Science.gov

Sample records for chartarum induce immunotoxic

  1. Co-cultivated damp building related microbes Streptomyces californicus and Stachybotrys chartarum induce immunotoxic and genotoxic responses via oxidative stress.

    PubMed

    Markkanen Penttinen, Piia; Pelkonen, Jukka; Tapanainen, Maija; Mäki-Paakkanen, Jorma; Jalava, Pasi I; Hirvonen, Maija-Riitta

    2009-08-01

    Oxidative stress has been proposed to be one mechanism behind the adverse health outcomes associated with living in a damp indoor environment. In the present study, the capability of damp building-related microbes Streptomyces californicus and Stachybotrys chartarum to induce oxidative stress was evaluated in vitro. In addition, the role of oxidative stress in provoking the detected cytotoxic, genotoxic, and inflammatory responses was studied by inhibiting the production of reactive oxygen species (ROS) using N-acetyl-l-cysteine (NAC). RAW264.7 macrophages were exposed in a dose- and time-dependent manner to the spores of co-cultivated S. californicus and S. chartarum, to their separately cultivated spore-mixture, or to the spores of these microbes alone. The intracellular peroxide production and cytotoxicity were measured by flow cytometric analysis, nitric oxide production was analyzed by the Griess method, DNA damage was determined by the comet assay, and cytokine production was measured by an immunochemical ELISA (enzyme-linked immunosorbent assay). All the studied microbial exposures triggered oxidative stress and subsequent cellular damage in RAW264.7 macrophages. The ROS scavenger, NAC, prevented growth arrest, apoptosis, DNA damage, and cytokine production induced by the co-culture since it reduced the intracellular level of ROS within macrophages. In contrast, the DNA damage and cell cycle arrest induced by the spores of S. californicus alone could not be prevented by NAC. Bioaerosol-induced oxidative stress in macrophages may be an important mechanism behind the frequent respiratory symptoms and diseases suffered by residents of moisture damaged buildings. Furthermore, microbial interactions during co-cultivation stimulate the production of highly toxic compound(s) which may significantly increase oxidative damage.

  2. Co-cultivation of Streptomyces californicus and Stachybotrys chartarum stimulates the production of cytostatic compound(s) with immunotoxic properties

    SciTech Connect

    Penttinen, Piia . E-mail: Piia.Penttinen@ktl.fi; Pelkonen, Jukka; Huttunen, Kati; Hirvonen, Maija-Riitta

    2006-12-15

    We have recently shown that the actinobacterium Streptomyces californicus and the fungus Stachybotrys chartarum originating from moisture damaged buildings possess both immunotoxic and immunostimulatory characteristics, which are synergistically potentiated by microbial interaction. In the search for the causative agent(s) behind the immunotoxicity, the cytostatic effects of the co-cultivated spores of S. californicus and S. chartarum were compared to those caused by widely used cytostatic agents produced by streptomycetes. The RAW264.7 macrophages were exposed to four doses of doxorubicin (DOX), actinomycin D (AMD), mitomycin C (MMC) or phleomycin (PHLEO) for 24 h. Kinetics of the spores of the co-cultivated and the separately cultivated microbes (1 x 10{sup 6} spores/ml) was compared to DOX (0.15 {mu}M). Apoptotic responses were analyzed by measuring DNA content and mitochondria membrane depolarization with flow cytometer, and by the fluorometric caspase-3 assay. The present data indicate that interactions during co-cultivation of S. californicus and S. chartarum stimulate the production of an unidentified cytostatic compound(s) capable of inducing mitochondria mediated apoptosis and cell cycle arrest at S-G{sub 2}/M. The spores of co-cultivated microbes caused a 4-fold collapse of mitochondrial membrane potential and an almost 6-fold caspase-3 activation and DNA fragmentation when compared to control. Similar responses were induced by DNA cleaving compounds, especially DOX and AMD, at the relatively low concentrations, but not the spores of the same microbes when they were grown separately. These data suggest that when growing in the same habitat, interactions between S. californicus and S. chartarum stimulates the production of an unknown cytostatic compound(s) which evoke immunotoxic effects similar to those by chemotherapeutic drugs.

  3. Co-cultivation of Streptomyces californicus and Stachybotrys chartarum stimulates the production of cytostatic compound(s) with immunotoxic properties.

    PubMed

    Penttinen, Piia; Pelkonen, Jukka; Huttunen, Kati; Hirvonen, Maija-Riitta

    2006-12-15

    We have recently shown that the actinobacterium Streptomyces californicus and the fungus Stachybotrys chartarum originating from moisture damaged buildings possess both immunotoxic and immunostimulatory characteristics, which are synergistically potentiated by microbial interaction. In the search for the causative agent(s) behind the immunotoxicity, the cytostatic effects of the co-cultivated spores of S. californicus and S. chartarum were compared to those caused by widely used cytostatic agents produced by streptomycetes. The RAW264.7 macrophages were exposed to four doses of doxorubicin (DOX), actinomycin D (AMD), mitomycin C (MMC) or phleomycin (PHLEO) for 24 h. Kinetics of the spores of the co-cultivated and the separately cultivated microbes (1x10(6) spores/ml) was compared to DOX (0.15 muM). Apoptotic responses were analyzed by measuring DNA content and mitochondria membrane depolarization with flow cytometer, and by the fluorometric caspase-3 assay. The present data indicate that interactions during co-cultivation of S. californicus and S. chartarum stimulate the production of an unidentified cytostatic compound(s) capable of inducing mitochondria mediated apoptosis and cell cycle arrest at S-G(2)/M. The spores of co-cultivated microbes caused a 4-fold collapse of mitochondrial membrane potential and an almost 6-fold caspase-3 activation and DNA fragmentation when compared to control. Similar responses were induced by DNA cleaving compounds, especially DOX and AMD, at the relatively low concentrations, but not the spores of the same microbes when they were grown separately. These data suggest that when growing in the same habitat, interactions between S. californicus and S. chartarum stimulates the production of an unknown cytostatic compound(s) which evoke immunotoxic effects similar to those by chemotherapeutic drugs.

  4. DNA damage and p53 in RAW264.7 cells induced by the spores of co-cultivated Streptomyces californicus and Stachybotrys chartarum.

    PubMed

    Penttinen, Piia; Tampio, Marjo; Mäki-Paakkanen, Jorma; Vähäkangas, Kirsi; Pelkonen, Jukka; Hirvonen, Maija-Riitta

    2007-06-03

    Our recent studies have revealed that the co-cultivation of environmental microbes, Streptomyces californicus and Stachybotrys chartarum, potentiates the immunotoxic properties of the spores. In the present study, the spore-induced genotoxic potential of these microbes was investigated. Dose related differences in genotoxic and cytotoxic effects and in p53 level in mouse RAW264.7 macrophages were studied after 24h exposure to the spores of separately cultivated Streptomyces californicus or Stachybotrys chartarum alone, a simple spore-mixture of these microbes as well as to the spores of co-cultivated microbes. The genotoxic effect of the exposures was determined by the Comet assay and p53 level was analyzed by immunoblotting. Cytotoxicity was assessed by using flow cytometric analysis and also by the MTT test. The results revealed that the spores of co-cultivated microbes evoked DNA damage, p53 accumulation and cytotoxicity at a lower dose than the other exposures, and at the highest dose there was a 2.5-fold increase in DNA damage compared to control. In addition, the spores of Streptomyces californicus alone induced a 1.5-fold increase in DNA damage compared to control, dose dependent p53 accumulation and also extensive cytotoxicity. In contrast, the mixture of separately cultivated spores or the spores of Stachybotrys chartarum alone did not induce DNA damage with any tested dose although they triggered significant cytotoxicity and a slightly increased p53 level. Our results suggest that the detected genotoxic responses are the result of DNA damage in RAW264.7 cells by some genotoxically active metabolite(s) and the production of this compound was stimulated in Streptomyces californicus when it was co-cultivated with Stachybotrys chartarum.

  5. Stachybotrys chartarum-Induced Hypersensitivity Pneumonitis Is TLR9 Dependent

    PubMed Central

    Bhan, Urvashi; Newstead, Michael J.; Zeng, Xianying; Ballinger, Megan N.; Standiford, Louis R.; Standiford, Theodore J.

