Role of a Helix B Lysine Residue in the Photoactive Site in Channelrhodopsins

PubMed Central

Li, Hai; Govorunova, Elena G.; Sineshchekov, Oleg A.; Spudich, John L.

2014-01-01

In most studied microbial rhodopsins two conserved carboxylic acid residues (the homologs of Asp-85 and Asp-212 in bacteriorhodopsin) and an arginine residue (the homolog of Arg-82) form a complex counterion to the protonated retinylidene Schiff base, and neutralization of the negatively charged carboxylates causes red shifts of the absorption maximum. In contrast, the corresponding neutralizing mutations in some relatively low-efficiency channelrhodopsins (ChRs) result in blue shifts. These ChRs do not contain a lysine residue in the second helix, conserved in higher efficiency ChRs (Lys-132 in the crystallized ChR chimera). By action spectroscopy of photoinduced channel currents in HEK293 cells and absorption spectroscopy of detergent-purified pigments, we found that in tested ChRs the Lys-132 homolog controls the direction of spectral shifts in the mutants of the photoactive site carboxylic acid residues. Analysis of double mutants shows that red spectral shifts occur when this Lys is present, whether naturally or by mutagenesis, and blue shifts occur when it is replaced with a neutral residue. A neutralizing mutation of the Lys-132 homolog alone caused a red spectral shift in high-efficiency ChRs, whereas its introduction into low-efficiency ChR1 from Chlamydomonas augustae (CaChR1) caused a blue shift. Taking into account that the effective charge of the carboxylic acid residues is a key factor in microbial rhodopsin spectral tuning, these findings suggest that the Lys-132 homolog modulates their pKa values. On the other hand, mutation of the Arg-82 homolog that fulfills this role in bacteriorhodopsin caused minimal spectral changes in the tested ChRs. Titration revealed that the pKa of the Asp-85 homolog in CaChR1 lies in the alkaline region unlike in most studied microbial rhodopsins, but is substantially decreased by introduction of a Lys-132 homolog or neutralizing mutation of the Asp-212 homolog. In the three ChRs tested the Lys-132 homolog also alters channel current kinetics. PMID:24739160

Quantum mechanical calculation of electric fields and vibrational Stark shifts at active site of human aldose reductase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, Xianwei; State Key Laboratory of Precision Spectroscopy, Institute of Theoretical and Computational Science, East China Normal University, Shanghai 200062; Zhang, John Z. H.

2015-11-14

Recent advance in biophysics has made it possible to directly measure site-specific electric field at internal sites of proteins using molecular probes with C = O or C≡N groups in the context of vibrational Stark effect. These measurements directly probe changes of electric field at specific protein sites due to, e.g., mutation and are very useful in protein design. Computational simulation of the Stark effect based on force fields such as AMBER and OPLS, while providing good insight, shows large errors in comparison to experimental measurement due to inherent difficulties associated with point charge based representation of force fields. Inmore » this study, quantum mechanical calculation of protein’s internal electrostatic properties and vibrational Stark shifts was carried out by using electrostatically embedded generalized molecular fractionation with conjugate caps method. Quantum calculated change of mutation-induced electric field and vibrational Stark shift is reported at the internal probing site of enzyme human aldose reductase. The quantum result is in much better agreement with experimental data than those predicted by force fields, underscoring the deficiency of traditional point charge models describing intra-protein electrostatic properties.« less

In Silico and In Vitro Investigations of the Mutability of Disease-Causing Missense Mutation Sites in Spermine Synthase

PubMed Central

Zhang, Zhe; Norris, Joy; Schwartz, Charles; Alexov, Emil

2011-01-01

Background Spermine synthase (SMS) is a key enzyme controlling the concentration of spermidine and spermine in the cell. The importance of SMS is manifested by the fact that single missense mutations were found to cause Snyder-Robinson Syndrome (SRS). At the same time, currently there are no non-synonymous single nucleoside polymorphisms, nsSNPs (harmless mutations), found in SMS, which may imply that the SMS does not tolerate amino acid substitutions, i.e. is not mutable. Methodology/Principal Findings To investigate the mutability of the SMS, we carried out in silico analysis and in vitro experiments of the effects of amino acid substitutions at the missense mutation sites (G56, V132 and I150) that have been shown to cause SRS. Our investigation showed that the mutation sites have different degree of mutability depending on their structural micro-environment and involvement in the function and structural integrity of the SMS. It was found that the I150 site does not tolerate any mutation, while V132, despite its key position at the interface of SMS dimer, is quite mutable. The G56 site is in the middle of the spectra, but still quite sensitive to charge residue replacement. Conclusions/Significance The performed analysis showed that mutability depends on the detail of the structural and functional factors and cannot be predicted based on conservation of wild type properties alone. Also, harmless nsSNPs can be expected to occur even at sites at which missense mutations were found to cause diseases. PMID:21647366

Electron holes appear to trigger cancer-implicated mutations

NASA Astrophysics Data System (ADS)

Miller, John; Villagran, Martha

Malignant tumors are caused by mutations, which also affect their subsequent growth and evolution. We use a novel approach, computational DNA hole spectroscopy [M.Y. Suarez-Villagran & J.H. Miller, Sci. Rep. 5, 13571 (2015)], to compute spectra of enhanced hole probability based on actual sequence data. A hole is a mobile site of positive charge created when an electron is removed, for example by radiation or contact with a mutagenic agent. Peaks in the hole spectrum depict sites where holes tend to localize and potentially trigger a base pair mismatch during replication. Our studies of reveal a correlation between hole spectrum peaks and spikes in human mutation frequencies. Importantly, we also find that hole peak positions that do not coincide with large variant frequencies often coincide with cancer-implicated mutations and/or (for coding DNA) encoded conserved amino acids. This enables combining hole spectra with variant data to identify critical base pairs and potential cancer `driver' mutations. Such integration of DNA hole and variance spectra could also prove invaluable for pinpointing critical regions, and sites of driver mutations, in the vast non-protein-coding genome. Supported by the State of Texas through the Texas Ctr. for Superconductivity.

Sun exposure causes somatic second-hit mutations and angiofibroma development in tuberous sclerosis complex

PubMed Central

Tyburczy, Magdalena E.; Wang, Ji-an; Li, Shaowei; Thangapazham, Rajesh; Chekaluk, Yvonne; Moss, Joel; Kwiatkowski, David J.; Darling, Thomas N.

2014-01-01

Tuberous sclerosis complex (TSC) is characterized by the formation of tumors in multiple organs and is caused by germline mutation in one of two tumor suppressor genes, TSC1 and TSC2. As for other tumor suppressor gene syndromes, the mechanism of somatic second-hit events in TSC tumors is unknown. We grew fibroblast-like cells from 29 TSC skin tumors from 22 TSC subjects and identified germline and second-hit mutations in TSC1/TSC2 using next-generation sequencing. Eighteen of 22 (82%) subjects had a mutation identified, and 8 of the 18 (44%) subjects were mosaic with mutant allele frequencies of 0 to 19% in normal tissue DNA. Multiple tumors were available from four patients, and in each case, second-hit mutations in TSC2 were distinct indicating they arose independently. Most remarkably, 7 (50%) of the 14 somatic point mutations were CC>TT ultraviolet ‘signature’ mutations, never seen as a TSC germline mutation. These occurred exclusively in facial angiofibroma tumors from sun-exposed sites. These results implicate UV-induced DNA damage as a cause of second-hit mutations and development of TSC facial angiofibromas and suggest that measures to limit UV exposure in TSC children and adults should reduce the frequency and severity of these lesions. PMID:24271014

Modulation of Global Transcriptional Regulatory Networks as a Strategy for Increasing Kanamycin Resistance of the Translational Elongation Factor-G Mutants in Escherichia coli

PubMed Central

Mogre, Aalap; Veetil, Reshma T.; Seshasayee, Aswin Sai Narain

2017-01-01

Evolve and resequence experiments have provided us a tool to understand bacterial adaptation to antibiotics. In our previous work, we used short-term evolution to isolate mutants resistant to the ribosome targeting antibiotic kanamycin, and reported that Escherichia coli develops low cost resistance to kanamycin via different point mutations in the translation Elongation Factor-G (EF-G). Furthermore, we had shown that the resistance of EF-G mutants could be increased by second site mutations in the genes rpoD/cpxA/topA/cyaA. Mutations in three of these genes had been discovered in earlier screens for aminoglycoside resistance. In this work, we expand our understanding of these second site mutations, the goal being to understand how these mutations affect the activities of the mutated gene products to confer resistance. We show that the mutation in cpxA most likely results in an active Cpx stress response. Further evolution of an EF-G mutant in a higher concentration of kanamycin than what was used in our previous experiments identified the cpxA locus as a primary target for a significant increase in resistance. The mutation in cyaA results in a loss of catalytic activity and probably results in resistance via altered CRP function. Despite a reduction in cAMP levels, the CyaAN600Y mutant has a transcriptome indicative of increased CRP activity, pointing to an unknown role for CyaA and / or cAMP in gene expression. From the transcriptomes of double and single mutants, we describe the epistasis between the mutation in EF-G and these second site mutations. We show that the large scale transcriptomic changes in the topoisomerase I (FusAA608E-TopAS180L) mutant likely result from increased negative supercoiling in the cell. Finally, genes with known roles in aminoglycoside resistance were present among the misregulated genes in the mutants. PMID:29046437

Importance of the Active Site "Canopy" Residues in an O2-Tolerant [NiFe]-Hydrogenase.

PubMed

Brooke, Emily J; Evans, Rhiannon M; Islam, Shams T A; Roberts, Gerri M; Wehlin, Sara A M; Carr, Stephen B; Phillips, Simon E V; Armstrong, Fraser A

2017-01-10

The active site of Hyd-1, an oxygen-tolerant membrane-bound [NiFe]-hydrogenase from Escherichia coli, contains four highly conserved residues that form a "canopy" above the bimetallic center, closest to the site at which exogenous agents CO and O 2 interact, substrate H 2 binds, and a hydrido intermediate is stabilized. Genetic modification of the Hyd-1 canopy has allowed the first systematic and detailed kinetic and structural investigation of the influence of the immediate outer coordination shell on H 2 activation. The central canopy residue, arginine 509, suspends a guanidine/guanidinium side chain at close range above the open coordination site lying between the Ni and Fe atoms (N-metal distance of 4.4 Å): its replacement with lysine lowers the H 2 oxidation rate by nearly 2 orders of magnitude and markedly decreases the H 2 /D 2 kinetic isotope effect. Importantly, this collapse in rate constant can now be ascribed to a very unfavorable activation entropy (easily overriding the more favorable activation enthalpy of the R509K variant). The second most important canopy residue for H 2 oxidation is aspartate 118, which forms a salt bridge to the arginine 509 headgroup: its mutation to alanine greatly decreases the H 2 oxidation efficiency, observed as a 10-fold increase in the potential-dependent Michaelis constant. Mutations of aspartate 574 (also salt-bridged to R509) to asparagine and proline 508 to alanine have much smaller effects on kinetic properties. None of the mutations significantly increase sensitivity to CO, but neutralizing the expected negative charges from D118 and D574 decreases O 2 tolerance by stabilizing the oxidized resting Ni III -OH state ("Ni-B"). An extensive model of the catalytic importance of residues close to the active site now emerges, whereby a conserved gas channel culminates in the arginine headgroup suspended above the Ni and Fe.

Myelin protein zero gene mutated in Charcot-Marie-Tooth type 1B patients

DOE Office of Scientific and Technical Information (OSTI.GOV)

Su, Ying; Li, Lanying; Lepercq, J.

1993-11-15

The autosomal dominant of Charcot-Marie-Tooth disease (CMT), whose gene is type 1B (CMT1B), has slow nerve conduction with demyelinated Schwann cells. In this study the abundant peripheral myelin protein zero (MPZ) gene, MPZ, was mapped 130 kb centromeric to the Fc receptor immunoglobulin gene cluster in band 1q22, and a major MPZ point mutation was found to cosegregate with CMT1B in one large CMT1B family. The MPZ point mutation in 18 of 18 related CMT1B pedigree 1 patients converts a positively charged lysine in codon 96 to a negatively charged glutamate. The same MPZ locus cosegregates with the CMT1B diseasemore » gene in a second CMT1B family [total multipoint logarithm of odds (lod) = 11.4 at [theta] = 0.00] with a splice junction mutation. Both mutations occur in MPZ protein regions otherwise conserved identically in human, rat, and cow since these species diverged 100 million years ago. MPZ protein, expressed exclusively in myelinated peripheral nerve Schwann cells, constitutes >50% of myelin protein. These mutations are anticipated to disrupt homophilic MPZ binding and result in CMT1B peripheral nerve demyelination.« less

Active site electrostatics protect genome integrity by blocking abortive hydrolysis during DNA recombination

PubMed Central

Ma, Chien-Hui; Rowley, Paul A; Macieszak, Anna; Guga, Piotr; Jayaram, Makkuni

2009-01-01

Water, acting as a rogue nucleophile, can disrupt transesterification steps of important phosphoryl transfer reactions in DNA and RNA. We have unveiled this risk, and identified safeguards instituted against it, during strand cleavage and joining by the tyrosine site-specific recombinase Flp. Strand joining is threatened by a latent Flp endonuclease activity (type I) towards the 3′-phosphotyrosyl intermediate resulting from strand cleavage. This risk is not alleviated by phosphate electrostatics; neutralizing the negative charge on the scissile phosphate through methylphosphonate (MeP) substitution does not stimulate type I endonuclease. Rather, protection derives from the architecture of the recombination synapse and conformational dynamics within it. Strand cleavage is protected against water by active site electrostatics. Replacement of the catalytic Arg-308 of Flp by alanine, along with MeP substitution, elicits a second Flp endonuclease activity (type II) that directly targets the scissile phosphodiester bond in DNA. MeP substitution, combined with appropriate active site mutations, will be useful in revealing anti-hydrolytic mechanisms engendered by systems that mediate DNA relaxation, DNA transposition, site-specific recombination, telomere resolution, RNA splicing and retrohoming of mobile introns. PMID:19440204

Holes influence the mutation spectrum of human mitochondrial DNA

NASA Astrophysics Data System (ADS)

Villagran, Martha; Miller, John

Mutations drive evolution and disease, showing highly non-random patterns of variant frequency vs. nucleotide position. We use computational DNA hole spectroscopy [M.Y. Suarez-Villagran & J.H. Miller, Sci. Rep. 5, 13571 (2015)] to reveal sites of enhanced hole probability in selected regions of human mitochondrial DNA. A hole is a mobile site of positive charge created when an electron is removed, for example by radiation or contact with a mutagenic agent. The hole spectra are quantum mechanically computed using a two-stranded tight binding model of DNA. We observe significant correlation between spectra of hole probabilities and of genetic variation frequencies from the MITOMAP database. These results suggest that hole-enhanced mutation mechanisms exert a substantial, perhaps dominant, influence on mutation patterns in DNA. One example is where a trapped hole induces a hydrogen bond shift, known as tautomerization, which then triggers a base-pair mismatch during replication. Our results deepen overall understanding of sequence specific mutation rates, encompassing both hotspots and cold spots, which drive molecular evolution.

X-linked CHARGE-like Abruzzo-Erickson syndrome and classic cleft palate with ankyloglossia result from TBX22 splicing mutations.

PubMed

Pauws, E; Peskett, E; Boissin, C; Hoshino, A; Mengrelis, K; Carta, E; Abruzzo, M A; Lees, M; Moore, G E; Erickson, R P; Stanier, P

2013-04-01

X-linked cleft palate (CPX) is caused by mutations in the gene encoding the TBX22 transcription factor and is known to exhibit phenotypic variability, usually involving either a complete, partial or submucous cleft palate, with or without ankyloglossia. This study hypothesized a possible involvement of TBX22 in a family with X-linked, CHARGE-like Abruzzo-Erickson syndrome, of unknown etiology. The phenotype extends to additional features including sensorineural deafness and coloboma, which are suggested by the Tbx22 developmental expression pattern but not previously associated in CPX patients. A novel TBX22 splice acceptor mutation (c.593-5T>A) was identified that tracked with the phenotype in this family. A novel splice donor variant (c.767+5G>A) and a known canonical splice donor mutation (c.767+1G>A) affecting the same exon were identified in patients with classic CPX phenotypes and were comparatively analyzed using both in silico and in vitro splicing studies. All three variants were predicted to abolish normal mRNA splicing and an in vitro assay indicated that use of alternative splice sites was a likely outcome. Collectively, the data showed the functional effect of several novel intronic splice site variants but most importantly confirms that TBX22 is the gene underlying Abruzzo-Erickson syndrome, expanding the phenotypic spectrum of TBX22 mutations. © 2012 John Wiley & Sons A/S. Published by Blackwell Publishing Ltd.

Determinants of the VP1/2A junction cleavage by the 3C protease in foot-and-mouth disease virus-infected cells.

PubMed

Kristensen, Thea; Normann, Preben; Gullberg, Maria; Fahnøe, Ulrik; Polacek, Charlotta; Rasmussen, Thomas Bruun; Belsham, Graham J

2017-03-01

The foot-and-mouth disease virus (FMDV) capsid precursor, P1-2A, is cleaved by FMDV 3C protease to yield VP0, VP3, VP1 and 2A. Cleavage of the VP1/2A junction is the slowest. Serotype O FMDVs with uncleaved VP1-2A (having a K210E substitution in VP1; at position P2 in cleavage site) have been described previously and acquired a second site substitution (VP1 E83K) during virus rescue. Furthermore, introduction of the VP1 E83K substitution alone generated a second site change at the VP1/2A junction (2A L2P, position P2' in cleavage site). These virus adaptations have now been analysed using next-generation sequencing to determine sub-consensus level changes in the virus; this revealed other variants within the E83K mutant virus population that changed residue VP1 K210. The construction of serotype A viruses with a blocked VP1/2A cleavage site (containing K210E) has now been achieved. A collection of alternative amino acid substitutions was made at this site, and the properties of the mutant viruses were determined. Only the presence of a positively charged residue at position P2 in the cleavage site permitted efficient cleavage of the VP1/2A junction, consistent with analyses of diverse FMDV genome sequences. Interestingly, in contrast to the serotype O virus results, no second site mutations occurred within the VP1 coding region of serotype A viruses with the blocked VP1/2A cleavage site. However, some of these viruses acquired changes in the 2C protein that is involved in enterovirus morphogenesis. These results have implications for the testing of potential antiviral agents targeting the FMDV 3C protease.

Combined density functional theory (DFT) and continuum calculations of pKa in carbonic anhydrase.

PubMed

Jiao, Dian; Rempe, Susan B

2012-07-31

Deprotonation of zinc-bound water in carbonic anhydrase II is the rate-limiting step in the catalysis of carbon dioxide between gas- and water-soluble forms. To understand the factors determining the extent of dissociation, or pK(a), of the zinc-bound water, we apply quantum chemistry calculations to the active site coupled with a continuum model of the surrounding environment. Experimentally determined changes in pK(a) associated with mutations of the active site are well reproduced by this approach. Analysis of the active site structure and charge/dipole values provides evidence that mutations cause changes in both conformation of the active site structure and local polarization, which accounts for the shifts in pK(a). More specifically, the shifts in pK(a) correlate with the dipole moments of the zinc-bound water upon deprotonation. The data further support the conclusion that the distinct pK(a) values found in mutations of the same type, but applied to different sites, result from asymmetric ligation and different electronic environments around the zinc ion.

Second-site changes affect viability of amphotropic/ecotropic chimeric enveloped murine leukemia viruses.

PubMed

O'Reilly, L; Roth, M J

2000-01-01

Chimeras were previously generated between the ecotropic (Moloney-MuLV) and amphotropic (4070A) SU and TM proteins of murine leukemia virus (MuLV). After passage in D17 cells, three chimeras with junctions in the C terminus of SU (AE5, AE6, and AE7), showed improved kinetics of viral spreading, suggesting that they had adapted. Sequencing of the viruses derived from the D17 cell lines revealed second-site changes within the env gene. Changes were detected in the receptor binding domain, the proline-rich region, the C terminus of SU, and the ectodomain of TM. Second-site changes were subcloned into the parental DNA, singly and in combination, and tested for viability. All viruses had maintained their original cloned mutations and junctions. Reconstruction and passage of AE7 or AE6 virus with single point mutations recovered the additional second-site changes identified in the parental population. The AE5 isolate required changes in the VRA, the VRC, the VRB-hinge region, and the C terminus of SU for efficient infection. Passage of virus, including the parental 4070A, in D17 cells resulted in a predominant G100R mutation within the receptor binding domain. Viruses were subjected to titer determination in three cell types, NIH 3T3, canine D17, and 293T. AE6 viruses with changes in the proline-rich region initially adapted for growth on D17 cells could infect all cell types tested. AE6-based chimeras with additional mutations in the C terminus of SU could infect D17 and 293T cells. Infection of NIH 3T3 cells was dependent on the proline-rich mutation. AE7-based chimeras encoding L538Q and G100R were impaired in infecting NIH 3T3 and 293T cells.

Second-Site Changes Affect Viability of Amphotropic/Ecotropic Chimeric Enveloped Murine Leukemia Viruses

PubMed Central

O'Reilly, Lucille; Roth, Monica J.

2000-01-01

Chimeras were previously generated between the ecotropic (Moloney-MuLV) and amphotropic (4070A) SU and TM proteins of murine leukemia virus (MuLV). After passage in D17 cells, three chimeras with junctions in the C terminus of SU (AE5, AE6, and AE7), showed improved kinetics of viral spreading, suggesting that they had adapted. Sequencing of the viruses derived from the D17 cell lines revealed second-site changes within the env gene. Changes were detected in the receptor binding domain, the proline-rich region, the C terminus of SU, and the ectodomain of TM. Second-site changes were subcloned into the parental DNA, singly and in combination, and tested for viability. All viruses had maintained their original cloned mutations and junctions. Reconstruction and passage of AE7 or AE6 virus with single point mutations recovered the additional second-site changes identified in the parental population. The AE5 isolate required changes in the VRA, the VRC, the VRB-hinge region, and the C terminus of SU for efficient infection. Passage of virus, including the parental 4070A, in D17 cells resulted in a predominant G100R mutation within the receptor binding domain. Viruses were subjected to titer determination in three cell types, NIH 3T3, canine D17, and 293T. AE6 viruses with changes in the proline-rich region initially adapted for growth on D17 cells could infect all cell types tested. AE6-based chimeras with additional mutations in the C terminus of SU could infect D17 and 293T cells. Infection of NIH 3T3 cells was dependent on the proline-rich mutation. AE7-based chimeras encoding L538Q and G100R were impaired in infecting NIH 3T3 and 293T cells. PMID:10623753

Effect of a mutation at arginine 301 on the stability, crystal quality and the preliminary crystallographic analysis of recombinant canavalin from Canavalia ensiformis

NASA Astrophysics Data System (ADS)

Elizabeth Green, M.; Kirkland, Natalie; Ng, Joseph D.

2001-11-01

The technique of site-directed mutagenesis was used to implement rational amino acid changes in the plant storage protein canavalin, the major seed storage protein of the jack bean ( Canavali ensiformis). The mutations were targeted to amino acids previously demonstrated to be involved in either the intra- or intermolecular salt bridges, thought to be responsible for maintaining the three-dimensional structure of the trimer. The amino acid changes were designed to disrupt the salt bridge interactions by substituting a neutral alanine for a negatively charged aspartate or glutamate, or by substituting a negatively charged glutamate for a positively charged arginine. The resulting recombinant mutants were subsequently expressed, purified, and crystallized. The crystals of the mutant versions of canavalin were compared to those of the wild-type canavalin by visual inspection and X-ray analysis. Of the crystals obtained for the mutants, those for the Arg301Glu mutation appeared to be more stable with fewer surface defects than any of the other mutants or the wild-type protein. The I/ σ ratio of reflections versus the resolution for the Arg301Glu mutation was approximately 30% greater over the entire resolution range than that obtained for any of the other mutations or for the wild-type. Additionally, the crystals of Arg301Glu mutations displayed lower mosaicity. Finally, the Arg301Glu mutation displayed a striking increase in the transition temperature when subjected to thermal denaturation. This paper describes the rationale and techniques behind the mutation of canavalin and suggests possible explanations for the observed and measured differences between the Arg301Glu mutant and the wild-type protein. We show the initial crystallographic structure analysis of this mutant and its preliminary implications.

Solvent dielectric effect and side chain mutation on the structural stability of Burkholderia cepacia lipase active site: a quantum mechanical/molecular mechanics study.

PubMed

Tahan, A; Monajjemi, M

2011-12-01

Quantum mechanical and molecular dynamics methods were used to analyze the structure and stability of neutral and zwitterionic configurations of the extracted active site sequence from a Burkholderia cepacia lipase, histidyl-seryl-glutamin (His86-Ser87-Gln88) and its mutated form, histidyl-cysteyl-glutamin (His86-Cys87-Gln88) in vacuum and different solvents. The effects of solvent dielectric constant, explicit and implicit water molecules and side chain mutation on the structure and stability of this sequence in both neutral and zwitterionic forms are represented. The quantum mechanics computations represent that the relative stability of zwitterionic and neutral configurations depends on the solvent structure and its dielectric constant. Therefore, in vacuum and the considered non-polar solvents, the neutral form of the interested sequences is more stable than the zwitterionic form, while their zwitterionic form is more stable than the neutral form in the aqueous solution and the investigated polar solvents in most cases. However, on the potential energy surfaces calculated, there is a barrier to proton transfer from the positively charged ammonium group to the negatively charged carboxylat group or from the ammonium group to the adjacent carbonyl oxygen and or from side chain oxygen and sulfur to negatively charged carboxylat group. Molecular dynamics simulations (MD) were also performed by using periodic boundary conditions for the zwitterionic configuration of the hydrated molecules in a box of water molecules. The obtained results demonstrated that the presence of explicit water molecules provides the more compact structures of the studied molecules. These simulations also indicated that side chain mutation and replacement of sulfur with oxygen leads to reduction of molecular flexibility and packing.

Effects of mutations on active site conformation and dynamics of RNA-dependent RNA polymerase from Coxsackievirus B3.

PubMed

Shen, Hujun; Deng, Mingsen; Zhang, Yachao

2017-10-01

Recent crystal structures of RNA-dependent RNA polymerase (3D pol ) from Coxsackievirus B3 (CVB3) revealed that a tyrosine mutation at Phe364 (F364Y) resulted in structures with open active site whereas a hydrophobic mutation at Phe364 (F364A) led to conformations with closed active site. Besides, the crystal structures showed that the F364W mutation had no preference between the open and closed active sites, similar to wild-type. In this paper, we present a molecular dynamics (MD) study on CVB3 3D pol in order to address some important questions raised by experiments. First, MD simulations of F364Y and F364A were carried out to explore how these mutations at Phe364 influence active site dynamics and conformations. Second, MD simulations of wild-type and mutants were performed to discover the connection between active site dynamics and polymerase function. MD simulations reveal that the effect of mutations on active site dynamics is associated with the interaction between the structural motifs A and D in CVB3 3D pol . Interestingly, we discover that the active site state is influenced by the formation of a hydrogen bond between backbone atoms of Ala231 (in motif A) and Ala358 (in motif D), which has never been revealed before. Copyright © 2017 Elsevier Inc. All rights reserved.

Mutation-Induced Changes in the Protein Environment and Site Energies in the (M)L214G Mutant of the Rhodobacter sphaeroides Bacterial Reaction Center.

PubMed

Jankowiak, Ryszard; Rancova, Olga; Chen, Jinhai; Kell, Adam; Saer, Rafael G; Beatty, J Thomas; Abramavicius, Darius

2016-08-18

This work focuses on the low-temperature (5 K) photochemical (transient) hole-burned (HB) spectra within the P870 absorption band, and their theoretical analysis, for the (M)L214G mutant of the photosynthetic Rhodobacter sphaeroides bacterial reaction center (bRC). To provide insight into system-bath interactions of the bacteriochlorophyll a (BChl a) special pair, i.e., P870, in the mutated bRC, the optical line shape function for the P870 band is calculated numerically. On the basis of the modeling studies, we demonstrate that (M)L214G mutation leads to a heterogeneous population of bRCs with modified (increased) total electron-phonon coupling strength of the special pair BChl a and larger inhomogeneous broadening. Specifically, we show that after mutation in the (M)L214G bRC a large fraction (∼50%) of the bacteriopheophytin (HA) chromophores shifts red and the 800 nm absorption band broadens, while the remaining fraction of HA cofactors retains nearly the same site energy as HA in the wild-type bRC. Modeling using these two subpopulations allowed for fits of the absorption and nonresonant (transient) HB spectra of the mutant bRC in the charge neutral, oxidized, and charge-separated states using the Frenkel exciton Hamiltonian, providing new insight into the mutant's complex electronic structure. Although the average (M)L214G mutant quantum efficiency of P(+)QA(-) state formation seems to be altered in comparison with the wild-type bRC, the average electron transfer time (measured via resonant transient HB spectra within the P870 band) was not affected. Thus, mutation in the vicinity of the electron acceptor (HA) does not tune the charge separation dynamics. Finally, quenching of the (M)L214G mutant excited states by P(+) is addressed by persistent HB spectra burned within the B band in chemically oxidized samples.

Modulation of protein stability and aggregation properties by surface charge engineering.

PubMed

Raghunathan, Govindan; Sokalingam, Sriram; Soundrarajan, Nagasundarapandian; Madan, Bharat; Munussami, Ganapathiraman; Lee, Sun-Gu

2013-09-01

An attempt to alter protein surface charges through traditional protein engineering approaches often affects the native protein structure significantly and induces misfolding. This limitation is a major hindrance in modulating protein properties through surface charge variations. In this study, as a strategy to overcome such a limitation, we attempted to co-introduce stabilizing mutations that can neutralize the destabilizing effect of protein surface charge variation. Two sets of rational mutations were designed; one to increase the number of surface charged amino acids and the other to decrease the number of surface charged amino acids by mutating surface polar uncharged amino acids and charged amino acids, respectively. These two sets of mutations were introduced into Green Fluorescent Protein (GFP) together with or without stabilizing mutations. The co-introduction of stabilizing mutations along with mutations for surface charge modification allowed us to obtain functionally active protein variants (s-GFP(+15-17) and s-GFP(+5-6)). When the protein properties such as fluorescent activity, folding rate and kinetic stability were assessed, we found the possibility that the protein stability can be modulated independently of activity and folding by engineering protein surface charges. The aggregation properties of GFP could also be altered through the surface charge engineering.

Identification of the heparin binding site on adeno-associated virus serotype 3B (AAV-3B)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lerch, Thomas F.; Chapman, Michael S., E-mail: chapmami@ohsu.edu

2012-02-05

Adeno-associated virus is a promising vector for gene therapy. In the current study, the binding site on AAV serotype 3B for the heparan sulfate proteoglycan (HSPG) receptor has been characterized. X-ray diffraction identified a disaccharide binding site at the most positively charged region on the virus surface. The contributions of basic amino acids at this and other sites were characterized using site-directed mutagenesis. Both heparin and cell binding are correlated to positive charge at the disaccharide binding site, and transduction is significantly decreased in AAV-3B vectors mutated at this site to reduce heparin binding. While the receptor attachment sites ofmore » AAV-3B and AAV-2 are both in the general vicinity of the viral spikes, the exact amino acids that participate in electrostatic interactions are distinct. Diversity in the mechanisms of cell attachment by AAV serotypes will be an important consideration for the rational design of improved gene therapy vectors.« less

Identification of the heparin binding site on adeno-associated virus serotype 3B (AAV-3B)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lerch, Thomas F.; Chapman, Michael S.

2012-05-24

Adeno-associated virus is a promising vector for gene therapy. In the current study, the binding site on AAV serotype 3B for the heparan sulfate proteoglycan (HSPG) receptor has been characterized. X-ray diffraction identified a disaccharide binding site at the most positively charged region on the virus surface. The contributions of basic amino acids at this and other sites were characterized using site-directed mutagenesis. Both heparin and cell binding are correlated to positive charge at the disaccharide binding site, and transduction is significantly decreased in AAV-3B vectors mutated at this site to reduce heparin binding. While the receptor attachment sites ofmore » AAV-3B and AAV-2 are both in the general vicinity of the viral spikes, the exact amino acids that participate in electrostatic interactions are distinct. Diversity in the mechanisms of cell attachment by AAV serotypes will be an important consideration for the rational design of improved gene therapy vectors.« less

Consortium for Osteogenesis Imperfecta Mutations in the Helical Domain of Type I Collagen: Regions Rich in Lethal Mutations Align With Collagen Binding Sites for Integrins and Proteoglycans

PubMed Central

Marini, Joan C.; Forlino, Antonella; Cabral, Wayne A.; Barnes, Aileen M.; San Antonio, James D.; Milgrom, Sarah; Hyland, James C.; Körkkö, Jarmo; Prockop, Darwin J.; De Paepe, Anne; Coucke, Paul; Symoens, Sofie; Glorieux, Francis H.; Roughley, Peter J.; Lund, Alan M.; Kuurila-Svahn, Kaija; Hartikka, Heini; Cohn, Daniel H.; Krakow, Deborah; Mottes, Monica; Schwarze, Ulrike; Chen, Diana; Yang, Kathleen; Kuslich, Christine; Troendle, James; Dalgleish, Raymond; Byers, Peter H.

2014-01-01

Osteogenesis imperfecta (OI) is a generalized disorder of connective tissue characterized by fragile bones and easy susceptibility to fracture. Most cases of OI are caused by mutations in type I collagen. We have identified and assembled structural mutations in type I collagen genes (COL1A1 and COL1A2, encoding the proα1(I) and proα2(I) chains, respectively) that result in OI. Quantitative defects causing type I OI were not included. Of these 832 independent mutations, 682 result in substitution for glycine residues in the triple helical domain of the encoded protein and 150 alter splice sites. Distinct genotype–phenotype relationships emerge for each chain. One-third of the mutations that result in glycine substitutions in α1(I) are lethal, especially when the substituting residues are charged or have a branched side chain. Substitutions in the first 200 residues are nonlethal and have variable outcome thereafter, unrelated to folding or helix stability domains. Two exclusively lethal regions (helix positions 691–823 and 910–964) align with major ligand binding regions (MLBRs), suggesting crucial interactions of collagen monomers or fibrils with integrins, matrix metalloproteinases (MMPs), fibronectin, and cartilage oligomeric matrix protein (COMP). Mutations in COL1A2 are predominantly nonlethal (80%). Lethal substitutions are located in eight regularly spaced clusters along the chain, supporting a regional model. The lethal regions align with proteoglycan binding sites along the fibril, suggesting a role in fibril–matrix interactions. Recurrences at the same site in α2(I) are generally concordant for outcome, unlike α1(I). Splice site mutations comprise 20% of helical mutations identified in OI patients, and may lead to exon skipping, intron inclusion, or the activation of cryptic splice sites. Splice site mutations in COL1A1 are rarely lethal; they often lead to frameshifts and the mild type I phenotype. In α2(I), lethal exon skipping events are located in the carboxyl half of the chain. Our data on genotype–phenotype relationships indicate that the two collagen chains play very different roles in matrix integrity and that phenotype depends on intracellular and extracellular events. PMID:17078022

[Molecular and structural-biological analysis of Nicotiana plumbaginifolia mutants for identification of the site of beta-tubulins interaction with dinitroanilines and phosphorotioamidates].

PubMed

Emets, A I; Baiard, U V; Nyporko, A Iu; Swire-Clark, G A; Blium, Ia B

2009-01-01

The identification of point mutation locations on beta-tubulin molecules of amiprophosmethyl- and trifluralin-resistant Nicotiana plumbaginifolia lines have described in the work. It was shown that in the first case this mutation is connected with the substitution ofserine residue on proline in position 248; in the second case--with the substitution of phenilalanine on serine in position 317 of beta-tubulin amino acid sequence. Three-dimensional models of beta-tubulin molecule from Chlamydomonas with well-known location of mutations conferring dinitroaniline- and phosphorotioamidate resistance (substitution of lysine residue to methionine on position 350), and beta-tubulin from Nicotiana plumbaginifolia have been reconstructed. On the basis of analysis of site of interaction with dinitroanilines and phosphorotioamides on Chlamydomonas beta-tubulin molecule it was concluded that the revealed mutations on Nicotiana plumbaginifolia beta-tubulin affect amino acid residues participating in formation of this site.

Atoms-in-molecules study of the genetically encoded amino acids. III. Bond and atomic properties and their correlations with experiment including mutation-induced changes in protein stability and genetic coding.

PubMed

Matta, Chérif F; Bader, Richard F W

2003-08-15

This article presents a study of the molecular charge distributions of the genetically encoded amino acids (AA), one that builds on the previous determination of their equilibrium geometries and the demonstrated transferability of their common geometrical parameters. The properties of the charge distributions are characterized and given quantitative expression in terms of the bond and atomic properties determined within the quantum theory of atoms-in-molecules (QTAIM) that defines atoms and bonds in terms of the observable charge density. The properties so defined are demonstrated to be remarkably transferable, a reflection of the underlying transferability of the charge distributions of the main chain and other groups common to the AA. The use of the atomic properties in obtaining an understanding of the biological functions of the AA, whether free or bound in a polypeptide, is demonstrated by the excellent statistical correlations they yield with experimental physicochemical properties. A property of the AA side chains of particular importance is the charge separation index (CSI), a quantity previously defined as the sum of the magnitudes of the atomic charges and which measures the degree of separation of positive and negative charges in the side chain of interest. The CSI values provide a correlation with the measured free energies of transfer of capped side chain analogues, from the vapor phase to aqueous solution, yielding a linear regression equation with r2 = 0.94. The atomic volume is defined by the van der Waals isodensity surface and it, together with the CSI, which accounts for the electrostriction of the solvent, yield a linear regression (r2 = 0.98) with the measured partial molar volumes of the AAs. The changes in free energies of transfer from octanol to water upon interchanging 153 pairs of AAs and from cyclohexane to water upon interchanging 190 pairs of AAs, were modeled using only three calculated parameters (representing electrostatic and volume contributions) yielding linear regressions with r2 values of 0.78 and 0.89, respectively. These results are a prelude to the single-site mutation-induced changes in the stabilities of two typical proteins: ubiquitin and staphylococcal nuclease. Strong quadratic correlations (r2 approximately 0.9) were obtained between DeltaCSI upon mutation and each of the two terms DeltaDeltaH and TDeltaDeltaS taken from recent and accurate differential scanning calorimetry experiments on ubiquitin. When the two terms are summed to yield DeltaDeltaG, the quadratic terms nearly cancel, and the result is a simple linear fit between DeltaDeltaG and DeltaCSI with r2 = 0.88. As another example, the change in the stability of staphylococcal nuclease upon mutation has been fitted linearly (r2 = 0.83) to the sum of a DeltaCSI term and a term representing the change in the van der Waals volume of the side chains upon mutation. The suggested correlation of the polarity of the side chain with the second letter of the AA triplet genetic codon is given concrete expression in a classification of the side chains in terms of their CSI values and their group dipole moments. For example, all amino acids with a pyrimidine base as their second letter in mRNA possess side-chain CSI < or = 2.8 (with the exception of Cys), whereas all those with CSI > 2.8 possess an purine base. The article concludes with two proposals for measuring and predicting molecular complementarity: van der Waals complementarity expressed in terms of the van der Waals isodensity surface and Lewis complementarity expressed in terms of the local charge concentrations and depletions defined by the topology of the Laplacian of the electron density. A display of the experimentally accessible Laplacian distribution for a folded protein would offer a clear picture of the operation of the "stereochemical code" proposed as the determinant in the folding process. Copyright 2003 Wiley-Liss, Inc.

Molecular Determinants of Mutant Phenotypes, Inferred from Saturation Mutagenesis Data.

PubMed

Tripathi, Arti; Gupta, Kritika; Khare, Shruti; Jain, Pankaj C; Patel, Siddharth; Kumar, Prasanth; Pulianmackal, Ajai J; Aghera, Nilesh; Varadarajan, Raghavan

2016-11-01

Understanding how mutations affect protein activity and organismal fitness is a major challenge. We used saturation mutagenesis combined with deep sequencing to determine mutational sensitivity scores for 1,664 single-site mutants of the 101 residue Escherichia coli cytotoxin, CcdB at seven different expression levels. Active-site residues could be distinguished from buried ones, based on their differential tolerance to aliphatic and charged amino acid substitutions. At nonactive-site positions, the average mutational tolerance correlated better with depth from the protein surface than with accessibility. Remarkably, similar results were observed for two other small proteins, PDZ domain (PSD95 pdz3 ) and IgG-binding domain of protein G (GB1). Mutational sensitivity data obtained with CcdB were used to derive a procedure for predicting functional effects of mutations. Results compared favorably with those of two widely used computational predictors. In vitro characterization of 80 single, nonactive-site mutants of CcdB showed that activity in vivo correlates moderately with thermal stability and solubility. The inability to refold reversibly, as well as a decreased folding rate in vitro, is associated with decreased activity in vivo. Upon probing the effect of modulating expression of various proteases and chaperones on mutant phenotypes, most deleterious mutants showed an increased in vivo activity and solubility only upon over-expression of either Trigger factor or SecB ATP-independent chaperones. Collectively, these data suggest that folding kinetics rather than protein stability is the primary determinant of activity in vivo This study enhances our understanding of how mutations affect phenotype, as well as the ability to predict fitness effects of point mutations. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

U2AF1 mutations alter splice site recognition in hematological malignancies.

PubMed

Ilagan, Janine O; Ramakrishnan, Aravind; Hayes, Brian; Murphy, Michele E; Zebari, Ahmad S; Bradley, Philip; Bradley, Robert K

2015-01-01

Whole-exome sequencing studies have identified common mutations affecting genes encoding components of the RNA splicing machinery in hematological malignancies. Here, we sought to determine how mutations affecting the 3' splice site recognition factor U2AF1 alter its normal role in RNA splicing. We find that U2AF1 mutations influence the similarity of splicing programs in leukemias, but do not give rise to widespread splicing failure. U2AF1 mutations cause differential splicing of hundreds of genes, affecting biological pathways such as DNA methylation (DNMT3B), X chromosome inactivation (H2AFY), the DNA damage response (ATR, FANCA), and apoptosis (CASP8). We show that U2AF1 mutations alter the preferred 3' splice site motif in patients, in cell culture, and in vitro. Mutations affecting the first and second zinc fingers give rise to different alterations in splice site preference and largely distinct downstream splicing programs. These allele-specific effects are consistent with a computationally predicted model of U2AF1 in complex with RNA. Our findings suggest that U2AF1 mutations contribute to pathogenesis by causing quantitative changes in splicing that affect diverse cellular pathways, and give insight into the normal function of U2AF1's zinc finger domains. © 2015 Ilagan et al.; Published by Cold Spring Harbor Laboratory Press.

Phosphate assimilation in Rhizobium (Sinorhizobium) meliloti: identification of a pit-like gene.

PubMed

Bardin, S D; Voegele, R T; Finan, T M

1998-08-01

Rhizobium meliloti mutants defective in the phoCDET-encoded phosphate transport system form root nodules on alfalfa plants that fail to fix nitrogen (Fix-). We have previously reported that two classes of second-site mutations can suppress the Fix- phenotype of phoCDET mutants to Fix+. Here we show that one of these suppressor loci (sfx1) contains two genes, orfA and pit, which appear to form an operon transcribed in the order orfA-pit. The Pit protein is homologous to various phosphate transporters, and we present evidence that three suppressor mutations arose from a single thymidine deletion in a hepta-thymidine sequence centered 54 nucleotides upstream of the orfA transcription start site. This mutation increased the level of orfA-pit transcription. These data, together with previous biochemical evidence, show that the orfA-pit genes encode a Pi transport system that is expressed in wild-type cells grown with excess Pi but repressed in cells under conditions of Pi limitation. In phoCDET mutant cells, orfA-pit expression is repressed, but this repression is alleviated by the second-site suppressor mutations. Suppression increases orfA-pit expression compensating for the deficiencies in phosphate assimilation and symbiosis of the phoCDET mutants.

DNA Damage Signals and Space Radiation Risk

NASA Technical Reports Server (NTRS)

Cucinotta, Francis A.

2011-01-01

Space radiation is comprised of high-energy and charge (HZE) nuclei and protons. The initial DNA damage from HZE nuclei is qualitatively different from X-rays or gamma rays due to the clustering of damage sites which increases their complexity. Clustering of DNA damage occurs on several scales. First there is clustering of single strand breaks (SSB), double strand breaks (DSB), and base damage within a few to several hundred base pairs (bp). A second form of damage clustering occurs on the scale of a few kbp where several DSB?s may be induced by single HZE nuclei. These forms of damage clusters do not occur at low to moderate doses of X-rays or gamma rays thus presenting new challenges to DNA repair systems. We review current knowledge of differences that occur in DNA repair pathways for different types of radiation and possible relationships to mutations, chromosomal aberrations and cancer risks.

Molecular and phenotypic aspects of CHD7 mutation in CHARGE syndrome

PubMed Central

Zentner, Gabriel E.; Layman, Wanda S.; Martin, Donna M.; Scacheri, Peter C.

2010-01-01

CHARGE syndrome (Coloboma of the eye, Heart defects, Atresia of the choanae, Retardation of growth and/or development, Genital and/or urinary abnormalities, and Ear abnormalities (including deafness) is a genetic disorder characterized by a specific and a recognizable pattern of anomalies. De novo mutations in the gene encoding chromodomain helicase DNA binding protein 7 (CHD7) are the major cause of CHARGE syndrome. Here, we review the clinical features of 379 CHARGE patients who tested positive or negative for mutations in CHD7. We found that CHARGE individuals with CHD7 mutations more commonly have ocular colobomas, temporal bone anomalies (semicircular canal hypoplasia/dysplasia), and facial nerve paralysis compared with mutation negative individuals. We also highlight recent genetic and genomic studies that have provided functional insights into CHD7 and the pathogenesis of CHARGE syndrome. PMID:20186815

Computational DNA hole spectroscopy: A new tool to predict mutation hotspots, critical base pairs, and disease ‘driver’ mutations

PubMed Central

Suárez, Martha Y.; Villagrán; Miller, John H.

2015-01-01

We report on a new technique, computational DNA hole spectroscopy, which creates spectra of electron hole probabilities vs. nucleotide position. A hole is a site of positive charge created when an electron is removed. Peaks in the hole spectrum depict sites where holes tend to localize and potentially trigger a base pair mismatch during replication. Our studies of mitochondrial DNA reveal a correlation between L-strand hole spectrum peaks and spikes in the human mutation spectrum. Importantly, we also find that hole peak positions that do not coincide with large variant frequencies often coincide with disease-implicated mutations and/or (for coding DNA) encoded conserved amino acids. This enables combining hole spectra with variant data to identify critical base pairs and potential disease ‘driver’ mutations. Such integration of DNA hole and variance spectra could ultimately prove invaluable for pinpointing critical regions of the vast non-protein-coding genome. An observed asymmetry in correlations, between the spectrum of human mtDNA variations and the L- and H-strand hole spectra, is attributed to asymmetric DNA replication processes that occur for the leading and lagging strands. PMID:26310834

Computational DNA hole spectroscopy: A new tool to predict mutation hotspots, critical base pairs, and disease 'driver' mutations.

PubMed

Villagrán, Martha Y Suárez; Miller, John H

2015-08-27

We report on a new technique, computational DNA hole spectroscopy, which creates spectra of electron hole probabilities vs. nucleotide position. A hole is a site of positive charge created when an electron is removed. Peaks in the hole spectrum depict sites where holes tend to localize and potentially trigger a base pair mismatch during replication. Our studies of mitochondrial DNA reveal a correlation between L-strand hole spectrum peaks and spikes in the human mutation spectrum. Importantly, we also find that hole peak positions that do not coincide with large variant frequencies often coincide with disease-implicated mutations and/or (for coding DNA) encoded conserved amino acids. This enables combining hole spectra with variant data to identify critical base pairs and potential disease 'driver' mutations. Such integration of DNA hole and variance spectra could ultimately prove invaluable for pinpointing critical regions of the vast non-protein-coding genome. An observed asymmetry in correlations, between the spectrum of human mtDNA variations and the L- and H-strand hole spectra, is attributed to asymmetric DNA replication processes that occur for the leading and lagging strands.

Identification and Characterization of Mutations Conferring Resistance to d-Amino Acids in Bacillus subtilis

PubMed Central

Leiman, Sara A.; Richardson, Charles; Foulston, Lucy; Elsholz, Alexander K. W.; First, Eric A.

2015-01-01

ABSTRACT Bacteria produce d-amino acids for incorporation into the peptidoglycan and certain nonribosomally produced peptides. However, d-amino acids are toxic if mischarged on tRNAs or misincorporated into protein. Common strains of the Gram-positive bacterium Bacillus subtilis are particularly sensitive to the growth-inhibitory effects of d-tyrosine due to the absence of d-aminoacyl-tRNA deacylase, an enzyme that prevents misincorporation of d-tyrosine and other d-amino acids into nascent proteins. We isolated spontaneous mutants of B. subtilis that survive in the presence of a mixture of d-leucine, d-methionine, d-tryptophan, and d-tyrosine. Whole-genome sequencing revealed that these strains harbored mutations affecting tRNATyr charging. Three of the most potent mutations enhanced the expression of the gene (tyrS) for tyrosyl-tRNA synthetase. In particular, resistance was conferred by mutations that destabilized the terminator hairpin of the tyrS riboswitch, as well as by a mutation that transformed a tRNAPhe into a tyrS riboswitch ligand. The most potent mutation, a substitution near the tyrosine recognition site of tyrosyl-tRNA synthetase, improved enzyme stereoselectivity. We conclude that these mutations promote the proper charging of tRNATyr, thus facilitating the exclusion of d-tyrosine from protein biosynthesis in cells that lack d-aminoacyl-tRNA deacylase. IMPORTANCE Proteins are composed of l-amino acids. Mischarging of tRNAs with d-amino acids or the misincorporation of d-amino acids into proteins causes toxicity. This work reports on mutations that confer resistance to d-amino acids and their mechanisms of action. PMID:25733611

Influence of Electron–Holes on DNA Sequence-Specific Mutation Rates

PubMed Central

Suárez-Villagrán, Martha Y; Azevedo, Ricardo B R; Miller, John H

2018-01-01

Abstract Biases in mutation rate can influence molecular evolution, yielding rates of evolution that vary widely in different parts of the genome and even among neighboring nucleotides. Here, we explore one possible mechanism of influence on sequence-specific mutation rates, the electron–hole, which can localize and potentially trigger a replication mismatch. A hole is a mobile site of positive charge created during one-electron oxidation by, for example, radiation, contact with a mutagenic agent, or oxidative stress. Its quantum wavelike properties cause it to localize at various sites with probabilities that vary widely, by orders of magnitude, and depend strongly on the local sequence. We find significant correlations between hole probabilities and mutation rates within base triplets, observed in published mutation accumulation experiments on four species of bacteria. We have also computed hole probability spectra for hypervariable segment I of the human mtDNA control region, which contains several mutational hotspots, and for heptanucleotides in noncoding regions of the human genome, whose polymorphism levels have recently been reported. We observe significant correlations between hole probabilities, and context-specific mutation and substitution rates. The correlation with hole probability cannot be explained entirely by CpG methylation in the heptanucleotide data. Peaks in hole probability tend to coincide with mutational hotspots, even in mtDNA where CpG methylation is rare. Our results suggest that hole-enhanced mutational mechanisms, such as oxidation-stabilized tautomerization and base deamination, contribute to molecular evolution. PMID:29617801

Splice-site mutations identified in PDE6A responsible for retinitis pigmentosa in consanguineous Pakistani families

PubMed Central

Khan, Shahid Y.; Ali, Shahbaz; Naeem, Muhammad Asif; Khan, Shaheen N.; Husnain, Tayyab; Butt, Nadeem H.; Qazi, Zaheeruddin A.; Akram, Javed; Riazuddin, Sheikh; Ayyagari, Radha; Hejtmancik, J. Fielding

2015-01-01

Purpose This study was conducted to localize and identify causal mutations associated with autosomal recessive retinitis pigmentosa (RP) in consanguineous familial cases of Pakistani origin. Methods Ophthalmic examinations that included funduscopy and electroretinography (ERG) were performed to confirm the affectation status. Blood samples were collected from all participating individuals, and genomic DNA was extracted. A genome-wide scan was performed, and two-point logarithm of odds (LOD) scores were calculated. Sanger sequencing was performed to identify the causative variants. Subsequently, we performed whole exome sequencing to rule out the possibility of a second causal variant within the linkage interval. Sequence conservation was performed with alignment analyses of PDE6A orthologs, and in silico splicing analysis was completed with Human Splicing Finder version 2.4.1. Results A large multigenerational consanguineous family diagnosed with early-onset RP was ascertained. An ophthalmic clinical examination consisting of fundus photography and electroretinography confirmed the diagnosis of RP. A genome-wide scan was performed, and suggestive two-point LOD scores were observed with markers on chromosome 5q. Haplotype analyses identified the region; however, the region did not segregate with the disease phenotype in the family. Subsequently, we performed a second genome-wide scan that excluded the entire genome except the chromosome 5q region harboring PDE6A. Next-generation whole exome sequencing identified a splice acceptor site mutation in intron 16: c.2028–1G>A, which was completely conserved in PDE6A orthologs and was absent in ethnically matched 350 control chromosomes, the 1000 Genomes database, and the NHLBI Exome Sequencing Project. Subsequently, we investigated our entire cohort of RP familial cases and identified a second family who harbored a splice acceptor site mutation in intron 10: c.1408–2A>G. In silico analysis suggested that these mutations will result in the elimination of wild-type splice acceptor sites that would result in either skipping of the respective exon or the creation of a new cryptic splice acceptor site; both possibilities would result in retinal photoreceptor cells that lack PDE6A wild-type protein. Conclusions we report two splice acceptor site variations in PDE6A in consanguineous Pakistani families who manifested cardinal symptoms of RP. Taken together with our previously published work, our data suggest that mutations in PDE6A account for about 2% of the total genetic load of RP in our cohort and possibly in the Pakistani population as well. PMID:26321862

MD-2 residues tyrosine 42, arginine 69, aspartic acid 122, and leucine 125 provide species specificity for lipid IVA.

PubMed

Meng, Jianmin; Drolet, Joshua R; Monks, Brian G; Golenbock, Douglas T

2010-09-03

Lipopolysaccharide (LPS) activates the innate immune response through the Toll-like receptor 4 (TLR4).MD-2 complex. A synthetic lipid A precursor, lipid IV(A), induces an innate immune response in mice but not in humans. Both TLR4 and MD-2 are required for the agonist activity of lipid IV(A) in mice, with TLR4 interacting through specific surface charges at the dimerization interface. In this study, we used site-directed mutagenesis to identify the MD-2 residues that determine lipid IV(A) species specificity. A single mutation of murine MD-2 at the hydrophobic pocket entrance, E122K, substantially reduced the response to lipid IV(A). Combining the murine MD-2 E122K with the murine TLR4 K367E/S386K/R434Q mutations completely abolished the response to lipid IV(A), effectively converting the murine cellular response to a human-like response. In human cells, however, simultaneous mutations of K122E, K125L, Y41F, and R69G on human MD-2 were required to promote a response to lipid IV(A). Combining the human MD-2 quadruple mutations with the human TLR4 E369K/Q436R mutations completely converted the human MD-2/human TLR4 receptor to a murine-like receptor. Because MD-2 residues 122 and 125 reside at the dimerization interface near the pocket entrance, surface charge differences here directly affect receptor dimerization. In comparison, residues 42 and 69 reside at the MD-2/TLR4 interaction surface opposite the dimerization interface. Surface charge differences there likely affect the binding angle and/or rigidity between MD-2 and TLR4, exerting an indirect influence on receptor dimerization and activation. Thus, surface charge differences at the two MD-2/TLR4 interfaces determine the species-specific activation of lipid IV(A).

Foundational errors in the Neutral and Nearly-Neutral theories of evolution in relation to the Synthetic Theory: is a new evolutionary paradigm necessary?

PubMed

Valenzuela, Carlos Y

2013-01-01

The Neutral Theory of Evolution (NTE) proposes mutation and random genetic drift as the most important evolutionary factors. The most conspicuous feature of evolution is the genomic stability during paleontological eras and lack of variation among taxa; 98% or more of nucleotide sites are monomorphic within a species. NTE explains this homology by random fixation of neutral bases and negative selection (purifying selection) that does not contribute either to evolution or polymorphisms. Purifying selection is insufficient to account for this evolutionary feature and the Nearly-Neutral Theory of Evolution (N-NTE) included negative selection with coefficients as low as mutation rate. These NTE and N-NTE propositions are thermodynamically (tendency to random distributions, second law), biotically (recurrent mutation), logically and mathematically (resilient equilibria instead of fixation by drift) untenable. Recurrent forward and backward mutation and random fluctuations of base frequencies alone in a site make life organization and fixations impossible. Drift is not a directional evolutionary factor, but a directional tendency of matter-energy processes (second law) which threatens the biotic organization. Drift cannot drive evolution. In a site, the mutation rates among bases and selection coefficients determine the resilient equilibrium frequency of bases that genetic drift cannot change. The expected neutral random interaction among nucleotides is zero; however, huge interactions and periodicities were found between bases of dinucleotides separated by 1, 2... and more than 1,000 sites. Every base is co-adapted with the whole genome. Neutralists found that neutral evolution is independent of population size (N); thus neutral evolution should be independent of drift, because drift effect is dependent upon N. Also, chromosome size and shape as well as protein size are far from random.

R248Q mutation--Beyond p53-DNA binding.

PubMed

Ng, Jeremy W K; Lama, Dilraj; Lukman, Suryani; Lane, David P; Verma, Chandra S; Sim, Adelene Y L

2015-12-01

R248 in the DNA binding domain (DBD) of p53 interacts directly with the minor groove of DNA. Earlier nuclear magnetic resonance (NMR) studies indicated that the R248Q mutation resulted in conformation changes in parts of DBD far from the mutation site. However, how information propagates from the mutation site to the rest of the DBD is still not well understood. We performed a series of all-atom molecular dynamics (MD) simulations to dissect sterics and charge effects of R248 on p53-DBD conformation: (i) wild-type p53 DBD; (ii) p53 DBD with an electrically neutral arginine side-chain; (iii) p53 DBD with R248A; (iv) p53 DBD with R248W; and (v) p53 DBD with R248Q. Our results agree well with experimental observations of global conformational changes induced by the R248Q mutation. Our simulations suggest that both charge- and sterics are important in the dynamics of the loop (L3) where the mutation resides. We show that helix 2 (H2) dynamics is altered as a result of a change in the hydrogen bonding partner of D281. In turn, neighboring L1 dynamics is altered: in mutants, L1 predominantly adopts the recessed conformation and is unable to interact with the major groove of DNA. We focused our attention the R248Q mutant that is commonly found in a wide range of cancer and observed changes at the zinc-binding pocket that might account for the dominant negative effects of R248Q. Furthermore, in our simulations, the S6/S7 turn was more frequently solvent exposed in R248Q, suggesting that there is a greater tendency of R248Q to partially unfold and possibly lead to an increased aggregation propensity. Finally, based on the observations made in our simulations, we propose strategies for the rescue of R248Q mutants. © 2015 Wiley Periodicals, Inc.

Two distinct modes of metal ion binding in the nuclease active site of a viral DNA-packaging terminase: insight into the two-metal-ion catalytic mechanism

PubMed Central

Zhao, Haiyan; Lin, Zihan; Lynn, Anna Y.; Varnado, Brittany; Beutler, John A.; Murelli, Ryan P.; Le Grice, Stuart F. J.; Tang, Liang

2015-01-01

Many dsDNA viruses encode DNA-packaging terminases, each containing a nuclease domain that resolves concatemeric DNA into genome-length units. Terminase nucleases resemble the RNase H-superfamily nucleotidyltransferases in folds, and share a two-metal-ion catalytic mechanism. Here we show that residue K428 of a bacteriophage terminase gp2 nuclease domain mediates binding of the metal cofactor Mg2+. A K428A mutation allows visualization, at high resolution, of a metal ion binding mode with a coupled-octahedral configuration at the active site, exhibiting an unusually short metal-metal distance of 2.42 Å. Such proximity of the two metal ions may play an essential role in catalysis by generating a highly positive electrostatic niche to enable formation of the negatively charged pentacovalent phosphate transition state, and provides the structural basis for distinguishing Mg2+ from Ca2+. Using a metal ion chelator β-thujaplicinol as a molecular probe, we observed a second mode of metal ion binding at the active site, mimicking the DNA binding state. Arrangement of the active site residues differs drastically from those in RNase H-like nucleases, suggesting a drifting of the active site configuration during evolution. The two distinct metal ion binding modes unveiled mechanistic details of the two-metal-ion catalysis at atomic resolution. PMID:26450964

Synonymous mutations in RNASEH2A create cryptic splice sites impairing RNase H2 enzyme function in Aicardi-Goutières syndrome

PubMed Central

Rice, Gillian I.; Reijns, Martin A.M.; Coffin, Stephanie R.; Forte, Gabriella M.A.; Anderson, Beverley H.; Szynkiewicz, Marcin; Gornall, Hannah; Gent, David; Leitch, Andrea; Botella, Maria P.; Fazzi, Elisa; Gener, Blanca; Lagae, Lieven; Olivieri, Ivana; Orcesi, Simona; Swoboda, Kathryn J.; Perrino, Fred W.; Jackson, Andrew P.; Crow, Yanick J.

2013-01-01

Aicardi-Goutières syndrome (AGS) is an inflammatory disorder resulting from mutations in TREX1, RNASEH2A/2B/2C, SAMHD1 or ADAR1. Here we provide molecular, biochemical and cellular evidence for the pathogenicity of two synonymous variants in RNASEH2A. Firstly, the c.69G>A (p.Val23Val) mutation causes the formation of a splice donor site within exon 1, resulting in an out of frame deletion at the end of exon 1, leading to reduced RNase H2 protein levels. The second mutation, c.75C>T (p.Arg25Arg), also introduces a splice donor site within exon 1, and the internal deletion of 18 amino acids. The truncated protein still forms a heterotrimeric RNase H2 complex, but lacks catalytic activity. However, as a likely result of leaky splicing, a small amount of full-length active protein is apparently produced in an individual homozygous for this mutation. Recognition of the disease causing status of these variants allows for diagnostic testing in relevant families. PMID:23592335

Mutations in the Promoter Region of the Aldolase B Gene that cause Hereditary Fructose Intolerance

PubMed Central

Coffee, Erin M.; Tolan, Dean R.

2010-01-01

SUMMARY Hereditary fructose intolerance (HFI) is a potentially fatal inherited metabolic disease caused by a deficiency of aldolase B activity in the liver and kidney. Over 40 disease-causing mutations are known in the protein-coding region of ALDOB. Mutations upstream of the protein-coding portion of ALDOB are reported here for the first time. DNA sequence analysis of 61 HFI patients revealed single base mutations in the promoter, intronic enhancer, and the first exon, which is entirely untranslated. One mutation, g.–132G>A, is located within the promoter at an evolutionarily conserved nucleotide within a transcription factor-binding site. A second mutation, IVS1+1G>C, is at the donor splice site of the first exon. In vitro electrophoretic mobility shift assays show a decrease in nuclear extract-protein binding at the g.–132G>A mutant site. The promoter mutation results in decreased transcription using luciferase reporter plasmids. Analysis of cDNA from cells transfected with plasmids harboring the IVS1+1G>C mutation results in aberrant splicing leading to complete retention of the first intron (~ 5 kb). The IVS1+1G>C splicing mutation results in loss of luciferase activity from a reporter plasmid. These novel mutations in ALDOB represent 2% of alleles in American HFI patients, with IVS1+1G>C representing a significantly higher allele frequency (6%) among HFI patients of Hispanic and African-American ethnicity. PMID:20882353

Nematode radiobiology and development in space. Results from IML-1

NASA Technical Reports Server (NTRS)

Nelson, Gregory A.; Schubert, W. W.; Kazarians, G. A.; Richards, G. F.; Benton, E. V.; Benton, E. R.; Henke, R.

1994-01-01

The Radiat experiment was one of 17 investigations which used the ESA Biorack on IML-1 (International Microgravity Laboratory) and it had two objectives. The first objective was to isolate and characterize mutations induced by cosmic rays; the second was to assess the fidelity of development in 0-gravity over two consecutive generations. Two strategies were used to isolate mutations in a set of essential genes or a specific gene and to correlate the genetic events with the passage of charged particles. The results were isolation of 60 lethal mutations whose phenotypes are related to the local pattern of energy deposition. 12 mutations in the unc-22 gene include large deletions as characterized by DNA hybridization studies. Development of nematodes proceeded through two consecutive generations with no obvious defects. Cytoplasmic determinants in embryos, nuclear location and symmetry of cellular anatomy were normal as were Mendelian segregation and recombination of genetic markers.

Evolutionary conservativeness of electric field in the Cu,Zn superoxide dismutase active site. Evidence for co-ordinated mutation of charged amino acid residues.

PubMed

Desideri, A; Falconi, M; Polticelli, F; Bolognesi, M; Djinovic, K; Rotilio, G

1992-01-05

Equipotential lines were calculated, using the Poisson-Boltzmann equation, for six Cu,Zn superoxide dismutases with different protein electric charge and various degrees of sequence homology, namely those from ox, pig, sheep, yeast, and the isoenzymes A and B from the amphibian Xenopus laevis. The three-dimensional structures of the porcine and ovine superoxide dismutases were obtained by molecular modelling reconstruction using the structure of the highly homologous bovine enzyme as a template. The three-dimensional structure of the evolutionary distant yeast Cu,Zn superoxide dismutase was recently resolved by us, while computer-modelled structures are available for X. laevis isoenzymes. The six proteins display large differences in the net protein charge and distribution of electrically charged surface residues but the trend of the equipotential lines in the proximity of the active sites was found to be constant in all cases. These results are in line with the very similar catlytic rate constants experimentally measured for the corresponding enzyme activities. This analysis shows that electrostatic guidance for the enzyme-substrate interaction in Cu,Zn superoxide dismutases is related to a spatial distribution of charges, arranged so as to maintain, in the area surrounding the active sites, an identical electrostatic potential distribution, which is conserved in the evolution of this protein family.

Potential Electrostatic Interactions in Multiple Regions Affect Human Metapneumovirus F-Mediated Membrane Fusion

PubMed Central

Chang, Andres; Hackett, Brent A.; Winter, Christine C.; Buchholz, Ursula J.

2012-01-01

The recently identified human metapneumovirus (HMPV) is a worldwide respiratory virus affecting all age groups and causing pneumonia and bronchiolitis in severe cases. Despite its clinical significance, no specific antiviral agents have been approved for treatment of HMPV infection. Unlike the case for most paramyxoviruses, the fusion proteins (F) of a number of strains, including the clinical isolate CAN97-83, can be triggered by low pH. We recently reported that residue H435 in the HRB linker domain acts as a pH sensor for HMPV CAN97-83 F, likely through electrostatic repulsion forces between a protonated H435 and its surrounding basic residues, K295, R396, and K438, at low pH. Through site-directed mutagenesis, we demonstrated that a positive charge at position 435 is required but not sufficient for F-mediated membrane fusion. Arginine or lysine substitution at position 435 resulted in a hyperfusogenic F protein, while replacement with aspartate or glutamate abolished fusion activity. Studies with recombinant viruses carrying mutations in this region confirmed its importance. Furthermore, a second region within the F2 domain identified as being rich in charged residues was found to modulate fusion activity of HMPV F. Loss of charge at residues E51, D54, and E56 altered local folding and overall stability of the F protein, with dramatic consequences for fusion activity. As a whole, these studies implicate charged residues and potential electrostatic interactions in function, pH sensing, and overall stability of HMPV F. PMID:22761366

Roles of s3 site residues of nattokinase on its activity and substrate specificity.

PubMed

Wu, Shuming; Feng, Chi; Zhong, Jin; Huan, Liandong

2007-09-01

Nattokinase (Subtilisin NAT, NK) is a bacterial serine protease with high fibrinolytic activity. To probe their roles on protease activity and substrate specificity, three residues of S3 site (Gly(100), Ser(101) and Leu(126)) were mutated by site-directed mutagenesis. Kinetics parameters of 20 mutants were measured using tetrapeptides as substrates, and their fibrinolytic activities were determined by fibrin plate method. Results of mutation analysis showed that Gly(100) and Ser(101) had reverse steric and electrostatic effects. Residues with bulky or positively charged side chains at position 100 decreased the substrate binding and catalytic activity drastically, while residues with the same characters at position 101 could obviously enhance protease and fibrinolytic activity of NK. Mutation of Leu(126) might impair the structure of the active cleft and drastically decreased the activity of NK. Kinetics studies of the mutants showed that S3 residues were crucial to keep protease activity while they moderately affected substrate specificity of NK. The present study provided some original insight into the P3-S3 interaction in NK and other subtilisins, as well as showed successful protein engineering cases to improve NK as a potential therapeutic agent.

Novel Tay-Sachs disease mutations from China.

PubMed

Akalin, N; Shi, H P; Vavougios, G; Hechtman, P; Lo, W; Scriver, C R; Mahuran, D; Kaplan, F

1992-01-01

We describe three HEXA mutations associated with infantile Tay-Sachs disease (TSD) in three unrelated nonconsanguineous Chinese families. Novel mutations were found in two of these families. The third is a previously reported mutation (G-->A transition at nt 1444) (Nakano et al., 1988). Direct sequencing of PCR products identified a novel insertion of an A after nt 547 in family 1. This change generates an early termination codon 6 bp downstream from the insertion site. Allele-specific oligonucleotide hybridization confirmed homozygosity in the proband. Single strand conformational polymorphism analysis and direct sequencing of amplified exon 13 revealed a T-->C transition at nt 1453 with the corresponding amino acid substitution W485R in the second family. This mutation creates an Fnu4HI restriction site. The proband is homozygous for this allele. When the site-specific mutagenized alpha cDNA carrying the T-->C transition at nt 1453 was expressed in COS 1 cells hexosaminidase S activity was not detectable above background. A G-->A transition at nt 1444 (exon 13) corresponding to the E482K substitution was found in the third family. This mutation occurs at a CpG dinucleotide. It has been reported in an Italian TSD proband and causes defective intracellular transport of the alpha-subunit from the rough endoplasmic reticulum to the Golgi apparatus.

Synonymous mutations in RNASEH2A create cryptic splice sites impairing RNase H2 enzyme function in Aicardi-Goutières syndrome.

PubMed

Rice, Gillian I; Reijns, Martin A M; Coffin, Stephanie R; Forte, Gabriella M A; Anderson, Beverley H; Szynkiewicz, Marcin; Gornall, Hannah; Gent, David; Leitch, Andrea; Botella, Maria P; Fazzi, Elisa; Gener, Blanca; Lagae, Lieven; Olivieri, Ivana; Orcesi, Simona; Swoboda, Kathryn J; Perrino, Fred W; Jackson, Andrew P; Crow, Yanick J

2013-08-01

Aicardi-Goutières syndrome is an inflammatory disorder resulting from mutations in TREX1, RNASEH2A/2B/2C, SAMHD1, or ADAR1. Here, we provide molecular, biochemical, and cellular evidence for the pathogenicity of two synonymous variants in RNASEH2A. Firstly, the c.69G>A (p.Val23Val) mutation causes the formation of a splice donor site within exon 1, resulting in an out of frame deletion at the end of exon 1, leading to reduced RNase H2 protein levels. The second mutation, c.75C>T (p.Arg25Arg), also introduces a splice donor site within exon 1, and the internal deletion of 18 amino acids. The truncated protein still forms a heterotrimeric RNase H2 complex, but lacks catalytic activity. However, as a likely result of leaky splicing, a small amount of full-length active protein is apparently produced in an individual homozygous for this mutation. Recognition of the disease causing status of these variants allows for diagnostic testing in relevant families. © 2013 WILEY PERIODICALS, INC.

An in-silico method for identifying aggregation rate enhancer and mitigator mutations in proteins.

PubMed

Rawat, Puneet; Kumar, Sandeep; Michael Gromiha, M

2018-06-24

Newly synthesized polypeptides must pass stringent quality controls in cells to ensure appropriate folding and function. However, mutations, environmental stresses and aging can reduce efficiencies of these controls, leading to accumulation of protein aggregates, amyloid fibrils and plaques. In-vitro experiments have shown that even single amino acid substitutions can drastically enhance or mitigate protein aggregation kinetics. In this work, we have collected a dataset of 220 unique mutations in 25 proteins and classified them as enhancers or mitigators on the basis of their effect on protein aggregation rate. The data were analyzed via machine learning to identify features capable of distinguishing between aggregation rate enhancers and mitigators. Our initial Support Vector Machine (SVM) model separated such mutations with an overall accuracy of 69%. When local secondary structures at the mutation sites were considered, the accuracies further improved by 13-15%. The machine-learnt features are distinct for each secondary structure class at mutation sites. Protein stability and flexibility changes are important features for mutations in α-helices. β-strand propensity, polarity and charge become important when mutations occur in β-strands and ability to form secondary structure, helical tendency and aggregation propensity are important for mutations lying in coils. These results have been incorporated into a sequence-based algorithm (available at http://www.iitm.ac.in/bioinfo/aggrerate-disc/) capable of predicting whether a mutation will enhance or mitigate a protein's aggregation rate. This algorithm will find several applications towards understanding protein aggregation in human diseases, enable in-silico optimization of biopharmaceuticals and enzymes for improved biophysical attributes and de novo design of bio-nanomaterials. Copyright © 2018. Published by Elsevier B.V.

Alternative Computational Protocols for Supercharging Protein Surfaces for Reversible Unfolding and Retention of Stability

PubMed Central

Der, Bryan S.; Kluwe, Christien; Miklos, Aleksandr E.; Jacak, Ron; Lyskov, Sergey; Gray, Jeffrey J.; Georgiou, George; Ellington, Andrew D.; Kuhlman, Brian

2013-01-01

Reengineering protein surfaces to exhibit high net charge, referred to as “supercharging”, can improve reversibility of unfolding by preventing aggregation of partially unfolded states. Incorporation of charged side chains should be optimized while considering structural and energetic consequences, as numerous mutations and accumulation of like-charges can also destabilize the native state. A previously demonstrated approach deterministically mutates flexible polar residues (amino acids DERKNQ) with the fewest average neighboring atoms per side chain atom (AvNAPSA). Our approach uses Rosetta-based energy calculations to choose the surface mutations. Both protocols are available for use through the ROSIE web server. The automated Rosetta and AvNAPSA approaches for supercharging choose dissimilar mutations, raising an interesting division in surface charging strategy. Rosetta-supercharged variants of GFP (RscG) ranging from −11 to −61 and +7 to +58 were experimentally tested, and for comparison, we re-tested the previously developed AvNAPSA-supercharged variants of GFP (AscG) with +36 and −30 net charge. Mid-charge variants demonstrated ∼3-fold improvement in refolding with retention of stability. However, as we pushed to higher net charges, expression and soluble yield decreased, indicating that net charge or mutational load may be limiting factors. Interestingly, the two different approaches resulted in GFP variants with similar refolding properties. Our results show that there are multiple sets of residues that can be mutated to successfully supercharge a protein, and combining alternative supercharge protocols with experimental testing can be an effective approach for charge-based improvement to refolding. PMID:23741319

Pore Polarity and Charge Determine Differential Block of Kir1.1 and Kir7.1 Potassium Channels by Small-Molecule Inhibitor VU590.

PubMed

Kharade, Sujay V; Sheehan, Jonathan H; Figueroa, Eric E; Meiler, Jens; Denton, Jerod S

2017-09-01

VU590 was the first publicly disclosed, submicromolar-affinity (IC 50 = 0.2 μ M), small-molecule inhibitor of the inward rectifier potassium (Kir) channel and diuretic target, Kir1.1. VU590 also inhibits Kir7.1 (IC 50 ∼ 8 μ M), and has been used to reveal new roles for Kir7.1 in regulation of myometrial contractility and melanocortin signaling. Here, we employed molecular modeling, mutagenesis, and patch clamp electrophysiology to elucidate the molecular mechanisms underlying VU590 inhibition of Kir1.1 and Kir7.1. Block of both channels is voltage- and K + -dependent, suggesting the VU590 binding site is located within the pore. Mutagenesis analysis in Kir1.1 revealed that asparagine 171 (N171) is the only pore-lining residue required for high-affinity block, and that substituting negatively charged residues (N171D, N171E) at this position dramatically weakens block. In contrast, substituting a negatively charged residue at the equivalent position in Kir7.1 enhances block by VU590, suggesting the VU590 binding mode is different. Interestingly, mutations of threonine 153 (T153) in Kir7.1 that reduce constrained polarity at this site (T153C, T153V, T153S) make wild-type and binding-site mutants (E149Q, A150S) more sensitive to block by VU590. The Kir7.1-T153C mutation enhances block by the structurally unrelated inhibitor VU714 but not by a higher-affinity analog ML418, suggesting that the polar side chain of T153 creates a barrier to low-affinity ligands that interact with E149 and A150. Reverse mutations in Kir1.1 suggest that this mechanism is conserved in other Kir channels. This study reveals a previously unappreciated role of membrane pore polarity in determination of Kir channel inhibitor pharmacology. Copyright © 2017 by The American Society for Pharmacology and Experimental Therapeutics.

Improvement of the optimum pH of Aspergillus niger xylanase towards an alkaline pH by site-directed mutagenesis.

PubMed

Li, Fei; Xie, Jingcong; Zhang, Xuesong; Zhao, Linguo

2015-01-01

In an attempt to shift the optimal pH of the xylanase B (XynB) from Aspergillus niger towards alkalinity, target mutation sites were selected by alignment between Aspergillus niger xylanase B and other xylanases that have alkalophilic pH optima that highlight charged residues in the eight-residues-longer loop in the alkalophilic xylanase. Multiple engineered XynB mutants were created by site-directed mutagenesis with substitutions Q164K and Q164K+D117N. The variant XynB-117 had the highest optimum pH (at 5.5), which corresponded to a basic 0.5 pH unit shift when compared with the wild-type enzyme. However, the optimal pH of the XynB- 164 mutation was not changed, similar to the wild type. These results suggest that the residues at positions 164 and 117 in the eight-residues-longer loop and the cleft's edge are important in determining the pH optima of XynB from Aspergillus niger.

The Crystal Structure of Streptococcus pyogenes Uridine Phosphorylase Reveals a Distinct Subfamily of Nucleoside Phosphorylases

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tran, Timothy H.; Christoffersen, S.; Allan, Paula W.

2011-09-20

Uridine phosphorylase (UP), a key enzyme in the pyrimidine salvage pathway, catalyzes the reversible phosphorolysis of uridine or 2'-deoxyuridine to uracil and ribose 1-phosphate or 2'-deoxyribose 1-phosphate. This enzyme belongs to the nucleoside phosphorylase I superfamily whose members show diverse specificity for nucleoside substrates. Phylogenetic analysis shows Streptococcus pyogenes uridine phosphorylase (SpUP) is found in a distinct branch of the pyrimidine subfamily of nucleoside phosphorylases. To further characterize SpUP, we determined the crystal structure in complex with the products, ribose 1-phosphate and uracil, at 1.8 {angstrom} resolution. Like Escherichia coli UP (EcUP), the biological unit of SpUP is a hexamermore » with an ?/? monomeric fold. A novel feature of the active site is the presence of His169, which structurally aligns with Arg168 of the EcUP structure. A second active site residue, Lys162, is not present in previously determined UP structures and interacts with O2 of uracil. Biochemical studies of wild-type SpUP showed that its substrate specificity is similar to that of EcUP, while EcUP is {approx}7-fold more efficient than SpUP. Biochemical studies of SpUP mutants showed that mutations of His169 reduced activity, while mutation of Lys162 abolished all activity, suggesting that the negative charge in the transition state resides mostly on uracil O2. This is in contrast to EcUP for which transition state stabilization occurs mostly at O4.« less

cis-acting intron mutations that affect the efficiency of avian retroviral RNA splicing: implication for mechanisms of control.

PubMed Central

Katz, R A; Kotler, M; Skalka, A M

1988-01-01

The full-length retroviral RNA transcript serves as (i) mRNA for the gag and pol gene products, (ii) genomic RNA that is assembled into progeny virions, and (iii) a pre-mRNA for spliced subgenomic mRNAs. Therefore, a balance of spliced and unspliced RNA is required to generate the appropriate levels of protein and RNA products for virion production. We have introduced an insertion mutation near the avian sarcoma virus env splice acceptor site that results in a significant increase in splicing to form functional env mRNA. The mutant virus is replication defective, but phenotypic revertant viruses that have acquired second-site mutations near the splice acceptor site can be isolated readily. Detailed analysis of one of these viruses revealed that a single nucleotide change at -20 from the splice acceptor site, within the original mutagenic insert, was sufficient to restore viral growth and significantly decrease splicing efficiency compared with the original mutant and wild-type viruses. Thus, minor sequence alterations near the env splice acceptor site can produce major changes in the balance of spliced and unspliced RNAs. Our results suggest a mechanism of control in which splicing is modulated by cis-acting sequences at the env splice acceptor site. Furthermore, this retroviral system provides a powerful genetic method for selection and analysis of mutations that affect splicing control. Images PMID:2839694

CEF1/CDC5 alleles modulate transitions between catalytic conformations of the spliceosome

PubMed Central

Query, Charles C.; Konarska, Maria M.

2012-01-01

Conformational change within the spliceosome is required between the first and second catalytic steps of pre-mRNA splicing. A prior genetic screen for suppressors of an intron mutant that stalls between the two steps yielded both prp8 and non-prp8 alleles that suppressed second-step splicing defects. We have now identified the strongest non-prp8 suppressors as alleles of the NTC (Prp19 complex) component, CEF1. These cef1 alleles generally suppress second-step defects caused by a variety of intron mutations, mutations in U6 snRNA, or deletion of the second-step protein factor Prp17, and they can activate alternative 3′ splice sites. Genetic and functional interactions between cef1 and prp8 alleles suggest that they modulate the same event(s) in the first-to-second-step transition, most likely by stabilization of the second-step spliceosome; in contrast, alleles of U6 snRNA that also alter this transition modulate a distinct event, most likely by stabilization of the first-step spliceosome. These results implicate a myb-like domain of Cef1/CDC5 in interactions that modulate conformational states of the spliceosome and suggest that alteration of these events affects splice site use, resulting in alternative splicing-like patterns in yeast. PMID:22408182

The Importance of a Gatekeeper Residue on the Aggregation of Transthyretin

PubMed Central

Sant'Anna, Ricardo; Braga, Carolina; Varejão, Nathalia; Pimenta, Karinne M.; Graña-Montes, Ricardo; Alves, Aline; Cortines, Juliana; Cordeiro, Yraima; Ventura, Salvador; Foguel, Debora

2014-01-01

Protein aggregation into β-sheet-enriched amyloid fibrils is associated with an increasing number of human disorders. The adoption of such amyloid conformations seems to constitute a generic property of polypeptide chains. Therefore, during evolution, proteins have adopted negative design strategies to diminish their intrinsic propensity to aggregate, including enrichment of gatekeeper charged residues at the flanks of hydrophobic aggregation-prone segments. Wild type transthyretin (TTR) is responsible for senile systemic amyloidosis, and more than 100 mutations in the TTR gene are involved in familial amyloid polyneuropathy. The TTR 26–57 segment bears many of these aggressive amyloidogenic mutations as well as the binding site for heparin. We demonstrate here that Lys-35 acts as a gatekeeper residue in TTR, strongly decreasing its amyloidogenic potential. This protective effect is sequence-specific because Lys-48 does not affect TTR aggregation. Lys-35 is part of the TTR basic heparin-binding motif. This glycosaminoglycan blocks the protective effect of Lys-35, probably by neutralization of its side chain positive charge. A K35L mutation emulates this effect and results in the rapid self-assembly of the TTR 26–57 region into amyloid fibrils. This mutation does not affect the tetrameric protein stability, but it strongly increases its aggregation propensity. Overall, we illustrate how TTR is yet another amyloidogenic protein exploiting negative design to prevent its massive aggregation, and we show how blockage of conserved protective features by endogenous factors or mutations might result in increased disease susceptibility. PMID:25086037

Proton conduction within the reaction centers of Rhodobacter capsulatus: the electrostatic role of the protein.

PubMed

Maróti, P; Hanson, D K; Baciou, L; Schiffer, M; Sebban, P

1994-06-07

Light-induced charge separation in the photosynthetic reaction center results in delivery of two electrons and two protons to the terminal quinone acceptor QB. In this paper, we have used flash-induced absorbance spectroscopy to study three strains that share identical amino acid sequences in the QB binding site, all of which lack the protonatable amino acids Glu-L212 and Asp-L213. These strains are the photosynthetically incompetent site-specific mutant Glu-L212/Asp-L213-->Ala-L212/Ala-L213 and two different photocompetent derivatives that carry both alanine substitutions and an intergenic suppressor mutation located far from QB (class 3 strain, Ala-Ala + Arg-M231-->Leu; class 4 strain, Ala-Ala + Asn-M43-->Asp). At pH 8 in the double mutant, we observe a concomitant decrease of nearly 4 orders of magnitude in the rate constants of second electron and proton transfer to QB compared to the wild type. Surprisingly, these rates are increased to about the same extent in both types of suppressor strains but remain > 2 orders of magnitude smaller than those of the wild type. In the double mutant, at pH 8, the loss of Asp-L213 and Glu-L212 leads to a substantial stabilization (> or = 60 meV) of the semiquinone energy level. Both types of compensatory mutations partially restore, to nearly the same level, the original free energy difference for electron transfer from primary quinone QA to QB. The pH dependence of the electron and proton transfer processes in the double-mutant and the suppressor strains suggests that when reaction centers of the double mutant are shifted to lower pH (1.5-2 units), they function like those of the suppressor strains at physiological pH. Our data suggest that the main effect of the compensatory mutations is to partially restore the negative electrostatic environment of QB and to increase an apparent "functional" pK of the system for efficient proton transfer to the active site. This emphasizes the role of the protein in tuning the electrostatic environment of its cofactors and highlights the possible long-range electrostatic effects.

Influences of Mutations on the Electrostatic Binding Free Energies of Chloride Ions in Escherichia Coli ClC

PubMed Central

Yu, Tao; Wang, Xiao-Qing; Sang, Jian-Ping; Pan, Chun-Xu; Zou, Xian-Wu; Chen, Tsung-Yu; Zou, Xiaoqin

2012-01-01

Mutations in ClC channel proteins may cause serious functional changes and even diseases. The function of ClC proteins mainly manifests as Cl− transport, which is related to the binding free energies of chloride ions. Therefore, the influence of a mutation on ClC function can be studied by investigating the mutational effect on the binding free energies of chloride ions. The present study provides quantitative and systematic investigations on the influences of residue mutations on the electrostatic binding free energies in Escherichia coli ClC (EcClC) proteins, using all-atom molecular dynamics simulations. It was found that the change of the electrostatic binding free energy decreases linearly with the increase of the residue-chloride ion distance for a mutation. This work reveals how changes in the charge of a mutated residue and in the distance between the mutated residue and the binding site govern the variations in the electrostatic binding free energies, and therefore influence the transport of chloride ions and conduction in EcClC. This work would facilitate our understanding of the mutational effects on transport of chloride ions and functions of ClC proteins, and provide a guideline to estimate which residue mutations will have great influences on ClC functions. PMID:22612693

Cloning and polymorphisms of yak lactate dehydrogenase B gene.

PubMed

Wang, Guosheng; Zhao, Xingbo; Zhong, Juming; Cao, Meng; He, Qinghua; Liu, Zhengxin; Lin, Yaqiu; Xu, Yaou; Zheng, Yucai

2013-06-05

The main objective of this work was to study the unique polymorphisms of the lactate dehydrogenase-1 (LDH1) gene in yak (Bos grunniens). Native polyacrylamide gel electrophoresis revealed three phenotypes of LDH1 (a tetramer of H subunit) in yak heart and longissimus muscle extracts. The corresponding gene, ldhb, encoding H subunits of three LDH1 phenotypes was obtained by RT-PCR. A total of six nucleotide differences were detected in yak ldhb compared with that of cattle, of which five mutations cause amino acid substitutions. Sequence analysis shows that the G896A and C689A, mutations of ldhb gene, result in alterations of differently charged amino acids, and create the three phenotypes (F, M, and S) of yak LDH1. Molecular modeling of the H subunit of LDH indicates that the substituted amino acids are not located within NAD+ or substrate binding sites. PCR-RFLP examination of G896A mutation demonstrated that most LDH1-F samples are actually heterozygote at this site. These results help to elucidate the molecular basis and genetic characteristic of the three unique LDH1 phenotypes in yak.

Cloning and Polymorphisms of Yak Lactate Dehydrogenase b Gene

PubMed Central

Wang, Guosheng; Zhao, Xingbo; Zhong, Juming; Cao, Meng; He, Qinghua; Liu, Zhengxin; Lin, Yaqiu; Xu, Yaou; Zheng, Yucai

2013-01-01

The main objective of this work was to study the unique polymorphisms of the lactate dehydrogenase-1 (LDH1) gene in yak (Bos grunniens). Native polyacrylamide gel electrophoresis revealed three phenotypes of LDH1 (a tetramer of H subunit) in yak heart and longissimus muscle extracts. The corresponding gene, ldhb, encoding H subunits of three LDH1 phenotypes was obtained by RT-PCR. A total of six nucleotide differences were detected in yak ldhb compared with that of cattle, of which five mutations cause amino acid substitutions. Sequence analysis shows that the G896A and C689A, mutations of ldhb gene, result in alterations of differently charged amino acids, and create the three phenotypes (F, M, and S) of yak LDH1. Molecular modeling of the H subunit of LDH indicates that the substituted amino acids are not located within NAD+ or substrate binding sites. PCR-RFLP examination of G896A mutation demonstrated that most LDH1-F samples are actually heterozygote at this site. These results help to elucidate the molecular basis and genetic characteristic of the three unique LDH1 phenotypes in yak. PMID:23739677

A gain-of-function mutation in the M-domain of cardiac myosin-binding protein-C increases binding to actin.

PubMed

Bezold, Kristina L; Shaffer, Justin F; Khosa, Jaskiran K; Hoye, Elaine R; Harris, Samantha P

2013-07-26

The M-domain is the major regulatory subunit of cardiac myosin-binding protein-C (cMyBP-C) that modulates actin and myosin interactions to influence muscle contraction. However, the precise mechanism(s) and the specific residues involved in mediating the functional effects of the M-domain are not fully understood. Positively charged residues adjacent to phosphorylation sites in the M-domain are thought to be critical for effects of cMyBP-C on cross-bridge interactions by mediating electrostatic binding with myosin S2 and/or actin. However, recent structural studies revealed that highly conserved sequences downstream of the phosphorylation sites form a compact tri-helix bundle. Here we used site-directed mutagenesis to probe the functional significance of charged residues adjacent to the phosphorylation sites and conserved residues within the tri-helix bundle. Results confirm that charged residues adjacent to phosphorylation sites and residues within the tri-helix bundle are important for mediating effects of the M-domain on contraction. In addition, four missense variants within the tri-helix bundle that are associated with human hypertrophic cardiomyopathy caused either loss-of-function or gain-of-function effects on force. Importantly, the effects of the gain-of-function variant, L348P, increased the affinity of the M-domain for actin. Together, results demonstrate that functional effects of the M-domain are not due solely to interactions with charged residues near phosphorylatable serines and provide the first demonstration that the tri-helix bundle contributes to the functional effects of the M-domain, most likely by binding to actin.

The X-ray Crystal Structures of Human {alpha}-Phosphomannomutase 1 Reveal the Structural Basis of Congenital Disorder of Glycosylation Type 1a

DOE Office of Scientific and Technical Information (OSTI.GOV)

Silvaggi,N.; Zhang, C.; Lu, Z.

