Science.gov

Sample records for chartarum induce immunotoxic

  1. Co-cultivation of Streptomyces californicus and Stachybotrys chartarum stimulates the production of cytostatic compound(s) with immunotoxic properties

    SciTech Connect

    Penttinen, Piia . E-mail: Piia.Penttinen@ktl.fi; Pelkonen, Jukka; Huttunen, Kati; Hirvonen, Maija-Riitta

    2006-12-15

    We have recently shown that the actinobacterium Streptomyces californicus and the fungus Stachybotrys chartarum originating from moisture damaged buildings possess both immunotoxic and immunostimulatory characteristics, which are synergistically potentiated by microbial interaction. In the search for the causative agent(s) behind the immunotoxicity, the cytostatic effects of the co-cultivated spores of S. californicus and S. chartarum were compared to those caused by widely used cytostatic agents produced by streptomycetes. The RAW264.7 macrophages were exposed to four doses of doxorubicin (DOX), actinomycin D (AMD), mitomycin C (MMC) or phleomycin (PHLEO) for 24 h. Kinetics of the spores of the co-cultivated and the separately cultivated microbes (1 x 10{sup 6} spores/ml) was compared to DOX (0.15 {mu}M). Apoptotic responses were analyzed by measuring DNA content and mitochondria membrane depolarization with flow cytometer, and by the fluorometric caspase-3 assay. The present data indicate that interactions during co-cultivation of S. californicus and S. chartarum stimulate the production of an unidentified cytostatic compound(s) capable of inducing mitochondria mediated apoptosis and cell cycle arrest at S-G{sub 2}/M. The spores of co-cultivated microbes caused a 4-fold collapse of mitochondrial membrane potential and an almost 6-fold caspase-3 activation and DNA fragmentation when compared to control. Similar responses were induced by DNA cleaving compounds, especially DOX and AMD, at the relatively low concentrations, but not the spores of the same microbes when they were grown separately. These data suggest that when growing in the same habitat, interactions between S. californicus and S. chartarum stimulates the production of an unknown cytostatic compound(s) which evoke immunotoxic effects similar to those by chemotherapeutic drugs.

  2. Co-cultivation of Streptomyces californicus and Stachybotrys chartarum stimulates the production of cytostatic compound(s) with immunotoxic properties.

    PubMed

    Penttinen, Piia; Pelkonen, Jukka; Huttunen, Kati; Hirvonen, Maija-Riitta

    2006-12-15

    We have recently shown that the actinobacterium Streptomyces californicus and the fungus Stachybotrys chartarum originating from moisture damaged buildings possess both immunotoxic and immunostimulatory characteristics, which are synergistically potentiated by microbial interaction. In the search for the causative agent(s) behind the immunotoxicity, the cytostatic effects of the co-cultivated spores of S. californicus and S. chartarum were compared to those caused by widely used cytostatic agents produced by streptomycetes. The RAW264.7 macrophages were exposed to four doses of doxorubicin (DOX), actinomycin D (AMD), mitomycin C (MMC) or phleomycin (PHLEO) for 24 h. Kinetics of the spores of the co-cultivated and the separately cultivated microbes (1x10(6) spores/ml) was compared to DOX (0.15 muM). Apoptotic responses were analyzed by measuring DNA content and mitochondria membrane depolarization with flow cytometer, and by the fluorometric caspase-3 assay. The present data indicate that interactions during co-cultivation of S. californicus and S. chartarum stimulate the production of an unidentified cytostatic compound(s) capable of inducing mitochondria mediated apoptosis and cell cycle arrest at S-G(2)/M. The spores of co-cultivated microbes caused a 4-fold collapse of mitochondrial membrane potential and an almost 6-fold caspase-3 activation and DNA fragmentation when compared to control. Similar responses were induced by DNA cleaving compounds, especially DOX and AMD, at the relatively low concentrations, but not the spores of the same microbes when they were grown separately. These data suggest that when growing in the same habitat, interactions between S. californicus and S. chartarum stimulates the production of an unknown cytostatic compound(s) which evoke immunotoxic effects similar to those by chemotherapeutic drugs.

  3. Processed Aloe vera gel ameliorates cyclophosphamide-induced immunotoxicity.

    PubMed

    Im, Sun-A; Kim, Ki-Hyang; Kim, Hee-Suk; Lee, Ki-Hwa; Shin, Eunju; Do, Seon-Gil; Jo, Tae Hyung; Park, Young In; Lee, Chong-Kil

    2014-10-24

    The effects of processed Aloe vera gel (PAG) on cyclophosphamide (CP)-induced immunotoxicity were examined in mice. Intraperitoneal injection of CP significantly reduced the total number of lymphocytes and erythrocytes in the blood. Oral administration of PAG quickly restored CP-induced lymphopenia and erythropenia in a dose-dependent manner. The reversal of CP-induced hematotoxicity by PAG was mediated by the functional preservation of Peyer's patch cells. Peyer's patch cells isolated from CP-treated mice, which were administered PAG, produced higher levels of T helper 1 cytokines and colony-stimulating factors (CSF) in response to concanavalin A stimulation as compared with those isolated from CP-treated control mice. PAG-derived polysaccharides directly activated Peyer's patch cells isolated from normal mice to produce cytokines including interleukin (IL)-6, IL-12, interferon-γ, granulocyte-CSF, and granulocyte-macrophage-CSF. The cytokines produced by polysaccharide-stimulated Peyer's patch cells had potent proliferation-inducing activity on mouse bone marrow cells. In addition, oral administration of PAG restored IgA secretion in the intestine after CP treatment. These results indicated that PAG could be an effective immunomodulator and that it could prevent CP-induced immunotoxic side effects.

  4. Processed Aloe vera Gel Ameliorates Cyclophosphamide-Induced Immunotoxicity

    PubMed Central

    Im, Sun-A; Kim, Ki-Hyang; Kim, Hee-Suk; Lee, Ki-Hwa; Shin, Eunju; Do, Seon-Gil; Jo, Tae Hyung; Park, Young In; Lee, Chong-Kil

    2014-01-01

    The effects of processed Aloe vera gel (PAG) on cyclophosphamide (CP)-induced immunotoxicity were examined in mice. Intraperitoneal injection of CP significantly reduced the total number of lymphocytes and erythrocytes in the blood. Oral administration of PAG quickly restored CP-induced lymphopenia and erythropenia in a dose-dependent manner. The reversal of CP-induced hematotoxicity by PAG was mediated by the functional preservation of Peyer’s patch cells. Peyer’s patch cells isolated from CP-treated mice, which were administered PAG, produced higher levels of T helper 1 cytokines and colony-stimulating factors (CSF) in response to concanavalin A stimulation as compared with those isolated from CP-treated control mice. PAG-derived polysaccharides directly activated Peyer’s patch cells isolated from normal mice to produce cytokines including interleukin (IL)-6, IL-12, interferon-γ, granulocyte-CSF, and granulocyte-macrophage-CSF. The cytokines produced by polysaccharide-stimulated Peyer’s patch cells had potent proliferation-inducing activity on mouse bone marrow cells. In addition, oral administration of PAG restored IgA secretion in the intestine after CP treatment. These results indicated that PAG could be an effective immunomodulator and that it could prevent CP-induced immunotoxic side effects. PMID:25347273

  5. Systemic immunotoxicity reactions induced by adjuvanted vaccines.

    PubMed

    Batista-Duharte, Alexander; Portuondo, Deivys; Pérez, O; Carlos, Iracilda Zeppone

    2014-05-01

    Vaccine safety is a topic of concern for the treated individual, the family, the health care personnel, and the others involved in vaccination programs as recipients or providers. Adjuvants are necessary components to warrant the efficacy of vaccines, however the overstimulation of the immune system is also associated with adverse effects. Local reactions are the most frequent manifestation of toxicity induced by adjuvanted vaccines and, with the exception of the acute phase response (APR), much less is known about the systemic reactions that follow vaccination. Their low frequency or subclinical expression meant that this matter has been neglected. In this review, various systemic reactions associated with immune stimulation will be addressed, including: APR, hypersensitivity, induction or worsening of autoimmune diseases, modification of hepatic metabolism and vascular leak syndrome (VLS), with an emphasis on the mechanism involved. Finally, the authors analyze the current focus of discussion about vaccine safety and opportunities to improve the design of new adjuvanted vaccines in the future.

  6. Aquatic pollution-induced immunotoxicity in wildlife species.

    PubMed

    Luebke, R W; Hodson, P V; Faisal, M; Ross, P S; Grasman, K A; Zelikoff, J

    1997-05-01

    The potential for chemicals to adversely affect human immunologic health has traditionally been evaluated in rodents, under laboratory conditions. These laboratory studies have generated valuable hazard identification and immunotoxicologic mechanism data; however, genetically diverse populations exposed in the wild may better reflect both human exposure conditions and may provide insight into potential immunotoxic effects in humans. In addition, comparative studies of species occupying reference and impacted sites provide important information on the effects of environmental pollution on the immunologic health of wildlife populations. In this symposium overview, Peter Hodson describes physiological changes in fish collected above or below the outflows of paper mills discharging effluent from the bleaching process (BKME). Effects attributable to BKME were identified, as were physiological changes attributable to other environmental factors. In this context, he discussed the problems of identifying true cause and effect relationships in field studies. Mohamed Faisal described changes in immune function of fish collected from areas with high levels of polyaromatic hydrocarbon contamination. His studies identified a contaminant-related decreases in the ability of anterior kidney leukocytes to bind to and kill tumor cell line targets, as well as changes in lymphocyte proliferation in response to mitogens. Altered proliferative responses of fish from the contaminated site were partially reversed by maintaining fish in water from the reference site. Peter Ross described studies in which harbor seals were fed herring obtained from relatively clean (Atlantic Ocean) and contaminated (Baltic Sea) waters. Decreased natural killer cell activity and lymphoproliferative responses to T and B cell mitogens, as well as depressed antibody and delayed hypersensitivity responses to injected antigens, were identified in seals fed contaminated herring. In laboratory studies, it was

  7. Exposure to mercuric chloride induces developmental damage, oxidative stress and immunotoxicity in zebrafish embryos-larvae.

    PubMed

    Zhang, Qun-Fang; Li, Ying-Wen; Liu, Zhi-Hao; Chen, Qi-Liang

    2016-12-01

    Mercury (Hg) is a widespread environmental pollutant that can produce severe negative effects on fish even at very low concentrations. However, the mechanisms underlying inorganic Hg-induced oxidative stress and immunotoxicity in the early development stage of fish still need to be clarified. In the present study, zebrafish (Danio rerio) embryos were exposed to different concentrations of Hg(2+) (0, 1, 4 and 16μg/L; added as mercuric chloride, HgCl2) from 2h post-fertilization (hpf) to 168hpf. Developmental parameters and total Hg accumulation were monitored during the exposure period, and antioxidant status and the mRNA expression of genes related to the innate immune system were examined at 168hpf. The results showed that increasing Hg(2+) concentration and time significantly increased total Hg accumulation in zebrafish embryos-larvae. Exposure to 16μg/L Hg(2+) caused developmental damage, including increased mortality and malformation, decreased body length, and delayed hatching period. Meanwhile, HgCl2 exposure (especially in the 16μg/L Hg(2+) group) induced oxidative stress affecting antioxidant enzyme (CAT, GST and GPX) activities, endogenous GSH and MDA contents, as well as the mRNA levels of genes (cat1, sod1, gstr, gpx1a, nrf2, keap1, hsp70 and mt) encoding antioxidant proteins. Moreover, the transcription levels of several representative genes (il-1β, il-8, il-10, tnfα2, lyz and c3) involved in innate immunity were up-regulated by HgCl2 exposure, suggesting that inorganic Hg had the potential to induce immunotoxicity. Taken together, the present study provides evidence that waterborne HgCl2 exposure can induce developmental impairment, oxidative stress and immunotoxicity in the early development stage of fish, which brings insights into the toxicity mechanisms of inorganic Hg in fish.

  8. Effect of thyroidectomy and thyroxine on 2,3,7,8-tetrachlorodibenzo-p-dioxin-induced immunotoxicity

    SciTech Connect

    Pazdernik, T.L.; Rozman, K.K.

    1985-02-18

    Radiothyroidectomy protected against 2,3,7,8-tetrachloro dibenzo-p-dioxin (TCDD)-induced immunotoxicity in rats as assessed by the spleen anti-SRBC plaque-forming cell assay. Thyroxin (T/sub 4/) replacement therapy partially reversed the effects of thyroidectomy on T/sub 4/ and triiodothyronine (T/sub 3/) serum levels, body weight and immune function as well as restored TCDD-induced immunotoxicity. Thus, hypothyroidism induced by TCDD exposure can be viewed as a protective response of the organism to reduce the insult caused by TCDD.

  9. Protective role of bentonite against aflatoxin B1- and ochratoxin A-induced immunotoxicity in broilers.

    PubMed

    Bhatti, Sheraz Ahmed; Khan, Muhammad Zargham; Saleemi, Muhammad Kashif; Saqib, Muhammad; Khan, Ahrar; Ul-Hassan, Zahoor

    2017-12-01

    The present study was designed to investigate any ameliorative effects of bentonite (BN) against immuno-pathological alterations induced by dietary aflatoxin B1 (AFB1) or ochratoxin A (OTA) in broiler chicks. In one experiment, AFB1 (0.1, 0.2 or 0.6 mg/kg feed) was fed alone and par alley with bentonite clay (3.7 or 7.5 g/kg feed) to the broilers. In the second experiment, the broilers were given feed contaminated with OTA (0.15, 0.3 or 1.0 mg/kg feed) alone and in combination with bentonite clay (3.7, 7.5, or 15 g/kg feed). Experimental feedings were continued for 42 days. At various time points along the feeding schedule, immune system organ histologic status, as well as host humoral and cellular immune responses, were evaluated in all groups. The dietary addition of AFB1 and OTA alone significantly reduced immune responses in the birds as assessed by histological changes in the bursa of Fabricius and thymus, antibody responses to SRBC, in-vivo lympho-proliferative responses to Phytohemagglutinin-P (PHA-P) and, phagocytic function in situ. The dietary addition of BN significantly ameliorated the immunotoxicity of 0.1 and 0.2 mg/kg dietary AFB1, however with a level of 0.6 mg AFB1/kg only partial amelioration was seen. The co-treatment of birds exposed to OTA with BN at all levels only partially alleviated deleterious effects on histology and immune responses. Taken together, the results here suggested to us that dietary addition of BN could help ameliorate AFB1-mediated immunotoxicities but could not afford such protection against OTA-induced immune damage.

  10. Protective effects of selenium on mercury induced immunotoxic effects in mice by way of concurrent drinking water exposure.

    PubMed

    Li, Xuan; Yin, Daqiang; Li, Jiang; Wang, Rui

    2014-07-01

    Selenium (Se) has been recognized as one key to understanding mercury (Hg) exposure risks. To explore the effects of Se on Hg-induced immunotoxicity, female Balb/c mice were exposed to HgCl2- or MeHgCl-contaminated drinking water (0.001, 0.01, and 0.1 mM as Hg) with coexisting Na2SeO3 at different Se/Hg molar ratios (0:1, 1/3:1, 1:1 and 3:1). The potential immunotoxicity induced by Na2SeO3 exposure alone (by way of drinking water) was also determined within a wide range of concentrations. After 14 days' exposure, the effects of Hg or Se on the immune system of Balb/c mice were investigated by determining the proliferation of T and B lymphocytes and the activity of natural killer cells. Hg exposure alone induced a dose-dependent suppression effect, whereas Se provided promotion effects at low exposure level (<0.01 mM) and inhibition effects at high exposure level (>0.03 mM). Under Hg and Se coexposure condition, the effects on immunotoxicity depended on the Hg species, Se/Hg ratio, and exposure concentration. At low Hg concentration (0.001 mM), greater Se ingestion exhibited stronger protective effects on Hg-induced suppression effect mainly by way of decreasing Hg concentrations in target organs. At greater Hg concentration (0.01 and 0.1 mM), immunotoxicity induced by Se (>0.03 mM) became evident, and the protective effects appeared more significant at an Se/Hg molar ratio of 1:1. The complex antagonistic effects between Se and Hg suggested that both Se/Hg molar ratio and concentration should be considered when evaluating the potential health risk of Hg-contaminated biota.

  11. Interactions between Streptomyces californicus and Stachybotrys chartarum can induce apoptosis and cell cycle arrest in mouse RAW264.7 macrophages

    SciTech Connect

    Penttinen, Piia . E-mail: Piia.Penttinen@ktl.fi; Pelkonen, Jukka; Huttunen, Kati; Toivola, Mika; Hirvonen, Maija-Riitta

    2005-02-01

    Exposure to complex mixtures of bacteria and fungi in moisture-damaged buildings is a potential cause of inflammatory related symptoms among occupants. The present study assessed interactions between two characteristic moldy house microbes Streptomyces californicus and Stachybotrys chartarum. Differences in cytotoxic and inflammatory responses in mouse (RAW264.7) macrophages were studied after exposure to the spores of co-cultivated microbes, the mixture of separately cultivated spores, and the spores of either of these microbes cultivated alone. The RAW264.7 cells were exposed to six doses (1 x 10{sup 4} to 3 x 10{sup 6} spores/ml) for 24 h, and the time course of the induced responses was evaluated after 4, 8, 16, and 24 h of exposure (1 x 10{sup 6} spores/ml). The cytotoxic potential of the spores was characterized by the MTT test, DNA content analysis, and enzyme assay for caspase-3 activity. The production of cytokines (IL-1{beta}, IL-6, IL-10, TNF{alpha}, and MIP2) was measured immunochemically and nitric oxide by the Griess method. Co-cultivation increased the ability of the spores to cause apoptosis by more than 4-fold and the proportion of RAW264.7 cells at the G{sub 2}/M stage increased nearly 2-fold when compared to the response induced by the mixture of spores. In contrast, co-cultivation decreased significantly the ability of the spores to trigger the production of NO and IL-6 in RAW264.7 cells. In conclusion, these data suggest that co-culture of S. californicus and S. chartarum can result in microbial interactions that significantly potentiate the ability of the spores to cause apoptosis and cell cycle arrest in mammalian cells.

  12. IS YOUR STACHYBOTRYS CHARTARUM A GENUINE S. CHARTARUM?

    EPA Science Inventory

    The fungus Stachybotrys chartarum is the type species of the genus Stachybotrys. Certain strains of the species are known to produce trichothecene mycotoxins,. It is a celluolytic saprophyte with worldwide distribution and frequently discovered in water-damaged buildings. Evid...

  13. Differential immunotoxicity induced by two different windows of developmental trichloroethylene exposure.

    PubMed

    Gilbert, Kathleen M; Woodruff, William; Blossom, Sarah J

    2014-01-01

    Developmental exposure to environmental toxicants may induce immune system alterations that contribute to adult stage autoimmune disease. We have shown that continuous exposure of MRL+/+ mice to trichloroethylene (TCE) from gestational day (GD) 0 to postnatal day (PND) 49 alters several aspects of CD4(+) T cell function. This window of exposure corresponds to conception-adolescence/young adulthood in humans. More narrowly defining the window of TCE developmental exposure causes immunotoxicity that would establish the stage at which avoidance and/or intervention would be most effective. The current study divided continuous TCE exposure into two separate windows, namely, gestation only (GD0 to birth (PND0)) and early-life only (PND0-PND49). The mice were examined for specific alterations in CD4(+) T cell function at PND49. One potentially long-lasting effect of developmental exposure, alterations in retrotransposon expression indicative of epigenetic alterations, was found in peripheral CD4(+) T cells from both sets of developmentally exposed mice. Interestingly, certain other effects, such as alterations in thymus cellularity, were only found in mice exposed to TCE during gestation. In contrast, expansion of memory/activation cell subset of peripheral CD4(+) T cells were only found in mice exposed to TCE during early life. Different windows of developmental TCE exposure can have different functional consequences.

  14. Differential Immunotoxicity Induced by Two Different Windows of Developmental Trichloroethylene Exposure

    PubMed Central

    Gilbert, Kathleen M.; Woodruff, William; Blossom, Sarah J.

    2014-01-01

    Developmental exposure to environmental toxicants may induce immune system alterations that contribute to adult stage autoimmune disease. We have shown that continuous exposure of MRL+/+ mice to trichloroethylene (TCE) from gestational day (GD) 0 to postnatal day (PND) 49 alters several aspects of CD4+ T cell function. This window of exposure corresponds to conception-adolescence/young adulthood in humans. More narrowly defining the window of TCE developmental exposure causes immunotoxicity that would establish the stage at which avoidance and/or intervention would be most effective. The current study divided continuous TCE exposure into two separate windows, namely, gestation only (GD0 to birth (PND0)) and early-life only (PND0-PND49). The mice were examined for specific alterations in CD4+ T cell function at PND49. One potentially long-lasting effect of developmental exposure, alterations in retrotransposon expression indicative of epigenetic alterations, was found in peripheral CD4+ T cells from both sets of developmentally exposed mice. Interestingly, certain other effects, such as alterations in thymus cellularity, were only found in mice exposed to TCE during gestation. In contrast, expansion of memory/activation cell subset of peripheral CD4+ T cells were only found in mice exposed to TCE during early life. Different windows of developmental TCE exposure can have different functional consequences. PMID:24696780

  15. Investigations of immunotoxicity and allergic potential induced by topical application of triclosan in mice

    PubMed Central

    Anderson, Stacey E.; Meade, B. Jean; Long, Carrie M.; Lukomska, Ewa; Marshall, Nikki B.

    2016-01-01

    Triclosan is an antimicrobial chemical commonly used occupationally and by the general public. Using select immune function assays, the purpose of these studies was to evaluate the immunotoxicity of triclosan following dermal exposure using a murine model. Triclosan was not identified to be a sensitizer in the murine local lymph node assay (LLNA) when tested at concentrations ranging from 0.75–3.0%. Following a 28-day exposure, triclosan produced a significant increase in liver weight at concentrations of ≥ 1.5%. Exposure to the high dose (3.0%) also produced a significant increase in spleen weights and number of platelets. The absolute number of B-cells, T-cells, dendritic cells and NK cells were significantly increased in the skin draining lymph node, but not the spleen. An increase in the frequency of dendritic cells was also observed in the lymph node following exposure to 3.0% triclosan. The IgM antibody response to sheep red blood cells (SRBC) was significantly increased at 0.75% – but not at the higher concentrations – in the spleen and serum. These results demonstrate that dermal exposure to triclosan induces stimulation of the immune system in a murine model and raise concerns about potential human exposure. PMID:25812624

  16. Investigations of immunotoxicity and allergic potential induced by topical application of triclosan in mice.

    PubMed

    Anderson, Stacey E; Meade, B Jean; Long, Carrie M; Lukomska, Ewa; Marshall, Nikki B

    2016-01-01

    Triclosan is an antimicrobial chemical commonly used occupationally and by the general public. Using select immune function assays, the purpose of these studies was to evaluate the immunotoxicity of triclosan following dermal exposure using a murine model. Triclosan was not identified to be a sensitizer in the murine local lymph node assay (LLNA) when tested at concentrations ranging from 0.75-3.0%. Following a 28-day exposure, triclosan produced a significant increase in liver weight at concentrations of ≥ 1.5%. Exposure to the high dose (3.0%) also produced a significant increase in spleen weights and number of platelets. The absolute number of B-cells, T-cells, dendritic cells and NK cells were significantly increased in the skin draining lymph node, but not the spleen. An increase in the frequency of dendritic cells was also observed in the lymph node following exposure to 3.0% triclosan. The IgM antibody response to sheep red blood cells (SRBC) was significantly increased at 0.75% - but not at the higher concentrations - in the spleen and serum. These results demonstrate that dermal exposure to triclosan induces stimulation of the immune system in a murine model and raise concerns about potential human exposure.

  17. Tunisian radish (Raphanus sativus) extract prevents cadmium-induced immunotoxic and biochemical alterations in rats.

    PubMed

    ben Salah-Abbès, Jalila; Abbès, Samir; Zohra, Haous; Oueslati, Ridha

    2015-01-01

    Cadmium (Cd), a known carcinogen and potent immunotoxicant in humans and animals, is dispersed throughout the environment as a result of pollution from a variety of sources. Tunisian radish (Raphanus sativus) extract (TRE) is a known anti-oxidant and free radical scavenger that has been shown to help alleviate immune system disorders, including some induced by environmental toxicants. The present study was undertaken to investigate potential protective effects of TRE against Cd-induced immunotoxicities (and general toxicities) in situ. Cadmium chloride (at 2.5 mg CdCl2/kg BW) and TRE (5, 10, or 15 mg/kg BW) were given (alone or in combination [actually, in sequence of Cd and then TRE]) to rats daily by oral gavage for 2 weeks. Results indicated that treatment with CdCl2 alone resulted in significant decreases in plasma levels of total protein, triglycerides, creatine kinase, creatinine, IgG and IgA, T-lymphocyte sub-types (CD4(+), CD3(+), CD56(+), and CD8(+)), and in thymic and hepatic indices (relative weights). In contrast, CdCl2 treatment caused significant increases in serum LDH, AST, and ALT, in the formation/release of pro-inflammatory cytokines (IL-1 and TNFα), and in the relative weights of host spleen and kidneys. Rats treated with TRE alone had no discernable changes compared to the controls with regard to all test parameters. Combined treatment of CdCl2 and TRE-at any dose-resulted in a significant improvement of all test parameters compared to those seen with Cd alone. These results illustrated (and provided further support for a continuing belief in) the beneficial effects of TRE in reducing the harmful outcomes of commonly encountered toxicants (like Cd) on the immune system and on overall host health status.

  18. Comparison of immunotoxic effects induced by the extracts from methanol and gasoline engine exhausts in vitro.

    PubMed

    Che, Wangjun; Liu, Guiming; Qiu, Hong; Zhang, Hao; Ran, Yun; Zeng, Xianggui; Wen, Weihua; Shu, Ya

    2010-06-01

    Gasoline engine exhaust has been considered as a major source of air pollution in China. Due to lower cyto- and geno-toxicity effects of methanol engine exhaust, methanol is regarded as a potential substitute for gasoline. We have previously compared cyto- and geno-toxicities of gasoline engine exhaust with that of methanol engine exhaust in A549 cells (Zhang et al., 2007).To characterize the immunotoxic effects for gasoline and methanol engine exhausts in immune cell, in this study, we further compared effects of gasoline and methanol engine exhausts on immune function in RAW264.7 cell and rabbit alveolar macrophages. Results showed that both gasoline and methanol engine exhaust could evidently inhibit RAW264.7 cell proliferation, promote RAW264.7 cell apoptosis, decrease E-rosette formation rate and inhibit anti-tumor effects of alveolar macrophages, at the same time, these effects of gasoline engine exhaust were far stronger than those of methanol engine exhaust. In addition, gasoline engine exhaust could significantly inhibit activities of ADCC of alveolar macrophages, but methanol engine exhaust could not. These results suggested that both gasoline and methanol engine exhausts might be immunotoxic atmospheric pollutants, but some effects of gasoline engine exhaust on immunotoxicities may be far stronger than that of methanol engine exhaust.

  19. Walnut Polyphenol Extract Attenuates Immunotoxicity Induced by 4-Pentylphenol and 3-methyl-4-nitrophenol in Murine Splenic Lymphocyte

    PubMed Central

    Yang, Lubing; Ma, Sihui; Han, Yu; Wang, Yuhan; Guo, Yan; Weng, Qiang; Xu, Meiyu

    2016-01-01

    4-pentylphenol (PP) and 3-methyl-4-nitrophenol (PNMC), two important components of vehicle emissions, have been shown to confer toxicity in splenocytes. Certain natural products, such as those derived from walnuts, exhibit a range of antioxidative, antitumor, and anti-inflammatory properties. Here, we investigated the effects of walnut polyphenol extract (WPE) on immunotoxicity induced by PP and PNMC in murine splenic lymphocytes. Treatment with WPE was shown to significantly enhance proliferation of splenocytes exposed to PP or PNMC, characterized by increases in the percentages of splenic T lymphocytes (CD3+ T cells) and T cell subsets (CD4+ and CD8+ T cells), as well as the production of T cell-related cytokines and granzymes (interleukin-2, interleukin-4, and granzyme-B) in cells exposed to PP or PNMC. These effects were associated with a decrease in oxidative stress, as evidenced by changes in OH, SOD, GSH-Px, and MDA levels. The total phenolic content of WPE was 34,800 ± 200 mg gallic acid equivalents/100 g, consisting of at least 16 unique phenols, including ellagitannins, quercetin, valoneic acid dilactone, and gallic acid. Taken together, these results suggest that walnut polyphenols significantly attenuated PP and PNMC-mediated immunotoxicity and improved immune function by inhibiting oxidative stress. PMID:27187455

  20. Investigations into the Immunotoxicity and Allergic Potential Induced by Topical Application of N-Butylbenzenesulfonamide (NBBS) in a Murine Model

    PubMed Central

    Marrocco, Antonella; Meade, B. Jean; Long, Carrie M.; Lukomska, Ewa; Marshall, Nikki B.; Anderson, Stacey E.

    2015-01-01

    N-Butylbenzene sulfonamide (NBBS) is a commonly used plasticizer found in numerous products. Due to its extensive use, lack of adequate toxicological data, and suspicion of toxicity based on the presence of structural alerts, it was nominated to the National Toxicology Program for comprehensive toxicological testing. The purpose of this study was to evaluate the potential for hypersensitivity and immune suppression following dermal exposure to NBBS using a murine model. NBBS tested negative in a combined irritancy/local lymph node assay (LLNA), classifying it as nonirritating and nonsensitizing. To estimate the immunosuppressive potential of NBBS, assays that assessed immunotoxicity were performed, including the immumnoglobulin (Ig) M response to T-cell-dependent antigen sheep red blood cells (SRBC), using the plaque-forming cell (PFC) assay and immune cell phenotyping. After a 28-d treatment with NBBS, mice exposed to the lowest concentration (25% NBBS) showed a significant increase in IgM-producing B cells in the spleen. No marked changes were identified in immune cell markers in the lymph node. In contrast to body weight, a significant elevation in kidney and liver weight was observed following dermal exposure to all concentrations of NBBS. These results demonstrate that dermal exposure to NBBS, other than liver and kidney toxicity, did not apparently induce immunotoxicity in a murine model. PMID:26291892

  1. Role of Glutathione Conjugation in 1-Bromobutane-induced Immunotoxicity in Mice

    PubMed Central

    Lee, Sang Kyu; Lee, Dong Ju; Jeon, Tae Won; Ko, Gyu Sub; Yoo, Se Hyun; Ha, Hyun Woo; Kang, Mi Jeong; Kang, Wonku; Kim, Sang Kyum

    2010-01-01

    Halogenated organic compounds, such as 1-bromobutane (1-BB) , have been used as cleaning agents, agents for chemical syntheses or extraction solvents in workplace. In the present study, immunotoxic effects of 1-BB and its conjugation with glutathione (GSH) were investigated in female BALB/c mice. Animals were treated orally with 1-BB at 375, 750 and 1500 mg/kg in corn oil once for dose response or treated orally with 1-BB at 1500 mg/kg for 6, 12, 24 and 48 hr for time course. S-Butyl GSH was identified in spleen by liquid chromatography-electrospray ionization tandem mass spectrometry. Splenic GSH levels were significantly reduced by single treatment with 1-BB. S-Butyl GSH conjugates were detected in spleen from 6 hr after treatment. Oral 1-BB significantly suppressed the antibody response to a T-dependent antigen and the production of splenic intracellular interlukin-2 in response to Con A. Our present results suggest that 1-BB could cause immunotoxicity as well as reduction of splenic GSH content, due to the formation of GSH conjugates in mice. The present results would be useful to understand molecular toxic mechanism of low molecular weight haloalkanes and to develop biological markers for exposure to haloalkanes. PMID:24278512

  2. Acute exposure to waterborne cadmium induced oxidative stress and immunotoxicity in the brain, ovary and liver of zebrafish (Danio rerio).

    PubMed

    Zheng, Jia-Lang; Yuan, Shuang-Shuang; Wu, Chang-Wen; Lv, Zhen-Ming

    2016-11-01

    Cadmium (Cd) is an environmental contaminant that poses serious risks to aquatic organisms and their associated ecosystem. The mechanisms underlying Cd-induced oxidative stress and immunotoxicity in fish remain largely unknown. In this study, adult female zebrafish were exposed to 0 (control), 1mgL(-1) Cd for 24h and 96h, and the oxidative stress and inflammatory responses induced by Cd were evaluated in the brain, liver and ovary. Reactive oxygen species (ROS), nitric oxide (NO), and malondialdehyde (MDA) increased in a time-dependent manner after treatment with Cd in the brain and liver. The increase may result from the disturbance of genes including copper and zinc superoxide dismutase (Cu/Zn-SOD), catalase (CAT), inducible nitric oxide synthase (iNOS), and ciclooxigenase-2 (COX-2) at mRNA, protein and activity levels. Although ROS, NO and MDA were not significantly affected by Cd in the ovary, the up-regulation of Cu/Zn-SOD, CAT, iNOS, and COX-2 was observed. Exposure to Cd induced a sharp increase in the protein levels of tumor necrosis factor alpha (TNF-α) in the brain, liver and ovary, possibly contributing to activate inflammatory responses. Furthermore, we also found a dramatic increase in mRNA levels of NF-E2-related factor 2 (Nrf2) and nuclear transcription factor κB (NF-κB) at 24h in the liver and ovary. The corresponding changes in the mRNA levels of Kelch-like-ECH-associated protein 1 (Keap1a and Keap1b) and the inhibitor of κBα (IκBαa and IκBαb) may contribute to regulate the transcriptional activity of Nrf2 and NF-κB, respectively. Contrarily, mRNA levels of Nrf2, NF-κB, Keap1, Keap1b, IκBαa and IκBαb remained stable at 24 and 96h in the brain. Taken together, we demonstrated Cd-induced oxidative stress and immunotoxicity in fish, possibly through transcriptional regulation of Nrf2 and NF-κB and gene modifications at transcriptional, translational, post-translational levels, which would greatly extend our understanding on the Cd

  3. Allergic Potential and Immunotoxicity Induced by Topical Application of 1-Chloro-4-(Trifluoromethyl)Benzene (PCBTF) in a Murine Model

    PubMed Central

    Franko, Jennifer; Jackson, Laurel G.; Meade, B. Jean; Anderson, Stacey E.

    2011-01-01

    The purpose of the studies in this paper was to evaluate the allergic potential, immunotoxicity, and irritancy of the occupationally relevant chemical, 1-chloro-4-(trifluoromethyl)benzene, also known as parachlorobenzotrifluoride (PCBTF), following dermal exposure in a murine model. Evaluation of the sensitization potential, conducted using the local lymph node assay (LLNA) at concentrations ranging from 50% to 100%, identified a dose-dependent increase in lymphocyte proliferation with a calculated EC3 value of 53.1%. While no elevations in total or specific IgE were observed after exposure to any concentration of the chemical, significant increases in IFN-γ protein production by stimulated draining lymphoid cells were observed, indicating a T-cell-mediated response. Dermal exposure to PCBTF was not found to alter the immune response to a T-cell-dependant antigen. These results demonstrate that PCBTF has the potential to induce allergic sensitization following dermal exposure and based on LLNA results would be classified as a weak sensitizer. PMID:21747864

  4. Introduction to Immunotoxicity

    EPA Science Inventory

    Recognition that the immune system is vulnerable to adverse effects after exposure to xenobiotics led to the discipline of immunotoxicology and the subsequent addition of immunotoxicology testing to regulatory guidelines for toxicity. Immunotoxic effects can result in immunosuppr...

  5. The role of fungal proteinases in pathophysiology of Stachybotrys chartarum.

    PubMed

    Yike, Iwona; Rand, Thomas; Dearborn, Dorr G

    2007-10-01

    The adverse health effects of Stachybotrys chartarum have often been linked to exposure to the trichothecene mycotoxins. Recent studies have shown that in addition to mycotoxins this fungus is capable of producing and secreting in vivo proteins such as hemolysins and proteinases. Spore extracts obtained from a high trichothecene producing isolate JS 58-17 exhibited a significantly lower proteolytic activity compared to the low trichothecene producer, JS 58-06. Growing isolates on rice or potato dextrose agar results in higher proteolytic activity of the spores compared to those grown on drywall. Proteinases in the spore extracts can hydrolyze gelatin and collagen I and IV. Analysis of zymograms shows the presence of several proteins with proteolytic activity in the spores of S. chartarum. Human tracheal epithelial cells exposed to spore extracts produced significantly higher levels of IL-6, IL-8, and TNF-alpha than control cells. This stimulation of cytokine production was completely abolished by Pefabloc, a serine protease inhibitor. Neutrophil numbers and proinflammatory cytokine (IL1-beta and TNF-alpha) concentrations were highly elevated in the lungs of 7 day old rat pups exposed intratracheally to 4 x 10(4) spores/gm body weight compared to control. No significant differences in those inflammatory indices in vivo were noted between the treatments with the high trichothecene producer, isolate JS 58-17 and JS 58-06, which does not produce macrocyclic trichothecenes. Immunohistochemistry revealed reduced collagen IV labeling in spore-induced lung granulomas in rat pups exposed to both isolates. These results suggest that proteinases from S. chartarum spores significantly contribute to lung inflammation and injury.

  6. CHARACTERIZATION OF THE HEMOLYSIN, FROM STACHYBOTRYS CHARTARUM

    EPA Science Inventory

    Stachybotrys chartarum is a toxigenic fungus that has been associated with human health concerns, including pulmonary hemorrhage and hemosiderosis. This fungus produces a hemolysin, stachylysin, which in its apparent monomeric form has a molecular mass of 11,920
    Da as determ...

  7. DNA damage, redox changes, and associated stress-inducible signaling events underlying the apoptosis and cytotoxicity in murine alveolar macrophage cell line MH-S by methanol-extracted Stachybotrys chartarum toxins

    SciTech Connect

    Wang Huiyan; Yadav, Jagjit S. . E-mail: Jagjit.Yadav@uc.edu

    2006-08-01

    Spore-extracted toxins of the indoor mold Stachybotrys chartarum (SC) caused cytotoxicity (release of lactate dehydrogenase), inhibition of cell proliferation, and cell death in murine alveolar macrophage cell line MH-S in a dose- and time-dependent manner. Apoptotic cell death, confirmed based on morphological changes, DNA ladder formation, and caspase 3/7 activation, was detectable as early as at 3 h during treatment with a toxin concentration of 1 spore equivalent/macrophage and was preceded by DNA damage beginning at 15 min, as evidenced by DNA comet formation in single cell gel electrophoresis assay. The apoptotic dose of SC toxins did not induce detectable nitric oxide and pro-inflammatory cytokines (IL-1{beta}, IL-6, and TNF-{alpha}) but showed exacerbated cytotoxicity in presence of a non-apoptotic dose of the known pro-inflammatory agent LPS (10 ng/ml). Intracellular reduced glutathione (GSH) level showed a significant decrease beginning at 9 h of the toxin treatment whereas oxidized glutathione (GSSG) showed a corresponding significant increase, indicating a delayed onset of oxidative stress in the apoptosis process. The toxin-treated macrophages accumulated p53, an indicator of DNA damage response, and showed activation of the stress-inducible MAP kinases, JNK, and p38, in a time-dependent manner. Chemical blocking of either p38 or p53 inhibited in part the SC toxin-induced apoptosis whereas blocking of JNK did not show any such effect. This study constitutes the first report on induction of DNA damage and associated p53 activation by SC toxins, and demonstrates the involvement of p38- and p53-mediated signaling events in SC toxin-induced apoptosis of alveolar macrophages.

  8. Immunotoxicity of air pollutants

    SciTech Connect

    Graham, J.A.; Gardner, D.E.

    1984-01-01

    The most common ubiquitous air pollutants, as well as some point source (e.g. metals) air pollutants, decrease the function of pulmonary host defense mechanisms against infection. Most of this knowledge is based on animal studies and involves cellular antibacterial defenses such as alveolar macrophages and mucociliary clearance. Information on viral infectivity is more sparse. Since there is no routine treatment for viral infections which have a relatively high rate of occurrence, this gap in knowledge is of concern. Given the major gaps in knowledge, resaonably accurate assessment of the immunotoxicity of air pollutants is not possible. When the limited data base is reviewed relative to ambient levels of the common pollutants, it appears that acute exposures to O3 and H2SO4 and chronic exposures to NO2 are the major exposures of concern for immunotoxic effects. It is critical to point out, however, that until information is available for chronic exposures to low levels of metals and for exposures to common organic vapors, the immunotoxicity of air pollutants cannot be assessed adequately.

  9. Genome sequence of Stachybotrys chartarum Strain 51-11

    EPA Science Inventory

    Stachybotrys chartarum strain 51-11 genome was sequenced by shotgun sequencing utilizing Illumina Hiseq 2000 and PacBio long read technology. Since Stachybotrys chartarum has been implicated in health impacts within water-damaged buildings, any information extracted from the geno...

  10. Potential for amelioration of aflatoxin B1-induced immunotoxic effects in progeny of White Leghorn breeder hens co-exposed to vitamin E.

    PubMed

    Khan, Wajid Arshad; Khan, Muhammad Zargham; Khan, Ahrar; Ul Hassan, Zahoor; Saleemi, Muhammad Kashif

    2014-01-01

    This study was designed to evaluate the protective activity of Vitamin E (Vit E) on the immunotoxic effects induced by aflatoxin B1 (AFB1) in the progeny of breeder hens. For this purpose, 192 White Leghorn (WL) layer breeder hens were divided into 12 groups (A-L) and then fed test diets for either 1, 2 or 3 weeks. Group A was kept on basal feed (2900 Kcal/kg metabolizable energy) and served as control, while group B was offered a feed supplemented with Vit E at 100 mg/Kg. Groups C-G were offered feed containing 0.1, 0.5, 2.5, 5.0, and 10.0 mg/Kg AFB1, respectively, whereas groups H-L were offered the same dietary levels of AFB1 along with 100 mg/Kg Vit E supplementation. Hatching eggs were shifted to an incubator on a weekly basis to get progeny chicks. Hatched chicks in each group were maintained on basal ration and then subjected to different immunological assays. Lymphoproliferative responses (against PHA-P), antibody titers (against SRBC), oxidative damage to RBC, as well as phagocytic and nitrite production potential of the peritoneal macrophages from the chicks, were all adversely impacted by hen exposure to the higher doses of AFB1 or by increased intake (time) by the hens at a given dose of the toxin. No consistent ameliorative effects from Vit E were noted in these studies, i.e. effects seen against lower AFB1 doses were no longer apparent with the highest doses of AFB1. As such, for now it can be concluded that, with this particular single dose level of Vit E, AFB1-associated immunotoxic effects in progeny chicks can potentially be mitigated by dietary intake of Vit E by their hen dams. However, this is clearly an outcome that is driven by the level of the mycotoxin present in the feed. Future studies need to examine what impact higher Vit E doses than those employed herein might have in these ameliorative outcomes.

  11. Protective effects of meat from lambs on selenium nanoparticle supplemented diet in a mouse model of polycyclic aromatic hydrocarbon-induced immunotoxicity.

    PubMed

    Ungvári, Éva; Monori, István; Megyeri, Attila; Csiki, Zoltán; Prokisch, József; Sztrik, Attila; Jávor, András; Benkő, Ilona

    2014-02-01

    Increased environmental oxidative stress caused primarily by chemicals like polycyclic aromatic hydrocarbons, plays significant role in human diseases. A representative compound, 7,12-dimethylbenz(a)anthracene (DMBA), was used for modeling oxidative damages including the significant decrease of the antioxidant capacity of the blood. Selenium has antioxidant effects but with a narrow therapeutic window. In our current studies to avoid accidental overdose and toxicity selenium was given to meat-producing animals. The standard rodent diet of mice was replaced by meat from lambs either on standard or selenium-enriched diet. Selenium concentration of lamb meat was enhanced three times by nano-selenium administration and an increase in the antioxidant capacity of the blood of mice was measured after the indirect selenium supplementation. Protective effects were also observed against DMBA-induced immunotoxicity. Twice the amount of white blood cells and among them three times more phagocytes survived. Similarly, in their renewal system in bone marrow twice the amount of cells survived and regenerative capacity of granulopoiesis was four times higher than in control DMBA-damaged mice. Our findings suggest functional dietary benefits of lamb meat enriched with selenium by feeding lambs with nanoparticle selenium supplements.

  12. Stachybotrys chartarum alters surfactant-related phospholipid synthesis and CTP:cholinephosphate cytidylyltransferase activity in isolated fetal rat type II cells.

    PubMed

    Hastings, C; Rand, T; Bergen, H T; Thliveris, J A; Shaw, A R; Lombaert, G A; Mantsch, H H; Giles, B L; Dakshinamurti, S; Scott, J E

    2005-03-01

    Stachybotry chartarum, a fungal contaminant of water-damaged buildings commonly grows on damp cellulose-containing materials. It produces a complex array of mycotoxins. Their mechanisms of action on the pulmonary system are not entirely clear. Previous studies suggest spore products may depress formation of disaturated phosphatidylcholine (DSPC), the major surface-active component of pulmonary surfactant (PS). If S. chartarum can indeed affect formation of this phospholipid, then mold exposure may be a significant issue for pulmonary function in both mature lung and developing fetal lung. To address this possibility, fetal rat type II cells, the principal source of DSPC, were used to assess effects of S. chartarum extract on formation of DSPC. Isolated fetal rat lung type II cells prelabeled with 3H-choline and incubated with spore extract showed decreased incorporation of 3H-choline into DSPC. The activity of CTP:cholinephosphate cytidylyltransferase (CPCT), the rate-limiting enzyme in phosphatidylcholine synthesis was reduced by approximately 50% by a 1:10 dilution of spore extract. Two different S. chartarum extracts (isolates from S. chartarum (Cleveland) and S. chartarum (Hawaiian)) were used to compare activity of CPCT in the presence of phosphatidylglycerol (PG), a known activator. PG produced an approximate two-fold increase in CPCT activity. The spore isolate from Hawaii did not alter enzyme activity. S. chartarum (Cleveland) eliminated the PG-induced activation of CPCT. These results support previous observations that mold products alter PS metabolism and may pose a risk in developing lung, inhibiting surfactant synthesis. Different isolates of the same species of fungus are not equivalent in terms of potential exposure risks.

  13. Complete Genome of Stachybotrys chartarum strain 51-11

    EPA Pesticide Factsheets

    Complete genome sequence of the fungus Stachybotrys chartarum. Sequences can be used to identify genes, genetic pathways, gene clusters, genetic organization, etc. utilizing appropriate bioinformatics software.This dataset is associated with the following publication:Betancourt , D., T. Dean , J. Kim, and J. Levy. Genome sequence of Stachybotrys chartarum Strain 51-11. Genome Announcements. American Society for Microbiology, Washington, DC, USA, 3(6): 1114-1115, (2015).

  14. Occurrence of Stachybotrys chartarum chemotype S in dried culinary herbs.

    PubMed

    Biermaier, Barbara; Gottschalk, Christoph; Schwaiger, Karin; Gareis, Manfred

    2015-02-01

    Stachybotrys (S.) chartarum is an omnipresent cellulolytic mould which produces secondary metabolites, such as the highly toxic macrocyclic trichothecenes. While it is known to occur in animal feed like hay and straw as well as in water-damaged indoor environments, there is little knowledge about the occurrence of S. chartarum and its secondary metabolites in food. The objective of the present study was to examine selected dried culinary herbs for the presence of S. chartarum chemotype S, to assess the potential risk of a contamination of foods with macrocyclic trichothecenes. In total, 50 Stachybotrys isolates from different types of culinary herbs (n=100) such as marjoram (Origanum majorana Linné (L.)), oregano (Origanum vulgare L.), thyme (Thymus vulgaris L.), and savory (Satureja hortensis L.) were examined by MTT-cell culture test (effect-based bioassay), ELISA, and by liquid chromatography tandem mass spectrometry (LC-MS/MS). Selected toxic and non-toxic isolates (n=15) were genetically characterized by PCR and sequencing. Five isolates (10%) were highly toxic in the MTT-cell culture test, and the production of macrocyclic trichothecenes was proven by ELISA and LC-MS/MS. These five isolates were genetically confirmed as S. chartarum chemotype S. To the best of our knowledge, this is the first report about a contamination of dried culinary herbs with toxigenic S. chartarum.

  15. Immunotoxicity -- The Risk is Real

    EPA Science Inventory

    Several papers published over the last year represent significant progress in closing the gap between rodent immunotoxicity data and human risk and indicate that, at least for the developing immune system, the concern raised by rodent data is justified. The studies reviewed here...

  16. Immunotoxicity of trenbolone acetate in Japanese quail

    USGS Publications Warehouse

    Quinn, M.J.; McKernan, M.; Lavoie, E.T.; Ottinger, M.A.

    2007-01-01

    Trenbolone acetate is a synthetic androgen that is currently used as a growth promoter in many meat-exporting countries. Despite industry laboratories classifying trenbolone as nonteratogenic, data showed that embryonic exposure to this androgenic chemical altered development of the immune system in Japanese quail. Trenbolone is lipophilic, persistent, and released into the environment in manure used as soil fertilizer. This is the first study to date to assess this chemical's immunotoxic effects in an avian species. A one-time injection of trenbolone into yolks was administered to mimic maternal deposition, and subsequent effects on the development and function of the immune system were determined in chicks and adults. Development of the bursa of Fabricius, an organ responsible for development of the humoral arm of the immune system, was disrupted, as indicated by lower masse, and smaller and fewer follicles at day 1 of hatch. Morphological differences in the bursas persisted in adults, although no differences in either two measures of immune function were observed. Total numbers of circulating leukocytes were reduced and heterophil-lymphocyte ratios were elevated in chicks but not adults. This study shows that trenbolone acetate is teratogenic and immunotoxic in Japanese quail, and provides evidence that the quail immune system may be fairly resilient to embryonic endocrine-disrupting chemical-induced alterations following no further exposure posthatch.

  17. Synergistic interaction in simultaneous exposure to Streptomyces californicus and Stachybotrys chartarum.

    PubMed Central

    Huttunen, Kati; Pelkonen, Jukka; Nielsen, Kristian Fogg; Nuutinen, Ulla; Jussila, Juha; Hirvonen, Maija-Riitta

    2004-01-01

    The microbial exposure associated with health complaints in moldy houses consists of a heterogeneous group of components, including both living and dead bacteria, fungi, and their metabolites and active compounds. However, little is known about the interactions between different microbes and their metabolites, although the cytotoxicity and inflammatory potential of certain individual microbes have been reported. In this study, we investigated the inflammatory responses of mouse RAW264.7 macrophages after exposure to six indoor air microbes (Aspergillus versicolor, Penicillium spinulosum, Stachybotrys chartarum, Bacillus cereus, Mycobacterium terrae, and Pseudomonas fluorescens) alone and together with the actinomycete Streptomyces californicus. The production of nitric oxide, levels of the proinflammatory cytokines tumor necrosis factor alpha (TNF-alpha) and interleukin-6 (IL-6), and cytotoxicity were measured. The coexposure to Sta. chartarum and Str. californicus caused a synergistic increase in the production of IL-6 but not other cytokines. In further experiments, the metabolites from Sta. chartarum or from closely related fungi (atranones B and E, satratoxin G, trichodermin, 7-alpha-hydroxytrichodermol, staplabin, and SMTP-7) and the known fungal toxins sterigmatocystin, citrinin, and ochratoxin A were each tested with Str. californicus. The testing revealed a synergistic response in TNF-alpha and IL-6 production after coexposure to Str. californicus with both trichodermin and 7-alpha-hydroxytrichodermol. Finally, the synergistic inflammatory response caused by Str. californicus and trichodermin together was studied by analyzing for the presence of nuclear factor-kappa-B (NF-kappa-B) in nuclear extracts of the exposed cells. The exposure to Str. californicus induced the binding of NF-kappa-B proteins to the NF-kappa-B consensus sequence as well as to the natural NF-kappa-B site of the IL-6 promoter. Adding trichodermin to the exposure did not increase the DNA

  18. CHARACTERIZATION OF THE HEMOLYSIN, STACHYLYSIN, FROM STACHYBOTRYS CHARTARUM

    EPA Science Inventory

    Stachybotrys chartarum is a toxigenic fungus that has been associated with human health concerns, including pulmonary hemorrhage/hemosiderosis. This fungus produces a hemolysin, stachylysin, which in its monomeric form, has a molecular wieght of 11,920 daltons as determined by m...

  19. STACHYLYSIN MAY BE CAUSE OF HEMORRAHAGING IN STACHYBOTRYS CHARTARUM EXPOSURES

    EPA Science Inventory

    Stachybotrys chartarum is a toxigenic fungus that has been associated with human health concerns like nasal bleeding in adults and pulmonary hemosiderosis (PH) in infants. Stachylysin is a glycosylated protein, with the deglycosylated molecular mass of 21.5 kDa. Seven of eight ...

  20. In vitro testing for direct immunotoxicity: state of the art.

    PubMed

    Lankveld, D P K; Van Loveren, H; Baken, K A; Vandebriel, R J

    2010-01-01

    Immunotoxicity is defined as the toxicological effects of xenobiotics including pharmaceuticals on the functioning of the immune system and can be induced in either direct or indirect ways. Direct immunotoxicity is caused by the effects of chemicals on the immune system, leading to immunosuppression and subsequently to reduced resistance to infectious diseases or certain forms of nongenotoxic carcinogenicity.In vitro testing has several advantages over in vivo testing, such as detailed mechanistic understanding, species extrapolation (parallelogram approach), and reduction, refinement, and replacement of animal experiments. In vitro testing for direct immunotoxicity can be done in a two-tiered approach, the first tier measuring myelotoxicity. If this type of toxicity is apparent, the compound can be designated immunotoxic. If not, the compound is tested for lymphotoxicity (second tier). Several in vitro assays for lymphotoxicity exist, each comprising specific functions of the immune system (cytokine production, cell proliferation, cytotoxic T-cell activity, natural killer cell activity, antibody production, and dendritic cell maturation). A brief description of each assay is provided. Only one assay, the human whole blood cytokine release assay, has undergone formal prevalidation, while another one, the lymphocyte proliferation assay, is progressing towards that phase.Progress in in vitro testing for direct immunotoxicity includes prevalidation of existing assays and selection of the assay (or combination of assays) that performs best. To avoid inter-species extrapolation, assays should preferably use human cells. Furthermore, the use of whole blood has the advantage of comprising multiple cell types in their natural proportion and environment. The so-called "omics" techniques provide additional mechanistic understanding and hold promise for the characterization of classes of compounds and prediction of specific toxic effects. Technical innovations such as high

  1. IMMUNOCYTOCHEMICAL LOCALIZATION OF STACHYLYSIN IN STACHYBOTRYS CHARTARUM SPORES AND SPORE-IMPACTED MOUSE AND RAT LUNG TISSUES

    EPA Science Inventory

    Stachylysin is a proteinaceous hemolytic agent that is producted by S. chartarum. Stachylysin was found, using immunohistochemistical and immunocytochemical methods, to be localized in S. chartarum spores/mycelia primarily in the inner wall suggesting that it is constitutively ...

  2. Modulation of Benzo[a]pyrene induced immunotoxicity in mice actively immunized with a B[a]P-diphtheria toxoid conjugate

    SciTech Connect

    Schellenberger, Mario T.; Grova, Nathalie; Willieme, Stephanie; Farinelle, Sophie; Prodhomme, Emmanuel J.F.

    2009-10-01

    Benzo[a]pyrene (B[a]P) is a small molecular weight carcinogen and the prototype of polycyclic aromatic hydrocarbons (PAHs). While these compounds are primarily known for their carcinogenicity, B[a]P and its metabolites are also toxic for mammalian immune cells. To develop a prophylactic immune strategy against detrimental effects of B[a]P, we have immunized mice with a B[a]P-diphtheria toxoid conjugate vaccine. We showed that high levels of antibodies against B[a]P and its metabolites modulate the redistribution of these PAHs in the blood. After immunization, increased levels of B[a]P and its metabolites were recovered in the blood. B[a]P significantly suppressed the proliferative response of both T and B cells after a sub-acute administration, an effect that was completely reversed by vaccination. In immunized mice also the immunotoxic effect of B[a]P on IFN-{gamma}, IL-12, TNF-{alpha} production and the reduced B cell activation was restored. Finally, our results showed that specific antibodies inhibited the induction of Cyp1a1 by B[a]P in lymphocytes and Cyp1b1 in the liver, enzymes that are known to convert the procarcinogen B[a]P to the ultimate DNA-adduct forming metabolite, a major risk factor of chemical carcinogenesis. Thus, we demonstrate that vaccination with a B[a]P conjugate vaccine based on a carrier protein used in licensed human vaccines reduces immunotoxicity and possibly other detrimental effects associated with B[a]P.

  3. Use of contact hypersensitivity in immunotoxicity testing.

    PubMed

    Descotes, Jacques

    2010-01-01

    The histopathological examination of lymphoid organs together with a T-dependent antibody (TDAR) assay are the primary components of preclinical immunotoxicity assessment. Additional testing including measurement of cellular immunity may be considered. Besides ex vivo lymphocyte proliferation assays, either delayed or contact hypersensitivity models can be used. Contact hypersensitivity testing is typically performed either in mice or in guinea pigs and is directly derived from classical models used for the detection of contact sensitizing chemicals. Whatever the selected model, it is comprised of a sensitizing phase where the animals are applied a strong contact sensitizer topically, then a rest phase, and finally an eliciting phase where sensitized animals are challenged topically with the same contact sensitizer.In mice, the ear-swelling test is the reference procedure in which mice are sensitized to the ear or shaved abdominal skin and then challenged on the ear. Ear swelling usually measured from ear thickness reflects a cell-mediated immune response. In guinea pigs, a strong sensitizer is applied on the shaved skin of the abdomen or the interscapular area. The sensitized animals are challenged on another area of the shaved abdomen, and the cell-mediated response is assessed semiquantitatively from the magnitude of induced erythema inconsistently associated with edema. Treatment or exposure with immunosuppressive chemicals can result in a significantly decreased ear swelling or skin reaction. Contact hypersensitivity models are seldom used nowadays in preclinical immunotoxicity testing, most likely because of the lack of standardization and extensive validation as well as their use being restricted to mice or guinea pigs.

  4. Biomechanics of conidial dispersal in the toxic mold Stachybotrys chartarum.

    PubMed

    Tucker, Kathryn; Stolze, Jessica L; Kennedy, Aaron H; Money, Nicholas P

    2007-07-01

    Conidial dispersal in Stachybotrys chartarum in response to low-velocity airflow was studied using a microflow apparatus. The maximum rate of spore release occurred during the first 5 min of airflow, followed by a dramatic reduction in dispersal that left more than 99% of the conidia attached to their conidiophores. Micromanipulation of undisturbed colonies showed that micronewton (microN) forces were needed to dislodge spore clusters from their supporting conidiophores. Calculations show that airspeeds that normally prevail in the indoor environment disturb colonies with forces that are 1000-fold lower, in the nanonewton (nN) range. Low-velocity airflow does not, therefore, cause sufficient disturbance to disperse a large proportion of the conidia of S. chartarum.

  5. Biomechanics of conidial dispersal in the toxic mold Stachybotrys chartarum

    PubMed Central

    Tucker, Kathryn; Stolze, Jessica L.; Kennedy, Aaron H.; Money, Nicholas P.

    2007-01-01

    Conidial dispersal in Stachybotrys chartarum in response to low-velocity airflow was studied using a microflow apparatus. The maximum rate of spore release occurred during the first 5 min of airflow, followed by a dramatic reduction in dispersal that left more than 99% of the conidia attached to their conidiophores. Micromanipulation of undisturbed colonies showed that micronewton (μN) forces were needed to dislodge spore clusters from their supporting conidiophores. Calculations show that airspeeds that normally prevail in the indoor environment disturb colonies with forces that are 1,000-fold lower, in the nanonewton (nN) range. Low-velocity airflow does not, therefore, cause sufficient disturbance to disperse a large proportion of the conidia of S. chartarum. PMID:17267247

  6. GROWTH RESPONSE OF STACHYBOTRYS CHARTARUM TO MOISTURE VARIATION ON COMMON BUILDING MATERIALS

    EPA Science Inventory

    The mold Stachybotrys chartarum has been found to be associated with idiopathic pulmonary hemorrhage in infants and has been studied for toxin production and its occurrence in water damaged buildings. Growth of S. chartarum on building materials such as drywall has been frequentl...

  7. ELISA MEASUREMENT OF STACHYLYSIN IN SERUM TO QUANTIFY HUMAN EXPOSURES TO THE INDOOR MOLD STACHYBOTRYS CHARTARUM

    EPA Science Inventory

    Problem- To develop a measurable indicator of human exposure to Stachybotys chartarum.

    Methods- Antibodies were produced against the hemolytic agent stachylysin obtained from the mold S. chartarum. These antibodies were used to develop two enzyme-linked immunosorbent ass...

  8. FACTORS RELATING TO THE RELEASE OF STACHYBOTRYS CHARTARUM SPORES FROM CONTAMINATED SOURCES

    EPA Science Inventory

    The paper describes preliminary results of a research project to determine the factors that control the release of S. chartarum spores from a contaminated source and test ways to reduce spore release and thus exposure. As anticipated, S. chartarum spore emissions from gypsum boar...

  9. GERMINATION, VIABILITY AND CLEARANCE OF STACHYBOTRYS CHARTARUM IN THE LUNGS OF INFANT RATS

    EPA Science Inventory

    The fungus Stachybotrys chartarum has been associated with many adverse health effects including the condition known as idiopathic pulmonary hemorrhage in infants. In order to gain some insight into possible mechanisms, viable conidia of S. chartarum were instilled into the lung...

  10. AN EXTRACT OF STACHYBOTRYS CHARTARUM CAUSES ALLERGIC RESPONSE IN A BALB/C MOUSE MODEL

    EPA Science Inventory

    ABSTRACT
    Environmental exposure to Stachybotrys chartarum has been associated with adverse health effects in humans. The goal of this study was to assess soluble components of this fungus for allergenic potential. Five isolates of S. chartarum were combined and extracted to fo...

  11. Use of SRBC antibody responses for immunotoxicity testing.

    PubMed

    Ladics, Gregory S

    2007-01-01

    The production of antigen-specific antibodies represents a major defense mechanism of humoral immune responses and involves the cooperation and interaction of several immune cell types: antigen presenting cells, T helper cells, and B cells. Thus, there are several cells or cell products (e.g., interleukins) that may be altered following xenobiotic exposure, making assays that evaluate the production of antigen specific antibody a relatively comprehensive and sensitive assessment of immune function. Data suggest that the primary antibody response to SRBC may be one of the most sensitive endpoints available to assess chemical-induced alterations to the immune system. As a result, this endpoint has become the cornerstone of several recently established guidelines for assessing the potential immunotoxicity of xenobiotics. Five types of antibody may be produced in a humoral immune response (i.e., IgGs of various subtypes, IgM, IgD, IgA, or IgE). For immunotoxicity assessment, the focus has primarily been on assays that assess production of IgM antibodies. Although a number of assays have been developed to evaluate antibody production, the antibody forming cell (AFC) assay and enzyme-linked immunosorbent assay (ELISA) are the two most frequently employed to evaluate the potential immunotoxicity of a xenobiotic. In this manuscript, background information, as well as the pros and cons of each of these assays are discussed and detailed methods on conducting each assay are provided.

  12. The peptide toxin amylosin of Bacillus amyloliquefaciens from moisture-damaged buildings is immunotoxic, induces potassium efflux from mammalian cells, and has antimicrobial activity.

    PubMed

    Rasimus-Sahari, Stiina; Teplova, Vera V; Andersson, Maria A; Mikkola, Raimo; Kankkunen, Päivi; Matikainen, Sampsa; Gahmberg, Carl G; Andersson, Leif C; Salkinoja-Salonen, Mirja

    2015-04-01

    Amylosin, a heat-stable channel-forming non-ribosomally synthesized peptide toxin produced by strains of Bacillus amyloliquefaciens isolated from moisture-damaged buildings, is shown in this paper to have immunotoxic and cytotoxic effects on human cells as well as antagonistic effects on microbes. Human macrophages exposed to 50 ng of amylosin ml(-1) secreted high levels of cytokines interleukin-1β (IL-1β) and IL-18 within 2 h, indicating activation of the NLRP3 inflammasome, an integral part of the innate immune system. At the same exposure level, expression of IL-1β and IL-18 mRNA increased. Amylosin caused dose-dependent potassium ion efflux from all tested mammalian cells (human monocytes and keratinocytes and porcine sperm cells) at 1 to 2 μM exposure. Amylosin also inhibited the motility of porcine sperm cells and depolarized the mitochondria of human keratinocytes. Amylosin may thus trigger the activation of the NLRP3 inflammasome and subsequently cytokine release by causing potassium efflux from exposed cells. The results of this study indicate that exposure to amylosin activates the innate immune system, which could offer an explanation for the inflammatory symptoms experienced by occupants of moisture-damaged buildings. In addition, the amylosin-producing B. amyloliquefaciens inhibited the growth of both prokaryotic and eukaryotic indoor microbes, and purified amylosin also had an antimicrobial effect. These antimicrobial effects could make amylosin producers dominant and therefore significant causal agents of health problems in some moisture-damaged sites.

  13. From immunotoxicity to carcinogenicity: the effects of carbamate pesticides on the immune system.

    PubMed

    Dhouib, Ines; Jallouli, Manel; Annabi, Alya; Marzouki, Soumaya; Gharbi, Najoua; Elfazaa, Saloua; Lasram, Mohamed Montassar

    2016-05-01

    The immune system can be the target of many chemicals, with potentially severe adverse effects on the host's health. In the literature, carbamate (CM) pesticides have been implicated in the increasing prevalence of diseases associated with alterations of the immune response, such as hypersensitivity reactions, some autoimmune diseases and cancers. CMs may initiate, facilitate, or exacerbate pathological immune processes, resulting in immunotoxicity by induction of mutations in genes coding for immunoregulatory factors and modifying immune tolerance. In the present study, direct immunotoxicity, endocrine disruption and inhibition of esterases activities have been introduced as the main mechanisms of CMs-induced immune dysregulation. Moreover, the evidence on the relationship between CM pesticide exposure, dysregulation of the immune system and predisposition to different types of cancers, allergies, autoimmune and infectious diseases is criticized. In addition, in this review, we will discuss the relationship between immunotoxicity and cancer, and the advances made toward understanding the basis of cancer immune evasion.

  14. Indoor mold, toxigenic fungi, and Stachybotrys chartarum: infectious disease perspective.

    PubMed

    Kuhn, D M; Ghannoum, M A

    2003-01-01

    Damp buildings often have a moldy smell or obvious mold growth; some molds are human pathogens. This has caused concern regarding health effects of moldy indoor environments and has resulted in many studies of moisture- and mold-damaged buildings. Recently, there have been reports of severe illness as a result of indoor mold exposure, particularly due to Stachybotrys chartarum. While many authors describe a direct relationship between fungal contamination and illness, close examination of the literature reveals a confusing picture. Here, we review the evidence regarding indoor mold exposure and mycotoxicosis, with an emphasis on S. chartarum. We also examine possible end-organ effects, including pulmonary, immunologic, neurologic, and oncologic disorders. We discuss the Cleveland infant idiopathic pulmonary hemorrhage reports in detail, since they provided important impetus for concerns about Stachybotrys. Some valid concerns exist regarding the relationship between indoor mold exposure and human disease. Review of the literature reveals certain fungus-disease associations in humans, including ergotism (Claviceps species), alimentary toxic aleukia (Fusarium), and liver disease (Aspergillys). While many papers suggest a similar relationship between Stachybotrys and human disease, the studies nearly uniformly suffer from significant methodological flaws, making their findings inconclusive. As a result, we have not found well-substantiated supportive evidence of serious illness due to Stachybotrys exposure in the contemporary environment. To address issues of indoor mold-related illness, there is an urgent need for studies using objective markers of illness, relevant animal models, proper epidemiologic techniques, and examination of confounding factors.

  15. Indoor Mold, Toxigenic Fungi, and Stachybotrys chartarum: Infectious Disease Perspective

    PubMed Central

    Kuhn, D. M.; Ghannoum, M. A.

    2003-01-01

    Damp buildings often have a moldy smell or obvious mold growth; some molds are human pathogens. This has caused concern regarding health effects of moldy indoor environments and has resulted in many studies of moisture- and mold-damaged buildings. Recently, there have been reports of severe illness as a result of indoor mold exposure, particularly due to Stachybotrys chartarum. While many authors describe a direct relationship between fungal contamination and illness, close examination of the literature reveals a confusing picture. Here, we review the evidence regarding indoor mold exposure and mycotoxicosis, with an emphasis on S. chartarum. We also examine possible end-organ effects, including pulmonary, immunologic, neurologic, and oncologic disorders. We discuss the Cleveland infant idiopathic pulmonary hemorrhage reports in detail, since they provided important impetus for concerns about Stachybotrys. Some valid concerns exist regarding the relationship between indoor mold exposure and human disease. Review of the literature reveals certain fungus-disease associations in humans, including ergotism (Claviceps species), alimentary toxic aleukia (Fusarium), and liver disease (Aspergillys). While many papers suggest a similar relationship between Stachybotrys and human disease, the studies nearly uniformly suffer from significant methodological flaws, making their findings inconclusive. As a result, we have not found well-substantiated supportive evidence of serious illness due to Stachybotrys exposure in the contemporary environment. To address issues of indoor mold-related illness, there is an urgent need for studies using objective markers of illness, relevant animal models, proper epidemiologic techniques, and examination of confounding factors. PMID:12525430

  16. Method for detection of Stachybotrys chartarum in pure culture and field samples using quantitative polymerase chain reaction

    DOEpatents

    Cruz-Perez, Patricia; Buttner, Mark P.

    2004-05-11

    A method for detecting the fungus Stachybotrys chartarum includes isolating DNA from a sample suspected of containing the fungus Stachybotrys chartarum. The method further includes subjecting the DNA to polymerase chain reaction amplification utilizing at least one of several primers, the several primers each including one of the base sequences 5'GTTGCTTCGGCGGGAAC3', 5'TTTGCGTTTGCCACTCAGAG3', 5'ACCTATCGTTGCTTCGGCG3', and 5'GCGTTTGCCACTCAGAGAATACT3'. The method additionally includes detecting the fungus Stachybotrys chartarum by visualizing the product of the polymerase chain reaction.

  17. Coexposure to mercury increases immunotoxicity of trichloroethylene.

    PubMed

    Gilbert, Kathleen M; Rowley, Benjamin; Gomez-Acevedo, Horacio; Blossom, Sarah J

    2011-02-01

    We have shown previously that chronic (32 weeks) exposure to occupationally relevant concentrations of the environmental pollutant trichloroethylene (TCE) induced autoimmune hepatitis (AIH) in autoimmune-prone MRL+/+ mice. In real-life, individuals are never exposed to only one chemical such as TCE. However, very little is known about the effects of chemical mixtures on the immune system. The current study examined whether coexposure to another known immunotoxicant, mercuric chloride (HgCl(2)), altered TCE-induced AIH. Female MRL+/+ mice were treated for only 8 weeks with TCE (9.9 or 186.9 mg/kg/day in drinking water) and/or HgCl(2) (260 μg/kg/day, sc). Unlike mice exposed to either TCE or HgCl(2) alone, mice exposed to both toxicants for 8 weeks developed significant liver pathology commensurate with early stages of AIH. Disease development in the coexposed mice was accompanied by a unique pattern of anti-liver and anti-brain antibodies that recognized, among others, a protein of approximately 90 kDa. Subsequent immunoblotting showed that sera from the coexposed mice contained antibodies specific for heat shock proteins, a chaperone protein targeted by antibodies in patients with AIH. Thus, although TCE can promote autoimmune disease following chronic exposure, a shorter exposure to a binary mixture of TCE and HgCl(2) accelerated disease development. Coexposure to TCE and HgCl(2) also generated a unique liver-specific antibody response not found in mice exposed to a single toxicant. This finding stresses the importance of including mixtures in assessments of chemical immunotoxicity.