    2011-01-01

    Hypersensitivity pneumonitis (HP), an inflammatory lung disease, develops after repeated exposure to inhaled particulate antigen and is characterized by a vigorous T helper type 1-mediated immune response, resulting in the release of IL-12 and interferon (IFN)-γ. These T helper type 1 cytokines may participate in the pathogenesis of HP. Stachybotrys chartarum (SC) is a dimorphic fungus implicated in a number of respiratory illnesses, including HP. Here, we have developed a murine model of SC-induced HP that reproduces pathology observed in human HP and hypothesized that toll receptor-like 9 (TLR9)-mediated dendritic cell responses are required for the generation of granulomatous inflammation induced by inhaled SC. Mice sensitized and challenged with 106 SC spores develop granulomatous inflammation with multinucleate giant cells, accompanied by increased accumulation of neutrophils and CD4+ and CD8+ T cells. SC sensitization and challenge resulted in robust pulmonary expression of tumor necrosis factor-α, IL-12, and IFN-γ. SC-mediated granulomatous inflammation required IFN-γ and was TLR9 dependent, because TLR9−/− mice displayed reduced peribronchial inflammation, decreased accumulation and/or activation of polymorphonuclear (PMN) and CD4+ and CD8+ T cells, and reduced lung expression of type 1 cytokines and chemokines. T-cell production of IFN-γ was IL-12 dependent. Our studies suggest that TLR9 is critical for dendritic cell-mediated development of a type 1 granulomatous inflammation in the lung in response to SC. PMID:21982832

  6. Stachybotrys chartarum-induced hypersensitivity pneumonitis is TLR9 dependent.

    PubMed

    Bhan, Urvashi; Newstead, Michael J; Zeng, Xianying; Ballinger, Megan N; Standiford, Louis R; Standiford, Theodore J

    2011-12-01

    Hypersensitivity pneumonitis (HP), an inflammatory lung disease, develops after repeated exposure to inhaled particulate antigen and is characterized by a vigorous T helper type 1-mediated immune response, resulting in the release of IL-12 and interferon (IFN)-γ. These T helper type 1 cytokines may participate in the pathogenesis of HP. Stachybotrys chartarum (SC) is a dimorphic fungus implicated in a number of respiratory illnesses, including HP. Here, we have developed a murine model of SC-induced HP that reproduces pathology observed in human HP and hypothesized that toll receptor-like 9 (TLR9)-mediated dendritic cell responses are required for the generation of granulomatous inflammation induced by inhaled SC. Mice sensitized and challenged with 10(6) SC spores develop granulomatous inflammation with multinucleate giant cells, accompanied by increased accumulation of neutrophils and CD4(+) and CD8(+) T cells. SC sensitization and challenge resulted in robust pulmonary expression of tumor necrosis factor-α, IL-12, and IFN-γ. SC-mediated granulomatous inflammation required IFN-γ and was TLR9 dependent, because TLR9(-/-) mice displayed reduced peribronchial inflammation, decreased accumulation and/or activation of polymorphonuclear (PMN) and CD4(+) and CD8(+) T cells, and reduced lung expression of type 1 cytokines and chemokines. T-cell production of IFN-γ was IL-12 dependent. Our studies suggest that TLR9 is critical for dendritic cell-mediated development of a type 1 granulomatous inflammation in the lung in response to SC. Copyright © 2011 American Society for Investigative Pathology. Published by Elsevier Inc. All rights reserved.

  7. Microcystin-LR Induced Immunotoxicity in Mammals.

    PubMed

    Lone, Yaqoob; Bhide, Mangla; Koiri, Raj Kumar

    2016-01-01

    Microcystins are toxic molecules produced by cyanobacterial blooms due to water eutrophication. Exposure to microcystins is a global health problem because of its association with various other pathological effects and people all over the world are exposed to microcystins on a regular basis. Evidence shows that microcystin-LR (MC-LR) may adversely affect the immune system, but its specific effects on immune functions are lacking. In the present review, immunotoxicological effects associated with MC-LR in animals, humans, and in vitro models have been reported. Overall, the data shows that chronic exposure to MC-LR has the potential to impair vital immune responses which could lead to increased risk of various diseases including cancers. Studies in animal and in vitro models have provided some pivotal understanding into the potential mechanisms of MC-LR related immunotoxicity suggesting that further investigation, particularly in humans, is required to better understand the relationship between development of disease and the MC-LR exposure.

  8. TLR9-dependent IL-23/IL-17 is required for the generation of Stachybotrys chartarum-induced hypersensitivity pneumonitis.

    PubMed

    Bhan, Urvashi; Newstead, Michael J; Zeng, Xianying; Podsaid, Amy; Goswami, Moloy; Ballinger, Megan N; Kunkel, Steven L; Standiford, Theodore J

    2013-01-01

    Hypersensitivity pneumonitis (HP) is an inflammatory lung disease that develops after repeated exposure to inhaled particulate Ag. Stachybotrys chartarum is a dimorphic fungus that has been implicated in a number of respiratory illnesses, including HP. In this study, we have developed a murine model of S. chartarum-induced HP that reproduces pathology observed in human HP, and we have hypothesized that TLR9-mediated IL-23 and IL-17 responses are required for the generation of granulomatous inflammation induced by inhaled S. chartarum. Mice that undergo i.p. sensitization and intratracheal challenge with 10(6) S. chartarum spores developed granulomatous inflammation with multinucleate giant cells, accompanied by increased accumulation of T cells. S. chartarum sensitization and challenge resulted in robust pulmonary expression of IL-17 and IL-23. S. chartarum-mediated granulomatous inflammation required intact IL-23 or IL-17 responses and required TLR9, because TLR9(-/-) mice displayed reduced IL-17 and IL-23 expression in whole lung associated with decreased accumulation of IL-17 expressing CD4(+) and γδ T cells. Compared with S. chartarum-sensitized dendritic cells (DC) isolated from WT mice, DCs isolated from TLR9(-/-) mice had a reduced ability to produce IL-23 in responses to S. chartarum. Moreover, shRNA knockdown of IL-23 in DCs abolished IL-17 production from splenocytes in response to Ag challenge. Finally, the intratracheal reconstitution of IL-23 in TLR9(-/-) mice recapitulated the immunopathology observed in WT mice. In conclusion, our studies suggest that TLR9 is critical for the development of Th17-mediated granulomatous inflammation in the lung in response to S. chartarum.

  9. Processed Aloe vera gel ameliorates cyclophosphamide-induced immunotoxicity.

    PubMed

    Im, Sun-A; Kim, Ki-Hyang; Kim, Hee-Suk; Lee, Ki-Hwa; Shin, Eunju; Do, Seon-Gil; Jo, Tae Hyung; Park, Young In; Lee, Chong-Kil

    2014-10-24

    The effects of processed Aloe vera gel (PAG) on cyclophosphamide (CP)-induced immunotoxicity were examined in mice. Intraperitoneal injection of CP significantly reduced the total number of lymphocytes and erythrocytes in the blood. Oral administration of PAG quickly restored CP-induced lymphopenia and erythropenia in a dose-dependent manner. The reversal of CP-induced hematotoxicity by PAG was mediated by the functional preservation of Peyer's patch cells. Peyer's patch cells isolated from CP-treated mice, which were administered PAG, produced higher levels of T helper 1 cytokines and colony-stimulating factors (CSF) in response to concanavalin A stimulation as compared with those isolated from CP-treated control mice. PAG-derived polysaccharides directly activated Peyer's patch cells isolated from normal mice to produce cytokines including interleukin (IL)-6, IL-12, interferon-γ, granulocyte-CSF, and granulocyte-macrophage-CSF. The cytokines produced by polysaccharide-stimulated Peyer's patch cells had potent proliferation-inducing activity on mouse bone marrow cells. In addition, oral administration of PAG restored IgA secretion in the intestine after CP treatment. These results indicated that PAG could be an effective immunomodulator and that it could prevent CP-induced immunotoxic side effects.