2006-01-01

Carbohydrate-deficient glycoprotein syndrome type 1a (CDG-1a) is a congenital disease characterized by severe defects in nervous system development. It is caused by mutations in alpha -phosphomannomutase (of which there are two isozymes, {alpha}-PMM1 and {alpha}-PPM2). Here we report the X-ray crystal structures of human {alpha}-PMM1 in the open conformation, with and without the bound substrate, {alpha}-D-mannose 1-phosphate. {alpha}-PMM1, like most Haloalkanoic Acid Dehalogenase Superfamily (HADSF) members, consists of two domains, the cap and core, which open to bind substrate and then close to provide a solvent exclusive environment for catalysis. The substrate phosphate group is observed at a positively chargedmore » site of the cap domain, rather than at the core domain phosphoryl-transfer site defined by the D19 nucleophile and Mg{sup 2+} cofactor. This suggests that substrate binds first to the cap and then is swept into the active site upon cap closure. The orientation of the acid/base residue D21 suggests that {alpha}-PMM uses a different method of protecting the aspartylphosphate from hydrolysis than the HADSF member {beta}-phosphoglucomutase. It is hypothesized that the electrostatic repulsion of positive charges at the interface of the cap and core domains stabilizes {alpha}-PMM1 in the open conformation, and that the negatively charged substrate binds to the cap, thereby facilitating its closure over the core domain. The two isozymes {alpha}-PMM1 and {alpha}-PMM2 are shown to have a conserved active-site structure and to display similar kinetic properties. Analysis of the known mutation sites in the context of the structures reveals the genotype-phenotype relationship underlying CDG-1a.« less

Electrostatic Interactions Mediate Binding of Obscurin to Small Ankyrin 1: Biochemical and Molecular Modeling Studies

PubMed Central

Busby, Ben; Oashi, Taiji; Willis, Chris D.; Ackermann, Maegen A.; Kontrogianni-Konstantopoulos, Aikaterini; MacKerell, Alexander D.; Bloch, Robert J.

2012-01-01

Small ankyrin 1 (sAnk1; also Ank1.5) is an integral protein of the sarcoplasmic reticulum in skeletal and cardiac muscle cells, where it is thought to bind to the C-terminal region of obscurin, a large modular protein that surrounds the contractile apparatus. Using fusion proteins in vitro, in combination with site directed mutagenesis and surface plasmon resonance measurements, we previously showed that the binding site on sAnk1 for obscurin consists in part of six lysine and arginine residues. Here we show that four charged residues in the high affinity binding site on obscurin for sAnk1, between residues 6316-6345, consisting of three glutamates and a lysine, are necessary, but not sufficient, for this site on obscurin to bind with high affinity to sAnk1. We also identify specific complementary mutations in sAnk1 that can partially or completely compensate for the changes in binding caused by charge-switching mutations in obscurin. We used molecular modeling to develop structural models of residues 6322-6339 of obscurin bound to sAnk1. The models, based on a combination of Brownian and molecular dynamics simulations, predict that the binding site on sAnk1 for obscurin is organized as two ankyrin-like repeats, with the last α-helical segment oriented at an angle to the nearby helices, allowing lysine-6338 of obscurin to form an ionic interaction with aspartate-111 of sAnk1. This prediction was validated by double mutant cycle experiments. Our results are consistent with a model in which electrostatic interactions between specific pairs of side chains on obscurin and sAnk1 promote binding and complex formation. PMID:21333652

Transition State Charge Stabilization and Acid-Base Catalysis of mRNA Cleavage by the Endoribonuclease RelE

PubMed Central

Dunican, Brian F.; Hiller, David A.; Strobel, Scott A.

2015-01-01

The bacterial toxin RelE is a ribosome-dependent endoribonuclease. It is part of a type II toxin-antitoxin system that contributes to antibiotic resistance and biofilm formation. During amino acid starvation RelE cleaves mRNA in the ribosomal A-site, globally inhibiting protein translation. RelE is structurally similar to microbial RNases that employ general acid-base catalysis to facilitate RNA cleavage. The RelE active-site is atypical for acid-base catalysis, in that it is enriched for positively charged residues and lacks the prototypical histidine-glutamate catalytic pair, making the mechanism of mRNA cleavage unclear. In this study we use a single-turnover kinetic analysis to measure the effect of pH and phosphorothioate substitution on the rate constant for cleavage of mRNA by wild-type RelE and seven active-site mutants. Mutation and thio-effects indicate a major role for stabilization of increased negative change in the transition state by arginine 61. The wild-type RelE cleavage rate constant is pH-independent, but the reaction catalyzed by many of the mutants is strongly pH dependent, suggestive of general acid-base catalysis. pH-rate curves indicate that wild-type RelE operates with the pKa of at least one catalytic residue significantly downshifted by the local environment. Mutation of any single active-site residue is sufficient to disrupt this microenvironment and revert the shifted pKa back above neutrality. pH-rate curves are consistent with K54 functioning as a general base and R81 as a general acid. The capacity of RelE to effect a large pKa shift and facilitate a common catalytic mechanism by uncommon means furthers our understanding of other atypical enzymatic active sites. PMID:26535789

Analysis of the plasticity of location of the Arg244 positive charge within the active site of the TEM-1 β-lactamase

PubMed Central

Marciano, David C; Brown, Nicholas G; Palzkill, Timothy

2009-01-01

A large number of β-lactamases have emerged that are capable of conferring bacterial resistance to β-lactam antibiotics. Comparison of the structural and functional features of this family has refined understanding of the catalytic properties of these enzymes. An arginine residue present at position 244 in TEM-1 β-lactamase interacts with the carboxyl group common to penicillin and cephalosporin antibiotics and thereby stabilizes both the substrate and transition state complexes. A comparison of class A β-lactamase sequences reveals that arginine at position 244 is not conserved, although a positive charge at this structural location is conserved and is provided by an arginine at positions 220 or 276 for those enzymes lacking arginine at position 244. The plasticity of the location of positive charge in the β-lactamase active site was experimentally investigated by relocating the arginine at position 244 in TEM-1 β-lactamase to positions 220, 272, and 276 by site-directed mutagenesis. Kinetic analysis of the engineered β-lactamases revealed that removal of arginine 244 by alanine mutation reduced catalytic efficiency against all substrates tested and restoration of an arginine at positions 272 or 276 partially suppresses the catalytic defect of the Arg244Ala substitution. These results suggest an evolutionary mechanism for the observed divergence of the position of positive charge in the active site of class A β-lactamases. PMID:19672877

A novel mutation of the beta-globin gene promoter (-102 C>A) and pitfalls in family screening.

PubMed

Aguilar-Martinez, Patricia; Jourdan, Eric; Brun, Sophie; Cunat, Séverine; Giansily-Blaizot, Muriel; Pissard, Serge; Schved, Jean-François

2007-12-01

We describe a family with beta-thalassemia in which several pitfalls of genetic diagnoses were present. These include coherent family phenotypes with discrepancies in molecular findings because of nonpaternity, and a false beta-globin gene homozygous genotype due to a large deletion in the second locus. These findings underline the difficulties of family genetic studies and the need for tight relationship between professionals involved in laboratory studies and those in-charge of the clinical follow-up and genetic counselling. In this family, we also report a new silent beta-thalassemia mutation, -102 (C>A), in the distal CACCC box of the beta-globin gene promoter.

The Role of CHD7 Mutations in Patients with Idiopathic Hypogonadotropic Hypogonadism and Kallmann Syndrome

PubMed Central

Kim, Hyung-Goo; Layman, Lawrence C.

2013-01-01

Mutations in the chromodomain helicase DNA binding protein-7 (CHD7) cause CHARGE syndrome, which includes eye coloboma, heart malformations, atresia of the choanae, retardation of growth/development, genital anomalies, and ear abnormalities. CHARGE syndrome is usually sporadic, but is also autosomal dominant. CHD7 encodes a large protein that participates in chromatin remodeling and transcription. Findings from studies of mouse models employing ENU-mutagenesis or gene-trap methods recapitulate human CHARGE syndrome. CHARGE patients may manifest anosmia and/or hypogonadism, features that overlap with idiopathic hypogonadotropic hypogonadism (IHH) and Kallmann syndrome (KS). Similarly, IHH/KS patients may also display partial CHARGE features. Therefore, it has been hypothesized that IHH/KS represents a milder allelic variant of CHARGE syndrome, which has been supported by the identification of heterozygous CHD7 mutations in both normosmic IHH and KS. Developmental expression within the hypothalamus and the presence of human mutations indicate that CHD7 has an important role in puberty and reproduction. PMID:21856375

Construction and properties of a temperature-sensitive mutation in the gene for the bacteriophage SPO1 DNA-binding protein TF1.

PubMed

Sayre, M H; Geiduschek, E P

1990-08-01

The Bacillus subtilis bacteriophage SPO1 encodes the DNA-binding protein TF1, a homolog of the ubiquitous type II DNA-binding proteins that are components of bacterial chromatin. The known three-dimensional structure of a related protein was used in devising a scheme of site-directed mutagenesis that led to the creation of a temperature-sensitive mutation in the TF1 gene. At the nonpermissive temperature, this mutation disrupted the temporal regulation of viral protein synthesis and processing, altered the kinetics of accumulation of at least one viral transcript, and prohibited the production of infective progeny phage. We suggest that TF1 function is required to shut off the expression of several early-middle and middle viral genes and that TF1 plays a role in phage head morphogenesis. Spontaneous second-site mutations of the temperature-sensitive mutant TF1 allele that suppressed its associated phenotypes were analyzed. These suppressor mutations conferred greater amino acid sequence homology with the type II DNA-binding protein from the thermophile Bacillus stearothermophilus.

Drosophila as a model for intractable epilepsy: gilgamesh suppresses seizures in para(bss1) heterozygote flies.

PubMed

Howlett, Iris C; Rusan, Zeid M; Parker, Louise; Tanouye, Mark A

2013-08-07

Intractable epilepsies, that is, seizure disorders that do not respond to currently available therapies, are difficult, often tragic, neurological disorders. Na(+) channelopathies have been implicated in some intractable epilepsies, including Dravet syndrome (Dravet 1978), but little progress has been forthcoming in therapeutics. Here we examine a Drosophila model for intractable epilepsy, the Na(+) channel gain-of-function mutant para(bss1) that resembles Dravet syndrome in some aspects (parker et al. 2011a). In particular, we identify second-site mutations that interact with para(bss1), seizure enhancers, and seizure suppressors. We describe one seizure-enhancer mutation named charlatan (chn). The chn gene normally encodes an Neuron-Restrictive Silencer Factor/RE1-Silencing Transcription factor transcriptional repressor of neuronal-specific genes. We identify a second-site seizure-suppressor mutation, gilgamesh (gish), that reduces the severity of several seizure-like phenotypes of para(bss1)/+ heterozygotes. The gish gene normally encodes the Drosophila ortholog of casein kinase CK1g3, a member of the CK1 family of serine-threonine kinases. We suggest that CK1g3 is an unexpected but promising new target for seizure therapeutics.

Mutagenic effects of heavy ion radiation in plants

NASA Astrophysics Data System (ADS)

Mei, M.; Deng, H.; Lu, Y.; Zhuang, C.; Liu, Z.; Qiu, Q.; Qiu, Y.; Yang, T. C.

1994-10-01

Genetic and developmental effects of heavy ions in maize and rice were investigated. Heavy particles with various charges and energies were accelerated at the BEVALAC. The frequency of occurence of white-yellow stripes on leaves of plants developed from irradiated maize seeds increased linearly with dose, and high-LET heavy charged particles, e.g., neon, argon, and iron, were 2-12 times as effective as gamma rays in inducing this type of mutation. The effectiveness of high-LET heavy ion in (1) inhibiting rice seedling growth, (2) reducing plant fertility, (3) inducing chromosome aberration and micronuclei in root tip cells and pollen mother cells of the first generation plants developed from exposed seeds, and (4) inducing mutation in the second generation, were greater than that of low-LET gamma rays. All effects observed were dose-dependent; however, there appeared to be an optimal range of doses for inducing certain types of mutation, for example, for argon ions (400 MeV/u) at 90-100 Gy, several valuable mutant lines with favorable characters, such as semidwarf, early maturity and high yield ability, were obtained. Experimental results suggest that the potential application of heavy ions in crop improvement is promising. RFLP analysis of two semidwarf mutants induced by argon particles revealed that large DNA alterations might be involved in these mutants.

Studies of the aggregation of mutant proteins in vitro provide insights into the genetics of amyloid diseases.

PubMed

Chiti, Fabrizio; Calamai, Martino; Taddei, Niccolo; Stefani, Massimo; Ramponi, Giampietro; Dobson, Christopher M

2002-12-10

Protein aggregation and the formation of highly insoluble amyloid structures is associated with a range of debilitating human conditions, which include Alzheimer's disease, Parkinson's disease, and the Creutzfeldt-Jakob disease. Muscle acylphosphatase (AcP) has already provided significant insights into mutational changes that modulate amyloid formation. In the present paper, we have used this system to investigate the effects of mutations that modify the charge state of a protein without affecting significantly the hydrophobicity or secondary structural propensities of the polypeptide chain. A highly significant inverse correlation was found to exist between the rates of aggregation of the protein variants under denaturing conditions and their overall net charge. This result indicates that aggregation is generally favored by mutations that bring the net charge of the protein closer to neutrality. In light of this finding, we have analyzed natural mutations associated with familial forms of amyloid diseases that involve alteration of the net charge of the proteins or protein fragments associated with the diseases. Sixteen mutations have been identified for which the mechanism of action that causes the pathological condition is not yet known or fully understood. Remarkably, 14 of these 16 mutations cause the net charge of the corresponding peptide or protein that converts into amyloid deposits to be reduced. This result suggests that charge has been a key parameter in molecular evolution to ensure the avoidance of protein aggregation and identifies reduction of the net charge as an important determinant in at least some forms of protein deposition diseases.

Adaptation of Bacillus subtilis to Life at Extreme Potassium Limitation.

PubMed

Gundlach, Jan; Herzberg, Christina; Hertel, Dietrich; Thürmer, Andrea; Daniel, Rolf; Link, Hannes; Stülke, Jörg

2017-07-05

Potassium is the most abundant metal ion in every living cell. This ion is essential due to its requirement for the activity of the ribosome and many enzymes but also because of its role in buffering the negative charge of nucleic acids. As the external concentrations of potassium are usually low, efficient uptake and intracellular enrichment of the ion is necessary. The Gram-positive bacterium Bacillus subtilis possesses three transporters for potassium, KtrAB, KtrCD, and the recently discovered KimA. In the absence of the high-affinity transporters KtrAB and KimA, the bacteria were unable to grow at low potassium concentrations. However, we observed the appearance of suppressor mutants that were able to overcome the potassium limitation. All these suppressor mutations affected amino acid metabolism, particularly arginine biosynthesis. In the mutants, the intracellular levels of ornithine, citrulline, and arginine were strongly increased, suggesting that these amino acids can partially substitute for potassium. This was confirmed by the observation that the supplementation with positively charged amino acids allows growth of B. subtilis even at the extreme potassium limitation that the bacteria experience if no potassium is added to the medium. In addition, a second class of suppressor mutations allowed growth at extreme potassium limitation. These mutations result in increased expression of KtrAB, the potassium transporter with the highest affinity and therefore allow the acquisition and accumulation of the smallest amounts of potassium ions from the environment. IMPORTANCE Potassium is essential for every living cell as it is required for the activity for many enzymes and for maintaining the intracellular pH by buffering the negative charge of the nucleic acids. We have studied the adaptation of the soil bacterium Bacillus subtilis to life at low potassium concentrations. If the major high-affinity transporters are missing, the bacteria are unable to grow unless they acquire mutations that result in the accumulation of positively charged amino acids such as ornithine, citrulline, and arginine. Supplementation of the medium with these amino acids rescued growth even in the absence of externally added potassium. Moreover, these growth conditions, which the bacteria experience as an extreme potassium limitation, can be overcome by the acquisition of mutations that result in increased expression of the high-affinity potassium transporter KtrAB. Our results indicate that positively charged amino acids can partially take over the function of potassium. Copyright © 2017 Gundlach et al.

Mapping disease-related missense mutations in the immunoglobulin-like fold domain of lamin A/C reveals novel genotype-phenotype associations for laminopathies.

PubMed

Scharner, Juergen; Lu, Hui-Chun; Fraternali, Franca; Ellis, Juliet A; Zammit, Peter S

2014-06-01

Mutations in A-type nuclear lamins cause laminopathies. However, genotype-phenotype correlations using the 340 missense mutations within the LMNA gene are unclear: partially due to the limited availability of three-dimensional structure. The immunoglobulin (Ig)-like fold domain has been solved, and using bioinformatics tools (including Polyphen-2, Fold X, Parameter OPtimized Surfaces, and PocketPicker) we characterized 56 missense mutations for position, surface exposure, change in charge and effect on Ig-like fold stability. We find that 21 of the 27 mutations associated with a skeletal muscle phenotype are distributed throughout the Ig-like fold, are nonsurface exposed and predicted to disrupt overall stability of the Ig-like fold domain. Intriguingly, the remaining 6 mutations clustered, had higher surface exposure, and did not affect stability. The majority of 9 lipodystrophy or 10 premature aging syndrome mutations also did not disrupt Ig-like fold domain stability and were surface exposed and clustered in distinct regions that overlap predicted binding pockets. Although buried, the 10 cardiac mutations had no other consistent properties. Finally, most lipodystrophy and premature aging mutations resulted in a -1 net charge change, whereas skeletal muscle mutations caused no consistent net charge changes. Since premature aging, lipodystrophy and the subset of 6 skeletal muscle mutations cluster tightly in distinct, charged regions, they likely affect lamin A/C -protein/DNA/RNA interactions: providing a consistent genotype-phenotype relationship for mutations in this domain. Thus, this subgroup of skeletal muscle laminopathies that we term the 'Skeletal muscle cluster', may have a distinct pathological mechanism. These novel associations refine the ability to predict clinical features caused by certain LMNA missense mutations. © 2013 Wiley Periodicals, Inc.

Mutations in POLR3A and POLR3B Encoding RNA Polymerase III Subunits Cause an Autosomal-Recessive Hypomyelinating Leukoencephalopathy

PubMed Central

Saitsu, Hirotomo; Osaka, Hitoshi; Sasaki, Masayuki; Takanashi, Jun-ichi; Hamada, Keisuke; Yamashita, Akio; Shibayama, Hidehiro; Shiina, Masaaki; Kondo, Yukiko; Nishiyama, Kiyomi; Tsurusaki, Yoshinori; Miyake, Noriko; Doi, Hiroshi; Ogata, Kazuhiro; Inoue, Ken; Matsumoto, Naomichi

2011-01-01

Congenital hypomyelinating disorders are a heterogeneous group of inherited leukoencephalopathies characterized by abnormal myelin formation. We have recently reported a hypomyelinating syndrome characterized by diffuse cerebral hypomyelination with cerebellar atrophy and hypoplasia of the corpus callosum (HCAHC). We performed whole-exome sequencing of three unrelated individuals with HCAHC and identified compound heterozygous mutations in POLR3B in two individuals. The mutations include a nonsense mutation, a splice-site mutation, and two missense mutations at evolutionally conserved amino acids. Using reverse transcription-PCR and sequencing, we demonstrated that the splice-site mutation caused deletion of exon 18 from POLR3B mRNA and that the transcript harboring the nonsense mutation underwent nonsense-mediated mRNA decay. We also identified compound heterozygous missense mutations in POLR3A in the remaining individual. POLR3A and POLR3B encode the largest and second largest subunits of RNA Polymerase III (Pol III), RPC1 and RPC2, respectively. RPC1 and RPC2 together form the active center of the polymerase and contribute to the catalytic activity of the polymerase. Pol III is involved in the transcription of small noncoding RNAs, such as 5S ribosomal RNA and all transfer RNAs (tRNA). We hypothesize that perturbation of Pol III target transcription, especially of tRNAs, could be a common pathological mechanism underlying POLR3A and POLR3B mutations. PMID:22036171

Strong Enrichment of Aromatic Residues in Binding Sites from a Charge-neutralized Hyperthermostable Sso7d Scaffold Library*

PubMed Central

Kiefer, Jonathan D.; Srinivas, Raja R.; Lobner, Elisabeth; Tisdale, Alison W.; Mehta, Naveen K.; Yang, Nicole J.; Tidor, Bruce; Wittrup, K. Dane

2016-01-01

The Sso7d protein from the hyperthermophilic archaeon Sulfolobus solfataricus is an attractive binding scaffold because of its small size (7 kDa), high thermal stability (Tm of 98 °C), and absence of cysteines and glycosylation sites. However, as a DNA-binding protein, Sso7d is highly positively charged, introducing a strong specificity constraint for binding epitopes and leading to nonspecific interaction with mammalian cell membranes. In the present study, we report charge-neutralized variants of Sso7d that maintain high thermal stability. Yeast-displayed libraries that were based on this reduced charge Sso7d (rcSso7d) scaffold yielded binders with low nanomolar affinities against mouse serum albumin and several epitopes on human epidermal growth factor receptor. Importantly, starting from a charge-neutralized scaffold facilitated evolutionary adaptation of binders to differentially charged epitopes on mouse serum albumin and human epidermal growth factor receptor, respectively. Interestingly, the distribution of amino acids in the small and rigid binding surface of enriched rcSso7d-based binders is very different from that generally found in more flexible antibody complementarity-determining region loops but resembles the composition of antibody-binding energetic hot spots. Particularly striking was a strong enrichment of the aromatic residues Trp, Tyr, and Phe in rcSso7d-based binders. This suggests that the rigidity and small size of this scaffold determines the unusual amino acid composition of its binding sites, mimicking the energetic core of antibody paratopes. Despite the high frequency of aromatic residues, these rcSso7d-based binders are highly expressed, thermostable, and monomeric, suggesting that the hyperstability of the starting scaffold and the rigidness of the binding surface confer a high tolerance to mutation. PMID:27582495

Temporal and Geographical Distribution of Adamantane-Resistant H1N1 Virus and The Evolution Tree of MP Gene Mutation

NASA Astrophysics Data System (ADS)

He, W.; Dong, G.

2016-12-01

The adamantanamine, a kind of M2 inhibitor, is globally used to treat the infection of Influenza A(H1N1). But for the past decade, the H1N1 influenza virus becomes significantly resistant to adamantanamine owing to the mutation on site 26, 27, 30, 31 and 34. This study collects a number of 14823 M2 protein sequences of H1N1 virus strains from NCBI range from 1918 to April 12, 2016. We statistics the mutation rate of different hosts, mutation sites, countries and years to find out the change of mutation rate. The result shows that 60.53% H1N1 influenza virus affected Human have the resistance to adamantanamine and the S31N mutation should be the main reason. We also find that the mutation rate of S31N raised from 23.33% to 88.76%. The second aspect in this study is analyzing the MP gene sequence of H1N1 influenza virus to find out the evolution of H1N1 according to MP protein. This study collecting a great number of M2 protein sequences to find out the mutation situation of H1N1 have a signification to the surveillance of drug resistance and have a bit of guidance on using the adamantanamine.

Novel inborn error of folate metabolism: identification by exome capture and sequencing of mutations in the MTHFD1 gene in a single proband.

PubMed

Watkins, David; Schwartzentruber, Jeremy A; Ganesh, Jaya; Orange, Jordan S; Kaplan, Bernard S; Nunez, Laura Dempsey; Majewski, Jacek; Rosenblatt, David S

2011-09-01

An infant was investigated because of megaloblastic anaemia, atypical hemolytic uraemic syndrome, severe combined immune deficiency, elevated blood levels of homocysteine and methylmalonic acid, and a selective decreased synthesis of methylcobalamin in cultured fibroblasts. Exome sequencing was performed on patient genomic DNA. Two mutations were identified in the MTHFD1 gene, which encodes a protein that catalyses three reactions involved in cellular folate metabolism. This protein is essential for the generation of formyltetrahydrofolate and methylenetetrahydrofolate and important for nucleotide and homocysteine metabolism. One mutation (c.727+1G>A) affects the splice acceptor site of intron 8. The second mutation, c.517C>T (p.R173C), changes a critical arginine residue in the NADP-binding site of the protein. Mutations affecting this arginine have previously been shown to affect enzyme activity. Both parents carry a single mutation and an unaffected sibling carries neither mutation. The combination of two mutations in the MTHFRD1 gene, predicted to have severe consequences, in the patient and their absence in the unaffected sibling, supports causality. This patient represents the first case of an inborn error of folate metabolism affecting the trifunctional MTHFD1 protein. This report reinforces the power of exome capture and sequencing for the discovery of novel genes, even when only a single proband is available for study.

[Study of gene mutation in 62 hemophilia A children].

PubMed

Hu, Q; Liu, A G; Zhang, L Q; Zhang, A; Wang, Y Q; Wang, S M; Lu, Y J; Wang, X

2017-11-02

Objective: To analyze the mutation type of FⅧ gene in children with hemophilia A and to explore the relationship among hemophilia gene mutation spectrum, gene mutation and clinical phenotype. Method: Sixty-two children with hemophilia A from Department of Pediatric Hematology, Tongji Hospital of Tongji Medical College, Huazhong University of Science and Technology between January 2015 and March 2017 were enrolled. All patients were male, aged from 4 months to 7 years and F Ⅷ activity ranged 0.2%-11.0%. Fifty cases had severe, 10 cases had moderate and 2 cases had mild hemophilia A. DNA was isolated from peripheral blood in hemophilia A children and the target gene fragment was amplified by PCR, in combination with the second generation sequencing, 22 and 1 introns were detected. Negative cases were detected by the second generation sequencing and results were compared with those of the international FⅧ gene mutation database. Result: There were 20 cases (32%) of intron 22 inversion, 2 cases (3%) of intron 1 inversion, 18 cases (29%) of missense mutation, 5 cases (8%) of nonsense mutation, 7 cases (11%) of deletion mutation, 1 case(2%)of splice site mutation, 2 cases (3%) of large fragment deletion and 1 case of insertion mutation (2%). No mutation was detected in 2 cases (3%), and 4 cases (7%) failed to amplify. The correlation between phenotype and genotype showed that the most common gene mutation in severe hemophilia A was intron 22 inversion (20 cases), accounting for 40% of severe patients, followed by 11 cases of missense mutation (22%). The most common mutation in moderate hemophilia A was missense mutation (6 cases), accounting for 60% of moderate patients. Conclusion: The most frequent mutation type in hemophilia A was intron 22 inversion, followed by missense mutation, again for missing mutation. The relationship between phenotype and genotype: the most frequent gene mutation in severe hemophilia A is intron 22 inversion, followed by missense mutation; the most frequent gene mutation in medium hemophilia A is missense mutation.

Haemoglobin Pierre-Benite--a high affinity variant associated with relative polycythaemia.

PubMed

Beard, M E; Potter, H C; Spearing, R L; Brennan, S O

2001-12-01

This is the second reported example of Hb Pierre--Benite (beta90 Glu-->Asp). This mutation is associated with increased oxygen affinity and polycythaemia. No instability was found and there was no charge shift detected by cellulose acetate electrophoresis at pH 8.3. The mutation was however, clearly indicated by electrospray ionization mass spectrometry (ESI MS), which showed an abnormal beta chain with a 14 Da decrease in mass. Blood volume studies documented a relative rather than a true polycythaemia and this finding has been reported in at least two other high affinity haemoglobin variants--Hb Heathrow and Hb Rahere. This finding led to delay in diagnosis because high oxygen affinity variants are conventionally considered to cause a true polycythaemia.

Classical and atypical agonists activate M1 muscarinic acetylcholine receptors through common mechanisms.

PubMed

Randáková, Alena; Dolejší, Eva; Rudajev, Vladimír; Zimčík, Pavel; Doležal, Vladimír; El-Fakahany, Esam E; Jakubík, Jan

2015-07-01

We mutated key amino acids of the human variant of the M1 muscarinic receptor that target ligand binding, receptor activation, and receptor-G protein interaction. We compared the effects of these mutations on the action of two atypical M1 functionally preferring agonists (N-desmethylclozapine and xanomeline) and two classical non-selective orthosteric agonists (carbachol and oxotremorine). Mutations of D105 in the orthosteric binding site and mutation of D99 located out of the orthosteric binding site decreased affinity of all tested agonists that was translated as a decrease in potency in accumulation of inositol phosphates and intracellular calcium mobilization. Mutation of D105 decreased the potency of the atypical agonist xanomeline more than that of the classical agonists carbachol and oxotremorine. Mutation of the residues involved in receptor activation (D71) and coupling to G-proteins (R123) completely abolished the functional responses to both classical and atypical agonists. Our data show that both classical and atypical agonists activate hM1 receptors by the same molecular switch that involves D71 in the second transmembrane helix. The principal difference among the studied agonists is rather in the way they interact with D105 in the orthosteric binding site. Furthermore, our data demonstrate a key role of D105 in xanomeline wash-resistant binding and persistent activation of hM1 by wash-resistant xanomeline. Copyright © 2015 The Authors. Published by Elsevier Ltd.. All rights reserved.

Tighter Ligand Binding Can Compensate for Impaired Stability of an RNA-Binding Protein.

PubMed

Wallis, Christopher P; Richman, Tara R; Filipovska, Aleksandra; Rackham, Oliver

2018-06-15

It has been widely shown that ligand-binding residues, by virtue of their orientation, charge, and solvent exposure, often have a net destabilizing effect on proteins that is offset by stability conferring residues elsewhere in the protein. This structure-function trade-off can constrain possible adaptive evolutionary changes of function and may hamper protein engineering efforts to design proteins with new functions. Here, we present evidence from a large randomized mutant library screen that, in the case of PUF RNA-binding proteins, this structural relationship may be inverted and that active-site mutations that increase protein activity are also able to compensate for impaired stability. We show that certain mutations in RNA-protein binding residues are not necessarily destabilizing and that increased ligand-binding can rescue an insoluble, unstable PUF protein. We hypothesize that these mutations restabilize the protein via thermodynamic coupling of protein folding and RNA binding.

Functional identification and characterization of sodium binding sites in Na symporters

PubMed Central

Loo, Donald D. F.; Jiang, Xuan; Gorraitz, Edurne; Hirayama, Bruce A.; Wright, Ernest M.

2013-01-01

Sodium cotransporters from several different gene families belong to the leucine transporter (LeuT) structural family. Although the identification of Na+ in binding sites is beyond the resolution of the structures, two Na+ binding sites (Na1 and Na2) have been proposed in LeuT. Na2 is conserved in the LeuT family but Na1 is not. A biophysical method has been used to measure sodium dissociation constants (Kd) of wild-type and mutant human sodium glucose cotransport (hSGLT1) proteins to identify the Na+ binding sites in hSGLT1. The Na1 site is formed by residues in the sugar binding pocket, and their mutation influences sodium binding to Na1 but not to Na2. For the canonical Na2 site formed by two –OH side chains, S392 and S393, and three backbone carbonyls, mutation of S392 to cysteine increased the sodium Kd by sixfold. This was accompanied by a dramatic reduction in the apparent sugar and phlorizin affinities. We suggest that mutation of S392 in the Na2 site produces a structural rearrangement of the sugar binding pocket to disrupt both the binding of the second Na+ and the binding of sugar. In contrast, the S393 mutations produce no significant changes in sodium, sugar, and phlorizin affinities. We conclude that the Na2 site is conserved in hSGLT1, the side chain of S392 and the backbone carbonyl of S393 are important in the first Na+ binding, and that Na+ binding to Na2 promotes binding to Na1 and also sugar binding. PMID:24191006

Ground motion analysis of OSSY

DOE Office of Scientific and Technical Information (OSTI.GOV)

Swift, R.P.; Snell, C.M.

1993-11-01

The On Site Seismic Yield experiment, OSSY, was performed to investigate the viability of a high-explosive technique to help estimate the yield of nuclear explosions. We have analyzed recorded data and conducted numerical simulations of the 100-pound OSSY experiments performed in hole UE-10 ITS No. 3 at the Nevada Test Site. Particle velocity wave forms from these experiments show a distinct dual-pulse structure in the close-in and far-field regions, with the amplitude of the second pulse being as large as or larger than the first pulse. To gain some insight into the cause of the dual-pulse feature, we examine howmore » the explosion-induced close-in response is affected by (1) certain features of inelastic rock/soil constitutive models applied in the near-field region, (2) the large length-to-diameter charge ratio of 8, (3) the charge and gauge package emplacement, and (4) geology (e.g., layering) in the vicinity of the explosion. Our results from 1-D and 2-D simulations show the following: (a) the response, measured by accelerometers located above the charges, is significantly influenced by the charge length-to-diameter ratio out to a distance of 8 m. (b) the grout emplacement of the charge has very little effect on the response. (c) the geologic layering serves mainly to phase the arrival of the pulses. (d) the second pulse can be best accounted for by applying a dilatant feature that allows for pore recovery during unloading. Other material property variations do not provide any contribution to the formation of a second pulse.« less

Zinc Binding and Dimerization of Streptococcus pyogenes Pyrogenic Exotoxin C Are Not Essential for T-Cell Stimulation

DTIC Science & Technology

2003-03-14

streptococcal superantigen binding to MHCII on the surface of cells (7–9), suggesting an essential role in both MHCII molecular recognition and TCR-mediated...extent, mutations of side chains found in a second conserved MHCII alpha-chain-binding site consisting of a hydrophobic surface loop decreased T-cell...fraction of dimer is present at T-cell stimulatory concentrations of Spe-C following mutation of the unpaired side chain of cys- teine at residue 27 to

Distinct signatures for mutator sensitivity of lacZ reversions and for the spectrum of lacI/lacO forward mutations on the chromosome of nondividing Escherichia coli.

PubMed Central

Bharatan, Shanti M; Reddy, Manjula; Gowrishankar, J

2004-01-01

A conditional lethal galE(Ts)-based strategy was employed in Escherichia coli, first to eliminate all growth-associated chromosomal reversions in lacZ or forward mutations in lacI/lacO by incubation at the restrictive temperature and subsequently to recover (as papillae) spontaneous mutations that had arisen in the population of nondividing cells after shift to the permissive temperature. Data from lacZ reversion studies in mutator strains indicated that the products of all genes for mismatch repair (mutHLS, dam, uvrD), of some for oxidative damage repair (mutMT), and of that for polymerase proofreading (dnaQ) are required in dividing cells; some others for oxidative damage repair (mutY, nth nei) are required in both dividing and nondividing cells; and those for alkylation damage repair (ada ogt) are required in nondividing cells. The spectrum of lacI/lacO mutations in nondividing cells was distinguished both by lower frequencies of deletions and IS1 insertions and by the unique occurrence of GC-to-AT transitions at lacO +5. In the second approach to study mutations that had occurred in nondividing cells, lacI/lacO mutants were selected as late-arising papillae from the lawn of a galE+ strain; once again, transitions at lacO +5 were detected among the mutants that had been obtained from populations initially grown on poor carbon sources such as acetate, palmitate, or succinate. Our results indicate that the lacO +5 site is mutable only in nondividing cells, one possible mechanism for which might be that random endogenous alkylation (or oxidative) damage to DNA in these cells is efficiently corrected by the Ada Ogt (or Nth Nei) repair enzymes at most sites but not at lacO +5. Furthermore, the late-arising papillae from the second approach were composed almost exclusively of dominant lacI/lacO mutants. This finding lends support to "instantaneous gratification" models in which a spontaneous lesion, occurring at a random site in DNA of a nondividing cell, is most likely to be fixed as a mutation if it allows the cell to immediately exit the nondividing state. PMID:15020459

Impact of mutations on the allosteric conformational equilibrium

PubMed Central

Weinkam, Patrick; Chen, Yao Chi; Pons, Jaume; Sali, Andrej

2012-01-01

Allostery in a protein involves effector binding at an allosteric site that changes the structure and/or dynamics at a distant, functional site. In addition to the chemical equilibrium of ligand binding, allostery involves a conformational equilibrium between one protein substate that binds the effector and a second substate that less strongly binds the effector. We run molecular dynamics simulations using simple, smooth energy landscapes to sample specific ligand-induced conformational transitions, as defined by the effector-bound and unbound protein structures. These simulations can be performed using our web server: http://salilab.org/allosmod/. We then develop a set of features to analyze the simulations and capture the relevant thermodynamic properties of the allosteric conformational equilibrium. These features are based on molecular mechanics energy functions, stereochemical effects, and structural/dynamic coupling between sites. Using a machine-learning algorithm on a dataset of 10 proteins and 179 mutations, we predict both the magnitude and sign of the allosteric conformational equilibrium shift by the mutation; the impact of a large identifiable fraction of the mutations can be predicted with an average unsigned error of 1 kBT. With similar accuracy, we predict the mutation effects for an 11th protein that was omitted from the initial training and testing of the machine-learning algorithm. We also assess which calculated thermodynamic properties contribute most to the accuracy of the prediction. PMID:23228330

Enhanced vulnerability of human proteins towards disease-associated inactivation through divergent evolution.

PubMed

Medina-Carmona, Encarnación; Fuchs, Julian E; Gavira, Jose A; Mesa-Torres, Noel; Neira, Jose L; Salido, Eduardo; Palomino-Morales, Rogelio; Burgos, Miguel; Timson, David J; Pey, Angel L

2017-09-15

Human proteins are vulnerable towards disease-associated single amino acid replacements affecting protein stability and function. Interestingly, a few studies have shown that consensus amino acids from mammals or vertebrates can enhance protein stability when incorporated into human proteins. Here, we investigate yet unexplored relationships between the high vulnerability of human proteins towards disease-associated inactivation and recent evolutionary site-specific divergence of stabilizing amino acids. Using phylogenetic, structural and experimental analyses, we show that divergence from the consensus amino acids at several sites during mammalian evolution has caused local protein destabilization in two human proteins linked to disease: cancer-associated NQO1 and alanine:glyoxylate aminotransferase, mutated in primary hyperoxaluria type I. We demonstrate that a single consensus mutation (H80R) acts as a disease suppressor on the most common cancer-associated polymorphism in NQO1 (P187S). The H80R mutation reactivates P187S by enhancing FAD binding affinity through local and dynamic stabilization of its binding site. Furthermore, we show how a second suppressor mutation (E247Q) cooperates with H80R in protecting the P187S polymorphism towards inactivation through long-range allosteric communication within the structural ensemble of the protein. Our results support that recent divergence of consensus amino acids may have occurred with neutral effects on many functional and regulatory traits of wild-type human proteins. However, divergence at certain sites may have increased the propensity of some human proteins towards inactivation due to disease-associated mutations and polymorphisms. Consensus mutations also emerge as a potential strategy to identify structural hot-spots in proteins as targets for pharmacological rescue in loss-of-function genetic diseases. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Mutational analysis of the antigenomic trans-acting delta ribozyme: the alterations of the middle nucleotides located on the P1 stem.

PubMed Central

Ananvoranich, S; Lafontaine, D A; Perreault, J P

1999-01-01

Our previous report on delta ribozyme cleavage using a trans -acting antigenomic delta ribozyme and a collection of short substrates showed that the middle nucleotides of the P1 stem, the substrate binding site, are essential for the cleavage activity. Here we have further investigated the effect of alterations in the P1 stem on the kinetic and thermodynamic parameters of delta ribozyme cleavage using various ribozyme variants carrying single base mutations at putative positions reported. The kinetic and thermodynamic values obtained in mutational studies of the two middle nucleotides of the P1 stem suggest that the binding and active sites of the delta ribozyme are uniquely formed. Firstly, the substrate and the ribozyme are engaged in the formation of a helix, known as the P1 stem, which may contain a weak hydrogen bond(s) or a bulge. Secondly, a tertiary interaction involving the base moieties in the middle of the P1 stem likely plays a role in defining the chemical environment. As a con-sequence, the active site might form simultaneously or subsequently to the binding site during later steps of the pathway. PMID:10037808

Effect of Handling, Storage and Cycling on Ni-H2 Cells: Second Plateau Phenomenon

NASA Technical Reports Server (NTRS)

Vaidyanathan, Hari; Rao, Gopalakrishna

2001-01-01

Proper handling of Ni-H2 cells/batteries in storage, during I&T, and at launch site is very important to preserve the useful energy and to extend the mission life. Cell reversal test is not a prudent test to verify or quantify the nickel pre-charge in Ni-H2 cells/batteries. The second plateau is due to the formation of Ni(+3) that is electrochemically inactive. Gas analysis of the cell, and chemical analysis of the positive plate are confirmatory tests to determine the nature of pre-charge in Ni-H2 cells.

Importance of the Extracellular Loop 4 in the Human Serotonin Transporter for Inhibitor Binding and Substrate Translocation*

PubMed Central

Rannversson, Hafsteinn; Wilson, Pamela; Kristensen, Kristina Birch; Sinning, Steffen; Kristensen, Anders Skov; Strømgaard, Kristian; Andersen, Jacob

2015-01-01

The serotonin transporter (SERT) terminates serotonergic neurotransmission by performing reuptake of released serotonin, and SERT is the primary target for antidepressants. SERT mediates the reuptake of serotonin through an alternating access mechanism, implying that a central substrate site is connected to both sides of the membrane by permeation pathways, of which only one is accessible at a time. The coordinated conformational changes in SERT associated with substrate translocation are not fully understood. Here, we have identified a Leu to Glu mutation at position 406 (L406E) in the extracellular loop 4 (EL4) of human SERT, which induced a remarkable gain-of-potency (up to >40-fold) for a range of SERT inhibitors. The effects were highly specific for L406E relative to six other mutations in the same position, including the closely related L406D mutation, showing that the effects induced by L406E are not simply charge-related effects. Leu406 is located >10 Å from the central inhibitor binding site indicating that the mutation affects inhibitor binding in an indirect manner. We found that L406E decreased accessibility to a residue in the cytoplasmic pathway. The shift in equilibrium to favor a more outward-facing conformation of SERT can explain the reduced turnover rate and increased association rate of inhibitor binding we found for L406E. Together, our findings show that EL4 allosterically can modulate inhibitor binding within the central binding site, and substantiates that EL4 has an important role in controlling the conformational equilibrium of human SERT. PMID:25903124

Investigation of protein selectivity in multimodal chromatography using in silico designed Fab fragment variants.

PubMed

Karkov, Hanne Sophie; Krogh, Berit Olsen; Woo, James; Parimal, Siddharth; Ahmadian, Haleh; Cramer, Steven M

2015-11-01

In this study, a unique set of antibody Fab fragments was designed in silico and produced to examine the relationship between protein surface properties and selectivity in multimodal chromatographic systems. We hypothesized that multimodal ligands containing both hydrophobic and charged moieties would interact strongly with protein surface regions where charged groups and hydrophobic patches were in close spatial proximity. Protein surface property characterization tools were employed to identify the potential multimodal ligand binding regions on the Fab fragment of a humanized antibody and to evaluate the impact of mutations on surface charge and hydrophobicity. Twenty Fab variants were generated by site-directed mutagenesis, recombinant expression, and affinity purification. Column gradient experiments were carried out with the Fab variants in multimodal, cation-exchange, and hydrophobic interaction chromatographic systems. The results clearly indicated that selectivity in the multimodal system was different from the other chromatographic modes examined. Column retention data for the reduced charge Fab variants identified a binding site comprising light chain CDR1 as the main electrostatic interaction site for the multimodal and cation-exchange ligands. Furthermore, the multimodal ligand binding was enhanced by additional hydrophobic contributions as evident from the results obtained with hydrophobic Fab variants. The use of in silico protein surface property analyses combined with molecular biology techniques, protein expression, and chromatographic evaluations represents a previously undescribed and powerful approach for investigating multimodal selectivity with complex biomolecules. © 2015 Wiley Periodicals, Inc.

Oxidation of p53 through DNA Charge Transport Involves a Network of Disulfides within the DNA-Binding Domain

PubMed Central

2016-01-01

Transcription factor p53 plays a critical role in the cellular response to stress stimuli. We have seen that p53 dissociates selectively from various promoter sites as a result of oxidation at long-range through DNA-mediated charge transport (CT). Here, we examine this chemical oxidation and determine the residues in p53 that are essential for oxidative dissociation, focusing on the network of cysteine residues adjacent to the DNA-binding site. Of the eight mutants studied, only the C275S mutation shows decreased affinity for the Gadd45 promoter site. However, both mutations C275S and C277S result in substantial attenuation of oxidative dissociation, with C275S causing the most severe attenuation. Differential thiol labeling was used to determine the oxidation states of cysteine residues within p53 after DNA-mediated oxidation. Reduced cysteines were iodoacetamide-labeled, whereas oxidized cysteines participating in disulfide bonds were 13C2D2-iodoacetamide-labeled. Intensities of respective iodoacetamide-modified peptide fragments were analyzed by mass spectrometry. A distinct shift in peptide labeling toward 13C2D2-iodoacetamide-labeled cysteines is observed in oxidized samples, confirming that chemical oxidation of p53 occurs at long range. All observable cysteine residues trend toward the heavy label under conditions of DNA CT, indicating the formation of multiple disulfide bonds among the cysteine network. On the basis of these data, it is proposed that disulfide formation involving C275 is critical for inducing oxidative dissociation of p53 from DNA. PMID:25584637

Kinetic analysis of butyrylcholinesterase-catalyzed hydrolysis of acetanilides.

PubMed

Masson, Patrick; Froment, Marie-Thérèse; Gillon, Emilie; Nachon, Florian; Darvesh, Sultan; Schopfer, Lawrence M

2007-09-01

The aryl-acylamidase (AAA) activity of butyrylcholinesterase (BuChE) has been known for a long time. However, the kinetic mechanism of aryl-acylamide hydrolysis by BuChE has not been investigated. Therefore, the catalytic properties of human BuChE and its peripheral site mutant (D70G) toward neutral and charged aryl-acylamides were determined. Three neutral (o-nitroacetanilide, m-nitroacetanilide, o-nitrophenyltrifluoroacetamide) and one positively charged (3-(acetamido) N,N,N-trimethylanilinium, ATMA) acetanilides were studied. Hydrolysis of ATMA by wild-type and D70G enzymes showed a long transient phase preceding the steady state. The induction phase was characterized by a hysteretic "burst". This reflects the existence of two enzyme states in slow equilibrium with different catalytic properties. Steady-state parameters for hydrolysis of the three acetanilides were compared to catalytic parameters for hydrolysis of esters giving the same acetyl intermediate. Wild-type BuChE showed substrate activation while D70G displayed a Michaelian behavior with ATMA as with positively charged esters. Owing to the low affinity of BuChE for amide substrates, the hydrolysis kinetics of neutral amides was first order. Acylation was the rate-determining step for hydrolysis of aryl-acetylamide substrates. Slow acylation of the enzyme, relative to that by esters may, in part, be due suboptimal fit of the aryl-acylamides in the active center of BuChE. The hypothesis that AAA and esterase active sites of BuChE are non-identical was tested with mutant BuChE. It was found that mutations on the catalytic serine, S198C and S198D, led to complete loss of both activities. The silent variant (FS117) had neither esterase nor AAA activity. Mutation in the peripheral site (D70G) had the same effect on esterase and AAA activities. Echothiophate inhibited both activities identically. It was concluded that the active sites for esterase and AAA activities are identical, i.e. S198. This excludes any other residue present in the gorge for being the catalytic nucleophile pole.

Quantum coupled mutation finder: predicting functionally or structurally important sites in proteins using quantum Jensen-Shannon divergence and CUDA programming.

PubMed

Gültas, Mehmet; Düzgün, Güncel; Herzog, Sebastian; Jäger, Sven Joachim; Meckbach, Cornelia; Wingender, Edgar; Waack, Stephan

2014-04-03

The identification of functionally or structurally important non-conserved residue sites in protein MSAs is an important challenge for understanding the structural basis and molecular mechanism of protein functions. Despite the rich literature on compensatory mutations as well as sequence conservation analysis for the detection of those important residues, previous methods often rely on classical information-theoretic measures. However, these measures usually do not take into account dis/similarities of amino acids which are likely to be crucial for those residues. In this study, we present a new method, the Quantum Coupled Mutation Finder (QCMF) that incorporates significant dis/similar amino acid pair signals in the prediction of functionally or structurally important sites. The result of this study is twofold. First, using the essential sites of two human proteins, namely epidermal growth factor receptor (EGFR) and glucokinase (GCK), we tested the QCMF-method. The QCMF includes two metrics based on quantum Jensen-Shannon divergence to measure both sequence conservation and compensatory mutations. We found that the QCMF reaches an improved performance in identifying essential sites from MSAs of both proteins with a significantly higher Matthews correlation coefficient (MCC) value in comparison to previous methods. Second, using a data set of 153 proteins, we made a pairwise comparison between QCMF and three conventional methods. This comparison study strongly suggests that QCMF complements the conventional methods for the identification of correlated mutations in MSAs. QCMF utilizes the notion of entanglement, which is a major resource of quantum information, to model significant dissimilar and similar amino acid pair signals in the detection of functionally or structurally important sites. Our results suggest that on the one hand QCMF significantly outperforms the previous method, which mainly focuses on dissimilar amino acid signals, to detect essential sites in proteins. On the other hand, it is complementary to the existing methods for the identification of correlated mutations. The method of QCMF is computationally intensive. To ensure a feasible computation time of the QCMF's algorithm, we leveraged Compute Unified Device Architecture (CUDA).The QCMF server is freely accessible at http://qcmf.informatik.uni-goettingen.de/.

A basic cluster in the N terminus of yellow fever virus NS2A contributes to infectious particle production.

PubMed

Voßmann, Stephanie; Wieseler, Janett; Kerber, Romy; Kümmerer, Beate Mareike

2015-05-01

The flavivirus NS2A protein is involved in the assembly of infectious particles. To further understand its role in this process, a charged-to-alanine scanning analysis was performed on NS2A encoded by an infectious cDNA clone of yellow fever virus (YFV). Fifteen mutants containing single, double, or triple charged-to-alanine changes were tested. Five of them did not produce infectious particles, whereas efficient RNA replication was detectable for two of the five NS2A mutants (R22A-K23A-R24A and R99A-E100A-R101A mutants). Prolonged cultivation of transfected cells resulted in the recovery of pseudorevertants. Besides suppressor mutants in NS2A, a compensating second-site mutation in NS3 (D343G) arose for the NS2A R22A-K23A-R24A mutant. We found this NS3 mutation previously to be suppressive for the NS2Aα cleavage site Q189S mutant, also deficient in virion assembly. In this study, the subsequently suggested interaction between NS2A and NS3 was proven by coimmunoprecipitation analyses. Using selectively permeabilized cells, we could demonstrate that the regions encompassing R22A-K23A-R24A and Q189S in NS2A are localized to the cytoplasm, where NS3 is also known to reside. However, the defect in particle production observed for the NS2A R22A-K23A-R24A and Q189S mutants was not due to a defect in physical interaction between NS2A and NS3, as the NS2A mutations did not interrupt NS3 interaction. In fact, a region just upstream of R22-K23-R24 was mapped to be critical for NS2A-NS3 interaction. Taken together, these data support a complex interplay between YFV NS2A and NS3 in virion assembly and identify a basic cluster in the NS2A N terminus to be critical in this process. Despite an available vaccine, yellow fever remains endemic in tropical areas of South America and Africa. To control the disease, antiviral drugs are required, and an understanding of the determinants of virion assembly is central to their development. In this study, we identified a basic cluster of amino acids in the N terminus of YFV NS2A which inhibited virion assembly upon mutation. The defect was rescued by a spontaneously occurring mutation in NS3. Our study proves an interaction between NS2A and NS3, which, remarkably, was maintained for the NS2A mutant in the presence and absence of the NS3 mutation. This suggests a role for other viral and/or cellular proteins in virion assembly. Residues important for YFV virion production reported here only partially coincided with those reported for other flaviviruses, suggesting that the determinants for particle production are virus specific. Reconstruction of a YFV encoding tagged NS2A paves the way to identify further NS2A interaction partners. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

A Basic Cluster in the N Terminus of Yellow Fever Virus NS2A Contributes to Infectious Particle Production

PubMed Central

Voßmann, Stephanie; Wieseler, Janett; Kerber, Romy

2015-01-01

ABSTRACT The flavivirus NS2A protein is involved in the assembly of infectious particles. To further understand its role in this process, a charged-to-alanine scanning analysis was performed on NS2A encoded by an infectious cDNA clone of yellow fever virus (YFV). Fifteen mutants containing single, double, or triple charged-to-alanine changes were tested. Five of them did not produce infectious particles, whereas efficient RNA replication was detectable for two of the five NS2A mutants (R22A-K23A-R24A and R99A-E100A-R101A mutants). Prolonged cultivation of transfected cells resulted in the recovery of pseudorevertants. Besides suppressor mutants in NS2A, a compensating second-site mutation in NS3 (D343G) arose for the NS2A R22A-K23A-R24A mutant. We found this NS3 mutation previously to be suppressive for the NS2Aα cleavage site Q189S mutant, also deficient in virion assembly. In this study, the subsequently suggested interaction between NS2A and NS3 was proven by coimmunoprecipitation analyses. Using selectively permeabilized cells, we could demonstrate that the regions encompassing R22A-K23A-R24A and Q189S in NS2A are localized to the cytoplasm, where NS3 is also known to reside. However, the defect in particle production observed for the NS2A R22A-K23A-R24A and Q189S mutants was not due to a defect in physical interaction between NS2A and NS3, as the NS2A mutations did not interrupt NS3 interaction. In fact, a region just upstream of R22-K23-R24 was mapped to be critical for NS2A-NS3 interaction. Taken together, these data support a complex interplay between YFV NS2A and NS3 in virion assembly and identify a basic cluster in the NS2A N terminus to be critical in this process. IMPORTANCE Despite an available vaccine, yellow fever remains endemic in tropical areas of South America and Africa. To control the disease, antiviral drugs are required, and an understanding of the determinants of virion assembly is central to their development. In this study, we identified a basic cluster of amino acids in the N terminus of YFV NS2A which inhibited virion assembly upon mutation. The defect was rescued by a spontaneously occurring mutation in NS3. Our study proves an interaction between NS2A and NS3, which, remarkably, was maintained for the NS2A mutant in the presence and absence of the NS3 mutation. This suggests a role for other viral and/or cellular proteins in virion assembly. Residues important for YFV virion production reported here only partially coincided with those reported for other flaviviruses, suggesting that the determinants for particle production are virus specific. Reconstruction of a YFV encoding tagged NS2A paves the way to identify further NS2A interaction partners. PMID:25694595

FTIR Studies of Internal Water Molecules of Bacteriorhodopsin: Structural Analysis of Halide-bound D85S and D212N Mutants in the Schiff Base Region

NASA Astrophysics Data System (ADS)

Shibata, Mikihiro; Kandori, Hideki

2007-12-01

Bacteriorhodopsin (BR), a membrane protein found in Halobacterium salinarum, functions as a light-driven proton pump. The Schiff base region has a quadropolar structure with positive charges located at the protonated Schiff base and Arg82, and counterbalancing negative charges located at Asp85 and Asp212 (Figure 1A). It is known that BR lacks a proton-pumping activity if Asp85 or Asp212 is neutralized by mutation. On the other hand, binding of C1- brings different effects for pumping functions in mutants at D85 and D212 position. While C1--bound D85T and D85S pump C1-, photovoltage measurements suggested that C1--bound D212N pumps protons at low pH. In this study, we measured low-temperature FTIR spectra of D85S and D212N containing various halides to compare the halide binding site of both proteins. In the case of D85S, the N-D stretching vibrations of the Schiff base were halide-dependent. This result suggests that the halide is a hydrogen-bond acceptor of the Schiff base, being consistent with the X-ray crystal structure. On the other hand, no halide dependence was observed for vibrational bands of the retinal skeleton and the Schiff base in the D212N mutant. This result suggests that the halide does not form a hydrogen bond with the Schiff base directly, unlike the mutation at D85 position. Halide-dependent water bands in the Schiff base region also differ between D85S and D212N. From these results, halide binding site of both proteins and role of two negative charges in BR will be discussed.

Differential Effects of Mutations on the Transport Properties of the Na+/H+ Antiporter NhaA from Escherichia coli*

PubMed Central

Mager, Thomas; Braner, Markus; Kubsch, Bastian; Hatahet, Lina; Alkoby, Dudu; Rimon, Abraham; Padan, Etana; Fendler, Klaus

2013-01-01

Na+/H+ antiporters show a marked pH dependence, which is important for their physiological function in eukaryotic and prokaryotic cells. In NhaA, the Escherichia coli Na+/H+ antiporter, specific single site mutations modulating the pH profile of the transporter have been described in the past. To clarify the mechanism by which these mutations influence the pH dependence of NhaA, the substrate dependence of the kinetics of selected NhaA variants was electrophysiologically investigated and analyzed with a kinetic model. It is shown that the mutations affect NhaA activity in quite different ways by changing the properties of the binding site or the dynamics of the transporter. In the first case, pK and/or KDNa are altered, and in the second case, the rate constants of the conformational transition between the inside and the outside open conformation are modified. It is shown that residues as far apart as 15–20 Å from the binding site can have a significant impact on the dynamics of the conformational transitions or on the binding properties of NhaA. The implications of these results for the pH regulation mechanism of NhaA are discussed. PMID:23836890

Dissecting protein function: an efficient protocol for identifying separation-of-function mutations that encode structurally stable proteins.

PubMed

Lubin, Johnathan W; Rao, Timsi; Mandell, Edward K; Wuttke, Deborah S; Lundblad, Victoria

2013-03-01

Mutations that confer the loss of a single biochemical property (separation-of-function mutations) can often uncover a previously unknown role for a protein in a particular biological process. However, most mutations are identified based on loss-of-function phenotypes, which cannot differentiate between separation-of-function alleles vs. mutations that encode unstable/unfolded proteins. An alternative approach is to use overexpression dominant-negative (ODN) phenotypes to identify mutant proteins that disrupt function in an otherwise wild-type strain when overexpressed. This is based on the assumption that such mutant proteins retain an overall structure that is comparable to that of the wild-type protein and are able to compete with the endogenous protein (Herskowitz 1987). To test this, the in vivo phenotypes of mutations in the Est3 telomerase subunit from Saccharomyces cerevisiae were compared with the in vitro secondary structure of these mutant proteins as analyzed by circular-dichroism spectroscopy, which demonstrates that ODN is a more sensitive assessment of protein stability than the commonly used method of monitoring protein levels from extracts. Reverse mutagenesis of EST3, which targeted different categories of amino acids, also showed that mutating highly conserved charged residues to the oppositely charged amino acid had an increased likelihood of generating a severely defective est3(-) mutation, which nevertheless encoded a structurally stable protein. These results suggest that charge-swap mutagenesis directed at a limited subset of highly conserved charged residues, combined with ODN screening to eliminate partially unfolded proteins, may provide a widely applicable and efficient strategy for generating separation-of-function mutations.

Activation of a cryptic splice site in the mitochondrial elongation factor GFM1 causes combined OXPHOS deficiency☆

PubMed Central

Simon, Mariella T.; Ng, Bobby G.; Friederich, Marisa W.; Wang, Raymond Y.; Boyer, Monica; Kircher, Martin; Collard, Renata; Buckingham, Kati J.; Chang, Richard; Shendure, Jay; Nickerson, Deborah A.; Bamshad, Michael J.; Van Hove, Johan L.K.; Freeze, Hudson H.; Abdenur, Jose E.

2017-01-01

We report the clinical, biochemical, and molecular findings in two brothers with encephalopathy and multi-systemic disease. Abnormal transferrin glycoforms were suggestive of a type I congenital disorder of glycosylation (CDG). While exome sequencing was negative for CDG related candidate genes, the testing revealed compound heterozygous mutations in the mitochondrial elongation factor G gene (GFM1). One of the mutations had been reported previously while the second, novel variant was found deep in intron 6, activating a cryptic splice site. Functional studies demonstrated decreased GFM1 protein levels, suggested disrupted assembly of mitochondrial complexes III and V and decreased activities of mitochondrial complexes I and IV, all indicating combined OXPHOS deficiency. PMID:28216230

Refinement of the conformation of a critical region of charge-charge interaction between cholecystokinin and its receptor.

PubMed

Ding, Xi-Qin; Pinon, Delia I; Furse, Kristina E; Lybrand, Terry P; Miller, Laurence J

2002-05-01

Insight into the molecular basis of cholecystokinin (CCK) binding to its receptor has come from receptor mutagenesis and photoaffinity labeling studies, with both contributing to the current hypothesis that the acidic Tyr-sulfate-27 residue within the peptide is situated adjacent to basic Arg(197) in the second loop of the receptor. Here, we refine our understanding of this region of interaction by examining a structure-activity series of these positions within both ligand and receptor and by performing three-dimensional molecular modeling of key pairs of modified ligand and receptor constructs. The important roles of Arg(197) and Tyr-sulfate-27 were supported by the marked negative impact on binding and biological response with their natural partner molecule when the receptor residue was replaced by acidic Asp or Glu and when the peptide residue was replaced by basic Arg, Lys, p-amino-Phe, p-guanidino-Phe, or p-methylamino-Phe. Complementary ligand-receptor charge-exchange experiments were unable to regain the lost function. This was supported by the molecular modeling, which demonstrated that the charge-reversed double mutants could not form a good interaction without extensive rearrangement of receptor conformation. The models further predicted that R197D and R197E mutations would lead to conformational changes in the extracellular domain, and this was experimentally supported by data showing that these mutations decreased peptide agonist and antagonist binding and increased nonpeptidyl antagonist binding. These receptor constructs also had increased susceptibility to trypsin degradation relative to the wild-type receptor. In contrast, the relatively conservative R197K mutation had modest negative impact on peptide agonist binding, again consistent with the modeling demonstration of loss of a series of stabilizing inter- and intramolecular bonds. The strong correlation between predicted and experimental results support the reported refinement in the three-dimensional structure of the CCK-occupied receptor.

A novel frameshift mutation of CHD7 in a Japanese patient with CHARGE syndrome

PubMed Central

Kohmoto, Tomohiro; Shono, Miki; Naruto, Takuya; Watanabe, Miki; Suga, Ken-ichi; Nakagawa, Ryuji; Kagami, Shoji; Masuda, Kiyoshi; Imoto, Issei

2016-01-01

CHARGE syndrome is a rare autosomal dominant developmental disorder involving multiple organs. CHD7 is a major causative gene of CHARGE syndrome. We performed targeted-exome sequencing using a next-generation sequencer for molecular diagnosis of a 4-month-old male patient who was clinically suspected to have CHARGE syndrome, and report a novel monoallelic mutation in CHD7, NM_017780.3(CHD7_v001):c.2966del causing a reading frameshift [p.(Cys989Serfs*3)]. PMID:27081570

A novel frameshift mutation of CHD7 in a Japanese patient with CHARGE syndrome.

PubMed

Kohmoto, Tomohiro; Shono, Miki; Naruto, Takuya; Watanabe, Miki; Suga, Ken-Ichi; Nakagawa, Ryuji; Kagami, Shoji; Masuda, Kiyoshi; Imoto, Issei

2016-01-01

CHARGE syndrome is a rare autosomal dominant developmental disorder involving multiple organs. CHD7 is a major causative gene of CHARGE syndrome. We performed targeted-exome sequencing using a next-generation sequencer for molecular diagnosis of a 4-month-old male patient who was clinically suspected to have CHARGE syndrome, and report a novel monoallelic mutation in CHD7, NM_017780.3(CHD7_v001):c.2966del causing a reading frameshift [p.(Cys989Serfs*3)].

Mutagenic effects of heavy ion radiation in plants

NASA Technical Reports Server (NTRS)

Mei, M.; Deng, H.; Lu, Y.; Zhuang, C.; Liu, Z.; Qiu, Q.; Qiu, Y.; Yang, T. C.

1994-01-01

Genetic and developmental effects of heavy ions in maize and rice were investigated. Heavy particles with various charges and energies were accelerated at the BEVALAC. The frequency of occurrence of white-yellow stripes on leaves of plants developed from irradiated maize seeds increased linearly with dose, and high Linear Energy Transfer (LET) heavy charged particles, e.g., neon, argon, and iron, were 2-12 times as effective as gamma rays in inducing this type of mutation. The effectiveness of high-LET heavy ion in (1) inhibiting rice seedling growth, (2) reducing plant fertility, (3) inducing chromosome aberration and micronuclei in root tip cells and pollen mother cells of the first generation plants developed from exposed seeds, and (4) inducing mutation in the second generation, were greater than that of low-LET gamma rays. All effects observed were dose-dependent; however, there appeared to be an optimal range of doses for inducing certain types of mutation, for example, for argon ions (400 MeV/u) at 90-100 Gy, several valuable mutant lines with favorable characters, such as semidwarf, early maturity and high yield ability, were obtained. Experimental results suggest that the potential application of heavy ions in crop improvement is promising. Restriction-fragment-length-polymorphism (RFLP) analysis of two semidwarf mutants induced by argon particles revealed that large DNA alterations might be involved in these mutants.

Glu311 and Arg337 Stabilize a Closed Active-site Conformation and Provide a Critical Catalytic Base and Countercation for Green Bioluminescence in Beetle Luciferases.

PubMed

Viviani, V R; Simões, A; Bevilaqua, V R; Gabriel, G V M; Arnoldi, F G C; Hirano, T

2016-08-30

Beetle luciferases elicit the emission of different bioluminescence colors from green to red. Whereas firefly luciferases emit yellow-green light and are pH-sensitive, undergoing a typical red-shift at acidic pH and higher temperatures and in the presence of divalent heavy metals, click beetle and railroadworm luciferases emit a wider range of colors from green to red but are pH-independent. Despite many decades of study, the structural determinants and mechanisms of bioluminescence colors and pH sensitivity remain enigmatic. Here, through modeling studies, site-directed mutagenesis, and spectral and kinetic studies using recombinant luciferases from the three main families of bioluminescent beetles that emit different colors of light (Macrolampis sp2 firefly, Phrixotrix hirtus railroadworm, and Pyrearinus termitilluminans click beetle), we investigated the role of E311 and R337 in bioluminescence color determination. All mutations of these residues in firefly luciferase produced red mutants, indicating that the preservation of opposite charges and the lengths of the side chains of E311 and R337 are essential for keeping a salt bridge that stabilizes a closed hydrophobic conformation favorable for green light emission. Kinetic studies indicate that residue R337 is important for binding luciferin and creating a positively charged environment around excited oxyluciferin phenolate. In Pyrearinus green-emitting luciferase, the R334A mutation causes a 27 nm red-shift, whereas in Phrixotrix red-emitting luciferase, the L334R mutation causes a blue-shift that is no longer affected by guanidine. These results provide compelling evidence that the presence of arginine at position 334 is essential for blue-shifting the emission spectra of most beetle luciferases. Therefore, residues E311 and R337 play both structural and catalytic roles in bioluminescence color determination, by stabilizing a closed hydrophobic conformation favorable for green light emission, and also providing a base to accept excited oxyluciferin phenol proton, and a countercation to shield the negative charge of E311 and to stabilize excited oxyluciferin phenolate, blue-shifting emission spectra in most beetle luciferases.

Functional consequences of an arginine180 to glutamine mutation in factor IX Hilo.

PubMed

Monroe, D M; McCord, D M; Huang, M N; High, K A; Lundblad, R L; Kasper, C K; Roberts, H R

1989-05-01

Factor IX Hilo is a variant factor IX molecule that has no detectable coagulant activity. The defect in factor IX Hilo arises from a point mutation in the gene such that in the protein Arg180 is converted to a Gln. Activation of factor IX Hilo by factor Xla was monitored using the fluorescent active site probe p-aminobenzamidine. Normal factor IX showed complete activation in one hour as determined by measuring the increase in fluorescence when p-aminobenzamidine bound to activated factor IX. Factor IX Hilo showed no increase in fluorescence even after 24 hours, indicating that the active site was not exposed. Polyacrylamide gel electrophoresis showed that factor IX Hilo was cleaved to a light chain plus a larger peptide with a molecular weight equivalent to a heavy chain covalently linked to an activation peptide. Amino terminal amino acid sequencing of factor IX Hilo cleaved by factor Xla showed cleavage only at Arg145-Ala146, indicating that the Gln180-Val181 bond was not cleaved and that the active site was thus not exposed. The presence of factor IX Hilo in patient plasma was responsible for the patient having a very long ox brain prothrombin time characteristic of severe hemophilia Bm. Patient plasma had an ox brain prothrombin time of 100 seconds using a Thrombotest kit, significantly prolonged over the normal control value of 45 seconds. When factor IX Hilo was depleted from patient plasma using an immunoaffinity column, the ox brain prothrombin time decreased to 41 seconds. When factor IX Hilo was added back to depleted patient plasma, to normal plasma depleted of factor IX by the same affinity column, or to plasma from a CRM- hemophilia B patient, the ox brain prothrombin time was significantly prolonged. We conclude that the Arg180 to Gln mutation in factor IX Hilo results in a molecule that cannot be activated by factor Xla. Further, our data suggest that the mutation results in a molecule that interacts with components of the extrinsic pathway to give a prolonged ox brain prothrombin time.

Investigating the inter-subunit/subdomain interactions and motions relevant to disease mutations in the N-terminal domain of ryanodine receptors by molecular dynamics simulation.

PubMed

Zheng, Wenjun; Liu, Zheng

2017-09-01

The ryanodine receptors (RyR) are essential to calcium signaling in striated muscles, and numerous disease mutations have been identified in two RyR isoforms, RyR1 in skeletal muscle and RyR2 in cardiac muscle. A deep understanding of the activation/regulation mechanisms of RyRs has been hampered by the shortage of high-resolution structures and dynamic information for this giant tetrameric complex in different functional states. Toward elucidating the molecular mechanisms of disease mutations in RyRs, we performed molecular dynamics simulation of the N-terminal domain (NTD) which is not only the best-resolved structural component of RyRs, but also a hotspot of disease mutations. First, we simulated the tetrameric NTD of wild-type RyR1 and three disease mutants (K155E, R157Q, and R164Q) that perturb the inter-subunit interfaces. Our simulations identified a dynamic network of salt bridges involving charged residues at the inter-subunit/subdomain interfaces and disease-mutation sites. By perturbing this key network, the above three mutations result in greater flexibility with the highest inter-subunit opening probability for R157Q. Next, we simulated the monomeric NTD of RyR2 in the presence or absence of a central Cl - anion which is known to stabilize the interfaces between the three NTD subdomains (A, B, and C). We found that the loss of Cl - restructures the salt-bridge network near the Cl - -binding site, leading to rotations of subdomain A/B relative to subdomain C and enhanced mobility between the subdomains. This finding supports a mechanism for disease mutations in the NTD of RyR2 via perturbation of the Cl - binding. The rich structural and dynamic information gained from this study will guide future mutational and functional studies of the NTD of RyRs. Proteins 2017; 85:1633-1644. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

Uncovering the determinants of a highly perturbed tyrosine pKa in the active site of ketosteroid isomerase.

PubMed

Schwans, Jason P; Sunden, Fanny; Gonzalez, Ana; Tsai, Yingssu; Herschlag, Daniel

2013-11-05

Within the idiosyncratic enzyme active-site environment, side chain and ligand pKa values can be profoundly perturbed relative to their values in aqueous solution. Whereas structural inspection of systems has often attributed perturbed pKa values to dominant contributions from placement near charged groups or within hydrophobic pockets, Tyr57 of a Pseudomonas putida ketosteroid isomerase (KSI) mutant, suggested to have a pKa perturbed by nearly 4 units to 6.3, is situated within a solvent-exposed active site devoid of cationic side chains, metal ions, or cofactors. Extensive comparisons among 45 variants with mutations in and around the KSI active site, along with protein semisynthesis, (13)C NMR spectroscopy, absorbance spectroscopy, and X-ray crystallography, was used to unravel the basis for this perturbed Tyr pKa. The results suggest that the origin of large energetic perturbations are more complex than suggested by visual inspection. For example, the introduction of positively charged residues near Tyr57 raises its pKa rather than lowers it; this effect, and part of the increase in the Tyr pKa from the introduction of nearby anionic groups, arises from accompanying active-site structural rearrangements. Other mutations with large effects also cause structural perturbations or appear to displace a structured water molecule that is part of a stabilizing hydrogen-bond network. Our results lead to a model in which three hydrogen bonds are donated to the stabilized ionized Tyr, with these hydrogen-bond donors, two Tyr side chains, and a water molecule positioned by other side chains and by a water-mediated hydrogen-bond network. These results support the notion that large energetic effects are often the consequence of multiple stabilizing interactions rather than a single dominant interaction. Most generally, this work provides a case study for how extensive and comprehensive comparisons via site-directed mutagenesis in a tight feedback loop with structural analysis can greatly facilitate our understanding of enzyme active-site energetics. The extensive data set provided may also be a valuable resource for those wishing to extensively test computational approaches for determining enzymatic pKa values and energetic effects.

Uncovering the Determinants of a Highly Perturbed Tyrosine pKa in the Active Site of Ketosteroid Isomerase†

PubMed Central

Schwans, Jason P.; Sunden, Fanny; Gonzalez, Ana; Tsai, Yingssu; Herschlag, Daniel

2013-01-01

Within the idiosyncratic enzyme active site environment, side chain and ligand pKa values can be profoundly perturbed relative to their values in aqueous solution. Whereas structural inspection of systems has often attributed perturbed pKa values to dominant contributions from placement near to charged groups or within hydrophobic pockets, Tyr57 of a P. putida ketosteroid isomerase (KSI) mutant, suggested to have a pKa perturbed by nearly 4 units to 6.3, is situated within a solvent-exposed active site devoid of cationic side chains, metal ions, or cofactors. Extensive comparisons among 45 variants with mutations in and around the KSI active site, along with protein semi-synthesis, 13C NMR spectroscopy, absorbance spectroscopy, and x-ray crystallography, was used to unravel the basis for this perturbed Tyr pKa. The results suggest that the origin of large energetic perturbations are more complex than suggested by visual inspection. For example, the introduction of positively charged residues near Tyr57 raises its pKa rather than lowers it; this effect, and part of the increase in the Tyr pKa from introduction of nearby anionic groups arise from accompanying active site structural rearrangements. Other mutations with large effects also cause structural perturbations or appear to displace a structured water molecule that is part of a stabilizing hydrogen bond network. Our results lead to a model in which three hydrogen bonds are donated to the stabilized ionized Tyr, with these hydrogen bond donors, two Tyr side chains and a water molecule, positioned by other side chains and by a water-mediated hydrogen bond network. These results support the notion that large energetic effects are often the consequence of multiple stabilizing interactions, rather than a single dominant interaction. Most generally, this work provides a case study for how extensive and comprehensive comparisons via site-directed mutagenesis in a tight feedback loop with structural analysis can greatly facilitate our understanding of enzyme active site energetics. The extensive dataset provided may also be a valuable resource for those wishing to extensively test computational approaches for determining enzymatic pKa values and energetic effects. PMID:24151972

Emergence of Ebola Virus Escape Variants in Infected Nonhuman Primates Treated with the MB-003 Antibody Cocktail.

PubMed

Kugelman, Jeffrey R; Kugelman-Tonos, Johanny; Ladner, Jason T; Pettit, James; Keeton, Carolyn M; Nagle, Elyse R; Garcia, Karla Y; Froude, Jeffrey W; Kuehne, Ana I; Kuhn, Jens H; Bavari, Sina; Zeitlin, Larry; Dye, John M; Olinger, Gene G; Sanchez-Lockhart, Mariano; Palacios, Gustavo F

2015-09-29

MB-003, a plant-derived monoclonal antibody cocktail used effectively in treatment of Ebola virus infection in non-human primates, was unable to protect two of six animals when initiated 1 or 2 days post-infection. We characterized a mechanism of viral escape in one of the animals, after observation of two clusters of genomic mutations that resulted in five nonsynonymous mutations in the monoclonal antibody target sites. These mutations were linked to a reduction in antibody binding and later confirmed to be present in a viral isolate that was not neutralized in vitro. Retrospective evaluation of a second independent study allowed the identification of a similar case. Four SNPs in previously identified positions were found in this second fatality, suggesting that genetic drift could be a potential cause for treatment failure. These findings highlight the importance selecting different target domains for each component of the cocktail to minimize the potential for viral escape. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

R1 in the Shaker S4 occupies the gating charge transfer center in the resting state

PubMed Central

Lin, Meng-chin A.; Hsieh, Jui-Yi; Mock, Allan F.

2011-01-01

During voltage-dependent activation in Shaker channels, four arginine residues in the S4 segment (R1–R4) cross the transmembrane electric field. It has been proposed that R1–R4 movement is facilitated by a “gating charge transfer center” comprising a phenylalanine (F290) in S2 plus two acidic residues, one each in S2 and S3. According to this proposal, R1 occupies the charge transfer center in the resting state, defined as the conformation in which S4 is maximally retracted toward the cytoplasm. However, other evidence suggests that R1 is located extracellular to the charge transfer center, near I287 in S2, in the resting state. To investigate the resting position of R1, we mutated I287 to histidine (I287H), paired it with histidine mutations of key voltage sensor residues, and determined the effect of extracellular Zn2+ on channel activity. In I287H+R1H, Zn2+ generated a slow component of activation with a maximum amplitude (Aslow,max) of ∼56%, indicating that only a fraction of voltage sensors can bind Zn2+ at a holding potential of −80 mV. Aslow,max decreased after applying either depolarizing or hyperpolarizing prepulses from −80 mV. The decline of Aslow,max after negative prepulses indicates that R1 moves inward to abolish ion binding, going beyond the point where reorientation of the I287H and R1H side chains would reestablish a binding site. These data support the proposal that R1 occupies the charge transfer center upon hyperpolarization. Consistent with this, pairing I287H with A359H in the S3–S4 loop generated a Zn2+-binding site. At saturating concentrations, Aslow,max reached 100%, indicating that Zn2+ traps the I287H+A359H voltage sensor in an absorbing conformation. Transferring I287H+A359H into a mutant background that stabilizes the resting state significantly enhanced Zn2+ binding at −80 mV. Our results strongly support the conclusion that R1 occupies the gating charge transfer center in the resting conformation. PMID:21788609

Ground state destabilization from a positioned general base in the ketosteroid isomerase active site.

PubMed

Ruben, Eliza A; Schwans, Jason P; Sonnett, Matthew; Natarajan, Aditya; Gonzalez, Ana; Tsai, Yingssu; Herschlag, Daniel

2013-02-12

We compared the binding affinities of ground state analogues for bacterial ketosteroid isomerase (KSI) with a wild-type anionic Asp general base and with uncharged Asn and Ala in the general base position to provide a measure of potential ground state destabilization that could arise from the close juxtaposition of the anionic Asp and hydrophobic steroid in the reaction's Michaelis complex. The analogue binding affinity increased ~1 order of magnitude for the Asp38Asn mutation and ~2 orders of magnitude for the Asp38Ala mutation, relative to the affinity with Asp38, for KSI from two sources. The increased level of binding suggests that the abutment of a charged general base and a hydrophobic steroid is modestly destabilizing, relative to a standard state in water, and that this destabilization is relieved in the transition state and intermediate in which the charge on the general base has been neutralized because of proton abstraction. Stronger binding also arose from mutation of Pro39, the residue adjacent to the Asp general base, consistent with an ability of the Asp general base to now reorient to avoid the destabilizing interaction. Consistent with this model, the Pro mutants reduced or eliminated the increased level of binding upon replacement of Asp38 with Asn or Ala. These results, supported by additional structural observations, suggest that ground state destabilization from the negatively charged Asp38 general base provides a modest contribution to KSI catalysis. They also provide a clear illustration of the well-recognized concept that enzymes evolve for catalytic function and not, in general, to maximize ground state binding. This ground state destabilization mechanism may be common to the many enzymes with anionic side chains that deprotonate carbon acids.

Cancer Incidence in First- and Second-Degree Relatives of BRCA1 and BRCA2 Mutation Carriers.

PubMed

Streff, Haley; Profato, Jessica; Ye, Yuanqing; Nebgen, Denise; Peterson, Susan K; Singletary, Claire; Arun, Banu K; Litton, Jennifer K

2016-07-01

Mutations in the BRCA1 and BRCA2 genes are associated with increased risk of breast, ovarian, and several other cancers. The purpose of the present study was to evaluate the incidence of cancer in first- and second-degree relatives of BRCA mutation carriers compared with the general population. A total of 1,086 pedigrees of BRCA mutation carriers was obtained from a prospectively maintained, internal review board-approved study of persons referred for clinical genetic counseling at the University of Texas MD Anderson Cancer Center. We identified 9,032 first- and second-degree relatives from 784 pedigrees that had demonstrated a clear indication of parental origin of mutation. Standardized incidence ratios (SIRs) were used to compare the observed incidence of 20 primary cancer sites to the expected incidence of each cancer based on the calculated risk estimates according to each subject's age, sex, and ethnicity. BRCA1 families had increased SIRs for breast and ovarian cancer (p < .001) and decreased SIRs for kidney, lung, prostate, and thyroid cancer and non-Hodgkin's lymphoma (p < .001). BRCA2 families had increased SIRs for breast, ovarian, and pancreatic cancer (p < .001) and decreased SIRs for kidney, lung, thyroid, and uterine cancer and non-Hodgkin's lymphoma (p < .0025). Analysis of only first-degree relatives (n = 4,099) identified no decreased SIRs and agreed with the increased SIRs observed in the overall study population. We have confirmed previous reports of an association between breast, ovarian, and pancreatic cancers with BRCA mutations. Additional research to quantify the relative risks of these cancers for BRCA mutation carriers can help tailor recommendations for risk reduction and enhance genetic counseling. BRCA gene mutations have been well described to carry an increased risk of both breast and ovarian cancer. However, the implications and risks of other cancers continues to be investigated. Evaluating the risks for other cancers further is key in identifying and managing risk reduction strategies. ©AlphaMed Press.

Lysine and the Na+/K+ Selectivity in Mammalian Voltage-Gated Sodium Channels.

PubMed

Li, Yang; Liu, Huihui; Xia, Mengdie; Gong, Haipeng

2016-01-01

Voltage-gated sodium (Nav) channels are critical in the generation and transmission of neuronal signals in mammals. The crystal structures of several prokaryotic Nav channels determined in recent years inspire the mechanistic studies on their selection upon the permeable cations (especially between Na+ and K+ ions), a property that is proposed to be mainly determined by residues in the selectivity filter. However, the mechanism of cation selection in mammalian Nav channels lacks direct explanation at atomic level due to the difference in amino acid sequences between mammalian and prokaryotic Nav homologues, especially at the constriction site where the DEKA motif has been identified to determine the Na+/K+ selectivity in mammalian Nav channels but is completely absent in the prokaryotic counterparts. Among the DEKA residues, Lys is of the most importance since its mutation to Arg abolishes the Na+/K+ selectivity. In this work, we modeled the pore domain of mammalian Nav channels by mutating the four residues at the constriction site of a prokaryotic Nav channel (NavRh) to DEKA, and then mechanistically investigated the contribution of Lys in cation selection using molecular dynamics simulations. The DERA mutant was generated as a comparison to understand the loss of ion selectivity caused by the K-to-R mutation. Simulations and free energy calculations on the mutants indicate that Lys facilitates Na+/K+ selection by electrostatically repelling the cation to a highly Na+-selective location sandwiched by the carboxylate groups of Asp and Glu at the constriction site. In contrast, the electrostatic repulsion is substantially weakened when Lys is mutated to Arg, because of two intrinsic properties of the Arg side chain: the planar geometric design and the sparse charge distribution of the guanidine group.

Proven germline mosaicism in a father of two children with CHARGE syndrome.

PubMed

Pauli, S; Pieper, L; Häberle, J; Grzmil, P; Burfeind, P; Steckel, M; Lenz, U; Michelmann, H W

2009-05-01

CHARGE syndrome is an autosomal dominant malformation syndrome caused by mutations in the CHD7 gene. The majority of cases are sporadic and only few familial cases have been reported. In these families, mosaicism in one parent, as well as parent- to-child transmission of a CHD7 mutation, has been described. In some further cases, germline mosaicism has been suggested. Here, we report the first case in which germline mosaicism could be demonstrated in a father of two affected children with CHARGE syndrome. The truncating mutation c.7302dupA in exon 34 of the CHD7 gene was found in both affected children but was not detected in parental lymphocytes. However, in DNA extracted from the father's spermatozoa, the c.7302dupA mutation could be identified. Furthermore, mutation analysis of DNA isolated from 59 single spermatozoa revealed that the c.7302dupA mutation occurs in 16 spermatozoa, confirming germline mosaicism in the father of the affected children. This result has a high impact for genetic counselling of the family and for their recurrence risk in further pregnancies.

The clustered regularly interspaced short palindromic repeats/associated proteins system for the induction of gene mutations and phenotypic changes in Bombyx mori.

PubMed

Song, Jia; Che, Jiaqian; You, Zhengying; Ye, Xiaogang; Li, Jisheng; Ye, Lupeng; Zhang, Yuyu; Qian, Qiujie; Zhong, Boxiong

2016-12-01

To probe the general phenomena of gene mutations, Bombyx mori, the lepidopterous model organism, was chosen as the experimental model. To easily detect phenotypic variations, the piggyBac system was utilized to introduce two marker genes into the silkworm, and 23.4% transposition efficiency aided in easily breeding a new strain for the entire experiment. Then, the clustered regularly interspaced short palindromic repeats/an associated protein (Cas9) system was utilized. The results showed that the Cas9 system can induce efficient gene mutations and the base changes could be detected since the G 0 individuals in B. mori; and that the mutation rates on different target sites were diverse. Next, the gRNA2-targeted site that generated higher mutation rate was chosen, and the experimental results were enumerated. First, the mutation proportion in G 1 generation was 30.1%, and some gene mutations were not inherited from the G 0 generation; second, occasionally, base substitutions did not lead to variation in the amino-acid sequence, which decreased the efficiency of phenotypic changes compared with that of genotypic changes. These results laid the foundation for better use of the Cas9 system in silkworm gene editing. © The Author 2016. Published by Oxford University Press on behalf of the Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Omega-oxidation impairs oxidizability of polyenoic fatty acids by 15-lipoxygenases: consequences for substrate orientation at the active site.

PubMed Central

Ivanov, I; Schwarz, K; Holzhütter, H G; Myagkova, G; Kühn, H

1998-01-01

During oxygenation by 15-lipoxygenases, polyenoic fatty acids are bound at the active site in such a way that the omega-terminus of the fatty acids penetrates into the substrate binding pocket. In contrast, for arachidonic acid 5-lipoxygenation, an inverse head to tail orientation has been suggested. However, an inverse orientation may be hindered by the large energy barrier associated with burying the charged carboxylate group in the hydrophobic environment of the substrate binding cleft. We studied the oxygenation kinetics of omega-modified fatty acids by 15-lipoxygenases and found that omega-hydroxylation strongly impaired substrate affinity (higher Km), but only moderately altered Vmax. In contrast, omega-carboxylation completely prevented the lipoxygenase reaction; however, methylation of the additional carboxylate group restored the activity. Arg403 of the human 15-lipoxygenase has been implicated in fatty acid binding by forming a salt bridge with the carboxylate group, and thus mutation of this amino acid to an uncharged residue was supposed to favour an inverse substrate orientation. The prepared Arg403-->Leu mutant of the rabbit 15-lipoxygenase was found to be a less effective catalyst of linoleic acid oxygenation. However, the oxygenation rate of omega-hydroxyarachidonic acid was similar when the wild-type and mutant enzyme were compared, and the patterns of oxygenation products were identical for both enzyme species. These data suggest that introduction of a polar, or even charged residue, at the omega-terminus of substrate fatty acids in connection with mutation of Arg403 may not alter substrate alignment at the active site of 15-lipoxygenases. PMID:9820810

Identification of a Novel EF-Loop in the N-terminus of TRPM2 Channel Involved in Calcium Sensitivity

PubMed Central

Luo, Yuhuan; Yu, Xiafei; Ma, Cheng; Luo, Jianhong; Yang, Wei

2018-01-01

As an oxidative stress sensor, transient receptor potential melastatin 2 (TRPM2) channel is involved in many physiological and pathological processes including warmth sensing, ischemia injury, inflammatory diseases and diabetes. Intracellular calcium is critical for TRPM2 channel activation and the IQ-like motif in the N-terminus has been shown to be important by mediating calmodulin binding. Sequence analysis predicted two potential EF-loops in the N-terminus of TRPM2. Site-directed mutagenesis combining with functional assay showed that substitution with alanine of several residues, most of which are conserved in the typical EF-loop, including D267, D278, D288, and E298 dramatically reduced TRPM2 channel currents. By further changing the charges or side chain length of these conserved residues, our results indicate that the negative charge of D267 and the side chain length of D278 are critical for calcium-induced TRPM2 channel activation. G272I mutation also dramatically reduced the channel currents, suggesting that this site is critical for calcium-induced TRPM2 channel activation. Furthermore, D267A mutant dramatically reduced the currents induced by calcium alone compared with that by ADPR, indicating that D267 residue in D267–D278 motif is the most important site for calcium sensitivity of TRPM2. In addition, inside-out recordings showed that mutations at D267, G272, D278, and E298 had no effect on single-channel conductance. Taken together, our data indicate that D267–D278 motif in the N-terminus as a novel EF-loop is critical for calcium-induced TRPM2 channel activation.

Quantification of the transferability of a designed protein specificity switch reveals extensive epistasis in molecular recognition

DOE PAGES

Melero, Cristina; Ollikainen, Noah; Harwood, Ian; ...

2014-10-13

Re-engineering protein–protein recognition is an important route to dissecting and controlling complex interaction networks. Experimental approaches have used the strategy of “second-site suppressors,” where a functional interaction is inferred between two proteins if a mutation in one protein can be compensated by a mutation in the second. Mimicking this strategy, computational design has been applied successfully to change protein recognition specificity by predicting such sets of compensatory mutations in protein–protein interfaces. To extend this approach, it would be advantageous to be able to “transplant” existing engineered and experimentally validated specificity changes to other homologous protein–protein complexes. Here, we test thismore » strategy by designing a pair of mutations that modulates peptide recognition specificity in the Syntrophin PDZ domain, confirming the designed interaction biochemically and structurally, and then transplanting the mutations into the context of five related PDZ domain–peptide complexes. We find a wide range of energetic effects of identical mutations in structurally similar positions, revealing a dramatic context dependence (epistasis) of designed mutations in homologous protein–protein interactions. To better understand the structural basis of this context dependence, we apply a structure-based computational model that recapitulates these energetic effects and we use this model to make and validate forward predictions. The context dependence of these mutations is captured by computational predictions, our results both highlight the considerable difficulties in designing protein–protein interactions and provide challenging benchmark cases for the development of improved protein modeling and design methods that accurately account for the context.« less

Quantification of the transferability of a designed protein specificity switch reveals extensive epistasis in molecular recognition

DOE Office of Scientific and Technical Information (OSTI.GOV)

Melero, Cristina; Ollikainen, Noah; Harwood, Ian

Re-engineering protein–protein recognition is an important route to dissecting and controlling complex interaction networks. Experimental approaches have used the strategy of “second-site suppressors,” where a functional interaction is inferred between two proteins if a mutation in one protein can be compensated by a mutation in the second. Mimicking this strategy, computational design has been applied successfully to change protein recognition specificity by predicting such sets of compensatory mutations in protein–protein interfaces. To extend this approach, it would be advantageous to be able to “transplant” existing engineered and experimentally validated specificity changes to other homologous protein–protein complexes. Here, we test thismore » strategy by designing a pair of mutations that modulates peptide recognition specificity in the Syntrophin PDZ domain, confirming the designed interaction biochemically and structurally, and then transplanting the mutations into the context of five related PDZ domain–peptide complexes. We find a wide range of energetic effects of identical mutations in structurally similar positions, revealing a dramatic context dependence (epistasis) of designed mutations in homologous protein–protein interactions. To better understand the structural basis of this context dependence, we apply a structure-based computational model that recapitulates these energetic effects and we use this model to make and validate forward predictions. The context dependence of these mutations is captured by computational predictions, our results both highlight the considerable difficulties in designing protein–protein interactions and provide challenging benchmark cases for the development of improved protein modeling and design methods that accurately account for the context.« less

Site directed recombination

DOEpatents

Jurka, Jerzy W.

1997-01-01

Enhanced homologous recombination is obtained by employing a consensus sequence which has been found to be associated with integration of repeat sequences, such as Alu and ID. The consensus sequence or sequence having a single transition mutation determines one site of a double break which allows for high efficiency of integration at the site. By introducing single or double stranded DNA having the consensus sequence flanking region joined to a sequence of interest, one can reproducibly direct integration of the sequence of interest at one or a limited number of sites. In this way, specific sites can be identified and homologous recombination achieved at the site by employing a second flanking sequence associated with a sequence proximal to the 3'-nick.

Extended Minus-Strand DNA as Template for R-U5-Mediated Second-Strand Transfer in Recombinational Rescue of Primer Binding Site-Modified Retroviral Vectors

PubMed Central

Mikkelsen, Jacob Giehm; Lund, Anders H.; Dybkær, Karen; Duch, Mogens; Pedersen, Finn Skou

1998-01-01

We have previously demonstrated recombinational rescue of primer binding site (PBS)-impaired Akv murine leukemia virus-based vectors involving initial priming on endogenous viral sequences and template switching during cDNA synthesis to obtain PBS complementarity in second-strand transfer of reverse transcription (Mikkelsen et al., J. Virol. 70:1439–1447, 1996). By use of the same forced recombination system, we have now found recombinant proviruses of different structures, suggesting that PBS knockout vectors may be rescued through initial priming on endogenous virus RNA, read-through of the mutated PBS during minus-strand synthesis, and subsequent second-strand transfer mediated by the R-U5 complementarity of the plus strand and the extended minus-strand DNA acceptor template. Mechanisms for R-U5-mediated second-strand transfer and its possible role in retrovirus replication and evolution are discussed. PMID:9499117

The effect of charge-introduction mutations on E. coli thioredoxin stability.

