10(-8) cm2/s. The transfer in muscle barriers is due to the migration across charged interfibrillar channels with the negative diffusion activation energy, which is explained by changes in the structure of muscle fibers and expenditures of thermal energy for the extrusion of Cl- from channel walls with the diffusion coefficient D = (6.0-10.0) x 10(-6) cm2/s.

Molecular Model of a Quantum Dot Beyond the Constant Interaction Approximation

NASA Astrophysics Data System (ADS)

Temirov, Ruslan; Green, Matthew F. B.; Friedrich, Niklas; Leinen, Philipp; Esat, Taner; Chmielniak, Pawel; Sarwar, Sidra; Rawson, Jeff; Kögerler, Paul; Wagner, Christian; Rohlfing, Michael; Tautz, F. Stefan

2018-05-01

We present a physically intuitive model of molecular quantum dots beyond the constant interaction approximation. It accurately describes their charging behavior and allows the extraction of important molecular properties that are otherwise experimentally inaccessible. The model is applied to data recorded with a noncontact atomic force microscope on three different molecules that act as a quantum dot when attached to the microscope tip. The results are in excellent agreement with first-principles simulations.

Numerical analysis of ion wind flow using space charge for optimal design

NASA Astrophysics Data System (ADS)

Ko, Han Seo; Shin, Dong Ho; Baek, Soo Hong

2014-11-01

Ion wind flow has been widly studied for its advantages of a micro fluidic device. However, it is very difficult to predict the performance of the ion wind flow for various conditions because of its complicated electrohydrodynamic phenomena. Thus, a reliable numerical modeling is required to design an otimal ion wind generator and calculate velocity of the ion wind for the proper performance. In this study, the numerical modeling of the ion wind has been modified and newly defined to calculate the veloctiy of the ion wind flow by combining three basic models such as electrostatics, electrodynamics and fluid dynamics. The model has included presence of initial space charges to calculate transfer energy between space charges and air gas molecules using a developed space charge correlation. The simulation has been performed for a geometry of a pin to parallel plate electrode. Finally, the results of the simulation have been compared with the experimental data for the ion wind velocity to confirm the accuracy of the modified numerical modeling and to obtain the optimal design of the ion wind generator. This work was supported by the Basic Science Research Program through the National Research Foundation of Korea (NRF) funded by the Korean government (MEST) (No. 2013R1A2A2A01068653).

EUV emission spectra in collisions of highly charged tantalum ions with nitrogen and oxygen molecules

NASA Astrophysics Data System (ADS)

Tanuma, Hajime; Numadate, Naoki; Uchikura, Yoshiyuki; Shimada, Kento; Akutsu, Takuto; Long, Elaine; O'Sullivan, Gerry

2017-10-01

We have performed ion beam collision experiments using multiply charged tantalum ions and observed EUV (extreme ultra-violet) emission spectra in collisions of ions with molecular targets, N2 and O2. Broad UTAs (un-resolved transition arrays) from multiply charged Ta ions were observed, and the mean wavelengths of the UTAs shifted and became shorter at higher charge statea of Ta ions. These UTAs may be attributed to the 4f-5d and 4f-5g transitions. Not only the UTA emission from incident ions, but also the sharp emission lines from multiply charged fragment atomic ions were observed. Production of temporary highly charged molecular ions, their kinetic energy and fragmentation processes have been investigated with coincident detection technique. However, the observation of emission from the fragments might be for the first time. The formation mechanisms of the multiply charged fragment atomic ions from target molecules are discussed.

Understanding charge transport in molecular electronics.

PubMed

Kushmerick, J J; Pollack, S K; Yang, J C; Naciri, J; Holt, D B; Ratner, M A; Shashidhar, R

2003-12-01

For molecular electronics to become a viable technology the factors that control charge transport across a metal-molecule-metal junction need to be elucidated. We use an experimentally simple crossed-wire tunnel junction to interrogate how factors such as metal-molecule coupling, molecular structure, and the choice of metal electrode influence the current-voltage characteristics of a molecular junction.

[Distribution of electric charges in 2 substances inducing tumor cell regression].

PubMed

Smeyers, Y G; Huertas, A

1983-01-01

The charge distribution of anti-cancer molecules 4-thiazolidine-carboxylic acid and 2-amino-2-thiazoline hydrochloride was calculated with a CNDO/2 semiempiral quantum mechanic method. The activity seems to be related with the formation of Zn2+ and Mn2+ ions. Both molecules show local isosterism, origin of their chelating properties.

Phase behavior and structure of stable complexes between a long polyanion and a branched polycation

NASA Astrophysics Data System (ADS)

Mengarelli, Valentina; Zeghal, Mehdi; Auvray, Loïc; Clemens, Daniel

2011-08-01

The association between oppositely charged branched polyethylenimine (BPEI) and polymethacrylic acid (PMA) in the dilute regime is investigated using turbidimetric titration and electrophoretic mobility measurements. The complexation is controlled by tuning continuously the pH-sensitive charge of the polyacid in acidic solution. The formation of soluble and stable positively charged complexes is a cooperative process characterized by the existence of two regimes of weak and strong complexation. In the regime of weak complexation, a long PMA chain overcharged by several BPEI molecules forms a binary complex. As the charge of the polyacid increases, these binary complexes condense at a well defined charge ratio of the mixture to form large positively charged aggregates. The overcharging and the existence of two regimes of complexation are analyzed in the light of recent theories. The structure of the polyelectrolytes is investigated at higher polymer concentration by small angle neutron scattering. Binary complexes of finite size present an open structure where the polyacid chains connecting a small number of BPEI molecules have shrunk slightly. In the condensed complexes, BPEI molecules, wrapped by polyacid chains, form networks of stretched necklaces.

First-Principles Study of Charge Diffusion between Proximate Solid-State Qubits and Its Implications on Sensor Applications

NASA Astrophysics Data System (ADS)

Chou, Jyh-Pin; Bodrog, Zoltán; Gali, Adam

2018-03-01

Solid-state qubits from paramagnetic point defects in solids are promising platforms to realize quantum networks and novel nanoscale sensors. Recent advances in materials engineering make it possible to create proximate qubits in solids that might interact with each other, leading to electron spin or charge fluctuation. Here we develop a method to calculate the tunneling-mediated charge diffusion between point defects from first principles and apply it to nitrogen-vacancy (NV) qubits in diamond. The calculated tunneling rates are in quantitative agreement with previous experimental data. Our results suggest that proximate neutral and negatively charged NV defect pairs can form a NV-NV molecule. A tunneling-mediated model for the source of decoherence of the near-surface NV qubits is developed based on our findings on the interacting qubits in diamond.

Electrostatic coupling of ion pumps.

PubMed

Nieto-Frausto, J; Lüger, P; Apell, H J

1992-01-01

In this paper the electrostatic interactions between membrane-embedded ion-pumps and their consequences for the kinetics of pump-mediated transport processes have been examined. We show that the time course of an intrinsically monomolecular transport reaction can become distinctly nonexponential, if the reaction is associated with charge translocation and takes place in an aggregate of pump molecules. First we consider the electrostatic coupling of a single dimer of ion-pumps embedded in the membrane. Then we apply the treatment to the kinetic analysis of light-driven proton transport by bacteriorhodopsin which forms two-dimensional hexagonal lattices. Finally, for the case of nonordered molecules, we also consider a model in which the pumps are randomly distributed over the nodes of a lattice. Here the average distance is equal to that deduced experimentally and the elemental size of the lattice is the effective diameter of one single pump. This latter model is applied to an aggregate of membrane-embedded Na, K- and Ca-pumps. In all these cases the electrostatic potential considered is the exact solution calculated from the method of electrical images for a plane membrane of finite thickness immersed in an infinite aqueous solution environment. The distributions of charges (ions or charged binding sites) are considered homogeneous or discrete in the membrane and/or in the external solution. In the case of discrete distributions we compare the results from a mean field approximation and a stochastic simulation.

An improved limit on the charge of antihydrogen from stochastic acceleration.

PubMed

Ahmadi, M; Baquero-Ruiz, M; Bertsche, W; Butler, E; Capra, A; Carruth, C; Cesar, C L; Charlton, M; Charman, A E; Eriksson, S; Evans, L T; Evetts, N; Fajans, J; Friesen, T; Fujiwara, M C; Gill, D R; Gutierrez, A; Hangst, J S; Hardy, W N; Hayden, M E; Isaac, C A; Ishida, A; Jones, S A; Jonsell, S; Kurchaninov, L; Madsen, N; Maxwell, D; McKenna, J T K; Menary, S; Michan, J M; Momose, T; Munich, J J; Nolan, P; Olchanski, K; Olin, A; Povilus, A; Pusa, P; Rasmussen, C Ø; Robicheaux, F; Sacramento, R L; Sameed, M; Sarid, E; Silveira, D M; So, C; Tharp, T D; Thompson, R I; van der Werf, D P; Wurtele, J S; Zhmoginov, A I

2016-01-21

Antimatter continues to intrigue physicists because of its apparent absence in the observable Universe. Current theory requires that matter and antimatter appeared in equal quantities after the Big Bang, but the Standard Model of particle physics offers no quantitative explanation for the apparent disappearance of half the Universe. It has recently become possible to study trapped atoms of antihydrogen to search for possible, as yet unobserved, differences in the physical behaviour of matter and antimatter. Here we consider the charge neutrality of the antihydrogen atom. By applying stochastic acceleration to trapped antihydrogen atoms, we determine an experimental bound on the antihydrogen charge, Qe, of |Q| < 0.71 parts per billion (one standard deviation), in which e is the elementary charge. This bound is a factor of 20 less than that determined from the best previous measurement of the antihydrogen charge. The electrical charge of atoms and molecules of normal matter is known to be no greater than about 10(-21)e for a diverse range of species including H2, He and SF6. Charge-parity-time symmetry and quantum anomaly cancellation demand that the charge of antihydrogen be similarly small. Thus, our measurement constitutes an improved limit and a test of fundamental aspects of the Standard Model. If we assume charge superposition and use the best measured value of the antiproton charge, then we can place a new limit on the positron charge anomaly (the relative difference between the positron and elementary charge) of about one part per billion (one standard deviation), a 25-fold reduction compared to the current best measurement.

On the solvation structure of dimethylsulfoxide/water around the phosphatidylcholine head group in solution

NASA Astrophysics Data System (ADS)

Dabkowska, Aleksandra P.; Foglia, Fabrizia; Lawrence, M. Jayne; Lorenz, Christian D.; McLain, Sylvia E.

2011-12-01

The solution structure of the phosphocholine (PC) head group in 1,2-dipropionyl-sn-glycero-3-phosphocholine (C3-PC) in 30 mol. % dimethylsulfoxide (DMSO)-water solutions has been determined by using neutron diffraction enhanced with isotopic substitution in combination with computer simulation techniques. By investigating the atomic scale hydration structure around the PC head group, a unique description of the displacement of water molecules by DMSO molecules is detailed around various locations of the head group. Specifically, DMSO molecules were found to be the most prevalent around the onium portion of the head group, with the dipoles of the DMSO molecules being aligned where the negatively charged oxygen can interact strongly with the positively charged lipid group. The phosphate group is also partially dehydrated by the presence of the DMSO molecules. However, around this group the bulkier positive end of the DMSO dipole is interacting with negatively charged groups of the lipid head group, the DMSO layer shows no obvious ordering as it cannot form hydrogen bonds with the oxygen atoms in the PO4 group such as water molecules can. Interestingly, DMSO-water contacts have also increased in the presence of the lipid molecule relative to DMSO-water contacts observed in pure DMSO/water solutions at similar concentrations.

Surface enhanced Raman scattering of aged graphene: Effects of annealing in vacuum

NASA Astrophysics Data System (ADS)

Wang, Yingying; Ni, Zhenhua; Li, Aizhi; Zafar, Zainab; Zhang, Yan; Ni, Zhonghua; Qu, Shiliang; Qiu, Teng; Yu, Ting; Xiang Shen, Ze

2011-12-01

In this paper, we report a simple method to recover the surface enhanced Raman scattering activity of aged graphene. The Raman signals of Rhodamine molecules absorbed on aged graphene are dramatically increased after vacuum annealing and comparable to those on fresh graphene. Atomic force microscopy measurements indicate that residues on aged graphene surface can efficiently be removed by vacuum annealing, which makes target molecule closely contact with graphene. We also find that the hole doping in graphene will facilitate charge transfer between graphene and molecule. These results confirm the strong Raman enhancement of target molecule absorbed on graphene is due to the charge transfer mechanism.

DFT computational analysis of piracetam.

PubMed

Rajesh, P; Gunasekaran, S; Seshadri, S; Gnanasambandan, T

2014-11-11

Density functional theory calculation with B3LYP using 6-31G(d,p) and 6-31++G(d,p) basis set have been used to determine ground state molecular geometries. The first order hyperpolarizability (β0) and related properties (β, α0 and Δα) of piracetam is calculated using B3LYP/6-31G(d,p) method on the finite-field approach. The stability of molecule has been analyzed by using NBO/NLMO analysis. The calculation of first hyperpolarizability shows that the molecule is an attractive molecule for future applications in non-linear optics. Molecular electrostatic potential (MEP) at a point in the space around a molecule gives an indication of the net electrostatic effect produced at that point by the total charge distribution of the molecule. The calculated HOMO and LUMO energies show that charge transfer occurs within these molecules. Mulliken population analysis on atomic charge is also calculated. Because of vibrational analysis, the thermodynamic properties of the title compound at different temperatures have been calculated. Finally, the UV-Vis spectra and electronic absorption properties are explained and illustrated from the frontier molecular orbitals. Copyright © 2014 Elsevier B.V. All rights reserved.

Contactless experiments on individual DNA molecules show no evidence for molecular wire behavior.

PubMed

Gómez-Navarro, C; Moreno-Herrero, F; de Pablo, P J; Colchero, J; Gómez-Herrero, J; Baró, A M

2002-06-25

A fundamental requirement for a molecule to be considered a molecular wire (MW) is the ability to transport electrical charge with a reasonably low resistance. We have carried out two experiments that measure first, the charge transfer from an electrode to the molecule, and second, the dielectric response of the MW. The latter experiment requires no contacts to either end of the molecule. From our experiments we conclude that adsorbed individual DNA molecules have a resistivity similar to mica, glass, and silicon oxide substrates. Therefore adsorbed DNA is not a conductor, and it should not be considered as a viable candidate for MW applications. Parallel studies on other nanowires, including single-walled carbon nanotubes, showed conductivity as expected.

Study on structures and properties of ammonia clusters (NH3)n (n=1-5) and liquid ammonia in terms of ab initio method and atom-bond electronegativity equalization method ammonia-8P fluctuating charge potential model.

PubMed

Yu, Ling; Yang, Zhong-Zhi

2010-05-07

Structures, binding energies, and vibrational frequencies of (NH(3))(n) (n=2-5) isomers and dynamical properties of liquid ammonia have been explored using a transferable intermolecular potential eight point model including fluctuating charges and flexible body based on a combination of the atom-bond electronegativity equalization and molecular (ABEEM) mechanics (ABEEM ammonia-8P) in this paper. The important feature of this model is to divide the charge sites of one ammonia molecule into eight points region containing four atoms, three sigma bonds, and a lone pair, and allows the charges in system to fluctuate responding to the ambient environment. Due to the explicit descriptions of charges and special treatment of hydrogen bonds, the results of equilibrium geometries, dipole moments, cluster interaction energies, vibrational frequencies for the gas phase of small ammonia clusters, and radial distribution function for liquid ammonia calculated with the ABEEM ammonia-8P potential model are in good agreement with those measured by available experiments and those obtained from high level ab initio calculations. The properties of ammonia dimer are studied in detail involving the structure and one-dimensional, two-dimensional potential energy surface. As for interaction energies, the root mean square deviation is 0.27 kcal/mol, and the linear correlation coefficient reaches 0.994.

Chitosugar translocation by an unexpressed monomeric protein channel

NASA Astrophysics Data System (ADS)

Soysa, H. Sasimali M.; Suginta, Wipa; Moonsap, Watcharaporn; Smith, M. F.

2018-05-01

The outer membrane protein channel Ec ChiP , associated with a silent gene in E . coli, is a monomeric chitoporin. In a glucose-deficient environment, E . coli can express the ChiP gene to exploit chitin degradation products. Single-channel small ion current measurements, which reveal the dynamics of single sugar molecules trapped in channel, are used here to study the exotic transport of chitosugars by E . coli. Molecules escape from the channel on multiple timescales. Voltage-dependent trapping rates observed for charged chitosan molecules, as well as model calculations, indicate that the rapid escape processes are those in which the molecule escapes back to the side of the membrane from which it originated. The probability that a sugar molecule is translocated through the membrane is thus estimated from the current data and the dependence of this translocation probability on the length of the chitosugar molecule and the applied voltage analyzed. The described method for obtaining the translocation probability and related molecular translocation current is applicable to other transport channels.

Single charging events on colloidal particles in a nonpolar liquid with surfactant

NASA Astrophysics Data System (ADS)

Schreuer, Caspar; Vandewiele, Stijn; Brans, Toon; Strubbe, Filip; Neyts, Kristiaan; Beunis, Filip

2018-01-01

Electrical charging of colloidal particles in nonpolar liquids due to surfactant additives is investigated intensively, motivated by its importance in a variety of applications. Most methods rely on average electrophoretic mobility measurements of many particles, which provide only indirect information on the charging mechanism. In the present work, we present a method that allows us to obtain direct information on the charging mechanism, by measuring the charge fluctuations on individual particles with a precision higher than the elementary charge using optical trapping electrophoresis. We demonstrate the capabilities of the method by studying the influence of added surfactant OLOA 11000 on the charging of single colloidal PMMA particles in dodecane. The particle charge and the frequency of charging events are investigated both below and above the critical micelle concentration (CMC) and with or without applying a DC offset voltage. It is found that at least two separate charging mechanisms are present below the critical micelle concentration. One mechanism is a process where the particle is stripped from negatively charged ionic molecules. An increase in the charging frequency with increased surfactant concentration suggests a second mechanism that involves single surfactant molecules. Above the CMC, neutral inverse micelles can also be involved in the charging process.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mani, Tomoyasu; Grills, David C.

Delocalization of charges is one of the factors controlling charge transport in conjugated molecules. It is considered to play an important role in the performance of a wide range of molecular technologies, including organic solar cells and organic electronics. Dimerization reactions are well-suited as a model to investigate intermolecular spatial delocalization of charges. And while dimerization reactions of radical cations are well investigated, studies on radical anions are still scarce. Upon dimerization of radical anions with neutral counterparts, an electron is considered to delocalize over the two molecules. By using time-resolved infrared (TRIR) detection coupled with pulse radiolysis, we showmore » that radical anions of 4-n-hexyl-4'-cyanobiphenyl (6CB) undergo such dimerization reactions, with an electron equally delocalized over the two molecules. We have recently demonstrated that nitrile ν(C≡N) vibrations respond to the degree of electron localization of nitrile-substituted anions: we can quantify the changes in the electronic charges from the neutral to the anion states in the nitriles by monitoring the ν(C≡N) IR shifts. In the first part of this article, we show that the sensitivity of the ν(C≡N) IR shifts does not depend on solvent polarity. In the second part, we describe how probing the shifts of the nitrile IR vibrational band unambiguously confirms the formation of dimer radical anions, with K dim = 3 × 10 4 M –1. IR findings are corroborated by electronic absorption spectroscopy and electronic structure calculations. We find that the presence of a hexyl chain and the formation of π–π interactions are both crucial for dimerization of radical anions of 6CB with neutral 6CB. Our study provides clear evidence of spatial delocalization of electrons over two molecular fragments.« less

Probing Intermolecular Electron Delocalization in Dimer Radical Anions by Vibrational Spectroscopy

DOE PAGES

Mani, Tomoyasu; Grills, David C.

2017-07-05

Delocalization of charges is one of the factors controlling charge transport in conjugated molecules. It is considered to play an important role in the performance of a wide range of molecular technologies, including organic solar cells and organic electronics. Dimerization reactions are well-suited as a model to investigate intermolecular spatial delocalization of charges. And while dimerization reactions of radical cations are well investigated, studies on radical anions are still scarce. Upon dimerization of radical anions with neutral counterparts, an electron is considered to delocalize over the two molecules. By using time-resolved infrared (TRIR) detection coupled with pulse radiolysis, we showmore » that radical anions of 4-n-hexyl-4'-cyanobiphenyl (6CB) undergo such dimerization reactions, with an electron equally delocalized over the two molecules. We have recently demonstrated that nitrile ν(C≡N) vibrations respond to the degree of electron localization of nitrile-substituted anions: we can quantify the changes in the electronic charges from the neutral to the anion states in the nitriles by monitoring the ν(C≡N) IR shifts. In the first part of this article, we show that the sensitivity of the ν(C≡N) IR shifts does not depend on solvent polarity. In the second part, we describe how probing the shifts of the nitrile IR vibrational band unambiguously confirms the formation of dimer radical anions, with K dim = 3 × 10 4 M –1. IR findings are corroborated by electronic absorption spectroscopy and electronic structure calculations. We find that the presence of a hexyl chain and the formation of π–π interactions are both crucial for dimerization of radical anions of 6CB with neutral 6CB. Our study provides clear evidence of spatial delocalization of electrons over two molecular fragments.« less

Investigation of solvent polarity effect on molecular structure and vibrational spectrum of xanthine with the aid of quantum chemical computations.

PubMed

Polat, Turgay; Yıldırım, Gurcan

2014-04-05

The main scope of this study is to determine the effects of 8 solvents on the geometric structure and vibrational spectra of the title compound, xanthine, by means of the DFT/B3LYP level of theory in the combination with the polarizable conductor continuum model (CPCM) for the first time. After determination of the most-steady state (favored structure) of the xanthine molecule, the role of the solvent polarity on the SCF energy (for the molecule stability), atomic charges (for charge distribution) and dipole moments (for molecular charge transfer) belonging to tautomer is discussed in detail. The results obtained indicate not only the presence of the hydrogen bonding and strong intra-molecular charge transfer (ICT) in the compound but the increment of the molecule stability with the solvent polarity, as well. Moreover, it is noted that the optimized geometric parameters and the theoretical vibrational frequencies are in good agreement with the available experimental results found in the literature. In fact, the correlations between the experimental and theoretical findings for the molecular structures improve with the enhancement of the solvent polarity. At the same time, the dimer forms of the xanthine compound are simulated to describe the effect of intermolecular hydrogen bonding on the molecular geometry and vibrational frequencies. It is found that the CO and NH stretching vibrations shift regularly to lower frequency value with higher IR intensity as the dielectric medium enhances systematically due to the intermolecular NH⋯O hydrogen bonds. Theoretical vibrational spectra are also assigned based on the potential energy distribution (PED) using the VEDA 4 program. Copyright © 2013 Elsevier B.V. All rights reserved.

An accurate and linear-scaling method for calculating charge-transfer excitation energies and diabatic couplings

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pavanello, Michele; Van Voorhis, Troy; Visscher, Lucas

2013-02-07

Quantum-mechanical methods that are both computationally fast and accurate are not yet available for electronic excitations having charge transfer character. In this work, we present a significant step forward towards this goal for those charge transfer excitations that take place between non-covalently bound molecules. In particular, we present a method that scales linearly with the number of non-covalently bound molecules in the system and is based on a two-pronged approach: The molecular electronic structure of broken-symmetry charge-localized states is obtained with the frozen density embedding formulation of subsystem density-functional theory; subsequently, in a post-SCF calculation, the full-electron Hamiltonian and overlapmore » matrix elements among the charge-localized states are evaluated with an algorithm which takes full advantage of the subsystem DFT density partitioning technique. The method is benchmarked against coupled-cluster calculations and achieves chemical accuracy for the systems considered for intermolecular separations ranging from hydrogen-bond distances to tens of Angstroms. Numerical examples are provided for molecular clusters comprised of up to 56 non-covalently bound molecules.« less

An accurate and linear-scaling method for calculating charge-transfer excitation energies and diabatic couplings.