  10. Processed Aloe vera Gel Ameliorates Cyclophosphamide-Induced Immunotoxicity

    PubMed Central

    Im, Sun-A; Kim, Ki-Hyang; Kim, Hee-Suk; Lee, Ki-Hwa; Shin, Eunju; Do, Seon-Gil; Jo, Tae Hyung; Park, Young In; Lee, Chong-Kil

    2014-01-01

    The effects of processed Aloe vera gel (PAG) on cyclophosphamide (CP)-induced immunotoxicity were examined in mice. Intraperitoneal injection of CP significantly reduced the total number of lymphocytes and erythrocytes in the blood. Oral administration of PAG quickly restored CP-induced lymphopenia and erythropenia in a dose-dependent manner. The reversal of CP-induced hematotoxicity by PAG was mediated by the functional preservation of Peyer’s patch cells. Peyer’s patch cells isolated from CP-treated mice, which were administered PAG, produced higher levels of T helper 1 cytokines and colony-stimulating factors (CSF) in response to concanavalin A stimulation as compared with those isolated from CP-treated control mice. PAG-derived polysaccharides directly activated Peyer’s patch cells isolated from normal mice to produce cytokines including interleukin (IL)-6, IL-12, interferon-γ, granulocyte-CSF, and granulocyte-macrophage-CSF. The cytokines produced by polysaccharide-stimulated Peyer’s patch cells had potent proliferation-inducing activity on mouse bone marrow cells. In addition, oral administration of PAG restored IgA secretion in the intestine after CP treatment. These results indicated that PAG could be an effective immunomodulator and that it could prevent CP-induced immunotoxic side effects. PMID:25347273

  11. Systemic immunotoxicity reactions induced by adjuvanted vaccines.

    PubMed

    Batista-Duharte, Alexander; Portuondo, Deivys; Pérez, O; Carlos, Iracilda Zeppone

    2014-05-01

    Vaccine safety is a topic of concern for the treated individual, the family, the health care personnel, and the others involved in vaccination programs as recipients or providers. Adjuvants are necessary components to warrant the efficacy of vaccines, however the overstimulation of the immune system is also associated with adverse effects. Local reactions are the most frequent manifestation of toxicity induced by adjuvanted vaccines and, with the exception of the acute phase response (APR), much less is known about the systemic reactions that follow vaccination. Their low frequency or subclinical expression meant that this matter has been neglected. In this review, various systemic reactions associated with immune stimulation will be addressed, including: APR, hypersensitivity, induction or worsening of autoimmune diseases, modification of hepatic metabolism and vascular leak syndrome (VLS), with an emphasis on the mechanism involved. Finally, the authors analyze the current focus of discussion about vaccine safety and opportunities to improve the design of new adjuvanted vaccines in the future.

  12. Aquatic pollution-induced immunotoxicity in wildlife species.

    PubMed

    Luebke, R W; Hodson, P V; Faisal, M; Ross, P S; Grasman, K A; Zelikoff, J

    1997-05-01

    The potential for chemicals to adversely affect human immunologic health has traditionally been evaluated in rodents, under laboratory conditions. These laboratory studies have generated valuable hazard identification and immunotoxicologic mechanism data; however, genetically diverse populations exposed in the wild may better reflect both human exposure conditions and may provide insight into potential immunotoxic effects in humans. In addition, comparative studies of species occupying reference and impacted sites provide important information on the effects of environmental pollution on the immunologic health of wildlife populations. In this symposium overview, Peter Hodson describes physiological changes in fish collected above or below the outflows of paper mills discharging effluent from the bleaching process (BKME). Effects attributable to BKME were identified, as were physiological changes attributable to other environmental factors. In this context, he discussed the problems of identifying true cause and effect relationships in field studies. Mohamed Faisal described changes in immune function of fish collected from areas with high levels of polyaromatic hydrocarbon contamination. His studies identified a contaminant-related decreases in the ability of anterior kidney leukocytes to bind to and kill tumor cell line targets, as well as changes in lymphocyte proliferation in response to mitogens. Altered proliferative responses of fish from the contaminated site were partially reversed by maintaining fish in water from the reference site. Peter Ross described studies in which harbor seals were fed herring obtained from relatively clean (Atlantic Ocean) and contaminated (Baltic Sea) waters. Decreased natural killer cell activity and lymphoproliferative responses to T and B cell mitogens, as well as depressed antibody and delayed hypersensitivity responses to injected antigens, were identified in seals fed contaminated herring. In laboratory studies, it was

  13. Exposure to mercuric chloride induces developmental damage, oxidative stress and immunotoxicity in zebrafish embryos-larvae.

    PubMed

    Zhang, Qun-Fang; Li, Ying-Wen; Liu, Zhi-Hao; Chen, Qi-Liang

    2016-12-01

    Mercury (Hg) is a widespread environmental pollutant that can produce severe negative effects on fish even at very low concentrations. However, the mechanisms underlying inorganic Hg-induced oxidative stress and immunotoxicity in the early development stage of fish still need to be clarified. In the present study, zebrafish (Danio rerio) embryos were exposed to different concentrations of Hg(2+) (0, 1, 4 and 16μg/L; added as mercuric chloride, HgCl2) from 2h post-fertilization (hpf) to 168hpf. Developmental parameters and total Hg accumulation were monitored during the exposure period, and antioxidant status and the mRNA expression of genes related to the innate immune system were examined at 168hpf. The results showed that increasing Hg(2+) concentration and time significantly increased total Hg accumulation in zebrafish embryos-larvae. Exposure to 16μg/L Hg(2+) caused developmental damage, including increased mortality and malformation, decreased body length, and delayed hatching period. Meanwhile, HgCl2 exposure (especially in the 16μg/L Hg(2+) group) induced oxidative stress affecting antioxidant enzyme (CAT, GST and GPX) activities, endogenous GSH and MDA contents, as well as the mRNA levels of genes (cat1, sod1, gstr, gpx1a, nrf2, keap1, hsp70 and mt) encoding antioxidant proteins. Moreover, the transcription levels of several representative genes (il-1β, il-8, il-10, tnfα2, lyz and c3) involved in innate immunity were up-regulated by HgCl2 exposure, suggesting that inorganic Hg had the potential to induce immunotoxicity. Taken together, the present study provides evidence that waterborne HgCl2 exposure can induce developmental impairment, oxidative stress and immunotoxicity in the early development stage of fish, which brings insights into the toxicity mechanisms of inorganic Hg in fish.

  14. Effect of thyroidectomy and thyroxine on 2,3,7,8-tetrachlorodibenzo-p-dioxin-induced immunotoxicity

    SciTech Connect

    Pazdernik, T.L.; Rozman, K.K.

    1985-02-18

    Radiothyroidectomy protected against 2,3,7,8-tetrachloro dibenzo-p-dioxin (TCDD)-induced immunotoxicity in rats as assessed by the spleen anti-SRBC plaque-forming cell assay. Thyroxin (T/sub 4/) replacement therapy partially reversed the effects of thyroidectomy on T/sub 4/ and triiodothyronine (T/sub 3/) serum levels, body weight and immune function as well as restored TCDD-induced immunotoxicity. Thus, hypothyroidism induced by TCDD exposure can be viewed as a protective response of the organism to reduce the insult caused by TCDD.

  15. Comparison of inflammatory responses in mouse lungs exposed to atranones A and C from Stachybotrys chartarum.

    PubMed

    Rand, Thomas G; Flemming, J; David Miller, J; Womiloju, Taiwo O

    2006-07-01

    Stachybotrys chartarum isolates can be separated into two distinct chemotypes based on the toxins they produce. One chemotype produces macrocyclic trichothecenes; the other produces atranones (and sometimes simple trichothecenes, e.g., trichodermol and trichodermin). Studies using in vivo models of lung disease revealed that exposure to spores of the atranone producing S. chartarum isolates led to a variety of immunotoxic, inflammatory, and other pathological changes. However, it is unclear from these studies what role the pure atranone toxins sequestered in spores of these isolates exert on lung disease onset. This study examined dose-response (0.2, 1.0, 2.0, 5.0, or 20 microg atranone/animal) and time-course (3, 6, 24, and 48 h postinstillation [PI]) relationships associated with inflammatory cell and proinflammatory chemokine/cytokine responses in mouse lungs intratracheally instilled with two pure atranones (either A or C) isolated from S. chartarum. High doses (2.0 to 20 microg toxin/animal) of atranone A and C induced significant inflammatory responses manifested as differentially elevated macrophage, neutrophil, macrophage inflammatory protein (MIP)-2, tumor necrosis factor (TNF) and interleukin (IL)-6 concentrations in the bronchioalveolar lavage fluid (BALF) of intratracheally exposed mice. Compared to controls, BALF macrophage and neutrophil numbers were increased to significant levels from 6 to 48 h (PI). Except for macrophage numbers in atranone A treatment animals, cells exhibited significant dose dependent-like responses. The chemokine/cytokine marker responses were significantly and dose-dependently increased from 3 to 24 h PI and declined to nonsignificant levels at 48 h PI. The results suggest not only that atranones are inflammatory but also that they exhibit different inflammatory potency with different toxicokinetics. Data also suggest that exposure to these toxins in spores of S. chartarum in contaminated building environments could contribute

  16. Simultaneous administration of hesperidin or garlic oil modulates diazinon-induced hemato- and immunotoxicity in rats.