PubMed

Perez-Jimenez, Raul; Godoy-Ruiz, Raquel; Ibarra-Molero, Beatriz; Sanchez-Ruiz, Jose M

2005-04-01

Technological applications of proteins are often hampered by their low-stability and, consequently, the development of procedures for protein stabilization is of considerable biotechnological interest. Here, we use simple electrostatics to determine positions in E. coli thioredoxin at which mutations that introduce new charged residues are expected to lead to stability enhancement. We also obtain the corresponding mutants and characterize their stability using differential scanning calorimetry. The results are interpreted in terms of the accessibility in the native structure of the mutated residues and the potential effect of the mutations on the residual structure of the denatured state.

Alteration of the Regiospecificity of Human Heme Oxygenase-1 by Unseating of the Heme but not Disruption of the Distal Hydrogen Bonding Network†

PubMed Central

Wang, Jinling; Evans, John P.; Ogura, Hiroshi; La Mar, Gerd N.; Ortiz de Montellano, Paul R.

2008-01-01

Heme oxygenase regiospecifically oxidizes heme at the α-meso position to give biliverdin IXα, CO, and iron. The heme orientation within the active site, which is thought to determine the oxidation regiospecificity, is shown here for the human enzyme (hHO1) to be largely determined by interactions between the heme carboxylic acid groups and residues Arg183 and Lys18 but not Tyr134. Mutation of either Arg183 or Lys18 individually does not significantly alter the NADPH-cytochrome P450 reductase-dependent reaction regiochemistry, but partially shifts the oxidation to the β/δ-meso positions in the reaction supported by ascorbic acid. Mutation of Glu29 to a lysine, which places a positive charge where it can interact with a heme carboxyl if the heme rotates by ~90°, causes a slight loss of regiospecificity, but combined with the R183E and K18E mutations results primarily in β/δ-meso oxidation of the heme under all conditions. NMR analysis of heme binding to the triple K18E/E29K/R183E mutant confirms rotation of the heme in the active site. Kinetic studies demonstrate that mutations of Arg183 greatly impair the rate of the P450 reductase-dependent reaction, in accord with the earlier finding that Arg183 is involved in binding of the reductase to hHO1, but have little effect on the ascorbate reaction. Mutations of Asp140 and Tyr58 that disrupt the active site hydrogen bonding network, impair catalytic rates but do not influence the oxidation regiochemistry. The results indicate both that the oxidation regiochemistry is largely controlled by ionic interactions of the heme propionic acid groups with the protein and that shifts in regiospecificity involve rotation of the heme about an axis perpendicular to the heme plane. PMID:16388581

Genetics of Type III Bartter Syndrome in Spain, Proposed Diagnostic Algorithm

PubMed Central

García Castaño, Alejandro; Pérez de Nanclares, Gustavo; Madariaga, Leire; Aguirre, Mireia; Madrid, Alvaro; Nadal, Inmaculada; Navarro, Mercedes; Lucas, Elena; Fijo, Julia; Espino, Mar; Espitaletta, Zilac; Castaño, Luis; Ariceta, Gema

2013-01-01

The p.Ala204Thr mutation (exon 7) of the CLCNKB gene is a "founder" mutation that causes most of type III Bartter syndrome cases in Spain. We performed genetic analysis of the CLCNKB gene, which encodes for the chloride channel protein ClC-Kb, in a cohort of 26 affected patients from 23 families. The diagnostic algorithm was: first, detection of the p.Ala204Thr mutation; second, detecting large deletions or duplications by Multiplex Ligation-dependent Probe Amplification and Quantitative Multiplex PCR of Short Fluorescent Fragments; and third, sequencing of the coding and flanking regions of the whole CLCNKB gene. In our genetic diagnosis, 20 families presented with the p.Ala204Thr mutation. Of those, 15 patients (15 families) were homozygous (57.7% of overall patients). Another 8 patients (5 families) were compound heterozygous for the founder mutation together with a second one. Thus, 3 patients (2 siblings) presented with the c. -19-?_2053+? del deletion (comprising the entire gene); one patient carried the p.Val170Met mutation (exon 6); and 4 patients (3 siblings) presented with the novel p.Glu442Gly mutation (exon 14). On the other hand, another two patients carried two novel mutations in compound heterozygosis: one presented the p.Ile398_Thr401del mutation (exon 12) associated with the c. -19-?_2053+? del deletion, and the other one carried the c.1756+1G>A splice-site mutation (exon 16) as well as the already described p.Ala210Val change (exon 7). One case turned out to be negative in our genetic screening. In addition, 51 relatives were found to be heterozygous carriers of the described CLCNKB mutations. In conclusion, different mutations cause type III Bartter syndrome in Spain. The high prevalence of the p.Ala204Thr in Spanish families thus justifies an initial screen for this mutation. However, should it not be detected further investigation of the CLCNKB gene is warranted in clinically diagnosed families. PMID:24058621

Genetics of type III Bartter syndrome in Spain, proposed diagnostic algorithm.

PubMed

García Castaño, Alejandro; Pérez de Nanclares, Gustavo; Madariaga, Leire; Aguirre, Mireia; Madrid, Alvaro; Nadal, Inmaculada; Navarro, Mercedes; Lucas, Elena; Fijo, Julia; Espino, Mar; Espitaletta, Zilac; Castaño, Luis; Ariceta, Gema

2013-01-01

The p.Ala204Thr mutation (exon 7) of the CLCNKB gene is a "founder" mutation that causes most of type III Bartter syndrome cases in Spain. We performed genetic analysis of the CLCNKB gene, which encodes for the chloride channel protein ClC-Kb, in a cohort of 26 affected patients from 23 families. The diagnostic algorithm was: first, detection of the p.Ala204Thr mutation; second, detecting large deletions or duplications by Multiplex Ligation-dependent Probe Amplification and Quantitative Multiplex PCR of Short Fluorescent Fragments; and third, sequencing of the coding and flanking regions of the whole CLCNKB gene. In our genetic diagnosis, 20 families presented with the p.Ala204Thr mutation. Of those, 15 patients (15 families) were homozygous (57.7% of overall patients). Another 8 patients (5 families) were compound heterozygous for the founder mutation together with a second one. Thus, 3 patients (2 siblings) presented with the c. -19-?_2053+? del deletion (comprising the entire gene); one patient carried the p.Val170Met mutation (exon 6); and 4 patients (3 siblings) presented with the novel p.Glu442Gly mutation (exon 14). On the other hand, another two patients carried two novel mutations in compound heterozygosis: one presented the p.Ile398_Thr401del mutation (exon 12) associated with the c. -19-?_2053+? del deletion, and the other one carried the c.1756+1G>A splice-site mutation (exon 16) as well as the already described p.Ala210Val change (exon 7). One case turned out to be negative in our genetic screening. In addition, 51 relatives were found to be heterozygous carriers of the described CLCNKB mutations. In conclusion, different mutations cause type III Bartter syndrome in Spain. The high prevalence of the p.Ala204Thr in Spanish families thus justifies an initial screen for this mutation. However, should it not be detected further investigation of the CLCNKB gene is warranted in clinically diagnosed families.

Systems, methods and computer readable media for estimating capacity loss in rechargeable electrochemical cells

DOEpatents

Gering, Kevin L.

2013-06-18

A system includes an electrochemical cell, monitoring hardware, and a computing system. The monitoring hardware periodically samples charge characteristics of the electrochemical cell. The computing system periodically determines cell information from the charge characteristics of the electrochemical cell. The computing system also periodically adds a first degradation characteristic from the cell information to a first sigmoid expression, periodically adds a second degradation characteristic from the cell information to a second sigmoid expression and combines the first sigmoid expression and the second sigmoid expression to develop or augment a multiple sigmoid model (MSM) of the electrochemical cell. The MSM may be used to estimate a capacity loss of the electrochemical cell at a desired point in time and analyze other characteristics of the electrochemical cell. The first and second degradation characteristics may be loss of active host sites and loss of free lithium for Li-ion cells.

Strong Enrichment of Aromatic Residues in Binding Sites from a Charge-neutralized Hyperthermostable Sso7d Scaffold Library.

PubMed

Traxlmayr, Michael W; Kiefer, Jonathan D; Srinivas, Raja R; Lobner, Elisabeth; Tisdale, Alison W; Mehta, Naveen K; Yang, Nicole J; Tidor, Bruce; Wittrup, K Dane

2016-10-21

The Sso7d protein from the hyperthermophilic archaeon Sulfolobus solfataricus is an attractive binding scaffold because of its small size (7 kDa), high thermal stability (T m of 98 °C), and absence of cysteines and glycosylation sites. However, as a DNA-binding protein, Sso7d is highly positively charged, introducing a strong specificity constraint for binding epitopes and leading to nonspecific interaction with mammalian cell membranes. In the present study, we report charge-neutralized variants of Sso7d that maintain high thermal stability. Yeast-displayed libraries that were based on this reduced charge Sso7d (rcSso7d) scaffold yielded binders with low nanomolar affinities against mouse serum albumin and several epitopes on human epidermal growth factor receptor. Importantly, starting from a charge-neutralized scaffold facilitated evolutionary adaptation of binders to differentially charged epitopes on mouse serum albumin and human epidermal growth factor receptor, respectively. Interestingly, the distribution of amino acids in the small and rigid binding surface of enriched rcSso7d-based binders is very different from that generally found in more flexible antibody complementarity-determining region loops but resembles the composition of antibody-binding energetic hot spots. Particularly striking was a strong enrichment of the aromatic residues Trp, Tyr, and Phe in rcSso7d-based binders. This suggests that the rigidity and small size of this scaffold determines the unusual amino acid composition of its binding sites, mimicking the energetic core of antibody paratopes. Despite the high frequency of aromatic residues, these rcSso7d-based binders are highly expressed, thermostable, and monomeric, suggesting that the hyperstability of the starting scaffold and the rigidness of the binding surface confer a high tolerance to mutation. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

Crystal Structures of Penicillin-Binding Protein 2 From Penicillin-Susceptible And -Resistant Strains of Neisseria Gonorrhoeae Reveal An Unexpectedly Subtle Mechanism for Antibiotic Resistance

DOE Office of Scientific and Technical Information (OSTI.GOV)

Powell, A.J.; Tomberg, J.; Deacon, A.M.

Penicillin-binding protein 2 (PBP2) from N. gonorrhoeae is the major molecular target for {beta}-lactam antibiotics used to treat gonococcal infections. PBP2 from penicillin-resistant strains of N. gonorrhoeae harbors an aspartate insertion after position 345 (Asp-345a) and 4-8 additional mutations, but how these alter the architecture of the protein is unknown. We have determined the crystal structure of PBP2 derived from the penicillin-susceptible strain FA19, which shows that the likely effect of Asp-345a is to alter a hydrogen-bonding network involving Asp-346 and the SXN triad at the active site. We have also solved the crystal structure of PBP2 derived from themore » penicillin-resistant strain FA6140 that contains four mutations near the C terminus of the protein. Although these mutations lower the second order rate of acylation for penicillin by 5-fold relative to wild type, comparison of the two structures shows only minor structural differences, with the positions of the conserved residues in the active site essentially the same in both. Kinetic analyses indicate that two mutations, P551S and F504L, are mainly responsible for the decrease in acylation rate. Melting curves show that the four mutations lower the thermal stability of the enzyme. Overall, these data suggest that the molecular mechanism underlying antibiotic resistance contributed by the four mutations is subtle and involves a small but measurable disordering of residues in the active site region that either restricts the binding of antibiotic or impedes conformational changes that are required for acylation by {beta}-lactam antibiotics.« less

An alternative derivation of the stationary distribution of the multivariate neutral Wright-Fisher model for low mutation rates with a view to mutation rate estimation from site frequency data.

PubMed

Schrempf, Dominik; Hobolth, Asger

2017-04-01

Recently, Burden and Tang (2016) provided an analytical expression for the stationary distribution of the multivariate neutral Wright-Fisher model with low mutation rates. In this paper we present a simple, alternative derivation that illustrates the approximation. Our proof is based on the discrete multivariate boundary mutation model which has three key ingredients. First, the decoupled Moran model is used to describe genetic drift. Second, low mutation rates are assumed by limiting mutations to monomorphic states. Third, the mutation rate matrix is separated into a time-reversible part and a flux part, as suggested by Burden and Tang (2016). An application of our result to data from several great apes reveals that the assumption of stationarity may be inadequate or that other evolutionary forces like selection or biased gene conversion are acting. Furthermore we find that the model with a reversible mutation rate matrix provides a reasonably good fit to the data compared to the one with a non-reversible mutation rate matrix. Copyright © 2016 The Author(s). Published by Elsevier Inc. All rights reserved.

Role for cis-acting RNA sequences in the temperature-dependent expression of the multiadhesive lig proteins in Leptospira interrogans.

PubMed

Matsunaga, James; Schlax, Paula J; Haake, David A

2013-11-01

The spirochete Leptospira interrogans causes a systemic infection that provokes a febrile illness. The putative lipoproteins LigA and LigB promote adhesion of Leptospira to host proteins, interfere with coagulation, and capture complement regulators. In this study, we demonstrate that the expression level of the LigA and LigB proteins was substantially higher when L. interrogans proliferated at 37°C instead of the standard culture temperature of 30°C. The RNA comprising the 175-nucleotide 5' untranslated region (UTR) and first six lig codons, whose sequence is identical in ligA and ligB, is predicted to fold into two distinct stem-loop structures separated by a single-stranded region. The ribosome-binding site is partially sequestered in double-stranded RNA within the second structure. Toeprint analysis revealed that in vitro formation of a 30S-tRNA(fMet)-mRNA ternary complex was inhibited unless a 5' deletion mutation disrupted the second stem-loop structure. To determine whether the lig sequence could mediate temperature-regulated gene expression in vivo, the 5' UTR and the first six codons were inserted between the Escherichia coli l-arabinose promoter and bgaB (β-galactosidase from Bacillus stearothermophilus) to create a translational fusion. The lig fragment successfully conferred thermoregulation upon the β-galactosidase reporter in E. coli. The second stem-loop structure was sufficient to confer thermoregulation on the reporter, while sequences further upstream in the 5' UTR slightly diminished expression at each temperature tested. Finally, the expression level of β-galactosidase was significantly higher when point mutations predicted to disrupt base pairs in the second structure were introduced into the stem. Compensatory mutations that maintained base pairing of the stem without restoring the wild-type sequence reinstated the inhibitory effect of the 5' UTR on expression. These results indicate that ligA and ligB expression is limited by double-stranded RNA that occludes the ribosome-binding site. At elevated temperatures, the ribosome-binding site is exposed to promote translation initiation.

Mutations participating in interallelic complementation in propionic acidemia

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gravel, R.A.; Akerman, B.R.; Lamhonwah, A.M.

1994-07-01

Deficiency of propionyl-CoA carboxylase (PCC; [alpha][sub 4][beta][sub 4]) results in the rare, autosomal recessive disease propionic acidemia. Cell fusion experiments have revealed two complementation groups, pccA and pccB, corresponding to defects of the PCCA ([alpha]-subunit) and PCCB ([beta]-subunit) genes, respectively. The pccBCC group includes subgroups, pccB and pccC, which are thought to reflect interallelic complementation between certain mutations of the PCCB gene. In this study, the authors have identified the mutations in two pccB, one pccC, and two pccBC cell lines and have deduced those alleles participating in interallelic complementation. One pccB line was a compound hetrozygote of Pro228Leu andmore » Asn536Asp. The latter mutation was also detected in a noncomplementing pccBC line. This leaves Pro228Leu responsible for complementation in the pccB cells. The second pccB line contained an insertional duplication, dupKICK140-143, and a splice mutation IVS+1 G[yields]T, located after Lys466. The authors suggest that the dupKICK mutation is the complementing allele, since the second allele is incompatible with normal splicing. The pccC line studied was homozygous for Arg410Trp, which is necessarily the complementing allele in that line. For a second pccC line, they previously had proposed that [Delta]Ile408 was the complementing allele. They now show that its second allele, [open quotes]Ins[center dot]Del[close quotes], a 14-bp deletion replaced by a 12-bp insertion beginning at codon 407, fails to complement in homozygous form. The authors conclude that the interallelic complementation results from mutations in domains that can interact between [beta]-subunits in the PCC heteromer to restore enzymatic function. On the basis of sequence homology with the Propionibacterium shermanii transcarboxylase 12S subunit, they suggest that the pccC domain, defined by Ile408 and Arg410, may involve the propionyl-CoA binding site. 37 refs., 5 figs., 2 tabs.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lewis, Hal A.; Zhao, Xun; Wang, Chi

Cystic fibrosis is caused by defects in the cystic fibrosis transmembrane conductance regulator (CFTR), commonly the deletion of residue Phe-508 (DeltaF508) in the first nucleotide-binding domain (NBD1), which results in a severe reduction in the population of functional channels at the epithelial cell surface. Previous studies employing incomplete NBD1 domains have attributed this to aberrant folding of DeltaF508 NBD1. We report structural and biophysical studies on complete human NBD1 domains, which fail to demonstrate significant changes of in vitro stability or folding kinetics in the presence or absence of the DeltaF508 mutation. Crystal structures show minimal changes in protein conformationmore » but substantial changes in local surface topography at the site of the mutation, which is located in the region of NBD1 believed to interact with the first membrane spanning domain of CFTR. These results raise the possibility that the primary effect of DeltaF508 is a disruption of proper interdomain interactions at this site in CFTR rather than interference with the folding of NBD1. Interestingly, increases in the stability of NBD1 constructs are observed upon introduction of second-site mutations that suppress the trafficking defect caused by the DeltaF508 mutation, suggesting that these suppressors might function indirectly by improving the folding efficiency of NBD1 in the context of the full-length protein. The human NBD1 structures also solidify the understanding of CFTR regulation by showing that its two protein segments that can be phosphorylated both adopt multiple conformations that modulate access to the ATPase active site and functional interdomain interfaces.« less

Identification of a Second Substrate-binding Site in Solute-Sodium Symporters*

PubMed Central

Li, Zheng; Lee, Ashley S. E.; Bracher, Susanne; Jung, Heinrich; Paz, Aviv; Kumar, Jay P.; Abramson, Jeff; Quick, Matthias; Shi, Lei

2015-01-01

The structure of the sodium/galactose transporter (vSGLT), a solute-sodium symporter (SSS) from Vibrio parahaemolyticus, shares a common structural fold with LeuT of the neurotransmitter-sodium symporter family. Structural alignments between LeuT and vSGLT reveal that the crystallographically identified galactose-binding site in vSGLT is located in a more extracellular location relative to the central substrate-binding site (S1) in LeuT. Our computational analyses suggest the existence of an additional galactose-binding site in vSGLT that aligns to the S1 site of LeuT. Radiolabeled galactose saturation binding experiments indicate that, like LeuT, vSGLT can simultaneously bind two substrate molecules under equilibrium conditions. Mutating key residues in the individual substrate-binding sites reduced the molar substrate-to-protein binding stoichiometry to ∼1. In addition, the related and more experimentally tractable SSS member PutP (the Na+/proline transporter) also exhibits a binding stoichiometry of 2. Targeting residues in the proposed sites with mutations results in the reduction of the binding stoichiometry and is accompanied by severely impaired translocation of proline. Our data suggest that substrate transport by SSS members requires both substrate-binding sites, thereby implying that SSSs and neurotransmitter-sodium symporters share common mechanistic elements in substrate transport. PMID:25398883

Evidence of a potential receptor-binding site on the Nipah virus G protein (NiV-G): identification of globular head residues with a role in fusion promotion and their localization on an NiV-G structural model.

PubMed

Guillaume, Vanessa; Aslan, Hamide; Ainouze, Michelle; Guerbois, Mathilde; Wild, T Fabian; Buckland, Robin; Langedijk, Johannes P M

2006-08-01

As a preliminary to the localization of the receptor-binding site(s) on the Nipah virus (NiV) glycoprotein (NiV-G), we have undertaken the identification of NiV-G residues that play a role in fusion promotion. To achieve this, we have used two strategies. First, as NiV and Hendra virus (HeV) share a common receptor and their cellular tropism is similar, we hypothesized that residues functioning in receptor attachment could be conserved between their respective G proteins. Our initial strategy was to target charged residues (which can be expected to be at the surface of the protein) conserved between the NiV-G and HeV-G globular heads. Second, we generated NiV variants that escaped neutralization by anti-NiV-G monoclonal antibodies (MAbs) that neutralize NiV both in vitro and in vivo, likely by blocking receptor attachment. The sequencing of such "escape mutants" identified NiV-G residues present in the epitopes to which the neutralizing MAbs are directed. Residues identified via these two strategies whose mutation had an effect on fusion promotion were localized on a new structural model for the NiV-G protein. Our results suggest that seven NiV-G residues, including one (E533) that was identified using both strategies, form a contiguous site on the top of the globular head that is implicated in ephrinB2 binding. This site commences near the shallow depression in the center of the top surface of the globular head and extends to the rim of the barrel-like structure on the top loops of beta-sheet 5. The topology of this site is strikingly similar to that proposed to form the SLAM receptor site on another paramyxovirus attachment protein, that of the measles virus hemagglutinin.

Evidence of a Potential Receptor-Binding Site on the Nipah Virus G Protein (NiV-G): Identification of Globular Head Residues with a Role in Fusion Promotion and Their Localization on an NiV-G Structural Model

PubMed Central

Guillaume, Vanessa; Aslan, Hamide; Ainouze, Michelle; Guerbois, Mathilde; Fabian Wild, T.; Buckland, Robin; Langedijk, Johannes P. M.

2006-01-01

As a preliminary to the localization of the receptor-binding site(s) on the Nipah virus (NiV) glycoprotein (NiV-G), we have undertaken the identification of NiV-G residues that play a role in fusion promotion. To achieve this, we have used two strategies. First, as NiV and Hendra virus (HeV) share a common receptor and their cellular tropism is similar, we hypothesized that residues functioning in receptor attachment could be conserved between their respective G proteins. Our initial strategy was to target charged residues (which can be expected to be at the surface of the protein) conserved between the NiV-G and HeV-G globular heads. Second, we generated NiV variants that escaped neutralization by anti-NiV-G monoclonal antibodies (MAbs) that neutralize NiV both in vitro and in vivo, likely by blocking receptor attachment. The sequencing of such “escape mutants” identified NiV-G residues present in the epitopes to which the neutralizing MAbs are directed. Residues identified via these two strategies whose mutation had an effect on fusion promotion were localized on a new structural model for the NiV-G protein. Our results suggest that seven NiV-G residues, including one (E533) that was identified using both strategies, form a contiguous site on the top of the globular head that is implicated in ephrinB2 binding. This site commences near the shallow depression in the center of the top surface of the globular head and extends to the rim of the barrel-like structure on the top loops of β-sheet 5. The topology of this site is strikingly similar to that proposed to form the SLAM receptor site on another paramyxovirus attachment protein, that of the measles virus hemagglutinin. PMID:16840334

Mechanism of Flavoprotein l-6-Hydroxynicotine Oxidase: pH and Solvent Isotope Effects and Identification of Key Active Site Residues.

PubMed

Fitzpatrick, Paul F; Chadegani, Fatemeh; Zhang, Shengnan; Dougherty, Vi

2017-02-14

The flavoenzyme l-6-hydroxynicotine oxidase is a member of the monoamine oxidase family that catalyzes the oxidation of (S)-6-hydroxynicotine to 6-hydroxypseudooxynicotine during microbial catabolism of nicotine. While the enzyme has long been understood to catalyze oxidation of the carbon-carbon bond, it has recently been shown to catalyze oxidation of a carbon-nitrogen bond [Fitzpatrick, P. F., et al. (2016) Biochemistry 55, 697-703]. The effects of pH and mutagenesis of active site residues have now been utilized to study the mechanism and roles of active site residues. Asn166 and Tyr311 bind the substrate, while Lys287 forms a water-mediated hydrogen bond with flavin N5. The N166A and Y311F mutations result in ∼30- and ∼4-fold decreases in k cat /K m and k red for (S)-6-hydroxynicotine, respectively, with larger effects on the k cat /K m value for (S)-6-hydroxynornicotine. The K287M mutation results in ∼10-fold decreases in these parameters and a 6000-fold decrease in the k cat /K m value for oxygen. The shapes of the pH profiles are not altered by the N166A and Y311F mutations. There is no solvent isotope effect on the k cat /K m value for amines. The results are consistent with a model in which both the charged and neutral forms of the amine can bind, with the former rapidly losing a proton to a hydrogen bond network of water and amino acids in the active site prior to the transfer of hydride to the flavin.

Molecular Dynamics Simulations of Family 7 Cellobiohydrolase Mutants Aimed at Reducing Product Inhibition.

PubMed

Silveira, Rodrigo L; Skaf, Munir S

2015-07-23

Enzymatic conversion of lignocellulosic biomass into biofuels and chemicals constitutes a potential route for sustainable development. Cellobiohydrolases are key enzymes used in industrial cocktails for depolymerization of crystalline cellulose, and their mechanism of action has been intensely studied in the past several years. Provided with a tunnel-like substrate-binding cavity, cellobiohydrolases possess the ability to processively hydrolyze glycosidic bonds of crystalline cellulose, yielding one molecule of cellobiose per catalytic cycle. As such, cellobiose expulsion from the product binding site is a necessary step in order to allow for the processive hydrolysis mechanism. However, the high-affinity binding of cellobiose to the enzyme impairs the process and causes activity inhibition due to reaction products. Here, we use molecular dynamics simulations to study the binding of cellobiose to the Trichoderma reesei Cel7A (TrCel7A) cellobiohydrolase and the effects of mutations that reduce cellobiose binding, without affecting the structural and dynamical integrities of the enzyme. We observe that the product binding site exhibits an intrinsic flexibility that can sterically hinder cellobiose release. Several point mutations in the product binding site reduce cellobiose-enzyme interactions, but not all modifications are able to maintain the structural integrity of the enzyme. In particular, mutation of charged residues in the TrCel7A product binding site causes perturbations that affect the structure of the loops that form the substrate-binding tunnel of the enzyme and, hence, may affect TrCel7A function in other steps of the hydrolysis mechanism. Our results suggest there is a trade-off between product inhibition and catalytic efficiency, and they provide directions for cellulases engineering.

Dynamic Factors Affecting Gaseous Ligand Binding in an Artificial Oxygen Transport Protein‡

PubMed Central

Zhang, Lei; Andersen, Eskil M.E.; Khajo, Abdelahad; Magliozzo, Richard S.; Koder, Ronald L.

2013-01-01

We report the functional analysis of an artificial hexacoordinate oxygen transport protein, HP7, which operates via a mechanism similar to that of human neuroglobin and cytoglobin: the destabilization of one of two heme-ligating histidine residues. In the case of HP7 this is the result of the coupling of histidine side chain ligation with the burial of three charged glutamate residues on the same helix. Here we compare gaseous ligand binding, including rates, affinities and oxyferrous state lifetimes, of both heme binding sites in HP7. We find that despite the identical sequence of helices in both binding sites, there are differences in oxygen affinity and oxyferrous state lifetime which may be the result of differences in the freedom of motion imposed by the candelabra fold on the two sites of the protein. We further examine the effect of mutational removal of the buried glutamates on function. Heme iron in the ferrous state of this mutant is rapidly oxidized when when exposed to oxygen. Compared to HP7, distal histidine affinity is increased by a 22-fold decrease in the histidine ligand off-rate. EPR comparison of these ferric hemoproteins demonstrates that the mutation increases disorder at the heme binding site. NMR-detected deuterium exchange demonstrates that the mutation greatly increases water penetration into the protein core. The inability of the mutant protein to bind oxygen may be due to increased water penetration, the large decrease in binding rate caused by the increase in distal histidine affinity, or a combination of the two factors. Together these data underline the importance of the control of protein dynamics in the design of functional artificial proteins. PMID:23249163

Dynamic factors affecting gaseous ligand binding in an artificial oxygen transport protein.

PubMed

Zhang, Lei; Andersen, Eskil M E; Khajo, Abdelahad; Magliozzo, Richard S; Koder, Ronald L

2013-01-22

We report the functional analysis of an artificial hexacoordinate oxygen transport protein, HP7, which operates via a mechanism similar to that of human neuroglobin and cytoglobin: the destabilization of one of two heme-ligating histidine residues. In the case of HP7, this is the result of the coupling of histidine side chain ligation with the burial of three charged glutamate residues on the same helix. Here we compare gaseous ligand binding, including rates, affinities, and oxyferrous state lifetimes, of both heme binding sites in HP7. We find that despite the identical sequence of helices in both binding sites, there are differences in oxygen affinity and oxyferrous state lifetime that may be the result of differences in the freedom of motion imposed by the candelabra fold on the two sites of the protein. We further examine the effect of mutational removal of the buried glutamates on function. Heme iron in the ferrous state of this mutant is rapidly oxidized when exposed to oxygen. Compared to that of HP7, the distal histidine affinity is increased by a 22-fold decrease in the histidine ligand off rate. Electron paramagnetic resonance comparison of these ferric hemoproteins demonstrates that the mutation increases the level of disorder at the heme binding site. Nuclear magnetic resonance-detected deuterium exchange demonstrates that the mutation greatly increases the degree of penetration of water into the protein core. The inability of the mutant protein to bind oxygen may be due to an increased level of water penetration, the large decrease in binding rate caused by the increase in distal histidine affinity, or a combination of the two factors. Together, these data underline the importance of the control of protein dynamics in the design of functional artificial proteins.

TALEN-mediated single-base-pair editing identification of an intergenic mutation upstream of BUB1B as causative of PCS (MVA) syndrome

PubMed Central

Ochiai, Hiroshi; Miyamoto, Tatsuo; Kanai, Akinori; Hosoba, Kosuke; Sakuma, Tetsushi; Kudo, Yoshiki; Asami, Keiko; Ogawa, Atsushi; Watanabe, Akihiro; Kajii, Tadashi; Yamamoto, Takashi; Matsuura, Shinya

2014-01-01

Cancer-prone syndrome of premature chromatid separation with mosaic variegated aneuploidy [PCS (MVA) syndrome] is a rare autosomal recessive disorder characterized by constitutional aneuploidy and a high risk of childhood cancer. We previously reported monoallelic mutations in the BUB1B gene (encoding BUBR1) in seven Japanese families with the syndrome. No second mutation was found in the opposite allele of any of the families studied, although a conserved BUB1B haplotype and a decreased transcript were identified. To clarify the molecular pathology of the second allele, we extended our mutational search to a candidate region surrounding BUB1B. A unique single nucleotide substitution, G > A at ss802470619, was identified in an intergenic region 44 kb upstream of a BUB1B transcription start site, which cosegregated with the disorder. To examine whether this is the causal mutation, we designed a transcription activator-like effector nuclease–mediated two-step single-base pair editing strategy and biallelically introduced this substitution into cultured human cells. The cell clones showed reduced BUB1B transcripts, increased PCS frequency, and MVA, which are the hallmarks of the syndrome. We also encountered a case of a Japanese infant with PCS (MVA) syndrome carrying a homozygous single nucleotide substitution at ss802470619. These results suggested that the nucleotide substitution identified was the causal mutation of PCS (MVA) syndrome. PMID:24344301

Recent Management of Patients with Advanced Epidermal Growth Factor Receptor Mutation Non-small Cell Lung Cancer: Role of Afatinib and Lesson Learned for Developing Countries.

PubMed

Amin, Zulkifli; Jayalie, Vito Filbert; Rajabto, Wulyo

2017-01-01

Lung cancer is a devastating disease with a high incidence, mortality and morbidity rate, especially in developing countries. Conventional treatment with cytotoxic chemotherapy has some limitations attributed to chemoresistance and toxicity. Recent advances have shown that first generation Tyrosine Kinase Inhibitor (TKI), Gefitinib and Erlotinib, and the newest available second generation Tyrosine Kinase Inhibitor (TKI), Afatinib, have the potential to be an option in the management of patients with epidermal growth factor receptor/ EGFR mutation positive advanced/ metastatic non-small cell lung cancer. Afatinib works by binding to EGFR irreversibly, thus inactivating the tyrosine kinase receptor. Some studies demostrated that Afatinib first-line may result in longer progression free survival (PFS) and better disease control, and as an alternative for patients who intolerance to Gefitinib or Erlotinib. In Indonesia, the era of National Health Insurance has been implemented and National Health Insurance has covered treatment for cancer, including first generation TKIs, Gefitinib dan erlotinib, for patients with EGFR mutation positive advanced/ metastatic non-small cell lung cancer at Cipto Mangunkusumo National Hospital. Afatinib, as one of the newest available second generation TKI, may be given free of charge too as an alternative if the National Health Insurance will be covered in the future. Further research is needed to know the efficacy and adverse effects that may occur in patients from developing countries.

Genetic selection for mistranslation rescues a defective co-chaperone in yeast.

PubMed

Hoffman, Kyle S; Berg, Matthew D; Shilton, Brian H; Brandl, Christopher J; O'Donoghue, Patrick

2017-04-07

Despite the general requirement for translation fidelity, mistranslation can be an adaptive response. We selected spontaneous second site mutations that suppress the stress sensitivity caused by a Saccharomyces cerevisiae tti2 allele with a Leu to Pro mutation at residue 187, identifying a single nucleotide mutation at the same position (C70U) in four tRNAProUGG genes. Linkage analysis and suppression by SUF9G3:U70 expressed from a centromeric plasmid confirmed the causative nature of the suppressor mutation. Since the mutation incorporates the G3:U70 identity element for alanyl-tRNA synthetase into tRNAPro, we hypothesized that suppression results from mistranslation of Pro187 in Tti2L187P as Ala. A strain expressing Tti2L187A was not stress sensitive. In vitro, tRNAProUGG (C70U) was mis-aminoacylated with alanine by alanyl-tRNA synthetase, but was not a substrate for prolyl-tRNA synthetase. Mass spectrometry from protein expressed in vivo and a novel GFP reporter for mistranslation confirmed substitution of alanine for proline at a rate of ∼6%. Mistranslating cells expressing SUF9G3:U70 induce a partial heat shock response but grow nearly identically to wild-type. Introducing the same G3:U70 mutation in SUF2 (tRNAProAGG) suppressed a second tti2 allele (tti2L50P). We have thus identified a strategy that allows mistranslation to suppress deleterious missense Pro mutations in Tti2. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Ovarian Tumors related to Intronic Mutations in DICER1: A Report from the International Ovarian and Testicular Stromal Tumor Registry

PubMed Central

Schultz, Kris Ann; Harris, Anne; Messinger, Yoav; Sencer, Susan; Baldinger, Shari; Dehner, Louis P.; Hill, D. Ashley

2015-01-01

Germline DICER1 mutations have been described in individuals with pleuropulmonary blastoma (PPB), ovarian Sertoli-Leydig cell tumor (SLCT), sarcomas, multinodular goiter, thyroid carcinoma, cystic nephroma and other neoplastic conditions. Early results from the International Ovarian and Testicular Stromal Tumor Registry show germline DICER1 mutations in 48% of girls and women with SLCT. In this report, a young woman presented with ovarian undifferentiated sarcoma. Four years later, she presented with SLCT. She was successfully treated for both malignancies. Sequence results showed a germline intronic mutation in DICER1. This mutation results in an exact duplication of the six bases at the splice site at the intron 23 and exon 24 junction. Predicted improper splicing leads to inclusion of 10 bases of intronic sequence, frameshift and premature truncation of the protein disrupting the RNase IIIb domain. A second individual with SLCT was found to have an identical germline mutation. In each of the ovarian tumors, an additional somatic mutation in the RNase IIIb domain of DICER1 was found. In rare patients, germline intronic mutations in DICER1 that are predicted to cause incorrect splicing can also contribute to the pathogenesis of SLCT. PMID:26289771

Structures of oncogenic, suppressor and rescued p53 core-domain variants: mechanisms of mutant p53 rescue

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wallentine, Brad D.; Wang, Ying; Tretyachenko-Ladokhina, Vira

2013-10-01

X-ray crystallographic structures of four p53 core-domain variants were determined in order to gain insights into the mechanisms by which certain second-site suppressor mutations rescue the function of a significant number of cancer mutations of the tumor suppressor protein p53. To gain insights into the mechanisms by which certain second-site suppressor mutations rescue the function of a significant number of cancer mutations of the tumor suppressor protein p53, X-ray crystallographic structures of four p53 core-domain variants were determined. These include an oncogenic mutant, V157F, two single-site suppressor mutants, N235K and N239Y, and the rescued cancer mutant V157F/N235K/N239Y. The V157F mutationmore » substitutes a smaller hydrophobic valine with a larger hydrophobic phenylalanine within strand S4 of the hydrophobic core. The structure of this cancer mutant shows no gross structural changes in the overall fold of the p53 core domain, only minor rearrangements of side chains within the hydrophobic core of the protein. Based on biochemical analysis, these small local perturbations induce instability in the protein, increasing the free energy by 3.6 kcal mol{sup −1} (15.1 kJ mol{sup −1}). Further biochemical evidence shows that each suppressor mutation, N235K or N239Y, acts individually to restore thermodynamic stability to V157F and that both together are more effective than either alone. All rescued mutants were found to have wild-type DNA-binding activity when assessed at a permissive temperature, thus pointing to thermodynamic stability as the critical underlying variable. Interestingly, thermodynamic analysis shows that while N239Y demonstrates stabilization of the wild-type p53 core domain, N235K does not. These observations suggest distinct structural mechanisms of rescue. A new salt bridge between Lys235 and Glu198, found in both the N235K and rescued cancer mutant structures, suggests a rescue mechanism that relies on stabilizing the β-sandwich scaffold. On the other hand, the substitution N239Y creates an advantageous hydrophobic contact between the aromatic ring of this tyrosine and the adjacent Leu137. Surprisingly, the rescued cancer mutant shows much larger structural deviations than the cancer mutant alone when compared with wild-type p53. These suppressor mutations appear to rescue p53 function by creating novel intradomain interactions that stabilize the core domain, allowing compensation for the destabilizing V157F mutation.« less

Small-scale high-throughput sequencing-based identification of new therapeutic tools in cystic fibrosis.

PubMed

Bonini, Jennifer; Varilh, Jessica; Raynal, Caroline; Thèze, Corinne; Beyne, Emmanuelle; Audrezet, Marie-Pierre; Ferec, Claude; Bienvenu, Thierry; Girodon, Emmanuelle; Tuffery-Giraud, Sylvie; Des Georges, Marie; Claustres, Mireille; Taulan-Cadars, Magali

2015-10-01

Although 97-99% of CFTR mutations have been identified, great efforts must be made to detect yet-unidentified mutations. We developed a small-scale next-generation sequencing approach for reliably and quickly scanning the entire gene, including noncoding regions, to identify new mutations. We applied this approach to 18 samples from patients suffering from cystic fibrosis (CF) in whom only one mutation had hitherto been identified. Using an in-house bioinformatics pipeline, we could rapidly identify a second disease-causing CFTR mutation for 16 of 18 samples. Of them, c.1680-883A>G was found in three unrelated CF patients. Analysis of minigenes and patients' transcripts showed that this mutation results in aberrantly spliced transcripts because of the inclusion of a pseudoexon. It is located only three base pairs from the c.1680-886A>G mutation (1811+1.6kbA>G), the fourth most frequent mutation in southwestern Europe. We next tested the effect of antisense oligonucleotides targeting splice sites on these two mutations on pseudoexon skipping. Oligonucleotide transfection resulted in the restoration of the full-length, in-frame CFTR transcript, demonstrating the effect of antisense oligonucleotide-induced pseudoexon skipping in CF. Our data confirm the importance of analyzing noncoding regions to find unidentified mutations, which is essential to designing targeted therapeutic approaches.

Concurrent BRAF and PTEN mutations in melanoma of unknown origin presenting as a breast mass

PubMed Central

Agosto-Arroyo, Emmanuel; Rosa, Marilin; Chau, Alec; Khazai, Laila

2017-01-01

Background: Metastases represent a small percentage of the malignancies affecting the breast, and only 5% of melanomas originate from non-cutaneous sites. Multiple genetic aberrations have been associated with the development of melanocytic lesions, including BRAF V600E mutation. Mutations in PTEN gene have also been related to the pathogenesis of multiple malignancies. Purpose/Method: This is the case of a 28-year-old female who presented with a tender, palpable mass in the upper outer quadrant of the right breast. Ultrasound showed a 1-cm solid mass, initially diagnosed as invasive ductal carcinoma on biopsy. During pre-operative workup, a second mass was identified and biopsied. Immunohistochemical stains performed on the second mass biopsy demonstrated that the neoplastic cells were positive for cytokeratin AE1/3, pan-melanoma, tyrosinase, and SOX-10 and negative for CK7, CAM5.2, and GATA-3. Subsequent workup showed widespread metastatic disease involving the liver, lungs, bones, and brain. The brain metastasis tested positive for BRAF p.V600E and PTEN p.R130Efs*4 mutations. Thorough skin and eye examination did not reveal a primary melanoma. Conclusion: Only few reports have been published of melanoma presenting as a breast mass. This is an interesting case due to the clinical presentation, diagnostic challenges, and genetic mutations profile. PMID:28607685

Measurements of particle emission from discharge sites in Teflon irradiated by high energy electron beams

NASA Technical Reports Server (NTRS)

Hazelton, R. C.; Churchill, R. J.; Yadlowsky, E. J.

1979-01-01

Anomalous behavior of synchronous orbit satellites manifested by overall degradation of system performance and reduced operating life is associated with electrical discharges resulting from differential charging of the spacecraft surface by fluxes of high energy electrons. During a laboratory simulation silver-backed Teflon samples have been irradiated by electron beams having energies in the range 16-26 keV. Charged particles emitted from the resultant electrical discharges have been measured with a biased Faraday cup and retarding potential analyser. Measurements indicate the presence of two distinct fluxes of particles, the first being an early pulse (0-600ns) of high energy (about 7keV) electrons, while the second is a late pulse (1-5 microseconds) of low energy electrons (less than 1eV) and ions (70eV) leaving the discharge site as a quasi plasma. Calculations indicate an electrostatic field as the dominant accelerating mechanism for charged particles.

Structure-function Analysis of Receptor-binding in Adeno-Associated Virus Serotype 6 (AAV-6)

PubMed Central

Xie, Qing; Lerch, Thomas F.; Meyer, Nancy L.; Chapman, Michael S.

2011-01-01

Crystal structures of the AAV-6 capsid at 3 Å reveal a subunit fold homologous to other parvoviruses with greatest differences in two external loops. The electrostatic potential suggests that receptor-attachment is mediated by four residues: Arg576, Lys493, Lys459 and Lys531, defining a positively charged region curving up from the valley between adjacent spikes. It overlaps only partially with the receptor-binding site of AAV-2, and the residues endowing the electrostatic character are not homologous. Mutational substitution of each residue decreases heparin affinity, particularly Lys531 and Lys459. Neither is conserved among heparin-binding serotypes, indicating that diverse modes of receptor attachment have been selected in different serotypes. Surface topology and charge are also distinct at the shoulder of the spike, where linear epitopes for AAV-2’s neutralizing monoclonal antibody A20 come together. Evolutionarily, selection of changed side-chain charge may have offered a conservative means to evade immune neutralization while preserving other essential functionality. PMID:21917284

Diverse point mutations in the human gene for polymorphic N-acetyltransferase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vatsis, K.P.; Martell, K.J.; Weber, W.W.

1991-07-15

Classification of humans as rapid or slow acetylators is based on hereditary differences in rates of N-acetylation of therapeutic and carcinogenic agents, but N-acetylation of certain arylamine drugs displays no genetic variation. Two highly homologous human genes for N-acetyltransferase NAT1 and NAT2, presumably code for the genetically invariant and variant NAT proteins, respectively. In the present investigation, 1.9-kilobase human genomic EcoRI fragments encoding NAT2 were generated by the polymerase chain reaction with liver and leukocyte DNA from seven subjects phenotyped as homozygous and heterozygous acetylators. Direct sequencing revealed multiple point mutations in the coding region of two distinct NAT2 variants.more » One of these was derived from leukocytes of a slow acetylator and was distinguished by a silent mutation (coden 94) and a separate G {r arrow} A transition (position 590) leading to replacement of Arg-197 by Gln; the mutated guanine was part of a CpG dinucleotide and a Taq I site. The second NAT2 variant originated from liver with low N-acetylation activity. It was characterized by three nucleotide transitions giving rise to a silent mutation (codon 161), accompanied by obliteration of the sole Kpn I site, and two amino acid substitutions. The results show conclusively that the genetically variant NAT is encoded by NAT2.« less

Electrostatic effects on the folding stability of FKBP

NASA Astrophysics Data System (ADS)

Batra, Jyotica; Zhou, Huan-Xiang

2006-11-01

Charged residues play important roles in the folding of proteins and their interactions with biological targets. We have developed computational models for predicting electrostatic contributions to protein folding and binding stability. To rigorously test and further refine these models, we carried out experimental studies on the effects of charge mutations on the folding stability of FKBP. Two close homologues of FKBP, FKBP12 and FKBP12.6, differ in 18 of 107 positions, and 8 of which involve substitutions of charged residues. These 8 substitutions were introduced on FKBP12 and their effects on the folding stability were measured. The changes in unfolding free energy varied from -0.34 to 0.65 kcal/mol. A double and a triple mutation were introduced to accumulate the stabilization effect of individual substitutions, resulting an increase in stability of about 0.84 kcal/mol. On the other hand, neutralizing one or both partners of a conserved salt bridge reduced the stability by as much as 0.64 kcal/mol. These results suggest that charged residues can modulate the folding stability significantly. To further exploit stabilization effects of charged residues, experiments are now underway to introduce charge mutations that are modeled after a thermophilic FKBP.

Sequence charge decoration dictates coil-globule transition in intrinsically disordered proteins.

PubMed

Firman, Taylor; Ghosh, Kingshuk

2018-03-28

We present an analytical theory to compute conformations of heteropolymers-applicable to describe disordered proteins-as a function of temperature and charge sequence. The theory describes coil-globule transition for a given protein sequence when temperature is varied and has been benchmarked against the all-atom Monte Carlo simulation (using CAMPARI) of intrinsically disordered proteins (IDPs). In addition, the model quantitatively shows how subtle alterations of charge placement in the primary sequence-while maintaining the same charge composition-can lead to significant changes in conformation, even as drastic as a coil (swelled above a purely random coil) to globule (collapsed below a random coil) and vice versa. The theory provides insights on how to control (enhance or suppress) these changes by tuning the temperature (or solution condition) and charge decoration. As an application, we predict the distribution of conformations (at room temperature) of all naturally occurring IDPs in the DisProt database and notice significant size variation even among IDPs with a similar composition of positive and negative charges. Based on this, we provide a new diagram-of-states delineating the sequence-conformation relation for proteins in the DisProt database. Next, we study the effect of post-translational modification, e.g., phosphorylation, on IDP conformations. Modifications as little as two-site phosphorylation can significantly alter the size of an IDP with everything else being constant (temperature, salt concentration, etc.). However, not all possible modification sites have the same effect on protein conformations; there are certain "hot spots" that can cause maximal change in conformation. The location of these "hot spots" in the parent sequence can readily be identified by using a sequence charge decoration metric originally introduced by Sawle and Ghosh. The ability of our model to predict conformations (both expanded and collapsed states) of IDPs at a high-throughput level can provide valuable insights into the different mechanisms by which phosphorylation/charge mutation controls IDP function.

Sequence charge decoration dictates coil-globule transition in intrinsically disordered proteins

NASA Astrophysics Data System (ADS)

Firman, Taylor; Ghosh, Kingshuk

2018-03-01

We present an analytical theory to compute conformations of heteropolymers—applicable to describe disordered proteins—as a function of temperature and charge sequence. The theory describes coil-globule transition for a given protein sequence when temperature is varied and has been benchmarked against the all-atom Monte Carlo simulation (using CAMPARI) of intrinsically disordered proteins (IDPs). In addition, the model quantitatively shows how subtle alterations of charge placement in the primary sequence—while maintaining the same charge composition—can lead to significant changes in conformation, even as drastic as a coil (swelled above a purely random coil) to globule (collapsed below a random coil) and vice versa. The theory provides insights on how to control (enhance or suppress) these changes by tuning the temperature (or solution condition) and charge decoration. As an application, we predict the distribution of conformations (at room temperature) of all naturally occurring IDPs in the DisProt database and notice significant size variation even among IDPs with a similar composition of positive and negative charges. Based on this, we provide a new diagram-of-states delineating the sequence-conformation relation for proteins in the DisProt database. Next, we study the effect of post-translational modification, e.g., phosphorylation, on IDP conformations. Modifications as little as two-site phosphorylation can significantly alter the size of an IDP with everything else being constant (temperature, salt concentration, etc.). However, not all possible modification sites have the same effect on protein conformations; there are certain "hot spots" that can cause maximal change in conformation. The location of these "hot spots" in the parent sequence can readily be identified by using a sequence charge decoration metric originally introduced by Sawle and Ghosh. The ability of our model to predict conformations (both expanded and collapsed states) of IDPs at a high-throughput level can provide valuable insights into the different mechanisms by which phosphorylation/charge mutation controls IDP function.

Amino-Acid Network Clique Analysis of Protein Mutation Non-Additive Effects: A Case Study of Lysozme.

PubMed

Ming, Dengming; Chen, Rui; Huang, He

2018-05-10

Optimizing amino-acid mutations in enzyme design has been a very challenging task in modern bio-industrial applications. It is well known that many successful designs often hinge on extensive correlations among mutations at different sites within the enzyme, however, the underpinning mechanism for these correlations is far from clear. Here, we present a topology-based model to quantitively characterize non-additive effects between mutations. The method is based on the molecular dynamic simulations and the amino-acid network clique analysis. It examines if the two mutation sites of a double-site mutation fall into to a 3-clique structure, and associates such topological property of mutational site spatial distribution with mutation additivity features. We analyzed 13 dual mutations of T4 phage lysozyme and found that the clique-based model successfully distinguishes highly correlated or non-additive double-site mutations from those additive ones whose component mutations have less correlation. We also applied the model to protein Eglin c whose structural topology is significantly different from that of T4 phage lysozyme, and found that the model can, to some extension, still identify non-additive mutations from additive ones. Our calculations showed that mutation non-additive effects may heavily depend on a structural topology relationship between mutation sites, which can be quantitatively determined using amino-acid network k -cliques. We also showed that double-site mutation correlations can be significantly altered by exerting a third mutation, indicating that more detailed physicochemical interactions should be considered along with the network clique-based model for better understanding of this elusive mutation-correlation principle.

Recombination Can Initiate and Terminate at a Large Number of Sites within the Rosy Locus of Drosophila Melanogaster

PubMed Central

Clark, S. H.; Hilliker, A. J.; Chovnick, A.

1988-01-01

This report presents the results of a recombination experiment designed to question the existence of special sites for the initiation or termination of a recombination heteroduplex within the region of the rosy locus. Intragenic recombination events were monitored between two physically separated rosy mutant alleles ry(301) and ry(2) utilizing DNA restriction site polymorphisms as genetic markers. Both ry(301) and ry(2) are known from previous studies to be associated with gene conversion frequencies an order of magnitude lower than single site mutations. The mutations are associated with large, well defined insertions located as internal sites within the locus in prior intragenic mapping studies. On the molecular map, they represent large insertions approximately 2.7 kb apart in the second and third exons, respectively, of the XDH coding region. The present study monitors intragenic recombination in a mutant heterozygous genotype in which DNA homology is disrupted by these large discontinuities, greater than the region of DNA homology and flanking both sides of the locus. If initiation/or termination requires separate sites at either end of the locus, then intragenic recombination within the rosy locus of the heterozygote should be eliminated. Contrary to expectation, significant recombination between these sites is seen. PMID:2834266

Osimertinib making a breakthrough in lung cancer targeted therapy

PubMed Central

Zhang, Haijun

2016-01-01

Epidermal growth factor receptor (EGFR) tyrosine kinase inhibitors (TKIs) are the evidence-based first-line treatment for advanced non-small-cell lung cancer that harbors sensitizing EGFR mutations (EGFRm+) such as exon 19 deletions and L858R substitutions in exon 21. However, acquired resistance to EGFR TKIs is mostly driven by a second-site EGFR T790M mutation, which negates their inhibitory activity. Osimertinib (AZD9291, Tagrisso™), an oral, third-generation EGFR TKI, has been designed to target the EGFR T790M mutation, while sparing wild-type EGFR. In this up-to-date review, focus is not only on the structure, mechanisms, and pharmacokinetics of osimertinib but also on summarizing clinical trials and making recommendations of osimertinib for patients with non-small-cell lung cancer. PMID:27660466

Matriptase shedding is closely coupled with matriptase zymogen activation and requires de novo proteolytic cleavage likely involving its own activity

PubMed Central

Barndt, Robert; Gu, Yayun; Chen, Chien-Yu; Tseng, I-Chu; Su, Sheng-Fang; Wang, Jehng-Kang; Johnson, Michael D.

2017-01-01

The type 2 transmembrane serine protease matriptase is involved in many pathophysiological processes probably via its enzymatic activity, which depends on the dynamic relationship between zymogen activation and protease inhibition. Matriptase shedding can prolong the life of enzymatically active matriptase and increase accessibility to substrates. We show here that matriptase shedding occurs via a de novo proteolytic cleavage at sites located between the SEA domain and the CUB domain. Point or combined mutations at the four positively charged amino acid residues in the region following the SEA domain allowed Arg-186 to be identified as the primary cleavage site responsible for matriptase shedding. Kinetic studies further demonstrate that matriptase shedding is temporally coupled with matriptase zymogen activation. The onset of matriptase shedding lags one minute behind matriptase zymogen activation. Studies with active site triad Ser-805 point mutated matriptase, which no longer undergoes zymogen activation or shedding, further suggests that matriptase shedding depends on matriptase zymogen activation, and that matriptase proteolytic activity may be involved in its own shedding. Our studies uncover an autonomous mechanism coupling matriptase zymogen activation, proteolytic activity, and shedding such that a proportion of newly generated active matriptase escapes HAI-1-mediated rapid inhibition by shedding into the extracellular milieu. PMID:28829816

The DNA Maturation Domain of gpA, the DNA Packaging Motor Protein of Bacteriophage Lambda, Contains an ATPase Site Associated with Endonuclease Activity

PubMed Central

Ortega, Marcos E.; Gaussier, Helene; Catalano, Carlos E.

2007-01-01

Summary Terminase enzymes are common to double-stranded DNA (dsDNA) viruses and are responsible for packaging viral DNA into the confines of an empty capsid shell. In bacteriophage lambda the catalytic terminase subunit is gpA, which is responsible for maturation of the genome end prior to packaging and subsequent translocation of the matured DNA into the capsid. DNA packaging requires an ATPase catalytic site situated in the N-terminus of the protein. A second ATPase catalytic site associated with the DNA maturation activities of the protein has been proposed; however, direct demonstration of this putative second site is lacking. Here we describe biochemical studies that define protease-resistant peptides of gpA and expression of these putative domains in E. coli. Biochemical characterization of gpA-ΔN179, a construct in which the N-terminal 179 residues of gpA have been deleted, indicates that this protein encompasses the DNA maturation domain of gpA. The construct is folded, soluble and possesses an ATP-dependent nuclease activity. Moreover, the construct binds and hydrolyzes ATP despite the fact that the DNA packaging ATPase site in the N-terminus of gpA has been deleted. Mutation of lysine 497, which alters the conserved lysine in a predicted Walker A “P-loop” sequence, does not affect ATP binding but severely impairs ATP hydrolysis. Further, this mutation abrogates the ATP-dependent nuclease activity of the protein. These studies provide direct evidence for the elusive nucleotide-binding site in gpA that is directly associated with the DNA maturation activity of the protein. The implications of these results with respect to the two roles of the terminase holoenzyme – DNA maturation and DNA packaging – are discussed. PMID:17870092

Triboelectric generator

DOEpatents

Wang, Zhong L; Fan, Fengru; Lin, Long; Zhu, Guang; Pan, Caofeng; Zhou, Yusheng

2015-11-03

A generator includes a thin first contact charging layer and a thin second contact charging layer. The thin first contact charging layer includes a first material that has a first rating on a triboelectric series. The thin first contact charging layer has a first side with a first conductive electrode applied thereto and an opposite second side. The thin second contact charging layer includes a second material that has a second rating on a triboelectric series that is more negative than the first rating. The thin first contact charging layer has a first side with a first conductive electrode applied thereto and an opposite second side. The thin second contact charging layer is disposed adjacent to the first contact charging layer so that the second side of the second contact charging layer is in contact with the second side of the first contact charging layer.

Improvement thermostability of Pseudoalteromonas carrageenovora arylsulfatase by rational design.

PubMed

Zhu, Yanbing; Qiao, Chaochao; Li, Hebin; Li, Lijun; Xiao, Anfeng; Ni, Hui; Jiang, Zedong

2018-03-01

This study aimed to improve the thermostability of arylsulfatase from Pseudoalteromonas carrageenovora. A total of 10 single-site mutants were chosen using the PoPMuSiC program, and two mutants of K253N and P314T showed enhanced thermal stability. By saturation mutagenesis and thermostability analysis, K253H and P314T were the best mutants at the two sites. Combinational mutations of K253H, P314T and H260L were subsequently introduced, and the best mutant of K253H/H260L was selected. Thermal inactivation analysis showed the half-life (t 1/2 ) value at 55°C for K253H/H260L was 7.7-fold that of the wild-type enzyme (WT), meanwhile this mutant maintained the specific enzyme activity. Structure modeling demonstrated that the additional hydrogen bonds, optimization of surface charge-charge interactions, and increasing of hydrophobic interaction could account for the improved thermostability imparted by K253H/H260L. Copyright © 2017. Published by Elsevier B.V.

Mutation Frequency of the Major Frontotemporal Dementia Genes, MAPT, GRN and C9ORF72 in a Turkish Cohort of Dementia Patients.

PubMed

Guven, Gamze; Lohmann, Ebba; Bras, Jose; Gibbs, J Raphael; Gurvit, Hakan; Bilgic, Basar; Hanagasi, Hasmet; Rizzu, Patrizia; Heutink, Peter; Emre, Murat; Erginel-Unaltuna, Nihan; Just, Walter; Hardy, John; Singleton, Andrew; Guerreiro, Rita

2016-01-01

'Microtubule-associated protein tau' (MAPT), 'granulin' (GRN) and 'chromosome 9 open reading frame72' (C9ORF72) gene mutations are the major known genetic causes of frontotemporal dementia (FTD). Recent studies suggest that mutations in these genes may also be associated with other forms of dementia. Therefore we investigated whether MAPT, GRN and C9ORF72 gene mutations are major contributors to dementia in a random, unselected Turkish cohort of dementia patients. A combination of whole-exome sequencing, Sanger sequencing and fragment analysis/Southern blot was performed in order to identify pathogenic mutations and novel variants in these genes as well as other FTD-related genes such as the 'charged multivesicular body protein 2B' (CHMP2B), the 'FUS RNA binding protein' (FUS), the 'TAR DNA binding protein' (TARDBP), the 'sequestosome1' (SQSTM1), and the 'valosin containing protein' (VCP). We determined one pathogenic MAPT mutation (c.1906C>T, p.P636L) and one novel missense variant (c.38A>G, p.D13G). In GRN we identified a probably pathogenic TGAG deletion in the splice donor site of exon 6. Three patients were found to carry the GGGGCC expansions in the non-coding region of the C9ORF72 gene. In summary, a complete screening for mutations in MAPT, GRN and C9ORF72 genes revealed a frequency of 5.4% of pathogenic mutations in a random cohort of 93 Turkish index patients with dementia.

Double heterozygous mutations Gln100Leu and His348Gln of the F7 gene in a patient with factor VII deficiency.

PubMed

Li, Min; Zheng, Fangxiu; Jin, Yanhui; Wang, Mingshan; Zhu, Liqing; Yang, Lihong

2013-03-01

A 25-year-old Chinese woman who had a history of easy bruising was admitted to hospital due to uncontrolled epistaxis. She showed factor VII activity level of 2% and factor VII antigen level of 4% of the normal value. We detected a novel missense mutation g.8355 A>T (p.Gln100Leu) in the second epidermal growth factor-like (EGF) domain and a g.11482 T>G (p.His348Gln) in the catalytic domain. Although the Gln100 residue is close to the junction of EGF-2 domain with the serine protease domain, we infer that the substitution of polar negatively charged Gln residue at the position 100 with introduction of nonpolar Leu residue may be likely to perturb proper folding, resulting in decreasing factor VII activity.

A negative charge in transmembrane segment 1 of domain II of the cockroach sodium channel is critical for channel gating and action of pyrethroid insecticides

DOE Office of Scientific and Technical Information (OSTI.GOV)

Du Yuzhe; Song Weizhong; Groome, James R.

2010-08-15

Voltage-gated sodium channels are the primary target of pyrethroids, an important class of synthetic insecticides. Pyrethroids bind to a distinct receptor site on sodium channels and prolong the open state by inhibiting channel deactivation and inactivation. Recent studies have begun to reveal sodium channel residues important for pyrethroid binding. However, how pyrethroid binding leads to inhibition of sodium channel deactivation and inactivation remains elusive. In this study, we show that a negatively charged aspartic acid residue at position 802 (D802) located in the extracellular end of transmembrane segment 1 of domain II (IIS1) is critical for both the action ofmore » pyrethroids and the voltage dependence of channel activation. Charge-reversing or -neutralizing substitutions (K, G, or A) of D802 shifted the voltage dependence of activation in the depolarizing direction and reduced channel sensitivity to deltamethrin, a pyrethroid insecticide. The charge-reversing mutation D802K also accelerated open-state deactivation, which may have counteracted the inhibition of sodium channel deactivation by deltamethrin. In contrast, the D802G substitution slowed open-state deactivation, suggesting an additional mechanism for neutralizing the action of deltamethrin. Importantly, Schild analysis showed that D802 is not involved in pyrethroid binding. Thus, we have identified a sodium channel residue that is critical for regulating the action of pyrethroids on the sodium channel without affecting the receptor site of pyrethroids.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kuo, Nai-Wei; Gao, Yong; Schill, Megan S.

Chemokines play important roles in the immune system, not only recruiting leukocytes to the site of infection and inflammation but also guiding cell homing and cell development. The soluble poxvirusencoded protein vCCI, a CC chemokine inhibitor, can bind to human CC chemokines tightly to impair the host immune defense. This protein has no known homologs in eukaryotes, and may represent a potent method to stop inflammation. Previously, our structure of the vCCI:MIP-1β complex indicated that vCCI uses negatively charged residues in β-sheet II to interact with positively charged residues in the MIP-1βN-terminus, 20’s region and 40’s loop. However, the interactionsmore » between vCCI and other CC chemokines have not yet been fully explored. Here, we used NMR and fluorescence anisotropy to study the interaction between vCCI and eotaxin-1 (CCL11), another CC chemokine that is an important factor in the asthma response. NMR results reveal that the binding pattern is very similar to the vCCI:MIP-1βcomplex, and suggest that electrostatic interactions provide a major contribution to binding. Fluorescence anisotropy results on variants of eotaxin-1 further confirm the critical roles of the charged residues in eotaxin. Compared to wild-type eotaxin, single, double, or triple mutations at these critical charged residues weaken the binding. One exception is the K47A mutation that exhibits increased affinity for vCCI, which can be explained structurally. In addition, the binding affinity between vCCI and other wild type CC chemokines, MCP-1, MIP-1β and RANTES, were determined as 1.09 nM, 1.16 nM, and 0.22 nM, respectively. To our knowledge, this is the first work quantitatively measuring the binding affinity between vCCI and different CC chemokines.« less

The genetic and functional basis of isolated 17,20-lyase deficiency.

PubMed

Geller, D H; Auchus, R J; Mendonça, B B; Miller, W L

1997-10-01

Human male sexual differentiation requires production of fetal testicular testosterone, whose biosynthesis requires steroid 17,20-lyase activity. Patients with putative isolated 17,20-lyase deficiency have been reported. The existence of true isolated 17,20-lyase deficiency, however, has been questioned because 17 alpha-hydroxylase and 17,20-lyase activities are catalyzed by a single enzyme, microsomal cytochrome P450c17, and because the index case of apparent isolated 17,20-lyase deficiency had combined deficiencies of both activities. We studied two patients with clinical and hormonal findings suggestive of isolated 17,20-lyase deficiency. We found two patients homozygous for substitution mutations in CYP17, the gene encoding P450c17. When expressed in COS-1 cells, the mutants retained 17 alpha-hydroxylase activity but had minimal 17,20-lyase activity. Substrate competition experiments suggested that the mutations did not alter the enzyme's substrate-binding capacity, but co-transfection of cells with P450 oxidoreductase, the electron donor used by P450c17, indicated that the mutants had a diminished ability to interact with redox partners. Computer-graphic modelling of P450c17 suggests that both mutations lie in or near the redox-partner binding site, on the opposite side of the haem from the substrate-binding pocket. These mutations alter electrostatic charge distribution in the redox-partner binding site, so that electron transfer for the 17,20-lyase reaction is selectively lost or diverted to uncoupling reactions. These are the first proven cases of isolated 17,20-lyase deficiency, and they demonstrate a novel mechanism for loss of enzymatic activity.

Active and regulatory sites of cytosolic 5'-nucleotidase.

PubMed

Pesi, Rossana; Allegrini, Simone; Careddu, Maria Giovanna; Filoni, Daniela Nicole; Camici, Marcella; Tozzi, Maria Grazia

2010-12-01

Cytosolic 5'-nucleotidase (cN-II), which acts preferentially on 6-hydroxypurine nucleotides, is essential for the survival of several cell types. cN-II catalyses both the hydrolysis of nucleotides and transfer of their phosphate moiety to a nucleoside acceptor through formation of a covalent phospho-intermediate. Both activities are regulated by a number of phosphorylated compounds, such as diadenosine tetraphosphate (Ap₄A), ADP, ATP, 2,3-bisphosphoglycerate (BPG) and phosphate. On the basis of a partial crystal structure of cN-II, we mutated two residues located in the active site, Y55 and T56. We ascertained that the ability to catalyse the transfer of phosphate depends on the presence of a bulky residue in the active site very close to the aspartate residue that forms the covalent phospho-intermediate. The molecular model indicates two possible sites at which adenylic compounds may interact. We mutated three residues that mediate interaction in the first activation site (R144, N154, I152) and three in the second (F127, M436 and H428), and found that Ap₄A and ADP interact with the same site, but the sites for ATP and BPG remain uncertain. The structural model indicates that cN-II is a homotetrameric protein that results from interaction through a specific interface B of two identical dimers that have arisen from interaction of two identical subunits through interface A. Point mutations in the two interfaces and gel-filtration experiments indicated that the dimer is the smallest active oligomerization state. Finally, gel-filtration and light-scattering experiments demonstrated that the native enzyme exists as a tetramer, and no further oligomerization is required for enzyme activation. © 2010 The Authors Journal compilation © 2010 FEBS.

Increased Tuberculosis Patient Mortality Associated with Mycobacterium tuberculosis Mutations Conferring Resistance to Second-Line Antituberculous Drugs

PubMed Central

Seifert, Marva; Garfein, Richard S.; Rodwell, Timothy C.

2017-01-01

ABSTRACT Rapid molecular diagnostics have great potential to limit the spread of multidrug-resistant tuberculosis (MDR-TB) and extensively drug-resistant tuberculosis (XDR-TB) (M/XDR-TB). These technologies detect mutations in the Mycobacterium tuberculosis genome that confer phenotypic drug resistance. However, there have been few data published regarding the relationships between the detected M. tuberculosis resistance mutations and M/XDR-TB treatment outcomes, limiting our current ability to exploit the full potential of molecular diagnostics. We analyzed clinical, microbiological, and sequencing data for 451 patients and their clinical isolates collected in a multinational, observational cohort study to determine if there was an association between M. tuberculosis resistance mutations and patient mortality. The presence of an rrs 1401G mutation was associated with significantly higher odds of patient mortality (adjusted odds ratio [OR] = 5.72; 95% confidence interval [CI], 1.65 to 19.84]) after adjusting for relevant patient clinical characteristics and all other resistance mutations. Further analysis of mutations, categorized by the associated resistance level, indicated that the detection of mutations associated with high-level fluoroquinolone (OR, 3.99 [95% CI, 1.10 to 14.40]) and kanamycin (OR, 5.47 [95% CI, 1.64 to 18.24]) resistance was also significantly associated with higher odds of patient mortality, even after accounting for clinical site, patient age, reported smoking history, body mass index (BMI), diabetes, HIV, and all other resistance mutations. Specific gyrA and rrs resistance mutations, associated with high-level resistance, were associated with patient mortality as identified in clinical M. tuberculosis isolates from a diverse M/XDR-TB patient population at three high-burden clinical sites. These results have important implications for the interpretation of molecular diagnostics, including identifying patients at increased risk for mortality during treatment. (This study has been registered at ClinicalTrials.gov under registration no. NCT02170441.) PMID:28404672

Increased Tuberculosis Patient Mortality Associated with Mycobacterium tuberculosis Mutations Conferring Resistance to Second-Line Antituberculous Drugs.

PubMed

Georghiou, Sophia B; Seifert, Marva; Catanzaro, Donald G; Garfein, Richard S; Rodwell, Timothy C

2017-06-01

Rapid molecular diagnostics have great potential to limit the spread of multidrug-resistant tuberculosis (MDR-TB) and extensively drug-resistant tuberculosis (XDR-TB) (M/XDR-TB). These technologies detect mutations in the Mycobacterium tuberculosis genome that confer phenotypic drug resistance. However, there have been few data published regarding the relationships between the detected M. tuberculosis resistance mutations and M/XDR-TB treatment outcomes, limiting our current ability to exploit the full potential of molecular diagnostics. We analyzed clinical, microbiological, and sequencing data for 451 patients and their clinical isolates collected in a multinational, observational cohort study to determine if there was an association between M. tuberculosis resistance mutations and patient mortality. The presence of an rrs 1401G mutation was associated with significantly higher odds of patient mortality (adjusted odds ratio [OR] = 5.72; 95% confidence interval [CI], 1.65 to 19.84]) after adjusting for relevant patient clinical characteristics and all other resistance mutations. Further analysis of mutations, categorized by the associated resistance level, indicated that the detection of mutations associated with high-level fluoroquinolone (OR, 3.99 [95% CI, 1.10 to 14.40]) and kanamycin (OR, 5.47 [95% CI, 1.64 to 18.24]) resistance was also significantly associated with higher odds of patient mortality, even after accounting for clinical site, patient age, reported smoking history, body mass index (BMI), diabetes, HIV, and all other resistance mutations. Specific gyrA and rrs resistance mutations, associated with high-level resistance, were associated with patient mortality as identified in clinical M. tuberculosis isolates from a diverse M/XDR-TB patient population at three high-burden clinical sites. These results have important implications for the interpretation of molecular diagnostics, including identifying patients at increased risk for mortality during treatment. (This study has been registered at ClinicalTrials.gov under registration no. NCT02170441.). Copyright © 2017 American Society for Microbiology.

Rational design of a conformation-switchable Ca2+- and Tb3+-binding protein without the use of multiple coupled metal-binding sites.

PubMed

Li, Shunyi; Yang, Wei; Maniccia, Anna W; Barrow, Doyle; Tjong, Harianto; Zhou, Huan-Xiang; Yang, Jenny J

2008-10-01

Ca2+, as a messenger of signal transduction, regulates numerous target molecules via Ca2+-induced conformational changes. Investigation into the determinants for Ca2+-induced conformational change is often impeded by cooperativity between multiple metal-binding sites or protein oligomerization in naturally occurring proteins. To dissect the relative contributions of key determinants for Ca2+-dependent conformational changes, we report the design of a single-site Ca2+-binding protein (CD2.trigger) created by altering charged residues at an electrostatically sensitive location on the surface of the host protein rat Cluster of Differentiation 2 (CD2).CD2.trigger binds to Tb3+ and Ca2+ with dissociation constants of 0.3 +/- 0.1 and 90 +/- 25 microM, respectively. This protein is largely unfolded in the absence of metal ions at physiological pH, but Tb3+ or Ca2+ binding results in folding of the native-like conformation. Neutralization of the charged coordination residues, either by mutation or protonation, similarly induces folding of the protein. The control of a major conformational change by a single Ca2+ ion, achieved on a protein designed without reliance on sequence similarity to known Ca2+-dependent proteins and coupled metal-binding sites, represents an important step in the design of trigger proteins.

Identification of an Inhibitory Alcohol Binding Site in GABAA ρ1 Receptors

PubMed Central

Borghese, Cecilia M.; Ruiz, Carlos I.; Lee, Ui S.; Cullins, Madeline A.; Bertaccini, Edward J.; Trudell, James R.; Harris, R. Adron

2016-01-01

Alcohols inhibit γ-aminobutyric acid type A ρ1 receptor function. After introducing mutations in several positions of the second transmembrane helix in ρ1, we studied the effects of ethanol and hexanol on GABA responses using two-electrode voltage clamp electrophysiology in Xenopus laevis oocytes. The 6′ mutations produced the following effects on ethanol and hexanol responses: small increase or no change (T6′M), increased inhibition (T6′V) and small potentiation (T6′Y and T6′F). The 5′ mutations produced mainly increases in hexanol inhibition. Other mutations produced small (3′ and 9′) or no changes (2′ and L277 in the first transmembrane domain) in alcohol effects. These results suggest an inhibitory alcohol binding site near the 6′ position. Homology models of ρ1 receptors based on the X-ray structure of GluCl showed that the 2′, 5′, 6’ and 9′ residues were easily accessible from the ion pore, with 5′ and 6′ residues from neighboring subunits facing each other; L3′ and L277 also faced the neighboring subunit. We tested ethanol through octanol on single and double mutated ρ1 receptors [ρ1(I15′S), ρ1(T6′Y) and ρ1(T6′Y,I15′S)] to further characterize the inhibitory alcohol pocket in the wild-type ρ1 receptor. The pocket can only bind relatively short-chain alcohols and is eliminated by introducing Y in the 6’ position. Replacing the bulky 15′ residue with a smaller side chain introduced a potentiating binding site, more sensitive to long-chain than to short-chain alcohols. In conclusion, the net alcohol effect on the ρ1 receptor is determined by the sum of its actions on inhibitory and potentiating sites. PMID:26571107

Molecular dynamics investigation of the ionic liquid/enzyme interface: application to engineering enzyme surface charge.

PubMed

Burney, Patrick R; Nordwald, Erik M; Hickman, Katie; Kaar, Joel L; Pfaendtner, Jim

2015-04-01

Molecular simulations of the enzymes Candida rugosa lipase and Bos taurus α-chymotrypsin in aqueous ionic liquids 1-butyl-3-methylimidazolium chloride and 1-ethyl-3-methylimidazolium ethyl sulfate were used to study the change in enzyme-solvent interactions induced by modification of the enzyme surface charge. The enzymes were altered by randomly mutating lysine surface residues to glutamate, effectively decreasing the net surface charge by two for each mutation. These mutations resemble succinylation of the enzyme by chemical modification, which has been shown to enhance the stability of both enzymes in ILs. After establishing that the enzymes were stable on the simulated time scales, we focused the analysis on the organization of the ionic liquid substituents about the enzyme surface. Calculated solvent charge densities show that for both enzymes and in both solvents that changing positively charged residues to negative charge does indeed increase the charge density of the solvent near the enzyme surface. The radial distribution of IL constituents with respect to the enzyme reveals decreased interactions with the anion are prevalent in the modified systems when compared to the wild type, which is largely accompanied by an increase in cation contact. Additionally, the radial dependence of the charge density and ion distribution indicates that the effect of altering enzyme charge is confined to short range (≤1 nm) ordering of the IL. Ultimately, these results, which are consistent with that from prior experiments, provide molecular insight into the effect of enzyme surface charge on enzyme stability in ILs. © 2015 Wiley Periodicals, Inc.

Mobility of the maize suppressor-mutator element in transgenic tobacco cells.

PubMed Central

Masson, P; Fedoroff, N V

1989-01-01

Maize Suppressor-mutator (Spm) transposable elements have been introduced into tobacco cells and a visual assay for Spm activity has been developed using a bacterial beta-glucuronidase gene. The Spm element is mobile in tobacco and can trans-activate excision of a transposition-defective Spm (dSpm) element either from a different site on the same transforming Ti plasmid or from a second plasmid. An Spm element expressed from the stronger cauliflower mosaic virus 35S promoter trans-activates transposition of a dSpm element earlier after its introduction into tobacco cells than an element expressed from its own promoter. Images PMID:2538837

Next-Generation EGFR Tyrosine Kinase Inhibitors for Treating EGFR-Mutant Lung Cancer beyond First Line

PubMed Central

Sullivan, Ivana; Planchard, David

2017-01-01

Tyrosine kinase inhibitors (TKIs) against the human epidermal growth factor receptor (EGFR) are now standard treatment in the clinic for patients with advanced EGFR mutant non-small-cell lung cancer (NSCLC). First-generation EGFR TKIs, binding competitively and reversibly to the ATP-binding site of the EGFR tyrosine kinase domain, have resulted in a significant improvement in outcome for NSCLC patients with activating EGFR mutations (L858R and Del19). However, after a median duration of response of ~12 months, all patients develop tumor resistance, and in over half of these patients this is due to the emergence of the EGFR T790M resistance mutation. The second-generation EGFR/HER TKIs were developed to treat resistant disease, targeting not only T790M but EGFR-activating mutations and wild-type EGFR. Although they exhibited promising anti-T790M activity in the laboratory, their clinical activity among T790M+ NSCLC was poor mainly because of dose-limiting toxicity due to simultaneous inhibition of wild-type EGFR. The third-generation EGFR TKIs selectively and irreversibly target EGFR T790M and activating EGFR mutations, showing promising efficacy in NSCLC resistant to the first- and second-generation EGFR TKIs. They also appear to have lower incidences of toxicity due to the limited inhibitory effect on wild-type EGFR. Currently, the first-generation gefitinib and erlotinib and second-generation afatinib have been approved for first-line treatment of metastatic NSCLC with activating EGFR mutations. Among the third-generation EGFR TKIs, osimertinib is today the only drug approved by the Food and Drug Administration and the European Medicines Agency to treat metastatic EGFR T790M NSCLC patients who have progressed on or after EGFR TKI therapy. In this review, we summarize the available post-progression therapies including third-generation EGFR inhibitors and combination treatment strategies for treating patients with NSCLC harboring EGFR mutations and address the known mechanisms of resistance. PMID:28149837

Atomic Structure of the Cystic Fibrosis Transmembrane Conductance Regulator.

PubMed

Zhang, Zhe; Chen, Jue

2016-12-01

The cystic fibrosis transmembrane conductance regulator (CFTR) is an anion channel evolved from the ATP-binding cassette (ABC) transporter family. In this study, we determined the structure of zebrafish CFTR in the absence of ATP by electron cryo-microscopy to 3.7 Å resolution. Human and zebrafish CFTR share 55% sequence identity, and 42 of the 46 cystic-fibrosis-causing missense mutational sites are identical. In CFTR, we observe a large anion conduction pathway lined by numerous positively charged residues. A single gate near the extracellular surface closes the channel. The regulatory domain, dephosphorylated, is located in the intracellular opening between the two nucleotide-binding domains (NBDs), preventing NBD dimerization and channel opening. The structure also reveals why many cystic-fibrosis-causing mutations would lead to defects either in folding, ion conduction, or gating and suggests new avenues for therapeutic intervention. Copyright © 2016 Elsevier Inc. All rights reserved.

Development of positive control materials for DNA-based detection of cystic fibrosis: Cloning and sequencing of 31 mutations

DOE Office of Scientific and Technical Information (OSTI.GOV)

Iovannisci, D.; Brown, C.; Winn-Deen, E.

1994-09-01

The cloning and sequencing of the gene associated with cystic fibrosis (CF) now provides the opportunity for earlier detection and carrier screening through DNA-based detection schemes. To date, over 300 mutations have been reported to the CF Consortium; however, only 30 mutations have been observed frequently enough world-wide to warrant routine screening. Many of these mutations are not available as cloned material or as established tissue culture cell lines to aid in the development of DNA-based detection assays. We have therefore cloned the 30 most frequently reported mutations, plus the mutation R347H due to its association with male infertility (31more » mutations, total). Two approaches were employed: direct PCR amplification, where mutations were available from patient sources, and site-directed PCR mutagenesis of normal genomic DNA to generate the remaining mutations. After amplification, products were cloned into a sequencing vector, bacterial transformants were screened by a novel method (PCR/oligonucleotide litigation assay/sequence-coded separation), and plamid DNA sequences determined by automated fluorescent methods on the Applied Biosystems 373A. Mixing of the clones allows the construction of artificial genotypes useful as positive control material for assay validation. A second round of mutagenesis, resulting in the construction of plasmids bearing multiple mutations, will be evaluated for their utility as reagent control materials in kit development.« less

Genetic screening for von Hippel-Lindau gene mutations in non-syndromic pheochromocytoma: low prevalence and false-positives or misdiagnosis indicate a need for caution.

PubMed

Eisenhofer, G; Vocke, C D; Elkahloun, A; Huynh, T-T; Prodanov, T; Lenders, J W M; Timmers, H J; Benhammou, J N; Linehan, W M; Pacak, K

2012-05-01

Genetic testing of tumor susceptibility genes is now recommended in most patients with pheochromocytoma or paraganglioma (PPGL), even in the absence of a syndromic presentation. Once a mutation is diagnosed there is rarely follow-up validation to assess the possibility of misdiagnosis. This study prospectively examined the prevalence of von Hippel-Lindau (VHL) gene mutations among 182 patients with non-syndromic PPGLs. Follow-up in positive cases included comparisons of biochemical and tumor gene expression data in 64 established VHL patients, with confirmatory genetic testing in cases with an atypical presentation. VHL mutations were detected by certified laboratory testing in 3 of the 182 patients with non-syndromic PPGLs. Two of the 3 had an unusual presentation of diffuse peritoneal metastases and substantial increases in plasma metanephrine, the metabolite of epinephrine. Tumor gene expression profiles in these 2 patients also differed markedly from those associated with established VHL syndrome. One patient was diagnosed with a partial deletion by Southern blot analysis and the other with a splice site mutation. Quantitative polymerase chain reaction, multiplex ligation-dependent probe amplification, and comparative genomic hybridization failed to confirm the partial deletion indicated by certified laboratory testing. Analysis of tumor DNA in the other patient with a splice site alteration indicated no loss of heterozygosity or second hit point mutation. In conclusion, VHL germline mutations represent a minor cause of non-syndromic PPGLs and misdiagnoses can occur. Caution should therefore be exercised in interpreting positive genetic test results as the cause of disease in patients with non-syndromic PPGLs. © Georg Thieme Verlag KG Stuttgart · New York.

Intronic splicing mutations in PTCH1 cause Gorlin syndrome.

PubMed

Bholah, Zaynab; Smith, Miriam J; Byers, Helen J; Miles, Emma K; Evans, D Gareth; Newman, William G

2014-09-01

Gorlin syndrome is an autosomal dominant disorder characterized by multiple early-onset basal cell carcinoma, odontogenic keratocysts and skeletal abnormalities. It is caused by heterozygous mutations in the tumour suppressor PTCH1. Routine clinical genetic testing, by Sanger sequencing and multiplex ligation-dependent probe amplification (MLPA) to confirm a clinical diagnosis of Gorlin syndrome, identifies a mutation in 60-90 % of cases. We undertook RNA analysis on lymphocytes from ten individuals diagnosed with Gorlin syndrome, but without known PTCH1 mutations by exonic sequencing or MLPA. Two altered PTCH1 transcripts were identified. Genomic DNA sequence analysis identified an intron 7 mutation c.1068-10T>A, which created a strong cryptic splice acceptor site, leading to an intronic insertion of eight bases; this is predicted to create a frameshift p.(His358Alafs*12). Secondly, a deep intronic mutation c.2561-2057A>G caused an inframe insertion of 78 intronic bases in the cDNA transcript, leading to a premature stop codon p.(Gly854fs*3). The mutations are predicted to cause loss of function of PTCH1, consistent with its tumour suppressor function. The findings indicate the importance of RNA analysis to detect intronic mutations in PTCH1 not identified by routine screening techniques.

Extensive Variation in the Mutation Rate Between and Within Human Genes Associated with Mendelian Disease.

PubMed

Smith, Thomas; Ho, Gladys; Christodoulou, John; Price, Elizabeth Ann; Onadim, Zerrin; Gauthier-Villars, Marion; Dehainault, Catherine; Houdayer, Claude; Parfait, Beatrice; van Minkelen, Rick; Lohman, Dietmar; Eyre-Walker, Adam

2016-05-01

We have investigated whether the mutation rate varies between genes and sites using de novo mutations (DNMs) from three genes associated with Mendelian diseases (RB1, NF1, and MECP2). We show that the relative frequency of mutations at CpG dinucleotides relative to non-CpG sites varies between genes and relative to the genomic average. In particular we show that the rate of transition mutation at CpG sites relative to the rate of non-CpG transversion is substantially higher in our disease genes than amongst DNMs in general; the rate of CpG transition can be several hundred-fold greater than the rate of non-CpG transversion. We also show that the mutation rate varies significantly between sites of a particular mutational type, such as non-CpG transversion, within a gene. We estimate that for all categories of sites, except CpG transitions, there is at least a 30-fold difference in the mutation rate between the 10% of sites with the highest and lowest mutation rates. However, our best estimate is that the mutation rate varies by several hundred-fold variation. We suggest that the presence of hypermutable sites may be one reason certain genes are associated with disease. © 2016 WILEY PERIODICALS, INC.

Alteration of Electrostatic Surface Potential Enhances Affinity and Tumor Killing Properties of Anti-ganglioside GD2 Monoclonal Antibody hu3F8.

PubMed

Zhao, Qi; Ahmed, Mahiuddin; Guo, Hong-fen; Cheung, Irene Y; Cheung, Nai-Kong V

2015-05-22

Ganglioside GD2 is highly expressed on neuroectodermal tumors and an attractive therapeutic target for antibodies that have already shown some clinical efficacy. To further improve the current antibodies, which have modest affinity, we sought to improve affinity by using a combined method of random mutagenesis and in silico assisted design to affinity-mature the anti-GD2 monoclonal antibody hu3F8. Using yeast display, mutants in the Fv with enhanced binding over the parental clone were FACS-sorted and cloned. In silico modeling identified the minimal key interacting residues involved in the important charged interactions with the sialic acid groups of GD2. Two mutations, D32H (L-CDR1) and E1K (L-FR1) altered the electrostatic surface potential of the antigen binding site, allowing for an increase in positive charge to enhance the interaction with the negatively charged GD2-pentasaccharide headgroup. Purified scFv and IgG mutant forms were then tested for antigen specificity by ELISA, for tissue specificity by immunohistochemistry, for affinity by BIACORE, for antibody-dependent cell-mediated cytotoxicity (ADCC) and complement-mediated cytotoxicity in vitro, and for anti-tumor efficacy in xenografted humanized mice. The nearly 7-fold improvement in affinity of hu3F8 with a single D32H (L-CDR1) mutation translated into a ∼12-fold improvement in NK92MI-transfected CD16-mediated ADCC, a 6-fold improvement in CD32-mediated ADCC, and a 2.5-fold improvement in complement-mediated cytotoxicity while maintaining restricted normal tissue cross-reactivity and achieving substantial improvement in tumor ablation in vivo. Despite increasing GD2 affinity, the double mutation D32H (L-CDR1) and E1K (L-FR1) did not further improve anti-tumor efficacy. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

Association of KIT exon 9 mutations with nongastric primary site and aggressive behavior: KIT mutation analysis and clinical correlates of 120 gastrointestinal stromal tumors.

PubMed

Antonescu, Cristina R; Sommer, Gunhild; Sarran, Lisa; Tschernyavsky, Sylvia J; Riedel, Elyn; Woodruff, James M; Robson, Mark; Maki, Robert; Brennan, Murray F; Ladanyi, Marc; DeMatteo, Ronald P; Besmer, Peter

2003-08-15

Activating mutations of the KIT juxtamembrane region are the most common genetic events in gastrointestinal stromal tumors (GISTs) and have been noted as independent prognostic factors. The impact of KIT mutation in other regions, such as the extracellular or kinase domains, is not well-defined and fewer than 30 cases have been published to date. One hundred twenty GISTs, confirmed by KIT immunoreactivity, were evaluated for the presence of KIT exon 9, 11, 13, and 17 mutations. The relation between the presence/type of KIT mutation and clinicopathological factors was analyzed using Fisher's exact test and log-rank test. Forty-four % of the tumors were located in the stomach, 47% in the small bowel, 6% in the rectum, and 3% in the retroperitoneum. Overall, KIT mutations were detected in 78% of patients as follows: 67% in exon 11, 11% in exon 9, and none in exon 13 or 17. The types of KIT exon 11 mutations were heterogeneous and clustered in the classic "hot spot" at the 5' end of exon 11. Seven % of cases showed internal tandem duplications (ITD) at the 3' end of exon 11, in a region that we designate as a second hot spot for KIT mutations. Interestingly, these cases were associated with: female predominance, stomach location, occurrence in older patients, and favorable outcome. There were significant associations between exon 9 mutations and large tumor size (P < 0.001) and extragastric location (P = 0.02). Ten of these 13 patients with more than 1-year follow-up have developed recurrent disease. Most KIT-expressing GISTs show KIT mutations that are preferentially located within the classic hot spot of exon 11. In addition, we found an association between a second hot spot at the 3'end of exon 11, characterized by ITDs, and a subgroup of clinically indolent gastric GISTs in older females. KIT exon 9 mutations seem to define a distinct subset of GISTs, located predominantly in the small bowel and associated with an unfavorable clinical course.

Amino acid contribution to protein solubility: Asp, Glu, and Ser contribute more favorably than the other hydrophilic amino acids in RNase Sa.

PubMed

Trevino, Saul R; Scholtz, J Martin; Pace, C Nick

2007-02-16

Poor protein solubility is a common problem in high-resolution structural studies, formulation of protein pharmaceuticals, and biochemical characterization of proteins. One popular strategy to improve protein solubility is to use site-directed mutagenesis to make hydrophobic to hydrophilic mutations on the protein surface. However, a systematic investigation of the relative contributions of all 20 amino acids to protein solubility has not been done. Here, 20 variants at the completely solvent-exposed position 76 of ribonuclease (RNase) Sa are made to compare the contributions of each amino acid. Stability measurements were also made for these variants, which occur at the i+1 position of a type II beta-turn. Solubility measurements in ammonium sulfate solutions were made at high positive net charge, low net charge, and high negative net charge. Surprisingly, there was a wide range of contributions to protein solubility even among the hydrophilic amino acids. The results suggest that aspartic acid, glutamic acid, and serine contribute significantly more favorably than the other hydrophilic amino acids especially at high net charge. Therefore, to increase protein solubility, asparagine, glutamine, or threonine should be replaced with aspartic acid, glutamic acid or serine.

Pitfalls in the molecular genetic diagnosis of Leber hereditary optic neuropathy (LHON)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Johns, D.R.; Neufeld, M.J.

1993-10-01

Pathogenetic mutations in mtDNA are found in the majority of patients with Leber hereditary optic neuropathy (LHON), and molecular genetic techniques to detect them are important for diagnosis. A false-positive molecular genetic error has adverse consequences for the diagnosis of this maternally inherited disease. The authors found a number of mtDNA polymorphisms that occur adjacent to known LHON-associated mutations and that confound their molecular genetic detection. These transition mutations occur at mtDNA nt 11779 (SfaNI site loss, 11778 mutation), nt 3459 (BsaHI site loss, 3460 mutation), nt 15258 (AccI site loss, 15257 mutation), nt 14485 (mismatch primer Sau3AI site loss,more » 14484 mutation), and nt 13707 (BstNI site loss, 13708 mutation). Molecular genetic detection of the most common pathogenetic mtDNA mutations in LHON, using a single restriction enzyme, may be confounded by adjacent polymorphisms that occur with a false-positive rate of 2%-7%. 19 refs.« less

Mechanisms Responsible for ω-Pore Currents in Cav Calcium Channel Voltage-Sensing Domains.