  18. Value of phagocyte function screening for immunotoxicity of nanoparticles in vivo

    PubMed Central

    Fröhlich, Eleonore

    2015-01-01

    Nanoparticles (NPs) present in the environment and in consumer products can cause immunotoxic effects. The immune system is very complex, and in vivo studies are the gold standard for evaluation. Due to the increased amount of NPs that are being developed, cellular screening assays to decrease the amount of NPs that have to be tested in vivo are highly needed. Effects on the unspecific immune system, such as effects on phagocytes, might be suitable for screening for immunotoxicity because these cells mediate unspecific and specific immune responses. They are present at epithelial barriers, in the blood, and in almost all organs. This review summarizes the effects of carbon, metal, and metal oxide NPs used in consumer and medical applications (gold, silver, titanium dioxide, silica dioxide, zinc oxide, and carbon nanotubes) and polystyrene NPs on the immune system. Effects in animal exposures through different routes are compared to the effects on isolated phagocytes. In addition, general problems in the testing of NPs, such as unknown exposure doses, as well as interference with assays are mentioned. NPs appear to induce a specific immunotoxic pattern consisting of the induction of inflammation in normal animals and aggravation of pathologies in disease models. The evaluation of particle action on several phagocyte functions in vitro may provide an indication on the potency of the particles to induce immunotoxicity in vivo. In combination with information on realistic exposure levels, in vitro studies on phagocytes may provide useful information on the health risks of NPs. PMID:26060398

  19. A comparison of immunotoxic effects of nanomedicinal products with regulatory immunotoxicity testing requirements

    PubMed Central

    Giannakou, Christina; Park, Margriet VDZ; de Jong, Wim H; van Loveren, Henk; Vandebriel, Rob J; Geertsma, Robert E

    2016-01-01

    Nanomaterials (NMs) are attractive for biomedical and pharmaceutical applications because of their unique physicochemical and biological properties. A major application area of NMs is drug delivery. Many nanomedicinal products (NMPs) currently on the market or in clinical trials are most often based on liposomal products or polymer conjugates. NMPs can be designed to target specific tissues, eg, tumors. In virtually all cases, NMPs will eventually reach the immune system. It has been shown that most NMs end up in organs of the mononuclear phagocytic system, notably liver and spleen. Adverse immune effects, including allergy, hypersensitivity, and immunosuppression, have been reported after NMP administration. Interactions of NMPs with the immune system may therefore constitute important side effects. Currently, no regulatory documents are specifically dedicated to evaluate the immunotoxicity of NMs or NMPs. Their immunotoxicity assessment is performed based on existing guidelines for conventional substances or medicinal products. Due to the unique properties of NMPs when compared with conventional medicinal products, it is uncertain whether the currently prescribed set of tests provides sufficient information for an adequate evaluation of potential immunotoxicity of NMPs. The aim of this study was therefore, to compare the current regulatory immunotoxicity testing requirements with the accumulating knowledge on immunotoxic effects of NMPs in order to identify potential gaps in the safety assessment. This comparison showed that immunotoxic effects, such as complement activation-related pseudoallergy, myelosuppression, inflammasome activation, and hypersensitivity, are not readily detected by using current testing guidelines. Immunotoxicity of NMPs would be more accurately evaluated by an expanded testing strategy that is equipped to stratify applicable testing for the various types of NMPs. PMID:27382281

  20. A comparison of immunotoxic effects of nanomedicinal products with regulatory immunotoxicity testing requirements.

    PubMed

    Giannakou, Christina; Park, Margriet Vdz; de Jong, Wim H; van Loveren, Henk; Vandebriel, Rob J; Geertsma, Robert E

    2016-01-01

    Nanomaterials (NMs) are attractive for biomedical and pharmaceutical applications because of their unique physicochemical and biological properties. A major application area of NMs is drug delivery. Many nanomedicinal products (NMPs) currently on the market or in clinical trials are most often based on liposomal products or polymer conjugates. NMPs can be designed to target specific tissues, eg, tumors. In virtually all cases, NMPs will eventually reach the immune system. It has been shown that most NMs end up in organs of the mononuclear phagocytic system, notably liver and spleen. Adverse immune effects, including allergy, hypersensitivity, and immunosuppression, have been reported after NMP administration. Interactions of NMPs with the immune system may therefore constitute important side effects. Currently, no regulatory documents are specifically dedicated to evaluate the immunotoxicity of NMs or NMPs. Their immunotoxicity assessment is performed based on existing guidelines for conventional substances or medicinal products. Due to the unique properties of NMPs when compared with conventional medicinal products, it is uncertain whether the currently prescribed set of tests provides sufficient information for an adequate evaluation of potential immunotoxicity of NMPs. The aim of this study was therefore, to compare the current regulatory immunotoxicity testing requirements with the accumulating knowledge on immunotoxic effects of NMPs in order to identify potential gaps in the safety assessment. This comparison showed that immunotoxic effects, such as complement activation-related pseudoallergy, myelosuppression, inflammasome activation, and hypersensitivity, are not readily detected by using current testing guidelines. Immunotoxicity of NMPs would be more accurately evaluated by an expanded testing strategy that is equipped to stratify applicable testing for the various types of NMPs.

  1. Identification of putative sequence specific PCR primers for detection of the toxigenic fungal species Stachybotrys chartarum.

    PubMed

    Haugland, R A; Heckman, J L

    1998-12-01

    The nucleotide sequence of a c 936 bp segment of the nuclear rRNA gene operon was determined for the toxigenic fungal species Stachybotrys chartarum and for other species of Stachybotrys and the related genus Memnoniella. This information was used to infer the phylogenetic relationships of these organisms and to search for sequence specific polymerase chain reaction (PCR) primers for S. chartarum in the internal transcribed spacer (ITS) regions. Searches for candidate primers were performed both by computer using the commercially available Oligo(R) v5.0 primer analysis software package and by manual inspection of the aligned sequences. Primers identified in both types of searches were evaluated for their specificities using a priming efficiency analysis algorithm available in the Oligo(R) 5.0 software. The automated computer searches were unsuccessful in finding S. chartarum-specific primers but did identify a group-specific reverse primer (designated as StacR4) for a phylogenetically related cluster of species that included S. chartarum. Manual searches led to the identification of a reverse primer (designated as StacR3) that was predicted to be specific for only S. chartarum and one other species of Stachybotrys. Experimental PCR analyses using these primers in conjunction with a universal forward primer indicated that the computer-generated amplification efficiency predictions were correct in most instances. A notable exception was the finding that StacR3 was specific only for S. chartarum. The relative merits of different PCR strategies for the detection of S. chartarum employing either one or both of the primers identified in this study are discussed.

  2. Subacute immunotoxicity of the marine phycotoxin yessotoxin in rats.

    PubMed

    Ferreiro, Sara F; Vilariño, Natalia; Carrera, Cristina; Louzao, M Carmen; Santamarina, Germán; Cantalapiedra, Antonio G; Cifuentes, J Manuel; Vieira, Andrés C; Botana, Luis M

    2017-04-01

    Yessotoxin (YTX) is a marine phycotoxin produced by dinoflagellates and accumulated in filter feeding shellfish. YTX content in shellfish is regulated by many food safety authorities to protect human health, although currently no human intoxication episodes have been unequivocally related to YTX presence in food. The immune system has been proposed as one of the target organs of YTX due to alterations of lymphoid tissues and cellular and humoral components. The aim of the present study was to explore subacute immunotoxicity of YTX in rats by evaluating the haematological response, inflammatory cytokine biomarkers and the presence of YTX-induced structural alterations in the spleen and thymus. The results showed that repeated administrations of YTX caused a decrease of lymphocyte percentage and an increase of neutrophil counts, a reduction in interleukine-6 (IL-6) plasmatic levels and histopathological splenic alterations in rats after four intraperitoneal injections of YTX at doses of 50 or 70 μg/kg that were administered every 4 days along a period of 15 days. Therefore, for the first time, subacute YTX-immunotoxicity is reported in rats, suggesting that repeated exposures to low amounts of YTX might also suppose a threat to human health, especially in immuno-compromised populations.

  3. AN EXTRACT OF STACHYBOTRYS CHARTARUM CAUSES ALLERGIC RESPONSES IN A BALB/C MOUSE MODEL: I. BIOCHEMICAL AND PATHOLOGICAL RESPONSES

    EPA Science Inventory

    Environmental exposure to Stachybotrys chartarum has been associated with adverse health effects in humans. The goal of this study was to assess soluble components of this fungus for allergenic potential. Five isolates of S. chartarum were combined and extracted to form a crude...

  4. The effect of spaceflight on growth of Ulocladium chartarum colonies on the international space station.

    PubMed

    Gomoiu, Ioana; Chatzitheodoridis, Elias; Vadrucci, Sonia; Walther, Isabelle

    2013-01-01

    The objectives of this 14 days experiment were to investigate the effect of spaceflight on the growth of Ulocladium chartarum, to study the viability of the aerial and submerged mycelium and to put in evidence changes at the cellular level. U. chartarum was chosen for the spaceflight experiment because it is well known to be involved in biodeterioration of organic and inorganic substrates covered with organic deposits and expected to be a possible contaminant in Spaceships. Colonies grown on the International Space Station (ISS) and on Earth were analysed post-flight. This study clearly indicates that U. chartarum is able to grow under spaceflight conditions developing, as a response, a complex colony morphotype never mentioned previously. We observed that spaceflight reduced the rate of growth of aerial mycelium, but stimulated the growth of submerged mycelium and of new microcolonies. In Spaceships and Space Stations U. chartarum and other fungal species could find a favourable environment to grow invasively unnoticed in the depth of surfaces containing very small amount of substrate, posing a risk factor for biodegradation of structural components, as well as a direct threat for crew health. The colony growth cycle of U. chartarum provides a useful eukaryotic system for the study of fungal growth under spaceflight conditions.

  5. The Effect of Spaceflight on Growth of Ulocladium chartarum Colonies on the International Space Station

    PubMed Central

    Gomoiu, Ioana; Chatzitheodoridis, Elias; Vadrucci, Sonia; Walther, Isabelle

    2013-01-01

    The objectives of this 14 days experiment were to investigate the effect of spaceflight on the growth of Ulocladium chartarum, to study the viability of the aerial and submerged mycelium and to put in evidence changes at the cellular level. U. chartarum was chosen for the spaceflight experiment because it is well known to be involved in biodeterioration of organic and inorganic substrates covered with organic deposits and expected to be a possible contaminant in Spaceships. Colonies grown on the International Space Station (ISS) and on Earth were analysed post-flight. This study clearly indicates that U. chartarum is able to grow under spaceflight conditions developing, as a response, a complex colony morphotype never mentioned previously. We observed that spaceflight reduced the rate of growth of aerial mycelium, but stimulated the growth of submerged mycelium and of new microcolonies. In Spaceships and Space Stations U. chartarum and other fungal species could find a favourable environment to grow invasively unnoticed in the depth of surfaces containing very small amount of substrate, posing a risk factor for biodegradation of structural components, as well as a direct threat for crew health. The colony growth cycle of U. chartarum provides a useful eukaryotic system for the study of fungal growth under spaceflight conditions. PMID:23637980

  6. In vitro evaluation of the immunotoxic potential of perfluorinated compounds (PFCs).

    PubMed

    Corsini, Emanuela; Avogadro, Anna; Galbiati, Valentina; dell'Agli, Mario; Marinovich, Marina; Galli, Corrado L; Germolec, Dori R

    2011-01-15

    There is evidence from both epidemiology and laboratory studies that perfluorinated compounds may be immunotoxic, affecting both cell-mediated and humoral immunity. The overall goal of this study was to investigate the mechanisms underlying the immunotoxic effects of perfluorooctane sulfonate (PFOS) and perfluorooctane acid (PFOA), using in vitro assays. The release of the pro-inflammatory cytokines IL-6, IL-8, and TNF-α was evaluated in lipolysaccharide (LPS)-stimulated human peripheral blood leukocytes and in the human promyelocytic cell line THP-1, while the release of IL-4, IL-10 and IFN-γ was evaluated in phytohaemagglutinin (PHA)-stimulated peripheral blood leukocytes. PFOA and PFOS suppressed LPS-induced TNF-α production in primary human cultures and THP-1 cells, while IL-8 was suppressed only in THP-1 cells. IL-6 release was decreased only by PFOS. Both PFOA and PFOS decreased T-cell derived, PHA-induced IL-4 and IL-10 release, while IFN-γ release was affected only by PFOS. In all instances, PFOS was more potent than PFOA. Mechanistic investigations carried out in THP-1 cells demonstrated that the effect on cytokine release was pre-transcriptional, as assessed by a reduction in LPS-induced TNF-α mRNA expression. Using siRNA, a role for PPAR-α could be demonstrated for PFOA-induced immunotoxicity, while an inhibitory effect on LPS-induced I-κB degradation could explain the immunomodulatory effect of PFOS. The dissimilar role of PPAR-α in PFOA and PFOS-induced immunotoxicity was consistent with the differing effects observed on LPS-induced MMP-9 release: PFOA, as the PPAR-α agonist fenofibrate, modulated the release, while PFOS had no effect. Overall, these studies suggest that PFCs directly suppress cytokine secretion by immune cells, and that PFOA and PFOS have different mechanisms of action.

  7. In vitro evaluation of the immunotoxic potential of perfluorinated compounds (PFCs)

    SciTech Connect

    Corsini, Emanuela; Avogadro, Anna; Galbiati, Valentina; Dell'Agli, Mario; Marinovich, Marina; Galli, Corrado L.; Germolec, Dori R.

    2011-01-15

    There is evidence from both epidemiology and laboratory studies that perfluorinated compounds may be immunotoxic, affecting both cell-mediated and humoral immunity. The overall goal of this study was to investigate the mechanisms underlying the immunotoxic effects of perfluorooctane sulfonate (PFOS) and perfluorooctane acid (PFOA), using in vitro assays. The release of the pro-inflammatory cytokines IL-6, IL-8, and TNF-{alpha} was evaluated in lipolysaccharide (LPS)-stimulated human peripheral blood leukocytes and in the human promyelocytic cell line THP-1, while the release of IL-4, IL-10 and IFN-{gamma} was evaluated in phytohaemagglutinin (PHA)-stimulated peripheral blood leukocytes. PFOA and PFOS suppressed LPS-induced TNF-{alpha} production in primary human cultures and THP-1 cells, while IL-8 was suppressed only in THP-1 cells. IL-6 release was decreased only by PFOS. Both PFOA and PFOS decreased T-cell derived, PHA-induced IL-4 and IL-10 release, while IFN-{gamma} release was affected only by PFOS. In all instances, PFOS was more potent than PFOA. Mechanistic investigations carried out in THP-1 cells demonstrated that the effect on cytokine release was pre-transcriptional, as assessed by a reduction in LPS-induced TNF-{alpha} mRNA expression. Using siRNA, a role for PPAR-{alpha} could be demonstrated for PFOA-induced immunotoxicity, while an inhibitory effect on LPS-induced I-{kappa}B degradation could explain the immunomodulatory effect of PFOS. The dissimilar role of PPAR-{alpha} in PFOA and PFOS-induced immunotoxicity was consistent with the differing effects observed on LPS-induced MMP-9 release: PFOA, as the PPAR-{alpha} agonist fenofibrate, modulated the release, while PFOS had no effect. Overall, these studies suggest that PFCs directly suppress cytokine secretion by immune cells, and that PFOA and PFOS have different mechanisms of action.

  8. Immunotoxicity of mercury: Pathological and toxicological effects.

    PubMed

    Maqbool, Faheem; Niaz, Kamal; Hassan, Fatima Ismail; Khan, Fazlullah; Abdollahi, Mohammad

    2017-01-02

    Mercury (Hg) is toxic and hazardous metal that causes natural disasters in the earth's crust. Exposure to Hg occurs via various routes; like oral (fish), inhalation, dental amalgams, and skin from cosmetics. In this review, we have discussed the sources of Hg and its potential for causing toxicity in humans. In addition, we also review its bio-chemical cycling in the environment; its systemic, immunotoxic, genotoxic/carcinogenic, and teratogenic health effects; and the dietary influences; as well as the important considerations in risk assessment and management of Hg poisoning have been discussed in detail. Many harmful outcomes have been reported, which will provide more awareness.

  9. INITIAL CHARACTERIZATION OF MONOCLONAL ANTIBODIES AGAINST THE FUNGAL HEMOLYSIN STACHYLYSIN FROM STACHYBOTRYS CHARTARUM

    EPA Science Inventory

    Stachybotrys chartarum is known to produce the hemolysin stachylysin and its detection in human serum has been proposed as a biomarker for exposure to the fungus. In this study we report the initial characterization of monoclonal antibodies (mAbs) against stachylysin and the dev...

  10. IDENTIFICATION OF SEQUENCE SPECIFIC PCR PRIMERS FOR DETECTION OF THE TOXIGENIC FUNGAL SPECIES STACHYBOTRYS CHARTARUM

    EPA Science Inventory

    The nucleotide sequence of a 936 bp segment of the nuclear rRNA gene operon was determined for the toxigenic fungal species Stachybotrys chartarum and for other species of Stachybotrys and the related genus Memnoniella. This information was used to infer the phylogenitic relati...

  11. IDENTIFICATION OF PUTATIVE SEQUENCE SPECIFIC PCR PRIMERS FOR DETECTION OF THE TOXIGENIC FUNGAL SPECIES STACHYBOTRYS CHARTARUM

    EPA Science Inventory

    The nucleotide sequence of a c 936 bp segment of the nuclear rRNA gene operon was determined for the toxigenic fungal species Stachybotrys chartarum and for other species of Stachbotrys and the related genus Memnoniella. This information was used to infer the phylogenetic relatio...

  12. Microbial Volatile Organic Compound Emissions from Stachybotrys chartarum growing on Gypsum Wallboard and Ceiling tile

    EPA Science Inventory

    This study compared seven toxigenic strains of S. chartarum found in water-damaged buildings to characterize the microbial volatile organic compound (MVOC) emissions profile while growing on gypsum wallboard (W) and ceiling tile (C) coupons. The inoculated coupons with their sub...

  13. The relative allergenicity of Stachybotrys chartarum compared to house dust mite extracts in a mouse model

    EPA Science Inventory

    A report by the Institute of Medicine suggested that more research is needed to better understand mold effects on allergic disease, particularly asthma development. The authors compared the ability of the fungus Stachybotrys chartarum (SCE) and house dust mite (HDM) extracts to i...

  14. CHARACTERIZATION OF MICROBIAL VOLATILE ORGANIC COMPOUNDS (MVOC) EMITTED BY STACHYBOTRYS CHARTARUM

    EPA Science Inventory

    Stachybotrys chartarum is a filamentous fungi usually found in water-damaged buildings. Severe illnesses have been reported after indoor exposure to this mold. Toxicity has caused the production of secondary metabolites or mycotoxins, and the emission of by-products, specifically...

  15. Identification of a Novel Fungus, Leptosphaerulina chartarum SJTU59 and Characterization of Its Xylanolytic Enzymes

    PubMed Central

    Wu, Qiong; Li, Yaqian; Li, Yingying; Gao, Shigang; Wang, Meng; Zhang, Tailong; Chen, Jie

    2013-01-01

    Xylanolytic enzymes are widely used in processing industries, e.g., pulp and paper, food, livestock feeds, and textile. Furthermore, certain xylanotic enzymes have demonstrated the capability to improve the resistance and immunity of plants. Screening of high-yield microbial xylanolytic enzyme producers is significant for improving large-scale cost-effective xylanolytic enzyme production. This study provided new evidence of high-level xylanolytic enzyme production by a novel fungus, designated Leptosphaerulina chartarum SJTU59. Under laboratory conditions, L. chartarum SJTU59 produced xylanolytic enzymes of up to 17.566 U/mL (i.e., 878.307 U/g substrate). The enzyme solution was relatively stable over a wide range of pH (pH 3.0 to pH 9.0) and temperature (40°C to 65°C) while showing high resistance to the majority of metal ions tested. Composition analysis of the hydrolytic products of xylan showed sufficient degradation by xylanolytic enzymes from L. chartarum SJTU59, mainly the monosaccharide xylose, and a small amount of xylobiose were enzymatically produced; whereas in the presence of sufficient xylan substrates, mainly xylooligosaccharides, an emerging prebiotic used in food industry, were produced. In addition, the xylanolytic enzyme preparation from L. chartarum SJTU59 could initiate tissue necrosis and oxidative burst in tobacco leaves, which may be related to enhanced plant defense to adversity and disease. L. chartarum SJTU59 possessed a complex xylanolytic enzyme system, from which two novel endo-β-1,4-xylanases of the glycoside hydrolase (GH) family 10, one novel endo-β-1,4-xylanase of the GH family 11, and one novel β-xylosidase of the GH family 43 were obtained via rapid amplification of complementary DNA ends. Given the high yield and stable properties of xylanolytic enzymes produced by L. chartarum SJTU59, future studies will be conducted to characterize the properties of individual xylanolytic enzymes from L. chartarum SJTU59. xylanolytic

  16. Effects of Stachybotrys chartarum (atra) conidia and isolated toxin on lung surfactant production and homeostasis.

    PubMed

    Mason, C D; Rand, T G; Oulton, M; MacDonald, J M; Scott, J E

    1998-01-01

    This study evaluated the effects of Stachybotrys chartarum conidia and a trichothecene, isosatratoxin-F, on choline incorporation into DSPC by fetal rabbit alveolar type II cells and on alveolar surfactant subtypes in mice. Exposure of fetal rabbit type II cells to S. chartarum conidia at concentrations of 10(3) to 10(6) conidia ml(-1) significantly depressed [3H] choline incorporation after 24 h of exposure. Exposure of the rabbit cells to 10(5) to 10(6) conidia ml(-1) also resulted in significantly depressed [3H] choline uptake after 48 h. Additionally, fetal rabbit alveolar type II cells exposed to isosatratoxin-F in concentrations ranging from 10(-9) to 10(-4) M showed a significant reduction in [3H] choline incorporation into DSPC. Alveolar surfactant phospholipid concentrations in the different metabolic subfractions of lung lavage fluid of mice intratracheally exposed to either 50 microl of 10(7) ml(-1) S. chartarum conidia or 50 microl 10(-7) M isosatratoxin-F showed some significant changes at 12, 24, 48, and 72 h post-exposure, compared to the surfactant subfractions of control mice which were either untreated, exposed to saline or to 50 microl of 10(-7) ml(-1) Cladosporium cladosporioides conidia. In both the S. chartarum- and the isosatratoxin-F-treated mice, exposure significantly increased P10, P100, and S100 phospholipid concentrations, while the P60 phospholipid concentrations were depressed. In contrast, C. cladosporioides-treated mice showed only one significant change in subfraction phospholipid concentration: P60 was depressed at 48 h post-exposure. These results reveal that alveolar type II cells are sensitive to exposure to S. chartarum conidia and to isosatratoxin F. Sensitivity is manifest by alterations in the normal metabolic processing of alveolar surfactant. In exposed mice, this effect appears to involve a significant increase in newly secreted surfactant and an accumulation of the used surfactant forms.

  17. DESTRUCTION OF ASPERGILLUS VERSICOLOR, PENICILLIUM CRYSOGENUM, STACHYBOTRYS CHARTARUM, AND CLADOSPORIUM CLADOSPORIDES SPORES USING CHEMICAL OXIDATION TREATMENT PROCESS

    EPA Science Inventory

    The survival of aqueous suspensions of Penicillium chrysogenum, Stachybotrys chartarum, Aspergillus versicolor, and Cladosporium cladosporioides spores was evaluated using various combinations of hydrogen peroxide and iron (II) as catalyst. Spores were suspended in water and trea...

  18. Identification and Characterisation of a Novel Protein FIP-sch3 from Stachybotrys chartarum

    PubMed Central

    Li, Shuying; Zhao, Leiming; Xu, Wenyi; Jiang, Zhonghao; Kang, Jun; Wang, Fengzhong; Xin, Fengjiao

    2016-01-01

    In this study, a novel FIP named FIP-sch3 has been identified and characterised. FIP-sch3 was identified in the ascomycete Stachybotrys chartarum, making it the second FIP to be identified outside the order of Basidiomycota. Recombinant FIP-sch3 (rFIP-shc3) was produced in Escherichia coli and purified using GST-affinity magnetic beads. The bioactive characteristics of FIP-sch3 were compared to those of well-known FIPs LZ-8 from Ganoderma lucidum and FIP-fve from Flammulina velutipes, which were produced and purified using the same method. The purified rFIP-sch3 exhibited a broad spectrum of anti-tumour activity in several types of tumour cells but had no cytotoxicity in normal human embryonic kidney 293 cells. Assays that were implemented to study these properties indicated that rFIP-sch3 significantly suppressed cell proliferation, induced apoptosis and inhibited cell migration in human lung adenocarcinoma A549 cells. The anti-tumour effects of rFIP-sch3 in A549 cells were comparable to those of rLZ-8, but they were significantly greater than those of rFIP-fve. Molecular assays that were built on real-time PCR further revealed potential mechanisms related to apoptosis and migration and that underlie phenotypic effects. These results indicate that FIP-shc3 has a unique anti-tumour bioactive profile, as do other FIPs, which provide a foundation for further studies on anti-tumour mechanisms. Importantly, this study also had convenient access to FIP-sch3 with potential human therapeutic applications. PMID:27997578

  19. Developmental immunotoxicity (DIT), postnatal immune dysfunction and childhood leukemia.

    PubMed

    Dietert, Rodney R

    2009-01-01

    The developing immune system is a sensitive target for environmentally-induced disruption producing postnatal immune dysfunction. Unique immune maturational events occur during critical windows of prenatal/perinatal development and environmentally-induced disruption of one-time events can have serious health consequences. Additionally, the specialized immunological conditions necessary to bring a semi-allogeneic fetus to term place restrictions on both the maternal and offspring immune systems. These features combine not only to increase the risk of early-life immune insult (ELII), which includes xenobiotically-induced developmental immunotoxicity (DIT), but also to influence the nature of DIT-associated diseases for the child. Exposure to certain toxicants as well as maternal infections and other pregnancy stressors is known to induce postnatal immune dysfunction. Because dysfunctional immune responses to childhood infections have been proposed to play a role in childhood leukemia, DIT is a potential risk factor for this disease. This review details the range of disease susceptibilities impacted by DIT and discusses the importance of effective DIT safety testing for drugs and chemicals as a preventative measure.

  20. IMMUNOTOXICITY OF INDIVIDUAL ORGANOTIN COMPOUNDS IN SPRAGUE-DAWLEY RATS

    EPA Science Inventory

    Organotins, used as stabilizers for polyvinyl chloride pipe, leach into drinking water from supply pipes and may cause multisystem toxicity, including immunotoxicity. We assessed immune function in Sprague-Dawley rats exposed to dibutyltin dichloride (DBTC) or dimethyltin dichlor...

  1. QUANTIFICATION OF SIDEROPHORE AND HEMOLYSIN FROM STACHYBOTRYS CHARTARUM STRAINS, INCLUDING A STRAIN ISOLATED FROM THE LUNG OF A CHILD WITH PULMONARY HEMORRHAGE AND HEMOSIDEROSIS

    EPA Science Inventory

    A strain of Stachybotrys chartarum was recently isolated from the lung of a pulmonary hemorrhage and hemosiderosis (PH) patient in Texas (designated the Houston strain). This is the first time that S. chartarum has been isolated from the lung of a PH patient. In this study, the ...

  2. Evaluation of Apoptosis in Immunotoxicity Testing

    PubMed Central

    Nagarkatti, Mitzi; Rieder, Sadiye Amcaoglu; Vakharia, Dilip; Nagarkatti, Prakash S.

    2014-01-01

    Immunotoxicity testing is important in determining the toxic effects of chemical substances, medicinal products, airborne pollutants, cosmetics, medical devices, and food additives. The immune system of the host is a direct target of these toxicants, and the adverse effects include serious health complications such as susceptibility to infections, cancer, allergic reactions, and autoimmune diseases. One way to investigate the harmful effects of different chemicals is to study apoptosis in immune cell populations. Apoptosis is defined as the programmed cell death, and in general, this process helps in development and maintains homeostasis. However, in the case of an insult by a toxicant, apoptosis of the immune cells can lead to immunosuppression resulting in the development of cancer and the inability to fight infections. Apoptosis is characterized by cell shrinkage, nuclear condensation, changes in cell membrane and mitochondria, DNA fragmentation into 200 base oligomers, and protein degradation by caspases. Various methods are employed in order to investigate apoptosis. These methods include direct measurement of apoptotic cells with flow cytometry and in situ labeling, as well as RNA, DNA, and protein assays that are indicative of apoptotic molecules. PMID:19967519

  3. Evaluation of apoptosis in immunotoxicity testing.

    PubMed

    Nagarkatti, Mitzi; Rieder, Sadiye Amcaoglu; Vakharia, Dilip; Nagarkatti, Prakash S

    2010-01-01

    Immunotoxicity testing is important in determining the toxic effects of chemical substances, medicinal products, airborne pollutants, cosmetics, medical devices, and food additives. The immune system of the host is a direct target of these toxicants, and the adverse effects include serious health complications such as susceptibility to infections, cancer, allergic reactions, and autoimmune diseases. One way to investigate the harmful effects of different chemicals is to study apoptosis in immune cell populations. Apoptosis is defined as the programmed cell death, and in general, this process helps in development and maintains homeostasis. However, in the case of an insult by a toxicant, apoptosis of the immune cells can lead to immunosuppression resulting in the development of cancer and the inability to fight infections. Apoptosis is characterized by cell shrinkage, nuclear condensation, changes in cell membrane and mitochondria, DNA fragmentation into 200 base oligomers, and protein degradation by caspases. Various methods are employed in order to investigate apoptosis. These methods include direct measurement of apoptotic cells with flow cytometry and in situ labeling, as well as RNA, DNA, and protein assays that are indicative of apoptotic molecules.

  4. Toxicity screening of materials from buildings with fungal indoor air quality problems (Stachybotrys chartarum).

    PubMed

    E, J; M, G; S, Y C; E-L, H; M, N; B, J; R, D

    1998-06-01

    Samples of building materials visibly contaminated with moisture-related fungi (drywall, fiberglass, wallpaper, wood) were tested with indirect (FFL) and direct (MTT) cytotoxicity screening tests that are particularly sensitive toStachybotrys chartarum toxins. In addition, microscopic, chemical, immunochemical (Roridin A enzyme immunoassay) and mycological culture analyses were performed. In all cases in which building occupants had reported verifiable skin, mucous membrane, respiratory, central nervous system or neuropsychological abnormalities, cytotoxicity was identified. Results of a cytotoxicity screening test of field samples, such as the direct MTT test method, will give investigators of health problems related to indoor air quality problems important toxicity information.

  5. Assessment of immunotoxicity using precision-cut tissue slices

    PubMed Central

    2013-01-01

    1. When the immune system encounters incoming infectious agents, this generally leads to immunity. The evoked immune response is usually robust, but can be severely perturbed by potentially harmful environmental agents such as chemicals, pharmaceuticals and allergens. 2. Immunosuppression, hypersensitivity and autoimmunity may occur due to changed immune activity. Evaluation of the immunotoxic potency of agents as part of risk assessment is currently established in vivo with animal models and in vitro with cell lines or primary cells. 3. Although in vivo testing is usually the most relevant situation for many agents, more and more in vitro models are being developed for assessment of immunotoxicity. In this context, hypersensitivity and immunosuppression are considered to be a primary focus for developing in vitro methods. Three-dimensional organotypic tissue models are also part of current research in immunotoxicology. 4. In recent years, there has been a revival of interest in organotypic tissue models. In the context of immunotoxicity testing, precision-cut lung slices in particular have been intensively studied. Therefore, this review is very much focused on pulmonary immunotoxicology. Respiratory hypersensitivity and inflammation are further highlighted aspects of this review. Immunotoxicity assessment currently is of limited use in other tissue models, which are therefore described only briefly within this review. PMID:23199366

  6. Immunotoxical evaluation of St. Lawrence beluga whales (Deiphinapterus leucas)

    SciTech Connect

    Guise, S. De; Fournier, M.; Martineau, D.; Beland, P.

    1995-12-31

    An isolated population of beluga whales live in the St. Lawrence estuary. From approximately 5,000 at the beginning of the century, they now number 500 and their number has not increased since the last 10 years. High concentrations of environmental contaminants including organohalogens (mostly PCBs and DDT), as well as heavy metals (mostly mercury and lead) and HAP exposure have been demonstrated in tissues of these animals. A high incidence of diverse and severe lesions including infections with mildly pathogenic bacteria and numerous tumors were found upon examination of carcasses from the same population. An immunotoxicological evaluation of St. Lawrence beluga whales compared to relatively unpolluted Arctic animals was undertaken to study the possibility of a contaminants induced immunosuppression which would explain the diversity and severity of those lesions. As a first step, several assays were developed to evaluate immune functions in beluga whales, and baseline data were established using Arctic animals. In vitro exposure of Arctic beluga lymphocytes to single contaminants present in St. Lawrence beluga blubber were also performed and showed a suppression of proliferation of lymphocytes with concentrations of mercury below those found in liver of adult St. Lawrence animals. Animal models were also developed to evaluate the immunotoxic potential of the mixture of contaminants found in blubber of St. Lawrence belugas. Rats were fed lipids from either St. Lawrence or Arctic belugas or a mixture of the two groups, and immune functions will be evaluated in these animals. Finally, the last step of the study will be to catch belugas in the St. Lawrence, evaluate their immune functions, compare them to those of Arctic animals and relate them to concentrations of the different contaminants measured in their blubber and plasma.

  7. Transcriptome-based functional classifiers for direct immunotoxicity.

    PubMed

    Shao, Jia; Berger, Laura F; Hendriksen, Peter J M; Peijnenburg, Ad A C M; van Loveren, Henk; Volger, Oscar L

    2014-03-01

    Current screening methods for direct immunotoxic chemicals are mainly based on general toxicity studies with rodents. The present study aimed to identify transcriptome-based functional classifiers that can eventually be exploited for the development of in vitro screening assays for direct immunotoxicity. To this end, a toxicogenomics approach was applied in which gene expression changes in human Jurkat lymphoblastic T cells were investigated in response to a wide range of compounds, including direct immunotoxicants, immunosuppressive drugs, and non-immunotoxic control chemicals. On the basis of DNA microarray data previously obtained by the exposure of Jurkat cells to 31 test compounds (Shao et al. in Toxicol Sci 135(2):328-346, 2013), we identified a set of 93 genes, of which 80 were significantly regulated (|numerical ratio| ≥1.62) by at least three compounds and the other 13 genes were significantly regulated by either one single compound or compound class. A total of 28 most differentially regulated genes were selected for qRT-PCR verification using a training set of 44 compounds consisting of the above-mentioned 31 compounds (23 immunotoxic and 8 non-immunotoxic) and 13 additional immunotoxicants. Good correlation between the results of microarray and qRT-PCR (Pearson's correlation, R ≥ 0.69) was found for 27 out of the 28 genes. Redundancy analysis of these 27 potential classifiers led to a final set of 25 genes. To assess the performance of these genes, Jurkat cells were exposed to 20 additional compounds (external verification set) followed by qRT-PCR. The classifier set of 25 genes gave a good performance in the external verification: accuracy 85 %, true positive rate (sensitivity) 88 %, and true negative rate (specificity) 67 %. Furthermore, on the basis of the gene ontology annotation of the 25 classifier genes, the immunotoxicants examined in this study could be categorized into distinct functional subclasses. In conclusion, we have identified and

  8. EVALUATION OF STACHYBOTRYS CHARTARUM IN THE HOUSE OF AN INFANT WITH PULMONARY HEMORRHAGE: QUANTITATIVE ASSESSMENT BEFORE, DURING, AND AFTER REMEDIATION

    EPA Science Inventory

    Stachybotrys chartarum is an indoor mold that has been associated with pulmonary hemorrhage (PH) cases in the Cleveland, Ohio area. This study applied two new quantitative measurements to air samples from a home where an infant developed PH. Quantitative polymerase chain reacti...

  9. ELISA MEASUREMENT OF STACHYLYSIN (TM) IN SERUM TO QUANTIFY HUMAN EXPOSURES TO THE INDOOR MOLD STACHYBOTRYS CHARTARUM

    EPA Science Inventory

    Antibodies were produced against the hemolytic agent stachylysin obtained from the mold Stachybotryis chartarum. These antibodies were used to develop two enzyme-linked immunosorbent assay (ELISA) methods for the analysis of stachylysin in human and rat sera and environmental sa...

  10. Assessment of Immunotoxicity of Dextran Coated Ferrite Nanoparticles in Albino Mice

    PubMed Central

    Syama, Santhakumar; Gayathri, Viswanathan; Mohanan, Parayanthala Valappil

    2015-01-01

    In this study, dextran coated ferrite nanoparticles (DFNPs) of size <25 nm were synthesized, characterized, and evaluated for cytotoxicity, immunotoxicity, and oxidative stress by in vitro and in vivo methods. Cytotoxicity was performed in vitro using splenocytes with different concentrations of DFNPs. Gene expression of selected cytokines (IL-1, IL-10, and TNF β) secretion by splenocytes was evaluated. Also, 100 mg of DFNPs was injected intraperitoneally to 18 albino mice for immunological stimulations. Six animals each were sacrificed at the end of 7, 14, and 21 days. Spleen was subjected to immunotoxic response and liver was analyzed for antioxidant parameters (lipid peroxidation, reduced glutathione, glutathione peroxidase, superoxide dismutase, and glutathione reductase). The results indicated that DFNPs failed to induce any immunological reactions and no significant alternation in antioxidant defense mechanism. Also, mRNA expression of the cytokines revealed an increase in IL-10 expression and subsequent decreased expression of IL-1 and TNF β. Eventually, DNA sequencing of liver actin gene revealed base alteration in nonconserved regions (10–20 bases) of all the treated groups when compared to control samples. Hence, it can be concluded that the DFNPs were nontoxic at the cellular level and nonimmunotoxic when exposed intraperitoneally to mice. PMID:26576301

  11. Consecutive evaluation of graphene oxide and reduced graphene oxide nanoplatelets immunotoxicity on monocytes.

    PubMed

    Yan, Junyan; Chen, Liliang; Huang, Chih-Ching; Lung, Shih-Chun Candice; Yang, Lingyan; Wang, Wen-Cheng; Lin, Po-Hsiung; Suo, Guangli; Lin, Chia-Hua

    2017-05-01

    The biocompatibilities of graphene-family nanomaterials (GFNs) should be thoroughly evaluated before their application in drug delivery and anticancer therapy. The present study aimed to consecutively assess the immunotoxicity of graphene oxide nanoplatelets (GONPs) and reduced GONPs (rGONPs) on THP-1 cells, a human acute monocytic leukemia cell line. GONPs induced the expression of antioxidative enzymes and inflammatory factors, whereas rGONPs had substantially higher cellular uptake rate, higher levels of NF-κB expression. These distinct toxic mechanisms were observed because the two nanomaterials differ in their oxidation state, which imparts different affinities for the cell membrane. Because GONPs have a higher cell membrane affinity and higher impact on membrane proteins compared with rGONPs, macrophages (THP-1a) derived from GONPs treated THP-1cells showed a severer effect on phagocytosis. By consecutive evaluation the effects of GONPs and rGONPs on THP-1 and THP-1a, we demonstrated that their surface oxidation states may cause GFNs to behave differently and cause different immunotoxic effects.

  12. Molecular and phenotypic descriptions of Stachybotrys chlorohalonata sp. nov. and two chemotypes of Stachybotrys chartarum found in water-damaged buildings.

    PubMed

    Andersen, Birgitte; Nielsen, Kristian F; Thrane, Ulf; Szaro, Tim; Taylor, John W; Jarvis, Bruce B

    2003-01-01

    Twenty-five Stachybotrys isolates from two previous studies have been examined and compared, using morphological, chemical and phylogenetic methods. The results show that S. chartarum sensu lato can be segregated into two chemotypes and one new species. The new species, S. chlorohalonata, differs morphologically from S. chartarum by having smooth conidia, being more restricted in growth and producing a green extracellular pigment on the medium CYA. S. chlorohalonata and S. chartarum also have different tri5, chs1 and tub1 gene fragment sequences. The two chemotypes of S. chartarum, chemotype S and chemotype A, have similar morphology but differ in production of metabolites. Chemotype S produces macrocyclic trichothecenes, satratoxins and roridins, while chemotype A produces atranones and dolabellanes. There is no difference between the two chemotypes in the tub1 gene fragment, but there is a one nucleotide difference in each of the tri5 and the chs1 gene fragments.

  13. Building-associated pulmonary disease from exposure to Stachybotrys chartarum and Aspergillus versicolor.

    PubMed

    Hodgson, M J; Morey, P; Leung, W Y; Morrow, L; Miller, D; Jarvis, B B; Robbins, H; Halsey, J F; Storey, E

    1998-03-01

    The authors present an outbreak of disease associated with exposure to Stachybotrys chartarum and Aspergillus species. A courthouse and two associated office buildings had generated discomfort among employees for two years since initial occupancy. Multiple interventions had been unsuccessful An initial evaluation of 14 individuals identified three with potential asthma and three with symptoms consistent with interstitial lung disease. A clinical screening protocol to identify individuals who should be removed from work identified three likely and seven possible cases of building-related asthma. Detailed environmental and engineering assessments of the building identified major problems in mechanical system design, building construction, and operational strategies leading to excess moisture and elevated relative humidities. Moisture-damaged interior surfaces in both buildings were contaminated with S. chartarum, A. versicolor, and Penicillium species. Aspergillus species, especially A. versicolor, at concentrations of 10(1) to 10(4)/m3 dominated the indoor air under normal operating conditions. Bulk samples also revealed large quantities of Stachybotrys. A questionnaire survey of the three case and two control buildings documented between three- and 15-fold increases in symptoms. A nested case-control study suggested emphysematous-like disease in individuals meeting questionnaire definitions for cases. Replication of analysis strategies used in similar previous investigations suggested an association between worsening symptoms and decreased diffusing capacity of the lung. Performance on neuropsychological measures was similar for both cases and controls, although workers with symptoms reported increased levels of current but not past psychiatric symptomatology. Chemical analyses demonstrated the presence of satratoxins G and H. Cytotoxic laboratory analyses demonstrated the presence of agents with biological effectiveness in bulk materials. No association was seen

  14. Immunotoxic effects of prolonged dietary exposure of male rats to 2,3,7,8-tetrachlorodibenzo-p-dioxin.

    PubMed

    Badesha, J S; Maliji, G; Flaks, B

    1995-12-07

    The effects of low level exposure of rats to 2,3,7,8-tetrachlorodibenzo-p- dioxin (TCDD) on their immune system was investigated Dietary administration to young adult male Leeds strain rats of a total dose of 3 micrograms/kg body weight of TCDD resulted in an exposure duration-dependent reduction of in vitro lipopolysaccharide-induced production of interleukin (IL)-1 in cultures of their splenic macrophages. A 30-day exposure produced approximately 30% suppression and 180-day exposure produced approximately 52% suppression. This reduction did not negatively influence lipopolysaccharide- induced proliferation of B cells, instead an enhancement of B cell proliferation was observed after 30 days exposure. A 180 day exposure significantly suppressed the generation of IL-2 by either concanavalin A or phorbol myristate acetate/calcium ionophore stimulation, and reduced the lectin-induced proliferation of splenic T cells. The 30-day TCDD exposure showed no such immunotoxicity. TCDD at both exposure durations suppressed the expression of the alpha chain of the IL-2 receptor in concanavalin A-activated T cells, without affecting the CD4+/CD8+ ratio. The results suggest that exposure to a low dietary dose of TCDD suppresses the functions of several T cell subsets, some of the immunotoxic effects being produced early, while others require a longer exposure also down-regulates the IL-1 production function of macrophages. A common mechanism of TCDD immunotoxicity may be on the multifunctional signal transduction pathways downstream to the activation of protein kinase C and Ca2+ flux.

  15. Safety and immunotoxicity assessment of immunomodulatory monoclonal antibodies

    PubMed Central

    Morton, Laura Dill; Spindeldreher, Sebastian; Kiessling, Andrea; Allenspach, Roy; Hey, Adam; Muller, Patrick Y; Frings, Werner; Sims, Jennifer

    2010-01-01

    Most therapeutic monoclonal antibodies (mAbs) licensed for human use or in clinical development are indicated for treatment of patients with cancer and inflammatory/autoimmune disease and as such, are designed to directly interact with the immune system. A major hurdle for the development and early clinical investigation of many of these immunomodulatory mAbs is their inherent risk for adverse immune-mediated drug reactions in humans such as infusion reactions, cytokine storms, immunosuppression and autoimmunity. A thorough understanding of the immunopharmacology of a mAb in humans and animals is required to both anticipate the clinical risk of adverse immunotoxicological events and to select a safe starting dose for first-in-human (FIH) clinical studies. This review summarizes the most common adverse immunotoxicological events occurring in humans with immunomodulatory mAbs and outlines non-clinical strategies to define their immunopharmacology and assess their immunotoxic potential, as well as reduce the risk of immunotoxicity through rational mAb design. Tests to assess the relative risk of mAb candidates for cytokine release syndrome, innate immune system (dendritic cell) activation and immunogenicity in humans are also described. The importance of selecting a relevant and sensitive toxicity species for human safety assessment in which the immunopharmacology of the mAb is similar to that expected in humans is highlighted, as is the importance of understanding the limitations of the species selected for human safety assessment and supplementation of in vivo safety assessment with appropriate in vitro human assays. A tiered approach to assess effects on immune status, immune function and risk of infection and cancer, governed by the mechanism of action and structural features of the mAb, is described. Finally, the use of immunopharmacology and immunotoxicity data in determining a minimum anticipated biologic effect Level (MABEL) and in the selection of safe human

  16. Approaches and considerations for the assessment of immunotoxicity for environmental chemicals: a workshop summary.

    PubMed

    Boverhof, Darrell R; Ladics, Greg; Luebke, Bob; Botham, Jane; Corsini, Emanuela; Evans, Ellen; Germolec, Dori; Holsapple, Michael; Loveless, Scott E; Lu, Haitian; van der Laan, Jan Willem; White, Kimber L; Yang, Yung

    2014-02-01

    As experience is gained with toxicology testing and as new assays and technologies are developed, it is critical for stakeholders to discuss opportunities to advance our overall testing strategies. To facilitate these discussions, a workshop on practices for assessing immunotoxicity for environmental chemicals was held with the goal of sharing perspectives on immunotoxicity testing strategies and experiences, developmental immunotoxicity (DIT), and integrated and alternative approaches to immunotoxicity testing. Experiences across the chemical and pharmaceutical industries suggested that standard toxicity studies, combined with triggered-based testing approaches, represent an effective and efficient approach to evaluate immunotoxic potential. Additionally, discussions on study design, critical windows, and new guideline approaches and experiences identified important factors to consider before initiating DIT evaluations including assay choice and timing and the impact of existing adult data. Participants agreed that integrating endpoints into standard repeat-dose studies should be considered for fulfilling any immunotoxicity testing requirements, while also maximizing information and reducing animal use. Participants also acknowledged that in vitro evaluation of immunosuppression is complex and may require the use of multiple assays that are still being developed. These workshop discussions should contribute to developing an effective but more resource and animal efficient approach for evaluating chemical immunotoxicity.

  17. In vitro characterization of the immunotoxic potential of several perfluorinated compounds (PFCs)

    SciTech Connect

    Corsini, Emanuela; Sangiovanni, Enrico; Avogadro, Anna; Galbiati, Valentina; Viviani, Barbara; Marinovich, Marina; Galli, Corrado L.; Dell'Agli, Mario; Germolec, Dori R.

    2012-01-15

    We have previously shown that PFOA and PFOS directly suppress cytokine secretion in immune cells, with different mechanisms of action. In particular, we have demonstrated a role for PPAR-α in PFOA-induced immunotoxicity, and that PFOS has an inhibitory effect on LPS-induced I-κB degradation. These studies investigate the immunomodulatory effects of four other PFCs, namely PFBS, PFOSA, PFDA, and fluorotelomer using in vitro assays. The release of the pro-inflammatory cytokines IL-6 and TNF-α was evaluated in lipolysaccharide (LPS)-stimulated human peripheral blood leukocytes (hPBL) and in the human promyelocytic cell line THP-1, while the release of IL-10 and IFN-γ was evaluated in phytohemagglutinin (PHA)-stimulated hPBL. All PFCs suppressed LPS-induced TNF-α production in hPBL and THP-1 cells, while IL-6 production was suppressed by PFOSA, PFOS, PFDA and fluorotelomer. PFBS, PFOSA, PFOS, PFDA and fluorotelomer inhibited PHA-induced IL-10 release, while IFN-γ secretion was affected by PFOSA, PFOS, PFDA and fluorotelomer. Leukocytes obtained from female donors appear to be more sensitive to the in vitro immunotoxic effects of PFCs when their responses are compared to the results obtained using leukocytes from male donors. Mechanistic investigations demonstrated that inhibition of TNF-α release in THP-1 cells occurred at the transcriptional level. All PFCs, including PFOA and PFOS, decreased LPS-induced NF-κB activation. With the exception of PFOA, none of the PFCs tested was able to activate PPARα driven transcription in transiently transfected THP-1 cells, excluding a role for PPARα in the immunomodulation observed. PFBS and PFDA prevented LPS-induced I-κB degradation. Overall, these studies suggest that PFCs affect NF-κB activation, which directly suppresses cytokine secretion by immune cells. Our results indicate that PFOA is the least active of the PFCs examined followed by PFBS, PFDA, PFOS, PFOSA and fluorotelomer. -- Research Highlights: ► PFCs

  18. In vitro characterization of the immunotoxic potential of several perfluorinated compounds (PFCs).

    PubMed

    Corsini, Emanuela; Sangiovanni, Enrico; Avogadro, Anna; Galbiati, Valentina; Viviani, Barbara; Marinovich, Marina; Galli, Corrado L; Dell'Agli, Mario; Germolec, Dori R

    2012-01-15

    We have previously shown that PFOA and PFOS directly suppress cytokine secretion in immune cells, with different mechanisms of action. In particular, we have demonstrated a role for PPAR-α in PFOA-induced immunotoxicity, and that PFOS has an inhibitory effect on LPS-induced I-κB degradation. These studies investigate the immunomodulatory effects of four other PFCs, namely PFBS, PFOSA, PFDA, and fluorotelomer using in vitro assays. The release of the pro-inflammatory cytokines IL-6 and TNF-α was evaluated in lipolysaccharide (LPS)-stimulated human peripheral blood leukocytes (hPBL) and in the human promyelocytic cell line THP-1, while the release of IL-10 and IFN-γ was evaluated in phytohemagglutinin (PHA)-stimulated hPBL. All PFCs suppressed LPS-induced TNF-α production in hPBL and THP-1 cells, while IL-6 production was suppressed by PFOSA, PFOS, PFDA and fluorotelomer. PFBS, PFOSA, PFOS, PFDA and fluorotelomer inhibited PHA-induced IL-10 release, while IFN-γ secretion was affected by PFOSA, PFOS, PFDA and fluorotelomer. Leukocytes obtained from female donors appear to be more sensitive to the in vitro immunotoxic effects of PFCs when their responses are compared to the results obtained using leukocytes from male donors. Mechanistic investigations demonstrated that inhibition of TNF-α release in THP-1 cells occurred at the transcriptional level. All PFCs, including PFOA and PFOS, decreased LPS-induced NF-κB activation. With the exception of PFOA, none of the PFCs tested was able to activate PPARα driven transcription in transiently transfected THP-1 cells, excluding a role for PPARα in the immunomodulation observed. PFBS and PFDA prevented LPS-induced I-κB degradation. Overall, these studies suggest that PFCs affect NF-κB activation, which directly suppresses cytokine secretion by immune cells. Our results indicate that PFOA is the least active of the PFCs examined followed by PFBS, PFDA, PFOS, PFOSA and fluorotelomer.

  19. Vanadium carcinogenic, immunotoxic and neurotoxic effects: a review of in vitro studies.

    PubMed

    Zwolak, Iwona

    2014-01-01

    Deleterious health effects induced by inorganic vanadium compounds are linked with carcinogenic, immunotoxic and neurotoxic insults. The goal of this review is to provide a summary of mammalian cell culture studies (from the 1990s to most recent) looking into the mode of the above-mentioned adverse actions of vanadium. Regarding the carcinogenicity potential, the key cell-based studies have evidenced the ability of vanadium to induce genotoxic lesions, cell morphological transformation and anti-apoptotic effects in a certain type of cells. Two contradictory effects of vanadium on the immune functions of cells have been observed in cell culture studies. The first effect involves reduction of cell immune responses such as vanadium-dependent inhibition of cytokine-inducible functions, which may underlie the mechanism of vanadium-induced immunosuppression. The second one involves stimulation of immune activity, for example, a vanadium-mediated increase in cytokine production, which may contribute to vanadium-related inflammation. So far, an in vitro evaluation of vanadium neurotoxicity has only been reported in few articles. These papers indicate probable cytotoxic mechanisms resulting from exposure of neurons and glial cells to vanadium. In summary, this literature review collects in vitro reports on adverse vanadium effects and thus provides vanadium researchers with a single, concise source of data.

  20. The immunotoxicity of 3,3{prime},4,4{prime},5-pentachlorobiphenyl (PeCB) and tributyltin (TBT) in channel catfish, Ictalurus punctatus

    SciTech Connect

    Rice, C.D.; Banes, M.M.; Hurt, K.L.

    1994-12-31

    There is considerable evidence that planar PCBs and Tributyltin (TBT) may be immunotoxic to fish. Apparently the immune system is a target organ for both compounds in rodents. The mechanisms of action are different as PeCB immunotoxicity is associated with cytosolic Ah-R binding and induction of several nuclear response elements while TBT immunotoxicity is associated with membrane perturbation and layered calcium homeostasis. The authors have investigated the effects of a single i.p. dose of PeCB and TBT at 0.01, 0.1, 1.0 mg/kg on several innate immune responses including non-specific cytotoxic cell activity, neutrophil activation, and lymphocyte mitogenesis, as well as baseline hematology at days 3 and 7 post treatment. Hematocrits were affected in TBT treated fish at 1.0 mg/kg while neutrophilia and leukopenia were noted at 0.01 and 1.0 mg/kg. These observations are typical of stress hemograms. PeCB had no adverse effect on hematocrits or leukocyte % but did induce neutrophilia at 1.0 mg/kg. Neutrophil activation was suppressed in both PeCB and TBT treated animals but only at 1.0 mg/kg. NCC activity was suppressed at all three doses of PECB but only 1.0 mg/kg in TBT treated animals. Lymphocyte mitogenesis was affected by both compounds but only at 1.0 mg/kg. A note of interest is that both compounds have the same molecular weight and therefore their immunotoxic effects can be compared on a {micro}mole/kg basis.

  1. Neurotoxicity and Immunotoxicity Outcomes following Gestational Exposure to Four Lab Drinking Water Concentrates

    EPA Science Inventory

    To evaluate whether developmental exposure to drinking water concentrates altered other endpoints, standard neuro- and immunotoxicity tests were conducted on the offspring. Male and female offspring (10/sex/treatment) exposed to chlorinated concentrated water (CCW) or reverse os...

  2. Successful validation of genomic biomarkers for human immunotoxicity in Jurkat T cells in vitro.

    PubMed

    Schmeits, Peter C J; Shao, Jia; van der Krieken, Danique A; Volger, Oscar L; van Loveren, Henk; Peijnenburg, Ad A C M; Hendriksen, Peter J M

    2015-07-01

    Previously, we identified 25 classifier genes that were able to assess immunotoxicity using human Jurkat T cells. The present study aimed to validate these classifiers. For that purpose, Jurkat cells were exposed for 6 h to subcytotoxic doses of nine immunotoxicants, five non-immunotoxicants and four compounds for which human immunotoxicity has not yet been fully established. RNA was isolated and subjected to Fluidigm quantitative real time (qRT)-PCR analysis. The sensitivity, specificity and accuracy of the screening assay as based on the nine immunotoxicants and five non-immunotoxicants used in this study were 100%, 80% and 93%, respectively, which is better than the performance in our previous study. Only one compound was classified as false positive (benzo-e-pyrene). Of the four potential (non-)immunotoxicants, chlorantraniliprole and Hidrasec were classified immunotoxic and Sunset yellow and imidacloprid as non-immunotoxic. ToxPi analysis of the PCR data provided insight in the molecular pathways that were affected by the compounds. The immunotoxicants 2,3-dichloro-propanol and cypermethrin, although structurally different, affected protein metabolism and cholesterol biosynthesis and transport. In addition, four compounds, i.e. chlorpyrifos, aldicarb, benzo-e-pyrene and anti-CD3, affected genes in cholesterol metabolism and transport, protein metabolism and transcription regulation. qRT-PCR on eight additional genes coding for similar processes as defined in ToxPi analyzes, supported these results. In conclusion, the 25 immunotoxic classifiers performed very well in a screening with new non-immunotoxic and immunotoxic compounds. Therefore, the Jurkat screening assay has great promise to be applied within a tiered approach for animal free testing of human immunotoxicity.

  3. Zearalenone, an estrogenic mycotoxin, is an immunotoxic compound.

    PubMed

    Hueza, Isis M; Raspantini, Paulo Cesar F; Raspantini, Leonila Ester R; Latorre, Andreia O; Górniak, Silvana L

    2014-03-13

    The aim of this study was to assess the toxic effects of zearalenone (ZEA) on the immune function. Ovariectomised rats were treated daily by gavage with 3.0 mg/kg of ZEA for 28 days. Body weight gain, food consumption, haemotological parameters, lymphoid organs, and their cellularities were evaluated. Moreover, acquired immune responses and macrophage activity were also assessed. ZEA promoted reduction in body weight gain, which is not fully explained by diminished food consumption. Despite no effect on haematological parameters, ZEA caused thymic atrophy with histological and thymocyte phenotype changes and decrease in the B cell percentage in the spleen. With respect to acquired and innate immune responses, no statistically significant differences in delayed-type hypersensitivity were noticed; however, in the ZEA-treated rats, antibody production and peroxide release by macrophages were impaired. The observed results could be related to ZEA activity on ERs; thus, ZEA is an immunotoxic compound similar to estrogen and some endocrine disruptors.

  4. Selenium reverses Pteridium aquilinum-induced immunotoxic effects

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We have previously shown that bracken fern (Pteridium aquilinum) has immunomodulatory effects on mouse natural killer (NK) cells by reducing cytotoxicity. Alternatively, it has been demonstrated that selenium can enhance NK cell activity. Therefore, the aims of the present study were to evaluate if ...

  5. In vivo immunotoxicity of perfluorooctane sulfonate in BALB/c mice: Identification of T-cell receptor and calcium-mediated signaling pathway disruption through gene expression profiling of the spleen.

    PubMed

    Lv, Qi-Yan; Wan, Bin; Guo, Liang-Hong; Yang, Yu; Ren, Xiao-Min; Zhang, Hui

    2015-10-05

    Perfluorooctane sulfonate (PFOS) is a persistent organic pollutant that is used worldwide and is continuously being detected in biota and the environment, thus presenting potential threats to the ecosystem and human health. Although PFOS is highly immunotoxic, its underlying molecular mechanisms remain largely unknown. The present study examined PFOS-induced immunotoxicity in the mouse spleen and explored its underlying mechanisms by gene expression profiling. Oral exposure of male BALB/c mice for three weeks followed by one-week recovery showed that a 10 mg/kg/day PFOS exposure damaged the splenic architecture, inhibited T-cell proliferation in response to mitogen, and increased the percentages of T helper (CD3(+)CD4(+)) and cytotoxic T (CD3(+)CD8(+)) cells, despite the decrease in the absolute number of these cells. A delayed type of PFOS immunotoxicity was observed, which mainly occurred during the recovery period. Global gene expression profiling of mouse spleens and QRT-PCR analyses suggest that PFOS inhibited the expression of genes involved in cell cycle regulation and NRF2-mediated oxidative stress response, and upregulated those in TCR signaling, calcium signaling, and p38/MAPK signaling pathways. Western blot analysis confirmed that the expressions of CAMK4, THEMIS, and CD3G, which were involved in the upregulated pathways, were induced upon PFOS exposure. Acute PFOS exposure modulated calcium homoeostasis in splenocytes. These results indicate that PFOS exposure can activate TCR signaling and calcium ion influx, which provides a clue for the potential mechanism of PFOS immunotoxicity. The altered signaling pathways by PFOS treatment as revealed in the present study might facilitate in better understanding PFOS immunotoxicity and explain the association between immune disease and PFOS exposure.

  6. Satratoxin G from the black mold Stachybotrys chartarum evokes olfactory sensory neuron loss and inflammation in the murine nose and brain.

    PubMed

    Islam, Zahidul; Harkema, Jack R; Pestka, James J

    2006-07-01

    Satratoxin G (SG) is a macrocyclic trichothecene mycotoxin produced by Stachybotrys chartarum, the "black mold" suggested to contribute etiologically to illnesses associated with water-damaged buildings. Using an intranasal instillation model in mice, we found that acute SG exposure specifically induced apoptosis of olfactory sensory neurons (OSNs) in the olfactory epithelium. Dose-response analysis revealed that the no-effect and lowest-effect levels at 24 hr postinstillation (PI) were 5 and 25 microg/kg body weight (bw) SG, respectively, with severity increasing with dose. Apoptosis of OSNs was identified using immunohistochemistry for caspase-3 expression, electron microscopy for ultrastructural cellular morphology, and real-time polymerase chain reaction for elevated expression of the proapoptotic genes Fas, FasL, p75NGFR, p53, Bax, caspase-3, and CAD. Time-course studies with a single instillation of SG (500 microg/kg bw) indicated that maximum atrophy of the olfactory epithelium occurred at 3 days PI. Exposure to lower doses (100 microg/kg bw) for 5 consecutive days resulted in similar atrophy and apoptosis, suggesting that in the short term, these effects are cumulative. SG also induced an acute, neutrophilic rhinitis as early as 24 hr PI. Elevated mRNA expression for the proinflammatory cytokines tumor necrosis factor-alpha, interleukin-6 (IL-6) , and IL-1 and the chemokine macrophage-inflammatory protein-2 (MIP-2) were detected at 24 hr PI in both the ethmoid turbinates of the nasal airways and the adjacent olfactory bulb of the brain. Marked atrophy of the olfactory nerve and glomerular layers of the olfactory bulb was also detectable by 7 days PI along with mild neutrophilic encephalitis. These findings suggest that neurotoxicity and inflammation within the nose and brain are potential adverse health effects of exposure to satratoxins and Stachybotrys in the indoor air of water-damaged buildings.

  7. Biological Responses of Raw 264.7 Macrophage Exposed to Two Strains of Stachybotrys chartarum Spores Grown on Four Different Wallboard Types

    EPA Science Inventory

    The focus of this research was to provide a better understanding of the health impacts caused by Stachybotrys chartarum (Houston and 51-11) spores grown on four gypsum products two of which were resistant to microbes. Raw 264.7 cells were exposed to whole spores and fragmented 51...

  8. SOLVENT COMPARISON IN THE ISOLATION, SOLUBILIZATION, AND TOXICITY OF STACHYBOTRYS CHARTARUM SPORE TRICHOTHECENE MYCOTOXINS IN AN ESTABLISHED IN VITRO LUMINESCENCE PROTEIN TRANSLATION INHIBITION ASSAY

    EPA Science Inventory

    It is well known that non-viable mold contaminants such as macrocyclic trichothecene mycotoxins of Stachybotrys chartarum are highly toxinigenic to humans. However, there is no agreed upon method of recovering native mycotoxin. The purpose of this study was to provide quantitativ...

  9. The immunotoxicity of graphene oxides and the effect of PVP-coating.

    PubMed

    Zhi, Xiao; Fang, Hongliang; Bao, Chenchen; Shen, Guangxia; Zhang, Jiali; Wang, Kan; Guo, Shouwu; Wan, Tao; Cui, Daxiang

    2013-07-01

    Graphene oxide (GO) immunotoxicity is not clarified well up to date. Herein we reported the effects of GOs with and without polyvinylpyrrolidone (PVP) coating on human immune cells such as dendritic cells (DCs), T lymphocytes and macrophages. Human immune cells such as dendritic cells (DCs), T lymphocytes and macrophages were isolated from health donated bloods, PVP-coating GO (PVP-GO) exhibited lower immunogenicity compared with pure GO on the aspect of inducing differentiation and maturation of dendritic cells (DCs), the levels of secreted TNF-α and IL-1β had no obvious difference between two groups, yet the secretion of IL-6 remained in PVP-coating GO group. In addition, PVP-coating GO delayed significantly the apoptotic process of T lymphocytes, at the same time, and exhibited anti-phagocytosis ability against macrophages and markedly enhanced the physiological activity of macrophages. In conclusion, PVP-coating GO possesses good immunological biocompatibility and immunoenhancement effects in vitro, and is likely to be an available candidate of immunoadjuvant in the future.

  10. AMP-Conjugated Quantum Dots: Low Immunotoxicity Both In Vitro and In Vivo

    NASA Astrophysics Data System (ADS)

    Dai, Tongcheng; Li, Na; Liu, Lu; Liu, Qin; Zhang, Yuanxing

    2015-11-01

    Quantum dots (QDs) are engineered nanoparticles that possess special optical and electronic properties and have shown great promise for future biomedical applications. In this work, adenosine 5'-monophosphate (AMP), a small biocompatible molecular, was conjugated to organic QDs to produce hydrophilic AMP-QDs. Using macrophage J774A.1 as the cell model, AMP-QDs exhibited both prior imaging property and low toxicity, and more importantly, triggered limited innate immune responses in macrophage, indicating low immunotoxicity in vitro. Using BALB/c mice as the animal model, AMP-QDs were found to be detained in immune organs but did not evoke robust inflammation responses or obvious histopathological abnormalities, which reveals low immunotoxicity in vivo. This work suggests that AMP is an excellent surface ligand with low immunotoxicity, and potentially used in surface modification for more extensive nanoparticles.

  11. Summary of a workshop on nonclinical and clinical immunotoxicity assessment of immunomodulatory drugs.

    PubMed

    Piccotti, Joseph R; Lebrec, Herve N; Evans, Ellen; Herzyk, Danuta J; Hastings, Kenneth L; Burns-Naas, Leigh Ann; Gourley, Ian S; Wierda, Daniel; Kawabata, Thomas T

    2009-03-01

    The number of anti-inflammatory and immunomodulatory drugs being developed in the pharmaceutical industry has increased considerably in the past decade. This increase in research and development has been paralleled by questions from both regulatory agencies and industry on how best to assess decreased host resistance to infections or adverse immunostimulation caused by immunomodulatory agents such as anti-cytokine antibodies (e.g., the tumor necrosis factor-alpha inhibitors), anti-adhesion molecule antibodies (e.g., anti-alpha-4 integrin inhibitors) and immunostimulatory molecules (e.g., anti-CD28 antibodies). Although several methods have been developed for nonclinical assessment of immunotoxicity, highly publicized adverse events have brought to light significant gaps in the application of nonclinical immunotoxicity testing in assessing potential risk in humans. Confounding this problem is inconsistent application of immunotoxicology methods for risk assessment within the scientific community, limited understanding of appropriate immunotoxicity testing strategy for immunomodulators and inconsistent testing requests by regulatory agencies. To address these concerns, The Immunotoxicology Technical Committee (ITC) of the International Life Science Institute (ILSI) Health and Environmental Sciences Institute (HESI) organized a workshop on Immunomodulators and Clinical Immunotoxicology in May 2007. The Workshop was convened to identify key gaps in nonclinical and clinical immunotoxicity testing of anti-inflammatory and immunomodulatory agents and to begin to develop consistent approaches for immunotoxicity testing and risk assessment. This paper summarizes the outcome of the HESI ITC Immunomodulators and Clinical Immunotoxicology Workshop. Topics not discussed at the Workshop were outside the scope of this report. Although more work is needed to develop consistent approaches for immunotoxicity assessment of immunomodulators, this Workshop provided the foundation for

  12. Development and evaluation of the mallard duck as a model to investigate the immunotoxicity of environmental chemicals

    SciTech Connect

    Fowles, J.R.

    1993-01-01

    Studies were conducted to characterize the mallard duck (Anas platyrhyncos) as a model for evaluating the immunotoxic effects of environmental chemicals. A battery of immunotoxicity tests was validated for the mallard, including natural killer cell (NKC) activity, lymphocyte mitogenesis, antibody titers to sheep erythrocytes, peripheral differential leukocyte counts, macrophage phagocytosis and prostaglandin-E[sub 2] (PGE2) production. To investigate potential hormonal-immune axes, dexamethasone (DEX), methimazole, and thyroxine (T4) were used to study the influence of glucocorticoid excess, hypo-, and hyperthyroidism on immunity, respectively. Subsequently, the effects of polychlorinated biphenyls (PCBs, Aroclor 1254) on immune, endocrine, and hepatic cytochrome-P450 function were evaluated and interpreted using results from the endocrine/immune studies. Results of these studies showed that antibody production was susceptible to suppression by DEX at doses which also caused significant changes in clinical plasma biochemistry values. NKC activity was enhanced by exposure to DEX in vivo, a phenomenon due to the inhibition of PGE2 production by adherent peripheral blood cells by DEX and mimicked in vitro with addition of indomethacin or DEX. Macrophage phagocytosis was significantly suppressed by DEX in vitro. Macrophage production of PGE2 ex vivo was suppressed in birds treated with DEX. In contrast to DEX, T4 or methimazole treatment elicited only slight physiologic changes in plasma albumin and cholesterol levels. No immune/thyroid axis was observed in mallards. Exposure to Aroclor 1254 induced significant hepatic microsomal ethoxy- and pentoxy-resorufin-O-deethylase activities in addition to increasing total cytochrome P450 content, but did not affect immune function, plasma corticosterone, or clinical biochemistry values. Total triiodothyronine, but not T4, was dose-dependently suppressed by PCB treatment.

  13. Immunotoxic effects of environmental pollutants in marine mammals.

    PubMed

    Desforges, Jean-Pierre W; Sonne, Christian; Levin, Milton; Siebert, Ursula; De Guise, Sylvain; Dietz, Rune

    2016-01-01

    immune function in marine mammals exposed to environmental contaminants. Exposure to immunotoxic contaminants may have significant population level consequences as a contributing factor to increasing anthropogenic stress in wildlife and infectious disease outbreaks.

  14. Health assessment of gasoline and fuel oxygenate vapors: immunotoxicity evaluation.

    PubMed

    White, Kimber L; Peachee, Vanessa L; Armstrong, Sarah R; Twerdok, Lorraine E; Clark, Charles R; Schreiner, Ceinwen A

    2014-11-01

    Female Sprague Dawley rats were exposed via inhalation to vapor condensates of either gasoline or gasoline combined with various fuel oxygenates to assess potential immunotoxicity of evaporative emissions. Test articles included vapor condensates prepared from "baseline gasoline" (BGVC), or gasoline combined with methyl tertiary butyl ether (G/MTBE), ethyl t-butyl ether (G/ETBE), t-amyl methyl ether (G/TAME), diisopropyl ether (G/DIPE), ethanol (G/EtOH), or t-butyl alcohol (G/TBA). Target concentrations were 0, 2000, 10,000 or 20,000mg/mg(3) administered for 6h/day, 5days/week for 4weeks. The antibody-forming cell (AFC) response to the T-dependent antigen, sheep erythrocyte (sRBC), was used to determine the effects of the gasoline vapor condensates on the humoral components of the immune system. Exposure to BGVC, G/MTBE, G/TAME, and G/TBA did not result in significant changes in the IgM AFC response to sRBC, when evaluated as either specific activity (AFC/10(6) spleen cells) or as total spleen activity (AFC/spleen). Exposure to G/EtOH and G/DIPE resulted in a dose-dependent decrease in the AFC response, reaching the level of statistical significance only at the high 20,000mg/m(3) level. Exposure to G/ETBE resulted in a statistically significant decrease in the AFC response at the middle (10,000mg/m(3)) and high (20,000mg/m(3)) exposure concentrations.