    PubMed

    Hassouna, Imam; Ibrahim, Hany; Abdel Gaffar, Faten; El-Elaimy, Ibrahim; Abdel Latif, Heba

    2015-01-01

    Diazinon (DZN) has been used for several years in agriculture and urban applications leading to a variety of negative effects on health. Hesperidin (HDN) and garlic oil are naturally occurring compounds present in fruits and vegetables, which have been reported to have antioxidants and anti-inflammatory actions. This study was undertaken to throw light on the modulatory effect of HDN or garlic oil against hemato- and immunotoxicity induced by DZN in Wistar rats. Oral administration of DZN for 30 days resulted in significant decrease in RBCs count, Hb content, Ht value, platelet count, and relative lymphocyte and monocyte counts when compared with control groups. Moreover, DZN reduced significantly the serum total immunoglobulin concentration, hemagglutination titer, quantitative hemolysis of SRBCs, delayed type hypersensitivity, blood mononuclear cell proliferation, phagocytic index and blood T-cell subtypes (CD4(+) and CD8(+)) in comparison with vehicle treatment. Co-administration of HDN or garlic oil, 30 min before DZN was able to normalize most of the hematological and immunological parameters. These results suggested that HDN or garlic oil, the natural antioxidants, can alleviate DZN induced hemato- and immunotoxicity.

  17. Protective role of bentonite against aflatoxin B1- and ochratoxin A-induced immunotoxicity in broilers.

    PubMed

    Bhatti, Sheraz Ahmed; Khan, Muhammad Zargham; Saleemi, Muhammad Kashif; Saqib, Muhammad; Khan, Ahrar; Ul-Hassan, Zahoor

    2017-12-01

    The present study was designed to investigate any ameliorative effects of bentonite (BN) against immuno-pathological alterations induced by dietary aflatoxin B1 (AFB1) or ochratoxin A (OTA) in broiler chicks. In one experiment, AFB1 (0.1, 0.2 or 0.6 mg/kg feed) was fed alone and par alley with bentonite clay (3.7 or 7.5 g/kg feed) to the broilers. In the second experiment, the broilers were given feed contaminated with OTA (0.15, 0.3 or 1.0 mg/kg feed) alone and in combination with bentonite clay (3.7, 7.5, or 15 g/kg feed). Experimental feedings were continued for 42 days. At various time points along the feeding schedule, immune system organ histologic status, as well as host humoral and cellular immune responses, were evaluated in all groups. The dietary addition of AFB1 and OTA alone significantly reduced immune responses in the birds as assessed by histological changes in the bursa of Fabricius and thymus, antibody responses to SRBC, in-vivo lympho-proliferative responses to Phytohemagglutinin-P (PHA-P) and, phagocytic function in situ. The dietary addition of BN significantly ameliorated the immunotoxicity of 0.1 and 0.2 mg/kg dietary AFB1, however with a level of 0.6 mg AFB1/kg only partial amelioration was seen. The co-treatment of birds exposed to OTA with BN at all levels only partially alleviated deleterious effects on histology and immune responses. Taken together, the results here suggested to us that dietary addition of BN could help ameliorate AFB1-mediated immunotoxicities but could not afford such protection against OTA-induced immune damage.

  18. Rhein Induces Oxidative Stress and Apoptosis in Mouse Blastocysts and Has Immunotoxic Effects during Embryonic Development.

    PubMed

    Huang, Chien-Hsun; Chan, Wen-Hsiung

    2017-09-20

    Rhein, a glucoside chemical compound found in a traditional Chinese medicine derived from the roots of rhubarb, induces cell apoptosis and is considered to have high potential as an antitumor drug. Several previous studies showed that rhein can inhibit cell proliferation and trigger mitochondria-related or endoplasmic reticulum (ER) stress-dependent apoptotic processes. However, the side effects of rhein on pre- and post-implantation embryonic development remain unclear. Here, we show that rhein has cytotoxic effects on blastocyst-stage mouse embryos and induces oxidative stress and immunotoxicity in mouse fetuses. Blastocysts incubated with 5-20 μM rhein showed significant cell apoptosis, as well as decreases in their inner cell mass cell numbers and total cell numbers. An in vitro development assay showed that rhein affected the developmental potentials of both pre- and post-implantation embryos. Incubation of blastocysts with 5-20 μM rhein was associated with increased resorption of post-implantation embryos and decreased fetal weight in an embryo transfer assay. Importantly, in an in vivo model, intravenous injection of dams with rhein (1, 3, and 5 mg/kg body weight/day) for four days resulted in apoptosis of blastocyst-stage embryos, early embryonic developmental injury, and decreased fetal weight. Intravenous injection of dams with 5 mg/kg body weight/day rhein significantly increased the total reactive oxygen species (ROS) content of fetuses and the transcription levels of antioxidant proteins in fetal livers. Additional work showed that rhein induced apoptosis through ROS generation, and that prevention of apoptotic processes effectively rescued the rhein-induced injury effects on embryonic development. Finally, the transcription levels of the innate-immunity related genes, CXCL1, IL-1β and IL-8, were down-regulated in the fetuses of dams that received intravenous injections of rhein. These results collectively show that rhein has the potential to induce

  19. Protective effects of selenium on mercury induced immunotoxic effects in mice by way of concurrent drinking water exposure.

    PubMed

    Li, Xuan; Yin, Daqiang; Li, Jiang; Wang, Rui

    2014-07-01

    Selenium (Se) has been recognized as one key to understanding mercury (Hg) exposure risks. To explore the effects of Se on Hg-induced immunotoxicity, female Balb/c mice were exposed to HgCl2- or MeHgCl-contaminated drinking water (0.001, 0.01, and 0.1 mM as Hg) with coexisting Na2SeO3 at different Se/Hg molar ratios (0:1, 1/3:1, 1:1 and 3:1). The potential immunotoxicity induced by Na2SeO3 exposure alone (by way of drinking water) was also determined within a wide range of concentrations. After 14 days' exposure, the effects of Hg or Se on the immune system of Balb/c mice were investigated by determining the proliferation of T and B lymphocytes and the activity of natural killer cells. Hg exposure alone induced a dose-dependent suppression effect, whereas Se provided promotion effects at low exposure level (<0.01 mM) and inhibition effects at high exposure level (>0.03 mM). Under Hg and Se coexposure condition, the effects on immunotoxicity depended on the Hg species, Se/Hg ratio, and exposure concentration. At low Hg concentration (0.001 mM), greater Se ingestion exhibited stronger protective effects on Hg-induced suppression effect mainly by way of decreasing Hg concentrations in target organs. At greater Hg concentration (0.01 and 0.1 mM), immunotoxicity induced by Se (>0.03 mM) became evident, and the protective effects appeared more significant at an Se/Hg molar ratio of 1:1. The complex antagonistic effects between Se and Hg suggested that both Se/Hg molar ratio and concentration should be considered when evaluating the potential health risk of Hg-contaminated biota.

  20. Investigations of immunotoxicity and allergic potential induced by topical application of triclosan in mice.

    PubMed

    Anderson, Stacey E; Meade, B Jean; Long, Carrie M; Lukomska, Ewa; Marshall, Nikki B

    2016-01-01

    Triclosan is an antimicrobial chemical commonly used occupationally and by the general public. Using select immune function assays, the purpose of these studies was to evaluate the immunotoxicity of triclosan following dermal exposure using a murine model. Triclosan was not identified to be a sensitizer in the murine local lymph node assay (LLNA) when tested at concentrations ranging from 0.75-3.0%. Following a 28-day exposure, triclosan produced a significant increase in liver weight at concentrations of ≥ 1.5%. Exposure to the high dose (3.0%) also produced a significant increase in spleen weights and number of platelets. The absolute number of B-cells, T-cells, dendritic cells and NK cells were significantly increased in the skin draining lymph node, but not the spleen. An increase in the frequency of dendritic cells was also observed in the lymph node following exposure to 3.0% triclosan. The IgM antibody response to sheep red blood cells (SRBC) was significantly increased at 0.75% - but not at the higher concentrations - in the spleen and serum. These results demonstrate that dermal exposure to triclosan induces stimulation of the immune system in a murine model and raise concerns about potential human exposure.

  1. Differential Immunotoxicity Induced by Two Different Windows of Developmental Trichloroethylene Exposure

    PubMed Central

    Gilbert, Kathleen M.; Woodruff, William; Blossom, Sarah J.