PubMed

Monteleone, Stefania; Lieb, Andreas; Pinggera, Alexandra; Negro, Giulia; Fuchs, Julian E; Hofer, Florian; Striessnig, Jörg; Tuluc, Petronel; Liedl, Klaus R

2017-10-03

Mutations of positively charged amino acids in the S4 transmembrane segment of a voltage-gated ion channel form ion-conducting pathways through the voltage-sensing domain, named ω-current. Here, we used structure modeling and MD simulations to predict pathogenic ω-currents in Ca V 1.1 and Ca V 1.3 Ca 2+ channels bearing several S4 charge mutations. Our modeling predicts that mutations of Ca V 1.1-R1 (R528H/G, R897S) or Ca V 1.1-R2 (R900S, R1239H) linked to hypokalemic periodic paralysis type 1 and of Ca V 1.3-R3 (R990H) identified in aldosterone-producing adenomas conducts ω-currents in resting state, but not during voltage-sensing domain activation. The mechanism responsible for the ω-current and its amplitude depend on the number of charges in S4, the position of the mutated S4 charge and countercharges, and the nature of the replacing amino acid. Functional characterization validates the modeling prediction showing that Ca V 1.3-R990H channels conduct ω-currents at hyperpolarizing potentials, but not upon membrane depolarization compared with wild-type channels. Copyright © 2017 Biophysical Society. Published by Elsevier Inc. All rights reserved.

Yeast Fex1p Is a Constitutively Expressed Fluoride Channel with Functional Asymmetry of Its Two Homologous Domains*

PubMed Central

Smith, Kathryn D.; Gordon, Patricia B.; Rivetta, Alberto; Allen, Kenneth E.; Berbasova, Tetyana; Slayman, Clifford; Strobel, Scott A.

2015-01-01

Fluoride is a ubiquitous environmental toxin with which all biological species must cope. A recently discovered family of fluoride export (FEX) proteins protects organisms from fluoride toxicity by removing it from the cell. We show here that FEX proteins in Saccharomyces cerevisiae function as ion channels that are selective for fluoride over chloride and that these proteins are constitutively expressed at the yeast plasma membrane. Continuous expression is in contrast to many other toxin exporters in yeast, and this, along with the fact that two nearly duplicate proteins are encoded in the yeast genome, suggests that the threat posed by fluoride ions is frequent and detrimental. Structurally, eukaryotic FEX proteins consist of two homologous four-transmembrane helix domains folded into an antiparallel dimer, where the orientation of the two domains is fixed by a single transmembrane linker helix. Using phylogenetic sequence conservation as a guide, we have identified several functionally important residues. There is substantial functional asymmetry in the effect of mutation at corresponding sites in the two domains. Specifically, mutations to residues in the C-terminal domain proved significantly more detrimental to function than did similar mutations in the N-terminal domain. Our data suggest particular residues that may be important to anion specificity, most notably the necessity of a positive charge near the end of TMH1 in the C-terminal domain. It is possible that a cationic charge at this location may create an electrostatic well for fluoride ions entering the channel from the cytoplasm. PMID:26055717

Specific electrostatic interactions between charged amino acid residues regulate binding of von Willebrand factor to blood platelets.

PubMed

Interlandi, Gianluca; Yakovenko, Olga; Tu, An-Yue; Harris, Jeff; Le, Jennie; Chen, Junmei; López, José A; Thomas, Wendy E

2017-11-10

The plasma protein von Willebrand factor (VWF) is essential for hemostasis initiation at sites of vascular injury. The platelet-binding A1 domain of VWF is connected to the VWF N-terminally located D'D3 domain through a relatively unstructured amino acid sequence, called here the N-terminal linker. This region has previously been shown to inhibit the binding of VWF to the platelet surface receptor glycoprotein Ibα (GpIbα). However, the molecular mechanism underlying the inhibitory function of the N-terminal linker has not been elucidated. Here, we show that an aspartate at position 1261 is the most critical residue of the N-terminal linker for inhibiting binding of the VWF A1 domain to GpIbα on platelets in blood flow. Through a combination of molecular dynamics simulations, mutagenesis, and A1-GpIbα binding experiments, we identified a network of salt bridges between Asp 1261 and the rest of A1 that lock the N-terminal linker in place such that it reduces binding to GpIbα. Mutations aimed at disrupting any of these salt bridges activated binding unless the mutated residue also formed a salt bridge with GpIbα, in which case the mutations inhibited the binding. These results show that interactions between charged amino acid residues are important both to directly stabilize the A1-GpIbα complex and to indirectly destabilize the complex through the N-terminal linker. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

Studies of the TLR4-associated protein MD-2 using yeast-display and mutational analyses

PubMed Central

Mattis, Daiva M.; Chervin, Adam; Ranoa, Diana; Kelley, Stacy; Tapping, Richard; Kranz, David M.

2015-01-01

Bacterial lipopolysaccharide (LPS) activates the innate immune system by forming a complex with myeloid differentiation factor 2 (MD-2) and Toll-like receptor 4 (TLR4), which is present on antigen presenting cells. MD-2 plays an essential role in this activation of the innate immune system as a member of the ternary complex, TLR4:MD-2:LPS. With the goal of further understanding the molecular details of the interaction of MD-2 with LPS and TLR4, and possibly toward engineering dominant negative regulators of the MD-2 protein, here we subjected MD-2 to a mutational analysis using yeast display. The approach included generation of site-directed alanine mutants, and ligand-driven selections of MD-2 mutant libraries. Our findings showed that: 1) proline mutations in the F119-K132 loop that binds LPS were strongly selected for enhanced yeast surface stability, 2) there was a preference for positive-charged side chains (R/K) at residue 120 for LPS binding, and negative-charged side chains (D/E) for TLR4 binding, 3) aromatic residues were strongly preferred at F119 and F121 for LPS binding, and 4) an MD-2 mutant (T84N/D101A/S118A/S120D/K122P) exhibited increased binding to TLR4 but decreased binding to LPS. These studies revealed the impact of specific residues and regions of MD-2 on the binding of LPS and TLR4, and they provide a framework for further directed evolution of the MD-2 protein. PMID:26320630

Mutation of Putative N-Glycosylation Sites on Dengue Virus NS4B Decreases RNA Replication.

PubMed

Naik, Nenavath Gopal; Wu, Huey-Nan

2015-07-01

Dengue virus (DENV) nonstructural protein 4B (NS4B) is an endoplasmic reticulum (ER) membrane-associated protein, and mutagenesis studies have revealed its significance in viral genome replication. In this work, we demonstrated that NS4B is an N-glycosylated protein in virus-infected cells as well as in recombinant protein expression. NS4B is N glycosylated at residues 58 and 62 and exists in two forms, glycosylated and unglycosylated. We manipulated full-length infectious RNA clones and subgenomic replicons to generate N58Q, N62Q, and N58QN62Q mutants. Each of the single mutants had distinct effects, but the N58QN62Q mutation resulted in dramatic reduction of viral production efficiency without affecting secretion or infectivity of the virion in mammalian and mosquito C6/36 hosts. Real-time quantitative PCR (qPCR), subgenomic replicon, and trans-complementation assays indicated that the N58QN62Q mutation affected RNA replication possibly by the loss of glycans. In addition, four intragenic mutations (S59Y, S59F, T66A, and A137T) were obtained from mammalian and/or mosquito C6/36 cell culture systems. All of these second-site mutations compensated for the replication defect of the N58QN62Q mutant without creating novel glycosylation sites. In vivo protein stability analyses revealed that the N58QN62Q mutation alone or plus a compensatory mutation did not affect the stability of NS4B. Overall, our findings indicated that mutation of putative N-glycosylation sites affected the biological function of NS4B in the viral replication complex. This is the first report to identify and reveal the biological significance of dengue virus (DENV) nonstructural protein 4B (NS4B) posttranslation N-glycosylation to the virus life cycle. The study demonstrated that NS4B is N glycosylated in virus-infected cells and in recombinant protein expression. NS4B is modified by glycans at Asn-58 and Asn-62. Functional characterization implied that DENV NS4B utilizes the glycosylation machinery in both mammalian and mosquito hosts. Four intragenic mutations were found to compensate for replication and subsequent viral production deficiencies without creating novel N-glycosylation sites or modulating the stabilities of the protein, suggesting that glycans may be involved in maintaining the NS4B protein conformation. NS4B glycans may be necessary elements of the viral life cycle, but compensatory mutations can circumvent their requirement. This novel finding may have broader implications in flaviviral biology as the most likely glycan at Asn-62 of NS4B is conserved in DENV serotypes and in some related flaviviruses. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Novel LAMP2 mutations in Chinese patients with Danon disease cause varying degrees of clinical severity.

PubMed

Luo, Su-shan; Xi, Jian-ying; Cai, Shuang; Zhao, Chong-bo; Lu, Jia-hong; Zhu, Wen-hua; Lin, Jie; Qiao, Kai; Wang, Yin; Ye, Zhu-rong

2014-01-01

Danon disease is an Xlinked dominant lysosomal glycogen storage disorder characterized by cardiomyopathy, skeletal myopathy, and mental retardation. This study described two Chinese cases of Danon disease in order to broaden the phenotypic and genetic spectrum. Clinical data were collected and LAMP2 mutations were analyzed. Patient A had fluctuating limb weakness during 6 months follow-up and was diagnosed with drug-induced myopathy due to anti-hepatitis B therapy with lamivudine. However, the first muscle biopsy with large cytoplasmic vacuoles confused the diagnosis and led to the second biopsy that allowed for the final diagnosis. Patient B had severe cardiac disturbances leading to sudden death. Molecularly, patient A harbored a synonymous mutation adjacent to the exon 6-intron 6 junction; mRNA analysis provided evidence that totally abolished the donor site and caused skipping of exon 6. Patient B harbored a frame-shift deletion mutation in exon 3 (c.396delA) leading to a truncated protein. To our knowledge, this is the first report of Danon disease caused by a synonymous exon mutation that affected mRNA splicing, which indicates that a synonymous substitution may not be silent when it is in the exon sequences close to the splice sites. It is also the first description of Danon disease clinically presenting as druginduced myopathy at onset; the pathological changes might be the key point for making a differential diagnosis. *These two authors contributed equally to this work.

Understanding the basis of I50V-induced affinity decrease in HIV-1 protease via molecular dynamics simulations using polarized force field.

PubMed

Duan, Rui; Lazim, Raudah; Zhang, Dawei

2015-09-30

Human immunodeficiency virus (HIV)-1 protease is one of the most promising drug target commonly utilized to combat Acquired Immune Deficiency Syndrome (AIDS). However, with the emergence of drug resistance arising from mutations, the efficiency of protease inhibitors (PIs) as a viable treatment for AIDS has been greatly reduced. I50V mutation as one of the most significant mutations occurring in HIV-1 protease will be investigated in this study. Molecular dynamics (MD) simulation was utilized to examine the effect of I50V mutation on the binding of two PIs namely indinavir and amprenavir to HIV-1 protease. Prior to the simulations conducted, the electron density distributions of the PI and each residue in HIV-1 protease are derived by combining quantum fragmentation approach molecular fractionation with conjugate caps and Poisson-Boltzmann solvation model based on polarized protein-specific charge scheme. The atomic charges of the binding complex are subsequently fitted using delta restrained electrostatic potential (delta-RESP) method to overcome the poor charge determination of buried atom. This way, both intraprotease polarization and the polarization between protease and the PI are incorporated into partial atomic charges. Through this study, the mutation-induced affinity variations were calculated and significant agreement between experiments and MD simulations conducted was observed for both HIV-1 protease-drug complexes. In addition, the mechanism governing the decrease in the binding affinity of PI in the presence of I50V mutation was also explored to provide insights pertaining to the design of the next generation of anti-HIV drugs. © 2015 Wiley Periodicals, Inc.

Mutation of the C/EBP binding sites in the Rous sarcoma virus long terminal repeat and gag enhancers.

PubMed Central

Ryden, T A; de Mars, M; Beemon, K

1993-01-01

Several C/EBP binding sites within the Rous sarcoma virus (RSV) long terminal repeat (LTR) and gag enhancers were mutated, and the effect of these mutations on viral gene expression was assessed. Minimal site-specific mutations in each of three adjacent C/EBP binding sites in the LTR reduced steady-state viral RNA levels. Double mutation of the two 5' proximal LTR binding sites resulted in production of 30% of wild-type levels of virus. DNase I footprinting analysis of mutant DNAs indicated that the mutations blocked C/EBP binding at the affected sites. Additional C/EBP binding sites were identified upstream of the 3' LTR and within the 5' end of the LTRs. Point mutations in the RSV gag intragenic enhancer region, which blocked binding of C/EBP at two of three adjacent C/EBP sites, also reduced virus production significantly. Nuclear extracts prepared from both chicken embryo fibroblasts (CEFs) and chicken muscle contained proteins binding to the same RSV DNA sites as did C/EBP, and mutations that prevented C/EBP binding also blocked binding of these chicken proteins. It appears that CEFs and chicken muscle contain distinct proteins binding to these RSV DNA sites; the CEF binding protein was heat stable, as is C/EBP, while the chicken muscle protein was heat sensitive. Images PMID:8386280

West Nile virus (WNV) genome RNAs with up to three adjacent mutations that disrupt long distance 5'-3' cyclization sequence basepairs are viable

DOE Office of Scientific and Technical Information (OSTI.GOV)

Basu, Mausumi; Brinton, Margo A., E-mail: mbrinton@gsu.ed

2011-03-30

Mosquito-borne flavivirus genomes contain conserved 5' and 3' cyclization sequences (CYC) that facilitate long distance RNA-RNA interactions. In previous studies, flavivirus replicon RNA replication was completely inhibited by single or multiple mismatching CYC nt substitutions. In the present study, full-length WNV genomes with one, two or three mismatching CYC substitutions showed reduced replication efficiencies but were viable and generated revertants with increased replication efficiency. Several different three adjacent mismatching CYC substitution mutant RNAs were rescued by a second site mutation that created an additional basepair (nts 147-10913) on the internal genomic side of the 5'-3' CYC. The finding that full-lengthmore » genomes with up to three mismatching CYC mutations are viable and can be rescued by a single nt spontaneous mutation indicates that more than three adjacent CYC basepair substitutions would be required to increase the safety of vaccine genomes by creating mismatches in inter-genomic recombinants.« less

Rare splicing defects of FAS underly severe recessive autoimmune lymphoproliferative syndrome.

PubMed

Agrebi, N; Ben-Mustapha, I; Matoussi, N; Dhouib, N; Ben-Ali, M; Mekki, N; Ben-Ahmed, M; Larguèche, B; Ben Becher, S; Béjaoui, M; Barbouche, M R

2017-10-01

Autoimmune lymphoproliferative syndrome (ALPS) is a prototypic disorder of impaired apoptosis characterized by autoimmune features and lymphoproliferation. Heterozygous germline or somatic FAS mutations associated with preserved protein expression have been described. Very rare cases of homozygous germline FAS mutations causing severe autosomal recessive form of ALPS with a complete defect of Fas expression have been reported. We report two unrelated patients from highly inbred North African population showing a severe ALPS phenotype and an undetectable Fas surface expression. Two novel homozygous mutations have been identified underlying rare splicing defects mechanisms. The first mutation breaks a branch point sequence and the second alters a regulatory exonic splicing site. These splicing defects induce the skipping of exon 6 encoding the transmembrane domain of CD95. Our findings highlight the requirement of tight regulation of FAS exon 6 splicing for balanced alternative splicing and illustrate the importance of such studies in highly consanguineous populations. Copyright © 2017 Elsevier Inc. All rights reserved.

Rates of loss of heterozygosity and mitotic recombination in NF2 schwannomas, sporadic vestibular schwannomas and schwannomatosis schwannomas.

PubMed

Hadfield, K D; Smith, M J; Urquhart, J E; Wallace, A J; Bowers, N L; King, A T; Rutherford, S A; Trump, D; Newman, W G; Evans, D G

2010-11-25

Biallelic inactivation of the NF2 gene occurs in the majority of schwannomas. This usually involves a combination of a point mutation or multiexon deletion, in conjunction with either a second point mutation or loss of heterozygosity (LOH). We have performed DNA sequence and dosage analysis of the NF2 gene in a panel of 239 schwannoma tumours: 97 neurofibromatosis type 2 (NF2)-related schwannomas, 104 sporadic vestibular schwannomas (VS) and 38 schwannomatosis-related schwannomas. In total, we identified germline NF2 mutations in 86 out of 97 (89%) NF2 patients and a second mutational event in 77 out of 97 (79%). LOH was by far the most common form of second hit. A combination of microsatellite analysis with either conventional comparative genomic hybridization (CGH) or multiplex ligation-dependent probe amplification (MLPA) identified mitotic recombination (MR) as the cause of LOH in 14 out of 72 (19%) total evaluable tumours. Among sporadic VS, at least one NF2 mutation was identified by sequence analysis or MLPA in 65 out of 98 (66%) tumours. LOH occurred in 54 out of 96 (56%) evaluable tumours, but MR only accounted for 5 out of 77 (6%) tested. LOH was present in 28 out of 34 (82%) schwannomatosis-related schwannomas. In all eight patients who had previously tested positive for a germline SMARCB1 mutation, this involved loss of the whole, or part of the long arm, of chromosome 22. In contrast, 5 out of 22 (23%) tumours from patients with no germline SMARCB1 mutation exhibited MR. High-resolution Affymetrix SNP6 genotyping and copy number (CN) analysis (Affymetrix, Santa Clara, CA, USA) were used to determine the chromosomal breakpoint locations in tumours with MR. A range of unique recombination sites, spanning approximately 11.4 Mb, were identified. This study shows that MR is a mechanism of LOH in NF2 and SMARCB1-negative schwannomatosis-related schwannomas, occurring less frequently in sporadic VS. We found no evidence of MR in SMARCB1-positive schwannomatosis, suggesting that susceptibility to MR varies according to the disease context.

Effect of the F610A mutation on substrate extrusion in the AcrB transporter: explanation and rationale by molecular dynamics simulations.

PubMed

Vargiu, Attilio V; Collu, Francesca; Schulz, Robert; Pos, Klaas M; Zacharias, Martin; Kleinekathöfer, Ulrich; Ruggerone, Paolo

2011-07-20

The tripartite efflux pump AcrAB-TolC is responsible for the intrinsic and acquired multidrug resistance in Escherichia coli. Its active part, the homotrimeric transporter AcrB, is in charge of the selective binding of substrates and energy transduction. The mutation F610A has been shown to significantly reduce the minimum inhibitory concentration of doxorubicin and many other substrates, although F610 does not appear to interact strongly with them. Biochemical study of transport kinetics in AcrB is not yet possible, except for some β-lactams, and other techniques should supply this important information. Therefore, in this work, we assess the impact of the F610A mutation on the functionality of AcrB by means of computational techniques, using doxorubicin as substrate. We found that the compound slides deeply inside the binding pocket after mutation, increasing the strength of the interaction. During subsequent conformational alterations of the transporter, doxorubicin was either not extruded from the binding site or displaced along a direction other than the one associated with extrusion. Our study indicates how subtle interactions determine the functionality of multidrug transporters, since decreased transport might not be simplistically correlated to decreased substrate binding affinity.

A Dual Phenotype of Periventricular Nodular Heterotopia and Frontometaphyseal Dysplasia in One Patient Caused by a Single FLNA Mutation Leading to Two Functionally Different Aberrant Transcripts

PubMed Central

Zenker, Martin; Rauch, Anita; Winterpacht, Andreas; Tagariello, Andreas; Kraus, Cornelia; Rupprecht, Thomas; Sticht, Heinrich; Reis, André

2004-01-01

Two disorders, periventricular nodular heterotopia (PVNH) and a group of skeletal dysplasias belonging to the oto-palato-digital (OPD) spectrum, are caused by FLNA mutations. They are considered mutually exclusive because of the different presumed effects of the respective FLNA gene mutations, leading to loss of function (PVNH) and gain of function (OPD), respectively. We describe here the first patient manifesting PVNH in combination with frontometaphyseal dysplasia, a skeletal dysplasia of the OPD-spectrum. A novel de novo mutation, 7315C→A in exon 45 of the FLNA gene, was identified. It leads to two aberrant transcripts, one full-length transcript with the point mutation causing a substitution of a highly conserved leucine residue (L2439M) and a second shortened transcript lacking 21 bp due to the creation of an ectopic splice donor site in exon 45. We propose that the dual phenotype is caused by two functionally different, aberrant filamin A proteins and therefore represents an exceptional model case of allelic gain-of-function and loss-of-function phenotypes due to a single mutational event. PMID:14988809

[Genetic diagnostics of pathogenic splicing abnormalities in the clinical laboratory--pitfalls and screening approaches].

PubMed

Niimi, Hideki; Ogawa, Tomomi; Note, Rhougou; Hayashi, Shirou; Ueno, Tomohiro; Harada, Kenu; Uji, Yoshinori; Kitajima, Isao

2010-12-01

In recent years, genetic diagnostics of pathogenic splicing abnormalities are increasingly recognized as critically important in the clinical genetic diagnostics. It is reported that approximately 10% of pathogenic mutations causing human inherited diseases are splicing mutations. Nonetheless, it is still difficult to identify splicing abnormalities in routine genetic diagnostic settings. Here, we studied two different kinds of cases with splicing abnormalities. The first case is a protein S deficiency. Nucleotide analyses revealed that the proband had a previously reported G to C substitution in the invariant AG dinucleotide at the splicing acceptor site of intronl/exon2, which produces multiple splicing abnormalities resulting in protein S deficiency. The second case is an antithrombin (AT) deficiency. This proband had a previously reported G to A substitution, at nucleotide position 9788 in intron 4, 14 bp in front of exon 5, which created a de novo exon 5 splice site and resulted in AT deficiency. From a practical standpoint, we discussed the pitfalls, attentions, and screening approaches in genetic diagnostics of pathogenic splicing abnormalities. Due to the difficulty with full-length sequence analysis of introns, and the lack of RNA samples, splicing mutations may escape identification. Although current genetic testing remains to be improved, to screen for splicing abnormalities more efficiently, it is significant to use an appropriate combination of various approaches such as DNA and/or RNA samples, splicing mutation databases, bioinformatic tools to detect splice sites and cis-regulatory elements, and in vitro and/or in vivo experimentally methods as needed.

Hypogonadism in a patient with two novel mutations of the luteinizing hormone β-subunit gene expressed in a compound heterozygous form.

PubMed

Basciani, Sabrina; Watanabe, Mikiko; Mariani, Stefania; Passeri, Marina; Persichetti, Agnese; Fiore, Daniela; Scotto d'Abusco, Anna; Caprio, Massimiliano; Lenzi, Andrea; Fabbri, Andrea; Gnessi, Lucio

2012-09-01

LH gene mutations are rare; only four mutations have been described. The affected individuals are hypogonadal. We describe the clinical features of a 31-yr-old man who presented with delayed puberty and azoospermia and was found to have hypogonadism associated with an absence of circulating LH. The patient had a 12-bp deletion in exon 2 in the LH β-subunit gene and a mutation of the 5' splice site IVS2+1G→T in the same gene present in a compound heterozygous state. The first mutation predicts a deletion of four leucines of the hydrophobic core of the signal peptide. The second mutation disrupts the splicing of mRNA, generating a gross abnormality in the processing. The patient's heterozygous parents were clinically normal. The phenotype of a 16-yr-old sister of the proband, carrying the same mutations, was characterized by normal pubertal development and oligomenorrhea. This report unravels two novel mutations of the LH gene critical for synthesis and activity of the LH molecule. The insight gained from the study is that normal pubertal maturation in women can occur in a state of LH deficiency, whereas LH is essential for maturation of Leydig cells and thus steroidogenesis, puberty, and spermatogenesis in man. These mutations should be considered in girls and boys with selective deficiency of LH.

Antagonism of ligand-gated ion channel receptors: two domains of the glycine receptor alpha subunit form the strychnine-binding site.

PubMed Central

Vandenberg, R J; French, C R; Barry, P H; Shine, J; Schofield, P R

1992-01-01

The inhibitory glycine receptor (GlyR) is a member of the ligand-gated ion channel receptor superfamily. Glycine activation of the receptor is antagonized by the convulsant alkaloid strychnine. Using in vitro mutagenesis and functional analysis of the cDNA encoding the alpha 1 subunit of the human GlyR, we have identified several amino acid residues that form the strychnine-binding site. These residues were identified by transient expression of mutated cDNAs in mammalian (293) cells and examination of resultant [3H]strychnine binding, glycine displacement of [3H]strychnine, and electrophysiological responses to the application of glycine and strychnine. This mutational analysis revealed that residues from two separate domains within the alpha 1 subunit form the binding site for the antagonist strychnine. The first domain includes the amino acid residues Gly-160 and Tyr-161, and the second domain includes the residues Lys-200 and Tyr-202. These results, combined with analyses of other ligand-gated ion channel receptors, suggest a conserved tertiary structure and a common mechanism for antagonism in this receptor superfamily. PMID:1311851

KSC-03pd0359

NASA Image and Video Library

2003-02-12

KENNEDY SPACE CENTER, FLA. - Retired Navy Admiral Harold W. Gehman Jr. (second from left), chairman of the Columbia Accident Investigation Board, visits the Thermal Protection System shop and is briefed by Martin Wilson (second from right), the shop manager. Gehman and other members of the board are visiting sites at KSC to become familiar with the Shuttle launch process. The independent board is charged with determining what caused the destruction of the Space Shuttle Columbia and the loss of its seven-member crew on Feb. 1 during reentry.

Structural basis of DNA bending and oriented heterodimer binding by the basic leucine zipper domains of Fos and Jun.

PubMed

Leonard, D A; Rajaram, N; Kerppola, T K

1997-05-13

Interactions among transcription factors that bind to separate sequence elements require bending of the intervening DNA and juxtaposition of interacting molecular surfaces in an appropriate orientation. Here, we examine the effects of single amino acid substitutions adjacent to the basic regions of Fos and Jun as well as changes in sequences flanking the AP-1 site on DNA bending. Substitution of charged amino acid residues at positions adjacent to the basic DNA-binding domains of Fos and Jun altered DNA bending. The change in DNA bending was directly proportional to the change in net charge for all heterodimeric combinations between these proteins. Fos and Jun induced distinct DNA bends at different binding sites. Exchange of a single base pair outside of the region contacted in the x-ray crystal structure altered DNA bending. Substitution of base pairs flanking the AP-1 site had converse effects on the opposite directions of DNA bending induced by homodimers and heterodimers. These results suggest that Fos and Jun induce DNA bending in part through electrostatic interactions between amino acid residues adjacent to the basic region and base pairs flanking the AP-1 site. DNA bending by Fos and Jun at inverted binding sites indicated that heterodimers bind to the AP-1 site in a preferred orientation. Mutation of a conserved arginine within the basic regions of Fos and transversion of the central C:G base pair in the AP-1 site to G:C had complementary effects on the orientation of heterodimer binding and DNA bending. The conformational variability of the Fos-Jun-AP-1 complex may contribute to its functional versatility at different promoters.

Study of the electrostatic effects of mutations on the surface of dehaloperoxidase-hemoglobin A.

PubMed

Zhao, Junjie; Rowe, Jennifer; Franzen, Jocelyn; He, Chi; Franzen, Stefan

2012-04-20

Point mutations of dehaloperoxidase-hemoglobin A (DHP A) that affect the surface charge have been prepared to study the interaction between DHP A with its substrate 2,4,6-trichlorophenol (TCP). Kinetic studies of these surface mutations showed a correlation, in which the more positively charged mutants have increased catalytic efficiency compared with wild type DHP A. As a result, the hypothesis of this study is that there is a global electrostatic interaction between DHP A and TCP. The electrostatic nature of substrate binding was further confirmed by the result that kinetic assays of DHP A were affected by ionic strength. Furthermore, isoelectric focusing (IEF) gel study showed that the pI-6.8 for DHP A, which indicates that DHP A has a slight negative charge pH 7, consistent with the kinetic observations. Copyright © 2012 Elsevier Inc. All rights reserved.

Effects of polarons on static polarizabilities and second order hyperpolarizabilities of conjugated polymers

NASA Astrophysics Data System (ADS)

Wang, Ya-Dong; Meng, Yan; Di, Bing; Wang, Shu-Ling; An, Zhong

2010-12-01

According to the one-dimensional tight-binding Su—Schrieffer—Heeger model, we have investigated the effects of charged polarons on the static polarizability, αxx, and the second order hyperpolarizabilities, γxxxx, of conjugated polymers. Our results are consistent qualitatively with previous ab initio and semi-empirical calculations. The origin of the universal growth is discussed using a local-view formalism that is based on the local atomic charge derivatives. Furthermore, combining the Su-Schrieffer-Heeger model and the extended Hubbard model, we have investigated systematically the effects of electron-electron interactions on αxx and γxxxx of charged polymer chains. For a fixed value of the nearest-neighbour interaction V, the values of αxx and γxxxx increase as the on-site Coulomb interaction U increases for U < Uc and decrease with U for U > Uc, where Uc is a critical value of U at which the static polarizability or the second order hyperpolarizability reaches a maximal value of αmax or γmax. It is found that the effect of the e-e interaction on the value of αxx is dependent on the ratio between U and V for either a short or a long charged polymer. Whereas, that effect on the value of γxxxx is sensitive both to the ratio of U to V and to the size of the molecule.

Glycosylation of Cblns attenuates their receptor binding.

PubMed

Rong, Yongqi; Bansal, Parmil K; Wei, Peng; Guo, Hong; Correia, Kristen; Parris, Jennifer; Morgan, James I

2018-05-18

Cbln1 is the prototype of a family (Cbln1-Cbln4) of secreted glycoproteins and is essential for normal synapse structure and function in cerebellum by bridging presynaptic Nrxn to postsynaptic Grid2. Here we report the effects of glycosylation on the in vitro receptor binding properties of Cblns. Cbln1, 2 and 4 harbor two N-linked glycosylation sites, one at the N-terminus is in a region implicated in Nrxn binding and the second is in the C1q domain, a region involved in Grid2 binding. Mutation (asparagine to glutamine) of the N-terminal site, increased neurexin binding whereas mutation of the C1q site markedly increased Grid2 binding. These mutations did not influence subunit composition of Cbln trimeric complexes (mediated through the C1q domain) nor their assembly into hexamers (mediated by the N-terminal region). Therefore, glycosylation likely masks the receptor binding interfaces of Cblns. As Cbln4 has undetectable Grid2 binding in vitro we assessed whether transgenic expression of wild type Cbln4 or its glycosylation mutants rescued the Cbln1-null phenotype in vivo. Cbln4 partially rescued and both glycosylation mutants completely rescued ataxia in cbln1-null mice. Thus Cbln4 has intrinsic Grid2 binding that is attenuated by glycosylation, and glycosylation mutants exhibit gain of function in vivo. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

Genetic Regulation of Charged Particle Mutagenesis in Human Cells

NASA Technical Reports Server (NTRS)

Kronenberg, Amy; Gauny, S.; Cherbonnel-Lasserre, C.; Liu, W.; Wiese, C.

1999-01-01

Our studies use a series of syngeneic, and where possible, isogenic human B-lymphoblastoid cell lines to assess the genetic factors that modulate susceptibility apoptosis and their impact on the mutagenic risks of low fluence exposures to 1 GeV Fe ions and 55 MeV protons. These ions are representative of the types of charged particle radiation that are of particular significance for human health in the space radiation environment. The model system employs cell lines derived from the male donor WIL-2. These cells have a single X chromosome and they are hemizygous for one mutation marker, hypoxanthine phosphoribosyltransferase (HPRT). TK6 and WTK1 cells were each derived from descendants of WIL-2 and were each selected as heterozygotes for a second mutation marker, the thymidine kinase (TK) gene located on chromosome 17q. The HPRT and TK loci can detect many different types of mutations, from single basepair substitutions up to large scale loss of heterozygosity (LOH). The single expressing copy of TK in the TK6 and WTKI cell lines is found on the same copy of chromosome 17, and this allele can be identified by a restriction fragment length polymorphism (RFLP) identified when high molecular weight DNA is digested by the SacI restriction endonuclease and hybridized against the cDNA probe for TK. A large series of polymorphic linked markers has been identified that span more than 60 cM of DNA (approx. 60 megabasepairs) and distinguish the copy of chromosome 17 bearing the initially active TK allele from the copy of chromosome 17 bearing the silent TK allele in both TK6 and WTKI cells. TK6 cells express normal p53 protein while WTKI cells express homozygous mutant p53. Expression of mutant p53 can increase susceptibility to x-ray-induced mutations. It's been suggested that the increased mutagenesis in p53 mutant cells might be due to reduced apoptosis.

Deep sequencing of natural and experimental populations of Drosophila melanogaster reveals biases in the spectrum of new mutations.

PubMed

Assaf, Zoe June; Tilk, Susanne; Park, Jane; Siegal, Mark L; Petrov, Dmitri A

2017-12-01

Mutations provide the raw material of evolution, and thus our ability to study evolution depends fundamentally on having precise measurements of mutational rates and patterns. We generate a data set for this purpose using (1) de novo mutations from mutation accumulation experiments and (2) extremely rare polymorphisms from natural populations. The first, mutation accumulation (MA) lines are the product of maintaining flies in tiny populations for many generations, therefore rendering natural selection ineffective and allowing new mutations to accrue in the genome. The second, rare genetic variation from natural populations allows the study of mutation because extremely rare polymorphisms are relatively unaffected by the filter of natural selection. We use both methods in Drosophila melanogaster , first generating our own novel data set of sequenced MA lines and performing a meta-analysis of all published MA mutations (∼2000 events) and then identifying a high quality set of ∼70,000 extremely rare (≤0.1%) polymorphisms that are fully validated with resequencing. We use these data sets to precisely measure mutational rates and patterns. Highlights of our results include: a high rate of multinucleotide mutation events at both short (∼5 bp) and long (∼1 kb) genomic distances, showing that mutation drives GC content lower in already GC-poor regions, and using our precise context-dependent mutation rates to predict long-term evolutionary patterns at synonymous sites. We also show that de novo mutations from independent MA experiments display similar patterns of single nucleotide mutation and well match the patterns of mutation found in natural populations. © 2017 Assaf et al.; Published by Cold Spring Harbor Laboratory Press.

Molecular dynamics explorations of active site structure in designed and evolved enzymes.

PubMed

Osuna, Sílvia; Jiménez-Osés, Gonzalo; Noey, Elizabeth L; Houk, K N

2015-04-21

This Account describes the use of molecular dynamics (MD) simulations to reveal how mutations alter the structure and organization of enzyme active sites. As proposed by Pauling about 70 years ago and elaborated by many others since then, biocatalysis is efficient when functional groups in the active site of an enzyme are in optimal positions for transition state stabilization. Changes in mechanism and covalent interactions are often critical parts of enzyme catalysis. We describe our explorations of the dynamical preorganization of active sites using MD, studying the fluctuations between active and inactive conformations normally concealed to static crystallography. MD shows how the various arrangements of active site residues influence the free energy of the transition state and relates the populations of the catalytic conformational ensemble to the enzyme activity. This Account is organized around three case studies from our laboratory. We first describe the importance of dynamics in evaluating a series of computationally designed and experimentally evolved enzymes for the Kemp elimination, a popular subject in the enzyme design field. We find that the dynamics of the active site is influenced not only by the original sequence design and subsequent mutations but also by the nature of the ligand present in the active site. In the second example, we show how microsecond MD has been used to uncover the role of remote mutations in the active site dynamics and catalysis of a transesterase, LovD. This enzyme was evolved by Tang at UCLA and Codexis, Inc., and is a useful commercial catalyst for the production of the drug simvastatin. X-ray analysis of inactive and active mutants did not reveal differences in the active sites, but relatively long time scale MD in solution showed that the active site of the wild-type enzyme preorganizes only upon binding of the acyl carrier protein (ACP) that delivers the natural acyl group to the active site. In the absence of bound ACP, a noncatalytic arrangement of the catalytic triad is dominant. Unnatural truncated substrates are inactive because of the lack of protein-protein interactions provided by the ACP. Directed evolution is able to gradually restore the catalytic organization of the active site by motion of the protein backbone that alters the active site geometry. In the third case, we demonstrate the key role of MD in combination with crystallography to identify the origins of substrate-dependent stereoselectivities in a number of Codexis-engineered ketoreductases, one of which is used commercially for the production of the antibiotic sulopenem. Here, mutations alter the shape of the active site as well as the accessibility of water to different regions of it. Each of these examples reveals something different about how mutations can influence enzyme activity and shows that directed evolution, like natural evolution, can increase catalytic activity in a variety of remarkable and often subtle ways.

E2F1 somatic mutation within miRNA target site impairs gene regulation in colorectal cancer.

PubMed

Lopes-Ramos, Camila M; Barros, Bruna P; Koyama, Fernanda C; Carpinetti, Paola A; Pezuk, Julia; Doimo, Nayara T S; Habr-Gama, Angelita; Perez, Rodrigo O; Parmigiani, Raphael B

2017-01-01

Genetic studies have largely concentrated on the impact of somatic mutations found in coding regions, and have neglected mutations outside of these. However, 3' untranslated regions (3' UTR) mutations can also disrupt or create miRNA target sites, and trigger oncogene activation or tumor suppressor inactivation. We used next-generation sequencing to widely screen for genetic alterations within predicted miRNA target sites of oncogenes associated with colorectal cancer, and evaluated the functional impact of a new somatic mutation. Target sequencing of 47 genes was performed for 29 primary colorectal tumor samples. For 71 independent samples, Sanger methodology was used to screen for E2F1 mutations in miRNA predicted target sites, and the functional impact of these mutations was evaluated by luciferase reporter assays. We identified germline and somatic alterations in E2F1. Of the 100 samples evaluated, 3 had germline alterations at the MIR205-5p target site, while one had a somatic mutation at MIR136-5p target site. E2F1 gene expression was similar between normal and tumor tissues bearing the germline alteration; however, expression was increased 4-fold in tumor tissue that harbored a somatic mutation compared to that in normal tissue. Luciferase reporter assays revealed both germline and somatic alterations increased E2F1 activity relative to wild-type E2F1. We demonstrated that somatic mutation within E2F1:MIR136-5p target site impairs miRNA-mediated regulation and leads to increased gene activity. We conclude that somatic mutations that disrupt miRNA target sites have the potential to impact gene regulation, highlighting an important mechanism of oncogene activation.

Mechanistic Insight from Calorimetric Measurements of the Assembly of the Binuclear Metal Active Site of Glycerophosphodiesterase (GpdQ) from Enterobacter aerogenes.

PubMed

Pedroso, Marcelo M; Ely, Fernanda; Carpenter, Margaret C; Mitić, Nataša; Gahan, Lawrence R; Ollis, David L; Wilcox, Dean E; Schenk, Gerhard

2017-07-05

Glycerophosphodiesterase (GpdQ) from Enterobacter aerogenes is a binuclear metallohydrolase with a high affinity for metal ions at its α site but a lower affinity at its β site in the absence of a substrate. Isothermal titration calorimetry (ITC) has been used to quantify the Co(II) and Mn(II) binding affinities and thermodynamics of the two sites in wild-type GpdQ and two mutants, both in the absence and in the presence of phosphate. Metal ions bind to the six-coordinate α site in an entropically driven process with loss of a proton, while binding at the β site is not detected by ITC. Phosphate enhances the metal affinity of the α site by increasing the binding entropy and the metal affinity of the β site by enthalpic (Co) or entropic (Mn) contributions, but no additional loss of protons. Mutations of first- and second-coordination sphere residues at the β site increase the metal affinity of both sites by enhancing the binding enthalpy. In particular, loss of the hydrogen bond from second-sphere Ser127 to the metal-coordinating Asn80 has a significant effect on the metal binding thermodynamics that result in a resting binuclear active site with high catalytic activity. While structural and spectroscopic data with excess metal ions have indicated a bridging hydroxide in the binuclear GpdQ site, analysis of ITC data here reveals the loss of a single proton in the assembly of this site, indicating that the metal-bound hydroxide nucleophile is formed in the resting inactive mononuclear form, which becomes catalytically competent upon binding the second metal ion.

Battling Btk Mutants With Noncovalent Inhibitors That Overcome Cys481 and Thr474 Mutations.

PubMed

Johnson, Adam R; Kohli, Pawan Bir; Katewa, Arna; Gogol, Emily; Belmont, Lisa D; Choy, Regina; Penuel, Elicia; Burton, Luciana; Eigenbrot, Charles; Yu, Christine; Ortwine, Daniel F; Bowman, Krista; Franke, Yvonne; Tam, Christine; Estevez, Alberto; Mortara, Kyle; Wu, Jiansheng; Li, Hong; Lin, May; Bergeron, Philippe; Crawford, James J; Young, Wendy B

2016-10-21

The Bruton's tyrosine kinase (Btk) inhibitor ibrutinib has shown impressive clinical efficacy in a range of B-cell malignancies. However, acquired resistance has emerged, and second generation therapies are now being sought. Ibrutinib is a covalent, irreversible inhibitor that modifies Cys481 in the ATP binding site of Btk and renders the enzyme inactive, thereby blocking B-cell receptor signal transduction. Not surprisingly, Cys481 is the most commonly mutated Btk residue in cases of acquired resistance to ibrutinib. Mutations at other sites, including Thr474, a gatekeeper residue, have also been detected. Herein, we describe noncovalent Btk inhibitors that differ from covalent inhibitors like ibrutinib in that they do not interact with Cys481, they potently inhibit the ibrutinib-resistant Btk C481S mutant in vitro and in cells, and they are exquisitely selective for Btk. Noncovalent inhibitors such as GNE-431 also show excellent potency against the C481R, T474I, and T474M mutants. X-ray crystallographic analysis of Btk provides insight into the unique mode of binding of these inhibitors that explains their high selectivity for Btk and their retained activity against mutant forms of Btk. This class of noncovalent Btk inhibitors may provide a treatment option to patients, especially those who have acquired resistance to ibrutinib by mutation of Cys481 or Thr474.

Human deoxyhaemoglobin-2,3-diphosphoglycerate complex low-salt structure at 2.5 A resolution.

PubMed

Richard, V; Dodson, G G; Mauguen, Y

1993-09-20

The haemoglobin-2,3-diphosphoglycerate complex structure has been solved at 2.5 A resolution using crystals grown from low-salt solutions. The results show some important differences with the precedent haemoglobin-2,3-diphosphoglycerate high-salt structure solved by Arnone. First, we observe a loss of symmetry in the binding site, secondly both of the lysine residues 82 beta interact with 2,3-diphosphoglycerate at the same time, each making two contacts. This level of interaction is in agreement with the functional behaviour of natural haemoglobin mutants with mutations at the 2,3-diphosphoglycerate binding site.

Dominant Drop mutants are gain-of-function alleles of the muscle segment homeobox gene (msh) whose overexpression leads to the arrest of eye development.

PubMed

Mozer, B A

2001-05-15

Dominant Drop (Dr) mutations are nearly eyeless and have additional recessive phenotypes including lethality and patterning defects in eye and sensory bristles due to cis-regulatory lesions in the cell cycle regulator string (stg). Genetic analysis demonstrates that the dominant small eye phenotype is the result of separate gain-of-function mutations in the closely linked muscle segment homeobox (msh) gene, encoding a homeodomain transcription factor required for patterning of muscle and nervous system. Reversion of the Dr(Mio) allele was coincident with the generation of lethal loss-of-function mutations in msh in cis, suggesting that the dominant eye phenotype is the result of ectopic expression. Molecular genetic analysis revealed that two dominant Dr alleles contain lesions upstream of the msh transcription start site. In the Dr(Mio) mutant, a 3S18 retrotransposon insertion is the target of second-site mutations (P-element insertions or deletions) which suppress the dominant eye phenotype following reversion. The pattern of 3S18 expression and the absence of msh in eye imaginal discs suggest that transcriptional activation of the msh promoter accounts for ectopic expression. Dr dominant mutations arrest eye development by blocking the progression of the morphogenetic furrow leading to photoreceptor cell loss via apoptosis. Gal4-mediated ubiquitous expression of msh in third-instar larvae was sufficient to arrest the morphogenetic furrow in the eye imaginal disc and resulted in lethality prior to eclosion. Dominant mutations in the human msx2 gene, one of the vertebrate homologs of msh, are associated with craniosynostosis, a disease affecting cranial development. The Dr mutations are the first example of gain-of-function mutations in the msh/msx gene family identified in a genetically tractible model organism and may serve as a useful tool to identify additional genes that regulate this class of homeodomain proteins. Copyright 2001 Academic Press.

Mutation screening of the HGD gene identifies a novel alkaptonuria mutation with significant founder effect and high prevalence.

PubMed

Sakthivel, Srinivasan; Zatkova, Andrea; Nemethova, Martina; Surovy, Milan; Kadasi, Ludevit; Saravanan, Madurai P

2014-05-01

Alkaptonuria (AKU) is an autosomal recessive disorder; caused by the mutations in the homogentisate 1, 2-dioxygenase (HGD) gene located on Chromosome 3q13.33. AKU is a rare disorder with an incidence of 1: 250,000 to 1: 1,000,000, but Slovakia and the Dominican Republic have a relatively higher incidence of 1: 19,000. Our study focused on studying the frequency of AKU and identification of HGD gene mutations in nomads. HGD gene sequencing was used to identify the mutations in alkaptonurics. For the past four years, from subjects suspected to be clinically affected, we found 16 positive cases among a randomly selected cohort of 41 Indian nomads (Narikuravar) settled in the specific area of Tamil Nadu, India. HGD gene mutation analysis showed that 11 of these patients carry the same homozygous splicing mutation c.87 + 1G > A; in five cases, this mutation was found to be heterozygous, while the second AKU-causing mutation was not identified in these patients. This result indicates that the founder effect and high degree of consanguineous marriages have contributed to AKU among nomads. Eleven positive samples were homozygous for a novel mutation c.87 + 1G > A, that abolishes an intron 2 donor splice site and most likely causes skipping of exon 2. The prevalence of AKU observed earlier seems to be highly increased in people of nomadic origin. © 2014 John Wiley & Sons Ltd/University College London.

Influence of Coherent Tunneling and Incoherent Hopping on the Charge Transfer Mechanism in Linear Donor-Bridge-Acceptor Systems.

PubMed

Li, Guangqi; Govind, Niranjan; Ratner, Mark A; Cramer, Christopher J; Gagliardi, Laura

2015-12-17

The mechanism of charge transfer has been observed to change from tunneling to hopping with increasing numbers of DNA base pairs in polynucleotides and with the length of molecular wires. The aim of this paper is to investigate this transition by examining the population dynamics using a tight-binding Hamiltonian with model parameters to describe a linear donor-bridge-acceptor (D-B-A) system. The model includes a primary vibration and an electron-vibration coupling at each site. A further coupling of the primary vibration with a secondary phonon bath allows the system to dissipate energy to the environment and reach a steady state. We apply the quantum master equation (QME) approach, based on second-order perturbation theory in a quantum dissipative system, to examine the dynamical processes involved in charge-transfer and follow the population transfer rate at the acceptor, ka, to shed light on the transition from tunneling to hopping. With a small tunneling parameter, V, the on-site population tends to localize and form polarons, and the hopping mechanism dominates the transfer process. With increasing V, the population tends to be delocalized and the tunneling mechanism dominates. The competition between incoherent hopping and coherent tunneling governs the mechanism of charge transfer. By varying V and the total number of sites, we also examine the onset of the transition from tunneling to hopping with increasing length.

A mutational analysis and molecular dynamics simulation of quinolone resistance proteins QnrA1 and QnrC from Proteus mirabilis.

PubMed

Guo, Qinglan; Weng, Jingwei; Xu, Xiaogang; Wang, Minghua; Wang, Xiaoying; Ye, Xinyu; Wang, Wenning; Wang, Minggui

2010-10-08

The first report on the transferable, plasmid-mediated quinolone-resistance determinant qnrA1 was in 1998. Since then, qnr alleles have been discovered worldwide in clinical strains of Gram-negative bacilli. Qnr proteins confer quinolone resistance, and belong to the pentapeptide repeat protein (PRP) family. Several PRP crystal structures have been solved, but little is known about the functional significance of their structural arrangement. We conducted random and site-directed mutagenesis on qnrA1 and on qnrC, a newly identified quinolone-resistance gene from Proteus mirabilis. Many of the Qnr mutants lost their quinolone resistance function. The highly conserved hydrophobic Leu or Phe residues at the center of the pentapeptide repeats are known as i sites, and loss-of-function mutations included replacement of the i site hydrophobic residues with charged residues, replacing the i-2 site, N-terminal to the i residues, with bulky side-chain residues, introducing Pro into the β-helix coil, deletion of the N- and C-termini, and excision of a central coil. Molecular dynamics simulations and homology modeling demonstrated that QnrC overall adopts a stable β-helix fold and shares more similarities with MfpA than with other PRP structures. Based on homology modeling and molecular dynamics simulation, the dysfunctional point mutations introduced structural deformations into the quadrilateral β-helix structure of PRPs. Of the pentapeptides of QnrC, two-thirds adopted a type II β-turn, while the rest adopted type IV turns. A gap exists between coil 2 and coil 3 in the QnrC model structure, introducing a structural flexibility that is similar to that seen in MfpA. The hydrophobic core and the β-helix backbone conformation are important for maintaining the quinolone resistance property of Qnr proteins. QnrC may share structural similarity with MfpA.

Looking for the optimal rate of recombination for evolutionary dynamics

NASA Astrophysics Data System (ADS)

Saakian, David B.

2018-01-01

We consider many-site mutation-recombination models of evolution with selection. We are looking for situations where the recombination increases the mean fitness of the population, and there is an optimal recombination rate. We found two fitness landscapes supporting such nonmonotonic behavior of the mean fitness versus the recombination rate. The first case is related to the evolution near the error threshold on a neutral-network-like fitness landscape, for moderate genome lengths and large population. The more realistic case is the second one, in which we consider the evolutionary dynamics of a finite population on a rugged fitness landscape (the smooth fitness landscape plus some random contributions to the fitness). We also give the solution to the horizontal gene transfer model in the case of asymmetric mutations. To obtain nonmonotonic behavior for both mutation and recombination, we need a specially designed (ideal) fitness landscape.

Further confirmation of the MED13L haploinsufficiency syndrome.

PubMed

van Haelst, Mieke M; Monroe, Glen R; Duran, Karen; van Binsbergen, Ellen; Breur, Johannes M; Giltay, Jacques C; van Haaften, Gijs

2015-01-01

MED13L haploinsufficiency syndrome has been described in two patients and is characterized by moderate intellectual disability (ID), conotruncal heart defects, facial abnormalities and hypotonia. Missense mutations in MED13L are linked to transposition of the great arteries and non-syndromal intellectual disability. Here we describe two novel patients with de novo MED13L aberrations. The first patient has a de novo mutation in the splice acceptor site of exon 5 of MED13L. cDNA analysis showed this mutation results in an in-frame deletion, removing 15 amino acids in middle of the conserved MED13L N-terminal domain. The second patient carries a de novo deletion of exons 6-20 of MED13L. Both patients show features of the MED13L haploinsufficiency syndrome, except for the heart defects, thus further confirming the existence of the MED13L haploinsufficiency syndrome.

First report of HGD mutations in a Chinese with alkaptonuria.

PubMed

Yang, Yong-jia; Guo, Ji-hong; Chen, Wei-jian; Zhao, Rui; Tang, Jin-song; Meng, Xiao-hua; Zhao, Liu; Tu, Ming; He, Xin-yu; Wu, Ling-qian; Zhu, Yi-min

2013-04-15

Alkaptonuria (AKU) is one of the first prototypic inborn errors in metabolism and the first human disease found to be transmitted via Mendelian autosomal recessive inheritance. It is caused by HGD mutations, which leads to a deficiency in homogentisate 1,2-dioxygenase (HGD) activity. To date, several HGD mutations have been identified as the cause of the prototypic disease across different ethnic populations worldwide. However, in Asia, the HGD mutation is very rarely reported. For the Chinese population, no literature on HGD mutation screening is available to date. In this paper, we describe two novel HGD mutations in a Chinese AKU family, the splicing mutation of IVS7+1G>C, a donor splice site of exon 7, and a missense mutation of F329C in exon 12. The predicted new splicing site of the mutated exon 7 sequence demonstrated a 303bp extension after the mutation site. The F329C mutation most probably disturbed the stability of the conformation of the two loops critical to the Fe(2+) active site of the HGD enzyme. Copyright © 2013 Elsevier B.V. All rights reserved.

Rules of co-occurring mutations characterize the antigenic evolution of human influenza A/H3N2, A/H1N1 and B viruses.

PubMed

Chen, Haifen; Zhou, Xinrui; Zheng, Jie; Kwoh, Chee-Keong

2016-12-05

The human influenza viruses undergo rapid evolution (especially in hemagglutinin (HA), a glycoprotein on the surface of the virus), which enables the virus population to constantly evade the human immune system. Therefore, the vaccine has to be updated every year to stay effective. There is a need to characterize the evolution of influenza viruses for better selection of vaccine candidates and the prediction of pandemic strains. Studies have shown that the influenza hemagglutinin evolution is driven by the simultaneous mutations at antigenic sites. Here, we analyze simultaneous or co-occurring mutations in the HA protein of human influenza A/H3N2, A/H1N1 and B viruses to predict potential mutations, characterizing the antigenic evolution. We obtain the rules of mutation co-occurrence using association rule mining after extracting HA1 sequences and detect co-mutation sites under strong selective pressure. Then we predict the potential drifts with specific mutations of the viruses based on the rules and compare the results with the "observed" mutations in different years. The sites under frequent mutations are in antigenic regions (epitopes) or receptor binding sites. Our study demonstrates the co-occurring site mutations obtained by rule mining can capture the evolution of influenza viruses, and confirms that cooperative interactions among sites of HA1 protein drive the influenza antigenic evolution.

Structural insight with mutational impact on tyrosinase and PKC-β interaction from Homo sapiens: Molecular modeling and docking studies for melanogenesis, albinism and increased risk for melanoma.

PubMed

Banerjee, Arundhati; Ray, Sujay

2016-10-30

Human tyrosinase, is an important protein for biosynthetic pathway of melanin. It was studied to be phosphorylated and activated by protein kinase-C, β-subunit (PKC-β) through earlier experimentations with in vivo evidences. Documentation documents that mutation in two essentially vital serine residues in C-terminal end of tyrosinase leads to albinism. Due to the deficiency of protective shield like enzyme; melanin, albinos are at an increased peril for melanoma and other skin cancers. So, computational and residue-level insight including a mutational exploration with evolutionary importance into this mechanism lies obligatory for future pathological and therapeutic developments. Therefore, functional tertiary models of the relevant proteins were analyzed after satisfying their stereo-chemical features. Evolutionarily paramount residues for the activation of tyrosinase were perceived via multiple sequence alignment phenomena. Mutant-type tyrosinase protein (S98A and S102A) was thereby modeled, maintaining the wild-type proteins' functionality. Furthermore, this present comparative study discloses the variation in the stable residual participation (for mutant-type and wild-type tyrosinase-PKCβ complex). Mainly, an increased number of polar negatively charged residues from the wild-type tyrosinase participated with PKC-β, predominantly. Fascinatingly supported by evaluation of statistical significances, mutation even led to a destabilizing impact in tyrosinase accompanied by conformational switches with a helix-to-coil transition in the mutated protein. Even the allosteric sites in the protein got poorly hampered upon mutation leading to weaker tendency for binding partners to interact. Copyright © 2016 Elsevier B.V. All rights reserved.

Laboratory studies of aerosol electrification and experimental evidence for electrical breakdown at different scales.

NASA Astrophysics Data System (ADS)

Alois, Stefano; Merrison, Jonathan; Iversen, Jens Jacob; Sesterhenn, Joern

2017-04-01

Contact electrification between different particles size/material can lead to electric field generation high enough to produce electrical breakdown. Experimental studies of solid aerosol contact electrification (Alois et al., 2016) has shown various electrical breakdown phenomena; these range from field emission at the contact site (nm-scale) limiting particle surface charge concentration, to visible electrical discharges (cm-scale) observed both with the use of an electrometer and high-speed camera. In these experiments micron-size particles are injected into a low-pressure chamber, where they are deviated by an applied electric field. A laser Doppler velocimeter allows the simultaneous determination of particle size and charge of single grains. Results have shown an almost constant surface charge concentration, which is likely to be due to charge limitation by field emission at the contact site between particle and injector. In a second measurement technique, the electrically isolated injector tube (i.e. a Faraday cage) is connected to an oscilloscope and synchronised to a high speed camera filming the injection. Here the electrification of a large cloud of particles can be quantified and discharging effects studied. This study advances our understanding on the physical processes leading to electrification and electrical breakdown mechanisms.

Novel MSH2 splice-site mutation in a young patient with Lynch syndrome

PubMed Central

Liccardo, Raffaella; De Rosa, Marina; Izzo, Paola; Duraturo, Francesca

2018-01-01

Lynch Syndrome (LS) is associated with germline mutations in one of the mismatch repair (MMR) genes, including MutL homolog 1 (MLH1), MutS homolog 2 (MSH2), MSH6, PMS1 homolog 2, mismatch repair system component (PMS2), MLH3 and MSH3. The mutations identified in MMR genes are point mutations or large rearrangements. The point mutations are certainly pathogenetic whether they determine formation of truncated protein. The mutations that arise in splice sites are classified as ‘likely pathogenic’ variants. In the present study, a novel splicing mutation was identified, (named c.212-1g>a), in the MSH2 gene. This novel mutation in the consensus splice site of MSH2 exon 2 leads to the loss of the canonical splice site, without skipping in-frame of exon 2; also with the formation of 2 aberrant transcripts, due to the activation of novel splice sites in exon 2. This mutation was identified in a young patient who developed colon cancer at the age of 26 years and their belongs to family that met the ‘Revised Amsterdam Criteria’. The present study provided insight into the molecular mechanism determining the pathogenicity of this novel MSH2 mutation and it reaffirms the importance of genetic testing in LS. PMID:29568967

ATP hydrolysis in Eg5 kinesin involves a catalytic two-water mechanism.

PubMed

Parke, Courtney L; Wojcik, Edward J; Kim, Sunyoung; Worthylake, David K

2010-02-19

Motor proteins couple steps in ATP binding and hydrolysis to conformational switching both in and remote from the active site. In our kinesin.AMPPPNP crystal structure, closure of the active site results in structural transformations appropriate for microtubule binding and organizes an orthosteric two-water cluster. We conclude that a proton is shared between the lytic water, positioned for gamma-phosphate attack, and a second water that serves as a general base. To our knowledge, this is the first experimental detection of the catalytic base for any ATPase. Deprotonation of the second water by switch residues likely triggers subsequent large scale structural rearrangements. Therefore, the catalytic base is responsible for initiating nucleophilic attack of ATP and for relaying the positive charge over long distances to initiate mechanotransduction. Coordination of switch movements via sequential proton transfer along paired water clusters may be universal for nucleotide triphosphatases with conserved active sites, such as myosins and G-proteins.

Combinatorial mutagenesis of the voltage-sensing domain enables the optical resolution of action potentials firing at 60 Hz by a genetically encoded fluorescent sensor of membrane potential.

PubMed

Piao, Hong Hua; Rajakumar, Dhanarajan; Kang, Bok Eum; Kim, Eun Ha; Baker, Bradley J

2015-01-07

ArcLight is a genetically encoded fluorescent voltage sensor using the voltage-sensing domain of the voltage-sensing phosphatase from Ciona intestinalis that gives a large but slow-responding optical signal in response to changes in membrane potential (Jin et al., 2012). Fluorescent voltage sensors using the voltage-sensing domain from other species give faster yet weaker optical signals (Baker et al., 2012; Han et al., 2013). Sequence alignment of voltage-sensing phosphatases from different species revealed conserved polar and charged residues at 7 aa intervals in the S1-S3 transmembrane segments of the voltage-sensing domain, suggesting potential coil-coil interactions. The contribution of these residues to the voltage-induced optical signal was tested using a cassette mutagenesis screen by flanking each transmembrane segment with unique restriction sites to allow for the testing of individual mutations in each transmembrane segment, as well as combinations in all four transmembrane segments. Addition of a counter charge in S2 improved the kinetics of the optical response. A double mutation in the S4 domain dramatically reduced the slow component of the optical signal seen in ArcLight. Combining that double S4 mutant with the mutation in the S2 domain yielded a probe with kinetics <10 ms. Optimization of the linker sequence between S4 and the fluorescent protein resulted in a new ArcLight-derived probe, Bongwoori, capable of resolving action potentials in a hippocampal neuron firing at 60 Hz. Additional manipulation of the voltage-sensing domain could potentially lead to fluorescent sensors capable of optically resolving neuronal inhibition and subthreshold synaptic activity. Copyright © 2015 the authors 0270-6474/15/350372-15$15.00/0.

Expanding the Catalytic Triad in Epoxide Hydrolases and Related Enzymes.

PubMed

Amrein, Beat A; Bauer, Paul; Duarte, Fernanda; Janfalk Carlsson, Åsa; Naworyta, Agata; Mowbray, Sherry L; Widersten, Mikael; Kamerlin, Shina C L

2015-10-02

Potato epoxide hydrolase 1 exhibits rich enantio- and regioselectivity in the hydrolysis of a broad range of substrates. The enzyme can be engineered to increase the yield of optically pure products as a result of changes in both enantio- and regioselectivity. It is thus highly attractive in biocatalysis, particularly for the generation of enantiopure fine chemicals and pharmaceuticals. The present work aims to establish the principles underlying the activity and selectivity of the enzyme through a combined computational, structural, and kinetic study using the substrate trans -stilbene oxide as a model system. Extensive empirical valence bond simulations have been performed on the wild-type enzyme together with several experimentally characterized mutants. We are able to computationally reproduce the differences between the activities of different stereoisomers of the substrate and the effects of mutations of several active-site residues. In addition, our results indicate the involvement of a previously neglected residue, H104, which is electrostatically linked to the general base H300. We find that this residue, which is highly conserved in epoxide hydrolases and related hydrolytic enzymes, needs to be in its protonated form in order to provide charge balance in an otherwise negatively charged active site. Our data show that unless the active-site charge balance is correctly treated in simulations, it is not possible to generate a physically meaningful model for the enzyme that can accurately reproduce activity and selectivity trends. We also expand our understanding of other catalytic residues, demonstrating in particular the role of a noncanonical residue, E35, as a "backup base" in the absence of H300. Our results provide a detailed view of the main factors driving catalysis and regioselectivity in this enzyme and identify targets for subsequent enzyme design efforts.

The iron-sulfur cluster of electron transfer flavoprotein-ubiquinone oxidoreductase is the electron acceptor for electron transfer flavoprotein.

PubMed

Swanson, Michael A; Usselman, Robert J; Frerman, Frank E; Eaton, Gareth R; Eaton, Sandra S

2008-08-26

Electron transfer flavoprotein-ubiquinone oxidoreductase (ETF-QO) accepts electrons from electron transfer flavoprotein (ETF) and reduces ubiquinone from the ubiquinone pool. It contains one [4Fe-4S] (2+,1+) and one FAD, which are diamagnetic in the isolated oxidized enzyme and can be reduced to paramagnetic forms by enzymatic donors or dithionite. In the porcine protein, threonine 367 is hydrogen bonded to N1 and O2 of the flavin ring of the FAD. The analogous site in Rhodobacter sphaeroides ETF-QO is asparagine 338. Mutations N338T and N338A were introduced into the R. sphaeroides protein by site-directed mutagenesis to determine the impact of hydrogen bonding at this site on redox potentials and activity. The mutations did not alter the optical spectra, EPR g-values, spin-lattice relaxation rates, or the [4Fe-4S] (2+,1+) to FAD point-dipole interspin distances. The mutations had no impact on the reduction potential for the iron-sulfur cluster, which was monitored by changes in the continuous wave EPR signals of the [4Fe-4S] (+) at 15 K. For the FAD semiquinone, significantly different potentials were obtained by monitoring the titration at 100 or 293 K. Based on spectra at 293 K the N338T mutation shifted the first and second midpoint potentials for the FAD from +47 and -30 mV for wild type to -11 and -19 mV, respectively. The N338A mutation decreased the potentials to -37 and -49 mV. Lowering the midpoint potentials resulted in a decrease in the quinone reductase activity and negligible impact on disproportionation of ETF 1e (-) catalyzed by ETF-QO. These observations indicate that the FAD is involved in electron transfer to ubiquinone but not in electron transfer from ETF to ETF-QO. Therefore, the iron-sulfur cluster is the immediate acceptor from ETF.

The Iron-Sulfur Cluster of Electron Transfer Flavoprotein-Ubiquinone Oxidoreductase Is the Electron Acceptor for Electron Transfer Flavoprotein†

PubMed Central

Swanson, Michael A.; Usselman, Robert J.; Frerman, Frank E.; Eaton, Gareth R.; Eaton, Sandra S.

2009-01-01

Electron transfer flavoprotein-ubiquinone oxidoreductase (ETF-QO) accepts electrons from electron transfer flavoprotein (ETF) and reduces ubiquinone from the ubiquinone pool. It contains one [4Fe-4S]2+,1+ and one FAD, which are diamagnetic in the isolated oxidized enzyme and can be reduced to paramagnetic forms by enzymatic donors or dithionite. In the porcine protein, threonine 367 is hydrogen bonded to N1 and O2 of the flavin ring of the FAD. The analogous site in Rhodobacter sphaeroides ETF-QO is asparagine 338. Mutations N338T and N338A were introduced into the R. sphaeroides protein by site-directed mutagenesis to determine the impact of hydrogen bonding at this site on redox potentials and activity. The mutations did not alter the optical spectra, EPR g-values, spin-lattice relaxation rates, or the [4Fe-4S]2+,1+ to FAD point-dipole interspin distances. The mutations had no impact on the reduction potential for the iron-sulfur cluster, which was monitored by changes in the continuous wave EPR signals of the [4Fe-4S]+ at 15 K. For the FAD semiquinone, significantly different potentials were obtained by monitoring the titration at 100 or 293 K. Based on spectra at 293 K the N338T mutation shifted the first and second midpoint potentials for the FAD from +47 and -30 mV for wild type to -11 and -19 mV, respectively. The N338A mutation decreased the potentials to -37 and -49 mV. Lowering the midpoint potentials resulted in a decrease in the quinone reductase activity and negligible impact on disproportionation of ETF1e- catalyzed by ETF-QO. These observations indicate that the FAD is involved in electron transfer to ubiquinone but not in electron transfer from ETF to ETF-QO. Therefore, the iron-sulfur cluster is the immediate acceptor from ETF. PMID:9585549

Gorlin syndrome with an ovarian leiomyoma associated with a PTCH1 second hit.

PubMed

Akizawa, Yoshika; Miyashita, Toshiyuki; Sasaki, Ryo; Nagata, Reiko; Aoki, Ryoko; Ishitani, Ken; Nagashima, Yoji; Matsui, Hideo; Saito, Kayoko

2016-04-01

We describe a Gorlin syndrome (GS) case with two different second hit mutations of PTCH1, one in a keratocystic odontogenic tumor (KCOT) and the other in an ovarian leiomyoma. GS is a rare genetic condition manifesting as multiple basal cell nevi associated with other features such as medulloblastomas, skeletal abnormalities, and ovarian fibromas. A 21-year-old Japanese woman with a history of two KCOTs was diagnosed with GS according to clinical criteria. A PTCH1 mutation, c.1427del T, was detected in peripheral blood. A novel PTCH1 mutation, c.264_265insAATA, had been found in the maxillary KCOT as a second hit mutation. More recently, the ovarian tumor was detected during a gynecological examination. Laparoscopic adnexectomy was performed, and the pathological diagnosis of the ovarian tumor was leiomyoma. Interestingly, another novel mutation, loss of heterozygosity spanning from 9q22.32 to 9q31.2, including PTCH1 and 89 other genes, was detected in this ovarian tumor, providing evidence of a second hit mutation. This is the first report describing a GS-associated ovarian tumor carrying a second hit in the PTCH1 region. We anticipate that accumulation of more cases will clarify the importance of second hit mutations in ovarian tumor formation in GS. © 2016 Wiley Periodicals, Inc.

Mutations in new cell cycle genes that fail to complement a multiply mutant third chromosome of Drosophila.

PubMed

White-Cooper, H; Carmena, M; Gonzalez, C; Glover, D M

1996-11-01

We have simultaneously screened for new alleles and second site mutations that fail to complement five cell cycle mutations of Drosphila carried on a single third chromosome (gnu, polo, mgr, asp, stg). Females that are either transheterozygous for scott of the antartic (scant) and polo, or homozygous for scant produce embryos that show mitotic defects. A maternal effect upon embryonic mitoses is also seen in embryos derived from females transheterozygous with helter skelter (hsk) and either mgr or asp. cleopatra (cleo), fails to complement asp but is not uncovered by a deficiency for asp. The mitotic phenotype of larvae heterozygous for cleo and the multiple mutant chromosome is similar to weak alleles of asp, but there are no defects in male meiosis. Mutations that failed to complement stg fell into two complementation groups corresponding to stg and a new gene noose. Three of the new stg alleles are early zygotic lethals, whereas the fourth is a pharate adult lethal allele that affects both mitosis and meiosis. Mutations in noose fully complement a small deficiency that removes stg, but when placed in trans to certain stg alleles, result in late lethality and mitotic abnormalities in larval brains.

Characterisation of four novel fibrillin-1 (FBN1) mutations in Marfan syndrome.

PubMed Central

Adès, L C; Haan, E A; Colley, A F; Richard, R I

1996-01-01

Forty-four percent of the fibrillin-1 gene (FBN1) from 19 unrelated families with Marfan syndrome was screened for putative mutations by single strand conformational polymorphism (SSCP) analysis. Four novel mutations were identified and characterised in five people, three with classical Marfan syndrome (two from one family, and one from an unrelated family), one with a more severe phenotype, and one with neonatal Marfan syndrome. The base substitutions G2113A, G2132A, T3163G, and G3458A result in amino acid substitutions A705T, C711Y, C1055G, and C1152Y, respectively. C711Y, C1055G, and C1152Y lead to replacement of a cysteine by another amino acid; the latter two occur within epidermal growth factor-like motifs in exon 25 and 27, respectively. The A705T mutation occurs at exon 16 adjacent to the GT splice site. The A705T and C711Y mutations, at exon 16 and 17, respectively, are the first documented in the second transforming growth factor-beta 1 binding protein-like motif of FBN1. Images PMID:8863159

Amino acid contribution to protein solubility: Asp, Glu, and Ser contribute more favorably than the other hydrophilic amino acids in RNase Sa

PubMed Central

Trevino, Saul R.; Scholtz, J. Martin; Pace, C. Nick

2009-01-01

SUMMARY Poor protein solubility is a common problem in high resolution structural studies, formulation of protein pharmaceuticals, and biochemical characterization of proteins. One popular strategy to improve protein solubility is to use site-directed mutagenesis to make hydrophobic to hydrophilic mutations on the protein surface. However, a systematic investigation of the relative contributions of all twenty amino acids to protein solubility has not been done. Here, twenty variants at the completely solvent-exposed position 76 of Ribonuclease (RNase) Sa are made to compare the contributions of each amino acid. Stability measurements were also made for these variants, which occur at the i+1 position of a type II β-turn. Solubility measurements in ammonium sulfate solutions were made at high positive net charge, low net charge, and high negative net charge. Surprisingly, there was a wide range of contributions to protein solubility even among the hydrophilic amino acids. The results suggest that aspartic acid, glutamic acid, and serine contribute significantly more favorably than the other hydrophilic amino acids especially at high net charge. Therefore, to increase protein solubility, asparagine, glutamine, or threonine should be replaced with aspartic acid, glutamic acid or serine. PMID:17174328

DOE Office of Scientific and Technical Information (OSTI.GOV)

Petroulakis, E.; Cao, Z.; Salo, T.

Mutations in the HEXA gene that encodes the {alpha}-subunit of the heterodimeric lysosomal enzyme {beta}-hexosaminidase A, or Hex A ({alpha}{beta}), cause G{sub M2} gangliosidosis, type 1. The infantile form (Tay-Sachs disease) results when there is no residual Hex A activity, while less severe and more variable clinical phenotypes result when residual Hex A activity is present. A non-Jewish male who presented with an acute psychotic episode at age 16 was diagnosed with a subacute encephalopathic form of G{sub M2} gangliosidosis. At age 19, chronic psychosis with intermittent acute exacerbations remains the most disabling symptom in this patient and his affectedmore » brother although both exhibit some ataxia and moderately severe dysarthria. We have found a 4 bp insertion (+TATC 1278) associated with infantile Tay-Sachs disease on one allele; no previously identified mutation was found on the second allele. SSCP analysis detected a shift in exon 13 and sequencing revealed a G1422C mutation in the second allele that results in a Trp474Cys substitution. The presence of the mutation was confirmed by the loss of HaeIII and ScrFI sites in exon 13 PCR products from the subjects and their father. The mutation was introduced into the {alpha}-subunit cDNA and Hex S ({alpha}{alpha}) and Hex A ({alpha}{beta}) were transiently expressed in monkey COS-7 cells. The Trp474Cys mutant protein had approximately 5% and 12% of wild-type Hex S and Hex A activity, respectively. Western blot analysis revealed a small amount of residual mature {alpha}-subunit and a normal level of precursor protein. We conclude that the Trp474Cys mutation is the cause of the Hex A deficiency associated with a subacute (juvenile-onset) phenotype in this patient. Like other mutations in exon 13 of HEXA, it appears to affect intracellular processing. Studies of the defect in intracellular processing are in progress.« less

The two Na+ sites in the human serotonin transporter play distinct roles in the ion coupling and electrogenicity of transport.

PubMed

Felts, Bruce; Pramod, Akula Bala; Sandtner, Walter; Burbach, Nathan; Bulling, Simon; Sitte, Harald H; Henry, L Keith

2014-01-17

Neurotransmitter transporters of the SLC6 family of proteins, including the human serotonin transporter (hSERT), utilize Na(+), Cl(-), and K(+) gradients to induce conformational changes necessary for substrate translocation. Dysregulation of ion movement through monoamine transporters has been shown to impact neuronal firing potentials and could play a role in pathophysiologies, such as depression and anxiety. Despite multiple crystal structures of prokaryotic and eukaryotic SLC transporters indicating the location of both (or one) conserved Na(+)-binding sites (termed Na1 and Na2), much remains uncertain in regard to the movements and contributions of these cation-binding sites in the transport process. In this study, we utilize the unique properties of a mutation of hSERT at a single, highly conserved asparagine on TM1 (Asn-101) to provide several lines of evidence demonstrating mechanistically distinct roles for Na1 and Na2. Mutations at Asn-101 alter the cation dependence of the transporter, allowing Ca(2+) (but not other cations) to functionally replace Na(+) for driving transport and promoting 5-hydroxytryptamine (5-HT)-dependent conformational changes. Furthermore, in two-electrode voltage clamp studies in Xenopus oocytes, both Ca(2+) and Na(+) illicit 5-HT-induced currents in the Asn-101 mutants and reveal that, although Ca(2+) promotes substrate-induced current, it does not appear to be the charge carrier during 5-HT transport. These findings, in addition to functional evaluation of Na1 and Na2 site mutants, reveal separate roles for Na1 and Na2 and provide insight into initiation of the translocation process as well as a mechanism whereby the reported SERT stoichiometry can be obtained despite the presence of two putative Na(+)-binding sites.

The Two Na+ Sites in the Human Serotonin Transporter Play Distinct Roles in the Ion Coupling and Electrogenicity of Transport*

PubMed Central

Felts, Bruce; Pramod, Akula Bala; Sandtner, Walter; Burbach, Nathan; Bulling, Simon; Sitte, Harald H.; Henry, L. Keith

2014-01-01

Neurotransmitter transporters of the SLC6 family of proteins, including the human serotonin transporter (hSERT), utilize Na+, Cl−, and K+ gradients to induce conformational changes necessary for substrate translocation. Dysregulation of ion movement through monoamine transporters has been shown to impact neuronal firing potentials and could play a role in pathophysiologies, such as depression and anxiety. Despite multiple crystal structures of prokaryotic and eukaryotic SLC transporters indicating the location of both (or one) conserved Na+-binding sites (termed Na1 and Na2), much remains uncertain in regard to the movements and contributions of these cation-binding sites in the transport process. In this study, we utilize the unique properties of a mutation of hSERT at a single, highly conserved asparagine on TM1 (Asn-101) to provide several lines of evidence demonstrating mechanistically distinct roles for Na1 and Na2. Mutations at Asn-101 alter the cation dependence of the transporter, allowing Ca2+ (but not other cations) to functionally replace Na+ for driving transport and promoting 5-hydroxytryptamine (5-HT)-dependent conformational changes. Furthermore, in two-electrode voltage clamp studies in Xenopus oocytes, both Ca2+ and Na+ illicit 5-HT-induced currents in the Asn-101 mutants and reveal that, although Ca2+ promotes substrate-induced current, it does not appear to be the charge carrier during 5-HT transport. These findings, in addition to functional evaluation of Na1 and Na2 site mutants, reveal separate roles for Na1 and Na2 and provide insight into initiation of the translocation process as well as a mechanism whereby the reported SERT stoichiometry can be obtained despite the presence of two putative Na+-binding sites. PMID:24293367

Arginine residues on the opposite side of the active site stimulate the catalysis of ribosome depurination by ricin A chain by interacting with the P-protein stalk.

PubMed

Li, Xiao-Ping; Kahn, Peter C; Kahn, Jennifer Nielsen; Grela, Przemyslaw; Tumer, Nilgun E

2013-10-18

Ricin inhibits protein synthesis by depurinating the α-sarcin/ricin loop (SRL). Ricin holotoxin does not inhibit translation unless the disulfide bond between the A (RTA) and B (RTB) subunits is reduced. Ricin holotoxin did not bind ribosomes or depurinate them but could depurinate free RNA. When RTA is separated from RTB, arginine residues located at the interface are exposed to the solvent. Because this positively charged region, but not the active site, is blocked by RTB, we mutated arginine residues at or near the interface of RTB to determine if they are critical for ribosome binding. These variants were structurally similar to wild type RTA but could not bind ribosomes. Their K(m) values and catalytic rates (k(cat)) for an SRL mimic RNA were similar to those of wild type, indicating that their activity was not altered. However, they showed an up to 5-fold increase in K(m) and up to 38-fold decrease in kcat toward ribosomes. These results suggest that the stalk binding stimulates the catalysis of ribosome depurination by RTA. The mutated arginines have side chains behind the active site cleft, indicating that the ribosome binding surface of RTA is on the opposite side of the surface that interacts with the SRL. We propose that stalk binding stimulates the catalysis of ribosome depurination by orienting the active site of RTA toward the SRL and thereby allows docking of the target adenine into the active site. This model may apply to the translation factors that interact with the stalk.

A prohormone convertase cleavage site within a predicted alpha-helix mediates sorting of the neuronal and endocrine polypeptide VGF into the regulated secretory pathway.

PubMed

Garcia, Angelo L; Han, Shan-Kuo; Janssen, William G; Khaing, Zin Z; Ito, Timothy; Glucksman, Marc J; Benson, Deanna L; Salton, Stephen R J

2005-12-16

Distinct intracellular pathways are involved in regulated and constitutive protein secretion from neuronal and endocrine cells, yet the peptide signals and molecular mechanisms responsible for targeting and retention of soluble proteins in secretory granules are incompletely understood. By using confocal microscopy and subcellular fractionation, we examined trafficking of the neuronal and endocrine peptide precursor VGF that is stored in large dense core vesicles and undergoes regulated secretion. VGF cofractionated with secretory vesicle membranes but was not detected in detergent-resistant lipid rafts. Deletional analysis using epitope-tagged VGF suggested that the C-terminal 73-amino acid fragment of VGF, containing two predicted alpha-helical loops and four potential prohormone convertase (PC) cleavage sites, was necessary and sufficient with an N-terminal signal peptide-containing domain, for large dense core vesicle sorting and regulated secretion from PC12 and INS-1 cells. Further transfection analysis identified the sorting sequence as a compact C-terminal alpha-helix and embedded 564RRR566 PC cleavage site; mutation of the 564RRR566 PC site in VGF-(1-65): GFP:VGF-(545-617) blocked regulated secretion, whereas disruption of the alpha-helix had no effect. Mutation of the adjacent 567HFHH570 motif, a charged region that might enhance PC cleavage in acidic environments, also blocked regulated release. Finally, inhibition of PC cleavage in PC12 cells using the membrane-permeable synthetic peptide chloromethyl ketone (decanoyl-RVKR-CMK) blocked regulated secretion of VGF. Our studies define a critical RRR-containing C-terminal domain that targets VGF into the regulated pathway in neuronal PC12 and endocrine INS-1 cells, providing additional support for the proposed role that PCs and their cleavage sites play in regulated peptide secretion.

Identifying RNA splicing factors using IFT genes in Chlamydomonas reinhardtii.

PubMed

Lin, Huawen; Zhang, Zhengyan; Iomini, Carlo; Dutcher, Susan K

2018-03-01

Intraflagellar transport moves proteins in and out of flagella/cilia and it is essential for the assembly of these organelles. Using whole-genome sequencing, we identified splice site mutations in two IFT genes, IFT81 ( fla9 ) and IFT121 ( ift121-2 ), which lead to flagellar assembly defects in the unicellular green alga Chlamydomonas reinhardtii The splicing defects in these ift mutants are partially corrected by mutations in two conserved spliceosome proteins, DGR14 and FRA10. We identified a dgr14 deletion mutant, which suppresses the 3' splice site mutation in IFT81 , and a frameshift mutant of FRA10 , which suppresses the 5' splice site mutation in IFT121 Surprisingly, we found dgr14-1 and fra10 mutations suppress both splice site mutations. We suggest these two proteins are involved in facilitating splice site recognition/interaction; in their absence some splice site mutations are tolerated. Nonsense mutations in SMG1 , which is involved in nonsense-mediated decay, lead to accumulation of aberrant transcripts and partial restoration of flagellar assembly in the ift mutants. The high density of introns and the conservation of noncore splicing factors, together with the ease of scoring the ift mutant phenotype, make Chlamydomonas an attractive organism to identify new proteins involved in splicing through suppressor screening. © 2018 The Authors.

Evaluation of Cu(i) binding to the E2 domain of the amyloid precursor protein - a lesson in quantification of metal binding to proteins via ligand competition.

PubMed

Young, Tessa R; Wedd, Anthony G; Xiao, Zhiguang

2018-01-24

The extracellular domain E2 of the amyloid precursor protein (APP) features a His-rich metal-binding site (denoted as the M1 site). In conjunction with surrounding basic residues, the site participates in interactions with components of the extracellular matrix including heparins, a class of negatively charged polysaccharide molecules of varying length. This work studied the chemistry of Cu(i) binding to APP E2 with the probe ligands Bcs, Bca, Fz and Fs. APP E2 forms a stable Cu(i)-mediated ternary complex with each of these anionic ligands. The complex with Bca was selected for isolation and characterization and was demonstrated, by native ESI-MS analysis, to have the stoichiometry E2 : Cu(i) : Bca = 1 : 1 : 1. Formation of these ternary complexes is specific for the APP E2 domain and requires Cu(i) coordination to the M1 site. Mutation of the M1 site was consistent with the His ligands being part of the E2 ligand set. It is likely that interactions between the negatively charged probe ligands and a positively charged patch on the surface of APP E2 are one aspect of the generation of the stable ternary complexes. Their formation prevented meaningful quantification of the affinity of Cu(i) binding to the M1 site with these probe ligands. However, the ternary complexes are disrupted by heparin, allowing reliable determination of a picomolar Cu(i) affinity for the E2/heparin complex with the Fz or Bca probe ligands. This is the first documented example of the formation of stable ternary complexes between a Cu(i) binding protein and a probe ligand. The ready disruption of the complexes by heparin identified clear 'tell-tale' signs for diagnosis of ternary complex formation and allowed a systematic review of conditions and criteria for reliable determination of affinities for metal binding via ligand competition. This study also provides new insights into a potential correlation of APP functions regulated by copper binding and heparin interaction.

Mapping mutational effects along the evolutionary landscape of HIV envelope

PubMed Central

Hilton, Sarah K; Overbaugh, Julie

2018-01-01

The immediate evolutionary space accessible to HIV is largely determined by how single amino acid mutations affect fitness. These mutational effects can shift as the virus evolves. However, the prevalence of such shifts in mutational effects remains unclear. Here, we quantify the effects on viral growth of all amino acid mutations to two HIV envelope (Env) proteins that differ at >100 residues. Most mutations similarly affect both Envs, but the amino acid preferences of a minority of sites have clearly shifted. These shifted sites usually prefer a specific amino acid in one Env, but tolerate many amino acids in the other. Surprisingly, shifts are only slightly enriched at sites that have substituted between the Envs—and many occur at residues that do not even contact substitutions. Therefore, long-range epistasis can unpredictably shift Env’s mutational tolerance during HIV evolution, although the amino acid preferences of most sites are conserved between moderately diverged viral strains. PMID:29590010

Structure of the DBL3x domain of pregnancy-associated malaria protein VAR2CSA complexed with chondroitin sulfate A

DOE Office of Scientific and Technical Information (OSTI.GOV)

Singh, K.; Gittis, A.G.; Nguyen, P.

Plasmodium falciparum-infected erythrocytes bind to chondroitin sulfate A (CSA) in the placenta via the VAR2CSA protein, a member of the P. falciparum erythrocyte membrane protein-1 family, leading to life-threatening malaria in pregnant women with severe effects on their fetuses and newborns. Here we describe the structure of the CSA binding DBL3x domain, a Duffy binding-like (DBL) domain of VAR2CSA. By forming a complex of DBL3x with CSA oligosaccharides and determining its structure, we have identified the CSA binding site to be a cluster of conserved positively charged residues on subdomain 2 and subdomain 3. Mutation or chemical modification of lysinemore » residues at the site markedly diminished CSA binding to DBL3x. The location of the CSA binding site is an important step forward in the molecular understanding of pregnancy-associated malaria and offers a new target for vaccine development.« less

Rearrangement of competing U2 RNA helices within the spliceosome promotes multiple steps in splicing

PubMed Central

Perriman, Rhonda J.; Ares, Manuel

2007-01-01

Nuclear pre-messenger RNA (pre-mRNA) splicing requires multiple spliceosomal small nuclear RNA (snRNA) and pre-mRNA rearrangements. Here we reveal a new snRNA conformational switch in which successive roles for two competing U2 helices, stem IIa and stem IIc, promote distinct splicing steps. When stem IIa is stabilized by loss of stem IIc, rapid ATP-independent and Cus2p-insensitive prespliceosome formation occurs. In contrast, hyperstabilized stem IIc improves the first splicing step on aberrant branchpoint pre-mRNAs and rescues temperature-sensitive U6–U57C, a U6 mutation that also suppresses first-step splicing defects of branchpoint mutations. A second, later role for stem IIa is revealed by its suppression of a cold-sensitive allele of the second-step splicing factor PRP16. Our data expose a spliceosomal progression cycle of U2 stem IIa formation, disruption by stem IIc, and then reformation of stem IIa before the second catalytic step. We propose that the competing stem IIa and stem IIc helices are key spliceosomal RNA elements that optimize juxtaposition of the proper reactive sites during splicing. PMID:17403781

Conformational changes in the M2 muscarinic receptor induced by membrane voltage and agonist binding

PubMed Central

Navarro-Polanco, Ricardo A; Galindo, Eloy G Moreno; Ferrer-Villada, Tania; Arias, Marcelo; Rigby, J Ryan; Sánchez-Chapula, José A; Tristani-Firouzi, Martin

2011-01-01

Abstract The ability to sense transmembrane voltage is a central feature of many membrane proteins, most notably voltage-gated ion channels. Gating current measurements provide valuable information on protein conformational changes induced by voltage. The recent observation that muscarinic G-protein-coupled receptors (GPCRs) generate gating currents confirms their intrinsic capacity to sense the membrane electrical field. Here, we studied the effect of voltage on agonist activation of M2 muscarinic receptors (M2R) in atrial myocytes and how agonist binding alters M2R gating currents. Membrane depolarization decreased the potency of acetylcholine (ACh), but increased the potency and efficacy of pilocarpine (Pilo), as measured by ACh-activated K+ current, IKACh. Voltage-induced conformational changes in M2R were modified in a ligand-selective manner: ACh reduced gating charge displacement while Pilo increased the amount of charge displaced. Thus, these ligands manifest opposite voltage-dependent IKACh modulation and exert opposite effects on M2R gating charge displacement. Finally, mutations in the putative ligand binding site perturbed the movement of the M2R voltage sensor. Our data suggest that changes in voltage induce conformational changes in the ligand binding site that alter the agonist–receptor interaction in a ligand-dependent manner. Voltage-dependent GPCR modulation has important implications for cellular signalling in excitable tissues. Gating current measurement allows for the tracking of subtle conformational changes in the receptor that accompany agonist binding and changes in membrane voltage. PMID:21282291

Familial Mediterranean fever with a single MEFV mutation: where is the second hit?

PubMed

Booty, Matthew G; Chae, Jae Jin; Masters, Seth L; Remmers, Elaine F; Barham, Beverly; Le, Julie M; Barron, Karyl S; Holland, Steve M; Kastner, Daniel L; Aksentijevich, Ivona

2009-06-01

Familial Mediterranean fever (FMF) has traditionally been considered an autosomal-recessive disease; however, it has been observed that a substantial number of patients with clinical FMF possess only 1 demonstrable MEFV mutation. The purpose of this study was to perform an extensive search for a second MEFV mutation in 46 patients diagnosed clinically as having FMF and carrying only 1 high-penetrance FMF mutation. MEFV and other candidate genes were sequenced by standard capillary electrophoresis. In 10 patients, the entire 15-kb MEFV genomic region was resequenced using hybridization-based chip technology. MEFV gene expression levels were determined by quantitative reverse transcription-polymerase chain reaction. Pyrin protein levels were examined by Western blotting. A second MEFV mutation was not identified in any of the patients who were screened. Haplotype analysis did not identify a common haplotype that might be associated with the transmission of a second FMF allele. Western blots did not demonstrate a significant difference in pyrin levels between patients with a single mutation and those with a double mutation; however, FMF patients of both types showed higher protein expression as compared with controls and with non-FMF patients with active inflammation. Screening of genes encoding pyrin-interacting proteins identified rare mutations in a small number of patients, suggesting the possibility of digenic inheritance. Our data underscore the existence of a significant subset of FMF patients who are carriers of only 1 MEFV mutation and demonstrate that complete MEFV sequencing is not likely to yield a second mutation. Screening for the set of the most common mutations and detection of a single mutation appears to be sufficient in the presence of clinical symptoms for the diagnosis of FMF and the initiation of a trial of colchicine.

Trafficking defects and loss of ligand binding are the underlying causes of all reported DDR2 missense mutations found in SMED-SL patients.

PubMed

Ali, Bassam R; Xu, Huifang; Akawi, Nadia A; John, Anne; Karuvantevida, Noushad S; Langer, Ruth; Al-Gazali, Lihadh; Leitinger, Birgit

2010-06-01

Spondylo-meta-epiphyseal dysplasia (SMED) with short limbs and abnormal calcifications (SMED-SL) is a rare, autosomal recessive human growth disorder, characterized by disproportionate short stature, short limbs, short broad fingers, abnormal metaphyses and epiphyses, platyspondyly and premature calcifications. Recently, three missense mutations and one splice-site mutation in the DDR2 gene were identified as causative genetic defects for SMED-SL, but the underlying cellular and biochemical mechanisms were not explored. Here we report a novel DDR2 missense mutation, c.337G>A (p.E113K), that causes SMED-SL in two siblings in the United Arab Emirates. Another DDR2 missense mutation, c.2254C>T (p.R752C), matching one of the previously reported SMED-SL mutations, was found in a second affected family. DDR2 is a plasma membrane receptor tyrosine kinase that functions as a collagen receptor. We expressed DDR2 constructs with the identified point mutations in human cell lines and evaluated their localization and functional properties. We found that all SMED-SL missense mutants were defective in collagen-induced receptor activation and that the three previously reported mutants (p.T713I, p.I726R and p.R752C) were retained in the endoplasmic reticulum. The novel mutant (p.E113K), in contrast, trafficked normally, like wild-type DDR2, but failed to bind collagen. This finding is in agreement with our recent structural data identifying Glu113 as an important amino acid in the DDR2 ligand-binding site. Our data thus demonstrate that SMED-SL can result from at least two different loss-of-function mechanisms: namely defects in DDR2 targeting to the plasma membrane or the loss of its ligand-binding activity.