PubMed

Pavanello, Michele; Van Voorhis, Troy; Visscher, Lucas; Neugebauer, Johannes

2013-02-07

Quantum-mechanical methods that are both computationally fast and accurate are not yet available for electronic excitations having charge transfer character. In this work, we present a significant step forward towards this goal for those charge transfer excitations that take place between non-covalently bound molecules. In particular, we present a method that scales linearly with the number of non-covalently bound molecules in the system and is based on a two-pronged approach: The molecular electronic structure of broken-symmetry charge-localized states is obtained with the frozen density embedding formulation of subsystem density-functional theory; subsequently, in a post-SCF calculation, the full-electron Hamiltonian and overlap matrix elements among the charge-localized states are evaluated with an algorithm which takes full advantage of the subsystem DFT density partitioning technique. The method is benchmarked against coupled-cluster calculations and achieves chemical accuracy for the systems considered for intermolecular separations ranging from hydrogen-bond distances to tens of Ångstroms. Numerical examples are provided for molecular clusters comprised of up to 56 non-covalently bound molecules.

Rapid preparative separation of monoclonal antibody charge variants using laterally-fed membrane chromatography.

PubMed

Sadavarte, Rahul; Madadkar, Pedram; Filipe, Carlos Dm; Ghosh, Raja

2018-01-15

Monoclonal antibodies undergo various forms of chemical transformation which have been shown to cause loss in efficacy and alteration in pharmacokinetic properties of these molecules. Such modified antibody molecules are known as variants. They also display physical properties such as charge that are different from intact antibody molecules. However, the difference in charge is very subtle and separation based on it is quite challenging. Charge variants are usually separated using ion-exchange column chromatography or isoelectric focusing. In this paper, we report a rapid and scalable method for fractionating monoclonal antibody charge variants, based on the use of cation exchange laterally-fed membrane chromatography (LFMC). Starting with a sample of monoclonal antibody hIgG1-CD4, three well-resolved fractions were obtained using either pH or salt gradient. These fractions were identified as acidic, neutral and basic variants. Each of these fractions contained intact heavy and light chains and so antibody fragmentation had no role in variant generation. The separation was comparable to that using column chromatography but was an order of magnitude faster. Copyright © 2017 Elsevier B.V. All rights reserved.

Adaptive and iterative methods for simulations of nanopores with the PNP-Stokes equations

NASA Astrophysics Data System (ADS)

Mitscha-Baude, Gregor; Buttinger-Kreuzhuber, Andreas; Tulzer, Gerhard; Heitzinger, Clemens

2017-06-01

We present a 3D finite element solver for the nonlinear Poisson-Nernst-Planck (PNP) equations for electrodiffusion, coupled to the Stokes system of fluid dynamics. The model serves as a building block for the simulation of macromolecule dynamics inside nanopore sensors. The source code is released online at http://github.com/mitschabaude/nanopores. We add to existing numerical approaches by deploying goal-oriented adaptive mesh refinement. To reduce the computation overhead of mesh adaptivity, our error estimator uses the much cheaper Poisson-Boltzmann equation as a simplified model, which is justified on heuristic grounds but shown to work well in practice. To address the nonlinearity in the full PNP-Stokes system, three different linearization schemes are proposed and investigated, with two segregated iterative approaches both outperforming a naive application of Newton's method. Numerical experiments are reported on a real-world nanopore sensor geometry. We also investigate two different models for the interaction of target molecules with the nanopore sensor through the PNP-Stokes equations. In one model, the molecule is of finite size and is explicitly built into the geometry; while in the other, the molecule is located at a single point and only modeled implicitly - after solution of the system - which is computationally favorable. We compare the resulting force profiles of the electric and velocity fields acting on the molecule, and conclude that the point-size model fails to capture important physical effects such as the dependence of charge selectivity of the sensor on the molecule radius.

Ligand solvation in molecular docking.

PubMed

Shoichet, B K; Leach, A R; Kuntz, I D

1999-01-01

Solvation plays an important role in ligand-protein association and has a strong impact on comparisons of binding energies for dissimilar molecules. When databases of such molecules are screened for complementarity to receptors of known structure, as often occurs in structure-based inhibitor discovery, failure to consider ligand solvation often leads to putative ligands that are too highly charged or too large. To correct for the different charge states and sizes of the ligands, we calculated electrostatic and non-polar solvation free energies for molecules in a widely used molecular database, the Available Chemicals Directory (ACD). A modified Born equation treatment was used to calculate the electrostatic component of ligand solvation. The non-polar component of ligand solvation was calculated based on the surface area of the ligand and parameters derived from the hydration energies of apolar ligands. These solvation energies were subtracted from the ligand-receptor interaction energies. We tested the usefulness of these corrections by screening the ACD for molecules that complemented three proteins of known structure, using a molecular docking program. Correcting for ligand solvation improved the rankings of known ligands and discriminated against molecules with inappropriate charge states and sizes.

Tuning Charge and Correlation Effects for a Single Molecule on a Graphene Device

NASA Astrophysics Data System (ADS)

Tsai, Hsin-Zon; Wickenburg, Sebastian; Lu, Jiong; Lischner, Johannes; Omrani, Arash A.; Riss, Alexander; Karrasch, Christoph; Jung, Han Sae; Khajeh, Ramin; Wong, Dillon; Watanabe, Kenji; Taniguchi, Takashi; Zettl, Alex; Louie, Steven G.; Crommie, Michael F.

Controlling electronic devices down to the single molecule level is a grand challenge of nanotechnology. Single-molecules have been integrated into devices capable of tuning electronic response, but a drawback for these systems is that their microscopic structure remains unknown due to inability to image molecules in the junction region. Here we present a combined STM and nc-AFM study demonstrating gate-tunable control of the charge state of individual F4TCNQ molecules at the surface of a graphene field effect transistor. This is different from previous studies in that the Fermi level of the substrate was continuously tuned across the molecular orbital energy level. Using STS we have determined the resulting energy level evolution of the LUMO, its associated vibronic modes, and the graphene Dirac point (ED). We show that the energy difference between ED and the LUMO increases as EF is moved away from ED due to electron-electron interactions that renormalize the molecular quasiparticle energy. This is attributed to gate-tunable image-charge screening in graphene and corroborated by ab initio calculations.

Charge-controlled switchable CO adsorption on FeN4 cluster embedded in graphene

NASA Astrophysics Data System (ADS)

Omidvar, Akbar

2018-02-01

Electrical charging of an FeN4 cluster embedded in graphene (FeN4G) is proposed as an approach for electrocatalytically switchable carbon monoxide (CO) adsorption. Using density functional theory (DFT), we found that the CO molecule is strongly adsorbed on the uncharged FeN4G cluster. Our results show that the adsorption energy of a CO molecule on the FeN4G cluster is dramatically decreased by introducing extra electrons into the cluster. Once the charges are removed, the CO molecule is spontaneously adsorbed on the FeN4G absorbent. In the framework of frontier molecular orbital (FMO) analysis, the enhanced sensitivity and reactivity of the FeN4G cluster towards the CO molecule can be interpreted in terms of interaction between the HOMO of CO molecule and the LUMO of FeN4G cluster. Therefore, this approach promises both facile reversibility and tunable kinetics without the need of specific catalysts. Our study indicates that the FeN4G nanomaterial is an excellent absorbent for controllable and reversible capture and release of the CO.

Atomic charges of sulfur in ionic liquids: experiments and calculations.

PubMed

Fogarty, Richard M; Rowe, Rebecca; Matthews, Richard P; Clough, Matthew T; Ashworth, Claire R; Brandt, Agnieszka; Corbett, Paul J; Palgrave, Robert G; Smith, Emily F; Bourne, Richard A; Chamberlain, Thomas W; Thompson, Paul B J; Hunt, Patricia A; Lovelock, Kevin R J

2017-12-14

Experimental near edge X-ray absorption fine structure (NEXAFS) spectra, X-ray photoelectron (XP) spectra and Auger electron spectra are reported for sulfur in ionic liquids (ILs) with a range of chemical structures. These values provide experimental measures of the atomic charge in each IL and enable the evaluation of the suitability of NEXAFS spectroscopy and XPS for probing the relative atomic charge of sulfur. In addition, we use Auger electron spectroscopy to show that when XPS binding energies differ by less than 0.5 eV, conclusions on atomic charge should be treated with caution. Our experimental data provides a benchmark for calculations of the atomic charge of sulfur obtained using different methods. Atomic charges were computed for lone ions and ion pairs, both in the gas phase (GP) and in a solvation model (SMD), with a wide range of ion pair conformers considered. Three methods were used to compute the atomic charges: charges from the electrostatic potential using a grid based method (ChelpG), natural bond orbital (NBO) population analysis and Bader's atoms in molecules (AIM) approach. By comparing the experimental and calculated measures of the atomic charge of sulfur, we provide an order for the sulfur atoms, ranging from the most negative to the most positive atomic charge. Furthermore, we show that both ChelpG and NBO are reasonable methods for calculating the atomic charge of sulfur in ILs, based on the agreement with both the XPS and NEXAFS spectroscopy results. However, the atomic charges of sulfur derived from ChelpG are found to display significant, non-physical conformational dependence. Only small differences in individual atomic charge of sulfur were observed between lone ion (GP) and ion pair IL(SMD) model systems, indicating that ion-ion interactions do not strongly influence individual atomic charges.

The gas-phase absorption spectrum of a neutral GFP model chromophore.

PubMed

Lammich, L; Petersen, M Axman; Nielsen, M Brøndsted; Andersen, L H

2007-01-01

We have studied the gas-phase absorption properties of the green fluorescent protein (GFP) chromophore in its neutral (protonated) charge state in a heavy-ion storage ring. To accomplish this we synthesized a new molecular chromophore with a charged NH(3) group attached to a neutral model chromophore of GFP. The gas-phase absorption cross section of this chromophore molecule as a function of the wavelength is compared to the well-known absorption profile of GFP. The chromophore has a maximum absorption at 415 +/- 5 nm. When corrected for the presence of the charged group attached to the GFP model chromophore, the unperturbed neutral chromophore is predicted to have an absorption maximum at 399 nm in vacuum. This is very close to the corresponding absorption peak of the protein at 397 nm. Together with previous data obtained with an anionic GFP model chromophore, the present data show that the absorption of GFP is primarily determined by intrinsic chromophore properties. In other words, there is strong experimental evidence that, in terms of absorption, the conditions in the hydrophobic interior of this protein are very close to those in vacuum.

Fourier series of atomic radial distribution functions: A molecular fingerprint for machine learning models of quantum chemical properties

DOE Office of Scientific and Technical Information (OSTI.GOV)

von Lilienfeld, O. Anatole; Ramakrishnan, Raghunathan; Rupp, Matthias

We introduce a fingerprint representation of molecules based on a Fourier series of atomic radial distribution functions. This fingerprint is unique (except for chirality), continuous, and differentiable with respect to atomic coordinates and nuclear charges. It is invariant with respect to translation, rotation, and nuclear permutation, and requires no preconceived knowledge about chemical bonding, topology, or electronic orbitals. As such, it meets many important criteria for a good molecular representation, suggesting its usefulness for machine learning models of molecular properties trained across chemical compound space. To assess the performance of this new descriptor, we have trained machine learning models ofmore » molecular enthalpies of atomization for training sets with up to 10 k organic molecules, drawn at random from a published set of 134 k organic molecules with an average atomization enthalpy of over 1770 kcal/mol. We validate the descriptor on all remaining molecules of the 134 k set. For a training set of 10 k molecules, the fingerprint descriptor achieves a mean absolute error of 8.0 kcal/mol. This is slightly worse than the performance attained using the Coulomb matrix, another popular alternative, reaching 6.2 kcal/mol for the same training and test sets. (c) 2015 Wiley Periodicals, Inc.« less

A study of the small-molecule system used to investigate the effect of arginine on antibody elution in hydrophobic charge-induction chromatography.

PubMed

Hirano, Atsushi; Maruyama, Takuya; Shiraki, Kentaro; Arakawa, Tsutomu; Kameda, Tomoshi

2017-01-01

Hydrophobic charge-induction chromatography (HCIC) using 4-mercaptoethylpyridine (4-MEP) as the ligand is used to purify antibodies. The 4-MEP resin ligand has high affinity for antibodies, which makes it difficult to optimize the elution conditions. Recent studies showed that arginine is effective at eluting and purifying antibodies using the HCIC with 4-MEP. In the present study, we investigated the mechanism of the action of arginine on the interaction between butyl gallate (BG) and the 4-MEP resin as a model system for protein-4-MEP interactions. Equilibrium adsorption experiments showed that arginine has a significant effect on the desorption of BG from the 4-MEP resin and, in fact, is found to exhibit a greater effectiveness than guanidine and urea, which are known denaturants. The calculated binding free energy between a BG molecule and a 4-MEP resin ligand molecule using molecular dynamics simulations was qualitatively consistent with the experimental results. A principal component analysis of the simulations showed that arginine molecules intervene in the interaction between the BG and 4-MEP molecules at a distance of 8.5 Å by entering the space between the phenol and pyridine planes. The present results suggest that arginine has a unique mechanism of interaction with the phenol-pyridine system, which should be associated with the effects of arginine on the protein-4-MEP systems. Copyright © 2016 Elsevier Inc. All rights reserved.

Self-Assembling of Tetradecylammonium Chain on Swelling High Charge Micas (Na-Mica-3 and Na-Mica-2): Effect of Alkylammonium Concentration and Mica Layer Charge.

PubMed

Pazos, M Carolina; Cota, Agustín; Osuna, Francisco J; Pavón, Esperanza; Alba, María D

2015-04-21

A family of tetradecylammonium micas is synthesized using synthetic swelling micas with high layer charge (Na(n)Si(8-n)Al(n)Mg6F4O20·XH2O, where n = 2 and 3) exchanged with tetradecylammonium cations. The molecular arrangement of the surfactant is elucidated on the basis of XRD patterns and DTA. The ordering conformation of the surfactant molecules into the interlayer space of micas is investigated by IR/FT, (13)C, (27)Al, and (29)Si MAS NMR. The structural arrangement of the tetradecylammonium cation in the interlayer space of high-charge micas is more sensitive to the effect of the mica layer charge at high concentration. The surfactant arrangement is found to follow the bilayer-paraffin model for all values of layer charge and surfactant concentration. However, at initial concentration below the mica CEC, a lateral monolayer is also observed. The amount of ordered conformation all-trans is directly proportional to the layer charge and surfactant concentration.

Impact of charge carrier injection on single-chain photophysics of conjugated polymers

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hofmann, Felix J.; Vogelsang, Jan, E-mail: jan.vogelsang@physik.uni-regensburg.de; Lupton, John M.

Charges in conjugated polymer materials have a strong impact on the photophysics and their interaction with the primary excited state species has to be taken into account in understanding device properties. Here, we employ single-molecule spectroscopy to unravel the influence of charges on several photoluminescence (PL) observables. The charges are injected either stochastically by a photochemical process or deterministically in a hole-injection sandwich device configuration. We find that upon charge injection, besides a blue-shift of the PL emission and a shortening of the PL lifetime due to quenching and blocking of the lowest-energy chromophores, the non-classical photon arrival time distributionmore » of the multichromophoric chain is modified towards a more classical distribution. Surprisingly, the fidelity of photon antibunching deteriorates upon charging, whereas one would actually expect the opposite: the number of chromophores to be reduced. A qualitative model is presented to explain the observed PL changes. The results are of interest to developing a microscopic understanding of the intrinsic charge-exciton quenching interaction in devices.« less

Control of microtubule trajectory within an electric field by altering surface charge density

PubMed Central

Isozaki, Naoto; Ando, Suguru; Nakahara, Tasuku; Shintaku, Hirofumi; Kotera, Hidetoshi; Meyhöfer, Edgar; Yokokawa, Ryuji

2015-01-01

One of challenges for using microtubules (MTs) driven by kinesin motors in microfluidic environments is to control their direction of movement. Although applying physical biases to rectify MTs is prevalent, it has not been established as a design methodology in conjunction with microfluidic devices. In the future, the methodology is expected to achieve functional motor-driven nanosystems. Here, we propose a method to guide kinesin-propelled MTs in multiple directions under an electric field by designing a charged surface of MT minus ends labeled with dsDNA via a streptavidin-biotin interaction. MTs labeled with 20-bp or 50-bp dsDNA molecules showed significantly different trajectories according to the DNA length, which were in good agreement with values predicted from electrophoretic mobilities measured for their minus ends. Since the effective charge of labeled DNA molecules was equal to that of freely dispersed DNA molecules in a buffer solution, MT trajectory could be estimated by selecting labeling molecules with known charges. Moreover, the estimated trajectory enables to define geometrical sizes of a microfluidic device. This rational molecular design and prediction methodology allows MTs to be guided in multiple directions, demonstrating the feasibility of using molecular sorters driven by motor proteins. PMID:25567007

Control of microtubule trajectory within an electric field by altering surface charge density.

PubMed

Isozaki, Naoto; Ando, Suguru; Nakahara, Tasuku; Shintaku, Hirofumi; Kotera, Hidetoshi; Meyhöfer, Edgar; Yokokawa, Ryuji

2015-01-08

One of challenges for using microtubules (MTs) driven by kinesin motors in microfluidic environments is to control their direction of movement. Although applying physical biases to rectify MTs is prevalent, it has not been established as a design methodology in conjunction with microfluidic devices. In the future, the methodology is expected to achieve functional motor-driven nanosystems. Here, we propose a method to guide kinesin-propelled MTs in multiple directions under an electric field by designing a charged surface of MT minus ends labeled with dsDNA via a streptavidin-biotin interaction. MTs labeled with 20-bp or 50-bp dsDNA molecules showed significantly different trajectories according to the DNA length, which were in good agreement with values predicted from electrophoretic mobilities measured for their minus ends. Since the effective charge of labeled DNA molecules was equal to that of freely dispersed DNA molecules in a buffer solution, MT trajectory could be estimated by selecting labeling molecules with known charges. Moreover, the estimated trajectory enables to define geometrical sizes of a microfluidic device. This rational molecular design and prediction methodology allows MTs to be guided in multiple directions, demonstrating the feasibility of using molecular sorters driven by motor proteins.

Modeling the Dynamics of Gel Electrophorresis in the High School Classroom

ERIC Educational Resources Information Center

Saucedo, Skyler R.

2013-01-01

Gel electrophoresis, used by geneticists and forensic experts alike, is an immensely popular technique that utilizes an electric field to separate molecules and proteins by size and charge. At the microscopic level, a dye or complex protein like DNA is passed through agarose, a gelatinous three-dimensional matrix of pores and nano-sized tunnels.…

Electric-field-driven electron-transfer in mixed-valence molecules

DOE Office of Scientific and Technical Information (OSTI.GOV)

Blair, Enrique P., E-mail: enrique-blair@baylor.edu; Corcelli, Steven A., E-mail: scorcell@nd.edu; Lent, Craig S., E-mail: lent@nd.edu

2016-07-07

Molecular quantum-dot cellular automata is a computing paradigm in which digital information is encoded by the charge configuration of a mixed-valence molecule. General-purpose computing can be achieved by arranging these compounds on a substrate and exploiting intermolecular Coulombic coupling. The operation of such a device relies on nonequilibrium electron transfer (ET), whereby the time-varying electric field of one molecule induces an ET event in a neighboring molecule. The magnitude of the electric fields can be quite large because of close spatial proximity, and the induced ET rate is a measure of the nonequilibrium response of the molecule. We calculate themore » electric-field-driven ET rate for a model mixed-valence compound. The mixed-valence molecule is regarded as a two-state electronic system coupled to a molecular vibrational mode, which is, in turn, coupled to a thermal environment. Both the electronic and vibrational degrees-of-freedom are treated quantum mechanically, and the dissipative vibrational-bath interaction is modeled with the Lindblad equation. This approach captures both tunneling and nonadiabatic dynamics. Relationships between microscopic molecular properties and the driven ET rate are explored for two time-dependent applied fields: an abruptly switched field and a linearly ramped field. In both cases, the driven ET rate is only weakly temperature dependent. When the model is applied using parameters appropriate to a specific mixed-valence molecule, diferrocenylacetylene, terahertz-range ET transfer rates are predicted.« less

Controlling the orbital sequence in individual Cu-phthalocyanine molecules.

PubMed

Uhlmann, C; Swart, I; Repp, J

2013-02-13

We report on the controlled change of the energetic ordering of molecular orbitals. Negatively charged copper(II)phthalocyanine on NaCl/Cu(100) undergoes a Jahn-Teller distortion that lifts the degeneracy of two frontier orbitals. The energetic order of the levels can be controlled by Au and Ag atoms in the vicinity of the molecule. As only one of the states is occupied, the control of the energetic order is accompanied by bistable changes of the charge distribution inside the molecule, rendering it a bistable switch.

Charge Exchange X-Ray Emission due to Highly Charged Ion Collisions with H, He, and H2: Line Ratios for Heliospheric and Interstellar Applications

NASA Astrophysics Data System (ADS)

Cumbee, R. S.; Mullen, P. D.; Lyons, D.; Shelton, R. L.; Fogle, M.; Schultz, D. R.; Stancil, P. C.

2018-01-01

The fundamental collisional process of charge exchange (CX) has been established as a primary source of X-ray emission from the heliosphere, planetary exospheres, and supernova remnants. In this process, X-ray emission results from the capture of an electron by a highly charged ion from a neutral atom or molecule, to form a highly excited, high-charge state ion. As the captured electron cascades down to the lowest energy level, photons are emitted, including X-rays. To provide reliable CX-induced X-ray spectral models to realistically simulate these environments, line ratios and spectra are computed using theoretical CX cross sections obtained with the multi-channel Landau-Zener, atomic-orbital close-coupling, molecular-orbital close-coupling, and classical trajectory Monte Carlo methods for various collisional velocities relevant to astrophysics. X-ray spectra were computed for collisions of bare and H-like C to Al ions with H, He, and H2 with results compared to available experimental data. Using these line ratios, XSPEC models of CX emission in the northeast rim of the Cygnus Loop supernova remnant and the heliosphere are shown as examples with ion velocity dependence.

SERS of semiconducting nanoparticles (TiO{sub 2} hybrid composites).

DOE Office of Scientific and Technical Information (OSTI.GOV)

Musumeci, A.; Gosztola, D.; Schiller, T.