    2014-01-01

    Developmental exposure to environmental toxicants may induce immune system alterations that contribute to adult stage autoimmune disease. We have shown that continuous exposure of MRL+/+ mice to trichloroethylene (TCE) from gestational day (GD) 0 to postnatal day (PND) 49 alters several aspects of CD4+ T cell function. This window of exposure corresponds to conception-adolescence/young adulthood in humans. More narrowly defining the window of TCE developmental exposure causes immunotoxicity that would establish the stage at which avoidance and/or intervention would be most effective. The current study divided continuous TCE exposure into two separate windows, namely, gestation only (GD0 to birth (PND0)) and early-life only (PND0-PND49). The mice were examined for specific alterations in CD4+ T cell function at PND49. One potentially long-lasting effect of developmental exposure, alterations in retrotransposon expression indicative of epigenetic alterations, was found in peripheral CD4+ T cells from both sets of developmentally exposed mice. Interestingly, certain other effects, such as alterations in thymus cellularity, were only found in mice exposed to TCE during gestation. In contrast, expansion of memory/activation cell subset of peripheral CD4+ T cells were only found in mice exposed to TCE during early life. Different windows of developmental TCE exposure can have different functional consequences. PMID:24696780

  2. Differential immunotoxicity induced by two different windows of developmental trichloroethylene exposure.

    PubMed

    Gilbert, Kathleen M; Woodruff, William; Blossom, Sarah J

    2014-01-01

    Developmental exposure to environmental toxicants may induce immune system alterations that contribute to adult stage autoimmune disease. We have shown that continuous exposure of MRL+/+ mice to trichloroethylene (TCE) from gestational day (GD) 0 to postnatal day (PND) 49 alters several aspects of CD4(+) T cell function. This window of exposure corresponds to conception-adolescence/young adulthood in humans. More narrowly defining the window of TCE developmental exposure causes immunotoxicity that would establish the stage at which avoidance and/or intervention would be most effective. The current study divided continuous TCE exposure into two separate windows, namely, gestation only (GD0 to birth (PND0)) and early-life only (PND0-PND49). The mice were examined for specific alterations in CD4(+) T cell function at PND49. One potentially long-lasting effect of developmental exposure, alterations in retrotransposon expression indicative of epigenetic alterations, was found in peripheral CD4(+) T cells from both sets of developmentally exposed mice. Interestingly, certain other effects, such as alterations in thymus cellularity, were only found in mice exposed to TCE during gestation. In contrast, expansion of memory/activation cell subset of peripheral CD4(+) T cells were only found in mice exposed to TCE during early life. Different windows of developmental TCE exposure can have different functional consequences.

  3. Investigations of immunotoxicity and allergic potential induced by topical application of triclosan in mice

    PubMed Central

    Anderson, Stacey E.; Meade, B. Jean; Long, Carrie M.; Lukomska, Ewa; Marshall, Nikki B.

    2016-01-01

    Triclosan is an antimicrobial chemical commonly used occupationally and by the general public. Using select immune function assays, the purpose of these studies was to evaluate the immunotoxicity of triclosan following dermal exposure using a murine model. Triclosan was not identified to be a sensitizer in the murine local lymph node assay (LLNA) when tested at concentrations ranging from 0.75–3.0%. Following a 28-day exposure, triclosan produced a significant increase in liver weight at concentrations of ≥ 1.5%. Exposure to the high dose (3.0%) also produced a significant increase in spleen weights and number of platelets. The absolute number of B-cells, T-cells, dendritic cells and NK cells were significantly increased in the skin draining lymph node, but not the spleen. An increase in the frequency of dendritic cells was also observed in the lymph node following exposure to 3.0% triclosan. The IgM antibody response to sheep red blood cells (SRBC) was significantly increased at 0.75% – but not at the higher concentrations – in the spleen and serum. These results demonstrate that dermal exposure to triclosan induces stimulation of the immune system in a murine model and raise concerns about potential human exposure. PMID:25812624

  4. TLR9-Dependent IL-23/IL-17 is Required for the Generation of Stachybotrys chartarum-induced Hypersensitivity Pneumonitis

    PubMed Central

    Bhan, Urvashi; Newstead, Michael J.; Zeng, Xianying; Podsaid, Amy; Goswami, Moloy; Ballinger, Megan N.; Kunkel, Steven L.; Standiford, Theodore J.

    2012-01-01

    Hypersensitivity pneumonitis (HP) is an inflammatory lung disease that develops following repeated exposure to inhaled particulate antigen. Stachybotrys chartarum (SC) is a dimorphic fungus that has been implicated in a number of respiratory illnesses, including HP (1). In this study we have developed a murine model of SC- induced HP that reproduces pathology observed in human HP and hypothesized that TLR9–mediated IL-23/IL-17 responses are required for the generation of granulomatous inflammation induced by inhaled SC. Mice that undergo i.p. sensitization and i.t. challenge with 106 SC spores developed granulomatous inflammation with multinucleate giant cells, accompanied by increased accumulation of T cells. SC sensitization and challenge resulted in robust pulmonary expression of IL-17 and IL-23. SC-mediated granulomatous inflammation required intact IL-23/IL-17 responses and required TLR9, as TLR9−/− mice displayed reduced IL-17 and IL-23 expression in whole lung associated with decreased accumulation of IL-17 expressing CD4+ and γδ T cells. As compared to SC-sensitized dendritic cells (DC) isolated from WT mice, DC isolated from TLR9−/− mice had a reduced ability to produce IL-23 in responses to SC. Moreover, shRNA knockdown of IL-23 in DC abolished IL-17 production from splenocytes in response to antigen challenge. Finally, the i.t. reconstitution of IL-23 in TLR9−/− mice recapitulated the immunopathology observed in WT mice. In conclusion, our studies suggest that TLR9 is critical for development of Th17-mediated granulomatous inflammation in the lung in response to SC. PMID:23180821

  5. Tunisian radish (Raphanus sativus) extract prevents cadmium-induced immunotoxic and biochemical alterations in rats.

    PubMed

    ben Salah-Abbès, Jalila; Abbès, Samir; Zohra, Haous; Oueslati, Ridha

    2015-01-01

    Cadmium (Cd), a known carcinogen and potent immunotoxicant in humans and animals, is dispersed throughout the environment as a result of pollution from a variety of sources. Tunisian radish (Raphanus sativus) extract (TRE) is a known anti-oxidant and free radical scavenger that has been shown to help alleviate immune system disorders, including some induced by environmental toxicants. The present study was undertaken to investigate potential protective effects of TRE against Cd-induced immunotoxicities (and general toxicities) in situ. Cadmium chloride (at 2.5 mg CdCl2/kg BW) and TRE (5, 10, or 15 mg/kg BW) were given (alone or in combination [actually, in sequence of Cd and then TRE]) to rats daily by oral gavage for 2 weeks. Results indicated that treatment with CdCl2 alone resulted in significant decreases in plasma levels of total protein, triglycerides, creatine kinase, creatinine, IgG and IgA, T-lymphocyte sub-types (CD4(+), CD3(+), CD56(+), and CD8(+)), and in thymic and hepatic indices (relative weights). In contrast, CdCl2 treatment caused significant increases in serum LDH, AST, and ALT, in the formation/release of pro-inflammatory cytokines (IL-1 and TNFα), and in the relative weights of host spleen and kidneys. Rats treated with TRE alone had no discernable changes compared to the controls with regard to all test parameters. Combined treatment of CdCl2 and TRE-at any dose-resulted in a significant improvement of all test parameters compared to those seen with Cd alone. These results illustrated (and provided further support for a continuing belief in) the beneficial effects of TRE in reducing the harmful outcomes of commonly encountered toxicants (like Cd) on the immune system and on overall host health status.

  6. Comparison of immunotoxic effects induced by the extracts from methanol and gasoline engine exhausts in vitro.

    PubMed

    Che, Wangjun; Liu, Guiming; Qiu, Hong; Zhang, Hao; Ran, Yun; Zeng, Xianggui; Wen, Weihua; Shu, Ya

    2010-06-01

    Gasoline engine exhaust has been considered as a major source of air pollution in China. Due to lower cyto- and geno-toxicity effects of methanol engine exhaust, methanol is regarded as a potential substitute for gasoline. We have previously compared cyto- and geno-toxicities of gasoline engine exhaust with that of methanol engine exhaust in A549 cells (Zhang et al., 2007).To characterize the immunotoxic effects for gasoline and methanol engine exhausts in immune cell, in this study, we further compared effects of gasoline and methanol engine exhausts on immune function in RAW264.7 cell and rabbit alveolar macrophages. Results showed that both gasoline and methanol engine exhaust could evidently inhibit RAW264.7 cell proliferation, promote RAW264.7 cell apoptosis, decrease E-rosette formation rate and inhibit anti-tumor effects of alveolar macrophages, at the same time, these effects of gasoline engine exhaust were far stronger than those of methanol engine exhaust. In addition, gasoline engine exhaust could significantly inhibit activities of ADCC of alveolar macrophages, but methanol engine exhaust could not. These results suggested that both gasoline and methanol engine exhausts might be immunotoxic atmospheric pollutants, but some effects of gasoline engine exhaust on immunotoxicities may be far stronger than that of methanol engine exhaust.