Trafficking defects and loss of ligand binding are the underlying causes of all reported DDR2 missense mutations found in SMED-SL patients

PubMed Central

Ali, Bassam R.; Xu, Huifang; Akawi, Nadia A.; John, Anne; Karuvantevida, Noushad S.; Langer, Ruth; Al-Gazali, Lihadh; Leitinger, Birgit

2010-01-01

Spondylo-meta-epiphyseal dysplasia (SMED) with short limbs and abnormal calcifications (SMED-SL) is a rare, autosomal recessive human growth disorder, characterized by disproportionate short stature, short limbs, short broad fingers, abnormal metaphyses and epiphyses, platyspondyly and premature calcifications. Recently, three missense mutations and one splice-site mutation in the DDR2 gene were identified as causative genetic defects for SMED-SL, but the underlying cellular and biochemical mechanisms were not explored. Here we report a novel DDR2 missense mutation, c.337G>A (p.E113K), that causes SMED-SL in two siblings in the United Arab Emirates. Another DDR2 missense mutation, c.2254C>T (p.R752C), matching one of the previously reported SMED-SL mutations, was found in a second affected family. DDR2 is a plasma membrane receptor tyrosine kinase that functions as a collagen receptor. We expressed DDR2 constructs with the identified point mutations in human cell lines and evaluated their localization and functional properties. We found that all SMED-SL missense mutants were defective in collagen-induced receptor activation and that the three previously reported mutants (p.T713I, p.I726R and p.R752C) were retained in the endoplasmic reticulum. The novel mutant (p.E113K), in contrast, trafficked normally, like wild-type DDR2, but failed to bind collagen. This finding is in agreement with our recent structural data identifying Glu113 as an important amino acid in the DDR2 ligand-binding site. Our data thus demonstrate that SMED-SL can result from at least two different loss-of-function mechanisms: namely defects in DDR2 targeting to the plasma membrane or the loss of its ligand-binding activity. PMID:20223752

Clinical and functional characterization of a patient carrying a compound heterozygous pericentrin mutation and a heterozygous IGF1 receptor mutation.

PubMed

Müller, Eva; Dunstheimer, Desiree; Klammt, Jürgen; Friebe, Daniela; Kiess, Wieland; Kratzsch, Jürgen; Kruis, Tassilo; Laue, Sandy; Pfäffle, Roland; Wallborn, Tillmann; Heidemann, Peter H

2012-01-01

Intrauterine and postnatal longitudinal growth is controlled by a strong genetic component that regulates a complex network of endocrine factors integrating them with cellular proliferation, differentiation and apoptotic processes in target tissues, particularly the growth centers of the long bones. Here we report on a patient born small for gestational age (SGA) with severe, proportionate postnatal growth retardation, discreet signs of skeletal dysplasia, microcephaly and moyamoya disease. Initial genetic evaluation revealed a novel heterozygous IGF1R p.Leu1361Arg mutation affecting a highly conserved residue with the insulin-like growth factor type 1 receptor suggestive for a disturbance within the somatotropic axis. However, because the mutation did not co-segregate with the phenotype and functional characterization did not reveal an obvious impairment of the ligand depending major IGF1R signaling capabilities a second-site mutation was assumed. Mutational screening of components of the somatotropic axis, constituents of the IGF signaling system and factors involved in cellular proliferation, which are described or suggested to provoke syndromic dwarfism phenotypes, was performed. Two compound heterozygous PCNT mutations (p.[Arg585X];[Glu1774X]) were identified leading to the specification of the diagnosis to MOPD II. These investigations underline the need for careful assessment of all available information to derive a firm diagnosis from a sequence aberration.

Clinical and Functional Characterization of a Patient Carrying a Compound Heterozygous Pericentrin Mutation and a Heterozygous IGF1 Receptor Mutation

PubMed Central

Klammt, Jürgen; Friebe, Daniela; Kiess, Wieland; Kratzsch, Jürgen; Kruis, Tassilo; Laue, Sandy; Pfäffle, Roland; Wallborn, Tillmann; Heidemann, Peter H.

2012-01-01

Intrauterine and postnatal longitudinal growth is controlled by a strong genetic component that regulates a complex network of endocrine factors integrating them with cellular proliferation, differentiation and apoptotic processes in target tissues, particularly the growth centers of the long bones. Here we report on a patient born small for gestational age (SGA) with severe, proportionate postnatal growth retardation, discreet signs of skeletal dysplasia, microcephaly and moyamoya disease. Initial genetic evaluation revealed a novel heterozygous IGF1R p.Leu1361Arg mutation affecting a highly conserved residue with the insulin-like growth factor type 1 receptor suggestive for a disturbance within the somatotropic axis. However, because the mutation did not co-segregate with the phenotype and functional characterization did not reveal an obvious impairment of the ligand depending major IGF1R signaling capabilities a second-site mutation was assumed. Mutational screening of components of the somatotropic axis, constituents of the IGF signaling system and factors involved in cellular proliferation, which are described or suggested to provoke syndromic dwarfism phenotypes, was performed. Two compound heterozygous PCNT mutations (p.[Arg585X];[Glu1774X]) were identified leading to the specification of the diagnosis to MOPD II. These investigations underline the need for careful assessment of all available information to derive a firm diagnosis from a sequence aberration. PMID:22693602

Spatio-temporal genetic heterogeneity of CTNNB1 mutations in sporadic desmoid type fibromatosis lesions.

PubMed

Doyen, Jérôme; Duranton-Tanneur, Valérie; Hostein, Isabelle; Karanian-Philippe, Marie; Chevreau, Christine; Breibach, Florence; Coutts, Michael; Dadone, Bérengère; Saint-Paul, Marie-Christine; Gugenheim, Jean; Duffaud, Florence; Pedeutour, Florence

2016-03-01

Desmoid type fibromatosis (DT) is a rare lesion of unclear pathogenesis that most often presents a mutation of the (β-catenin) gene. The natural history and clinical evolution are highly variable between patients and to date there is no consensus on optimal therapy. We report two cases of a patient with multiple DT lesions. Molecular investigations performed in both patients on multiple tumors at different anatomical sites revealed non-identical CTNNB1 mutations. The first patient was a 39-year-old man with a history of recurrent DT. In two of the DT lesions, three different mutations were found in codons 41 and 45, respectively. The lesions showed marked inflammatory features, characterized by IgG4 positive lymphoplasmacytic infiltrates and a foreign body reaction, which increased in intensity over time. The patient was eventually treated with a COX-2 inhibitor and the remaining mass was stabilized. In the two DT lesions of the second patient, CTNNB1 mutations S45P and T41A were found. The presence of different mutations in multiple focally recurrent sporadic DT lesions indicates that they do not have a clonal relationship. Our data suggest that a CTNNB1 mutation is a necessary event probably by providing a selective growth advantage. An IgG4 host antigen response is discussed as a potential predisposing factor for one of the patients.

Rational design of viscosity reducing mutants of a monoclonal antibody: Hydrophobic versus electrostatic inter-molecular interactions

PubMed Central

Nichols, Pilarin; Li, Li; Kumar, Sandeep; Buck, Patrick M; Singh, Satish K; Goswami, Sumit; Balthazor, Bryan; Conley, Tami R; Sek, David; Allen, Martin J

2015-01-01

High viscosity of monoclonal antibody formulations at concentrations ≥100 mg/mL can impede their development as products suitable for subcutaneous delivery. The effects of hydrophobic and electrostatic intermolecular interactions on the solution behavior of MAB 1, which becomes unacceptably viscous at high concentrations, was studied by testing 5 single point mutants. The mutations were designed to reduce viscosity by disrupting either an aggregation prone region (APR), which also participates in 2 hydrophobic surface patches, or a negatively charged surface patch in the variable region. The disruption of an APR that lies at the interface of light and heavy chain variable domains, VH and VL, via L45K mutation destabilized MAB 1 and abolished antigen binding. However, mutation at the preceding residue (V44K), which also lies in the same APR, increased apparent solubility and reduced viscosity of MAB 1 without sacrificing antigen binding or thermal stability. Neutralizing the negatively charged surface patch (E59Y) also increased apparent solubility and reduced viscosity of MAB 1, but charge reversal at the same position (E59K/R) caused destabilization, decreased solubility and led to difficulties in sample manipulation that precluded their viscosity measurements at high concentrations. Both V44K and E59Y mutations showed similar increase in apparent solubility. However, the viscosity profile of E59Y was considerably better than that of the V44K, providing evidence that inter-molecular interactions in MAB 1 are electrostatically driven. In conclusion, neutralizing negatively charged surface patches may be more beneficial toward reducing viscosity of highly concentrated antibody solutions than charge reversal or aggregation prone motif disruption. PMID:25559441

Rational design of viscosity reducing mutants of a monoclonal antibody: hydrophobic versus electrostatic inter-molecular interactions.

PubMed

Nichols, Pilarin; Li, Li; Kumar, Sandeep; Buck, Patrick M; Singh, Satish K; Goswami, Sumit; Balthazor, Bryan; Conley, Tami R; Sek, David; Allen, Martin J

2015-01-01

High viscosity of monoclonal antibody formulations at concentrations ≥100 mg/mL can impede their development as products suitable for subcutaneous delivery. The effects of hydrophobic and electrostatic intermolecular interactions on the solution behavior of MAB 1, which becomes unacceptably viscous at high concentrations, was studied by testing 5 single point mutants. The mutations were designed to reduce viscosity by disrupting either an aggregation prone region (APR), which also participates in 2 hydrophobic surface patches, or a negatively charged surface patch in the variable region. The disruption of an APR that lies at the interface of light and heavy chain variable domains, VH and VL, via L45K mutation destabilized MAB 1 and abolished antigen binding. However, mutation at the preceding residue (V44K), which also lies in the same APR, increased apparent solubility and reduced viscosity of MAB 1 without sacrificing antigen binding or thermal stability. Neutralizing the negatively charged surface patch (E59Y) also increased apparent solubility and reduced viscosity of MAB 1, but charge reversal at the same position (E59K/R) caused destabilization, decreased solubility and led to difficulties in sample manipulation that precluded their viscosity measurements at high concentrations. Both V44K and E59Y mutations showed similar increase in apparent solubility. However, the viscosity profile of E59Y was considerably better than that of the V44K, providing evidence that inter-molecular interactions in MAB 1 are electrostatically driven. In conclusion, neutralizing negatively charged surface patches may be more beneficial toward reducing viscosity of highly concentrated antibody solutions than charge reversal or aggregation prone motif disruption.

ClC-7 is a slowly voltage-gated 2Cl−/1H+-exchanger and requires Ostm1 for transport activity

PubMed Central

Leisle, Lilia; Ludwig, Carmen F; Wagner, Florian A; Jentsch, Thomas J; Stauber, Tobias

2011-01-01

Mutations in the ClC-7/Ostm1 ion transporter lead to osteopetrosis and lysosomal storage disease. Its lysosomal localization hitherto precluded detailed functional characterization. Using a mutated ClC-7 that reaches the plasma membrane, we now show that both the aminoterminus and transmembrane span of the Ostm1 β-subunit are required for ClC-7 Cl−/H+-exchange, whereas the Ostm1 transmembrane domain suffices for its ClC-7-dependent trafficking to lysosomes. ClC-7/Ostm1 currents were strongly outwardly rectifying owing to slow gating of ion exchange, which itself displays an intrinsically almost linear voltage dependence. Reversal potentials of tail currents revealed a 2Cl−/1H+-exchange stoichiometry. Several disease-causing CLCN7 mutations accelerated gating. Such mutations cluster to the second cytosolic cystathionine-β-synthase domain and potential contact sites at the transmembrane segment. Our work suggests that gating underlies the rectification of all endosomal/lysosomal CLCs and extends the concept of voltage gating beyond channels to ion exchangers. PMID:21527911

Bacterial genes mutL, mutS, and dcm participate in repair of mismatches at 5-methylcytosine sites.

PubMed Central

Lieb, M

1987-01-01

Certain amber mutations in the cI gene of bacteriophage lambda appear to recombine very frequently with nearby mutations. The aberrant mutations included C-to-T transitions at the second cytosine in 5'CC(A/T)GG sequences (which are subject to methylation by bacterial cytosine methylase) and in 5'CCAG and 5'CAGG sequences. Excess cI+ recombinants arising in crosses that utilize these mutations are attributable to the correction of mismatches by a bacterial very-short-patch (VSP) mismatch repair system. In the present study I found that two genes required for methyladenine-directed (long-patch) mismatch repair, mutL and mutS, also functioned in VSP mismatch repair; mutH and mutU (uvrD) were dispensable. VSP mismatch repair was greatly reduced in a dcm Escherichia coli mutant, in which 5-methylcytosine was not methylated. However, mismatches in heteroduplexes prepared from lambda DNA lacking 5-methylcytosine were repaired in dcm+ bacteria. These results indicate that the product of gene dcm has a repair function in addition to its methylase activity. PMID:2959653

Molecular interactions and residues involved in force generation in the T4 viral DNA packaging motor.

PubMed

Migliori, Amy D; Smith, Douglas E; Arya, Gaurav

2014-12-12

Many viruses utilize molecular motors to package their genomes into preformed capsids. A striking feature of these motors is their ability to generate large forces to drive DNA translocation against entropic, electrostatic, and bending forces resisting DNA confinement. A model based on recently resolved structures of the bacteriophage T4 motor protein gp17 suggests that this motor generates large forces by undergoing a conformational change from an extended to a compact state. This transition is proposed to be driven by electrostatic interactions between complementarily charged residues across the interface between the N- and C-terminal domains of gp17. Here we use atomistic molecular dynamics simulations to investigate in detail the molecular interactions and residues involved in such a compaction transition of gp17. We find that although electrostatic interactions between charged residues contribute significantly to the overall free energy change of compaction, interactions mediated by the uncharged residues are equally if not more important. We identify five charged residues and six uncharged residues at the interface that play a dominant role in the compaction transition and also reveal salt bridging, van der Waals, and solvent hydrogen-bonding interactions mediated by these residues in stabilizing the compact form of gp17. The formation of a salt bridge between Glu309 and Arg494 is found to be particularly crucial, consistent with experiments showing complete abrogation in packaging upon Glu309Lys mutation. The computed contributions of several other residues are also found to correlate well with single-molecule measurements of impairments in DNA translocation activity caused by site-directed mutations. Copyright © 2014 Elsevier Ltd. All rights reserved.

Structure and function in rhodopsin: Rhodopsin mutants with a neutral amino acid at E134 have a partially activated conformation in the dark state*

PubMed Central

Kim, Jong-Myoung; Altenbach, Christian; Thurmond, Robin L.; Khorana, H. Gobind; Hubbell, Wayne L.

1997-01-01

The Glu-134–Arg-135 residues in rhodopsin, located near the cytoplasmic end of the C helix, are involved in G protein binding, or activation, or both. Furthermore, the charge-neutralizing mutation Glu-134 to Gln-134 produces hyperactivity in the activated state and produces constitutive activity in opsin. The Glu/Asp-Arg charge pair is highly conserved in equivalent positions in other G protein-coupled receptors. To investigate the structural consequences of charge-neutralizing mutations at Glu-134 and Arg-135 in rhodopsin, single spin-labeled side chains were introduced at sites in the cytoplasmic domains of helices C (140), E (227), F (250), or G (316) to serve as “molecular sensors” of the local helix bundle conformation. In each of the spin-labeled rhodopsins, a Gln substitution was introduced at either Glu-134 or Arg-135, and the electron paramagnetic resonance spectrum of the spin label was used to monitor the structural response of the helix bundle. The results indicate that a Gln substitution at Glu-134 induces a photoactivated conformation around helices C and G even in the dark state, an observation of potential relevance to the hyperactivity and constitutive activity of the mutant. In contrast, little change is induced in helix F, which has been shown to undergo a dominant motion upon photoactivation. This result implies that the multiple helix motions accompanying photoactivation are not strongly coupled and can be induced to take place independently. Gln substitution at Arg-135 produces only minor structural changes in the dark- or light-activated conformation, suggesting that this residue is not a determinant of structure in the regions investigated, although it may be functionally important. PMID:9405602

Second generation noninvasive fetal genome analysis reveals de novo mutations, single-base parental inheritance, and preferred DNA ends

PubMed Central

Chan, K. C. Allen; Jiang, Peiyong; Sun, Kun; Cheng, Yvonne K. Y.; Tong, Yu K.; Cheng, Suk Hang; Wong, Ada I. C.; Hudecova, Irena; Leung, Tak Y.; Chiu, Rossa W. K.; Lo, Yuk Ming Dennis

2016-01-01

Plasma DNA obtained from a pregnant woman was sequenced to a depth of 270× haploid genome coverage. Comparing the maternal plasma DNA sequencing data with the parental genomic DNA data and using a series of bioinformatics filters, fetal de novo mutations were detected at a sensitivity of 85% and a positive predictive value of 74%. These results represent a 169-fold improvement in the positive predictive value over previous attempts. Improvements in the interpretation of the sequence information of every base position in the genome allowed us to interrogate the maternal inheritance of the fetus for 618,271 of 656,676 (94.2%) heterozygous SNPs within the maternal genome. The fetal genotype at each of these sites was deduced individually, unlike previously, where the inheritance was determined for a collection of sites within a haplotype. These results represent a 90-fold enhancement in the resolution in determining the fetus’s maternal inheritance. Selected genomic locations were more likely to be found at the ends of plasma DNA molecules. We found that a subset of such preferred ends exhibited selectivity for fetal- or maternal-derived DNA in maternal plasma. The ratio of the number of maternal plasma DNA molecules with fetal preferred ends to those with maternal preferred ends showed a correlation with the fetal DNA fraction. Finally, this second generation approach for noninvasive fetal whole-genome analysis was validated in a pregnancy diagnosed with cardiofaciocutaneous syndrome with maternal plasma DNA sequenced to 195× coverage. The causative de novo BRAF mutation was successfully detected through the maternal plasma DNA analysis. PMID:27799561

The R35 residue of the influenza A virus NS1 protein has minimal effects on nuclear localization but alters virus replication through disrupting protein dimerization

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lalime, Erin N.; Pekosz, Andrew, E-mail: apekosz@jhsph.edu

The influenza A virus NS1 protein has a nuclear localization sequence (NLS) in the amino terminal region. This NLS overlaps sequences that are important for RNA binding as well as protein dimerization. To assess the significance of the NS1 NLS on influenza virus replication, the NLS amino acids were individually mutated to alanines and recombinant viruses encoding these mutations were rescued. Viruses containing NS1 proteins with mutations at R37, R38 and K41 displayed minimal changes in replication or NS1 protein nuclear localization. Recombinant viruses encoding NS1 R35A were not recovered but viruses containing second site mutations at position D39 inmore » addition to the R35A mutation were isolated. The mutations at position 39 were shown to partially restore NS1 protein dimerization but had minimal effects on nuclear localization. These data indicate that the amino acids in the NS1 NLS region play a more important role in protein dimerization compared to nuclear localization. - Highlights: • Mutations were introduced into influenza NS1 NLS1. • NS1 R37A, R38A, K41A viruses had minimal changes in replication and NS1 localization. • Viruses from NS1 R35A rescue all contained additional mutations at D39. • NS1 R35A D39X mutations recover dimerization lost in NS1 R35A mutations. • These results reaffirm the importance of dimerization for NS1 protein function.« less

[Gene mutation analysis of X-linked hypophosphatemic rickets].

PubMed

Song, Ying; Ma, Hong-Wei; Li, Fang; Hu, Man; Ren, Shuang; Yu, Ya-Fen; Zhao, Gui-Jie

2013-11-01

To investigate the frequency and type of PHEX gene mutations in children with X-linked hypophosphatemic rickets (XLH), the possible presence of mutational hot spots, and the relationship between genotype and clinical phenotype. Clinical data of 10 children with XLH was retrospectively reviewed. The relationship between gene mutation type and severity of XLH was evaluated. PHEX gene mutations were detected in all 10 children with XLH, including 6 cases of missense mutation, 2 cases of splice site mutation, 1 case of frameshift mutation, and 1 case of nonsense mutation. Two new mutations, c.2048T>C and IVS14+1delAG, were found. The type of PHEX gene mutation was not associated with the degree of short stature and leg deformity (P=0.571 and 0.467), and the mutation site was also not associated with the degree of short stature and leg deformity (P=0.400 and 1.000). Missense mutation is the most common type of PHEX gene mutation in children with XLH, and c.2048T>C and IVS14+1delAG are two new PHEX gene mutations. The type and site of PHEX gene mutation are not associated with the severity of XLH.

Mutation induction by charged particles of defined linear energy transfer.

PubMed

Hei, T K; Chen, D J; Brenner, D J; Hall, E J

1988-07-01

The mutagenic potential of charged particles of defined linear energy transfer (LET) was assessed using the hypoxanthine-guanine phosphoribosyl transferase locus (HGPRT) in primary human fibroblasts. Exponentially growing cultures of early passaged fibroblasts were grown as monolayers on thin mylar sheets and were irradiated with accelerated protons, deuterons or helium-3 ions. The mutation rates were compared with those generated by 137Cs gamma-rays. LET values for charged particles accelerated at the Radiological Research Accelerator Facility, using the track segment mode, ranged from 10 to 150 keV/micron. After irradiation, cells were trypsinized, subcultured and assayed for both cytotoxicity and 6-thioguanine resistance. For gamma-rays, and for the charged particles of lower LET, the dose-response curves for cell survival were characterized by a marked initial shoulder, but approximated to an exponential function of dose for higher LETs. Mutation frequencies, likewise, showed a direct correlation to LET over the dose range examined. Relative biological effectiveness (RBE) for mutagenesis, based on the initial slopes of the dose-response curves, ranged from 1.30 for 10 keV/micron protons to 9.40 for 150 keV/micron helium-3 ions. Results of the present studies indicate that high-LET radiations, apart from being efficient inducers of cell lethality, are even more efficient in mutation induction as compared to low-LET ionizing radiation. These data are consistent with results previously obtained with both rodent and human fibroblast cell lines.

Extensive de novo mutation rate variation between individuals and across the genome of Chlamydomonas reinhardtii

PubMed Central

Ness, Rob W.; Morgan, Andrew D.; Vasanthakrishnan, Radhakrishnan B.; Colegrave, Nick; Keightley, Peter D.

2015-01-01

Describing the process of spontaneous mutation is fundamental for understanding the genetic basis of disease, the threat posed by declining population size in conservation biology, and much of evolutionary biology. Directly studying spontaneous mutation has been difficult, however, because new mutations are rare. Mutation accumulation (MA) experiments overcome this by allowing mutations to build up over many generations in the near absence of natural selection. Here, we sequenced the genomes of 85 MA lines derived from six genetically diverse strains of the green alga Chlamydomonas reinhardtii. We identified 6843 new mutations, more than any other study of spontaneous mutation. We observed sevenfold variation in the mutation rate among strains and that mutator genotypes arose, increasing the mutation rate approximately eightfold in some replicates. We also found evidence for fine-scale heterogeneity in the mutation rate, with certain sequence motifs mutating at much higher rates, and clusters of multiple mutations occurring at closely linked sites. There was little evidence, however, for mutation rate heterogeneity between chromosomes or over large genomic regions of 200 kbp. We generated a predictive model of the mutability of sites based on their genomic properties, including local GC content, gene expression level, and local sequence context. Our model accurately predicted the average mutation rate and natural levels of genetic diversity of sites across the genome. Notably, trinucleotides vary 17-fold in rate between the most and least mutable sites. Our results uncover a rich heterogeneity in the process of spontaneous mutation both among individuals and across the genome. PMID:26260971

Drug resistance conferred by mutations outside the active site through alterations in the dynamic and structural ensemble of HIV-1 protease.

PubMed

Ragland, Debra A; Nalivaika, Ellen A; Nalam, Madhavi N L; Prachanronarong, Kristina L; Cao, Hong; Bandaranayake, Rajintha M; Cai, Yufeng; Kurt-Yilmaz, Nese; Schiffer, Celia A

2014-08-27

HIV-1 protease inhibitors are part of the highly active antiretroviral therapy effectively used in the treatment of HIV infection and AIDS. Darunavir (DRV) is the most potent of these inhibitors, soliciting drug resistance only when a complex combination of mutations occur both inside and outside the protease active site. With few exceptions, the role of mutations outside the active site in conferring resistance remains largely elusive. Through a series of DRV-protease complex crystal structures, inhibition assays, and molecular dynamics simulations, we find that single and double site mutations outside the active site often associated with DRV resistance alter the structure and dynamic ensemble of HIV-1 protease active site. These alterations correlate with the observed inhibitor binding affinities for the mutants, and suggest a network hypothesis on how the effect of distal mutations are propagated to pivotal residues at the active site and may contribute to conferring drug resistance.

Site-directed mutagenesis of the conserved Asp-443 and Asp-498 carboxy-terminal residues of HIV-1 reverse transcriptase.

PubMed Central

Mizrahi, V; Usdin, M T; Harington, A; Dudding, L R

1990-01-01

Substitution of the conserved Asp-443 residue of HIV-1 reverse transcriptase by asparagine specifically suppressed the ribonuclease H activity of the enzyme without affecting the reverse transcriptase activity, suggesting involvement of this ionizable residue at the ribonuclease H active site. An analogous asparagine substitution of the Asp-498 residue yielded an unstable enzyme that was difficult to enzymatically characterize. However, the instability caused by the Asn-498 mutation was relieved by the introduction of a second distal Asn-443 substitution, yielding an enzyme with wild type reverse transcriptase activity, but lacking ribonuclease H activity. Images PMID:1699202

Protein charge ladders reveal that the net charge of ALS-linked superoxide dismutase can be different in sign and magnitude from predicted values

PubMed Central

Shi, Yunhua; Abdolvahabi, Alireza; Shaw, Bryan F

2014-01-01

This article utilized “protein charge ladders”—chemical derivatives of proteins with similar structure, but systematically altered net charge—to quantify how missense mutations that cause amyotrophic lateral sclerosis (ALS) affect the net negative charge (Z) of superoxide dismutase-1 (SOD1) as a function of subcellular pH and Zn2+ stoichiometry. Capillary electrophoresis revealed that the net charge of ALS-variant SOD1 can be different in sign and in magnitude—by up to 7.4 units per dimer at lysosomal pH—than values predicted from standard pKa values of amino acids and formal oxidation states of metal ions. At pH 7.4, the G85R, D90A, and G93R substitutions diminished the net negative charge of dimeric SOD1 by up to +2.29 units more than predicted; E100K lowered net charge by less than predicted. The binding of a single Zn2+ to mutant SOD1 lowered its net charge by an additional +2.33 ± 0.01 to +3.18 ± 0.02 units, however, each protein regulated net charge when binding a second, third, or fourth Zn2+ (ΔZ < 0.44 ± 0.07 per additional Zn2+). Both metalated and apo-SOD1 regulated net charge across subcellular pH, without inverting from negative to positive at the theoretical pI. Differential scanning calorimetry, hydrogen-deuterium exchange, and inductively coupled plasma mass spectrometry confirmed that the structure, stability, and metal content of mutant proteins were not significantly affected by lysine acetylation. Measured values of net charge should be used when correlating the biophysical properties of a specific ALS-variant SOD1 protein with its observed aggregation propensity or clinical phenotype. PMID:25052939

Therapeutic strategies based on modified U1 snRNAs and chaperones for Sanfilippo C splicing mutations.

PubMed

Matos, Liliana; Canals, Isaac; Dridi, Larbi; Choi, Yoo; Prata, Maria João; Jordan, Peter; Desviat, Lourdes R; Pérez, Belén; Pshezhetsky, Alexey V; Grinberg, Daniel; Alves, Sandra; Vilageliu, Lluïsa

2014-12-10

Mutations affecting RNA splicing represent more than 20% of the mutant alleles in Sanfilippo syndrome type C, a rare lysosomal storage disorder that causes severe neurodegeneration. Many of these mutations are localized in the conserved donor or acceptor splice sites, while few are found in the nearby nucleotides. In this study we tested several therapeutic approaches specifically designed for different splicing mutations depending on how the mutations affect mRNA processing. For three mutations that affect the donor site (c.234 + 1G > A, c.633 + 1G > A and c.1542 + 4dupA), different modified U1 snRNAs recognizing the mutated donor sites, have been developed in an attempt to rescue the normal splicing process. For another mutation that affects an acceptor splice site (c.372-2A > G) and gives rise to a protein lacking four amino acids, a competitive inhibitor of the HGSNAT protein, glucosamine, was tested as a pharmacological chaperone to correct the aberrant folding and to restore the normal trafficking of the protein to the lysosome. Partial correction of c.234 + 1G > A mutation was achieved with a modified U1 snRNA that completely matches the splice donor site suggesting that these molecules may have a therapeutic potential for some splicing mutations. Furthermore, the importance of the splice site sequence context is highlighted as a key factor in the success of this type of therapy. Additionally, glucosamine treatment resulted in an increase in the enzymatic activity, indicating a partial recovery of the correct folding. We have assayed two therapeutic strategies for different splicing mutations with promising results for the future applications.

Regeneration of bovine and octopus opsins in situ with natural and artificial retinals

DOE Office of Scientific and Technical Information (OSTI.GOV)

Koutalos, Y.; Ebrey, T.G.; Tsuda, M.

1989-03-21

The authors consider the problem of color regulation in visual pigments for both bovine rhodopsin and octopus rhodopsin. Both pigments have 11-cis-retinal as their chromophore. These rhodopsins were bleached in their native membranes, and the opsins were regenerated with natural and artificial chromophores. Both bovine and octopus opsins were regenerated with the 9-cis- and 11-cis-retinal isomers, but the octopus opsin was additionally regenerated with the 13-cis and all-trans isomers. Titration of the octopus opsin with 11-cis-retinal gave an extinction coefficient for octopus rhodopsin of 27,000 {plus minus} 3,000 M{sup {minus}1} cm{sup {minus}1} at 475 nm. The absorption maxima of bovinemore » artificial pigments formed by regenerating opsin with the 11-cis dihydro series of chromophores support a color regulation model for bovine rhodopsin in which the chromophore-binding site of the protein has two negative charges: one directly hydrogen bonded to the Schiff base nitrogen and another near carbon-13. Formation of octopus artificial pigments with both all-trans and 11-cis dihydro chromophores leads to a similar model for octopus rhodopsin and metarhodopsin: there are two negative charges in the chromophore-binding site, one directly hydrogen bonded to the Schiff base nitrogen and a second near carbon-13. The interaction of this second charge with the chromophore in octopus rhodopsin is weaker than in bovine, while in metarhodopsin it is as strong as in bovine.« less

Deep mutational scanning identifies sites in influenza nucleoprotein that affect viral inhibition by MxA

PubMed Central

Ashenberg, Orr; Padmakumar, Jai

2017-01-01

The innate-immune restriction factor MxA inhibits influenza replication by targeting the viral nucleoprotein (NP). Human influenza virus is more resistant than avian influenza virus to inhibition by human MxA, and prior work has compared human and avian viral strains to identify amino-acid differences in NP that affect sensitivity to MxA. However, this strategy is limited to identifying sites in NP where mutations that affect MxA sensitivity have fixed during the small number of documented zoonotic transmissions of influenza to humans. Here we use an unbiased deep mutational scanning approach to quantify how all single amino-acid mutations to NP affect MxA sensitivity in the context of replication-competent virus. We both identify new sites in NP where mutations affect MxA resistance and re-identify mutations known to have increased MxA resistance during historical adaptations of influenza to humans. Most of the sites where mutations have the greatest effect are almost completely conserved across all influenza A viruses, and the amino acids at these sites confer relatively high resistance to MxA. These sites cluster in regions of NP that appear to be important for its recognition by MxA. Overall, our work systematically identifies the sites in influenza nucleoprotein where mutations affect sensitivity to MxA. We also demonstrate a powerful new strategy for identifying regions of viral proteins that affect inhibition by host factors. PMID:28346537

Molecular basis of a novel renal amyloidosis due to N184K gelsolin variant

PubMed Central

Bonì, Francesco; Milani, Mario; Porcari, Riccardo; Barbiroli, Alberto; Ricagno, Stefano; de Rosa, Matteo

2016-01-01

Mutations in gelsolin are responsible for a systemic amyloidosis first described in 1969. Until recently, the disease was associated with two substitutions of the same residue, leading to the loss of the calcium binding site. Novel interest arose in 2014 when the N184K variant of the protein was identified as the etiological agent of a novel kidney-localized amyloidosis. Here we provide a first rationale for N184K pathogenicity. We show that the mutation induces a destabilization of gelsolin second domain, without compromising its calcium binding capacity. X-ray data combined with molecular dynamics simulations demonstrates that the primary source of the destabilization is a loss of connectivity in proximity of the metal. Such rearrangement of the H-bond network does not have a major impact on the overall fold of the domain, nevertheless, it increases the flexibility of a stretch of the protein, which is consequently processed by furin protease. Overall our data suggest that the N184K variant is subjected to the same aberrant proteolytic events responsible for the formation of amyloidogenic fragments in the previously characterized mutants. At the same time our data suggest that a broader number of mutations, unrelated to the metal binding site, can lead to a pathogenic phenotype. PMID:27633054

Molecular basis of a novel renal amyloidosis due to N184K gelsolin variant

NASA Astrophysics Data System (ADS)

Bonì, Francesco; Milani, Mario; Porcari, Riccardo; Barbiroli, Alberto; Ricagno, Stefano; De Rosa, Matteo

2016-09-01

Mutations in gelsolin are responsible for a systemic amyloidosis first described in 1969. Until recently, the disease was associated with two substitutions of the same residue, leading to the loss of the calcium binding site. Novel interest arose in 2014 when the N184K variant of the protein was identified as the etiological agent of a novel kidney-localized amyloidosis. Here we provide a first rationale for N184K pathogenicity. We show that the mutation induces a destabilization of gelsolin second domain, without compromising its calcium binding capacity. X-ray data combined with molecular dynamics simulations demonstrates that the primary source of the destabilization is a loss of connectivity in proximity of the metal. Such rearrangement of the H-bond network does not have a major impact on the overall fold of the domain, nevertheless, it increases the flexibility of a stretch of the protein, which is consequently processed by furin protease. Overall our data suggest that the N184K variant is subjected to the same aberrant proteolytic events responsible for the formation of amyloidogenic fragments in the previously characterized mutants. At the same time our data suggest that a broader number of mutations, unrelated to the metal binding site, can lead to a pathogenic phenotype.

Novel splice site mutation in the growth hormone receptor gene in Turkish patients with Laron-type dwarfism.

PubMed

Arman, Ahmet; Ozon, Alev; Isguven, Pinar S; Coker, Ajda; Peker, Ismail; Yordam, Nursen

2008-01-01

Growth hormone (GH) is involved in growth, and fat and carbohydrate metabolism. Interaction of GH with the GH receptor (GHR) is necessary for systemic and local production of insulin-like growth factor-I (IGF-I) which mediates GH actions. Mutations in the GHR cause severe postnatal growth failure; the disorder is an autosomal recessive genetic disease resulting in GH insensitivity, called Laron syndrome. It is characterized by dwarfism with elevated serum GH and low levels of IGF-I. We analyzed the GHR gene for mutations and polymorphisms in eight patients with Laron-type dwarfism from six families. We found three missense mutations (S40L, V125A, I526L), one nonsense mutation (W157X), and one splice site mutation in the extracellular domain of GHR. Furthermore, G168G and exon 3 deletion polymorphisms were detected in patients with Laron syndrome. The splice site mutation, which is a novel mutation, was located at the donor splice site of exon 2/ intron 2 within GHR. Although this mutation changed the highly conserved donor splice site consensus sequence GT to GGT by insertion of a G residue, the intron splicing between exon 2 and exon 3 was detected in the patient. These results imply that the splicing occurs arthe GT site in intron 2, leaving the extra inserted G residue at the end of exon 2, thus changing the open reading frame of GHR resulting in a premature termination codon in exon 3.

Method and Circuit for Injecting a Precise Amount of Charge onto a Circuit Node

NASA Technical Reports Server (NTRS)

Hancock, Bruce R. (Inventor)

2016-01-01

A method and circuit for injecting charge into a circuit node, comprising (a) resetting a capacitor's voltage through a first transistor; (b) after the resetting, pre-charging the capacitor through the first transistor; and (c) after the pre-charging, further charging the capacitor through a second transistor, wherein the second transistor is connected between the capacitor and a circuit node, and the further charging draws charge through the second transistor from the circuit node, thereby injecting charge into the circuit node.

Stabilization of a nucleotide-binding domain of the cystic fibrosis transmembrane conductance regulator yields insight into disease-causing mutations.

PubMed

Vernon, Robert M; Chong, P Andrew; Lin, Hong; Yang, Zhengrong; Zhou, Qingxian; Aleksandrov, Andrei A; Dawson, Jennifer E; Riordan, John R; Brouillette, Christie G; Thibodeau, Patrick H; Forman-Kay, Julie D

2017-08-25

Characterization of the second nucleotide-binding domain (NBD2) of the cystic fibrosis transmembrane conductance regulator (CFTR) has lagged behind research into the NBD1 domain, in part because NBD1 contains the F508del mutation, which is the dominant cause of cystic fibrosis. Research on NBD2 has also been hampered by the overall instability of the domain and the difficulty of producing reagents. Nonetheless, multiple disease-causing mutations reside in NBD2, and the domain is critical for CFTR function, because channel gating involves NBD1/NBD2 dimerization, and NBD2 contains the catalytically active ATPase site in CFTR. Recognizing the paucity of structural and biophysical data on NBD2, here we have defined a bioinformatics-based method for manually identifying stabilizing substitutions in NBD2, and we used an iterative process of screening single substitutions against thermal melting points to both produce minimally mutated stable constructs and individually characterize mutations. We present a range of stable constructs with minimal mutations to help inform further research on NBD2. We have used this stabilized background to study the effects of NBD2 mutations identified in cystic fibrosis (CF) patients, demonstrating that mutants such as N1303K and G1349D are characterized by lower stability, as shown previously for some NBD1 mutations, suggesting a potential role for NBD2 instability in the pathology of CF. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

Characterization of Nucleoside Reverse Transcriptase Inhibitor-Associated Mutations in the RNase H Region of HIV-1 Subtype C Infected Individuals.

PubMed

Ngcapu, Sinaye; Theys, Kristof; Libin, Pieter; Marconi, Vincent C; Sunpath, Henry; Ndung'u, Thumbi; Gordon, Michelle L

2017-11-08

The South African national treatment programme includes nucleoside reverse transcriptase inhibitors (NRTIs) in both first and second line highly active antiretroviral therapy regimens. Mutations in the RNase H domain have been associated with resistance to NRTIs but primarily in HIV-1 subtype B studies. Here, we investigated the prevalence and association of RNase H mutations with NRTI resistance in sequences from HIV-1 subtype C infected individuals. RNase H sequences from 112 NRTI treated but virologically failing individuals and 28 antiretroviral therapy (ART)-naive individuals were generated and analysed. In addition, sequences from 359 subtype C ART-naive sequences were downloaded from Los Alamos database to give a total of 387 sequences from ART-naive individuals for the analysis. Fisher's exact test was used to identify mutations and Bayesian network learning was applied to identify novel NRTI resistance mutation pathways in RNase H domain. The mutations A435L, S468A, T470S, L484I, A508S, Q509L, L517I, Q524E and E529D were more prevalent in sequences from treatment-experienced compared to antiretroviral treatment naive individuals, however, only the E529D mutation remained significant after correction for multiple comparison. Our findings suggest a potential interaction between E529D and NRTI-treatment; however, site-directed mutagenesis is needed to understand the impact of this RNase H mutation.

Mitochondrial DNA mutation screening of male patients with obstructive sleep apnea-hypopnea syndrome.

PubMed

Huang, Xiao-Ying; Li, Hong; Xu, Xiao-Mei; Wang, Liang-Xing

2014-08-01

The aim of the present study was to analyze the differences between the genes of the mitochondrial DNA (mtDNA) displacement loop (D-loop) region and the Cambridge Reference sequence, in order to screen the mutation sites and investigate the correlation between mutations, clinical parameters and complications associated with obstructive sleep apnea-hypopnea syndrome (OSAHS). mtDNA was obtained from male patients with OSAHS in the Zhejiang Province. In total, 60 male patients with OSAHS and 102 healthy adults were assessed to determine the levels of fasting blood glucose, total cholesterol, triglyceride (TG) and high-density and low-density lipoproteins (LDL). Furthermore, peripheral mtDNA was extracted and bidirectional sequencing was conducted to enable mutation screening. In the mtDNA D-loop region, 178 mutation sites were identified, of which 115 sites were present in the two groups. The number of non-common sites in the OSAHS group was significantly higher compared with the control group (P<0.05). No statistically significant difference was observed in the mutations among the mild, moderate and severe OSAHS groups (P>0.05). A total of 21 cases in the severe OSAHS group exhibited mutation rates of >10%. In the control group, there were 24 cases where the np73A-G and np263A-G mutations were predominant. The np303-np315 region was identified to be the highly variable region and various mutation forms were observed. Statistically significant differences were observed in the neck perimeter, TG and LDL levels among the OSAHS-no-mutation subgroups (P<0.05) and LDL was shown to be associated with an mtDNA mutation in the OSAHS group. Numerous polymorphic mutation sites were identified in the mtDNA D-loop region of the OSAHS group. Therefore, mtDNA mutation sites may be closely associated with the clinical manifestations and complications of OSAHS.

Decision-making process of women carrying a BRCA1 or BRCA2 mutation who have chosen prophylactic mastectomy.

PubMed

McQuirter, Megan; Castiglia, Luisa Luciani; Loiselle, Carmen G; Wong, Nora

2010-05-01

To explore the decision-making process of women with a BRCA1 or BRCA2 gene mutation who have chosen to undergo prophylactic mastectomy. Cross-sectional, qualitative, descriptive design. Participants were recruited from an outpatient cancer prevention center in the oncology and medical genetics departments of a large university-affiliated hospital in Montreal, Quebec, Canada. 10 women carrying a BRCA1 or BRCA2 mutation; 8 previously had had a prophylactic mastectomy and 2 were scheduled for surgery at the time of study. Semistructured, in-depth interviews were conducted. Field notes were written and audiotapes were transcribed verbatim. The textual data were coded and analyzed. Decision-making process for prophylactic mastectomy. Two broad findings emerged. First, several intrapersonal and contextual factors interacted throughout the process to move women either closer to choosing a prophylactic mastectomy or further from the decision. Second, all women reported experiencing a "pivotal point," an emotionally charged event when the decision to have a prophylactic mastectomy became definitive. Pivotal points for patients included either receiving a positive result for a genetic mutation or a breast cancer diagnosis for herself or a family member in the context of positive mutation status. Decision making about prophylactic mastectomy was an affective and intuitive process incorporating contexts and their relations rather than a rational, straight-forward process of weighing pros and cons. Supportive interventions for women in this population should explicitly address the individual and the inter-relationships of contextual factors that shape decision making about prophylactic mastectomy while recognizing important affective components involved.

Distinct cerebellar foliation anomalies in a CHD7 haploinsufficient mouse model of CHARGE syndrome

PubMed Central

Whittaker, Danielle E.; Kasah, Sahrunizam; Donovan, Alex P. A.; Ellegood, Jacob; Riegman, Kimberley L. H.; Volk, Holger A.; McGonnell, Imelda; Lerch, Jason P.

2017-01-01

Mutations in the gene encoding the ATP dependent chromatin‐remodeling factor, CHD7 are the major cause of CHARGE (Coloboma, Heart defects, Atresia of the choanae, Retarded growth and development, Genital‐urinary anomalies, and Ear defects) syndrome. Neurodevelopmental defects and a range of neurological signs have been identified in individuals with CHARGE syndrome, including developmental delay, lack of coordination, intellectual disability, and autistic traits. We previously identified cerebellar vermis hypoplasia and abnormal cerebellar foliation in individuals with CHARGE syndrome. Here, we report mild cerebellar hypoplasia and distinct cerebellar foliation anomalies in a Chd7 haploinsufficient mouse model. We describe specific alterations in the precise spatio‐temporal sequence of fissure formation during perinatal cerebellar development responsible for these foliation anomalies. The altered cerebellar foliation pattern in Chd7 haploinsufficient mice show some similarities to those reported in mice with altered Engrailed, Fgf8 or Zic1 gene expression and we propose that mutations or polymorphisms in these genes may modify the cerebellar phenotype in CHARGE syndrome. Our findings in a mouse model of CHARGE syndrome indicate that a careful analysis of cerebellar foliation may be warranted in patients with CHARGE syndrome, particularly in patients with cerebellar hypoplasia and developmental delay. PMID:29168327

The energy landscape of adenylate kinase during catalysis

PubMed Central

Kerns, S. Jordan; Agafonov, Roman V.; Cho, Young-Jin; Pontiggia, Francesco; Otten, Renee; Pachov, Dimitar V.; Kutter, Steffen; Phung, Lien A.; Murphy, Padraig N.; Thai, Vu; Alber, Tom; Hagan, Michael F.; Kern, Dorothee

2014-01-01

Kinases perform phosphoryl-transfer reactions in milliseconds; without enzymes, these reactions would take about 8000 years under physiological conditions. Despite extensive studies, a comprehensive understanding of kinase energy landscapes, including both chemical and conformational steps, is lacking. Here we scrutinize the microscopic steps in the catalytic cycle of adenylate kinase, through a combination of NMR measurements during catalysis, pre-steady-state kinetics, MD simulations, and crystallography of active complexes. We find that the Mg2+ cofactor activates two distinct molecular events, phosphoryl transfer (>105-fold) and lid-opening (103-fold). In contrast, mutation of an essential active-site arginine decelerates phosphoryl transfer 103-fold without substantially affecting lid-opening. Our results highlight the importance of the entire energy landscape in catalysis and suggest that adenylate kinases have evolved to activate key processes simultaneously by precise placement of a single, charged and very abundant cofactor in a pre-organized active site. PMID:25580578

Bone Metastasis in Prostate Cancer: Recurring Mitochondrial DNA Mutation Reveals Selective Pressure Exerted by the Bone Microenvironment

PubMed Central

Arnold, Rebecca S.; Fedewa, Stacey A.; Goodman, Michael; Osunkoya, Adeboye O.; Kissick, Haydn T.; Morrissey, Colm; True, Lawrence D.; Petros, John A.

2015-01-01

Background Cancer progression and metastasis occurs such that cells with acquired mutations enhancing growth and survival (or inhibiting cell death) increase in number, a concept that has been recognized as analogous to Darwinian evolution of species since Peter C. Nowell’s description in 1976. Selective forces include those intrinsic to the host (including metastatic site) as well as those resulting from anti-cancer therapies. By examining the mutational status of multiple tumor sites within an individual patient some insight may be gained into those genetic variants that enhance site-specific metastasis. By comparing these data across multiple individuals, recurrent patterns may identify alterations that are fundamental to successful site-specific metastasis. Methods We sequenced the mitochondrial genome in 10 prostate cancer patients with bone metastases enrolled in a rapid autopsy program. Patients had late stage disease and received androgen ablation and frequently other systemic therapies. For each of 9 patients, 4 separate tissues were sequenced: the primary prostate cancer, a soft tissue metastasis, a bone metastasis and an uninvolved normal tissue that served as the non-cancerous control. An additional (10th) patient had no primary prostate available for sequencing but had both metastatic sites (and control DNA) sequenced. We then examined the number and location of somatically acquired mitochondrial DNA (mtDNA) mutations in the primary and two metastatic sites in each individual patient. Finally, we compared patients with each other to determine any common patterns of somatic mutation. Results Somatic mutations were significantly more numerous in bone compared to either the primary tumor or soft tissue metastases. A missense mutation at nucleotide position (np) 10398 (A10398G; Thr114Ala) in the respiratory complex I gene ND3 was the most common (7 of 10 patients) and was detected only in bone. Other notable somatic mutations that occurred in more than one patient include a tRNA Arg mutation at np 10436 and a tRNA Thr mutation at np 15928. The tRNA Arg mutation was restricted to bone metastases and occurred in three of 10 patients (30%). Somatic mutation at 15928 was not restricted to bone and also occurred in three patients. Conclusions Mitochondrial genomic variation was greater in metastatic sites than the primary tumor and bone metastases had statistically significantly greater numbers of somatic mutations than either the primary or the soft tissue metastases. The genome was not mutated randomly. At least one mutational “hot-spot” was identified at the individual base level (nucleotide position 10398 in bone metastases) indicating a pervasive selective pressure for bone metastatic cells that had acquired the 10398 mtDNA mutation. Two additional recurrent mutations (tRNA Arg and tRNA Thr) support the concept of bone site-specific “survival of the fittest” as revealed by variation in the mitochondrial genome and selective pressure exerted by the metastatic site. PMID:25952970

Bone metastasis in prostate cancer: Recurring mitochondrial DNA mutation reveals selective pressure exerted by the bone microenvironment.

PubMed

Arnold, Rebecca S; Fedewa, Stacey A; Goodman, Michael; Osunkoya, Adeboye O; Kissick, Haydn T; Morrissey, Colm; True, Lawrence D; Petros, John A

2015-09-01

Cancer progression and metastasis occur such that cells with acquired mutations enhancing growth and survival (or inhibiting cell death) increase in number, a concept that has been recognized as analogous to Darwinian evolution of species since Peter C. Nowell's description in 1976. Selective forces include those intrinsic to the host (including metastatic site) as well as those resulting from anti-cancer therapies. By examining the mutational status of multiple tumor sites within an individual patient some insight may be gained into those genetic variants that enhance site-specific metastasis. By comparing these data across multiple individuals, recurrent patterns may identify alterations that are fundamental to successful site-specific metastasis. We sequenced the mitochondrial genome in 10 prostate cancer patients with bone metastases enrolled in a rapid autopsy program. Patients had late stage disease and received androgen ablation and frequently other systemic therapies. For each of 9 patients, 4 separate tissues were sequenced: the primary prostate cancer, a soft tissue metastasis, a bone metastasis and an uninvolved normal tissue that served as the non-cancerous control. An additional (10th) patient had no primary prostate available for sequencing but had both metastatic sites (and control DNA) sequenced. We then examined the number and location of somatically acquired mitochondrial DNA (mtDNA) mutations in the primary tumor and two metastatic sites in each individual patient. Finally, we compared patients with each other to determine any common patterns of somatic mutation. Somatic mutations were significantly more numerous in the bone compared to either the primary tumor or soft tissue metastases. A missense mutation at nucleotide position (n.p.) 10398 (A10398G; Thr114Ala) in the respiratory complex I gene ND3 was the most common (7 of 10 patients) and was detected only in the bone. Other notable somatic mutations that occurred in more than one patient include a tRNA Arg mutation at n.p. 10436 and a tRNA Thr mutation at n.p. 15928. The tRNA Arg mutation was restricted to bone metastases and occurred in three of 10 patients (30%). Somatic mutation at 15928 was not restricted to the bone and also occurred in three patients. Mitochondrial genomic variation was greater in metastatic sites than in the primary tumor and bone metastases had statistically significantly greater numbers of somatic mutations than either the primary or the soft tissue metastases. The genome was not mutated randomly. At least one mutational "hot-spot" was identified at the individual base level (nucleotide position 10398 in bone metastases) indicating a pervasive selective pressure for bone metastatic cells that had acquired the 10398 mtDNA mutation. Two additional recurrent mutations (tRNA Arg and tRNA Thr) support the concept of bone site-specific "survival of the fittest" as revealed by variation in the mitochondrial genome and selective pressure exerted by the metastatic site. Published by Elsevier Inc.

Binding of Amphipathic Cell Penetrating Peptide p28 to Wild Type and Mutated p53 as studied by Raman, Atomic Force and Surface Plasmon Resonance spectroscopies.

PubMed

Signorelli, Sara; Santini, Simona; Yamada, Tohru; Bizzarri, Anna Rita; Beattie, Craig W; Cannistraro, Salvatore

2017-04-01

Mutations within the DNA binding domain (DBD) of the tumor suppressor p53 are found in >50% of human cancers and may significantly modify p53 secondary structure impairing its function. p28, an amphipathic cell-penetrating peptide, binds to the DBD through hydrophobic interaction and induces a posttranslational increase in wildtype and mutant p53 restoring functionality. We use mutation analyses to explore which elements of secondary structure may be critical to p28 binding. Molecular modeling, Raman spectroscopy, Atomic Force Spectroscopy (AFS) and Surface Plasmon Resonance (SPR) were used to identify which secondary structure of site-directed and naturally occurring mutant DBDs are potentially altered by discrete changes in hydrophobicity and the molecular interaction with p28. We show that specific point mutations that alter hydrophobicity within non-mutable and mutable regions of the p53 DBD alter specific secondary structures. The affinity of p28 was positively correlated with the β-sheet content of a mutant DBD, and reduced by an increase in unstructured or random coil that resulted from a loss in hydrophobicity and redistribution of surface charge. These results help refine our knowledge of how mutations within p53-DBD alter secondary structure and provide insight on how potential structural alterations in p28 or similar molecules improve their ability to restore p53 function. Raman spectroscopy, AFS, SPR and computational modeling are useful approaches to characterize how mutations within the p53DBD potentially affect secondary structure and identify those structural elements prone to influence the binding affinity of agents designed to increase the functionality of p53. Copyright © 2017 Elsevier B.V. All rights reserved.

The p.M292T NDUFS2 mutation causes complex I-deficient Leigh syndrome in multiple families.

PubMed

Tuppen, Helen A L; Hogan, Vanessa E; He, Langping; Blakely, Emma L; Worgan, Lisa; Al-Dosary, Mazhor; Saretzki, Gabriele; Alston, Charlotte L; Morris, Andrew A; Clarke, Michael; Jones, Simon; Devlin, Anita M; Mansour, Sahar; Chrzanowska-Lightowlers, Zofia M A; Thorburn, David R; McFarland, Robert; Taylor, Robert W

2010-10-01

Isolated complex I deficiency is the most frequently observed oxidative phosphorylation defect in children with mitochondrial disease, leading to a diverse range of clinical presentations, including Leigh syndrome. For most patients the genetic cause of the biochemical defect remains unknown due to incomplete understanding of the complex I assembly process. Nonetheless, a plethora of pathogenic mutations have been described to date in the seven mitochondrial-encoded subunits of complex I as well as in 12 of the nuclear-encoded subunits and in six assembly factors. Whilst several mitochondrial DNA mutations are recurrent, the majority of these mutations are reported in single families. We have sequenced core structural and functional nuclear-encoded subunits of complex I in a cohort of 34 paediatric patients with isolated complex I deficiency, identifying pathogenic mutations in 6 patients. These included a novel homozygous NDUFS1 mutation in an Asian child with Leigh syndrome, a previously identified NDUFS8 mutation (c.236C>T, p.P79L) in a second Asian child with Leigh-like syndrome and six novel, compound heterozygous NDUFS2 mutations in four white Caucasian patients with Leigh or Leigh-like syndrome. Three of these children harboured an identical NDUFS2 mutation (c.875T>C, p.M292T), which was also identified in conjunction with a novel NDUFS2 splice site mutation (c.866+4A>G) in a fourth Caucasian child who presented to a different diagnostic centre, with microsatellite and single nucleotide polymorphism analyses indicating that this was due to an ancient common founder event. Our results confirm that NDUFS2 is a mutational hotspot in Caucasian children with isolated complex I deficiency and recommend the routine diagnostic investigation of this gene in patients with Leigh or Leigh-like phenotypes.

Extracellular determinants of anion discrimination of the Cl-/H+ antiporter protein CLC-5.

PubMed

De Stefano, Silvia; Pusch, Michael; Zifarelli, Giovanni

2011-12-23

Mammalian CLC proteins comprise both Cl- channels and Cl-/H+ antiporters that carry out fundamental physiological tasks by transporting Cl- across plasma membrane and intracellular compartments. The NO3- over Cl- preference of a plant CLC transporter has been pinpointed to a conserved serine residue located at Scen and it is generally assumed that the other two binding sites of CLCs, Sext and Sin, do not substantially contribute to anion selectivity. Here we show for the Cl-/H+ antiporter CLC-5 that the conserved and extracellularly exposed Lys210 residue is critical to determine the anion specificity for transport activity. In particular, mutations that neutralize or invert the charge at this position reverse the NO3- over Cl- preference of WT CLC-5 at a concentration of 100 mm, but do not modify the coupling stoichiometry with H+. The importance of the electrical charge is shown by chemical modification of K210C with positively charged cysteine-reactive compounds that reintroduce the WT preference for Cl-. At saturating extracellular anion concentrations, neutralization of Lys210 is of little impact on the anion preference, suggesting an important role of Lys210 on the association rate of extracellular anions to Sext.

Mapping mutational effects along the evolutionary landscape of HIV envelope.

PubMed

Haddox, Hugh K; Dingens, Adam S; Hilton, Sarah K; Overbaugh, Julie; Bloom, Jesse D

2018-03-28

The immediate evolutionary space accessible to HIV is largely determined by how single amino acid mutations affect fitness. These mutational effects can shift as the virus evolves. However, the prevalence of such shifts in mutational effects remains unclear. Here, we quantify the effects on viral growth of all amino acid mutations to two HIV envelope (Env) proteins that differ at [Formula: see text]100 residues. Most mutations similarly affect both Envs, but the amino acid preferences of a minority of sites have clearly shifted. These shifted sites usually prefer a specific amino acid in one Env, but tolerate many amino acids in the other. Surprisingly, shifts are only slightly enriched at sites that have substituted between the Envs-and many occur at residues that do not even contact substitutions. Therefore, long-range epistasis can unpredictably shift Env's mutational tolerance during HIV evolution, although the amino acid preferences of most sites are conserved between moderately diverged viral strains. © 2018, Haddox et al.

Select human cancer mutants of NRMT1 alter its catalytic activity and decrease N-terminal trimethylation.

PubMed

Shields, Kaitlyn M; Tooley, John G; Petkowski, Janusz J; Wilkey, Daniel W; Garbett, Nichola C; Merchant, Michael L; Cheng, Alan; Schaner Tooley, Christine E

2017-08-01

A subset of B-cell lymphoma patients have dominant mutations in the histone H3 lysine 27 (H3K27) methyltransferase EZH2, which change it from a monomethylase to a trimethylase. These mutations occur in aromatic resides surrounding the active site and increase growth and alter transcription. We study the N-terminal trimethylase NRMT1 and the N-terminal monomethylase NRMT2. They are 50% identical, but differ in key aromatic residues in their active site. Given how these residues affect EZH2 activity, we tested whether they are responsible for the distinct catalytic activities of NRMT1/2. Additionally, NRMT1 acts as a tumor suppressor in breast cancer cells. Its loss promotes oncogenic phenotypes but sensitizes cells to DNA damage. Mutations of NRMT1 naturally occur in human cancers, and we tested a select group for altered activity. While directed mutation of the aromatic residues had minimal catalytic effect, NRMT1 mutants N209I (endometrial cancer) and P211S (lung cancer) displayed decreased trimethylase and increased monomethylase/dimethylase activity. Both mutations are located in the peptide-binding channel and indicate a second structural region impacting enzyme specificity. The NRMT1 mutants demonstrated a slower rate of trimethylation and a requirement for higher substrate concentration. Expression of the mutants in wild type NRMT backgrounds showed no change in N-terminal methylation levels or growth rates, demonstrating they are not acting as dominant negatives. Expression of the mutants in cells lacking endogenous NRMT1 resulted in minimal accumulation of N-terminal trimethylation, indicating homozygosity could help drive oncogenesis or serve as a marker for sensitivity to DNA damaging chemotherapeutics or γ-irradiation. © 2017 The Protein Society.

Roles of the conserved cytoplasmic region and non-conserved carboxy-terminal region of SecE in Escherichia coli protein translocase.

PubMed

Kontinen, V P; Yamanaka, M; Nishiyama, K; Tokuda, H

1996-06-01

SecE, an essential membrane component of the Escherichia coli protein translocase, consists of 127 amino acid residues. Only a part of the second putative cytoplasmic region comprising some 13 residues is essential for the SecE function as long as the proper topological arrangement is retained. The Trp84 and Pro85 residues of this region are conserved in all eubacterial SecE homologues. The conservation of positively charged residues corresponding to Arg80 and Lys81 is also substantial. We deleted or replaced these residues to assess their roles in the SecE function. Deletion of the Arg80-Lys81 dipeptide did not abolish the SecE function whereas that of Trp84 or Pro85 caused a loss of the function. Strikingly, however, replacement of Pro85 with either Gly, Ser, or Ala, and that of Trp84 with Lys did not abolish the SecE function. These results indicate that the strong conservation of these residues does not reflect their obligatory requirement for the SecE function. A chimeric SecE possessing the cytoplasmic region of the E. coli SecE and the following region of the Bacillus subtilis SecE was able to form the translocation machinery together with SecA, SecY, and SecG. Although a Leu to Arg mutation at position 108 has been thought to cause a loss of signal recognition fidelity and thereby suppress a signal sequence defect, the same mutation at position 111 caused a complete loss of the function. The levels of SecY and SecG in the secEcsE501 mutant, which expresses SecE at a decreased level and is sensitive to low temperature, increased upon the expression of functional SecE derivatives, irrespective of the site of mutation, suggesting that the levels of SecY and SecG are co-operatively determined by the level of functional, but not non-functional, SecE. Based on these results, the SecE function in the translocase is discussed.

Point mutations abolishing the mannose-binding capability of boar spermadhesin AQN-1.

PubMed

Ekhlasi-Hundrieser, Mahnaz; Calvete, Juan J; Von Rad, Bettina; Hettel, Christiane; Nimtz, Manfred; Töpfer-Petersen, Edda

2008-05-01

The mannose-binding capability of recombinant wild-type boar spermadhesin AQN-1 and of its site-directed mutants in the highly-conserved region around of the single glycosylation site (asparagine 50) of some spermadhesins, where the carbohydrate binding site has been proposed to be located, was checked using a solid-phase assay and a biotinylated mannose ligand. Substitution of glycine 54 by amino acids bearing an unipolar side chain did not cause significant decrease in the mannose-binding activity. However, amino acids with uncharged polar side chains or having a charged polar side chain abolished the binding of biotinylated mannose to the corresponding AQN-1 mutants. The results suggest that the higher surface accessibility of amino acids possessing polar side chains compared to those bearing nonpolar groups may sterically interfere with monosaccharide binding. The location of the mannose-binding site in AQN-1 appears to be topologically conserved in other heparin-binding boar spermadhesins, i.e., AQN-3 and AWN, but departs from the location of the mannose-6-phosphate-recognition site of PSP-II. This indicates that different spermadhesin molecules have evolved non-equivalent carbohydrate-binding capabilities, which may underlie their distinct patterns of biological activities.

Mutations in the gene for X-linked adrenoleukodystrophy in patients with different clinical phenotypes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Braun, A.; Ambach, H.; Kammerer, S.

Recently, the gene for the most common peroxisomal disorder, X-linked adrenoleukodystrophy (X-ALD), has been described encoding a peroxisomal membrane transporter protein. We analyzed the entire protein-coding sequence of this gene by reverse-transcription PCR, SSCP, and DNA sequencing in five patients with different clinical expressions were cerebral childhood ALD, adrenomyecloneuropathy (AMN), and {open_quotes}Addison disease only{close_quotes} (AD) phenotype. In the three patients exhibiting the classical picture of severe childhood ALD we identified in the 5{prime} portion of the X-ALD gene a 38-bp deletion that causes a frameshift mutation, a 3-bp deletion leading to a deletion of an amino acid in the ATP-bindingmore » domain of the ALD protein, and a missense mutation. In the patient with the clinical phenotype of AMN, a nonsense mutation in codon 212, along with a second site mutation at codon 178, was observed. Analysis of the patient with the ADO phenotype revealed a further missense mutation at a highly conserved position in the ALDP/PMP70 comparison. The disruptive nature of two mutations (i.e., the frameshift and the nonsense mutation) in patients with biochemically proved childhood ALD and AMN further strongly supports the hypothesis that alterations in this gene play a crucial role in the pathogenesis of X-ALD. Since the current biochemical techniques for X-ALD carrier detection in affected families lack sufficient reliability, our procedure described for systematic mutation scanning is also capable of improving genetic counseling and prenatal diagnosis. 19 refs., 6 figs., 3 tabs.« less

[Mutation analysis of the PAH gene in children with phenylketonuria from the Qinghai area of China].

PubMed

He, Jiang; Wang, Hui-Zhen; Xu, Fa-Liang; Yang, Xi; Wang, Rui; Zou, Hong-Yun; Yu, Wu-Zhong

2015-11-01

To study the mutation characteristics of the phenylalanine hydroxylase (PAH) gene in children with phenylketonuria (PKU) from the Qinghai area of China, in order to provide basic information for genetic counseling and prenatal diagnosis. Mutations of the PAH gene were detected in the promoter and exons 1-13 and their flanking intronic sequences of PAH gene by PCR and DNA sequencing in 49 children with PKU and their parents from the Qinghai area of China. A total of 30 different mutations were detected in 80 out of 98 mutant alleles (82%), including 19 missense (63%), 5 nonsense (17%), 3 splice-site (10%) and 3 deletions (10%). Most mutations were detected in exons 3, 6, 7, 11 and intron 4 of PAH gene. The most frequent mutations were p.R243Q (19%), IVS4-1G>A (9%), p.Y356X (7%) and p.EX6-96A>G(5%). Two novel mutations p.N93fsX5 (c.279-282delCATC) and p.G171E (c.512G>A) were found. p.H64fsX9(c.190delC) was documented for the second time in Chinese PAH gene. The mutation spectrum of the gene PAH in the Qinghai population was similar to that in other populations in North China while significantly different from that in the populations from some provinces in southern China, Japan and Europe. The mutations of PAH gene in the Qinghai area of China demonstrate a unique diversity, complexity and specificity.

Interplay between DMD Point Mutations and Splicing Signals in Dystrophinopathy Phenotypes

PubMed Central

Juan-Mateu, Jonàs; González-Quereda, Lidia; Rodríguez, Maria José; Verdura, Edgard; Lázaro, Kira; Jou, Cristina; Nascimento, Andrés; Jiménez-Mallebrera, Cecilia; Colomer, Jaume; Monges, Soledad; Lubieniecki, Fabiana; Foncuberta, Maria Eugenia; Pascual-Pascual, Samuel Ignacio; Molano, Jesús; Baiget, Montserrat; Gallano, Pia

2013-01-01

DMD nonsense and frameshift mutations lead to severe Duchenne muscular dystrophy while in-frame mutations lead to milder Becker muscular dystrophy. Exceptions are found in 10% of cases and the production of alternatively spliced transcripts is considered a key modifier of disease severity. Several exonic mutations have been shown to induce exon-skipping, while splice site mutations result in exon-skipping or activation of cryptic splice sites. However, factors determining the splicing pathway are still unclear. Point mutations provide valuable information regarding the regulation of pre-mRNA splicing and elements defining exon identity in the DMD gene. Here we provide a comprehensive analysis of 98 point mutations related to clinical phenotype and their effect on muscle mRNA and dystrophin expression. Aberrant splicing was found in 27 mutations due to alteration of splice sites or splicing regulatory elements. Bioinformatics analysis was performed to test the ability of the available algorithms to predict consequences on mRNA and to investigate the major factors that determine the splicing pathway in mutations affecting splicing signals. Our findings suggest that the splicing pathway is highly dependent on the interplay between splice site strength and density of regulatory elements. PMID:23536893

Restriction digest screening facilitates efficient detection of site-directed mutations introduced by CRISPR in C. albicans UME6.

PubMed

Evans, Ben A; Smith, Olivia L; Pickerill, Ethan S; York, Mary K; Buenconsejo, Kristen J P; Chambers, Antonio E; Bernstein, Douglas A

2018-01-01

Introduction of point mutations to a gene of interest is a powerful tool when determining protein function. CRISPR-mediated genome editing allows for more efficient transfer of a desired mutation into a wide range of model organisms. Traditionally, PCR amplification and DNA sequencing is used to determine if isolates contain the intended mutation. However, mutation efficiency is highly variable, potentially making sequencing costly and time consuming. To more efficiently screen for correct transformants, we have identified restriction enzymes sites that encode for two identical amino acids or one or two stop codons. We used CRISPR to introduce these restriction sites directly upstream of the Candida albicans UME6 Zn 2+ -binding domain, a known regulator of C. albicans filamentation. While repair templates coding for different restriction sites were not equally successful at introducing mutations, restriction digest screening enabled us to rapidly identify isolates with the intended mutation in a cost-efficient manner. In addition, mutated isolates have clear defects in filamentation and virulence compared to wild type C. albicans . Our data suggest restriction digestion screening efficiently identifies point mutations introduced by CRISPR and streamlines the process of identifying residues important for a phenotype of interest.

Elucidating the Interdependence of Drug Resistance from Combinations of Mutations.

PubMed

Ragland, Debra A; Whitfield, Troy W; Lee, Sook-Kyung; Swanstrom, Ronald; Zeldovich, Konstantin B; Kurt-Yilmaz, Nese; Schiffer, Celia A

2017-11-14

HIV-1 protease is responsible for the cleavage of 12 nonhomologous sites within the Gag and Gag-Pro-Pol polyproteins in the viral genome. Under the selective pressure of protease inhibition, the virus evolves mutations within (primary) and outside of (secondary) the active site, allowing the protease to process substrates while simultaneously countering inhibition. The primary protease mutations impede inhibitor binding directly, while the secondary mutations are considered accessory mutations that compensate for a loss in fitness. However, the role of secondary mutations in conferring drug resistance remains a largely unresolved topic. We have shown previously that mutations distal to the active site are able to perturb binding of darunavir (DRV) via the protein's internal hydrogen-bonding network. In this study, we show that mutations distal to the active site, regardless of context, can play an interdependent role in drug resistance. Applying eigenvalue decomposition to collections of hydrogen bonding and van der Waals interactions from a series of molecular dynamics simulations of 15 diverse HIV-1 protease variants, we identify sites in the protease where amino acid substitutions lead to perturbations in nonbonded interactions with DRV and/or the hydrogen-bonding network of the protease itself. While primary mutations are known to drive resistance in HIV-1 protease, these findings delineate the significant contributions of accessory mutations to resistance. Identifying the variable positions in the protease that have the greatest impact on drug resistance may aid in future structure-based design of inhibitors.

Enhanced production of a single domain antibody with an engineered stabilizing extra disulfide bond.

PubMed

Liu, Jinny L; Goldman, Ellen R; Zabetakis, Dan; Walper, Scott A; Turner, Kendrick B; Shriver-Lake, Lisa C; Anderson, George P

2015-10-09

Single domain antibodies derived from the variable region of the unique heavy chain antibodies found in camelids yield high affinity and regenerable recognition elements. Adding an additional disulfide bond that bridges framework regions is a proven method to increase their melting temperature, however often at the expense of protein production. To fulfill their full potential it is essential to achieve robust protein production of these stable binding elements. In this work, we tested the hypothesis that decreasing the isoelectric point of single domain antibody extra disulfide bond mutants whose production fell due to the incorporation of the extra disulfide bond would lead to recovery of the protein yield, while maintaining the favorable melting temperature and affinity. Introduction of negative charges into a disulfide bond mutant of a single domain antibody specific for the L1 antigen of the vaccinia virus led to approximately 3.5-fold increase of protein production to 14 mg/L, while affinity and melting temperature was maintained. In addition, refolding following heat denaturation improved from 15 to 70 %. It also maintained nearly 100 % of its binding function after heating to 85 °C for an hour at 1 mg/mL. Disappointingly, the replacement of neutral or positively charged amino acids with negatively charged ones to lower the isoelectric point of two anti-toxin single domain antibodies stabilized with a second disulfide bond yielded only slight increases in protein production. Nonetheless, for one of these binders the charge change itself stabilized the structure equivalent to disulfide bond addition, thus providing an alternative route to stabilization which is not accompanied by loss in production. The ability to produce high affinity, stable single domain antibodies is critical for their utility. While the addition of a second disulfide bond is a proven method for enhancing stability of single domain antibodies, it frequently comes at the cost of reduced yields. While decreasing the isoelectric point of double disulfide mutants of single domain antibodies may improve protein production, charge addition appears to consistently improve refolding and some charge changes can also improve thermal stability, thus providing a number of benefits making the examination of such mutations worth consideration.

Splice Site Mutations in the ATP7A Gene

PubMed Central

Møller, Lisbeth Birk

2011-01-01

Menkes disease (MD) is caused by mutations in the ATP7A gene. We describe 33 novel splice site mutations detected in patients with MD or the milder phenotypic form, Occipital Horn Syndrome. We review these 33 mutations together with 28 previously published splice site mutations. We investigate 12 mutations for their effect on the mRNA transcript in vivo. Transcriptional data from another 16 mutations were collected from the literature. The theoretical consequences of splice site mutations, predicted with the bioinformatics tool Human Splice Finder, were investigated and evaluated in relation to in vivo results. Ninety-six percent of the mutations identified in 45 patients with classical MD were predicted to have a significant effect on splicing, which concurs with the absence of any detectable wild-type transcript in all 19 patients investigated in vivo. Sixty-seven percent of the mutations identified in 12 patients with milder phenotypes were predicted to have no significant effect on splicing, which concurs with the presence of wild-type transcript in 7 out of 9 patients investigated in vivo. Both the in silico predictions and the in vivo results support the hypothesis previously suggested by us and others, that the presence of some wild-type transcript is correlated to a milder phenotype. PMID:21494555

Bridging the Gap Between Theory and Experiment to Derive a Detailed Understanding of Hammerhead Ribozyme Catalysis

PubMed Central

Lee, Tai-Sung; Wong, Kin-Yiu; Giambasu, George M.; York, Darrin M.

2016-01-01

Herein we summarize our progress toward the understanding of hammerhead ribozyme (HHR) catalysis through a multiscale simulation strategy. Simulation results collectively paint a picture of HHR catalysis: HHR first folds to form an electronegative active site pocket to recruit a threshold occupation of cationic charges, either a Mg2+ ion or multiple monovalent cations. Catalytically active conformations that have good in-line fitness are supported by specific metal ion coordination patterns that involve either a bridging Mg2+ ion or multiple Na+ ions, one of which is also in a bridging coordination pattern. In the case of a single Mg2+ ion bound in the active site, the Mg2+ ion undergoes a migration that is coupled with deprotonation of the nucleophile (C17:O2′). As the reaction proceeds, the Mg2+ ion stabilizes the accumulating charge of the leaving group and significantly increases the general acid ability of G8:O2′. Further computational mutagenesis simulations suggest that the disruptions due to mutations may severely impact HHR catalysis at different stages of the reaction. Catalytic mechanisms supported by the simulation results are consistent with available structural and biochemical experiments, and together they advance our understanding of HHR catalysis. PMID:24156941

Genetic interaction analysis of point mutations enables interrogation of gene function at a residue-level resolution

PubMed Central

Braberg, Hannes; Moehle, Erica A.; Shales, Michael; Guthrie, Christine; Krogan, Nevan J.

2014-01-01

We have achieved a residue-level resolution of genetic interaction mapping – a technique that measures how the function of one gene is affected by the alteration of a second gene – by analyzing point mutations. Here, we describe how to interpret point mutant genetic interactions, and outline key applications for the approach, including interrogation of protein interaction interfaces and active sites, and examination of post-translational modifications. Genetic interaction analysis has proven effective for characterizing cellular processes; however, to date, systematic high-throughput genetic interaction screens have relied on gene deletions or knockdowns, which limits the resolution of gene function analysis and poses problems for multifunctional genes. Our point mutant approach addresses these issues, and further provides a tool for in vivo structure-function analysis that complements traditional biophysical methods. We also discuss the potential for genetic interaction mapping of point mutations in human cells and its application to personalized medicine. PMID:24842270

Mutations in a signal sequence for the thylakoid membrane identify multiple protein transport pathways and nuclear suppressors

PubMed Central

1994-01-01

The apparatus that permits protein translocation across the internal thylakoid membranes of chloroplasts is completely unknown, even though these membranes have been the subject of extensive biochemical analysis. We have used a genetic approach to characterize the translocation of Chlamydomonas cytochrome f, a chloroplast-encoded protein that spans the thylakoid once. Mutations in the hydrophobic core of the cytochrome f signal sequence inhibit the accumulation of cytochrome f, lead to an accumulation of precursor, and impair the ability of Chlamydomonas cells to grow photosynthetically. One hydrophobic core mutant also reduces the accumulation of other thylakoid membrane proteins, but not those that translocate completely across the membrane. These results suggest that the signal sequence of cytochrome f is required and is involved in one of multiple insertion pathways. Suppressors of two signal peptide mutations describe at least two nuclear genes whose products likely describe the translocation apparatus, and selected second-site chloroplast suppressors further define regions of the cytochrome f signal peptide. PMID:8034740

Oxygen activation in flavoprotein oxidases: the importance of being positive.

PubMed

Gadda, Giovanni

2012-04-03

The oxidation of flavin hydroquinones by O(2) in solution is slow, with second-order rate constants of ~250 M(-1) s(-1). This is due to the obligatory, single-electron transfer that initiates the reaction being thermodynamically unfavored and poorly catalyzed. Notwithstanding considerations of O(2) accessibility to the reaction site, its desolvation and geometry and other factors that can also contribute to further rate acceleration, flavoprotein oxidases must activate O(2) for reaction with flavin hydroquinones to be able to achieve the 100-1000-fold rate enhancements typically observed. Protein positive charges have been identified in glucose oxidase, monomeric sarcosine oxidase, N-methyltryptophan oxidase and fructosamine oxidase that electrostatically stabilize the transition state for the initial single electron transfer that generates the O(2)(-•)/flavin semiquinone radical pair. In choline oxidase despite the presence of three histidines in the active site, the trimethylammonium group of the reaction product provides such an electrostatic stabilization. A nonpolar site proximal to the flavin C(4a) atom in choline oxidase has also been identified, which contributes to the geometry and desolvation of the O(2) reaction site. The relevance of O(2) activation by product charges to other flavoprotein oxidases, such as for example those catalyzing amine oxidations, is discussed in this review. A nonpolar site close to the flavin C(4a) atom and a positive charge is identified through structural analysis in several flavoprotein oxidases. Mutagenesis has disclosed nonpolar sites in O(2)-reducing enzymes that utilize copper/TPQ or iron. It is predicted that classes of O(2)-reducing enzymes utilizing other cofactors also contain a similar catalytic motif.

A mutational analysis of U12-dependent splice site dinucleotides

PubMed Central

DIETRICH, ROSEMARY C.; FULLER, JOHN D.; PADGETT, RICHARD A.

2005-01-01

Introns spliced by the U12-dependent minor spliceosome are divided into two classes based on their splice site dinucleotides. The /AU-AC/ class accounts for about one-third of U12-dependent introns in humans, while the /GU-AG/ class accounts for the other two-thirds. We have investigated the in vivo and in vitro splicing phenotypes of mutations in these dinucleotide sequences. A 5′ A residue can splice to any 3′ residue, although C is preferred. A 5′ G residue can splice to 3′ G or U residues with a preference for G. Little or no splicing was observed to 3′ A or C residues. A 5′ U or C residue is highly deleterious for U12-dependent splicing, although some combinations, notably 5′ U to 3′ U produced detectable spliced products. The dependence of 3′ splice site activity on the identity of the 5′ residue provides evidence for communication between the first and last nucleotides of the intron. Most mutants in the second position of the 5′ splice site and the next to last position of the 3′ splice site were defective for splicing. Double mutants of these residues showed no evidence of communication between these nucleotides. Varying the distance between the branch site and the 3′ splice site dinucleotide in the /GU-AG/ class showed that a somewhat larger range of distances was functional than for the /AU-AC/ class. The optimum branch site to 3′ splice site distance of 11–12 nucleotides appears to be the same for both classes. PMID:16043500

Anosmia predicts hypogonadotropic hypogonadism in CHARGE syndrome.

PubMed

Bergman, Jorieke E H; Bocca, Gianni; Hoefsloot, Lies H; Meiners, Linda C; van Ravenswaaij-Arts, Conny M A

2011-03-01

To test the hypothesis that a smell test could predict the occurrence of hypogonadotropic hypogonadism (HH) in patients with CHARGE syndrome, which is a variable combination of ocular coloboma, heart defects, choanal atresia, retardation of growth/development, genital hypoplasia, and ear anomalies or hearing loss caused by mutations in the CHD7 (chromodomain helicase DNA binding protein 7) gene. We performed endocrine studies and smell testing (University of Pennsylvania Smell Identification Test) in 35 adolescent patients with molecularly confirmed CHARGE syndrome. Complete data on smell and puberty were available for 15 patients; 11 patients had both anosmia and HH, whereas 4 patients had normosmia/hyposmia and spontaneous puberty. In addition, 7 boys were highly suspected of having HH (they were too young for definite HH diagnosis, but all had cryptorchidism, micropenis, or both) and had anosmia. The type of CHD7 mutation could not predict HH because a father and daughter with the same CHD7 mutation were discordant for HH and anosmia. Anosmia and HH were highly correlated in our cohort, and therefore smell testing seems to be an attractive method for predicting the occurrence of HH in patients with CHARGE syndrome. The use of this test could prevent delay of hormonal pubertal induction, resulting in an age-appropriate puberty. Copyright © 2011 Mosby, Inc. All rights reserved.

Effect of electrical polarization of hydroxyapatite ceramics on new bone formation.

PubMed

Itoh, S; Nakamura, S; Kobayashi, T; Shinomiya, K; Yamashita, K; Itoh, S

2006-03-01

Large surface charges can be induced on hydroxyapatite (HAp) ceramics by proton transport polarization, but this does not affect beta-tricalcium phosphate (TCP) because of its low polarizability. We wished to examine differences in osteogenic cell activity and new bone growth between positively or negatively surface-charged HAp and HAp/TCP plates using a calvarial bone defect model. In the first group of rats, test pieces were placed with their positively charged surfaces face down on the dura mater. In the second group, test pieces were placed with their negatively charged surfaces face down on the dura mater. A third group received noncharged test pieces. Histological examination, including enzymatic staining for osteoblasts and osteoclasts, was carried out. While no bone formation was observed at the pericranium, direct bone formation on the cranial bone debris and new bone growth expanded from the margins of the sites of injury to bridge across both the positively and negatively charged surfaces of HAp and HAp/TCP plates occurred. Electrical polarization of implanted plates, including positive charge, led to enhanced osteoblast activity, though decreased osteoclast activity was seen on the positively charged plate surface. Thus, polarization of HAp ceramics may modulate new bone formation and resorption.

Space environment induced mutations prefer to occur at polymorphic sites of rice genomes

NASA Astrophysics Data System (ADS)

Li, Y.; Liu, M.; Cheng, Z.; Sun, Y.

To explore the genomic characteristics of rice mutants induced by space environment, space-induced mutants 971-5, 972-4, and R955, which acquired new traits after space flight such as increased yield, reduced resistance to rice blast, and semi-dwarfism compared with their on-ground controls, 971ck, 972ck, and Bing95-503, respectively, together with other 8 japonica and 3 indica rice varieties, 17 in total, were analyzed by amplified fragment length polymorphism (AFLP) method. We chose 16 AFLP primer-pairs which generated a total of 1251 sites, of which 745 (59.6%) were polymorphic over all the genotypes. With the 16 pairs of primer combinations, 54 space-induced mutation sites were observed in 971-5, 86 in 972-4, and 5 in R955 compared to their controls, and the mutation rates were 4.3%, 6.9% and 0.4%, respectively. Interestingly, 75.9%, 84.9% and 100% of the mutation sites identified in 971-5, 972-4, and R955 occurred in polymorphic sites. This result suggests that the space environment preferentially induced mutations at polymorphic sites in rice genomes and might share a common mechanism with other types of mutagens. It also implies that polymorphic sites in genomes are potential "hotspots" for mutations induced by the space environment.

A site specific model and analysis of the neutral somatic mutation rate in whole-genome cancer data.

PubMed

Bertl, Johanna; Guo, Qianyun; Juul, Malene; Besenbacher, Søren; Nielsen, Morten Muhlig; Hornshøj, Henrik; Pedersen, Jakob Skou; Hobolth, Asger

2018-04-19

Detailed modelling of the neutral mutational process in cancer cells is crucial for identifying driver mutations and understanding the mutational mechanisms that act during cancer development. The neutral mutational process is very complex: whole-genome analyses have revealed that the mutation rate differs between cancer types, between patients and along the genome depending on the genetic and epigenetic context. Therefore, methods that predict the number of different types of mutations in regions or specific genomic elements must consider local genomic explanatory variables. A major drawback of most methods is the need to average the explanatory variables across the entire region or genomic element. This procedure is particularly problematic if the explanatory variable varies dramatically in the element under consideration. To take into account the fine scale of the explanatory variables, we model the probabilities of different types of mutations for each position in the genome by multinomial logistic regression. We analyse 505 cancer genomes from 14 different cancer types and compare the performance in predicting mutation rate for both regional based models and site-specific models. We show that for 1000 randomly selected genomic positions, the site-specific model predicts the mutation rate much better than regional based models. We use a forward selection procedure to identify the most important explanatory variables. The procedure identifies site-specific conservation (phyloP), replication timing, and expression level as the best predictors for the mutation rate. Finally, our model confirms and quantifies certain well-known mutational signatures. We find that our site-specific multinomial regression model outperforms the regional based models. The possibility of including genomic variables on different scales and patient specific variables makes it a versatile framework for studying different mutational mechanisms. Our model can serve as the neutral null model for the mutational process; regions that deviate from the null model are candidates for elements that drive cancer development.

Modulating the Voltage-sensitivity of a Genetically Encoded Voltage Indicator

PubMed Central

Jung, Arong; Rajakumar, Dhanarajan; Yoon, Bong-June

2017-01-01

Saturation mutagenesis was performed on a single position in the voltage-sensing domain (VSD) of a genetically encoded voltage indicator (GEVI). The VSD consists of four transmembrane helixes designated S1-S4. The V220 position located near the plasma membrane/extracellular interface had previously been shown to affect the voltage range of the optical signal. Introduction of polar amino acids at this position reduced the voltage-dependent optical signal of the GEVI. Negatively charged amino acids slightly reduced the optical signal by 33 percent while positively charge amino acids at this position reduced the optical signal by 80%. Surprisingly, the range of V220D was similar to that of V220K with shifted optical responses towards negative potentials. In contrast, the V220E mutant mirrored the responses of the V220R mutation suggesting that the length of the side chain plays in role in determining the voltage range of the GEVI. Charged mutations at the 219 position all behaved similarly slightly shifting the optical response to more negative potentials. Charged mutations to the 221 position behaved erratically suggesting interactions with the plasma membrane and/or other amino acids in the VSD. Introduction of bulky amino acids at the V220 position increased the range of the optical response to include hyperpolarizing signals. Combining The V220W mutant with the R217Q mutation resulted in a probe that reduced the depolarizing signal and enhanced the hyperpolarizing signal which may lead to GEVIs that only report neuronal inhibition. PMID:29093633

Modulating the Voltage-sensitivity of a Genetically Encoded Voltage Indicator.

PubMed

Jung, Arong; Rajakumar, Dhanarajan; Yoon, Bong-June; Baker, Bradley J

2017-10-01

Saturation mutagenesis was performed on a single position in the voltage-sensing domain (VSD) of a genetically encoded voltage indicator (GEVI). The VSD consists of four transmembrane helixes designated S1-S4. The V220 position located near the plasma membrane/extracellular interface had previously been shown to affect the voltage range of the optical signal. Introduction of polar amino acids at this position reduced the voltage-dependent optical signal of the GEVI. Negatively charged amino acids slightly reduced the optical signal by 33 percent while positively charge amino acids at this position reduced the optical signal by 80%. Surprisingly, the range of V220D was similar to that of V220K with shifted optical responses towards negative potentials. In contrast, the V220E mutant mirrored the responses of the V220R mutation suggesting that the length of the side chain plays in role in determining the voltage range of the GEVI. Charged mutations at the 219 position all behaved similarly slightly shifting the optical response to more negative potentials. Charged mutations to the 221 position behaved erratically suggesting interactions with the plasma membrane and/or other amino acids in the VSD. Introduction of bulky amino acids at the V220 position increased the range of the optical response to include hyperpolarizing signals. Combining The V220W mutant with the R217Q mutation resulted in a probe that reduced the depolarizing signal and enhanced the hyperpolarizing signal which may lead to GEVIs that only report neuronal inhibition.

Suppressor Mutation Analysis of the Sensory Rhodopsin I-Transducer Complex: Insights into the Color-Sensing Mechanism

PubMed Central

Jung, Kwang-Hwan; Spudich, John L.

1998-01-01

The molecular complex containing the phototaxis receptor sensory rhodopsin I (SRI) and transducer protein HtrI (halobacterial transducer for SRI) mediates color-sensitive phototaxis responses in the archaeon Halobacterium salinarum. One-photon excitation of the complex by orange light elicits attractant responses, while two-photon excitation (orange followed by near-UV light) elicits repellent responses in swimming cells. Several mutations in SRI and HtrI cause an unusual mutant phenotype, called orange-light-inverted signaling, in which the cell produces a repellent response to normally attractant light. We applied a selection procedure for intragenic and extragenic suppressors of orange-light-inverted mutants and identified 15 distinct second-site mutations that restore the attractant response. Two of the 3 suppressor mutations in SRI are positioned at the cytoplasmic ends of helices F and G, and 12 suppressor mutations in HtrI cluster at the cytoplasmic end of the second HtrI transmembrane helix (TM2). Nearly all suppressors invert the normally repellent response to two-photon stimulation to an attractant response when they are expressed with their suppressible mutant alleles or in an otherwise wild-type strain. The results lead to a model for control of flagellar reversal by the SRI-HtrI complex. The model invokes an equilibrium between the A (reversal-inhibiting) and R (reversal-stimulating) conformers of the signaling complex. Attractant light and repellent light shift the equilibrium toward the A and R conformers, respectively, and mutations are proposed to cause intrinsic shifts in the equilibrium in the dark form of the complex. Differences in the strength of the two-photon signal inversion and in the allele specificity of suppression are correlated, and this correlation can be explained in terms of different values of the equilibrium constant (Keq) for the conformational transition in different mutants and mutant-suppressor pairs. PMID:9555883

Histopathological analysis of aggressive renal cell carcinoma harboring a unique germline mutation in fumarate hydratase.

PubMed

Matsumoto, Kana; Udaka, Naoko; Hasumi, Hisashi; Nakaigawa, Noboru; Nagashima, Yoji; Tanaka, Reiko; Kato, Ikuma; Yao, Masahiro; Furuya, Mitsuko

2018-05-24

Hereditary leiomyomatosis and renal cell cancer (HLRCC) is a rare genetic disorder characterized by cutaneous and uterine leiomyomatosis with RCC. This disorder is caused by a germline mutation in the fumarate hydratase (FH) gene, which encodes an important enzyme of the tricarboxylic acid (TCA) cycle. This mutation distinguishes HLRCC from sporadic RCCs. Herein, we investigated a case of HLRCC in a 32-year-old man who underwent nephrectomy for treatment of a solid-cystic tumor in the left kidney. Histopathology demonstrated a variegated architecture of papillary, tubulocystic and cribriform patterns composed of high-grade tumor cells with enlarged nuclei and eosinophilic nucleoli. Immunostaining and western blotting revealed no FH expression in the tumor. Genomic DNA sequencing identified a heterozygous mutation involving deletion of the 3' end of exon 2 and intron 2 of the FH gene (c.251_267+7delTGACAGAACGCATGCCAGTAAGTG), and RT-PCR confirmed exon 2 skipping in FH mRNA. The somatic FH gene status of the tumor showed only the mutated allele, indicating loss of heterozygosity as the "second hit" of tumor suppressor gene inactivation. These data support that an FH mutation involving the splice site causes exon skipping, changing the conformation of the protein and accelerating carcinogenic cascades under impaired FH functioning in the TCA cycle. © 2018 Japanese Society of Pathology and John Wiley & Sons Australia, Ltd.

A mouse model for the cystic fibrosis delta F508 mutation.

PubMed Central

van Doorninck, J H; French, P J; Verbeek, E; Peters, R H; Morreau, H; Bijman, J; Scholte, B J

1995-01-01

Most cystic fibrosis (CF) patients produce a mutant form (delta F508) of the cystic fibrosis transmembrane conductance regulator (CFTR), which is not properly processed in normal cells but is active as a chloride channel in several experimental systems. We used a double homologous recombination ('Hit and Run') procedure to generate a mouse model for the delta F508 mutation. Targeted embryonic stem (ES) cells (Hit clones) were found; of these either 80 or 20% of the clones had lost the delta F508 mutation, depending on the distance between the linearization site in the targeting construct and the delta F508 mutation. Correctly targeted clones underwent a second selection step resulting in ES cell clones (Run clones) heterozygous for the delta F508 mutation with an efficiency of 2-7%. Chimeric mice were generated and offspring homozygous for the delta F508 mutation showed electrophysiological abnormalities in nasal epithelium, gallbladder and in the intestine, and histological abnormalities in the intestine, typical of CF. Our data suggest that the delta F508 mice have residual delta F508 CFTR activity which would explain the mild pathology of the delta F508 mice. The delta F508 mouse may provide a useful model for the study of the processing defect of delta F508 CFTR and for the development of novel therapeutic approaches based on circumvention of the processing block. Images PMID:7556083

Mutations in Nature Conferred a High Affinity Phosphatidylinositol 4,5-Bisphosphate-binding Site in Vertebrate Inwardly Rectifying Potassium Channels*

PubMed Central

Tang, Qiong-Yao; Larry, Trevor; Hendra, Kalen; Yamamoto, Erica; Bell, Jessica; Cui, Meng; Logothetis, Diomedes E.; Boland, Linda M.