  15. ENVIRONMENTAL POLLUTION AND THE IMMUNE SYSTEM: MECHANISMS OF IMMUNOTOXICITY ACROSS PHYLA

    EPA Science Inventory

    Environmental pollution and the immune system: Mechanisms of immunotoxicity across phyla. Bob Luebke and Dori Germolec, US EPA, RTP, NC and NIEHS, RTP, NC

    Our current understanding of immunotoxicology comes largely from studies done in rodents or using in vitro systems, a...

  16. Immunotoxicity testing: Implementation of mechanistic understanding, key pathways of toxicological concern and components of these pathways.

    EPA Science Inventory

    At present, several animal-based assays are used to assess immunotoxic effects such as immunosuppression and sensitization. Growing societal and ethical concerns, European legislation and current research demands by industry are driving animal-based toxicity testing towards new a...

  17. Immunotoxicity of dibromoacetic acid administered via drinking water to female B₆C₃F₁ mice.

    PubMed

    Smith, Matthew J; Germolec, Dori R; Luebke, Robert W; Sheth, Christopher M; Auttachoat, Wimolnut; Guo, Tai L; White, Kimber L

    2010-01-01

    Dibromoacetic acid (DBA) is a disinfection by-product commonly found in drinking water as a result of chlorination/ ozonation processes. The Environmental Protection Agency estimates that more than 200 million people consume disinfected water in the United States. This study was conducted to evaluate the potential immunotoxicological effects of DBA exposure when administered for 28 days via drinking water to B₆C₃F₁ mice, at concentrations of 125, 500, and 1000 mg/L. Multiple endpoints were evaluated to assess innate, humoral, and cell-mediated immune components, as well as host resistance. Standard toxicological parameters were unaffected, with the exception of a dose-responsive increase in liver weight and a decrease in thymus weight at the two highest exposure levels. Splenocyte differentials were affected, although the effects were not dose-responsive. Exposure to DBA did not significantly affect humoral immunity (immunoglobulin M [IgM] plaque assay and serum IgM anti-sheep erythrocyte titers) or cell-mediated immunity (mixed-leukocyte response). No effects were observed on innate immune function in either interferon-γ-induced in vitro macrophage cytotoxic activity or basal natural killer (NK)-cell activity. Augmented NK-cell activity (following exposure to polyinosinic-polycytidylic acid) was decreased at the low dose, however the effect was not dose-responsive. Finally, DBA exposure had no effect on resistance to infection with either Streptococcus pneumoniae or Plasmodium yoelii, or challenge with B16F10 melanoma cells. With the exception of changes in thymus weight, these results indicate that DBA exposure resulted in no immunotoxic effects at concentrations much larger than those considered acceptable in human drinking water.

  18. Hebb-Williams performance and scopolamine challenge in rats with partial immunotoxic hippocampal cholinergic deafferentation.

    PubMed

    Marques Pereira, Patricia; Cosquer, Brigitte; Schimchowitsch, Sarah; Cassel, Jean-Christophe

    2005-01-15

    Recent studies suggested that the cholinergic innervation of the hippocampus is not crucial for spatial learning, but it might be important for other forms of learning. This study assessed the effects of partial immunotoxic cholinergic lesions in the medial septum and concurrent scopolamine challenge in a complex learning task, the Hebb-Williams maze. Long-Evans rats were given intraseptal injections of 192 IgG-saporin (SAPO). Rats injected with phosphate-buffered saline (PBS) served as controls. Starting 25 days after surgery, behavioural performance was assessed in the Hebb-Williams maze test without prior or after injection of scopolamine (0.17 or 0.5 mg/kg, i.p.). In SAPO rats, histochemical analysis showed a 40-45% decrease in the density of hippocampal AChE staining. The number of ChAT-positive cell bodies in the medial septum was also significantly decreased (-56%) and there was a non-significant reduction of the number of parvalbumine-positive neurons. The behavioural results demonstrated that the lesions induced small but significant learning deficits. At 0.17 mg/kg, scopolamine produced more impairments in SAPO rats than in PBS-injected rats, suggesting an additive effect between the partial lesion and the drug. These observations indicate that the Hebb-Williams test may be more sensitive to alterations of septohippocampal cholinergic function, than radial- or water-maze tasks. They also show that subtle learning deficits can be detected after partial lesions of the cholinergic septohippocampal pathways. Finally, the data from the scopolamine challenge are in keeping with clinical results showing higher sensitivity to muscarinic blockade in aged subjects in whom weaker cholinergic functions can be presumed.

  19. Visualization of the structural changes in plywood and gypsum board during the growth of Chaetomium globosum and Stachybotrys chartarum.

    PubMed

    Lewinska, Anna M; Hoof, Jakob B; Peuhkuri, Ruut H; Rode, Carsten; Lilje, Osu; Foley, Matthew; Trimby, Patrick; Andersen, Birgitte

    2016-10-01

    Fungal growth in indoor environments is associated with many negative health effects. Many studies focus on brown- and white-rot fungi and their effect on wood, but there is none that reveals the influence of soft-rot fungi, such as Stachybotrys spp. and Chaetomium spp., on the structure of building materials such as plywood and gypsum wallboard. This study focuses on using micro-computed tomography (microCT) to investigate changes of the structure of plywood and gypsum wallboard during fungal degradation by S. chartarum and C. globosum. Changes in the materials as a result of dampness and fungal growth were determined by measuring porosity and pore shape via microCT. The results show that the composition of the building material influenced the level of penetration by fungi as shown by scanning electron microscopy (SEM). Plywood appeared to be the most affected, with the penetration of moisture and fungi throughout the whole thickness of the sample. Conversely, fungi grew only on the top cardboard in the gypsum wallboard and they did not have significant influence on the gypsum wallboard structure. The majority of the observed changes in gypsum wallboard occurred due to moisture. This paper suggests that the mycelium distribution within building materials and the structural changes, caused by dampness and fungal growth, depend on the type of the material.

  20. Role of alterations in Ca{sup 2+}-associated signaling pathways in the immunotoxicity of polycyclic aromatic hydrocarbons

    SciTech Connect

    Davila, D.R.; Davs, D.P.; Campbell, K.

    1995-08-01

    Polycyclic aromatic hydrocarbons (PAHs) are an important class of environmental pollutants that are known to be carcinogenic and immunotoxic. The effects of PAHs on the immune system of various animals and models have been studied for at least 30 yr. Despite these efforts, the mechanism or mechanisms by which PAHs exert their effects on the immune system are still largely unknown. During recent years, the molecular events associated with lymphocyte activation and receptor-mediated signaling have become increasingly clear. Substantial progress has been made in understanding the molecular and cellular bases for toxicant-induced immune cell injury. Understanding mechanisms of drug or chemical effects on the immune system is an important area of research in the field of immunotoxicology, and indeed in all fields of toxicology. Mechanistic toxicology plays an important role in risk assessment and extrapolation of potential human health effects. In this review, we have summarized recent evidence that has examined the effects of PAHs on the immune system of animals and humans. In particular, we have focused on the effects of PAHs on cell signaling in lymphoid cells and have examined the hypothesis that PAHs alter lymphocyte activation via calcium-dependent mechanisms. Previously published reports are discussed, and new data obtained with murine B cells and cell lines are presented demonstrating the relationship between alterations in intracellular calcium and immune dysregulation. These data demonstrate a strong association between PAH-induced alterations in B- and T-lymphocyte activation and changes in calcium homeostasis. 111 refs., 6 figs., 1 tab.

  1. Role of developmental immunotoxicity and immune dysfunction in chronic disease and cancer.

    PubMed

    Dietert, Rodney R

    2011-04-01

    The developing immune system is among the most sensitive targets for environmental insult and risk of chronic disease including cancer. Developmental immunotoxicity (DIT)-associated health risks include not only pediatric diseases like childhood asthma and type 1 diabetes, but also multi-disease "patterns" of conditions linked to the initial immune dysfunction. DIT contributes to ever-increasing health care costs, increasing reliance on drugs and reduced quality of life. Drug discovery efforts using cutting-edge immunology produce effective tools for management of allergic, autoimmune and inflammatory diseases; in stark contrast, required immunotoxicity testing clings to an outdated understanding of the immune system and its relationship to disease. As currently required, immune safety evaluation of drugs and chemicals lacks the capability of protecting against the most prevalent pediatric immune dysfunction-based diseases. For this reason, mandatory and relevant DIT testing is needed for all drugs and chemicals where pregnant women and children are at risk.

  2. 'Fluorescent Cell Chip' for immunotoxicity testing: Development of the c-fos expression reporter cell lines

    SciTech Connect

    Trzaska, Dominika; Zembek, Patrycja; Olszewski, Maciej; Adamczewska, Violetta; Ulleras, Erik; Dastych, JarosIaw . E-mail: jdastych@cbm.pan.pl

    2005-09-01

    The Fluorescent Cell Chip for in vitro immunotoxicity testing employs cell lines derived from lymphocytes, mast cells, and monocytes-macrophages transfected with various EGFP cytokine reporter gene constructs. While cytokine expression is a valid endpoint for in vitro immunotoxicity screening, additional marker for the immediate-early response gene expression level could be of interest for further development and refinement of the Fluorescent Cell Chip. We have used BW.5147.3 murine thymoma transfected with c-fos reporter constructs to obtain reporter cell lines expressing ECFP under the control of murine c-fos promoter. These cells upon serum withdrawal and readdition and incubation with heavy metal compounds showed paralleled induction of c-Fos expression as evidenced by Real-Time PCR and ECFP fluorescence as evidenced by computer-supported fluorescence microscopy. In conclusion, we developed fluorescent reporter cell lines that could be employed in a simple and time-efficient screening assay for possible action of chemicals on c-Fos expression in lymphocytes. The evaluation of usefulness of these cells for the Fluorescent Cell Chip-based detection of immunotoxicity will require additional testing with a larger number of chemicals.

  3. Potential preventive role of lactic acid bacteria against aflatoxin M₁ immunotoxicity and genotoxicity in mice.

    PubMed

    Ben Salah-Abbès, Jalila; Abbès, Samir; Jebali, Rania; Haous, Zohra; Oueslati, Ridha

    2015-01-01

    Aflatoxin M1 (AFM1) is a mycotoxin produced by numerous Aspergillus species in pre- or post-harvest cereals and milk. Exposure to AFM1 imparts potent economic losses in the livestock industry. Toxicologically, it also causes severe immune system problems. The aims of this study were to evaluate a new AFM1-binding/degrading microorganism for biologic detoxification, to examine its ability to degrade AFM1 in liquid medium, and to evaluate its potential for in vivo preventative effects against AFM1-induced immunotoxicity and genotoxicity in mice. Lactobacillus plantarum MON03 (LP) isolated from Tunisian artisanal butter was found to display significant binding ability to AFM1 in PBS (93%) within 24 h of incubation. Further, the LP was able to tolerate gastric acidity, bile salts, and adhere efficiently to Caco-3 cells in vitro. The in vivo study used Balb/c mice that received either vehicle (control), LP only (at 1 × 10(9)CFU/L, ∼1 mg/kg bw), AFM1 (100 mg/kg bw), or AFM1 + LP daily for 15 days (by gavage); two other groups received a single dose of colchicine (4 mg/kg) or mitomycin C (1 mg/kg) as positive controls for induction of micronuclei and chromosomal aberrations, respectively. The results showed that, compared to in control mice, AFM1 treatment led to significantly decreased body weight gains, and caused cytotoxic/genotoxic effects as indicated by increases in frequencies of polychromatic erythrocytes, as well as those with micronucleation (PCEMN) and chromosomal aberrations, among bone marrow cells. The concurrent administration of LP with AFM1 strongly reduced the adverse effects of AFM1 on each parameter. Mice receiving AFM1 + LP co-treatment displayed no significant differences in the assayed parameters as compared to the control mice. By itself, the bacteria caused no adverse effects. Based on the data, it is concluded that the test bacteria could potentially be beneficial in the detoxification of AFM1-contaminated foods and feeds

  4. Differential immunotoxic effects of ethanol on murine EL-4 lymphoma and normal lymphocytes is mediated through increased ROS production and activation of p38MAPK.

    PubMed

    Premachandran, Sudha; Khan, Nazir M; Thakur, Vikas S; Shukla, Jyoti; Poduval, T B

    2012-08-01

    Ethanol has been used to achieve thymic depletion in myasthenia gravis patients. Ethanol (95%) has also been used widely in the therapy of many tumors including hepatocellular carcinoma. In light of these findings, we delineated the differential immunotoxic behavior and mechanism of lower concentration of ethanol towards murine EL-4 lymphoma and its normal counterpart lymphocytes. EL-4 lymphoma and normal lymphocytes were cultured with ethanol (0%-5%) for 6 h and cytotoxicity was measured by various methods. EL-4 cells treated with ethanol showed concentration-dependent loss of viability at 2%-5% ethanol concentration and exhibit proliferative arrest at preG1 stage. Acridine-orange and ethidium-bromide staining indicated that ethanol induced death in EL-4 cells, by induction of both apoptosis and necrosis which was further supported by findings of DNA-fragmentation and trypan blue dye exclusion test. However, treatment of lymphocytes with similar concentration of ethanol did not show any death-associated parameters. Furthermore, ethanol induced significantly higher ROS generation in EL-4 cells as compared to lymphocytes and caused PARP cleavage and activation of apoptotic proteins like p53 and Bax, in EL-4 cells and not in normal lymphocytes. In addition, ethanol exposure to EL-4 cells led to phosphorylation of p38MAPK, and upregulation of death receptor Fas (CD95). Taken together, these results suggest that ethanol upto a concentration of 5% caused no significant immunotoxicity towards normal lymphocytes and induced cell death in EL-4 cells via phosphorylation of p38MAPK and regulation of p53 leading to further activation of both extrinsic (Fas) and intrinsic (Bax) apoptotic markers.

  5. Immunotoxic effects of single and combined pharmaceuticals exposure on a harbor seal (Phoca vitulina) B lymphoma cell line.

    PubMed

    Kleinert, Christine; Lacaze, Emilie; Mounier, Méryl; De Guise, Sylvain; Fournier, Michel

    2017-03-02

    The potential risk of pharmaceuticals in the environment to top-predators is still largely unknown. In this study, we assessed the immunotoxic effects of ten pharmaceuticals individually and as mixtures on a harbor seal (Phoca vitulina) B lymphoma cell line. A significant reduction in lymphocyte transformation was observed following an exposure to 12,500μg/L 17α-ethinyl estradiol and 25,000μg/L naproxen. Exposure to 12,500μg/L 17α-ethinyl estradiol decreased the percentage of cell in the G0/G1 phase of the cell cycle while increasing the percentage of cells in the S phase. Carbamazepine exposure increased the amount of cells in the G2/M phase. Binary mixtures showed synergistic effects in lymphocyte transformation, cell cycle and apoptosis assays. Concentrations inducing toxic effects in the cell line were similar to those affecting fish in previous studies. A reduction of functional activities of the immune system may lead to altered host resistance to pathogens in free-ranging pinnipeds.

  6. The effect of ozonization on furniture dust: microbial content and immunotoxicity in vitro.

    PubMed

    Huttunen, Kati; Kauhanen, Eeva; Meklin, Teija; Vepsäläinen, Asko; Hirvonen, Maija-Riitta; Hyvärinen, Anne; Nevalainen, Aino

    2010-05-01

    Moisture and mold problems in buildings contaminate also the furniture and other movable property. If cleaning of the contaminated furniture is neglected, it may continue to cause problems to the occupants even after the moisture-damage repairs. The aim of this study was to determine the effectiveness of high-efficiency ozone treatment in cleaning of the furniture from moisture-damaged buildings. In addition, the effectiveness of two cleaning methods was compared. Samples were vacuumed from the padded areas before and after the treatment. The microbial flora and concentrations in the dust sample were determined by quantitative cultivation and QPCR-methods. The immunotoxic potential of the dust samples was analyzed by measuring effects on cell viability and production of inflammatory mediators in vitro. Concentrations of viable microbes decreased significantly in most of the samples after cleaning. Cleaning with combined steam wash and ozonisation was more effective method than ozonising alone, but the difference was not statistically significant. Detection of fungal species with PCR showed a slight but nonsignificant decrease in concentrations after the cleaning. The immunotoxic potential of the collected dust decreased significantly in most of the samples. However, in a small subgroup of samples, increased concentrations of microbes and immunotoxicological activity were detected. This study shows that a transportable cleaning unit with high-efficiency ozonising is in most cases effective in decreasing the concentrations of viable microbes and immunotoxicological activity of the furniture dust. However, the method does not destroy or remove all fungal material present in the dust, as detected with QPCR analysis, and in some cases the cleaning procedure may increase the microbial concentrations and immunotoxicity of the dust.

  7. Immunotoxicity and genotoxicity testing for in-flight experiments under microgravity

    NASA Astrophysics Data System (ADS)

    Hansen, Peter-Diedrich; Hansen, Peter-Diedrich; Unruh, Eckehardt

    Life Sciences as Related to Space (F) Influence of Spaceflight Environment on Biological Systems (F44) Immunotoxicity and genotoxicity testing for In-flight experiments under microgravity Sensing approaches for ecosystem and human health Author: Peter D. Hansen Technische Universit¨t Berlin, Faculty VI - Planen, Bauen, Umwelt, a Institute for Ecological Research and Technology, Department for Ecotoxicology, Berlin, Germany Peter-diedrich.hansen@tu-berlin.de Eckehardt Unruh Technische Universit¨t Berlin, Faculty VI - Planen, Bauen, Umwelt, Institute a for Ecological Research and Technology, Department for Ecotoxicology, Berlin, Germany An immune response by mussel hemocytes is the selective reaction to particles which are identified as foreign by its immune system shown by phagocytosis. Phagocytotic activity is based on the chemotaxis and adhesion, ingestion and phagosome formation. The attachment at the surface of the hemocytes and consequently the uptake of the particles or bacteria can be directly quantified in the format of a fluorescent assay. Another relevant endpoint of phagocytosis is oxidative burst measured by luminescence. Phagocytosis-related production of ROS will be stimulated with opsonised zymosan. The hemocytes will be stored frozen at -80oC and reconstituted in-flight for the experiment. The assay system of the TRIPLELUX-B Experiment has been performed with a well-defined quantification and evaluation of the immune function phagocytosis. The indicator cells are the hemocytes of blue mussels (Mytilus edulis). The signals of the immuno cellular responses are translated into luminescence as a rapid optical reporter system. The results expected will determine whether the observed responses are caused by microgravity and/or radiation (change in permeability, endpoints in genotoxicity: DNA unwinding). The samples for genotoxicity will be processed after returning to earth. The immune system of invertebrates has not been studied so far in space. The

  8. Immunotoxicity of aflatoxin B1: Impairment of the cell-mediated response to vaccine antigen and modulation of cytokine expression

    SciTech Connect

    Meissonnier, Guylaine M.; Pinton, Philippe; Laffitte, Joelle; Cossalter, Anne-Marie; Gong, Yun Yun; Wild, Christopher P.; Bertin, Gerard; Galtier, Pierre; Oswald, Isabelle P.

    2008-09-01

    Aflatoxin B1 (AFB1), a mycotoxin produced by Aspergillus flavus or A. parasiticus, is a frequent contaminant of food and feed. This toxin is hepatotoxic and immunotoxic. The present study analyzed in pigs the influence of AFB1 on humoral and cellular responses, and investigated whether the immunomodulation observed is produced through interference with cytokine expression. For 28 days, pigs were fed a control diet or a diet contaminated with 385, 867 or 1807 {mu}g pure AFB1/kg feed. At days 4 and 15, pigs were vaccinated with ovalbumin. AFB1 exposure, confirmed by an observed dose-response in blood aflatoxin-albumin adduct, had no major effect on humoral immunity as measured by plasma concentrations of total IgA, IgG and IgM and of anti-ovalbumin IgG. Toxin exposure did not impair the mitogenic response of lymphocytes but delayed and decreased their specific proliferation in response to the vaccine antigen, suggesting impaired lymphocyte activation in pigs exposed to AFB1. The expression level of pro-inflammatory (TNF-{alpha}, IL-1{beta}, IL-6, IFN-{gamma}) and regulatory (IL-10) cytokines was assessed by real-time PCR in spleen. A significant up-regulation of all 5 cytokines was observed in spleen from pigs exposed to the highest dose of AFB1. In pigs exposed to the medium dose, IL-6 expression was increased and a trend towards increased IFN-{gamma} and IL-10 was observed. In addition we demonstrate that IL-6 impaired in vitro the antigenic- but not the mitogenic-induced proliferation of lymphocytes from control pigs vaccinated with ovalbumin. These results indicate that AFB1 dietary exposure decreases cell-mediated immunity while inducing an inflammatory response. These impairments in the immune response could participate in failure of vaccination protocols and increased susceptibility to infections described in pigs exposed to AFB1.

  9. Immunotoxicity activity from the essential oils of coriander (Coriandrum sativum) seeds.

    PubMed

    Chung, Ill-Min; Ahmad, Ateeque; Kim, Eun-Hye; Kim, Seung-Hyun; Jung, Woo-Suk; Kim, Jin-Hoi; Nayeem, Abdul; Nagella, Praveen

    2012-06-01

    The seeds of the Coriandrum sativum were extracted and the essential oil composition and immunotoxicity effects were studied. The analysis of the essential oil was conducted by gas chromatography-mass spectroscopy, which revealed 33 components, representing 99.99% of the total oil from the seeds of coriander. The major components are linalool (55.09%), α-pinene (7.49%), 2,6-Octadien-1-ol, 3,7-dimethyl-, acetate, (E)- (5.70%), geraniol (4.83%), 3-Cyclohexene-1-methanol, α,α,4-trimethyl- (4.72%), hexadecanoic acid (2.65%), tetradecanoic acid (2.49%), 2-α-pinene (2.39%), citronellyl acetate (1.77%), and undecanal (1.29%). The seed oil had significant toxic effects against the larvae of Aedes aegypti with an LC(50) value of 21.55 ppm and LC(90) value of 38.79 ppm. The above data indicate that the major components in the essential oil of coriander play an important role as immunotoxicity on the A. aegypti.

  10. Oral subchronic immunotoxicity study of ethyl tertiary butyl ether in the rat.

    PubMed

    Banton, Marcy I; Peachee, Vanessa L; White, Kimber L; Padgett, Eric L

    2011-01-01

    The potential for immunotoxicological effects of ethyl tertiary butyl ether (ETBE, CAS RN 637-92-3) was studied in young adult female Crl:CD(SD) rats following subchronic oral exposures. Rats were exposed by gavage once daily for 28 consecutive days to 0, 250, 500, or 1000 mg ETBE/kg body weight (BW)/day; a concurrent positive control group received four intraperitoneal injections of at 50 mg cyclophosphamide monohydrate (CPS)/kg/day on study Days 24-27. Immunotoxicity was evaluated using a splenic antibody-forming cell (AFC) assay to assess T-cell-dependent antibody responses in rats sensitized with sheep red blood cells (SRBC). All rats survived to the scheduled necropsy. There were no effects on clinical observations, body weights, feed or water consumption, or macroscopic pathology findings in the ETBE-treated rats. No ETBE-related effects were observed on absolute or relative (to final body weight) spleen or thymus weights, spleen cellularity, or on the specific (AFC/10(6) spleen cells) or total activity (AFC/spleen) of splenic IgM AFC to the T-cell-dependent antigen SRBC. CPS produced expected effects consistent with its known immunosuppressive properties and validated the appropriateness of the AFC assay. Based on the results of this study, ETBE did not suppress the humoral component of the immune system in female rats. The no-observed-effect level for immunotoxicity was the highest dosage tested at 1000 mg/kg/day.

  11. Ecological impacts of the deepwater horizon oil spill: implications for immunotoxicity.

    PubMed

    Barron, Mace G

    2012-01-01

    The Deepwater Horizon (DWH) oil spill was the largest environmental disaster and response effort in U.S. history, with nearly 800 million liters of crude oil spilled. Vast areas of the Gulf of Mexico were contaminated with oil, including deep-ocean communities and over 1,600 kilometers of shoreline. Multiple species of pelagic, tidal, and estuarine organisms; sea turtles; marine mammals; and birds were affected, and over 20 million hectares of the Gulf of Mexico were closed to fishing. Several large-scale field efforts were performed, including assessments of shoreline and wildlife oiling and of coastal waters and sediments. The assessment of injuries, damages, and restoration options for the DWH spill is ongoing. Although petroleum and the polycyclic aromatic hydrocarbon component of oils are known to affect the immune systems of aquatic organisms and wildlife, immunotoxicity is not typically assessed during oil spills and has not been a focus of the DHW assessment. The effects of oil spill contaminants on immune responses are variable and often exposure dependent, but immunotoxic effects seem likely from the DHW spill based on the reported effects of a variety of oils on both aquatic and wildlife species.

  12. Acute and subchronic toxic effects of atrazine and chlorpyrifos on common carp (Cyprinus carpio L.): Immunotoxicity assessments.

    PubMed

    Xing, Houjuan; Liu, Tao; Zhang, Ziwei; Wang, Xiaolong; Xu, Shiwen

    2015-08-01

    Atrazine (ATR) and chlorpyrifos (CPF) are widely used pesticides in agricultural practices throughout world. It has resulted in a series of toxicological and environmental problems, such as impacts on many non-target aquatic species, including fish. The spleen and head kidney in the bony fish are the major hematopoietic organs, and play a crucial part in immune responses. This study evaluated the subchronic effects of ATR and CPF on the mRNA and protein levels of HSP60, HSP70 and HSP90 in the immune organs of common carp and compared the acute and subchronic effects of ATR and CPF on the swimming speed (SS) of common carp. The results of acute toxicity tests showed that the 96 h-LC50 of ATR and CPF for common carp was determined to be 2.142 and 0.582 mg/L, respectively. Meanwhile, acute and subacute toxicity of ATR and CPF in common carp resulted in hypoactivity. We also found that the mRNA and protein levels of HSP60, HSP70 and HSP90 genes were induced in the spleen and head kidney of common carp exposed to ATR and CPF in the subchronic toxicity test. Our results indicate that ATR and CPF are highly toxic to common carp, and hypoactivity in common carp by acute and subchronic toxicity of ATR and CPF may provide a useful tool for assessing the toxicity of triazine herbicide and organophosphorous pesticides to aquatic organisms. In addition, the results from the subchronic toxicity test exhibited that increasing concentration of ATR and CPF in the environment causes considerable stress for common carp, suggesting that ATR and CPF exposure cause immunotoxicity to common carp.

  13. Immunotoxicity of washing soda in a freshwater sponge of India.

    PubMed

    Mukherjee, Soumalya; Ray, Mitali; Ray, Sajal

    2015-03-01

    The natural habitat of sponge, Eunapius carteri faces an ecotoxicological threat of contamination by washing soda, a common household cleaning agent of India. Washing soda is chemically known as sodium carbonate and is reported to be toxic to aquatic organisms. Domestic effluent, drain water and various human activities in ponds and lakes have been identified as the major routes of washing soda contamination of water. Phagocytosis and generation of cytotoxic molecules are important immunological responses offered by the cells of sponges against environmental toxins and pathogens. Present study involves estimation of phagocytic response and generation of cytotoxic molecules like superoxide anion, nitric oxide and phenoloxidase in E. carteri under the environmentally realistic concentrations of washing soda. Sodium carbonate exposure resulted in a significant decrease in the phagocytic response of sponge cells under 4, 8, 16 mg/l of the toxin for 96h and all experimental concentrations of the toxin for 192h. Washing soda exposure yielded an initial increase in the generation of the superoxide anion and nitric oxide followed by a significant decrease in generation of these cytotoxic agents. Sponge cell generated a high degree of phenoloxidase activity under the experimental exposure of 2, 4, 8, 16 mg/l of sodium carbonate for 96 and 192 h. Washing soda induced alteration of phagocytic and cytotoxic responses of E. carteri was indicative to an undesirable shift in their immune status leading to the possible crises of survival and propagation of sponges in their natural habitat.

  14. Immunotoxicity of silicon dioxide nanoparticles with different sizes and electrostatic charge.

    PubMed

    Kim, Jae-Hyun; Kim, Cheol-Su; Ignacio, Rosa Mistica Coles; Kim, Dong-Heui; Sajo, Ma Easter Joy; Maeng, Eun Ho; Qi, Xu-Feng; Park, Seong-Eun; Kim, Yu-Ri; Kim, Meyoung-Kon; Lee, Kyu-Jae; Kim, Soo-Ki

    2014-01-01

    Silicon dioxide (SiO2) nanoparticles (NPs) have been widely used in the biomedical field, such as in drug delivery and gene therapy. However, little is known about the biological effects and potential hazards of SiO2. Herein, the colloidal SiO2 NPs with two different sizes (20 nm and 100 nm) and different charges (L-arginine modified: SiO2 (EN20[R]), SiO2 (EN100[R]); and negative: SiO2 (EN20[-]), SiO2 (EN100[-]) were orally administered (750 mg/kg/day) in female C57BL/6 mice for 14 days. Assessments of immunotoxicity include hematology profiling, reactive oxygen species generation and their antioxidant effect, stimulation assays for B- and T-lymphocytes, the activity of natural killer (NK) cells, and cytokine profiling. In vitro toxicity was also investigated in the RAW 264.7 cell line. When the cellularity of mouse spleen was evaluated, there was an overall decrease in the proliferation of B- and T-cells for all the groups fed with SiO2 NPs. Specifically, the SiO2 (EN20(-)) NPs showed the most pronounced reduction. In addition, the nitric oxide production and NK cell activity in SiO2 NP-fed mice were significantly suppressed. Moreover, there was a decrease in the serum concentration of inflammatory cytokines such as interleukin (IL)-1β, IL-12 (p70), IL-6, tumor necrosis factor-α, and interferon-γ. To elucidate the cytotoxicity mechanism of SiO2 in vivo, an in vitro study using the RAW 264.7 cell line was performed. Both the size and charge of SiO2 using murine macrophage RAW 264.7 cells decreased cell viability dose-dependently. Collectively, our data indicate that different sized and charged SiO2 NPs would cause differential immunotoxicity. Interestingly, the small-sized and negatively charged SiO2 NPs showed the most potent in vivo immunotoxicity by way of suppressing the proliferation of lymphocytes, depressing the killing activity of NK cells, and decreasing proinflammatory cytokine production, thus leading to immunosuppression.

  15. Immunotoxicity assessment for the novel Spleen tyrosine kinase inhibitor R406

    SciTech Connect

    Zhu Yanhong; Herlaar, Ellen; Masuda, Esteban S.; Burleson, Gary R.; Nelson, Andrew J.; Grossbard, Elliott B.; Clemens, George R. . E-mail: gclemens@rigel.com

    2007-06-15

    Spleen tyrosine kinase (Syk) is a novel pharmaceutical target for treatment of allergic, autoimmune, and neoplastic disorders. Previous studies have indicated that Syk signaling plays critical roles in regulating the lymphohematopoietic system. These observations prompted us to investigate whether inhibition of Syk would promote immunotoxicity. In a series of studies, rats were treated orally with R406, at dose levels up to and including 100 mg/kg/day (or its prodrug R788 at dose levels up to and including 100 mg/kg/day, reduced to 50 mg/kg/day for females as MTD was exceeded), a potent Syk inhibitor, twice daily for 28 days. In addition to standard toxicological assessments, immunophenotyping by flow cytometric analysis, and a study of humoral immune response measuring anti-KLH IgM and IgG levels, were undertaken. Other immunotoxicity studies included three host resistance models in female Balb/c mice to further ascertain effects of R406 on innate and acquired immunity. Following R406 treatment, expected immunomodulating effects (e.g., decreased thymic and spleen weight, hypocellularity of bone marrow, and reduced lymphocyte counts, including T and B cells) were observed in the rat studies. These changes essentially resolved during a 14-day treatment-free recovery period. A KLH challenge in rats demonstrated no adverse effects on IgG or IgM response. R788/406, administered orally at dose levels up to and including 80 mg/kg/day for 28 days, did not affect bacterial or viral clearance in the Listeria, Streptococcal, or Influenza host resistance mouse models, respectively. This correlated with previous in vitro macrophage and neutrophil function assays (assessing migration, phagocytosis, oxidative burst and microbicidal activity), which revealed that R406 did not adversely affect macrophage or neutrophil function in innate immune responses. Collectively, these results demonstrate that R406 has minimal functional immunotoxicity notwithstanding its lymphocytopenic

  16. Retrospective evaluation of the impact of functional immunotoxicity testing on pesticide hazard identification and risk assessment.

    PubMed

    Gehen, Sean C; Blacker, Ann M; Boverhof, Darrell R; Hanley, Thomas R; Hastings, Charles E; Ladics, Gregory S; Lu, Haitian; O'Neal, Fredrick O

    2014-05-01

    Conduct of a T-cell-dependent antibody response (TDAR) assay in rodents according to Environmental Protection Agency (EPA) Test Guideline OPPTS 870.7800 is now required for chemical pesticide active ingredients registered in the United States. To assess potential regulatory impact, a retrospective analysis was developed using TDAR tests conducted on 78 pesticide chemicals from 46 separate chemical classes. The objective of the retrospective analysis was to examine the frequency of positive responses and determine the potential for the TDAR to yield lower endpoints than those utilized to calculate reference doses (RfDs). A reduction in the TDAR response was observed at only the high-dose level in five studies, while it was unaltered in the remaining studies. Importantly, for all 78 pesticide chemicals, the TDAR no-observed-adverse-effect levels (TDAR NOAELs) were greater than the NOAELS currently in use as risk assessment endpoints. The TDAR NOAELs were higher than the current EPA-selected endpoints for the chronic RfD, short-term, intermediate and long-term exposure scenarios by 3-27,000, 3-1,688, 3-1,688 and 4.9-1,688 times, respectively. Based on this analysis, conduct of the TDAR assay had minimal impact on hazard identification and did not impact human health risk assessments for the pesticides included in this evaluation. These data strongly support employment of alternative approaches including initial weight-of-evidence analysis for immunotoxic potential prior to conducting functional immunotoxicity testing for pesticide active ingredients.

  17. Immunotoxicity of β-Diketone Antibiotic Mixtures to Zebrafish (Danio rerio) by Transcriptome Analysis

    PubMed Central

    Li, Fanghui; Wang, Hui; Liu, Jinfeng; Lin, Jiebo; Zeng, Aibing; Ai, Weiming; Wang, Xuedong; Dahlgren, Randy A.; Wang, Huili

    2016-01-01

    Fluoroquinolones and tetracyclines are known as β-diketone antibiotics (DKAs) because of bearing a diketone group in their molecular structure. DKAs are the most widely used antibiotics to prevent generation of disease in humans and animals and to suppress bacterial growth in aquaculture. In recent years, overuse of DKAs has caused serious environmental risk due to their pseudo-persistence in the environment, even though their half-lives are not long. So far, no reports were concerned with the joint immunotoxicity of DKAs. Herein, we reported on the immunotoxicity of DKAs on zebrafish after a 3-month DKAs exposure using transcriptomic techniques. According to transcriptome sequencing, 10 differentially expressed genes were screened out among the genes related to KEGG pathways with high enrichment. The identified 7 genes showed to be consistent between RNA-seq and qRT-PCR. Due to DKAs exposure, the content or activity for a series of immune-related biomarkers (Complement 3, lysozyme, IgM and AKP) showed the inconsistent changing trends as compared with the control group. Histopathological observations showed that the number of goblet cells increased sharply, the columnar epithelial cells swelled, the nucleus became slender in intestinal villi, and numerous brown metachromatic granules occurred in spleens of DKAs-exposed groups. Overall, both detection of biomarkers and histopathological observation corroborated that chronic DKAs exposure could result in abnormal expression of immune genes and enzymes, and variable levels of damage to immune-related organs. These complex effects of DKAs may lead to zebrafish dysfunction and occurrence of diseases related to the immune system. PMID:27046191

  18. Overlapping gene expression profiles of model compounds provide opportunities for immunotoxicity screening

    SciTech Connect

    Baken, Kirsten A. Pennings, Jeroen L.A.; Jonker, Martijs J.; Schaap, Mirjam M.; Vries, Annemieke de; Steeg, Harry van; Breit, Timo M.; Loveren, Henk van

    2008-01-01

    In order to investigate immunotoxic effects of a set of model compounds in mice, a toxicogenomics approach was combined with information on macroscopical and histopathological effects on spleens and on modulation of immune function. Bis(tri-n-butyltin)oxide (TBTO), cyclosporin A (CsA), and benzo[a]pyrene (B[a]P) were administered to C57BL/6 mice at immunosuppressive dose levels. Acetaminophen (APAP) was included in the study since indications of immunomodulating properties of this compound have appeared in the literature. TBTO exposure caused the most pronounced effect on gene expression and also resulted in the most severe reduction of body weight gain and induction of splenic irregularities. All compounds caused inhibition of cell division in the spleen as shown by microarray analysis as well as by suppression of lymphocyte proliferation after application of a contact sensitizer as demonstrated in an immune function assay that was adapted from the local lymph node assay. The immunotoxicogenomics approach applied in this study thus pointed to immunosuppression through cell cycle arrest as a common mechanism of action of immunotoxicants, including APAP. Genes related to cell division such as Ccna2, Brca1, Birc5, Incenp, and Cdkn1a (p21) were identified as candidate genes to indicate anti-proliferative effects of xenobiotics in immune cells for future screening assays. The results of our experiments also show the value of group wise pathway analysis for detection of more subtle transcriptional effects and the potency of evaluation of effects in the spleen to demonstrate immunotoxicity.

  19. Developmental Immunotoxicity

    EPA Science Inventory

    Animal models suggest that the immature immune system is more susceptible to xenobiotics than the fully mature system, and sequelae of developmental immunotoxicant exposure may be persistent well into adulthood. Immune maturation may be delayed by xenobiotic exposure and recover...

  20. Immunotoxicity Studies

    EPA Science Inventory

    Immunotoxicology is a subdiscipline of toxicology that focuses on unintended modulation of the immune system. Effects that may occur include immunosuppression, immunostimulation, hypersensitivity, or autoimmunity, which may result in outcomes such as increased incidences of infec...

  1. Systemic and immunotoxicity of pristine and PEGylated multi-walled carbon nanotubes in an intravenous 28 days repeated dose toxicity study

    PubMed Central

    Zhang, Ting; Tang, Meng; Zhang, Shanshan; Hu, Yuanyuan; Li, Han; Zhang, Tao; Xue, Yuying; Pu, Yuepu

    2017-01-01

    The numerous increasing use of carbon nanotubes (CNTs) derived from nanotechnology has raised concerns about their biosafety and potential toxicity. CNTs cause immunologic dysfunction and limit the application of CNTs in biomedicine. The immunological responses induced by pristine multi-walled carbon nanotubes (p-MWCNTs) and PEGylated multi-walled carbon nanotubes (MWCNTs-PEG) on BALB/c mice via an intravenous administration were investigated. The results reflect that the p-MWCNTs induced significant increases in spleen, thymus, and lung weight. Mice treated with p-MWCNTs showed altered lymphocyte populations (CD3+, CD4+, CD8+, and CD19+) in peripheral blood and increased serum IgM and IgG levels, and splenic macrophage ultrastructure indicated mitochondria swelling. p-MWCNTs inhibited humoral and cellular immunity function and were associated with decreased immune responses against sheep erythrocytes and serum hemolysis level. Natural killer (NK) activity was not modified by two types of MWCNTs. In comparison with two types of MWCNTs, for a same dose, p-MWCNTs caused higher levels of inflammation and immunosuppression than MWCNTs-PEG. The results of immunological function suggested that after intravenous administration with p-MWCNTs caused more damage to systemic immunity than MWCNTs-PEG. Here, we demonstrated that a surface functional modification on MWCNTs reduces their immune perturbations in vivo. The chemistry-modified MWCNTs change their preferred immune response in vivo and reduce the immunotoxicity of p-MWCNTs. PMID:28280324

  2. Systemic and immunotoxicity of pristine and PEGylated multi-walled carbon nanotubes in an intravenous 28 days repeated dose toxicity study.

    PubMed

    Zhang, Ting; Tang, Meng; Zhang, Shanshan; Hu, Yuanyuan; Li, Han; Zhang, Tao; Xue, Yuying; Pu, Yuepu

    2017-01-01

    The numerous increasing use of carbon nanotubes (CNTs) derived from nanotechnology has raised concerns about their biosafety and potential toxicity. CNTs cause immunologic dysfunction and limit the application of CNTs in biomedicine. The immunological responses induced by pristine multi-walled carbon nanotubes (p-MWCNTs) and PEGylated multi-walled carbon nanotubes (MWCNTs-PEG) on BALB/c mice via an intravenous administration were investigated. The results reflect that the p-MWCNTs induced significant increases in spleen, thymus, and lung weight. Mice treated with p-MWCNTs showed altered lymphocyte populations (CD3(+), CD4(+), CD8(+), and CD19(+)) in peripheral blood and increased serum IgM and IgG levels, and splenic macrophage ultrastructure indicated mitochondria swelling. p-MWCNTs inhibited humoral and cellular immunity function and were associated with decreased immune responses against sheep erythrocytes and serum hemolysis level. Natural killer (NK) activity was not modified by two types of MWCNTs. In comparison with two types of MWCNTs, for a same dose, p-MWCNTs caused higher levels of inflammation and immunosuppression than MWCNTs-PEG. The results of immunological function suggested that after intravenous administration with p-MWCNTs caused more damage to systemic immunity than MWCNTs-PEG. Here, we demonstrated that a surface functional modification on MWCNTs reduces their immune perturbations in vivo. The chemistry-modified MWCNTs change their preferred immune response in vivo and reduce the immunotoxicity of p-MWCNTs.

  3. Characterization of human lymphoblastoid cell lines as a novel in vitro test system to predict the immunotoxicity of xenobiotics.

    PubMed

    Markovič, Tijana; Gobec, Martina; Gurwitz, David; Mlinarič-Raščan, Irena

    2015-02-17

    Evaluating immunomodulatory effects of xenobiotics is an important component of the toxicity studies. Herein we report on the establishment of a novel invitro test system for the immunotoxicity screening of xenobiotics based on human lymphoblastoid cell lines (LCLs). Four immunotoxic compounds; tributyltin chloride, cyclosporine A, benzo(a)pyrene and verapamil hydrochloride, as well as three immune-inert compounds; urethane, furosemide and mannitol were selected for characterization. The treatment of LCLs with immunosuppressive compounds resulted in reduced viability. The IC50 values determined in human LCLs were in agreement with the data obtained for human peripheral mononuclear cells. Since cytokine production reflects lymphocytes responses to external stimuli, we evaluated the functional responses of LCLs by monitoring their pro-inflammatory and immunoregulatory cytokine production. Our findings prove that LCLs allowed for reliable differentiation between immunomodulatory and immune-inert compounds. Hence, pre-treatment with immunomodulatory compounds led to a decrease in the production of pro-inflammatory TNFα, IL-6 and immunoregulatory IL-2, IL-4, IL-10 and IFNγ cytokines, when compared to untreated ionomycin/PMA stimulated cells. Moreover, testing a panel of ten LCLs derived from unrelated healthy individuals reflects inter-individual variability in response to immunomodulatory xenobiotics. In conclusion, LCLs provide a novel alternative method for the testing of the immunotoxic effects of xenobiotics.

  4. Vitamin E pretreatment prevents the immunotoxicity of dithiocarbamate pesticide mancozeb in vitro: A comparative age-related assessment in mice and chick.

    PubMed

    Singh, Saurabh Kumar; Bano, Farhad; Mohanty, Banalata

    2016-01-01

    Pesticides used for crop protection cause life-threatening diseases affecting the immune system of non-target organisms including birds and mammals. Functionality of immune system is age-dependent; early- as well as old-life stages are more susceptible to toxic exposures because of less competent immune system. Vitamins are so far known to reduce toxic effect of several pesticides and/or xenobiotics. The present in vitro study elucidated immunotoxicity of fungicide mancozeb through comparable stages of immune system maturation in mice (1, 3, and 12months) and chicks (4, 8, and 11weeks). In vitro splenocytes viability on exposure to mancozeb was quantitatively assessed by MTT assay and qualitatively by acridine orange and ethidium bromide (AO/EB) double fluorescence staining. Mancozeb exposure dose dependently (250, 500, 1000, 2500, 5000 and 10,000ng/ml) decreased the splenocytes viability. The in vitro preventive effect of Vitamin E has also been explored on toxicity induced by mancozeb. The increased susceptibility observed both in early and aged groups was due to less/decline competence of the immune system.

  5. Immunotoxicity activity from various essential oils of Angelica genus from South Korea against Aedes aegypti L.

    PubMed

    Chung, Ill-Min; Kim, Eun-Hye; Lee, Jai-Heon; Lee, Young-Choon; Moon, Hyung-In

    2012-02-01

    The leaves of Angelica anomala Lallemant, Angelica cartilagino-marginata var. distans (Nakai) Kitag, Angelica czernevia (Fisch. et Meyer) Kitagawa, Angelica dahurica Benth. et Hooker, Angelica decursiva (Miq.) Franch. & Sav, Angelica fallax Boissieu, Angelica gigas Nakai, Angelica japonica A. gray were essential oil extracted and immunotoxicity effects were studied. The Angelica anomala, A. cartilagino-marginata var. distans, A. czernevia, A. dahurica, A. decursiva, A. fallax, A. gigas, A. japonica essential oil yield were 4.13, 4.83, 4.45, 3.25, 4.11, 4.73, 4.34 and 4.21%. The A. dahurica essential oil had a significant toxic effect against early fourth-stage larvae of Aedes aegypti L with a lethal concentration 50 (LC₅₀) value of 43.12 ppm and an LC₉₀ value of 65.23 ppm. The above indicates that essential oil contents may play a more important role in the toxicity of essential oil.

  6. In vitro immunotoxicity assessment of culture-derived extracellular vesicles in human monocytes

    PubMed Central

    Rosas, Lucia E.; Elgamal, Ola A.; Mo, Xiaokui; Phelps, Mitch A.; Schmittgen, Thomas D.; Papenfuss, Tracey L.

    2016-01-01

    The potential to engineer extracellular vesicles (EV) that target specific cells and deliver a therapeutic payload has propelled a growing interest in their development as promising therapeutics. These EV are often produced from cultured cells. Very little is known about the interaction of cell culture-derived EV with cells of the immune system and their potential immunomodulatory effects. The present study evaluated potential immunotoxic effects of HEK293T-derived EV on the human monocytic cell lines THP-1 and U937. Incubation of cells with different doses of EV for 16–24 h was followed by assessment of cytotoxicity and cell function by flow cytometry. Changes in cell functionality were evaluated by the capacity of cells to phagocytize fluorescent microspheres. In addition, the internalization of labeled EV in THP-1 and U937 cells was evaluated. Exposure to EV did not affect the viability of THP-1 or U937 cells. Although lower doses of the EV increased phagocytic capacity in both cell lines, phagocytic efficiency of individual cells was not affected by EV exposure at any of the doses evaluated. This study also demonstrated that THP-1 and U937 monocytic cells are highly permissive to EV entry in a dose-response manner. These results suggest that, although HEK293T-derived EV are efficiently internalized by human monocytic cells, they do not exert a cytotoxic effect or alter phagocytic efficiency on the cell lines evaluated. PMID:27075513

  7. Arsenic Exposure and Immunotoxicity: a Review Including the Possible Influence of Age and Sex.

    PubMed

    Ferrario, Daniele; Gribaldo, Laura; Hartung, Thomas

    2016-03-01

    Increasing evidence suggests that inorganic arsenic, a major environmental pollutant, exerts immunosuppressive effects in epidemiological, in vitro, and animal models. The mechanisms, however, remain unclear, and little is known about variation in susceptibilities due to age and sex. We performed a review of the experimental and epidemiologic evidence on the association of arsenic exposure and immune diseases. The majority of the studies described arsenic as a potent immunosuppressive compound, though others have reported an increase in allergy and autoimmune diseases, suggesting that arsenic may also act as an immune system stimulator, depending on the dose or timing of exposure. Limited information, due to either the high concentrations of arsenic used in in vitro studies or the use of non-human data for predicting human risks, is available from experimental studies. Moreover, although there is emerging evidence that health effects of arsenic manifest differently between men and women, we found limited information on sex differences on the immunotoxic effects of arsenic. In conclusion, preliminary data show that chronic early-life exposure to arsenic might impair immune responses, potentially leading to increased risk of infections and inflammatory-like diseases during childhood and in adulthood. Further investigation to evaluate effects of arsenic exposure on the developing immune system of both sexes, particularly in human cells and using concentrations relevant to human exposure, should be a research priority.

  8. Lysozyme activity in earthworm (Lumbricus terrestris) coelomic fluid and coelomocytes: Enzyme assay for immunotoxicity of xenobiotics

    SciTech Connect

    Goven, A.J.; Chen, S.C.; Fitzpatrick, L.C. . Dept. of Biological Sciences); Venables, B.J. . Dept. of Biological Sciences TRAC Laboratories Inc., Denton, TX )

    1994-04-01

    Lysozyme activity in earthworm (Lumbricus terrestris) coelomic fluid and coelomocytes appears sufficiently sensitive for use as a nonmammalian biomarker to detect toxic effects of sublethal body burdens of Cu[sup 2+]. Lysozyme, a phylogenetically conserved enzyme, is capable of bactericidal activity via action on peptidoglycan of gram-positive bacterial cell walls and functions as a component of an organism's innate antimicrobial defense mechanism. Coelomic fluid and coelomocyte lysozyme activities, which exhibit temperature-response patterns similar to those of human saliva, plasma, serum and leukocyte extracts, were sensitive to Cu[sup 2+] exposure. Lysozyme activity of coelomic fluid and coelomocyte extracts from earthworms exposed for 5 d to CuSO[sub 4], using filter paper contact exposure, decreased with increasing sublethal Cu[sup 2+] concentrations of 0.05 and 0.1 [mu]g/cm[sup 2]. Compared to controls, coelomic fluid lysozyme activity was suppressed significantly at both exposure concentrations, whereas coelomocyte extract lysozyme activity was suppressed significantly at the 0.1-[mu]g/cm[sup 2] exposure concentration. Low inherent natural variability and sensitivity to sublethal Cu[sup 2+] body burdens indicate that lysozyme activity has potential as a biomarker for assaying immunotoxicity of metals.

  9. Phagocytosis in earthworms: An environmentally acceptable endpoint to assess immunotoxic potential of contaminated soils

    SciTech Connect

    Giggleman, M.A.; Fitzpatrick, L.C.; Goven, A.J.; Venables, B.J.; Callahan, C.A.

    1995-12-31

    Phagocytosis, a host-defense mechanism phylogenetically conserved throughout the animal kingdom, by earthworm (Lumbricus terrestris) coelomocytes has potential as a surrogate for vertebrates to be used as an environmentally acceptable endpoint to assess sublethal immunotoxic risks of contaminated soils to environmental (eg. higher wildlife) and public health. Coelomocytes can be exposed in vivo to complex contaminated parent soils by placing earthworms in situ at hazardous waste sites (HWS) or into soil samples and their dilutions with artificial soil (AS) in the laboratory, or in vitro to soil extracts and their fractionations. Here the authors report on phagocytosis by coelomocytes in earthworms exposed to pentachlorophenol (PCP) contaminated soils from a wood treatment HWS, PCP-spiked AS and PCP treated filter paper (FP). HWS soil was diluted to 25% with AS to a sublethal concentration (ca. 125 mg kg{sup {minus}1}) and earthworms exposed for 14d at 10 C under light conditions. AS was spiked at ca. 125 mg kg{sup {minus}1} PCP and earthworms were similarly exposed. Controls for both consisted of earthworms exposed to 100% AS. Earthworms were exposed to FP treated with a sublethal PCP concentration (15 {micro}g cm{sup {minus}2}) at 10 C under dark conditions for 96H. Controls were similarly exposed without PCP. Phagocytosis by coelomocytes in earthworms exposed to HWS soil, spiked AS and treated FP was suppressed 37, 41 and 29%, respectively. Results are discussed in terms of PCP body burdens and exposure protocols.

  10. Pre-clinical immunotoxicity studies of nanotechnology-formulated drugs: Challenges, considerations and strategy.

    PubMed

    Dobrovolskaia, Marina A

    2015-12-28

    Assorted challenges in physicochemical characterization, sterilization, depyrogenation, and in the assessment of pharmacology, safety, and efficacy profiles accompany pre-clinical development of nanotechnology-formulated drugs. Some of these challenges are not unique to nanotechnology and are common in the development of other pharmaceutical products. However, nanoparticle-formulated drugs are biochemically sophisticated, which causes their translation into the clinic to be particularly complex. An understanding of both the immune compatibility of nanoformulations and their effects on hematological parameters is now recognized as an important step in the (pre)clinical development of nanomedicines. An evaluation of nanoparticle immunotoxicity is usually performed as a part of a traditional toxicological assessment; however, it often requires additional in vitro and in vivo specialized immuno- and hematotoxicity tests. Herein, I review literature examples and share the experience with the NCI Nanotechnology Characterization Laboratory assay cascade used in the early (discovery-level) phase of pre-clinical development to summarize common challenges in the immunotoxicological assessment of nanomaterials, highlight considerations and discuss solutions to overcome problems that commonly slow or halt the translation of nanoparticle-formulated drugs toward clinical trials. Special attention will be paid to the grand-challenge related to detection, quantification and removal of endotoxin from nanoformulations, and practical considerations related to this challenge.

  11. Potential for early-life immune insult including developmental immunotoxicity in autism and autism spectrum disorders: focus on critical windows of immune vulnerability.

    PubMed

    Dietert, Rodney R; Dietert, Janice M

    2008-10-01

    Early-life immune insults (ELII) including xenobiotic-induced developmental immunotoxicity (DIT) are important factors in childhood and adult chronic diseases. However, prenatal and perinatal environmentally induced immune alterations have yet to be considered in depth in the context of autism and autism spectrum disorders (ASDs). Numerous factors produce early-life-induced immune dysfunction in offspring, including exposure to xenobiotics, maternal infections, and other prenatal-neonatal stressors. Early life sensitivity to ELII, including DIT, results from the heightened vulnerability of the developing immune system to disruption and the serious nature of the adverse outcomes arising after disruption of one-time immune maturational events. The resulting health risks extend beyond infectious diseases, cancer, allergy, and autoimmunity to include pathologies of the neurological, reproductive, and endocrine systems. Because these changes may include misregulation of resident inflammatory myelomonocytic cells in tissues such as the brain, they are a potential concern in cases of prenatal-neonatal brain pathologies and neurobehavioral deficits. Autism and ASDs are chronic developmental neurobehavioral disorders that are on the rise in the United States with prenatal and perinatal environmental factors suspected as contributors to this increase. Evidence for an association between environmentally associated childhood immune dysfunction and ASDs suggests that ELII and DIT may contribute to these conditions. However, it is not known if this linkage is directly associated with the brain pathologies or represents a separate (or secondary) outcome. This review considers the known features of ELII and DIT and how they may provide important clues to prenatal brain inflammation and the risk of autism and ASDs.

  12. Data Mining as a Guide for the Construction of Cross-Linked Nanoparticles with Low Immunotoxicity via Control of Polymer Chemistry and Supramolecular Assembly.

    PubMed

    Elsabahy, Mahmoud; Wooley, Karen L

    2015-06-16

    The potential immunotoxicity of nanoparticles that are currently being approved, in different phases of clinical trials, or undergoing rigorous in vitro and in vivo characterizations in several laboratories has recently raised special attention. Products with no apparent in vitro or in vivo toxicity may still trigger various components of the immune system unintentionally and lead to serious adverse reactions. Cytokines are one of the useful biomarkers for predicting the effect of biotherapeutics on modulation of the immune system and for screening the immunotoxicity of nanoparticles both in vitro and in vivo, and they were recently found to partially predict the in vivo pharmacokinetics and biodistribution of nanomaterials. Control of polymer chemistry and supramolecular assembly provides a great opportunity for the construction of biocompatible nanoparticles for biomedical clinical applications. However, the sources of data collected regarding immunotoxicities of nanomaterials are diverse, and experiments are usually conducted using different assays under specific conditions. As a result, making direct comparisons nearly impossible, and thus, tailoring the properties of nanomaterials on the basis of the available data is challenging. In this Account, the effects of chemical structure, cross-linking, degradability, morphology, concentration, and surface chemistry on the immunotoxicity of an expansive array of polymeric nanomaterials will be highlighted, with a focus on assays conducted using the same in vitro and in vivo models and experimental conditions. Furthermore, numerical descriptive values have been utilized uniquely to stand for induction of cytokines by nanoparticles. This treatment of available data provides a simple way to compare the immunotoxicities of various nanomaterials, and the values were found to correlate well with published data. On the basis of the polymeric systems investigated in this study, valuable information has been collected that

  13. Immunotoxic effects of in vitro exposure of dolphin lymphocytes to Louisiana sweet crude oil and Corexit™.

    PubMed

    White, Natasha D; Godard-Codding, Celine; Webb, Sarah J; Bossart, Gregory D; Fair, Patricia A

    2016-11-20

    The Deepwater Horizon oil spill was one of the worst environmental disasters on record in the United States. Response efforts to reduce the magnitude of the oil slick included the use of thousands of gallons of the chemical dispersant Corexit™ in surface and deep-water environments. The immunotoxicity of Louisiana sweet crude oil and the chemical dispersant Corexit was examined using lymphocyte proliferation (LP) and natural killer cell (NK) assays as measures of impact on the adaptive (LP) and innate (NK) immune response in bottlenose dolphins. Study results show that both high-energy media-accommodated fractions (MAF) and chemically enhanced MAF (CEMAF) mixtures modulate immune function. Following exposure to Louisiana sweet crude, both B- and T-cell proliferation of white blood cells was increased for all exposure concentrations, compared to control; however, this increase was only significant for the 50% and 100% treatments. In contrast, exposure of white blood cells to the CEMAF mixture significantly decreased both T- and B-cell proliferation in the 25%, 50% and 100% treatments. NK cell activity was enhanced significantly by CEMAF mixtures for the 50% and 100% treatments. The immunosuppression of LP at environmentally relevant concentrations of oil and dispersant suggests that marine mammals may be unable to mount an adequate defense against xenobiotic threats following exposure to oil and dispersant, leaving them more susceptible to disease. In contrast, NK cell activity was significantly enhanced, which may increase an organism's tumor or viral surveillance ability by mounting an enhanced immune response. Copyright © 2016 John Wiley & Sons, Ltd.

  14. Effect of Different Selenium Supplementation Levels on Oxidative Stress, Cytokines, and Immunotoxicity in Chicken Thymus.

    PubMed

    Wang, Yachao; Jiang, Li; Li, Yuanfeng; Luo, Xuegang; He, Jian

    2016-08-01

    This study assessed the effects of different selenium (Se) supplementation levels on oxidative stress, cytokines, and immunotoxicity in chicken thymus. A total of 180 laying hens (1 day old; Mianyang, China) were randomly divided into 4 groups (n = 45). The chickens were maintained either on a basic diet (control group) containing 0.2 mg/kg Se, a low-supplemented diet containing 5 mg/kg Se, a medium-supplemented diet containing 10 mg/kg Se, or a high-supplemented diet containing 15 mg/kg Se for 15, 30, and 45 days, respectively. Over the entire experimental period, serum and thymus samples were collected and used for the detection of the experimental index. The results indicated that the antioxidative enzyme activities and messenger RNA (mRNA) levels of antioxidative enzymes, IFN-γ and IL-2 in the thymus, and the content of IFN-γ and IL-2 in the serum of excessive-Se-treated chickens at all time points (except for the 5 mg/kg Se supplement group at 15 days) were significantly decreased (P < 0.05) compared to the corresponding control groups. Interestingly, a significantly increase (P < 0.05) in the content of IFN-γ was observed in the serum and thymus in the 5 mg/kg Se supplement group at 15 and 30 days compared to the corresponding control groups. In histopathological examination, the thymus tissue from excessive-Se-treated chickens revealed different degrees of cortex drop, incrassation of the medulla, and degeneration of the reticular cells. These results suggested that the excessive Se could result in a decrease in immunity, an increase in oxidative damage, and a series of clinical pathology changes, such as cortex drop, incrassation of the medulla, and degeneration of the reticular cells.

  15. An organotin mixture found in polyvinyl chloride (PVC) pipe is not immunotoxic to adult Sprague-Dawley rats.

    PubMed

    DeWitt, Jamie C; Copeland, Carey B; Luebke, Robert W

    2008-01-01

    Organotin compounds used in polyvinyl chloride (PVC) pipe production are of concern to the U.S. Environmental Protection Agency (EPA) because they leach from supply pipes into drinking water and are reported multisystem toxicants. Immune function was assessed in male Sprague-Dawley rats exposed to the mixture of organotins used in PVC pipe production. Although several of these organotins are reported immunotoxicants, their immunotoxicity as a mixture when given by drinking water has not been evaluated. Adult male rats were given drinking water for 28 d containing a mixture of dibutyltin dichloride (DBTC), dimethyltin dichloride (DMTC), monobutyltin trichloride (MBT), and monomethyltin trichloride (MMT) in a 2:2:1:1 ratio, respectively, at 3 different concentrations (5:5:2.5:2.5, 10:10:5:5, or 20:20:10:10 mg organotin/L), MMT alone (20 or 40 mg MMT/L), or plain water as a control. Delayed-type hypersensitivity, antibody synthesis, and natural killer cell cytotoxicity were evaluated in separate endpoint groups (n = 8/dose; 24/endpoint) immediately after exposure ended. The evaluated immune functions were not affected by the mixture or by MMT alone. Our data suggest that immunotoxicity is unlikely to result from the concentration of organotins present in drinking water delivered via PVC pipes, as the concentrations used were several orders of magnitude higher than those expected to leach from PVC pipes.

  16. Biological and immunotoxicity evaluation of antimicrobial peptide-loaded coatings using a layer-by-layer process on titanium

    PubMed Central

    Shi, Jue; Liu, Yu; Wang, Ying; Zhang, Jing; Zhao, Shifang; Yang, Guoli

    2015-01-01

    The prevention and control of peri-implantitis is a challenge in dental implant surgery. Dental implants with sustained antimicrobial coating are an ideal way of preventing peri-implantitis. This study reports development of a non- immunotoxicity multilayered coating on a titanium surface that had sustained antimicrobial activity and limited early biofilm formation. In this study, the broad spectrum AMP, Tet213, was linked to collagen IV through sulfo-SMPB and has been renamed as AMPCol. The multilayer AMPCol coatings were assembled on smooth titanium surfaces using a LBL technique. Using XPS, AFM, contact angle analysis, and QCM, layer-by-layer accumulation of coating thickness was measured and increased surface wetting compared to controls was confirmed. Non-cytotoxicity to HaCaT and low erythrocyte hemolysis by the AMPCol coatings was observed. In vivo immunotoxicity assays showed IP administration of AMPCol did not effect serum immunoglobulin levels. This coating with controlled release of AMP decreased the growth of both a Gram-positive aerobe (Staphylococcus aureus) and a Gram-negative anaerobe (Porphyromonas gingivalis) up to one month. Early S. aureus biofilm formation was inhibited by the coating. The excellent long-term sustained antimicrobial activity of this multilayer coating is a potential method for preventing peri-implantitis through coated on the neck of implants before surgery. PMID:26548760

  17. Biological and immunotoxicity evaluation of antimicrobial peptide-loaded coatings using a layer-by-layer process on titanium.

    PubMed

    Shi, Jue; Liu, Yu; Wang, Ying; Zhang, Jing; Zhao, Shifang; Yang, Guoli

    2015-11-09

    The prevention and control of peri-implantitis is a challenge in dental implant surgery. Dental implants with sustained antimicrobial coating are an ideal way of preventing peri-implantitis. This study reports development of a non- immunotoxicity multilayered coating on a titanium surface that had sustained antimicrobial activity and limited early biofilm formation. In this study, the broad spectrum AMP, Tet213, was linked to collagen IV through sulfo-SMPB and has been renamed as AMPCol. The multilayer AMPCol coatings were assembled on smooth titanium surfaces using a LBL technique. Using XPS, AFM, contact angle analysis, and QCM, layer-by-layer accumulation of coating thickness was measured and increased surface wetting compared to controls was confirmed. Non-cytotoxicity to HaCaT and low erythrocyte hemolysis by the AMPCol coatings was observed. In vivo immunotoxicity assays showed IP administration of AMPCol did not effect serum immunoglobulin levels. This coating with controlled release of AMP decreased the growth of both a Gram-positive aerobe (Staphylococcus aureus) and a Gram-negative anaerobe (Porphyromonas gingivalis) up to one month. Early S. aureus biofilm formation was inhibited by the coating. The excellent long-term sustained antimicrobial activity of this multilayer coating is a potential method for preventing peri-implantitis through coated on the neck of implants before surgery.

  18. Biological and immunotoxicity evaluation of antimicrobial peptide-loaded coatings using a layer-by-layer process on titanium

    NASA Astrophysics Data System (ADS)

    Shi, Jue; Liu, Yu; Wang, Ying; Zhang, Jing; Zhao, Shifang; Yang, Guoli

    2015-11-01

    The prevention and control of peri-implantitis is a challenge in dental implant surgery. Dental implants with sustained antimicrobial coating are an ideal way of preventing peri-implantitis. This study reports development of a non- immunotoxicity multilayered coating on a titanium surface that had sustained antimicrobial activity and limited early biofilm formation. In this study, the broad spectrum AMP, Tet213, was linked to collagen IV through sulfo-SMPB and has been renamed as AMPCol. The multilayer AMPCol coatings were assembled on smooth titanium surfaces using a LBL technique. Using XPS, AFM, contact angle analysis, and QCM, layer-by-layer accumulation of coating thickness was measured and increased surface wetting compared to controls was confirmed. Non-cytotoxicity to HaCaT and low erythrocyte hemolysis by the AMPCol coatings was observed. In vivo immunotoxicity assays showed IP administration of AMPCol did not effect serum immunoglobulin levels. This coating with controlled release of AMP decreased the growth of both a Gram-positive aerobe (Staphylococcus aureus) and a Gram-negative anaerobe (Porphyromonas gingivalis) up to one month. Early S. aureus biofilm formation was inhibited by the coating. The excellent long-term sustained antimicrobial activity of this multilayer coating is a potential method for preventing peri-implantitis through coated on the neck of implants before surgery.

  19. Immunotoxic effects of sodium tungstate dihydrate on female B6C3F1/N mice when administered in drinking water.

    PubMed

    Frawley, Rachel P; Smith, Matthew J; White, Kimber L; Elmore, Susan A; Herbert, Ron; Moore, Rebecca; Staska, Lauren M; Behl, Mamta; Hooth, Michelle J; Kissling, Grace E; Germolec, Dori R

    2016-09-01

    Tungsten is a naturally occurring, high-tensile strength element that has been used in a number of consumer products. Tungsten has been detected in soil, waterways, groundwater, and human tissue and body fluids. Elevated levels of tungsten in urine were reported for populations exposed to tungstate in drinking water in areas where natural tungsten formations were prevalent. Published reports indicated that sodium tungstate may modulate hematopoiesis, immune cell populations, and immune responses in rodent models. The objective of this study was to assess potential immunotoxicity of sodium tungstate dihydrate (STD), a drinking water contaminant. Female B6C3F1/N mice received 0-2000 mg STD/L in their drinking water for 28 d, and were evaluated for effects on immune cell populations in spleen and bone marrow, and humoral-mediated, cell-mediated, and innate immunity. Three different parameters of cell-mediated immunity were similarly affected at 1000 mg STD/L. T-cell proliferative responses against allogeneic leukocytes and anti-CD3 were decreased 32%, and 21%, respectively. Cytotoxic T-lymphocyte activity was decreased at all effector:target cell ratios examined. At 2000 mg STD/L, the absolute numbers of CD3(+) T-cell progenitor cells in bone marrow were increased 86%, but the alterations in B-lymphocyte and other progenitor cells were not significant. There were no effects on bone marrow DNA synthesis or colony forming capabilities. STD-induced effects on humoral-mediated immunity, innate immunity, and splenocyte sub-populations were limited. Enhanced histopathology did not detect treatment-related lesions in any of the immune tissues. These data suggest exposure to STD in drinking water may adversely affect cell-mediated immunity.

  20. Size distribution effects of cadmium tellurium quantum dots (CdS/CdTe) immunotoxicity on aquatic organisms.

    PubMed

    Bruneau, A; Fortier, M; Gagne, F; Gagnon, C; Turcotte, P; Tayabali, A; Davis, T L; Auffret, M; Fournier, M

    2013-03-01

    The increasing use of products derived from nanotechnology has raised concern about their potential toxicity to aquatic life. This study sought to examine the comparative immunotoxicity of capped cadmium sulphide/cadmium telluride (CdS/CdTe) quantum dots (QDs) and possible impact of particle/aggregate size on two bivalves (Mytilus edulis and Elliptio complanata) and a fish (Oncorhynchus mykiss). The QDs were dispersed in sterile water and fractionated using a series of micro/ultrafiltration membranes of decreasing pore size: 450 nm, 100 nm, 50 nm, 25 nm, 100 kDa (6.8 nm), 30 kDa (4.6 nm), 10 kDa (3.2 nm) and 1 kDa (1.5 nm). The total concentrations of cadmium and tellurium were determined for the filtered material and for that retained on the filters (retentate). The immunotoxicity was determined by measuring cell viability and phagocytosis. Results revealed that nanoparticles retained on the ultrafilters had a higher Cd/Te ratio compared to the permeate fraction (ratio of 5 and 2 respectively) which could indicate that the CdS core was not associated with the permeable fraction of Cd. Our results demonstrate that the toxicity of CdS/CdTe QDs was concentration and size dependent. Large CdS/CdTe QD aggregates (25 nm < size < 100 nm) reduced phagocytosis more than did smaller nanoparticles (<25 nm). Moreover, our results revealed that the different species responded differently to these fractions. Mytilus edulis hemocytes were less sensitive to CdS/CdTe QDs than the Oncorhynchus mykiss macrophage and Elliptio complanata hemocytes.

  1. In vitro immunotoxicity of untreated and treated urban wastewaters using various treatment processes to rainbow trout leucocytes.

    PubMed

    Gagné, François; Fortier, Marlène; Fournier, Michel; Smyth, Shirley-Anne

    2013-07-01

    Municipal effluents are known to impede the immune system of aquatic organisms. The purpose of this study was to examine the immunotoxicity of urban wastewaters before and after 6 treatment processes from 12 cities toward trout leucocytes. Freshly prepared trout leucocytes were exposed to increasing concentrations of solid phase (C18) extracts of wastewaters for 24 hr at 150C. Immunocompetence was determined by following changes in leucocyte viability and the proportion of cells able to ingest at least one (immunoactivity) and at least three (immunoefficiency) fluorescent beads. The influents were treated by six different treatment strategies consisting of facultative aerated lagoons, activated sludge, biological aerated filter, biological nutrient removal, chemically-assisted physical treatment and trickling filter/solid contact. Water quality parameters of the wastewaters revealed that the plants effectively removed total suspended solids and reduced the chemical oxygen demand. The results revealed that the effluents' immunotoxic properties were generally more influenced by the properties of the untreated wastewaters than by the treatment processes. About half of the incoming influents decreased leucocyte viability while 4 treatment plants were able to reduce toxicity. The influents readily increased phagocytosis activity for 8/12 influents while it was decreased in 4/12 influents. This increase was abolished for 4/12 of the effluents using treatments involving biological and oxidative processes. In conclusion, municipal effluents have the potential to alter the immune system in fish and more research will be needed to improve the treatments of wastewaters to better protect the quality of the aquatic environment.