  7. Copper-induced immunotoxicity involves cell cycle arrest and cell death in the spleen and thymus.

    PubMed

    Mitra, Soham; Keswani, Tarun; Dey, Manali; Bhattacharya, Shaswati; Sarkar, Samrat; Goswami, Suranjana; Ghosh, Nabanita; Dutta, Anuradha; Bhattacharyya, Arindam

    2012-03-11

    Copper is an essential trace element for human physiological processes. To evaluate the potential adverse health impact/immunotoxicological effects of this metal in situ due to over exposure, Swiss albino mice were treated (via intraperitoneal injections) with copper (II) chloride (copper chloride) at doses of 0, 5, or 7.5 mg copper chloride/kg body weight (b.w.) twice a week for 4 wk; these values were derived from LD₅₀ studies using copper chloride doses that ranged from 0 to 40 mg/kg BW (2×/wk, for 4 wk). Copper treated mice evidenced immunotoxicity as indicated by dose-related decreases and increases, respectively, in thymic and splenic weights. Histomorphological changes evidenced in these organs were thymic atrophy, white pulp shrinkage in the spleen, and apoptosis of splenocytes and thymocytes; these observations were confirmed by microscopic analyses. Cell count analyses indicated that the proliferative functions of the splenocytes and thymocytes were also altered because of the copper exposures. Among both cell types from the copper treated hosts, flow cytometric analyses revealed a dose related increase in the percentages of cells in the Sub-G₀/G₁ state, indicative of apoptosis which was further confirmed by Annexin V binding assay. In addition, the copper treatments altered the expression of selected cell death related genes such as EndoG and Bax in a dose related manner. Immunohistochemical analyses revealed that there was also increased ubiquitin expression in both the cell types. In conclusion, these studies show that sublethal exposure to copper (as copper chloride) induces toxicity in the thymus and spleen, and increased Sub G₀/G₁ population among splenocytes and thymocytes that is mediated, in part, by the EndoG-Bax-ubiquitin pathway. This latter damage to these cells that reside in critical immune system organs are likely to be important contributing factors underlying the immunosuppression that has been documented by other

  8. Investigations into the Immunotoxicity and Allergic Potential Induced by Topical Application of N-Butylbenzenesulfonamide (NBBS) in a Murine Model

    PubMed Central

    Marrocco, Antonella; Meade, B. Jean; Long, Carrie M.; Lukomska, Ewa; Marshall, Nikki B.; Anderson, Stacey E.

    2015-01-01

    N-Butylbenzene sulfonamide (NBBS) is a commonly used plasticizer found in numerous products. Due to its extensive use, lack of adequate toxicological data, and suspicion of toxicity based on the presence of structural alerts, it was nominated to the National Toxicology Program for comprehensive toxicological testing. The purpose of this study was to evaluate the potential for hypersensitivity and immune suppression following dermal exposure to NBBS using a murine model. NBBS tested negative in a combined irritancy/local lymph node assay (LLNA), classifying it as nonirritating and nonsensitizing. To estimate the immunosuppressive potential of NBBS, assays that assessed immunotoxicity were performed, including the immumnoglobulin (Ig) M response to T-cell-dependent antigen sheep red blood cells (SRBC), using the plaque-forming cell (PFC) assay and immune cell phenotyping. After a 28-d treatment with NBBS, mice exposed to the lowest concentration (25% NBBS) showed a significant increase in IgM-producing B cells in the spleen. No marked changes were identified in immune cell markers in the lymph node. In contrast to body weight, a significant elevation in kidney and liver weight was observed following dermal exposure to all concentrations of NBBS. These results demonstrate that dermal exposure to NBBS, other than liver and kidney toxicity, did not apparently induce immunotoxicity in a murine model. PMID:26291892

  9. Walnut Polyphenol Extract Attenuates Immunotoxicity Induced by 4-Pentylphenol and 3-methyl-4-nitrophenol in Murine Splenic Lymphocyte

    PubMed Central

    Yang, Lubing; Ma, Sihui; Han, Yu; Wang, Yuhan; Guo, Yan; Weng, Qiang; Xu, Meiyu

    2016-01-01

    4-pentylphenol (PP) and 3-methyl-4-nitrophenol (PNMC), two important components of vehicle emissions, have been shown to confer toxicity in splenocytes. Certain natural products, such as those derived from walnuts, exhibit a range of antioxidative, antitumor, and anti-inflammatory properties. Here, we investigated the effects of walnut polyphenol extract (WPE) on immunotoxicity induced by PP and PNMC in murine splenic lymphocytes. Treatment with WPE was shown to significantly enhance proliferation of splenocytes exposed to PP or PNMC, characterized by increases in the percentages of splenic T lymphocytes (CD3+ T cells) and T cell subsets (CD4+ and CD8+ T cells), as well as the production of T cell-related cytokines and granzymes (interleukin-2, interleukin-4, and granzyme-B) in cells exposed to PP or PNMC. These effects were associated with a decrease in oxidative stress, as evidenced by changes in OH, SOD, GSH-Px, and MDA levels. The total phenolic content of WPE was 34,800 ± 200 mg gallic acid equivalents/100 g, consisting of at least 16 unique phenols, including ellagitannins, quercetin, valoneic acid dilactone, and gallic acid. Taken together, these results suggest that walnut polyphenols significantly attenuated PP and PNMC-mediated immunotoxicity and improved immune function by inhibiting oxidative stress. PMID:27187455

  10. Interactions between Streptomyces californicus and Stachybotrys chartarum can induce apoptosis and cell cycle arrest in mouse RAW264.7 macrophages

    SciTech Connect

    Penttinen, Piia . E-mail: Piia.Penttinen@ktl.fi; Pelkonen, Jukka; Huttunen, Kati; Toivola, Mika; Hirvonen, Maija-Riitta

    2005-02-01

    Exposure to complex mixtures of bacteria and fungi in moisture-damaged buildings is a potential cause of inflammatory related symptoms among occupants. The present study assessed interactions between two characteristic moldy house microbes Streptomyces californicus and Stachybotrys chartarum. Differences in cytotoxic and inflammatory responses in mouse (RAW264.7) macrophages were studied after exposure to the spores of co-cultivated microbes, the mixture of separately cultivated spores, and the spores of either of these microbes cultivated alone. The RAW264.7 cells were exposed to six doses (1 x 10{sup 4} to 3 x 10{sup 6} spores/ml) for 24 h, and the time course of the induced responses was evaluated after 4, 8, 16, and 24 h of exposure (1 x 10{sup 6} spores/ml). The cytotoxic potential of the spores was characterized by the MTT test, DNA content analysis, and enzyme assay for caspase-3 activity. The production of cytokines (IL-1{beta}, IL-6, IL-10, TNF{alpha}, and MIP2) was measured immunochemically and nitric oxide by the Griess method. Co-cultivation increased the ability of the spores to cause apoptosis by more than 4-fold and the proportion of RAW264.7 cells at the G{sub 2}/M stage increased nearly 2-fold when compared to the response induced by the mixture of spores. In contrast, co-cultivation decreased significantly the ability of the spores to trigger the production of NO and IL-6 in RAW264.7 cells. In conclusion, these data suggest that co-culture of S. californicus and S. chartarum can result in microbial interactions that significantly potentiate the ability of the spores to cause apoptosis and cell cycle arrest in mammalian cells.