2015-01-01

All vertebrate inwardly rectifying potassium (Kir) channels are activated by phosphatidylinositol 4,5-bisphosphate (PIP2) (Logothetis, D. E., Petrou, V. I., Zhang, M., Mahajan, R., Meng, X. Y., Adney, S. K., Cui, M., and Baki, L. (2015) Annu. Rev. Physiol. 77, 81–104; Fürst, O., Mondou, B., and D'Avanzo, N. (2014) Front. Physiol. 4, 404–404). Structural components of a PIP2-binding site are conserved in vertebrate Kir channels but not in distantly related animals such as sponges and sea anemones. To expand our understanding of the structure-function relationships of PIP2 regulation of Kir channels, we studied AqKir, which was cloned from the marine sponge Amphimedon queenslandica, an animal that represents the phylogenetically oldest metazoans. A requirement for PIP2 in the maintenance of AqKir activity was examined in intact oocytes by activation of a co-expressed voltage-sensing phosphatase, application of wortmannin (at micromolar concentrations), and activation of a co-expressed muscarinic acetylcholine receptor. All three mechanisms to reduce the availability of PIP2 resulted in inhibition of AqKir current. However, time-dependent rundown of AqKir currents in inside-out patches could not be re-activated by direct application to the inside membrane surface of water-soluble dioctanoyl PIP2, and the current was incompletely re-activated by the more hydrophobic arachidonyl stearyl PIP2. When we introduced mutations to AqKir to restore two positive charges within the vertebrate PIP2-binding site, both forms of PIP2 strongly re-activated the mutant sponge channels in inside-out patches. Molecular dynamics simulations validate the additional hydrogen bonding potential of the sponge channel mutants. Thus, nature's mutations conferred a high affinity activation of vertebrate Kir channels by PIP2, and this is a more recent evolutionary development than the structures that explain ion channel selectivity and inward rectification. PMID:25957411

Mutations of Cytochrome b559 and PsbJ on and near the QC Site in Photosystem II Influence the Regulation of Short-Term Light Response and Photosynthetic Growth of the Cyanobacterium Synechocystis sp. PCC 6803.

PubMed

Huang, Jine-Yung; Chiu, Yi-Fang; Ortega, José M; Wang, Hsing-Ting; Tseng, Tien-Sheng; Ke, Shyue-Chu; Roncel, Mercedes; Chu, Hsiu-An

2016-04-19

The characteristic features of two types of short-term light adaptations of the photosynthetic apparatus of the cyanobacterium Synechocystis sp. PCC 6803, state transition and blue-green light-induced fluorescence quenching, were compared in wild-type and cytochrome b559 and PsbJ mutant cells with mutations on and near the QC site in photosystem II (PSII). All mutant cells grew photoautotrophically and assembled stable PSII. Thermoluminescence emission experiments showed a decrease in the stability of the S3QB(-)/S2QB(-) charge pairs in the A16FJ, S28Aβ, and V32Fβ mutant cells. When dark-adapted wild-type and mutant cells were illuminated by medium-intensity blue light, the increase in the PSII fluorescence yield (indicating a transition to state 1) was more prominent in mutant than wild-type cells. Strong blue-light conditions induced a quenching of fluorescence corresponding to nonphotochemical fluorescence quenching (NPQ). The extension of NPQ decreased significantly in the mutants, and the kinetics appeared to be affected. When similar measures were repeated on an orange carotenoid protein (OCP)-deficient background, little or no quenching was observed, which confirms that the decrease in fluorescence under strong blue light corresponded to the OCP-dependent NPQ. Immunoblot results showed that the attenuated effect of blue light-induced NPQ in mutant cells was not due to a lack of OCP. Photosynthetic growth and biomass production were greater for A16FJ, S28Aβ, and V32Fβ mutant cells than for wild-type cells under normal growth conditions. Our results suggest that mutations of cytochrome b559 and PsbJ on and near the QC site of PSII may modulate the short-term light response in cyanobacteria.

Single electrode triboelectric generator

DOEpatents

Wang, Zhong Lin; Yang, Ya; Zhang, Hulin; Zhu, Guang

2017-11-07

A triboelectric generator includes a first contact charging member, a second contact charging member and an electrical load. The first contact charging member has a contact side and an opposite back side. The first contact charging member includes a material that has a first rating on a triboelectric series and also has a conductive aspect. The second contact charging member has a second rating on the triboelectric series, different from the first rating, and is configured to come into contact with the first contact layer and go out of contact with the first contact layer. The electrical load electrically is coupled to the first contact charging member and to a common voltage so that current will flow through the load after the second contact charging member comes into contact with the first contact charging member and then goes out of contact with the first contact charging member.

Identification and characterization of influenza variants resistant to a viral endonuclease inhibitor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Song, Min-Suk; Kumar, Gyanendra; Shadrick, William R.

The influenza endonuclease is an essential subdomain of the viral RNA polymerase. It processes host pre-mRNAs to serve as primers for viral mRNA and is an attractive target for antiinfluenza drug discovery. Compound L-742,001 is a prototypical endonuclease inhibitor, and we found that repeated passaging of influenza virus in the presence of this drug did not lead to the development of resistant mutant strains. Reduced sensitivity to L-742,001 could only be induced by creating point mutations via a random mutagenesis strategy. Furthermore, these mutations mapped to the endonuclease active site where they can directly impact inhibitor binding. Engineered viruses containingmore » the mutations showed resistance to L-742,001 both in vitro and in vivo, with only a modest reduction in fitness. Introduction of the mutations into a second virus also increased its resistance to the inhibitor. When using the isolated wild-type and mutant endonuclease domains, we used kinetics, inhibitor binding and crystallography to characterize how the two most significant mutations elicit resistance to L-742,001. These studies lay the foundation for the development of a new class of influenza therapeutics with reduced potential for the development of clinical endonuclease inhibitor-resistant influenza strains.« less

Identification and characterization of influenza variants resistant to a viral endonuclease inhibitor

DOE PAGES

Song, Min-Suk; Kumar, Gyanendra; Shadrick, William R.; ...

2016-03-14

The influenza endonuclease is an essential subdomain of the viral RNA polymerase. It processes host pre-mRNAs to serve as primers for viral mRNA and is an attractive target for antiinfluenza drug discovery. Compound L-742,001 is a prototypical endonuclease inhibitor, and we found that repeated passaging of influenza virus in the presence of this drug did not lead to the development of resistant mutant strains. Reduced sensitivity to L-742,001 could only be induced by creating point mutations via a random mutagenesis strategy. Furthermore, these mutations mapped to the endonuclease active site where they can directly impact inhibitor binding. Engineered viruses containingmore » the mutations showed resistance to L-742,001 both in vitro and in vivo, with only a modest reduction in fitness. Introduction of the mutations into a second virus also increased its resistance to the inhibitor. When using the isolated wild-type and mutant endonuclease domains, we used kinetics, inhibitor binding and crystallography to characterize how the two most significant mutations elicit resistance to L-742,001. These studies lay the foundation for the development of a new class of influenza therapeutics with reduced potential for the development of clinical endonuclease inhibitor-resistant influenza strains.« less

Structural modification of P-glycoprotein induced by OH radicals: Insights from atomistic simulations

NASA Astrophysics Data System (ADS)

Khosravian, N.; Kamaraj, B.; Neyts, E. C.; Bogaerts, A.

2016-02-01

This study reports on the possible effects of OH radical impact on the transmembrane domain 6 of P-glycoprotein, TM6, which plays a crucial role in drug binding in human cells. For the first time, we employ molecular dynamics (MD) simulations based on the self-consistent charge density functional tight binding (SCC-DFTB) method to elucidate the potential sites of fragmentation and mutation in this domain upon impact of OH radicals, and to obtain fundamental information about the underlying reaction mechanisms. Furthermore, we apply non-reactive MD simulations to investigate the long-term effect of this mutation, with possible implications for drug binding. Our simulations indicate that the interaction of OH radicals with TM6 might lead to the breaking of C-C and C-N peptide bonds, which eventually cause fragmentation of TM6. Moreover, according to our simulations, the OH radicals can yield mutation in the aromatic ring of phenylalanine in TM6, which in turn affects its structure. As TM6 plays an important role in the binding of a range of cytotoxic drugs with P-glycoprotein, any changes in its structure are likely to affect the response of the tumor cell in chemotherapy. This is crucial for cancer therapies based on reactive oxygen species, such as plasma treatment.

Three-dimensional modeling of glucose-6-phosphate dehydrogenase-deficient variants from German ancestry.

PubMed

Kiani, Farooq; Schwarzl, Sonja; Fischer, Stefan; Efferth, Thomas

2007-07-18

Loss of function of dimeric glucose-6-phosphate dehydrogenase (G6PD) represents the most common inborn error of metabolism throughout the world affecting an estimated 400 million people. In Germany, this enzymopathy is very rare. On the basis of G6PD crystal structures, we have analyzed six G6PD variants of German ancestry by three-dimensional modeling. All mutations present in the German population are either close to one of the three G6P or NADP(+) units or to the interface of the two monomers. Two of the three mutated amino acids of G6PD Vancouver are closer to the binding site of NADP(+). The G6PD Aachen mutation is also closer to the second NADP(+) unit. The G6PD Wayne mutation is closer to the G6P binding region. These mutations may affect the binding of G6P and NADP(+) units. Three mutations, i.e. G6PD Munich, G6PD Riverside and G6PD Gastonia, lie closer to the interface of the two monomers. These may also affect the interface of two monomers. None of these G6PD variants share mutations with the common G6PD variants known from the Mediterranean, Near East, or Africa indicating that they have developed independently. The G6PD variants have been compared with mutants from other populations and the implications for survival of G6PD variants from natural selection have been discussed.

Differential effects of FGFR2 mutations on syndactyly and cleft palate in Apert syndrome

DOE Office of Scientific and Technical Information (OSTI.GOV)

Slaney, S.F.; Oldridge, M.; Wilkie, A.O.M.

1996-05-01

Apert syndrome is a distinctive human malformation characterized by craniosynostosis and severe syndactyly of the hands and feet. It is caused by specific missense substitutions involving adjacent amino acids (Ser252Trp or Pro253Arg) in the linker between the second and third extracellular immunoglobulin domains of fibroblast growth factor receptor 2 (FGFR2). We have developed a simple PCR assay for these mutations in genomic DNA, based on the creation of novel SfiI and BstUI restriction sites. Analysis of DNA from 70 unrelated patients with Apert syndrome showed that 45 had the Ser252Trp mutation and 25 had the Pro253Arg mutation. Phenotypic differences betweenmore » these two groups of patients were investigated. Significant differences were found for severity of syndactyly and presence of cleft palate. The syndactyly was more severe with the Pro253Arg mutation, for both the hands and the feet. In contrast, cleft palate was significantly more common in the Ser252Trp patients. No convincing differences were found in the prevalence of other malformations associated with Apert syndrome. We conclude that, although the phenotype attributable to the two mutations is very similar, there are subtle differences. The opposite trends for severity of syndactyly and cleft palate in relation to the two mutations may relate to the varying patterns of temporal and tissue-specific expression of different fibroblast growth factors, the ligands for FGFR2. 54 refs., 5 figs., 3 tabs.« less

Mutations affecting two adjacent amino acid residues in the alpha subunit of RNA polymerase block transcriptional activation by the bacteriophage P2 Ogr protein.

PubMed Central

Ayers, D J; Sunshine, M G; Six, E W; Christie, G E

1994-01-01

The bacteriophage P2 ogr gene product is a positive regulator of transcription from P2 late promoters. The ogr gene was originally defined by compensatory mutations that overcame the block to P2 growth imposed by a host mutation, rpoA109, in the gene encoding the alpha subunit of RNA polymerase. DNA sequence analysis has confirmed that this mutation affects the C-terminal region of the alpha subunit, changing a leucine residue at position 290 to a histidine (rpoAL290H). We have employed a reporter plasmid system to screen other, previously described, rpoA mutants for effects on activation of a P2 late promoter and have identified a second allele, rpoA155, that blocks P2 late transcription. This mutation lies just upstream of rpoAL290H, changing the leucine residue at position 289 to a phenylalanine (rpoAL289F). The effect of the rpoAL289F mutation is not suppressed by the rpoAL290H-compensatory P2 ogr mutation. P2 ogr mutants that overcome the block imposed by rpoAL289F were isolated and characterized. Our results are consistent with a direct interaction between Ogr and the alpha subunit of RNA polymerase and support a model in which transcription factor contact sites within the C terminus of alpha are discrete and tightly clustered. PMID:8002564

Effects of mutation at the D-JH junction on affinity, specificity, and idiotypy of anti-progesterone antibody DB3.

PubMed

He, Mingyue; Hamon, Maureen; Liu, Hong; Corper, Adam L; Taussig, Michael J

2006-09-01

The crystal structures of the Fab' fragment of the anti-progesterone monoclonal antibody DB3 and its complexes with steroid haptens have shown that the D-JH junctional residue TrpH100 is a key contributor to binding site interactions with ligands. The indole group of TrpH100 also undergoes a significant conformational change between the bound and unliganded states, effectively opening and closing the combining site pocket. In order to explore the effect of substitutions at this position on steroid recognition, we have carried out mutagenesis on a construct encoding a three-domain single-chain fragment (VH/K) of DB3 expressed in Escherichia coli. TrpH100 was replaced by 13 different amino acids or deleted, and the functional and antigenic properties of the mutated fragments were analyzed. Most substitutions, including small, hydrophobic, hydrophilic, neutral, and negatively charged side chains, were reduced or abolished binding to free progesterone, although binding to progesterone-BSA was partially retained. The reduction in antigen binding was paralleled by alteration of the idiotype associated with the DB3 combining site. In contrast, the replacement of TrpH100 by Arg produced a mutant that retained wild-type antibody affinity and idiotype, but with altered specificity. Significant changes in this mutant included increased relative affinities of 10(4)-fold for progesterone-3-carboxymethyloxime and 10-fold for aetiocholanolone. Our results demonstrate an essential role for the junctional residue H100 in determining steroid-binding specificity and combining site idiotype and show that these properties can be changed by a single amino acid substitution at this position.

Stigmatellin Probes the Electrostatic Potential in the QB Site of the Photosynthetic Reaction Center

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gerencsér, László; Boros, Bogáta; Derrien, Valerie

2015-01-01

The electrostatic potential in the secondary quinone (QB) binding site of the reaction center (RC) of the photosynthetic bacterium Rhodobacter sphaeroides determines the rate and free energy change (driving force) of electron transfer to QB. It is controlled by the ionization states of residues in a strongly interacting cluster around the QB site. Reduction of the QB induces change of the ionization states of residues and binding of protons from the bulk. Stigmatellin, an inhibitor of the mitochondrial and photosynthetic respiratory chain, has been proven to be a unique voltage probe of the QB binding pocket. It binds to themore » QB site with high affinity, and the pK value of its phenolic group monitors the local electrostatic potential with high sensitivity. Investigations with different types of detergent as a model system of isolated RC revealed that the pK of stigmatellin was controlled overwhelmingly by electrostatic and slightly by hydrophobic interactions. Measurements showed a high pK value (>11) of stigmatellin in the QB pocket of the dark-state wild-type RC, indicating substantial negative potential. When the local electrostatics of the QB site was modulated by a single mutation, L213Asp/Ala, or double mutations, L213Asp-L212Glu/Ala-Ala (AA), the pK of stigmatellin dropped to 7.5 and 7.4, respectively, which corresponds to a >210 mV increase in the electrostatic potential relative to the wild-type RC. This significant pK drop (DpK > 3.5) decreased dramatically to (DpK > 0.75) in the RC of the compensatory mutant (AAþM44Asn/AAþM44Asp). Our results indicate that the L213Asp is the most important actor in the control of the electrostatic potential in the QB site of the dark-state wild-type RC, in good accordance with conclusions of former studies using theoretical calculations or light-induced charge recombination assay.« less

Defects in the calcium-binding region drastically affect the cadherin-like domains of RET tyrosine kinase.

PubMed

Gao, Chunxia; Grøtli, Morten; Eriksson, Leif A

2016-03-28

Mutations in the rearranged during transfection (RET) tyrosine kinase gene leading to gain or loss of function have been associated with the development of several human cancers and Hirschsprung's disease (HSCR). However, to what extent these mutations affect individual bio-molecular functions remains unclear. In this article, the functionally significant mutations in the RET CLD1-4 calcium-binding site which lead to HSCR, and depletion of calcium ions in the RET CLD1-4 calcium binding site, were investigated by molecular dynamics simulations--to understand the mechanistic action of the mutations or loss of calcium ions in altering the protein kinase structure, dynamics, and stability. The mutations or loss of calcium ions change the local conformation and change the free energy landscape. Specifically, the mutations and loss of calcium ions decrease the radius of gyration of the whole structure, leading to improper protein folding and GFL-GFRα contact site reduction. Furthermore, based on the most populated conformation in the wildtype MD simulations, a pharmacophore was generated by fragment docking to identify key features of the possible inhibitors targeting the calcium binding site. Overall, the findings may provide useful structural insights into the molecular mechanism underlying RET calcium-binding site mutations and assist in development of novel drugs targeting the extracellular ligand contact site of wildtype RET.

Topology of charge density of flucytosine and related molecules and characteristics of their bond charge distributions.

PubMed

Murgich, Juan; Franco, Héctor J; San-Blas, Gioconda

2006-08-24

The molecular charge distribution of flucytosine (4-amino-5-fluoro-2-pyrimidone), uracil, 5-fluorouracil, and thymine was studied by means of density functional theory calculations (DFT). The resulting distributions were analyzed by means of the atoms in molecules (AIM) theory. Bonds were characterized through vectors formed with the charge density value, its Laplacian, and the bond ellipticity calculated at the bond critical point (BCP). Within each set of C=O, C-H, and N-H bonds, these vectors showed little dispersion. C-C bonds formed three different subsets, one with a significant degree of double bonding, a second corresponding to single bonds with a finite ellipticity produced by hyperconjugation, and a third one formed by a pure single bond. In N-C bonds, a decrease in bond length (an increase in double bond character) was not reflected as an increase in their ellipticity, as in all C-C bonds studied. It was also found that substitution influenced the N-C, C-O, and C-C bond ellipticity much more than density and its Laplacian at the BCP. The Laplacian of charge density pointed to the existence of both bonding and nonbonding maxima in the valence shell charge concentration of N, O, and F, while only bonding ones were found for the C atoms. The nonbonding maxima related to the sites for electrophilic attack and H bonding in O and N, while sites of nucleophilic attack were suggested by the holes in the valence shell of the C atoms of the carbonyl groups.

First-second shell interactions in metal binding sites in proteins: a PDB survey and DFT/CDM calculations.

PubMed

Dudev, Todor; Lin, Yen-lin; Dudev, Minko; Lim, Carmay

2003-03-12

The role of the second shell in the process of metal binding and selectivity in metalloproteins has been elucidated by combining Protein Data Bank (PDB) surveys of Mg, Mn, Ca, and Zn binding sites with density functional theory/continuum dielectric methods (DFT/CDM). Peptide backbone groups were found to be the most common second-shell ligand in Mg, Mn, Ca, and Zn binding sites, followed (in decreasing order) by Asp/Glu, Lys/Arg, Asn/Gln, and Ser/Thr side chains. Aromatic oxygen- or nitrogen-containing side chains (Tyr, His, and Trp) and sulfur-containing side chains (Cys and Met) are seldom found in the second coordination layer. The backbone and Asn/Gln side chain are ubiquitous in the metal second coordination layer as their carbonyl oxygen and amide hydrogen can act as a hydrogen-bond acceptor and donor, respectively, and can therefore partner practically every first-shell ligand. The second most common outer-shell ligand, Asp/Glu, predominantly hydrogen bonds to a metal-bound water or Zn-bound histidine and polarizes the H-O or H-N bond. In certain cases, a second-shell Asp/Glu could affect the protonation state of the metal ligand. It could also energetically stabilize a positively charged metal complex more than a neutral ligand such as the backbone and Asn/Gln side chain. As for the first shell, the second shell is predicted to contribute to the metal selectivity of the binding site by discriminating between metal cations of different ionic radii and coordination geometries. The first-shell-second-shell interaction energies decay rapidly with increasing solvent exposure of the metal binding site. They are less favorable but are of the same order of magnitude as compared to the respective metal-first-shell interaction energies. Altogether, the results indicate that the structure and properties of the second shell are dictated by those of the first layer. The outer shell is apparently designed to stabilize/protect the inner-shell and complement/enhance its properties.

Electrostatic design of protein-protein association rates.

PubMed

Schreiber, Gideon; Shaul, Yossi; Gottschalk, Kay E

2006-01-01

De novo design and redesign of proteins and protein complexes have made promising progress in recent years. Here, we give an overview of how to use available computer-based tools to design proteins to bind faster and tighter to their protein-complex partner by electrostatic optimization between the two proteins. Electrostatic optimization is possible because of the simple relation between the Debye-Huckel energy of interaction between a pair of proteins and their rate of association. This can be used for rapid, structure-based calculations of the electrostatic attraction between the two proteins in the complex. Using these principles, we developed two computer programs that predict the change in k(on), and as such the affinity, on introducing charged mutations. The two programs have a web interface that is available at www.weizmann.ac.il/home/bcges/PARE.html and http://bip.weizmann.ac.il/hypare. When mutations leading to charge optimization are introduced outside the physical binding site, the rate of dissociation is unchanged and therefore the change in k(on) parallels that of the affinity. This design method was evaluated on a number of different protein complexes resulting in binding rates and affinities of hundreds of fold faster and tighter compared to wild type. In this chapter, we demonstrate the procedure and go step by step over the methodology of using these programs for protein-association design. Finally, the way to easily implement the principle of electrostatic design for any protein complex of choice is shown.

The conserved phenylalanine in the K+ channel voltage-sensor domain creates a barrier with unidirectional effects.

PubMed

Schwaiger, Christine S; Liin, Sara I; Elinder, Fredrik; Lindahl, Erik

2013-01-08

Voltage-gated ion channels are crucial for regulation of electric activity of excitable tissues such as nerve cells, and play important roles in many diseases. During activation, the charged S4 segment in the voltage sensor domain translates across a hydrophobic core forming a barrier for the gating charges. This barrier is critical for channel function, and a conserved phenylalanine in segment S2 has previously been identified to be highly sensitive to substitutions. Here, we have studied the kinetics of K(v)1-type potassium channels (Shaker and K(v)1.2/2.1 chimera) through site-directed mutagenesis, electrophysiology, and molecular simulations. The F290L mutation in Shaker (F233L in K(v)1.2/2.1) accelerates channel closure by at least a factor 50, although opening is unaffected. Free energy profiles with the hydrophobic neighbors of F233 mutated to alanine indicate that the open state with the fourth arginine in S4 above the hydrophobic core is destabilized by ∼17 kJ/mol compared to the first closed intermediate. This significantly lowers the barrier of the first deactivation step, although the last step of activation is unaffected. Simulations of wild-type F233 show that the phenyl ring always rotates toward the extracellular side both for activation and deactivation, which appears to help stabilize a well-defined open state. Copyright © 2013 Biophysical Society. Published by Elsevier Inc. All rights reserved.

Restriction digest screening facilitates efficient detection of site-directed mutations introduced by CRISPR in C. albicans UME6

PubMed Central

Evans, Ben A.; Smith, Olivia L.; Pickerill, Ethan S.; York, Mary K.; Buenconsejo, Kristen J.P.; Chambers, Antonio E.

2018-01-01

Introduction of point mutations to a gene of interest is a powerful tool when determining protein function. CRISPR-mediated genome editing allows for more efficient transfer of a desired mutation into a wide range of model organisms. Traditionally, PCR amplification and DNA sequencing is used to determine if isolates contain the intended mutation. However, mutation efficiency is highly variable, potentially making sequencing costly and time consuming. To more efficiently screen for correct transformants, we have identified restriction enzymes sites that encode for two identical amino acids or one or two stop codons. We used CRISPR to introduce these restriction sites directly upstream of the Candida albicans UME6 Zn2+-binding domain, a known regulator of C. albicans filamentation. While repair templates coding for different restriction sites were not equally successful at introducing mutations, restriction digest screening enabled us to rapidly identify isolates with the intended mutation in a cost-efficient manner. In addition, mutated isolates have clear defects in filamentation and virulence compared to wild type C. albicans. Our data suggest restriction digestion screening efficiently identifies point mutations introduced by CRISPR and streamlines the process of identifying residues important for a phenotype of interest. PMID:29892505

The prototype HIV-1 maturation inhibitor, bevirimat, binds to the CA-SP1 cleavage site in immature Gag particles.

PubMed

Nguyen, Albert T; Feasley, Christa L; Jackson, Ken W; Nitz, Theodore J; Salzwedel, Karl; Air, Gillian M; Sakalian, Michael

2011-12-07

Bevirimat, the prototype Human Immunodeficiency Virus type 1 (HIV-1) maturation inhibitor, is highly potent in cell culture and efficacious in HIV-1 infected patients. In contrast to inhibitors that target the active site of the viral protease, bevirimat specifically inhibits a single cleavage event, the final processing step for the Gag precursor where p25 (CA-SP1) is cleaved to p24 (CA) and SP1. In this study, photoaffinity analogs of bevirimat and mass spectrometry were employed to map the binding site of bevirimat to Gag within immature virus-like particles. Bevirimat analogs were found to crosslink to sequences overlapping, or proximal to, the CA-SP1 cleavage site, consistent with previous biochemical data on the effect of bevirimat on Gag processing and with genetic data from resistance mutations, in a region predicted by NMR and mutational studies to have α-helical character. Unexpectedly, a second region of interaction was found within the Major Homology Region (MHR). Extensive prior genetic evidence suggests that the MHR is critical for virus assembly. This is the first demonstration of a direct interaction between the maturation inhibitor, bevirimat, and its target, Gag. Information gained from this study sheds light on the mechanisms by which the virus develops resistance to this class of drug and may aid in the design of next-generation maturation inhibitors.

Systematic Analysis of Splice-Site-Creating Mutations in Cancer

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jayasinghe, Reyka G.; Cao, Song; Gao, Qingsong

For the past decade, cancer genomic studies have focused on mutations leading to splice-site disruption, overlooking those having splice-creating potential. Here, we applied a bioinformatic tool, MiSplice, for the large-scale discovery of splice-site-creating mutations (SCMs) across 8,656 TCGA tumors. We report 1,964 originally mis-annotated mutations having clear evidence of creating alternative splice junctions. TP53 and GATA3 have 26 and 18 SCMs, respectively, and ATRX has 5 from lower-grade gliomas. Mutations in 11 genes, including PARP1, BRCA1, and BAP1, were experimentally validated for splice-site-creating function. Notably, we found that neoantigens induced by SCMs are likely several folds more immunogenic compared tomore » missense mutations, exemplified by the recurrent GATA3 SCM. Further, high expression of PD-1 and PD-L1 was observed in tumors with SCMs, suggesting candidates for immune blockade therapy. Finally, our work highlights the importance of integrating DNA and RNA data for understanding the functional and the clinical implications of mutations in human diseases.« less

Systematic Analysis of Splice-Site-Creating Mutations in Cancer.

PubMed

Jayasinghe, Reyka G; Cao, Song; Gao, Qingsong; Wendl, Michael C; Vo, Nam Sy; Reynolds, Sheila M; Zhao, Yanyan; Climente-González, Héctor; Chai, Shengjie; Wang, Fang; Varghese, Rajees; Huang, Mo; Liang, Wen-Wei; Wyczalkowski, Matthew A; Sengupta, Sohini; Li, Zhi; Payne, Samuel H; Fenyö, David; Miner, Jeffrey H; Walter, Matthew J; Vincent, Benjamin; Eyras, Eduardo; Chen, Ken; Shmulevich, Ilya; Chen, Feng; Ding, Li

2018-04-03

For the past decade, cancer genomic studies have focused on mutations leading to splice-site disruption, overlooking those having splice-creating potential. Here, we applied a bioinformatic tool, MiSplice, for the large-scale discovery of splice-site-creating mutations (SCMs) across 8,656 TCGA tumors. We report 1,964 originally mis-annotated mutations having clear evidence of creating alternative splice junctions. TP53 and GATA3 have 26 and 18 SCMs, respectively, and ATRX has 5 from lower-grade gliomas. Mutations in 11 genes, including PARP1, BRCA1, and BAP1, were experimentally validated for splice-site-creating function. Notably, we found that neoantigens induced by SCMs are likely several folds more immunogenic compared to missense mutations, exemplified by the recurrent GATA3 SCM. Further, high expression of PD-1 and PD-L1 was observed in tumors with SCMs, suggesting candidates for immune blockade therapy. Our work highlights the importance of integrating DNA and RNA data for understanding the functional and the clinical implications of mutations in human diseases. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.

Systematic Analysis of Splice-Site-Creating Mutations in Cancer

DOE PAGES

Jayasinghe, Reyka G.; Cao, Song; Gao, Qingsong; ...

2018-04-05

For the past decade, cancer genomic studies have focused on mutations leading to splice-site disruption, overlooking those having splice-creating potential. Here, we applied a bioinformatic tool, MiSplice, for the large-scale discovery of splice-site-creating mutations (SCMs) across 8,656 TCGA tumors. We report 1,964 originally mis-annotated mutations having clear evidence of creating alternative splice junctions. TP53 and GATA3 have 26 and 18 SCMs, respectively, and ATRX has 5 from lower-grade gliomas. Mutations in 11 genes, including PARP1, BRCA1, and BAP1, were experimentally validated for splice-site-creating function. Notably, we found that neoantigens induced by SCMs are likely several folds more immunogenic compared tomore » missense mutations, exemplified by the recurrent GATA3 SCM. Further, high expression of PD-1 and PD-L1 was observed in tumors with SCMs, suggesting candidates for immune blockade therapy. Finally, our work highlights the importance of integrating DNA and RNA data for understanding the functional and the clinical implications of mutations in human diseases.« less

Electrostatic dominoes: long distance propagation of mutational effects in photosynthetic reaction centers of Rhodobacter capsulatus.

PubMed

Sebban, P; Maróti, P; Schiffer, M; Hanson, D K

1995-07-04

Two point mutants from the purple bacterium Rhodobacter capsulatus, both modified in the M protein of the photosynthetic reaction center, have been studied by flash-induced absorbance spectroscopy. These strains carry either the M231Arg --> Leu or M43ASN --> Asp mutations, which are located 9 and 15 A, respectively, from the terminal electron acceptor QB. In the wild-type Rb. sphaeroides structure, M231Arg is involved in a conserved salt bridge with H125Glu and H232Glu and M43Asn is located among several polar residues that form or surround the QB binding site. These substitutions were originally uncovered in phenotypic revertants isolated from the photosynthetically incompetent L212Glu-L213Asp --> Ala-Ala site-specific double mutant. As second-site suppressor mutations, they have been shown to restore the proton transfer function that is interrupted in the L212Ala-L213Ala double mutant. The electrostatic effects that are induced in reaction centers by the M231Arg --> Leu and M43Asn --> Asp substitutions are roughly the same in either the double-mutant or wild-type backgrounds. In a reaction center that is otherwise wild type in sequence, they decrease the free energy gap between the QA- and QB- states by 24 +/- 5 and 45 +/- 5 meV, respectively. The pH dependences of K2, the QA-QB <--> QAQB- equilibrium constant, are altered in reaction centers that carry either of these substitutions, revealing differences in the pKas of titratable groups compared to the wild type.(ABSTRACT TRUNCATED AT 250 WORDS)

Evolutionary renovation of L/M opsin polymorphism confers a fruit discrimination advantage to ateline New World monkeys

PubMed Central

Matsumoto, Yoshifumi; Hiramatsu, Chihiro; Matsushita, Yuka; Ozawa, Norihiro; Ashino, Ryuichi; Nakata, Makiko; Kasagi, Satoshi; Di Fiore, Anthony; Schaffner, Colleen M; Aureli, Filippo; Melin, Amanda D; Kawamura, Shoji

2014-01-01

New World monkeys exhibit prominent colour vision variation due to allelic polymorphism of the long-to-middle wavelength (L/M) opsin gene. The known spectral variation of L/M opsins in primates is broadly determined by amino acid composition at three sites: 180, 277 and 285 (the ‘three-sites’ rule). However, two L/M opsin alleles found in the black-handed spider monkeys (Ateles geoffroyi) are known exceptions, presumably due to novel mutations. The spectral separation of the two L/M photopigments is 1.5 times greater than expected based on the ‘three-sites’ rule. Yet the consequence of this for the visual ecology of the species is unknown, as is the evolutionary mechanism by which spectral shift was achieved. In this study, we first examine L/M opsins of two other Atelinae species, the long-haired spider monkeys (A. belzebuth) and the common woolly monkeys (Lagothrix lagotricha). By a series of site-directed mutagenesis, we show that a mutation Y213D (tyrosine to aspartic acid at site 213) in the ancestral opsin of the two alleles enabled N294K, which occurred in one allele of the ateline ancestor and increased the spectral separation between the two alleles. Second, by modelling the chromaticity of dietary fruits and background leaves in a natural habitat of spider monkeys, we demonstrate that chromatic discrimination of fruit from leaves is significantly enhanced by these mutations. This evolutionary renovation of L/M opsin polymorphism in atelines illustrates a previously unappreciated dynamism of opsin genes in shaping primate colour vision. PMID:24612406

Simultaneous site-directed mutagenesis of duplicated loci in soybean using a single guide RNA.

PubMed

Kanazashi, Yuhei; Hirose, Aya; Takahashi, Ippei; Mikami, Masafumi; Endo, Masaki; Hirose, Sakiko; Toki, Seiichi; Kaga, Akito; Naito, Ken; Ishimoto, Masao; Abe, Jun; Yamada, Tetsuya

2018-03-01

Using a gRNA and Agrobacterium-mediated transformation, we performed simultaneous site-directed mutagenesis of two GmPPD loci in soybean. Mutations in GmPPD loci were confirmed in at least 33% of T 2 seeds. The clustered regularly interspaced short palindromic repeat (CRISPR)/CRISPR-associated endonuclease 9 (Cas9) system is a powerful tool for site-directed mutagenesis in crops. Using a single guide RNA (gRNA) and Agrobacterium-mediated transformation, we performed simultaneous site-directed mutagenesis of two homoeologous loci in soybean (Glycine max), GmPPD1 and GmPPD2, which encode the orthologs of Arabidopsis thaliana PEAPOD (PPD). Most of the T 1 plants had heterozygous and/or chimeric mutations for the targeted loci. The sequencing analysis of T 1 and T 2 generations indicates that putative mutation induced in the T 0 plant is transmitted to the T 1 generation. The inheritable mutation induced in the T 1 plant was also detected. This result indicates that continuous induction of mutations during T 1 plant development increases the occurrence of mutations in germ cells, which ensures the transmission of mutations to the next generation. Simultaneous site-directed mutagenesis in both GmPPD loci was confirmed in at least 33% of T 2 seeds examined. Approximately 19% of double mutants did not contain the Cas9/gRNA expression construct. Double mutants with frameshift mutations in both GmPPD1 and GmPPD2 had dome-shaped trifoliate leaves, extremely twisted pods, and produced few seeds. Taken together, our data indicate that continuous induction of mutations in the whole plant and advancing generations of transgenic plants enable efficient simultaneous site-directed mutagenesis in duplicated loci in soybean.

RAS mutations affect pattern of metastatic spread and increase propensity for brain metastasis in colorectal cancer.

PubMed

Yaeger, Rona; Cowell, Elizabeth; Chou, Joanne F; Gewirtz, Alexandra N; Borsu, Laetitia; Vakiani, Efsevia; Solit, David B; Rosen, Neal; Capanu, Marinela; Ladanyi, Marc; Kemeny, Nancy

2015-04-15

RAS and PIK3CA mutations in metastatic colorectal cancer (mCRC) have been associated with worse survival. We sought to evaluate the impact of RAS and PIK3CA mutations on cumulative incidence of metastasis to potentially curable sites of liver and lung and other sites such as bone and brain. We performed a computerized search of the electronic medical record of our institution for mCRC cases genotyped for RAS or PIK3CA mutations from 2008 to 2012. Cases were reviewed for patient characteristics, survival, and site-specific metastasis. Among the 918 patients identified, 477 cases were RAS wild type, and 441 cases had a RAS mutation (394 at KRAS exon 2, 29 at KRAS exon 3 or 4, and 18 in NRAS). RAS mutation was significantly associated with shorter median overall survival (OS) and on multivariate analysis independently predicted worse OS (HR, 1.6; P < .01). RAS mutant mCRC exhibited a significantly higher cumulative incidence of lung, bone, and brain metastasis and on multivariate analysis was an independent predictor of involvement of these sites (HR, 1.5, 1.6, and 3.7, respectively). PIK3CA mutations occurred in 10% of the 786 cases genotyped, did not predict for worse survival, and did not exhibit a site-specific pattern of metastatic spread. The metastatic potential of CRC varies with the presence of RAS mutation. RAS mutation is associated with worse OS and increased incidence of lung, bone, and brain metastasis. An understanding of this site-specific pattern of spread may help to inform physicians' assessment of symptoms in patients with mCRC. © 2014 American Cancer Society.

X-linked Alport syndrome caused by splicing mutations in COL4A5.

PubMed

Nozu, Kandai; Vorechovsky, Igor; Kaito, Hiroshi; Fu, Xue Jun; Nakanishi, Koichi; Hashimura, Yuya; Hashimoto, Fusako; Kamei, Koichi; Ito, Shuichi; Kaku, Yoshitsugu; Imasawa, Toshiyuki; Ushijima, Katsumi; Shimizu, Junya; Makita, Yoshio; Konomoto, Takao; Yoshikawa, Norishige; Iijima, Kazumoto

2014-11-07

X-linked Alport syndrome is caused by mutations in the COL4A5 gene. Although many COL4A5 mutations have been detected, the mutation detection rate has been unsatisfactory. Some men with X-linked Alport syndrome show a relatively mild phenotype, but molecular basis investigations have rarely been conducted to clarify the underlying mechanism. In total, 152 patients with X-linked Alport syndrome who were suspected of having Alport syndrome through clinical and pathologic investigations and referred to the hospital for mutational analysis between January of 2006 and January of 2013 were genetically diagnosed. Among those patients, 22 patients had suspected splice site mutations. Transcripts are routinely examined when suspected splice site mutations for abnormal transcripts are detected; 11 of them showed expected exon skipping, but others showed aberrant splicing patterns. The mutation detection strategy had two steps: (1) genomic DNA analysis using PCR and direct sequencing and (2) mRNA analysis using RT-PCR to detect RNA processing abnormalities. Six splicing consensus site mutations resulting in aberrant splicing patterns, one exonic mutation leading to exon skipping, and four deep intronic mutations producing cryptic splice site activation were identified. Interestingly, one case produced a cryptic splice site with a single nucleotide substitution in the deep intron that led to intronic exonization containing a stop codon; however, the patient showed a clearly milder phenotype for X-linked Alport syndrome in men with a truncating mutation. mRNA extracted from the kidney showed both normal and abnormal transcripts, with the normal transcript resulting in the milder phenotype. This novel mechanism leads to mild clinical characteristics. This report highlights the importance of analyzing transcripts to enhance the mutation detection rate and provides insight into genotype-phenotype correlations. This approach can clarify the cause of atypically mild phenotypes in X-linked Alport syndrome. Copyright © 2014 by the American Society of Nephrology.

BRCA 1 & 2 mutations in Sudanese secondary school girls with known breast cancer in their families

PubMed Central

Elnour, Ahmed M; Elderdery, Abozer Y; Mills, Jeremy; Mohammed, Babiker A; ElbietAbdelaal, Daw; Mohamed, Abdelraheem Osman; Elhassan, Kamal Eldin H; A, Abdel Hady; Wahab, Abdel; Cooper, Alan

2012-01-01

Objective Breast cancer is a major cause of morbidity and mortality in women worldwide. In Sudan, it is the most commonly diagnosed cancer. This study assesses the prevalence of BRCA1 and BRCA2 mutations among female students with a family history of breast cancer, in secondary schools of Marawi Locality, Northern State, Sudan. Methods From a survey of 2370 students, 67 cases (47 with family history and 20 controls) were analyzed for BRCA1 and BRCA2 mutations with a single-stranded conformation polymorphism (SSCP) mutation detection method applied to peripheral blood. Eighteen subjects knew of first degree female relatives with breast cancer, 23 with second degree female family members affected and 6 with related male sufferers. Twenty randomly selected girls from the remainder of the survey population with no known family history were also tested. Results The breast cancer susceptibility genes BRCA1 and BRCA2 accounted, respectively, for 1.21% of responders or 51% of those claiming a family history. Mutations were found in 20% of the group selected with no family history. Only 2 BRCA 2 mutations were found, both in girls with no known afflicted relatives. Six girls knew of male relatives with breast cancer; five of these girls carried mutant BRCA 1. Most of the BRCA1- mutations located to exon 11 fragments 11.9 and 11.1. Conclusion The study indicates a high prevalence of genetically associated breast cancer in the Marawi locality suggesting a need to focus on the two mutation sites in developing screening protocols for at least this area of Sudan. PMID:23267305

Spinal Neurofibromatosis without Café-au-Lait Macules in Two Families with Null Mutations of the NF1 Gene

PubMed Central

Kaufmann, Dieter; Müller, Ralf; Bartelt, Britta; Wolf, Michael; Kunzi-Rapp, Karin; Hanemann, Clemens Oliver; Fahsold, Raimund; Hein, Christian; Vogel, Walther; Assum, Günter

2001-01-01

Spinal neurofibromatosis (SNF) is considered to be an alternative form of neurofibromatosis, showing multiple spinal tumors and café-au-lait macules. Involvement of the neurofibromatosis type 1 (NF1) locus has been demonstrated, by linkage analysis, for three families with SNF. In one of them, a cosegregating frameshift mutation in exon 46 of the NF1 gene was identified. In the present study, we report four individuals from two families who carry NF1 null mutations that would be expected to cause NF1. Three patients have multiple spinal tumors and no café-au-lait macules, and the fourth has no clinical signs of NF1. In the first family, a missense mutation (Leu2067Pro) in NF1 exon 33 was found, and, in the second, a splice-site mutation (IVS31-5A→G) enlarging exon 32 by 4 bp at the 5′ end was found. The latter mutation has also been observed in an unrelated patient with classical NF1. Both NF1 mutations cause a reduction in neurofibromin of ∼50%, with no truncated protein present in the cells. This demonstrates that typical NF1 null mutations can result in a phenotype that is distinct from classical NF1, showing only a small spectrum of the NF1 symptoms, such as multiple spinal tumors, but not completely fitting the current clinical criteria for SNF. We speculate that this phenotype is caused by an unknown modifying gene that compensates for some, but not all, of the effects caused by neurofibromin deficiency. PMID:11704931

Common founder mutation in the LDL receptor gene causing familial hypercholesterolaemia in the Icelandic population.

PubMed

Gudnason, V; Sigurdsson, G; Nissen, H; Humphries, S E

1997-01-01

Haplotype analysis in 18 apparently unrelated families with familial hypercholesterolaemia (FH) in Iceland has identified at least five different chromosomes cosegregating with hypercholesterolaemia. The most common haplotype was identified in 11 of the 18 families, indicating a responsible for FH in the Icelandic population. By using single-strand conformation polymorphism (SSCP) and direct sequencing of amplified DNA, we identified a novel mutation (a T to a C) in the second nucleotide in the 5' part of intron 4 in the LDL receptor gene. This mutation was present in approximately 60% of the FH families (10/18), supporting the prediction of a common founder. These families could be traced to a common ancestor in half of the cases by going back no further than the eighteenth century. The mutation was predicted to affect correct splicing of exon 4, and analysis at the cellular level demonstrated an abnormal mRNA containing intron 4 sequence in lymphoblastoid cells from a patient carrying this mutation. Translation of the mRNA would lead to a premature stop codon and a truncated nonfunctional protein of 285 amino acids. The novel sequence change created a new restriction site for the restriction endonuclease NlaIII, and using this assay, 29 unrelated individuals with possible FH attending a lipid clinic for treatment were examined for this mutation. Two individuals in this group of patients were found to be carriers of this mutation, supporting the suggestion of a founder mutation. Using this assay for the detection of FH in the Icelandic population should identify > 60% of these individuals.

Translational autocontrol of the Escherichia coli ribosomal protein S15.

PubMed

Portier, C; Dondon, L; Grunberg-Manago, M

1990-01-20

When rpsO, the gene encoding the ribosomal protein S15 in Escherichia coli, is carried by a multicopy plasmid, the mRNA synthesis rate of S15 increases with the gene dosage but the rate of synthesis of S15 does not rise. A translational fusion between S15 and beta-galactosidase was introduced on the chromosome in a delta lac strain and the expression of beta-galactosidase studied under different conditions. The presence of S15 in trans represses the beta-galactosidase level five- to sixfold, while the synthesis rate of the S15-beta-galactosidase mRNA decreases by only 30 to 50%. These data indicate that S15 is subject to autogenous translational control. Derepressed mutants were isolated and sequenced. All the point mutations map in the second codon of S15, suggesting a location for the operator site that is very near to the translation initiation codon. However, the creation of deletion mutations shows that the operator extends into the 5' non-coding part of the message, thus overlapping the ribosome loading site.

KCNE1 divides the voltage sensor movement in KCNQ1/KCNE1 channels into two steps

NASA Astrophysics Data System (ADS)

Barro-Soria, Rene; Rebolledo, Santiago; Liin, Sara I.; Perez, Marta E.; Sampson, Kevin J.; Kass, Robert S.; Larsson, H. Peter

2014-04-01

The functional properties of KCNQ1 channels are highly dependent on associated KCNE-β subunits. Mutations in KCNQ1 or KCNE subunits can cause congenital channelopathies, such as deafness, cardiac arrhythmias and epilepsy. The mechanism by which KCNE1-β subunits slow the kinetics of KCNQ1 channels is a matter of current controversy. Here we show that KCNQ1/KCNE1 channel activation occurs in two steps: first, mutually independent voltage sensor movements in the four KCNQ1 subunits generate the main gating charge movement and underlie the initial delay in the activation time course of KCNQ1/KCNE1 currents. Second, a slower and concerted conformational change of all four voltage sensors and the gate, which opens the KCNQ1/KCNE1 channel. Our data show that KCNE1 divides the voltage sensor movement into two steps with widely different voltage dependences and kinetics. The two voltage sensor steps in KCNQ1/KCNE1 channels can be pharmacologically isolated and further separated by a disease-causing mutation.

Normal and impaired charge transport in biological systems

NASA Astrophysics Data System (ADS)

Miller, John H.; Villagrán, Martha Y. Suárez; Maric, Sladjana; Briggs, James M.

2015-03-01

We examine the physics behind some of the causes (e.g., hole migration and localization that cause incorrect base pairing in DNA) and effects (due to amino acid replacements affecting mitochondrial charge transport) of disease-implicated point mutations, with emphasis on mutations affecting mitochondrial DNA (mtDNA). First we discuss hole transport and localization in DNA, including some of our quantum mechanical modeling results, as they relate to certain mutations in cancer. Next, we give an overview of electron and proton transport in the mitochondrial electron transport chain, and how such transport can become impaired by mutations implicated in neurodegenerative diseases, cancer, and other major illnesses. In particular, we report on our molecular dynamics (MD) studies of a leucine→arginine amino acid replacement in ATP synthase, encoded by the T→G point mutation at locus 8993 of mtDNA. This mutation causes Leigh syndrome, a devastating maternally inherited neuromuscular disorder, and has been found to trigger rapid tumor growth in prostate cancer cell lines. Our MD results suggest, for the first time, that this mutation adversely affects water channels that transport protons to and from the c-ring of the rotary motor ATP synthase, thus impairing the ability of the motor to produce ATP. Finally, we discuss possible future research topics for biological physics, such as mitochondrial complex I, a large proton-pumping machine whose physics remains poorly understood.

Astrobiological aspects of the mutagenesis of cosmic radiation on bacterial spores.

PubMed

Moeller, Ralf; Reitz, Günther; Berger, Thomas; Okayasu, Ryuichi; Nicholson, Wayne L; Horneck, Gerda

2010-06-01

Based on their unique resistance to various space parameters, Bacillus endospores are one of the model systems used for astrobiological studies. In this study, spores of B. subtilis were used to study the effects of galactic cosmic radiation (GCR) on spore survival and induced mutagenesis. In interplanetary space, outside Earth's protective magnetic field, spore-containing rocks would be exposed to bombardment by high-energy charged particle radiation from galactic sources and from the Sun, which consists of photons (X-rays, gamma rays), protons, electrons, and heavy, high-energy charged (HZE) particles. B. subtilis spores were irradiated with X-rays and accelerated heavy ions (helium, carbon, silicon and iron) in the linear energy transfer (LET) range of 2-200 keV/mum. Spore survival and the rate of the induced mutations to rifampicin resistance (Rif(R)) depended on the LET of the applied species of ions and radiation, whereas the exposure to high-energy charged particles, for example, iron ions, led to a low level of spore survival and increased frequency of mutation to Rif(R) compared to low-energy charged particles and X-rays. Twenty-one Rif(R) mutant spores were isolated from X-ray and heavy ion-irradiated samples. Nucleotide sequencing located the Rif(R) mutations in the rpoB gene encoding the beta-subunit of RNA polymerase. Most mutations were primarily found in Cluster I and were predicted to result in amino acid changes at residues Q469L, A478V, and H482P/Y. Four previously undescribed alleles in B. subtilis rpoB were isolated: L467P, R484P, and A488P in Cluster I and H507R in the spacer between Clusters I and II. The spectrum of Rif(R) mutations arising from spores exposed to components of GCR is distinctly different from those of spores exposed to simulated space vacuum and martian conditions.

Distinct cerebellar foliation anomalies in a CHD7 haploinsufficient mouse model of CHARGE syndrome.

PubMed

Whittaker, Danielle E; Kasah, Sahrunizam; Donovan, Alex P A; Ellegood, Jacob; Riegman, Kimberley L H; Volk, Holger A; McGonnell, Imelda; Lerch, Jason P; Basson, M Albert

2017-12-01

Mutations in the gene encoding the ATP dependent chromatin-remodeling factor, CHD7 are the major cause of CHARGE (Coloboma, Heart defects, Atresia of the choanae, Retarded growth and development, Genital-urinary anomalies, and Ear defects) syndrome. Neurodevelopmental defects and a range of neurological signs have been identified in individuals with CHARGE syndrome, including developmental delay, lack of coordination, intellectual disability, and autistic traits. We previously identified cerebellar vermis hypoplasia and abnormal cerebellar foliation in individuals with CHARGE syndrome. Here, we report mild cerebellar hypoplasia and distinct cerebellar foliation anomalies in a Chd7 haploinsufficient mouse model. We describe specific alterations in the precise spatio-temporal sequence of fissure formation during perinatal cerebellar development responsible for these foliation anomalies. The altered cerebellar foliation pattern in Chd7 haploinsufficient mice show some similarities to those reported in mice with altered Engrailed, Fgf8 or Zic1 gene expression and we propose that mutations or polymorphisms in these genes may modify the cerebellar phenotype in CHARGE syndrome. Our findings in a mouse model of CHARGE syndrome indicate that a careful analysis of cerebellar foliation may be warranted in patients with CHARGE syndrome, particularly in patients with cerebellar hypoplasia and developmental delay. © 2017 The Authors. American Journal of Medical Genetics Part C Published by Wiley Periodicals, Inc.

Comparative biology approaches for charged particle exposures and cancer development processes

NASA Astrophysics Data System (ADS)

Kronenberg, Amy; Gauny, Stacey; Kwoh, Ely; Sudo, Hiroko; Wiese, Claudia; Dan, Cristian; Turker, Mitchell

Comparative biology studies can provide useful information for the extrapolation of results be-tween cells in culture and the more complex environment of the tissue. In other circumstances, they provide a method to guide the interpretation of results obtained for cells from differ-ent species. We have considered several key cancer development processes following charged particle exposures using comparative biology approaches. Our particular emphases have been mutagenesis and genomic instability. Carcinogenesis requires the accumulation of mutations and most of htese mutations occur on autosomes. Two loci provide the greatest avenue for the consideration of charged particle-induced mutation involving autosomes: the TK1 locus in human cells and the APRT locus in mouse cells. Each locus can provide information on a wide variety of mutational changes, from small intragenic mutations through multilocus dele-tions and extensive tracts of mitotic recombination. In addition, the mouse model can provide a direct measurement of chromosome loss which cannot be accomplished in the human cell system. Another feature of the mouse APRT model is the ability to examine effects for cells exposed in vitro with those obtained for cells exposed in situ. We will provide a comparison of the results obtained for the TK1 locus following 1 GeV/amu Fe ion exposures to the human lymphoid cells with those obtained for the APRT locus for mouse kidney epithelial cells (in vitro or in situ). Substantial conservation of mechanisms is found amongst these three exposure scenarios, with some differences attributable to the specific conditions of exposure. A similar approach will be applied to the consideraiton of proton-induced autosomal mutations in the three model systems. A comparison of the results obtained for Fe ions vs. protons in each case will highlight LET-specificc differences in response. Another cancer development process that is receiving considerable interest is genomic instability. We have examined this process following exposure to sparsely and densely ionizing charged particles in human lymphoid cells and in human epithelial cells. A comparison of the results in these systems can reveal similari-ties and differences as a function of cell type and LET. Last, we will approach the question of the relevance of genomic instability in the context of charged particle mutagenesis. In many models, it has been difficult to link these two processes. We will present data regarding the mechanistic associations between these processes. Taken together, these studies will allow the definition of conserved pathways that are likely to contribute strongly to the cancer risks for astronauts exposed to charged particle radiations. Supported by NASA grant NNJ07HC721 to A. Kronenberg and NASA grant NNX10AC12G to M. Turker.

HIV type-1 genotypic resistance profiles in vertically infected patients from Argentina reveal an association between K103N+L100I and L74V mutations.

PubMed

Aulicino, Paula C; Rocco, Carlos A; Mecikovsky, Debora; Bologna, Rosa; Mangano, Andrea; Sen, Luisa

2010-01-01

Patterns and pathways of HIV type-1 (HIV-1) antiretroviral (ARV) drug resistance-associated mutations in clinical isolates are conditioned by ARV history and factors such as viral subtype and fitness. Our aim was to analyse the frequency and association of ARV drug resistance mutations in a group of long-term vertically infected patients from Argentina. Plasma samples from 71 patients (38 children and 33 adolescents) were collected for genotypic HIV-1 ARV resistance testing during the period between February 2006 and October 2008. Statistically significant pairwise associations between ARV resistance mutations in pol, as well as associations between mutations and drug exposure, were identified using Fisher's exact tests with Bonferroni and false discovery rate corrections. Phylogenetic analyses were performed for subtype assignment. In protease (PR), resistance-associated mutations M46I/L, I54M/L/V/A/S and V82A/F/T/S/M/I were associated with each other and with minor mutations at codons 10, 24 and 71. Mutations V82A/F/T/S/M/I were primarily selected by the administration of ritonavir (RTV) in an historical ARV regimen. In reverse transcriptase, thymidine analogue mutation (TAM)1 profile was more common than TAM2. The non-nucleoside K103N+L100I mutations were observed at high frequency (15.5%) and were significantly associated with the nucleoside mutation L74V in BF recombinants. Associations of mutations at PR sites reflect the frequent use of RTV at an early time in this group of patients and convergent resistance mechanisms driven by the high exposure to protease inhibitors, as well as local HIV-1 diversity. The results provide clinical evidence of a molecular interaction between K103N+L100I and L74V mutations at the reverse transcriptase gene in vivo, limiting the future use of second-generation non-nucleoside reverse transcriptase inhibitors such as etravirine.

Molecular basis for competitive solvation of the Burkholderia cepacia lipase by sorbitol and urea.

PubMed

Oliveira, Ivan P; Martínez, Leandro

2016-08-21

Increasing the stability of proteins is important for their application in industrial processes. In the intracellular environment many small molecules, called osmolytes, contribute to protein stabilization under physical or chemical stress. Understanding the nature of the interactions of these osmolytes with proteins can help the design of solvents and mutations to increase protein stability in extracellular media. One of the most common stabilizing osmolyes is sorbitol and one of the most common chemical denaturants is urea. In this work, we use molecular dynamics simulations to obtain a detailed picture of the solvation of the Burkholderia cepacia lipase (BCL) in the presence of the protecting osmolyte sorbitol and of the urea denaturant. We show that both sorbitol and urea compete with water for interactions with the protein surface. Overall, sorbitol promotes the organization of water in the first solvation shell and displaces water from the second solvation shell, while urea causes opposite effects. These effects are, however, highly heterogeneous among residue types. For instance, the depletion of water from the first protein solvation shell by urea can be traced down essentially to the side chain of negatively charged residues. The organization of water in the first solvation shell promoted by sorbitol occurs at polar (but not charged) residues, where the urea effect is minor. By contrast, sorbitol depletes water from the second solvation shell of polar residues, while urea promotes water organization at the same distances. The interactions of urea with negatively charged residues are insensitive to the presence of sorbitol. This osmolyte removes water and urea particularly from the second solvation shell of polar and non-polar residues. In summary, we provide a comprehensive description of the diversity of protein-solvent interactions, which can guide further investigations on the stability of proteins in non-conventional media, and assist solvent and protein design.

Mutations in apoptosis-inducing factor cause X-linked recessive auditory neuropathy spectrum disorder

PubMed Central

Zong, Liang; Guan, Jing; Ealy, Megan; Zhang, Qiujing; Wang, Dayong; Wang, Hongyang; Zhao, Yali; Shen, Zhirong; Campbell, Colleen A; Wang, Fengchao; Yang, Ju; Sun, Wei; Lan, Lan; Ding, Dalian; Xie, Linyi; Qi, Yue; Lou, Xin; Huang, Xusheng; Shi, Qiang; Chang, Suhua; Xiong, Wenping; Yin, Zifang; Yu, Ning; Zhao, Hui; Wang, Jun; Wang, Jing; Salvi, Richard J; Petit, Christine; Smith, Richard J H; Wang, Qiuju

2015-01-01

Background Auditory neuropathy spectrum disorder (ANSD) is a form of hearing loss in which auditory signal transmission from the inner ear to the auditory nerve and brain stem is distorted, giving rise to speech perception difficulties beyond that expected for the observed degree of hearing loss. For many cases of ANSD, the underlying molecular pathology and the site of lesion remain unclear. The X-linked form of the condition, AUNX1, has been mapped to Xq23-q27.3, although the causative gene has yet to be identified. Methods We performed whole-exome sequencing on DNA samples from the AUNX1 family and another small phenotypically similar but unrelated ANSD family. Results We identified two missense mutations in AIFM1 in these families: c.1352G>A (p.R451Q) in the AUNX1 family and c.1030C>T (p.L344F) in the second ANSD family. Mutation screening in a large cohort of 3 additional unrelated families and 93 sporadic cases with ANSD identified 9 more missense mutations in AIFM1. Bioinformatics analysis and expression studies support this gene as being causative of ANSD. Conclusions Variants in AIFM1 gene are a common cause of familial and sporadic ANSD and provide insight into the expanded spectrum of AIFM1-associated diseases. The finding of cochlear nerve hypoplasia in some patients was AIFM1-related ANSD implies that MRI may be of value in localising the site of lesion and suggests that cochlea implantation in these patients may have limited success. PMID:25986071

Mutation Rate Variation is a Primary Determinant of the Distribution of Allele Frequencies in Humans

PubMed Central

Pritchard, Jonathan K.

2016-01-01

The site frequency spectrum (SFS) has long been used to study demographic history and natural selection. Here, we extend this summary by examining the SFS conditional on the alleles found at the same site in other species. We refer to this extension as the “phylogenetically-conditioned SFS” or cSFS. Using recent large-sample data from the Exome Aggregation Consortium (ExAC), combined with primate genome sequences, we find that human variants that occurred independently in closely related primate lineages are at higher frequencies in humans than variants with parallel substitutions in more distant primates. We show that this effect is largely due to sites with elevated mutation rates causing significant departures from the widely-used infinite sites mutation model. Our analysis also suggests substantial variation in mutation rates even among mutations involving the same nucleotide changes. In summary, we show that variable mutation rates are key determinants of the SFS in humans. PMID:27977673

Clostridium botulinum C2 toxin. Identification of the binding site for chloroquine and related compounds and influence of the binding site on properties of the C2II channel.

PubMed

Neumeyer, Tobias; Schiffler, Bettina; Maier, Elke; Lang, Alexander E; Aktories, Klaus; Benz, Roland

2008-02-15

Clostridium botulinum C2 toxin belongs to the family of binary AB type toxins that are structurally organized into distinct enzyme (A, C2I) and binding (B, C2II) components. The proteolytically activated 60-kDa C2II binding component is essential for C2I transport into target cells. It oligomerizes into heptamers and forms channels in lipid bilayer membranes. The C2II channel is cation-selective and can be blocked by chloroquine and related compounds. Residues 303-330 of C2II contain a conserved pattern of alternating hydrophobic and hydrophilic residues, which has been implicated in the formation of two amphipathic beta-strands involved in membrane insertion and channel formation. In the present study, C2II mutants created by substitution of different negatively charged amino acids by alanine-scanning mutagenesis were analyzed in artificial lipid bilayer membranes. The results suggested that most of the C2II mutants formed SDS-resistant oligomers (heptamers) similar to wild type. The mutated negatively charged amino acids did not influence channel properties with the exception of Glu(399) and Asp(426), which are probably localized in the vestibule near the channel entrance. These mutants show a dramatic decrease in their affinity for binding of chloroquine and its analogues. Similarly, F428A, which represents the Phi-clamp in anthrax protective antigen, was mutated in C2II in several other amino acids. The C2II mutants F428A, F428D, F428Y, and F428W not only showed altered chloroquine binding but also had drastically changed single channel properties. The results suggest that amino acids Glu(399), Asp(426), and Phe(428) have a major impact on the function of C2II as a binding protein for C2I delivery into target cells.

Protecting the normal in order to better kill the cancer

PubMed Central

Liu, Bingya; Ezeogu, Lewis; Zellmer, Lucas; Yu, Baofa; Xu, Ningzhi; Joshua Liao, Dezhong

2015-01-01

Chemotherapy is the only option for oncologists when a cancer has widely spread to different body sites. However, almost all currently available chemotherapeutic drugs will eventually encounter resistance after their initial positive effect, mainly because cancer cells develop genetic alterations, collectively coined herein as mutations, to adapt to the therapy. Some patients may still respond to a second chemo drug, but few cases respond to a third one. Since it takes time for cancer cells to develop new mutations and then select those life-sustaining ones via clonal expansion, “run against time for mutations to emerge” should be a crucial principle for treatment of those currently incurable cancers. Since cancer cells constantly change to adapt to the therapy whereas normal cells are stable, it may be a better strategy to shift our focus from killing cancer cells per se to protecting normal cells from chemotherapeutic toxicity. This new strategy requires the development of new drugs that are nongenotoxic and can quickly, in just hours or days, kill cancer cells without leaving the still-alive cells with time to develop mutations, and that should have their toxicities confined to only one or few organs, so that specific protections can be developed and applied. PMID:26177855

Congenital Hypogonadotropic Hypogonadism during Childhood: Presentation and Genetic Analyses in 46 Boys

PubMed Central

Vizeneux, Audrey; Hilfiger, Aude; Bouligand, Jérôme; Pouillot, Monique; Brailly-Tabard, Sylvie; Bashamboo, Anu; McElreavey, Ken; Brauner, Raja

2013-01-01

Background The majority of the patients reported with mutations in isolated hypogonadotropic hypogonadism (HH) are adults. We analysed the presentation and the plasma inhibin B and anti-müllerian hormone (AMH) concentrations during childhood and adolescence, and compared them to the genetic results. Methods This was a retrospective, single-center study of 46 boys with HH. Results Fourteen (30.4%) had Kallmann syndrome (KS), 4 (8.7%) had CHARGE syndrome and 28 (60.9%) had HH without olfaction deficit nor olfactive bulb hypoplasia. Eighteen (39%) had an associated malformation or syndromes. At diagnosis, 22 (47.8%) boys were aged

The role of lysine(100) in the binding of acetylcoenzyme A to human arylamine N-acetyltransferase 1: implications for other acetyltransferases.

PubMed

Minchin, Rodney F; Butcher, Neville J

2015-04-01

The arylamine N-acetyltransferases (NATs) catalyze the acetylation of aromatic and heterocyclic amines as well as hydrazines. All proteins in this family of enzymes utilize acetyl coenzyme A (AcCoA) as an acetyl donor, which initially binds to the enzyme and transfers an acetyl group to an active site cysteine. Here, we have investigated the role of a highly conserved amino acid (Lys(100)) in the enzymatic activity of human NAT1. Mutation of Lys(100) to either a glutamine or a leucine significantly increased the Ka for AcCoA without changing the Kb for the acetyl acceptor p-aminobenzoic acid. In addition, substrate inhibition was more marked with the mutant enzymes. Steady state kinetic analyzes suggested that mutation of Lys(100) to either leucine or glutamine resulted in a less stable enzyme-cofactor complex, which was not seen with a positively charged arginine at this position. When p-nitrophenylacetate was used as acetyl donor, no differences were seen between the wild-type and mutant enzymes because p-nitrophenylacetate is too small to interact with Lys(100) when bound to the active site. Using 3'-dephospho-AcCoA as the acetyl donor, kinetic data confirmed that Ly(100) interacts with the 3'-phosphoanion to stabilize the enzyme-cofactor complex. Mutation of Lys(100) decreases the affinity of AcCoA for the protein and increases the rate of CoA release. Crystal structures of several other unrelated acetyltransferases show a lysine or arginine residue within 3Å of the 3'-phosphoanion of AcCoA, suggesting that this mechanism for stabilizing the complex by the formation of a salt bridge may be widely applicable in nature. Copyright © 2015 Elsevier Inc. All rights reserved.

Probing structural features of Alzheimer's amyloid-β pores in bilayers using site-specific amino acid substitutions.

PubMed

Capone, Ricardo; Jang, Hyunbum; Kotler, Samuel A; Kagan, Bruce L; Nussinov, Ruth; Lal, Ratnesh

2012-01-24

A current hypothesis for the pathology of Alzheimer's disease (AD) proposes that amyloid-β (Aβ) peptides induce uncontrolled, neurotoxic ion flux across cellular membranes. The mechanism of ion flux is not fully understood because no experiment-based Aβ channel structures at atomic resolution are currently available (only a few polymorphic states have been predicted by computational models). Structural models and experimental evidence lend support to the view that the Aβ channel is an assembly of loosely associated mobile β-sheet subunits. Here, using planar lipid bilayers and molecular dynamics (MD) simulations, we show that amino acid substitutions can be used to infer which residues are essential for channel structure. We created two Aβ(1-42) peptides with point mutations: F19P and F20C. The substitution of Phe19 with Pro inhibited channel conductance. MD simulation suggests a collapsed pore of F19P channels at the lower bilayer leaflet. The kinks at the Pro residues in the pore-lining β-strands induce blockage of the solvated pore by the N-termini of the chains. The cysteine mutant is capable of forming channels, and the conductance behavior of F20C channels is similar to that of the wild type. Overall, the mutational analysis of the channel activity performed in this work tests the proposition that the channels consist of a β-sheet rich organization, with the charged/polar central strand containing the mutation sites lining the pore, and the C-terminal strands facing the hydrophobic lipid tails. A detailed understanding of channel formation and its structure should aid studies of drug design aiming to control unregulated Aβ-dependent ion fluxes.

Probing Structural Features of Alzheimer’s Amyloid-β Pores in Bilayers Using Site-Specific Amino Acid Substitutions

PubMed Central

2012-01-01

A current hypothesis for the pathology of Alzheimer’s disease (AD) proposes that amyloid-β (Aβ) peptides induce uncontrolled, neurotoxic ion flux across cellular membranes. The mechanism of ion flux is not fully understood because no experiment-based Aβ channel structures at atomic resolution are currently available (only a few polymorphic states have been predicted by computational models). Structural models and experimental evidence lend support to the view that the Aβ channel is an assembly of loosely associated mobile β-sheet subunits. Here, using planar lipid bilayers and molecular dynamics (MD) simulations, we show that amino acid substitutions can be used to infer which residues are essential for channel structure. We created two Aβ1–42 peptides with point mutations: F19P and F20C. The substitution of Phe19 with Pro inhibited channel conductance. MD simulation suggests a collapsed pore of F19P channels at the lower bilayer leaflet. The kinks at the Pro residues in the pore-lining β-strands induce blockage of the solvated pore by the N-termini of the chains. The cysteine mutant is capable of forming channels, and the conductance behavior of F20C channels is similar to that of the wild type. Overall, the mutational analysis of the channel activity performed in this work tests the proposition that the channels consist of a β-sheet rich organization, with the charged/polar central strand containing the mutation sites lining the pore, and the C-terminal strands facing the hydrophobic lipid tails. A detailed understanding of channel formation and its structure should aid studies of drug design aiming to control unregulated Aβ-dependent ion fluxes. PMID:22242635

The Iron-Sulfur Cluster of Electron Transfer Flavoprotein-ubiquinone Oxidoreductase (ETF-QO) is the Electron Acceptor for Electron Transfer Flavoprotein†

PubMed Central

Swanson, Michael A.; Usselman, Robert J.; Frerman, Frank E.; Eaton, Gareth R.; Eaton, Sandra S.

2011-01-01

Electron-transfer flavoprotein-ubiquinone oxidoreductase (ETF-QO) accepts electrons from electron-transfer flavoprotein (ETF) and reduces ubiquinone from the ubiquinone-pool. It contains one [4Fe-4S]2+,1+ and one FAD, which are diamagnetic in the isolated oxidized enzyme and can be reduced to paramagnetic forms by enzymatic donors or dithionite. In the porcine protein, threonine 367 is hydrogen bonded to N1 and O2 of the flavin ring of the FAD. The analogous site in Rhodobacter sphaeroides ETF-QO is asparagine 338. Mutations N338T and N338A were introduced into the R. sphaeroides protein by site-directed mutagenesis to determine the impact of hydrogen bonding at this site on redox potentials and activity. The mutations did not alter the optical spectra, EPR g-values, spin-lattice relaxation rates, or the [4Fe-4S]2+,1+ to FAD point-dipole interspin distances. The mutations had no impact on the reduction potential for the iron-sulfur cluster, which was monitored by changes in the continuous wave EPR signals of the [4Fe-4S]+ at 15 K. For the FAD semiquinone, significantly different potentials were obtained by monitoring the titration at 100 or 293 K. Based on spectra at 293 K the N338T mutation shifted the first and second midpoint potentials for the FAD from +47 mV and −30 mV for wild type to −11 mV and −19 mV, respectively. The N338A mutation decreased the potentials to −37 mV and −49 mV. Lowering the midpoint potentials resulted in a decrease in the quinone reductase activity and negligible impact on disproportionation of ETF1e− catalyzed by ETF-QO. These observations indicate that the FAD is involved in electron transfer to ubiquinone, but not in electron transfer from ETF to ETF-QO. Therefore the iron-sulfur cluster is the immediate acceptor from ETF. PMID:18672901

Frequency of hepatitis B surface antigen variants (HBsAg) in hepatitis B virus genotype B and C infected East- and Southeast Asian patients: Detection by the Elecsys® HBsAg II assay.

PubMed

Kim, Hyon Suk; Chen, Xinyue; Xu, Min; Yan, Cunling; Liu, Yali; Deng, Haohui; Hoang, Bui Huu; Thuy, Pham Thi Thu; Wang, Terry; Yan, Yiwen; Zeng, Zhen; Gencay, Mikael; Westergaard, Gaston; Pabinger, Stephan; Kriegner, Albert; Nauck, Markus; Seffner, Anja; Gohl, Peter; Hübner, Kirsten; Kaminski, Wolfgang E

2018-06-01

To avoid false negative results, hepatitis B surface antigen (HBsAg) assays need to detect samples with mutations in the immunodominant 'a' determinant region, which vary by ethnographic region. We evaluated the prevalence and type of HBsAg mutations in a hepatitis B virus (HBV)-infected East- and Southeast Asian population, and the diagnostic performance of the Elecsys ® HBsAg II Qualitative assay. We analyzed 898 samples from patients with HBV infection from four sites (China [Beijing and Guangzhou], Korea and Vietnam). HBsAg mutations were detected and sequenced using highly sensitive ultra-deep sequencing and compared between the first (amino acids 124-137) and second (amino acids 139-147) loops of the 'a' determinant region using the Elecsys ® HBsAg II Qualitative assay. Overall, 237 distinct amino acid mutations in the major hydrophilic region were identified; mutations were present in 660 of 898 HBV-infected patient samples (73.5%). Within the pool of 237 distinct mutations, the majority of the amino acid mutations were found in HBV genotype C (64.8%). We identified 25 previously unknown distinct mutations, mostly prevalent in genotype C-infected Korean patients (n = 18) followed by Chinese (n = 12) patients. All 898 samples were correctly identified by the Elecsys ® HBsAg II Qualitative assay. We observed 237 distinct (including 25 novel) mutations, demonstrating the complexity of HBsAg variants in HBV-infected East- and Southeast Asian patients. The Elecsys ® HBsAg II Qualitative assay can reliably detect HBV-positive samples and is suitable for routine diagnostic use in East and Southeast Asia. Copyright © 2018 Roche Diagnostics International Ltd. Published by Elsevier B.V. All rights reserved.

Familial Mediterranean fever with a single MEFV mutation: Where is the second hit?

PubMed Central

Booty, Matthew G.; Chae, Jae Jin; Masters, Seth L.; Remmers, Elaine F.; Barham, Beverly; Lee, Julie M.; Barron, Karyl S.; Holland, Steve; Kastner, Daniel L.; Aksentijevich, Ivona

2009-01-01

Objective FMF has traditionally been considered an autosomal recessive disease; however, it has been observed that a substantial number of patients with clinical FMF possess only one demonstrable MEFV mutation. Here, an extensive search for a second MEFV mutation was performed in 46 patients clinically diagnosed with FMF and carrying only one high-penetrance FMF mutation. Methods MEFV and other candidate genes were sequenced by standard capillary electrophoresis. The entire 15 kb MEFV genomic region was re-sequenced in 10 patients using a hybridization-based chip technology. MEFV gene expression levels were determined by qRT-PCR and pyrin protein levels were examined by Western blotting. Results A second MEFV mutation was not identified in any of the screened patients. Haplotype analysis did not identify a common haplotype that might be associated with the transmission of a second FMF allele. Western blots did not demonstrate a significant difference in pyrin levels between single and double variant patients; however, FMF patients of both types showed higher protein expression compared to controls and non-FMF patients with active inflammation. Screening of genes encoding pyrin-interacting proteins identified rare variants in a small number of patients, suggesting the possibility of digenic inheritance. Conclusion Our data underscore the existence of a significant subset of FMF patients who are carriers of only one MEFV mutation and demonstrate that complete MEFV sequencing is not likely to yield a second mutation. Screening for the set of most common mutations appears sufficient in the presence of clinical symptoms to diagnose FMF and initiate a trial of colchicine. PMID:19479870

Engineered single nucleotide polymorphisms in the mosquito MEK docking site alter Plasmodium berghei development in Anopheles gambiae.

PubMed

Brenton, Ashley A; Souvannaseng, Lattha; Cheung, Kong; Anishchenko, Michael; Brault, Aaron C; Luckhart, Shirley

2014-06-23

Susceptibility to Plasmodium infection in Anopheles gambiae has been proposed to result from naturally occurring polymorphisms that alter the strength of endogenous innate defenses. Despite the fact that some of these mutations are known to introduce non-synonymous substitutions in coding sequences, these mutations have largely been used to rationalize knockdown of associated target proteins to query the effects on parasite development in the mosquito host. Here, we assay the effects of engineered mutations on an immune signaling protein target that is known to control parasite sporogonic development. By this proof-of-principle work, we have established that naturally occurring mutations can be queried for their effects on mosquito protein function and on parasite development and that this important signaling pathway can be genetically manipulated to enhance mosquito resistance. We introduced SNPs into the A. gambiae MAPK kinase MEK to alter key residues in the N-terminal docking site (D-site), thus interfering with its ability to interact with the downstream kinase target ERK. ERK phosphorylation levels in vitro and in vivo were evaluated to confirm the effects of MEK D-site mutations. In addition, overexpression of various MEK D-site alleles was used to assess P. berghei infection in A. gambiae. The MEK D-site contains conserved lysine residues predicted to mediate protein-protein interaction with ERK. As anticipated, each of the D-site mutations (K3M, K6M) suppressed ERK phosphorylation and this inhibition was significant when both mutations were present. Tissue-targeted overexpression of alleles encoding MEK D-site polymorphisms resulted in reduced ERK phosphorylation in the midgut of A. gambiae. Furthermore, as expected, inhibition of MEK-ERK signaling due to D-site mutations resulted in reduction in P. berghei development relative to infection in the presence of overexpressed catalytically active MEK. MEK-ERK signaling in A. gambiae, as in model organisms and humans, depends on the integrity of conserved key residues within the MEK D-site. Disruption of signal transmission via engineered SNPs provides a purposeful proof-of-principle model for the study of naturally occurring mutations that may be associated with mosquito resistance to parasite infection as well as an alternative genetic basis for manipulation of this important immune signaling pathway.

Two strategies to engineer flexible loops for improved enzyme thermostability

PubMed Central

Yu, Haoran; Yan, Yihan; Zhang, Cheng; Dalby, Paul A.

2017-01-01

Flexible sites are potential targets for engineering the stability of enzymes. Nevertheless, the success rate of the rigidifying flexible sites (RFS) strategy is still low due to a limited understanding of how to determine the best mutation candidates. In this study, two parallel strategies were applied to identify mutation candidates within the flexible loops of Escherichia coli transketolase (TK). The first was a “back to consensus mutations” approach, and the second was computational design based on ΔΔG calculations in Rosetta. Forty-nine single variants were generated and characterised experimentally. From these, three single-variants I189H, A282P, D143K were found to be more thermostable than wild-type TK. The combination of A282P with H192P, a variant constructed previously, resulted in the best all-round variant with a 3-fold improved half-life at 60 °C, 5-fold increased specific activity at 65 °C, 1.3-fold improved kcat and a Tm increased by 5 °C above that of wild type. Based on a statistical analysis of the stability changes for all variants, the qualitative prediction accuracy of the Rosetta program reached 65.3%. Both of the two strategies investigated were useful in guiding mutation candidates to flexible loops, and had the potential to be used for other enzymes. PMID:28145457

Rare Autosomal Recessive Cardiac Valvular Form of Ehlers-Danlos Syndrome Results from Mutations in the COL1A2 Gene That Activate the Nonsense-Mediated RNA Decay Pathway

PubMed Central

Schwarze, Ulrike; Hata, Ryu-Ichiro; McKusick, Victor A.; Shinkai, Hiroshi; Hoyme, H. Eugene; Pyeritz, Reed E.; Byers, Peter H.

2004-01-01

Splice site mutations in the COL1A2 gene of type I collagen can give rise to forms of Ehlers-Danlos syndrome (EDS) because of partial or complete skipping of exon 6, as well as to mild, moderate, or lethal forms of osteogenesis imperfecta as a consequence of skipping of other exons. We identified three unrelated individuals with a rare recessively inherited form of EDS (characterized by joint hypermobility, skin hyperextensibility, and cardiac valvular defects); in two of them, COL1A2 messenger RNA (mRNA) instability results from compound heterozygosity for splice site mutations in the COL1A2 gene, and, in the third, it results from homozygosity for a nonsense codon. The splice site mutations led to use of cryptic splice donor sites, creation of a downstream premature termination codon, and extremely unstable mRNA. In the wild-type allele, the two introns (IVS11 and IVS24) in which these mutations occurred were usually spliced slowly in relation to their respective immediate upstream introns. In the mutant alleles, the upstream intron was removed, so that exon skipping could not occur. In the context of the mutation in IVS24, computer-generated folding of a short stretch of mRNA surrounding the mutation site demonstrated realignment of the relationships between the donor and acceptor sites that could facilitate use of a cryptic donor site. These findings suggest that the order of intron removal is an important variable in prediction of mutation outcome at splice sites and that folding of the nascent mRNA could be one element that contributes to determination of order of splicing. The complete absence of proα2(I) chains has the surprising effect of producing cardiac valvular disease without bone involvement. PMID:15077201

Rare autosomal recessive cardiac valvular form of Ehlers-Danlos syndrome results from mutations in the COL1A2 gene that activate the nonsense-mediated RNA decay pathway.

PubMed

Schwarze, Ulrike; Hata, Ryu-Ichiro; McKusick, Victor A; Shinkai, Hiroshi; Hoyme, H Eugene; Pyeritz, Reed E; Byers, Peter H

2004-05-01

Splice site mutations in the COL1A2 gene of type I collagen can give rise to forms of Ehlers-Danlos syndrome (EDS) because of partial or complete skipping of exon 6, as well as to mild, moderate, or lethal forms of osteogenesis imperfecta as a consequence of skipping of other exons. We identified three unrelated individuals with a rare recessively inherited form of EDS (characterized by joint hypermobility, skin hyperextensibility, and cardiac valvular defects); in two of them, COL1A2 messenger RNA (mRNA) instability results from compound heterozygosity for splice site mutations in the COL1A2 gene, and, in the third, it results from homozygosity for a nonsense codon. The splice site mutations led to use of cryptic splice donor sites, creation of a downstream premature termination codon, and extremely unstable mRNA. In the wild-type allele, the two introns (IVS11 and IVS24) in which these mutations occurred were usually spliced slowly in relation to their respective immediate upstream introns. In the mutant alleles, the upstream intron was removed, so that exon skipping could not occur. In the context of the mutation in IVS24, computer-generated folding of a short stretch of mRNA surrounding the mutation site demonstrated realignment of the relationships between the donor and acceptor sites that could facilitate use of a cryptic donor site. These findings suggest that the order of intron removal is an important variable in prediction of mutation outcome at splice sites and that folding of the nascent mRNA could be one element that contributes to determination of order of splicing. The complete absence of pro alpha 2(I) chains has the surprising effect of producing cardiac valvular disease without bone involvement.

Scanning the Effects of Ethyl Methanesulfonate on the Whole Genome of Lotus japonicus Using Second-Generation Sequencing Analysis

PubMed Central

Mohd-Yusoff, Nur Fatihah; Ruperao, Pradeep; Tomoyoshi, Nurain Emylia; Edwards, David; Gresshoff, Peter M.; Biswas, Bandana; Batley, Jacqueline

2015-01-01

Genetic structure can be altered by chemical mutagenesis, which is a common method applied in molecular biology and genetics. Second-generation sequencing provides a platform to reveal base alterations occurring in the whole genome due to mutagenesis. A model legume, Lotus japonicus ecotype Miyakojima, was chemically mutated with alkylating ethyl methanesulfonate (EMS) for the scanning of DNA lesions throughout the genome. Using second-generation sequencing, two individually mutated third-generation progeny (M3, named AM and AS) were sequenced and analyzed to identify single nucleotide polymorphisms and reveal the effects of EMS on nucleotide sequences in these mutant genomes. Single-nucleotide polymorphisms were found in every 208 kb (AS) and 202 kb (AM) with a bias mutation of G/C-to-A/T changes at low percentage. Most mutations were intergenic. The mutation spectrum of the genomes was comparable in their individual chromosomes; however, each mutated genome has unique alterations, which are useful to identify causal mutations for their phenotypic changes. The data obtained demonstrate that whole genomic sequencing is applicable as a high-throughput tool to investigate genomic changes due to mutagenesis. The identification of these single-point mutations will facilitate the identification of phenotypically causative mutations in EMS-mutated germplasm. PMID:25660167

Destabilization of the metal site as a hub for the pathogenic mechanism of five ALS-linked mutants of copper, zinc superoxide dismutase.

PubMed

Mera-Adasme, Raúl; Erdmann, Hannes; Bereźniak, Tomasz; Ochsenfeld, Christian

2016-10-01

Amyotrophic lateral sclerosis (ALS) is a lethal neurodegenerative disease, with no effective pharmacological treatment. Its pathogenesis is unknown, although a subset of the cases is linked to genetic mutations. A significant fraction of the mutations occur in one protein, copper, zinc superoxide dismutase (SOD1). The toxic function of mutant SOD1 has not been elucidated, but damage to the metal site of the protein is believed to play a major role. In this work, we study the electrostatic loop of SOD1, which we had previously proposed to work as a "solvent seal" isolating the metal site from water molecules. Out of the five contact points identified between the electrostatic loop and its dock in the rest of the protein, three points were found to be affected by ALS-linked mutations, with a total of five mutations identified. The effect of the five mutations was studied using methods of computational chemistry. We found that four of the mutations destabilize the proposed solvent seal, while the fifth mutation directly affects the metal-site stability. In the two contact points unaffected by ALS-linked mutations, the side chains of the residues were not found to play a stabilizing role. Our results show that the docking of the electrostatic loop to the rest of SOD1 plays a role in ALS pathogenesis, in support of that structure acting as a solvent barrier for the metal site. The results provide a unified pathogenic mechanism for five different ALS-linked mutations of SOD1.

Identification and characterization of a novel XK splice site mutation in a patient with McLeod syndrome.

PubMed

Arnaud, Lionel; Salachas, François; Lucien, Nicole; Maisonobe, Thierry; Le Pennec, Pierre-Yves; Babinet, Jérôme; Cartron, Jean-Pierre

2009-03-01

McLeod syndrome is a rare X-linked neuroacanthocytosis syndrome with hematologic, muscular, and neurologic manifestations. McLeod syndrome is caused by mutations in the XK gene whose product is expressed at the red blood cell (RBC) surface but whose function is currently unknown. A variety of XK mutations has been reported but no clear phenotype-genotype correlation has been found, especially for the point mutations affecting splicing sites. A man suspected of neuroacanthocytosis was evaluated by neurologic examination, electromyography, muscle biopsy, muscle computed tomography, and cerebral magnetic resonance imaging. The McLeod RBC phenotype was disclosed by blood smear and immunohematology analyses and then confirmed at the biochemical level by Western blot analysis. The responsible XK mutation was characterized at the mRNA level by reverse transcription-polymerase chain reaction (PCR), identified by genomic DNA sequencing, and verified by allele-specific PCR. A novel XK splice site mutation (IVS1-1G>A) has been identified in a McLeod patient who has developed hematologic, neuromuscular, and neurologic symptoms. This is the first reported example of a XK point mutation affecting the 3' acceptor splice site of Intron 1, and it was demonstrated that this mutation indeed induces aberrant splicing of XK RNA and lack of XK protein at the RBC membrane. The detailed characterization at the molecular biology level of this novel XK splice site mutation associated with the clinical description of the patient contributes to a better understanding of the phenotype-genotype correlation in the McLeod syndrome.

Identification of Site-Specific Adaptations Conferring Increased Neural Cell Tropism during Human Enterovirus 71 Infection

PubMed Central

Schibler, Manuel; Martinez, Yannick; Gerlach, Daniel; van Belle, Sandra; Turin, Lara; Zdobnov, Evgeny; Kaiser, Laurent; Tapparel, Caroline

2012-01-01

Enterovirus 71 (EV71) is one of the most virulent enteroviruses, but the specific molecular features that enhance its ability to disseminate in humans remain unknown. We analyzed the genomic features of EV71 in an immunocompromised host with disseminated disease according to the different sites of infection. Comparison of five full-length genomes sequenced directly from respiratory, gastrointestinal, nervous system, and blood specimens revealed three nucleotide changes that occurred within a five-day period: a non-conservative amino acid change in VP1 located within the BC loop (L97R), a region considered as an immunogenic site and possibly important in poliovirus host adaptation; a conservative amino acid substitution in protein 2B (A38V); and a silent mutation in protein 3D (L175). Infectious clones were constructed using both BrCr (lineage A) and the clinical strain (lineage C) backgrounds containing either one or both non-synonymous mutations. In vitro cell tropism and competition assays revealed that the VP197 Leu to Arg substitution within the BC loop conferred a replicative advantage in SH-SY5Y cells of neuroblastoma origin. Interestingly, this mutation was frequently associated in vitro with a second non-conservative mutation (E167G or E167A) in the VP1 EF loop in neuroblastoma cells. Comparative models of these EV71 VP1 variants were built to determine how the substitutions might affect VP1 structure and/or interactions with host cells and suggest that, while no significant structural changes were observed, the substitutions may alter interactions with host cell receptors. Taken together, our results show that the VP1 BC loop region of EV71 plays a critical role in cell tropism independent of EV71 lineage and, thus, may have contributed to dissemination and neurotropism in the immunocompromised patient. PMID:22910880

The role of Rdl in resistance to phenylpyrazoles in Drosophila melanogaster.

PubMed

Remnant, Emily J; Morton, Craig J; Daborn, Phillip J; Lumb, Christopher; Yang, Ying Ting; Ng, Hooi Ling; Parker, Michael W; Batterham, Philip

2014-11-01

Extensive use of older generation insecticides may result in pre-existing cross-resistance to new chemical classes acting at the same target site. Phenylpyrazole insecticides block inhibitory neurotransmission in insects via their action on ligand-gated chloride channels (LGCCs). Phenylpyrazoles are broad-spectrum insecticides widely used in agriculture and domestic pest control. So far, all identified cases of target site resistance to phenylpyrazoles are based on mutations in the Rdl (Resistance to dieldrin) LGCC subunit, the major target site for cyclodiene insecticides. We examined the role that mutations in Rdl have on phenylpyrazole resistance in Drosophila melanogaster, exploring naturally occurring variation, and generating predicted resistance mutations by mutagenesis. Natural variation at the Rdl locus in inbred strains of D. melanogaster included gene duplication, and a line containing two Rdl mutations found in a highly resistant line of Drosophila simulans. These mutations had a moderate impact on survival following exposure to two phenylpyrazoles, fipronil and pyriprole. Homology modelling suggested that the Rdl chloride channel pore contains key residues for binding fipronil and pyriprole. Mutagenesis of these sites and assessment of resistance in vivo in transgenic lines showed that amino acid identity at the Ala(301) site influenced resistance levels, with glycine showing greater survival than serine replacement. We confirm that point mutations at the Rdl 301 site provide moderate resistance to phenylpyrazoles in D. melanogaster. We also emphasize the beneficial aspects of testing predicted mutations in a whole organism to validate a candidate gene approach. Copyright © 2014 Elsevier Ltd. All rights reserved.

Molecular survey of turfgrass species for mutations conferring resistance to ACCase inhibiting herbicides

USDA-ARS?s Scientific Manuscript database

The control of grassy weeds in turfgrass is often problematic due to lack of herbicide selectivity. Seven different naturally occurring mutation sites have been reported to confer resistance to Acetyl coenzyme A carboxylase inhibiting herbicides. One or more of these mutation sites may hold potentia...

Neutralisation of a single voltage sensor affects gating determinants in all four pore-forming S6 segments of Ca(V)1.2: a cooperative gating model.

PubMed

Beyl, Stanislav; Depil, Katrin; Hohaus, Annette; Stary-Weinzinger, Anna; Linder, Tobias; Timin, Eugen; Hering, Steffen

2012-10-01

Voltage sensors trigger the closed-open transitions in the pore of voltage-gated ion channels. To probe the transmission of voltage sensor signalling to the channel pore of Ca(V)1.2, we investigated how elimination of positive charges in the S4 segments (charged residues were replaced by neutral glutamine) modulates gating perturbations induced by mutations in pore-lining S6 segments. Neutralisation of all positively charged residues in IIS4 produced a functional channel (IIS4(N)), while replacement of the charged residues in IS4, IIIS4 and IVS4 segments resulted in nonfunctional channels. The IIS4(N) channel displayed activation kinetics similar to wild type. Mutations in a highly conserved structure motif on S6 segments ("GAGA ring": G432W in IS6, A780T in IIS6, G1193T in IIIS6 and A1503G in IVS6) induce strong left-shifted activation curves and decelerated channel deactivation kinetics. When IIS4(N) was combined with these mutations, the activation curves were shifted back towards wild type and current kinetics were accelerated. In contrast, 12 other mutations adjacent to the GAGA ring in IS6-IVS6, which also affect activation gating, were not rescued by IIS4(N). Thus, the rescue of gating distortions in segments IS6-IVS6 by IIS4(N) is highly position-specific. Thermodynamic cycle analysis supports the hypothesis that IIS4 is energetically coupled with the distantly located GAGA residues. We speculate that conformational changes caused by neutralisation of IIS4 are not restricted to domain II (IIS6) but are transmitted to gating structures in domains I, III and IV via the GAGA ring.

Structural and functional determinants of conserved lipid interaction domains of inward rectifying Kir6.2 channels.