Raman scattering of molecules adsorbed on the surface of TiO{sub 2} nanoparticles was investigated. We find strong enhancement of Raman scattering in hybrid composites that exhibit charge transfer absorption with TiO{sub 2} nanoparticles. An enhancement factor up to {approx}10{sup 3} was observed in the solutions containing TiO{sub 2} nanoparticles and biomolecules, including the important class of neurotransmitters such as dopamine and dopac (3,4-dihydroxy-phenylacetic acid). Only selected vibrations are enhanced, indicating molecular specificity due to distinct binding and orientation of the biomolecules coupled to the TiO{sub 2} surface. All enhanced modes are associated with the asymmetric vibrations of attached molecules thatmore » lower the symmetry of the charge transfer complex. The intensity and the energy of selected vibrations are dependent on the size and shape of nanoparticle support. Moreover, we show that localization of the charge in quantized nanoparticles (2 nm), demonstrated as the blue shift of particle absorption, diminishes SERS enhancement. Importantly, the smallest concentration of adsorbed molecules shows the largest Raman enhancements suggesting the possibility for high sensitivity of this system in the detection of biomolecules that form a charge transfer complex with metal oxide nanoparticles. The wavelength-dependent properties of a hybrid composite suggest a Raman resonant state. Adsorbed molecules that do not show a charge transfer complex show weak enhancements probably due to the dielectric cavity effect.« less

SERS of semiconducting nanoparticles (TIO{sub 2} hybrid composites).

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rajh, T.; Musumeci, A.; Gosztola, D.

Raman scattering of molecules adsorbed on the surface of TiO{sub 2} nanoparticles was investigated. We find strong enhancement of Raman scattering in hybrid composites that exhibit charge transfer absorption with TiO{sub 2} nanoparticles. An enhancement factor up to {approx}10{sup 3} was observed in the solutions containing TiO{sub 2} nanoparticles and biomolecules, including the important class of neurotransmitters such as dopamine and dopac (3,4-dihydroxy-phenylacetic acid). Only selected vibrations are enhanced, indicating molecular specificity due to distinct binding and orientation of the biomolecules coupled to the TiO{sub 2} surface. All enhanced modes are associated with the asymmetric vibrations of attached molecules thatmore » lower the symmetry of the charge transfer complex. The intensity and the energy of selected vibrations are dependent on the size and shape of nanoparticle support. Moreover, we show that localization of the charge in quantized nanoparticles (2 nm), demonstrated as the blue shift of particle absorption, diminishes SERS enhancement. Importantly, the smallest concentration of adsorbed molecules shows the largest Raman enhancements suggesting the possibility for high sensitivity of this system in the detection of biomolecules that form a charge transfer complex with metal oxide nanoparticles. The wavelength-dependent properties of a hybrid composite suggest a Raman resonant state. Adsorbed molecules that do not show a charge transfer complex show weak enhancements probably due to the dielectric cavity effect.« less

A nonadditive methanol force field: Bulk liquid and liquid-vapor interfacial properties via molecular dynamics simulations using a fluctuating charge model

NASA Astrophysics Data System (ADS)

Patel, Sandeep; Brooks, Charles L.

2005-01-01

We study the bulk and interfacial properties of methanol via molecular dynamics simulations using a CHARMM (Chemistry at HARvard Molecular Mechanics) fluctuating charge force field. We discuss the parametrization of the electrostatic model as part of the ongoing CHARMM development for polarizable protein force fields. The bulk liquid properties are in agreement with available experimental data and competitive with existing fixed-charge and polarizable force fields. The liquid density and vaporization enthalpy are determined to be 0.809 g/cm3 and 8.9 kcal/mol compared to the experimental values of 0.787 g/cm3 and 8.94 kcal/mol, respectively. The liquid structure as indicated by radial distribution functions is in keeping with the most recent neutron diffraction results; the force field shows a slightly more ordered liquid, necessarily arising from the enhanced condensed phase electrostatics (as evidenced by an induced liquid phase dipole moment of 0.7 D), although the average coordination with two neighboring molecules is consistent with the experimental diffraction study as well as with recent density functional molecular dynamics calculations. The predicted surface tension of 19.66±1.03 dyn/cm is slightly lower than the experimental value of 22.6 dyn/cm, but still competitive with classical force fields. The interface demonstrates the preferential molecular orientation of molecules as observed via nonlinear optical spectroscopic methods. Finally, via canonical molecular dynamics simulations, we assess the model's ability to reproduce the vapor-liquid equilibrium from 298 to 423 K, the simulation data then used to obtain estimates of the model's critical temperature and density. The model predicts a critical temperature of 470.1 K and critical density of 0.312 g/cm3 compared to the experimental values of 512.65 K and 0.279 g/cm3, respectively. The model underestimates the critical temperature by 8% and overestimates the critical density by 10%, and in this sense is roughly equivalent to the underlying fixed-charge CHARMM22 force field.

A rotation-translation invariant molecular descriptor of partial charges and its use in ligand-based virtual screening

PubMed Central

2014-01-01

Background Measures of similarity for chemical molecules have been developed since the dawn of chemoinformatics. Molecular similarity has been measured by a variety of methods including molecular descriptor based similarity, common molecular fragments, graph matching and 3D methods such as shape matching. Similarity measures are widespread in practice and have proven to be useful in drug discovery. Because of our interest in electrostatics and high throughput ligand-based virtual screening, we sought to exploit the information contained in atomic coordinates and partial charges of a molecule. Results A new molecular descriptor based on partial charges is proposed. It uses the autocorrelation function and linear binning to encode all atoms of a molecule into two rotation-translation invariant vectors. Combined with a scoring function, the descriptor allows to rank-order a database of compounds versus a query molecule. The proposed implementation is called ACPC (AutoCorrelation of Partial Charges) and released in open source. Extensive retrospective ligand-based virtual screening experiments were performed and other methods were compared with in order to validate the method and associated protocol. Conclusions While it is a simple method, it performed remarkably well in experiments. At an average speed of 1649 molecules per second, it reached an average median area under the curve of 0.81 on 40 different targets; hence validating the proposed protocol and implementation. PMID:24887178

Observation of excited state charge transfer with fs/ps-CARS

DOE Office of Scientific and Technical Information (OSTI.GOV)

Blom, Alex Jason

2009-01-01

Excited state charge transfer processes are studied using the fs/ps-CARS probe technique. This probe allows for multiplexed detection of Raman active vibrational modes. Systems studied include Michler's Ketone, Coumarin 120, 4-dimethylamino-4'-nitrostilbene, and several others. The vibrational spectrum of the para di-substituted benzophenone Michler's Ketone in the first excited singlet state is studied for the first time. It is found that there are several vibrational modes indicative of structural changes of the excited molecule. A combined experimental and theoretical approach is used to study the simplest 7-amino-4-methylcoumarin, Coumarin 120. Vibrations observed in FTIR and spontaneous Raman spectra are assigned using densitymore » functional calculations and a continuum solvation model is used to predict how observed modes are affected upon inclusion of a solvent. The low frequency modes of the excited state charge transfer species 4-dimethylamino-4{prime}-nitrostilbene are studied in acetonitrile. Results are compared to previous work on this molecule in the fingerprint region. Finally, several partially completed projects and their implications are discussed. These include the two photon absorption of Coumarin 120, nanoconfinement in cyclodextrin cavities and sensitization of titania nanoparticles.« less

A dipole-bound dianion

NASA Astrophysics Data System (ADS)

Skurski, Piotr; Simons, Jack

2000-04-01

The possibility of binding two electrons by the dipole potential of a molecule was examined earlier by us using model potentials. That study suggested that large dipole moments μ=qR and large charge separation distances R (or equivalently large charges q) would be required to achieve binding two electrons. For example, even with a charge q=1.5 a.u. which might be achieved using di- or tri-valent cations, a dipole moment exceeding 15.922 D is needed. The presence of inner-shell electrons even further increases the value of μ that is required because the dipole-bound electrons' orbital must be orthogonal to and excluded from such inner shells. In the present work, we discuss our efforts to find a real molecule that can actually bind two electrons to a single dipole site. Numerical results are presented for the mono- and dianions of a double 5-member carbon ring system substituted with a Ca atom and three superhalogen -PF5 groups. The dianion of this molecule is found to be geometrically stable and to have a vertical electron detachment energy of ca. 0.8 eV. Its two excess electrons occupy the same fully symmetric a1 molecular orbital localized at the electropositive Ca end of the neutral system as is routinely observed in dipole-bound monoanions. Although our final candidate is chemically unusual, it is hoped that our predictions about it will encourage others to search for more synthetically tractable alternatives.

Time-dependent transition density matrix for visualizing charge-transfer excitations in photoexcited organic donor-acceptor systems

NASA Astrophysics Data System (ADS)

Li, Yonghui; Ullrich, Carsten

2013-03-01

The time-dependent transition density matrix (TDM) is a useful tool to visualize and interpret the induced charges and electron-hole coherences of excitonic processes in large molecules. Combined with time-dependent density functional theory on a real-space grid (as implemented in the octopus code), the TDM is a computationally viable visualization tool for optical excitation processes in molecules. It provides real-time maps of particles and holes which gives information on excitations, in particular those that have charge-transfer character, that cannot be obtained from the density alone. Some illustration of the TDM and comparison with standard density difference plots will be shown for photoexcited organic donor-acceptor molecules. This work is supported by NSF Grant DMR-1005651

Current at Metal-Organic Interfaces

NASA Astrophysics Data System (ADS)

Kern, Klaus

2012-02-01

Charge transport through atomic and molecular constrictions greatly affects the operation and performance of organic electronic devices. Much of our understanding of the charge injection and extraction processes in these systems relays on our knowledge of the electronic structure at the metal-organic interface. Despite significant experimental and theoretical advances in studying charge transport in nanoscale junctions, a microscopic understanding at the single atom/molecule level is missing. In the present talk I will present our recent results to probe directly the nanocontact between single molecules and a metal electrode using scanning probe microscopy and spectroscopy. The experiments provide unprecedented microscopic details of single molecule and atom junctions and open new avenues to study quantum critical and many body phenomena at the atomic scale. Implications for energy conversion devices and carbon based nanoelectronics will also be discussed.

Thermally induced charge current through long molecules

NASA Astrophysics Data System (ADS)

Zimbovskaya, Natalya A.; Nitzan, Abraham

2018-01-01

In this work, we theoretically study steady state thermoelectric transport through a single-molecule junction with a long chain-like bridge. Electron transmission through the system is computed using a tight-binding model for the bridge. We analyze dependences of thermocurrent on the bridge length in unbiased and biased systems operating within and beyond the linear response regime. It is shown that the length-dependent thermocurrent is controlled by the lineshape of electron transmission in the interval corresponding to the HOMO/LUMO transport channel. Also, it is demonstrated that electron interactions with molecular vibrations may significantly affect the length-dependent thermocurrent.

Direct Observation of Azimuthal Correlations between DNA in Hydrated Aggregates

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kornyshev, Alexei A.; Lee, Dominic J.; Wynveen, Aaron

2005-09-30

This study revisits the classical x-ray diffraction patterns from hydrated, noncrystalline fibers originally used to establish the helical structure of DNA. We argue that changes in these diffraction patterns with DNA packing density reveal strong azimuthally dependent interactions between adjacent molecules up to {approx}40 A interaxial or {approx}20 A surface-to-surface separations. These interactions appear to force significant torsional 'straightening' of DNA and strong azimuthal alignment of nearest neighbor molecules. The results are in good agreement with the predictions of recent theoretical models relating DNA-DNA interactions to the helical symmetry of their surface charge patterns.

Conformational sensitivity of conjugated poly(ethylene oxide)-poly(amidoamine) molecules to cations adducted upon electrospray ionization - a mass spectrometry, ion mobility and molecular modeling study.

PubMed

Tintaru, Aura; Chendo, Christophe; Wang, Qi; Viel, Stéphane; Quéléver, Gilles; Peng, Ling; Posocco, Paola; Pricl, Sabrina; Charles, Laurence

2014-01-15

Tandem mass spectrometry and ion mobility spectrometry experiments were performed on multiply charged molecules formed upon conjugation of a poly(amidoamine) (PAMAM) dendrimer with a poly(ethylene oxide) (PEO) linear polymer to evidence any conformational modification as a function of their charge state (2+ to 4+) and of the adducted cation (H(+)vs Li(+)). Experimental findings were rationalized by molecular dynamics simulations. The G0 PAMAM head-group could accommodate up to three protons, with protonated terminal amine group enclosed in a pseudo 18-crown-6 ring formed by the PEO segment. This particular conformation enabled a hydrogen bond network which allowed long-range proton transfer to occur during collisionally activated dissociation. In contrast, lithium adduction was found to mainly occur onto oxygen atoms of the polyether, each Li(+) cation being coordinated by a 12-crown-4 pseudo structure. As a result, for the studied polymeric segment (Mn=1500gmol(-1)), PEO-PAMAM hybrid molecules exhibited a more expanded shape when adducted to lithium as compared to proton. Copyright © 2013 Elsevier B.V. All rights reserved.

The voltage-dependent anion channel as a biological transistor: theoretical considerations.

PubMed

Lemeshko, V V; Lemeshko, S V

2004-07-01

The voltage-dependent anion channel (VDAC) is a porin of the mitochondrial outer membrane with a bell-shaped permeability-voltage characteristic. This porin restricts the flow of negatively charged metabolites at certain non-zero voltages, and thus might regulate their flux across the mitochondrial outer membrane. Here, we have developed a mathematical model illustrating the possibility of interaction between two steady-state fluxes of negatively charged metabolites circulating across the VDAC in a membrane. The fluxes interact by contributing to generation of the membrane electrical potential with subsequent closure of the VDAC. The model predicts that the VDAC might function as a single-molecule biological transistor and amplifier, because according to the obtained calculations a small change in the flux of one pair of different negatively charged metabolites causes a significant modulation of a more powerful flux of another pair of negatively charged metabolites circulating across the same membrane with the VDAC. Such transistor-like behavior of the VDAC in the mitochondrial outer membrane might be an important principle of the cell energy metabolism regulation under some physiological conditions.

Vibrational spectroscopic investigation and normal coordinate analysis of the fibrate hypolipidemic agent 5-(2,5-dimethylphenoxy)-2,2-dimethyl pentanoic acid (Gemfibrozil)

NASA Astrophysics Data System (ADS)

Priya, M. Siva; Benitta, T. Asenath; James, C.

2011-03-01

Colorless crystals of 5-(2,5-dimethylphenoxy)-2,2-dimethyl pentanoic acid were grown by slow evaporation method and the FT-IR and FT-Raman spectra of the sample were recorded in the region 4000-450 cm -1 and 4000-50 cm -1 respectively. Molecular structure is optimized with the help of B3LYP/6-31G (d) density functional theory method. Stability of the molecule arising from hyperconjugation and charge delocalization is confirmed by the natural bond orbital analysis (NBO). The results show that electron density (ED) in the σ ∗ antibonding orbitals and E (2) energies confirms the occurrence of intra-molecular charge transfer (ICT) within the molecule. The assignments of the vibrational spectra have been carried out with the help of Normal coordinate analysis following the scaled quantum mechanical force field (SQMFF) methodology. Mulliken population analysis on atomic charges is also calculated. The calculated HOMO and LUMO energy gap shows that charge transfer occurs within the molecule.

Ionization in atmospheres of brown dwarfs and extrasolar planets VI: Properties of large-scale discharge events

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bailey, R. L.; Helling, Ch.; Hodosán, G.

2014-03-20

Mineral clouds in substellar atmospheres play a special role as a catalyst for a variety of charge processes. If clouds are charged, the surrounding environment becomes electrically activated, and ensembles of charged grains are electrically discharging (e.g., by lightning), which significantly influences the local chemistry creating conditions similar to those thought responsible for life in early planetary atmospheres. We note that such lightning discharges contribute also to the ionization state of the atmosphere. We apply scaling laws for electrical discharge processes from laboratory measurements and numerical experiments to DRIFT-PHOENIX model atmosphere results to model the discharge's propagation downward (as lightning)more » and upward (as sprites) through the atmospheric clouds. We evaluate the spatial extent and energetics of lightning discharges. The atmospheric volume affected (e.g., by increase of temperature or electron number) is larger in a brown dwarf atmosphere (10{sup 8}-10{sup 10} m{sup 3}) than in a giant gas planet (10{sup 4}-10{sup 6} m{sup 3}). Our results suggest that the total dissipated energy in one event is <10{sup 12} J for all models of initial solar metallicity. First attempts to show the influence of lightning on the local gas phase indicate an increase of small carbohydrate molecules like CH and CH{sub 2} at the expense of CO and CH{sub 4}. Dust-forming molecules are destroyed and the cloud particle properties are frozen in unless enough time is available for complete evaporation. We summarize instruments potentially suitable to observe lightning on extrasolar objects.« less

Single-molecule interfacial electron transfer dynamics in solar energy conversion

NASA Astrophysics Data System (ADS)

Dhital, Bharat

This dissertation work investigated the parameters affecting the interfacial electron transfer (ET) dynamics in dye-semiconductor nanoparticles (NPs) system by using single-molecule fluorescence spectroscopy and imaging combined with electrochemistry. The influence of the molecule-substrate electronic coupling, the molecular structure, binding geometry on the surface and the molecule-attachment surface chemistry on interfacial charge transfer processes was studied on zinc porphyrin-TiO2 NP systems. The fluorescence blinking measurement on TiO2 NP demonstrated that electronic coupling regulates dynamics of charge transfer processes at the interface depending on the conformation of molecule on the surface. Moreover, semiconductor surface charge induced electronic coupling of molecule which is electrostatically adsorbed on the semiconductor surface also predominantly alters the ET dynamics. Furthermore, interfacial electric field and electron accepting state density dependent ET dynamics has been dissected in zinc porphyrin-TiO2 NP system by observing the single-molecule fluorescence blinking dynamics and fluorescence lifetime with and without applied bias. The significant difference in fluorescence fluctuation and lifetime suggested the modulation of charge transfer dynamics at the interface with external electric field perturbation. Quasi-continuous distribution of fluorescence intensity with applied negative potential was attributed to the faster charge recombination due to reduced density of electron accepting states. The driving force and electron accepting state density ET dependent dynamics has also been probed in zinc porphyrin-TiO2 NP and zinc porphyrin-indium tin oxide (ITO) systems. Study of a molecule adsorbed on two different semiconductors (ITO and TiO2), with large difference in electron densities and distinct driving forces, allows us to observe the changes in rates of back electron transfer process reflected by the suppressed fluorescence blinking of molecule on ITO surface. Finally, the electric field effect on the interface properties has been probed by using surface-enhanced Raman spectroscopy and supported by density functional theory calculations in alizarin-TiO2 system. The perturbation, created by the external potential, has been observed to cause a shift and/or splitting interfacial bond vibrational mode, typical indicator of the coupling energy changes between alizarin and TiO2. Such splitting provides evidence for electric field-dependent electronic coupling changes that have a significant impact on the interfacial electron transfer dynamics.

Single-Molecule Electronic Measurements with Metal Electrodes

ERIC Educational Resources Information Center

Lindsay, Stuart

2005-01-01

A review of concepts like tunneling through a metal-molecule-metal-junction, contrast with electrochemical and optical-charge injection, strong-coupling limit, calculations of tunnel transport, electron transfer through Redox-active molecules is presented. This is followed by a discussion of experimental approaches for single-molecule measurements.

Single molecule transistor based nanopore for the detection of nicotine

NASA Astrophysics Data System (ADS)

Ray, S. J.

2014-12-01

A nanopore based detection methodology was proposed and investigated for the detection of Nicotine. This technique uses a Single Molecular Transistor working as a nanopore operational in the Coulomb Blockade regime. When the Nicotine molecule is pulled through the nanopore area surrounded by the Source(S), Drain (D), and Gate electrodes, the charge stability diagram can detect the presence of the molecule and is unique for a specific molecular structure. Due to the weak coupling between the different electrodes which is set by the nanopore size, the molecular energy states stay almost unaffected by the electrostatic environment that can be realised from the charge stability diagram. Identification of different orientation and position of the Nicotine molecule within the nanopore area can be made from specific regions of overlap between different charge states on the stability diagram that could be used as an electronic fingerprint for detection. This method could be advantageous and useful to detect the presence of Nicotine in smoke which is usually performed using chemical chromatography techniques.

The tilt-dependent potential of mean force of a pair of DNA oligomers from all-atom molecular dynamics simulations

DOE PAGES

Cortini, Ruggero; Cheng, Xiaolin; Smith, Jeremy C.

2017-01-16

Electrostatic interactions between DNA molecules have been extensively studied experimentally and theoretically, but several aspects (e.g. its role in determining the pitch of the cholesteric DNA phase) still remain unclear. Here, we performed large-scale all-atom molecular dynamics simulations in explicit water and 150 mM sodium chloride, to reconstruct the potential of mean force (PMF) of two DNA oligomers 24 base pairs long as a function of their interaxial angle and intermolecular distance. We find that the potential of mean force is dominated by total DNA charge, and not by the helical geometry of its charged groups. The theory of homogeneously charged cylinders fits well all our simulation data, and the fit yields the optimal value of the total compensated charge on DNA to ≈65% of its total fixed charge (arising from the phosphorous atoms), close to the value expected from Manning's theory of ion condensation. The PMF calculated from our simulations does not show a significant dependence on the handedness of the angle between the two DNA molecules, or its size is on the order ofmore » $$1{{k}_{\\text{B}}}T$$ . Thermal noise for molecules of the studied length seems to mask the effect of detailed helical charge patterns of DNA. The fact that in monovalent salt the effective interaction between two DNA molecules is independent on the handedness of the tilt may suggest that alternative mechanisms are required to understand the cholesteric phase of DNA.« less

The tilt-dependent potential of mean force of a pair of DNA oligomers from all-atom molecular dynamics simulations

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cortini, Ruggero; Cheng, Xiaolin; Smith, Jeremy C.

Electrostatic interactions between DNA molecules have been extensively studied experimentally and theoretically, but several aspects (e.g. its role in determining the pitch of the cholesteric DNA phase) still remain unclear. Here, we performed large-scale all-atom molecular dynamics simulations in explicit water and 150 mM sodium chloride, to reconstruct the potential of mean force (PMF) of two DNA oligomers 24 base pairs long as a function of their interaxial angle and intermolecular distance. We find that the potential of mean force is dominated by total DNA charge, and not by the helical geometry of its charged groups. The theory of homogeneously charged cylinders fits well all our simulation data, and the fit yields the optimal value of the total compensated charge on DNA to ≈65% of its total fixed charge (arising from the phosphorous atoms), close to the value expected from Manning's theory of ion condensation. The PMF calculated from our simulations does not show a significant dependence on the handedness of the angle between the two DNA molecules, or its size is on the order ofmore » $$1{{k}_{\\text{B}}}T$$ . Thermal noise for molecules of the studied length seems to mask the effect of detailed helical charge patterns of DNA. The fact that in monovalent salt the effective interaction between two DNA molecules is independent on the handedness of the tilt may suggest that alternative mechanisms are required to understand the cholesteric phase of DNA.« less

Intermolecular Interactions and Electrostatic Properties of the [beta]-Hydroquinone Apohost: Implications for Supramolecular Chemistry

DOE Office of Scientific and Technical Information (OSTI.GOV)

Clausen, Henrik F.; Chen, Yu-Sheng; Jayatilaka, Dylan

2012-02-07

The crystal structure of the {beta}-polymorph of hydroquinone ({beta}-HQ), the apohost of a large family of clathrates, is reported with a specific focus on intermolecular interactions and the electrostatic nature of its cavity. Hirshfeld surface analysis reveals subtle close contacts between two interconnecting HQ networks, and the local packing and related close contacts were examined by breakdown of the fingerprint plot. An experimental multipole model containing anisotropic thermal parameters for hydrogen atoms has been successfully refined against 15(2) K single microcrystal synchrotron X-ray diffraction data. The experimental electron density model has been compared with a theoretical electron density calculated withmore » the molecule embedded in its own crystal field. Hirshfeld charges, interaction energies and the electrostatic potential calculated for both models are qualitatively in good agreement, but small differences in the electrostatic potential persist due to charge transfer from all hydrogen atoms to the oxygen atoms in the theoretical model. The electrostatic potential in the center of the cavity is positive, very shallow and highly symmetric, suggesting that the inclusion of polar molecules in the void will involve a balance between opposing effects. The electric field is by symmetry zero in the center of the cavity, increasing to a value of 0.0185 e/{angstrom}{sup 2} (0.27 V/{angstrom}) 1 {angstrom} along the 3-fold axis and 0.0105 e/{angstrom}{sup 2} (0.15 V/{angstrom}) 1 {angstrom} along the perpendicular direction. While these values are substantial in a macroscopic context, they are quite small for a molecular cavity and are not expected to strongly polarize a guest molecule.« less

Transition from direct to inverted charge transport Marcus regions in molecular junctions via molecular orbital gating

NASA Astrophysics Data System (ADS)

Yuan, Li; Wang, Lejia; Garrigues, Alvar R.; Jiang, Li; Annadata, Harshini Venkata; Anguera Antonana, Marta; Barco, Enrique; Nijhuis, Christian A.