  2. Inhibition of cytochrome P-450 with 2-diethylamino-ethyl-2,2-diphenylpropylacetate (SKF-525A) reduces immunotoxicity of chlorinated carbohydrates.

    PubMed

    Zabrodskii, P F; Mandych, V G; Germanchuk, V G

    2006-09-01

    Experiments on outbred albino rats showed that single intraperitoneal injection of cytochrome P-450 inhibitor 2-diethylaminoethyl-2,2-diphenylpropylacetate (SKF-525A) in a dose of 50 mg/kg before acute poisoning with 1,2-dichloroethane and trichloroethane in a dose of 1.0 LD(50), metabolized in the body to compounds with higher toxicity (the phenomenon of "lethal synthesis") reduced their immunotoxicity by decreasing the formation of their biotransformation products.

  3. In vivo immunotoxicity of SiO2@(Y0.5Gd0.45Eu0.05)2O3 as dual-modality nanoprobes.

    PubMed

    Tian, Xiumei; Li, Ermao; Yang, Fanwen; Peng, Ye; Zhu, Jixiang; He, Fupo; Chen, Xiaoming

    2014-08-07

    We have successfully synthesized SiO2@(Y0.5Gd0.45Eu0.05)2O3 nanocomposites as a potential dual-modality nanoprobe for molecular imaging in vitro. However, their immunotoxicity assessment in vivo remains unknown. In this article, the in vitro biocompatibility of our dual-modality nanoprobes was assayed in terms of cell viability and apoptosis. In vivo immunotoxicity was investigated by monitoring the generation of reactive oxygen species (ROS), cluster of differentiation (CD) markers and cytokines in Balb/c mice. The data show that the in vitro biocompatibility was satisfactory. In addition, the immunotoxicity data revealed there are no significant changes in the expression levels of CD11b and CD71 between the nanoprobe group and the Gd in a diethylenetriaminepentaacetic acid (DTPA) chelator (Gd-DTPA) group 24 h after injection in Balb/c mice (p>0.05). Importantly, there are significant differences in the expression levels of CD206 and CD25 as well as the secretion of IL-4 and the generation of ROS 24 h after injection (p<0.05). Transmission electron microscopy (TEM) images showed that few nanoprobes were localized in the phagosomes of liver and lung. In conclusion, the toxic effects of our nanoprobes may mainly result from the aggregation of particles in phagosomes. This accumulation may damage the microstructure of the cells and generate oxidative stress reactions that further stimulate the immune response. Therefore, it is important to evaluate the in vivo immunotoxicity of these rare earth-based biomaterials at the molecular level before molecular imaging in vivo.

  4. Subchronic toxicity and immunotoxicity of MeO-PEG-poly(D,L-lactic-co-glycolic acid)-PEG-OMe triblock copolymer nanoparticles delivered intravenously into rats

    NASA Astrophysics Data System (ADS)

    Liao, Longfei; Zhang, Mengtian; Liu, Huan; Zhang, Xuanmiao; Xie, Zhaolu; Zhang, Zhirong; Gong, Tao; Sun, Xun

    2014-06-01

    Although monomethoxy(polyethyleneglycol)-poly (D,L-lactic-co-glycolic acid)-monomethoxy (PELGE) nanoparticles have been widely studied as a drug delivery system, little is known about their toxicity in vivo. Here we examined the subchronic toxicity and immunotoxicity of different doses of PELGE nanoparticles with diameters of 50 and 200 nm (PELGE50 and PELGE200) in rats. Neither size of PELGE nanoparticles showed obvious subchronic toxic effects during 28 d of continuous intravenous administration based on clinical observation, body weight, hematology parameters and histopathology analysis. PELGE200 nanoparticles showed no overt signs of immunotoxicity based on organ coefficients, histopathology analysis, immunoglobulin levels, blood lymphocyte subpopulations and splenocyte cytokines. Conversely, PELGE50 nanoparticles were associated with an increased organ coefficient and histopathological changes in the spleen, increased serum IgM and IgG levels, alterations in blood lymphocyte subpopulations and enhanced expression of spleen interferon-γ. Taken together, these results suggest that PELGE nanoparticles show low subchronic toxicity but substantial immunotoxicity, which depends strongly on particle size. These findings will be useful for safe application of PELGE nanoparticles in drug delivery systems.

  5. Immunotoxicity of 2,3,7,8-tetrachlorodibenzo-p-dioxin in a complex environmental mixture from the Love Canal.

    PubMed

    Silkworth, J B; Cutler, D S; Sack, G

    1989-02-01

    The organic phase of the leachate (OPL) from the Love Canal chemical dump site contains more than 100 organic compounds including 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). The immunotoxic potential of OPL was determined in two mouse strains which differ in their sensitivity to aromatic hydrocarbon (Ah) receptor-mediated toxicity. OPL was administered in corn oil in a single oral gavage to male BALB/cByJ (Ahb/Ahb) mice (0.5, 0.8, or 1.1 g/kg) and DBA/2J (Ahd/Ahd) mice (0.6, 0.9, or 1.3 g/kg). TCDD was similarly administered at 0.25, 1.0, 4.0, or 16.0 micrograms/kg. Two days later all mice were immunized with sheep erythrocytes (SRBC). The antibody response (PFC) and organ weights were evaluated 4 days later. OPL produced thymic atrophy and hepatomegaly in both strains at all dose levels. The PFC/spleen in BALB/cByJ mice was significantly reduced at the three doses to 34, 13, and 15%, respectively, of the control response. Serum anti-SRBC antibody levels and relative spleen weights were also reduced. The only immune effect in the DBA/2J mice was a decrease of the PFC/spleen to 58% of the control at the highest dose. TCDD decreased the relative thymus and spleen weights only in BALB/cByJ mice. However, TCDD produced hepatomegaly, a decrease in serum antibody, and a decrease in PFC/spleen in both BALB/cByJ and DBA/2J mice to 3 and 15%, respectively, at 16 micrograms/kg. Thus, the TCDD dose required to cause a 50% suppression (ED50) of PFC/spleen for the BALB/cByJ and DBA/2J strains was 1.84 and 3.89 micrograms/kg, respectively. The ED50 for OPL was 0.24 g/kg in BALB/cByJ mice. The TCDD concentration in the OPL was estimated to be 7.6 ppm, which agrees closely with the chemical analysis (3 ppm). The results suggest that the immunosuppression caused by OPL in BALB/cByJ mice was primarily due to TCDD, that the non-TCDD components of OPL diminished the TCDD immunotoxicity in the DBA/2J strain, and that the thymic atrophy and hepatomegaly were caused primarily by the non

  6. IMMUNOTOXICOGENOMICS: THE POTENTIAL OF GENOMICS TECHNOLOGY IN THE IMMUNOTOXICITY RISK ASSESSMENT PROCESS

    EPA Science Inventory

    Evaluation of xenobiotic-induced changes in gene expression as a method to identify and classify potential toxicants is being pursued by industry and regulatory agencies worldwide. A workshop was held at the Research Triangle Park campus of the Environmental Protection Agency to...

  7. IMMUNOTOXICITY AND BIODISTRIBUTION ANALYSIS OF ARSENIC TRIOXIDE IN C57Bl/6 MICE FOLLOWING A TWO-WEEK INHALATION EXPOSURE

    PubMed Central

    Burchiel, Scott W.; Mitchell, Leah A.; Lauer, Fredine T.; Sun, Xi; McDonald, Jacob D.; Hudson, Laurie G.; Liu, Ke Jian

    2010-01-01

    In these studies the immunotoxicity of arsenic trioxide (ATO, As2O3) was evaluated in mice following 14 days of inhalation exposures (nose only, 3 hrs per day) at concentrations of 50 μg/m3 and 1 mg/m3. A biodistribution analysis performed immediately after inhalation exposures revealed highest levels of arsenic in the kidneys, bladder, liver, and lung. Spleen cell levels were comparable to those found in the blood, with the highest concentration of arsenic detected in the spleen being 150 μg/mg tissue following the 1 mg/m3 exposures. No spleen cell cytotoxicity was observed at either of the two exposure levels. There were no changes in spleen cell surface marker expression for B cells, T cells, macrophages, and natural killer (NK) cells. There were also no changes detected in the B cell (LPS-stimulated) and T cell (Con A-stimulated) proliferative responses of spleen cells, and no changes were found in the NK-mediated lysis of Yac-1 target cells. The primary T-dependent antibody response was, however, found to be highly susceptible to ATO suppression. Both the 50 μg/m3 and 1 mg/m3 exposures produced greater than 70% suppression of the humoral immune response to sheep red blood cells. Thus, the primary finding of this study is that the T-dependent humoral immune response is extremely sensitive to suppression by ATO and assessment of humoral immune responses should be considered in evaluating the health effects of arsenic containing agents. PMID:19800901

  8. Immunotoxicity and biodistribution analysis of arsenic trioxide in C57Bl/6 mice following a 2-week inhalation exposure

    SciTech Connect

    Burchiel, Scott W.; Mitchell, Leah A.; Lauer, Fredine T.; Sun Xi; McDonald, Jacob D.; Hudson, Laurie G.; Liu Kejian

    2009-12-15

    In these studies the immunotoxicity of arsenic trioxide (ATO, As{sub 2}O{sub 3}) was evaluated in mice following 14 days of inhalation exposures (nose only, 3 h per day) at concentrations of 50 mug/m{sup 3} and 1 mg/m{sup 3}. A biodistribution analysis performed immediately after inhalation exposures revealed highest levels of arsenic in the kidneys, bladder, liver, and lung. Spleen cell levels were comparable to those found in the blood, with the highest concentration of arsenic detected in the spleen being 150 mug/g tissue following the 1 mg/m{sup 3} exposures. No spleen cell cytotoxicity was observed at either of the two exposure levels. There were no changes in spleen cell surface marker expression for B cells, T cells, macrophages, and natural killer (NK) cells. There were also no changes detected in the B cell (LPS-stimulated) and T cell (Con A-stimulated) proliferative responses of spleen cells, and no changes were found in the NK-mediated lysis of Yac-1 target cells. The primary T-dependent antibody response was, however, found to be highly susceptible to ATO suppression. Both the 50 mug/m{sup 3} and 1 mg/m{sup 3} exposures produced greater than 70% suppression of the humoral immune response to sheep red blood cells. Thus, the primary finding of this study is that the T-dependent humoral immune response is extremely sensitive to suppression by ATO and assessment of humoral immune responses should be considered in evaluating the health effects of arsenic containing agents.

  9. Carcinogenicity and Immunotoxicity of Embedded Depleted Uranium and Heavy-Metal Tungsten Alloy in Rodents

    DTIC Science & Technology

    2006-10-01

    the implantation site. In addition, WA-implanted rats (high-dose group) exhibited splenomegaly and hematological changes suggesting polycythemia ...controls. The hematological changes observed in the high-dose WA rats are suggestive of polycythemia . Cobalt has been used experimentally to induce... polycythemia in rats (Rakusan et al., 2001; Endoh et al., 2000) although the concentration required is far greater than found in the WA pellets. The

  10. Carcinogenicity and Immunotoxicity of Embedded Depleted Uranium and Heavy-Metal Tungsten Alloy in Rodents

    DTIC Science & Technology

    2005-10-01

    the Year 3 report, rats implanted with 20 pellets of WA (high dose group) exhibited characteristics of polycythemia (elevated red blood cell counts...hematologic changes, indicative of polycythemia , were also observed in the high-dose WA- military of many nations to replace DU in implanted rats. These...210. to induce polycythemia in rats (Endoh et al. sis. Recently, the role of tungsten in human Miller AC, Mog S, McKinney L, Luo L, Allen J, Xu J, et

  11. Fate of silver nanoparticles in wastewater and immunotoxic effects on rainbow trout.

    PubMed

    Bruneau, A; Turcotte, P; Pilote, M; Gagné, F; Gagnon, C

    2016-05-01

    Silver nanoparticles (AgNPs) are currently used in technology, medicine and consumer products, even though the fate and the ecotoxicological risks on aquatic organisms of these new materials are not well known. The purpose of this study was to investigate the fate, bioavailability of AgNPs and their effects on fish in presence of municipal effluents. Juvenile rainbow trout were exposed for 96h to 40μg/L of AgNPs or 4μg/L of dissolved silver (AgNO3) in diluted (10%) municipal wastewater. Silver (Ag) concentrations were measured both on water samples and fish tissues (liver and gills). Toxicity was investigated by following immunological parameters in the pronephros (viability, phagocytosis) and biomarkers in liver and gills (cyclooxygenase activity, lipid peroxidation, glutathione-S-transferase, metallothioneins, DNA strand breaks and labile zinc). Results indicated that AgNPs appeared as small non-charged aggregates in wastewaters (11.7±1.4nm). In gills, the exposure to AgNPs induced morphological modifications without visible nanoparticle bioaccumulation. Dissolved Ag(+) was bioavailable in diluted effluent and induced oxidative stress (lipid peroxidation), labile zinc and a marginal decrease in superoxide dismutase in fish gills. Ag(+) also increased significantly metallothionein levels and inhibited the DNA repair activity in the liver. Finally, the two silver forms were found in liver and induced immunosuppression and inflammation (increase in cyclooxygenase activity). This study demonstrated that both forms of Ag produced harmful effects and AgNPs in wastewater were bioavailable to fish despite of their formation of aggregates.

  12. Surface Charges and Shell Crosslinks Each Play Significant Roles in Mediating Degradation, Biofouling, Cytotoxicity and Immunotoxicity for Polyphosphoester-based Nanoparticles

    NASA Astrophysics Data System (ADS)

    Elsabahy, Mahmoud; Zhang, Shiyi; Zhang, Fuwu; Deng, Zhou J.; Lim, Young H.; Wang, Hai; Parsamian, Perouza; Hammond, Paula T.; Wooley, Karen L.

    2013-11-01

    The construction of nanostructures from biodegradable precursors and shell/core crosslinking have been pursued as strategies to solve the problems of toxicity and limited stability, respectively. Polyphosphoester (PPE)-based micelles and crosslinked nanoparticles with non-ionic, anionic, cationic, and zwitterionic surface characteristics for potential packaging and delivery of therapeutic and diagnostic agents, were constructed using a quick and efficient synthetic strategy, and importantly, demonstrated remarkable differences in terms of cytotoxicity, immunotoxicity, and biofouling properties, as a function of their surface characteristics and also with dependence on crosslinking throughout the shell layers. For instance, crosslinking of zwitterionic micelles significantly reduced the immunotoxicity, as evidenced from the absence of secretions of any of the 23 measured cytokines from RAW 264.7 mouse macrophages treated with the nanoparticles. The micelles and their crosslinked analogs demonstrated lower cytotoxicity than several commercially-available vehicles, and their degradation products were not cytotoxic to cells at the range of the tested concentrations. PPE-nanoparticles are expected to have broad implications in clinical nanomedicine as alternative vehicles to those involved in several of the currently available medications.

  13. Immunotoxicity in ascidians: antifouling compounds alternative to organotins-IV. The case of zinc pyrithione.

    PubMed

    Cima, Francesca; Ballarin, Loriano

    2015-03-01

    New biocides such as the organometallic compound zinc pyrithione (ZnP) have been massively introduced by many countries in formulations of antifouling paints following the ban on tributyltin (TBT). The effects of sublethal concentrations (LC50=82.5 μM, i.e., 26.2 mg/l) on cultured haemocytes of the ascidian Botryllus schlosseri have been investigated and compared with TBT. The percentage of haemocytes with amoeboid morphology and containing phagocytised yeast cells were significantly (p<0.05) reduced after exposure to 0.1 (31.7 μg/l) and 0.5 μM (158 μg/l), respectively. An antagonistic interaction in inducing cytoskeletal alterations was observed when ZnP and TBT were co-present in the exposure medium. ZnP affected only the actin component. As caused by TBT, ZnP induced apoptosis and inhibited both oxidative phosphorylation and lysosomal activities. In contrast to the case of TBT, a decrement in Ca(2+)-ATPase activity and a decrease in cytosolic Ca(2+) were detected after incubation at the highest concentration (1 μM, i.e., 317.7 μg/l) used. In comparison with other antifouling compounds, ZnP shows as much toxicity as TBT to cultured haemocytes at extremely low concentrations interfering with fundamental cell activities.

  14. Immunotoxicity of 2,3,7,8-tetrachlorodibenzo-p-dioxin in a complex environmental mixture from the Love Canal

    SciTech Connect

    Silkworth, J.B.; Cutler, D.S.; Sack, G.

    1989-02-01

    The organic phase of the leachate (OPL) from the Love Canal chemical dump site contains more than 100 organic compounds including 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). The immunotoxic potential of OPL was determined in two mouse strains which differ in their sensitivity to aromatic hydrocarbon (Ah) receptor-mediated toxicity. OPL was administered in corn oil in a single oral gavage to male BALB/cByJ (Ahb/Ahb) mice (0.5, 0.8, or 1.1 g/kg) and DBA/2J (Ahd/Ahd) mice (0.6, 0.9, or 1.3 g/kg). TCDD was similarly administered at 0.25, 1.0, 4.0, or 16.0 micrograms/kg. Two days later all mice were immunized with sheep erythrocytes (SRBC). The antibody response (PFC) and organ weights were evaluated 4 days later. OPL produced thymic atrophy and hepatomegaly in both strains at all dose levels. The PFC/spleen in BALB/cByJ mice was significantly reduced at the three doses to 34, 13, and 15%, respectively, of the control response. Serum anti-SRBC antibody levels and relative spleen weights were also reduced. The only immune effect in the DBA/2J mice was a decrease of the PFC/spleen to 58% of the control at the highest dose. TCDD decreased the relative thymus and spleen weights only in BALB/cByJ mice. However, TCDD produced hepatomegaly, a decrease in serum antibody, and a decrease in PFC/spleen in both BALB/cByJ and DBA/2J mice to 3 and 15%, respectively, at 16 micrograms/kg. Thus, the TCDD dose required to cause a 50% suppression (ED50) of PFC/spleen for the BALB/cByJ and DBA/2J strains was 1.84 and 3.89 micrograms/kg, respectively. The ED50 for OPL was 0.24 g/kg in BALB/cByJ mice. The TCDD concentration in the OPL was estimated to be 7.6 ppm, which agrees closely with the chemical analysis (3 ppm).

  15. Functionalized porous silica&maghemite core-shell nanoparticles for applications in medicine: design, synthesis, and immunotoxicity

    PubMed Central

    Zasońska, Beata A.; Líšková, Aurélia; Kuricová, Miroslava; Tulinská, Jana; Pop-Georgievski, Ognen; Čiampor, Fedor; Vávra, Ivo; Dušinská, Mária; Ilavská, Silvia; Horváthová, Mira; Horák, Daniel

    2016-01-01

    Aim To determine cytotoxicity and effect of silica-coated magnetic nanoparticles (MNPs) on immune response, in particular lymphocyte proliferative activity, phagocytic activity, and leukocyte respiratory burst and in vitro production of interleukin-6 (IL-6) and 8 (IL-8), interferon-gamma (IFN-γ), tumor necrosis factor-alpha (TNF-α), and granulocyte macrophage colony stimulating factor (GM-CSF). Methods Maghemite was prepared by coprecipitation of iron salts with ammonia, oxidation with NaOCl and modified by tetramethyl orthosilicate and aminosilanes. Particles were characterized by transmission electron microscopy (TEM), dynamic light scattering (DLS), Fourier-transform infrared (FTIR), and X-ray photoelectron spectroscopy (XPS). Cytotoxicity and lymphocyte proliferative activity were assessed using [3H]-thymidine incorporation into DNA of proliferating human peripheral blood cells. Phagocytic activity and leukocyte respiratory burst were measured by flow cytometry; cytokine levels in cell supernatants were determined by ELISA. Results γ-Fe2O3&SiO2-NH2 MNPs were 13 nm in size. According to TEM, they were localized in the cell cytoplasm and extracellular space. Neither cytotoxic effect nor significant differences in T-lymphocyte and T-dependent B-cell proliferative response were found at particle concentrations 0.12-75 μg/cm2 after 24, 48, and 72 h incubation. Significantly increased production of IL-6 and 8, and GM-CSF cytokines was observed in the cells treated with 3, 15, and 75 µg of particles/cm2 for 48 h and stimulated with pokeweed mitogen (PHA). No significant changes in TNF-α and IFN-γ production were observed. MNPs did not affect phagocytic activity of monocytes and granulocytes when added to cells for 24 and 48 h. Phagocytic respiratory burst was significantly enhanced in the cultures exposed to 75 µg MNPs/cm2 for 48 h. Conclusions The cytotoxicity and in vitro immunotoxicity were found to be minimal in the newly developed porous core-shell γ-Fe2

  16. An investigation of the immunotoxicity of oil sands processed water and leachates in trout leukocytes.

    PubMed

    Gagné, F; Bruneau, A; Turcotte, P; Gagnon, C; Lacaze, E

    2017-03-14

    Increased oil sands (OS) mining activity has raised concerns about impacts on aquatic organisms. This study sought to examine the effects of single representative compounds from OS (benzo(a)pyrene, naphthalene), a mixture of naphthenic acids (NAs), OS-processed water (OSPW) and OS leachate (OSL) extracts on rainbow trout leukocytes. Primary cultures of trout leukocytes were exposed to increasing concentrations of benzo(a)pyrene, naphthalene, NAs, OSPW and OSL for 48h at 18°C. Immunocompetence was followed by measuring changes in lymphocyte and macrophage viability and phagocytosis. Changes in the expression of 10 transcripts were also followed: interleukin 1, 2 and 6 (Il-1, Il-2 and Il-6), calreticulin (CRT), caspase 9 (Cas9), aryl hydrocarbon receptor (AhR), cyclooxygenase-2 (COX2), glutathione S-transferase (GST), catalase (CAT) and p53 tumor suppressor. The results revealed that exposure to OSPW extracts decreased the capacity of macrophages to engulf three beads or more, while the other compounds generally increased phagocytosis activity. Lymphocyte apoptosis was increased by all compounds and mixtures except naphthalene. Both OSPW and OSL induced apoptosis in macrophages. At the gene expression level, Cas9, CRT, Il-1 (inhibition) and Il-2 were specifically influenced by OSPW, while CAT, p53, COX2 and Il-1 (induction) transcripts were specifically expressed by OSL. Leukocyte exposure to OSPW produced characteristic changes in immunocompetence and genes involved in proinflammatory, apoptosis and protein damage (CRT) pathways which could not be explained by OSL, benzo(a)pyrene, naphthalene and NA mixture.

  17. Immunotoxicity of trichloroethylene: a study with MRL-lpr/lpr mice.

    PubMed

    Kaneko, T; Saegusa, M; Tasaka, K; Sato, A

    2000-01-01

    In recent immunological studies, it has been suggested that trichloroethylene (TCE) participates in the onset of pneumatosis cystoides intestinalis (PCI) through a certain mechanism; however, the mechanism by which it develops remains unknown. Based on findings that secondary PCI is often linked with autoimmune disease, the possibility that some genetic or immunological mechanisms are involved in the development of PCI has been proposed. Pneumatosis cystoides intestinalis is not a type of disease where a dose-response relationship with TCE exposure can be recognized and it is difficult to reproduce its physiopathology through TCE exposure in ordinary experimental animals. In the present study, immunological changes caused by TCE exposure were investigated by employing MRL-lpr/lpr mice that are genetically labile to autoimmune diseases. To observe changes in B cell functions, serum antibody titres were measured; and for the T cell function, T cell subsets were examined. The animals were exposed to TCE at dosages of 0, 500, 1000 and 2000 ppm through inhalation 4 h a day, 6 days a week, for 8 weeks. It was found that only IgG production capacity was suppressed and there were no changes in T cell subsets with TCE concentrations up to 1000 ppm. At a concentration of 2000 ppm, changes were noted in both T and B cell functions. Typical organs that are responsible for immunological functions were examined for their morphological changes under a light microscope: the spleen and liver exhibited dose-response changes at a concentration of 500 ppm or greater. The development of immunoblastoid cells at a concentration of 1000 ppm indicated a possibility that a change has occurred in the immunological system. These findings show that exposure to TCE at high concentrations affects the immune system, but the study failed to induce PCI in the experimental animals. Further studies on TCE exposure at lower concentrations for longer periods are needed.

  18. Immunotoxicity of the xenoestrogen 4-nonylphenol to the cockle Cerastoderma glaucum.

    PubMed

    Matozzo, Valerio; Rova, Giulio; Ricciardi, Francesco; Marin, Maria Gabriella

    2008-01-01

    The in vivo effects of 4-nonylphenol (NP) on functional responses of haemocytes from the cockle Cerastoderma glaucum were investigated after 7 days exposure to sublethal NP concentrations (0, 0+acetone, 0.0125, 0.025, 0.05 and 0.1 mg/l NP). Haemocytes from both controls and exposed cockles were collected, and the effects of NP on total haemocyte count (THC) and volume of circulating cells, intracellular superoxide anion (O(2)(-)) levels, acid phosphatase and lysozyme-like activities in both haemocyte lysate (HL) and cell-free haemolymph (CFH) were evaluated. Exposure of cockles to 0.1mg/l NP significantly increased THC (p<0.05) with respect to controls. Analysis of haemocyte size frequency distribution showed that the haemocyte fraction of about 7-8 microm in diameter and 250 femtolitres in volume increased markedly in cockles exposed to the highest NP concentration tested. Apoptosis resulting in cell volume reduction in NP-exposed animals cannot be excluded. No statistically significant variation in intracellular O(2)(-) levels was observed. Conversely, significant increases (p<0.05) in acid phosphatase activity were observed in CFH from 0.05 and 0.1mg/l NP-exposed animals; no significant differences in enzyme activity were recorded in HL. Lysozyme-like activity also increased significantly in CFH from cockles exposed to 0.05 mg/l NP (p<0.05) and 0.1 mg/l NP (p<0.001). Instead, lysozyme-like activity decreased significantly (p<0.05) in the HL of animals exposed to 0.05 mg/lNP. Our results suggest that NP induces variations in the functional responses of haemocytes of C. glaucum, mainly by reducing cell membrane stability and promoting cell degranulation.

  19. Immunotoxic effect of thiamethoxam in immunized mice with Brucella abortus cultural filtrate antigen

    PubMed Central

    Salema, L. H.; Alwan, M. J.; Yousif, Afaf Abdulrahman

    2016-01-01

    in the 2nd group (7.66±0.33). Phagocytic ratio results in the 1st group showed an increase to reach (18.55±0.44) than a ratio in the 2nd group (13.24±0.32) and the control group (5.46±0.25). Conclusion: It was concluded that TMX induced suppression of humoral and cellular immune responses in immunized mice with CFBAgs. PMID:28096613

  20. Oral Exposure to Atrazine Induces Oxidative Stress and Calcium Homeostasis Disruption in Spleen of Mice

    PubMed Central

    Wang, Zhichun; Zhang, Chonghua; Jia, Liming

    2016-01-01

    The widely used herbicide atrazine (ATR) can cause many adverse effects including immunotoxicity, but the underlying mechanisms are not fully understood. The current study investigated the role of oxidative stress and calcium homeostasis in ATR-induced immunotoxicity in mice. ATR at doses of 0, 100, 200, or 400 mg/kg body weight was administered to Balb/c mice daily for 21 days by oral gavage. The studies performed 24 hr after the final exposure showed that ATR could induce the generation of reactive oxygen species in the spleen of the mice, increase the level of advanced oxidation protein product (AOPP) in the host serum, and cause the depletion of reduced glutathione in the serum, each in a dose-related manner. In addition, DNA damage was observed in isolated splenocytes as evidenced by increase in DNA comet tail formation. ATR exposure also caused increases in intracellular Ca2+ within splenocytes. Moreover, ATR treatment led to increased expression of genes for some antioxidant enzymes, such as HO-1 and Gpx1, as well as increased expression of NF-κB and Ref-1 proteins in the spleen. In conclusion, it appears that oxidative stress and disruptions in calcium homeostasis might play an important role in the induction of immunotoxicity in mice by ATR. PMID:27957240

  1. ANIMAL MODELS FOR IMMUNOTOXICITY

    EPA Science Inventory

    Greater susceptibility to infection is a hallmark of compromised immune function in humans and animals, and is often considered the benchmark against which the predictive value of immune function tests are compared. This focus of this paper is resistance to infection with the pa...

  2. Facts about Stachybotrys chartarum and Other Molds

    MedlinePlus

    ... Issues Resources Quick Links Air Pollution & Respiratory Health Air Quality Asthma Mold What's New National Center for Environmental ... issued additional guidance, the WHO Guidelines for Indoor Air Quality: Dampness and Mould [PDF - 2.52 MB] . Other ...

  3. Composition of the essential oil constituents from leaves and stems of Korean Coriandrum sativum and their immunotoxicity activity on the Aedes aegypti L.

    PubMed

    Chung, Ill-Min; Ahmad, Ateeque; Kim, Sun-Jin; Naik, Poornanand Madhava; Nagella, Praveen

    2012-02-01

    The leaves and stems of Coriandrum sativum were extracted and the essential oil composition and immunotoxicity effects were studied. The analyses were conducted by gas chromatography-mass spectroscopy (GC-MS), which revealed the essential oils of C. sativum leaves and stems. Thirty-nine components representing 99.62% of the total oil were identified from the leaves. The major components are cyclododecanol (23.11%), tetradecanal (17.86%), 2-dodecenal (9.93%), 1-decanol (7.24%), 13-tetradecenal (6.85%), 1-dodecanol (6.54%), dodecanal (5.16%), 1-undecanol (2.28%), and decanal (2.33%). Thirty-eight components representing 98.46% of the total oil were identified from the stems of the coriander. The major components are phytol (61.86%), 15-methyltricyclo[6.5.2(13,14),0(7,15)]-pentadeca-1,3,5,7,9,11,13-heptene (7.01%), dodecanal (3.18%), and 1-dodecanol (2.47%). The leaf oil had significant toxic effects against the larvae of Aedes aegypti with an LC₅₀ value of 26.93 ppm and an LC₉₀ value of 37.69 ppm and the stem oil has toxic effects against the larvae of A. aegypti with an LC₅₀ value of 29.39 ppm and an LC₉₀ value of 39.95 ppm. Also, the above data indicate that the major compounds may play an important role in the toxicity of essential oils.

  4. Four-week inhalation toxicity, mutagenicity and immunotoxicity studies of Keum-Yeon-Cho (NosmoQ), tobacco substitute composition, in mice.

    PubMed

    Kim, Min-Young; Yoo, Gi-Yong; Yoo, Won-Ha; Choi, Jin-Hyuk; Bae, Mi-Ok; Kim, Jun-Sung; Kim, Hyun-Woo; Moon, Seo-Hyun; Kim, Jung-Hyun; Han, Kyu-Tae; Chae, Chan-Hee; Kim, Myung-Soo; Cho, Myung-Haing

    2003-01-01

    Safety of Keum-Yeon-Cho (NosmoQ), a tobacco substitute composition, was evaluated in terms of acute- and 4 weeks repeated-inhalation toxicity, mutagenicity, and immunotoxicity using Balb/c mice. The air inside the inhalation chamber was collected and analyzed by GC-MS. In acute inhalation toxicity test, male and female mice were exposed to 40 Keum-Yeon-Cho cigarettes. The 50% lethal concentration (LC(50)) of NosmoQ was considered to be much higher than 40 cigarettes in both sexes. In 4-week repeated inhalation toxicity test, male and female mice were exposed for 6 h/day, 5 days/week for 4 weeks to 10 and 20 cigarettes per day, while control mice were exposed to filtered air. Our data indicated that no observed adverse effect level (NOAEL) of Keum-Yeon-Cho should be over 20 cigarettes per day. Results of Salmonella typhimurium reversion assay with/without histidine moiety, in vivo chromosomal aberration and in vivo micronucleus assays using mouse bone marrow cells revealed that Keum-Yeon-Cho has no mutagenicity. Evaluation of peripheral cellular immunity of mice treated with Keum-Yeon-Cho using in vitro lymphocyte proliferation assay showed no significant difference in mean stimulation index (SI) between mice exposed to Keum-Yeon-Cho and control mice. Mean CO concentrations and total particulate matter contents of 10 and 20 cigarettes were 21.1±1.23 and 40.7±1.21 ppm (mean±S.D., n=5), and 25.7±3.09 and 59.0±4.0 mg dry weight (mean±S.D., n=5), respectively. Although at negligible concentration (less than ppb level) several polycyclic aromatic hydrocarbons (PAHs) were also detected, these results indicate that NosmoQ has no toxic effect on mice.

  5. Immunotoxic effects of cis-urocanic acid exposure in C57BL/6N and C3H/HeN mice.

    PubMed

    Prater, M Renee; Gogal, Robert M; De Fabo, Edward C; Longstreth, Janice; Holladay, Steven D

    2003-04-01

    Exposure to ultraviolet radiation results in increased levels of intradermal cis-urocanic acid (cUCA) and alters cutaneous immunity by interfering with processing and presentation of antigen by Langerhans cells. Reports on effects of systemic immunotoxicity with 30 day cUCA exposure in laboratory rodents include thymic atrophy, thymic hypocellularity and decreased T-cell-mediated immunity; however, immune effects of single exposure or 5 day cUCA administration, which may better mimic human exposures, are poorly defined. The present study initially evaluated immune effects of single, 5 day, and 4 week cUCA exposure in C57BL/6N mice. Single administration of intradermal cUCA resulted in decreased splenocyte phagocytosis that persisted for 30 days after cUCA exposure. Five day consecutive cUCA exposure decreased numbers of phenotypically mature CD4(+)CD8(-) and CD4(-)CD8(+) (single positive) thymocytes, increased CD4(+)CD8(+) (double positive) immature thymocytes and increased splenocyte proliferation. Prolonged cUCA exposure (4 weeks) caused profound thymic hypocellularity and splenic hypercellularity and increased splenic macrophage chemiluminescence. Because of this apparent sensitivity of C57BL/6N mice to cUCA, thymic hypocellularity was compared between C57BL/6N and C3H/HeN mice dosed with cUCA, and was found to be more pronounced in the C57BL/6N strain. These results are an extension of previous conclusions on immune modulation caused by cUCA in the spleen and thymus. Further, the observed variation in sensitivity between the mouse strains is consistent with known genetic susceptibility of these strains to the immunomodulatory effects of exposure to sunlight.

  6. Aged garlic extract ameliorates immunotoxicity, hematotoxicity and impaired burn-healing in malathion- and carbaryl-treated male albino rats.

    PubMed

    Ramadan, Gamal; El-Beih, Nadia M; Ahmed, Rehab S A

    2017-03-01

    Malathion and carbaryl are the most widely used organophosphate and carbamate insecticides, respectively, especially in developing countries; they pose a potential health hazard for both humans and animals. Here, we evaluated the protective effects of an odorless (free from allicin) Kyolic aged garlic extract (AGE, containing 0.1% S-allylcysteine; 200 mg/kg body weight) on the toxicity induced by 0.1 LD50 of malathion (89.5 mg/kg body weight) and/or carbaryl (33.9 mg/kg body weight) in male Wistar rats. Doses were orally administered to animals for four consecutive weeks. The present study showed that AGE completely modulated most adverse effects induced by malathion and/or carbaryl in rats including the normocytic normochromic anemia, immunosuppression, and the delay in the skin-burning healing process through normalizing the count of blood cells (erythrocytes, leucocytes and platelets), hemoglobin content, hematocrit value, blood glucose-6-phosphodehydrogenase activity, weights and cellularity of lymphoid organs, serum γ-globulin concentration, and the delayed type of hypersensitivity response to the control values, and accelerating the inflammatory and proliferative phases of burn-healing. In addition, AGE completely modulated the decrease in serum reduced glutathione (GSH) concentration and the increase in clotting time in malathion alone and carbaryl alone treated rats. Moreover, AGE induced a significant increase (P < 0.001) in serum GSH concentration (above the normal value) and accelerating burn-healing process in healthy rats. In conclusion, AGE was effective in modulating most adverse effects induced in rats by malathion and carbaryl, and hence may be useful as a dietary adjunct for alleviating the toxicity in highly vulnerable people to insecticides intoxication. © 2016 Wiley Periodicals, Inc. Environ Toxicol 32: 789-798, 2017.

  7. In vitro immunotoxic and genotoxic activities of particles emitted from two different small-scale wood combustion appliances

    NASA Astrophysics Data System (ADS)

    Tapanainen, Maija; Jalava, Pasi I.; Mäki-Paakkanen, Jorma; Hakulinen, Pasi; Happo, Mikko S.; Lamberg, Heikki; Ruusunen, Jarno; Tissari, Jarkko; Nuutinen, Kati; Yli-Pirilä, Pasi; Hillamo, Risto; Salonen, Raimo O.; Jokiniemi, Jorma; Hirvonen, Maija-Riitta

    2011-12-01

    Residential wood combustion appliances emit large quantities of fine particles which are suspected to cause a substantial health burden worldwide. Wood combustion particles contain several potential health-damaging metals and carbon compounds such as polycyclic aromatic hydrocarbons (PAH), which may determine the toxic properties of the emitted particles. The aim of the present study was to characterize in vitro immunotoxicological and chemical properties of PM 1 ( Dp ≤ 1 μm) emitted from a pellet boiler and a conventional masonry heater. Mouse RAW264.7 macrophages were exposed for 24 h to different doses of the emission particles. Cytotoxicity, production of the proinflammatory cytokine TNF-α and the chemokine MIP-2, apoptosis and phases of the cell cycle as well as genotoxic activity were measured after the exposure. The type of wood combustion appliance had a significant effect on emissions and chemical composition of the particles. All the studied PM 1 samples induced cytotoxic, genotoxic and inflammatory responses in a dose-dependent manner. The particles emitted from the conventional masonry heater were 3-fold more potent inducers of programmed cell death and DNA damage than those emitted from the pellet boiler. Furthermore, the particulate samples that induced extensive DNA damage contained also large amounts of PAH compounds. Instead, significant differences between the studied appliances were not detected in measurements of inflammatory mediators, although the chemical composition of the combustion particles differed considerably from each other. In conclusion, the present results show that appliances representing different combustion technology have remarkable effects on physicochemical and associated toxicological and properties of wood combustion particles. The present data indicate that the particles emitted from incomplete combustion are toxicologically more potent than those emitted from more complete combustion processes.

  8. The bioflavonoid galangin blocks aryl hydrocarbon receptor activation and polycyclic aromatic hydrocarbon-induced pre-B cell apoptosis.

    PubMed

    Quadri, S A; Qadri, A N; Hahn, M E; Mann, K K; Sherr, D H

    2000-09-01

    Bioflavonoids are plant compounds touted for their potential to treat or prevent several diseases including cancers induced by common environmental chemicals. Much of the biologic activity of one such class of pollutants, polycyclic aromatic hydrocarbons (PAH), is mediated by the aryl hydrocarbon receptor/transcription factor (AhR). For example, the AhR regulates PAH immunotoxicity that manifests as pre-B cell apoptosis in models of B cell development. Because bioflavonoids block PAH-induced cell transformation and are structurally similar to AhR ligands, it was postulated that some of them would suppress PAH-induced, AhR-dependent immunotoxicity, possibly through a direct AhR blockade. This hypothesis was tested using a model of B cell development in which pre-B cells are cultured with and are dependent on bone marrow stromal or hepatic parenchymal cell monolayers. Of seven bioflavonoids screened, galangin (3,5,7-trihydroxyflavone) blocked PAH-induced but not C(2)-ceramide- or H(2)O(2)-induced pre-B cell apoptosis. Because galangin blocked AhR-dependent reporter gene expression, AhR complex-DNA binding, and AhR nuclear translocation, inhibition of a relatively early step in AhR signaling was implicated. This hypothesis was supported by the ability of galangin to bind the AhR and stabilize AhR-90-kDa heat shock protein complexes in the presence of AhR agonists. These studies demonstrate the utility of pre-B cell culture systems in identifying compounds capable of blocking PAH immunotoxicity, define at least one mechanism of galangin activity (i.e., repression of AhR activation), and motivate the use of this and similar dietary bioflavonoids as relatively nontoxic inhibitors of AhR agonist activity and as pharmacologic agents with which to dissect AhR signaling pathways.

  9. Arsenite exposure in human lymphoblastoid cell lines induces autophagy and coordinated induction of lysosomal genes.

    PubMed

    Bolt, Alicia M; Douglas, Randi M; Klimecki, Walter T

    2010-11-30

    Chronic exposure to inorganic arsenic is associated with diverse, complex diseases, making the identification of the mechanism underlying arsenic-induced toxicity a challenge. An increasing body of literature from epidemiological and in vitro studies has demonstrated that arsenic is an immunotoxicant, but the mechanism driving arsenic-induced immunotoxicity is not well established. We have previously demonstrated that in human lymphoblastoid cell lines (LCLs), arsenic-induced cell death is strongly associated with the induction of autophagy. In this study we utilized genome-wide gene expression analysis and functional assays to characterize arsenic-induced effects in seven LCLs that were exposed to an environmentally relevant, minimally cytotoxic, concentration of arsenite (0.75 μM) over an eight-day time course. Arsenic exposure resulted in inhibition of cellular growth and induction of autophagy (measured by expansion of acidic vesicles) over the eight-day exposure duration. Gene expression analysis revealed that arsenic exposure increased global lysosomal gene expression, which was associated with increased functional activity of the lysosome protease, cathepsin D. The arsenic-induced expansion of the lysosomal compartment in LCL represents a novel target that may offer insight into the immunotoxic effects of arsenic.

  10. Novel biomarkers of mercury-induced autoimmune dysfunction: a Cross-sectional study in Amazonian Brazil

    PubMed Central

    Motts, Jonathan A.; Shirley, Devon L.; Silbergeld, Ellen K.; Nyland, Jennifer F.

    2014-01-01

    Mercury is an ubiquitous environmental contaminant, causing both neurotoxicity and immunotoxicity. Given its ability to amalgamate gold, mercury is frequently used in small-scale artisanal gold mining. We have previously reported that elevated serum titers of antinuclear autoantibodies (ANA) are associated with mercury exposures of miners in gold mining. The goal of this project was to identify novel serum biomarkers of mercury-induced immunotoxicity and autoimmune dysregulation. We conducted an analysis of serum samples from a cross-sectional epidemiological study on miners working in Amazonian Brazil. In proteomic screening analyses, samples were stratified based on mercury concentrations and ANA titer and a subset of serum samples (N=12) were profiled using Immune Response Biomarker Profiling ProtoArray protein microarray for elevated autoantibodies. Of the up-regulated autoantibodies in the mercury-exposed cohort, potential target autoantibodies were selected based on relevance to pro-inflammatory and macrophage activation pathways. ELISAs were developed to test the entire sample cohort (N=371) for serum titers to the highest of these autoantibodies (anti-glutathione S-transferase alpha, GSTA1) identified in the high mercury/high ANA group. We found positive associations between elevated mercury exposure and up-regulated serum titers of 3760 autoantibodies as identified by ProtoArray. Autoantibodies identified as potential novel biomarkers of mercury-induced immunotoxicity include antibodies to the following proteins: GSTA1, tumor necrosis factor ligand superfamily member 13, linker for activation of T cells, signal peptide peptidase like 2B, stimulated by retinoic acid 13, and interferon induced transmembrane protein. ELISA analyses confirmed that mercury-exposed gold miners had significantly higher serum titers of anti-GSTA1 autoantibody [unadjusted odds ratio = 89.6; 95% confidence interval: 27.2, 294.6] compared to emerald miners (referent population

  11. GC-TOF/MS-based metabolomics approach to study the cellular immunotoxicity of deoxynivalenol on murine macrophage ANA-1 cells.

    PubMed

    Ji, Jian; Sun, Jiadi; Pi, Fuwei; Zhang, Shuang; Sun, Chao; Wang, Xiumei; Zhang, Yinzhi; Sun, Xiulan

    2016-08-25

    Gas chromatography-time of fly/mass spectrum (GC-TOF/MS) based complete murine macrophage ANA-1 cell metabolome strategy, including the endo-metabolome and the exo-metabolome, ANA-1 cell viability assays and apoptosis induced by diverse concentrations of DON were evaluated for selection of an optimized dose for in-depth metabolomic research. Using the optimized chromatography and mass spectrometry parameters, the metabolites detected by GC-TOF/MS were identified and processed with multivariate statistical analysis, including principal componentanalysis (PCA) and orthogonal projection to latent structures-discriminant analysis (OPLS-DA) analysis. The data sets were screened with a t-test (P) value < 0.05, VIP value > 1, similarity value > 500, leaving 16 exo-metabolite variables and 11 endo-metabolite variables for further pathway analysis. Implementing the integration of key metabolic pathways, the metabolism pathways were categorized into two dominating types, metabolism of amino acid and glycometabolism. Glycine, serine and threonine metabolism, phenylalanine, tyrosine and tryptophan biosynthesis and phenylalanine metabolism were the significant amino acids affected by the metabolic pathways, indicating statistically significant fold changes including pyruvate, serine, glycine, lactate and threonine. Glycolysis or gluconeogenesis, starch and sucrose metabolism, and galactose metabolism, belonging to glycometabolism, were the pathways that were found to be primarily affected, resulting in abnormal metabolites such as glucose-1P, Glucose, gluconic acid, myo-inositol, sorbitol and glycerol.

  12. Workshop report. Children as a special subpopulation: focus on immunotoxicity. Federal Institute for Health Protection of Consumers and Veterinary Medicine (BgVV), 15-16 November 2001, Berlin, Germany.

    PubMed

    Richter-Reichhelm, H B; Althoff, J; Schulte, A; Ewe, S; Gundert-Remy, U

    2002-07-01

    relevant aspects into existing test guidelines for testing developmental immunotoxicity. In this context, it is recommended that animals culled otherwise in one- and two-generation studies be examined for developmental immunotoxicity according to the valid methods and parameters discussed. The majority of participants agreed that a safety factor of 10 is too low in risk assessment and management to protect a sensitive subpopulation of children against man-made environmental pollutants.

  13. Comparative immunotoxicity of 2,2`-dichlorodiethyl sulfide and cyclophosphamide: Evaluation of L1210 tumor cell resistance, cell-mediated immunity, and humoral immunity. (Reannouncement with new availability information)

    SciTech Connect

    Blank, J.A.; Joiner, R.L.; Houchens, D.P.; Dill, G.S.; Hobson, D.W.

    1991-12-31

    The immunotoxicity of 2,2`-dichlorodiethyl sulfide (sulfur mustard, SM),on humoral and cell-mediated immunity was compared with that of the nitrogen mustard 2-(bis(2-chloroethyl) amino)tetrahydro- 2H-1,3,2-oxazophosphorine 2-oxide (cyclophosphamide, CP). SM and CP had similar effects on thymic and splenic weights, spleen cell number, and the formation of antibody producing cells to sheep red blood cells (sRBC) when examined 5 days after exposure, but differed in their effects on body weights. Although there were no differences in the delayed hypersensitivity response to keyhole limpet hemocyanin, CP and SM had different effects in the L1210 tumor cell allograft rejection assay. CP, but not SM, decreased the 28 day survival rate of allogeneic mice exposed to a sublethal L1210 tumor challenge. The differing effects on survival to the L1210 tumor challenge could not be attributed to a direct cytotoxic effect of SM on the L1210 tumor cells as SM did not increase the survival rate or mediansurvival time of syngeneic mice exposed to a lethal L1210 tumor cell challenge. In summary, SM and CP had immunosuppressive effects in the humoral immune assay. Although neither compound suppressed the delayed hypersensitivity response, CP was found to suppress host resistance to L1210 tumor cells.

  14. Visual agnosia and Klüver-Bucy syndrome in marmosets (Callithrix jacchus) following ablation of inferotemporal cortex, with additional mnemonic effects of immunotoxic lesions of cholinergic projections to medial temporal areas.

    PubMed

    Ridley, R M; Warner, K A; Maclean, C J; Gaffan, D; Baker, H F

    2001-04-13

    Inferotemporal ablations in the New World monkey, the common marmoset (Callithrix jacchus), produced a persistent impairment on visual discrimination learning and a florid, but transient, Klüver-Bucy syndrome. Monkeys with these ablations were impaired on acquisition of object discriminations to a high criterion and on concurrent discrimination learning, to a single high criterion across all trials. Neither the control monkeys nor the monkeys with inferotemporal ablations found acquisition more difficult when the component discriminations of a set were presented concurrently compared to consecutively, although the monkeys with inferotemporal ablations found acquisition under both these conditions somewhat more difficult than did control monkeys. This suggests that the severe impairment caused by inferotemporal ablations on concurrent learning measured across all trials is due to the need for sustained performance across a concurrent set rather than to the extra mnemonic demands of concurrent presentation. When immunotoxic lesions of the cholinergic projection to the hippocampal formation were added to the inferotemporal ablations, a further impairment on retention, and a differential impairment on concurrent, compared to consecutive, learning was observed. Previous studies have shown that lesions of the cholinergic projection to the hippocampus alone, or excitotoxic hippocampal lesions, do not affect simple visual discrimination learning. It is suggested that large inferotemporal ablations in monkeys produce a visual agnosia which causes severe 'psychic blindness' in the first instance, and a persistent impairment on visual discrimination learning. The hippocampus makes a contribution, which may be mnemonic, to discrimination performance after inferotemporal ablations.

  15. PEG-b-PPS-b-PEI micelles and PEG-b-PPS/PEG-b-PPS-b-PEI mixed micelles as non-viral vectors for plasmid DNA: tumor immunotoxicity in B16F10 melanoma.

    PubMed

    Velluto, Diana; Thomas, Susan N; Simeoni, Eleonora; Swartz, Melody A; Hubbell, Jeffrey A

    2011-12-01

    Cationic micelles formed from poly(ethylene glycol)-bl-poly(propylene sulfide)-bl-poly(ethylene imine) (PEG-b-PPS-b-PEI) and from mixtures of poly(ethylene glycol)-bl-poly(propylene sulfide) (PEG-b-PPS) with PEG-b-PPS-b-PEI were explored as non-viral vectors for plasmid DNA (pDNA) transfection in a tumor immunotoxicity model. Complexes with pDNA were found to be templated exclusively by the size of the pDNA-free micelles and ranged from 240 nm (for PEG-b-PPS-b-PEI) to 30 nm (for mixed micelles of PEG-b-PPS/PEG-b-PPS-b-PEI). Both formulations transfected melanoma cells well in vitro. As a model with a functional read-out of tumor cell death, one with likely only small bystander effects, tumors were transfected with an antigen transgene, using an antigen to which the recipient animals had been previously vaccinated with a Th1-biasing adjuvant. Reduction in tumor growth, increase in intratumoral infiltration of cytotoxic T lymphocytes and accumulation of Th1-biasing cytokines indicated that both micelle formulations transfected efficiently compared with naked pDNA and with low cytotoxicity.

  16. Effects of prior oral exposure to combinations of environmental immunosuppressive agents on ovalbumin allergen-induced allergic airway inflammation in Balb/c mice.

    PubMed

    Fukuyama, Tomoki; Nishino, Risako; Kosaka, Tadashi; Watanabe, Yuko; Kurosawa, Yoshimi; Ueda, Hideo; Harada, Takanori

    2014-08-01

    Abstract Humans are exposed daily to multiple environmental chemicals in the atmosphere, in food, and in commercial products. Therefore, hazard identification and risk management must account for exposure to chemical mixtures. The objective of the study reported here was to investigate the effects of combinations of three well-known environmental immunotoxic chemicals - methoxychlor (MXC), an organochlorine compound; parathion (PARA), an organophosphate compound; and piperonyl butoxide (PBO), an agricultural insecticide synergist - by using a mouse model of ovalbumin (OVA)-induced allergic airway inflammation. Four-week-old Balb/c mice were exposed orally to either one or two of the environmental immunotoxic chemicals for five consecutive days, prior to intraperitoneal sensitization with OVA and an inhalation challenge. We assessed IgE levels in serum, B-cell counts, and cytokine production in hilar lymph nodes, and differential cell counts and levels of related chemokines in bronchoalveolar lavage fluid (BALF). Mice treated with MXC + PARA or PBO + MXC showed marked increases in serum IgE, IgE-positive B-cells and cytokines in lymph nodes, and differential cell counts and related chemokines in BALF compared with mice that received the vehicle control or the corresponding individual test substances. These results suggest that simultaneous exposure to multiple environmental chemicals aggravates allergic airway inflammation more than exposure to individual chemicals. It is expected that the results of this study will help others in their evaluation of immunotoxic combinational effects when conducting assessments of the safety of environmental/occupational chemicals.

  17. Differential sensitivities of bone marrow, spleen and thymus to genotoxicity induced by environmentally relevant concentrations of arsenite.

    PubMed

    Xu, Huan; McClain, Shea; Medina, Sebastian; Lauer, Fredine T; Douillet, Christelle; Liu, Ke Jian; Hudson, Laurie G; Stýblo, Miroslav; Burchiel, Scott W

    2016-11-16

    It is known in humans and mouse models, that drinking water exposures to arsenite (As(+3)) leads to immunotoxicity. Previously, our group showed that certain types of immune cells are extremely sensitive to arsenic induced genotoxicity. In order to see if cells from different immune organs have differential sensitivities to As(+3), and if the sensitivities correlate with the intracellular concentrations of arsenic species, male C57BL/6J mice were dosed with 0, 100 and 500ppb As(+3)via drinking water for 30d. Oxidation State Specific Hydride Generation- Cryotrapping- Inductively Coupled Plasma- Mass Spectrometry (HG- CT- ICP- MS) was applied to analyze the intracellular arsenic species and concentrations in bone marrow, spleen and thymus cells isolated from the exposed mice. A dose-dependent increase in intracellular monomethylarsonous acid (MMA(+3)) was observed in both bone marrow and thymus cells, but not spleen cells. The total arsenic and MMA(+3) levels were correlated with an increase in DNA damage in bone marrow and thymus cells. An in vitro treatment of 5, 50 and 500nM As(+3) and MMA(+3) revealed that bone marrow cells are most sensitive to As(+3) treatment, and MMA(+3) is more genotoxic than As(+3). These results suggest that the differential sensitivities of the three immune organs to As(+3) exposure are due to the different intracellular arsenic species and concentrations, and that MMA(+3) may play a critical role in immunotoxicity.

  18. Viral protein R of HIV type-1 induces retrotransposition and upregulates glutamate synthesis by the signal transducer and activator of transcription 1 signaling pathway.

    PubMed

    Doi, Akihiro; Iijima, Kenta; Kano, Shigeyuki; Ishizaka, Yukihito

    2015-07-01

    Viral protein R (Vpr) of HIV-1 plays an important role in viral replication in macrophages. Various lines of evidence suggest that expression of Vpr in macrophages causes immunopathogenesis; however, the underlying mechanism is not yet fully understood. In this study, it was shown that recombinant Vpr (rVpr) induces retrotransposition of long interspersed element-1 in RAW264.7, a macrophage-like cell line, and activates reverse transcriptase-dependent immunotoxic cascades including production of IFN-β and phosphorylation of signal transducer and activator of transcription 1 (STAT1). Knockout experiments based on the CRISPR/Cas9 nickase system further demonstrated that cyclic guanosine monophosphate-adenosine monophosphate synthase (cGAS) and stimulator of interferon gene (STING) are responsible for IFN-β production and STAT1 phosphorylation, respectively. Moreover, rVpr was found to increase production of glutaminase C, a regulator of glutamate synthesis, which is also dependent on the cGAS-STING pathway. Taken together with reports that glutaminase C is involved in the pathogenesis of HIV-associated neurocognitive disorder (HAND) and that Vpr is detectable in the cerebrospinal fluid of HIV-1-positive patients, a possible role of Vpr-induced L1-RTP and immunotoxic cascades in the development of HAND is discussed.

  19. Immunotoxicity of nanoparticles: a computational study suggests that CNTs and C60 fullerenes might be recognized as pathogens by Toll-like receptors

    NASA Astrophysics Data System (ADS)

    Turabekova, M.; Rasulev, B.; Theodore, M.; Jackman, J.; Leszczynska, D.; Leszczynski, J.

    2014-03-01

    Over the last decade, a great deal of attention has been devoted to study the inflammatory response upon exposure to multi/single-walled carbon nanotubes (CNTs) and different fullerene derivatives. In particular, carbon nanoparticles are reported to provoke substantial inflammation in alveolar and bronchial epithelial cells, epidermal keratinocytes, cultured monocyte-macrophage cells, etc. We suggest a hypothetical model providing the potential mechanistic explanation for immune and inflammatory responses observed upon exposure to carbon nanoparticles. Specifically, we performed a theoretical study to analyze CNT and C60 fullerene interactions with the available X-ray structures of Toll-like receptors (TLRs) homo- and hetero-dimer extracellular domains. This assumption was based on the fact that similar to the known TLR ligands both CNTs and fullerenes induce, in cells, the secretion of certain inflammatory protein mediators, such as interleukins and chemokines. These proteins are observed within inflammation downstream processes resulted from the ligand molecule dependent inhibition or activation of TLR-induced signal transduction. Our computational studies have shown that the internal hydrophobic pockets of some TLRs might be capable of binding small-sized carbon nanostructures (5,5 armchair SWCNTs containing 11 carbon atom layers and C60 fullerene). High binding scores and minor structural alterations induced in TLR ectodomains upon binding C60 and CNTs further supported our hypothesis. Additionally, the proposed hypothesis is strengthened by the indirect experimental findings indicating that CNTs and fullerenes induce an excessive expression of specific cytokines and chemokines (i.e. IL-8 and MCP1).Over the last decade, a great deal of attention has been devoted to study the inflammatory response upon exposure to multi/single-walled carbon nanotubes (CNTs) and different fullerene derivatives. In particular, carbon nanoparticles are reported to provoke

  20. In vitro and in vivo comparison of the immunotoxicity of single- and multi-layered graphene oxides with or without pluronic F-127

    PubMed Central

    Cho, Young Chol; Pak, Pyo June; Joo, Yong Hoon; Lee, Hoi-Seon; Chung, Namhyun

    2016-01-01

    Graphene oxide (GO) has been a focus of research in the fields of electronics, energy, and biomedicine, including drug delivery. Thus, single- and multi-layered GO (SLGO and MLGO) have been produced and investigated. However, little information on their toxicity and biocompatibility is available. In the present study, we performed a comprehensive study of the size- and dose-dependent toxicity of GOs in the presence or absence of Pluronic F-127 on THP-1 cells by examining their viability, membrane integrity, levels of cytokine and ROS production, phagocytosis, and cytometric apoptosis. Moreover, as an extended study, a toxicity evaluation in the acute and chronic phases was performed in mice via intravenous injection of the materials. GOs exhibited dose- and size-dependent toxicity. Interestingly, SLGO induced ROS production to a lesser extent than MLGO. Cytometric analysis indicated that SLGO induced necrosis and apoptosis to a lesser degree than MLGO. In addition, cell damage and IL-1β production were influenced by phagocytosis. A histological animal study revealed that GOs of various sizes induced acute and chronic damage to the lung and kidney in the presence or absence of Pluronic F-127. These results will facilitate studies of GO prior to its biomedical application. PMID:27941848

  1. The molecular mechanism of G2/M cell cycle arrest induced by AFB1 in the jejunum

    PubMed Central

    Yin, Heng; Jiang, Min; Peng, Xi; Cui, Hengmin; Zhou, Yi; He, Min; Zuo, Zhicai; Ouyang, Ping; Fan, Junde; Fang, Jing

    2016-01-01

    Aflatoxin B1 (AFB1) has potent hepatotoxic, carcinogenic, genotoxic, immunotoxic and other adverse effects in human and animals. The aim of this study was to investigate the molecular mechanism of G2/M cell cycle arrest induced by AFB1 in the jejunum of broilers. Broilers, as experimental animals, were fed 0.6 mg/kg AFB1 diet for 3 weeks. Our results showed that AFB1 reduced the jejunal villus height, villus height/crypt ratio and caused G2/M cell cycle arrest. The G2/M cell cycle was accompanied by the increase of ataxia telangiectasia mutated (ATM), p53, Chk2, p21 protein and mRNA expression, and the decrease of Mdm2, cdc25C, cdc2, cyclin B and proliferating cell nuclear antigen protein and mRNA expression. In conclusion, AFB1 blocked G2/M cell cycle by ATM pathway in the jejunum of broilers. PMID:27232757

  2. Immunotoxicity of Jet Fuels and Solvents

    DTIC Science & Technology

    2002-11-01

    as demonstrated by studies with tumor immunotherapy ( Kuby , 1992). Since the immune system is incredibly complex, it is difficult to discern the...significant factor in production and proliferation of T- cells, triggering and managing the immune response (Reid et al., 1994; Kuby , 1992). THI cells can...to produce IL-2 within 24 to 48 hours after activation by an antigen or mitogen ( Kuby , 1992). Mice given an intraperitoneal injection of benzene or

  3. 40 CFR 799.9780 - TSCA immunotoxicity.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... examined. (E) Spleen cell viability shall be determined. (F) The numbers of IgM PFC per spleen, and the... YAC-1 lymphoma cells may be appropriate for use in the assay. In all cases, target cell viability... B cells in response to antigens, and bind specifically to the eliciting antigen. The...

  4. Quinones and Sulfhydryl-Dependent Immunotoxicity

    DTIC Science & Technology

    1983-08-01

    regulation of the final response (Rosenberg and Lipsky, 19,1; Yoshinaga et al., 1972; McClain and Edelman, 1980; Suthanthiren et al., 1980). Cell-cell... Yoshinaga et al., 1972; McClain and Edelman, 1980; Suthanthiren et al., 1980). These observations were the basis for developing an in vitro model for...1981; Yoshinaga et al., 1972; Sanderson. 1981; Ryser and Vassalli, 1981; Adams et al., 1982; Weissmann et al., 1981; Henson et al., 1981; Keller et

  5. Immune System Toxicity and Immunotoxicity Hazard Identification

    EPA Science Inventory

    Exposure to chemicals may alter immune system health, increasing the risk of infections, allergy and autoimmune diseases. The chapter provides a concise overview of the immune system, host factors that affect immune system heal, and the effects that xenobiotic exposure may have ...

  6. 40 CFR 799.9780 - TSCA immunotoxicity.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... quantitative analysis of the effects of a chemical on the numbers of cells in major lymphocyte populations and..., and the research sample shall be stored under conditions that maintain its purity and stability. Prior... type of effect. (ii) All observed results, quantitative and incidental, shall be evaluated by...

  7. 40 CFR 799.9780 - TSCA immunotoxicity.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... quantitative analysis of the effects of a chemical on the numbers of cells in major lymphocyte populations and..., and the research sample shall be stored under conditions that maintain its purity and stability. Prior... type of effect. (ii) All observed results, quantitative and incidental, shall be evaluated by...

  8. 40 CFR 799.9780 - TSCA immunotoxicity.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... quantitative analysis of the effects of a chemical on the numbers of cells in major lymphocyte populations and..., and the research sample shall be stored under conditions that maintain its purity and stability. Prior... type of effect. (ii) All observed results, quantitative and incidental, shall be evaluated by...

  9. 40 CFR 799.9780 - TSCA immunotoxicity.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... quantitative analysis of the effects of a chemical on the numbers of cells in major lymphocyte populations and..., and the research sample shall be stored under conditions that maintain its purity and stability. Prior... type of effect. (ii) All observed results, quantitative and incidental, shall be evaluated by...

  10. Perfluorinated Compounds: Emerging POPs with Potential Immunotoxicity

    EPA Science Inventory

    Perfluorinated compounds (PFCs) have been recognized as an important class of environmental contaminants commonly detected in blood samples of both wildlife and humans. These compounds have been in use for more than 60 years as surface treatment chemicals, polymerization aids, an...

  11. Tetrabromobisphenol-A induces apoptotic death of auditory cells and hearing loss.

    PubMed

    Park, Channy; Kim, Se-Jin; Lee, Won Kyo; Moon, Sung Kyun; Kwak, SeongAe; Choe, Seong-Kyu; Park, Raekil

    2016-09-30

    Phenolic tetrabromobisphenol-A (TBBPA) and its derivatives are commonly used flame-retardants, in spite of reported toxic effects including neurotoxicity, immunotoxicity, nephrotoxicity, and hepatotoxicity. However, the effects of TBBPA on ototoxicity have not yet been reported. In this study, we investigated the effect of TBBPA on hearing function in vivo and in vitro. Auditory Brainstem Response (ABR) threshold was markedly increased in mice after oral administration of TBBPA, indicating that TBBPA causes hearing loss. In addition, TBBPA induced the loss of both zebrafish neuromasts and hair cells in the rat cochlea in a dose-dependent manner. Mechanistically, hearing loss is largely attributed to apoptotic cell death, as TBBPA increased the expression of pro-apoptotic genes but decreased the expression of anti-apoptotic genes. We also found that TBBPA induced oxidative stress, and importantly, pretreatment with NAC, an anti-oxidant reagent, reduced TBBPA-induced reactive oxygen species (ROS) generation and partially prevented cell death. Our results show that TBBPA-mediated ROS generation induces ototoxicity and hearing loss. These findings implicate TBBPA as a potential environmental ototoxin by exerting its hazardous effects on the auditory system.

  12. Regulation of isocyanate-induced apoptosis, oxidative stress, and inflammation in cultured human neutrophils: isocyanate-induced neutrophils apoptosis.

    PubMed

    Mishra, P K; Khan, S; Bhargava, A; Panwar, H; Banerjee, S; Jain, S K; Maudar, K K

    2010-06-01

    Implications of environmental toxins on the regulation of neutrophil function are being significantly appraised. Such effects can be varied and markedly different depending on the type and extent of chemical exposure, which results in direct damage to the immune system. Isocyanates with functional group (-NCO), are considered as highly reactive molecules with diverse industrial applications. However, patho-physiological implications resulting from their occupational and accidental exposures have not been well delineated. The present study was carried out to assess the immunotoxic response of isocyanates and their mode of action at a molecular level on cultured human neutrophils isolated from healthy human volunteers. Studies were conducted to evaluate both dose- and time-dependent (n = 3) response using N-succinimidyl N-methylcarbamate, a chemical entity that mimics the effects of methyl isocyanate in vitro. Measure of apoptosis through annexin-V-FITC/PI assay, active caspase-3, apoptotic DNA ladder assay and mitochondrial depolarization; induction of oxidative stress by CM-H(2)DCFDA and formation of 8'-hydroxy-2'-deoxyguanosine; and levels of antioxidant defense system enzyme glutathione reductase, multiplex cytometric bead array analysis to quantify the secreted cytokine levels (interleukin-8, interleukin-1beta, interleukin-6, interleukin-10, interferon-gamma, tumor necrosis factor, and interleukin-12p70) parameters were evaluated. Our results demonstrate that isocyanates induce neutrophil apoptosis via activation of mitochondrial-mediated pathway along with reactive oxygen species production; depletion in antioxidant defense states; and elevated pro-inflammatory cytokine response.

  13. Does developmental exposure to perflurooctanoic acid (PFOA) induce immunopathologies commonly observed in neurodevelopmental disorders?

    PubMed

    Hu, Qing; Franklin, Jason N; Bryan, Ian; Morris, Erin; Wood, Andrew; DeWitt, Jamie C

    2012-12-01

    Immune comorbidities often are reported in subsets of patients with neurodevelopmental disorders, including autism spectrum disorders and attention-deficit hyperactivity disorder. A common immunopathology is an increase in serum autoantibodies against myelin basic protein (MBP) relative to control patients. Increases in autoantibodies suggest possible deficits in self-tolerance that may contribute to the formation of brain-specific autoantibodies and subsequent effects on the central nervous system (CNS). Oppositely, the formation of neuronal autoantibodies may be a reaction to neuronal injury or damage. Perfluorooctanoic acid (PFOA) is an environmental pollutant that induces multisystem toxicity in rodent models, including immunotoxicity and neurotoxicity. We hypothesized that developmental exposure to PFOA may induce immunotoxicity similar to that observed in subsets of patients with neurodevelopmental disorders. To test this hypothesis, we evaluated subsets of T cells from spleens, serum markers of autoreactivity, and levels of MBP and T cell infiltration in the cerebella of adult offspring exposed to 0.02, 0.2, or 2mg/kg of PFOA given to dams from gestation through lactation. Litter weights of offspring from dams exposed to 2mg/kg of PFOA were reduced by 32.6%, on average, from postnatal day one (PND1) through weaning (PND21). The percentage of splenic CD4+CD25+Foxp3+ T cells in male and female offspring from dams exposed to 2mg/kg of PFOA was reduced by 22% relative to the control percentage. Ex vivo co-cultures of splenic CD4+CD25+ T cells and CD4+CD25- T cells from dosed male offspring produced less IL-10 relative to control cells. Anti-ssDNA, a serum marker of autoreactivity, was decreased by 26%, on average, in female offspring from dams exposed to 0.02 and 2mg/kg PFOA. No other endpoints were statistically different by dose. These data suggest that developmental PFOA exposure may impact T cell responses and may be a possible route to downstream effects on

  14. Modulation of biochemical parameters by Hemidesmus indicus in cumene hydroperoxide-induced murine skin: possible role in protection against free radicals-induced cutaneous oxidative stress and tumor promotion.

    PubMed

    Sultana, Sarwat; Khan, Naghma; Sharma, Sonia; Alam, Aftab

    2003-03-01

    Hemidesmus indicus has been shown to possess significant activity against immunotoxicity and other pharmacological and physiological disorders. In this communication, we have shown the modulating effect of H. indicus on cumene hydroperoxide-mediated cutaneous oxidative stress and tumor promotion response in murine skin. Cumene hydroperoxide treatment (30 mg per animal) increased cutaneous microsomal lipid peroxidation and induction of xanthine oxidase activity which are accompanied by decrease in the activities of cutaneous antioxidant enzymes and depletion in the level of glutathione. Parallel to these changes a sharp decrease in the activities of phase II metabolizing enzymes was observed. Cumene hydroperoxide treatment also induced the ornithine decarboxylase activity and enhanced the [3H]-thymidine uptake in DNA synthesis in murine skin. Application of ethanolic extract of H. indicus at a dose level of 1.5 and 3.0mg/kg body weight in acetone prior to that of cumene hydroperoxide treatment resulted in significant inhibition of cumene hydroperoxide-induced cutaneous oxidative stress, epidermal ornithine decarboxylase activity and enhanced DNA synthesis in a dose-dependent manner. Enhanced susceptibility of cutaneous microsomal membrane for lipid peroxidation and xanthine oxidase activity were significantly reduced (P<0.01). In addition the depleted level of glutathione, inhibited activities of antioxidants and phase II metabolizing enzymes were recovered to significant level (P<0.05). In summary, our data suggest that H. indicus is an effective chemopreventive agent in skin and capable of ameliorating hydroperoxide-induced cutaneous oxidative stress and tumor promotion.

  15. Protective Effects of Diallyl Sulfide against Thioacetamide-Induced Toxicity: A Possible Role of Cytochrome P450 2E1

    PubMed Central

    Kim, Nam Hee; Lee, Sangkyu; Kang, Mi Jeong; Jeong, Hye Gwang; Kang, Wonku; Jeong, Tae Cheon

    2014-01-01

    Effects of diallyl sulfide (DAS) on thioacetamide-induced hepatotoxicity and immunotoxicity were investigated. When male Sprague-Dawley rats were treated orally with 100, 200 and 400 mg/kg of DAS in corn oil for three consecutive days, the activity of cytochrome P450 (CYP) 2E1-selective p-nitrophenol hydroxylase was dose-dependently suppressed. In addition, the activities of CYP 2B-selective benzyloxyresorufin O-debenzylase and pentoxyresorufin O-depentylase were significantly induced by the treatment with DAS. Western immunoblotting analyses also indicated the suppression of CYP 2E1 protein and/or the induction of CYP 2B protein by DAS. To investigate a possible role of metabolic activation by CYP enzymes in thioacetamide-induced hepatotoxicity, rats were pre-treated with 400 mg/kg of DAS for 3 days, followed by a single intraperitoneal treatment with 100 and 200 mg/kg of thioacetamide in saline for 24 hr. The activities of serum alanine aminotransferase and aspartate aminotransferase significantly elevated by thioacetamide were protected in DAS-pretreated animals. Likewise, the suppressed antibody response to sheep erythrocytes by thioacetamide was protected by DAS pretreatment in female BALB/c mice. Taken together, our present results indicated that thioacetamide might be activated to its toxic metabolite(s) by CYP 2E1, not by CYP 2B, in rats and mice. PMID:24753821

  16. Acacia ferruginea inhibits cyclophosphamide-induced immunosuppression and urotoxicity by modulating cytokines in mice.