PubMed

Cukras, Catherine A; Jeliazkova, Iana; Nichols, Colin G

2002-06-01

All members of the inward rectifiier K(+) (Kir) channel family are activated by phosphoinositides and other amphiphilic lipids. To further elucidate the mechanistic basis, we examined the membrane association of Kir6.2 fragments of K(ATP) channels, and the effects of site-directed mutations of these fragments and full-length Kir6.2 on membrane association and K(ATP) channel activity, respectively. GFP-tagged Kir6.2 COOH terminus and GFP-tagged pleckstrin homology domain from phospholipase C delta1 both associate with isolated membranes, and association of each is specifically reduced by muscarinic m1 receptor-mediated phospholipid depletion. Kir COOH termini are predicted to contain multiple beta-strands and a conserved alpha-helix (residues approximately 306-311 in Kir6.2). Systematic mutagenesis of D307-F315 reveals a critical role of E308, I309, W311 and F315, consistent with residues lying on one side of a alpha-helix. Together with systematic mutation of conserved charges, the results define critical determinants of a conserved domain that underlies phospholipid interaction in Kir channels.

Contributions of all 20 amino acids at site 96 to the stability and structure of T4 lysozyme

PubMed Central

Mooers, Blaine H M; Baase, Walter A; Wray, Jonathan W; Matthews, Brian W

2009-01-01

To try to resolve the loss of stability in the temperature-sensitive mutant of T4 lysozyme, Arg 96 → His, all of the remaining 18 naturally occurring amino acids were substituted at site 96. Also, in response to suggestions that the charged residues Lys85 and Asp89, which are 5–8 Å away, may have important effects, each of these amino acids was replaced with alanine. Crystal structures were determined for many of the variants. With the exception of the tryptophan and valine mutants R96W and R96V, the crystallographic analysis shows that the substituted side chain following the path of Arg96 in wildtype (WT). The melting temperatures of the variants decrease by up to ∼16°C with WT being most stable. There are two site 96 replacements, with lysine or glutamine, that leave the stability close to that of WT. The only element that the side chains of these residues have in common with the WT arginine is the set of three carbon atoms at the Cα, Cβ, and Cγ positions. Although each side chain is long and flexible with a polar group at the distal position, the details of the hydrogen bonding to the rest of the protein differ in each case. Also, the glutamine replacement lacks a positive charge. This shows that there is some adaptability in achieving full stabilization at this site. At the other extreme, to be maximally destabilizing a mutation at site 96 must not only eliminate favorable interactions but also introduce an unfavorable element such as steric strain or a hydrogen-bonding group that remains unsatisfied. Overall, the study highlights the essential need for atomic resolution site-specific structural information to understand and to predict the stability of mutant proteins. It can be very misleading to simply assume that conservative amino acid substitutions cause small changes in stability, whereas large stability changes are associated with nonconservative replacements. PMID:19384988

Mutational Effects and Population Dynamics During Viral Adaptation Challenge Current Models

PubMed Central

Miller, Craig R.; Joyce, Paul; Wichman, Holly A.

2011-01-01

Adaptation in haploid organisms has been extensively modeled but little tested. Using a microvirid bacteriophage (ID11), we conducted serial passage adaptations at two bottleneck sizes (104 and 106), followed by fitness assays and whole-genome sequencing of 631 individual isolates. Extensive genetic variation was observed including 22 beneficial, several nearly neutral, and several deleterious mutations. In the three large bottleneck lines, up to eight different haplotypes were observed in samples of 23 genomes from the final time point. The small bottleneck lines were less diverse. The small bottleneck lines appeared to operate near the transition between isolated selective sweeps and conditions of complex dynamics (e.g., clonal interference). The large bottleneck lines exhibited extensive interference and less stochasticity, with multiple beneficial mutations establishing on a variety of backgrounds. Several leapfrog events occurred. The distribution of first-step adaptive mutations differed significantly from the distribution of second-steps, and a surprisingly large number of second-step beneficial mutations were observed on a highly fit first-step background. Furthermore, few first-step mutations appeared as second-steps and second-steps had substantially smaller selection coefficients. Collectively, the results indicate that the fitness landscape falls between the extremes of smooth and fully uncorrelated, violating the assumptions of many current mutational landscape models. PMID:21041559

Ligand complex structures of l-amino acid oxidase/monooxygenase from Pseudomonas sp. AIU 813 and its conformational change.

PubMed

Im, Dohyun; Matsui, Daisuke; Arakawa, Takatoshi; Isobe, Kimiyasu; Asano, Yasuhisa; Fushinobu, Shinya

2018-03-01

l-Amino acid oxidase/monooxygenase from Pseudomonas sp. AIU 813 (l-AAO/MOG) catalyzes both the oxidative deamination and oxidative decarboxylation of the α-group of l-Lys to produce a keto acid and amide, respectively. l-AAO/MOG exhibits limited specificity for l-amino acid substrates with a basic side chain. We previously determined its ligand-free crystal structure and identified a key residue for maintaining the dual activities. Here, we determined the structures of l-AAO/MOG complexed with l-Lys, l-ornithine, and l-Arg and revealed its substrate recognition. Asp238 is located at the ceiling of a long hydrophobic pocket and forms a strong interaction with the terminal, positively charged group of the substrates. A mutational analysis on the D238A mutant indicated that the interaction is critical for substrate binding but not for catalytic control between the oxidase/monooxygenase activities. The catalytic activities of the D238E mutant unexpectedly increased, while the D238F mutant exhibited altered substrate specificity to long hydrophobic substrates. In the ligand-free structure, there are two channels connecting the active site and solvent, and a short region located at the dimer interface is disordered. In the l-Lys complex structure, a loop region is displaced to plug the channels. Moreover, the disordered region in the ligand-free structure forms a short helix in the substrate complex structures and creates the second binding site for the substrate. It is assumed that the amino acid substrate enters the active site of l-AAO/MOG through this route. The atomic coordinates and structure factors (codes 5YB6, 5YB7, and 5YB8) have been deposited in the Protein Data Bank (http://wwpdb.org/). 1.4.3.2 (l-amino acid oxidase), 1.13.12.2 (lysine 2-monooxygenase).

Sequential Bottlenecks Drive Viral Evolution in Early Acute Hepatitis C Virus Infection

PubMed Central

McElroy, Kerensa; Gaudieri, Silvana; Pham, Son T.; Chopra, Abha; Cameron, Barbara; Maher, Lisa; Dore, Gregory J.; White, Peter A.; Lloyd, Andrew R.

2011-01-01

Hepatitis C is a pandemic human RNA virus, which commonly causes chronic infection and liver disease. The characterization of viral populations that successfully initiate infection, and also those that drive progression to chronicity is instrumental for understanding pathogenesis and vaccine design. A comprehensive and longitudinal analysis of the viral population was conducted in four subjects followed from very early acute infection to resolution of disease outcome. By means of next generation sequencing (NGS) and standard cloning/Sanger sequencing, genetic diversity and viral variants were quantified over the course of the infection at frequencies as low as 0.1%. Phylogenetic analysis of reassembled viral variants revealed acute infection was dominated by two sequential bottleneck events, irrespective of subsequent chronicity or clearance. The first bottleneck was associated with transmission, with one to two viral variants successfully establishing infection. The second occurred approximately 100 days post-infection, and was characterized by a decline in viral diversity. In the two subjects who developed chronic infection, this second bottleneck was followed by the emergence of a new viral population, which evolved from the founder variants via a selective sweep with fixation in a small number of mutated sites. The diversity at sites with non-synonymous mutation was higher in predicted cytotoxic T cell epitopes, suggesting immune-driven evolution. These results provide the first detailed analysis of early within-host evolution of HCV, indicating strong selective forces limit viral evolution in the acute phase of infection. PMID:21912520

The relative contribution of target-site mutations in complex acaricide resistant phenotypes as assessed by marker assisted backcrossing in Tetranychus urticae.

PubMed

Riga, Maria; Bajda, Sabina; Themistokleous, Christos; Papadaki, Stavrini; Palzewicz, Maria; Dermauw, Wannes; Vontas, John; Leeuwen, Thomas Van

2017-08-23

The mechanisms underlying insecticide and acaricide resistance in insects and mites are often complex, including additive effects of target-site insensitivity, increased metabolism and transport. The extent to which target-site resistance mutations contribute to the resistance phenotype is, however, not well studied. Here, we used marker-assisted backcrossing to create 30 congenic lines carrying nine mutations (alone, or in combination in a few cases) associated with resistance to avermectins, pyrethroids, mite growth inhibitors and mitochondrial complex III inhibitors (QoI) in a polyphagous arthropod pest, the spider mite Tetranychus urticae. Toxicity tests revealed that mutations in the voltage-gated sodium channel, chitin synthase 1 and cytochrome b confer high levels of resistance and, when fixed in a population, these mutations alone can result in field failure of acaricide treatment. In contrast, although we confirmed the implication of mutations in glutamate-gated chloride channels in abamectin and milbemectin insensitivity, these mutations do not lead to the high resistance levels that are often reported in abamectin resistant strains of T. urticae. Overall, this study functionally validates reported target-site resistance mutations in T. urticae, by uncoupling them from additional mechanisms, allowing to finally investigate the strength of the conferred phenotype in vivo.

New splicing-site mutations in the SURF1 gene in Leigh syndrome patients.

PubMed

Pequignot, M O; Desguerre, I; Dey, R; Tartari, M; Zeviani, M; Agostino, A; Benelli, C; Fouque, F; Prip-Buus, C; Marchant, D; Abitbol, M; Marsac, C

2001-05-04

The gene SURF1 encodes a factor involved in the biogenesis of cytochrome c oxidase, the last complex in the respiratory chain. Mutations of the SURF1 gene result in Leigh syndrome and severe cytochrome c oxidase deficiency. Analysis of seven unrelated patients with cytochrome c oxidase deficiency and typical Leigh syndrome revealed different SURF1 mutations in four of them. Only these four cases had associated demyelinating neuropathy. Three mutations were novel splicing-site mutations that lead to the excision of exon 6. Two different novel heterozygous mutations were found at the same guanine residue at the donor splice site of intron 6; one was a deletion, whereas the other was a transition [588+1G>A]. The third novel splicing-site mutation was a homozygous [516-2_516-1delAG] in intron 5. One patient only had a homozygous polymorphism in the middle of the intron 8 [835+25C>T]. Western blot analysis showed that Surf1 protein was absent in all four patients harboring mutations. Our studies confirm that the SURF1 gene is an important nuclear gene involved in the cytochrome c oxidase deficiency. We also show that Surf1 protein is not implicated in the assembly of other respiratory chain complexes or the pyruvate dehydrogenase complex.

A comparative study on low-energy ion beam and neutralized beam modifications of naked DNA and biological effect on mutation

NASA Astrophysics Data System (ADS)

Sarapirom, S.; Thongkumkoon, P.; Prakrajang, K.; Anuntalabhochai, S.; Yu, L. D.

2012-02-01

DNA conformation change or damage induced by low-energy ion irradiation has been of great interest owing to research developments in ion beam biotechnology and ion beam application in biomedicine. Mechanisms involved in the induction of DNA damage may account for effect from implanting ion charge. In order to check this effect, we used both ion beam and neutralized beam at keV energy to bombard naked DNA. Argon or nitrogen ion beam was generated and extracted from a radiofrequency (RF) ion source and neutralized by microwave-driven plasma in the beam path. Plasmid DNA pGFP samples were irradiated with the ion or neutralized beam in vacuum, followed by gel electrophoresis to observe changes in the DNA conformations. It was revealed that the ion charge played a certain role in inducing DNA conformation change. The subsequent DNA transfer into bacteria Escherichia coli ( E. coli) for mutation analysis indicated that the charged ion beam induced DNA change had high potential in mutation induction while neutralized beam did not. The intrinsic reason was attributed to additional DNA deformation and contortion caused by ion charge exchange effect so that the ion beam induced DNA damage could hardly be completely repaired, whereas the neutralized beam induced DNA change could be more easily recoverable owing to absence of the additional DNA deformation and contortion.

Mutual positional preference of IPMDH proteins for binding studied by coarse-grained molecular dynamics simulation

NASA Astrophysics Data System (ADS)

Ishioka, T.; Yamada, H.; Miyakawa, T.; Morikawa, R.; Akanuma, S.; Yamagishi, A.; Takasu, M.

2016-12-01

Proteins, which incorporate charged and hydrophobic amino acid residues, are useful as a material of nanotechnology. Among these proteins, IPMDH (3-isopropylmalate dehydrogenase), which has thermal stability, has potential as a material of nanofiber. In this study, we performed coarse-grained molecular dynamics simulation of IPMDH using MARTINI force fields, and we investigated the orientation for the binding of IPMDH. In simulation, we analyzed wild type of IPMDH and the mutated IPMDH proteins, where 13, 20, 27, 332, 335 and 338th amino acid residues are replaced by lysine residues which have positive charge and by glutamic acid residues which have negative charge. Since the binding of mutated IPMDH is advantageous compared with the binding of wild type for one orientation, we suggest that the Coulomb interaction for the binding of IPMDH is important.

Missense mutation T485S alters NBCe1-A electrogenicity causing proximal renal tubular acidosis

PubMed Central

Shao, Xuesi M.; Kao, Liyo; Azimov, Rustam; Weinstein, Alan M.; Newman, Debra; Liu, Weixin; Kurtz, Ira

2013-01-01

Mutations in SLC4A4, the gene encoding the electrogenic Na+-HCO3− cotransporter NBCe1, cause severe proximal renal tubular acidosis (pRTA), growth retardation, decreased IQ, and eye and teeth abnormalities. Among the known NBCe1 mutations, the disease-causing mechanism of the T485S (NBCe1-A numbering) mutation is intriguing because the substituted amino acid, serine, is structurally and chemically similar to threonine. In this study, we performed intracellular pH and whole cell patch-clamp measurements to investigate the base transport and electrogenic properties of NBCe1-A-T485S in mammalian HEK 293 cells. Our results demonstrated that Ser substitution of Thr485 decreased base transport by ∼50%, and importantly, converted NBCe1-A from an electrogenic to an electroneutral transporter. Aqueous accessibility analysis using sulfhydryl reactive reagents indicated that Thr485 likely resides in an NBCe1-A ion interaction site. This critical location is also supported by the finding that G486R (a pRTA causing mutation) alters the position of Thr485 in NBCe1-A thereby impairing its transport function. By using NO3− as a surrogate ion for CO32−, our result indicated that NBCe1-A mediates electrogenic Na+-CO32− cotransport when functioning with a 1:2 charge transport stoichiometry. In contrast, electroneutral NBCe1-T485S is unable to transport NO3−, compatible with the hypothesis that it mediates Na+-HCO3− cotransport. In patients, NBCe1-A-T485S is predicted to transport Na+-HCO3− in the reverse direction from blood into proximal tubule cells thereby impairing transepithelial HCO3− absorption, possibly representing a new pathogenic mechanism for generating human pRTA. PMID:23636456

A novel missense mutation close to the charge-stabilizing system in a patient with congenital factor VII deficiency.

PubMed

Jiang, Minghua; Wang, Zhaoyue; Yu, Ziqiang; Bai, Xia; Su, Jian; Cao, Lijuan; Zhang, Wei; Ruan, Changgeng

2011-06-01

Congenital factor VII (FVII) deficiency is a rare autosomal recessive bleeding disorder. Its clinical manifestation and mutational spectrum are highly variable. The purpose of this study was to identify and characterize the mutation causing the FVII deficiency in a Chinese patient and his family. The FVII gene was analyzed by genomic DNA sequencing, and the FVII levels in patient's plasma were measured with an enzyme-linked immunoabsorbent assay (ELISA) and one-stage prothrombin time based method. In addition, the FVII-Phe190 mutant identified in the pedigree was expressed in the HEK293 cells, and the subcellular localization experiments in the Chinese hamster ovary (CHO) cells were performed. The patient had a prolonged prothrombin time and low levels of both FVII antigen and activity, and two heterozygous mutations were identified in F7 gene (NG-009262.1): a g.15975 G>A in the splice receptor site of intron 6 and a novel g.16750 C>T in exon 8 resulting in Ser190 to Phe190 replacement. In expression experiments, the reduced antigen and activity levels of FVII-Phe190 in the culture medium were found, whereas an ELISA and Western blotting analysis of FVII revealed that mutant FVII-Phe190 was synthesized in the cells as the wild-type FVII-Ser190. And FVII-Phe190 was found in endoplasmic reticulum and Golgi apparatus. Compound heterozygous mutations in F7 gene should be responsible for the FVII deficiency in this patient. The FVII-Phe190 can normally be synthesized and transported from endoplasmic reticulum to Golgi apparatus, but degraded or inefficiently secreted.

The Glycerol-3-Phosphate Acyltransferase GPAT6 from Tomato Plays a Central Role in Fruit Cutin Biosynthesis1[OPEN

PubMed Central

Petit, Johann; Mauxion, Jean-Philippe; Tai, Fabienne Wong Jun; Fich, Eric A.; Joubès, Jérôme; Rothan, Christophe

2016-01-01

The thick cuticle covering and embedding the epidermal cells of tomato (Solanum lycopersicum) fruit acts not only as a protective barrier against pathogens and water loss but also influences quality traits such as brightness and postharvest shelf-life. In a recent study, we screened a mutant collection of the miniature tomato cultivar Micro-Tom and isolated several glossy fruit mutants in which the abundance of cutin, the polyester component of the cuticle, was strongly reduced. We employed a newly developed mapping-by-sequencing strategy to identify the causal mutation underlying the cutin deficiency in a mutant thereafter named gpat6-a (for glycerol-3-phosphate acyltransferase6). To this end, a backcross population (BC1F2) segregating for the glossy trait was phenotyped. Individuals displaying either a wild-type or a glossy fruit trait were then pooled into bulked populations and submitted to whole-genome sequencing prior to mutation frequency analysis. This revealed that the causal point mutation in the gpat6-a mutant introduces a charged amino acid adjacent to the active site of a GPAT6 enzyme. We further showed that this mutation completely abolished the GPAT activity of the recombinant protein. The gpat6-a mutant showed perturbed pollen formation but, unlike a gpat6 mutant of Arabidopsis (Arabidopsis thaliana), was not male sterile. The most striking phenotype was observed in the mutant fruit, where cuticle thickness, composition, and properties were altered. RNA sequencing analysis highlighted the main processes and pathways that were affected by the mutation at the transcriptional level, which included those associated with lipid, secondary metabolite, and cell wall biosynthesis. PMID:27208295

The Glycerol-3-Phosphate Acyltransferase GPAT6 from Tomato Plays a Central Role in Fruit Cutin Biosynthesis.

PubMed

Petit, Johann; Bres, Cécile; Mauxion, Jean-Philippe; Tai, Fabienne Wong Jun; Martin, Laetitia B B; Fich, Eric A; Joubès, Jérôme; Rose, Jocelyn K C; Domergue, Frédéric; Rothan, Christophe

2016-06-01

The thick cuticle covering and embedding the epidermal cells of tomato (Solanum lycopersicum) fruit acts not only as a protective barrier against pathogens and water loss but also influences quality traits such as brightness and postharvest shelf-life. In a recent study, we screened a mutant collection of the miniature tomato cultivar Micro-Tom and isolated several glossy fruit mutants in which the abundance of cutin, the polyester component of the cuticle, was strongly reduced. We employed a newly developed mapping-by-sequencing strategy to identify the causal mutation underlying the cutin deficiency in a mutant thereafter named gpat6-a (for glycerol-3-phosphate acyltransferase6). To this end, a backcross population (BC1F2) segregating for the glossy trait was phenotyped. Individuals displaying either a wild-type or a glossy fruit trait were then pooled into bulked populations and submitted to whole-genome sequencing prior to mutation frequency analysis. This revealed that the causal point mutation in the gpat6-a mutant introduces a charged amino acid adjacent to the active site of a GPAT6 enzyme. We further showed that this mutation completely abolished the GPAT activity of the recombinant protein. The gpat6-a mutant showed perturbed pollen formation but, unlike a gpat6 mutant of Arabidopsis (Arabidopsis thaliana), was not male sterile. The most striking phenotype was observed in the mutant fruit, where cuticle thickness, composition, and properties were altered. RNA sequencing analysis highlighted the main processes and pathways that were affected by the mutation at the transcriptional level, which included those associated with lipid, secondary metabolite, and cell wall biosynthesis. © 2016 American Society of Plant Biologists. All Rights Reserved.

Investigating the Structure and Dynamics of the PIK3CA Wild-Type and H1047R Oncogenic Mutant

PubMed Central

Pavlaki, Maria; Lazani, Vasiliki; Christoforidis, Savvas; Agianian, Bogos; Cournia, Zoe

2014-01-01

The PIK3CA gene is one of the most frequently mutated oncogenes in human cancers. It encodes p110α, the catalytic subunit of phosphatidylinositol 3-kinase alpha (PI3Kα), which activates signaling cascades leading to cell proliferation, survival, and cell growth. The most frequent mutation in PIK3CA is H1047R, which results in enzymatic overactivation. Understanding how the H1047R mutation causes the enhanced activity of the protein in atomic detail is central to developing mutant-specific therapeutics for cancer. To this end, Surface Plasmon Resonance (SPR) experiments and Molecular Dynamics (MD) simulations were carried out for both wild-type (WT) and H1047R mutant proteins. An expanded positive charge distribution on the membrane binding regions of the mutant with respect to the WT protein is observed through MD simulations, which justifies the increased ability of the mutated protein variant to bind to membranes rich in anionic lipids in our SPR experiments. Our results further support an auto-inhibitory role of the C-terminal tail in the WT protein, which is abolished in the mutant protein due to loss of crucial intermolecular interactions. Moreover, Functional Mode Analysis reveals that the H1047R mutation alters the twisting motion of the N-lobe of the kinase domain with respect to the C-lobe and shifts the position of the conserved P-loop residues in the vicinity of the active site. These findings demonstrate the dynamical and structural differences of the two proteins in atomic detail and propose a mechanism of overactivation for the mutant protein. The results may be further utilized for the design of mutant-specific PI3Kα inhibitors that exploit the altered mutant conformation. PMID:25340423

Novel compound heterozygous Thyroglobulin mutations c.745+1G>A/c.7036+2T>A associated with congenital goiter and hypothyroidism in a Vietnamese family. Identification of a new cryptic 5' splice site in the exon 6.

PubMed

Citterio, Cintia E; Morales, Cecilia M; Bouhours-Nouet, Natacha; Machiavelli, Gloria A; Bueno, Elena; Gatelais, Frédérique; Coutant, Regis; González-Sarmiento, Rogelio; Rivolta, Carina M; Targovnik, Héctor M

2015-03-15

Several patients were identified with dyshormonogenesis caused by mutations in the thyroglobulin (TG) gene. These defects are inherited in an autosomal recessive manner and affected individuals are either homozygous or compound heterozygous for the mutations. The aim of the present study was to identify new TG mutations in a patient of Vietnamese origin affected by congenital hypothyroidism, goiter and low levels of serum TG. DNA sequencing identified the presence of compound heterozygous mutations in the TG gene: the maternal mutation consists of a novel c.745+1G>A (g.IVS6 + 1G>A), whereas the hypothetical paternal mutation consists of a novel c.7036+2T>A (g.IVS40 + 2T>A). The father was not available for segregation analysis. Ex-vivo splicing assays and subsequent RT-PCR analyses were performed on mRNA isolated from the eukaryotic-cells transfected with normal and mutant expression vectors. Minigene analysis of the c.745+1G>A mutant showed that the exon 6 is skipped during pre-mRNA splicing or partially included by use of a cryptic 5' splice site located to 55 nucleotides upstream of the authentic exon 6/intron 6 junction site. The functional analysis of c.7036+2T>A mutation showed a complete skipping of exon 40. The theoretical consequences of splice site mutations, predicted with the bioinformatics tool NNSplice, Fsplice, SPL, SPLM and MaxEntScan programs were investigated and evaluated in relation with the experimental evidence. These analyses predicted that both mutant alleles would result in the abolition of the authentic splice donor sites. The c.745+1G>A mutation originates two putative truncated proteins of 200 and 1142 amino acids, whereas c.7036+2T>A mutation results in a putative truncated protein of 2277 amino acids. In conclusion, we show that the c.745+1G>A mutation promotes the activation of a new cryptic donor splice site in the exon 6 of the TG gene. The functional consequences of these mutations could be structural changes in the protein molecule that alter the biosynthesis of thyroid hormones. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

Charge immobilization of the voltage sensor in domain IV is independent of sodium current inactivation.

PubMed

Sheets, Michael F; Hanck, Dorothy A

2005-02-15

Recovery from fast inactivation in voltage-dependent Na+ channels is associated with a slow component in the time course of gating charge during repolarization (i.e. charge immobilization), which results from the slow movement of the S4 segments in domains III and IV (S4-DIII and S4-DIV). Previous studies have shown that the non-specific removal of fast inactivation by the proteolytic enzyme pronase eliminated charge immobilization, while the specific removal of fast inactivation (by intracellular MTSET modification of a cysteine substituted for the phenylalanine in the IFM motif, ICMMTSET, in the inactivation particle formed by the linker between domains III and IV) only reduced the amount of charge immobilization by nearly one-half. To investigate the molecular origin of the remaining slow component of charge immobilization we studied the human cardiac Na+ channel (hH1a) in which the outermost arginine in the S4-DIV, which contributes approximately 20% to total gating charge (Qmax), was mutated to a cysteine (R1C-DIV). Gating charge could be fully restored in R1C-DIV by exposure to extracellular MTSEA, a positively charged methanethiosulphonate reagent. The RIC-DIV mutation was combined with ICMMTSET to remove fast inactivation, and the gating currents of R1C-DIV-ICM(MTSET) were recorded before and after modification with MTSEAo. Prior to MTSEAo, the time course of the gating charge during repolarization (off-charge) was best described by a single fast time constant. After MTSEA, the off-charge had both fast and slow components, with the slow component accounting for nearly 35% of Qmax. These results demonstrate that the slow movement of the S4-DIV during repolarization is not dependent upon the normal binding of the inactivation particle.

Inference of directional selection and mutation parameters assuming equilibrium.

PubMed

Vogl, Claus; Bergman, Juraj

2015-12-01

In a classical study, Wright (1931) proposed a model for the evolution of a biallelic locus under the influence of mutation, directional selection and drift. He derived the equilibrium distribution of the allelic proportion conditional on the scaled mutation rate, the mutation bias and the scaled strength of directional selection. The equilibrium distribution can be used for inference of these parameters with genome-wide datasets of "site frequency spectra" (SFS). Assuming that the scaled mutation rate is low, Wright's model can be approximated by a boundary-mutation model, where mutations are introduced into the population exclusively from sites fixed for the preferred or unpreferred allelic states. With the boundary-mutation model, inference can be partitioned: (i) the shape of the SFS distribution within the polymorphic region is determined by random drift and directional selection, but not by the mutation parameters, such that inference of the selection parameter relies exclusively on the polymorphic sites in the SFS; (ii) the mutation parameters can be inferred from the amount of polymorphic and monomorphic preferred and unpreferred alleles, conditional on the selection parameter. Herein, we derive maximum likelihood estimators for the mutation and selection parameters in equilibrium and apply the method to simulated SFS data as well as empirical data from a Madagascar population of Drosophila simulans. Copyright © 2015 Elsevier Inc. All rights reserved.

Efficient implementation of three-dimensional reference interaction site model self-consistent-field method: Application to solvatochromic shift calculations

NASA Astrophysics Data System (ADS)

Minezawa, Noriyuki; Kato, Shigeki

2007-02-01

The authors present an implementation of the three-dimensional reference interaction site model self-consistent-field (3D-RISM-SCF) method. First, they introduce a robust and efficient algorithm for solving the 3D-RISM equation. The algorithm is a hybrid of the Newton-Raphson and Picard methods. The Jacobian matrix is analytically expressed in a computationally useful form. Second, they discuss the solute-solvent electrostatic interaction. For the solute to solvent route, the electrostatic potential (ESP) map on a 3D grid is constructed directly from the electron density. The charge fitting procedure is not required to determine the ESP. For the solvent to solute route, the ESP acting on the solute molecule is derived from the solvent charge distribution obtained by solving the 3D-RISM equation. Matrix elements of the solute-solvent interaction are evaluated by the direct numerical integration. A remarkable reduction in the computational time is observed in both routes. Finally, the authors implement the first derivatives of the free energy with respect to the solute nuclear coordinates. They apply the present method to "solute" water and formaldehyde in aqueous solvent using the simple point charge model, and the results are compared with those from other methods: the six-dimensional molecular Ornstein-Zernike SCF, the one-dimensional site-site RISM-SCF, and the polarizable continuum model. The authors also calculate the solvatochromic shifts of acetone, benzonitrile, and nitrobenzene using the present method and compare them with the experimental and other theoretical results.

Efficient implementation of three-dimensional reference interaction site model self-consistent-field method: application to solvatochromic shift calculations.

PubMed

Minezawa, Noriyuki; Kato, Shigeki

2007-02-07

The authors present an implementation of the three-dimensional reference interaction site model self-consistent-field (3D-RISM-SCF) method. First, they introduce a robust and efficient algorithm for solving the 3D-RISM equation. The algorithm is a hybrid of the Newton-Raphson and Picard methods. The Jacobian matrix is analytically expressed in a computationally useful form. Second, they discuss the solute-solvent electrostatic interaction. For the solute to solvent route, the electrostatic potential (ESP) map on a 3D grid is constructed directly from the electron density. The charge fitting procedure is not required to determine the ESP. For the solvent to solute route, the ESP acting on the solute molecule is derived from the solvent charge distribution obtained by solving the 3D-RISM equation. Matrix elements of the solute-solvent interaction are evaluated by the direct numerical integration. A remarkable reduction in the computational time is observed in both routes. Finally, the authors implement the first derivatives of the free energy with respect to the solute nuclear coordinates. They apply the present method to "solute" water and formaldehyde in aqueous solvent using the simple point charge model, and the results are compared with those from other methods: the six-dimensional molecular Ornstein-Zernike SCF, the one-dimensional site-site RISM-SCF, and the polarizable continuum model. The authors also calculate the solvatochromic shifts of acetone, benzonitrile, and nitrobenzene using the present method and compare them with the experimental and other theoretical results.

Fission gas in thoria

NASA Astrophysics Data System (ADS)

Kuganathan, Navaratnarajah; Ghosh, Partha S.; Galvin, Conor O. T.; Arya, Ashok K.; Dutta, Bijon K.; Dey, Gautam K.; Grimes, Robin W.

2017-03-01

The fission gases Xe and Kr, formed during normal reactor operation, are known to degrade fuel performance, particularly at high burn-up. Using first-principles density functional theory together with a dispersion correction (DFT + D), in ThO2 we calculate the energetics of neutral and charged point defects, the di-vacancy (DV), different neutral tri-vacancies (NTV), the charged tetravacancy (CTV) defect cluster geometries and their interaction with Xe and Kr. The most favourable incorporation point defect site for Xe or Kr in defective ThO2 is the fully charged thorium vacancy. The lowest energy NTV in larger supercells of ThO2 is NTV3, however, a single Xe atom is most stable when accommodated within a NTV1. The di-vacancy (DV) is a significantly less favoured incorporation site than the NTV1 but the CTV offers about the same incorporation energy. Incorporation of a second gas atom in a NTV is a high energy process and more unfavourable than accommodation within an existing Th vacancy. The bi-NTV (BNTV) cluster geometry studied will accommodate one or two gas atoms with low incorporation energies but the addition of a third gas atom incurs a high energy penalty. The tri-NTV cluster (TNTV) forms a larger space which accommodates three gas atoms but again there is a penalty to accommodate a fourth gas atom. By considering the energy to form the defect sites, solution energies were generated showing that in ThO2-x the most favourable solution equilibrium site is the NTV1 while in ThO2 it is the DV.

Molecular mechanism of reflectin's tunable biophotonic control: Opportunities and limitations for new optoelectronics

NASA Astrophysics Data System (ADS)

Levenson, Robert; DeMartini, Daniel G.; Morse, Daniel E.

2017-10-01

Discovery that reflectin proteins fill the dynamically tunable Bragg lamellae in the reflective skin cells of certain squids has prompted efforts to design new reflectin-inspired systems for dynamic photonics. But new insights into the actual role and mechanism of action of the reflectins constrain and better define the opportunities and limitations for rationally designing optical systems with reflectin-based components. We and our colleagues have discovered that the reflectins function as a signal-controlled molecular machine, regulating an osmotic motor that tunes the thickness, spacing, and refractive index of the tunable, membrane-bound Bragg lamellae in the iridocytes of the loliginid squids. The tunable reflectin proteins, characterized by a variable number of highly conserved peptide domains interspersed with positively charged linker segments, are restricted in intra- and inter-chain contacts by Coulombic repulsion. Physiologically, this inhibition is progressively overcome by charge-neutralization resulting from acetylcholine (neurotransmitter)-induced, site-specific phosphorylation, triggering the simultaneous activation and progressive tuning of reflectance from red to blue. Details of this process have been resolved through in vitro analyses of purified recombinant reflectins, controlling charge-neutralization by pH-titration or mutation as surrogates for the in vivo phosphorylation. Results of these analyses have shown that neutralization overcoming the Coulombic inhibition reversibly and cyclably triggers condensation and secondary folding of the reflectins, with the emergence of previously cryptic, phase-segregated hydrophobic domains enabling hierarchical assembly. This tunable, reversible, and cyclable assembly regulates the Gibbs-Donnan mediated osmotic shrinking or swelling of the Bragg lamellae that tunes the brightness and color of reflected light. Our most recent studies have revealed a direct relationship between the extent of charge neutralization and the size of the reflectin assemblies, further explaining the synergistic effects on the intensity and wavelength of reflected light. Mutational analyses show that the "switch" controlling reflectins' structural transitions is distributed along the protein, while detailed comparisons of the sequences and structures of the recently evolved tunable reflectins to those of their ancestral, non-tunable homologs are helping to identify the specific structural determinants governing tunability.

A leucine repeat motif in AbiA is required for resistance of Lactococcus lactis to phages representing three species.

PubMed

Dinsmore, P K; O'Sullivan, D J; Klaenhammer, T R

1998-05-28

The abiA gene encodes an abortive bacteriophage infection mechanism that can protect Lactococcus species from infection by a variety of bacteriophages including three unrelated phage species. Five heptad leucine repeats suggestive of a leucine zipper motif were identified between residues 232 and 266 in the predicted amino acid sequence of the AbiA protein. The biological role of residues in the repeats was investigated by incorporating amino acid substitutions via site-directed mutagenesis. Each mutant was tested for phage resistance against three phages, phi 31, sk1, and c2, belonging to species P335, 936, and c2, respectively. The five residues that comprise the heptad repeats were designated L234, L242, A249, L256, and L263. Three single conservative mutations of leucine to valine in positions L235, L242, and L263 and a double mutation of two leucines (L235 and L242) to valines did not affect AbiA activity on any phages tested. Non-conservative single substitutions of charged amino acids for three of the leucines (L235, L242, and L256) virtually eliminated AbiA activity on all phages tested. Substitution of the alanine residue in the third repeat (A249) with a charged residue did not affect AbiA activity. Replacement of L242 with an alanine elimination phage resistance against phi 31, but partial resistance to sk1 and c2 remained. Two single proline substitutions for leucines L242 and L263 virtually eliminated AbiA activity against all phages, indicating that the predicted alpha-helical structure of this region is important. Mutations in an adjacent region of basic amino acids had various effects on phage resistance, suggesting that these basic residues are also important for AbiA activity. This directed mutagenesis analysis of AbiA indicated that the leucine repeat structure is essential for conferring phage resistance against three species of lactococcal bacteriophages.

A unified description of the electrochemical, charge distribution, and spectroscopic properties of the special-pair radical cation in bacterial photosynthesis.

PubMed

Reimers, Jeffrey R; Hush, Noel S

2004-04-07

We apply our four-state 70-vibration vibronic-coupling model for the properties of the photosynthetic special-pair radical cation to: (1) interpret the observed correlations between the midpoint potential and the distribution of spin density between the two bacteriochlorophylls for 30 mutants of Rhodobacter sphaeroides, (2) interpret the observed average intervalence hole-transfer absorption energies as a function of spin density for six mutants, and (3) simulate the recently obtained intervalence electroabsorption Stark spectrum of the wild-type reaction center. While three new parameters describing the location of the sites of mutation with respect to the special pair are required to describe the midpoint-potential data, a priori predictions are made for the transition energies and the Stark spectrum. In general, excellent predictions are made of the observed quantities, with deviations being typically of the order of twice the experimental uncertainties. A unified description of many chemical and spectroscopic properties of the bacterial reaction center is thus provided. Central to the analysis is the assumption that the perturbations made to the reaction center, either via mutations of protein residues or by application of an external electric field, act only to independently modify the oxidation potentials of the two halves of the special pair and hence the redox asymmetry E0. While this appears to be a good approximation, clear evidence is presented that effects of mutation can be more extensive than what is allowed for. A thorough set of analytical equations describing the observed properties is obtained using the Born-Oppenheimer adiabatic approximation. These equations are generally appropriate for intervalence charge-transfer problems and include, for the first time, full treatment of both symmetric and antisymmetric vibrational motions. The limits of validity of the adiabatic approach to the full nonadiabatic problem are obtained.

Relatively high rates of G:C → A:T transitions at CpG sites were observed in certain epithelial tissues including pancreas and submaxillary gland of adult big blue® mice.

PubMed

Prtenjaca, Anita; Tarnowski, Heather E; Marr, Alison M; Heney, Melanie A; Creamer, Laura; Sathiamoorthy, Sarmitha; Hill, Kathleen A

2014-01-01

With few exceptions, spontaneous mutation frequency and pattern are similar across tissue types and relatively constant in young to middle adulthood in wild type mice. Underrepresented in surveys of spontaneous mutations across murine tissues is the diversity of epithelial tissues. For the first time, spontaneous mutations were detected in pancreas and submaxillary gland and compared with kidney, lung, and male germ cells from five adult male Big Blue® mice. Mutation load was assessed quantitatively through measurement of mutant and mutation frequency and qualitatively through identification of mutations and characterization of recurrent mutations, multiple mutations, mutation pattern, and mutation spectrum. A total of 9.6 million plaque forming units were screened, 226 mutants were collected, and 196 independent mutations were identified. Four novel mutations were discovered. Spontaneous mutation frequency was low in pancreas and high in the submaxillary gland. The submaxillary gland had multiple recurrent mutations in each of the mice and one mutant had two independent mutations. Mutation patterns for epithelial tissues differed from that observed in male germ cells with a striking bias for G:C to A:T transitions at CpG sites. A comprehensive review of lacI spontaneous mutation patterns in young adult mice and rats identified additional examples of this mutational bias. An overarching observation about spontaneous mutation frequency in adult tissues of the mouse remains one of stability. A repeated observation in certain epithelial tissues is a higher rate of G:C to A:T transitions at CpG sites and the underlying mechanisms for this bias are not known. Copyright © 2013 Wiley Periodicals, Inc.

Extracellular Determinants of Anion Discrimination of the Cl−/H+ Antiporter Protein CLC-5*

PubMed Central

De Stefano, Silvia; Pusch, Michael; Zifarelli, Giovanni

2011-01-01

Mammalian CLC proteins comprise both Cl− channels and Cl−/H+ antiporters that carry out fundamental physiological tasks by transporting Cl− across plasma membrane and intracellular compartments. The NO3− over Cl− preference of a plant CLC transporter has been pinpointed to a conserved serine residue located at Scen and it is generally assumed that the other two binding sites of CLCs, Sext and Sin, do not substantially contribute to anion selectivity. Here we show for the Cl−/H+ antiporter CLC-5 that the conserved and extracellularly exposed Lys210 residue is critical to determine the anion specificity for transport activity. In particular, mutations that neutralize or invert the charge at this position reverse the NO3− over Cl− preference of WT CLC-5 at a concentration of 100 mm, but do not modify the coupling stoichiometry with H+. The importance of the electrical charge is shown by chemical modification of K210C with positively charged cysteine-reactive compounds that reintroduce the WT preference for Cl−. At saturating extracellular anion concentrations, neutralization of Lys210 is of little impact on the anion preference, suggesting an important role of Lys210 on the association rate of extracellular anions to Sext. PMID:21921031

Structural studies of p53 inactivation by DNA-contact mutations and its rescue by suppressor mutations via alternative protein–DNA interactions

PubMed Central

Eldar, Amir; Rozenberg, Haim; Diskin-Posner, Yael; Rohs, Remo; Shakked, Zippora

2013-01-01

A p53 hot-spot mutation found frequently in human cancer is the replacement of R273 by histidine or cysteine residues resulting in p53 loss of function as a tumor suppressor. These mutants can be reactivated by the incorporation of second-site suppressor mutations. Here, we present high-resolution crystal structures of the p53 core domains of the cancer-related proteins, the rescued proteins and their complexes with DNA. The structures show that inactivation of p53 results from the incapacity of the mutated residues to form stabilizing interactions with the DNA backbone, and that reactivation is achieved through alternative interactions formed by the suppressor mutations. Detailed structural and computational analysis demonstrates that the rescued p53 complexes are not fully restored in terms of DNA structure and its interface with p53. Contrary to our previously studied wild-type (wt) p53-DNA complexes showing non-canonical Hoogsteen A/T base pairs of the DNA helix that lead to local minor-groove narrowing and enhanced electrostatic interactions with p53, the current structures display Watson–Crick base pairs associated with direct or water-mediated hydrogen bonds with p53 at the minor groove. These findings highlight the pivotal role played by R273 residues in supporting the unique geometry of the DNA target and its sequence-specific complex with p53. PMID:23863845

GFP Loss-of-Function Mutations in Arabidopsis thaliana.

PubMed

Fu, Jason L; Kanno, Tatsuo; Liang, Shih-Chieh; Matzke, Antonius J M; Matzke, Marjori

2015-07-06

Green fluorescent protein (GFP) and related fluorescent proteins are widely used in biological research to monitor gene expression and protein localization in living cells. The GFP chromophore is generated spontaneously in the presence of oxygen by a multi-step reaction involving cyclization of the internal tripeptide Ser65 (or Thr65)-Tyr66-Gly67, which is embedded in the center of an 11-stranded β-barrel structure. Random and site-specific mutagenesis has been used to optimize GFP fluorescence and create derivatives with novel properties. However, loss-of-function mutations that would aid in understanding GFP protein folding and chromophore formation have not been fully cataloged. Here we report a collection of ethyl methansulfonate-induced GFP loss-of-function mutations in the model plant Arabidopsis thaliana. Mutations that alter residues important for chromophore maturation, such as Arg96 and Ser205, greatly reduce or extinguish fluorescence without dramatically altering GFP protein accumulation. By contrast, other loss-of-fluorescence mutations substantially diminish the amount of GFP protein, suggesting that they compromise protein stability. Many mutations in this category generate substitutions of highly conserved glycine residues, including the following: Gly67 in the chromogenic tripeptide; Gly31, Gly33, and Gly35 in the second β-strand; and Gly20, Gly91, and Gly127 in the lids of the β-barrel scaffold. Our genetic analysis supports conclusions from structural and biochemical studies and demonstrates a critical role for multiple, highly conserved glycine residues in GFP protein stability. Copyright © 2015 Fu et al.

GFP Loss-of-Function Mutations in Arabidopsis thaliana

PubMed Central

Fu, Jason L.; Kanno, Tatsuo; Liang, Shih-Chieh; Matzke, Antonius J. M.; Matzke, Marjori

2015-01-01

Green fluorescent protein (GFP) and related fluorescent proteins are widely used in biological research to monitor gene expression and protein localization in living cells. The GFP chromophore is generated spontaneously in the presence of oxygen by a multi-step reaction involving cyclization of the internal tripeptide Ser65 (or Thr65)-Tyr66-Gly67, which is embedded in the center of an 11-stranded β-barrel structure. Random and site-specific mutagenesis has been used to optimize GFP fluorescence and create derivatives with novel properties. However, loss-of-function mutations that would aid in understanding GFP protein folding and chromophore formation have not been fully cataloged. Here we report a collection of ethyl methansulfonate–induced GFP loss-of-function mutations in the model plant Arabidopsis thaliana. Mutations that alter residues important for chromophore maturation, such as Arg96 and Ser205, greatly reduce or extinguish fluorescence without dramatically altering GFP protein accumulation. By contrast, other loss-of-fluorescence mutations substantially diminish the amount of GFP protein, suggesting that they compromise protein stability. Many mutations in this category generate substitutions of highly conserved glycine residues, including the following: Gly67 in the chromogenic tripeptide; Gly31, Gly33, and Gly35 in the second β-strand; and Gly20, Gly91, and Gly127 in the lids of the β-barrel scaffold. Our genetic analysis supports conclusions from structural and biochemical studies and demonstrates a critical role for multiple, highly conserved glycine residues in GFP protein stability. PMID:26153075

Slowly progressive retinitis pigmentosa caused by two novel mutations in the MAK gene.

PubMed

Gray, Joanna Monika; Orlans, Harry Otway; Shanks, Morag; Clouston, Penny; MacLaren, Robert Elvis

2018-05-21

The growing number of clinical trials currently underway for inherited retinal diseases has highlighted the importance of achieving a molecular diagnosis for all new cases presenting to hospital eye services. The male germ cell-associated kinase (MAK) gene encodes a cilium-associated protein selectively expressed in the retina and testis, and has recently been implicated in autosomal recessive retinitis pigmentosa (RP). Whole exome sequencing has previously identified a homozygous Alu insertion in probands with recessive RP and nonsense and missense mutations have also been reported. Here we describe two novel mutations in different alleles of the MAK gene in a 75-year-old British female, who had a clinical diagnosis of RP () with onset in the fourth decade and no relevant family history. The mutations were established through next generation sequencing of a panel of 111 genes associated with RP and RP-like phenotypes. Two novel null mutations were identified within the MAK gene. The first c.1195_1196delAC p.(Thr399fs), was a two base-pair deletion creating a frame-shift in exon 9 predicted to result in nonsense-mediated decay. The second, c.279-2A>G, involved the splice acceptor consensus site upstream of exon 4, predicted to lead to aberrant splicing. The natural history of this individual's RP is consistent with previously described MAK mutations, being significantly milder than that associated with other photoreceptor ciliopathies. We suggest inclusion of MAK as part of wider genetic testing in all individuals presenting with RP.

Mapping Interaction Sites on Human Chemokine Receptors by Deep Mutational Scanning.

PubMed

Heredia, Jeremiah D; Park, Jihye; Brubaker, Riley J; Szymanski, Steven K; Gill, Kevin S; Procko, Erik

2018-06-01

Chemokine receptors CXCR4 and CCR5 regulate WBC trafficking and are engaged by the HIV-1 envelope glycoprotein gp120 during infection. We combine a selection of human CXCR4 and CCR5 libraries comprising nearly all of ∼7000 single amino acid substitutions with deep sequencing to define sequence-activity landscapes for surface expression and ligand interactions. After consideration of sequence constraints for surface expression, known interaction sites with HIV-1-blocking Abs were appropriately identified as conserved residues following library sorting for Ab binding, validating the use of deep mutational scanning to map functional interaction sites in G protein-coupled receptors. Chemokine CXCL12 was found to interact with residues extending asymmetrically into the CXCR4 ligand-binding cavity, similar to the binding surface of CXCR4 recognized by an antagonistic viral chemokine previously observed crystallographically. CXCR4 mutations distal from the chemokine binding site were identified that enhance chemokine recognition. This included disruptive mutations in the G protein-coupling site that diminished calcium mobilization, as well as conservative mutations to a membrane-exposed site (CXCR4 residues H79 2.45 and W161 4.50 ) that increased ligand binding without loss of signaling. Compared with CXCR4-CXCL12 interactions, CCR5 residues conserved for gp120 (HIV-1 BaL strain) interactions map to a more expansive surface, mimicking how the cognate chemokine CCL5 makes contacts across the entire CCR5 binding cavity. Acidic substitutions in the CCR5 N terminus and extracellular loops enhanced gp120 binding. This study demonstrates how comprehensive mutational scanning can define functional interaction sites on receptors, and novel mutations that enhance receptor activities can be found simultaneously. Copyright © 2018 by The American Association of Immunologists, Inc.

Reconfigurable electronics using conducting metal-organic frameworks

DOEpatents

Allendorf, Mark D.; Talin, Albert Alec; Leonard, Francois; Stavila, Vitalie

2017-07-18

A device including a porous metal organic framework (MOF) disposed between two terminals, the device including a first state wherein the MOF is infiltrated by a guest species to form an electrical path between the terminals and a second state wherein the electrical conductivity of the MOF is less than the electrical conductivity in the first state. A method including switching a porous metal organic framework (MOF) between two terminals from a first state wherein a metal site in the MOF is infiltrated by a guest species that is capable of charge transfer to a second state wherein the MOF is less electrically conductive than in the first state.

Screening Phosphorylation Site Mutations in Yeast Acetyl-CoA Carboxylase Using Malonyl-CoA Sensor to Improve Malonyl-CoA-Derived Product.

PubMed

Chen, Xiaoxu; Yang, Xiaoyu; Shen, Yu; Hou, Jin; Bao, Xiaoming

2018-01-01

Malonyl-coenzyme A (malonyl-CoA) is a critical precursor for the biosynthesis of a variety of biochemicals. It is synthesized by the catalysis of acetyl-CoA carboxylase (Acc1p), which was demonstrated to be deactivated by the phosphorylation of Snf1 protein kinase in yeast. In this study, we designed a synthetic malonyl-CoA biosensor and used it to screen phosphorylation site mutations of Acc1p in Saccharomyces cerevisiae . Thirteen phosphorylation sites were mutated, and a combination of three site mutations in Acc1p, S686A, S659A, and S1157A, was found to increase malonyl-CoA availability. ACC1 S686AS659AS1157A expression also improved the production of 3-hydroxypropionic acid, a malonyl-CoA-derived chemical, compared to both wild type and the previously reported ACC1 S659AS1157A mutation. This mutation will also be beneficial for other malonyl-CoA-derived products.

Simultaneous Profiling of DNA Mutation and Methylation by Melting Analysis Using Magnetoresistive Biosensor Array.

PubMed

Rizzi, Giovanni; Lee, Jung-Rok; Dahl, Christina; Guldberg, Per; Dufva, Martin; Wang, Shan X; Hansen, Mikkel F

2017-09-26

Epigenetic modifications, in particular DNA methylation, are gaining increasing interest as complementary information to DNA mutations for cancer diagnostics and prognostics. We introduce a method to simultaneously profile DNA mutation and methylation events for an array of sites with single site specificity. Genomic (mutation) or bisulphite-treated (methylation) DNA is amplified using nondiscriminatory primers, and the amplicons are then hybridized to a giant magnetoresistive (GMR) biosensor array followed by melting curve measurements. The GMR biosensor platform offers scalable multiplexed detection of DNA hybridization, which is insensitive to temperature variation. The melting curve approach further enhances the assay specificity and tolerance to variations in probe length. We demonstrate the utility of this method by simultaneously profiling five mutation and four methylation sites in human melanoma cell lines. The method correctly identified all mutation and methylation events and further provided quantitative assessment of methylation density validated by bisulphite pyrosequencing.

Crystal structure of class III chitinase from pomegranate provides the insight into its metal storage capacity.

PubMed

Masuda, Taro; Zhao, Guanghua; Mikami, Bunzo

2015-01-01

Chitinase hydrolyzes the β-1,4-glycosidic bond in chitin. In higher plants, this enzyme has been regarded as a pathogenesis-related protein. Recently, we identified a class III chitinase, which functions as a calcium storage protein in pomegranate (Punica granatum) seed (PSC, pomegranate seed chitinase). Here, we solved a crystal structure of PSC at 1.6 Å resolution. Although its overall structure, including the structure of catalytic site and non-proline cis-peptides, was closely similar to those of other class III chitinases, PSC had some unique structural characteristics. First, there were some metal-binding sites with coordinated water molecules on the surface of PSC. Second, many unconserved aspartate residues were present in the PSC sequence which rendered the surface of PSC negatively charged. This acidic electrostatic property is in contrast to that of hevamine, well-characterized plant class III chitinase, which has rather a positively charged surface. Thus, the crystal structure provides a clue for metal association property of PSC.

Cooperative communication within and between single nanocatalysts

NASA Astrophysics Data System (ADS)

Zou, Ningmu; Zhou, Xiaochun; Chen, Guanqun; Andoy, Nesha May; Jung, Won; Liu, Guokun; Chen, Peng

2018-06-01

Enzymes often show catalytic allostery in which reactions occurring at different sites communicate cooperatively over distances of up to a few nanometres. Whether such effects can occur with non-biological nanocatalysts remains unclear, even though these nanocatalysts can undergo restructuring and molecules can diffuse over catalyst surfaces. Here we report that phenomenologically similar, but mechanistically distinct, cooperative effects indeed exist for nanocatalysts. Using spatiotemporally resolved single-molecule catalysis imaging, we find that catalytic reactions on a single Pd or Au nanocatalyst can communicate with each other, probably via hopping of positively charged holes on the catalyst surface, over 102 nanometres and with a temporal memory of 101 to 102 seconds, giving rise to positive cooperativity among its surface active sites. Similar communication is also observed between individual nanocatalysts, however it operates via a molecular diffusion mechanism involving negatively charged product molecules, and its communication distance is many micrometres. Generalization of these long-range intra- and interparticle catalytic communication mechanisms may introduce a novel conceptual framework for understanding nanoscale catalysis.

Frequency of ABL gene mutations in chronic myeloid leukemia patients resistant to imatinib and results of treatment switch to second-generation tyrosine kinase inhibitors.

PubMed

Marcé, Silvia; Zamora, Lurdes; Cabezón, Marta; Xicoy, Blanca; Boqué, Concha; Fernández, Cristalina; Grau, Javier; Navarro, José-Tomás; Fernández de Sevilla, Alberto; Ribera, Josep-Maria; Feliu, Evarist; Millá, Fuensanta

2013-08-04

Tyrosine kinase inhibitors (TKI) have improved the management of patients with chronic myeloid leukemia (CML). However, a significant proportion of patients do not achieve the optimal response or are resistant to TKI. ABL kinase domain mutations have been extensively implicated in the pathogenesis of TKI resistance. Treatment with second-generation TKI has produced high rates of hematologic and cytogenetic responses in mutated ABL patients. The aim of this study was to determine the type and frequency of ABL mutations in patients who were resistant to imatinib or had lost the response, and to analyze the effect of second-generation TKI on their outcome. The presence of ABL mutations in 45 CML patients resistant to imatinib was evaluated by direct sequencing and was correlated with the results of the cytogenetic study (performed in 39 cases). The outcome of these patients after therapy with nilotinib or dasatinib was analyzed. ABL mutations were detected in 14 out of 45 resistant patients. Patients with clonal cytogenetic evolution tended to develop mutations more frequently than those without clonal evolution. Nine out of the 15 patients with ABL mutation responded to a treatment switch to nilotinib (n=4), dasatinib (n=2), interferon (n=1) or hematopoietic stem cell transplantation (n=2). The frequency of ABL mutations in CML patients resistant to imatinib is high and is more frequent among those with clonal cytogenetic evolution. The change to second-generation TKI can overcome imatinib resistance in most of the mutated patients. Copyright © 2012 Elsevier España, S.L. All rights reserved.

Genomic sequencing in cystic fibrosis newborn screening: what works best, two-tier predefined CFTR mutation panels or second-tier CFTR panel followed by third-tier sequencing?

PubMed

Currier, Robert J; Sciortino, Stan; Liu, Ruiling; Bishop, Tracey; Alikhani Koupaei, Rasoul; Feuchtbaum, Lisa

2017-10-01

PurposeThe purpose of this study was to model the performance of several known two-tier, predefined mutation panels and three-tier algorithms for cystic fibrosis (CF) screening utilizing the ethnically diverse California population.MethodsThe cystic fibrosis transmembrane conductance regulator (CFTR) mutations identified among the 317 CF cases in California screened between 12 August 2008 and 18 December 2012 were used to compare the expected CF detection rates for several two- and three-tier screening approaches, including the current California approach, which consists of a population-specific 40-mutation panel followed by third-tier sequencing when indicated.ResultsThe data show that the strategy of using third-tier sequencing improves CF detection following an initial elevated immunoreactive trypsinogen and detection of only one mutation on a second-tier panel.ConclusionIn a diverse population, the use of a second-tier panel followed by third-tier CFTR gene sequencing provides a better detection rate for CF, compared with the use of a second-tier approach alone, and is an effective way to minimize the referrals of CF carriers for sweat testing. Restricting screening to a second-tier testing to predefined mutation panels, even broad ones, results in some missed CF cases and demonstrates the limited utility of this approach in states that have diverse multiethnic populations.

Otitis Media in a New Mouse Model for CHARGE Syndrome with a Deletion in the Chd7 Gene

PubMed Central

Tian, Cong; Yu, Heping; Yang, Bin; Han, Fengchan; Zheng, Ye; Bartels, Cynthia F.; Schelling, Deborah; Arnold, James E.; Scacheri, Peter C.; Zheng, Qing Yin

2012-01-01

Otitis media is a middle ear disease common in children under three years old. Otitis media can occur in normal individuals with no other symptoms or syndromes, but it is often seen in individuals clinically diagnosed with genetic diseases such as CHARGE syndrome, a complex genetic disease caused by mutation in the Chd7 gene and characterized by multiple birth defects. Although otitis media is common in human CHARGE syndrome patients, it has not been reported in mouse models of CHARGE syndrome. In this study, we report a mouse model with a spontaneous deletion mutation in the Chd7 gene and with chronic otitis media of early onset age accompanied by hearing loss. These mice also exhibit morphological alteration in the Eustachian tubes, dysregulation of epithelial proliferation, and decreased density of middle ear cilia. Gene expression profiling revealed up-regulation of Muc5ac, Muc5b and Tgf-β1 transcripts, the products of which are involved in mucin production and TGF pathway regulation. This is the first mouse model of CHARGE syndrome reported to show otitis media with effusion and it will be valuable for studying the etiology of otitis media and other symptoms in CHARGE syndrome. PMID:22539951

A novel AVPR2 splice site mutation leads to partial X-linked nephrogenic diabetes insipidus in two brothers.

PubMed

Schernthaner-Reiter, Marie Helene; Adams, David; Trivellin, Giampaolo; Ramnitz, Mary Scott; Raygada, Margarita; Golas, Gretchen; Faucz, Fabio R; Nilsson, Ola; Nella, Aikaterini A; Dileepan, Kavitha; Lodish, Maya; Lee, Paul; Tifft, Cynthia; Markello, Thomas; Gahl, William; Stratakis, Constantine A

2016-05-01

X-linked nephrogenic diabetes insipidus (NDI, OMIM#304800) is caused by mutations in the arginine vasopressin (AVP, OMIM*192340) receptor type 2 (AVPR2, OMIM*300538) gene. A 20-month-old boy and his 8-year-old brother presented with polyuria, polydipsia, and failure to thrive. Both boys demonstrated partial DDAVP (1-desamino-8-D AVP or desmopressin) responses; thus, NDI diagnosis was delayed. While routine sequencing of AVPR2 showed a potential splice site variant, it was not until exome sequencing confirmed the AVPR2 splice site variant and did not reveal any more likely candidates that the patients' diagnosis was made and proper treatment was instituted. Both patients were hemizygous for two AVPR2 variants predicted in silico to affect AVPR2 messenger RNA (mRNA) splicing. A minigene assay revealed that the novel AVPR2 c.276A>G mutation creates a novel splice acceptor site leading to 5' truncation of AVPR2 exon 2 in HEK293 human kidney cells. Both patients have been treated with high-dose DDAVP with a remarkable improvement of their symptoms and accelerated linear growth and weight gain. We present here a unique case of partial X-linked NDI due to an AVPR2 splice site mutation; patients with diabetes insipidus of unknown etiology may harbor splice site mutations that are initially underestimated in their pathogenicity on sequence analysis. • X-linked nephrogenic diabetes insipidus is caused by AVPR2 mutations, and disease severity can vary depending on the functional effect of the mutation. What is New: • We demonstrate here that a splice site mutation in AVPR2 leads to partial X-linked NDI in two brothers. • Treatment with high-dose DDAVP led to improvement of polyuria and polydipsia, weight gain, and growth.

De Novo GMNN Mutations Cause Autosomal-Dominant Primordial Dwarfism Associated with Meier-Gorlin Syndrome.

PubMed

Burrage, Lindsay C; Charng, Wu-Lin; Eldomery, Mohammad K; Willer, Jason R; Davis, Erica E; Lugtenberg, Dorien; Zhu, Wenmiao; Leduc, Magalie S; Akdemir, Zeynep C; Azamian, Mahshid; Zapata, Gladys; Hernandez, Patricia P; Schoots, Jeroen; de Munnik, Sonja A; Roepman, Ronald; Pearring, Jillian N; Jhangiani, Shalini; Katsanis, Nicholas; Vissers, Lisenka E L M; Brunner, Han G; Beaudet, Arthur L; Rosenfeld, Jill A; Muzny, Donna M; Gibbs, Richard A; Eng, Christine M; Xia, Fan; Lalani, Seema R; Lupski, James R; Bongers, Ernie M H F; Yang, Yaping

2015-12-03

Meier-Gorlin syndrome (MGS) is a genetically heterogeneous primordial dwarfism syndrome known to be caused by biallelic loss-of-function mutations in one of five genes encoding pre-replication complex proteins: ORC1, ORC4, ORC6, CDT1, and CDC6. Mutations in these genes cause disruption of the origin of DNA replication initiation. To date, only an autosomal-recessive inheritance pattern has been described in individuals with this disorder, with a molecular etiology established in about three-fourths of cases. Here, we report three subjects with MGS and de novo heterozygous mutations in the 5' end of GMNN, encoding the DNA replication inhibitor geminin. We identified two truncating mutations in exon 2 (the 1(st) coding exon), c.16A>T (p.Lys6(∗)) and c.35_38delTCAA (p.Ile12Lysfs(∗)4), and one missense mutation, c.50A>G (p.Lys17Arg), affecting the second-to-last nucleotide of exon 2 and possibly RNA splicing. Geminin is present during the S, G2, and M phases of the cell cycle and is degraded during the metaphase-anaphase transition by the anaphase-promoting complex (APC), which recognizes the destruction box sequence near the 5' end of the geminin protein. All three GMNN mutations identified alter sites 5' to residue Met28 of the protein, which is located within the destruction box. We present data supporting a gain-of-function mechanism, in which the GMNN mutations result in proteins lacking the destruction box and hence increased protein stability and prolonged inhibition of replication leading to autosomal-dominant MGS. Copyright © 2015 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

Exome Sequencing Identifies Mitochondrial Alanyl-tRNA Synthetase Mutations in Infantile Mitochondrial Cardiomyopathy

PubMed Central

Götz, Alexandra; Tyynismaa, Henna; Euro, Liliya; Ellonen, Pekka; Hyötyläinen, Tuulia; Ojala, Tiina; Hämäläinen, Riikka H.; Tommiska, Johanna; Raivio, Taneli; Oresic, Matej; Karikoski, Riitta; Tammela, Outi; Simola, Kalle O.J.; Paetau, Anders; Tyni, Tiina; Suomalainen, Anu

2011-01-01

Infantile cardiomyopathies are devastating fatal disorders of the neonatal period or the first year of life. Mitochondrial dysfunction is a common cause of this group of diseases, but the underlying gene defects have been characterized in only a minority of cases, because tissue specificity of the manifestation hampers functional cloning and the heterogeneity of causative factors hinders collection of informative family materials. We sequenced the exome of a patient who died at the age of 10 months of hypertrophic mitochondrial cardiomyopathy with combined cardiac respiratory chain complex I and IV deficiency. Rigorous data analysis allowed us to identify a homozygous missense mutation in AARS2, which we showed to encode the mitochondrial alanyl-tRNA synthetase (mtAlaRS). Two siblings from another family, both of whom died perinatally of hypertrophic cardiomyopathy, had the same mutation, compound heterozygous with another missense mutation. Protein structure modeling of mtAlaRS suggested that one of the mutations affected a unique tRNA recognition site in the editing domain, leading to incorrect tRNA aminoacylation, whereas the second mutation severely disturbed the catalytic function, preventing tRNA aminoacylation. We show here that mutations in AARS2 cause perinatal or infantile cardiomyopathy with near-total combined mitochondrial respiratory chain deficiency in the heart. Our results indicate that exome sequencing is a powerful tool for identifying mutations in single patients and allows recognition of the genetic background in single-gene disorders of variable clinical manifestation and tissue-specific disease. Furthermore, we show that mitochondrial disorders extend to prenatal life and are an important cause of early infantile cardiac failure. PMID:21549344

De Novo GMNN Mutations Cause Autosomal-Dominant Primordial Dwarfism Associated with Meier-Gorlin Syndrome

PubMed Central

Burrage, Lindsay C.; Charng, Wu-Lin; Eldomery, Mohammad K.; Willer, Jason R.; Davis, Erica E.; Lugtenberg, Dorien; Zhu, Wenmiao; Leduc, Magalie S.; Akdemir, Zeynep C.; Azamian, Mahshid; Zapata, Gladys; Hernandez, Patricia P.; Schoots, Jeroen; de Munnik, Sonja A.; Roepman, Ronald; Pearring, Jillian N.; Jhangiani, Shalini; Katsanis, Nicholas; Vissers, Lisenka E.L.M.; Brunner, Han G.; Beaudet, Arthur L.; Rosenfeld, Jill A.; Muzny, Donna M.; Gibbs, Richard A.; Eng, Christine M.; Xia, Fan; Lalani, Seema R.; Lupski, James R.; Bongers, Ernie M.H.F.; Yang, Yaping

2015-01-01

Meier-Gorlin syndrome (MGS) is a genetically heterogeneous primordial dwarfism syndrome known to be caused by biallelic loss-of-function mutations in one of five genes encoding pre-replication complex proteins: ORC1, ORC4, ORC6, CDT1, and CDC6. Mutations in these genes cause disruption of the origin of DNA replication initiation. To date, only an autosomal-recessive inheritance pattern has been described in individuals with this disorder, with a molecular etiology established in about three-fourths of cases. Here, we report three subjects with MGS and de novo heterozygous mutations in the 5′ end of GMNN, encoding the DNA replication inhibitor geminin. We identified two truncating mutations in exon 2 (the 1st coding exon), c.16A>T (p.Lys6∗) and c.35_38delTCAA (p.Ile12Lysfs∗4), and one missense mutation, c.50A>G (p.Lys17Arg), affecting the second-to-last nucleotide of exon 2 and possibly RNA splicing. Geminin is present during the S, G2, and M phases of the cell cycle and is degraded during the metaphase-anaphase transition by the anaphase-promoting complex (APC), which recognizes the destruction box sequence near the 5′ end of the geminin protein. All three GMNN mutations identified alter sites 5′ to residue Met28 of the protein, which is located within the destruction box. We present data supporting a gain-of-function mechanism, in which the GMNN mutations result in proteins lacking the destruction box and hence increased protein stability and prolonged inhibition of replication leading to autosomal-dominant MGS. PMID:26637980

Managing the risks of on-site health centers.

PubMed

Gorman, Kathleen M; Miller, Ross M

2011-11-01

This review sought to assess compliance concerns, determine risk management strategies, and identify opportunities for future research to contribute to employers' understanding of the laws and regulations that apply to on-site care. A comprehensive review of databases, professional organizations' websites, and journals resulted in 22 publications reporting on the consequences of noncompliance among on-site health centers accepted for inclusion. None of those studies reported a study design or quantifiable outcome data. Two noncompliance themes were repeated among the publications. First, direct penalties included fines, civil actions, loss of licensure, and, potentially, criminal charges. Second, noncompliance also resulted in indirect costs such as employee mistrust and lowered standards of care, which jeopardize on-site health centers' ability to demonstrate a return on investment. Further research with rigorous methodology is needed to inform employer decisions about on-site health services and associated risk management. Copyright 2011, SLACK Incorporated.

Crossovers are associated with mutation and biased gene conversion at recombination hotspots.

PubMed

Arbeithuber, Barbara; Betancourt, Andrea J; Ebner, Thomas; Tiemann-Boege, Irene

2015-02-17

Meiosis is a potentially important source of germline mutations, as sites of meiotic recombination experience recurrent double-strand breaks (DSBs). However, evidence for a local mutagenic effect of recombination from population sequence data has been equivocal, likely because mutation is only one of several forces shaping sequence variation. By sequencing large numbers of single crossover molecules obtained from human sperm for two recombination hotspots, we find direct evidence that recombination is mutagenic: Crossovers carry more de novo mutations than nonrecombinant DNA molecules analyzed for the same donors and hotspots. The observed mutations were primarily CG to TA transitions, with a higher frequency of transitions at CpG than non-CpGs sites. This enrichment of mutations at CpG sites at hotspots could predominate in methylated regions involving frequent single-stranded DNA processing as part of DSB repair. In addition, our data set provides evidence that GC alleles are preferentially transmitted during crossing over, opposing mutation, and shows that GC-biased gene conversion (gBGC) predominates over mutation in the sequence evolution of hotspots. These findings are consistent with the idea that gBGC could be an adaptation to counteract the mutational load of recombination.

Crossovers are associated with mutation and biased gene conversion at recombination hotspots

PubMed Central

Arbeithuber, Barbara; Betancourt, Andrea J.; Ebner, Thomas; Tiemann-Boege, Irene

2015-01-01

Meiosis is a potentially important source of germline mutations, as sites of meiotic recombination experience recurrent double-strand breaks (DSBs). However, evidence for a local mutagenic effect of recombination from population sequence data has been equivocal, likely because mutation is only one of several forces shaping sequence variation. By sequencing large numbers of single crossover molecules obtained from human sperm for two recombination hotspots, we find direct evidence that recombination is mutagenic: Crossovers carry more de novo mutations than nonrecombinant DNA molecules analyzed for the same donors and hotspots. The observed mutations were primarily CG to TA transitions, with a higher frequency of transitions at CpG than non-CpGs sites. This enrichment of mutations at CpG sites at hotspots could predominate in methylated regions involving frequent single-stranded DNA processing as part of DSB repair. In addition, our data set provides evidence that GC alleles are preferentially transmitted during crossing over, opposing mutation, and shows that GC-biased gene conversion (gBGC) predominates over mutation in the sequence evolution of hotspots. These findings are consistent with the idea that gBGC could be an adaptation to counteract the mutational load of recombination. PMID:25646453

Two novel mutations in the sixth transmembrane segment of the thyrotropin receptor gene causing hyperfunctioning thyroid nodules.

PubMed

Gozu, Hulya; Avsar, Melike; Bircan, Rifat; Claus, Maren; Sahin, Serap; Sezgin, Ozlem; Deyneli, Oguzhan; Paschke, Ralf; Cirakoglu, Beyazit; Akalin, Sema

2005-04-01

Autonomously functioning thyroid nodules (AFTNs) can present as hyperfunctioning adenomas or toxic multinodular goiters. In the last decade, a large number of activating mutations have been identified in the thyrotropin receptor (TSHR) gene in autonomously functioning thyroid nodules. Most have been situated close to, or within the sixth transmembrane segment and third intracellular loop of the TSHR where the receptor interacts with the Gs protein. In this study we describe two novel mutations in the sixth transmembrane segment of the TSHR causing hyperfunctioning thyroid nodules. Genomic DNAs were isolated from four hyperfunctioning thyroid nodules, normal tissues and peripheral leukocytes of two patients with toxic multinodular goiter. After amplifying the related regions, TSHR and G(s)alpha genes were analyzed by single-strand conformation polymorphism (SSCP) analysis. The precise localization of the mutations was identified by automatic DNA sequence analysis. Functional studies were done by site-directed mutagenesis and transfection of a mutant construct into COS-7 cells. We identified two novel TSHR mutations in two hyperfunctioning thyroid nodules: Phe631Val in the first patient and Iso630Met in the second patient. Both mutant receptors display an increase in constitutive stimulation of basal cyclic adenosine monophosphate (cAMP) levels compared to the wild-type receptor. This confirms that these mutant receptors cause hyperfunctioning thyroid nodules.

Human immunodeficiency virus type 1 pol gene mutations which cause decreased susceptibility to 2',3'-dideoxycytidine.

PubMed Central

Fitzgibbon, J E; Howell, R M; Haberzettl, C A; Sperber, S J; Gocke, D J; Dubin, D T

1992-01-01

To investigate whether human immunodeficiency virus type 1 pol gene mutations are selected during prolonged 2',3'-dideoxycytidine (ddC) therapy, we used the polymerase chain reaction to amplify a portion of the reverse transcriptase segment of the pol gene from the peripheral blood mononuclear cell DNA of a patient with AIDS before and after an 80-week course of ddC therapy. The consensus sequence from the second sample contained a unique double mutation (ACT to GAT) in the codon for reverse transcriptase amino acid 69, causing substitution of aspartic acid (Asp) for the wild-type threonine (Thr). A mutation (ACA to ATA) also occurred in the codon for position 165, causing substitution of isoleucine (Ile) for Thr. The GAT (Asp) codon was introduced into the pol gene of a molecular clone of human immunodeficiency virus via site-directed mutagenesis. Following transfection, mutant and wild-type viruses were tested for susceptibility to ddC by a plaque reduction assay. The mutant virus was fivefold less susceptible to ddC than the wild type; cross-resistance to 3'-azido-3'-deoxythymidine or 2'3'-dideoxyinosine was not found. The Ile-165 mutation did not confer additional ddC resistance. The Asp-69 substitution may have contributed to the generation of resistant virus in this patient. Images PMID:1317143

A molecular switch sensor for detection of PRSS1 genotype based on site-specific DNA cleavage of restriction endonuclease.

PubMed

Liu, Qicai; Gao, Feng; Weng, Shaohuang; Peng, Huaping; Lin, Liqing; Zhao, Chengfei; Lin, Xinhua

2015-01-01

PRSS1 mutations or polymorphism in the peripheral blood of patients can be used as susceptible molecular markers to pancreatic cancer. A sensor for selective electrochemical detection of PRSS1 genotypes was developed based on site-specific DNA cleavage of restriction endonuclease EcoRI. A mercapto-modified hairpin probe was immobilized on a gold electrode. The probe's neck can be cleaved by EcoRI in the absence of rs10273639 C/C of PRSS1 genotype, but it cannot be cleaved in the presence of T/T. The difference in quantity of electric charge was monitored by biosensors before and after enzymatic cleavage. Electrochemical signals are generated by differential pulse voltammetry interrogation of methylene blue (MB) that quantitatively binds to surface-confined hairpin probe via electrostatic interactions. The results suggested this method had a good specificity in distinguishing PRSS1 genotypes. There was a good linear relationship between the charge and the logarithmic function of PRSS1 rs10273639 T/T type DNA concentration (current=120.6303+8.8512log C, R=0.9942). The detection limit was estimated at 0.5 fM. The molecular switch sensor has several advantages, and it is possible to qualitatively, quantitatively, and noninvasively detect PRSS1 genotypes in the blood of patients with pancreatic cancer. © 2015 by the Association of Clinical Scientists, Inc.

Novel BRCA1 splice-site mutation in ovarian cancer patients of Slavic origin.

PubMed

Krivokuca, Ana; Dragos, Vita Setrajcic; Stamatovic, Ljiljana; Blatnik, Ana; Boljevic, Ivana; Stegel, Vida; Rakobradovic, Jelena; Skerl, Petra; Jovandic, Stevo; Krajc, Mateja; Magic, Mirjana Brankovic; Novakovic, Srdjan

2018-04-01

Mutations in breast cancer susceptibility gene 1 (BRCA1) lead to defects in a number of cellular pathways including DNA damage repair and transcriptional regulation, resulting in the elevated genome instability and predisposing to breast and ovarian cancers. We report a novel mutation LRG_292t1:c.4356delA,p.(Ala1453Glnfs*3) in the 12th exon of BRCA1, in the splice site region near the donor site of intron 12. It is a frameshift mutation with the termination codon generated on the third amino acid position from the site of deletion. Human Splice Finder 3.0 and MutationTaster have assessed this variation as disease causing, based on the alteration of splicing, creation of premature stop codon and other potential alterations initiated by nucleotide deletion. Among the most important alterations are frameshift and splice site changes (score of the newly created donor splice site: 0.82). c.4356delA was associated with two ovarian cancer cases in two families of Slavic origin. It was detected by next generation sequencing, and confirmed with Sanger sequencing in both cases. Because of the fact that it changes the reading frame of the protein, novel mutation c.4356delA p.(Ala1453Glnfs*3) in BRCA1 gene might be of clinical significance for hereditary ovarian cancer. Further functional as well as segregation analyses within the families are necessary for appropriate clinical classification of this variant. Since it has been detected in two ovarian cancer patients of Slavic origin, it is worth investigating founder effect of this mutation in Slavic populations.

In vitro selection of zinc fingers with altered DNA-binding specificity.

PubMed

Jamieson, A C; Kim, S H; Wells, J A

1994-05-17

We have used random mutagenesis and phage display to alter the DNA-binding specificity of Zif268, a transcription factor that contains three zinc finger domains. Four residues in the helix of finger 1 of Zif268 that potentially mediate DNA binding were identified from an X-ray structure of the Zif268-DNA complex. A library was constructed in which these residues were randomly mutated and the Zif268 variants were fused to a truncated version of the gene III coat protein on the surface of M13 filamentous phage particles. The phage displayed the mutant proteins in a monovalent fashion and were sorted by repeated binding and elution from affinity matrices containing different DNA sequences. When the matrix contained the natural nine base pair operator sequence 5'-GCG-TGG-GCG-3', native-like zinc fingers were isolated. New finger 1 variants were found by sorting with two different operators in which the singly modified triplets, GTG and TCG, replaced the native finger 1 triplet, GCG. Overall, the selected finger 1 variants contained a preponderance of polar residues at the four sites. Interestingly, the net charge of the four residues in any selected finger never derived more that one unit from neutrality despite the fact that about half the variants contained three or four charged residues over the four sites. Measurements of the dissociation constants for two of these purified finger 1 variants by gel-shift assay showed their specificities to vary over a 10-fold range, with the greatest affinity being for the DNA binding site for which they were sorted.(ABSTRACT TRUNCATED AT 250 WORDS)

Information theory-based analysis of CYP2C19, CYP2D6 and CYP3A5 splicing mutations.

PubMed

Rogan, Peter K; Svojanovsky, Stan; Leeder, J Steven

2003-04-01

Several mutations are known or suspected to affect mRNA splicing of CYP2C19, CYP2D6 and CYP3A5 genes; however, little experimental evidence exists to support these conclusions. The present study applies mathematical models that measure changes in information content of splice sites in these genes to demonstrate the relationship between the predicted phenotypes of these variants to the corresponding genotypes. Based on information analysis, the CYP2C19*2 variant activates a new cryptic site 40 nucleotides downstream of the natural splice site. CYP2C19*7 abolishes splicing at the exon 5 donor site. The CYP2D6*4 allele similarly inactivates splicing at the acceptor site of exon 4 and activates a new cryptic site one nucleotide downstream of the natural acceptor. CYP2D6*11 inactivates the acceptor site of exon 2. The CYP3A5*3 allele activates a new cryptic site 236 nucleotides upstream of the exon 4 natural acceptor site. CYP3A5*5 inactivates the exon 5 donor site and CYP3A5*6 strengthens a site upstream of the natural donor site, resulting in skipping of exon 7. Other previously described missense and nonsense mutations at terminal codons of exons in these genes affected splicing. CYP2D6*8 and CYP2D6*14 both decrease the strength of the exon 3 donor site, producing transcripts lacking this exon. The results of information analysis are consistent with the poor metabolizer phenotypes observed in patients with these mutations, and illustrate the potential value of these mathematical models to quantitatively evaluate the functional consequences of new mutations suspected of altering mRNA splicing.

A KCNH2 branch point mutation causing aberrant splicing contributes to an explanation of genotype-negative long QT syndrome.

PubMed

Crotti, Lia; Lewandowska, Marzena A; Schwartz, Peter J; Insolia, Roberto; Pedrazzini, Matteo; Bussani, Erica; Dagradi, Federica; George, Alfred L; Pagani, Franco

2009-02-01

Genetic screening of long QT syndrome (LQTS) fails to identify disease-causing mutations in about 30% of patients. So far, molecular screening has focused mainly on coding sequence mutations or on substitutions at canonical splice sites. The purpose of this study was to explore the possibility that intronic variants not at canonical splice sites might affect splicing regulatory elements, lead to aberrant transcripts, and cause LQTS. Molecular screening was performed through DHPLC and sequence analysis. The role of the intronic mutation identified was assessed with a hybrid minigene splicing assay. A three-generation LQTS family was investigated. Molecular screening failed to identify an obvious disease-causing mutation in the coding sequences of the major LQTS genes but revealed an intronic A-to-G substitution in KCNH2 (IVS9-28A/G) cosegregating with the clinical phenotype in family members. In vitro analysis proved that the mutation disrupts the acceptor splice site definition by affecting the branch point (BP) sequence and promoting intron retention. We further demonstrated a tight functional relationship between the BP and the polypyrimidine tract, whose weakness is responsible for the pathological effect of the IVS9-28A/G mutation. We identified a novel BP mutation in KCNH2 that disrupts the intron 9 acceptor splice site definition and causes LQT2. The present finding demonstrates that intronic mutations affecting pre-mRNA processing may contribute to the failure of traditional molecular screening in identifying disease-causing mutations in LQTS subjects and offers a rationale strategy for the reduction of genotype-negative cases.

Uterine metastasis of lung adenocarcinoma under molecular target therapy with epidermal growth factor receptor tyrosine kinase inhibitors: A case report and review of the literature.

PubMed

Shibata, Mayu; Shizu, Masato; Watanabe, Kazuko; Takeda, Akihiro

2018-02-01

A 63-year-old woman presented with abnormal vaginal bleeding. Her disease history was significant, and included advanced lung adenocarcinoma with a deletion mutation in exon 19 of the epidermal growth factor receptor (EGFR) gene, which was managed by concurrent chemoradiotherapy, followed by molecular targeted therapy with tyrosine kinase inhibitors (TKIs) for a two-year period. Contrast-enhanced computed tomography showed the enlargement of a previously suspicious myoma node, with peripheral enhancement. Hemorrhagic necrosis was also observed on magnetic resonance imaging. Transabdominal hysterectomy and bilateral salpingo-oophorectomy showed solitary intramyometrial metastatic lung adenocarcinoma with a second-site T790M gatekeeper mutation in exon 20 of the EGFR gene. In conclusion, uterine metastasis from lung adenocarcinoma can present a diagnostic challenge. The possibility of lung cancer metastasis should be considered when a uterine mass increases in size during treatment. Molecular analysis of the EGFR gene to detect mutations could provide useful information for planning the treatment strategy. © 2017 Japan Society of Obstetrics and Gynecology.

A CGG-repeat expansion mutation in ZNF713 causes FRA7A: association with autistic spectrum disorder in two families.

PubMed

Metsu, Sofie; Rainger, Jacqueline K; Debacker, Kim; Bernhard, Birgitta; Rooms, Liesbeth; Grafodatskaya, Daria; Weksberg, Rosanna; Fombonne, Eric; Taylor, Martin S; Scherer, Stephen W; Kooy, R Frank; FitzPatrick, David R

2014-11-01

We report de novo occurrence of the 7p11.2 folate-sensitive fragile site FRA7A in a male with an autistic spectrum disorder (ASD) due to a CGG-repeat expansion mutation (∼450 repeats) in a 5' intron of ZNF713. This expanded allele showed hypermethylation of the adjacent CpG island with reduced ZNF713 expression observed in a proband-derived lymphoblastoid cell line (LCL). His unaffected mother carried an unmethylated premutation (85 repeats). This CGG-repeat showed length polymorphism in control samples (five to 22 repeats). In a second unrelated family, three siblings with ASD and their unaffected father were found to carry FRA7A premutations, which were partially or mosaically methylated. In one of the affected siblings, mitotic instability of the premutation was observed. ZNF713 expression in LCLs in this family was increased in three of these four premutation carriers. A firm link cannot yet be established between ASD and the repeat expansion mutation but plausible pathogenic mechanisms are discussed. © 2014 WILEY PERIODICALS, INC.

The energy landscape of adenylate kinase during catalysis

DOE PAGES

Kerns, S. Jordan; Agafonov, Roman V.; Cho, Young-Jin; ...

2015-01-12

Kinases perform phosphoryl-transfer reactions in milliseconds; without enzymes, these reactions would take about 8,000 years under physiological conditions. Despite extensive studies, a comprehensive understanding of kinase energy landscapes, including both chemical and conformational steps, is lacking. In this paper, we scrutinize the microscopic steps in the catalytic cycle of adenylate kinase, through a combination of NMR measurements during catalysis, pre-steady-state kinetics, molecular-dynamics simulations and crystallography of active complexes. We find that the Mg 2+ cofactor activates two distinct molecular events: phosphoryl transfer (>10 5-fold) and lid opening (10 3-fold). In contrast, mutation of an essential active site arginine decelerates phosphorylmore » transfer 10 3-fold without substantially affecting lid opening. Finally, our results highlight the importance of the entire energy landscape in catalysis and suggest that adenylate kinases have evolved to activate key processes simultaneously by precise placement of a single, charged and very abundant cofactor in a preorganized active site.« less

Comparison of space flight and heavy ion radiation induced genomic/epigenomic mutations in rice (Oryza sativa)

NASA Astrophysics Data System (ADS)

Shi, Jinming; Lu, Weihong; Sun, Yeqing

2014-04-01

Rice seeds, after space flight and low dose heavy ion radiation treatment were cultured on ground. Leaves of the mature plants were obtained for examination of genomic/epigenomic mutations by using amplified fragment length polymorphism (AFLP) and methylation sensitive amplification polymorphism (MSAP) method, respectively. The mutation sites were identified by fragment recovery and sequencing. The heritability of the mutations was detected in the next generation. Results showed that both space flight and low dose heavy ion radiation can induce significant alterations on rice genome and epigenome (P < 0.05). For both genetic and epigenetic assays, while there was no significant difference in mutation rates and their ability to be inherited to the next generation, the site of mutations differed between the space flight and radiation treated groups. More than 50% of the mutation sites were shared by two radiation treated groups, radiated with different LET value and dose, while only about 20% of the mutation sites were shared by space flight group and radiation treated group. Moreover, in space flight group, we found that DNA methylation changes were more prone to occur on CNG sequence than CG sequence. Sequencing results proved that both space flight and heavy ion radiation induced mutations were widely spread on rice genome including coding region and repeated region. Our study described and compared the characters of space flight and low dose heavy ion radiation induced genomic/epigenomic mutations. Our data revealed the mechanisms of application of space environment for mutagenesis and crop breeding. Furthermore, this work implicated that the nature of mutations induced under space flight conditions may involve factors beyond ion radiation.

High prevalence of the point mutation in exon 6 of the xeroderma pigmentosum group A-complementing (XPAC) gene in xeroderma pigmentosum group A patients in Tunisia

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nishigori, Chikako; Imamura, Sadao; Yagi, Takashi

1993-11-01

Xeroderma pigmentosum (XP) patients in Tunisia who belong to the genetic complementation group A (XPA) have milder skin symptoms than do Japanese XPA patients. Such difference in the clinical features might be caused by the difference in the site of mutation in the XP A-complementing (XPAC) gene. The purpose of this study is to identify the genetic alterations in the XPAC gene in the Tunisian XPA patients and to investigate the relationship between the clinical symptoms and the genetic alterations. Three sites of mutation in the XPAC gene have been identified in the Japanese XPA patients, and about 85% ofmore » them have a G [yields] C point mutation at the splicing acceptor site of intron 3. The authors found that six (86%) of seven Tunisian XPA patients had a nonsense mutation in codon 228 in exon 6, because of a CGA [yields] TGA point mutation, which can be detected by the HphI RFLP. This type of mutation is the same as those found in two Japanese XPA patients with mild clinical RFLP. Milder skin symptoms in the XPA patients in Tunisia than in those in Japan, despite mostly sunny weather and the unsatisfactory sun protection in Tunisia, should be due to the difference in the mutation site. 11 refs., 2 figs., 2 tabs.« less

Roles of charged residues in pH-dependent redox properties of cytochrome c3 from Desulfovibrio vulgaris Miyazaki F

PubMed Central

Yahata, Naoki; Ozawa, Kiyoshi; Tomimoto, Yusuke; Morita, Kumiko; Komori, Hirofumi; Ogata, Hideaki; Higuchi, Yoshiki; Akutsu, Hideo

2006-01-01

Complicated pH-properties of the tetraheme cytochrome c3 (cyt c3) from Desulfovibrio vulgaris Miyazaki F (DvMF) were examined by the pH titrations of 1H-15N HSQC spectra in the ferric and ferrous states. The redox-linked pKa shift for the propionate group at C13 of heme 1 was observed as the changes of the NH signals around it. This pKa shift is consistent with the redox-linked conformational alteration responsible for the cooperative reduction between hemes 1 and 2. On the other hand, large chemical shift changes caused by the protonation/deprotonation of Glu41 and/or Asp42, and His67 were redox-independent. Nevertheless, these charged residues affect the redox properties of the four hemes. Furthermore, one of interesting charged residues, Glu41, was studied by site-directed mutagenesis. E41K mutation increased the microscopic redox potentials of heme 1 by 46 and 34 mV, and heme 2 by 35 and 30 mV at the first and last reduction steps, respectively. Although global folding in the crystal structure of E41K cyt c3 is similar to that of wild type, local change was observed in 1H NMR spectrum. Glu41 is important to keep the stable conformation in the region between hemes 1 and 2, controlling the redox properties of DvMF cyt c3. In contrast, the kinetic parameters for electron transfer from DvMF [NiFe] hydrogenase were not influenced by E41K mutation. This suggests that the region between hemes 1 and 2 is not involved in the interaction with [NiFe] hydrogenase, and it supports the idea that heme 4 is the exclusive entrance gate to accept the electron in the initial reduction stage. PMID:27857559

Roles of charged residues in pH-dependent redox properties of cytochrome c3 from Desulfovibrio vulgaris Miyazaki F.

PubMed

Yahata, Naoki; Ozawa, Kiyoshi; Tomimoto, Yusuke; Morita, Kumiko; Komori, Hirofumi; Ogata, Hideaki; Higuchi, Yoshiki; Akutsu, Hideo

2006-01-01

Complicated pH-properties of the tetraheme cytochrome c 3 (cyt c 3 ) from Desulfovibrio vulgaris Miyazaki F ( Dv MF) were examined by the pH titrations of 1 H- 15 N HSQC spectra in the ferric and ferrous states. The redox-linked p K a shift for the propionate group at C13 of heme 1 was observed as the changes of the NH signals around it. This p K a shift is consistent with the redox-linked conformational alteration responsible for the cooperative reduction between hemes 1 and 2. On the other hand, large chemical shift changes caused by the protonation/deprotonation of Glu41 and/or Asp42, and His67 were redox-independent. Nevertheless, these charged residues affect the redox properties of the four hemes. Furthermore, one of interesting charged residues, Glu41, was studied by site-directed mutagenesis. E41K mutation increased the microscopic redox potentials of heme 1 by 46 and 34 mV, and heme 2 by 35 and 30 mV at the first and last reduction steps, respectively. Although global folding in the crystal structure of E41K cyt c 3 is similar to that of wild type, local change was observed in 1 H NMR spectrum. Glu41 is important to keep the stable conformation in the region between hemes 1 and 2, controlling the redox properties of Dv MF cyt c 3 . In contrast, the kinetic parameters for electron transfer from Dv MF [NiFe] hydrogenase were not influenced by E41K mutation. This suggests that the region between hemes 1 and 2 is not involved in the interaction with [NiFe] hydrogenase, and it supports the idea that heme 4 is the exclusive entrance gate to accept the electron in the initial reduction stage.

An alkaline active xylanase: insights into mechanisms of high pH catalytic adaptation.

PubMed

Mamo, Gashaw; Thunnissen, Marjolein; Hatti-Kaul, Rajni; Mattiasson, Bo

2009-09-01

The alkaliphilic bacterium, Bacillus halodurans S7, produces an alkaline active xylanase (EC 3.2.1.8), which differs from many other xylanases in being operationally stable under alkaline conditions as well as at elevated temperature. Compared to non-alkaline active xylanases, this enzyme has a high percent composition of acidic amino acids which results in high ratio of negatively to positively charged residues. A positive correlation was observed between the charge ratio and the pH optima of xylanases. The recombinant xylanase was crystallized using a hanging drop diffusion method. The crystals belong to the space group P2(1)2(1)2(1) and the structure was determined at a resolution of 2.1 A. The enzyme has the common eight-fold TIM-barrel structure of family 10 xylanases; however, unlike non-alkaline active xylanases, it has a highly negatively charged surface and a deeper active site cleft. Mutational analysis of non-conserved amino acids which are close to the acid/base residue has shown that Val169, Ile170 and Asp171 are important to hydrolyze xylan at high pH. Unlike the wild type xylanase which has optimum pH at 9-9.5, the triple mutant xylanase (V169A, I170F and D171N), which was constructed using sequence information of alkaline sensitive xylanses was optimally active around pH 7. Compared to non-alkaline active xylanases, the alkaline active xylanases have highly acidic surfaces and fewer solvent exposed alkali labile residues. Based on these results obtained from sequence, structural and mutational analysis, the possible mechanisms of high pH stability and catalysis are discussed. This will provide useful information to understand the mechanism of high pH adaptation and engineering of enzymes that can be operationally stable at high pH.