  11. Role of Glutathione Conjugation in 1-Bromobutane-induced Immunotoxicity in Mice

    PubMed Central

    Lee, Sang Kyu; Lee, Dong Ju; Jeon, Tae Won; Ko, Gyu Sub; Yoo, Se Hyun; Ha, Hyun Woo; Kang, Mi Jeong; Kang, Wonku; Kim, Sang Kyum

    2010-01-01

    Halogenated organic compounds, such as 1-bromobutane (1-BB) , have been used as cleaning agents, agents for chemical syntheses or extraction solvents in workplace. In the present study, immunotoxic effects of 1-BB and its conjugation with glutathione (GSH) were investigated in female BALB/c mice. Animals were treated orally with 1-BB at 375, 750 and 1500 mg/kg in corn oil once for dose response or treated orally with 1-BB at 1500 mg/kg for 6, 12, 24 and 48 hr for time course. S-Butyl GSH was identified in spleen by liquid chromatography-electrospray ionization tandem mass spectrometry. Splenic GSH levels were significantly reduced by single treatment with 1-BB. S-Butyl GSH conjugates were detected in spleen from 6 hr after treatment. Oral 1-BB significantly suppressed the antibody response to a T-dependent antigen and the production of splenic intracellular interlukin-2 in response to Con A. Our present results suggest that 1-BB could cause immunotoxicity as well as reduction of splenic GSH content, due to the formation of GSH conjugates in mice. The present results would be useful to understand molecular toxic mechanism of low molecular weight haloalkanes and to develop biological markers for exposure to haloalkanes. PMID:24278512

  12. Assessing a theoretical risk of dolutegravir-induced developmental immunotoxicity in juvenile rats.

    PubMed

    Rhodes, Melissa; Laffan, Susan; Genell, Caroline; Gower, Jill; Maier, Curtis; Fukushima, Tamio; Nichols, Garrett; Bassiri, Ashlyn Eaton

    2012-11-01

    HIV-1 integrase inhibitors (INIs) are a promising class of antiretrovirals for the treatment of HIV in adults; there is interest in expanding their use into pediatric populations. A theoretical concern for developmental immunotoxicity was raised after a publication suggested that two HIV INI tool compounds inhibited in vitro cleavage activity of recombination activating genes 1 and 2 (RAG1/2) through the inhibition of their binding to recombination signal sequences. RAG1/2 are required for the development of mature B and T lymphocyte populations. The potential effects of the investigational INI dolutegravir on RAG1/2 were addressed by developing assays in juvenile rats to measure T cell receptor (TCR) Vβ usage by flow cytometry as an indicator of TCR repertoire diversity and a T cell dependent antibody response (TDAR) as an indicator of immunosuppression. These endpoints were incorporated into a juvenile rat toxicity study, along with immunophenotyping, hematology, and histopathology of immunologic organs. Dose levels of 0, 0.5, 2, or 75mg/kg/day dolutegravir were given via oral gavage from postnatal day 4 through 66. At the highest dose, there was decreased body weight gain and two preweanling deaths; however, there were no treatment-related effects on developmental parameters. There were no effects on immunologic competence, as measured by TDAR, and no effects on lymphocyte subsets or CD4 and CD8 TCR Vβ usage in peripheral blood. Histopathology of immunologic organs (spleen, thymus, lymph nodes) and hematology evaluation revealed no effects. The no observed adverse effect level for immunotoxicity endpoints was 75mg/kg/day.

  13. IS YOUR STACHYBOTRYS CHARTARUM A GENUINE S. CHARTARUM?

    EPA Science Inventory

    The fungus Stachybotrys chartarum is the type species of the genus Stachybotrys. Certain strains of the species are known to produce trichothecene mycotoxins,. It is a celluolytic saprophyte with worldwide distribution and frequently discovered in water-damaged buildings. Evid...

  14. IS YOUR STACHYBOTRYS CHARTARUM A GENUINE S. CHARTARUM?

    EPA Science Inventory

    The fungus Stachybotrys chartarum is the type species of the genus Stachybotrys. Certain strains of the species are known to produce trichothecene mycotoxins,. It is a celluolytic saprophyte with worldwide distribution and frequently discovered in water-damaged buildings. Evid...

  15. Acute exposure to waterborne cadmium induced oxidative stress and immunotoxicity in the brain, ovary and liver of zebrafish (Danio rerio).

    PubMed

    Zheng, Jia-Lang; Yuan, Shuang-Shuang; Wu, Chang-Wen; Lv, Zhen-Ming

    2016-11-01

    Cadmium (Cd) is an environmental contaminant that poses serious risks to aquatic organisms and their associated ecosystem. The mechanisms underlying Cd-induced oxidative stress and immunotoxicity in fish remain largely unknown. In this study, adult female zebrafish were exposed to 0 (control), 1mgL(-1) Cd for 24h and 96h, and the oxidative stress and inflammatory responses induced by Cd were evaluated in the brain, liver and ovary. Reactive oxygen species (ROS), nitric oxide (NO), and malondialdehyde (MDA) increased in a time-dependent manner after treatment with Cd in the brain and liver. The increase may result from the disturbance of genes including copper and zinc superoxide dismutase (Cu/Zn-SOD), catalase (CAT), inducible nitric oxide synthase (iNOS), and ciclooxigenase-2 (COX-2) at mRNA, protein and activity levels. Although ROS, NO and MDA were not significantly affected by Cd in the ovary, the up-regulation of Cu/Zn-SOD, CAT, iNOS, and COX-2 was observed. Exposure to Cd induced a sharp increase in the protein levels of tumor necrosis factor alpha (TNF-α) in the brain, liver and ovary, possibly contributing to activate inflammatory responses. Furthermore, we also found a dramatic increase in mRNA levels of NF-E2-related factor 2 (Nrf2) and nuclear transcription factor κB (NF-κB) at 24h in the liver and ovary. The corresponding changes in the mRNA levels of Kelch-like-ECH-associated protein 1 (Keap1a and Keap1b) and the inhibitor of κBα (IκBαa and IκBαb) may contribute to regulate the transcriptional activity of Nrf2 and NF-κB, respectively. Contrarily, mRNA levels of Nrf2, NF-κB, Keap1, Keap1b, IκBαa and IκBαb remained stable at 24 and 96h in the brain. Taken together, we demonstrated Cd-induced oxidative stress and immunotoxicity in fish, possibly through transcriptional regulation of Nrf2 and NF-κB and gene modifications at transcriptional, translational, post-translational levels, which would greatly extend our understanding on the Cd

  16. Strain differences influence murine pulmonary responses to Stachybotrys chartarum.

    PubMed

    Rosenblum Lichtenstein, Jamie H; Molina, Ramon M; Donaghey, Thomas C; Brain, Joseph D

    2006-10-01

    When the fungus Stachybotrys chartarum is inhaled, its mycotoxins may cause lung injury and inflammation. The severity of human responses to S. chartarum in both occupational and home settings varies widely. To explore these differences, we intratracheally instilled C3H/HeJ, BALB/c, and C57BL/6J mice with S. chartarum spores suspended in saline. One day later, the mice were humanely killed, bronchoalveolar lavage (BAL) was performed, and biochemical and cellular indicators of lung injury and inflammation were measured. BALB/c mice showed the highest myeloperoxidase activity, albumin and hemoglobin levels, and neutrophil numbers in their BAL among the three strains. BALB/c was the only strain to show significant increases in keratinocyte-derived cytokine (KC), monocyte chemotactic protein (MCP)-1, MCP-3, macrophage inflammatory protein (MIP)-1alpha, MIP-1beta, MIP-1gamma, MIP-2, RANTES, IL-1alpha, IL-1beta, IL-3, IL-6, IL-18, leukemia inhibitory factor, macrophage colony-stimulating factor, and TNF-alpha. A model of allergen-induced airway inflammation was examined to assess whether underlying allergic inflammation might contribute to increased susceptibility to S. chartarum-induced pulmonary inflammation and injury. Surprisingly, in BALB/c mice, ovalbumin-induced airway inflammation produced a protective effect against some S. chartarum-induced pulmonary responses. This is the first report of mammalian strain differences affecting responses to S. chartarum. These responses differ from those reported for LPS and other fungi. Analogous underlying genetic differences may contribute to the wide range of sensitivity to Stachybotrys among humans.

  17. Global gene expression changes underlying Stachybotrys chartarum toxin-induced apoptosis in murine alveolar macrophages: evidence of multiple signal transduction pathways.

    PubMed

    Wang, Huiyan; Yadav, Jagjit S

    2007-03-01

    The overall mechanism(s) underlying macrophage apoptosis caused by the toxins of the indoor mold Stachybotrys chartarum (SC) are not yet understood. In this direction, we report a microarray-based global gene expression profiling on the murine alveolar macrophage cell line (MH-S) treated with SC toxins for short (2 h) and long (24 h) periods, coinciding with the pre-apoptotic (<3 h) and progressed apoptotic stages of the treated cells, respectively. Microarray results on differential expression were validated by real-time RT-PCR analysis using representative gene targets. The toxin-regulated genes corresponded to multiple cellular processes, including cell growth, proliferation and death, inflammatory/immune response, genotoxic stress and oxidative stress, and to the underlying multiple signal transduction pathways involving MAPK-, NF-kB-, TNF-, and p53-mediated signaling. Transcription factor NF-kB showed dynamic temporal changes, characterized by an initial activation and a subsequent inhibition. Up-regulation of a battery of DNA damage-responsive and DNA repair genes in the early stage of the treatment suggested a possible role of genotoxic stress in the initiation of apoptosis. Simultaneous expression changes in both pro-survival genes and pro-apoptotic genes indicated the role of a critical balance between the two processes in SC toxin-induced apoptosis. Taken together, the results imply that multiple signaling pathways underlie the SC toxin-induced apoptosis in alveolar macrophages.