2018-04-01

Solid-state molecular tunnel junctions are often assumed to operate in the Landauer regime, which describes essentially activationless coherent tunnelling processes. In solution, on the other hand, charge transfer is described by Marcus theory, which accounts for thermally activated processes. In practice, however, thermally activated transport phenomena are frequently observed also in solid-state molecular junctions but remain poorly understood. Here, we show experimentally the transition from the Marcus to the inverted Marcus region in a solid-state molecular tunnel junction by means of intra-molecular orbital gating that can be tuned via the chemical structure of the molecule and applied bias. In the inverted Marcus region, charge transport is incoherent, yet virtually independent of temperature. Our experimental results fit well to a theoretical model that combines Landauer and Marcus theories and may have implications for the interpretation of temperature-dependent charge transport measurements in molecular junctions.

A simple method for the fast calculation of charge redistribution of solutes in an implicit solvent model

NASA Astrophysics Data System (ADS)

Dias, L. G.; Shimizu, K.; Farah, J. P. S.; Chaimovich, H.

2002-09-01

We propose and demonstrate the usefulness of a method, defined as generalized Born electronegativity equalization method (GBEEM) to estimate solvent-induced charge redistribution. The charges obtained by GBEEM, in a representative series of small organic molecules, were compared to PM3-CM1 charges in vacuum and in water. Linear regressions with appropriate correlation coefficients and standard deviations between GBEEM and PM3-CM1 methods were obtained ( R=0.94,SD=0.15, Ftest=234, N=32, in vacuum; R=0.94,SD=0.16, Ftest=218, N=29, in water). In order to test the GBEEM response when intermolecular interactions are involved we calculated a water dimer in dielectric water using both GBEEM and PM3-CM1 and the results were similar. Hence, the method developed here is comparable to established calculation methods.

Ionization, evaporation and fragmentation of C60 in collisions with highly charged C, O and F ions—effect of projectile charge state.

NASA Astrophysics Data System (ADS)

Kelkar, A. H.; Misra, D.; Tribedi, L. C.

2007-09-01

We study the various inelastic processes such ionization, fragmentation and evaporation of C60 molecule in collisions with fast heavy ions. We have used 2.33 MeV/u C, O and F projectile ion beams. Various ionization and fragmentation products were detected using time-of-flight mass spectrometer. The multiply charged C60r+ ions were detected for maximum r = 4. The projectile charge state (qp) dependence of the single and double ionization cross sections is well reproduced by a model based on the giant dipole plasmon resonance (GDPR). The qp-dependence of the fragmentation yields, was found to be linear. Variation of relative yields of the evaporation products of C602+ (i.e. C582+, C562+ etc) and C603+ (i.e. C583+, C563+ etc) with qp has also been investigated for various projectiles.

Fluorination-enabled optimal morphology leads to over 11% efficiency for inverted small-molecule organic solar cells

PubMed Central

Deng, Dan; Zhang, Yajie; Zhang, Jianqi; Wang, Zaiyu; Zhu, Lingyun; Fang, Jin; Xia, Benzheng; Wang, Zhen; Lu, Kun; Ma, Wei; Wei, Zhixiang

2016-01-01

Solution-processable small molecules for organic solar cells have attracted intense attention for their advantages of definite molecular structures compared with their polymer counterparts. However, the device efficiencies based on small molecules are still lower than those of polymers, especially for inverted devices, the highest efficiency of which is <9%. Here we report three novel solution-processable small molecules, which contain π-bridges with gradient-decreased electron density and end acceptors substituted with various fluorine atoms (0F, 1F and 2F, respectively). Fluorination leads to an optimal active layer morphology, including an enhanced domain purity, the formation of hierarchical domain size and a directional vertical phase gradation. The optimal morphology balances charge separation and transfer, and facilitates charge collection. As a consequence, fluorinated molecules exhibit excellent inverted device performance, and an average power conversion efficiency of 11.08% is achieved for a two-fluorine atom substituted molecule. PMID:27991486

Characterizing and engineering tunable spin functionality inside indium arsenide/gallium arsenide quantum dot molecules

NASA Astrophysics Data System (ADS)

Liu, Weiwen

The continual downsizing of the basic functional units used in the electronics industry has motivated the study of the quantum computation and related topics. To overcome the limitations of classical physics and engineering, some unique quantum mechanical features, especially entanglement and superpositions have begun to be considered as important properties for future bits. Including these quantum mechanical features is attractive because the ability to utilize quantum mechanics can dramatically enhance computational power. Among the various ways of constructing the basic building blocks for quantum computation, we are particularly interested in using spins inside epitaxially grown InAs/GaAs quantum dot molecules as quantum bits (qubits). The ability to design and engineer nanostructures with tailored quantum properties is critical to engineering quantum computers and other novel electro-optical devices and is one of the key challenges for scaling up new ideas for device application. In this thesis, we will focus on how the structure and composition of quantum dot molecules can be used to control spin properties and charge interactions. Tunable spin and charge properties can enable new, more scalable, methods of initializing and manipulating quantum information. In this thesis, we demonstrate one method to enable electric-field tunability of Zeeman splitting for a single electron spin inside a quantum dot molecules by using heterostructure engineering techniques to modify the barrier that separates quantum dots. We describe how these structural changes to the quantum dot molecules also change charge interactions and propose ways to use this effect to enable accurate measurement of coulomb interactions and possibly charge occupancy inside these complicated quantum dot molecules.

Vibrational spectroscopic and DFT calculation studies of 2-amino-7-bromo-5-oxo-[1]benzopyrano [2,3-b]pyridine-3 carbonitrile

NASA Astrophysics Data System (ADS)

Premkumar, S.; Jawahar, A.; Mathavan, T.; Kumara Dhas, M.; Milton Franklin Benial, A.

2015-03-01

The vibrational spectra of 2-amino-7-bromo-5-oxo-[1]benzopyrano [2,3-b]pyridine-3 carbonitrile were recorded using fourier transform-infrared and fourier transform-Raman spectrometer. The optimized structural parameters, vibrational frequencies, Mulliken atomic charge distribution, frontier molecular orbitals, thermodynamic properties, temperature dependence of thermodynamic parameters, first order hyperpolarizability and natural bond orbital calculations of the molecule were performed using the Gaussian 09 program. The vibrational frequencies were assigned on the basis of potential energy distribution calculation using the VEDA 4.0 program. The calculated first order hyperpolarizability of ABOBPC molecule was obtained as 6.908 × 10-30 issue, which was 10.5 times greater than urea. The nonlinear optical activity of the molecule was also confirmed by the frontier molecular orbitals and natural bond orbital analysis. The frontier molecular orbitals analysis shows that the lower energy gap of the molecule, which leads to the higher value of first order hyperpolarizability. The natural bond orbital analysis indicates that the nonlinear optical activity of the molecule arises due to the π → π∗ transitions. The Mulliken atomic charge distribution confirms the presence of intramolecular charge transfer within the molecule. The reactive site of the molecule was predicted from the molecular electrostatic potential contour map. The values of thermo dynamic parameters were increasing with increasing temperature.

Electrospray ionization of uranyl-citrate complexes

NASA Astrophysics Data System (ADS)

Somogyi, Árpád; Pasilis, Sofie P.; Pemberton, Jeanne E.

2007-09-01

Results presented here demonstrate the usefulness of electrospray ionization and gas-phase ion-molecule reactions to predict structural and electronic differences in complex inorganic ions. Electrospray ionization of uranyl citrate solutions generates positively and negatively charged ions that participate in further ion-molecule reactions in 3D ion trap and FT-ICR mass analyzers. Most ions observed are derived from the major solution uranyl-citrate complexes and involve species of {(UO2)2Cit2}2-, (UO2)3Cit2, and {(UO2)3Cit3}3-, where Cit indicates the citrate trianion, C6H5O73-. In a 3D ion trap operated at relatively high pressure, complex adducts containing solvent molecules, alkali and ammonium cations, and nitrate or chloride anions are dominant, and proton/alkali cation (Na+, K+) exchange is observed for up to six exchangeable protons in an excess of alkali cations. Adduct formation in a FT-ICR cell that is operated at lower pressures is less dominant, and direct detection of positive and negative ions of the major solution complexes is possible. Multiply charged ions are also detected, suggesting the presence of uranium in different oxidation states. Changes in uranium oxidation state are detected by He-CID and SORI-CID fragmentation, and certain fragments undergo association reactions in trapping analyzers, forming "exotic" species such as [(UO2)4O3]-, [(UO2)4O4]-, and [(UO2)4O5]-. Ion-molecule reactions with D2O in the FT-ICR cell indicate substantial differences in H/D exchange rate and D2O accommodation for different ion structures and charge states. Most notably, the positively charged ions [H2(UO2)2Cit2(H)]+ and [(UO2)2(Cit)]+ accommodate two and three D2O molecules, respectively, which reflects well the structural differences, i.e., tighter uranyl-citrate coordination in the former ion than in the latter. The corresponding negatively charged ions accommodate zero or two D2O molecules, which can be rationalized using suggested solution phase structures and charge state distributions.

Release of Native-like Gaseous Proteins from Electrospray Droplets via the Charged Residue Mechanism: Insights from Molecular Dynamics Simulations.

PubMed

McAllister, Robert G; Metwally, Haidy; Sun, Yu; Konermann, Lars

2015-10-07

The mechanism whereby gaseous protein ions are released from charged solvent droplets during electrospray ionization (ESI) remains a matter of debate. Also, it is unclear to what extent electrosprayed proteins retain their solution structure. Molecular dynamics (MD) simulations offer insights into the temporal evolution of protein systems. Surprisingly, there have been no all-atom simulations of the protein ESI process to date. The current work closes this gap by investigating the behavior of protein-containing aqueous nanodroplets that carry excess positive charge. We focus on "native ESI", where proteins initially adopt their biologically active solution structures. ESI proceeds while the protein remains entrapped within the droplet. Protein release into the gas phase occurs upon solvent evaporation to dryness. Droplet shrinkage is accompanied by ejection of charge carriers (Na(+) for the conditions chosen here), keeping the droplet at ∼85% of the Rayleigh limit throughout its life cycle. Any remaining charge carriers bind to the protein as the final solvent molecules evaporate. The outcome of these events is largely independent of the initial protein charge and the mode of charge carrier binding. ESI charge states and collision cross sections of the MD structures agree with experimental data. Our results confirm the Rayleigh/charged residue model (CRM). Field emission of excess Na(+) plays an ancillary role by governing the net charge of the shrinking droplet. Models that envision protein ejection from the droplet are not supported. Most nascent CRM ions retain native-like conformations. For unfolded proteins ESI likely proceeds along routes that are different from the native state mechanism explored here.

The importance of electrostatic potential in the interaction of sweet proteins with the sweet taste receptor.

PubMed

Esposito, Veronica; Gallucci, Roberta; Picone, Delia; Saviano, Gabriella; Tancredi, Teodorico; Temussi, Piero A

2006-07-07

In addition to many small molecular mass sweeteners there are in nature a few sweet proteins. The molecular volume of sweet proteins is so different from that of common sweeteners that it was difficult to understand how molecules as large as proteins can activate a receptor designed to host small molecules. We have recently shown that sweet proteins can activate the sweet receptor by a mechanism of interaction, called ''wedge model", in which proteins fit a large cavity of the receptor with wedge-shaped surfaces of their structures. In order to substantiate this model we have designed, expressed and characterized seven mutants of MNEI, a single chain monellin. Three uncharged residues of the interaction surface, Met42, Tyr63 and Tyr65, were changed either into acidic or basic residues whereas Asp68, a key acidic residue, was changed into a basic one. As a general trend, we observe that an increase of the negative charge is much more detrimental for sweetness than an increase of positive charge. In addition we show that by a careful choice of a residue at the center of the interface between MNEI and receptor, it is possible even to increase the sweetness of MNEI. These results are fully consistent with the wedge model.

Rational Design of Diketopyrrolopyrrole-Based Small Molecules as Donating Materials for Organic Solar Cells

PubMed Central

Jin, Ruifa; Wang, Kai

2015-01-01

A series of diketopyrrolopyrrole-based small molecules have been designed to explore their optical, electronic, and charge transport properties as organic solar cell (OSCs) materials. The calculation results showed that the designed molecules can lower the band gap and extend the absorption spectrum towards longer wavelengths. The designed molecules own the large longest wavelength of absorption spectra, the oscillator strength, and absorption region values. The optical, electronic, and charge transport properties of the designed molecules are affected by the introduction of different π-bridges and end groups. We have also predicted the mobility of the designed molecule with the lowest total energies. Our results reveal that the designed molecules are expected to be promising candidates for OSC materials. Additionally, the designed molecules are expected to be promising candidates for electron and/or hole transport materials. On the basis of our results, we suggest that molecules under investigation are suitable donors for [6,6]-phenyl-C61-butyric acid methyl ester (PCBM) and its derivatives as acceptors of OSCs. PMID:26343640

Synthetic high-charge organomica: effect of the layer charge and alkyl chain length on the structure of the adsorbed surfactants.

PubMed

Pazos, M Carolina; Castro, Miguel A; Orta, M Mar; Pavón, Esperanza; Valencia Rios, Jesús S; Alba, María D

2012-05-15

A family of organomicas was synthesized using synthetic swelling micas with high layer charge (Na(n)Si(8-n)Al(n)Mg(6)F(4)O(20)·XH(2)O, where n = 2, 3, and 4) exchanged with dodecylammonium and octadecylammonium cations. The molecular arrangement of the surfactant was elucidated on the basis on XRD patterns and DTA. The ordering conformation of the surfactant molecules into the interlayer space of micas was investigated by (13)C, (27)Al, and (29)Si MAS NMR. The arrangement of alkylammonium ions in these high-charge synthetic micas depends on the combined effects of the layer charge of the mica and the chain length of the cation. In the organomicas with dodecylammonium, a transition from a parallel layer to a bilayer-paraffin arrangement is observed when the layer charge of the mica increases. However, when octadecylammonium is the interlayer cation, the molecular arrangement of the surfactant was found to follow the bilayer-paraffin model for all values of layer charge. The amount of ordered conformation all-trans is directly proportional of layer charge.

Charging and coagulation of radioactive and nonradioactive particles in the atmosphere

DOE PAGES

Kim, Yong-ha; Yiacoumi, Sotira; Nenes, Athanasios; ...

2016-01-01

Charging and coagulation influence one another and impact the particle charge and size distributions in the atmosphere. However, few investigations to date have focused on the coagulation kinetics of atmospheric particles accumulating charge. This study presents three approaches to include mutual effects of charging and coagulation on the microphysical evolution of atmospheric particles such as radioactive particles. The first approach employs ion balance, charge balance, and a bivariate population balance model (PBM) to comprehensively calculate both charge accumulation and coagulation rates of particles. The second approach involves a much simpler description of charging, and uses a monovariate PBM and subsequentmore » effects of charge on particle coagulation. The third approach is further simplified assuming that particles instantaneously reach their steady-state charge distributions. It is found that compared to the other two approaches, the first approach can accurately predict time-dependent changes in the size and charge distributions of particles over a wide size range covering from the free molecule to continuum regimes. The other two approaches can reliably predict both charge accumulation and coagulation rates for particles larger than about 0.04 micrometers and atmospherically relevant conditions. These approaches are applied to investigate coagulation kinetics of particles accumulating charge in a radioactive neutralizer, the urban atmosphere, and an atmospheric system containing radioactive particles. Limitations of the approaches are discussed.« less

A charge carrier transport model for donor-acceptor blend layers

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fischer, Janine, E-mail: janine.fischer@iapp.de; Widmer, Johannes; Koerner, Christian

2015-01-28

Highly efficient organic solar cells typically comprise donor-acceptor blend layers facilitating effective splitting of excitons. However, the charge carrier mobility in the blends can be substantially smaller than in neat materials, hampering the device performance. Currently, available mobility models do not describe the transport in blend layers entirely. Here, we investigate hole transport in a model blend system consisting of the small molecule donor zinc phthalocyanine (ZnPc) and the acceptor fullerene C{sub 60} in different mixing ratios. The blend layer is sandwiched between p-doped organic injection layers, which prevent minority charge carrier injection and enable exploiting diffusion currents for themore » characterization of exponential tail states from a thickness variation of the blend layer using numerical drift-diffusion simulations. Trap-assisted recombination must be considered to correctly model the conductivity behavior of the devices, which are influenced by local electron currents in the active layer, even though the active layer is sandwiched in between p-doped contacts. We find that the density of deep tail states is largest in the devices with 1:1 mixing ratio (E{sub t} = 0.14 eV, N{sub t} = 1.2 × 10{sup 18 }cm{sup −3}) directing towards lattice disorder as the transport limiting process. A combined field and charge carrier density dependent mobility model are developed for this blend layer.« less

Molecular dynamics and charge transport in organic semiconductors: a classical approach to modeling electron transfer

DOE PAGES

Pelzer, Kenley M.; Vázquez-Mayagoitia, Álvaro; Ratcliff, Laura E.; ...

2017-01-01

Organic photovoltaics (OPVs) are a promising carbon-neutral energy conversion technology, with recent improvements pushing power conversion efficiencies over 10%. A major factor limiting OPV performance is inefficiency of charge transport in organic semiconducting materials (OSCs). Due to strong coupling with lattice degrees of freedom, the charges form polarons, localized quasi-particles comprised of charges dressed with phonons. These polarons can be conceptualized as pseudo-atoms with a greater effective mass than a bare charge. Here we propose that due to this increased mass, polarons can be modeled with Langevin molecular dynamics (LMD), a classical approach with a computational cost much lower thanmore » most quantum mechanical methods. Here we present LMD simulations of charge transfer between a pair of fullerene molecules, which commonly serve as electron acceptors in OSCs. We find transfer rates consistent with experimental measurements of charge mobility, suggesting that this method may provide quantitative predictions of efficiency when used to simulate materials on the device scale. Our approach also offers information that is not captured in the overall transfer rate or mobility: in the simulation data, we observe exactly when and why intermolecular transfer events occur. In addition, we demonstrate that these simulations can shed light on the properties of polarons in OSCs. In conclusion, much remains to be learned about these quasi-particles, and there are no widely accepted methods for calculating properties such as effective mass and friction. Lastly, our model offers a promising approach to exploring mass and friction as well as providing insight into the details of polaron transport in OSCs.« less

Correlational Effects of the Molecular-Tilt Configuration and the Intermolecular van der Waals Interaction on the Charge Transport in the Molecular Junction.

PubMed

Shin, Jaeho; Gu, Kyungyeol; Yang, Seunghoon; Lee, Chul-Ho; Lee, Takhee; Jang, Yun Hee; Wang, Gunuk

2018-06-25

Molecular conformation, intermolecular interaction, and electrode-molecule contacts greatly affect charge transport in molecular junctions and interfacial properties of organic devices by controlling the molecular orbital alignment. Here, we statistically investigated the charge transport in molecular junctions containing self-assembled oligophenylene molecules sandwiched between an Au probe tip and graphene according to various tip-loading forces ( F L ) that can control the molecular-tilt configuration and the van der Waals (vdW) interactions. In particular, the molecular junctions exhibited two distinct transport regimes according to the F L dependence (i.e., F L -dependent and F L -independent tunneling regimes). In addition, the charge-injection tunneling barriers at the junction interfaces are differently changed when the F L ≤ 20 nN. These features are associated to the correlation effects between the asymmetry-coupling factor (η), the molecular-tilt angle (θ), and the repulsive intermolecular vdW force ( F vdW ) on the molecular-tunneling barriers. A more-comprehensive understanding of these charge transport properties was thoroughly developed based on the density functional theory calculations in consideration of the molecular-tilt configuration and the repulsive vdW force between molecules.

Visualizing electron dynamics in organic materials: Charge transport through molecules and angular resolved photoemission

NASA Astrophysics Data System (ADS)

Kümmel, Stephan

Being able to visualize the dynamics of electrons in organic materials is a fascinating perspective. Simulations based on time-dependent density functional theory allow to realize this hope, as they visualize the flow of charge through molecular structures in real-space and real-time. We here present results on two fundamental processes: Photoemission from organic semiconductor molecules and charge transport through molecular structures. In the first part we demonstrate that angular resolved photoemission intensities - from both theory and experiment - can often be interpreted as a visualization of molecular orbitals. However, counter-intuitive quantum-mechanical electron dynamics such as emission perpendicular to the direction of the electrical field can substantially alter the picture, adding surprising features to the molecular orbital interpretation. In a second study we calculate the flow of charge through conjugated molecules. The calculations show in real time how breaks in the conjugation can lead to a local buildup of charge and the formation of local electrical dipoles. These can interact with neighboring molecular chains. As a consequence, collections of ''molecular electrical wires'' can show distinctly different characteristics than ''classical electrical wires''. German Science Foundation GRK 1640.

Charge transfer process at the Ag/MPH/TiO2 interface by SERS: alignment of the Fermi level.

PubMed

Zhang, Xiaolei; Sui, Huimin; Wang, Xiaolei; Su, Hongyang; Cheng, Weina; Wang, Xu; Zhao, Bing

2016-11-02

A nanoscale metal-molecule-semiconductor assembly (Ag/4-mercaptophenol/TiO 2 ) has been fabricated over Au nanoparticle (NP) films as a model to study the interfacial charge transfer (CT) effects involved in Ag/MPH/TiO 2 . Due to the interaction between Au NPs and Ag NPs, some distinct differences occur in the SERS spectra. We also measured the SERS of Ag/MPH (4-mercaptophenol), Ag/MPH/TiO 2 , and Au/Ag/MPH/TiO 2 assemblies at excitation wavelengths of 477, 514, 532, 633, and 785 nm. We found that the changes in the CT process, caused by the introduction of TiO 2 and Au, can be reflected in SERS. Then in combination with other detection methods, we proposed a possible CT process involved in the Ag/MPH, Ag/MPH/TiO 2 , and Au/Ag/MPH/TiO 2 assemblies. A Pt/Ag/MPH/TiO 2 assembly was also constructed to verify our proposed CT mechanism. This work not only provides more details about CT between metal-molecule-semiconductor interfaces but also aids in constructing nanoscale models to study interfacial problems with the SERS technique.

Rate equations for nitrogen molecules in ultrashort and intense x-ray pulses

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liu, Ji -Cai; Berrah, Nora; Cederbaum, Lorenz S.