    PubMed

    Sakthivel, K M; Guruvayoorappan, Chandrasekaran

    2015-01-01

    Cyclophosphamide (CTX), commonly used as an anti-neoplastic drug, can cause adverse side-effects including immunotoxicity and urotoxicity. Increasingly, plants have become sources of therapeutics that can help to restore host immunity to normal. In this study, Acacia ferruginea was assessed for an ability to protect mice against/mitigate CTX-induced toxicity. Co-administration of an extract of A. ferruginea (10 mg/kg BW, IP daily) for 10 consecutive days reduced CTX (25 mg/kg BW, IP daily)-induced toxicity. Apart from improvements in bladder and small intestine morphology, there was marked improvement in anti-oxidant (glutathione) levels in the bladder, suggesting a role for the anti-oxidant in reducing CTX-induced urotoxicity. Moreover, use of the extract significantly increased total leukocyte counts and bone marrow cellularity/α-esterase activity in CTX-treated mice which suggested a protective effect on the hematopoietic system. Co-treatment with the extract also prevented decreases in organ (liver, kidney, spleen, thymus) weight as well as body weight, thereby seemingly lessening the potential impact of CTX on the host immune system. Further, CTX-induced increases in serum aspartate transanimase, alanine transaminase, and alkaline phosphatase were reversed by extract co-treatment, as were alterations in in situ formation/release of interferon (IFN)-γ, interleukin (IL)-2, granulocyte-macrophage colony stimulating factor (GM-CSF), and tumor necrosis factor (TNF)-α. Overall, this study indicated there were some protective effects from use of an extract of A. ferruginea against CTX-induced toxicities, in part through modulation of levels of anti-oxidants and pro-inflammatory cytokines.

  17. Quantitative alterations in the liver and adrenal gland in pregnant rats induced by Pyralene 3000

    SciTech Connect

    Vreci, M.; Sek, S.; Lorger, J.; Bavdek, S.; Pogacnik, A.

    1995-06-01

    Polychlorinated biphenyls (PCBs) are among the most widespread environmental pollutants known in the world. The half-life of PCBs is very long and, therefore, once released into the environment, they accumulate in food chains and tissues of various mammals, including man. Their presence can cause numerous toxic effects, e.g., hepatotoxicity, immunotoxicity, dermatotoxicity, neurotoxicity, and disorders of the reproductive system, among others. These effects depend on the distribution route in the organism, the rate of metabolism and excretion. Their characteristics are closely associated with the number and position of the chlorine atoms in the molecule. Previous studies of trichlorobiphenyl distributions in various tissues demonstrated that low chlorinated trichlorobiphenyls do no accumulate in endocrine organs, whereas higher chlorinated biphenyls, such as hexa- and octachlorobiphenyl, are deposited and retained in the adrenal gland. A selective distribution of radioabelled tetrachlorobiphenyl to the zona fasciculata, accompanied by morphometric evidence of the hypertrophy of the zona fasciculata, was also noted. The purpose of this study was to examine changes in the tissue structure of the pregnant rat liver and adrenal gland induced experimentally by Pyralene 3000 administration. We chose this commercial low chlorinated PCB because it was in use in Slovenia and, discharged from the electroindustrial plants, caused a serious incidence of environmental pollution in the region of Bela Krajina. Our further aim was to research the transplacental influences of Pyralene 3000 in rats. 17 refs., 1 fig., 3 tabs.

  18. [Joint effects of apoptosis induced by microcystins and bacterial lipopolysaccharides on grass carp (Ctenopharyngodon idellus) lymphocytes].

    PubMed

    Fang, Wen-Di; Zhang, Hang-Jun; Wu, Yu-Huan

    2014-02-01

    In this study, grass carp (Ctenopharyngodon idellus) lymphocytes were used as the vitro test object to demonstrate the joint effects of microcystins (MC-LR) and bacterial lipopolysaccharides (LPS) on fish immune system. The results showed that MC-LR and LPS in the single and combined exposure groups could both induce grass carp lymphocytes apoptosis with typical ladder-like DNA electrophoresis characteristics. However, comparing the apoptosis rate of the combined and single exposure groups, it was suggested that bacterial LPS could cooperate with MC-LR causing a higher rate of fish lymphocytes apoptosis (2.1 and 3.3-fold of that for the single exposure group I (MC-LR) and II (LPS), respectively), and there existed a significant dose-response relationship. The MC-LR cooperating with bacterial LPS decreased the activity of glutathione S-transferase (GST), increased the levels of intracellular reactive oxygen species (ROS) and malondialdehyde (MDA), resulted in DNA damage and cell arrest in G0 phase, which inhibited cell proliferation and accelerated apoptosis. It was proved that MC-LR exacerbated fish immunotoxicity by collaborating with LPS, which had a serious adverse effect on aquaculture industry.

  19. Induced Abortion

    MedlinePlus

    ... Education & Events Advocacy For Patients About ACOG Induced Abortion Home For Patients Search FAQs Induced Abortion Page ... Induced Abortion FAQ043, May 2015 PDF Format Induced Abortion Special Procedures What is an induced abortion? What ...

  20. Permethrin-induced oxidative stress and toxicity and metabolism. A review.

    PubMed

    Wang, Xu; Martínez, María-Aránzazu; Dai, Menghong; Chen, Dongmei; Ares, Irma; Romero, Alejandro; Castellano, Victor; Martínez, Marta; Rodríguez, José Luis; Martínez-Larrañaga, María-Rosa; Anadón, Arturo; Yuan, Zonghui

    2016-08-01

    Permethrin (PER), the most frequently used synthetic Type I pyrethroid insecticide, is widely used in the world because of its high activity as an insecticide and its low mammalian toxicity. It was originally believed that PER exhibited low toxicity on untargeted animals. However, as its use became more extensive worldwide, increasing evidence suggested that PER might have a variety of toxic effects on animals and humans alike, such as neurotoxicity, immunotoxicity, cardiotoxicity, hepatotoxicity, reproductive, genotoxic, and haematotoxic effects, digestive system toxicity, and cytotoxicity. A growing number of studies indicate that oxidative stress played critical roles in the various toxicities associated with PER. To date, almost no review has addressed the toxicity of PER correlated with oxidative stress. The focus of this article is primarily to summarise advances in the research associated with oxidative stress as a potential mechanism for PER-induced toxicity as well as its metabolism. This review summarises the research conducted over the past decade into the reactive oxygen species (ROS) generation and oxidative stress as a consequence of PER treatments, and ultimately their correlation with the toxicity and the metabolism of PER. The metabolism of PER involves various CYP450 enzymes, alcohol or aldehyde dehydrogenases for oxidation and the carboxylesterases for hydrolysis, through which oxidative stress might occur, and such metabolic factors are also reviewed. The protection of a variety of antioxidants against PER-induced toxicity is also discussed, in order to further understand the role of oxidative stress in PER-induced toxicity. This review will throw new light on the critical roles of oxidative stress in PER-induced toxicity, as well as on the blind spots that still exist in the understanding of PER metabolism, the cellular effects in terms of apoptosis and cell signaling pathways, and finally strategies to help to protect against its oxidative

  1. Reactive oxygen species (ROS) induced cytokine production and cytotoxicity of PAMAM dendrimers in J774A.1 cells

    SciTech Connect

    Naha, Pratap C.; Davoren, Maria; Lyng, Fiona M.; Byrne, Hugh J.

    2010-07-15

    The immunotoxicity of three generations of polyamidoamine (PAMAM) dendrimers (G-4, G-5 and G-6) was evaluated in mouse macrophage cells in vitro. Using the Alamar blue and MTT assays, a generation dependent cytotoxicity of the PAMAM dendrimers was found whereby G-6 > G-5 > G-4. The toxic response of the PAMAM dendrimers correlated well with the number of surface primary amino groups, with increasing number resulting in an increase in toxic response. An assessment of intracellular ROS generation by the PAMAM dendrimers was performed by measuring the increased fluorescence as a result of intracellular oxidation of Carboxy H{sub 2}DCFDA to DCF both quantitatively using plate reader and qualitatively by confocal laser scanning microscopy. The inflammatory mediators macrophage inflammatory protein-2 (MIP-2), tumour necrosis factor-{alpha} (TNF-{alpha}) and interleukin-6, (IL-6) were measured by the enzyme linked immunosorbant assay (ELISA) following exposure of mouse macrophage cells to PAMAM dendrimers. A generation dependent ROS and cytokine production was found, which correlated well with the cytotoxicological response and therefore number of surface amino groups. A clear time sequence of increased ROS generation (maximum at {approx} 4 h), TNF-{alpha} and IL-6 secretion (maximum at {approx} 24 h), MIP-2 levels and cell death ({approx} 72 h) was observed. The intracellular ROS generation and cytokine production induced cytotoxicity point towards the mechanistic pathway of cell death upon exposure to PAMAM dendrimers.

  2. Fluoride exposure abates pro-inflammatory response and induces in vivo apoptosis rendering zebrafish (Danio rerio) susceptible to bacterial infections.

    PubMed

    Singh, Rashmi; Khatri, Preeti; Srivastava, Nidhi; Jain, Shruti; Brahmachari, Vani; Mukhopadhyay, Asish; Mazumder, Shibnath

    2017-02-20

    The present study describes the immunotoxic effect of chronic fluoride exposure on adult zebrafish (Danio rerio). Zebrafish were exposed to fluoride (71.12 mg/L; 1/10 LC50) for 30 d and the expression of selected genes studied. We observed significant elevation in the detoxification pathway gene cyp1a suggesting chronic exposure to non-lethal concentration of fluoride is indeed toxic to fish. Fluoride mediated pro-oxidative stress is implicated with the downregulation in superoxide dismutase 1 and 2 (sod1/2) genes. Fluoride affected DNA repair machinery by abrogating the expression of the DNA repair gene rad51 and growth arrest and DNA damage inducible beta a gene gadd45ba. The upregulated expression of casp3a coupled with altered Bcl-2 associated X protein/B-cell lymphoma 2 ratio (baxa/bcl2a) clearly suggested chronic fluoride exposure induced the apoptotic cascade in zebrafish. Fluoride-exposed zebrafish when challenged with non-lethal dose of fish pathogen A. hydrophila revealed gross histopathology in spleen, bacterial persistence and significant mortality. We report that fluoride interferes with system-level output of pro-inflammatory cytokines tumour necrosis factor-α, interleukin-1β and interferon-γ, as a consequence, bacteria replicate efficiently causing significant fish mortality. We conclude, chronic fluoride exposure impairs the redox balance, affects DNA repair machinery with pro-apoptotic implications and suppresses pro-inflammatory cytokines expression abrogating host immunity to bacterial infections.

  3. Dioxin exposure of human CD34+ hemopoietic cells induces gene expression modulation that recapitulates its in vivo clinical and biological effects.

    PubMed

    Fracchiolla, Nicola Stefano; Todoerti, Katia; Bertazzi, Pier Alberto; Servida, Federica; Corradini, Paolo; Carniti, Cristiana; Colombi, Antonio; Cecilia Pesatori, Angela; Neri, Antonino; Deliliers, Giorgio Lambertenghi

    2011-04-28

    2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD) has a large number of biological effects, including skin, cardiovascular, neurologic diseases, diabetes, infertility, cancers and immunotoxicity. We analysed the in vitro TCDD effects on human CD34+ cells and tested the gene expression modulation by means of microarray analyses before and after TCDD exposure. We identified 257 differentially modulated probe sets, identifying 221 well characterized genes. A large part of these resulted associated to cell adhesion and/or angiogenesis and to transcription regulation. Synaptic transmission and visual perception functions, with the particular involvement of the GABAergic pathway were also significantly modulated. Numerous transcripts involved in cell cycle or cell proliferation, immune response, signal transduction, ion channel activity or calcium ion binding, tissue development and differentiation, female or male fertility or in several metabolic pathways were also affected after dioxin exposure. The transcriptional profile induced by TCDD treatment on human CD34+ cells strikingly reproduces the clinical and biological effects observed in individuals exposed to dioxin and in biological experimental systems. Our data support a role of dioxin in the neoplastic transformation of hemopoietic stem cells and in immune modulation processes after in vivo exposure, as indicated by the epidemiologic data in dioxin accidentally exposed populations, providing a molecular basis for it. In addition, TCDD alters genes associated to glucidic and lipidic metabolisms, to GABAergic transmission or involved in male and female fertility, thus providing a possible explanation of the diabetogenic, dyslipidemic, neurologic and fertility effects induced by TCDD in vivo exposure.

  4. Carbon fullerenes (C60s) can induce inflammatory responses in the lung of mice

    SciTech Connect

    Park, Eun-Jung; Kim, Hero; Kim, Younghun; Yi, Jongheop; Choi, Kyunghee; Park, Kwangsik

    2010-04-15

    Fullerenes (C60s) occur in the environment due to natural and anthropogenic sources such as volcanic eruptions, forest fires, and the combustion of carbon-based materials. Recently, production and application of engineered C60s have also rapidly increased in diverse industrial fields and biomedicine due to C60' unique physico-chemical properties, so toxicity assessment on environmental and human health is being evaluated as a valuable work. However, data related to the toxicity of C60s have not been abundant up to now. In this study, we studied the immunotoxic mechanism and change of gene expression caused by the instillation of C60s. As a result, C60s induced an increase in sub G1 and G1 arrest in BAL cells, an increase in pro-inflammatory cytokines such as IL-1, TNF-alpha, and IL-6, and an increase of Th1 cytokines such as IL-12 and IFN-r in BAL fluid. In addition, IgE reached the maximum at 1 day after treatment in both BAL fluid and the blood, and decreased in a time-dependent manner. Gene expression of the MHC class II (H2-Eb1) molecule was stronger than that of the MHC class I (H2-T23), and an increase in T cell distribution was also observed during the experiment period. Furthermore, cell infiltration and expression of tissue damage related genes in lung tissue were constantly observed during the experiment period. Based on this, C60s may induce inflammatory responses in the lung of mice.

  5. Molecular mechanisms underlying mancozeb-induced inhibition of TNF-alpha production.

    PubMed

    Corsini, Emanuela; Viviani, Barbara; Birindelli, Sarah; Gilardi, Federica; Torri, Anna; Codecà, Ilaria; Lucchi, Laura; Bartesaghi, Stefano; Galli, Corrado L; Marinovich, Marina; Colosio, Claudio

    2006-04-15

    activity relative to control after mancozeb treatment, confirming NF-kappaB binding as an intracellular target of mancozeb. Overall, this study contributes to our understanding of the mechanism underlying mancozeb-induced immunotoxicity.

  6. Low-Dose Inorganic Mercury Increases Severity and Frequency of Chronic Coxsackievirus-Induced Autoimmune Myocarditis in Mice

    PubMed Central

    Nyland, Jennifer F.; Fairweather, DeLisa; Shirley, Devon L.; Davis, Sarah E.; Rose, Noel R.; Silbergeld, Ellen K.

    2012-01-01

    Mercury is a widespread environmental contaminant with neurotoxic impacts that have been observed over a range of exposures. In addition, there is increasing evidence that inorganic mercury (iHg) and organic mercury (including methyl mercury) have a range of immunotoxic effects, including immune suppression and induction of autoimmunity. In this study, we investigated the effect of iHg on a model of autoimmune heart disease in mice induced by infection with coxsackievirus B3 (CVB3). We examined the role of timing of iHg exposure on disease; in some experiments, mice were pretreated with iHg (200 μg/kg, every other day for 15 days) before disease induction with virus inoculation, and in others, they were treated with iHg after the acute (viral) phase of disease but before the development of dilated cardiomyopathy (DCM). iHg alone had no effect on heart pathology. Pretreatment with iHg before CVB3 infection significantly increased the severity of chronic myocarditis and DCM compared with control animals receiving vehicle alone. In contrast, treatment with iHg after acute myocarditis did not affect the severity of chronic disease. The increased chronic myocarditis, fibrosis, and DCM induced by iHg pretreatment were not due to increased viral replication in the heart, which was unaltered by iHg treatment. iHg pretreatment induced a macrophage infiltrate and mixed cytokine response in the heart during acute myocarditis, including significantly increased interleukin (IL)-12, IL-17, interferon-γ, and tumor necrosis factor-α levels. IL-17 levels were also significantly increased in the spleen during chronic disease. Thus, we show for the first time that low-dose Hg exposure increases chronic myocarditis and DCM in a murine model. PMID:21984480

  7. Silymarin protects PBMC against B(a)P induced toxicity by replenishing redox status and modulating glutathione metabolizing enzymes-An in vitro study

    SciTech Connect

    Kiruthiga, P.V.; Pandian, S. Karutha; Devi, K. Pandima

    2010-09-01

    PAHs are a ubiquitous class of environmental contaminants that have a large number of hazardous consequences on human health. An important prototype of PAHs, B(a)P, is notable for being the first chemical carcinogen to be discovered and the one classified by EPA as a probable human carcinogen. It undergoes metabolic activation to QD, which generate ROS by redox cycling system in the body and oxidatively damage the macromolecules. Hence, a variety of antioxidants have been tested as possible protectors against B(a)P toxicity. Silymarin is one such compound, which has high human acceptance, used clinically and consumed as dietary supplement around the world for its strong anti-oxidant efficacy. Silymarin was employed as an alternative approach for treating B(a)P induced damage and oxidative stress in PBMC, with an emphasis to provide the molecular basis for the effect of silymarin against B(a)P induced toxicity. PBMC cells exposed to either benzopyrene (1 {mu}M) or silymarin (2.4 mg/ml) or both was monitored for toxicity by assessing LPO, PO, redox status (GSH/GSSG ratio), glutathione metabolizing enzymes GR and GPx and antioxidant enzymes CAT and SOD. This study also investigated the protective effect of silymarin against B(a)P induced biochemical alteration at the molecular level by FT-IR spectroscopy. Our findings were quite striking that silymarin possesses substantial protective effect against B(a)P induced oxidative stress and biochemical changes by restoring redox status, modulating glutathione metabolizing enzymes, hindering the formation of protein oxidation products, inhibiting LPO and further reducing ROS mediated damages by changing the level of antioxidant enzymes. The results suggest that silymarin exhibits multiple protections and it should be considered as a potential protective agent for environmental contaminant induced immunotoxicity.

  8. TESTING ANTIMICROBIAL PAINT EFFICACY ON GYPSUM WALLBOARD CONTAMINATED WITH STACHYBOTRYS CHARTARUM

    EPA Science Inventory

    Often mold contaminated building materials are not properly removed, some surface cleaning is performed and paint is applied in an attempt to alleviate the problem. The efficacy of antimicrobial paints to eliminate or control mold regrowth on surfaces can easily be tested on non-...

  9. TESTING ANTIMICROBIAL CLEANER EFFICACY ON GYPSUM WALLBOARD CONTAMINATED WITH STACHYBOTRYS CHARTARUM

    EPA Science Inventory

    Reducing occupant exposure to indoor mold growth is the goal of this research, through the efficacy testing of antimicrobial cleaners. Often mold contaminated building materials are not properly removed, but instead surface cleaners are applied in an attempt to alleviate the prob...

  10. Purification, immunotoxic effects, and cellular uptake of trichothecene mycotoxins

    SciTech Connect

    Witt, M.F.

    1989-01-01

    Studies were carried out to better understand how the trichothecenes alter immune function in animals and humans. Deoxynivalenol (DON) was purified for use in animal feeding studies. Dietary exposure to DON for 8 weeks altered the serum immunoglobulin profile in mice and decreased the splenic plaque-forming cell response to the antigen sheep red blood cells. The uptake of ({sup 3}H)T-2 toxin by a murine B-cell hybridoma was studied in order to learn more about the way in which trichothecenes interact with immune cells. A simple procedure was developed for the laboratory production and purification of gram quantities of crystalline DON. When Fusarium graminearum R6576 was grown on rice, concentrations of 600 to 700 ppm DON accumulated after 13 to 18 days of incubation. A DON derivative, 15-acetylDON, was also found at concentrations of 100 to 300 ppm after 7 to 10 days. DON was purified from crude culture extracts by water-saturated silica gel chromatography. Alpha-({sup 3}H)T-2 toxin of 99% chemical and radiochemical purity was prepared for use in uptake studies. Both the rate of uptake of ({sup 3}H)T-2 toxin by hybridomas and the time required for accumulation of ({sup 3}H)T-2 to reach equilibrium were proportional to the concentration of ({sup 3}H)T-2. ({sup 3}H)T-2 toxin accumulated by hybridomas was proportional to the concentration of ({sup 3}H)T-2 between 10{sup {minus}8} and 10{sup {minus}3} M. The rate of uptake of ({sup 3}H)jT-2 toxin by hybridomas was inhibited by the trichothecenes T-2 toxin, DON, verrucarin A, and roridin A, as well as the antibiotic anisomycin. The kinetics and concentration dependence of accumulation, along with the inhibition patterns, suggest that uptake of ({sup 3}H)T-2 toxin by hybridomas is mediated by binding of toxin to ribosomes.

  11. Immunotoxicity Monitoring in a Population Exposed to Polychlorinated Biphenyls.

    PubMed

    Haase, Hajo; Fahlenkamp, Astrid; Schettgen, Thomas; Esser, Andre; Gube, Monika; Ziegler, Patrick; Kraus, Thomas; Rink, Lothar

    2016-03-08

    The relationship between polychlorinated biphenyl (PCB) burden and several indicators of immune function was investigated as part of the HELPcB (Health Effects in High-Level Exposure to PCB) program, offering bio-monitoring to workers, relatives, and neighbors exposed to PCBs by a German transformers and capacitors recycling company. The present retrospective observational study evaluates the correlation of plasma levels of total PCBs, five indicator congeners (28, 101, 138, 153, 180), and seven dioxin-like congeners (105, 114, 118, 156, 157, 167, 189) with several parameters of immune function. The cross-sectional study was performed immediately after the end of exposure (258 subjects), and one (218 subjects), and two (177 subjects) years later. At the first time point, measurements showed significant positive correlation between congeners with low to medium chlorination and the relative proportion of CD19 positive B-cells among lymphocytes, as well as a negative correlation of PCB114 with serum IgM, and of PCB 28 with suppressor T-cell and NK-cell numbers. Congeners with a high degree of chlorination, in particular PCB157 and 189, were positively associated with expression of the activation marker CD25 on T-cells in the cohort of the second time point. No associations between PCB levels and IFN-y production by T-cells and killing by NK-cells were found. In conclusion, there were several effects on the cellular composition of adaptive immunity, affecting both T- and B-cells. However, the values were not generally outside the reference ranges for healthy adult individuals and did not indicate overt functional immunodeficiency, even in subjects with the uppermost PCB burden.

  12. EVALUATION OF PERFLUOROOCTANOIC ACID IMMUNOTOXICITY IN ADULT MICE.

    EPA Science Inventory

    Perfluorooctanoic acid (PFOA) is used in the manufacture of fluoropolymers and may be formed by metabolism or degradation of other perfluoroalkyl acids. Safety concerns led the U.S. EPA to conduct a risk assessment of PFOA and related compounds due to their environmental persist...

  13. Immunotoxicity Monitoring in a Population Exposed to Polychlorinated Biphenyls

    PubMed Central

    Haase, Hajo; Fahlenkamp, Astrid; Schettgen, Thomas; Esser, Andre; Gube, Monika; Ziegler, Patrick; Kraus, Thomas; Rink, Lothar

    2016-01-01

    The relationship between polychlorinated biphenyl (PCB) burden and several indicators of immune function was investigated as part of the HELPcB (Health Effects in High-Level Exposure to PCB) program, offering bio-monitoring to workers, relatives, and neighbors exposed to PCBs by a German transformers and capacitors recycling company. The present retrospective observational study evaluates the correlation of plasma levels of total PCBs, five indicator congeners (28, 101, 138, 153, 180), and seven dioxin-like congeners (105, 114, 118, 156, 157, 167, 189) with several parameters of immune function. The cross-sectional study was performed immediately after the end of exposure (258 subjects), and one (218 subjects), and two (177 subjects) years later. At the first time point, measurements showed significant positive correlation between congeners with low to medium chlorination and the relative proportion of CD19 positive B-cells among lymphocytes, as well as a negative correlation of PCB114 with serum IgM, and of PCB 28 with suppressor T-cell and NK-cell numbers. Congeners with a high degree of chlorination, in particular PCB157 and 189, were positively associated with expression of the activation marker CD25 on T-cells in the cohort of the second time point. No associations between PCB levels and IFN-y production by T-cells and killing by NK-cells were found. In conclusion, there were several effects on the cellular composition of adaptive immunity, affecting both T- and B-cells. However, the values were not generally outside the reference ranges for healthy adult individuals and did not indicate overt functional immunodeficiency, even in subjects with the uppermost PCB burden. PMID:27005643

  14. Puerarin, isolated from Kudzu root (Willd.), attenuates hepatocellular cytotoxicity and regulates the GSK-3β/NF-κB pathway for exerting the hepatoprotection against chronic alcohol-induced liver injury in rats.

    PubMed

    Li, Rong; Liang, Tao; He, Qiaoling; Guo, Chao; Xu, Lingyuan; Zhang, Kefeng; Duan, Xiaoqun

    2013-09-01

    Puerarin (PR) has been utilized as a phytomedicine to managing liver disease in China. Thus, this study aimed to evaluate the potential PR-mediated hepatoprotective role against chronic alcohol-induced liver injury in rats. The results indicated that serum levels of alanine aminotransferase (ALT), aspartate aminotransferase (AST), alkaline phosphatase (ALP) and pro-inflammatory cytokines were significantly reduced following PR treatment, while the albumin (ALB) level was increased. Meanwhile, intrahepatic contents of alcohol dehydrogenase (ADH), aldehyde dehydrogenase (ALDH) were elevated. Pathological examination showed that alcohol-lesioned hepatocytes were mitigated through the PR treatment. In addition, the endogenous levels of glycogen synthase kinase-3β (GSK-3β) at the protein level and β-catenin expression at the mRNA level were notably down-regulated, whereas the tumor necrosis factor alpha (TNF-α) and nuclear factor-kappa B (NF-κB) proteins in the liver tissue were effectively decreased following the PR treatment. Together, these findings demonstrate that PR mediates hepatoprotection against alcohol-induced liver injury. The mechanisms underlying the cytoprotective effects of PR are associated with inhibiting immunotoxicity in hepatocytes and regulating the GSK-3β/NF-κB pathway, thereby maintaining metabolic homeostasis in the liver tissue.

  15. Global protein phosphorylation dynamics during deoxynivalenol-induced ribotoxic stress response in the macrophage

    SciTech Connect

    Pan, Xiao; Whitten, Douglas A.; Wu, Ming; Chan, Christina; Wilkerson, Curtis G.; Pestka, James J.

    2013-04-15

    Deoxynivalenol (DON), a trichothecene mycotoxin produced by Fusarium that commonly contaminates food, is capable of activating mononuclear phagocytes of the innate immune system via a process termed the ribotoxic stress response (RSR). To encapture global signaling events mediating RSR, we quantified the early temporal (≤ 30 min) phosphoproteome changes that occurred in RAW 264.7 murine macrophage during exposure to a toxicologically relevant concentration of DON (250 ng/mL). Large-scale phosphoproteomic analysis employing stable isotope labeling of amino acids in cell culture (SILAC) in conjunction with titanium dioxide chromatography revealed that DON significantly upregulated or downregulated phosphorylation of 188 proteins at both known and yet-to-be functionally characterized phosphosites. DON-induced RSR is extremely complex and goes far beyond its prior known capacity to inhibit translation and activate MAPKs. Transcriptional regulation was the main target during early DON-induced RSR, covering over 20% of the altered phosphoproteins as indicated by Gene Ontology annotation and including transcription factors/cofactors and epigenetic modulators. Other biological processes impacted included cell cycle, RNA processing, translation, ribosome biogenesis, monocyte differentiation and cytoskeleton organization. Some of these processes could be mediated by signaling networks involving MAPK-, NFκB-, AKT- and AMPK-linked pathways. Fuzzy c-means clustering revealed that DON-regulated phosphosites could be discretely classified with regard to the kinetics of phosphorylation/dephosphorylation. The cellular response networks identified provide a template for further exploration of the mechanisms of trichothecenemycotoxins and other ribotoxins, and ultimately, could contribute to improved mechanism-based human health risk assessment. - Highlights: ► Mycotoxin deoxynivalenol (DON) induces immunotoxicity via ribotoxic stress response. ► SILAC phosphoproteomics using

  16. Zinc protects HepG2 cells against the oxidative damage and DNA damage induced by ochratoxin A

    SciTech Connect

    Zheng, Juanjuan; Zhang, Yu; Xu, Wentao; Luo, YunBo; Hao, Junran; Shen, Xiao Li; Yang, Xuan; Li, Xiaohong; Huang, Kunlun

    2013-04-15

    Oxidative stress and DNA damage are the most studied mechanisms by which ochratoxin A (OTA) induces its toxic effects, which include nephrotoxicity, hepatotoxicity, immunotoxicity and genotoxicity. Zinc, which is an essential trace element, is considered a potential antioxidant. The aim of this paper was to investigate whether zinc supplement could inhibit OTA-induced oxidative damage and DNA damage in HepG2 cells and the mechanism of inhibition. The results indicated that that exposure of OTA decreased the intracellular zinc concentration; zinc supplement significantly reduced the OTA-induced production of reactive oxygen species (ROS) and decrease in superoxide dismutase (SOD) activity but did not affect the OTA-induced decrease in the mitochondrial membrane potential (Δψ{sub m}). Meanwhile, the addition of the zinc chelator N,N,N′,N′-tetrakis(2-pyridylmethyl)ethylenediamine (TPEN) strongly aggravated the OTA-induced oxidative damage. This study also demonstrated that zinc helped to maintain the integrity of DNA through the reduction of OTA-induced DNA strand breaks, 8-hydroxy-2′-deoxyguanosine (8-OHdG) formation and DNA hypomethylation. OTA increased the mRNA expression of metallothionein1-A (MT1A), metallothionein2-A (MT2A) and Cu/Zn superoxide dismutase (SOD1). Zinc supplement further enhanced the mRNA expression of MT1A and MT2A, but it had no effect on the mRNA expression of SOD1 and catalase (CAT). Zinc was for the first time proven to reduce the cytotoxicity of OTA through inhibiting the oxidative damage and DNA damage, and regulating the expression of zinc-associated genes. Thus, the addition of zinc can potentially be used to reduce the OTA toxicity of contaminated feeds. - Highlights: ► OTA decreased the intracellular zinc concentration. ► OTA induced the formation of 8-OHdG in HepG2 cells. ► It was testified for the first time that OTA induced DNA hypomethylation. ► Zinc protects against the oxidative damage and DNA damage induced by

  17. Deltamethrin-induced oxidative stress and mitochondrial caspase-dependent signaling pathways in murine splenocytes.

    PubMed

    Kumar, Anoop; Sasmal, D; Bhaskar, Amand; Mukhopadhyay, Kunal; Thakur, Aman; Sharma, Neelima

    2016-07-01

    Deltamethrin (DLM) is a well-known pyrethroid insecticide used extensively in pest control. Exposure to DLM has been demonstrated to cause apoptosis in various cells. However, the immunotoxic effects of DLM on mammalian system and its mechanism is still an open question to be explored. To explore these effects, this study has been designed to first observe the interactions of DLM to immune cell receptors and its effects on the immune system. The docking score revealed that DLM has strong binding affinity toward the CD45 and CD28 receptors. In vitro study revealed that DLM induces apoptosis in murine splenocytes in a concentration-dependent manner. The earliest markers of apoptosis such as enhanced reactive oxygen species and caspase 3 activation are evident as early as 1 h by 25 and 50 µM DLM. Western blot analysis demonstrated that p38 MAP kinase and Bax expression is increased in a concentration-dependent manner, whereas Bcl 2 expression is significantly reduced after 3 h of DLM treatment. Glutathione depletion has been also observed at 3 and 6 h by 25 and 50 µM concentration of DLM. Flow cytometry results imply that the fraction of hypodiploid cells has gradually increased with all the concentrations of DLM at 18 h. N-acetyl cysteine effectively reduces the percentage of apoptotic cells, which is increased by DLM. In contrast, buthionine sulfoxamine causes an elevation in the percentage of apoptotic cells. Phenotyping data imply the effect of DLM toxicity in murine splenocytes. In brief, the study demonstrates that DLM causes apoptosis through its interaction with CD45 and CD28 receptors, leading to oxidative stress and activation of the mitochondrial caspase-dependent pathways which ultimately affects the immune functions. This study provides mechanistic information by which DLM causes toxicity in murine splenocytes. © 2014 Wiley Periodicals, Inc. Environ Toxicol 31: 808-819, 2016.

  18. Oxidative damage of hepatopancreas induced by pollution depresses humoral immunity response in the freshwater crayfish Procambarus clarkii.

    PubMed

    Wei, Keqiang; Yang, Junxian

    2015-04-01

    Previous studies provide evidences for the possible oxidative damage of toxic environmental pollutants to tissue protein in fish and amphibian, but little information is available about their effects on immunity response in crustacean. In the present study, we evaluated the relationship between oxidative damage and immune response induced by both typical pollutants (viz. copper and beta-cypermethrin), by exposing the freshwater Procambarus clarkii to sub-lethal concentrations (1/40, 1/20, 1/10 and 1/5 of the 96 h LC50) up to 96 h. Five biomarkers of oxidative stress, i.e. reactive oxygen species (ROS), superoxide dismutase (SOD), catalase (CAT), malondialdehyde (MDA) and protein carbonyl in hepatopancreas, and two immune factors, i.e. phenoloxidase (PO) and hemocyanin in haemolymph were determined. The results indicated that there was a significant increase (P < 0.05) in the contents of ROS, MDA and protein carbonyl accompanied by markedly decreased (P < 0.05) PO and hemocyanin levels in a dose and time dependent manner. The significant and positive correlation (P < 0.01) between protein carbonyls induction and MDA formation was observed in crayfish hepatopancreas at 96 h. The production of these protein carbonyls could significantly depress (P < 0.01) the levels of phenoloxidase and hemocyanin in hemolymph. Higher contents of ROS enhanced the risk of lipid peroxidation, protein carbonylation and immunosuppression of crayfish, and hepatopancreas might play an important role in immune system of crustaceans. Protein oxidation may be one of the main mechanisms for pollution-induced immunotoxicity in P. clarkii.

  19. Effects of T-2 toxin on turkey herpesvirus–induced vaccinal immunity against Marek’s disease

    Technology Transfer Automated Retrieval System (TEKTRAN)

    T-2 toxin, a very potent immunotoxic Type A trichothecene, is a secondary metabolite produced primarily by Fusarium spp., which grows on cereal grains and can lead to contaminated livestock feed. Repeated exposure to T-2 toxin has been shown to cause immunosuppression and decrease the resistance of ...

  20. CYP1A2 IS NOT REQUIRED FOR 2, 3, 7, 8-TETRACHLORODIBENZO-P-DIOXIN-INDUCED IMMUNOSUPPRESSION

    EPA Science Inventory

    ABSTRACT
    One of the most sensitive and reproducible immunotoxic endpoints of 2,3,7,8-tetrachloro-dibenzo-p-dioxin (TCDD) exposure is suppression of the antibody response to sheep red blood cells (SRBCs) in mice. Immunosuppression occurs in concert with hepatomegaly and associ...

  1. Inducing labor

    MedlinePlus

    ... inducing labor is to "break the bag of waters" or rupture the membranes. Your health care provider will do a pelvic exam and will guide a small plastic probe with a hook on the end through your cervix to create a hole in the membrane. This does not hurt you ...

  2. In Utero exposure to genistein enhanced intranasal house dust mite allergen-induced respiratory sensitization in young adult B6C3F1 mice.

    PubMed

    Guo, Tai L; Meng, Andrew H

    2016-06-24

    Despite many hypothesized benefits of dietary isoflavone genistein (GEN) deriving from soy-based products, questions surrounding GEN's developmental immunotoxic effects are increasing. To understand how in utero GEN exposure may modulate postnatal respiratory sensitization, we conducted a time course study using a common household allergen (house dust mites: HDM; 10μg/mouse) following intranasal instillation, a physiological route of allergen exposure. GEN was administered to dams by gavage from gestational day 14 to parturition at a physiologically relevant dose (20mg/kg bw). Female and male offspring were sensitized with HDM allergens beginning about one month prior to sacrifice followed by challenges with three weekly doses of HDM extracts, and they were euthanized at day 3 following the final HDM exposure at four different time points (postnatal day (PND) 80, 120, 160, and 200). In utero GEN combined with postnatal HDM exposures (GEN+HDM) increased total IgE production in both young female and male B6C3F1 offspring (e.g., PND 80 in females and PND 120 in males). Increased antigen-specific IgG1, IgG2a and IgG2b levels were also observed at various time points in both female and male offspring. In addition, increases in macrophage number in bronchoalveolar lavage fluid of both female and male GEN+HDM offspring at PND 80 and PND 120, respectively, were observed when compared to the vehicle group. For T cells, an increase over the vehicle in female GEN+HDM offspring was observed at PND 80. Due to similar patterns of increases, it seems likely that GEN+HDM-induced increases in total IgE and macrophages are related. Overall, in utero GEN plus later-life HDM exposures exert increases in total IgE and HDM-specific IgG production as well as macrophage recruitments to the lung in young adult mice.

  3. Tributyltin potentiates 3,3{prime},4,4{prime},5-pentachlorobiphenyl-induced cytochrome P-4501A-related activity

    SciTech Connect

    DeLong, G.T.; Rice, C.D.

    1997-10-01

    Induction of cytochrome P-4501A protein and induction of related enzyme activity are hallmark physiological responses following exposure to planar halogenated aromatic hydrocarbons (HAHs) such as 3,3{prime},4,4{prime},5-pentachlorobiphenyl (PCB 126; PeCB). Environments contaminated by HAHs are often contaminated by mixtures of anthropogenic contaminants, including organometallic compounds. Both HAHs and organometallics easily bioconcentrate in aquatic food chains that may be linked to humans through seafood consumption. Tributyltin (TBT), a marine biocide, has been detected in many aquatic environments. Exposure to TBT, as well as several PCBs, has been associated with immunotoxicity, neurotoxicity, and endocrine disruption. Recently TBT has been shown to inhibit cytochrome P-4501A activity in vitro. Female mice were exposed to 0.07, 0.1, and 1.0 mg/kg PeCB, TBT or both. P-4501A levels and BaP-OHase activity were significantly elevated in mice exposed to PeCB alone. This effect was enhanced by coexposure to low levels of TBT; PeCB-induced P-4501A-related activity was potentiated at the low range of each. The highest dose of TBT, however, inhibited these activities when given in combination with PeCB. Thymic atrophy was evident only in mice exposed daily to 0.1 and 1.0 mg/kg PeCB alone, or to a combination of the lowest and highest dose of PeCB and TBT, respectively. Because environmental levels of. TBT are not expected to be as high as the highest level used in our toxicological studies, we conclude that environmental exposure to TBT may potentiate, rather than inhibit, the activity of environmental levels of HAHs that are associated with P-4501A induction. 31 refs., 8 figs.

  4. Exercise-Induced Bronchoconstriction

    MedlinePlus

    ... Conditions & Treatments ▸ Conditions Dictionary ▸ Exercise-Induced Bronchoconstriction Share | Exercise-Induced Bronchoconstriction (EIB) « Back to A to Z Listing Exercise-Induced Bronchoconstriction, (EIB), often known as exercise-induced ...

  5. NKT cell modulates NAFLD potentiation of metabolic oxidative stress-induced mesangial cell activation and proximal tubular toxicity

    PubMed Central

    Alhasson, Firas; Dattaroy, Diptadip; Das, Suvarthi; Chandrashekaran, Varun; Seth, Ratanesh Kumar; Schnellmann, Rick G.

    2015-01-01

    Obesity and nonalcoholic fatty liver disease (NAFLD) are associated with the development and progression of chronic kidney disease. We recently showed that NAFLD induces liver-specific cytochrome P-450 (CYP)2E1-mediated metabolic oxidative stress after administration of the CYP2E1 substrate bromodichloromethane (BDCM) (Seth RK, Das S, Kumar A, Chanda A, Kadiiska MB, Michelotti G, Manautou J, Diehl AM, Chatterjee S. Toxicol Appl Pharmacol 274: 42–54, 2014; Seth RK, Kumar A, Das S, Kadiiska MB, Michelotti G, Diehl AM, Chatterjee S. Toxicol Sci 134:291–303, 2013). The present study examined the effects of CYP2E1-mediated oxidative stress in NAFLD leading to kidney toxicity. Mice were fed a high-fat diet for 12 wk to induce NAFLD. NAFLD mice were exposed to BDCM, a CYP2E1 substrate, for 4 wk. NAFLD + BDCM increased CYP2E1-mediated lipid peroxidation in proximal tubular cells compared with mice with NAFLD alone or BDCM-treated lean mice, thus ruling out the exclusive role of BDCM. Lipid peroxidation increased IL-1β, TNF-α, and interferon-γ. In parallel, mesangial cell activation was observed by increased α-smooth muscle actin and transforming growth factor-β, which was blocked by the CYP2E1 inhibitor diallyl sulphide both in vivo and in vitro. Mice lacking natural killer T cells (CD1d knockout mice) showed elevated (>4-fold) proinflammatory mediator release, increased Toll-like receptor (TLR)4 and PDGF2 mRNA, and mesangial cell activation in the kidney. Finally, NAFLD CD1D knockout mice treated with BDCM exhibited increased high mobility group box 1 and Fas ligand levels and TUNEL-positive nuclei, indicating that higher cell death was attenuated in TLR4 knockout mice. Tubular cells showed increased cell death and cytokine release when incubated with activated mesangial cells. In summary, an underlying condition of progressive NAFLD causes renal immunotoxicity and aberrant glomerular function possibly through high mobility group box 1-dependent TLR4 signaling

  6. Weather and plant age affect the levels of steroidal saponin and Pithomyces chartarum spores in Brachiaria grass

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Brachiaria species are cultivated worldwide in tropical and subtropical climates as the main forage source for ruminants. Numerous tropical and warm-season grasses cause hepatogenous photosensitization, among them several species of Brachiaria. Steroidal saponins present in these plants may be respo...

  7. Exercise-Induced Asthma

    MedlinePlus

    ... Old Feeding Your 1- to 2-Year-Old Exercise-Induced Asthma KidsHealth > For Parents > Exercise-Induced Asthma ... they choose. previous continue Tips for Kids With Exercise-Induced Asthma For the most part, kids with ...

  8. Isocyanates induces DNA damage, apoptosis, oxidative stress, and inflammation in cultured human lymphocytes.

    PubMed

    Mishra, Pradyumna Kumar; Panwar, Hariom; Bhargava, Arpit; Gorantla, Venkata Raghuram; Jain, Subodh Kumar; Banerjee, Smita; Maudar, Kewal Krishan

    2008-01-01

    Isocyanates, a group of low molecular weight aromatic and aliphatic compounds containing the isocyanate group (-NCO), are important raw materials with diverse industrial applications; however, pathophysiological implications resulting from occupational and accidental exposures of these compounds are hitherto unknown. Although preliminary evidence available in the literature suggests that isocyanates and their derivatives may have deleterious health effects including immunotoxicity, but molecular mechanisms underlying such an effect have never been addressed. The present study was carried out to assess the immunotoxic response of methyl isocyanate (MIC) on cultured human lymphocytes isolated from healthy human volunteers. Studies were conducted to evaluate both dose-dependent and time-course response (n = 3), using N-succinimidyl N-methylcarbamate, a surrogate chemical substitute to MIC. Evaluation of DNA damage by ataxia telangiectasia mutated (ATM) and gamma H2AX protein phosphorylation states; measure of apoptotic index through annexin-V/PI assay, apoptotic DNA ladder assay, and mitochondrial depolarization; induction of oxidative stress by CM-H2DCFDA and formation of 8-hydroxy-2' deoxy guanosine; levels of antioxidant defense system enzyme glutathione reductase; and multiplex cytometric bead array analysis to quantify the secreted levels of inflammatory cytokines, interleukin-8, interleukin-1beta, interleukin-6, interleukin-10, tumor necrosis factor, and interleukin-12p70 parameters were carried out. The results of the study showed a dose- and time-dependent response, providing evidence to hitherto unknown molecular mechanisms of immunotoxic consequences of isocyanate exposure at a genomic level. We anticipate these data along with other studies reported in the literature would help to design better approaches in risk assessment of occupational and accidental exposure to isocyanates.

  9. Avermectin induced autophagy in pigeon spleen tissues.

    PubMed

    Liu, Ci; Zhao, Yanbing; Chen, Lijie; Zhang, Ziwei; Li, Ming; Li, Shu

    2015-12-05

    The level of autophagy is considered as an indicator for monitoring the toxic impact of pesticide exposure. Avermectin (AVM), a widely used insecticide, has immunotoxic effects on the pigeon spleen. The aim of this study was to investigate the status of autophagy and the expression levels of microtubule-associated protein1 light chain 3 (LC3), beclin-1, dynein, autophagy associated gene (Atg) 4B, Atg5, target of rapamycin complex 1 (TORC1) and target of rapamycin complex 2 (TORC2) in AVM-treated pigeon spleens. Eighty two-month-old pigeons were randomly divided into four groups: a control group, a low-dose group, a medium-dose group and a high-dose group, which were fed a basal diet spiked with 0, 20, 40 and 60 mg AVM/kg diet, respectively. Microscopic cellular morphology revealed a significant increase in autophagic structures in the AVM-treated groups. The expression of LC3, beclin-1, dynein, Atg4B and Atg5 increased, while mRNA levels of TORC1 and TORC2 were decreased in the AVM-treated groups relative to the control groups at 30, 60 and 90 days in the pigeon spleen. These results indicated that AVM exposure could up-regulate the level of autophagy in a dose-time-dependent manner in the pigeon spleen.

  10. Cavitation-resistant inducer

    DOEpatents

    Dunn, Charlton; Subbaraman, Maria R.

    1989-01-01

    An improvement in an inducer for a pump wherein the inducer includes a hub, a plurality of radially extending substantially helical blades and a wall member extending about and encompassing an outer periphery of the blades. The improvement comprises forming adjacent pairs of blades and the hub to provide a substantially rectangular cross-sectional flow area which cross-sectional flow area decreases from the inlet end of the inducer to a discharge end of the inducer, resulting in increased inducer efficiency improved suction performance, reduced susceptibility to cavitation, reduced susceptibility to hub separation and reduced fabrication costs.

  11. Cavitation-resistant inducer

    DOEpatents

    Dunn, C.; Subbaraman, M.R.

    1989-06-13

    An improvement in an inducer for a pump is disclosed wherein the inducer includes a hub, a plurality of radially extending substantially helical blades and a wall member extending about and encompassing an outer periphery of the blades. The improvement comprises forming adjacent pairs of blades and the hub to provide a substantially rectangular cross-sectional flow area which cross-sectional flow area decreases from the inlet end of the inducer to a discharge end of the inducer, resulting in increased inducer efficiency improved suction performance, reduced susceptibility to cavitation, reduced susceptibility to hub separation and reduced fabrication costs. 11 figs.

  12. Development of a squamous cell carcinoma mouse model for immunotoxicity testing.

    PubMed

    Sominski, Devon D; Rafferty, Patricia; Brosnan, Kerry; Volk, Amy; Walker, Mindi; Capaldi, Dorie; Emmell, Eva; Johnson, Kjell; Weinstock, Daniel

    2016-01-01

    An important component of safety assessment of new pharmaceuticals is evaluation of their potential to increase the risk of developing cancer in humans. The traditional 2-year rodent bioassay often is not feasible or scientifically applicable for evaluation of biotherapeutics. Additionally, it has poor predictive value for non-genotoxic immunosuppressive compounds. Thus, there is a need for alternative testing strategies. A novel 3-stage tumor model in syngeneic C3H/HeN mice was evaluated here to study the effects of immunosuppressive drugs on tumor promotion and progression in vivo. The model employed a skin squamous cell carcinoma cell line (SCC VII) due to the increased prevalence of squamous cell carcinoma (SCC) in humans associated with immunosuppression after transplants. Local invasion, colonization and tumor progression were evaluated. The validation set of immunosuppressive drugs included: Cyclosporin (CSA), cyclophosphamide (CTX), azathioprine, etanercept, abatacept and prednisone. Local invasion was evaluated by histological assessment as well as fluorescence trafficking from Qdot(®)-labeled tumor cells from the site of inoculation to the draining lymph node. Colonization was evaluated by lung colony counts following intravenous inoculation. Tumor progression was assessed by morphometric analysis of lesion area, angiogenesis and growth fraction of established metastatic neoplasia. Immunosuppressive drugs in the validation set yielded mixed results, including decreased progression. The methods and results described herein using an in vivo syngeneic mouse tumor model can provide insight about the assessment of immunosuppressive drugs in carcinogenicity risk assessment.

  13. From immunotoxicity to nanotherapy: the effects of nanomaterials on the immune system.

    PubMed

    Smith, Matthew J; Brown, Jared M; Zamboni, William C; Walker, Nigel J

    2014-04-01

    The potential for human exposure to the diverse and ever-changing world of nanoscale materials has raised concerns about their influence on health and disease. The novel physical and chemical properties of these materials, which are associated with their small size, complicate toxicological evaluations. Further, these properties may make engineered nanomaterials (ENMs) a prime target for interaction with the immune system following uptake by phagocytes. Undesired effects on antigen-presenting cells and other phagocytic cells are of concern due to the high likelihood of ENM uptake by these cells. In addition, ENM interactions with lymphocytes and other cell types can contribute to a varied spectrum of possible effects, including inflammation, hypersensitivity, and immunomodulation. Furthermore, the mast cell (a type of immune cell traditionally associated with allergy) appears to contribute to certain inflammatory and toxic effects associated with some ENMs. Although incidental exposure may be undesirable, nanomedicines engineered for various clinical applications provide opportunities to develop therapies that may or may not intentionally target the immune system. The interaction between ENMs and the immune system and the resulting pharmacokinetic and phenotypic responses are critical factors that dictate the balance between toxicity and clinical efficacy of nanotherapeutics.

  14. Approaches and Considerations for the Assessment of Immunotoxicity for Environmental Chemicals: A Workshop Summary

    EPA Science Inventory

    As additional experience is gained with current toxicology testing approaches and as new assays and technologies are developed, it is critical for all stakeholders to engage in active dialog about potential opportunities to advance our overall testing strategies. To facilitate t...

  15. Ecological impacts of the Deepwater Horizon oil spill: implications for immunotoxicity

    EPA Science Inventory

    Summary of major Federal and multi-stake holder research efforts in response to the DWH spill, including laboratory oil dispersant testing, estimation of oil release rates and oil fate calculations, subsea monitoring, and post-spill assessments. Impacts from shoreline oiling, wil...

  16. INTRODUCTION: INHALATION EXPOSURE AND SYSTEMIC IMMUNOTOXICITY: MECHANISMS LINKING THE LUNG AND IMMUNE SYSTEM

    EPA Science Inventory


    Concerns regarding inhaled compounds, immune suppression and increased risk of disease have focused primarily on suppression of local immune responses in the lung and susceptibility to respiratory infections. However, a number of studies have shown that both gaseous (O3, NO2)...

  17. Evaluation of the potential immunotoxicity of bromodichloromethane in rats and mice.

    PubMed

    French, A S; Copeland, C B; Andrews, D; Wiliams, W C; Riddle, M M; Luebke, R W

    1999-03-12

    In the past two decades, concern has been expressed over the potential carcinogenicity of disinfection by-products (DBPs) found in chlorinated drinking water. More recently, research efforts have expanded to include noncancer endpoints as well. The objective of the present studies was to evaluate the potential of bromodichloromethane (BDCM), one of the most prevalent DBPs, to adversely affect immune function in mice and rats following drinking water or gavage exposure. Antigen-specific immunity was assessed as the antibody response to sheep erythrocytes; responses to T- and B-cell mitogens were evaluated as a non-antigen-specific measure of the proliferative potential of splenic and mesenteric lymph node lymphocytes. In consideration of an exposure route relevant to humans, C57BL/6 mice received 0.05, 0.25, or 0.5 g BDCM/L and F344 rats received 0.07 or 0.7 g BDCM/L via drinking water. In order to evaluate the effects of higher doses, animals were administered 50, 125, or 250 mg BDCM/kg/d (mice) or 75, 150, or 300 mg BDCM/kg/d (rats) via gavage. Under the conditions of these studies, no significant adverse effects on immune function were observed in mice. Despite some changes that were observed in non-antigen-specific immunity in rats, these experiments suggest that the immune system is not a sensitive target organ for BDCM toxicity.

  18. THE COMPARATIVE IMMUNOTOXICITY OF FIVE SELCTED COMPOUNDS FOLLOWING DEVELOPMENTAL OR ADULT EXPOSURE

    EPA Science Inventory

    It is well established that human diseases associated with abnormal immune function, including some common infectious diseases and asthma, are considerably more prevalent at younger ages. Although not established absolutely, it is generally believed that development constitutes ...

  19. COMPARING IMMUNOTOXICITY IN RATS AFTER IN UTERO VERSUS AN ADULT EXPOSURE: IS DEVELOPMENTAL EXPOSURE MORE SENSITIVE?

    EPA Science Inventory

    Using a known immunosuppresant, dexamethasone (DEX), pregnant Sprague Dawley (SD) rats were given subcutaneous (s.c.) injections of DEX (0.0, 0.0375, 0.075, 0.15, 0.3 mg/kg) during gestation days 6 to 21. Both male and female offspring were tested for immune dysfunction. In a ...

  20. The effect of diesel (DE) exposure in utero on reproductive and developmental immunotoxicity

    EPA Science Inventory

    Epidemiology studies are beginning to show that in utero exposure to traffic related pollutants might increase the incidence of immune mediated lung diseases. Time pregnant BALB/c mice were exposed to air or two concentrations of diesel exhaust (0.5 and 2 mg/m3...

  1. Carcinogenicity and Immunotoxicity of Embedded Depleted Uranium and Heavy-Metal Tungsten Alloy in Rodents

    DTIC Science & Technology

    2006-10-01

    tungsten compounds have only lim- ited toxicity (Leggett 1997). For example, tungsten coils implanted into the subclavian artery of rabbits rapidly... pulmonary metastases. Apparent is the multifocal, vascu- lar orientation of these neoplasms. There are neoplastic cells surrounding the arterioles and...Environmental Health Perspectives Figure 4. Lung metastases from WA-implanted F344 rats. (A) Gross appearance of pulmonary metastases from WA-implanted rat

  2. Carcinogenicity and Immunotoxicity of Embedded Depleted Uranium and Heavy-Metal Tungsten Alloy in Rodents

    DTIC Science & Technology

    2006-10-01

    and modified National Toxicology Program protocols for such studies. Responses to the test metals were compared to responses to tantalum, a...A battery of immunological tests designed to assess both humoral and cell-mediated immunity, as well as the innate immune response, will be...found in Tables 21-26. The organs assessed were spleen, thymus, liver, kidney, and testes . Organ weights are provided in the tables, although

  3. DEVELOPMENTAL EXPOSURE TO DI-N-BUTYLTIN DICHLORIDE (DBTC): IMMUNOTOXIC AND NEUROTOXIC EVALUATION

    EPA Science Inventory

    Organotins are incorporated as stabilizers in PVC water supply pipe. Particularly when new, mono- and di-substituted methyl- and butyltins leach from the pipe and are thus of regulatory concern to EPA. These contaminants have adverse effects on both the immune and nervous systems...

  4. The impact of nanoparticle protein corona on cytotoxicity, immunotoxicity and target drug delivery

    PubMed Central

    Corbo, Claudia; Molinaro, Roberto; Parodi, Alessandro; Toledano Furman, Naama E; Salvatore, Francesco; Tasciotti, Ennio

    2016-01-01

    In a perfect sequence of events, nanoparticles (NPs) are injected into the bloodstream where they circulate until they reach the target tissue. The ligand on the NP surface recognizes its specific receptor expressed on the target tissue and the drug is released in a controlled manner. However, once injected in a physiological environment, NPs interact with biological components and are surrounded by a protein corona (PC). This can trigger an immune response and affect NP toxicity and targeting capabilities. In this review, we provide a survey of recent findings on the NP–PC interactions and discuss how the PC can be used to modulate both cytotoxicity and the immune response as well as to improve the efficacy of targeted delivery of nanocarriers. PMID:26653875

  5. Immunotoxicity of commercial-mixed glyphosate in broad snouted caiman (Caiman latirostris).

    PubMed

    Siroski, Pablo A; Poletta, Gisela L; Latorre, María A; Merchant, Mark E; Ortega, Hugo H; Mudry, Marta D

    2016-01-25

    The expansion and intensification of agriculture during the past 50 years is unprecedented, and thus environmental problems have been triggered at different scales. These transformations have caused the loss of habitat and biodiversity, and disruption of the structure and functioning of ecosystems. As a result of the expansion of the agricultural frontier in the recent past, many areas of the natural geographic distribution of the local wildlife, among them crocodilians and particularly the broad snouted caiman (Caiman latirostris), are being exposed to contaminants. The present study was designed to evaluate the effect of commercially-mixed glyphosate (RU) on some parameters of the immune system of C. latirostris. Two groups of caimans were exposed for two months to different concentrations of RU recommended for its application in the field, while one group was maintained as an unexposed control. The RU concentration was progressively decreased through the exposure period to simulate glyphosate degradation in water. After exposure, total and differential white blood cell (WBC), and complement system activity (CS) were determined. In addition, the animals were injected with a solution of lipopolysaccharide (LPS) from Escherichia coli to trigger an immune response and evaluate the parameters associated with it. The results showed that an effect of the herbicide on CS was observed, as animals exposed to RU showed a lower CS activity than animals from the negative control (NC) but not in total WBC. In the case of leukocyte population counts, differences were only found for heterophils and lymphocytes.

  6. Exploratory behavior and recognition memory in medial septal electrolytic, neuro- and immunotoxic lesioned rats.

    PubMed

    Dashniani, M G; Burjanadze, M A; Naneishvili, T L; Chkhikvishvili, N C; Beselia, G V; Kruashvili, L B; Pochkhidze, N O; Chighladze, M R

    2015-01-01

    In the present study, the effect of the medial septal (MS) lesions on exploratory activity in the open field and the spatial and object recognition memory has been investigated. This experiment compares three types of MS lesions: electrolytic lesions that destroy cells and fibers of passage, neurotoxic - ibotenic acid lesions that spare fibers of passage but predominantly affect the septal noncholinergic neurons, and immunotoxin - 192 IgG-saporin infusions that only eliminate cholinergic neurons. The main results are: the MS electrolytic lesioned rats were impaired in habituating to the environment in the repeated spatial environment, but rats with immuno- or neurotoxic lesions of the MS did not differ from control ones; the MS electrolytic and ibotenic acid lesioned rats showed an increase in their exploratory activity to the objects and were impaired in habituating to the objects in the repeated spatial environment; rats with immunolesions of the MS did not differ from control rats; electrolytic lesions of the MS disrupt spatial recognition memory; rats with immuno- or neurotoxic lesions of the MS were normal in detecting spatial novelty; all of the MS-lesioned and control rats clearly reacted to the object novelty by exploring the new object more than familiar ones. Results observed across lesion techniques indicate that: (i) the deficits after nonselective damage of MS are limited to a subset of cognitive processes dependent on the hippocampus, (ii) MS is substantial for spatial, but not for object recognition memory - the object recognition memory can be supported outside the septohippocampal system; (iii) the selective loss of septohippocampal cholinergic or noncholinergic projections does not disrupt the function of the hippocampus to a sufficient extent to impair spatial recognition memory; (iv) there is dissociation between the two major components (cholinergic and noncholinergic) of the septohippocampal pathway in exploratory behavior assessed in the open field - the memory exhibited by decrements in exploration of repeated object presentations is affected by either electrolytic or ibotenic lesions, but not saporin.

  7. IMMUNOTOXICITY IN CHANNEL CATFISH, ICTALURUS PUNCTATUS, FOLLOWING ACUTE EXPOSURE TO TRIBUTYLTIN. (R823881)

    EPA Science Inventory

    The perspectives, information and conclusions conveyed in research project abstracts, progress reports, final reports, journal abstracts and journal publications convey the viewpoints of the principal investigator and may not represent the views and policies of ORD and EPA. Concl...

  8. Association between chronic organochlorine exposure and immunotoxicity in the round stingray (Urobatis halleri).

    PubMed

    Sawyna, Jillian M; Spivia, Weston R; Radecki, Kelly; Fraser, Deborah A; Lowe, Christopher G

    2017-04-01

    Chronic organochlorine (OC) exposure has been shown to cause immune impairment in numerous vertebrate species. To determine if elasmobranchs exhibited compromised immunity due to high OC contamination along the coastal mainland of southern California, innate immune function was compared in round stingrays (Urobatis halleri) collected from the mainland and Santa Catalina Island. Proliferation and phagocytosis of peripheral blood, splenic, and epigonal leukocytes were assessed. Percent phagocytosis and mean fluorescence intensity (MFI) were evaluated by quantifying % leukocytes positive for, and relative amounts of ingested fluorescent E. coli BioParticles. Total cell proliferation differed between sites, with mainland rays having a higher cell concentration in whole blood. ∑PCB load explained significantly higher % phagocytosis in blood of mainland rays, while ∑PCB and ∑pesticide loads described increased splenic % phagocytosis and MFI in the mainland population. Data provides evidence of strong OC-correlated immunostimulation; however, other site-specific environmental variables may be contributing to the observed effects.

  9. The impact of nanoparticle protein corona on cytotoxicity, immunotoxicity and target drug delivery.

    PubMed

    Corbo, Claudia; Molinaro, Roberto; Parodi, Alessandro; Toledano Furman, Naama E; Salvatore, Francesco; Tasciotti, Ennio

    2016-01-01

    In a perfect sequence of events, nanoparticles (NPs) are injected into the bloodstream where they circulate until they reach the target tissue. The ligand on the NP surface recognizes its specific receptor expressed on the target tissue and the drug is released in a controlled manner. However, once injected in a physiological environment, NPs interact with biological components and are surrounded by a protein corona (PC). This can trigger an immune response and affect NP toxicity and targeting capabilities. In this review, we provide a survey of recent findings on the NP-PC interactions and discuss how the PC can be used to modulate both cytotoxicity and the immune response as well as to improve the efficacy of targeted delivery of nanocarriers.

  10. Effect of the protein corona on nanoparticles for modulating cytotoxicity and immunotoxicity

    PubMed Central

    Lee, Yeon Kyung; Choi, Eun-Ju; Webster, Thomas J; Kim, Sang-Hyun; Khang, Dongwoo

    2015-01-01

    Although the cytotoxicity of nanoparticles (NPs) is greatly influenced by their interactions with blood proteins, toxic effects resulting from blood interactions are often ignored in the development and use of nanostructured biomaterials for in vivo applications. Protein coronas created during the initial reaction with NPs can determine the subsequent immunological cascade, and protein coronas formed on NPs can either stimulate or mitigate the immune response. Along these lines, the understanding of NP-protein corona formation in terms of physiochemical surface properties of the NPs and NP interactions with the immune system components in blood is an essential step for evaluating NP toxicity for in vivo therapeutics. This article reviews the most recent developments in NP-based protein coronas through the modification of NP surface properties and discusses the associated immune responses. PMID:25565807

  11. THE DEVELOPMENTAL IMMUNOTOXICITY OF DIBUTYLTIN DICHLORIDE IN SPRAGUE-DAWLEY RATS

    EPA Science Inventory

    Methyl- and butyltin compounds used as stabilizers in polyvinyl chloride (PVC) pipe production are of concern as they leach from supply pipes into drinking water and have been associated with multisystem toxicity. This study assessed immune function in Sprague-Dawley (CD) rats d...

  12. A COMPARISON OF MULTIPLE TOXICITIES FOLLOWING DEVELOPMENTAL EXPOSURE TO PESTICIDES: NEUROTOXICITY, IMMUNOTOXICITY, AND REPRODUCTIVE TOXICITY.

    EPA Science Inventory

    The NAS report (Pesticides in the Diets of Infants and Children, 1993) called for significant research effort into the long-term effects of perinatal pesticide exposure on the nervous, immune, and reproductive systems. In response, the US EPA and NIEHS collaborated on a series o...

  13. Flumazenil-induced ballism.

    PubMed

    Kim, Joong-Seok; Ko, Seok-Bum; Choi, Yeong-Bin; Lee, Kwang-Soo

    2003-04-01

    Flumazenil, an imidazobenzodiazepine, is the first benzodiazepine antagonist and is being used to reverse the adverse pharmacological effects of benzodiazepine. There have been a few reports on the central nevous system side effects with its use. We report a patient with generalized ballism following administration of flumazenil. The mechanism through which flumazenil induced this symptom is unknown. It is conceivable that flumazenil may antagonize the GABA-benzodiazepine receptor complex and induce dopamine hypersensitivity, thus induce dyskinesic symptoms.

  14. Flumazenil-induced ballism.

    PubMed Central

    Kim, Joong-Seok; Ko, Seok-Bum; Choi, Yeong-Bin; Lee, Kwang-Soo

    2003-01-01

    Flumazenil, an imidazobenzodiazepine, is the first benzodiazepine antagonist and is being used to reverse the adverse pharmacological effects of benzodiazepine. There have been a few reports on the central nevous system side effects with its use. We report a patient with generalized ballism following administration of flumazenil. The mechanism through which flumazenil induced this symptom is unknown. It is conceivable that flumazenil may antagonize the GABA-benzodiazepine receptor complex and induce dopamine hypersensitivity, thus induce dyskinesic symptoms. PMID:12692435

  15. Drug-induced nephropathies.

    PubMed

    Paueksakon, Paisit; Fogo, Agnes B

    2017-01-01

    Drugs are associated frequently with the development of various types of acute and chronic kidney diseases. Nephrotoxicity is associated most commonly with injury in the tubulointerstitial compartment manifested as either acute tubular injury or acute interstitial nephritis. A growing number of reports has also highlighted the potential for drug-induced glomerular disease, including direct cellular injury and immune-mediated injury. Recognition of drug-induced nephropathies and rapid discontinuation of the offending agents are critical to maximizing the likelihood of renal function recovery. This review will focus on the pathology and pathogenesis of drug-induced acute interstitial nephritis and drug-induced glomerular diseases.

  16. Teacher-Induced Errors.

    ERIC Educational Resources Information Center

    Richmond, Kent C.

    Students of English as a second language (ESL) often come to the classroom with little or no experience in writing in any language and with inaccurate assumptions about writing. Rather than correct these assumptions, teachers often seem to unwittingly reinforce them, actually inducing errors into their students' work. Teacher-induced errors occur…

  17. Stress-induced flowering

    PubMed Central

    Wada, Kaede C

    2010-01-01

    Many plant species can be induced to flower by responding to stress factors. The short-day plants Pharbitis nil and Perilla frutescens var. crispa flower under long days in response to the stress of poor nutrition or low-intensity light. Grafting experiments using two varieties of P. nil revealed that a transmissible flowering stimulus is involved in stress-induced flowering. The P. nil and P. frutescens plants that were induced to flower by stress reached anthesis, fruited and produced seeds. These seeds germinated, and the progeny of the stressed plants developed normally. Phenylalanine ammonialyase inhibitors inhibited this stress-induced flowering, and the inhibition was overcome by salicylic acid (SA), suggesting that there is an involvement of SA in stress-induced flowering. PnFT2, a P. nil ortholog of the flowering gene FLOWERING LOCUS T (FT) of Arabidopsis thaliana, was expressed when the P. nil plants were induced to flower under poor-nutrition stress conditions, but expression of PnFT1, another ortholog of FT, was not induced, suggesting that PnFT2 is involved in stress-induced flowering. PMID:20505356

  18. Effects of diazinon on the lymphocytic cholinergic system of Nile tilapia fish (Oreochromis niloticus).

    PubMed

    Toledo-Ibarra, G A; Díaz-Resendiz, K J G; Pavón-Romero, L; Rojas-García, A E; Medina-Díaz, I M; Girón-Pérez, M I

    2016-08-01

    Fish rearing under intensive farming conditions can be easily disturbed by pesticides, substances that have immunotoxic properties and may predispose to infections. Organophosphorus pesticides (OPs) are widely used in agricultural activities; however, the mechanism of immunotoxicity of these substances is unclear. The aim of this study was to evaluate the effect of diazinon pesticides (OPs) on the cholinergic system of immune cells as a possible target of OP immunotoxicity. We evaluated ACh levels and cholinergic (nicotinic and muscarinic) receptor concentration. Additionally, AChE activity was evaluated in mononuclear cells of Nile tilapia (Oreochromis niloticus), a freshwater fish mostly cultivated in tropical regions around the world. The obtained results indicate that acute exposure to diazinon induces an increase in ACh concentration and a decrease in nAChR and mAChR concentrations and AChE activity in fish immune cells, This suggests that the non-neuronal lymphocytic cholinergic system may be the main target in the mechanism of OP immunotoxicity. This study contributes to the understanding of the mechanisms of immunotoxicity of pollutants and may help to take actions for animal health improvement.

  19. Space Station Induced Monitoring

    NASA Technical Reports Server (NTRS)

    Spann, James F. (Editor); Torr, Marsha R. (Editor)

    1988-01-01

    This report contains the results of a conference convened May 10-11, 1988, to review plans for monitoring the Space Station induced environment, to recommend primary components of an induced environment monitoring package, and to make recommendations pertaining to suggested modifications of the Space Station External Contamination Control Requirements Document JSC 30426. The contents of this report are divided as Follows: Monitoring Induced Environment - Space Station Work Packages Requirements, Neutral Environment, Photon Emission Environment, Particulate Environment, Surface Deposition/Contamination; and Contamination Control Requirements.

  20. Mania Induced by Opipramol

    PubMed Central

    Firoz, Kazhungil; Khaleel, Asfia; Rajmohan, V; Kumar, Manoj; Raghuram, TM

    2015-01-01

    Antidepressants have propensity to induce manic switch in patients with bipolar disorder. Opipramol is an atypical anxiolytic and antidepressant drug which predominantly acts on sigma receptors. Although structurally resembles tricyclic antidepressant imipramine it does not have inhibitory action on the reuptake of norepinephrine/serotonin and hence it is not presumed to cause manic switch in bipolar depression. Here, we describe a case of mania induced by opipramol, in a patient with bipolar affective disorder who was treated for moderate depressive episode with lithium and opipramol and we discuss neurochemical hypothesis of opipramol-induced mania. PMID:25722522

  1. Drug-induced catatonia.

    PubMed

    Duggal, Harpreet S; Singh, Ira

    2005-09-01

    Catatonia is a heterogeneous syndrome that varies in etiology, presentation, course and sequelae. Initially conceptualized as a subtype of schizophrenia, catatonia is now recognized to occur not only with other psychiatric conditions but also with medical conditions and drug-induced and toxic states. While drug-induced catatonia is now a recognized entity, most studies club it with catatonia due to general medical conditions or organic catatonia, thus precluding any meaningful interpretation of such cases. The literature on drug-induced catatonia mostly draws from scattered case reports. This article attempts to review the available literature in this realm and integrate the information in an attempt to explore the epidemiology, etiology, mechanism and treatment of drug-induced catatonia.

  2. Exercise-induced asthma

    MedlinePlus

    Wheezing - exercise-induced; Reactive airway disease - exercise ... Having asthma symptoms when you exercise does not mean you cannot or should not exercise. But be aware of your EIA triggers. Cold or dry air may ...