Construction of New Campylobacter Cloning Vectors and a New Mutational Cat Cassette

DTIC Science & Technology

1993-01-01

mutational cat cassette PE - 61102A PR - 3M161102 6. AUTHOR(S) TA - BS13AK Yao R, Aim RA, Trust TJ, Guerry P WU- 1291 7. PERFORMING ORGANIZATION NAME(S) AND...mutational cat cassette %~ccesion For (Site-specific mutagenesis; recombinant DNA; multiple cloning site; PCR; shuttle vectors) NTIS CRA&I OTIC TAB E...campylobacter portion of these vectors, only three CAT , Cm acetyllraaseriase; car, gene encoding CAT , Cm, restriction sites in the IacZ MCS remain unique

The Conformational Changes Induced by Ubiquinone Binding in the Na+-pumping NADH:Ubiquinone Oxidoreductase (Na+-NQR) Are Kinetically Controlled by Conserved Glycines 140 and 141 of the NqrB Subunit*

PubMed Central

Strickland, Madeleine; Juárez, Oscar; Neehaul, Yashvin; Cook, Darcie A.; Barquera, Blanca; Hellwig, Petra

2014-01-01

Na+-pumping NADH:ubiquinone oxidoreductase (Na+-NQR) is responsible for maintaining a sodium gradient across the inner bacterial membrane. This respiratory enzyme, which couples sodium pumping to the electron transfer between NADH and ubiquinone, is not present in eukaryotes and as such could be a target for antibiotics. In this paper it is shown that the site of ubiquinone reduction is conformationally coupled to the NqrB subunit, which also hosts the final cofactor in the electron transport chain, riboflavin. Previous work showed that mutations in conserved NqrB glycine residues 140 and 141 affect ubiquinone reduction and the proper functioning of the sodium pump. Surprisingly, these mutants did not affect the dissociation constant of ubiquinone or its analog HQNO (2-n-heptyl-4-hydroxyquinoline N-oxide) from Na+-NQR, which indicates that these residues do not participate directly in the ubiquinone binding site but probably control its accessibility. Indeed, redox-induced difference spectroscopy showed that these mutations prevented the conformational change involved in ubiquinone binding but did not modify the signals corresponding to bound ubiquinone. Moreover, data are presented that demonstrate the NqrA subunit is able to bind ubiquinone but with a low non-catalytically relevant affinity. It is also suggested that Na+-NQR contains a single catalytic ubiquinone binding site and a second site that can bind ubiquinone but is not active. PMID:25006248

Physiological and Pathophysiological Insights of Nav1.4 and Nav1.5 Comparison

PubMed Central

Loussouarn, Gildas; Sternberg, Damien; Nicole, Sophie; Marionneau, Céline; Le Bouffant, Francoise; Toumaniantz, Gilles; Barc, Julien; Malak, Olfat A.; Fressart, Véronique; Péréon, Yann; Baró, Isabelle; Charpentier, Flavien

2016-01-01

Mutations in Nav1.4 and Nav1.5 α-subunits have been associated with muscular and cardiac channelopathies, respectively. Despite intense research on the structure and function of these channels, a lot of information is still missing to delineate the various physiological and pathophysiological processes underlying their activity at the molecular level. Nav1.4 and Nav1.5 sequences are similar, suggesting structural and functional homologies between the two orthologous channels. This also suggests that any characteristics described for one channel subunit may shed light on the properties of the counterpart channel subunit. In this review article, after a brief clinical description of the muscular and cardiac channelopathies related to Nav1.4 and Nav1.5 mutations, respectively, we compare the knowledge accumulated in different aspects of the expression and function of Nav1.4 and Nav1.5 α-subunits: the regulation of the two encoding genes (SCN4A and SCN5A), the associated/regulatory proteins and at last, the functional effect of the same missense mutations detected in Nav1.4 and Nav1.5. First, it appears that more is known on Nav1.5 expression and accessory proteins. Because of the high homologies of Nav1.5 binding sites and equivalent Nav1.4 sites, Nav1.5-related results may guide future investigations on Nav1.4. Second, the analysis of the same missense mutations in Nav1.4 and Nav1.5 revealed intriguing similarities regarding their effects on membrane excitability and alteration in channel biophysics. We believe that such comparison may bring new cues to the physiopathology of cardiac and muscular diseases. PMID:26834636

Analyzing machupo virus-receptor binding by molecular dynamics simulations.

PubMed

Meyer, Austin G; Sawyer, Sara L; Ellington, Andrew D; Wilke, Claus O

2014-01-01

In many biological applications, we would like to be able to computationally predict mutational effects on affinity in protein-protein interactions. However, many commonly used methods to predict these effects perform poorly in important test cases. In particular, the effects of multiple mutations, non alanine substitutions, and flexible loops are difficult to predict with available tools and protocols. We present here an existing method applied in a novel way to a new test case; we interrogate affinity differences resulting from mutations in a host-virus protein-protein interface. We use steered molecular dynamics (SMD) to computationally pull the machupo virus (MACV) spike glycoprotein (GP1) away from the human transferrin receptor (hTfR1). We then approximate affinity using the maximum applied force of separation and the area under the force-versus-distance curve. We find, even without the rigor and planning required for free energy calculations, that these quantities can provide novel biophysical insight into the GP1/hTfR1 interaction. First, with no prior knowledge of the system we can differentiate among wild type and mutant complexes. Moreover, we show that this simple SMD scheme correlates well with relative free energy differences computed via free energy perturbation. Second, although the static co-crystal structure shows two large hydrogen-bonding networks in the GP1/hTfR1 interface, our simulations indicate that one of them may not be important for tight binding. Third, one viral site known to be critical for infection may mark an important evolutionary suppressor site for infection-resistant hTfR1 mutants. Finally, our approach provides a framework to compare the effects of multiple mutations, individually and jointly, on protein-protein interactions.

Analyzing machupo virus-receptor binding by molecular dynamics simulations

PubMed Central

Sawyer, Sara L.; Ellington, Andrew D.; Wilke, Claus O.

2014-01-01

In many biological applications, we would like to be able to computationally predict mutational effects on affinity in protein–protein interactions. However, many commonly used methods to predict these effects perform poorly in important test cases. In particular, the effects of multiple mutations, non alanine substitutions, and flexible loops are difficult to predict with available tools and protocols. We present here an existing method applied in a novel way to a new test case; we interrogate affinity differences resulting from mutations in a host–virus protein–protein interface. We use steered molecular dynamics (SMD) to computationally pull the machupo virus (MACV) spike glycoprotein (GP1) away from the human transferrin receptor (hTfR1). We then approximate affinity using the maximum applied force of separation and the area under the force-versus-distance curve. We find, even without the rigor and planning required for free energy calculations, that these quantities can provide novel biophysical insight into the GP1/hTfR1 interaction. First, with no prior knowledge of the system we can differentiate among wild type and mutant complexes. Moreover, we show that this simple SMD scheme correlates well with relative free energy differences computed via free energy perturbation. Second, although the static co-crystal structure shows two large hydrogen-bonding networks in the GP1/hTfR1 interface, our simulations indicate that one of them may not be important for tight binding. Third, one viral site known to be critical for infection may mark an important evolutionary suppressor site for infection-resistant hTfR1 mutants. Finally, our approach provides a framework to compare the effects of multiple mutations, individually and jointly, on protein–protein interactions. PMID:24624315

Exploring the Structure of the Voltage-gated Na+ Channel by an Engineered Drug Access Pathway to the Receptor Site for Local Anesthetics*

PubMed Central

Lukacs, Peter; Gawali, Vaibhavkumar S.; Cervenka, Rene; Ke, Song; Koenig, Xaver; Rubi, Lena; Zarrabi, Touran; Hilber, Karlheinz; Stary-Weinzinger, Anna; Todt, Hannes

2014-01-01

Despite the availability of several crystal structures of bacterial voltage-gated Na+ channels, the structure of eukaryotic Na+ channels is still undefined. We used predictions from available homology models and crystal structures to modulate an external access pathway for the membrane-impermeant local anesthetic derivative QX-222 into the internal vestibule of the mammalian rNaV1.4 channel. Potassium channel-based homology models predict amino acid Ile-1575 in domain IV segment 6 to be in close proximity to Lys-1237 of the domain III pore-loop selectivity filter. The mutation K1237E has been shown previously to increase the diameter of the selectivity filter. We found that an access pathway for external QX-222 created by mutations of Ile-1575 was abolished by the additional mutation K1237E, supporting the notion of a close spatial relationship between sites 1237 and 1575. Crystal structures of bacterial voltage-gated Na+ channels predict that the side chain of rNaV1.4 Trp-1531 of the domain IV pore-loop projects into the space between domain IV segment 6 and domain III pore-loop and, therefore, should obstruct the putative external access pathway. Indeed, mutations W1531A and W1531G allowed for exceptionally rapid access of QX-222. In addition, W1531G created a second non-selective ion-conducting pore, bypassing the outer vestibule but probably merging into the internal vestibule, allowing for control by the activation gate. These data suggest a strong structural similarity between bacterial and eukaryotic voltage-gated Na+ channels. PMID:24947510

Electric and hybrid vehicle program; Site Operator Program

NASA Astrophysics Data System (ADS)

Warren, J. F.

1992-05-01

Activities during the second quarter included the second meeting of the Site Operators in Phoenix, AZ in late April. The meeting was held in conjunction with the Solar and Electric 500 Race activities. Delivery of vehicles ordered previously has begun, although two of the operators are experiencing some delays in receiving their vehicles. Public demonstration activities continue, with an apparent increasing level of awareness and interest being displayed by the public. Initial problems with the Site Operator Database have been corrected and revised copies of the program have been supplied to the program participants. Operating and Maintenance data is being supplied and submitted to INEL on a monthly basis. Interest in the Site Operator Program is being reflected in requests for information from several organizations from across the country, representing a wide diversity of interests. These organizations have been referred to existing Site Operators with the explanation that the program will not be adding new participants, but that most of the existing organizations are willing to work with other groups. The exception to this was the addition of Potomac Electric Power Company (PEPCO) to the program. PEPCO has been awarded a subcontract to operate and maintain the DOE owned G-Van and Escort located in Washington, DC. They will provide data on these vehicles, as well as a Solectria Force which PEPCO has purchased. The Task Force intends to be actively involved in the infrastructure development in a wide range of areas. These include, among others, personnel development, safety, charging, and servicing. Work continues in these areas. York Technical College (YORK) has completed the draft outline for the EV Technician course. This is being circulated to organizations around the country for comments. Kansas State University (KSU) is working with a private sector company to develop a energy dispensing meter for opportunity charging in public areas.

Structural charge site influence on the interlayer hydration of expandable three-sheet clay minerals

USGS Publications Warehouse

Kerns, Raymond L.; Mankin, Charles J.

1968-01-01

Previous investigations have demonstrated the influences of interlayer cation composition, relative humidity, temperature, and magnitude of interlayer surface charge on the interlayer hydration of montmorillonites and vermiculites. It has been suggested that the sites of layer charge deficiencies may also have an influence upon the amount of hydration that can take place in the interlayers of expandable clay minerals. If the interlayer cation-to-layer bonds are considered as ideally electrostatic, the magnitude of the forces resisting expansion may be expressed as a form of Coulomb's law. If this effect is significant, expandable structures in which the charge-deficiency sites are predominantly in the tetrahedral sheet should have less pronounced swelling properties than should structures possessing charge deficiencies located primarily in the octahedral sheet.Three samples that differed in location of layer charge sites were selected for study. An important selection criterion was a non-correlation between tetrahedral charge sites and high surface-charge density, and between octahedral charge sites and low surface-charge density.The effects of differences in interlayer cation composition were eliminated by saturating portions of each sample with the same cations. Equilibrium (001) d values at controlled constant humidities were used as a measure of the relative degree of interlayer hydration.Although no correlation could be made between the degree of interlayer hydration and total surface-charge density, the investigation does not eliminate total surface-charge density as being significant to the swelling properties of three-sheet clay-mineral structures. The results do indicate a correlation between more intense expandability and predominance of charge deficiencies in the octahedral sheet. Conversely, less intense swelling behavior is associated with predominantly tetrahedral charge deficiencies.

[A study on mutations of the overlapping hepatitis B virus surface and polymerase gene in patients with HBV reinfection after liver transplantations].

PubMed

Song, Hong-li; Shen, Zhong-yang; Wang, Jian; Zheng, Wei-ping; Wang, Zheng-lu

2008-04-01

To investigate the influence of combined hepatitis B immune globulin (HBIG) and lamivudine (LMV) treatment on hepatitis B virus (HBV) surface antigen and polymerase overlapping gene mutations in HBV reinfected liver transplant recipients. From June 2002 to December 2003, 320 patients who underwent liver transplantations due to HBV-related end-stage liver diseases were followed-up for 1.5 to 3 years postoperatively. Fourteen patients developed HBV reinfection. They had LMV before their liver transplantations and had LMV and HBIG after the transplantations to prevent HBV infections. Their serum levels of HBV DNA were measured by polymerase chain reaction. Gene sequencing method was used to analyze HBV genotype and mutations of the S gene. Micro-particle enzyme immunoassay was used to measure the serum concentration of HBIG. (1) There was no obvious difference in the number of amino acid mutation sites in S and P regions before and after the transplantations. (2) The HBV genotypes were B-type (n=2) and C-type (n=12) in the reinfected group before the transplantations, and genotypes after the transplantations remained the same. (3) HBIG concentrations were 0 U/L in 7 patients, less than 100 U/L in 5 patients, and more than 100 U/L in 2 patients. Mutations were detected as I126S, T131N, S143T and G145R in 'a' determinant and L110F, I113S, T160K in up- or down-stream of 'a' determinant. (4) Mutations in S gene caused missense mutation in the surface antigen region. These mutations also caused corresponding missense mutations in the polymerase region. The missense mutation in the polymerase region involved lamivudine mutation sites and other mutation sites. Immunosuppressant therapy has no obvious influence on the numbers of mutations, but it can influence the sites of the mutations. Besides 'a' determinant mutations, there exist mutations in up- or down-streams of 'a' determinant and they may cause HBV reinfection.

Human Splicing Finder: an online bioinformatics tool to predict splicing signals.

PubMed

Desmet, François-Olivier; Hamroun, Dalil; Lalande, Marine; Collod-Béroud, Gwenaëlle; Claustres, Mireille; Béroud, Christophe

2009-05-01

Thousands of mutations are identified yearly. Although many directly affect protein expression, an increasing proportion of mutations is now believed to influence mRNA splicing. They mostly affect existing splice sites, but synonymous, non-synonymous or nonsense mutations can also create or disrupt splice sites or auxiliary cis-splicing sequences. To facilitate the analysis of the different mutations, we designed Human Splicing Finder (HSF), a tool to predict the effects of mutations on splicing signals or to identify splicing motifs in any human sequence. It contains all available matrices for auxiliary sequence prediction as well as new ones for binding sites of the 9G8 and Tra2-beta Serine-Arginine proteins and the hnRNP A1 ribonucleoprotein. We also developed new Position Weight Matrices to assess the strength of 5' and 3' splice sites and branch points. We evaluated HSF efficiency using a set of 83 intronic and 35 exonic mutations known to result in splicing defects. We showed that the mutation effect was correctly predicted in almost all cases. HSF could thus represent a valuable resource for research, diagnostic and therapeutic (e.g. therapeutic exon skipping) purposes as well as for global studies, such as the GEN2PHEN European Project or the Human Variome Project.

Human Splicing Finder: an online bioinformatics tool to predict splicing signals

PubMed Central

Desmet, François-Olivier; Hamroun, Dalil; Lalande, Marine; Collod-Béroud, Gwenaëlle; Claustres, Mireille; Béroud, Christophe

2009-01-01

Thousands of mutations are identified yearly. Although many directly affect protein expression, an increasing proportion of mutations is now believed to influence mRNA splicing. They mostly affect existing splice sites, but synonymous, non-synonymous or nonsense mutations can also create or disrupt splice sites or auxiliary cis-splicing sequences. To facilitate the analysis of the different mutations, we designed Human Splicing Finder (HSF), a tool to predict the effects of mutations on splicing signals or to identify splicing motifs in any human sequence. It contains all available matrices for auxiliary sequence prediction as well as new ones for binding sites of the 9G8 and Tra2-β Serine-Arginine proteins and the hnRNP A1 ribonucleoprotein. We also developed new Position Weight Matrices to assess the strength of 5′ and 3′ splice sites and branch points. We evaluated HSF efficiency using a set of 83 intronic and 35 exonic mutations known to result in splicing defects. We showed that the mutation effect was correctly predicted in almost all cases. HSF could thus represent a valuable resource for research, diagnostic and therapeutic (e.g. therapeutic exon skipping) purposes as well as for global studies, such as the GEN2PHEN European Project or the Human Variome Project. PMID:19339519

A Schiff base connectivity switch in sensory rhodopsin signaling

PubMed Central

Sineshchekov, Oleg A.; Sasaki, Jun; Phillips, Brian J.; Spudich, John L.

2008-01-01

Sensory rhodopsin I (SRI) in Halobacterium salinarum acts as a receptor for single-quantum attractant and two-quantum repellent phototaxis, transmitting light stimuli via its bound transducer HtrI. Signal-inverting mutations in the SRI–HtrI complex reverse the single-quantum response from attractant to repellent. Fast intramolecular charge movements reported here reveal that the unphotolyzed SRI–HtrI complex exists in two conformational states, which differ by their connection of the retinylidene Schiff base in the SRI photoactive site to inner or outer half-channels. In single-quantum photochemical reactions, the conformer with the Schiff base connected to the cytoplasmic (CP) half-channel generates an attractant signal, whereas the conformer with the Schiff base connected to the extracellular (EC) half-channel generates a repellent signal. In the wild-type complex the conformer equilibrium is poised strongly in favor of that with CP-accessible Schiff base. Signal-inverting mutations shift the equilibrium in favor of the EC-accessible Schiff base form, and suppressor mutations shift the equilibrium back toward the CP-accessible Schiff base form, restoring the wild-type phenotype. Our data show that the sign of the behavioral response directly correlates with the state of the connectivity switch, not with the direction of proton movements or changes in acceptor pKa. These findings identify a shared fundamental process in the mechanisms of transport and signaling by the rhodopsin family. Furthermore, the effects of mutations in the HtrI subunit of the complex on SRI Schiff base connectivity indicate that the two proteins are tightly coupled to form a single unit that undergoes a concerted conformational transition. PMID:18852467

A Schiff base connectivity switch in sensory rhodopsin signaling.

PubMed

Sineshchekov, Oleg A; Sasaki, Jun; Phillips, Brian J; Spudich, John L

2008-10-21

Sensory rhodopsin I (SRI) in Halobacterium salinarum acts as a receptor for single-quantum attractant and two-quantum repellent phototaxis, transmitting light stimuli via its bound transducer HtrI. Signal-inverting mutations in the SRI-HtrI complex reverse the single-quantum response from attractant to repellent. Fast intramolecular charge movements reported here reveal that the unphotolyzed SRI-HtrI complex exists in two conformational states, which differ by their connection of the retinylidene Schiff base in the SRI photoactive site to inner or outer half-channels. In single-quantum photochemical reactions, the conformer with the Schiff base connected to the cytoplasmic (CP) half-channel generates an attractant signal, whereas the conformer with the Schiff base connected to the extracellular (EC) half-channel generates a repellent signal. In the wild-type complex the conformer equilibrium is poised strongly in favor of that with CP-accessible Schiff base. Signal-inverting mutations shift the equilibrium in favor of the EC-accessible Schiff base form, and suppressor mutations shift the equilibrium back toward the CP-accessible Schiff base form, restoring the wild-type phenotype. Our data show that the sign of the behavioral response directly correlates with the state of the connectivity switch, not with the direction of proton movements or changes in acceptor pK(a). These findings identify a shared fundamental process in the mechanisms of transport and signaling by the rhodopsin family. Furthermore, the effects of mutations in the HtrI subunit of the complex on SRI Schiff base connectivity indicate that the two proteins are tightly coupled to form a single unit that undergoes a concerted conformational transition.

Associating mutations causing cystinuria with disease severity with the aim of providing precision medicine.

PubMed

Martell, Henry J; Wong, Kathie A; Martin, Juan F; Kassam, Ziyan; Thomas, Kay; Wass, Mark N

2017-08-11

Cystinuria is an inherited disease that results in the formation of cystine stones in the kidney, which can have serious health complications. Two genes (SLC7A9 and SLC3A1) that form an amino acid transporter are known to be responsible for the disease. Variants that cause the disease disrupt amino acid transport across the cell membrane, leading to the build-up of relatively insoluble cystine, resulting in formation of stones. Assessing the effects of each mutation is critical in order to provide tailored treatment options for patients. We used various computational methods to assess the effects of cystinuria associated mutations, utilising information on protein function, evolutionary conservation and natural population variation of the two genes. We also analysed the ability of some methods to predict the phenotypes of individuals with cystinuria, based on their genotypes, and compared this to clinical data. Using a literature search, we collated a set of 94 SLC3A1 and 58 SLC7A9 point mutations known to be associated with cystinuria. There are differences in sequence location, evolutionary conservation, allele frequency, and predicted effect on protein function between these mutations and other genetic variants of the same genes that occur in a large population. Structural analysis considered how these mutations might lead to cystinuria. For SLC7A9, many mutations swap hydrophobic amino acids for charged amino acids or vice versa, while others affect known functional sites. For SLC3A1, functional information is currently insufficient to make confident predictions but mutations often result in the loss of hydrogen bonds and largely appear to affect protein stability. Finally, we showed that computational predictions of mutation severity were significantly correlated with the disease phenotypes of patients from a clinical study, despite different methods disagreeing for some of their predictions. The results of this study are promising and highlight the areas of research which must now be pursued to better understand how mutations in SLC3A1 and SLC7A9 cause cystinuria. The application of our approach to a larger data set is essential, but we have shown that computational methods could play an important role in designing more effective personalised treatment options for patients with cystinuria.

Prospective cohort study of clinical characteristics and management patterns for patients with non-small-cell lung cancer in the Russian Federation: EPICLIN-Lung.

PubMed

Tjulandin, S; Imyanitov, E; Moiseyenko, V; Ponomarenko, D; Gurina, L; Koroleva, I; Karaseva, V

2015-06-01

Lung cancer is a major cause of mortality in Russia. This study aimed to document the characteristics, clinical management, EGFR mutation status and outcomes of patients with non-small-cell lung cancer (NSCLC) throughout the Russian Federation to inform future management decisions. This non-interventional, prospective cohort study (clinicaltrials.gov NCT01069835) was conducted at 33 sites across the Russian Federation. Patients with confirmed NSCLC were enrolled and followed for up to 12 months or until death. Investigators collected information on patient and disease characteristics, diagnosis and treatment patterns, clinical outcomes and adverse events (AEs). A logistic regression model was used to evaluate characteristics affecting tumor EGFR mutation status. Data were analyzed from 838 patients. Most (78.4%) were male and Caucasian (98%), mean age was 58.7 years and 26.5% were never-smokers. Squamous-cell carcinoma (54.3%) was the most prevalent histology, followed by adenocarcinoma (31%). Most patients presented with advanced disease (23.7% with stage IIIA, 14.1% with stage IIIB, 25.4% with stage IV) and 10.1% of patients had EGFR-mutation-positive tumors. EGFR mutation was significantly associated with female gender, never smoking, age and adenocarcinoma histology. First- or second-line chemotherapy had been performed in 370 and 96 patients, respectively, and median progression-free survival was 35 and 19.4 weeks, respectively. For 813 patients, 194 AEs were reported at visit 1. A median of two AEs was reported for patients who had at least one AE. Study limitations include potential site selection bias, short observation period, small sample size and inclusion of fewer than average stage III-IV patients. This study contributes to a better understanding of prognostic and predictive factors of NSCLC in the Russian Federation, which will enable optimal treatment selection in future clinical practice. Epidemiology of EGFR mutations in this NSCLC cohort was similar to other studies of NSCLC in Caucasian populations.

Bi-allelic Mutations in PKD1L1 Are Associated with Laterality Defects in Humans.

PubMed

Vetrini, Francesco; D'Alessandro, Lisa C A; Akdemir, Zeynep C; Braxton, Alicia; Azamian, Mahshid S; Eldomery, Mohammad K; Miller, Kathryn; Kois, Chelsea; Sack, Virginia; Shur, Natasha; Rijhsinghani, Asha; Chandarana, Jignesh; Ding, Yan; Holtzman, Judy; Jhangiani, Shalini N; Muzny, Donna M; Gibbs, Richard A; Eng, Christine M; Hanchard, Neil A; Harel, Tamar; Rosenfeld, Jill A; Belmont, John W; Lupski, James R; Yang, Yaping

2016-10-06

Disruption of the establishment of left-right (L-R) asymmetry leads to situs anomalies ranging from situs inversus totalis (SIT) to situs ambiguus (heterotaxy). The genetic causes of laterality defects in humans are highly heterogeneous. Via whole-exome sequencing (WES), we identified homozygous mutations in PKD1L1 from three affected individuals in two unrelated families. PKD1L1 encodes a polycystin-1-like protein and its loss of function is known to cause laterality defects in mouse and medaka fish models. Family 1 had one fetus and one deceased child with heterotaxy and complex congenital heart malformations. WES identified a homozygous splicing mutation, c.6473+2_6473+3delTG, which disrupts the invariant splice donor site in intron 42, in both affected individuals. In the second family, a homozygous c.5072G>C (p.Cys1691Ser) missense mutation was detected in an individual with SIT and congenital heart disease. The p.Cys1691Ser substitution affects a highly conserved cysteine residue and is predicted by molecular modeling to disrupt a disulfide bridge essential for the proper folding of the G protein-coupled receptor proteolytic site (GPS) motif. Damaging effects associated with substitutions of this conserved cysteine residue in the GPS motif have also been reported in other genes, namely GPR56, BAI3, and PKD1 in human and lat-1 in C. elegans, further supporting the likely pathogenicity of p.Cys1691Ser in PKD1L1. The identification of bi-allelic PKD1L1 mutations recapitulates previous findings regarding phenotypic consequences of loss of function of the orthologous genes in mice and medaka fish and further expands our understanding of genetic contributions to laterality defects in humans. Copyright © 2016 American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

Role of Loop-Clamping Side Chains in Catalysis by Triosephosphate Isomerase.

PubMed

Zhai, Xiang; Amyes, Tina L; Richard, John P

2015-12-09

The side chains of Y208 and S211 from loop 7 of triosephosphate isomerase (TIM) form hydrogen bonds to backbone amides and carbonyls from loop 6 to stabilize the caged enzyme-substrate complex. The effect of seven mutations [Y208T, Y208S, Y208A, Y208F, S211G, S211A, Y208T/S211G] on the kinetic parameters for TIM catalyzed reactions of the whole substrates dihydroxyacetone phosphate and d-glyceraldehyde 3-phosphate [(k(cat)/K(m))(GAP) and (k(cat)/K(m))DHAP] and of the substrate pieces glycolaldehyde and phosphite dianion (k(cat)/K(HPi)K(GA)) are reported. The linear logarithmic correlation between these kinetic parameters, with slope of 1.04 ± 0.03, shows that most mutations of TIM result in an identical change in the activation barriers for the catalyzed reactions of whole substrate and substrate pieces, so that the transition states for these reactions are stabilized by similar interactions with the protein catalyst. The second linear logarithmic correlation [slope = 0.53 ± 0.16] between k(cat) for isomerization of GAP and K(d)(⧧) for phosphite dianion binding to the transition state for wildtype and many mutant TIM-catalyzed reactions of substrate pieces shows that ca. 50% of the wildtype TIM dianion binding energy, eliminated by these mutations, is expressed at the wildtype Michaelis complex, and ca. 50% is only expressed at the wildtype transition state. Negative deviations from this correlation are observed when the mutation results in a decrease in enzyme reactivity at the catalytic site. The main effect of Y208T, Y208S, and Y208A mutations is to cause a reduction in the total intrinsic dianion binding energy, but the effect of Y208F extends to the catalytic site.

[Construction of thr461 --> Asn461 and Ile462 --> Val462 mutation vector of P4501A1 gene].

PubMed

Wei, Qing; Liu, Yi-Min; Wang, Hui; Zhao, Xiao-Lin; Ren, Tie-ling; Xiao, Yong-mei

2006-09-01

To construct Thr461 --> Asn461 and Ile462 --> Val462 mutation vector of P4501A1 gene and to provide scientific base for deeply researching on the function of cytochrome 1A1 gene (CYP1A1) and the mechanism of carcinogenesis. According to cDNA sequence of human CYP1A1 gene, universal primers (Pm3/Pm4) and mutant primers (Pt15/Pt16 and Pt17/Pt18) containing restriction enzyme site and mutation site were designed. The first set of primers involving Pm3/Pt16 and Pm3/Pt18 amplified a forward 1.5kb fragment from pGEM-T-CYP1A1 plasmid. The second set of primers involving Pt15/Pm4 and Pt17/Pm4 amplified a reverse 177-bp fragment from 10ng pGEM-T-CYP1A1 plasmid. The third set of primers involving Pm3/Pm4 amplified a 1.5kb fragment from the fomer PCR amplifications. The third PCR products were separated, purified and recovered from 1% agarose gel, then inserted into pMD-T vector. Subsequently the conjunct products were transformed into E. coil strain DH-5alpha., then the single clone was screened out and plasmids were extracted from such clone finally verified by restriction endonuclease analysis and sequencing. A 1.5kb fragment of tricycle PCR amplifications were digested by restriction endonucleases (BamHI and SailI) and sequenced bidirectionally by universal primers(T7p and SP6). The results verified that the cloned fragment including Asn461 and Val462 mutant site had 99.9% homology with the human cDNA of CYP1A1 gene in Genebank. The objective fragment containing Asn461 and Va462 mutant site with cDNA of the CYP1A1 gene has been successfully constructed in this experiment.

Mutational analysis of a patient with mucopolysaccharidosis type VII, and identification of pseudogenes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shipley, J.M.; Klinkenberg, M.; Wu, B.M.

1993-03-01

PCR of cDNA produced from patient fibroblasts allowed the authors to determine the paternal mutation in the first patient reported with [beta]-glucuronidase-deficiency mucopolysaccharidosis type VII (MPS VII). The G[r arrow]T transversion 1,881 bp downstream of the ATG translation initiation codon destroys an MboII restriction site and converts Trp627 to Cys (W627C). Digestion of genomic DNA PCR fragments with MboII indicated that the patient and the father were heterozygous for this missense mutation in exon 12. Failure to find cDNAs from patient RNA which did not contain this mutation suggested that the maternal mutation leads to greatly reduced synthesis or reducedmore » stability of mRNA from the mutant allele. In order to identify the maternal mutation, it was necessary to analyze genomic sequences. This approach was complicated by the finding of multiple unprocessed pseudogenes and/or closely related genes. Using PCR with a panel of human/rodent hybrid cell lines, the authors found that these pseudogenes were present over chromosomes 5-7, 20, and 22 and the Y chromosome. Conditions were defined which allowed them to amplify and characterize genomic sequences for the true [beta]-glucuronidase gene despite this background of related sequences. The patient proved to be heterozygous for a second mutation, in which a C[r arrow]T transition introduces a termination codon (R356STOP) in exon 7. The mother was also heterozygous for this mutation. Expression of a cDNA containing the maternal mutation produced no enzyme activity, as expected. Expression of the paternal mutation in COS-7 cells produced a surprisingly high (65% of control) level of activity. However, activity was 13% of control in transiently transfected murine MPS VII cells. The level of activity of this mutant allele appears to correlate with the level of overexpression. 39 refs., 5 figs., 1 tab.« less

Links between DNA Replication, Stem Cells and Cancer

PubMed Central

Vassilev, Alex; DePamphilis, Melvin L.

2017-01-01

Cancers can be categorized into two groups: those whose frequency increases with age, and those resulting from errors during mammalian development. The first group is linked to DNA replication through the accumulation of genetic mutations that occur during proliferation of developmentally acquired stem cells that give rise to and maintain tissues and organs. These mutations, which result from DNA replication errors as well as environmental insults, fall into two categories; cancer driver mutations that initiate carcinogenesis and genome destabilizing mutations that promote aneuploidy through excess genome duplication and chromatid missegregation. Increased genome instability results in accelerated clonal evolution leading to the appearance of more aggressive clones with increased drug resistance. The second group of cancers, termed germ cell neoplasia, results from the mislocation of pluripotent stem cells during early development. During normal development, pluripotent stem cells that originate in early embryos give rise to all of the cell lineages in the embryo and adult, but when they mislocate to ectopic sites, they produce tumors. Remarkably, pluripotent stem cells, like many cancer cells, depend on the Geminin protein to prevent excess DNA replication from triggering DNA damage-dependent apoptosis. This link between the control of DNA replication during early development and germ cell neoplasia reveals Geminin as a potential chemotherapeutic target in the eradication of cancer progenitor cells. PMID:28125050

Prediction of probable mutations in influenza virus hemagglutinin protein based on large-scale ab initio fragment molecular orbital calculations.

PubMed

Yoshioka, Akio; Fukuzawa, Kaori; Mochizuki, Yuji; Yamashita, Katsumi; Nakano, Tatsuya; Okiyama, Yoshio; Nobusawa, Eri; Nakajima, Katsuhisa; Tanaka, Shigenori

2011-09-01

Ab initio electronic-state calculations for influenza virus hemagglutinin (HA) trimer complexed with Fab antibody were performed on the basis of the fragment molecular orbital (FMO) method at the second and third-order Møller-Plesset (MP2 and MP3) perturbation levels. For the protein complex containing 2351 residues and 36,160 atoms, the inter-fragment interaction energies (IFIEs) were evaluated to illustrate the effective interactions between all the pairs of amino acid residues. By analyzing the calculated data on the IFIEs, we first discussed the interactions and their fluctuations between multiple domains contained in the trimer complex. Next, by combining the IFIE data between the Fab antibody and each residue in the HA antigen with experimental data on the hemadsorption activity of HA mutants, we proposed a protocol to predict probable mutations in HA. The proposed protocol based on the FMO-MP2.5 calculation can explain the historical facts concerning the actual mutations after the emergence of A/Hong Kong/1/68 influenza virus with subtype H3N2, and thus provides a useful methodology to enumerate those residue sites likely to mutate in the future. Copyright © 2011 Elsevier Inc. All rights reserved.

Congenital protein losing enteropathy: an inborn error of lipid metabolism due to DGAT1 mutations.

PubMed

Stephen, Joshi; Vilboux, Thierry; Haberman, Yael; Pri-Chen, Hadass; Pode-Shakked, Ben; Mazaheri, Sina; Marek-Yagel, Dina; Barel, Ortal; Di Segni, Ayelet; Eyal, Eran; Hout-Siloni, Goni; Lahad, Avishay; Shalem, Tzippora; Rechavi, Gideon; Malicdan, May Christine V; Weiss, Batia; Gahl, William A; Anikster, Yair

2016-08-01

Protein-losing enteropathy (PLE) is a clinical disorder of protein loss from the gastrointestinal system that results in hypoproteinemia and malnutrition. This condition is associated with a wide range of gastrointestinal disorders. Recently, a unique syndrome of congenital PLE associated with biallelic mutations in the DGAT1 gene has been reported in a single family. We hypothesize that mutations in this gene are responsible for undiagnosed cases of PLE in infancy. Here we investigated three children in two families presenting with severe diarrhea, hypoalbuminemia and PLE, using clinical studies, homozygosity mapping, and exome sequencing. In one family, homozygosity mapping using SNP arrays revealed the DGAT1 gene as the best candidate gene for the proband. Sequencing of all the exons including flanking regions and promoter regions of the gene identified a novel homozygous missense variant, p.(Leu295Pro), in the highly conserved membrane-bound O-acyl transferase (MBOAT) domain of the DGAT1 protein. Expression studies verified reduced amounts of DGAT1 in patient fibroblasts. In a second family, exome sequencing identified a previously reported splice site mutation in intron 8. These cases of DGAT1 deficiency extend the molecular and phenotypic spectrum of PLE, suggesting a re-evaluation of the use of DGAT1 inhibitors for metabolic disorders including obesity and diabetes.

HOL1 mutations confer novel ion transport in Saccharomyces cerevisiae.

PubMed Central

Gaber, R F; Kielland-Brandt, M C; Fink, G R

1990-01-01

Saccharomyces cerevisiae histidine auxotrophs are unable to use L-histidinol as a source of histidine even when they have a functional histidinol dehydrogenase. Mutations in the hol1 gene permit growth of His- cells on histidinol by enhancing the ability of cells to take up histidinol from the medium. Second-site mutations linked to HOL1-1 further increase histidinol uptake. HOL1 double mutants and, to a lesser extent, HOL1-1 single mutants show hypersensitivity to specific cations added to the growth medium, including Na+, Li+, Cs+, Be2+, guanidinium ion, and histidinol, but not K+, Rb+, Ca2+, or Mg2+. The Na(+)-hypersensitive phenotype is correlated with increased uptake and accumulation of this ion. The HOL1-1-101 gene was cloned and used to generate a viable haploid strain containing a hol1 deletion mutation (hol1 delta). The uptake of cations, the dominance of the mutant alleles, and the relative inability of hol1 delta cells to take up histidinol or Na+ suggest that hol1 encodes an ion transporter. The novel pattern of ion transport conferred by HOL1-1 and HOL1-1-101 mutants may be explained by reduced selectivity for the permeant ions. Images PMID:2405251

Report to the Nuclear energy Research Advisory Committee (NERAC) Subcommittee on "Long-Term Isotope Research and Productions Plan" - Responses to Questions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ammoniums

1999-07-01

This report presents responses to two series of questions that were raised by a subcommittee of the Nuclear Energy Research Advisory Committee (NERAC) that has been charged with producing a ''Long-Term Isotope Research and Production Plan.'' The NERAC subcommittee is chaired by Dr. Richard Reba, and the Hanford Site Visit team, which comprises a subset of the subcommittee members, is chaired by Dr. Thomas Ruth. The first set of questions raised by the subcommittee on isotope production at the Hanford Site was received from Dr. Ruth on May 10, 1999, and the second set was received from him on Julymore » 5, 1999. Responses to the first set of questions were prepared as part of a June 1999 report entitled ''Isotope Production at the Hanford Site in Richland, Washington'' (PNNL 1999a). The responses to these questions are summarized in this document, with frequent references to the June 1999 report for additional details. Responses to the second set of questions from the NERAC subcommittee are presented in this document for the first time.« less

Antiretroviral Drug Susceptibility Among HIV-Infected Adults Failing Antiretroviral Therapy in Rakai, Uganda

PubMed Central

Laeyendecker, Oliver; Nakigozi, Gertrude; Gallant, Joel E.; Huang, Wei; Hudelson, Sarah E.; Quinn, Thomas C.; Newell, Kevin; Serwadda, David; Gray, Ronald H.; Wawer, Maria J.; Eshleman, Susan H.

2012-01-01

Abstract We analyzed antiretroviral drug susceptibility in HIV-infected adults failing first- and second-line antiretroviral treatment (ART) in Rakai, Uganda. Samples obtained from participants at baseline (pretreatment) and at the time of failure on first-line ART and second-line ART were analyzed using genotypic and phenotypic assays for antiretroviral drug resistance. Test results were obtained from 73 samples from 38 individuals (31 baseline samples, 36 first-line failure samples, and six second-line failure samples). Four (13%) of the 31 baseline samples had mutations associated with resistance to nucleoside or nonnucleoside reverse transcriptase inhibitors (NRTIs and NNRTIs, respectively). Among the 36 first-line failure samples, 31 (86%) had NNRTI resistance mutations and 29 (81%) had lamivudine resistance mutations; only eight (22%) had other NRTI resistance mutations. None of the six individuals failing a second-line protease inhibitor (PI)-based regimen had PI resistance mutations. Six (16%) of the participants had discordant genotypic and phenotypic test results. Genotypic resistance to drugs included in first-line ART regimens was detected prior to treatment and among participants failing first-line ART. PI resistance was not detected in individuals failing second-line ART. Surveillance for transmitted and acquired drug resistance remains a priority for scale-up of ART. PMID:22443282

Synthetic and natural consensus design for engineering charge within an affibody targeting epidermal growth factor receptor.

PubMed

Case, Brett A; Hackel, Benjamin J

2016-08-01

Protein ligand charge can impact physiological delivery with charge reduction often benefiting performance. Yet neutralizing mutations can be detrimental to protein function. Herein, three approaches are evaluated to introduce charged-to-neutral mutations of three cations and three anions within an affibody engineered to bind epidermal growth factor receptor. These approaches-combinatorial library sorting or consensus design, based on natural homologs or library-sorted mutants-are used to identify mutations with favorable affinity, stability, and recombinant yield. Consensus design, based on 942 affibody homologs, yielded a mutant of modest function (Kd  = 11 ±4 nM, Tm  = 62°C, and yield = 4.0 ± 0.8 mg/L as compared to 5.3 ± 1.7 nM, 71°C, and 3.5 ± 0.3 mg/L for the parental affibody). Extension of consensus design to 10 additional mutants exhibited varied performance including a substantially improved mutant (Kd  = 6.9 ± 1.4 nM, Tm  = 71°C, and 12.7 ± 0.9 mg/L yield). Sorting a homolog-based combinatorial library of 7 × 10(5) mutants generated a distribution of mutants with lower stability and yield, but did identify one strongly binding variant (Kd  = 1.2 ± 0.3 nM, Tm  = 69°C, and 6.0 ± 0.4 mg/L yield). Synthetic consensus design, based on the amino acid distribution in functional library mutants, yielded higher affinities (P = 0.05) with comparable stabilities and yields. The best of four analyzed clones had Kd  = 1.7 ± 0.5 nM, Tm  = 68°C, and 7.0 ± 0.5 mg/L yield. While all three approaches were effective in creating targeted affibodies with six charged-to-neutral mutations, synthetic consensus design proved to be the most robust. Synthetic consensus design provides a valuable tool for ligand engineering, particularly in the context of charge manipulation. Biotechnol. Bioeng. 2016;113: 1628-1638. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

Microsatellite DNA mutations in double-crested cormorants (Phalacrocorax auritus) associated with exposure to PAH-containing industrial air pollution.

PubMed

King, L E; de Solla, S R; Small, J M; Sverko, E; Quinn, J S

2014-10-07

Hamilton Harbour, Ontario, Canada is one of the most polluted sites on the Great Lakes, and is subject to substantial airborne pollution due to emissions from both heavy industry and intense vehicle traffic. Mutagenic Polycyclic aromatic hydrocarbons (PAHs) are present at very high concentrations in the air and sediment of Hamilton Harbour. We used five variable DNA microsatellites to screen for mutations in 97 families of Double-crested Cormorants (Phalacrocorax auritus) from three wild colonies, two in Hamilton Harbour and one in cleaner northeastern Lake Erie. Mutations were identified in all five microsatellites at low frequencies, with the majority of mutations found in chicks from the Hamilton Harbour site closest to industrial sources of PAH contamination. Microsatellite mutation rates were 6-fold higher at the Hamilton Harbour site closest to the industrial sources of PAH contamination than the other Hamilton Harbour site, and both were higher than the reference colony. A Phase I metabolite of the PAH benzo[a]pyrene identified by LC-MS/MS in bile and liver from Hamilton Harbour cormorant chicks suggests that these cormorants are exposed to and metabolizing PAHs, highlighting their potential to have caused the observed mutations.

Spectrum of cisplatin-induced mutations in Escherichia coli

DOE Office of Scientific and Technical Information (OSTI.GOV)

Burnouf, D.; Duane, M.; Fuchs, R.P.

1987-06-01

Using a forward-mutation assay based on the inactivation of the tetracycline-resistance gene located on plasmid pBR322, we have determined the mutation spectrum induced in Escherichia coli by cisplatin (cis-diamminedichloroplatinum(II)), a widely used antitumor drug. Cisplatin is known to form mainly intrastrand diadducts at ApG and GpG sites. We found that cisplatin efficiently induces mutations in an SOS-dependent way (i.e., dependent upon UV irradiation of the host bacteria). More than 90% of the mutations are single-base-pair substitutions occurring at the potential sites of cisplatin adducts (ApG and GpG). Taking into account the relative proportions of ApG and GpG adducts, we foundmore » that the ApG adducts are at least 5 times more mutagenic than the GpG adducts. Moreover, a strong mutation specificity was seen at the 5' side of the ApG adducts (A X T----T X A transversions). The observation that most mutations occur at the 5' end of the adduct at both ApG and GpG sites is discussed in relation to recent structural data.« less

The population genetics of mutations: good, bad and indifferent

PubMed Central

Loewe, Laurence; Hill, William G.

2010-01-01

Population genetics is fundamental to our understanding of evolution, and mutations are essential raw materials for evolution. In this introduction to more detailed papers that follow, we aim to provide an oversight of the field. We review current knowledge on mutation rates and their harmful and beneficial effects on fitness and then consider theories that predict the fate of individual mutations or the consequences of mutation accumulation for quantitative traits. Many advances in the past built on models that treat the evolution of mutations at each DNA site independently, neglecting linkage of sites on chromosomes and interactions of effects between sites (epistasis). We review work that addresses these limitations, to predict how mutations interfere with each other. An understanding of the population genetics of mutations of individual loci and of traits affected by many loci helps in addressing many fundamental and applied questions: for example, how do organisms adapt to changing environments, how did sex evolve, which DNA sequences are medically important, why do we age, which genetic processes can generate new species or drive endangered species to extinction, and how should policy on levels of potentially harmful mutagens introduced into the environment by humans be determined? PMID:20308090

Two novel disease-causing variants in BMPR1B are associated with brachydactyly type A1.

PubMed

Racacho, Lemuel; Byrnes, Ashley M; MacDonald, Heather; Dranse, Helen J; Nikkel, Sarah M; Allanson, Judith; Rosser, Elisabeth; Underhill, T Michael; Bulman, Dennis E

2015-12-01

Brachydactyly type A1 is an autosomal dominant disorder primarily characterized by hypoplasia/aplasia of the middle phalanges of digits 2-5. Human and mouse genetic perturbations in the BMP-SMAD signaling pathway have been associated with many brachymesophalangies, including BDA1, as causative mutations in IHH and GDF5 have been previously identified. GDF5 interacts directly as the preferred ligand for the BMP type-1 receptor BMPR1B and is important for both chondrogenesis and digit formation. We report pathogenic variants in BMPR1B that are associated with complex BDA1. A c.975A>C (p.(Lys325Asn)) was identified in the first patient displaying absent middle phalanges and shortened distal phalanges of the toes in addition to the significant shortening of middle phalanges in digits 2, 3 and 5 of the hands. The second patient displayed a combination of brachydactyly and arachnodactyly. The sequencing of BMPR1B in this individual revealed a novel c.447-1G>A at a canonical acceptor splice site of exon 8, which is predicted to create a novel acceptor site, thus leading to a translational reading frameshift. Both mutations are most likely to act in a dominant-negative manner, similar to the effects observed in BMPR1B mutations that cause BDA2. These findings demonstrate that BMPR1B is another gene involved with the pathogenesis of BDA1 and illustrates the continuum of phenotypes between BDA1 and BDA2.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yi, MinKyung; Tong, Xiao; Skelton, Angela

Drug resistance is a major issue in the development and use of specific antiviral therapies. Here we report the isolation and characterization of hepatitis C virus RNA replicons resistant to a novel ketoamide inhibitor of the NS3/4A protease, SCH6 (originally SCH446211). Resistant replicon RNAs were generated by G418 selection in the presence of SCH6 in a dose-dependent fashion, with the emergence of resistance reduced at higher SCH6 concentrations. Sequencing demonstrated remarkable consistency in the mutations conferring SCH6 resistance in genotype 1b replicons derived from two different strains of hepatitis C virus, A156T/A156V and R109K. R109K, a novel mutation not reportedmore » previously to cause resistance to NS3/4A inhibitors, conferred moderate resistance only to SCH6. Structural analysis indicated that this reflects unique interactions of SCH6 with P{prime}-side residues in the protease active site. In contrast, A156T conferred high level resistance to SCH6 and a related ketoamide, SCH503034, as well as BILN 2061 and VX-950. Unlike R109K, which had minimal impact on NS3/4A enzymatic function, A156T significantly reduced NS3/4A catalytic efficiency, polyprotein processing, and replicon fitness. However, three separate second-site mutations, P89L, Q86R, and G162R, were capable of partially reversing A156T-associated defects in polyprotein processing and/or replicon fitness, without significantly reducing resistance to the protease inhibitor.« less

Interrelations of secondary structure stability and DNA-binding affinity in the bacteriophage SPO1-encoded type II DNA-binding protein TF1.

PubMed

Andera, L; Spangler, C J; Galeone, A; Mayol, L; Geiduschek, E P

1994-02-11

TF1, a homodimeric DNA-binding and -bending protein with a preference for hydroxymethyluracil-containing DNA is the Bacillus subtilis-encoded homolog of the bacterial HU proteins and of the E. coli integration host factor. A temperature-sensitive mutation at amino acid 25 of TF1 (L25-->A) and two intragenic second site revertants at amino acids 15 (E15-->G) and 32 (L32-->I) were previously identified and their effects on virus development were examined. The DNA-binding properties of these proteins and the thermal stability of their secondary structures have now been analyzed. Amino acids 15 and 32 are far removed from the putative DNA-binding domains of TF1 but changes there exert striking effects on DNA affinity that correlate with effects on structure. The double mutant protein TF1-G15I32 binds to a preferred site in hydroxymethyluracil-containing DNA 40 times more tightly, denatures at higher temperature (delta tm = 21 degrees C), and also exchanges subunits much more slowly than does the wild-type protein. The L25-->A mutation makes TF1 secondary structure and DNA-binding highly salt concentration-dependent. The E15-->G mutation partly suppresses this effect: secondary structure of TF1-A25G15 is restored at 21 degrees C by 1 M NaCl or, at low NaCl concentration, by binding to DNA.

Gene duplication in the major insecticide target site, Rdl, in Drosophila melanogaster

PubMed Central

Remnant, Emily J.; Good, Robert T.; Schmidt, Joshua M.; Lumb, Christopher; Robin, Charles; Daborn, Phillip J.; Batterham, Philip

2013-01-01

The Resistance to Dieldrin gene, Rdl, encodes a GABA-gated chloride channel subunit that is targeted by cyclodiene and phenylpyrazole insecticides. The gene was first characterized in Drosophila melanogaster by genetic mapping of resistance to the cyclodiene dieldrin. The 4,000-fold resistance observed was due to a single amino acid replacement, Ala301 to Ser. The equivalent change was subsequently identified in Rdl orthologs of a large range of resistant insect species. Here, we report identification of a duplication at the Rdl locus in D. melanogaster. The 113-kb duplication contains one WT copy of Rdl and a second copy with two point mutations: an Ala301 to Ser resistance mutation and Met360 to Ile replacement. Individuals with this duplication exhibit intermediate dieldrin resistance compared with single copy Ser301 homozygotes, reduced temperature sensitivity, and altered RNA editing associated with the resistant allele. Ectopic recombination between Roo transposable elements is involved in generating this genomic rearrangement. The duplication phenotypes were confirmed by construction of a transgenic, artificial duplication integrating the 55.7-kb Rdl locus with a Ser301 change into an Ala301 background. Gene duplications can contribute significantly to the evolution of insecticide resistance, most commonly by increasing the amount of gene product produced. Here however, duplication of the Rdl target site creates permanent heterozygosity, providing unique potential for adaptive mutations to accrue in one copy, without abolishing the endogenous role of an essential gene. PMID:23959864

Comparison of ALS functionality and plant growth in ALS-inhibitor susceptible and resistant Myosoton aquaticum L.

PubMed

Liu, Weitang; Bai, Shuang; Jia, Sisi; Guo, Wenlei; Zhang, Lele; Li, Wei; Wang, Jinxin

2017-10-01

Herbicide target-site resistance mutations may cause pleiotropic effects on plant ecology and physiology. The effect of several known (Pro197Ser, Pro197Leu Pro197Ala, and Pro197Glu) target-site resistance mutations of the ALS gene on both ALS functionality and plant vegetative growth of weed Myosoton aquaticum L. (water chickweed) have been investigated here. The enzyme kinetics of ALS from four purified water chickweed populations that each homozygous for the specific target-site resistance-endowing mutations were characterized and the effect of these mutations on plant growth was assessed via relative growth rate (RGR) analysis. Plants homozygous for Pro197Ser and Pro197Leu exhibited higher extractable ALS activity than susceptible (S) plants, while all ALS mutations with no negative change in ALS kinetics. The Pro197Leu mutation increased ALS sensitivity to isoleucine and valine, and Pro197Glu mutation slightly increased ALS sensitivity to isoleucine. RGR results indicated that none of these ALS resistance mutations impose negative pleiotropic effects on relative growth rate. However, resistant (R) seeds had a lowed germination rate than S seeds. This study provides baseline information on ALS functionality and plant growth characteristics associated with ALS inhibitor resistance-endowing mutations in water chickweed. Copyright © 2017. Published by Elsevier Inc.

Neutropenia-associated ELANE mutations disrupting translation initiation produce novel neutrophil elastase isoforms

PubMed Central

Tidwell, Timothy; Wechsler, Jeremy; Nayak, Ramesh C.; Trump, Lisa; Salipante, Stephen J.; Cheng, Jerry C.; Donadieu, Jean; Glaubach, Taly; Corey, Seth J.; Grimes, H. Leighton; Lutzko, Carolyn; Cancelas, Jose A.

2014-01-01

Hereditary neutropenia is usually caused by heterozygous germline mutations in the ELANE gene encoding neutrophil elastase (NE). How mutations cause disease remains uncertain, but two hypotheses have been proposed. In one, ELANE mutations lead to mislocalization of NE. In the other, ELANE mutations disturb protein folding, inducing an unfolded protein response in the endoplasmic reticulum (ER). In this study, we describe new types of mutations that disrupt the translational start site. At first glance, they should block translation and are incompatible with either the mislocalization or misfolding hypotheses, which require mutant protein for pathogenicity. We find that start-site mutations, instead, force translation from downstream in-frame initiation codons, yielding amino-terminally truncated isoforms lacking ER-localizing (pre) and zymogen-maintaining (pro) sequences, yet retain essential catalytic residues. Patient-derived induced pluripotent stem cells recapitulate hematopoietic and molecular phenotypes. Expression of the amino-terminally deleted isoforms in vitro reduces myeloid cell clonogenic capacity. We define an internal ribosome entry site (IRES) within ELANE and demonstrate that adjacent mutations modulate IRES activity, independently of protein-coding sequence alterations. Some ELANE mutations, therefore, appear to cause neutropenia via the production of amino-terminally deleted NE isoforms rather than by altering the coding sequence of the full-length protein. PMID:24184683

Charging Guidance of Electric Taxis Based on Adaptive Particle Swarm Optimization

PubMed Central

Niu, Liyong; Zhang, Di

2015-01-01

Electric taxis are playing an important role in the application of electric vehicles. The actual operational data of electric taxis in Shenzhen, China, is analyzed, and, in allusion to the unbalanced time availability of the charging station equipment, the electric taxis charging guidance system is proposed basing on the charging station information and vehicle information. An electric taxis charging guidance model is established and guides the charging based on the positions of taxis and charging stations with adaptive mutation particle swarm optimization. The simulation is based on the actual data of Shenzhen charging stations, and the results show that electric taxis can be evenly distributed to the appropriate charging stations according to the charging pile numbers in charging stations after the charging guidance. The even distribution among the charging stations in the area will be achieved and the utilization of charging equipment will be improved, so the proposed charging guidance method is verified to be feasible. The improved utilization of charging equipment can save public charging infrastructure resources greatly. PMID:26236770

Charging Guidance of Electric Taxis Based on Adaptive Particle Swarm Optimization.

PubMed

Niu, Liyong; Zhang, Di

2015-01-01

Electric taxis are playing an important role in the application of electric vehicles. The actual operational data of electric taxis in Shenzhen, China, is analyzed, and, in allusion to the unbalanced time availability of the charging station equipment, the electric taxis charging guidance system is proposed basing on the charging station information and vehicle information. An electric taxis charging guidance model is established and guides the charging based on the positions of taxis and charging stations with adaptive mutation particle swarm optimization. The simulation is based on the actual data of Shenzhen charging stations, and the results show that electric taxis can be evenly distributed to the appropriate charging stations according to the charging pile numbers in charging stations after the charging guidance. The even distribution among the charging stations in the area will be achieved and the utilization of charging equipment will be improved, so the proposed charging guidance method is verified to be feasible. The improved utilization of charging equipment can save public charging infrastructure resources greatly.

Mutation and polymorphism analysis of the human homogentisate 1, 2-dioxygenase gene in alkaptonuria patients.

PubMed Central

Beltrán-Valero de Bernabé, D; Granadino, B; Chiarelli, I; Porfirio, B; Mayatepek, E; Aquaron, R; Moore, M M; Festen, J J; Sanmartí, R; Peñalva, M A; de Córdoba, S R

1998-01-01

Alkaptonuria (AKU), a rare hereditary disorder of phenylalanine and tyrosine catabolism, was the first disease to be interpreted as an inborn error of metabolism. AKU patients are deficient for homogentisate 1,2 dioxygenase (HGO); this deficiency causes homogentisic aciduria, ochronosis, and arthritis. We cloned the human HGO gene and characterized two loss-of-function mutations, P230S and V300G, in the HGO gene in AKU patients. Here we report haplotype and mutational analysis of the HGO gene in 29 novel AKU chromosomes. We identified 12 novel mutations: 8 (E42A, W97G, D153G, S189I, I216T, R225H, F227S, and M368V) missense mutations that result in amino acid substitutions at positions conserved in HGO in different species, 1 (F10fs) frameshift mutation, 2 intronic mutations (IVS9-56G-->A, IVS9-17G-->A), and 1 splice-site mutation (IVS5+1G-->T). We also report characterization of five polymorphic sites in HGO and describe the haplotypic associations of alleles at these sites in normal and AKU chromosomes. One of these sites, HGO-3, is a variable dinucleotide repeat; IVS2+35T/A, IVS5+25T/C, and IVS6+46C/A are intronic sites at which single nucleotide substitutions (dimorphisms) have been detected; and c407T/A is a relatively frequent nucleotide substitution in the coding sequence, exon 4, resulting in an amino acid change (H80Q). These data provide insight into the origin and evolution of the various AKU alleles. PMID:9529363

Coarse-grained density functional theories for metallic alloys: Generalized coherent-potential approximations and charge-excess functional theory

NASA Astrophysics Data System (ADS)

Bruno, Ezio; Mammano, Francesco; Fiorino, Antonino; Morabito, Emanuela V.

2008-04-01

The class of the generalized coherent-potential approximations (GCPAs) to the density functional theory (DFT) is introduced within the multiple scattering theory formalism with the aim of dealing with ordered or disordered metallic alloys. All GCPA theories are based on a common ansatz for the kinetic part of the Hohenberg-Kohn functional and each theory of the class is specified by an external model concerning the potential reconstruction. Most existing DFT implementations of CPA-based theories belong to the GCPA class. The analysis of the formal properties of the density functional defined by GCPA theories shows that it consists of marginally coupled local contributions. Furthermore, it is shown that the GCPA functional does not depend on the details of the charge density and that it can be exactly rewritten as a function of the appropriate charge multipole moments to be associated with each lattice site. A general procedure based on the integration of the qV laws is described that allows for the explicit construction of the same function. The coarse-grained nature of the GCPA density functional implies a great deal of computational advantages and is connected with the O(N) scalability of GCPA algorithms. Moreover, it is shown that a convenient truncated series expansion of the GCPA functional leads to the charge-excess functional (CEF) theory [E. Bruno , Phys. Rev. Lett. 91, 166401 (2003)], which here is offered in a generalized version that includes multipolar interactions. CEF and the GCPA numerical results are compared with status of art linearized augmented plane wave (LAPW) full-potential density functional calculations for 62 bcc- and fcc-based ordered CuZn alloys, in all the range of concentrations. Two facts clearly emerge from these extensive tests. In the first place, the discrepancies between GCPA and CEF results are always within the numerical accuracy of the calculations, both for the site charges and the total energies. In the second place, the GCPA (or the CEF) is able to very carefully reproduce the LAPW site charges and a good agreement is obtained also about the total energies.

Mutation exposed: a neutral explanation for extreme base composition of an endosymbiont genome.

PubMed

Wernegreen, Jennifer J; Funk, Daniel J

2004-12-01

The influence of neutral mutation pressure versus selection on base composition evolution is a subject of considerable controversy. Yet the present study represents the first explicit population genetic analysis of this issue in prokaryotes, the group in which base composition variation is most dramatic. Here, we explore the impact of mutation and selection on the dynamics of synonymous changes in Buchnera aphidicola, the AT-rich bacterial endosymbiont of aphids. Specifically, we evaluated three forms of evidence. (i) We compared the frequencies of directional base changes (AT-->GC vs. GC-->AT) at synonymous sites within and between Buchnera species, to test for selective preference versus effective neutrality of these mutational categories. Reconstructed mutational changes across a robust intraspecific phylogeny showed a nearly 1:1 AT-->GC:GC-->AT ratio. Likewise, stationarity of base composition among Buchnera species indicated equal rates of AT-->GC and GC-->AT substitutions. The similarity of these patterns within and between species supported the neutral model. (ii) We observed an equivalence of relative per-site AT mutation rate and current AT content at synonymous sites, indicating that base composition is at mutational equilibrium. (iii) We demonstrated statistically greater equality in the frequency of mutational categories in Buchnera than in parallel mammalian studies that documented selection on synonymous sites. Our results indicate that effectively neutral mutational pressure, rather than selection, represents the major force driving base composition evolution in Buchnera. Thus they further corroborate recent evidence for the critical role of reduced N(e) in the molecular evolution of bacterial endosymbionts.

Ion Mobility Spectrometry-Hydrogen Deuterium Exchange Mass Spectrometry of Anions: Part 1. Peptides to Proteins

NASA Astrophysics Data System (ADS)

Donohoe, Gregory C.; Khakinejad, Mahdiar; Valentine, Stephen J.

2015-04-01

Ion mobility spectrometry (IMS) coupled with hydrogen deuterium exchange (HDX)-mass spectrometry (MS) has been used to study the conformations of negatively-charged peptide and protein ions. Results are presented for ion conformers of angiotensin 1, a synthetic peptide (SP), bovine insulin, ubiquitin, and equine cytochrome c. In general, the SP ion conformers demonstrate a greater level of HDX efficiency as a greater proportion of the sites undergo HDX. Additionally, these ions exhibit the fastest rates of exchange. Comparatively, the angiotensin 1 ions exhibit a lower rate of exchange and HDX level presumably because of decreased accessibility of exchange sites by charge sites. The latter are likely confined to the peptide termini. Insulin ions show dramatically reduced HDX levels and exchange rates, which can be attributed to decreased conformational flexibility resulting from the disulfide bonds. For the larger ubiquitin and protein ions, increased HDX is observed for larger ions of higher charge state. For ubiquitin, a conformational transition from compact to more elongated species (from lower to higher charge states) is reflected by an increase in HDX levels. These results can be explained by a combination of interior site protection by compact conformers as well as decreased access by charge sites. The elongated cytochrome c ions provide the largest HDX levels where higher values correlate with charge state. These results are consistent with increased exchange site accessibility by additional charge sites. The data from these enhanced IMS-HDX experiments are described in terms of charge site location, conformer rigidity, and interior site protection.

Mechanisms of mTORC1 activation by RHEB and inhibition by PRAS40.

PubMed

Yang, Haijuan; Jiang, Xiaolu; Li, Buren; Yang, Hyo J; Miller, Meredith; Yang, Angela; Dhar, Ankita; Pavletich, Nikola P

2017-12-21

The mechanistic target of rapamycin complex 1 (mTORC1) controls cell growth and metabolism in response to nutrients, energy levels, and growth factors. It contains the atypical kinase mTOR and the RAPTOR subunit that binds to the Tor signalling sequence (TOS) motif of substrates and regulators. mTORC1 is activated by the small GTPase RHEB (Ras homologue enriched in brain) and inhibited by PRAS40. Here we present the 3.0 ångström cryo-electron microscopy structure of mTORC1 and the 3.4 ångström structure of activated RHEB-mTORC1. RHEB binds to mTOR distally from the kinase active site, yet causes a global conformational change that allosterically realigns active-site residues, accelerating catalysis. Cancer-associated hyperactivating mutations map to structural elements that maintain the inactive state, and we provide biochemical evidence that they mimic RHEB relieving auto-inhibition. We also present crystal structures of RAPTOR-TOS motif complexes that define the determinants of TOS recognition, of an mTOR FKBP12-rapamycin-binding (FRB) domain-substrate complex that establishes a second substrate-recruitment mechanism, and of a truncated mTOR-PRAS40 complex that reveals PRAS40 inhibits both substrate-recruitment sites. These findings help explain how mTORC1 selects its substrates, how its kinase activity is controlled, and how it is activated by cancer-associated mutations.

Metastatic site location influences the diagnostic accuracy of ctDNA EGFR- mutation testing in NSCLC patients: a pooled analysis.

PubMed

Passiglia, Francesco; Rizzo, Sergio; Rolfo, Christian; Galvano, Antonio; Bronte, Enrico; Incorvaia, Lorena; Listi, Angela; Barraco, Nadia; Castiglia, Marta; Calo, Valentina; Bazan, Viviana; Russo, Antonio

2018-03-08

Recent studies evaluated the diagnostic accuracy of circulating tumor DNA (ctDNA) in the detection of epidermal growth factor receptor (EGFR) mutations from plasma of NSCLC patients, overall showing a high concordance as compared to standard tissue genotyping. However it is less clear if the location of metastatic site may influence the ability to identify EGFR mutations in plasma. This pooled analysis aims to evaluate the association between the metastatic site location and the sensitivity of ctDNA analysis in detecting EGFR mutations in NSCLC patients. Data from all published studies, evaluating the sensitivity of plasma-based EGFR-mutation testing, stratified by metastatic site location (extrathoracic (M1b) vs intrathoracic (M1a)) were collected by searching in PubMed, Cochrane Library, American Society of Clinical Oncology, and World Conference of Lung Cancer, meeting proceedings. Pooled Odds ratio (OR) and 95% confidence intervals (95% CIs) were calculated for the ctDNA analysis sensitivity, according to metastatic site location. A total of ten studies, with 1425 patients, were eligible. Pooled analysis showed that the sensitivity of ctDNA-based EGFR-mutation testing is significantly higher in patients with M1b vs M1a disease (OR: 5.09; 95% CIs: 2.93 - 8.84). A significant association was observed for both EGFR-activating (OR: 4.30, 95% CI: 2.35-7.88) and resistant T790M mutations (OR: 11.89, 95% CI: 1.45-97.22), regardless of the use of digital-PCR (OR: 5.85, 95% CI: 3.56-9.60) or non-digital PCR technologies (OR: 2.96, 95% CI: 2.24-3.91). These data suggest that the location of metastatic sites significantly influences the diagnostic accuracy of ctDNA analysis in detecting EGFR mutations in NSCLC patients. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

Impact of disruption of secondary binding site S2 on dopamine transporter function.

PubMed

Zhen, Juan; Reith, Maarten E A

2016-09-01

The structures of the leucine transporter, drosophila dopamine transporter, and human serotonin transporter show a secondary binding site (designated S2 ) for drugs and substrate in the extracellular vestibule toward the membrane exterior in relation to the primary substrate recognition site (S1 ). The present experiments are aimed at disrupting S2 by mutating Asp476 and Ile159 to Ala. Both mutants displayed a profound decrease in [(3) H]DA uptake compared with wild-type associated with a reduced turnover rate kcat . This was not caused by a conformational bias as the mutants responded to Zn(2+) (10 μM) similarly as WT. The dopamine transporters with either the D476A or I159A mutation both displayed a higher Ki for dopamine for the inhibition of [3H](-)-2-β-carbomethoxy-3-β-(4-fluorophenyl)tropane binding than did the WT transporter, in accordance with an allosteric interaction between the S1 and S2 sites. The results provide evidence in favor of a general applicability of the two-site allosteric model of the Javitch/Weinstein group from LeuT to dopamine transporter and possibly other monoamine transporters. X-ray structures of transporters closely related to the dopamine (DA) transporter show a secondary binding site S2 in the extracellular vestibule proximal to the primary binding site S1 which is closely linked to one of the Na(+) binding sites. This work examines the relationship between S2 and S1 sites. We found that S2 site impairment severely reduced DA transport and allosterically reduced S1 site affinity for the cocaine analog [(3) H]CFT. Our results are the first to lend direct support for the application of the two-site allosteric model, advanced for bacterial LeuT, to the human DA transporter. The model states that, after binding of the first DA molecule (DA1 ) to the primary S1 site (along with Na(+) ), binding of a second DA (DA2 ) to the S2 site triggers, through an allosteric interaction, the release of DA1 and Na(+) into the cytoplasm. © 2016 International Society for Neurochemistry.

Accurate detection for a wide range of mutation and editing sites of microRNAs from small RNA high-throughput sequencing profiles

PubMed Central

Zheng, Yun; Ji, Bo; Song, Renhua; Wang, Shengpeng; Li, Ting; Zhang, Xiaotuo; Chen, Kun; Li, Tianqing; Li, Jinyan

2016-01-01

Various types of mutation and editing (M/E) events in microRNAs (miRNAs) can change the stabilities of pre-miRNAs and/or complementarities between miRNAs and their targets. Small RNA (sRNA) high-throughput sequencing (HTS) profiles can contain many mutated and edited miRNAs. Systematic detection of miRNA mutation and editing sites from the huge volume of sRNA HTS profiles is computationally difficult, as high sensitivity and low false positive rate (FPR) are both required. We propose a novel method (named MiRME) for an accurate and fast detection of miRNA M/E sites using a progressive sequence alignment approach which refines sensitivity and improves FPR step-by-step. From 70 sRNA HTS profiles with over 1.3 billion reads, MiRME has detected thousands of statistically significant M/E sites, including 3′-editing sites, 57 A-to-I editing sites (of which 32 are novel), as well as some putative non-canonical editing sites. We demonstrated that a few non-canonical editing sites were not resulted from mutations in genome by integrating the analysis of genome HTS profiles of two human cell lines, suggesting the existence of new editing types to further diversify the functions of miRNAs. Compared with six existing studies or methods, MiRME has shown much superior performance for the identification and visualization of the M/E sites of miRNAs from the ever-increasing sRNA HTS profiles. PMID:27229138

Complete-proteome mapping of human influenza A adaptive mutations: implications for human transmissibility of zoonotic strains.

PubMed

Miotto, Olivo; Heiny, A T; Albrecht, Randy; García-Sastre, Adolfo; Tan, Tin Wee; August, J Thomas; Brusic, Vladimir

2010-02-03

There is widespread concern that H5N1 avian influenza A viruses will emerge as a pandemic threat, if they become capable of human-to-human (H2H) transmission. Avian strains lack this capability, which suggests that it requires important adaptive mutations. We performed a large-scale comparative analysis of proteins from avian and human strains, to produce a catalogue of mutations associated with H2H transmissibility, and to detect their presence in avian isolates. We constructed a dataset of influenza A protein sequences from 92,343 public database records. Human and avian sequence subsets were compared, using a method based on mutual information, to identify characteristic sites where human isolates present conserved mutations. The resulting catalogue comprises 68 characteristic sites in eight internal proteins. Subtype variability prevented the identification of adaptive mutations in the hemagglutinin and neuraminidase proteins. The high number of sites in the ribonucleoprotein complex suggests interdependence between mutations in multiple proteins. Characteristic sites are often clustered within known functional regions, suggesting their functional roles in cellular processes. By isolating and concatenating characteristic site residues, we defined adaptation signatures, which summarize the adaptive potential of specific isolates. Most adaptive mutations emerged within three decades after the 1918 pandemic, and have remained remarkably stable thereafter. Two lineages with stable internal protein constellations have circulated among humans without reassorting. On the contrary, H5N1 avian and swine viruses reassort frequently, causing both gains and losses of adaptive mutations. Human host adaptation appears to be complex and systemic, involving nearly all influenza proteins. Adaptation signatures suggest that the ability of H5N1 strains to infect humans is related to the presence of an unusually high number of adaptive mutations. However, these mutations appear unstable, suggesting low pandemic potential of H5N1 in its current form. In addition, adaptation signatures indicate that pandemic H1N1/09 strain possesses multiple human-transmissibility mutations, though not an unusually high number with respect to swine strains that infected humans in the past. Adaptation signatures provide a novel tool for identifying zoonotic strains with the potential to infect humans.

Structure of the Mitochondrial Aminolevulinic Acid Synthase, a Key Heme Biosynthetic Enzyme.

PubMed

Brown, Breann L; Kardon, Julia R; Sauer, Robert T; Baker, Tania A

2018-04-03

5-Aminolevulinic acid synthase (ALAS) catalyzes the first step in heme biosynthesis. We present the crystal structure of a eukaryotic ALAS from Saccharomyces cerevisiae. In this homodimeric structure, one ALAS subunit contains covalently bound cofactor, pyridoxal 5'-phosphate (PLP), whereas the second is PLP free. Comparison between the subunits reveals PLP-coupled reordering of the active site and of additional regions to achieve the active conformation of the enzyme. The eukaryotic C-terminal extension, a region altered in multiple human disease alleles, wraps around the dimer and contacts active-site-proximal residues. Mutational analysis demonstrates that this C-terminal region that engages the active site is important for ALAS activity. Our discovery of structural elements that change conformation upon PLP binding and of direct contact between the C-terminal extension and the active site thus provides a structural basis for investigation of disruptions in the first step of heme biosynthesis and resulting human disorders. Copyright © 2018 Elsevier Ltd. All rights reserved.

Avidin as a Model for Charge Driven Transport into Cartilage and Drug Delivery for treating Early Stage Post-traumatic Osteoarthritis

PubMed Central

Bajpayee, Ambika G.; Wong, Cliff R.; Bawendi, Moungi G.; Frank, Eliot H.; Grodzinsky, Alan J.

2013-01-01

Local drug delivery into cartilage remains a challenge due to its dense extracellular matrix of negatively charged proteoglycans enmeshed within a collagen fibril network. The high negative fixed charge density of cartilage offers the unique opportunity to utilize electrostatic interactions to augment transport, binding and retention of drug carriers. With the goal of developing particle-based drug delivery mechanisms for treating post-traumatic osteoarthritis, our objectives were, first, to determine the size range of a variety of solutes that could penetrate and diffuse through normal cartilage and enzymatically treated cartilage to mimic early stages of OA, and second, to investigate the effects of electrostatic interactions on particle partitioning, uptake and binding within cartilage using the highly positively charged protein, Avidin, as a model. Results showed that solutes having a hydrodynamic diameter ≤ 10 nm can penetrate into the full thickness of cartilage explants while larger sized solutes were trapped in the tissue’s superficial zone. Avidin had a 400-fold higher uptake than its neutral same-sized counterpart, NeutrAvidin, and >90% of the absorbed Avidin remained within cartilage explants for at least 15 days. We report reversible, weak binding (KD ~150 μM) of Avidin to intratissue sites in cartilage. The large effective binding site density (NT ~ 2920 μM) within cartilage matrix facilitates Avidin’s retention, making its structure suitable for particle based drug delivery into cartilage. PMID:24120044

Human β-Synuclein Rendered Fibrillogenic by Designed Mutations

PubMed Central

Zibaee, Shahin; Fraser, Graham; Jakes, Ross; Owen, David; Serpell, Louise C.; Crowther, R. Anthony; Goedert, Michel

2010-01-01

Filamentous inclusions made of α-synuclein are found in nerve cells and glial cells in a number of human neurodegenerative diseases, including Parkinson disease, dementia with Lewy bodies, and multiple system atrophy. The assembly and spreading of these inclusions are likely to play an important role in the etiology of common dementias and movement disorders. Both α-synuclein and the homologous β-synuclein are abundantly expressed in the central nervous system; however, β-synuclein is not present in the pathological inclusions. Previously, we observed a poor correlation between filament formation and the presence of residues 73–83 of α-synuclein, which are absent in β-synuclein. Instead, filament formation correlated with the mean β-sheet propensity, charge, and hydrophilicity of the protein (global physicochemical properties) and β-strand contiguity calculated by a simple algorithm of sliding averages (local physicochemical property). In the present study, we rendered β-synuclein fibrillogenic via one set of point mutations engineered to enhance global properties and a second set engineered to enhance predominantly β-strand contiguity. Our findings show that the intrinsic physicochemical properties of synucleins influence their fibrillogenic propensity via two distinct but overlapping modalities. The implications for filament formation and the pathogenesis of neurodegenerative diseases are discussed. PMID:20833719

Mechanism of opening a sliding clamp

PubMed Central

Douma, Lauren G.; Yu, Kevin K.; England, Jennifer K.

2017-01-01

Abstract Clamp loaders load ring-shaped sliding clamps onto DNA where the clamps serve as processivity factors for DNA polymerases. In the first stage of clamp loading, clamp loaders bind and stabilize clamps in an open conformation, and in the second stage, clamp loaders place the open clamps around DNA so that the clamps encircle DNA. Here, the mechanism of the initial clamp opening stage is investigated. Mutations were introduced into the Escherichia coli β-sliding clamp that destabilize the dimer interface to determine whether the formation of an open clamp loader–clamp complex is dependent on spontaneous clamp opening events. In other work, we showed that mutation of a positively charged Arg residue at the β-dimer interface and high NaCl concentrations destabilize the clamp, but neither facilitates the formation of an open clamp loader–clamp complex in experiments presented here. Clamp opening reactions could be fit to a minimal three-step ‘bind-open-lock’ model in which the clamp loader binds a closed clamp, the clamp opens, and subsequent conformational rearrangements ‘lock’ the clamp loader–clamp complex in a stable open conformation. Our results support a model in which the E. coli clamp loader actively opens the β-sliding clamp. PMID:28973453

Ubiquinol-binding site in the alternative oxidase: mutagenesis reveals features important for substrate binding and inhibition.

PubMed

Albury, Mary S; Elliott, Catherine; Moore, Anthony L

2010-12-01

The alternative oxidase (AOX) is a non-protonmotive ubiquinol oxidase that is found in all plants, some fungi, green algae, bacteria and pathogenic protozoa. The lack of AOX in the mammalian host renders this protein an important potential therapeutic target in the treatment of pathogenic protozoan infections. Bioinformatic searches revealed that, within a putative ubiquinol-binding crevice in AOX, Gln242, Asn247, Tyr253, Ser256, His261 and Arg262 were highly conserved. To confirm that these amino-acid residues are important for ubiquinol-binding and hence activity substitution mutations were generated and characterised. Assessment of AOX activity in isolated Schizosaccharomyces pombe mitochondria revealed that mutation of either Gln242, Ser256, His261 and Arg262 resulted in >90% inhibition of antimycin A-insensitive respiration suggesting that hydroxyl, guanidino, imidazole groups, polar and charged residues in addition to the size of the amino-acid chain are important for ubiquinone-binding. Substitution of Asn247 with glutamine or Tyr253 with phenylalanine had little effect upon the respiratory rate indicating that these residues are not critical for AOX activity. However replacement of Tyr253 by alanine resulted in a 72% loss of activity suggesting that the benzoquinone group and not hydroxyl group is important for quinol binding. These results provide important new insights into the ubiquinol-binding site of the alternative oxidase, the identity of which maybe important for future rational drug design. Copyright © 2010 Elsevier B.V. All rights reserved.

A shower of second hit events as the cause of multifocal renal cell carcinoma in tuberous sclerosis complex

PubMed Central

Tyburczy, Magdalena E.; Jozwiak, Sergiusz; Malinowska, Izabela A.; Chekaluk, Yvonne; Pugh, Trevor J.; Wu, Chin-Lee; Nussbaum, Robert L.; Seepo, Sara; Dzik, Tomasz; Kotulska, Katarzyna; Kwiatkowski, David J.

2015-01-01

Tuberous sclerosis complex (TSC) is a genetic disorder characterized by seizures and tumor formation in multiple organs, mainly in the brain, skin, kidney, lung and heart. Renal cell carcinoma (RCC) occurs in ∼3% of TSC patients, and typically develops at age <50. Here we describe genetic findings in two TSC patients with multiple renal tumors, each of whom had the germline mutation TSC2 p.R905Q. The first (female) TSC patient had a left followed by a right nephrectomy at ages 24 and 27. Both kidneys showed multifocal TSC-associated papillary RCC (PRCC). Targeted, next-generation sequencing (NGS) analysis of TSC2 in five tumors (four from the left kidney, one from the right) showed loss of heterozygosity in one tumor, and four different TSC2 point mutations (p.E1351*, p.R1032*, p.R1713H, c.4178_4179delCT) in the other four samples. Only one of the 11 other tumors available from this patient had one of the TSC2 second hit mutations identified. Whole-exome analysis of the five tumors identified a very small number of additional mutated genes, with an average of 3.4 nonsilent coding, somatic mutations per tumor, none of which were seen in >1 tumor. The second (male) TSC patient had bilateral partial nephrectomies (both at age 36), with similar findings of multifocal PRCC. NGS analysis of TSC2 in two of these tumors identified a second hit mutation c.2355+1G>T in one sample that was not seen in other tumors. In conclusion, we report the first detailed genetic analysis of RCCs in TSC patients. Molecular studies indicate that tumors developed independently due to various second hit events, suggesting that these patients experienced a ‘shower’ of second hit mutations in TSC2 during kidney development leading to this severe phenotype. PMID:25432535

Proximity charge sensing for semiconductor detectors

DOEpatents

Luke, Paul N; Tindall, Craig S; Amman, Mark

2013-10-08

A non-contact charge sensor includes a semiconductor detector having a first surface and an opposing second surface. The detector includes a high resistivity electrode layer on the first surface and a low resistivity electrode on the high resistivity electrode layer. A portion of the low resistivity first surface electrode is deleted to expose the high resistivity electrode layer in a portion of the area. A low resistivity electrode layer is disposed on the second surface of the semiconductor detector. A voltage applied between the first surface low resistivity electrode and the second surface low resistivity electrode causes a free charge to drift toward the first or second surface according to a polarity of the free charge and the voltage. A charge sensitive preamplifier coupled to a non-contact electrode disposed at a distance from the exposed high resistivity electrode layer outputs a signal in response to movement of free charge within the detector.

The influence of allosteric modulators and transmembrane mutations on desensitisation and activation of α7 nicotinic acetylcholine receptors

PubMed Central

Chatzidaki, Anna; D'Oyley, Jarryl M.; Gill-Thind, JasKiran K.; Sheppard, Tom D.; Millar, Neil S.

2015-01-01

Acetylcholine activates nicotinic acetylcholine receptors (nAChRs) by binding at an extracellular orthosteric site. Previous studies have described several positive allosteric modulators (PAMs) that are selective for homomeric α7 nAChRs. These include type I PAMs, which exert little or no effect on the rate of receptor desensitisation, and type II PAMs, which cause a dramatic loss of agonist-induced desensitisation. Here we report evidence that transmembrane mutations in α7 nAChRs have diverse effects on receptor activation and desensitisation by allosteric ligands. It has been reported previously that the L247T mutation, located toward the middle of the second transmembrane domain (at the 9′ position), confers reduced levels of desensitisation. In contrast, the M260L mutation, located higher up in the TM2 domain (at the 22′ position), does not show any difference in desensitisation compared to wild-type receptors. We have found that in receptors containing the L247T mutation, both type I PAMs and type II PAMs are converted into non-desensitising agonists. In contrast, in receptors containing the M260L mutation, this effect is seen only with type II PAMs. These findings, indicating that the M260L mutation has a selective effect on type II PAMs, have been confirmed both with previously described PAMs and also with a series of novel α7-selective PAMs. The novel PAMs examined in this study have close chemical similarity but diverse pharmacological properties. For example, they include compounds displaying effects on receptor desensitisation that are typical of classical type I and type II PAMs but, in addition, they include compounds with intermediate properties. PMID:25998276

The influence of allosteric modulators and transmembrane mutations on desensitisation and activation of α7 nicotinic acetylcholine receptors.

PubMed

Chatzidaki, Anna; D'Oyley, Jarryl M; Gill-Thind, JasKiran K; Sheppard, Tom D; Millar, Neil S

2015-10-01

Acetylcholine activates nicotinic acetylcholine receptors (nAChRs) by binding at an extracellular orthosteric site. Previous studies have described several positive allosteric modulators (PAMs) that are selective for homomeric α7 nAChRs. These include type I PAMs, which exert little or no effect on the rate of receptor desensitisation, and type II PAMs, which cause a dramatic loss of agonist-induced desensitisation. Here we report evidence that transmembrane mutations in α7 nAChRs have diverse effects on receptor activation and desensitisation by allosteric ligands. It has been reported previously that the L247T mutation, located toward the middle of the second transmembrane domain (at the 9' position), confers reduced levels of desensitisation. In contrast, the M260L mutation, located higher up in the TM2 domain (at the 22' position), does not show any difference in desensitisation compared to wild-type receptors. We have found that in receptors containing the L247T mutation, both type I PAMs and type II PAMs are converted into non-desensitising agonists. In contrast, in receptors containing the M260L mutation, this effect is seen only with type II PAMs. These findings, indicating that the M260L mutation has a selective effect on type II PAMs, have been confirmed both with previously described PAMs and also with a series of novel α7-selective PAMs. The novel PAMs examined in this study have close chemical similarity but diverse pharmacological properties. For example, they include compounds displaying effects on receptor desensitisation that are typical of classical type I and type II PAMs but, in addition, they include compounds with intermediate properties. Copyright © 2015 The Authors. Published by Elsevier Ltd.. All rights reserved.

Efficacy of artesunate + sulphadoxine/pyrimethamine and artemether + lumefantrine and dhfr and dhps mutations in Somalia: evidence for updating the malaria treatment policy.

PubMed

Warsame, Marian; Hassan, Abdikarim Hussein; Hassan, Abdillahi Mohamed; Arale, Abdulkadir Mohamed; Jibril, Ali Mohamed; Mohamud, Said Abdulkadir; Barrette, Amy; Muse, Abdikarim Yusuf; Yusuf, Fahmi Essa; Nada, Rania A; Amran, Jamal Ghilan Hefzullah

2017-04-01

To determine the therapeutic efficacy of artesunate + sulphadoxine/pyrimethamine (AS + SP) and artemether + lumefantrine (AL), and to investigate the presence of molecular mutations associated with resistance, to inform national malaria treatment policy. One-arm prospective studies were conducted in three study sites in Somalia in 2013 and 2015 to evaluate the efficacy of AS + SP and AL among patients with uncomplicated falciparum malaria. Outcomes included clinical and parasitological response over 28 days, and the presence of dihydrofolate reductase (dfhr) and dihydropteroate synthase (dhps) and mutations. Among patients treated with AS + SP, the PCR-corrected treatment failure rate was 12.3%. The majority of patients (89%) carried either the quintuple mutations (51I/108N + 437G/540E/581G or 51I/59R/108N + 437G/540E) or the quadruple mutation (51I/108N + 437G/540E). All patients who failed treatment with AS + SP carried the quintuple mutation (51I/108N + 437G/540E/581G). In the studies of AL, the PCR-corrected treatment failure rate was <6%. All patients in both treatment groups cleared their parasitaemia by day 3. The findings demonstrate a failing first-line treatment (AS + SP), with a failure rate above the threshold (10%) for policy change, and a high prevalence of quintuple mutations. In contrast, AL was highly efficacious. Based on these findings and the results from a previous AS + SP study, AL was selected to replace AS + SP as the first-line treatment for uncomplicated malaria in Somalia in 2016. Dihydroartemisinin + piperaquine (DHA + PPQ) has been recommended as the second-line treatment. Routine monitoring of recommended ACTs should continue to inform treatment policy. © 2017 John Wiley & Sons Ltd.

Mutations in the Basic Region of the Mason-Pfizer Monkey Virus Nucleocapsid Protein Affect Reverse Transcription, Genomic RNA Packaging, and the Virus Assembly Site.

PubMed

Dostálková, Alžběta; Kaufman, Filip; Křížová, Ivana; Kultová, Anna; Strohalmová, Karolína; Hadravová, Romana; Ruml, Tomáš; Rumlová, Michaela

2018-05-15

In addition to specific RNA-binding zinc finger domains, the retroviral Gag polyprotein contains clusters of basic amino acid residues that are thought to support Gag-viral genomic RNA (gRNA) interactions. One of these clusters is the basic K 16 NK 18 EK 20 region, located upstream of the first zinc finger of the Mason-Pfizer monkey virus (M-PMV) nucleocapsid (NC) protein. To investigate the role of this basic region in the M-PMV life cycle, we used a combination of in vivo and in vitro methods to study a series of mutants in which the overall charge of this region was more positive (RNRER), more negative (AEAEA), or neutral (AAAAA). The mutations markedly affected gRNA incorporation and the onset of reverse transcription. The introduction of a more negative charge (AEAEA) significantly reduced the incorporation of M-PMV gRNA into nascent particles. Moreover, the assembly of immature particles of the AEAEA Gag mutant was relocated from the perinuclear region to the plasma membrane. In contrast, an enhancement of the basicity of this region of M-PMV NC (RNRER) caused a substantially more efficient incorporation of gRNA, subsequently resulting in an increase in M-PMV RNRER infectivity. Nevertheless, despite the larger amount of gRNA packaged by the RNRER mutant, the onset of reverse transcription was delayed in comparison to that of the wild type. Our data clearly show the requirement for certain positively charged amino acid residues upstream of the first zinc finger for proper gRNA incorporation, assembly of immature particles, and proceeding of reverse transcription. IMPORTANCE We identified a short sequence within the Gag polyprotein that, together with the zinc finger domains and the previously identified RKK motif, contributes to the packaging of genomic RNA (gRNA) of Mason-Pfizer monkey virus (M-PMV). Importantly, in addition to gRNA incorporation, this basic region (KNKEK) at the N terminus of the nucleocapsid protein is crucial for the onset of reverse transcription. Mutations that change the positive charge of the region to a negative one significantly reduced specific gRNA packaging. The assembly of immature particles of this mutant was reoriented from the perinuclear region to the plasma membrane. On the contrary, an enhancement of the basic character of this region increased both the efficiency of gRNA packaging and the infectivity of the virus. However, the onset of reverse transcription was delayed even in this mutant. In summary, the basic region in M-PMV Gag plays a key role in the packaging of genomic RNA and, consequently, in assembly and reverse transcription. Copyright © 2018 American Society for Microbiology.

Stringency of substrate specificity of Escherichia coli malate dehydrogenase.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Boernke, W. E.; Millard, C. S.; Stevens, P. W.

1995-09-10

Malate dehydrogenase and lactate dehydrogenase are members of the structurally and functionally homologous family of 2-ketoacid dehydrogenases. Both enzymes display high specificity for their respective keto substrates, oxaloacetate and pyruvate. Closer analysis of their specificity, however, reveals that the specificity of malate dehydrogenase is much stricter and less malleable than that of lactate dehydrogenase. Site-specific mutagenesis of the two enzymes in an attempt to reverse their specificity has met with contrary results. Conversion of a specific active-site glutamine to arginine in lactate dehydrogenase from Bacillus stearothermophilus generated an enzyme that displayed activity toward oxaloacetate equal to that of the nativemore » enzyme toward pyruvate (H. M. Wilks et al. (1988) Science 242, 1541-1544). We have constructed a series of mutants in the mobile, active site loop of the Escherichia coli malate dehydrogenase that incorporate the complementary change, conversion of arginine 81 to glutamine, to evaluate the role of charge distribution and conformational flexibility within this loop in defining the substrate specificity of these enzymes. Mutants incorporating the change R81Q all had reversed specificity, displaying much higher activity toward pyruvate than to the natural substrate, oxaloacetate. In contrast to the mutated lactate dehydrogenase, these reversed-specificity mutants were much less active than the native enzyme. Secondary mutations within the loop of the E. coli enzyme (A80N, A80P, A80P/M85E/D86T) had either no or only moderately beneficial effects on the activity of the mutant enzyme toward pyruvate. The mutation A80P, which can be expected to reduce the overall flexibility of the loop, modestly improved activity toward pyruvate. The possible physiological relevance of the stringent specificity of malate dehydrogenase was investigated. In normal strains of E. coli, fermentative metabolism was not affected by expression of the mutant malate dehydrogenase. However, when expressed in a strain of E. coli unable to ferment glucose, the mutant enzyme restored growth and produced lactic acid as the sole fermentation product.« less