Here, we study theoretically the quantum dynamics of nitrogen molecules (N2) exposed to intense and ultrafast x-rays at a wavelength ofmore » $$1.1\\;{\\rm{nm}}$$ ($$1100\\;{\\rm{eV}}$$ photon energy) from the Linac Coherent Light Source (LCLS) free electron laser. Molecular rate equations are derived to describe the intertwined photoionization, decay, and dissociation processes occurring for N2. This model complements our earlier phenomenological approaches, the single-atom, symmetric-sharing, and fragmentation-matrix models of 2012 (J. Chem. Phys. 136 214310). Our rate-equations are used to obtain the effective pulse energy at the sample and the time scale for the dissociation of the metastable dication $${{\\rm{N}}}_{2}^{2+}$$. This leads to a very good agreement between the theoretically and experimentally determined ion yields and, consequently, the average charge states. The effective pulse energy is found to decrease with shortening pulse duration. This variation together with a change in the molecular fragmentation pattern and frustrated absorption—an effect that reduces absorption of x-rays due to (double) core hole formation—are the causes for the drop of the average charge state with shortening LCLS pulse duration discovered previously.« less

Rate equations for nitrogen molecules in ultrashort and intense x-ray pulses

DOE PAGES

Liu, Ji -Cai; Berrah, Nora; Cederbaum, Lorenz S.; ...

2016-03-16

Here, we study theoretically the quantum dynamics of nitrogen molecules (N2) exposed to intense and ultrafast x-rays at a wavelength ofmore » $$1.1\\;{\\rm{nm}}$$ ($$1100\\;{\\rm{eV}}$$ photon energy) from the Linac Coherent Light Source (LCLS) free electron laser. Molecular rate equations are derived to describe the intertwined photoionization, decay, and dissociation processes occurring for N2. This model complements our earlier phenomenological approaches, the single-atom, symmetric-sharing, and fragmentation-matrix models of 2012 (J. Chem. Phys. 136 214310). Our rate-equations are used to obtain the effective pulse energy at the sample and the time scale for the dissociation of the metastable dication $${{\\rm{N}}}_{2}^{2+}$$. This leads to a very good agreement between the theoretically and experimentally determined ion yields and, consequently, the average charge states. The effective pulse energy is found to decrease with shortening pulse duration. This variation together with a change in the molecular fragmentation pattern and frustrated absorption—an effect that reduces absorption of x-rays due to (double) core hole formation—are the causes for the drop of the average charge state with shortening LCLS pulse duration discovered previously.« less

Building a three-dimensional model of CYP2C9 inhibition using the Autocorrelator: an autonomous model generator.

PubMed

Lardy, Matthew A; Lebrun, Laurie; Bullard, Drew; Kissinger, Charles; Gobbi, Alberto

2012-05-25

In modern day drug discovery campaigns, computational chemists have to be concerned not only about improving the potency of molecules but also reducing any off-target ADMET activity. There are a plethora of antitargets that computational chemists may have to consider. Fortunately many antitargets have crystal structures deposited in the PDB. These structures are immediately useful to our Autocorrelator: an automated model generator that optimizes variables for building computational models. This paper describes the use of the Autocorrelator to construct high quality docking models for cytochrome P450 2C9 (CYP2C9) from two publicly available crystal structures. Both models result in strong correlation coefficients (R² > 0.66) between the predicted and experimental determined log(IC₅₀) values. Results from the two models overlap well with each other, converging on the same scoring function, deprotonated charge state, and predicted the binding orientation for our collection of molecules.

Hindered Diffusion in Polymeric Solutions Studied by Fluorescence Correlation Spectroscopy

PubMed Central

Zustiak, Silviya P.; Nossal, Ralph; Sackett, Dan L.

2011-01-01

Diffusion of molecules in the crowded and charged interior of the cell has long been of interest for understanding cellular processes. Here, we introduce a model system of hindered diffusion that includes both crowding and binding. In particular, we obtained the diffusivity of the positively charged protein, ribonuclease A (RNase), in solutions of dextrans of various charges (binding) and concentrations (crowding), as well as combinations of both, in a buffer of physiological ionic strength. Using fluorescence correlation spectroscopy, we observed that the diffusivity of RNase was unaffected by the presence of positively charged or neutral dextrans in the dilute regime but was affected by crowding at higher polymer concentrations. Conversely, protein diffusivity was significantly reduced by negatively charged dextrans, even at 0.4 μM (0.02% w/v) dextran. The diffusivity of RNase decreased with increasing concentrations of negative dextran, and the amount of bound RNase increased until it reached a plateau of ∼80% bound RNase. High salt concentrations were used to establish the electrostatic nature of the binding. Binding of RNase to the negatively charged dextrans was further confirmed by ultrafiltration. PMID:21723836

Development of a simulation method for dynamics of electrons ejected from DNA molecules irradiated with X-rays.

PubMed

Kai, Takeshi; Higuchi, Mariko; Fujii, Kentaro; Watanabe, Ritsuko; Yokoya, Akinari

2012-12-01

To develop a method for simulating the dynamics of the photoelectrons and Auger electrons ejected from DNA molecules irradiated with pulsed monochromatic X-rays. A 30-base-pair (bp) DNA molecule was used as the target model, and the X-rays were assumed to have a Gaussian-shaped time distribution. Photoionization and Auger decay were considered as the atomic processes. The atoms from which the photoelectrons or Auger electrons were emitted were specified in the DNA molecule (or DNA ion) using the Monte Carlo method, and the trajectory of each electron in the electric field formed around the positively charged DNA molecule was calculated with a Newtonian equation. The kinetics of the electrons produced by irradiation with X-rays at an intensity ranging from 1 × 10(12) to 1 × 10(16) photons/mm(2) and energies of 380 eV (below the carbon K-edge), 435 eV (above the nitrogen K-edge), and 560 eV (above the oxygen K-edge) were evaluated. It was found that at an X-ray intensity of 1 × 10(14) photons/mm(2) or less, all the produced electrons escaped from the target. However, above an X-ray intensity of 1 × 10(15) photons/mm(2) and an energy of 560 eV, some photoelectrons that were ejected from the oxygen atoms were trapped near the target DNA. A simulation method for studying the trajectories of electrons ejected from a 30-bp DNA molecule irradiated with pulsed monochromatic X-rays has been developed. The present results show that electron dynamics are strongly dependent on the charged density induced in DNA by pulsed X-ray irradiation.

Theoretical and Experimental Studies of N,N-Dimethyl-N'-Picryl-4,4'-Stilbenediamine.

PubMed

Papper, Vladislav; Wu, Yuanyuan; Kharlanov, Vladimir; Sukharaharja, Ayrine; Steele, Terry W J; Marks, Robert S

2018-01-01

N,N-dimethyl-N'-picryl-4,4'-stilbenediamine (DMPSDA) was prepared, purified and crystallised in a form of black lustrous crystals, and its absorption and fluorescence spectra were recorded in cyclohexane, acetonitrile and dimethyl sulfoxide. Non-emissive intramolecular charge transfer state (ICT) was clearly observed in this molecule in all three solvents. Theoretical calculations demonstrating a betaine electronic structure of the trinitrophenyl group in the ground state of the molecule and a charge transfer nature of the long wavelength transition S 0  → S 1 supported the experimental observations of the ICT formation in the molecule.

Van der Waals corrected DFT study of adsorption of groups VA and VIA hydrides on graphene monoxide

NASA Astrophysics Data System (ADS)

Notash, M. Yaghoobi; Ebrahimzadeh, A. Rastkar

2016-06-01

Adsorption properties of H2O, H2S, NH3 and PH3 on graphene monoxide (GMO) nano flack are investigated using density functional theory (DFT). Calculations were carried out by van der Waals correction and general gradient approximation. The adsorption energies and charge transfer between species are obtained and discussed for the considered positions of adsorbate molecules. Charge transfer analysis show that the gas molecules act as an electron acceptor in all cases. The analysis of the adsorption energies suggest GMO can be a good candidate for the adsorption of these molecules.

Enhancement of atom transfer in different surface chemistry of hydrogenated vs. fluorinated tribromobenzene on Ag(111) and Cu(111)

NASA Astrophysics Data System (ADS)

Cecily mary glory, D.; Sambathkumar, K.; Madivanane, R.; Rajkamal, N.; Venkatachalapathy, M.

2017-12-01

Systematic interactions of hydrogenated & fluorinated tribromobenzene on Ag and Cu surfaces. First bromine dehalogenation takes place right upon adsorption due to catalytic properties of Ag. Different adsorption geometries of monomers and dimmers of 1,3,5-tribromo-2,4,6-trifluoro-benzene(TBFB) and 1,3,5-tribromobenzene(TBB). DFT calculations of the Csbnd Br binding energy dependent on the amount of remaining bromine atoms for both TBFB and TBB were performed. The experiments were performed at low temperature of 80 K.STM measurements where performed for of TBFB and TBB. STM show adsorbed molecules in a loose arrangement of molecules. NBO analysis the stability of the molecule arising within hyper-conjugative interactions. The HOMO and LUMO energies and electronic charge transfer (ECT) confirms that electronic transition. High field indicates that this molecule exhibit considerable electrical conductivity in atomic charges. The ESP map is found to be positive within the molecule. The negative charges have a tendency to drift from left to right. The computed thermodynamic parameters like heat capacities (Cºp,m), entropies (Sºm) and enthalpies changes (Hºm) are used for various electrical field.

Photoelectron spectroscopy study of the electronic structures at CoPc/Bi(111) interface

NASA Astrophysics Data System (ADS)

Sun, Haoliang; Liang, Zhaofeng; Shen, Kongchao; Hu, Jinbang; Ji, Gengwu; Li, Zheshen; Li, Haiyang; Zhu, Zhiyuan; Li, Jiong; Gao, Xingyu; Han, Huang; Jiang, Zheng; Song, Fei

2017-07-01

Self-assembly of functional molecules on solid substrate has been recognized as an appealing approach for the fabrication of diverse nanostructures for nanoelectronics. Herein, we investigate the growth of cobalt phthalocyanine (CoPc) on a Bi(111) surface with focus on the interface electronic structures utilizing photoelectron spectroscopy. While charge transfer from bismuth substrate to the molecule results in the emergence of an interface component in the Co 3p core level at lower binding energy, core-levels associated to the molecular ligand (C 1s and N 1s) are less influenced by the adsorption. In addition, density functional theory (DFT) calculations also support the empirical inference that the molecule-substrate interaction mainly involves the out-of-plane empty Co 3d orbital and bismuth states. Finally, valence band spectra demonstrate the molecule-substrate interaction is induced by interface charge transfer, agreeing well with core level measurements. Charge transfer is shown to be mainly from the underlying bismuth substrate to the empty states located at the central Co atom in the CoPc molecules. This report may provide a fundamental basis to the on-surface engineering of interfaces for molecular devices and spintronics.

Alchemical prediction of hydration free energies for SAMPL

PubMed Central

Mobley, David L.; Liu, Shaui; Cerutti, David S.; Swope, William C.; Rice, Julia E.

2013-01-01

Hydration free energy calculations have become important tests of force fields. Alchemical free energy calculations based on molecular dynamics simulations provide a rigorous way to calculate these free energies for a particular force field, given sufficient sampling. Here, we report results of alchemical hydration free energy calculations for the set of small molecules comprising the 2011 Statistical Assessment of Modeling of Proteins and Ligands (SAMPL) challenge. Our calculations are largely based on the Generalized Amber Force Field (GAFF) with several different charge models, and we achieved RMS errors in the 1.4-2.2 kcal/mol range depending on charge model, marginally higher than what we typically observed in previous studies1-5. The test set consists of ethane, biphenyl, and a dibenzyl dioxin, as well as a series of chlorinated derivatives of each. We found that, for this set, using high-quality partial charges from MP2/cc-PVTZ SCRF RESP fits provided marginally improved agreement with experiment over using AM1-BCC partial charges as we have more typically done, in keeping with our recent findings5. Switching to OPLS Lennard-Jones parameters with AM1-BCC charges also improves agreement with experiment. We also find a number of chemical trends within each molecular series which we can explain, but there are also some surprises, including some that are captured by the calculations and some that are not. PMID:22198475

Molecular design and nanoscale engineering of organic nanofibril donor-acceptor heterojunctions

NASA Astrophysics Data System (ADS)

Huang, Helin

Organic nanofibril heterojunction materials have gained increasing research interest due to their broad applications in organic semiconductor devices. In order to enhance the device performance, we have investigated the structure-property relationship of these nanostructures by designing and synthesizing functional building block molecules, selfassembling the molecules into well-defined nanofibers, fabricating the nanofibers into optical and electrical devices, and testing their photoconductivity and sensor properties. In Chapter 2, we present a simple approach to fabricate efficient nanofibril heterojunctions by interfacial engineering of electron donor (D) coating onto acceptor (A) nanofibers. The nanofibers both create a large D/A interface for increased charge separation and act as long-range transport pathways for photogenerated charge carriers towards the electrodes, and the alkyl groups modified at the A molecules not only enable effective surface adsorption of D molecules on the nanofibers for effective electron-transfer communication, but also spatially separate the photogenerated charge carriers to prevent their recombination. In Chapter 3, we further investigated the effect of D molecular structure and coating morphology on photoconductivity of organic nanofiber materials. A series of D molecules with varying side-chain modifications were synthesized and investigated for the different intermolecular arrangements caused by pi-pi stacking in balance with steric hindrance of side-chains. Different molecular assemblies of D resulted in distinctive phase segregation between D and A nanofiber, which significantly affects the interfacial charge separation. In Chapter 4, we developed an alternative nanofibril heterojunction structure that is composed of D as the nanofiber, onto which a monolayer of A molecule was coated. Due to the strong redox (charge transfer) interaction between D and A, the nanofibril junction demonstrated high conductivity even without light illumination, which makes this material suitable for applications in chemiresistor sensors for detection of amines. In Chapter 5, a series of perylene tetracarboxylic monoimides were synthesized through a one-step reaction between cycloalkyl amines and the parent perylene dianhydride. The selection of appropriate reaction medium is the most critical for achieving the high purity of product. This approach opens up a new way for large scale production of the monoimides, which are the precursor for making a variety of perylene based building block molecules.

Host-guest chemistry of dendrimer-drug complexes. 2. Effects of molecular properties of guests and surface functionalities of dendrimers.

PubMed

Hu, Jingjing; Cheng, Yiyun; Wu, Qinglin; Zhao, Libo; Xu, Tongwen

2009-08-06

The host-guest chemistry of dendrimer-drug complexes is investigated by NMR techniques, including (1)H NMR and 2D-NOESY studies. The effects of molecular properties of drug molecules (protonation ability and spatial steric hindrance of charged groups) and surface functionalities of dendrimers (positively charged amine groups and negatively charged carboxylate groups) on the host-guest interactions are discussed. Different interaction mechanisms between dendrimers and drug molecules are proposed on the basis of NMR results. Primary amine- and secondary amine-containing drugs preferentially bind to negatively charged dendrimers by strong electrostatic interactions, whereas tertiary amine and quaternary ammonium-containing drugs have weak binding ability with dendrimers due to relatively low protonation ability of the tertiary amine group and serious steric hindrance of the quaternary ammonium group. Positively charged drugs locate only on the surface of negatively charged dendrimers, whereas negatively charged drugs locate both on the surface and in the interior cavities of positively charged dendrimers. The host-guest chemistry of dendrimer-drug complexes is promising for the development of new drug delivery systems.

Energy decomposition analysis for exciplexes using absolutely localized molecular orbitals

NASA Astrophysics Data System (ADS)

Ge, Qinghui; Mao, Yuezhi; Head-Gordon, Martin

2018-02-01

An energy decomposition analysis (EDA) scheme is developed for understanding the intermolecular interaction involving molecules in their excited states. The EDA utilizes absolutely localized molecular orbitals to define intermediate states and is compatible with excited state methods based on linear response theory such as configuration interaction singles and time-dependent density functional theory. The shift in excitation energy when an excited molecule interacts with the environment is decomposed into frozen, polarization, and charge transfer contributions, and the frozen term can be further separated into Pauli repulsion and electrostatics. These terms can be added to their counterparts obtained from the ground state EDA to form a decomposition of the total interaction energy. The EDA scheme is applied to study a variety of systems, including some model systems to demonstrate the correct behavior of all the proposed energy components as well as more realistic systems such as hydrogen-bonding complexes (e.g., formamide-water, pyridine/pyrimidine-water) and halide (F-, Cl-)-water clusters that involve charge-transfer-to-solvent excitations.

Gene Transfer in Eukaryotic Cells Using Activated Dendrimers

NASA Astrophysics Data System (ADS)

Dennig, Jörg

Gene transfer into eukaryotic cells plays an important role in cell biology. Over the last 30 years a number of transfection methods have been developed to mediate gene transfer into eukaryotic cells. Classical methods include co-precipitation of DNA with calcium phosphate, charge-dependent precipitation of DNA with DEAE-dextran, electroporation of nucleic acids, and formation of transfection complexes between DNA and cationic liposomes. Gene transfer technologies based on activated PAMAM-dendrimers provide another class of transfection reagents. PAMAM-dendrimers are highly branched, spherical molecules. Activation of newly synthesized dendrimers involves hydrolytic removal of some of the branches, and results in a molecule with a higher degree of flexibility. Activated dendrimers assemble DNA into compact structures via charge interactions. Activated dendrimer - DNA complexes bind to the cell membrane of eukaryotic cells, and are transported into the cell by non-specific endocytosis. A structural model of the activated dendrimer - DNA complex and a potential mechanism for its uptake into cells will be discussed.

Albumin adsorption on CoCrMo alloy surfaces

NASA Astrophysics Data System (ADS)

Yan, Yu; Yang, Hongjuan; Su, Yanjing; Qiao, Lijie

2015-12-01

Proteins can adsorb on the surface of artificial joints immediately after being implanted. Although research studying protein adsorption on medical material surfaces has been carried out, the mechanism of the proteins’ adsorption which affects the corrosion behaviour of such materials still lacks in situ observation at the micro level. The adsorption of bovine serum albumin (BSA) on CoCrMo alloy surfaces was studied in situ by AFM and SKPFM as a function of pH and the charge of CoCrMo alloy surfaces. Results showed that when the specimens were uncharged, hydrophobic interaction could govern the process of the adsorption rather than electrostatic interaction, and BSA molecules tended to adsorb on the surfaces forming a monolayer in the side-on model. Results also showed that adsorbed BSA molecules could promote the corrosion process for CoCrMo alloys. When the surface was positively charged, the electrostatic interaction played a leading role in the adsorption process. The maximum adsorption occurred at the isoelectric point (pH 4.7) of BSA.

Influence of functional groups on charge transport in molecular junctions

NASA Astrophysics Data System (ADS)

Mowbray, D. J.; Jones, G.; Thygesen, K. S.

2008-03-01

Using density functional theory (DFT), we analyze the influence of five classes of functional groups, as exemplified by NO2, OCH3, CH3, CCl3, and I, on the transport properties of a 1,4-benzenedithiolate (BDT) and 1,4-benzenediamine (BDA) molecular junction with gold electrodes. Our analysis demonstrates how ideas from functional group chemistry may be used to engineer a molecule's transport properties, as was shown experimentally and using a semiempirical model for BDA [Nano Lett. 7, 502 (2007)]. In particular, we show that the qualitative change in conductance due to a given functional group can be predicted from its known electronic effect (whether it is σ /π donating/withdrawing). However, the influence of functional groups on a molecule's conductance is very weak, as was also found in the BDA experiments. The calculated DFT conductances for the BDA species are five times larger than the experimental values, but good agreement is obtained after correcting for self-interaction and image charge effects.

Structure and functionality of bromine doped graphite.

PubMed

Hamdan, Rashid; Kemper, A F; Cao, Chao; Cheng, H P

2013-04-28

First-principles calculations are used to study the enhanced in-plane conductivity observed experimentally in Br-doped graphite, and to study the effect of external stress on the structure and functionality of such systems. The model used in the numerical calculations is that of stage two doped graphite. The band structure near the Fermi surface of the doped systems with different bromine concentrations is compared to that of pure graphite, and the charge transfer between carbon and bromine atoms is analyzed to understand the conductivity change along different high symmetry directions. Our calculations show that, for large interlayer separation between doped graphite layers, bromine is stable in the molecular form (Br2). However, with increased compression (decreased layer-layer separation) Br2 molecules tend to dissociate. While in both forms, bromine is an electron acceptor. The charge exchange between the graphite layers and Br atoms is higher than that with Br2 molecules. Electron transfer to the Br atoms increases the number of hole carriers in the graphite sheets, resulting in an increase of conductivity.

Agarose gel electrophoresis for the separation of DNA fragments.

PubMed

Lee, Pei Yun; Costumbrado, John; Hsu, Chih-Yuan; Kim, Yong Hoon

2012-04-20

Agarose gel electrophoresis is the most effective way of separating DNA fragments of varying sizes ranging from 100 bp to 25 kb(1). Agarose is isolated from the seaweed genera Gelidium and Gracilaria, and consists of repeated agarobiose (L- and D-galactose) subunits(2). During gelation, agarose polymers associate non-covalently and form a network of bundles whose pore sizes determine a gel's molecular sieving properties. The use of agarose gel electrophoresis revolutionized the separation of DNA. Prior to the adoption of agarose gels, DNA was primarily separated using sucrose density gradient centrifugation, which only provided an approximation of size. To separate DNA using agarose gel electrophoresis, the DNA is loaded into pre-cast wells in the gel and a current applied. The phosphate backbone of the DNA (and RNA) molecule is negatively charged, therefore when placed in an electric field, DNA fragments will migrate to the positively charged anode. Because DNA has a uniform mass/charge ratio, DNA molecules are separated by size within an agarose gel in a pattern such that the distance traveled is inversely proportional to the log of its molecular weight(3). The leading model for DNA movement through an agarose gel is "biased reptation", whereby the leading edge moves forward and pulls the rest of the molecule along(4). The rate of migration of a DNA molecule through a gel is determined by the following: 1) size of DNA molecule; 2) agarose concentration; 3) DNA conformation(5); 4) voltage applied, 5) presence of ethidium bromide, 6) type of agarose and 7) electrophoresis buffer. After separation, the DNA molecules can be visualized under uv light after staining with an appropriate dye. By following this protocol, students should be able to: Understand the mechanism by which DNA fragments are separated within a gel matrix Understand how conformation of the DNA molecule will determine its mobility through a gel matrix Identify an agarose solution of appropriate concentration for their needs Prepare an agarose gel for electrophoresis of DNA samples Set up the gel electrophoresis apparatus and power supply Select an appropriate voltage for the separation of DNA fragments Understand the mechanism by which ethidium bromide allows for the visualization of DNA bands Determine the sizes of separated DNA fragments.

Multi-Excitonic Quantum Dot Molecules

NASA Astrophysics Data System (ADS)

Scheibner, M.; Stinaff, E. A.; Doty, M. F.; Ware, M. E.; Bracker, A. S.; Gammon, D.; Ponomarev, I. V.; Reinecke, T. L.; Korenev, V. L.

2006-03-01

With the ability to create coupled pairs of quantum dots, the next step towards the realization of semiconductor based quantum information processing devices can be taken. However, so far little knowledge has been gained on these artificial molecules. Our photoluminescence experiments on single InAs/GaAs quantum dot molecules provide the systematics of coupled quantum dots by delineating the spectroscopic features of several key charge configurations in such quantum systems, including X, X^+,X^2+, XX, XX^+ (with X being the neutral exciton). We extract general rules which determine the formation of molecular states of coupled quantum dots. These include the fact that quantum dot molecules provide the possibility to realize various spin configurations and to switch the electron hole exchange interaction on and off by shifting charges inside the molecule. This knowledge will be valuable in developing implementations for quantum information processing.