  3. Drug-induced hepatitis

    MedlinePlus

    Toxic hepatitis ... to get liver damage. Some drugs can cause hepatitis with small doses, even if the liver breakdown ... liver. Many different drugs can cause drug-induced hepatitis. Painkillers and fever reducers that contain acetaminophen are ...

  4. Vitiligo, drug induced (image)

    MedlinePlus

    ... this person's face have resulted from drug-induced vitiligo. Loss of melanin, the primary skin pigment, occasionally ... is the case with this individual. The typical vitiligo lesion is flat and depigmented, but maintains the ...

  5. Statin induced myotoxicity.

    PubMed

    Sathasivam, Sivakumar

    2012-06-01

    Statins are an effective treatment for the prevention of cardiovascular diseases and used extensively worldwide. However, myotoxicity induced by statins is a common adverse event and a major barrier to maximising cardiovascular risk reduction. The clinical spectrum of statin induced myotoxicity includes asymptomatic rise in creatine kinase concentration, myalgia, myositis and rhabdomyolysis. In certain cases, the cessation of statin therapy does not result in the resolution of muscular symptoms or the normalization of creatine kinase, raising the possibility of necrotizing autoimmune myopathy. There is increasing understanding and recognition of the pathophysiology and risk factors of statin induced myotoxicity. Careful history and physical examination in conjunction with selected investigations such as creatine kinase measurement, electromyography and muscle biopsy in appropriate clinical scenario help diagnose the condition. The management of statin induced myotoxicity involves statin cessation, the use of alternative lipid lowering agents or treatment regimes, and in the case of necrotizing autoimmune myopathy, immunosuppression.

  6. Glucocorticoid-induced osteonecrosis.

    PubMed

    Weinstein, Robert S

    2012-04-01

    Awareness of the need for prevention of glucocorticoid-induced fractures is growing, but glucocorticoid administration is often overlooked as the most common cause of nontraumatic osteonecrosis. Glucocorticoid-induced osteonecrosis develops in 9-40% of patients receiving long-term therapy although it may also occur with short-term exposure to high doses, after intra-articular injection, and without glucocorticoid-induced osteoporosis. The name, osteonecrosis, is misleading because the primary histopathological lesion is osteocyte apoptosis. Apoptotic osteocytes persist because they are anatomically unavailable for phagocytosis and, with glucocorticoid excess, decreased bone remodeling retards their replacement. Glucocorticoid-induced osteocyte apoptosis, a cumulative and unrepairable defect, uniquely disrupts the mechanosensory function of the osteocyte-lacunar-canalicular system and thus starts the inexorable sequence of events leading to collapse of the femoral head. Current evidence indicates that bisphosphonates may rapidly reduce pain, increase ambulation, and delay joint collapse in patients with osteonecrosis.

  7. Ethionamide-induced Pellagra.

    PubMed

    Gupta, Yashashree; Shah, Ira

    2015-08-01

    Pellagra is a disorder characterized by dermatitis, diarrhea, dementia and eventually death, resulting from a deficiency of niacin or its precursor tryptophan. Ethionamide (a second-line antituberculosis agent)-induced pellagra is rarely encountered in clinical practice. Prompt diagnosis and treatment with nicotinamide can prevent life-threatening complications. To date, only three cases have been reported. We report a 13-year-old girl presenting with ethionamide-induced pellagra that resolved after the administration of niacin.

  8. Levodopa-induced myoclonus.

    PubMed

    Klawans, H L; Goetz, C; Bergen, D

    1975-05-01

    Twelve parkinsonian patients on long-term levodopa therapy developed intermittent, myoclonic body jerks. The movements consisted of single unilateral or bilateral abrupt jerks of the extremities and occurred most frequently during sleep. Although directly related to daily dosage of levodopa, the myoclonus was specifically blocked by the serotonin antagonist, methysergide. Levodopa-induced myoclonus may be related to intermittent increases of activity of serotonin in the brain and results from levodopa-induced dysregulation of serotonin activity.

  9. Induced polarization response of microbial induced sulfideprecipitation

    SciTech Connect

    Ntarlagiannis, Dimitrios; Williams, Kenneth Hurst; Slater, Lee; Hubbard, Susan

    2004-06-04

    A laboratory scale experiment was conducted to examine the use of induced polarization and electrical conductivity to monitor microbial induced sulfide precipitation under anaerobic conditions in sand filled columns. Three columns were fabricated; one for electrical measurements, one for geochemical sampling and a third non-inoculated column was used as a control. A continual upward flow of nutrients and metals in solution was established in each column. Desulfovibrio vulgaris microbes were injected into the middle of the geochemical and electrical columns. Iron and zinc sulfides precipitated along a microbial action front as a result of sulfate reduction due by Desulfovibrio vulgaris. The precipitation front initially developed near the microbial injection location, and subsequently migrated towards the nutrient inlet, as a result of chemotaxis by Desulfovibrio vulgaris. Sampling during and subsequent to the experiment revealed spatiotemporal changes in the biogeochemical measurements associated with microbial sulfate reduction. Conductivity measurements were insensitive to all biogeochemical changes occurred within the column. Changes in the IP response (of up to 14 mrad)were observed to coincide in place and in time with the active microbe respiration/sulfide precipitation front as determined from geochemical sampling. The IP response is correlated with the lactate concentration gradient, an indirect measurement of microbial metabolism, suggesting the potential of IP as a method for monitoring microbial respiration/activity. Post experimental destructive sample analysis and SEM imaging verified the geochemical results and supported our hypothesis that microbe induced sulfide precipitation is directly detectable using electrical methods. Although the processes not fully understood, the IP response appears to be sensitive to this anaerobic microbial precipitation, suggesting a possible novel application for the IP method.

  10. Gravitationally induced quantum transitions

    NASA Astrophysics Data System (ADS)

    Landry, A.; Paranjape, M. B.

    2016-06-01

    In this paper, we calculate the probability for resonantly inducing transitions in quantum states due to time-dependent gravitational perturbations. Contrary to common wisdom, the probability of inducing transitions is not infinitesimally small. We consider a system of ultracold neutrons, which are organized according to the energy levels of the Schrödinger equation in the presence of the Earth's gravitational field. Transitions between energy levels are induced by an oscillating driving force of frequency ω . The driving force is created by oscillating a macroscopic mass in the neighborhood of the system of neutrons. The neutron lifetime is approximately 880 sec while the probability of transitions increases as t2. Hence, the optimal strategy is to drive the system for two lifetimes. The transition amplitude then is of the order of 1.06 ×10-5, and hence with a million ultracold neutrons, one should be able to observe transitions.

  11. Radiation-induced gliomas

    PubMed Central

    Prasad, Gautam; Haas-Kogan, Daphne A.

    2013-01-01

    Radiation-induced gliomas represent a relatively rare but well-characterized entity in the neuro-oncologic literature. Extensive retrospective cohort data in pediatric populations after therapeutic intracranial radiation show a clearly increased risk in glioma incidence that is both patient age- and radiation dose/volume-dependent. Data in adults are more limited but show heightened risk in certain groups exposed to radiation. In both populations, there is no evidence linking increased risk associated with routine exposure to diagnostic radiation. At the molecular level, recent studies have found distinct genetic differences between radiation-induced gliomas and their spontaneously-occurring counterparts. Clinically, there is understandable reluctance on the part of clinicians to re-treat patients due to concern for cumulative neurotoxicity. However, available data suggest that aggressive intervention can lead to improved outcomes in patients with radiation-induced gliomas. PMID:19831840

  12. Drug-induced mania.

    PubMed

    Peet, M; Peters, S

    1995-02-01

    Mania can occur by chance association during drug treatment, particularly in patients predisposed to mood disorder. Single case reports are unreliable, and evidence must be sought from large series of treated patients, particularly those with a matched control group. Drugs with a definite propensity to cause manic symptoms include levodopa, corticosteroids and anabolic-androgenic steroids. Antidepressants of the tricyclic and monoamine oxidase inhibitor classes can induce mania in patients with pre-existing bipolar affective disorder. Drugs which are probably capable of inducing mania, but for which the evidence is less scientifically secure, include other dopaminergic anti-Parkinsonian drugs, thyroxine, iproniazid and isoniazid, sympathomimetic drugs, chloroquine, baclofen, alprazolam, captopril, amphetamine and phencyclidine. Other drugs may induce mania rarely and idiosyncratically. Management involves discontinuation or dosage reduction of the suspected drug, if this is medically possible, and treatment of manic symptoms with antipsychotic drugs or lithium.

  13. Crystalglobulin-induced nephropathy.

    PubMed

    Gupta, Vinay; El Ters, Mireille; Kashani, Kianoush; Leung, Nelson; Nasr, Samih H

    2015-03-01

    Crystalline nephropathy refers to renal parenchymal deposition of crystals leading to kidney damage. The most common forms of crystalline nephropathy encountered in renal pathology are nephrocalcinosis and oxalate nephropathy. Less frequent types include urate nephropathy, cystinosis, dihydroxyadeninuria, and drug-induced crystalline nephropathy (e.g., caused by indinavir or triamterene). Monoclonal proteins can also deposit in the kidney as crystals and cause tissue damage. This occurs in conditions such as light chain proximal tubulopathy, crystal-storing histiocytosis, and crystalglobulinemia. The latter is a rare complication of multiple myeloma that results from crystallization of monoclonal proteins in the systemic vasculature, leading to vascular injury, thrombosis, and occlusion. In this report, we describe a case of crystalglobulin-induced nephropathy and discuss its pathophysiology and the differential diagnosis of paraprotein-induced crystalline nephropathy.

  14. Geomagnetism and induced voltage

    NASA Astrophysics Data System (ADS)

    Abdul-Razzaq, W.; Biller, R. D.

    2010-07-01

    Introductory physics laboratories have seen an influx of conceptual integrated science over time in their classrooms with elements of other sciences such as chemistry, biology, Earth science, and astronomy. We describe a laboratory to introduce this development, as it attracts attention to the voltage induced in the human brain as it is initiated by the change in the magnetic flux due to the Earth's magnetic field and movement. This simple and enjoyable experiment will demonstrate how basic concepts in physics and geology can help us think about possible health effects due to the induced voltage.

  15. Surgery induced immunosuppression.

    PubMed

    Hogan, Brian V; Peter, Mark B; Shenoy, Hrishikesh G; Horgan, Kieran; Hughes, Thomas A

    2011-02-01

    Surgery and anaesthesia result in a variety of metabolic and endocrine responses, which result in a generalised state of immunosuppression in the immediate post-operative period. Surgery induced immunosuppression has been implicated in the development of post-operative septic complications and tumour metastasis formation. In addition the effectiveness of many treatments in the adjuvant setting is dependent on a functioning immune system. By understanding the mechanisms contributing to surgery-induced immunosuppression, surgeons may undertake strategies to minimise its effect and reduce potential short-term and long-term consequences to patients.

  16. Olmesartan-Induced Enteropathy

    PubMed Central

    Adike, Abimbola; Corral, Juan; Rybnicek, David; Sussman, Daniel; Shah, Samir; Quigley, Eamonn

    2016-01-01

    Olmesartan-induced enteropathy mimics celiac disease clinically and pathologically. As in celiac disease, the pathologic findings are villous atrophy and increased intraepithelial lymphocytes. Clinical presentation of olmesartan-induced enteropathy includes diarrhea, weight loss, and nausea. In contrast to celiac disease, tissue transglutaminase is not elevated and there is no response to a gluten-free diet. Including this entity in the differential diagnosis of sprue-like enteropathy is critical for its early diagnosis since replacing olmesartan with an alternative antihypertensive drug can simplify the diagnostic workup and provide both clinical and histologic improvement. PMID:28289500

  17. Inhibitory Ah Receptor-Androgen Receptor Crosstalk in Prostate Cancer

    DTIC Science & Technology

    2005-02-01

    induced luciferase ac- cleft palate, immunotoxicity and porphyria in mice and tivity in the latter cell line. This suggests that inhibitory CYP1A1 in...Williamson, H. Asou, J.W. Said, porphyria in genetically inbred mice: partial antagonism and S. Holden, I. Miyoshi, H.P. Koeffler, Ligand for peroxisome

  18. DETECTION OF STACHYBOTRYS CHARTARUM USING rRNA, tri5, AND Β-TUBULIN PRIMERS AND DETERMINING THEIR RELATIVE COPY NUMBER BY REAL TIME PCR

    EPA Science Inventory

    This research utilizes the quantitative polymerase chain reaction (qPCR) to determine ribosomal copy number of fungal organisms found in unhealthy indoor environments. Knowing specific copy numbers will allow for greater accuracy in quantification when utilizing current pQCR tec...

  19. Injection-induced earthquakes.

    PubMed

    Ellsworth, William L

    2013-07-12

    Earthquakes in unusual locations have become an important topic of discussion in both North America and Europe, owing to the concern that industrial activity could cause damaging earthquakes. It has long been understood that earthquakes can be induced by impoundment of reservoirs, surface and underground mining, withdrawal of fluids and gas from the subsurface, and injection of fluids into underground formations. Injection-induced earthquakes have, in particular, become a focus of discussion as the application of hydraulic fracturing to tight shale formations is enabling the production of oil and gas from previously unproductive formations. Earthquakes can be induced as part of the process to stimulate the production from tight shale formations, or by disposal of wastewater associated with stimulation and production. Here, I review recent seismic activity that may be associated with industrial activity, with a focus on the disposal of wastewater by injection in deep wells; assess the scientific understanding of induced earthquakes; and discuss the key scientific challenges to be met for assessing this hazard.

  20. Shrouded inducer pump

    DOEpatents

    Meng, S.Y.

    1989-08-08

    An improvement in a pump is described including a shrouded inducer, the improvement comprising first and second sealing means which cooperate with a first vortex cell and a series of secondary vortex cells to remove any tangential velocity components from the recirculation flow. 3 figs.

  1. [Chemotherapy-induced alopecia].

    PubMed

    Spaëth, Dominique; Rosso, Nathalie; Clivot, Laetitia

    2006-11-30

    Chemotherapy-induced alopecia is frequent with most chemotherapy regimens; mechanisms, evolution and small prevention tools are described. Scalp cooling (helmets or continuous cooling systems) can avoid or diminish hair loss in selected chemotherapy regimens but tolerance can be fair and long harmlessness needs to be confirmed by prospective studies. Drug prevention is only in the first steps of research.

  2. Effects of Induced Astigmatism.

    ERIC Educational Resources Information Center

    Schubert, Delwyn G.; Walton, Howard N.

    1968-01-01

    The relationship of astigmatism to reading and the possible detrimental effects it might have on reading were investigated. The greatest incidence of astigmatism was for the with-the-rule type ranging from .50 to 1.00 diopter. This type of astigmatism was induced in 35 seniors from the Los Angeles College of Optometry by placing cylindrical lenses…

  3. Drug-induced uveitis

    PubMed Central

    2013-01-01

    A number of medications have been associated with uveitis. This review highlights both well-established and recently reported systemic, topical, intraocular, and vaccine-associated causes of drug-induced uveitis, and assigns a quantitative score to each medication based upon criteria originally described by Naranjo and associates. PMID:23522744

  4. Drug-induced hyperkalemia.

    PubMed

    Ben Salem, Chaker; Badreddine, Atef; Fathallah, Neila; Slim, Raoudha; Hmouda, Houssem

    2014-09-01

    Hyperkalemia is a common clinical condition that can be defined as a serum potassium concentration exceeding 5.0 mmol/L. Drug-induced hyperkalemia is the most important cause of increased potassium levels in everyday clinical practice. Drug-induced hyperkalemia may be asymptomatic. However, it may be dramatic and life threatening, posing diagnostic and management problems. A wide range of drugs can cause hyperkalemia by a variety of mechanisms. Drugs can interfere with potassium homoeostasis either by promoting transcellular potassium shift or by impairing renal potassium excretion. Drugs may also increase potassium supply. The reduction in renal potassium excretion due to inhibition of the renin-angiotensin-aldosterone system represents the most important mechanism by which drugs are known to cause hyperkalemia. Medications that alter transmembrane potassium movement include amino acids, beta-blockers, calcium channel blockers, suxamethonium, and mannitol. Drugs that impair renal potassium excretion are mainly represented by angiotensin-converting enzyme inhibitors, angiotensin-II receptor blockers, direct renin inhibitors, nonsteroidal anti-inflammatory drugs, calcineurin inhibitors, heparin and derivatives, aldosterone antagonists, potassium-sparing diuretics, trimethoprim, and pentamidine. Potassium-containing agents represent another group of medications causing hyperkalemia. Increased awareness of drugs that can induce hyperkalemia, and monitoring and prevention are key elements for reducing the number of hospital admissions, morbidity, and mortality related to drug-induced hyperkalemia.

  5. Injection-induced earthquakes

    USGS Publications Warehouse

    Ellsworth, William L.

    2013-01-01

    Earthquakes in unusual locations have become an important topic of discussion in both North America and Europe, owing to the concern that industrial activity could cause damaging earthquakes. It has long been understood that earthquakes can be induced by impoundment of reservoirs, surface and underground mining, withdrawal of fluids and gas from the subsurface, and injection of fluids into underground formations. Injection-induced earthquakes have, in particular, become a focus of discussion as the application of hydraulic fracturing to tight shale formations is enabling the production of oil and gas from previously unproductive formations. Earthquakes can be induced as part of the process to stimulate the production from tight shale formations, or by disposal of wastewater associated with stimulation and production. Here, I review recent seismic activity that may be associated with industrial activity, with a focus on the disposal of wastewater by injection in deep wells; assess the scientific understanding of induced earthquakes; and discuss the key scientific challenges to be met for assessing this hazard.

  6. Geomagnetism and Induced Voltage

    ERIC Educational Resources Information Center

    Abdul-Razzaq, W.; Biller, R. D.

    2010-01-01

    Introductory physics laboratories have seen an influx of "conceptual integrated science" over time in their classrooms with elements of other sciences such as chemistry, biology, Earth science, and astronomy. We describe a laboratory to introduce this development, as it attracts attention to the voltage induced in the human brain as it…

  7. Shrouded inducer pump

    SciTech Connect

    Meng, Sen Y.

    1989-01-01

    An improvement in a pump including a shrouded inducer, the improvement comprising first and second sealing means 32,36 which cooperate with a first vortex cell 38 and a series of secondary vortex cells 40 to remove any tangential velocity components from the recirculation flow.

  8. Statin-induced Myopathy.

    PubMed

    Fitzgerald, Kara; Redmond, Elizabeth; Harbor, Cathryn

    2012-05-01

    Heart disease (HD) is the number one killer in the United States.(1) In 2006, the direct and indirect costs associated with cardiovascular disease in the United States were estimated at 400 billion dollars.(2) Statin therapy for cholesterol reduction is a mainstay intervention for cardiovascular disease (CVD) as reflected in atorvastatin's status as the number one prescribed medication in the United States.(3) Statin therapy, however, is also associated with side effects that signal mitochondrial distress. A commonly reported statin-induced symptom is myalgia, which is defined as muscle pain without an associated elevation of serum creatine kinase (CK). In clinical trials, the reports of myalgia vary from less than 1% to 25% of patients.(4) Myopathy is a general term defined as an abnormal condition or disease of muscle tissue. Myopathy includes myalgia, myositis (inflammation of muscle tissue associated with elevated CK) and the very serious condition rhabdomyolysis (extreme myositis). Histological findings in statin-induced myopathy demonstrate electron chain dysfunction making "mitochondrial myopathy" the more precise term.(5) Mitochondrial myopathy has been associated with statin-induced CoQ10 depletion.(5) Given the density of mitochondria in cardiomyocytes, and CoQ10's role in mitochondrial energy production, depletion has long been associated with increased risk for heart disease.(6-7) In the case below, mitochondrial-specific organic acids, serum CoQ10, vitamin D and clinical history all suggest statin-induced mitochondrial myopathy, despite normal serum CK.

  9. Bacteriocin Inducer Peptides

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Novel peptides produced by bacteriocin-producing bacteria stimulate the production of bacteriocins in vitro. The producer bacteria are cultured in the presence of a novel inducer bacteria and a peptide having a carboxy terminal sequence of VKGLT in order to achieve an increase in bacteriocin produc...

  10. Induced Angular Momentum

    ERIC Educational Resources Information Center

    Parker, G. W.

    1978-01-01

    Discusses, classically and quantum mechanically, the angular momentum induced in the bound motion of an electron by an external magnetic field. Calculates the current density and its magnetic moment, and then uses two methods to solve the first-order perturbation theory equation for the required eigenfunction. (Author/GA)

  11. Topological induced gravity

    NASA Astrophysics Data System (ADS)

    Oda, Ichiro

    We propose a topological model of induced gravity (pregeometry) where both Newton’s coupling constant and the cosmological constant appear as integration constants in solving field equations. The matter sector of a scalar field is also considered, and by solving field equations it is shown that various types of cosmological solutions in the Friedmann-Robertson-Walker (FRW) universe can be obtained. A detailed analysis is given of the meaning of the BRST transformations, which make the induced gravity be a topological field theory, by means of the canonical quantization analysis, and the physical reason why such BRST transformations are needed in the present formalism is clarified. Finally, we propose a dynamical mechanism for fixing the Lagrange multiplier fields by following the Higgs mechanism. The present study clearly indicates that the induced gravity can be constructed at the classical level without recourse to quantum fluctuations of matter and suggests an interesting relationship between the induced gravity and the topological quantum-field theory (TQFT).

  12. Schedule-Induced Stereotypy.

    ERIC Educational Resources Information Center

    Emerson, Eric; Howard, Denise

    1992-01-01

    The phenomena of the induction and entrainment of adjunctive behaviors was investigated in 8 people (ages 5-51) with severe or profound mental retardation who exhibited stereotypic behaviors. Seven of the eight demonstrated evidence of schedule-induced stereotypic behavior, whereas five also showed evidence of the entrainment of these behaviors by…

  13. Warfarin-induced erythroderma.

    PubMed

    Rowe, Casey J; Robertson, Ivan; James, Daniel; McMeniman, Erin

    2015-02-01

    Erythroderma is a potentially serious and life-threatening skin disease with a number of possible aetiologies. Drug reactions are well-documented causes, with carbamazepine, penicillin and allopurinol being the most commonly implicated. This case describes a unique presentation of warfarin-induced erythroderma in a 78-year-old female patient.

  14. Friction induced rail vibrations

    NASA Astrophysics Data System (ADS)

    Kralov, Ivan; Sinapov, Petko; Nedelchev, Krasimir; Ignatov, Ignat

    2012-11-01

    A model of rail, considered as multiple supported beam, subjected on friction induced vibration is studied in this work using FEM. The model is presented as continuous system and the mass and elastic properties of a real object are taken into account. The friction forces are nonlinear functions of the relative velocity during slipping. The problem is solved using Matlab Simulink.

  15. Heparin-induced thrombocytopaenia.

    PubMed

    Gounden, Ronald; Blockman, Marc

    2008-01-01

    Heparin-induced thrombocytopaenia (HIT) is an acquired, transient prothrombotic disorder caused by heparin. The predominant problem is the creation of a prothrombotic milieu, accompanied by a fall in the platelet count. This explains the apparent paradox of thrombosis in the face of thrombocytopaenia and why non-heparin antithrombotic agents are integral to its management.

  16. 2,5-hexanedione-induced immunomodulatory effect in mice

    SciTech Connect

    Upreti, R.K.; Shanker, R.

    1987-06-01

    The immunotoxic potential of 2,5-hexanedione (2,5-Hxdn), the end metabolite of n-hexane/methyl n-butyl ketone, was evaluated in a mouse model involving multiple pathomorphological, hematological, and immunological assays. Young adult male Swiss albino mice were given either single or seven consecutive oral doses of 0.2 x LD/sub 50/ of 2.5-Hxdn. None of the treated mice exhibited any sign of hind limb weakness up to 1 week. On the eighth day, half the animals were sacrificed for initial pathomorphological studies of various organs and the other half were subjected to several immune function tests. The results revealed treatment-related reduction in cellularity of spleen, thymus, and mesentric lymph nodes and pathotoxicological changes. Further, immune function tests such as delayed-type hypersensitivity reaction, plaque-forming cell assay, phagocytosis by adherent peritoneal exudate cells, and resistance to endotoxin shock were considerably impaired. These results suggest that 2,5-Hxdn treatment causes profound impairment of immunity in mice even before the onset of peripheral neuropathy.

  17. Viral induced demyelination.

    PubMed

    Stohlman, S A; Hinton, D R

    2001-01-01

    Viral induced demyelination, in both humans and rodent models, has provided unique insights into the cell biology of oligodendroglia, their complex cell-cell interactions and mechanisms of myelin destruction. They illustrate mechanisms of viral persistence, including latent infections in which no infectious virus is readily evident, virus reactivation and viral-induced tissue damage. These studies have also provided excellent paradigms to study the interactions between the immune system and the central nervous system (CNS). Although of interest in their own right, an understanding of the diverse mechanisms used by viruses to induce demyelination may shed light into the etiology and pathogenesis of the common demyelinating disorder multiple sclerosis (MS). This notion is supported by the persistent view that a viral infection acquired during adolescence might initiate MS after a long period of quiescence. Demyelination in both humans and rodents can be initiated by infection with a diverse group of enveloped and non-enveloped RNA and DNA viruses (Table 1). The mechanisms that ultimately result in the loss of CNS myelin appear to be equally diverse as the etiological agents capable of causing diseases which result in demyelination. Although demyelination can be a secondary result of axonal loss, in many examples of viral induced demyelination, myelin loss is primary and associated with axonal sparing. This suggests that demyelination induced by viral infections can result from: 1) a direct viral infection of oligodendroglia resulting in cell death with degeneration of myelin and its subsequent removal; 2) a persistent viral infection, in the presence or absence of infectious virus, resulting in the loss of normal cellular homeostasis and subsequent oligodendroglial death; 3) a vigorous virus-specific inflammatory response wherein the virus replicates in a cell type other than oligodendroglia, but cytokines and other immune mediators directly damage the

  18. [Steroid-induced osteoporosis].

    PubMed

    Perrot, Serge; Le Jeunne, Claire

    2012-04-01

    Bone-related steroid involvement is one of the most frequent complications of steroid treatment. Epidemiological data demonstrate that osteoporosis starts early during the treatment, predominantly involves trabecular bone and is correlated to dosage and treatment duration. Mechanisms and consequences of steroid bone involvement are related to osseous and extra-osseous mechanisms. In clinical practice, steroid-induced osteoporosis remains underdiagnosed and undertreated both in preventive and curative approaches. Recently, new molecules as teriparatide and zoledronic acid got indication for the treatment of steroid-induced osteoporosis. To guide treatment strategies, several recommendations are available: French, not updated recommendations since 2003 (Afssaps, 2003), European elaborated by the EULAR in 2007 and those of the ACR updated in 2010.

  19. Hypoxia-Inducible Hydrogels

    PubMed Central

    Park, Kyung Min; Gerecht, Sharon

    2014-01-01

    Oxygen is vital for the existence of all multicellular organisms, acting as a signaling molecule regulating cellular activities. Specifically, hypoxia, which occurs when the partial pressure of oxygen falls below 5%, plays a pivotal role during development, regeneration, and cancer. Here we report a novel hypoxia-inducible (HI) hydrogel composed of gelatin and ferulic acid that can form hydrogel networks via oxygen consumption in a laccase-mediated reaction. Oxygen levels and gradients within the hydrogels can be accurately controlled and precisely predicted. We demonstrate that HI hydrogels guide vascular morphogenesis in vitro via hypoxia-inducible factors activation of matrix metalloproteinases and promote rapid neovascularization from the host tissue during subcutaneous wound healing. The HI hydrogel is a new class of biomaterials that may prove useful in many applications, ranging from fundamental studies of developmental, regenerative and disease processes through the engineering of healthy and diseased tissue models towards the treatment of hypoxia-regulated disorders. PMID:24909742

  20. Current induced interlayer coupling

    NASA Astrophysics Data System (ADS)

    Levy, Peter M.; Heide, Carsten; Zhang, Shufeng; Fert, Albert

    2001-03-01

    It has recently been shown that a perpendicular current in a magnetically multilayered structures induces an unusual bilinear coupling between the magnetizations of the layers [1]. While this was demonstrated in the ballistic regime, transport is likely to be diffusive in the structures where this may be relevant to the role of currents in switching the magnetization of the layers. We have derived the current induced coupling by using the Boltzmann equation in terms of the parameters used to describe the giant magnetoresistance of magnetically layered structures, and thereby estimate the strength of this coupling. Work supported in part by DARPA and ONR. [1] C.Heide and R.J.Elliott, Europhys. Lett. 50, 271 (2000).

  1. Tulipalin A induced phytotoxicity.

    PubMed

    McCluskey, James; Bourgeois, Marie; Harbison, Raymond

    2014-04-01

    Tulipalin A induced phytotoxicity is a persistent allergic contact dermatitides documented in floral workers exposed to Alstroemeria and its cultivars.[1] The causative allergen is tulipalin A, a toxic glycoside named for the tulip bulbs from which it was first isolated.[2] The condition is characterized by fissured acropulpitis, often accompanied by hyperpigmentation, onychorrhexis, and paronychia. More of the volar surface may be affected in sensitized florists. Dermatitis and paronychia are extremely common conditions and diagnostic errors may occur. A thorough patient history, in conjunction with confirmatory patch testing with a bulb sliver and tuliposide A exposure, can prevent misdiagnosis. We report a case of Tulipalin A induced phytotoxicity misdiagnosed as an unresolved tinea manuum infection in a patient evaluated for occupational exposure.

  2. Tulipalin A induced phytotoxicity

    PubMed Central

    McCluskey, James; Bourgeois, Marie; Harbison, Raymond

    2014-01-01

    Tulipalin A induced phytotoxicity is a persistent allergic contact dermatitides documented in floral workers exposed to Alstroemeria and its cultivars.[1] The causative allergen is tulipalin A, a toxic glycoside named for the tulip bulbs from which it was first isolated.[2] The condition is characterized by fissured acropulpitis, often accompanied by hyperpigmentation, onychorrhexis, and paronychia. More of the volar surface may be affected in sensitized florists. Dermatitis and paronychia are extremely common conditions and diagnostic errors may occur. A thorough patient history, in conjunction with confirmatory patch testing with a bulb sliver and tuliposide A exposure, can prevent misdiagnosis. We report a case of Tulipalin A induced phytotoxicity misdiagnosed as an unresolved tinea manuum infection in a patient evaluated for occupational exposure. PMID:25024947

  3. Sepsis-induced Cardiomyopathy

    PubMed Central

    Romero-Bermejo, Francisco J; Ruiz-Bailen, Manuel; Gil-Cebrian, Julián; Huertos-Ranchal, María J

    2011-01-01

    Myocardial dysfunction is one of the main predictors of poor outcome in septic patients, with mortality rates next to 70%. During the sepsis-induced myocardial dysfunction, both ventricles can dilate and diminish its ejection fraction, having less response to fluid resuscitation and catecholamines, but typically is assumed to be reversible within 7-10 days. In the last 30 years, It´s being subject of substantial research; however no explanation of its etiopathogenesis or effective treatment have been proved yet. The aim of this manuscript is to review on the most relevant aspects of the sepsis-induced myocardial dysfunction, discuss its clinical presentation, pathophysiology, etiopathogenesis, diagnostic tools and therapeutic strategies proposed in recent years. PMID:22758615

  4. Buckling-Induced Kirigami

    NASA Astrophysics Data System (ADS)

    Rafsanjani, Ahmad; Bertoldi, Katia

    2017-02-01

    We investigate the mechanical response of thin sheets perforated with a square array of mutually orthogonal cuts, which leaves a network of squares connected by small ligaments. Our combined analytical, experimental and numerical results indicate that under uniaxial tension the ligaments buckle out of plane, inducing the formation of 3D patterns whose morphology is controlled by the load direction. We also find that by largely stretching the buckled perforated sheets, plastic strains develop in the ligaments. This gives rise to the formation of kirigami sheets comprising periodic distribution of cuts and permanent folds. As such, the proposed buckling-induced pop-up strategy points to a simple route for manufacturing complex morphable structures out of flat perforated sheets.

  5. Buckling-Induced Kirigami.

    PubMed

    Rafsanjani, Ahmad; Bertoldi, Katia

    2017-02-24

    We investigate the mechanical response of thin sheets perforated with a square array of mutually orthogonal cuts, which leaves a network of squares connected by small ligaments. Our combined analytical, experimental and numerical results indicate that under uniaxial tension the ligaments buckle out of plane, inducing the formation of 3D patterns whose morphology is controlled by the load direction. We also find that by largely stretching the buckled perforated sheets, plastic strains develop in the ligaments. This gives rise to the formation of kirigami sheets comprising periodic distribution of cuts and permanent folds. As such, the proposed buckling-induced pop-up strategy points to a simple route for manufacturing complex morphable structures out of flat perforated sheets.

  6. Cocaine-Induced Vasculitis

    PubMed Central

    Berman, Mark; Paran, Daphna; Elkayam, Ori

    2016-01-01

    The use of cocaine continues to grow worldwide. One of the possible side-effects of cocaine is vasculitis. Two distinct vasculitic syndromes have been described due to cocaine. One is cocaine-induced midline destructive lesion, secondary to a direct vasoconstrictor effect of cocaine, inducing ischemic necrosis of the septal cartilage and perforation of the nasal septum, mimicking findings of granulomatosis with polyangiitis in the upper airways. The other is ANCA-associated vasculitis, attributed to the levamisole component that contaminates about 70% of the cocaine. This type of vasculitis may be myeloperoxidase (MPO) and proteinase 3 (PR3) positive, and its main manifestations are typical cutaneous findings, arthralgia, otolaryngologic involvement, and agranulocytosis. A high degree of suspicion and awareness is needed in order properly to diagnose and treat these patients. PMID:27824551

  7. Drug-induced hypokalaemia.

    PubMed

    Ben Salem, Chaker; Hmouda, Houssem; Bouraoui, Kamel

    2009-01-01

    Hypokalaemia (defined as a plasma potassium concentration<3.5 mEq/L) is a common electrolyte abnormality in clinical practice. Drugs are a common cause of either asymptomatic or symptomatic hypokalaemia. Drug-induced hypokalaemia is an important problem particularly in the elderly and in patients with cardiovascular, renal or hepatic disease. Hypokalaemia can complicate the use of the drug in the therapeutic concentration range, and can also be precipitated with overdose or conditions leading to drug intoxication. Because the etiologies of hypokalaemia are numerous, the diagnosis of drug-induced hypokalaemia may be overlooked. Physicians should always pay close attention to this common side effect. Evaluation and management of a hypokalaemic patient should include a careful review of medications history to determine if a drug capable of causing or aggravating this electrolyte abnormality is present.

  8. Radiation-induced schwannomas

    SciTech Connect

    Rubinstein, A.B.; Reichenthal, E.; Borohov, H.

    1989-06-01

    The histopathology and clinical course of three patients with schwannomas of the brain and high cervical cord after therapeutic irradiation for intracranial malignancy and for ringworm of the scalp are described. Earlier reports in the literature indicated that radiation of the scalp may induce tumors in the head and neck. It is therefore suggested that therapeutic irradiation in these instances was a causative factor in the genesis of these tumors.

  9. Polarization induced doped transistor

    SciTech Connect

    Xing, Huili; Jena, Debdeep; Nomoto, Kazuki; Song, Bo; Zhu, Mingda; Hu, Zongyang

    2016-06-07

    A nitride-based field effect transistor (FET) comprises a compositionally graded and polarization induced doped p-layer underlying at least one gate contact and a compositionally graded and doped n-channel underlying a source contact. The n-channel is converted from the p-layer to the n-channel by ion implantation, a buffer underlies the doped p-layer and the n-channel, and a drain underlies the buffer.

  10. Drug-induced diarrhoea.

    PubMed

    Chassany, O; Michaux, A; Bergmann, J F

    2000-01-01

    Diarrhoea is a relatively frequent adverse event, accounting for about 7% of all drug adverse effects. More than 700 drugs have been implicated in causing diarrhoea; those most frequently involved are antimicrobials, laxatives, magnesium-containing antacids, lactose- or sorbitol-containing products, nonsteroidal anti-inflammatory drugs, prostaglandins, colchicine, antineoplastics, antiarrhythmic drugs and cholinergic agents. Certain new drugs are likely to induce diarrhoea because of their pharmacodynamic properties; examples include anthraquinone-related agents, alpha-glucosidase inhibitors, lipase inhibitors and cholinesterase inhibitors. Antimicrobials are responsible for 25% of drug-induced diarrhoea. The disease spectrum of antimicrobial-associated diarrhoea ranges from benign diarrhoea to pseudomembranous colitis. Several pathophysiological mechanisms are involved in drug-induced diarrhoea: osmotic diarrhoea, secretory diarrhoea, shortened transit time, exudative diarrhoea and protein-losing enteropathy, and malabsorption or maldigestion of fat and carbohydrates. Often 2 or more mechanisms are present simultaneously. In clinical practice, 2 major types of diarrhoea are seen: acute diarrhoea, which usually appears during the first few days of treatment, and chronic diarrhoea, lasting more than 3 or 4 weeks and which can appear a long time after the start of drug therapy. Both can be severe and poorly tolerated. In a patient presenting with diarrhoea, the medical history is very important, especially the drug history, as it can suggest a diagnosis of drug-induced diarrhoea and thereby avoid multiple diagnostic tests. The clinical examination should cover severity criteria such as fever, rectal emission of blood and mucus, dehydration and bodyweight loss. Establishing a relationship between drug consumption and diarrhoea or colitis can be difficult when the time elapsed between the start of the drug and the onset of symptoms is long, sometimes up to several

  11. Arsenic-Induced Pancreatitis

    PubMed Central

    Connelly, Sean; Zancosky, Krysia; Farah, Katie

    2011-01-01

    The introduction of all-trans retinoic acid (ATRA) and arsenic trioxide has brought about tremendous advancement in the treatment of acute promyelocytic myelogenous leukemia (APML). In most instances, the benefits of these treatments outweigh the risks associated with their respective safety profiles. Although acute pancreatitis is not commonly associated with arsenic toxicity, it should be considered as a possible side effect. We report a case of arsenic-induced pancreatitis in a patient with APML. PMID:22606427

  12. Ketamine-Induced Hallucinations

    PubMed Central

    Powers, A.R.; Gancsos, M.G.; Finn, E.S.; Morgan, P.T.; Corlett, P.R.

    2015-01-01

    Background Ketamine, the NMDA glutamate receptor antagonist drug, is increasingly employed as an experimental model of psychosis in healthy volunteers. At sub-anesthetic doses, it safely and reversibly causes delusion-like ideas, amotivation, and perceptual disruptions reminiscent of the aberrant salience experiences that characterize first-episode psychosis. However, auditory verbal hallucinations (AVHs), a hallmark symptom of schizophrenia, have not been reported consistently in healthy volunteers even at high doses of ketamine. Methods Here we present data from a set of healthy participants who received moderately dosed, placebo controlled ketamine infusions in the reduced stimulation environment of the magnetic resonance imaging scanner. We highlight the phenomenological experiences of three participants who experienced particularly vivid hallucinations. Results Participants in this series reported auditory verbal and musical hallucinations at a ketamine dose that does not induce auditory hallucination outside of the scanner. Discussion We interpret the observation of ketamine-induced AVHs in the context of the reduced perceptual environment of the magnetic resonance scanner, and offer an explanation grounded in predictive coding models of perception and psychosis: the brain fills in expected perceptual inputs and it does so more in situations of reduced perceptual input. The reduced perceptual input of the MRI scanner creates a mismatch between top-down perceptual expectations and the heightened bottom-up signals induced by ketamine; such circumstances induce aberrant percepts including musical and auditory verbal hallucinations. We suggest that these circumstances might represent a useful experimental model of AVHs and highlight the impact of ambient sensory stimuli on psychopathology. PMID:26361209

  13. Allopurinol induced erythroderma.

    PubMed

    Sharma, Geeta; Govil, Dinesh Chandra

    2013-01-01

    Allopurinol, a widely prescribed urate lowering agent is responsible for various adverse drug reactions, including erythroderma. A 45-year-old male patient was admitted with the complaints of fever, redness and scaling all over the body after 3-4 weeks of allopurinol treatment for asymptomatic hyperuricemia. Elevated liver enzymes were detected in his blood analysis. Skin biopsy was consistent with drug induced erythroderma. Allopurinol was stopped and steroids were started. Patient improved over a period of 2 weeks.

  14. Allergen-induced asthma

    PubMed Central

    Cockcroft, Donald W

    2014-01-01

    It was only in the late 19th century that specific allergens, pollen, animal antigens and, later, house dust mite, were identified to cause upper and lower airway disease. Early allergen challenge studies, crudely monitored before measurement of forced expiratory volume in 1 s became widespread in the 1950s, focused on the immediate effects but noted in passing prolonged and/or recurrent asthma symptoms. The late asthmatic response, recurrent bronchoconstriction after spontaneous resolution of the early responses occurring 3 h to 8 h or more postchallenge, has been identified and well characterized over the past 50 years. The associated allergen-induced airway hyper-responsiveness (1977) and allergen-induced airway inflammation (1985) indicate that these late sequelae are important in the mechanism of allergen-induced asthma. Allergens are now recognized to be the most important cause of asthma. A standardized allergen inhalation challenge model has been developed and is proving to be a valuable research tool in the investigation of asthma pathophysiology and of potential new pharmacological agents for the treatment of asthma. PMID:24791256

  15. Glycerol-induced hyperhydration

    NASA Technical Reports Server (NTRS)

    Riedesel, Marvin L.; Lyons, Timothy P.; Mcnamara, M. Colleen

    1991-01-01

    Maintenance of euhydration is essential for maximum work performance. Environments which induce hypohydration reduce plasma volume and cardiovascular performance progressively declines as does work capacity. Hyperhydration prior to exposure to dehydrating environments appears to be a potential countermeasure to the debilitating effects of hypohydration. The extravascular fluid space, being the largest fluid compartment in the body, is the most logical space by which significant hyperhydration can be accomplished. Volume and osmotic receptors in the vascular space result in physiological responses which counteract hyperhydration. Our hypothesis is that glycerol-induced hyperhydration (GIH) can accomplish extravascular fluid expansion because of the high solubility of glycerol in lipid and aqueous media. A hypertonic solution of glycerol is rapidly absorbed from the gastrointestinal tract, results in mild increases in plasma osmolality and is distributed to 65 percent of the body mass. A large volume of water ingested within minutes after glycerol intake results in increased total body water because of the osmotic action and distribution of glycerol. The resulting expanded extravascular fluid space can act as a reservoir to maintain plasma volume during exposure to dehydrating environments. The fluid shifts associated with exposure to microgravity result in increased urine production and is another example of an environment which induces hypohydration. Our goal is to demonstrate that GIH will facilitate maintenance of euhydration and cardiovascular performance during space flight and upon return to a 1 g environment.

  16. Induced QCD I: theory

    NASA Astrophysics Data System (ADS)

    Brandt, Bastian B.; Lohmayer, Robert; Wettig, Tilo

    2016-11-01

    We explore an alternative discretization of continuum SU( N c ) Yang-Mills theory on a Euclidean spacetime lattice, originally introduced by Budzcies and Zirnbauer. In this discretization the self-interactions of the gauge field are induced by a path integral over N b auxiliary boson fields, which are coupled linearly to the gauge field. The main progress compared to earlier approaches is that N b can be as small as N c . In the present paper we (i) extend the proof that the continuum limit of the new discretization reproduces Yang-Mills theory in two dimensions from gauge group U( N c ) to SU( N c ), (ii) derive refined bounds on N b for non-integer values, and (iii) perform a perturbative calculation to match the bare parameter of the induced gauge theory to the standard lattice coupling. In follow-up papers we will present numerical evidence in support of the conjecture that the induced gauge theory reproduces Yang-Mills theory also in three and four dimensions, and explore the possibility to integrate out the gauge fields to arrive at a dual formulation of lattice QCD.

  17. Ethanol-induced analgesia

    SciTech Connect

    Pohorecky, L.A.; Shah, P.

    1987-09-07

    The effect of ethanol (ET) on nociceptive sensitivity was evaluated using a new tail deflection response (TDR) method. The IP injection of ET (0.5 - 1.5 g/kg) produced raid dose-dependent analgesia. Near maximal effect (97% decrease in TDR) was produced with the 1.5 g/kg dose of ET ten minutes after injection. At ninety minutes post-injection there was still significant analgesia. Depression of ET-induced nociceptive sensitivity was partially reversed by a 1 mg/kg dose of naloxone. On the other hand, morphine (0.5 or 5.0 mg/kg IP) did not modify ET-induced analgesia, while 3.0 minutes of cold water swim (known to produce non-opioid mediated analgesia) potentiated ET-induced analgesic effect. The 0.5 g/kg dose of ET by itself did not depress motor activity in an open field test, but prevented partially the depression in motor activity produced by cold water swim (CWS). Thus, the potentiation by ET of the depression of the TDR produced by CWS cannot be ascribed to the depressant effects of ET on motor activity. 21 references, 4 figures, 1 table.

  18. Study of cavitating inducer instabilities

    NASA Technical Reports Server (NTRS)

    Young, W. E.; Murphy, R.; Reddecliff, J. M.

    1972-01-01

    An analytic and experimental investigation into the causes and mechanisms of cavitating inducer instabilities was conducted. Hydrofoil cascade tests were performed, during which cavity sizes were measured. The measured data were used, along with inducer data and potential flow predictions, to refine an analysis for the prediction of inducer blade suction surface cavitation cavity volume. Cavity volume predictions were incorporated into a linearized system model, and instability predictions for an inducer water test loop were generated. Inducer tests were conducted and instability predictions correlated favorably with measured instability data.

  19. Radiation Induced Genomic Instability

    SciTech Connect

    Morgan, William F.

    2011-03-01

    Radiation induced genomic instability can be observed in the progeny of irradiated cells multiple generations after irradiation of parental cells. The phenotype is well established both in vivo (Morgan 2003) and in vitro (Morgan 2003), and may be critical in radiation carcinogenesis (Little 2000, Huang et al. 2003). Instability can be induced by both the deposition of energy in irradiated cells as well as by signals transmitted by irradiated (targeted) cells to non-irradiated (non-targeted) cells (Kadhim et al. 1992, Lorimore et al. 1998). Thus both targeted and non-targeted cells can pass on the legacy of radiation to their progeny. However the radiation induced events and cellular processes that respond to both targeted and non-targeted radiation effects that lead to the unstable phenotype remain elusive. The cell system we have used to study radiation induced genomic instability utilizes human hamster GM10115 cells. These cells have a single copy of human chromosome 4 in a background of hamster chromosomes. Instability is evaluated in the clonal progeny of irradiated cells and a clone is considered unstable if it contains three or more metaphase sub-populations involving unique rearrangements of the human chromosome (Marder and Morgan 1993). Many of these unstable clones have been maintained in culture for many years and have been extensively characterized. As initially described by Clutton et al., (Clutton et al. 1996) many of our unstable clones exhibit persistently elevated levels of reactive oxygen species (Limoli et al. 2003), which appear to be due dysfunctional mitochondria (Kim et al. 2006, Kim et al. 2006). Interestingly, but perhaps not surprisingly, our unstable clones do not demonstrate a “mutator phenotype” (Limoli et al. 1997), but they do continue to rearrange their genomes for many years. The limiting factor with this system is the target – the human chromosome. While some clones demonstrate amplification of this chromosome and thus lend

  20. Polycation induced actin bundles.

    PubMed

    Muhlrad, Andras; Grintsevich, Elena E; Reisler, Emil

    2011-04-01

    Three polycations, polylysine, the polyamine spermine and the polycationic protein lysozyme were used to study the formation, structure, ionic strength sensitivity and dissociation of polycation-induced actin bundles. Bundles form fast, simultaneously with the polymerization of MgATP-G-actins, upon the addition of polycations to solutions of actins at low ionic strength conditions. This indicates that nuclei and/or nascent filaments bundle due to attractive, electrostatic effect of polycations and the neutralization of repulsive interactions of negative charges on actin. The attractive forces between the filaments are strong, as shown by the low (in nanomolar range) critical concentration of their bundling at low ionic strength. These bundles are sensitive to ionic strength and disassemble partially in 100 mM NaCl, but both the dissociation and ionic strength sensitivity can be countered by higher polycation concentrations. Cys374 residues of actin monomers residing on neighboring filaments in the bundles can be cross-linked by the short span (5.4Å) MTS-1 (1,1-methanedyl bismethanethiosulfonate) cross-linker, which indicates a tight packing of filaments in the bundles. The interfilament cross-links, which connect monomers located on oppositely oriented filaments, prevent disassembly of bundles at high ionic strength. Cofilin and the polysaccharide polyanion heparin disassemble lysozyme induced actin bundles more effectively than the polylysine-induced bundles. The actin-lysozyme bundles are pathologically significant as both proteins are found in the pulmonary airways of cystic fibrosis patients. Their bundles contribute to the formation of viscous mucus, which is the main cause of breathing difficulties and eventual death in this disorder.

  1. Method for inducing hypothermia

    DOEpatents

    Becker, Lance B.; Hoek, Terry Vanden; Kasza, Kenneth E.

    2003-04-15

    Systems for phase-change particulate slurry cooling equipment and methods to induce hypothermia in a patient through internal and external cooling are provided. Subcutaneous, intravascular, intraperitoneal, gastrointestinal, and lung methods of cooling are carried out using saline ice slurries or other phase-change slurries compatible with human tissue. Perfluorocarbon slurries or other slurry types compatible with human tissue are used for pulmonary cooling. And traditional external cooling methods are improved by utilizing phase-change slurry materials in cooling caps and torso blankets.

  2. Method for inducing hypothermia

    DOEpatents

    Becker, Lance B.; Hoek, Terry Vanden; Kasza, Kenneth E.

    2005-11-08

    Systems for phase-change particulate slurry cooling equipment and methods to induce hypothermia in a patient through internal and external cooling are provided. Subcutaneous, intravascular, intraperitoneal, gastrointestinal, and lung methods of cooling are carried out using saline ice slurries or other phase-change slurries compatible with human tissue. Perfluorocarbon slurries or other slurry types compatible with human tissue are used for pulmonary cooling. And traditional external cooling methods are improved by utilizing phase-change slurry materials in cooling caps and torso blankets.

  3. Isoniazid-induced pellagra.

    PubMed

    Bilgili, Serap Gunes; Karadag, Ayse Serap; Calka, Omer; Altun, Faruk

    2011-12-01

    Pellagra is characterized by dermatitis, diarrhea, dementia and eventually death occurring as a result of niacin or its precursor tryptophan deficiency. Although pellagra is a well-known complication of isoniazid (INH) therapy, the clinical diagnosis may be missed or delayed that may cause life-threatening consequences. Due to the diversity of pellagra-related signs and symptoms, the diagnosis can be made with an appropriate index of suspicion. We report a 7-year-old boy presenting with INH-induced pellagra that resolved after the administration of the niacin therapy.

  4. Trastuzumab-induced cardiomyopathy.

    PubMed

    Guglin, Maya; Cutro, Raymond; Mishkin, Joseph D

    2008-06-01

    Trastuzumab is a recombinant humanized monoclonal antibody used for the treatment of advanced breast cancer. It improves survival and increases response to chemotherapy. The major side effect of trastuzumab is cardiotoxicity manifesting as a reduction in left ventricular systolic function, either asymptomatic or with signs and symptoms of heart failure. Although reversible in most cases, cardiotoxicity frequently results in the discontinuation of trastuzumab. The objective of this review is to summarize facts about trastuzumab-induced cardiotoxicity and to highlight the areas of future investigations. We searched PubMed for trials involving trastuzumab used as an adjuvant therapy for breast cancer, including the metastatic breast cancer setting, and focused on cardiotoxicity.

  5. Bupropion-induced somnambulism.

    PubMed

    Khazaal, Yasser; Krenz, Sonia; Zullino, Daniele Fabio

    2003-09-01

    Whereas there are some case reports of bupropion-induced vivid dreaming and nightmares, until now it has not been associated with somnambulism. A case is reported of a patient treated with bupropion as a smoking cessation medication, who developed somnambulism during nicotine withdrawal. Furthermore, the sleepwalking episodes were associated with eating behaviour. Amnesia was reported for all episodes. As, on one hand,bupropion is a noradrenergic and dopaminergic drug and nicotine withdrawal, on the other hand, is associated with alterations in monoaminergic functions, an interaction at the level of these neurotransmitters is suggested as the underlying mechanism.

  6. [Neuroleptic induced deficit syndrome].

    PubMed

    Szafrański, T

    1995-01-01

    Increasing interest in subjective aspects of therapy and rehabilitation focused the attention of psychiatrists, psychologists and psychopharmacologists on the mental side effects of neuroleptics. For the drug-related impairment of affective, cognitive and social function the name of neuroleptic-induced deficit syndrome (NIDS) is proposed. Patients with NIDS appear to be indifferent to the environmental stimuli, retarded and apathetic. They complain of feeling drugged and drowsy, weird, they suffer from lack of motivation, feel like "zombies". The paper presents description of NIDS and its differentiation from negative and depressive symptoms in schizophrenia and subjective perceiving of extrapyramidal syndromes.

  7. Drug-induced gynecomastia.

    PubMed

    Eckman, Ari; Dobs, Adrian

    2008-11-01

    Gynecomastia is caused by drugs in 10 - 25% of all cases. The pathophysiologic mechanism for some drugs includes exogenous estrogens exposure, medications that cause hypogonadism, anti-androgenic effects and hyperprolactinemia. This manuscript reviews common examples of drug-induced gynecomastia, discussing the mechanisms and possible treatments. Discontinuing the medication is always the best choice; however, if this is not possible, then testosterone replacement therapy may be needed for hypogonadism. When a man is euogonadal, a trial of the anti-estrogen, tamoxifen or an aromatase inhibitor may be an option.

  8. Inducing Pluripotency in Cattle.

    PubMed

    Malaver-Ortega, Luis F; Taheri-Ghahfarokhi, Amir; Sumer, Huseyin

    2015-01-01

    Nuclear reprogramming technologies in general and induced pluripotent stem cells (iPSCs) in particular have opened the door to a vast number of practical applications in regenerative medicine and biotechnology. It also represents a possible alternative to the still evasive achievement of embryonic stem cells (ESCs) isolation from refractory species such as Bos. taurus. Herein, we described a protocol for bovine iPSCs (biPSCs) generation and characterization. The protocol is based on the overexpression of the exogenous transcription factors NANOG, OCT4, SOX2, KLF4 and c-MYC, using a pantropic retroviral system.

  9. 5-fluorouracil induced pericarditis.

    PubMed

    Killu, Ammar; Madhavan, Malini; Prasad, Kavita; Prasad, Abhiram

    2011-04-15

    Cardiac toxicity is an infrequent, but potentially serious side effect of 5-fluorouracil (5-FU). The reported incidence of 5-FU-induced cardiotoxicity is approximately 3%, although estimates vary from 1.2% to 18%. Cardiac death occurs in less than 1%. The prompt recognition of cardiac toxicity demands a thorough understanding of the myriad of potential cardiac manifestations and a high index of suspicion. The most common presentation is angina pectoris while other manifestations, namely myocardial infarction, left ventricular dysfunction, arrhythmias and sudden death have been recognised. The authors report an unusual case of myopericarditis masquerading as myocardial infarction.

  10. Method for inducing hypothermia

    SciTech Connect

    Becker, Lance B.; Hoek, Terry Vanden; Kasza, Kenneth E.

    2008-09-09

    Systems for phase-change particulate slurry cooling equipment and methods to induce hypothermia in a patient through internal and external cooling are provided. Subcutaneous, intravascular, intraperitoneal, gastrointestinal, and lung methods of cooling are carried out using saline ice slurries or other phase-change slurries compatible with human tissue. Perfluorocarbon slurries or other slurry types compatible with human tissue are used for pulmonary cooling. And traditional external cooling methods are improved by utilizing phase-change slurry materials in cooling caps and torso blankets.

  11. Antacid-induced osteomalacia.

    PubMed

    Boutsen, Y; Devogelaer, J P; Malghem, J; Noel, H; Nagant de Deuxchaisnes, C

    1996-01-01

    The case of a 49-year-old woman suffering from generalized skeletal pain and multiple fractures accompanied by severe hypophosphataemia and low urinary phosphorus excretion is reported. She had been taking large amounts of antacids containing aluminum hydroxide for many years. A diagnosis of antacid-induced osteomalacia was made. It was confirmed by biological work-up, radiographs and bone biopsy. A dramatic biological, osteodensitometric, and clinical improvement was achieved by withdrawal of antacids and phosphorus administration. The literature concerning this unusual condition has been reviewed.

  12. Drug-induced lupus.

    PubMed

    Rubin, Robert L

    2005-04-15

    Autoantibodies and, less commonly, systemic rheumatic symptoms are associated with treatment with numerous medications and other types of ingested compounds. Distinct syndromes can be distinguished, based on clinical and laboratory features, as well as exposure history. Drug-induced lupus has been reported as a side-effect of long-term therapy with over 40 medications. Its clinical and laboratory features are similar to systemic lupus erythematosus, except that patients fully recover after the offending medication is discontinued. This syndrome differs from typical drug hypersensitivity reactions in that drug-specific T-cells or antibodies are not involved in induction of autoimmunity, it usually requires many months to years of drug exposure, is drug dose-dependent and generally does not result in immune sensitization to the drug. Circumstantial evidence strongly suggests that oxidative metabolites of the parent compound trigger autoimmunity. Several mechanisms for induction of autoimmunity will be discussed, including bystander activation of autoreactive lymphocytes due to drug-specific immunity or to non-specific activation of lymphocytes, direct cytotoxicity with release of autoantigens and disruption of central T-cell tolerance. The latter hypothesis will be supported by a mouse model in which a reactive metabolite of procainamide introduced into the thymus results in lupus-like autoantibody induction. These findings, as well as evidence for thymic function in drug-induced lupus patients, support the concept that abnormalities during T-cell selection in the thymus initiate autoimmunity.

  13. [Exercise-induced anaphylaxis].

    PubMed

    Gani, Federica; Selvaggi, Lucia; Roagna, Davide

    2008-01-01

    Exercise-induced anaphylaxis (EIA) was defined for the first time in 1980. EIA is associated with different kind of exercise, although jogging is the most frequently reported. The clinical manifestations progress from itching, erythema and urticaria to some combination of cutaneous angioedema, gastrointestinal and laryngeal symptoms and signs of angioedema and vascular collapse. Mast cell participation in the pathogenesis of this syndrome has been proved by the finding of an elevated serum histamine level during experimentally-induced attacks and by cutaneous degranulation of mast cells with elevated serum tryptase after attacks. As predisposing factors of EIA, a specific or even aspecific sensitivity to food has been reported and such cases are called "food-dependent EIA". Many foods are implicated but particularly wheat, vegetables, crustacean. Another precipitating factor includes drugs intake (non steroidal anti-inflammatory drugs), climate variations and menstrual cycle factors. Treatment of an attack should include all the manoeuvres efficacious in the management of conventional anaphylactic syndrome, including the administration of epinephrine and antihistamines. Prevention of the attacks may be achieved with the interruption of the exercise at the appearance of the first premonitory symptoms. To prevent the onset of EIA it is also suitable to delay the exercise practice after at least 4-6 hours from the swallowing of food.

  14. Interferon induced thyroiditis.

    PubMed

    Tomer, Yaron; Menconi, Francesca

    2009-12-01

    Interferon-alpha (IFNalpha) is used for the treatment of various disorders, most notable chronic hepatitis C virus (HCV) infection. One of the commonest side effects of IFNalpha therapy is thyroiditis, with up to 40% of HCV patients on IFNalpha developing clinical or subclinical disease. In some cases interferon induced thyroiditis (IIT) may result in severe symptomatology necessitating discontinuation of therapy. IIT can manifest as clinical autoimmune thyroiditis, presenting with symptoms of classical Hashimoto's thyroiditis or Graves' disease, or as non-autoimmune thyroiditis. Non-autoimmune thyroiditis can manifest as destructive thyroiditis, with early thyrotoxicosis and later hypothyroidism, or as non-autoimmune hypothyroidism. While the epidemiology and clinical presentation of IIT have been well characterized the mechanisms causing IIT are still poorly understood. It is likely that the hepatitis C virus (HCV) itself plays a role in the disease, as the association between HCV infection and thyroiditis is well established. It is believed that IFNalpha induces thyroiditis by both immune stimulatory effects and by direct effects on the thyroid. Early detection and therapy of this condition are important in order to avoid complications of thyroid disease such as cardiac arrhythmias.

  15. [Gluten induced diseases].

    PubMed

    Frič, P; Zavoral, M; Dvořáková, T

    2013-05-01

    The introduction of cereals in human nutrition 10 000 years ago caused the occurrence of gluten induced diseases. This protein complex is involved in pathogenesis of wheat allergy, celiac disease, and gluten sensitivity. Wheat allergy and celiac disease are mediated by the system of adaptive immunity. Gluten sensitivity is a recently defined entity induced by innate immune mechanisms. These subjects present various intestinal and particularly extraintestinal symptoms. The differences between celiac disease and gluten intolerance include permeability of the intestinal mucosal barrier, histology of duodenal biopsy, and mucosal gene expression. The symptoms of gluten sensitivity may also have another genetic background of food intolerance independent of the HLADQ2, - DQ8 system and tissue transglutaminase (eg. in some psychiatric disorders). At present, there is no specific bio-marker of gluten sensitivity. The diagnosis is possible only by exclusion of other causes of symptoms and improvement on a glutenfree diet applied in a doubleblind placebo controlled manner with optional sequence of both stages to exclude the placebo effect due to nutritional intervention.

  16. Cholesterol depletion induces autophagy

    SciTech Connect

    Cheng, Jinglei; Ohsaki, Yuki; Tauchi-Sato, Kumi; Fujita, Akikazu; Fujimoto, Toyoshi . E-mail: tfujimot@med.nagoya-u.ac.jp

    2006-12-08

    Autophagy is a mechanism to digest cells' own components, and its importance in many physiological and pathological processes is being recognized. But the molecular mechanism that regulates autophagy is not understood in detail. In the present study, we found that cholesterol depletion induces macroautophagy. The cellular cholesterol in human fibroblasts was depleted either acutely using 5 mM methyl-{beta}-cyclodextrin or 10-20 {mu}g/ml nystatin for 1 h, or metabolically by 20 {mu}M mevastatin and 200 {mu}M mevalonolactone along with 10% lipoprotein-deficient serum for 2-3 days. By any of these protocols, marked increase of LC3-II was detected by immunoblotting and by immunofluorescence microscopy, and the increase was more extensive than that caused by amino acid starvation, i.e., incubation in Hanks' solution for several hours. The induction of autophagic vacuoles by cholesterol depletion was also observed in other cell types, and the LC3-positive membranes were often seen as long tubules, >50 {mu}m in length. The increase of LC3-II by methyl-{beta}-cyclodextrin was suppressed by phosphatidylinositol 3-kinase inhibitors and was accompanied by dephosphorylation of mammalian target of rapamycin. By electron microscopy, autophagic vacuoles induced by cholesterol depletion were indistinguishable from those seen after amino acid starvation. These results demonstrate that a decrease in cholesterol activates autophagy by a phosphatidylinositol 3-kinase-dependent mechanism.

  17. Statin-induced myopathies.

    PubMed

    Tomaszewski, Michał; Stępień, Karolina M; Tomaszewska, Joanna; Czuczwar, Stanisław J

    2011-01-01

    Statins are considered to be safe, well tolerated and the most efficient drugs for the treatment of hypercholesterolemia, one of the main risk factor for atherosclerosis, and therefore they are frequently prescribed medications. The most severe adverse effect of statins is myotoxicity, in the form of myopathy, myalgia, myositis or rhabdomyolysis. Clinical trials commonly define statin toxicity as myalgia or muscle weakness with creatine kinase (CK) levels greater than 10 times the normal upper limit. Rhabdomyolysis is the most severe adverse effect of statins, which may result in acute renal failure, disseminated intravascular coagulation and death. The exact pathophysiology of statin-induced myopathy is not fully known. Multiple pathophysiological mechanisms may contribute to statin myotoxicity. This review focuses on a number of them. The prevention of statin-related myopathy involves using the lowest statin dose required to achieve therapeutic goals and avoiding polytherapy with drugs known to increase systemic exposure and myopathy risk. Currently, the only effective treatment of statin-induced myopathy is the discontinuation of statin use in patients affected by muscle aches, pains and elevated CK levels.

  18. Drug-induced exanthems.

    PubMed

    Yawalkar, Nikhil

    2005-04-15

    Cutaneous adverse reactions to drugs can comprise a broad spectrum of clinical and histopathological features. Recent evidence from immunohistological and functional studies of drug-reactive T cells suggest that distinct T-cell functions may be responsible for this broad spectrum of different clinical reactions. Maculopapular exanthems represent the most commonly encountered cutaneous drug eruption. Previous studies on maculopapular exanthems indicate that drug-specific CD4+ T cells expressing cytotoxic granule proteins such as perforin and granzyme B are critically involved in killing activated keratinocytes. These cells are particularly found at the dermo-epidermal junction and may contribute to the generation of vacuolar alteration and destruction of basal keratinocytes, which are typical found in drug-induced maculopapular exanthems. In contrast to maculopapular exanthems, the preferential activation of drug-specific cytotoxic CD8+ T cells may lead to more severe reactions like bullous drug eruptions. Furthermore, activation of drug-specific T with distinct cytokine and chemokines profiles may also explain the different clinical features of drug-induced exanthems. IL-5 and eotaxin are upregulated in maculopapular exanthems and explain the eosinophilia often found in these reactions.

  19. Induced Seismicity Monitoring System

    NASA Astrophysics Data System (ADS)

    Taylor, S. R.; Jarpe, S.; Harben, P.

    2014-12-01

    There are many seismological aspects associated with monitoring of permanent storage of carbon dioxide (CO2) in geologic formations. Many of these include monitoring underground gas migration through detailed tomographic studies of rock properties, integrity of the cap rock and micro seismicity with time. These types of studies require expensive deployments of surface and borehole sensors in the vicinity of the CO2 injection wells. Another problem that may exist in CO2 sequestration fields is the potential for damaging induced seismicity associated with fluid injection into the geologic reservoir. Seismic hazard monitoring in CO2 sequestration fields requires a seismic network over a spatially larger region possibly having stations in remote settings. Expensive observatory-grade seismic systems are not necessary for seismic hazard deployments or small-scale tomographic studies. Hazard monitoring requires accurate location of induced seismicity to magnitude levels only slightly less than that which can be felt at the surface (e.g. magnitude 1), and the frequencies of interest for tomographic analysis are ~1 Hz and greater. We have developed a seismo/acoustic smart sensor system that can achieve the goals necessary for induced seismicity monitoring in CO2 sequestration fields. The unit is inexpensive, lightweight, easy to deploy, can operate remotely under harsh conditions and features 9 channels of recording (currently 3C 4.5 Hz geophone, MEMS accelerometer and microphone). An on-board processor allows for satellite transmission of parameter data to a processing center. Continuous or event-detected data is kept on two removable flash SD cards of up to 64+ Gbytes each. If available, data can be transmitted via cell phone modem or picked up via site visits. Low-power consumption allows for autonomous operation using only a 10 watt solar panel and a gel-cell battery. The system has been successfully tested for long-term (> 6 months) remote operations over a wide range

  20. Peripherally induced oromandibular dystonia

    PubMed Central

    Sankhla, C.; Lai, E.; Jankovic, J.

    1998-01-01

    OBJECTIVES—Oromandibular dystonia (OMD) is a focal dystonia manifested by involuntary muscle contractions producing repetitive, patterned mouth, jaw, and tongue movements. Dystonia is usually idiopathic (primary), but in some cases it follows peripheral injury. Peripherally induced cervical and limb dystonia is well recognised, and the aim of this study was to characterise peripherally induced OMD.
METHODS—The following inclusion criteria were used for peripherally induced OMD: (1) the onset of the dystonia was within a few days or months (up to 1 year) after the injury; (2) the trauma was well documented by the patient's history or a review of their medical and dental records; and (3) the onset of dystonia was anatomically related to the site of injury (facial and oral).
RESULTS—Twenty seven patients were identified in the database with OMD, temporally and anatomically related to prior injury or surgery. No additional precipitant other than trauma could be detected. None of the patients had any litigation pending. The mean age at onset was 50.11 (SD 14.15) (range 23-74) years and there was a 2:1 female preponderance. Mean latency between the initial trauma and the onset of OMD was 65 days (range 1 day-1 year). Ten (37%) patients had some evidence of predisposing factors such as family history of movement disorders, prior exposure to neuroleptic drugs, and associated dystonia affecting other regions or essential tremor. When compared with 21 patients with primary OMD, there was no difference for age at onset, female preponderance, and phenomenology. The frequency of dystonic writer's cramp, spasmodic dysphonia, bruxism, essential tremor, and family history of movement disorder, however, was lower in the post-traumatic group (p<0.05). In both groups the response to botulinum toxin treatment was superior to medical therapy (p<0.005). Surgical intervention for temporomandibular disorders was more frequent in the post-traumatic group and was associated with

  1. Drug-Induced Hematologic Syndromes

    PubMed Central

    Mintzer, David M.; Billet, Shira N.; Chmielewski, Lauren

    2009-01-01

    Objective. Drugs can induce almost the entire spectrum of hematologic disorders, affecting white cells, red cells, platelets, and the coagulation system. This paper aims to emphasize the broad range of drug-induced hematological syndromes and to highlight some of the newer drugs and syndromes. Methods. Medline literature on drug-induced hematologic syndromes was reviewed. Most reports and reviews focus on individual drugs or cytopenias. Results. Drug-induced syndromes include hemolytic anemias, methemoglobinemia, red cell aplasia, sideroblastic anemia, megaloblastic anemia, polycythemia, aplastic anemia, leukocytosis, neutropenia, eosinophilia, immune thrombocytopenia, microangiopathic syndromes, hypercoagulability, hypoprothrombinemia, circulating anticoagulants, myelodysplasia, and acute leukemia. Some of the classic drugs known to cause hematologic abnormalities have been replaced by newer drugs, including biologics, accompanied by their own syndromes and unintended side effects. Conclusions. Drugs can induce toxicities spanning many hematologic syndromes, mediated by a variety of mechanisms. Physicians need to be alert to the potential for iatrogenic drug-induced hematologic complications. PMID:19960059

  2. Induced seismicity. Final report

    SciTech Connect

    Segall, P.

    1997-09-18

    The objective of this project has been to develop a fundamental understanding of seismicity associated with energy production. Earthquakes are known to be associated with oil, gas, and geothermal energy production. The intent is to develop physical models that predict when seismicity is likely to occur, and to determine to what extent these earthquakes can be used to infer conditions within energy reservoirs. Early work focused on earthquakes induced by oil and gas extraction. Just completed research has addressed earthquakes within geothermal fields, such as The Geysers in northern California, as well as the interactions of dilatancy, friction, and shear heating, on the generation of earthquakes. The former has involved modeling thermo- and poro-elastic effects of geothermal production and water injection. Global Positioning System (GPS) receivers are used to measure deformation associated with geothermal activity, and these measurements along with seismic data are used to test and constrain thermo-mechanical models.

  3. [Tachycardia-induced cardiomyopathy].

    PubMed

    Povolný, Jan

    2015-01-01

    Cardiomyopathy is a heterogeneous group of diseases of heart muscle accompanied with impaired cardiac function. Tachycardia-induced cardiomyopathy (TIC) is caused by prolonged tachycardia leading to dilatation and systolic dysfunction with clinical manifestation of heart failure. This state is reversible after normalization of heart rate. The diagnosis is usually made retrospectively after normalization of heart rate and recovery of left ventricular function (LVF). More than 100 years after the first documented case (described in 1913 in a young patient with atrial fibrillation and symptoms of heart failure [25]) is still limited knowledge of pathophysiological mechanisms. The most common arrhythmias responsible for the TIC include atrial fibrillation [1,2], atrial flutter [3], incessant supraventricular tachycardia [4], ventricular tachycardia (VT) [5] and frequent ventricular extrasystoles (VES) [6]. TIC detection and therapeutic intervention is crucial considering potential reversibility of tachycardia. Current options of treatment involve drug therapy and surgical or catheter ablation.