Tuning ultrafast electron injection dynamics at organic-graphene/metal interfaces.

PubMed

Ravikumar, Abhilash; Kladnik, Gregor; Müller, Moritz; Cossaro, Albano; Bavdek, Gregor; Patera, Laerte L; Sánchez-Portal, Daniel; Venkataraman, Latha; Morgante, Alberto; Brivio, Gian Paolo; Cvetko, Dean; Fratesi, Guido

2018-05-03

We compare the ultrafast charge transfer dynamics of molecules on epitaxial graphene and bilayer graphene grown on Ni(111) interfaces through first principles calculations and X-ray resonant photoemission spectroscopy. We use 4,4'-bipyridine as a prototypical molecule for these explorations as the energy level alignment of core-excited molecular orbitals allows ultrafast injection of electrons from a substrate to a molecule on a femtosecond timescale. We show that the ultrafast injection of electrons from the substrate to the molecule is ∼4 times slower on weakly coupled bilayer graphene than on epitaxial graphene. Through our experiments and calculations, we can attribute this to a difference in the density of states close to the Fermi level between graphene and bilayer graphene. We therefore show how graphene coupling with the substrate influences charge transfer dynamics between organic molecules and graphene interfaces.

Deciphering the "chemical" nature of the exotic isotopes of hydrogen by the MC-QTAIM analysis: the positively charged muon and the muonic helium as new members of the periodic table.

PubMed

Goli, Mohammad; Shahbazian, Shant

2014-04-14

This report is a primarily survey on the chemical nature of some exotic species containing the positively charged muon and the muonic helium, i.e., the negatively charged muon plus helium nucleus, as exotic isotopes of hydrogen, using the newly developed multi-component quantum theory of atoms in molecules (MC-QTAIM) analysis, employing ab initio non-Born-Oppenhiemer wavefunctions. Accordingly, the "atoms in molecules" analysis performed on various asymmetric exotic isotopomers of the hydrogen molecule, recently detected experimentally [Science, 2011, 331, 448], demonstrates that both the exotic isotopes are capable of forming atoms in molecules and retaining the identity of hydrogen atoms. Various derived properties of atomic basins containing the muonic helium cast no doubt that apart from its short life time, it is a heavier isotope of hydrogen while the properties of basins containing the positively charged muon are more remote from those of the orthodox hydrogen basins, capable of appreciable donation of electrons as well as large charge polarization. However, with some tolerance, they may also be categorized as hydrogen basins though with a smaller electronegativity. All in all, the present study also clearly demonstrates that the MC-QTAIM analysis is an efficient approach to decipher the chemical nature of species containing exotic constituents, which are difficult to elucidate by experimental and/or alternative theoretical schemes.

Theoretical investigations on the structure and properties of p-n-alkoxy benzoic acid based liquid crystals

NASA Astrophysics Data System (ADS)

Subhapriya, P.; Dhanapal, V.; Sadasivam, K.; Vijayanand, P. S.

2016-05-01

The present study focused on the structural conformations, alkoxy chain lengths and mesogenic properties of two mole of alkoxy benzoic acid(nOBA) and one mole of suberic acid (SA) hydrogen bonded (nOBASA) complexes (n=8 to 10) by density functional theory (DFT) calculations and the Fourier Transform Infrared (FT-IR) spectrum. The intermolecular hydrogen bond formation was confirmed by the optimized geometric bond lengths and bond angles obtained by computation. Using the natural bond orbital (NBO) analysis, the stability of the molecule arising from hyper conjugative interactions and charge delocalization has been analyzed. Results obtained shows that the charge in electron density (ED) in σ*and π* antibonding orbital and second order delocalization energies E(2) authorizes the occurrence of intermolecular charge transfer. The molecular electrostatic potential (MEP) surface map is plotted over the optimized geometry of the molecule to obtain the chemical reactivity of the molecule. From the local charge distributions, the mesomorphic behavior and the nematic phase stabilities for each of the molecule have been predicted. Finally the calculated result is applied to simulated infrared spectra of 8OBASA mesogens which shows good agreement with the observed spectra. The comparison of the theoretical results obtained with the experimental ones shows the reliability of this DFT method.

Correlation-driven charge migration following double ionization and attosecond transient absorption spectroscopy

NASA Astrophysics Data System (ADS)

Hollstein, Maximilian; Santra, Robin; Pfannkuche, Daniela

2017-05-01

We theoretically investigate charge migration following prompt double ionization. Thereby, we extend the concept of correlation-driven charge migration, which was introduced by Cederbaum and coworkers for single ionization [Chem. Phys. Lett. 307, 205 (1999), 10.1016/S0009-2614(99)00508-4], to doubly ionized molecules. This allows us to demonstrate that compared to singly ionized molecules, in multiply ionized molecules, electron dynamics originating from electronic relaxation and correlation are particularly prominent. In addition, we also discuss how these correlation-driven electron dynamics might be evidenced and traced experimentally using attosecond transient absorption spectroscopy. For this purpose, we determine the time-resolved absorption cross section and find that the correlated electron dynamics discussed are reflected in it with exceptionally great detail. Strikingly, we find that features in the cross section can be traced back to electron hole populations and time-dependent partial charges and hence, can be interpreted with surprising ease. By taking advantage of element-specific core-to-valence transitions even atomic spatial resolution can be achieved. Thus, with the theoretical considerations presented, not only do we predict particularly diverse and correlated electron dynamics in molecules to follow prompt multiple ionization but we also identify a promising route towards their experimental investigation.

Replacing -CH2CH2- with -CONH- does not significantly change rates of charge transport through Ag(TS)-SAM//Ga2O3/EGaIn junctions.

PubMed

Thuo, Martin M; Reus, William F; Simeone, Felice C; Kim, Choongik; Schulz, Michael D; Yoon, Hyo Jae; Whitesides, George M

2012-07-04

This paper describes physical-organic studies of charge transport by tunneling through self-assembled monolayers (SAMs), based on systematic variations of the structure of the molecules constituting the SAM. Replacing a -CH(2)CH(2)- group with a -CONH- group changes the dipole moment and polarizability of a portion of the molecule and has, in principle, the potential to change the rate of charge transport through the SAM. In practice, this substitution produces no significant change in the rate of charge transport across junctions of the structure Ag(TS)-S(CH(2))(m)X(CH(2))(n)H//Ga(2)O(3)/EGaIn (TS = template stripped, X = -CH(2)CH(2)- or -CONH-, and EGaIn = eutectic alloy of gallium and indium). Incorporation of the amide group does, however, increase the yields of working (non-shorting) junctions (when compared to n-alkanethiolates of the same length). These results suggest that synthetic schemes that combine a thiol group on one end of a molecule with a group, R, to be tested, on the other (e.g., HS~CONH~R) using an amide-based coupling provide practical routes to molecules useful in studies of molecular electronics.

Spectroscopic Analysis of a Biomimetic Model of Tyr(Z) Function in PSII.

PubMed

Ravensbergen, Janneke; Antoniuk-Pablant, Antaeres; Sherman, Benjamin D; Kodis, Gerdenis; Megiatto, Jackson D; Méndez-Hernández, Dalvin D; Frese, Raoul N; van Grondelle, Rienk; Moore, Thomas A; Moore, Ana L; Gust, Devens; Kennis, John T M

2015-09-17

Using natural photosynthesis as a model, bio-inspired constructs for fuel generation from sunlight are being developed. Here we report the synthesis and time-resolved spectroscopic analysis of a molecular triad in which a porphyrin electron donor is covalently linked to both a cyanoporphyrin electron acceptor and a benzimidazole-phenol model for the TyrZ-D1His190 pair of PSII. A dual-laser setup enabled us to record the ultrafast kinetics and long-living species in a single experiment. From this data, the photophysical relaxation pathways were elucidated for the triad and reference compounds. For the triad, quenching of the cyanoporphyrin singlet excited state lifetime was interpreted as photoinduced electron transfer from the porphyrin to the excited cyanoporphyrin. In contrast to a previous study of a related molecule, we were unable to observe subsequent formation of a long-lived charge separated state involving the benzimidazole-phenol moiety. The lack of detection of a long-lived charge separated state is attributed to a change in energetic landscape for charge separation/recombination due to small differences in structure and solvation of the new triad.

Organic molecules on metal and oxide semiconductor substrates: Adsorption behavior and electronic energy level alignment

NASA Astrophysics Data System (ADS)

Ruggieri, Charles M.

Modern devices such as organic light emitting diodes use organic/oxide and organic/metal interfaces for crucial processes such as charge injection and charge transfer. Understanding fundamental physical processes occurring at these interfaces is essential to improving device performance. The ultimate goal of studying such interfaces is to form a predictive model of interfacial interactions, which has not yet been established. To this end, this thesis focuses on obtaining a better understanding of fundamental physical interactions governing molecular self-assembly and electronic energy level alignment at organic/metal and organic/oxide interfaces. This is accomplished by investigating both the molecular adsorption geometry using scanning tunneling microscopy, as well as the electronic structure at the interface using direct and inverse photoemission spectroscopy, and analyzing the results in the context of first principles electronic structure calculations. First, we study the adsorption geometry of zinc tetraphenylporphyrin (ZnTPP) molecules on three noble metal surfaces: Au(111), Ag(111), and Ag(100). These surfaces were chosen to systematically compare the molecular self-assembly and adsorption behavior on two metals of the same surface symmetry and two surface symmetries of one metal. From this investigation, we improve the understanding of self-assembly at organic/metal interfaces and the relative strengths of competing intermolecular and molecule-substrate interactions that influence molecular adsorption geometry. We then investigate the electronic structure of the ZnTPP/Au(111), Ag(111), and Ag(100) interfaces as examples of weakly-interacting systems. We compare these cases to ZnTPP on TiO2(110), a wide-bandgap oxide semiconductor, and explain the intermolecular and molecule-substrate interactions that determine the electronic energy level alignment at the interface. Finally we study tetracyanoquinodimethane (TCNQ), a strong electron acceptor, on TiO2(110), which exhibits chemical hybridization accompanied by molecular distortion, as well as extreme charge transfer resulting in the development of a space charge layer in the oxide. Thus, we present a broad experimental and theoretical perspective on the study of organic/metal and organic/oxide interfaces, elucidating fundamental physical interactions that govern molecular organization and energy level alignment.

On the electrophilic character of molecules through its relation with electronegativity and chemical hardness.

PubMed

Islam, Nazmul; Ghosh, Dulal C

2012-01-01

Electrophilicity is an intrinsic property of atoms and molecules. It probably originates logistically with the involvement in the physical process of electrostatics of soaked charge in electronic shells and the screened nuclear charge of atoms. Motivated by the existing view of conceptual density functional theory that similar to electronegativity and hardness equalization, there should be a physical process of equalization of electrophilicity during the chemical process of formation of hetero nuclear molecules, we have developed a new theoretical scheme and formula for evaluating the electrophilicity of hetero nuclear molecules. A comparative study with available bench marking reveals that the hypothesis of electrophilicity and equalization, and the present method of evaluating equalized electrophilicity, are scientifically promising.

On the Electrophilic Character of Molecules Through Its Relation with Electronegativity and Chemical Hardness

PubMed Central

Islam, Nazmul; Ghosh, Dulal C.

2012-01-01

Electrophilicity is an intrinsic property of atoms and molecules. It probably originates logistically with the involvement in the physical process of electrostatics of soaked charge in electronic shells and the screened nuclear charge of atoms. Motivated by the existing view of conceptual density functional theory that similar to electronegativity and hardness equalization, there should be a physical process of equalization of electrophilicity during the chemical process of formation of hetero nuclear molecules, we have developed a new theoretical scheme and formula for evaluating the electrophilicity of hetero nuclear molecules. A comparative study with available bench marking reveals that the hypothesis of electrophilicity and equalization, and the present method of evaluating equalized electrophilicity, are scientifically promising. PMID:22408445

Electron and hole transport in the organic small molecule α-NPD

NASA Astrophysics Data System (ADS)

Rohloff, R.; Kotadiya, N. B.; Crǎciun, N. I.; Blom, P. W. M.; Wetzelaer, G. A. H.

2017-02-01

Electron and hole transport properties of the organic small molecule N,N'-Di(1-naphthyl)-N,N'-diphenyl-(1,1'-biphenyl)-4,4'-diamine are investigated by space-charge-limited current measurements. The hole transport shows trap-free behavior with a mobility of 2.3 × 10-8 m2/Vs at vanishing carrier density and electric field. The electron transport, on the other hand, shows heavily trap-limited behavior, which leads to highly unbalanced transport. A trap concentration of 1.3 × 1024 m-3 was found by modeling the electron currents, similar to the universal trap concentration found in conjugated polymers. This indicates that electron trapping is a generic property of organic semiconductors, ranging from vacuum-deposited small-molecules to solution-processed conjugated polymers.

A Haptic-Enhanced System for Molecular Sensing

NASA Astrophysics Data System (ADS)

Comai, Sara; Mazza, Davide

The science of haptics has received an enormous attention in the last decade. One of the major application trends of haptics technology is data visualization and training. In this paper, we present a haptically-enhanced system for manipulation and tactile exploration of molecules.The geometrical models of molecules is extracted either from theoretical or empirical data using file formats widely adopted in chemical and biological fields. The addition of information computed with computational chemistry tools, allows users to feel the interaction forces between an explored molecule and a charge associated to the haptic device, and to visualize a huge amount of numerical data in a more comprehensible way. The developed tool can be used either for teaching or research purposes due to its high reliance on both theoretical and experimental data.

Nonlocal continuum electrostatic theory predicts surprisingly small energetic penalties for charge burial in proteins.

PubMed

Bardhan, Jaydeep P

2011-09-14

We study the energetics of burying charges, ion pairs, and ionizable groups in a simple protein model using nonlocal continuum electrostatics. Our primary finding is that the nonlocal response leads to markedly reduced solvent screening, comparable to the use of application-specific protein dielectric constants. Employing the same parameters as used in other nonlocal studies, we find that for a sphere of radius 13.4 Å containing a single +1e charge, the nonlocal solvation free energy varies less than 18 kcal/mol as the charge moves from the surface to the center, whereas the difference in the local Poisson model is ∼35 kcal/mol. Because an ion pair (salt bridge) generates a comparatively more rapidly varying Coulomb potential, energetics for salt bridges are even more significantly reduced in the nonlocal model. By varying the central parameter in nonlocal theory, which is an effective length scale associated with correlations between solvent molecules, nonlocal-model energetics can be varied from the standard local results to essentially zero; however, the existence of the reduction in charge-burial penalties is quite robust to variations in the protein dielectric constant and the correlation length. Finally, as a simple exploratory test of the implications of nonlocal response, we calculate glutamate pK(a) shifts and find that using standard protein parameters (ε(protein) = 2-4), nonlocal results match local-model predictions with much higher dielectric constants. Nonlocality may, therefore, be one factor in resolving discrepancies between measured protein dielectric constants and the model parameters often used to match titration experiments. Nonlocal models may hold significant promise to deepen our understanding of macromolecular electrostatics without substantially increasing computational complexity. © 2011 American Institute of Physics

Electric field changes on Au nanoparticles on semiconductor supports--the molecular voltmeter and other methods to observe adsorbate-induced charge-transfer effects in Au/TiO2 nanocatalysts.

PubMed

McEntee, Monica; Stevanovic, Ana; Tang, Wenjie; Neurock, Matthew; Yates, John T

2015-02-11

Infrared (IR) studies of Au/TiO2 catalyst particles indicate that charge transfer from van der Waals-bound donor or acceptor molecules on TiO2 to or from Au occurs via transport of charge carriers in the semiconductor TiO2 support. The ΔνCO on Au is shown to be proportional to the polarizability of the TiO2 support fully covered with donor or acceptor molecules, producing a proportional frequency shift in νCO. Charge transfer through TiO2 is associated with the population of electron trap sites in the bandgap of TiO2 and can be independently followed by changes in photoluminescence intensity and by shifts in the broad IR absorbance region for electron trap sites, which is also proportional to the polarizability of donors by IR excitation. Density functional theory calculations show that electron transfer from the donor molecules to TiO2 and to supported Au particles produces a negative charge on the Au, whereas the transfer from the Au particles to the TiO2 support into acceptor molecules results in a positive charge on the Au. These changes along with the magnitudes of the shifts are consistent with the Stark effect. A number of experiments show that the ∼3 nm Au particles act as "molecular voltmeters" in influencing ΔνCO. Insulator particles, such as SiO2, do not display electron-transfer effects to Au particles on their surface. These studies are preliminary to doping studies of semiconductor-oxide particles by metal ions which modify Lewis acid/base oxide properties and possibly strongly modify the electron-transfer and catalytic activity of supported metal catalyst particles.

Structural and vibrational characteristics of a non-linear optical material 3-(4-nitrophenyl)-1-(pyridine-3-yl) prop-2-en-1-one probed by quantum chemical computation and spectroscopic techniques

NASA Astrophysics Data System (ADS)

Kumar, Ram; Karthick, T.; Tandon, Poonam; Agarwal, Parag; Menezes, Anthoni Praveen; Jayarama, A.

2018-07-01

Chalcone and its derivatives are well-known for their high non-linear optical behavior and charge transfer characteristics. The effectiveness of charge transfer via ethylenic group and increase in NLO response of the chalcone upon substitutions are of great interest. The present study focuses the structural, charge transfer and non-linear optical properties of a new chalcone derivative "3-(4-nitrophenyl)-1-(pyridine-3-yl) prop-2-en-1-one" (hereafter abbreviated as 4 NP3AP). To accomplish this task, we have incorporated the experimental FT-IR, FT-Raman and UV-vis spectroscopic studies along with quantum chemical calculations. The frequency assignments of peaks in IR and Raman have been done on the basis of potential energy distribution and the results were compared with the earlier reports on similar kind of molecules. For obtaining the electronic transition details of 4 NP3AP, UV-vis spectrum has been simulated by considering both gaseous and solvent phase using time-dependent density functional theory (TD-DFT). The HOMO-LUMO energy gap, most important factor to be considered for studying charge transfer properties of the molecule has been calculated. The electron density surface map corresponding to the net electrostatic point charges has been generated to obtain the electrophilic and nucleophilic sites. The charge transfer originating from the occupied (donor) and unoccupied (acceptor) molecular orbitals have been analyzed with the help of natural bond orbital theory. Moreover, the estimation of second-hyperpolarizability of the molecule confirms the non-linear optical behavior of the molecule.

Structure and electronic absorption spectra of nematogenic alkoxycinnamic acids - a comparative study based on semiempirical and DFT methods.

PubMed

Praveen, Pogula Lakshmi; Ojha, Durga Prasad

2012-04-01

Structure of nematogenic p-n-Alkoxy cinnamic acids (nOCAC) with various alkyl chain carbon atoms (n = 2, 4, 6, 8) has been optimized using density functional B3LYP with 6-31+G (d) basis set using crystallographic geometry as input. Using the optimized geometry, electronic structure of the molecules has been evaluated using the semiempirical methods and DFT calculations. Molecular charge distribution and phase stability of these systems have been analyzed based on Mulliken and Löwdin population analysis. The electronic absorption spectra of nOCAC molecules have been simulated by employing DFT method, semiempirical CNDO/S and INDO/S parameterizations. Two types of calculations have been performed for model systems containing single and double molecules of nOCAC. UV-Visible spectra have been calculated for all single molecules. The UV stability of the molecules has been discussed in light of the electronic transition oscillator strength (f). The dimer complexes of higher homologues (n = 6, 8) have also been reported to enable the comparison between single and double molecules.

Track structure: time evolution from physics to chemistry.

PubMed

Dingfelder, M

2006-01-01

This review discusses interaction cross sections of charged particles (electrons, protons, light ions) with atoms and molecules. The focus is on biological relevant targets like liquid water which serves as a substitute of soft tissue in most Monte Carlo codes. The spatial distribution of energy deposition patterns by different radiation qualities and their importance to the time evolution from the physical to the chemical stage or radiation response is discussed. The determination of inelastic interaction cross sections for charged particles in condensed matter is discussed within the relativistic plane-wave Born approximation and semi-empirical models. The dielectric-response-function of liquid water is discussed.

Extension of the self-consistent-charge density-functional tight-binding method: third-order expansion of the density functional theory total energy and introduction of a modified effective coulomb interaction.

PubMed

Yang, Yang; Yu, Haibo; York, Darrin; Cui, Qiang; Elstner, Marcus

2007-10-25

The standard self-consistent-charge density-functional-tight-binding (SCC-DFTB) method (Phys. Rev. B 1998, 58, 7260) is derived by a second-order expansion of the density functional theory total energy expression, followed by an approximation of the charge density fluctuations by charge monopoles and an effective damped Coulomb interaction between the atomic net charges. The central assumptions behind this effective charge-charge interaction are the inverse relation of atomic size and chemical hardness and the use of a fixed chemical hardness parameter independent of the atomic charge state. While these approximations seem to be unproblematic for many covalently bound systems, they are quantitatively insufficient for hydrogen-bonding interactions and (anionic) molecules with localized net charges. Here, we present an extension of the SCC-DFTB method to incorporate third-order terms in the charge density fluctuations, leading to chemical hardness parameters that are dependent on the atomic charge state and a modification of the Coulomb scaling to improve the electrostatic treatment within the second-order terms. These modifications lead to a significant improvement in the description of hydrogen-bonding interactions and proton affinities of biologically relevant molecules.

A combined experimental and theoretical studies on FT-IR, FT-Raman and UV-vis spectra of 2-chloro-3-quinolinecarboxaldehyde

NASA Astrophysics Data System (ADS)

Prasad, M. V. S.; Udaya Sri, N.; Veeraiah, V.

2015-09-01

In the present study, the FT-IR and FT-Raman spectra of 2-chloro-3-quinolinecarboxaldehyde (2Cl3QC) have been recorded in the region 4000-400 and 3500-50 cm-1, respectively. The fundamental modes of vibrational frequencies of 2Cl3QC are assigned. Theoretical information on the optimized geometry, harmonic vibrational frequencies, infrared and Raman intensities were obtained by means of density functional theory (DFT) gradient calculations with complete relaxation in the potential energy surface using 6-31G(d,p) basis set. The vibrational frequencies which were determined experimentally from the spectral data are compared with those obtained theoretically from DFT calculations. A close agreement was achieved between the observed and calculated frequencies by refinement of the scale factors. The infrared and Raman spectra were also predicted from the calculated intensities. Thermodynamic properties like entropy, heat capacity, zero point energy, have been calculated for the molecule. The predicted first hyperpolarizability also shows that the molecule might have a reasonably good non-linear optical (NLO) behavior. The calculated HOMO-LUMO energy gap reveals that charge transfer occurs within the molecule. Stability of the molecule arising from hyper conjugative interactions, charge delocalization have been analyzed using natural bond orbitals (NBO) analysis. The results show that charge in electron density (ED) in the π∗ antibonding orbitals and E(2) energies confirms the occurrence of ICT (intra-molecular charge transfer) within the molecule. UV-visible spectrum of the title molecule has also been calculated using TD-DFT/CAM-B3LYP/6-31G(d,p) method. The calculated energy and oscillator strength almost exactly reproduces reported experimental data.

A combined experimental and theoretical studies on FT-IR, FT-Raman and UV-vis spectra of 2-chloro-3-quinolinecarboxaldehyde.