  4. Radiation-Induced Bioradicals

    NASA Astrophysics Data System (ADS)

    Lahorte, Philippe; Mondelaers, Wim

    This chapter represents the second part of a review in which the production and application of radiation-induced radicals in biological matter are discussed. In part one the general aspects of the four stages (physical, physicochemical, chemical and biological) of interaction of radiation with matter in general and biological matter in particular, were discussed. Here an overview is presented of modem technologies and theoretical methods available for studying these radiation effects. The relevance is highlighted of electron paramagnetic resonance spectroscopy and quantum chemical calculations with respect to obtaining structural information on bioradicals, and a survey is given of the research studies in this field. We also discuss some basic aspects of modem accelerator technologies which can be used for creating radicals and we conclude with an overview of applications of radiation processing in biology and related fields such as biomedical and environmental engineering, food technology, medicine and pharmacy.

  5. [Cannabis-induced disorders].

    PubMed

    Soyka, M; Preuss, U; Hoch, E

    2017-03-01

    Use and misuse of cannabis and marihuana are frequent. About 5% of the adult population are current users but only 1.2% are dependent. The medical use of cannabis is controversial but there is some evidence for improvement of chronic pain and spasticity. The somatic toxicity of cannabis is well proven but limited and psychiatric disorders induced by cannabis are of more relevance, e.g. cognitive disorders, amotivational syndrome, psychoses and delusional disorders as well as physical and psychological dependence. The withdrawal symptoms are usually mild and do not require pharmacological interventions. To date there is no established pharmacotherapy for relapse prevention. Psychosocial interventions include psychoeducation, behavioral therapy and motivational enhancement. The CANDIS protocol is the best established German intervention among abstinence-oriented therapies.

  6. Catatonia induced by levetiracetam.

    PubMed

    Chouinard, Marie-Josée; Nguyen, Dang-Khoa; Clément, Jean-François; Bruneau, Marie-Andrée

    2006-02-01

    Levetiracetam (Keppra) is a novel antiepileptic drug approved as adjunctive treatment for adults with partial onset seizures. Although the drug is generally well tolerated, behavioral side effects have been reported in variable frequency. Most behavioral problems are mild in nature (agitation, hostility, anxiety, emotional lability, apathy, depression) and quickly resolve with discontinuation of medication. However, serious psychiatric adverse events may also occur with rare cases of psychosis and suicidal behavior. We report here the case of a 43-year-old woman who developed symptoms compatible with catatonia after being exposed to levetiracetam for the treatment of epilepsy. To our knowledge, it is the first reported case of catatonia induced by levetiracetam. We review the difficulties that may be encountered in the differential diagnosis of medical catatonia.

  7. Gadolinium-Induced Fibrosis.

    PubMed

    Todd, Derrick J; Kay, Jonathan

    2016-01-01

    Gadolinium-based contrast agents (GBCAs), once believed to be safe for patients with renal disease, have been strongly associated with nephrogenic systemic fibrosis (NSF), a severe systemic fibrosing disorder that predominantly afflicts individuals with advanced renal dysfunction. We provide a historical perspective on the appearance and disappearance of NSF, including its initial recognition as a discrete clinical entity, its association with GBCA exposure, and the data supporting a causative relationship between GBCA exposure and NSF. On the basis of this body of evidence, we propose that the name gadolinium-induced fibrosis (GIF) more accurately reflects the totality of knowledge regarding this disease. Use of high-risk GBCAs, such as formulated gadodiamide, should be avoided in patients with renal disease. Restriction of GBCA use in this population has almost completely eradicated new cases of this debilitating condition. Emerging antifibrotic therapies may be useful for patients who suffer from GIF.

  8. [Designer drug induced psychosis].

    PubMed

    Fullajtar, Mate; Ferencz, Csaba

    2012-06-01

    3,4-methylene-dioxy-pyrovalerone (MDPV) is a popular designer drug in Hungary, known as MP4. We present a case of a 34-year-old man, whose first psychotic episode was observed in the presence of MP4 use. The paranoid ideas of reference and the dereistic thinking could be the consequence of drug-induced psychosis. Within 24 hours after the intoxication was over delirium set in. The patient's history included only the use of MP4, use of other kinds of drugs was negated. The drug tests were negative, amphetamine derivates were not detectable in the urine sample. It is most likely that the MP4 pill contained an amount of MDPV less than detectable. In conclusion we suggest that the clinical picture could be the consequence of regular MDPV use.

  9. Laser-induced bioluminescence

    SciTech Connect

    Hickman, G.D.; Lynch, R.V. III

    1981-01-01

    A project has been initiated to determine the feasibility of developing a complete airborne remote sensing system for rapidly mapping high concentration patches of bioluminescent organisms in the world's oceans. Conceptually, this system would be composed of a laser illuminator to induce bioluminescence and a low light level image intensifier for detection of light. Initial laboratory measurements consisted of using a 2-J flash lamp pulsed optical dye laser to excite bioluminescence in the marine dinoflagellate Pyrocustis lunula at ambient temperature using Rhodamine 6G as the lasing dye (585 nm) and a laser pulse width of 1 microsec. After a latency period of 15-20 msec, the bioluminescence maximum occurred in the blue (480 nm is the wavelength maximum for most dinoflagellate bioluminescence) with the peaking occurring approximately 65 msec after the laser pulse. Planned experiments will investigate the effect of different excitation wavelengths and energies at various temperatures and salinities of the cultures.

  10. Radiation Induced Oral Mucositis

    PubMed Central

    PS, Satheesh Kumar; Balan, Anita; Sankar, Arun; Bose, Tinky

    2009-01-01

    Patients receiving radiotherapy or chemotherapy will receive some degree of oral mucositis The incidence of oral mucositis was especially high in patients: (i) With primary tumors in the oral cavity, oropharynx, or nasopharynx; (ii) who also received concomitant chemotherapy; (iii) who received a total dose over 5,000 cGy; and (iv) who were treated with altered fractionation radiation schedules. Radiation-induced oral mucositis affects the quality of life of the patients and the family concerned. The present day management of oral mucositis is mostly palliative and or supportive care. The newer guidelines are suggesting Palifermin, which is the first active mucositis drug as well as Amifostine, for radiation protection and cryotherapy. The current management should focus more on palliative measures, such as pain management, nutritional support, and maintenance, of good oral hygiene PMID:20668585

  11. [Drug-induced asterixis].

    PubMed

    Rittmannsberger, H; Leblhuber, F

    1994-04-22

    A 54-year-old woman with acute schizoaffective psychosis was treated with lithium carbonate (1,350 mg daily) and zuclopenthixol. On admission, clozapine was added (250 mg daily). Because extrapyramidal symptoms (rigor, akinesia) developed, she was additionally given biperiden retard (4 mg daily) from the fourth hospital day onwards. Eleven days after admission she began to complain of "unsteadiness" and "tremors" in her arms and she had asterixis (flapping tremor) on holding up her arms. The electromyogram showed electrical pauses of 60-120 ms, typical for asterixis. There were no significant metabolic or organic cerebral changes that could have accounted for the symptoms which presumably had been induced by the drugs even though their dosage was not unusual. The symptoms in fact regressed completely after the clozapine dose had been reduced, at first to 125 mg then to 50 mg. Previous experience has suggested that the risk of asterixis is particularly high when lithium and clozapine are taken together.

  12. Load Induced Blindness

    PubMed Central

    Macdonald, James S. P.; Lavie, Nilli

    2008-01-01

    Although the perceptual load theory of attention has stimulated a great deal of research, evidence for the role of perceptual load in determining perception has typically relied on indirect measures that infer perception from distractor effects on reaction times or neural activity (see N. Lavie, 2005d`) was consistently reduced with high, compared to low, perceptual load but was unaffected by the level of working memory load. Because alternative accounts in terms of expectation, memory, response bias, and goal-neglect due to the more strenuous high load task were ruled out, these experiments clearly demonstrate that high perceptual load determines conscious perception, impairing the ability to merely detect the presence of a stimulus—a phenomenon of load induced blindness. PMID:18823196

  13. DNA Damage Induced Neuronal Death

    DTIC Science & Technology

    1999-10-01

    Experiments are proposed to examine the molecular mechanism by which mustard chemical warfare agents induce neuronal cell death . DNA damage is the...proposed underlying mechanism of mustard-induced neuronal cell death . We propose a novel research strategy to test this hypothesis by using mice with...perturbed DNA repair to explore the relationship between mustard-induced DNA damage and neuronal cell death . Initial in vitro studies (Years 1, 2 & 3

  14. Pertussis-induced cough.

    PubMed

    Wang, Kay; Harnden, Anthony

    2011-06-01

    Pertussis (whooping cough) is one of the commonest vaccine preventable diseases in the UK, despite vaccination coverage being maintained for the last 15 years at over 90% among infants and the addition of a pre-school booster to the UK national immunisation programme in 2001. However, it is known that pertussis vaccine does not confer long-term immunity to clinical infection. Evidence of pertussis infection has been reported in 37% of children presenting in UK primary care and 20% of adolescents and adults presenting in Canadian health centres with persistent cough. In children and adults with persistent cough, paroxysmal coughing is the most sensitive indicator of pertussis, but has poor specificity and limited diagnostic value. Vomiting and whooping, particularly in combination, are stronger predictors of pertussis. Cough duration is longer in children than in adults with pertussis (median cough duration 112 days versus 42 days); individuals may take even longer to recover fully and regain previous levels of exercise tolerance. A diagnosis of pertussis may be confirmed by culture, Polymerase Chain Reaction (PCR) or serology. Single estimates of anti-pertussis toxin (PT) antibody titres in blood or oral fluid samples are highly specific. There are currently no proven efficacious treatments for pertussis-induced cough. Treatment with macrolide antibiotics reduces the duration of an individual's infectious period, but does not alter the duration of cough. Further research is needed to re-examine the epidemiology of pertussis in countries with different vaccination schedules, find efficacious treatments and develop methods of measuring cough frequency and severity in patients with pertussis-induced cough.

  15. Bellows flow-induced vibrations

    NASA Technical Reports Server (NTRS)

    Tygielski, P. J.; Smyly, H. M.; Gerlach, C. R.

    1983-01-01

    The bellows flow excitation mechanism and results of comprehensive test program are summarized. The analytical model for predicting bellows flow induced stress is refined. The model includes the effects of an upstream elbow, arbitrary geometry, and multiple piles. A refined computer code for predicting flow induced stress is described which allows life prediction if a material S-N diagram is available.

  16. Fishbone-induced perforated appendicitis.

    PubMed

    Bababekov, Yanik J; Stanelle, Eric J; Abujudeh, Hani H; Kaafarani, Haytham M A

    2015-05-20

    We review the literature and describe a case of fishbone-induced appendicitis. A 63-year-old man presented with abdominal pain. Work up including a focused history and imaging revealed fishbone-induced perforated appendicitis. The patient was managed safely and successfully with laparoscopic removal of the foreign body and appendectomy.

  17. Clofibrate-Induced Antidiuresis

    PubMed Central

    Moses, Arnold M.; Howanitz, Joan; Gemert, Marcia Van; Miller, Myron

    1973-01-01

    Normal subjects and patients with antidiuretic hormone (ADH) deficiency were studied to determine the mechanism of the antidiuretic action of clofibrate. Before clofibrate treatment, the patients' ability to concentrate urine with a standardized dehydration procedure correlated with the amount of ADH which was excreted. During clofibrate administration all six patients with ADH deficiency developed an antidiuresis which was like that of ADH, since there was no change in sodium, potassium, total solute, or creatinine excretion. There was a correlation between the patients' ability to concentrate urine during dehydration and the subsequent response to clofibrate, and the excretion of ADH during dehydration correlated with the excretion of ADH on clofibrate therapy. Clofibrate-induced antidiuresis in these patients was partially overcome by ethanol and by water loading. Clofibrate interfered with the ability of patients and subjects to excrete a water load and prevented the water load from inhibiting ADH excretion in the normal subjects. These studies suggested that clofibrate was acting through endogenous ADH and this thesis was supported by the failure of clofibrate to produce an antidiuresis when injected into rats with total ADH deficiency (Brattleboro strain) although an antidiuresis was produced in water-loaded normal rats. When the drug was injected into Brattleboro rats with exogenous ADH, clofibrate either did not alter or it inhibited the action of the ADH. The data demonstrate that clofibrate has a significant ADH-like action. This action appears to be mediated through the release of endogenous ADH. Images PMID:4685079

  18. Chemotherapy-induced alopecia.

    PubMed

    Trüeb, Ralph M

    2009-03-01

    Few dermatologic conditions carry as much emotional distress as chemotherapy-induced alopecia (CIA). The prerequisite for successful development of strategies for CIA prevention is the understanding of the pathobiology of CIA. The incidence and severity of CIA are variable and related to the particular chemotherapeutic protocol. CIA is traditionally categorized as acute diffuse hair loss caused by dystrophic anagen effluvium; however, CIA presents with different clinical patterns of hair loss. When an arrest of mitotic activity occurs, obviously numerous and interacting factors influence the shedding pattern. The major approach to minimize CIA is by scalp cooling. Unfortunately, most published data on scalp cooling are of poor quality. Several experimental approaches to the development of pharmacologic agents are under evaluation and include drug-specific antibodies, hair growth cycle modifiers, cytokines and growth factors, antioxidants, inhibitors of apoptosis, and cell-cycle and proliferation modifiers. Ultimately, the protection should be selective to the hair follicle; for example, topical application, such that the anticancer efficacy of chemotherapy is not hampered. Among the few agents that have been evaluated so far in humans, AS101 and minoxidil were able to reduce the severity or shorten the duration of CIA, but could not prevent CIA.

  19. [Cold-induced urticaria].

    PubMed

    Delorme, N; Drouet, M; Thibaudeau, A; Verret, J L

    2002-09-01

    Cold urticaria is characterized by the development of urticaria, usually superficial and/or angioedematous reaction after cold contact. It was found predominantly in young women. The diagnosis is based on the history and ice cube test. Patients with a negative ice cube test may have represented systemic cold urticaria (atypical acquired cold urticaria) induced by general body cooling. The pathogenesis is poorly understood. Cold urticaria can be classified into acquired and familial disorders, with an autosomal dominant inheritance. Idiopathic cold urticaria is most common type but the research of a cryopathy is necessary. Therapy is often difficult. It is essential that the patient be warned of the dangers of swimming in cold water because systemic hypotension can occur. H1 antihistamines can be used for treatment of cold urticaria but the clinical responses are highly variable. The combination with an H2 antagonists is more effective. Doxepin may be useful in the treatment. Leukotriene receptor antagonists may be a novel, promising drug entity. In patients who do not respond to previous treatments, induction of cold tolerance may be tried.

  20. Discreteness inducing coexistence

    NASA Astrophysics Data System (ADS)

    dos Santos, Renato Vieira

    2013-12-01

    Consider two species that diffuse through space. Consider further that they differ only in initial densities and, possibly, in diffusion constants. Otherwise they are identical. What happens if they compete with each other in the same environment? What is the influence of the discrete nature of the interactions on the final destination? And what are the influence of diffusion and additive fluctuations corresponding to random migration and immigration of individuals? This paper aims to answer these questions for a particular competition model that incorporates intra and interspecific competition between the species. Based on mean field theory, the model has a stationary state dependent on the initial density conditions. We investigate how this initial density dependence is affected by the presence of demographic multiplicative noise and additive noise in space and time. There are three main conclusions: (1) Additive noise favors denser populations at the expense of the less dense, ratifying the competitive exclusion principle. (2) Demographic noise, on the other hand, favors less dense populations at the expense of the denser ones, inducing equal densities at the quasi-stationary state, violating the aforementioned principle. (3) The slower species always suffers the more deleterious effects of statistical fluctuations in a homogeneous medium.

  1. Laughter-induced syncope.

    PubMed

    Kim, Alexander J; Frishman, William H

    2012-01-01

    Reported cases of syncope caused directly by laughter are rare. The common scenario described in a few reports involved episodes of fortuitous laughter, sometimes followed by a short prodrome of lightheadedness, facial flushing, and dizziness, followed by an episode of definite syncope. There were no seizure-like movements, automatisms, or bladder or bowel incontinence. After the syncopal episodes that were seconds in length, the patients regained consciousness, and at that point were fully oriented. These episodes could recur in a similar situation with such laughter. Many of these patients subsequently underwent full syncope workups, without elucidating a primary cardiac or neurologic cause. In this review of laughter-induced syncope, we describe a patient of ours who fit these descriptions. This phenomenon is likely a subtype of benign Valsalva-related syncope, with autonomic reflex arcs coming into play that ultimately result in global cerebral hypoperfusion. Besides the Valsalva produced by a great fit of laughter, laughter itself has its own neuroendocrine and vasculature effects that may play a role.

  2. Inductive source induced polarization

    NASA Astrophysics Data System (ADS)

    Marchant, David; Haber, Eldad; Oldenburg, Douglas W.

    2013-02-01

    Induced polarization (IP) surveys are commonly performed to map the distribution of electrical chargeability that is a diagnostic physical property in mineral exploration and in many environmental problems. Although these surveys have been successful in the past, the galvanic sources required for traditional IP and magnetic IP (MIP) surveys prevent them from being applied in some geological settings. We develop a new methodology for processing frequency domain EM data to identify the presence of IP effects in observations of the magnetic fields arising from an inductive source. The method makes use of the asymptotic behaviour of the secondary magnetic fields at low frequency. A new quantity, referred to as the ISIP datum, is defined so that it equals zero at low frequencies for any frequency-independent (non-chargeable) conductivity distribution. Thus, any non-zero response in the ISIP data indicates the presence of chargeable material. Numerical simulations demonstrate that the method can be applied even in complicated geological situations. A 3-D inversion algorithm is developed to recover the chargeability from the ISIP data and the inversion is demonstrated on synthetic examples.

  3. Load induced blindness.

    PubMed

    Macdonald, James S P; Lavie, Nilli

    2008-10-01

    Although the perceptual load theory of attention has stimulated a great deal of research, evidence for the role of perceptual load in determining perception has typically relied on indirect measures that infer perception from distractor effects on reaction times or neural activity (see N. Lavie, 2005, for a review). Here we varied the level of perceptual load in a letter-search task and assessed its effect on the conscious perception of a search-irrelevant shape stimulus appearing in the periphery, using a direct measure of awareness (present/absent reports). Detection sensitivity (d') was consistently reduced with high, compared to low, perceptual load but was unaffected by the level of working memory load. Because alternative accounts in terms of expectation, memory, response bias, and goal-neglect due to the more strenuous high load task were ruled out, these experiments clearly demonstrate that high perceptual load determines conscious perception, impairing the ability to merely detect the presence of a stimulus--a phenomenon of load induced blindness.

  4. Loperamide-induced hypopituitarism

    PubMed Central

    Napier, Catherine; Gan, Earn H; Pearce, Simon H S

    2016-01-01

    Loperamide is the most commonly used antidiarrhoeal medication in the UK. We report a serious and hitherto undocumented adverse effect of chronic use in a 45-year-old man with inflammatory bowel disease. He presented to the endocrine clinic with fatigue and low libido; biochemical assessment revealed hypogonadism and adrenal insufficiency without any elevated adrenocorticotropic hormone. When symptoms allowed, loperamide was reduced and a short synacthen test (SST) showed a ‘clear pass’ with a normal peak cortisol of 833 nmol/L. Later, worsening diarrhoea necessitated an escalation in loperamide use again. While taking a daily dose of 15–20 mg (recommended daily maximum 16 mg) reassessment revealed a fall in peak cortisol on SST to 483 nmol/L, a subnormal response. Clinicians should exercise caution when relying on loperamide to manage their patients’ chronic diarrhoea and remain mindful of the possibility of drug-induced life-threatening adrenal insufficiency. PMID:27681351

  5. Immunotoxicity risks associated with land-treatment of petrochemical wastes revealed using an in situ rodent model.

    PubMed

    Rafferty, D P; Lochmiller, R L; McBee, K; Qualls, C W; Basta, N T

    2001-01-01

    Land-treatment of petrochemical wastes is a widely used method to dispose of hazardous and non-hazardous waste by biodegradation. However, no comprehensive assessment of the impact of such disposal techniques on terrestrial ecosystems has been conducted. Despite the presence of suspected immunotoxicants in the soil, wild rodents frequently reside on these waste sites after closure or abandonment. We explored the seasonal sensitivity of the immune system of the hispid cotton rat (Sigmodon hispidus) to in situ exposures on sites land-treated with petrochemical wastes. Animals were monitored on five contaminated land-treatment sites and five ecologically matched-reference sites in Oklahoma, USA, over two seasons (summer and winter). Most hematological parameters were not adversely affected by land-treatment; however, platelet counts were 26% greater in cotton rats from land-treatment sites compared to reference sites in winter. Significant treatment-related differences were observed in total serum protein concentrations, organ mass and organ cellularity, but these differences were not consistent across the five land-treatment units. Lymphoproliferative responses of cotton rat splenocytes stimulated in vitro were elevated for a T-cell mitogen and depressed for a B-cell mitogen in animals from land-treatment compared to reference sites. The ability of splenocytes to proliferate in response to interleukin-2 receptor-binding was not influenced by treatment. Total yields of peritoneal cells, yield of peritoneal macrophages, and yield of peritoneal lymphocytes were influenced to varying degrees by land-treatment. Functionally, in vitro metabolic activity of peritoneal macrophages was 114% greater in cotton rats from land-treatment sites compared to reference sites during summer. These results indicate that petrochemical wastes applied to soils on these five land-treatment sites had variable immunomodulatory effects in resident cotton rats. Immune alterations for some assays were indicative of enhancement on some land-treatment sites while suppressive on other land-treatment sites, which could have been a function of type and concentration of immunotoxicants present on each site and highlights the uniqueness of each land-treatment site.

  6. Evaluation of the utility of popliteal lymph node examination in a cyclophosphamide model of immunotoxicity in the rat.

    PubMed

    Lapointe, Jean-Martin; Valdez, Reginald A; Ryan, Anne M; Haley, Patrick J

    2016-07-01

    The objective of this study was to characterize the variability of rat lymphoid organ weights and morphology following treatment with a known immunotoxicant, with a focus on the usefulness of evaluating popliteal lymph node weight and histology. Cyclophosphamide was administered to male Sprague-Dawley rats by oral gavage at doses of 2, 7 or 12 mg/kg/day for 10 consecutive days. Left and right popliteal lymph nodes (PLN), spleen and thymus were collected at necropsy, weighed, fixed and processed for histopathology. Femoral bone marrow was also collected, fixed and processed for histology. Organ weight variability was greater for PLN than for either spleen or thymus in control animals. There was a significant but weak correlation between paired left and right PLN weights (p < 0.005; r(2) = 0.2774). Significant treatment-related decreases in lymphoid organ weights were observed in spleen and thymus at ≥ 7 mg/kg/day (p < 0.01), whereas in PLN a significant decrease (p < 0.05) was noted only at 12 mg/kg/day. The inclusion of PLN did not enhance the sensitivity of detection of systemic treatment-related changes in lymphoid organs in a rat cyclophosphamide model.

  7. Immunotoxicity of perfluorooctanoic acid and perfluorooctane sulfonate and the role of peroxisome proliferator-activated receptor alpha

    EPA Science Inventory

    Peroxisome proliferators, including perfluorooctanoic acid (PFOA), are environmentally widespread and persistent and multiple toxicities have been reported in experimental animals and humans. These compounds trigger biological activity via activation of the alpha isotype of pero...

  8. IMMUNOTOXICITY OF DlBROMOACETIC ACID ADMINISTERED VIA DRINKING WATER TO FEMALE B6C3Fl MICE

    EPA Science Inventory

    Dibromoacetic acid (DBA) is a disinfection by product commonly found in drinking water as a result of chlorination/ozonation processes. The EPA estimates that more than 200 million people consume disinfected water in the U.S. (EPA 1998). This study was conducted to evaluate the p...

  9. Cis-urocanic acid increases immunotoxicity and lethality of dermally administered permethrin in C57BL/6N mice.

    PubMed

    Prater, M R; Gogal, R M; Blaylock, B L; Holladay, S D

    2003-01-01

    Immunomodulatory effects of a single topical permethrin exposure, 5-day exposure to cis-urocanic acid (cUCA), or a combination of the two chemicals were evaluated in 4- to 5-week-old female C57BL/6N mice. Permethrin alone decreased thymic weight and cellularity. Although cUCA alone did not affect thymic end points, coexposure to topical permethrin and cUCA exacerbated the thymolytic effects of permethrin. The single topical dose of permethrin also depressed several immune responses in isolated splenic leukocytes. This included splenic T-cell proliferative response to mitogen, splenic macrophage hydrogen peroxide production, and splenic B lymphocyte-specific antibody production. Unlike the effect of coexposure to these agents on thymic end points, cUCA did not exacerbate permethrin's adverse effect on any of the splenic end points examined. These results appear to suggest divergent mechanisms by which these compounds affect precursor and functionally mature T cells. At the doses used in this study, permethrin caused neurotoxic effects, including lethality, in a portion of the mice. For undetermined reasons, cUCA significantly increased the rate of lethality caused by permethrin. Although the permethrin doses used in this study exceed that typically used in human medicine, these results raise some concerns about the possibility that sunlight, via cUCA, may increase the risk of adverse central nervous system and immune effects caused by permethrin alone.

  10. A quantitative multiplex nuclease protection assay reveals immunotoxicity gene expression profiles in the rabbit model for vaginal drug safety evaluation.

    PubMed

    Fichorova, Raina N; Mendonca, Kevin; Yamamoto, Hidemi S; Murray, Ryan; Chandra, Neelima; Doncel, Gustavo F

    2015-06-15

    Any vaginal product that alters the mucosal environment and impairs the immune barrier increases the risk of sexually transmitted infections, especially HIV infection, which thrives on mucosal damage and inflammation. The FDA-recommended rabbit vaginal irritation (RVI) model serves as a first line selection tool for vaginal products; however, for decades it has been limited to histopathology scoring, insufficient to select safe anti-HIV microbicides. In this study we incorporate to the RVI model a novel quantitative nuclease protection assay (qNPA) to quantify mRNA levels of 25 genes representing leukocyte differentiation markers, toll-like receptors (TLR), cytokines, chemokines, epithelial repair, microbicidal and vascular markers, by designing two multiplex arrays. Tissue sections were obtained from 36 rabbits (6 per treatment arm) after 14 daily applications of a placebo gel, saline, 4% nonoxynol-9 (N-9), and three combinations of the anti-HIV microbicides tenofovir (TFV) and UC781 in escalating concentrations (highest: 10% TFV+2.5%UC781). Results showed that increased expression levels of toll-like receptor (TLR)-4, interleukin (IL)-1β, CXCL8, epithelial membrane protein (EMP)-1 (P<0.05), and decreased levels of TLR2 (P<0.05), TLR3 and bactericidal permeability increasing protein (BPI) (P<0.001) were associated with cervicovaginal mucosal alteration (histopathology). Seven markers showed a significant linear trend predicting epithelial damage (up with CD4, IL-1β, CXCL8, CCL2, CCL21, EMP1 and down with BPI). Despite the low tissue damage RVI scores, the high-dose microbicide combination gel caused activation of HIV host cells (SLC and CD4) while N-9 caused proinflammatory gene upregulation (IL-8 and TLR4) suggesting a potential for increasing risk of HIV via different mechanisms depending on the chemical nature of the test product.

  11. A quantitative multiplex nuclease protection assay reveals immunotoxicity gene expression profiles in the rabbit model for vaginal drug safety evaluation

    SciTech Connect

    Fichorova, Raina N.; Mendonca, Kevin; Yamamoto, Hidemi S.; Murray, Ryan; Chandra, Neelima; Doncel, Gustavo F.

    2015-06-15

    Any vaginal product that alters the mucosal environment and impairs the immune barrier increases the risk of sexually transmitted infections, especially HIV infection, which thrives on mucosal damage and inflammation. The FDA-recommended rabbit vaginal irritation (RVI) model serves as a first line selection tool for vaginal products; however, for decades it has been limited to histopathology scoring, insufficient to select safe anti-HIV microbicides. In this study we incorporate to the RVI model a novel quantitative nuclease protection assay (qNPA) to quantify mRNA levels of 25 genes representing leukocyte differentiation markers, toll-like receptors (TLR), cytokines, chemokines, epithelial repair, microbicidal and vascular markers, by designing two multiplex arrays. Tissue sections were obtained from 36 rabbits (6 per treatment arm) after 14 daily applications of a placebo gel, saline, 4% nonoxynol-9 (N-9), and three combinations of the anti-HIV microbicides tenofovir (TFV) and UC781 in escalating concentrations (highest: 10% TFV + 2.5%UC781). Results showed that increased expression levels of toll-like receptor (TLR)-4, interleukin (IL)-1β, CXCL8, epithelial membrane protein (EMP)-1 (P < 0.05), and decreased levels of TLR2 (P < 0.05), TLR3 and bactericidal permeability increasing protein (BPI) (P < 0.001) were associated with cervicovaginal mucosal alteration (histopathology). Seven markers showed a significant linear trend predicting epithelial damage (up with CD4, IL-1β, CXCL8, CCL2, CCL21, EMP1 and down with BPI). Despite the low tissue damage RVI scores, the high-dose microbicide combination gel caused activation of HIV host cells (SLC and CD4) while N-9 caused proinflammatory gene upregulation (IL-8 and TLR4) suggesting a potential for increasing risk of HIV via different mechanisms depending on the chemical nature of the test product. - Highlights: • A transcriptome nuclease protection assay assessed microbicides for vaginal safety. • Biomarkers were correlated with histopathology in paraffin-embedded rabbit tissues. • Compounds differed by effects on putative pathways of increased risk of HIV. • Nonsoxynol-9 caused inflammatory tissue damage involving TLR4 and IL-8. • An antiretroviral combination stimulated immune cells evidenced by SLC and CD4.

  12. Extreme geomagnetically induced currents

    NASA Astrophysics Data System (ADS)

    Kataoka, Ryuho; Ngwira, Chigomezyo

    2016-12-01

    We propose an emergency alert framework for geomagnetically induced currents (GICs), based on the empirically extreme values and theoretical upper limits of the solar wind parameters and of d B/d t, the time derivative of magnetic field variations at ground. We expect this framework to be useful for preparing against extreme events. Our analysis is based on a review of various papers, including those presented during Extreme Space Weather Workshops held in Japan in 2011, 2012, 2013, and 2014. Large-amplitude d B/d t values are the major cause of hazards associated with three different types of GICs: (1) slow d B/d t with ring current evolution (RC-type), (2) fast d B/d t associated with auroral electrojet activity (AE-type), and (3) transient d B/d t of sudden commencements (SC-type). We set "caution," "warning," and "emergency" alert levels during the main phase of superstorms with the peak Dst index of less than -300 nT (once per 10 years), -600 nT (once per 60 years), or -900 nT (once per 100 years), respectively. The extreme d B/d t values of the AE-type GICs are 2000, 4000, and 6000 nT/min at caution, warning, and emergency levels, respectively. For the SC-type GICs, a "transient alert" is also proposed for d B/d t values of 40 nT/s at low latitudes and 110 nT/s at high latitudes, especially when the solar energetic particle flux is unusually high.

  13. Drug-Induced Metabolic Acidosis

    PubMed Central

    Pham, Amy Quynh Trang; Xu, Li Hao Richie; Moe, Orson W.

    2015-01-01

    Metabolic acidosis could emerge from diseases disrupting acid-base equilibrium or from drugs that induce similar derangements. Occurrences are usually accompanied by comorbid conditions of drug-induced metabolic acidosis, and clinical outcomes may range from mild to fatal. It is imperative that clinicians not only are fully aware of the list of drugs that may lead to metabolic acidosis but also understand the underlying pathogenic mechanisms. In this review, we categorized drug-induced metabolic acidosis in terms of pathophysiological mechanisms, as well as individual drugs’ characteristics. PMID:26918138

  14. Pregnancy-Induced hypertension.

    PubMed

    Kintiraki, Evangelia; Papakatsika, Sophia; Kotronis, George; Goulis, Dimitrios G; Kotsis, Vasilios

    2015-01-01

    Pregnancy-induced hypertension (PIH) complicates 6-10% of pregnancies. It is defined as systolic blood pressure (SBP) >140 mmHg and diastolic blood pressure (DBP) >90 mmHg. It is classified as mild (SBP 140-149 and DBP 90-99 mmHg), moderate (SBP 150-159 and DBP 100-109 mmHg) and severe (SBP ≥ 160 and DBP ≥ 110 mmHg). PIH refers to one of four conditions: a) pre-existing hypertension, b) gestational hypertension and preeclampsia (PE), c) pre-existing hypertension plus superimposed gestational hypertension with proteinuria and d) unclassifiable hypertension. PIH is a major cause of maternal, fetal and newborn morbidity and mortality. Women with PIH are at a greater risk of abruptio placentae, cerebrovascular events, organ failure and disseminated intravascular coagulation. Fetuses of these mothers are at greater risk of intrauterine growth retardation, prematurity and intrauterine death. Ambulatory blood pressure monitoring over a period of 24 h seems to have a role in predicting deterioration from gestational hypertension to PE. Antiplatelet drugs have moderate benefits when used for prevention of PE. Treatment of PIH depends on blood pressure levels, gestational age, presence of symptoms and associated risk factors. Non-drug management is recommended when SBP ranges between 140-149 mmHg or DBP between 90-99 mmHg. Blood pressure thresholds for drug management in pregnancy vary between different health organizations. According to 2013 ESH/ESC guidelines, antihypertensive treatment is recommended in pregnancy when blood pressure levels are ≥ 150/95 mmHg. Initiation of antihypertensive treatment at values ≥ 140/90 mmHg is recommended in women with a) gestational hypertension, with or without proteinuria, b) pre-existing hypertension with the superimposition of gestational hypertension or c) hypertension with asymptomatic organ damage or symptoms at any time during pregnancy. Methyldopa is the drug of choice in pregnancy. Atenolol and metoprolol appear to be

  15. Drug-induced urinary calculi.

    PubMed

    Matlaga, Brian R; Shah, Ojas D; Assimos, Dean G

    2003-01-01

    Urinary calculi may be induced by a number of medications used to treat a variety of conditions. These medications may lead to metabolic abnormalities that facilitate the formation of stones. Drugs that induce metabolic calculi include loop diuretics; carbonic anhydrase inhibitors; and laxatives, when abused. Correcting the metabolic abnormality may eliminate or dramatically attenuate stone activity. Urinary calculi can also be induced by medications when the drugs crystallize and become the primary component of the stones. In this case, urinary supersaturation of the agent may promote formation of the calculi. Drugs that induce calculi via this process include magnesium trisilicate; ciprofloxacin; sulfa medications; triamterene; indinavir; and ephedrine, alone or in combination with guaifenesin. When this situation occurs, discontinuation of the medication is usually necessary.

  16. Phentermine induced acute interstitial nephritis.

    PubMed

    Shao, Emily Ximin; Wilson, Gregory John; Ranganathan, Dwarakanathan

    2017-03-09

    Acute interstitial nephritis (AIN) has a number of medication-related aetiologies. Antibiotics, proton pump inhibitors and non-steroidal anti-inflammatory drugs are common causes; however, any medication has the potential to cause drug-induced AIN. We report the first case of phentermine-induced AIN. A Caucasian woman aged 43 years presented with a 5-week history of lethargy, left-sided lower abdominal pain, nausea and vomiting. She had been taking phentermine for weight loss for 9 months and had recently ceased the medication. The patient underwent a renal biopsy that showed a predominantly lymphohistiocytic interstitial infiltrate with a moderate number of eosinophils consistent with AIN. Phentermine is increasingly used for weight loss in obese patients. This is the first case implicating phentermine as the causative agent for drug-induced AIN. While rare, phentermine-induced AIN is a possible adverse reaction of phentermine. Physicians and patients need to be aware of this risk.

  17. Groundwater: Climate-induced pumping

    NASA Astrophysics Data System (ADS)

    Gurdak, Jason J.

    2017-01-01

    Groundwater resources are directly affected by climate variability via precipitation, evapotranspiration and recharge. Analyses of US and India trends reveal that climate-induced pumping indirectly influences groundwater depletion as well.

  18. Drug-induced lupus erythematosus

    MedlinePlus

    ... Causes Drug-induced lupus erythematosus is similar to systemic lupus erythematosus (SLE). It is an autoimmune disorder. This means ... 2015:chap 132. Wright B, Bharadwaj S, Abelson A. Systemic lupus erythematosus. In: Carey WD, ed. Cleveland Clinic: Current Clinical ...

  19. Victim-induced criminality.

    PubMed

    Fooner, M

    1966-09-02

    about the probable effects on the administration of criminal justice. These are pragmatic problems; there is a third problem which may at this time seem speculative, but is, nevertheless, quite important. 3) To what extent will a particular proposal for victim compensation contribute to a temptation-opportunity pattern in victim behavior? In previous studies it has been pointed out that large numbers of our fellow Americans have tended to acquire casual money-handling habits-generically designated "carelessness"-which contribute to the national growth of criminality. How the victim helps the criminal was sketched in reports of those studies (10). It was made abundantly clear that human beings in our affluent society cannot be assumed to be prudent or self-protective against the hazards of crime. Even when the "victim" is not overtly acting to commit a crime-as in the case of the property owner who hires an arsonist-he often tempts the offender. Among the victims of burglary-statistically the most prevalent crime in the United States-are a substantial number of Americans who keep cash, jewelry, and other valuables carelessly at home or in hotel rooms to which the burglar has easy access through door or window. Victims of automobile theft-one of the fastest growing classes of crime-include drivers who leave the vehicle or its contents invitingly accessible to thieves. And so on with other classes of crime. As pointed out in previous studies, when victim behavior follows a temptation-opportunity pattern, it (i) contributes to a "climate of criminal inducements," (ii) adds to the economic resources available to criminal societies, and (iii) detracts from the ability of lawenforcement agencies to suppress the growth of crime.

  20. Reprogramming with defined factors: from induced pluripotency to induced transdifferentiation.

    PubMed

    Masip, Manuel; Veiga, Anna; Izpisúa Belmonte, Juan Carlos; Simón, Carlos

    2010-11-01

    Ever since work on pluripotency induction was originally published, reporting the reprogramming of somatic cells to induced pluripotent stem cells (iPS cells) by the ectopic expression of the four transcription factors Oct4, Sox2, Klf4 and c-Myc, high expectations regarding their potential use for regenerative medicine have emerged. Very recently, the direct conversion of fibroblasts into functional neurons with no prior pluripotent stage has been described. Interconversion between adult cells from ontogenically different lineages by an induced transdifferentiation process based on the overexpression of a cocktail of transcription factors, while avoiding transition through an embryonic stem cell-like state, provides a new impetus in the field of regenerative medicine. Here, we review the induced reprogramming of somatic cells with defined factors and analyze their potential clinical use. Beginning with induced pluripotency, we summarize the initial objections including their extremely low efficiency and the risk of tumor generation. We also review recent reports describing iPS cells' capacity to generate viable offspring through tetraploid complementation, the most restrictive pluripotency criterion. Finally, we explore the available evidence for 'induced transdifferentiated cells' as a novel tool for adult cell fate modification.

  1. Induced airflow in flying insects II. Measurement of induced flow.

    PubMed

    Sane, Sanjay P; Jacobson, Nathaniel P

    2006-01-01

    The flapping wings of insects and birds induce a strong flow over their body during flight. Although this flow influences the sensory biology and physiology of a flying animal, there are very little data on the characteristics of this self-generated flow field or its biological consequences. A model proposed in the companion paper estimated the induced flow over flying insects. In this study, we used a pair of hot wire anemometers to measure this flow at two locations near the body of a tethered flapping hawk moth, Manduca sexta. The axial inflow anemometer measured the airflow prior to its entry into the stroke plane, whereas the radial outflow anemometer measured the airflow after it crossed the stroke plane. The high temporal resolution of the hot wire anemometers allowed us to measure not only the mean induced flow but also subtle higher frequency disturbances occurring at 1-4 times the wing beat frequency. These data provide evidence for the predictions of a mathematical model proposed in the companion paper. Specifically, the absolute value of the measured induced flow matches the estimate of the model. Also, as predicted by the model, the induced flow varies linearly with wing beat frequency. Our experiments also show that wing flexion contributes significantly to the observed higher frequency disturbances. Thus, the hot wire anemometry technique provides a useful means to quantify the aerodynamic signature of wing flexion. The phasic and tonic components of induced flow influence several physiological processes such as convective heat loss and gas exchange in endothermic insects, as well as alter the nature of mechanosensory and olfactory stimuli to the sensory organs of a flying insect.

  2. Jet-Induced Star Formation

    SciTech Connect

    van Breugel, W; Fragile, C; Anninos, P; Murray, S

    2003-12-16

    Jets from radio galaxies can have dramatic effects on the medium through which they propagate. We review observational evidence for jet-induced star formation in low ('FR-I') and high ('FR-II') luminosity radio galaxies, at low and high redshifts respectively. We then discuss numerical simulations which are aimed to explain a jet-induced starburst ('Minkowski's Object') in the nearby FR-I type radio galaxy NGC 541. We conclude that jets can induce star formation in moderately dense (10 cm{sup -3}), warm (10{sup 4} K) gas; that this may be more common in the dense environments of forming, active galaxies; and that this may provide a mechanism for 'positive' feedback from AGN in the galaxy formation process.

  3. Persistent nicorandil induced oral ulceration

    PubMed Central

    Healy, C M; Smyth, Y; Flint, S R

    2004-01-01

    Four patients with nicorandil induced ulceration are described, and the literature on the subject is reviewed. Nicorandil induced ulcers are very painful and distressing for patients. Clinically they appear as large, deep, persistent ulcers that have punched out edges. They are poorly responsive to topical steroids and usually require alteration of nicorandil treatment. The ulceration tends to occur at high doses of nicorandil and all four cases reported here were on doses of 40 mg per day or greater. In these situations reduction of nicorandil dose may be sufficient to promote ulcer healing and prevent further recurrence. However, nicorandil induced ulcers have been reported at doses as low as 10 mg daily and complete cessation of nicorandil may be required. PMID:15201264

  4. Validating induced seismicity forecast models—Induced Seismicity Test Bench

    NASA Astrophysics Data System (ADS)

    Király-Proag, Eszter; Zechar, J. Douglas; Gischig, Valentin; Wiemer, Stefan; Karvounis, Dimitrios; Doetsch, Joseph

    2016-08-01

    Induced earthquakes often accompany fluid injection, and the seismic hazard they pose threatens various underground engineering projects. Models to monitor and control induced seismic hazard with traffic light systems should be probabilistic, forward-looking, and updated as new data arrive. In this study, we propose an Induced Seismicity Test Bench to test and rank such models; this test bench can be used for model development, model selection, and ensemble model building. We apply the test bench to data from the Basel 2006 and Soultz-sous-Forêts 2004 geothermal stimulation projects, and we assess forecasts from two models: Shapiro and Smoothed Seismicity (SaSS) and Hydraulics and Seismics (HySei). These models incorporate a different mix of physics-based elements and stochastic representation of the induced sequences. Our results show that neither model is fully superior to the other. Generally, HySei forecasts the seismicity rate better after shut-in but is only mediocre at forecasting the spatial distribution. On the other hand, SaSS forecasts the spatial distribution better and gives better seismicity rate estimates before shut-in. The shut-in phase is a difficult moment for both models in both reservoirs: the models tend to underpredict the seismicity rate around, and shortly after, shut-in.

  5. Diapir-Induced Reorientation of Enceladus

    NASA Technical Reports Server (NTRS)

    Pappalardo, Robert T.; Nimno, Francis

    2006-01-01

    A viewgraph presentation on the diapir-induced reorientation of Enceladus is shown. The contents include: 1) Activity on Enceladus; 2) Miranda's Coronae: Origin above Diapirs; 3) Reorientation of Miranda; 4) Planetary Reorientation; 5) Modeling Diapir-Induced Reorientation; 6) Diapir-Induced Reorientation: Results; 7) Tectonic Implications of Reorientation; 8) Additional Tests of Reorientation; 9) Diapir-Induced Reorientation of Enceladus: Conclusions; and 10) Diapir-Induced Reorientation: Future Work

  6. Plasma rotation induced by RF

    SciTech Connect

    Chan, V. S.; Chiu, S. C.; Lin-Liu, Y. R. [General Atomics, P.O. Box 85608, San Diego, California 92186-5698; Omelchenko, Y. A. [General Atomics, P.O. Box 85608, San Diego, California 92186-5698

    1999-09-20

    Plasma rotation has many beneficial effects on tokamak operation including stabilization of MHD and microturbulence to improve the beta limit and confinement. Contrary to present-day tokamaks, neutral beams may not be effective in driving rotation in fusion reactors; hence the investigation of radiofrequency (RF) induced plasma rotation is of great interest and potential importance. This paper reviews the experimental results of RF induced rotation and possible physical mechanisms, suggested by theories, to explain the observations. This subject is only in the infancy of its research and many challenging issues remained to be understood and resolved. (c) 1999 American Institute of Physics.

  7. Induced radioactivity in LDEF components

    NASA Technical Reports Server (NTRS)

    Harmon, B. A.; Fishman, G. J.; Parnell, T. A.; Laird, C. E.

    1992-01-01

    A systematic study of the induced radioactivity of the Long Duration Exposure Facility (LDEF) is being carried out in order to gather information about the low earth orbit radiation environment and its effects on materials. The large mass of the LDEF spacecraft, its stabilized configuration, and long mission duration have presented an opportunity to determine space radiation-induced radioactivities with a precision not possible before. Data presented include preliminary activities for steel and aluminum structural samples, and activation subexperiment foils. Effects seen in the data show a clear indication of the trapped proton anisotropy in the South Atlantic Anomaly and suggest contributions from different sources of external radiation fluxes.

  8. Graphene with geometrically induced vorticity.

    PubMed

    Pachos, Jiannis K; Stone, Michael; Temme, Kristan

    2008-04-18

    At half filling, the electronic structure of graphene can be modeled by a pair of free two-dimensional Dirac fermions. We explicitly demonstrate that in the presence of a geometrically induced gauge field an everywhere-real Kekulé modulation of the hopping matrix elements can correspond to a nonreal Higgs field with nontrivial vorticity. This provides a natural setting for fractionally charged vortices with localized zero modes. For fullerenelike molecules we employ the index theorem to demonstrate the existence of six low-lying states that do not depend strongly on the Kekulé-induced mass gap.

  9. Efavirenz-induced exfoliative dermatitis.

    PubMed

    Zhang, Jiu-Cong; Sun, Yong-Tao

    2013-01-01

    Individuals with a human immunodeficiency virus (HIV) infection are at higher risk of developing adverse drug reactions. Multiple drugs are usually prescribed to patients with HIV infection for preventing the replication of HIV and for the treatment of the associated opportunistic infections. We report here the first case of an HIV-1-infected patient who developed an exfoliative dermatitis induced by efavirenz, a non-nucleoside reverse transcriptase inhibitor. Physicians should be aware of the possible occurrence of efavirenz-induced skin eruptions from the start of antiviral treatment of HIV infection.

  10. Method for induced polarization logging

    SciTech Connect

    Vinegar, H.J.; Waxman, M.H.

    1987-04-14

    A method is described for generating a log of the formation phase shift, resistivity and spontaneous potential of an earth formation from data obtained from the earth formation with a multi-electrode induced polarization logging tool. The method comprises obtaining data samples from the formation at measurement points equally spaced in time of the magnitude and phase of the induced voltage and the magnitude and phase of the current supplied by a circuit through a reference resistance R/sub 0/ to a survey current electrode associated with the tool.

  11. An induced junction photovoltaic cell

    NASA Technical Reports Server (NTRS)

    Call, R. L.

    1974-01-01

    Silicon solar cells operating with induced junctions rather than diffused junctions have been fabricated and tested. Induced junctions were created by forming an inversion layer near the surface of the silicon by supplying a sheet of positive charge above the surface. Measurements of the response of the inversion layer cell to light of different wavelengths indicated it to be more sensitive to the shorter wavelengths of the sun's spectrum than conventional cells. The greater sensitivity occurs because of the shallow junction and the strong electric field at the surface.

  12. Conflict-Induced Perceptual Filtering

    ERIC Educational Resources Information Center

    Wendt, Mike; Luna-Rodriguez, Aquiles; Jacobsen, Thomas

    2012-01-01

    In a variety of conflict paradigms, target and distractor stimuli are defined in terms of perceptual features. Interference evoked by distractor stimuli tends to be reduced when the ratio of congruent to incongruent trials is decreased, suggesting conflict-induced perceptual filtering (i.e., adjusting the processing weights assigned to stimuli…

  13. Photobiomodulation on alcohol induced dysfunction

    NASA Astrophysics Data System (ADS)

    Yang, Zheng-Ping; Liu, Timon C.; Zhang, Yan; Wang, Yan-Fang

    2007-05-01

    Alcohol, which is ubiquitous today, is a major health concern. Its use was already relatively high among the youngest respondents, peaked among young adults, and declined in older age groups. Alcohol is causally related to more than 60 different medical conditions. Overall, 4% of the global burden of disease is attributable to alcohol, which accounts for about as much death and disability globally as tobacco and hypertension. Alcohol also promotes the generation of reactive oxygen species (ROS) and/or interferes with the body's normal defense mechanisms against these compounds through numerous processes, particularly in the liver. Photobiomodulation (PBM) is a cell-specific effect of low intensity monochromatic light or low intensity laser irradiation (LIL) on biological systems. The cellular effects of both alcohol and LIL are ligand-independent so that PBM might rehabilitate alcohol induced dysfunction. The PBM on alcohol induced human neutrophil dysfunction and rat chronic atrophic gastritis, the laser acupuncture on alcohol addiction, and intravascular PBM on alcoholic coma of patients and rats have been observed. The endonasal PBM (EPBM) mediated by Yangming channel, autonomic nervous systems and blood cells is suggested to treat alcohol induced dysfunction in terms of EPBM phenomena, the mechanism of alcohol induced dysfunction and our biological information model of PBM. In our opinion, the therapeutic effects of PBM might also be achieved on alcoholic myopathy.

  14. Oxaliplatin-induced lung fibrosis

    PubMed Central

    Shah, Arpan; Udwadia, Zarir F.; Almel, Sachin

    2009-01-01

    Oxaliplatin has been approved for use as an adjuvant treatment in stage III colorectal carcinoma by the US-FDA. The majority of toxicity caused by this drug is manageable. However, rare, isolated cases of pulmonary fibrosis induced by this drug have been reported in literature. We report one such case of rapidly evolving pulmonary fibrosis following treatment with oxaliplatin. PMID:20838550

  15. Radiation-induced genomic instability

    NASA Technical Reports Server (NTRS)

    Kronenberg, A.

    1994-01-01

    Quantitative assessment of the heritable somatic effects of ionizing radiation exposures has relied upon the assumption that radiation-induced lesions were 'fixed' in the DNA prior to the first postirradiation mitosis. Lesion conversion was thought to occur during the initial round of DNA replication or as a consequence of error-prone enzymatic processing of lesions. The standard experimental protocols for the assessment of a variety of radiation-induced endpoints (cell death, specific locus mutations, neoplastic transformation and chromosome aberrations) evaluate these various endpoints at a single snapshot in time. In contrast with the aforementioned approaches, some studies have specifically assessed radiation effects as a function of time following exposure. Evidence has accumulated in support of the hypothesis that radiation exposure induces a persistent destabilization of the genome. This instability has been observed as a delayed expression of lethal mutations, as an enhanced rate of accumulation of non-lethal heritable alterations, and as a progressive intraclonal chromosomal heterogeneity. The genetic controls and biochemical mechanisms underlying radiation-induced genomic instability have not yet been delineated. The aim is to integrate the accumulated evidence that suggests that radiation exposure has a persistent effect on the stability of the mammalian genome.

  16. Adrafinil-induced orofacial dyskinesia.

    PubMed

    Thobois, Stéphane; Xie, Jing; Mollion, Helena; Benatru, Isabelle; Broussolle, Emmanuel

    2004-08-01

    We describe the first case of orofacial abnormal movements induced by adrafinil, a vigilance promoting agent of the same pharmacological class as modafinil. The dyskinesias did not spontaneously recover despite adrafinil withdrawal for a 4-month period. They were secondly dramatically improved by tetrabenazine, a presynaptic dopaminergic depleting drug which was introduced after the 4-month adrafinil-free period.

  17. Adolescents and Exercise Induced Asthma

    ERIC Educational Resources Information Center

    Hansen, Pamela; Bickanse, Shanna; Bogenreif, Mike; VanSickle, Kyle

    2008-01-01

    This article defines asthma and exercise induced asthma, and provides information on the triggers, signs, and symptoms of an attack. It also gives treatments for these conditions, along with prevention guidelines on how to handle an attack in the classroom or on the practice field. (Contains 2 tables and 1 figure.)

  18. [Readers' position against induced abortion].

    PubMed

    1981-08-25

    Replies to the request by the Journal of Nursing on readers' positions against induced abortion indicate there is a definite personal position against induced abortion and the assistance in this procedure. Some writers expressed an emotional "no" against induced abortion. Many quoted arguments from the literature, such as a medical dictionary definition as "a premeditated criminally induced abortion." The largest group of writers quoted from the Bible, the tenor always being: "God made man, he made us with his hands; we have no right to make the decision." People with other philosophies also objected. Theosophical viewpoint considers reincarnation and the law of cause and effect (karma). This philosophy holds that induced abortion impedes the appearance of a reincarnated being. The fundamental question in the abortion problem is, "can the fetus be considered a human life?" The German anatomist Professor E. Bleckschmidt points out that from conception there is human life, hence the fertilized cell can only develop into a human being and is not merely a piece of tissue. Professional nursing interpretation is that nursing action directed towards killing of a human being (unborn child) is against the nature and the essence of the nursing profession. A different opinion states that a nurse cares for patients who have decided for the operation. The nurse doesn't judge but respects the individual's decision. Some proabortion viewpoints considered the endangering of the mother's life by the unborn child, and the case of rape. With the arguments against abortion the question arises how to help the woman with unwanted pregnancy. Psychological counseling is emphasized as well as responsible and careful assistance. Referral to the Society for Protection of the Unborn Child (VBOK) is considered as well as other agencies. Further reader comments on this subject are solicited.

  19. An inducible offense: carnivore morph tadpoles induced by tadpole carnivory

    PubMed Central

    Levis, Nicholas A; de la Serna Buzón, Sofia; Pfennig, David W

    2015-01-01

    Phenotypic plasticity is commonplace, and plasticity theory predicts that organisms should often evolve mechanisms to detect and respond to environmental cues that accurately predict future environmental conditions. Here, we test this prediction in tadpoles of spadefoot toads, Spea multiplicata. These tadpoles develop into either an omnivore ecomorph, which is a dietary generalist, or a carnivore ecomorph, which specializes on anostracan shrimp and other tadpoles. We investigated a novel proximate cue – ingestion of Scaphiopus tadpoles – and its propensity to produce carnivores by rearing tadpoles on different diets. We found that diets containing tadpoles from the genus Scaphiopus produced more carnivores than diets without Scaphiopus tadpoles. We discuss why Scaphiopus tadpoles are an excellent food source and why it is therefore advantageous for S. multiplicata tadpoles to produce an inducible offense that allows them to better utilize this resource. In general, such inducible offenses provide an excellent setting for investigating the proximate and evolutionary basis of phenotypic plasticity. PMID:25897380

  20. Diuretic-induced hypokalaemia inducing torsades de pointes.

    PubMed

    Chvilicek, J P; Hurlbert, B J; Hill, G E

    1995-12-01

    Torsades de pointes (TP), an unique polymorphous type of ventricular tachycardia, is associated with either an acquired or congenitally prolonged QT interval. Several reports have demonstrated TP to follow an acquired prolonged QT interval secondary to chronic hypocalcaemia, hypomagnesaemia, or hypokalaemia. We report a rapid onset, acute extracellular hypokalaemia not associated with other electrolyte disturbances inducing a prolonged QT interval followed by TP. This is the first case report of a rapid onset isolated acute extracellular hypokalaemia inducing TP. Since anaesthetists are involved in therapies that will rapidly reduce extracellular potassium (diuretic, catecholamine, and/or insulin administration, hyperventilation), this cae report serves as a warning that such therapy may have the risk of arrhythmia induction.

  1. Distinguishing warming-induced drought from drought-induced warming

    NASA Astrophysics Data System (ADS)

    Roderick, M. L.; Yin, D.

    2015-12-01

    It is usually observed that temperatures, especially maximum temperatures are higher during drought. A very widely held public perception is that the increase in temperature is a cause of drought. This represents the warming-induced drought scenario. However, the agricultural and hydrologic scientific communities have a very different interpretation with drought being the cause of increasing temperature. In essence, those communities assume the warming is a surface feedback and their interpretation is for drought-induced warming. This is a classic cause-effect problem that has resisted definitive explanation due to the lack of radiative observations at suitable spatial and temporal scales. In this presentation we first summarise the observations and then use theory to untangle the cause-effect relationships that underlie the competing interpretations. We then show how satellite data (CERES, NASA) can be used to disentangle the cause-effect relations.

  2. Does a parthenogenesis-inducing Wolbachia induce vestigial cytoplasmic incompatibility?

    NASA Astrophysics Data System (ADS)

    Kraaijeveld, Ken; Reumer, Barbara M.; Mouton, Laurence; Kremer, Natacha; Vavre, Fabrice; van Alphen, Jacques J. M.

    2011-03-01

    Wolbachia is a maternally inherited bacterium that manipulates the reproduction of its host. Recent studies have shown that male-killing strains can induce cytoplasmic incompatibility (CI) when introgressed into a resistant host. Phylogenetic studies suggest that transitions between CI and other Wolbachia phenotypes have also occurred frequently, raising the possibility that latent CI may be widespread among Wolbachia. Here, we investigate whether a parthenogenesis-inducing Wolbachia strain can also induce CI. Parthenogenetic females of the parasitoid wasp Asobara japonica regularly produce a small number of males that may be either infected or not. Uninfected males were further obtained through removal of the Wolbachia using antibiotics and from a naturally uninfected strain. Uninfected females that had mated with infected males produced a slightly, but significantly more male-biased sex ratio than uninfected females that had mated with uninfected males. This effect was strongest in females that mated with males that had a relatively high Wolbachia titer. Quantitative PCR indicated that infected males did not show higher ratios of nuclear versus mitochondrial DNA content. Wolbachia therefore does not cause diploidization of cells in infected males. While these results are consistent with CI, other alternatives such as production of abnormal sperm by infected males cannot be completely ruled out. Overall, the effect was very small (9%), suggesting that if CI is involved it may have degenerated through the accumulation of mutations.

  3. Evaluation of the adverse effect of low concentration of cadmium on interleukin-4 induced class switch recombination in Burkett's lymphoma Raji cell line.

    PubMed

    Poltoratsky, Vladimir

    2014-01-01

    Affinity maturation of B lymphocytes, a process that includes somatic hypermutation and class switch recombination, initiates global DNA rearrangements. The interruption of this process has an adverse effect on human health and results in immunodeficiency and autoimmune disease. Class switch recombination is a fundamental factor of the human adaptive immunity. Evaluation of the class switch recombination efficiency is an important component of laboratory diagnostic of immunotoxic components. Here, we describe a method for testing the efficiency of the class switch recombination. Cultivation of Raji Burkett's lymphoma cell line with anti-CD40 antibodies and recombinant interleukin-4 (IL-4) triggers a cascade of signal transduction network events that lead to switching the immunoglobulin isotopes from IgM to IgE. This chapter describes the methodology of class switch recombination assay for assessment of the effect of the environmental pollutants in toxicological laboratory diagnostics.

  4. Patulin Degradation by the Biocontrol Yeast Sporobolomyces sp. Is an Inducible Process

    PubMed Central

    Ianiri, Giuseppe; Pinedo, Cristina; Fratianni, Alessandra; Panfili, Gianfranco; Castoria, Raffaello

    2017-01-01

    Patulin is a mycotoxin produced by Penicillium expansum and a common contaminant of pome fruits and their derived products worldwide. It is considered to be mutagenic, genotoxic, immunotoxic, teratogenic and cytotoxic, and the development of strategies to reduce this contamination is an active field of research. We previously reported that Sporobolomyces sp. is able to degrade patulin and convert it into the breakdown products desoxypatulinic acid and ascladiol, both of which were found to be less toxic than patulin. The specific aim of this study was the evaluation of the triggering of the mechanisms involved in patulin resistance and degradation by Sporobolomyces sp. Cells pre-incubated in the presence of a low patulin concentration showed a higher resistance to patulin toxicity and a faster kinetics of degradation. Similarly, patulin degradation was faster when crude intracellular protein extracts of Sporobolomyces sp. were prepared from cells pre-treated with the mycotoxin, indicating the induction of the mechanisms involved in the resistance and degradation of the mycotoxin by Sporobolomyces sp. This study contributes to the understanding of the mechanisms of patulin resistance and degradation by Sporobolomyces sp., which is an essential prerequisite for developing an industrial approach aiming at the production of patulin-free products. PMID:28208615

  5. Fluid injection and induced seismicity

    NASA Astrophysics Data System (ADS)

    Kendall, Michael; Verdon, James

    2016-04-01

    The link between fluid injection, or extraction, and induced seismicity has been observed in reservoirs for many decades. In fact spatial mapping of low magnitude events is routinely used to estimate a stimulated reservoir volume. However, the link between subsurface fluid injection and larger felt seismicity is less clear and has attracted recent interest with a dramatic increase in earthquakes associated with the disposal of oilfield waste fluids. In a few cases, hydraulic fracturing has also been linked to induced seismicity. Much can be learned from past case-studies of induced seismicity so that we can better understand the risks posed. Here we examine 12 case examples and consider in particular controls on maximum event size, lateral event distributions, and event depths. Our results suggest that injection volume is a better control on maximum magnitude than past, natural seismicity in a region. This might, however, simply reflect the lack of baseline monitoring and/or long-term seismic records in certain regions. To address this in the UK, the British Geological Survey is leading the deployment of monitoring arrays in prospective shale gas areas in Lancashire and Yorkshire. In most cases, seismicity is generally located in close vicinity to the injection site. However, in some cases, the nearest events are up to 5km from the injection point. This gives an indication of the minimum radius of influence of such fluid injection projects. The most distant events are never more than 20km from the injection point, perhaps implying a maximum radius of influence. Some events are located in the target reservoir, but most occur below the injection depth. In fact, most events lie in the crystalline basement underlying the sedimentary rocks. This suggests that induced seismicity may not pose a leakage risk for fluid migration back to the surface, as it does not impact caprock integrity. A useful application for microseismic data is to try and forecast induced seismicity

  6. Toxin-induced hepatic injury.

    PubMed

    Lopez, Annette M; Hendrickson, Robert G

    2014-02-01

    Toxins such as pharmaceuticals, herbals, foods, and supplements may lead to hepatic damage. This damage may range from nonspecific symptoms in the setting of liver test abnormalities to acute hepatic failure. The majority of severe cases of toxin-induced hepatic injury are caused by acetaminophen and ethanol. The most important step in the patient evaluation is to gather an extensive history that includes toxin exposure and exclude common causes of liver dysfunction. Patients whose hepatic dysfunction progresses to acute liver failure may benefit from transfer to a transplant service for further management. Currently, the mainstay in management for most exposures is discontinuing the offending agent. This manuscript will review the incidence, pathophysiology, diagnosis and management of the different forms of toxin-induced hepatic injury and exam in-depth the most common hepatic toxins.

  7. Disorder induced Floquet Topological Insulators

    NASA Astrophysics Data System (ADS)

    Bhattacharjee, Paraj; Lindner, Netanel; Rechtsman, Mikael; Refael, Gil

    2014-03-01

    We investigate the possibility of realizing a disorder induced topological state in two dimensional periodically driven systems. This phenomenon is akin to the topological Anderson insulator (TAI) in equilibrium systems. We focus on graphene band structures, where in the presence of the driving electromagnetic field, but in the absence of disorder, the system starts off in a trivial state due to the presence of a sublattice potential. We show that by adding on-site disorder a topological state is induced in this system. We numerically compute the average Bott index (the analog of the Chern number for disordered systems) to show that starting from a trivial phase, topological behavior can be observed at finite disorder strength. In the topological phase, we detect chiral edge states by a numerical time evolution of wavepackets at the edge of the system. We propose an experimental set-up in photonic lattices to observe this phenomenon.

  8. Aloe-induced Toxic Hepatitis

    PubMed Central

    Yang, Ha Na; Kim, Young Mook; Kim, Byoung Ho; Sohn, Kyoung Min; Choi, Myung Jin; Choi, Young Hee

    2010-01-01

    Aloe has been widely used in phytomedicine. Phytomedicine describes aloe as a herb which has anti-inflammatory, anti-proliferative, anti-aging effects. In recent years several cases of aloe-induced hepatotoxicity were reported. But its pharmacokinetics and toxicity are poorly described in the literature. Here we report three cases with aloe-induced toxic hepatitis. A 57-yr-old woman, a 62-yr-old woman and a 55-yr-old woman were admitted to the hospital for acute hepatitis. They had taken aloe preparation for months. Their clinical manifestation, laboratory findings and histologic findings met diagnostic criteria (RUCAM scale) of toxic hepatitis. Upon discontinuation of the oral aloe preparations, liver enzymes returned to normal level. Aloe should be considered as a causative agent in hepatotoxicity. PMID:20191055

  9. Drug-induced Liver Injury

    PubMed Central

    David, Stefan; Hamilton, James P

    2011-01-01

    Drug-induced liver injury (DILI) is common and nearly all classes of medications can cause liver disease. Most cases of DILI are benign, and improve after drug withdrawal. It is important to recognize and remove the offending agent as quickly as possible to prevent the progression to chronic liver disease and/or acute liver failure. There are no definite risk factors for DILI, but pre-existing liver disease and genetic susceptibility may predispose certain individuals. Although most patients have clinical symptoms that are identical to other liver diseases, some patients may present with symptoms of systemic hypersensitivity. Treatment of drug and herbal-induced liver injury consists of rapid drug discontinuation and supportive care targeted to alleviate unwanted symptoms. PMID:21874146

  10. Abacavir-induced liver toxicity.

    PubMed

    Pezzani, Maria Diletta; Resnati, Chiara; Di Cristo, Valentina; Riva, Agostino; Gervasoni, Cristina

    2016-01-01

    Abacavir-induced liver toxicity is a rare event almost exclusively occurring in HLA B*5701-positive patients. Herein, we report one case of abnormal liver function tests occurring in a young HLA B*5701-negative woman on a stable nevirapine-based regimen with no history of liver problems or alcohol abuse after switching to abacavir from tenofovir. We also investigated the reasons for abacavir discontinuation in a cohort of patients treated with abacavir-lamivudine-nevirapine.

  11. Cadmium-induced testicular injury

    SciTech Connect

    Siu, Erica R.; Mruk, Dolores D.; Porto, Catarina S.; Cheng, C. Yan

    2009-08-01

    Cadmium (Cd) is an environmental toxicant and an endocrine disruptor in humans and rodents. Several organs (e.g., kidney, liver) are affected by Cd and recent studies have illustrated that the testis is exceedingly sensitive to Cd toxicity. More important, Cd and other toxicants, such as heavy metals (e.g., lead, mercury) and estrogenic-based compounds (e.g., bisphenols) may account for the recent declining fertility in men among developed countries by reducing sperm count and testis function. In this review, we critically discuss recent data in the field that have demonstrated the Cd-induced toxicity to the testis is probably the result of interactions of a complex network of causes. This is likely to involve the disruption of the blood-testis barrier (BTB) via specific signal transduction pathways and signaling molecules, such as p38 mitogen-activated protein kinase (MAPK). We also summarize current studies on factors that confer and/or regulate the testis sensitivity to Cd, such as Cd transporters and metallothioneins, the impact of Cd on the testis as an endocrine disruptor and oxidative stress inducer, and how it may disrupt the Zn{sup 2+} and/or Ca{sup 2+} mediated cellular events. While much work is needed before a unified mechanistic pathway of Cd-induced testicular toxicity emerges, recent studies have helped to identify some of the likely mechanisms and/or events that take place during Cd-induced testis injury. Furthermore, some of the recent studies have shed lights on potential therapeutic or preventive approaches that can be developed in future studies by blocking or minimizing the destructive effects of Cd to testicular function in men.

  12. The fluctuation induced Hall effect

    SciTech Connect

    Shen, W.; Prager, S.C.

    1993-02-01

    The fluctuation induced Hall term, {le}{approximately}{ovr J} {times} {approximately}{ovr B}{ge}, has been measured in the MST reversed field pinch. The term is of interest as a possible source of current self-generation (dynamo). It is found to be non-negligible, but small in that it can account for less than 25% of the dynamo driven current.

  13. The fluctuation induced Hall effect

    SciTech Connect

    Shen, W.; Prager, S.C.

    1993-02-01

    The fluctuation induced Hall term, [le][approximately][ovr J] [times] [approximately][ovr B][ge], has been measured in the MST reversed field pinch. The term is of interest as a possible source of current self-generation (dynamo). It is found to be non-negligible, but small in that it can account for less than 25% of the dynamo driven current.

  14. Etanercept-induced cystic acne.

    PubMed

    Kashat, Maria; Caretti, Katherine; Kado, Jessica

    2014-07-01

    Tumor necrosis factor α antagonists are potent biologics used to treat a variety of autoimmune disorders such as rheumatoid arthritis, ankylosing spondylitis, Crohn disease, psoriasis, and psoriatic arthritis. These medications are known to have many side effects (eg, infusion reactions, cytopenia, risk for infection, heart failure); however, only a few cases of acne vulgaris have been associated with the use of these biologics, particularly infliximab and adalimumab. We report a rare case of etanercept-induced cystic acne.

  15. Nanostructure-induced DNA condensation

    NASA Astrophysics Data System (ADS)

    Zhou, Ting; Llizo, Axel; Wang, Chen; Xu, Guiying; Yang, Yanlian

    2013-08-01

    The control of the DNA condensation process is essential for compaction of DNA in chromatin, as well as for biological applications such as nonviral gene therapy. This review endeavours to reflect the progress of investigations on DNA condensation effects of nanostructure-based condensing agents (such as nanoparticles, nanotubes, cationic polymer and peptide agents) observed by using atomic force microscopy (AFM) and other techniques. The environmental effects on structural characteristics of nanostructure-induced DNA condensates are also discussed.

  16. Cadmium-induced Testicular Injury*

    PubMed Central

    Siu, Erica R.; Mruk, Dolores D.; Porto, Catarina S.; Cheng, C. Yan

    2009-01-01

    Cadmium (Cd) is an environmental toxicant and an endocrine disruptor in humans. Several organs (e.g., kidney, liver) are affected by Cd and recent studies have illustrated that the testis is exceedingly sensitive to Cd toxicity. More important, Cd and other toxicants, such as heavy metals (e.g., lead, mercury) and estrogenic-based compounds (e.g., bisphenols) may account for the recent declining fertility in men among developed countries by reducing sperm count and testis function. In this review, we critically discuss recent data in the field that have demonstrated the Cd-induced toxicity to the testis is probably the result of interactions of a complex network of causes. This is likely to involve the disruption of the blood-testis barrier (BTB) via specific signal transduction pathways and signaling molecules, such as p38 mitogen-activated protein kinase (MAPK). We also summarize current studies on factors that confer the testis sensitivity to Cd, such as Cd transporters and metallothioneins, and the impact of Cd on the testis as an endocrine disruptor, oxidative stress inducer and how it may disrupt the Zn+2 and/or Ca+2 mediated cellular events. While much work is needed before a unified mechanistic pathway of Cd-induced testicular toxicity is emerged, recent studies have helped to identify some of the likely mechanisms and/or events that take place during Cd-induced testis injury. Furthermore, some of the recent studies have shed lights on potential therapeutic or preventive approaches that can be developed in future studies by blocking or minimizing the destructive effects of Cd to testicular function in men. PMID:19236889

  17. Propulsion Induced Effects Test Program

    NASA Technical Reports Server (NTRS)

    Cappuccio, Gelsomina; Won, Mark; Bencze, Dan

    1999-01-01

    The objective of this milestone is to assess the propulsion/airframe integration characteristics of the Technology Concept Airplane and design variations through computational analysis and experimental subsonic through supersonic wind tunnel testing. The Milestone will generate a comprehensive CFD and wind tunnel data base of the baseline, and design variations. Emphasis will be placed on establishing the propulsion induced effects on the flight performance of the Technology Concept Airplane with all appropriate wind tunnel corrections.

  18. Acyclovir-induced thrombotic microangiopathy

    PubMed Central

    Goli, R.; Mukku, K. K.; Devaraju, S. B. R.; Uppin, M. S.

    2017-01-01

    Acyclovir is a commonly used antiviral drug. Acute kidney injury (AKI) due to intratubular crystal precipitation and interstitial nephritis is well known. Here we present a case of acyclovir induced AKI in a 61 year old male with herpes zoster, which presented like thrombotic microangiopathy with acute interstitial nephritis. This is the first case report on acyclovir causing thrombotic microaniopathy with partial improvement in renal function after plasmapharesis. PMID:28356666

  19. Drug-Induced Sleep Endoscopy.

    PubMed

    Charakorn, Natamon; Kezirian, Eric J

    2016-12-01

    Drug-induced sleep endoscopy (DISE) is an upper airway evaluation technique in which fiberoptic examination is performed under conditions of unconscious sedation. Unique information obtained from this 3-dimensional examination of the airway potentially provides additive benefits to other evaluation methods to guide treatment selection. This article presents recommendations regarding DISE technique and the VOTE Classification system for reporting DISE findings and reviews the evidence concerning DISE test characteristics and the association between DISE findings and treatment outcomes.

  20. Local Anesthetic-Induced Neurotoxicity

    PubMed Central

    Verlinde, Mark; Hollmann, Markus W.; Stevens, Markus F.; Hermanns, Henning; Werdehausen, Robert; Lirk, Philipp

    2016-01-01

    This review summarizes current knowledge concerning incidence, risk factors, and mechanisms of perioperative nerve injury, with focus on local anesthetic-induced neurotoxicity. Perioperative nerve injury is a complex phenomenon and can be caused by a number of clinical factors. Anesthetic risk factors for perioperative nerve injury include regional block technique, patient risk factors, and local anesthetic-induced neurotoxicity. Surgery can lead to nerve damage by use of tourniquets or by direct mechanical stress on nerves, such as traction, transection, compression, contusion, ischemia, and stretching. Current literature suggests that the majority of perioperative nerve injuries are unrelated to regional anesthesia. Besides the blockade of sodium channels which is responsible for the anesthetic effect, systemic local anesthetics can have a positive influence on the inflammatory response and the hemostatic system in the perioperative period. However, next to these beneficial effects, local anesthetics exhibit time and dose-dependent toxicity to a variety of tissues, including nerves. There is equivocal experimental evidence that the toxicity varies among local anesthetics. Even though the precise order of events during local anesthetic-induced neurotoxicity is not clear, possible cellular mechanisms have been identified. These include the intrinsic caspase-pathway, PI3K-pathway, and MAPK-pathways. Further research will need to determine whether these pathways are non-specifically activated by local anesthetics, or whether there is a single common precipitating factor. PMID:26959012

  1. Chemotherapy-induced peripheral neuropathy.

    PubMed

    Fehrenbacher, Jill C

    2015-01-01

    Chemotherapy-induced peripheral neuropathy (CIPN) is common in patients receiving anticancer treatment and can affect survivability and long-term quality of life of the patient following treatment. The symptoms of CIPN primarily include abnormal sensory discrimination of touch, vibration, thermal information, and pain. There is currently a paucity of pharmacological agents to prevent or treat CIPN. The lack of efficacious therapeutics is due, at least in part, to an incomplete understanding of the mechanisms by which chemotherapies alter the sensitivity of sensory neurons. Although the clinical presentation of CIPN can be similar with the various classes of chemotherapeutic agents, there are subtle differences, suggesting that each class of drugs might induce neuropathy via different mechanisms. Multiple mechanisms have been proposed to underlie the development and maintenance of neuropathy; however, most pharmacological agents generated from preclinical experiments have failed to alleviate the symptoms of CIPN in the clinic. Further research is necessary to identify the specific mechanisms by which each class of chemotherapeutics induces neuropathy.

  2. Induced radioactivity in LDEF components

    NASA Technical Reports Server (NTRS)

    Harmon, B. A.; Fishman, G. J.; Parnell, T. A.; Laird, C. E.

    1991-01-01

    The systematics of induced radioactivity on the Long Duration Exposure Facility (LDEF) were studied in a wide range of materials using low level background facilities for detection of gamma rays. Approx. 400 samples of materials processed from structural parts of the spacecraft, as well as materials from onboard experiments, were analyzed at national facilities. These measurements show the variety of radioisotopes that are produced with half-lives greater than 2 wks, most of which are characteristic of proton induced reactions above 20 MeV. For the higher activity, long lived isotopes, it was possible to map the depth and directional dependences of the activity. Due to the stabilized configuration of the LDEF, the induced radioactivity data clearly show contributions from the anisotropic trapped proton flux in the South Atlantic Anomaly. This effect is discussed, along with evidence for activation by galactic protons and thermal neutrons. The discovery of Be-7 was made on leading side parts of the spacecraft, although this was though not to be related to the in situ production of radioisotopes from external particle fluxes.

  3. [Drug-induced oral ulcerations].

    PubMed

    Madinier, I; Berry, N; Chichmanian, R M

    2000-06-01

    Different side effects of drugs have been described in the oral cavity, including oral ulcerations. Direct contact between drugs and oral mucosa may induce chemical burn or local hypersensitivity. Less frequently, these drug-induced oral ulcerations are part of a complex reaction with cutaneous or systemic manifestations. Sometimes, one or more oral ulcerations appear as the main side-effect of a drug, or exceptionally as solitary lesions. Solitary oral ulcerations usually appear after few weeks of treatment. In most of cases, these lesions resist to conventional treatments, with a rapid healing following the suppression of the responsible drug. This diagnosis is usually difficult, particularly with patients receiving multiple drug therapy. Besides, special attention must be paid to new drugs. Oral ulcerations following symptoms of burning mouth, metallic taste, dysgueusia or agueusia are strongly suggestive of a pharmacological origin. Most of the molecules able to induce solitary oral ulcerations are commonly prescribed in a) rheumatology: NSAI (diclofenac, flurbiprofen, indomethacin, naproxen), long-term rheumatoid arthritis therapy (azathioprine, methotrexate, penicillamine, gold compounds, tiopronin); b) cardiology: angiotensin-converting-enzyme inhibitors (captopril, enalapril), angiotensin 2-receptor antagonist (losartan), anti-angorous (nicorandil), c) psychiatry: antidepressants (fluoxetine, lithium), d) AIDS therapy (foscarnet, zalcitabine).

  4. Efficient treatment of induced dipoles

    PubMed Central

    Simmonett, Andrew C.; Pickard, Frank C.; Shao, Yihan; Cheatham, Thomas E.; Brooks, Bernard R.

    2015-01-01

    Most existing treatments of induced dipoles in polarizable molecular mechanics force field calculations use either the self-consistent variational method, which is solved iteratively, or the “direct” approximation that is non-iterative as a result of neglecting coupling between induced dipoles. The variational method is usually implemented using assumptions that are only strictly valid under tight convergence of the induced dipoles, which can be computationally demanding to enforce. In this work, we discuss the nature of the errors that result from insufficient convergence and suggest a strategy that avoids such problems. Using perturbation theory to reintroduce the mutual coupling into the direct algorithm, we present a computationally efficient method that combines the precision of the direct approach with the accuracy of the variational approach. By analyzing the convergence of this perturbation series, we derive a simple extrapolation formula that delivers a very accurate approximation to the infinite order solution at the cost of only a few iterations. We refer to the new method as extrapolated perturbation theory. Finally, we draw connections to our previously published permanent multipole algorithm to develop an efficient implementation of the electric field and Thole terms and also derive some necessary, but not sufficient, criteria that force field parameters must obey. PMID:26298123

  5. Chromium-induced kidney disease

    SciTech Connect

    Wedeen, R.P. ); Qian, Lifen )

    1991-05-01

    Kidney disease is often cited as one of the adverse effects of chromium, yet chronic renal disease due to occupational or environmental exposure to chromium has not been reported. Occasional cases of acute tubular necrosis (ATN) following massive absorption of chromate have been described. Chromate-induced ATN has been extensively studied in experimental animals following parenteral administration of large doses of potassium chromate (hexavalent). The chromate is selectively accumulated in the convoluted proximal tubule where necrosis occurs. An adverse long-term effect of low-dose chromium exposure on the kidneys is suggested by reports of low molecular weight (LMW) proteinuria in chromium workers. Excessive urinary excretion of {beta}{sub 2}-microglobulin, a specific proximal tubule brush border protein, and retinol-binding protein has been reported among chrome palters and welders. However, LMW proteinuria occurs after a variety of physiologic stresses, is usually reversible, and cannot by itself be considered evidence of chromic renal disease. Chromate-induced ATN and LMW proteinuria in chromium workers, nevertheless, raise the possibility that low-level, long-term exposure may produce persistent renal injury. The absence of evidence of chromate-induced chromic renal disease cannot be interpreted as evidence of the absence of such injury.

  6. Field induced gap infrared detector

    NASA Technical Reports Server (NTRS)

    Elliott, C. Thomas (Inventor)

    1990-01-01

    A tunable infrared detector which employs a vanishing band gap semimetal material provided with an induced band gap by a magnetic field to allow intrinsic semiconductor type infrared detection capabilities is disclosed. The semimetal material may thus operate as a semiconductor type detector with a wavelength sensitivity corresponding to the induced band gap in a preferred embodiment of a diode structure. Preferred semimetal materials include Hg(1-x)Cd(x)Te, x is less than 0.15, HgCdSe, BiSb, alpha-Sn, HgMgTe, HgMnTe, HgZnTe, HgMnSe, HgMgSe, and HgZnSe. The magnetic field induces a band gap in the semimetal material proportional to the strength of the magnetic field allowing tunable detection cutoff wavelengths. For an applied magnetic field from 5 to 10 tesla, the wavelength detection cutoff will be in the range of 20 to 50 micrometers for Hg(1-x)Cd(x)Te alloys with x about 0.15. A similar approach may also be employed to generate infrared energy in a desired band gap and then operating the structure in a light emitting diode or semiconductor laser type of configuration.

  7. Statistical Seismology and Induced Seismicity

    NASA Astrophysics Data System (ADS)

    Tiampo, K. F.; González, P. J.; Kazemian, J.

    2014-12-01

    While seismicity triggered or induced by natural resources production such as mining or water impoundment in large dams has long been recognized, the recent increase in the unconventional production of oil and gas has been linked to rapid rise in seismicity in many places, including central North America (Ellsworth et al., 2012; Ellsworth, 2013). Worldwide, induced events of M~5 have occurred and, although rare, have resulted in both damage and public concern (Horton, 2012; Keranen et al., 2013). In addition, over the past twenty years, the increase in both number and coverage of seismic stations has resulted in an unprecedented ability to precisely record the magnitude and location of large numbers of small magnitude events. The increase in the number and type of seismic sequences available for detailed study has revealed differences in their statistics that previously difficult to quantify. For example, seismic swarms that produce significant numbers of foreshocks as well as aftershocks have been observed in different tectonic settings, including California, Iceland, and the East Pacific Rise (McGuire et al., 2005; Shearer, 2012; Kazemian et al., 2014). Similarly, smaller events have been observed prior to larger induced events in several occurrences from energy production. The field of statistical seismology has long focused on the question of triggering and the mechanisms responsible (Stein et al., 1992; Hill et al., 1993; Steacy et al., 2005; Parsons, 2005; Main et al., 2006). For example, in most cases the associated stress perturbations are much smaller than the earthquake stress drop, suggesting an inherent sensitivity to relatively small stress changes (Nalbant et al., 2005). Induced seismicity provides the opportunity to investigate triggering and, in particular, the differences between long- and short-range triggering. Here we investigate the statistics of induced seismicity sequences from around the world, including central North America and Spain, and

  8. Ion beam induced luminescence: Relevance to radiation induced bystander effects

    NASA Astrophysics Data System (ADS)

    Ahmad, S. B.; McNeill, F. E.; Byun, S. H.; Prestwich, W. V.; Seymour, C.; Mothersill, C. E.

    2012-10-01

    The aim of this work is quantify the light emitted as a result of charged particle interaction in materials which may be of relevance to radiation induced "bystander effects" studies. We have developed a system which employs single photon counting to measure the light emitted from samples irradiated under vacuum by a charged particle beam. The system uses a fast photomultiplier tube with a peak cathode response at 420 nm. It has been tested in a proof-of-principle experiment using polystyrene targets. Light output, as a result of irradiation, was measured. The luminescence yield appears to have a non-linear behavior with the incident ion fluence: it rises exponentially to an asymptotic value. The target was irradiated with beam energies varying from 1 to 2 MeV and showed saturation at or before an incident fluence rate of 3 × 1013 H+/cm2 s. The average saturation value for the photon output was found to be 40 × 106 cps. Some measurements were performed using filters to study the emission at specific wavelengths. In the case of filtered light measurements, the photon output was found to saturate at 28 × 103, 10 × 106, and 35 × 106 cps for wavelengths of 280 ± 5 nm, 320 ± 5 nm and 340 ± 5 nm respectively. The light output reaches a maximum value because of damage induced in the polymer. Our measurements indicate a "damage cross section" of the order of 10-14 cm2. The average radiant intensity was found to increase at wavelengths of 280 and 320 nm when the proton energy was increased. This was not found to occur at 340 nm. In conclusion, the light emission at specific wavelengths was found to depend upon the incident proton fluence and the proton energy. The wavelengths of the emitted light measured in this study have significance for the understanding of radiation induced bystander effects.

  9. Homocysteine induces inflammatory transcriptional signaling in monocytes.

    PubMed

    Meng, Shu; Ciment, Stephen; Jan, Michael; Tran, Tran; Pham, Hung; Cueto, Ramon; Yang, Xiao-Feng; Wang, Hong

    2013-01-01

    Hyperhomocysteinemia (HHcy) is an independent risk factor for cardiovascular disease. Here, we studied transcriptional regulation in homocysteine (Hcy)-induced gene expression in monocytes (MC). We identified 11 Hcy-induced genes, 17 anti-inflammatory cytokine interleukin 10-induced, 8 pro-inflammatory cytokine interferon gamma (IFN gamma)-induced and 8 pro-inflammatory cytokine tumor necrosis factor alpha (TNF alpha)-induced genes through literature search. Binding frequency of 36 transcription factors (TFs) implicated in inflammation and MC differentiation were analyzed within core promoter regions of identified genes, and classified into 3 classes based on the significant binding frequency to the promoter of Hcy-induced genes. Class 1 TFs exert high significant binding frequency in Hcy-induced genes. Class 2 and 3 TFs have low and no significant binding frequency, respectively. Class 1 TF binding occurrence in Hcy-induced genes is similar to that in IFN gamma -induced genes, but not that in TNF alpha -induced. We conclude that Hcy is a pro-inflammatory amino acid and induces inflammatory transcriptional signal pathways mediated by class 1 TF. We term class 1 TF as putative Hcy-responsive TFs.

  10. Homocysteine induces inflammatory transcriptional signaling in monocytes

    PubMed Central

    Meng, Shu; Ciment, Stephen; Jan, Michael; Tran, Tran; Pham, Hung; Cueto, Ramón; Yang, Xiao-Feng; Wang, Hong

    2013-01-01

    Hyperhomocysteinemia (HHcy) is an independent risk factor for cardiovascular disease. This study is to investigate transcriptional mechanism underlying homocysteine (Hcy)-induced and monocytes (MC)-derived inflammatory response. We identified 11 Hcy-induced genes, 17 anti-inflammatory cytokine interleukin 10-induced, 8 pro-inflammatory cytokine interferon γ (IFNγ)-induced and 8 pro-inflammatory cytokine tumor necrosis factor α (TNFα)-induced genes through literature search. Binding frequency of 36 transcription factors (TFs) implicated in inflammation and MC differentiation were analyzed within core promoter regions of identified genes, and classified into 3 classes based on the significant binding frequency to the promoter of Hcy-induced genes. Class 1 TFs exert high significant binding frequency in Hcy-induced genes. Class 2 and 3 TFs have low and no significant binding frequency, respectively. Class 1 TF binding occurrence in Hcy-induced genes is similar to that in IFNγ-induced genes, but not that in TNFα-induced. We conclude that Hcy is a pro-inflammatory amino acid and induces inflammatory transcriptional signal pathways mediated by class 1 TF. We term class 1 TF, which includes heat shock factor, MC enhancer factor-2, nuclear factor of activated T-cells, nuclear factor kappa light chain enhancer of activated B cells and Krueppel-like factor 4, as putative Hcy-responsive TFs. PMID:23276953

  11. High homocysteine induces betaine depletion

    PubMed Central

    Imbard, Apolline; Benoist, Jean-François; Esse, Ruben; Gupta, Sapna; Lebon, Sophie; de Vriese, An S; de Baulny, Helene Ogier; Kruger, Warren; Schiff, Manuel; Blom, Henk J.

    2015-01-01

    Betaine is the substrate of the liver- and kidney-specific betaine-homocysteine (Hcy) methyltransferase (BHMT), an alternate pathway for Hcy remethylation. We hypothesized that BHMT is a major pathway for homocysteine removal in cases of hyperhomocysteinaemia (HHcy). Therefore, we measured betaine in plasma and tissues from patients and animal models of HHcy of genetic and acquired cause. Plasma was collected from patients presenting HHcy without any Hcy interfering treatment. Plasma and tissues were collected from rat models of HHcy induced by diet and from a mouse model of cystathionine β-synthase (CBS) deficiency. S-adenosyl-methionine (AdoMet), S-adenosyl-homocysteine (AdoHcy), methionine, betaine and dimethylglycine (DMG) were quantified by ESI—LC–MS/MS. mRNA expression was quantified using quantitative real-time (QRT)-PCR. For all patients with diverse causes of HHcy, plasma betaine concentrations were below the normal values of our laboratory. In the diet-induced HHcy rat model, betaine was decreased in all tissues analysed (liver, brain, heart). In the mouse CBS deficiency model, betaine was decreased in plasma, liver, heart and brain, but was conserved in kidney. Surprisingly, BHMT expression and activity was decreased in liver. However, in kidney, BHMT and SLC6A12 expression was increased in CBS-deficient mice. Chronic HHcy, irrespective of its cause, induces betaine depletion in plasma and tissues (liver, brain and heart), indicating a global decrease in the body betaine pool. In kidney, betaine concentrations were not affected, possibly due to overexpression of the betaine transporter SLC6A12 where betaine may be conserved because of its crucial role as an osmolyte. PMID:26182429

  12. High homocysteine induces betaine depletion.

    PubMed

    Imbard, Apolline; Benoist, Jean-François; Esse, Ruben; Gupta, Sapna; Lebon, Sophie; de Vriese, An S; de Baulny, Helene Ogier; Kruger, Warren; Schiff, Manuel; Blom, Henk J

    2015-04-28

    Betaine is the substrate of the liver- and kidney-specific betaine-homocysteine (Hcy) methyltransferase (BHMT), an alternate pathway for Hcy remethylation. We hypothesized that BHMT is a major pathway for homocysteine removal in cases of hyperhomocysteinaemia (HHcy). Therefore, we measured betaine in plasma and tissues from patients and animal models of HHcy of genetic and acquired cause. Plasma was collected from patients presenting HHcy without any Hcy interfering treatment. Plasma and tissues were collected from rat models of HHcy induced by diet and from a mouse model of cystathionine β-synthase (CBS) deficiency. S-adenosyl-methionine (AdoMet), S-adenosyl-homocysteine (AdoHcy), methionine, betaine and dimethylglycine (DMG) were quantified by ESI-LC-MS/MS. mRNA expression was quantified using quantitative real-time (QRT)-PCR. For all patients with diverse causes of HHcy, plasma betaine concentrations were below the normal values of our laboratory. In the diet-induced HHcy rat model, betaine was decreased in all tissues analysed (liver, brain, heart). In the mouse CBS deficiency model, betaine was decreased in plasma, liver, heart and brain, but was conserved in kidney. Surprisingly, BHMT expression and activity was decreased in liver. However, in kidney, BHMT and SLC6A12 expression was increased in CBS-deficient mice. Chronic HHcy, irrespective of its cause, induces betaine depletion in plasma and tissues (liver, brain and heart), indicating a global decrease in the body betaine pool. In kidney, betaine concentrations were not affected, possibly due to overexpression of the betaine transporter SLC6A12 where betaine may be conserved because of its crucial role as an osmolyte.

  13. Vibrational excitation induces double reaction.

    PubMed

    Huang, Kai; Leung, Lydie; Lim, Tingbin; Ning, Zhanyu; Polanyi, John C

    2014-12-23

    Electron-induced reaction at metal surfaces is currently the subject of extensive study. Here, we broaden the range of experimentation to a comparison of vibrational excitation with electronic excitation, for reaction of the same molecule at the same clean metal surface. In a previous study of electron-induced reaction by scanning tunneling microscopy (STM), we examined the dynamics of the concurrent breaking of the two C-I bonds of ortho-diiodobenzene physisorbed on Cu(110). The energy of the incident electron was near the electronic excitation threshold of E0=1.0 eV required to induce this single-electron process. STM has been employed in the present work to study the reaction dynamics at the substantially lower incident electron energies of 0.3 eV, well below the electronic excitation threshold. The observed increase in reaction rate with current was found to be fourth-order, indicative of multistep reagent vibrational excitation, in contrast to the first-order rate dependence found earlier for electronic excitation. The change in mode of excitation was accompanied by altered reaction dynamics, evidenced by a different pattern of binding of the chemisorbed products to the copper surface. We have modeled these altered reaction dynamics by exciting normal modes of vibration that distort the C-I bonds of the physisorbed reagent. Using the same ab initio ground potential-energy surface as in the prior work on electronic excitation, but with only vibrational excitation of the physisorbed reagent in the asymmetric stretch mode of C-I bonds, we obtained the observed alteration in reaction dynamics.

  14. Sad music induces pleasant emotion.

    PubMed

    Kawakami, Ai; Furukawa, Kiyoshi; Katahira, Kentaro; Okanoya, Kazuo

    2013-01-01

    In general, sad music is thought to cause us to experience sadness, which is considered an unpleasant emotion. As a result, the question arises as to why we listen to sad music if it evokes sadness. One possible answer to this question is that we may actually feel positive emotions when we listen to sad music. This suggestion may appear to be counterintuitive; however, in this study, by dividing musical emotion into perceived emotion and felt emotion, we investigated this potential emotional response to music. We hypothesized that felt and perceived emotion may not actually coincide in this respect: sad music would be perceived as sad, but the experience of listening to sad music would evoke positive emotions. A total of 44 participants listened to musical excerpts and provided data on perceived and felt emotions by rating 62 descriptive words or phrases related to emotions on a scale that ranged from 0 (not at all) to 4 (very much). The results revealed that the sad music was perceived to be more tragic, whereas the actual experiences of the participants listening to the sad music induced them to feel more romantic, more blithe, and less tragic emotions than they actually perceived with respect to the same music. Thus, the participants experienced ambivalent emotions when they listened to the sad music. After considering the possible reasons that listeners were induced to experience emotional ambivalence by the sad music, we concluded that the formulation of a new model would be essential for examining the emotions induced by music and that this new model must entertain the possibility that what we experience when listening to music is vicarious emotion.

  15. Metabolic Stress Induced by Arginine Deprivation Induces Autophagy Cell Death in Prostate Cancer

    DTIC Science & Technology

    2010-08-01

    Arginine deiminase as a novel therapy for prostate cancer induces autophagy and caspase-independent apoptosis. Cancer Research, 69(2):700-708...TITLE: Metabolic stress induced by arginine deprivation induces autophagy cell death in prostate cancer PRINCIPAL INVESTIGATOR: Richard Bold, MD...4. TITLE AND SUBTITLE Metabolic stress induced by arginine deprivation induces autophagy cell 5a. CONTRACT NUMBER death in prostate cancer 5b

  16. Spallation-induced fission reactions

    NASA Astrophysics Data System (ADS)

    Benlliure, J.; Rodríguez-Sánchez, J. L.

    2017-03-01

    During the last decade spallation-induced fission reactions have received particular attention because of their impact in the design of spallation-neutron sources or radioactive beam facilities, but also in the understanding of the fission process at high excitation energy. In this paper, we review the main progress brought by modern experimental techniques, in particular those based in the inverse kinematic, as well as the achievements in modelling these reactions. We will also address future possibilities for improving the investigation of fission dynamics.

  17. Sertraline-induced ventricular tachycardia.

    PubMed

    Patel, Nishit H; Golwala, Harsh; Stavrakis, Stavros; Schechter, Eliot

    2013-01-01

    Sertraline is a selective serotonin reuptake inhibitor, which is a commonly used drug for major depressive disorder. Most frequently reported adverse effects of sertraline in patients receiving 50-150 mg/d are dry mouth, headache, diarrhea, nausea, vomiting, sweating, and dizziness. We hereby report one of the few cases of sertraline-induced ventricular tachycardia, which has been for the first time objectively assessed by the Naranjo scale. We therefore urge the primary care physicians and the cardiologists to keep sertraline as a possible precipitating factor for evaluation of ventricular tachycardia.

  18. Auditory hallucinations induced by trazodone.

    PubMed

    Shiotsuki, Ippei; Terao, Takeshi; Ishii, Nobuyoshi; Hatano, Koji

    2014-04-03

    A 26-year-old female outpatient presenting with a depressive state suffered from auditory hallucinations at night. Her auditory hallucinations did not respond to blonanserin or paliperidone, but partially responded to risperidone. In view of the possibility that her auditory hallucinations began after starting trazodone, trazodone was discontinued, leading to a complete resolution of her auditory hallucinations. Furthermore, even after risperidone was decreased and discontinued, her auditory hallucinations did not recur. These findings suggest that trazodone may induce auditory hallucinations in some susceptible patients.

  19. Auditory hallucinations induced by trazodone

    PubMed Central

    Shiotsuki, Ippei; Terao, Takeshi; Ishii, Nobuyoshi; Hatano, Koji

    2014-01-01

    A 26-year-old female outpatient presenting with a depressive state suffered from auditory hallucinations at night. Her auditory hallucinations did not respond to blonanserin or paliperidone, but partially responded to risperidone. In view of the possibility that her auditory hallucinations began after starting trazodone, trazodone was discontinued, leading to a complete resolution of her auditory hallucinations. Furthermore, even after risperidone was decreased and discontinued, her auditory hallucinations did not recur. These findings suggest that trazodone may induce auditory hallucinations in some susceptible patients. PMID:24700048

  20. Cocaine-induced mesenteric ischaemia.

    PubMed

    Osorio, J; Farreras, N; Ortiz De Zárate L; Bachs, E

    2000-01-01

    We report a 33-year-old man with distal ileum infarction after intravenous abuse of cocaine. He underwent resection of a gangrenous bowel segment and survived. We review the literature regarding intestinal ischaemia related to cocaine. To date, 19 cases have been published. Like most previously reported cases, our patient was young and had no previous history of arteriosclerosis. He suffered cocaine-induced rhabdomyolysis and acute renal failure. Mesenteric ischaemia should be considered in the differential diagnosis of acute or chronic abdominal pain in cocaine consumers.

  1. Fluoroquinolone-induced Achilles tendinitis.

    PubMed

    Tam, P K; Ho, Carmen T K

    2014-12-01

    We report a case of Achilles tendinitis after intake of ciprofloxacin for treatment of respiratory tract infection. Fluoroquinolone-induced tendinopathy is an uncommon but increasingly recognised adverse effect of this antibiotic class. Most of the cases occur in the Achilles tendon and may lead to tendon rupture. Possible predisposing risk factors include use of steroid, patients with renal impairment or renal transplant, old age, and being an athlete. The drug should be stopped once this condition is suspected. Symptomatic treatment should be given and orthopaedic referral is desirable if tendon rupture occurs.

  2. [Pregnancy-induced haemolytic anaemia].

    PubMed

    Karagiozova, J; Masseva, A; Ivanov, St; Marinov, B; Kulinska, R; Boiadjiev, D; Jordanova, D

    2014-01-01

    This is the clinical case of a primiparous eight month pregnant female, presenting with symptoms of pregnancy-induced acute haemolytic anaemia (haemolytic aneamia provoked by an immune mechanism, intra- and extra-erythrocyte defects, and HELLP syndrome were excluded). The anaemia progressed to become life-threatening for both the pregnant women and the foetus, which brought the following questions into consideration: diagnosis of anaemia during pregnancy; dosing of corticosteroid therapy; possibility of giving birth to a viable foetus and prognosis for next pregnancies. Owing to the inter-disciplinary efforts, the life and health of this pregnant woman were preserved, but the foetus was lost.

  3. Metronidazole-Induced Cerebellar Toxicity

    PubMed Central

    Agarwal, Amit; Kanekar, Sangam; Sabat, Shyam; Thamburaj, Krishnamurthy

    2016-01-01

    Metronidazole is a very common antibacterial and antiprotozoal with wide usage across the globe, including the least developed countries. It is generally well-tolerated with a low incidence of serious side-effects. Neurological toxicity is fairly common with this drug, however majority of these are peripheral neuropathy with very few cases of central nervous toxicity reported. We report the imaging findings in two patients with cerebellar dysfunction after Metronidazole usage. Signal changes in the dentate and red nucleus were seen on magnetic resonance imaging in these patients. Most of the cases reported in literature reported similar findings, suggesting high predilection for the dentate nucleus in metronidazole induced encephalopathy. PMID:27127600

  4. Airway management: induced tension pneumoperitoneum

    PubMed Central

    Ahmed, Khedher; Amine, El Ghali Mohamed; Abdelbaki, Azouzi; Jihene, Ayachi; Khaoula, Meddeb; Yamina, Hamdaoui; Mohamed, Boussarsar

    2016-01-01

    Pneumoperitoneum is not always associated with hollow viscus perforation. Such condition is called non-surgical or spontaneous pneumoperitoneum. Intrathoracic causes remain the most frequently reported mechanism inducing this potentially life threatening complication. This clinical condition is associated with therapeutic dilemma. We report a case of a massive isolated pneumoperitoneum causing acute abdominal hypertension syndrome, in a 75 year female, which occurred after difficult airway management and mechanical ventilation. Emergent laparotomy yielded to full recovery. The recognition of such cases for whom surgical management can be avoided is primordial to avoid unnecessary laparotomy and its associated morbidity particularly in the critically ill.

  5. HYPOGLYCEMIA INDUCED BY ANTIDIABETIC SULFONYLUREAS.

    PubMed

    Confederat, Luminiţa; Constantin, Sandra; Lupaşcu, Florentina; Pânzariu, Andreea; Hăncianu, Monica; Profire, Lenuţa

    2015-01-01

    Diabetes mellitus is a major health problem due to its increasing prevalence and life-threatening complications. Antidiabetic sulfonylureas represent the first-line drugs in type 2 diabetes even though the most common associated risk is pharmacologically-induced hypoglycemia. In the development of this side effect are involved several factors including the pharmacokinetic and pharmacodynamic profile of the drug, patient age and behavior, hepatic or renal dysfunctions, or other drugs associated with a high risk of interactions. If all these are controlled, the risk-benefit balance can be equal to other oral antidiabetic drugs.

  6. Ion-induced nuclear radiotherapy

    DOEpatents

    Horn, Kevin M.; Doyle, Barney L.

    1996-01-01

    Ion-induced Nuclear Radiotherapy (INRT) is a technique for conducting radiosurgery and radiotherapy with a very high degree of control over the spatial extent of the irradiated volume and the delivered dose. Based upon the concept that low energy, ion induced atomic and nuclear reactions can be used to produce highly energetic reaction products at the site of a tumor, the INRT technique is implemented through the use of a conduit-needle or tube which conducts a low energy ion beam to a position above or within the intended treatment area. At the end of the conduit-needle or tube is a specially fabricated target which, only when struck by the ion beam, acts as a source of energetic radiation products. The inherent limitations in the energy, and therefore range, of the resulting reaction products limits the spatial extent of irradiation to a pre-defined volume about the point of reaction. Furthermore, since no damage is done to tissue outside this irradiated volume, the delivered dose may be made arbitrarily large. INRT may be used both as a point-source of radiation at the site of a small tumor, or as a topical bath of radiation to broad areas of diseased tissue.

  7. Chemotherapy-induced hair loss.

    PubMed

    Trüeb, R M

    2010-01-01

    Chemotherapy-induced hair loss occurs with an estimated incidence of 65%. Forty-seven percent of female patients consider hair loss to be the most traumatic aspect of chemotherapy and 8% would decline chemotherapy due to fears of hair loss. At present, no approved pharmacologic intervention exists to circumvent this side-effect of anticancer treatment, though a number of agents have been investigated on the basis of the current understanding of the underlying pathobiology. Among the agents that have been evaluated, topical minoxidil was able to reduce the severity or shorten the duration, but it did not prevent hair loss. The major approach to minimize chemotherapy-induced hair loss is by scalp cooling, though most published data on this technique are of poor quality. Fortunately, the condition is usually reversible, and appropriate hair and scalp care along with temporarily wearing a wig may represent the most effective coping strategy. However, some patients may show changes in color and/or texture of regrown hair, and in limited cases the reduction in density may persist.

  8. [Autoimmune hepatitis induced by isotretionine].

    PubMed

    Guzman Rojas, Patricia; Gallegos Lopez, Roxana; Ciliotta Chehade, Alessandra; Scavino, Yolanda; Morales, Alejandro; Tagle, Martín

    2016-01-01

    We describe a case of a teenage patient with the diagnosis of drug induced autoimmune hepatitis. The patient is a 16 years old female, with the past medical history of Hashimoto’s hypothyroidism controlled with levothyroxine, who started treatment with Isotretionin (®Accutane) 20 mg q/12 hours for a total of 3 months for the treatment of severe acne. The physical examination was within normal limits and the results of the laboratory exams are: Baseline values of ALT 28 U/L, AST 28 U/L. Three months later: AST 756 U/L, ALT 1199U/L, alkaline phosphatase 114 U/L, with normal bilirrubin levels throughout the process. The serology studies were negative for all viral hepatitis; ANA titers were positive (1/160) and igG levels were also elevated. A liver biopsy was performed, and was compatible with the diagnosis of autoimmune hepatitis. Corticosteroid therapy was started with Prednisone 40 mg per day one week after stopping the treatment with isotretionin, observing an improvement in the laboratory values. We describe this case and review the world literature since there are no reported cases of Isotretinoin-induced autoimmune hepatitis.

  9. Preference pulses induced by reinforcement.

    PubMed

    Hachiga, Yosuke; Sakagami, Takayuki; Silberberg, Alan

    2014-11-01

    Eight rats responded on concurrent Variable-Ratio 20 Extinction schedules for food reinforcement. The assignment of variable-ratio reinforcement to a left or right lever varied randomly following each reinforcer, and was cued by illumination of a stimulus light above that lever. Postreinforcement preference levels decreased substantially and reliably over time when the lever that just delivered reinforcement was now in extinction; however, if that lever was once again associated with variable ratio, this decrease in same-lever preference tended to be small, and for some subjects, not in evidence. The changes in preference level to the extinction lever were well described by a modified version of Killeen, Hanson, and Osborne's (1978) induction model. Consistent with this model's attribution of preference change to induction, we attribute preference change in this report to a brief period of reinforcer-induced arousal that energizes responding to the lever that delivered the last reinforcer. After a few seconds, this induced responding diminishes, and the operant responding that remains comes under the control of the stimulus light cuing the lever providing variable-ratio reinforcement.

  10. Radiation-induced cardiovascular effects

    NASA Astrophysics Data System (ADS)

    Tapio, Soile

    Recent epidemiological studies indicate that exposure to ionising radiation enhances the risk of cardiovascular mortality and morbidity in a moderate but significant manner. Our goal is to identify molecular mechanisms involved in the pathogenesis of radiation-induced cardiovascular disease using cellular and mouse models. Two radiation targets are studied in detail: the vascular endothelium that plays a pivotal role in the regulation of cardiac function, and the myocardium, in particular damage to the cardiac mitochondria. Ionising radiation causes immediate and persistent alterations in several biological pathways in the endothelium in a dose- and dose-rate dependent manner. High acute and cumulative doses result in rapid, non-transient remodelling of the endothelial cytoskeleton, as well as increased lipid peroxidation and protein oxidation of the heart tissue, independent of whether exposure is local or total body. Proteomic and functional changes are observed in lipid metabolism, glycolysis, mitochondrial function (respiration, ROS production etc.), oxidative stress, cellular adhesion, and cellular structure. The transcriptional regulators Akt and PPAR alpha seem to play a central role in the radiation-response of the endothelium and myocardium, respectively. We have recently started co-operation with GSI in Darmstadt to study the effect of heavy ions on the endothelium. Our research will facilitate the identification of biomarkers associated with adverse cardiac effects of ionising radiation and may lead to the development of countermeasures against radiation-induced cardiac damage.

  11. Inducer Hydrodynamic Load Measurement Devices

    NASA Technical Reports Server (NTRS)

    Skelley, Stephen E.; Zoladz, Thomas F.

    2002-01-01

    Marshall Space Flight Center (MSFC) has demonstrated two measurement devices for sensing and resolving the hydrodynamic loads on fluid machinery. The first - a derivative of the six component wind tunnel balance - senses the forces and moments on the rotating device through a weakened shaft section instrumented with a series of strain gauges. This "rotating balance" was designed to directly measure the steady and unsteady hydrodynamic loads on an inducer, thereby defining both the amplitude and frequency content associated with operating in various cavitation modes. The second device - a high frequency response pressure transducer surface mounted on a rotating component - was merely an extension of existing technology for application in water. MSFC has recently completed experimental evaluations of both the rotating balance and surface-mount transducers in a water test loop. The measurement bandwidth of the rotating balance was severely limited by the relative flexibility of the device itself, resulting in an unexpectedly low structural bending mode and invalidating the higher frequency response data. Despite these limitations, measurements confirmed that the integrated loads on the four-bladed inducer respond to both cavitation intensity and cavitation phenomena. Likewise, the surface-mount pressure transducers were subjected to a range of temperatures and flow conditions in a non-rotating environment to record bias shifts and transfer functions between the transducers and a reference device. The pressure transducer static performance was within manufacturer's specifications and dynamic response accurately followed that of the reference.

  12. Neutrino-Induced Meson Productions

    NASA Astrophysics Data System (ADS)

    Nakamura, Satoshi X.

    We develop a dynamical coupled-channels (DCC) model for neutrino-nucleon reactions in the resonance region, by extending the DCC model that we have previously developed through an analysis of π N,γ N to π N,η N,KΛ ,KΣ reaction data for W ≤ 2.1 GeV. We analyze electron-induced reaction data for both proton and neutron targets to determine the vector current form factors up to Q2 ≤ 3.0 (GeV/c)2. Axial-current matrix elements are derived in accordance with the Partially Conserved Axial Current (PCAC) relation to the πN interactions of the DCC model. As a result, we can uniquely determine the interference pattern between resonant and non-resonant amplitudes. Our calculated cross sections for neutrino-induced single-pion productions are compared with available data, and are found to be in reasonable agreement with the data. We also calculate the double-pion production cross sections in the resonance region, for the first time, with relevant resonance contributions and channel couplings. The result is compared with the double-pion production data. For a future development of a neutrino-nucleus reaction model and/or a neutrino event generator for analyses of neutrino experiments, the DCC model presented here can give a useful input.

  13. Stress proteins induced by arsenic.

    PubMed

    Del Razo, L M; Quintanilla-Vega, B; Brambila-Colombres, E; Calderón-Aranda, E S; Manno, M; Albores, A

    2001-12-01

    The elevated expression of stress proteins is considered to be a universal response to adverse conditions, representing a potential mechanism of cellular defense against disease and a potential target for novel therapeutics. Exposure to arsenicals either in vitro or in vivo in a variety of model systems has been shown to cause the induction of a number of the major stress protein families such as heat shock proteins (Hsp). Among them are members with low molecular weight, such as metallotionein and ubiquitin, as well as ones with masses of 27, 32, 60, 70, 90, and 110 kDa. In most of the cases, the induction of stress proteins depends on the capacity of the arsenical to reach the target, its valence, and the type of exposure, arsenite being the biggest inducer of most Hsp in several organs and systems. Hsp induction is a rapid dose-dependent response (1-8 h) to the acute exposure to arsenite. Thus, the stress response appears to be useful to monitor the sublethal toxicity resulting from a single exposure to arsenite. The present paper offers a critical review of the capacity of arsenicals to modulate the expression and/or accumulation of stress proteins. The physiological consequences of the arsenic-induced stress and its usefulness in monitoring effects resulting from arsenic exposure in humans and other organisms are discussed.

  14. Ion-induced nuclear radiotherapy

    DOEpatents

    Horn, K.M.; Doyle, B.L.

    1996-08-20

    Ion-induced Nuclear Radiotherapy (INRT) is a technique for conducting radiosurgery and radiotherapy with a very high degree of control over the spatial extent of the irradiated volume and the delivered dose. Based upon the concept that low energy, ion induced atomic and nuclear reactions can be used to produce highly energetic reaction products at the site of a tumor, the INRT technique is implemented through the use of a conduit-needle or tube which conducts a low energy ion beam to a position above or within the intended treatment area. At the end of the conduit-needle or tube is a specially fabricated target which, only when struck by the ion beam, acts as a source of energetic radiation products. The inherent limitations in the energy, and therefore range, of the resulting reaction products limits the spatial extent of irradiation to a pre-defined volume about the point of reaction. Furthermore, since no damage is done to tissue outside this irradiated volume, the delivered dose may be made arbitrarily large. INRT may be used both as a point-source of radiation at the site of a small tumor, or as a topical bath of radiation to broad areas of diseased tissue. 25 figs.

  15. Simulations of Cavitating Cryogenic Inducers

    NASA Technical Reports Server (NTRS)

    Dorney, Dan (Technical Monitor); Hosangadi, Ashvin; Ahuja, Vineet; Ungewitter, Ronald J.

    2004-01-01

    Simulations of cavitating turbopump inducers at their design flow rate are presented. Results over a broad range of Nss, numbers extending from single-phase flow conditions through the critical head break down point are discussed. The flow characteristics and performance of a subscale geometry designed for water testing are compared with the fullscale configuration that employs LOX. In particular, thermal depression effects arising from cavitation in cryogenic fluids are identified and their impact on the suction performance of the inducer quantified. The simulations have been performed using the CRUNCH CFD[R] code that has a generalized multi-element unstructured framework suitable for turbomachinery applications. An advanced multi-phase formulation for cryogenic fluids that models temperature depression and real fluid property variations is employed. The formulation has been extensively validated for both liquid nitrogen and liquid hydrogen by simulating the experiments of Hord on hydrofoils; excellent estimates of the leading edge temperature and pressure depression were obtained while the comparisons in the cavity closure region were reasonable.

  16. Hydroxycut-induced Liver Toxicity

    PubMed Central

    Kaswala, DH; Shah, S; Patel, N; Raisoni, S; Swaminathan, S

    2014-01-01

    In the recent era, use of various nutritional supplements is highly encouraged amongst the people of United States. Weight loss supplements are major part of the nutritional supplements and their usage is unregulated in the US. Obesity is a major health concern in the US and Americans spend around $30 billion a year for weight loss supplements. At times, these supplements can be responsible for documented or undocumented adverse drug effects. The health consequences related to these supplements are often overlooked by the general public, even though FDA issues advisories regarding them. One common supplement used for weight loss was Hydroxycut (Iovate Health Sciences Research, Oakville, Ontario, Canada). Hydroxycut was recalled from the market after a FDA warning in May 2009 because of 23 reports of serious health problems ranging from jaundice and elevated liver enzymes to liver damage. 1 This case report adds evidence for Hydroxycut - induced hepatotoxicity. A 27 year old man with right upper quadrant pain and jaundice was found to have elevated liver enzymes and was taking Hydroxycut along with other supplements. Liver biopsy showed drug induced hepatotoxicity. Discontinuation of Hydroxycut dramatically improved liver functions and related symptoms. PMID:24669349

  17. Inducer Hydrodynamic Load Measurement Devices

    NASA Technical Reports Server (NTRS)

    Skelley, Stephen E.; Zoladz, Thomas F.; Turner, Jim (Technical Monitor)

    2002-01-01

    Marshall Space Flight Center (MSFC) has demonstrated two measurement devices for sensing and resolving the hydrodynamic loads on fluid machinery. The first - a derivative of the six-component wind tunnel balance - senses the forces and moments on the rotating device through a weakened shaft section instrumented with a series of strain gauges. This rotating balance was designed to directly measure the steady and unsteady hydrodynamic loads on an inducer, thereby defining both the amplitude and frequency content associated with operating in various cavitation modes. The second device - a high frequency response pressure transducer surface mounted on a rotating component - was merely an extension of existing technology for application in water. MSFC has recently completed experimental evaluations of both the rotating balance and surface-mount transducers in a water test loop. The measurement bandwidth of the rotating balance was severely limited by the relative flexibility of the device itself, resulting in an unexpectedly low structural bending mode and invalidating the higher-frequency response data. Despite these limitations, measurements confirmed that the integrated loads on the four-bladed inducer respond to both cavitation intensity and cavitation phenomena. Likewise, the surface-mount pressure transducers were subjected to a range of temperatures and flow conditions in a non-rotating environment to record bias shifts and transfer functions between the transducers and a reference device. The pressure transducer static performance was within manufacturer's specifications and dynamic response accurately followed that of the reference.

  18. Diet-induced metabolic acidosis.

    PubMed

    Adeva, María M; Souto, Gema

    2011-08-01

    The modern Western-type diet is deficient in fruits and vegetables and contains excessive animal products, generating the accumulation of non-metabolizable anions and a lifespan state of overlooked metabolic acidosis, whose magnitude increases progressively with aging due to the physiological decline in kidney function. In response to this state of diet-derived metabolic acidosis, the kidney implements compensating mechanisms aimed to restore the acid-base balance, such as the removal of the non-metabolizable anions, the conservation of citrate, and the enhancement of kidney ammoniagenesis and urinary excretion of ammonium ions. These adaptive processes lower the urine pH and induce an extensive change in urine composition, including hypocitraturia, hypercalciuria, and nitrogen and phosphate wasting. Low urine pH predisposes to uric acid stone formation. Hypocitraturia and hypercalciuria are risk factors for calcium stone disease. Even a very mild degree of metabolic acidosis induces skeletal muscle resistance to the insulin action and dietary acid load may be an important variable in predicting the metabolic abnormalities and the cardiovascular risk of the general population, the overweight and obese persons, and other patient populations including diabetes and chronic kidney failure. High dietary acid load is more likely to result in diabetes and systemic hypertension and may increase the cardiovascular risk. Results of recent observational studies confirm an association between insulin resistance and metabolic acidosis markers, including low serum bicarbonate, high serum anion gap, hypocitraturia, and low urine pH.

  19. Coalescence-induced nanodroplet jumping

    NASA Astrophysics Data System (ADS)

    Cha, Hyeongyun; Xu, Chenyu; Sotelo, Jesus; Chun, Jae Min; Yokoyama, Yukihiro; Enright, Ryan; Miljkovic, Nenad

    2016-10-01

    Water vapor condensation on superhydrophobic surfaces has received much attention in recent years due to the ability of such surfaces to shed microscale water droplets via coalescence-induced droplet jumping, resulting in heat transfer, anti-icing, and self-cleaning performance enhancement. Here we report the coalescence-induced removal of water nanodroplets (R ≈500 nm ) from superhydrophobic carbon nanotube (CNT) surfaces. The two-droplet coalescence time is measured for varying droplet Ohnesorge numbers, confirming that coalescence prior to jumping is governed by capillary-inertial dynamics. By varying the conformal hydrophobic coating thickness on the CNT surface, the minimum jumping droplet radius is shown to increase with increasing solid fraction and decreasing apparent advancing contact angle, allowing us to explore both hydrodynamic limitations stemming from viscous dissipation and surface adhesion limitations. We find that, even for the smallest nanostructure length scale (≤100 nm) and lowest surface adhesions, nonideal surface interactions and the evolved droplet morphology play defining roles in limiting the minimum size for jumping on real surfaces. The outcomes of this work demonstrate the ability to passively shed nanometric water droplets, which has the potential to further increase the efficiency of systems that can harness jumping droplets for a wide range of energy and water applications.

  20. Amiodarone-induced myxoedema coma

    PubMed Central

    Hassan, Syed; Ayoub, Walaa; Hassan, Mona; Wisgerhof, Max

    2014-01-01

    A 62-year-old man was found to have bradycardia, hypothermia and respiratory failure 3 weeks after initiation of amiodarone therapy for atrial fibrillation. Thyroid-stimulating hormone was found to be 168 μIU/mL (nl. 0.3–5 μIU/mL) and free thyroxine (FT4) was <0.2 ng/dL (nl. 0.8–1.8 ng/dL). He received intravenous fluids, vasopressor therapy and stress dose steroids; he was intubated and admitted to the intensive care unit. He received 500 μg of intravenous levothyroxine in the first 18 h of therapy, and 150 µg intravenous daily thereafter. Haemodynamic improvement, along with complete recovery of mental status, occurred after 48 h. Twelve hours after the initiation of therapy, FT4 was 0.96 ng/dL. The patient was maintained on levothyroxine 175 (g POorally daily. A thyroid ultrasound showed diffuse heterogeneity. The 24 hour excretion of iodine was 3657 (mcg (25–756 ( mcg). The only two cases of amiodarone-induced myxoedema coma in the literature report patient death despite supportive therapy and thyroid hormone replacement. This case represents the most thoroughly investigated case of amiodarone-induced myxoedema coma with a history significant for subclinical thyroid disease. PMID:24729111

  1. Psychosocial aspects of induced abortion.

    PubMed

    Stotland, N L

    1997-09-01

    US anti-abortion groups have used misinformation on the long-term psychological impact of induced abortion to advance their position. This article reviews the available research evidence on the definition, history, cultural context, and emotional and psychiatric sequelae of induced abortion. Notable has been a confusion of normative, transient reactions to unintended pregnancy and abortion (e.g., guilt, depression, anxiety) with serious mental disorders. Studies of the psychiatric aspects of abortion have been limited by methodological problems such as the impossibility of randomly assigning women to study and control groups, resistance to follow-up, and confounding variables. Among the factors that may impact on an unintended pregnancy and the decision to abort are ongoing or past psychiatric illness, poverty, social chaos, youth and immaturity, abandonment issues, ongoing domestic responsibilities, rape and incest, domestic violence, religion, and contraceptive failure. Among the risk factors for postabortion psychosocial difficulties are previous or concurrent psychiatric illness, coercion to abort, genetic or medical indications, lack of social supports, ambivalence, and increasing length of gestation. Overall, the literature indicates that serious psychiatric illness is at least 8 times more common among postpartum than among postabortion women. Abortion center staff should acknowledge that the termination of a pregnancy may be experienced as a loss even when it is a voluntary choice. Referrals should be offered to women who show great emotional distress, have had several previous abortions, or request psychiatric consultation.

  2. Plasmon-induced artificial photosynthesis

    PubMed Central

    Ueno, Kosei; Oshikiri, Tomoya; Shi, Xu; Zhong, Yuqing; Misawa, Hiroaki

    2015-01-01

    We have successfully developed a plasmon-induced artificial photosynthesis system that uses a gold nanoparticle-loaded oxide semiconductor electrode to produce useful chemical energy as hydrogen and ammonia. The most important feature of this system is that both sides of a strontium titanate single-crystal substrate are used without an electrochemical apparatus. Plasmon-induced water splitting occurred even with a minimum chemical bias of 0.23 V owing to the plasmonic effects based on the efficient oxidation of water and the use of platinum as a co-catalyst for reduction. Photocurrent measurements were performed to determine the electron transfer between the gold nanoparticles and the oxide semiconductor. The efficiency of water oxidation was determined through spectroelectrochemical experiments aimed at elucidating the electron density in the gold nanoparticles. A set-up similar to the water-splitting system was used to synthesize ammonia via nitrogen fixation using ruthenium instead of platinum as a co-catalyst. PMID:26052419

  3. Induced gravity II: grand unification

    NASA Astrophysics Data System (ADS)

    Einhorn, Martin B.; Jones, D. R. Timothy

    2016-05-01

    As an illustration of a renormalizable, asymptotically-free model of induced gravity, we consider an SO(10) gauge theory interacting with a real scalar multiplet in the adjoint representation. We show that dimensional transmutation can occur, spontaneously breaking SO(10) to SU(5)⊗U(1), while inducing the Planck mass and a positive cosmological constant, all proportional to the same scale v. All mass ratios are functions of the values of coupling constants at that scale. Below this scale (at which the Big Bang may occur), the model takes the usual form of Einstein-Hilbert gravity in de Sitter space plus calculable corrections. We show that there exist regions of parameter space in which the breaking results in a local minimum of the effective action giving a positive dilaton (mass)2 from two-loop corrections associated with the conformal anomaly. Furthermore, unlike the singlet case we considered previously, some minima lie within the basin of attraction of the ultraviolet fixed point. Moreover, the asymptotic behavior of the coupling constants also lie within the range of convergence of the Euclidean path integral, so there is hope that there will be candidates for sensible vacua. Although open questions remain concerning unitarity of all such renormalizable models of gravity, it is not obvious that, in curved backgrounds such as those considered here, unitarity is violated. In any case, any violation that may remain will be suppressed by inverse powers of the reduced Planck mass.

  4. Shear-Induced Reactive Gelation.

    PubMed

    Brand, Bastian; Morbidelli, Massimo; Soos, Miroslav

    2015-11-24

    In this work, we describe a method for the production of porous polymer materials in the form of particles characterized by narrow pore size distribution using the principle of shear-induced reactive gelation. Poly(styrene-co-divinylbenzene) primary particles with diameter ranging from 80 to 200 nm are used as building blocks, which are assembled into fractal-like clusters when exposed to high shear rates generated in a microchannel. It was found that independent of the primary particle size, it is possible to modulate the internal structure of formed fractal-like aggregates having fractal dimension ranging from 2.4 to 2.7 by varying the residence time in the microchannel. Thermally induced postpolymerization was used to increase the mechanical resilience of such formed clusters. Primary particle interpenetration was observed by SEM and confirmed by light scattering resulting in an increase of fractal dimension. Nitrogen sorption measurements and mercury porosimetry confirmed formation of a porous material with surface area ranging from 20 to 40 m(2)/g characterized by porosity of 70% and narrow pore size distribution with an average diameter around 700 nm without the presence of any micropores. The strong perfusive character of the synthesized material was confirmed by the existence of a plateau of the height equivalent to a theoretical plate measured at high reduced velocities using a chromatographic column packed with the synthesized microclusters.

  5. Shear induced phase transitions induced in edible fats

    NASA Astrophysics Data System (ADS)

    Mazzanti, Gianfranco; Welch, Sarah E.; Marangoni, Alejandro G.; Sirota, Eric B.; Idziak, Stefan H. J.

    2003-03-01

    The food industry crystallizes fats under different conditions of temperature and shear to obtain products with desired crystalline phases. Milk fat, palm oil, cocoa butter and chocolate were crystallized from the melt in a temperature controlled Couette cell. Synchrotron x-ray diffraction studies were conducted to examine the role of shear on the phase transitions seen in edible fats. The shear forces on the crystals induced acceleration of the alpha to beta-prime phase transition with increasing shear rate in milk fat and palm oil. The increase was slow at low shear rates and became very strong above 360 s-1. In cocoa butter the acceleration between beta-prime-III and beta-V phase transition increased until a maximum of at 360 s-1, and then decreased, showing competition between enhanced heat transfer and viscous heat generation.

  6. Immunomodulatory Effects of Domoic Acid Differ Between In vivo and In vitro Exposure in Mice

    PubMed Central

    Levin, Milton; Leibrecht, Heather; Ryan, James; Van Dolah, Frances; De Guise, Sylvain

    2008-01-01

    The immunotoxic potential of domoic acid (DA), a well-characterized neurotoxin, has not been fully investigated. Phagocytosis and lymphocyte proliferation were evaluated following in vitro and in vivo exposure to assay direct vs indirect effects. Mice were injected intraperitoneally with a single dose of DA (2.5 μg/g b.w.) and sampled after 12, 24, or 48 hr. In a separate experiment, leukocytes and splenocytes were exposed in vitro to 0, 1, 10, or 100 μM DA. In vivo exposure resulted in a significant increase in monocyte phagocytosis (12-hr), a significant decrease in neutrophil phagocytosis (24-hr), a significant decrease in monocyte phagocytosis (48-hr), and a significant reduction in T-cell mitogen-induced lymphocyte proliferation (24-hr). In vitro exposure significantly reduced neutrophil and monocyte phagocytosis at 1 μM. B- and T-cell mitogen-induced lymphocyte proliferation were both significantly increased at 1 and 10 μM, and significantly decreased at 100 μM. Differences between in vitro and in vivo results suggest that DA may exert its immunotoxic effects both directly and indirectly. Modulation of cytosolic calcium suggests that DA exerts its effects through ionotropic glutamate subtype surface receptors at least on monocytes. This study is the first to identify DA as an immunotoxic chemical in a mammalian species. PMID:19172200

  7. Anion adsorption induced surface reconstructions

    NASA Astrophysics Data System (ADS)

    Tang, Lei

    2005-11-01

    Surface stress plays an important role in the behavior of solid surfaces. Potential-controlled anion adsorption in electrolytes alters the surface stress of the electrode and results in morphology changes to the surfaces. With a combination of potential-induced surface stress measurement and in situ electrochemical scanning tunneling microscopy (STM), it is demonstrated that anion adsorption induces changes in structure of thin films and modifies the growth morphology and stress evolution in epitaxially grown films. Surface structural transitions in the heteroepitaxial system consisting of one to two gold monolayers on platinum substrates were observed. By increasing the potential, structural transitions, from (1 x 1), to a striped phase, to a hexagonal structure, occurred in the gold bilayer. This hexagonal structure was related to the formation of an ordered sulfate adlayer with a ( 3x7 ) structure. Such transitions were repeatable by cycling the potential. Furthermore, the transitions between various dislocation structures were affected by anion adsorption. The surface composition of the gold bilayer on Pt was measured by underpotential deposition of copper. By subtracting the contribution of a pure Pt surface from the gold bi-layer on Pt, a stress change of -2.4 N/m was observed, which agrees with the stress change of -2.46 N/m predicted to accompany formation of 1.5 MLs of coherent Au on Pt(111) from epitaxy theory. The Cu monolayer deposited on Au(111) from an acid sulfate electrolyte was found to be pseudomorphic while the Cu monolayer formed on Au(111) in vacuum was incoherent. The stress-thickness change associated with the coherent monolayer of copper on Au(111) in electrolyte was -0.6 N/m, while conventional epitaxy theories predict a value of +7.76 N/m. STM results elucidated the sulfate adsorption on the copper monolayer caused an expansion of the layer as evidenced by a Moire Structure. For the Cu monolayer on Au(111), the sulfate-induced expansion

  8. Numerical calculation for cavitation flow of inducer

    NASA Astrophysics Data System (ADS)

    Ning, C.; Wang, Y.; Zhu, Z. T.; Xie, S. F.; Zhao, L. F.; Liu, Z. C.

    2015-01-01

    Inducer has significant effect on improving the cavitation characteristic of centrifugal pump. Several inducers were designed and modeled by Pro/E software. The mesh of flow field was done by ICEM and then was imported to ANSYS CFX to analyze the inducer's cavitation characteristic. Effects of the blade number on the performance of an inducer are investigated in the present paper. The inducers were designed on the basis of identical design flow rate and identical pressure elevation at nominal flow rate. The study focuses on the steady behavior of the inducers in cavitating conditions. Evolutions of performance, torque, mass flow rate, and amplitude of radial forces on the shaft according to the inlet pressure are considered. Furthermore, cavitation instabilities are analyzed in the study. The purpose of the present study is to investigate the pressure distribution and vapour volume fraction distribution through numerical simulations using the Navier-stokes solver with computational fluid dynamics (CFD) code.

  9. The mechanism of PDT-induced apoptosis

    NASA Astrophysics Data System (ADS)

    Cai, Xiongwei; Liu, Timon C.; Ding, Xin-Min; Gu, Ying; Liu, Fan-Guang; Liu, Song-Hao

    2003-12-01

    Photodynamic therapy (PDT) can induce apoptosis in many cancer cells in vitro and in tumors in vivo. Cells become more oxidation with PDT, and maintain differentiation and proliferation, go apoptosis and necrosis with the increase of reactive oxygen species (ROS) concentration. ROS can induce apoptosis through mitochondria by inhibiting respiration chain or oxidative phosphorylation or damaging mitochondrial membrane. ROS can initiate apoptosis through endoplamic reticulum(ER) by opening Ca2+ channel or starting unfold protein response (UPR). ROS can also induce apoptosis through Golgi by producing ganglioside GD3 by use of ceramide, which induces apoptosis by activating caspase-3, JNK and p38 MAPK. It can also induce apoptosis by activating Bip (mitochondria-dependant) or preocaspase-12 (mitochondria- independent) or inhibiting protein synthesizing. There are so complicated cross-talking among different signal pathways or organnells that we think PDT-induced apoptosis is mediated by multiplex pathways and excessive levels in a refined network.

  10. Tenofovir induced lichenoid drug eruption.

    PubMed

    Gupta, Mrinal; Gupta, Heena; Gupta, Anish

    2015-01-01

    Cutaneous adverse reactions are a common complication of anti-retroviral therapy. Tenofovir is a newer anti-retroviral drug belonging to the nucleotide reverse transcriptase inhibitor group. Systemic adverse effects like nausea, vomiting, diarrhea, hepatotoxicity and renal toxicity are common with tenofovir but cutaneous adverse effects are rare. Lichenoid drug eruptions are a common adverse effect seen with a large variety of drugs including antimalarials, antihypertensives, nonsteroidal anti-inflammatory drugs and diuretics. Lichenoid drug eruption is a rare cutaneous adverse effect of tenofovir with only a single case reported till date. Here, we report a case of tenofovir induced lichenoid drug eruption in a 54-year-old human immunodeficiency virus affected male who presented with generalized lichenoid eruption after 6 weeks of initiation of tenofovir and complete clearance on cessation of the drug.

  11. Pressure induced polymerization of Formates

    NASA Astrophysics Data System (ADS)

    Tschauner, Oliver

    2004-03-01

    The discovery of pressure induced polymerization of CO2 inspired us to search for C-O based chain structures forming at high pressure. We used salts of carboxylic acids as starting materials and exposed them to pressures between 10 and 30 GPa. Upon heating to temperatures above 1800 K we observed deprotonation and significant changes in the Raman shifts of C-O streching modes. Structure analysis based on powder diffraction patterns collected at sector 16 of the APS showed formation of extended C-O chain structures with the cations of the salts residing in the interchain spaces. These new high pressure polymers are interesting by their mechanical strength and provide basic molecular patterns of organic metallic conductors.

  12. Front interaction induces excitable behavior

    NASA Astrophysics Data System (ADS)

    Parra-Rivas, P.; Matías, M. A.; Colet, P.; Gelens, L.; Walgraef, D.; Gomila, D.

    2017-02-01

    Spatially extended systems can support local transient excitations in which just a part of the system is excited. The mechanisms reported so far are local excitability and excitation of a localized structure. Here we introduce an alternative mechanism based on the coexistence of two homogeneous stable states and spatial coupling. We show the existence of a threshold for perturbations of the homogeneous state. Subthreshold perturbations decay exponentially. Superthreshold perturbations induce the emergence of a long-lived structure formed by two back to back fronts that join the two homogeneous states. While in typical excitability the trajectory follows the remnants of a limit cycle, here reinjection is provided by front interaction, such that fronts slowly approach each other until eventually annihilating. This front-mediated mechanism shows that extended systems with no oscillatory regimes can display excitability.

  13. Human-induced Arctic moistening.

    PubMed

    Min, Seung-Ki; Zhang, Xuebin; Zwiers, Francis

    2008-04-25

    The Arctic and northern subpolar regions are critical for climate change. Ice-albedo feedback amplifies warming in the Arctic, and fluctuations of regional fresh water inflow to the Arctic Ocean modulate the deep ocean circulation and thus exert a strong global influence. By comparing observations to simulations from 22 coupled climate models, we find influence from anthropogenic greenhouse gases and sulfate aerosols in the space-time pattern of precipitation change over high-latitude land areas north of 55 degrees N during the second half of the 20th century. The human-induced Arctic moistening is consistent with observed increases in Arctic river discharge and freshening of Arctic water masses. This result provides new evidence that human activity has contributed to Arctic hydrological change.

  14. Broadband cavity electromagnetically induced transparency

    SciTech Connect

    Wei Xiaogang; Wang Yanhua; Zhang Jiepeng; Zhu Yifu

    2011-10-15

    Cavity electromagnetically induced transparency (EIT) is created in a three-level atomic system confined in a cavity and coupled to a free-space control laser and is manifested as a narrow transmission peak of a probe laser coupled into the cavity mode and tuned to the two-photon Raman resonance with the control laser. Cavity EIT can be observed with a control laser detuned from the atomic transition frequency in a range limited by the vacuum Rabi splitting of two cavity-atom normal modes. This leads to the broadband cavity EIT obtained in the coupled-cavity-atom system with a free-space, broadband control laser. We report an experimental observation of broadband cavity EIT in cold Rb atoms with a frequency-modulated control laser and discuss its application in multichannel and multifrequency light memory.

  15. Texture induced microwave background anisotropies

    SciTech Connect

    Borrill, Julian; Copeland, Edmund J.; Liddle, Andrew R.; Stebbins, Albert; Veeraraghavan, Shoba

    1994-03-01

    We use numerical simulations to calculate the cosmic microwave background anisotropy induced by the evolution of a global texture field, with special emphasis on individual textures. Both spherically symmetric and general configurations are analyzed, and in the latter case we consider field configurations which exhibit unwinding events and also ones which do not. We compare the results given by evolving the field numerically under both the expanded core (XCORE) and non-linear sigma model (NLSM) approximations with the analytic predictions of the NLSM exact solution for a spherically symmetric self-similar (SSSS) unwinding. We find that the random unwinding configuration spots' typical peak height is 60-75\\% and angular size typically only 10% of those of the SSSS unwinding, and that random configurations without an unwinding event nonetheless may generate indistinguishable hot and cold spots. A brief comparison is made with other work.

  16. Drug-Induced Liver Injury.

    PubMed

    Hamilton, Leslie A; Collins-Yoder, Angela; Collins, Rachel E

    2016-10-01

    Drug-induced liver injury (DILI) can result from both idiosyncratic and intrinsic mechanisms. This article discusses the clinical impact of DILI from a broad range of medications as well as herbal and dietary supplements. Risk factors for idiosyncratic DILI (IDILI) are the result of multiple host, environmental, and compound factors. Some triggers of IDILI often seen in critical care include antibiotics, antiepileptic medications, statins, novel anticoagulants, proton pump inhibitors, inhaled anesthetics, nonsteroidal anti-inflammatory agents, methotrexate, sulfasalazine, and azathioprine. The mechanism of IDILI due to these medications varies, and the resulting damage can be cholestatic, hepatocellular, or mixed. The primary treatment of IDILI is to discontinue the causative agent. DILI due to acetaminophen is intrinsic because the liver damage is predictably aligned with the dose ingested. Acute acetaminophen ingestion can be treated with activated charcoal or N-acetylcysteine. Future areas of research include identification of mitochondrial stress biomarkers and of the patients at highest risk for DILI.

  17. Phenytoin-induced Lyell's syndrome

    PubMed Central

    Lobão, Bárbara; Martins, Claúdio; Sousa, Manuel; Marques, Susana; Pedroso, Ermelinda

    2012-01-01

    Lyell's syndrome or toxic epidermal necrolysis (TEN) is a rare dermatological disease that causes serious morbidity and mortality. It is most commonly drug induced. The authors report the case of a 57-year-old woman who was admitted to our hospital with severe rash all over the body. She had been previously submitted to brain surgery for total resection of a large meningioma and medicated with phenytoin for seizures prophylaxis. During this treatment, erythematous lesions and blisters were observed first on her face and trunk and then spreading to the entire body. Detachment of the skin, as well as mucous involvement especially of mouth and conjunctiva, was also observed. TEN was diagnosed, and phenytoin was discontinued. Intravenous fluids, systemic steroids and tightened infection control measures were implemented. After 10 days, skin recovery and re-epithelialisation were established, temperature decreased and mucosal complications stabilised. The patient was discharged after 1 month of hospitalisation. PMID:23230258

  18. Radiocontrast-Induced Renal Failure

    PubMed Central

    Misson, Robert T.; Cutler, Ralph E.

    1985-01-01

    Review of the literature concerning contrast-induced renal dysfunction shows that the currently used agents are remarkably safe with careful patient selection. Clinically apparent kidney failure after their use is essentially nonexistent in those without preexistent renal insufficiency. The incidence rises rapidly in those with azotemia from any cause, however, and diabetic persons with nephropathy are perhaps at special risk. Vigorous volume expansion is possibly effective as a preventive measure and may attenuate adverse effects in those in whom postcontrast dysfunction occurs. New agents are becoming available. It is not yet known if these will prove safer or cost-effective. They have some experimentally demonstrated and theoretic advantages over the presently used agents. PMID:4013281

  19. Hemolysis induced by PMIVSD occluder.

    PubMed

    Rao, D Sheshagiri; Barik, Ramachandra; Siva Prasad, Akula

    2016-09-01

    Hemolysis related to occluder, prosthetic valve, and prosthetic ring used for mitral valve annuloplasty are not very unusual. However, hemolysis related to transcathetor closure of post-myocardial infarction ventricular septal defect (PMIVSD) is infrequent. A close follow-up for spontaneous resolution with or without blood transfusion has been reported in a few cases. Occasionally, surgical retrieval is unavoidable or lifelong blood transfusion is required if surgery cannot be done because of higher risk. In this illustration, we have showed a close follow-up of a case of hemolysis induced by atrial septal occluder used for VSD closure after myocardial infarction. Despite successful device closure of PMIVSD which is difficult, a close watch is needed for complications like residual leak, device embolization, and hemolysis.

  20. Statin induced necrotizing autoimmune myopathy.

    PubMed

    Babu, Suma; Li, Yuebing

    2015-04-15

    Statin induced necrotizing autoimmune myopathy (SINAM) is a recently characterized entity belonging to the spectrum of statin myotoxicity. It is a more severe form, and is usually associated with significant proximal muscle weakness, strikingly elevated creatine kinase levels and persistent symptoms despite statin discontinuation. The characteristic pathological finding is a marked muscle fiber necrosis with minimal or no inflammation on muscle biopsy. SINAM is an autoimmune disorder associated with an antibody against 3-hydroxy-3-methyglutaryl-coenzyme A reductase (HMGCR), and the antibody titer is a useful marker for assessing treatment response. However, anti-HMGCR positive myopathies are also caused by unknown etiologies other than statin exposure, especially in the younger population. SINAM should be promptly recognized as immunosuppressive therapy can improve its clinical outcome significantly. Further research is needed to elucidate its pathogenesis and provide evidence based guidelines for management.