PubMed

Prasad, M V S; Udaya Sri, N; Veeraiah, V

2015-09-05

In the present study, the FT-IR and FT-Raman spectra of 2-chloro-3-quinolinecarboxaldehyde (2Cl3QC) have been recorded in the region 4000-400 and 3500-50 cm(-1), respectively. The fundamental modes of vibrational frequencies of 2Cl3QC are assigned. Theoretical information on the optimized geometry, harmonic vibrational frequencies, infrared and Raman intensities were obtained by means of density functional theory (DFT) gradient calculations with complete relaxation in the potential energy surface using 6-31G(d,p) basis set. The vibrational frequencies which were determined experimentally from the spectral data are compared with those obtained theoretically from DFT calculations. A close agreement was achieved between the observed and calculated frequencies by refinement of the scale factors. The infrared and Raman spectra were also predicted from the calculated intensities. Thermodynamic properties like entropy, heat capacity, zero point energy, have been calculated for the molecule. The predicted first hyperpolarizability also shows that the molecule might have a reasonably good non-linear optical (NLO) behavior. The calculated HOMO-LUMO energy gap reveals that charge transfer occurs within the molecule. Stability of the molecule arising from hyper conjugative interactions, charge delocalization have been analyzed using natural bond orbitals (NBO) analysis. The results show that charge in electron density (ED) in the π(∗) antibonding orbitals and E((2)) energies confirms the occurrence of ICT (intra-molecular charge transfer) within the molecule. UV-visible spectrum of the title molecule has also been calculated using TD-DFT/CAM-B3LYP/6-31G(d,p) method. The calculated energy and oscillator strength almost exactly reproduces reported experimental data. Copyright © 2015 Elsevier B.V. All rights reserved.

Free-standing few-layered graphene oxide films: selective, steady and lasting permeation of organic molecules with adjustable speeds

NASA Astrophysics Data System (ADS)

Huang, Tao; An, Qi; Luan, Xinglong; Zhang, Qian; Zhang, Yihe

2016-01-01

A variety of small molecules with diameters around 1 nm possess a range of functions, such as antibiotic, antimicrobic, anticoagulant, pesticidal and chemotherapy effects, making these molecules especially useful in various applications ranging from medical treatment to environmental microbiological control. However, the long-term steady delivery (release or permeation) of these small molecules with adjustable and controllable speeds has remained an especially challenging task. In this study, we prepared covalently cross-linked free-standing few-layered GO films using a layer-by-layer technique in combination with photochemical cross-linkages, and achieved a controlled release of positively charged, negatively charged, and zwitterionic small molecules with adjustable and controllable speeds. The steady delivery of the small molecule lasted up to 9 days. Other functionalities, such as graphene-enhanced Raman spectra and electrochemical properties that could also be integrated or employed in delivery systems, were also studied for our films. We expect the special molecular delivery properties of our films to lead to new possibilities in drug/fertilizer delivery and environmental microbiological control applications.A variety of small molecules with diameters around 1 nm possess a range of functions, such as antibiotic, antimicrobic, anticoagulant, pesticidal and chemotherapy effects, making these molecules especially useful in various applications ranging from medical treatment to environmental microbiological control. However, the long-term steady delivery (release or permeation) of these small molecules with adjustable and controllable speeds has remained an especially challenging task. In this study, we prepared covalently cross-linked free-standing few-layered GO films using a layer-by-layer technique in combination with photochemical cross-linkages, and achieved a controlled release of positively charged, negatively charged, and zwitterionic small molecules with adjustable and controllable speeds. The steady delivery of the small molecule lasted up to 9 days. Other functionalities, such as graphene-enhanced Raman spectra and electrochemical properties that could also be integrated or employed in delivery systems, were also studied for our films. We expect the special molecular delivery properties of our films to lead to new possibilities in drug/fertilizer delivery and environmental microbiological control applications. Electronic supplementary information (ESI) available: AFM images of GO and GO films, UV-vis spectra of delayed release, and permeation fidelities. See DOI: 10.1039/c5nr08129g

HPAM: Hirshfeld Partitioned Atomic Multipoles

PubMed Central

Elking, Dennis M.; Perera, Lalith; Pedersen, Lee G.

2011-01-01

An implementation of the Hirshfeld (HD) and Hirshfeld-Iterated (HD-I) atomic charge density partitioning schemes is described. Atomic charges and atomic multipoles are calculated from the HD and HD-I atomic charge densities for arbitrary atomic multipole rank lmax on molecules of arbitrary shape and size. The HD and HD-I atomic charges/multipoles are tested by comparing molecular multipole moments and the electrostatic potential (ESP) surrounding a molecule with their reference ab initio values. In general, the HD-I atomic charges/multipoles are found to better reproduce ab initio electrostatic properties over HD atomic charges/multipoles. A systematic increase in precision for reproducing ab initio electrostatic properties is demonstrated by increasing the atomic multipole rank from lmax = 0 (atomic charges) to lmax = 4 (atomic hexadecapoles). Both HD and HD-I atomic multipoles up to rank lmax are shown to exactly reproduce ab initio molecular multipole moments of rank L for L ≤ lmax. In addition, molecular dipole moments calculated by HD, HD-I, and ChelpG atomic charges only (lmax = 0) are compared with reference ab initio values. Significant errors in reproducing ab initio molecular dipole moments are found if only HD or HD-I atomic charges used. PMID:22140274

Vibrational spectroscopic and DFT calculation studies of 2-amino-7-bromo-5-oxo-[1]benzopyrano [2,3-b]pyridine-3 carbonitrile.

PubMed

Premkumar, S; Jawahar, A; Mathavan, T; Kumara Dhas, M; Milton Franklin Benial, A

2015-03-05

The vibrational spectra of 2-amino-7-bromo-5-oxo-[1]benzopyrano [2,3-b]pyridine-3 carbonitrile were recorded using fourier transform-infrared and fourier transform-Raman spectrometer. The optimized structural parameters, vibrational frequencies, Mulliken atomic charge distribution, frontier molecular orbitals, thermodynamic properties, temperature dependence of thermodynamic parameters, first order hyperpolarizability and natural bond orbital calculations of the molecule were performed using the Gaussian 09 program. The vibrational frequencies were assigned on the basis of potential energy distribution calculation using the VEDA 4.0 program. The calculated first order hyperpolarizability of ABOBPC molecule was obtained as 6.908×10(-30) issue, which was 10.5 times greater than urea. The nonlinear optical activity of the molecule was also confirmed by the frontier molecular orbitals and natural bond orbital analysis. The frontier molecular orbitals analysis shows that the lower energy gap of the molecule, which leads to the higher value of first order hyperpolarizability. The natural bond orbital analysis indicates that the nonlinear optical activity of the molecule arises due to the π→π(∗) transitions. The Mulliken atomic charge distribution confirms the presence of intramolecular charge transfer within the molecule. The reactive site of the molecule was predicted from the molecular electrostatic potential contour map. The values of thermo dynamic parameters were increasing with increasing temperature. Copyright © 2014 Elsevier B.V. All rights reserved.

Gaussian polarizable-ion tight binding.

PubMed

Boleininger, Max; Guilbert, Anne Ay; Horsfield, Andrew P

2016-10-14

To interpret ultrafast dynamics experiments on large molecules, computer simulation is required due to the complex response to the laser field. We present a method capable of efficiently computing the static electronic response of large systems to external electric fields. This is achieved by extending the density-functional tight binding method to include larger basis sets and by multipole expansion of the charge density into electrostatically interacting Gaussian distributions. Polarizabilities for a range of hydrocarbon molecules are computed for a multipole expansion up to quadrupole order, giving excellent agreement with experimental values, with average errors similar to those from density functional theory, but at a small fraction of the cost. We apply the model in conjunction with the polarizable-point-dipoles model to estimate the internal fields in amorphous poly(3-hexylthiophene-2,5-diyl).

Gaussian polarizable-ion tight binding

NASA Astrophysics Data System (ADS)

Boleininger, Max; Guilbert, Anne AY; Horsfield, Andrew P.

2016-10-01

To interpret ultrafast dynamics experiments on large molecules, computer simulation is required due to the complex response to the laser field. We present a method capable of efficiently computing the static electronic response of large systems to external electric fields. This is achieved by extending the density-functional tight binding method to include larger basis sets and by multipole expansion of the charge density into electrostatically interacting Gaussian distributions. Polarizabilities for a range of hydrocarbon molecules are computed for a multipole expansion up to quadrupole order, giving excellent agreement with experimental values, with average errors similar to those from density functional theory, but at a small fraction of the cost. We apply the model in conjunction with the polarizable-point-dipoles model to estimate the internal fields in amorphous poly(3-hexylthiophene-2,5-diyl).

Electrostatics of polymer translocation events in electrolyte solutions.

PubMed

Buyukdagli, Sahin; Ala-Nissila, T

2016-07-07

We develop an analytical theory that accounts for the image and surface charge interactions between a charged dielectric membrane and a DNA molecule translocating through the membrane. Translocation events through neutral carbon-based membranes are driven by a competition between the repulsive DNA-image-charge interactions and the attractive coupling between the DNA segments on the trans and the cis sides of the membrane. The latter effect is induced by the reduction of the coupling by the dielectric membrane. In strong salt solutions where the repulsive image-charge effects dominate the attractive trans-cis coupling, the DNA molecule encounters a translocation barrier of ≈10 kBT. In dilute electrolytes, the trans-cis coupling takes over image-charge forces and the membrane becomes a metastable attraction point that can trap translocating polymers over long time intervals. This mechanism can be used in translocation experiments in order to control DNA motion by tuning the salt concentration of the solution.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ran, Niva A.; Roland, Steffen; Love, John A.

Here, a long standing question in organic electronics concerns the effects of molecular orientation at donor/acceptor heterojunctions. Given a well-controlled donor/acceptor bilayer system, we uncover the genuine effects of molecular orientation on charge generation and recombination. These effects are studied through the point of view of photovoltaics—however, the results have important implications on the operation of all optoelectronic devices with donor/acceptor interfaces, such as light emitting diodes and photodetectors. Our findings can be summarized by two points. First, devices with donor molecules face-on to the acceptor interface have a higher charge transfer state energy and less non-radiative recombination, resulting inmore » larger open-circuit voltages and higher radiative efficiencies. Second, devices with donor molecules edge-on to the acceptor interface are more efficient at charge generation, attributed to smaller electronic coupling between the charge transfer states and the ground state, and lower activation energy for charge generation.« less

Photodissociation spectroscopy of (benzene-toluene) +. Charge delocalization in the hetero-dimer ion

NASA Astrophysics Data System (ADS)

Ohashi, Kazuhiko; Nakane, Youko; Inokuchi, Yoshiya; Nakai, Yasuhiro; Nishi, Nobuyuki

1998-12-01

The electronic spectrum of the benzene-toluene hetero-dimer ion is measured in the 380-1400 nm region. The spectrum shows intense bands around 1175 and 670 nm and a weaker band around 920 nm, which correspond to charge resonance (CR) bands of homo-dimer ions. The observation indicates that the positive charge stays on the benzene part in some probability, although the ionization potential of benzene is 0.4162 eV higher than that of toluene. A local excitation (LE) band is observed around 420 nm, where a π←π transition is locally excited in the charged benzene or toluene molecule. On the basis of the positions of the CR-like bands, as well as the intensity of the LE band relative to that of homo-dimer ions, the probability of finding the charge on the benzene molecule is analyzed to be approximately 36%.

Improving the Charge Carrier Transport and Suppressing Recombination of Soluble Squaraine-Based Solar Cells via Parallel-Like Structure

PubMed Central

Zhu, Youqin; Liu, Jingli; Zhao, Jiao; Li, Yang; Qiao, Bo; Song, Dandan; Huang, Yan; Xu, Zheng; Zhao, Suling; Xu, Xurong

2018-01-01

Small molecule organic solar cells (SMOSCs) have attracted extensive attention in recent years. Squaraine (SQ) is a kind of small molecule material for potential use in high-efficiency devices, because of its high extinction coefficient and low-cost synthesis. However, the charge carrier mobility of SQ-based film is much lower than other effective materials, which leads to the pretty low fill factor (FF). In this study, we improve the performance of SQ derivative-based solar cells by incorporating PCDTBT into LQ-51/PC71BM host binary blend film. The incorporation of PCDTBT can not only increase the photon harvesting, but also provide an additional hole transport pathway. Through the charge carrier mobility and transient photovoltage measurement, we find that the hole mobility and charge carrier lifetime increase in the ternary system. Also, we carefully demonstrate that the charge carrier transport follows a parallel-like behavior. PMID:29747394

Nanocomplexes of Photolabile Polyelectrolyte and Upconversion Nanoparticles for Near-Infrared Light-Triggered Payload Release.

PubMed

Xiang, Jun; Ge, Feijie; Yu, Bing; Yan, Qiang; Shi, Feng; Zhao, Yue

2018-06-07

A new approach to encapsulating charged cargo molecules into a nanovector and subsequently using near-infrared (NIR) light to trigger the release is demonstrated. NIR light-responsive nanovector was prepared through electrostatic interaction-driven complexation between negatively charged silica-coated upconversion nanoparticles (UCNP@silica, 87 nm hydrodynamic diameter, polydispersity index ∼0.05) and a positively charged UV-labile polyelectrolyte bearing pendants of poly(ethylene glycol) and o-nitrobenzyl side groups; whereas charged fluorescein (FLU) was loaded through a co-complexation process. By controlling the amount of polyelectrolyte, UCNP@silica can be covered by the polymer, whereas remaining dispersed in aqueous solution. Under 980 nm laser excitation, UV light emitted by UCNP is absorbed by photolytic side groups within polyelectrolyte, which results in cleavage of o-nitrobenzyl groups and formation of carboxylic acid groups. Such NIR light-induced partial reversal of positive charge to negative charge on the polyelectrolyte layer disrupts the equilibrium among UCNP@silica, polyelectrolyte, and FLU and, consequently, leads to release of FLU molecules.

Impact of interfacial molecular orientation on radiative recombination and charge generation efficiency

DOE PAGES

Ran, Niva A.; Roland, Steffen; Love, John A.; ...

2017-07-19

Here, a long standing question in organic electronics concerns the effects of molecular orientation at donor/acceptor heterojunctions. Given a well-controlled donor/acceptor bilayer system, we uncover the genuine effects of molecular orientation on charge generation and recombination. These effects are studied through the point of view of photovoltaics—however, the results have important implications on the operation of all optoelectronic devices with donor/acceptor interfaces, such as light emitting diodes and photodetectors. Our findings can be summarized by two points. First, devices with donor molecules face-on to the acceptor interface have a higher charge transfer state energy and less non-radiative recombination, resulting inmore » larger open-circuit voltages and higher radiative efficiencies. Second, devices with donor molecules edge-on to the acceptor interface are more efficient at charge generation, attributed to smaller electronic coupling between the charge transfer states and the ground state, and lower activation energy for charge generation.« less

The Case Against Charge Transfer Interactions in Dissolved Organic Matter Optical Properties

NASA Astrophysics Data System (ADS)

McKay, G.; Korak, J.; Erickson, P. R.; Latch, D. E.; McNeill, K.; Rosario-Ortiz, F.

2017-12-01

The optical properties of dissolved organic matter influence chemical and biological processes in all aquatic ecosystems. Organic matter optical properties have been used by scientists and engineers for decades for remote sensing, in situ monitoring, and characterizing laboratory samples to track dissolved organic carbon concentration and character. However, there is still a lack of understanding of the origin of organic matter optical properties, which could conflict with other empirical fluorescence interpretation methods (e.g. PARAFAC). Organic matter optical properties have been attributed to a charge-transfer model in which donor-acceptor complexes play a primary role. This model was evaluated by measuring the absorbance and fluorescence response of organic matter isolates to perturbations in solvent temperature, viscosity, and polarity, which affect the position and intensity of spectra for known donor-acceptor complexes of organic molecules. Absorbance and fluorescence spectral shape were unaffected by these perturbations, indicating that the distribution of absorbing and emitting species was unchanged. These results call into question the wide applicability of the charge-transfer model for explaining organic matter optical properties and suggest that future research should explore other models for organic matter photophysics.

Addition of ferrocene controls polymorphism and enhances charge mobilities in poly(3-hexylthiophene) thin-film transistors

NASA Astrophysics Data System (ADS)

Smith, Brandon; Clark, Michael; Grieco, Christopher; Larsen, Alec; Asbury, John; Gomez, Enrique

2015-03-01

Crystalline organic molecules often exhibit the ability to form multiple crystal structures depending on the processing conditions. Exploiting this polymorphism to optimize molecular orbital overlap between adjacent molecules within the unit lattice of conjugated polymers is an approach to enhance charge transport within the material. We have demonstrated the formation of tighter π- π stacking poly(3-hexylthiophene-2,5-diyl) polymorphs in films spin coated from ferrocene-containing solutions using grazing incident X-ray diffraction. As a result, we found that the addition of ferrocene to casting solutions yields thin-film transistors which exhibit significantly higher source-drain current and charge mobilities than neat polymer devices. Insights gleaned from ferrocene/poly(3-hexylthiophene) mixtures can serve as a template for selection and optimization of next generation small molecule/polymer systems possessing greater baseline charge mobilities. Ultimately, the development of such techniques to enhance the characteristics of organic transistors without imparting high costs or loss of advantageous properties will be a critical factor determining the future of organic components within the electronics market.

Modeling of protein-anion exchange resin interaction for the human growth hormone charge variants.

PubMed

Lapelosa, Mauro; Patapoff, Thomas W; Zarraga, Isidro E

2015-12-01

Modeling ion exchange chromatography (IEC) behavior has generated significant interest because of the wide use of IEC as an analytical technique as well as a preparative protein purification process; indeed there is a need for better understanding of what drives the unique behavior of protein charge variants. We hypothesize that a complex protein molecule, which contains both hydrophobic and charged moieties, would interact strongly with an in silico designed resin through charged electrostatic patches on the surface of the protein. In the present work, variants of recombinant human growth hormone that mimic naturally-occurring deamidation products were produced and characterized in silico. The study included these four variants: rhGH, N149D, N152D, and N149D/N152D. Poisson-Boltzmann calculations were used to determine surface electrostatic potential. Metropolis Monte Carlo simulations were carried out with the resulting variants to simulate IEC systems, examining the free energy of the interaction of the protein with an in silico anion exchange column represented by polylysine polypeptide. The results show that the charge variants have different average binding energies and the free energy of interaction can be used to predict the retention time for the different variants. Copyright © 2015 Elsevier B.V. All rights reserved.

Comparison of all atom, continuum, and linear fitting empirical models for charge screening effect of aqueous medium surrounding a protein molecule

NASA Astrophysics Data System (ADS)

Takahashi, Takuya; Sugiura, Junnnosuke; Nagayama, Kuniaki

2002-05-01

To investigate the role hydration plays in the electrostatic interactions of proteins, the time-averaged electrostatic potential of the B1 domain of protein G in an aqueous solution was calculated with full atomic molecular dynamics simulations that explicitly considers every atom (i.e., an all atom model). This all atom calculated potential was compared with the potential obtained from an electrostatic continuum model calculation. In both cases, the charge-screening effect was fairly well formulated with an effective relative dielectric constant which increased linearly with increasing charge-charge distance. This simulated linear dependence agrees with the experimentally determined linear relation proposed by Pickersgill. Cut-off approximations for Coulomb interactions failed to reproduce this linear relation. Correlation between the all atom model and the continuum models was found to be better than the respective correlation calculated for linear fitting to the two models. This confirms that the continuum model is better at treating the complicated shapes of protein conformations than the simple linear fitting empirical model. We have tried a sigmoid fitting empirical model in addition to the linear one. When weights of all data were treated equally, the sigmoid model, which requires two fitting parameters, fits results of both the all atom and the continuum models less accurately than the linear model which requires only one fitting parameter. When potential values are chosen as weighting factors, the fitting error of the sigmoid model became smaller, and the slope of both linear fitting curves became smaller. This suggests the screening effect of an aqueous medium within a short range, where potential values are relatively large, is smaller than that expected from the linear fitting curve whose slope is almost 4. To investigate the linear increase of the effective relative dielectric constant, the Poisson equation of a low-dielectric sphere in a high-dielectric medium was solved and charges distributed near the molecular surface were indicated as leading to the apparent linearity.

Debye screening in single-molecule carbon nanotube field-effect sensors.

PubMed

Sorgenfrei, Sebastian; Chiu, Chien-Yang; Johnston, Matthew; Nuckolls, Colin; Shepard, Kenneth L

2011-09-14

Point-functionalized carbon nanotube field-effect transistors can serve as highly sensitive detectors for biomolecules. With a probe molecule covalently bound to a defect in the nanotube sidewall, two-level random telegraph noise (RTN) in the conductance of the device is observed as a result of a charged target biomolecule binding and unbinding at the defect site. Charge in proximity to the defect modulates the potential (and transmission) of the conductance-limiting barrier created by the defect. In this Letter, we study how these single-molecule electronic sensors are affected by ionic screening. Both charge in proximity to the defect site and buffer concentration are found to affect RTN amplitude in a manner that follows from simple Debye length considerations. RTN amplitude is also dependent on the potential of the electrolyte gate as applied to the reference electrode; at high enough gate potentials, the target DNA is completely repelled and RTN is suppressed.

Radical Chemistry and Charge Manipulation with an Atomic Force Microscope

NASA Astrophysics Data System (ADS)

Gross, Leo

The fuctionalization of tips by atomic manipulation dramatically increased the resolution of atomic force microscopy (AFM). The combination of high-resolution AFM with atomic manipulation now offers the unprecedented possibility to custom-design individual molecules by making and breaking bonds with the tip of the microscope and directly characterizing the products on the atomic scale. We recently applied this technique to generate and study reaction intermediates and to investigate chemical reactions trigged by atomic manipulation. We formed diradicals by dissociating halogen atoms and then reversibly triggered ring-opening and -closing reactions via atomic manipulation, allowing us to switch and control the molecule's reactivity, magnetic and optical properties. Additional information about charge states and charge distributions can be obtained by Kelvin probe force spectroscopy. On multilayer insulating films we investigated single-electron attachment, detachment and transfer between individual molecules. EU ERC AMSEL (682144), EU project PAMS (610446).

Possible influence of the Kuramoto length in a photo-catalytic water splitting reaction revealed by Poisson-Nernst-Planck equations involving ionization in a weak electrolyte

NASA Astrophysics Data System (ADS)

Suzuki, Yohichi; Seki, Kazuhiko

2018-03-01

We studied ion concentration profiles and the charge density gradient caused by electrode reactions in weak electrolytes by using the Poisson-Nernst-Planck equations without assuming charge neutrality. In weak electrolytes, only a small fraction of molecules is ionized in bulk. Ion concentration profiles depend on not only ion transport but also the ionization of molecules. We considered the ionization of molecules and ion association in weak electrolytes and obtained analytical expressions for ion densities, electrostatic potential profiles, and ion currents. We found the case that the total ion density gradient was given by the Kuramoto length which characterized the distance over which an ion diffuses before association. The charge density gradient is characterized by the Debye length for 1:1 weak electrolytes. We discuss the role of these length scales for efficient water splitting reactions using photo-electrocatalytic electrodes.

Single helically folded aromatic oligoamides that mimic the charge surface of double-stranded B-DNA

NASA Astrophysics Data System (ADS)

Ziach, Krzysztof; Chollet, Céline; Parissi, Vincent; Prabhakaran, Panchami; Marchivie, Mathieu; Corvaglia, Valentina; Bose, Partha Pratim; Laxmi-Reddy, Katta; Godde, Frédéric; Schmitter, Jean-Marie; Chaignepain, Stéphane; Pourquier, Philippe; Huc, Ivan

2018-05-01

Numerous essential biomolecular processes require the recognition of DNA surface features by proteins. Molecules mimicking these features could potentially act as decoys and interfere with pharmacologically or therapeutically relevant protein-DNA interactions. Although naturally occurring DNA-mimicking proteins have been described, synthetic tunable molecules that mimic the charge surface of double-stranded DNA are not known. Here, we report the design, synthesis and structural characterization of aromatic oligoamides that fold into single helical conformations and display a double helical array of negatively charged residues in positions that match the phosphate moieties in B-DNA. These molecules were able to inhibit several enzymes possessing non-sequence-selective DNA-binding properties, including topoisomerase 1 and HIV-1 integrase, presumably through specific foldamer-protein interactions, whereas sequence-selective enzymes were not inhibited. Such modular and synthetically accessible DNA mimics provide a versatile platform to design novel inhibitors of protein-DNA interactions.

Potassium-intercalated H2Pc films: Alkali-induced electronic and geometrical modifications

NASA Astrophysics Data System (ADS)

Nilson, K.; Åhlund, J.; Shariati, M.-N.; Schiessling, J.; Palmgren, P.; Brena, B.; Göthelid, E.; Hennies, F.; Huismans, Y.; Evangelista, F.; Rudolf, P.; Göthelid, M.; Mârtensson, N.; Puglia, C.

2012-07-01

X-ray spectroscopy studies of potassium intercalated metal-free phthalocyanine multilayers adsorbed on Al(110) have been undertaken. Photoelectron spectroscopy measurements show the presence of several charge states of the molecules upon K intercalation, due to a charge transfer from the alkali. In addition, the comparison of valence band photoemission spectra with the density functional theory calculations of the density of states of the H2Pc- anion indicates a filling of the formerly lowest unoccupied molecular orbital by charge transfer from the alkali. This is further confirmed by x-ray absorption spectroscopy (XAS) studies, which show a decreased density of unoccupied states. XAS measurements in different experimental geometries reveal that the molecules in the pristine film are standing upright on the surface or are only slightly tilted away from the surface normal but upon K intercalation, the molecular orientation is changed in that the tilt angle of the molecules increases.

Debye screening in single-molecule carbon nanotube field-effect transistors

PubMed Central

Sorgenfrei, Sebastian; Chiu, Chien-yang; Johnston, Matthew; Nuckolls, Colin; Shepard, Kenneth L.

2013-01-01

Point-functionalized carbon nanotube field-effect transistors can serve as highly sensitive detectors for biomolecules. With a probe molecule covalently bound to a defect in the nanotube sidewall, two-level random telegraph noise (RTN) in the conductance of the device is observed as a result of a charged target biomolecule binding and unbinding at the defect site. Charge in proximity to the defect modulates the potential (and transmission) of the conductance-limiting barrier created by the defect. In this Letter, we study how these single-molecule electronic sensors are affected by ionic screening. Both charge in proximity to the defect site and buffer concentration are found to affect RTN amplitude in a manner that follows from simple Debye length considerations. RTN amplitude is also dependent on the potential of the electrolyte gate as applied to the reference electrode; at high enough repulsive potentials, the target DNA is completely repelled and RTN is suppressed. PMID:21806018

The simulation study of protein-protein interfaces based on the 4-helix bundle structure

NASA Astrophysics Data System (ADS)

Fukuda, Masaki; Komatsu, Yu; Morikawa, Ryota; Miyakawa, Takeshi; Takasu, Masako; Akanuma, Satoshi; Yamagishi, Akihiko

2013-02-01

Docking of two protein molecules is induced by intermolecular interactions. Our purposes in this study are: designing binding interfaces on the two proteins, which specifically interact to each other; and inducing intermolecular interactions between the two proteins by mixing them. A 4-helix bundle structure was chosen as a scaffold on which binding interfaces were created. Based on this scaffold, we designed binding interfaces involving charged and nonpolar amino acid residues. We performed molecular dynamics (MD) simulation to identify suitable amino acid residues for the interfaces. We chose YciF protein as the scaffold for the protein-protein docking simulation. We observed the structure of two YciF protein molecules (I and II), and we calculated the distance between centroids (center of gravity) of the interfaces' surface planes of the molecules I and II. We found that the docking of the two protein molecules can be controlled by the number of hydrophobic and charged amino acid residues involved in the interfaces. Existence of six hydrophobic and five charged amino acid residues within an interface were most suitable for the protein-protein docking.

Single molecule transistor based nanopore for the detection of nicotine

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ray, S. J., E-mail: ray.sjr@gmail.com

A nanopore based detection methodology was proposed and investigated for the detection of Nicotine. This technique uses a Single Molecular Transistor working as a nanopore operational in the Coulomb Blockade regime. When the Nicotine molecule is pulled through the nanopore area surrounded by the Source(S), Drain (D), and Gate electrodes, the charge stability diagram can detect the presence of the molecule and is unique for a specific molecular structure. Due to the weak coupling between the different electrodes which is set by the nanopore size, the molecular energy states stay almost unaffected by the electrostatic environment that can be realisedmore » from the charge stability diagram. Identification of different orientation and position of the Nicotine molecule within the nanopore area can be made from specific regions of overlap between different charge states on the stability diagram that could be used as an electronic fingerprint for detection. This method could be advantageous and useful to detect the presence of Nicotine in smoke which is usually performed using chemical chromatography techniques.« less

Photodissociation of aligned CH3I and C6H3F2I molecules probed with time-resolved Coulomb explosion imaging by site-selective extreme ultraviolet ionization

PubMed Central

Amini, Kasra; Savelyev, Evgeny; Brauße, Felix; Berrah, Nora; Bomme, Cédric; Brouard, Mark; Burt, Michael; Christensen, Lauge; Düsterer, Stefan; Erk, Benjamin; Höppner, Hauke; Kierspel, Thomas; Krecinic, Faruk; Lauer, Alexandra; Lee, Jason W. L.; Müller, Maria; Müller, Erland; Mullins, Terence; Redlin, Harald; Schirmel, Nora; Thøgersen, Jan; Techert, Simone; Toleikis, Sven; Treusch, Rolf; Trippel, Sebastian; Ulmer, Anatoli; Vallance, Claire; Wiese, Joss; Johnsson, Per; Küpper, Jochen; Rudenko, Artem; Rouzée, Arnaud; Stapelfeldt, Henrik; Rolles, Daniel; Boll, Rebecca

2018-01-01

We explore time-resolved Coulomb explosion induced by intense, extreme ultraviolet (XUV) femtosecond pulses from a free-electron laser as a method to image photo-induced molecular dynamics in two molecules, iodomethane and 2,6-difluoroiodobenzene. At an excitation wavelength of 267 nm, the dominant reaction pathway in both molecules is neutral dissociation via cleavage of the carbon–iodine bond. This allows investigating the influence of the molecular environment on the absorption of an intense, femtosecond XUV pulse and the subsequent Coulomb explosion process. We find that the XUV probe pulse induces local inner-shell ionization of atomic iodine in dissociating iodomethane, in contrast to non-selective ionization of all photofragments in difluoroiodobenzene. The results reveal evidence of electron transfer from methyl and phenyl moieties to a multiply charged iodine ion. In addition, indications for ultrafast charge rearrangement on the phenyl radical are found, suggesting that time-resolved Coulomb explosion imaging is sensitive to the localization of charge in extended molecules. PMID:29430482

Photodissociation of aligned CH3I and C6H3F2I molecules probed with time-resolved Coulomb explosion imaging by site-selective extreme ultraviolet ionization.

PubMed

Amini, Kasra; Savelyev, Evgeny; Brauße, Felix; Berrah, Nora; Bomme, Cédric; Brouard, Mark; Burt, Michael; Christensen, Lauge; Düsterer, Stefan; Erk, Benjamin; Höppner, Hauke; Kierspel, Thomas; Krecinic, Faruk; Lauer, Alexandra; Lee, Jason W L; Müller, Maria; Müller, Erland; Mullins, Terence; Redlin, Harald; Schirmel, Nora; Thøgersen, Jan; Techert, Simone; Toleikis, Sven; Treusch, Rolf; Trippel, Sebastian; Ulmer, Anatoli; Vallance, Claire; Wiese, Joss; Johnsson, Per; Küpper, Jochen; Rudenko, Artem; Rouzée, Arnaud; Stapelfeldt, Henrik; Rolles, Daniel; Boll, Rebecca

2018-01-01

We explore time-resolved Coulomb explosion induced by intense, extreme ultraviolet (XUV) femtosecond pulses from a free-electron laser as a method to image photo-induced molecular dynamics in two molecules, iodomethane and 2,6-difluoroiodobenzene. At an excitation wavelength of 267 nm, the dominant reaction pathway in both molecules is neutral dissociation via cleavage of the carbon-iodine bond. This allows investigating the influence of the molecular environment on the absorption of an intense, femtosecond XUV pulse and the subsequent Coulomb explosion process. We find that the XUV probe pulse induces local inner-shell ionization of atomic iodine in dissociating iodomethane, in contrast to non-selective ionization of all photofragments in difluoroiodobenzene. The results reveal evidence of electron transfer from methyl and phenyl moieties to a multiply charged iodine ion. In addition, indications for ultrafast charge rearrangement on the phenyl radical are found, suggesting that time-resolved Coulomb explosion imaging is sensitive to the localization of charge in extended molecules.

A theoretical study of structural and electronic properties of pentacene/Al(100) interface.

PubMed

Saranya, G; Nair, Shiny; Natarajan, V; Kolandaivel, P; Senthilkumar, K

2012-09-01

The first principle calculations within the framework of density functional theory have been performed for the pentacene molecule deposited on the aluminum Al(100) substrate to study the structural and electronic properties of the pentacene/Al(100) interface. The most stable configuration was found at bridge site with 45° rotation of the pentacene molecule on Al(100) surface with a vertical distance of 3.4 Å within LDA and 3.8 Å within GGA functionals. The calculated adsorption energy reveals that the adsorption of pentacene molecule on Al(100) surface is physisorption. For the stable adsorption geometry the electronic properties such as density of states (DOS), partial density of states (PDOS), Mulliken population analysis and Schottky barrier height are studied. The analysis of atomic charge, DOS and PDOS show that the charge is transferred from the Al(100) surface to pentacene molecule, and the transferred charge is about -0.05 electrons. For the adsorbed system, the calculated Schottky barrier height for hole and electron transport is 0.27 and 1.55 eV, respectively. Copyright © 2012 Elsevier Inc. All rights reserved.

Vibrational spectroscopic and non-linear optical activity studies on nicotinanilide : A DFT approach

NASA Astrophysics Data System (ADS)

Premkumar, S.; Jawahar, A.; Mathavan, T.; Dhas, M. Kumara; Benial, A. Milton Franklin

2015-06-01

The molecular structure of nicotinanilide was optimized by the DFT/B3LYP method with cc-pVTZ basis set using Gaussian 09 program. The first order hyperpolarizability of the molecule was calculated, which exhibits the higher nonlinear optical activity. The natural bond orbital analysis confirms the presence of intramolecular charge transfer and the hydrogen bonding interaction, which leads to the higher nonlinear optical activity of the molecule. The Frontier molecular orbitals analysis of the molecule shows that the delocalization of electron density occurs within the molecule. The lower energy gap indicates that the hydrogen bond formation between the charged species. The vibrational frequencies were calculated and assigned on the basis of potential energy distribution calculation using the VEDA 4.0 program and the corresponding vibrational spectra were simulated. Hence, the nicotinanilide molecule can be a good candidate for second-order NLO material.

Quantum effects in the capture of charged particles by dipolar polarizable symmetric top molecules. I. General axially nonadiabatic channel treatment.

PubMed

Auzinsh, M; Dashevskaya, E I; Litvin, I; Nikitin, E E; Troe, J

2013-08-28

The rate coefficients for capture of charged particles by dipolar polarizable symmetric top molecules in the quantum collision regime are calculated within an axially nonadiabatic channel approach. It uses the adiabatic approximation with respect to rotational transitions of the target within first-order charge-dipole interaction and takes into account the gyroscopic effect that decouples the intrinsic angular momentum from the collision axis. The results are valid for a wide range of collision energies (from single-wave capture to the classical limit) and dipole moments (from the Vogt-Wannier and fly-wheel to the adiabatic channel limit).

Dynamic Colloidal Molecules Maneuvered by Light-Controlled Janus Micromotors.

PubMed

Gao, Yirong; Mou, Fangzhi; Feng, Yizheng; Che, Shengping; Li, Wei; Xu, Leilei; Guan, Jianguo

2017-07-12

In this work, we propose and demonstrate a dynamic colloidal molecule that is capable of moving autonomously and performing swift, reversible, and in-place assembly dissociation in a high accuracy by manipulating a TiO 2 /Pt Janus micromotor with light irradiation. Due to the efficient motion of the TiO 2 /Pt Janus motor and the light-switchable electrostatic interactions between the micromotor and colloidal particles, the colloidal particles can be captured and assembled one by one on the fly, subsequently forming into swimming colloidal molecules by mimicking space-filling models of simple molecules with central atoms. The as-demonstrated dynamic colloidal molecules have a configuration accurately controlled and stabilized by regulating the time-dependent intensity of UV light, which controls the stop-and-go motion of the colloidal molecules. The dynamic colloidal molecules are dissociated when the light irradiation is turned off due to the disappearance of light-switchable electrostatic interaction between the motor and the colloidal particles. The strategy for the assembly of dynamic colloidal molecules is applicable to various charged colloidal particles. The simulated optical properties of a dynamic colloidal molecule imply that the results here may provide a novel approach for in-place building functional microdevices, such as microlens arrays, in a swift and reversible manner.

Chemical Defects and Electronics States in Organic Semiconductors

DTIC Science & Technology

2008-05-31

from interacting with organic semiconductor devices. An expt./theoretical study of 0 2 in pentacene indicated that a positive gate voltage can cause...dissociative interaction of02 with pentacene . 1S. SUBJECT TERMS organic semiconductors, PBTIT, P3HT, PQT, polythiophenes, pentacene , defects...investigations of the interaction of02 molecules with pentacene were performed. Based on calculations of formation energies of charged defects a model was

Flight evidence of spacecraft surface contamination rate enhancement by spacecraft charging obtained with a quartz crystal microbalance

NASA Technical Reports Server (NTRS)

Clark, D. M.; Hall, D. F.

1980-01-01

The significance of the fraction of the mass outgassed by a negatively charged space vehicle which is ionized within the vehicle plasma sheath and electrostatically reattracted to the space vehicle was determined. The ML-12 retarding potential analyzer/temperature controlled quartz crystal microbalances (RPA/TQCMs) distinguishes between charged and neutral molecules and investigates contamination mass transport mechanism. Two long term, quick look flight data sets indicate that on the average a significant fraction of mass arriving at one RPA/TQCM is ionized. It is assumed that vehicle frame charging during these periods was approximately uniformly distributed in degree and frequency. It is shown that electrostatic reattraction of ionized molecules is an important contamination mechanism at and near geosynchronous altitudes.

Supramolecular Systems and Chemical Reactions in Single-Molecule Break Junctions.

PubMed

Li, Xiaohui; Hu, Duan; Tan, Zhibing; Bai, Jie; Xiao, Zongyuan; Yang, Yang; Shi, Jia; Hong, Wenjing

2017-04-01

The major challenges of molecular electronics are the understanding and manipulation of the electron transport through the single-molecule junction. With the single-molecule break junction techniques, including scanning tunneling microscope break junction technique and mechanically controllable break junction technique, the charge transport through various single-molecule and supramolecular junctions has been studied during the dynamic fabrication and continuous characterization of molecular junctions. This review starts from the charge transport characterization of supramolecular junctions through a variety of noncovalent interactions, such as hydrogen bond, π-π interaction, and electrostatic force. We further review the recent progress in constructing highly conductive molecular junctions via chemical reactions, the response of molecular junctions to external stimuli, as well as the application of break junction techniques in controlling and monitoring chemical reactions in situ. We suggest that beyond the measurement of single molecular conductance, the single-molecule break junction techniques provide a promising access to study molecular assembly and chemical reactions at the single-molecule scale.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rodriguez, Mark A.; Sava Gallis, Dorina F.; Chavez, James S.

We report here the synthesis of a neutral viologen derivative, C 24H 16N 2O 4·2H 2O. The non-solvent portion of the structure (Z-Lig) is a zwitterion, consisting of two positively charged pyridinium cations and two negatively charged carboxylate anions. The carboxylate group is almost coplanar [dihedral angle = 2.04 (11)°] with the benzene ring, whereas the dihedral angle between pyridine and benzene rings is 46.28 (5)°. TheZ-Lig molecule is positioned on a center of inversion (Fig. 1). The presence of the twofold axis perpendicular to thec-glide plane in space groupC2/c generates a screw-axis parallel to thebaxis that is shifted from themore » origin by 1/4 in theaandcdirections. This screw-axis replicates the molecule (and solvent water molecules) through space. TheZ-Lig molecule links to adjacent moleculesviaO—H...O hydrogen bonds involving solvent water molecules as well as intermolecular C—H...O interactions. There are also π–π interactions between benzene rings on adjacent molecules.« less

New fluorescent probes for visual proteins. Part II. 5-(Oxo)penta-2,4-dienyl-p-(N,N-dimethylamino)benzoate.

PubMed

Papper, Vladislav; Kharlanov, Vladimir; Schädel, Sandra; Maretzki, Dieter; Rettig, Wolfgang

2003-12-01

A new dual-fluorescent compound, 5-(oxo)penta-2,4-dienyl-p-(N,N-dimethylamino)benzoate (1), a derivative of dimethylaminobenzoic acid, has been synthesised and studied photophysically. This compound continues the series of potential fluorescent probes for visual and proton-pumping opsin proteins. The photophysical behaviour of this molecule, including charge-transfer interaction in the ground state and dual-fluorescence emission, is similar to that of the previously studied analogue cis-3-(oxo)propenyl-p-(N,N-dimethylamino)benzoate (cis-2). The presence of several theoretically calculated conformers of compound 2 was suggested to be responsible for the observed strongly red-shifted absorption and excitation wavelength dependence. These photophysical anomalies were also observed for molecule 1, though the models put forward to explain them in the cases of 1 and 2 are rather different. Based on theoretical calculations and experimental results, we propose that some of the stable conformers might be connected with either a charge-transfer complex or mesomeric interactions in the ground state. Upon changing the electronic nature of the oxo-pentadienyl acceptor moiety, e.g. protonation, chemical or biochemical reaction, the charge-transfer absorption disappears, which leads to a dramatic increase in the fluorescence quantum yield.

Strain effect on the adsorption, diffusion, and molecular dissociation of hydrogen on Mg (0001) surface

NASA Astrophysics Data System (ADS)

Lei, Huaping; Wang, Caizhuang; Yao, Yongxin; Wang, Yangang; Hupalo, Myron; McDougall, Dan; Tringides, Michael; Ho, Kaiming

2013-12-01

The adsorption, diffusion, and molecular dissociation of hydrogen on the biaxially strained Mg (0001) surface have been systematically investigated by the first principle calculations based on density functional theory. When the strain changes from the compressive to tensile state, the adsorption energy of H atom linearly increases while its diffusion barrier linearly decreases oppositely. The dissociation barrier of H2 molecule linearly reduces in the tensile strain region. Through the chemical bonding analysis including the charge density difference, the projected density of states and the Mulliken population, the mechanism of the strain effect on the adsorption of H atom and the dissociation of H2 molecule has been elucidated by an s-p charge transfer model. With the reduction of the orbital overlap between the surface Mg atoms upon the lattice expansion, the charge transfers from p to s states of Mg atoms, which enhances the hybridization of H s and Mg s orbitals. Therefore, the bonding interaction of H with Mg surface is strengthened and then the atomic diffusion and molecular dissociation barriers of hydrogen decrease accordingly. Our works will be helpful to understand and to estimate the influence of the lattice deformation on the performance of Mg-containing hydrogen storage materials.

Atomic Forces for Geometry-Dependent Point Multipole and Gaussian Multipole Models

PubMed Central

Elking, Dennis M.; Perera, Lalith; Duke, Robert; Darden, Thomas; Pedersen, Lee G.

2010-01-01

In standard treatments of atomic multipole models, interaction energies, total molecular forces, and total molecular torques are given for multipolar interactions between rigid molecules. However, if the molecules are assumed to be flexible, two additional multipolar atomic forces arise due to 1) the transfer of torque between neighboring atoms, and 2) the dependence of multipole moment on internal geometry (bond lengths, bond angles, etc.) for geometry-dependent multipole models. In the current study, atomic force expressions for geometry-dependent multipoles are presented for use in simulations of flexible molecules. The atomic forces are derived by first proposing a new general expression for Wigner function derivatives ∂Dlm′m/∂Ω. The force equations can be applied to electrostatic models based on atomic point multipoles or Gaussian multipole charge density. Hydrogen bonded dimers are used to test the inter-molecular electrostatic energies and atomic forces calculated by geometry-dependent multipoles fit to the ab initio electrostatic potential (ESP). The electrostatic energies and forces are compared to their reference ab initio values. It is shown that both static and geometry-dependent multipole models are able to reproduce total molecular forces and torques with respect to ab initio, while geometry-dependent multipoles are needed to reproduce ab initio atomic forces. The expressions for atomic force can be used in simulations of flexible molecules with atomic multipoles. In addition, the results presented in this work should lead to further development of next generation force fields composed of geometry-dependent multipole models. PMID:20839297

Coherent (photon) vs incoherent (current) detection of multidimensional optical signals from single molecules in open junctions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Agarwalla, Bijay Kumar; Hua, Weijie; Zhang, Yu

2015-06-07

The nonlinear optical response of a current-carrying single molecule coupled to two metal leads and driven by a sequence of impulsive optical pulses with controllable phases and time delays is calculated. Coherent (stimulated, heterodyne) detection of photons and incoherent detection of the optically induced current are compared. Using a diagrammatic Liouville space superoperator formalism, the signals are recast in terms of molecular correlation functions which are then expanded in the many-body molecular states. Two dimensional signals in benzene-1,4-dithiol molecule show cross peaks involving charged states. The correlation between optical and charge current signal is also observed.

Self-discharge of electrochemical capacitors based on soluble or grafted quinone.

PubMed

Shul, Galyna; Bélanger, Daniel

2016-07-28

The self-discharge of hybrid electrochemical capacitors based on the redox activity of electrolyte additives or grafted species to the electrode material is investigated simultaneously for the cell and each individual electrode. Electrochemical capacitors using a redox-active electrolyte consisting in hydroquinone added to the electrolyte solution and a redox-active electrode based on anthraquinone-grafted carbon as a negative electrode are investigated. The results are analyzed by using Conway kinetic models and compared to those of a common electrochemical double layer capacitor. The self-discharge investigation is complemented by charge/discharge cycling and it is shown that processes affecting galvanostatic charge/discharge cycling and the self-discharge rate occurring at each electrode of an electrochemical capacitor are different but related to each other. The electrochemical capacitor containing hydroquinone in the electrolyte exhibits a much quicker self-discharge rate than that using a negative electrode based on grafted anthraquinone with a 50% decay of the cell voltage of the fully charged device in 0.6 and 6 h, respectively. The fast self-discharge of the former is due to the diffusion of benzoquinone molecules (formed at the positive electrode during charging) to the negative electrode, where they are reduced, causing a quick depolarization. The grafting of anthraquinone molecules on the carbon material of the negative electrode led to a much slower self-discharge, which nonetheless occurred, by the reaction of the reduced form of the grafted species with electrolyte species.