  18. Modulatory role of dietary Chlorella vulgaris powder against arsenic-induced immunotoxicity and oxidative stress in Nile tilapia (Oreochromis niloticus).

    PubMed

    Zahran, Eman; Risha, Engy

    2014-12-01

    Arsenic intoxicant have long been regarded as an impending carcinogenic, genotoxic, and immunotoxic heavy metal to human and animals as well. In this respect, we evaluated biomarkers of the innate immune response and oxidative stress metabolism in gills and liver of Nile tilapia (Oreochromis niloticus) after arsenic exposure, and the protective role of Chlorella vulgaris (Ch) dietary supplementation were elucidated. Protective role of C. vulgaris (Ch), as supplementary feeds (5% and 10% of the diet) was studied in Nile tilapia (O. niloticus) against arsenic induced toxicity (NaAsO2 at 7 ppm) for 21 days exposure period. A significant down-regulation in innate immune response; including, respiratory burst, lysozyme, and bactericidal activity followed due to deliberately As(+3) exposure. Similarly, oxidative stress response; like nitric oxide (NO), catalase (CAT), glutathione (GSH), glutathione peroxidase (GPx), malondialdehyde (MDA) and hydrogen peroxide (H2O2) levels were significantly decreased. Combined treatment of Ch and As(+3) significantly enhanced the innate immune response and antioxidant activity. Strikingly, Ch supplementation at 10% has been considered the optimum for Nile tilapia since it exhibited enhancement of innate immune response and antioxidant activity over the level 5%, and even better than that of control level. Thus, our results concluded that dietary Ch supplementation could protect Nile tilapia against arsenic induced immunosuppression and oxidative stresses. Copyright © 2014 Elsevier Ltd. All rights reserved.

  19. Satratoxin-G from the black mold Stachybotrys chartarum induces rhinitis and apoptosis of olfactory sensory neurons in the nasal airways of rhesus monkeys.

    PubMed

    Carey, Stephan A; Plopper, Charles G; Hyde, Dallas M; Islam, Zahidul; Pestka, James J; Harkema, Jack R

    2012-08-01

    Satratoxin-G (SG) is a trichothecene mycotoxin of Stachybotrys chartarum, the black mold suggested to contribute etiologically to illnesses associated with water-damaged buildings. We have reported that intranasal exposure to SG evokes apoptosis of olfactory sensory neurons (OSNs) and acute inflammation in the nose and brain of laboratory mice. To further assess the potential human risk of nasal airway injury and neurotoxicity, we developed a model of SG exposure in monkeys, whose nasal airways more closely resemble those of humans. Adult, male rhesus macaques received a single intranasal instillation of 20 µg SG (high dose, n = 3), or 5 µg SG daily for four days (repeated low dose, n = 3) in one nasal passage, and saline vehicle in the contralateral nasal passage. Nasal tissues were examined using light and electron microscopy and morphometric analysis. SG induced acute rhinitis, atrophy of the olfactory epithelium (OE), and apoptosis of OSNs in both groups. High-dose and repeated low-dose SG elicited a 13% and 66% reduction in OSN volume density, and a 14-fold and 24-fold increase in apoptotic cells of the OE, respectively. This model provides new insight into the potential risk of nasal airway injury and neurotoxicity caused by exposure to water-damaged buildings.

  20. Allergic Potential and Immunotoxicity Induced by Topical Application of 1-Chloro-4-(Trifluoromethyl)Benzene (PCBTF) in a Murine Model

    PubMed Central

    Franko, Jennifer; Jackson, Laurel G.; Meade, B. Jean; Anderson, Stacey E.

    2011-01-01

    The purpose of the studies in this paper was to evaluate the allergic potential, immunotoxicity, and irritancy of the occupationally relevant chemical, 1-chloro-4-(trifluoromethyl)benzene, also known as parachlorobenzotrifluoride (PCBTF), following dermal exposure in a murine model. Evaluation of the sensitization potential, conducted using the local lymph node assay (LLNA) at concentrations ranging from 50% to 100%, identified a dose-dependent increase in lymphocyte proliferation with a calculated EC3 value of 53.1%. While no elevations in total or specific IgE were observed after exposure to any concentration of the chemical, significant increases in IFN-γ protein production by stimulated draining lymphoid cells were observed, indicating a T-cell-mediated response. Dermal exposure to PCBTF was not found to alter the immune response to a T-cell-dependant antigen. These results demonstrate that PCBTF has the potential to induce allergic sensitization following dermal exposure and based on LLNA results would be classified as a weak sensitizer. PMID:21747864

  1. Are pesticides immunotoxic?

    PubMed

    Botham, P A

    1990-01-01

    So far there is little evidence that occupational or environmental exposure to pesticides has led to clinically significant immunosuppression, and hence to an increased risk of developing infection or cancer. In addition, the incidence of hypersensitivity reactions to pesticides is generally low. Experiments have been conducted in experimental models that indicate that certain pesticides are immunosuppressive to animals. The majority of these experiments, however, have used high (frankly toxic) doses of pesticides and immunosuppression has been monitored using in vivo or in vitro immune function tests, the results of which are difficult to interpret in terms of effects on health. One exception is tributyltin oxide which, in the rat, causes immune dysfunction at doses below those that cause general toxicity, and which compromises the ability of the animals to resist bacterial and parasitic infection. Predictive assessment of possible immunotoxicity induced by exposure to a pesticide should be structured within the current framework of acute, subacute and chronic testing procedures used for regulatory purposes. With the exception of predicting some hypersensitivity reactions (respiratory allergy and autoimmunity), which would require the development of novel specialized methods, indications of potential immunotoxicity can be obtained from standard haematological investigations and by evaluation of lymphoid organs and tissues such as the spleen, thymus, lymph nodes, and bone marrow. Pathological and histopathological examination of the lymphoid system is a mandatory requirement of nearly all subchronic testing guidelines for pesticides worldwide. The incorporation of specialized, and in particular in vitro, immune function tests into the routine toxicological assessment of a pesticide is not only time-consuming and potentially wasteful of animals, but is also scientifically unacceptable; the significance of changes in such tests must await further research on the

  2. Introduction to Immunotoxicity

    EPA Science Inventory

    Recognition that the immune system is vulnerable to adverse effects after exposure to xenobiotics led to the discipline of immunotoxicology and the subsequent addition of immunotoxicology testing to regulatory guidelines for toxicity. Immunotoxic effects can result in immunosuppr...

  3. Introduction to Immunotoxicity

    EPA Science Inventory

    Recognition that the immune system is vulnerable to adverse effects after exposure to xenobiotics led to the discipline of immunotoxicology and the subsequent addition of immunotoxicology testing to regulatory guidelines for toxicity. Immunotoxic effects can result in immunosuppr...

  4. Cytokines as biomarkers of nanoparticle immunotoxicity

    PubMed Central

    Elsabahy, Mahmoud; Wooley, Karen L.

    2013-01-01

    Nanoscale objects, whether of biologic origin or synthetically created, are being developed into devices for a variety of bionanotechnology diagnostic and pharmaceutical applications. However, the potential immunotoxicity of these nanomaterials and mechanisms by which they may induce adverse reactions have not received sufficient attention. Nanomaterials, depending on their characteristics and compositions, can interact with the immune system in several ways and either enhance or suppress immune system function. Cytokines perform pleiotropic functions to mediate and regulate the immune response and are generally recognized as biomarkers of immunotoxicity. While the specificity and validity of certain cytokines as markers of adverse immune response has been established for chemicals, small and macromolecular drugs, research on their applicability for predicting and monitoring the immunotoxicity of engineered nanomaterials is still ongoing. The goal of this review is to provide guidelines as to important cytokines that can be utilized for evaluating the immunotoxicity of nanomaterials and to highlight the role of those cytokines in mediating adverse reactions, which is of particular importance for the clinical development of nanopharmaceuticals and other nanotechnology-based products. Importantly, the rational design of nanomaterials of low immunotoxicity will be discussed, focusing on synthetic nanodevices, with emphasis on both the nanoparticle-forming materials and the embedded cargoes. PMID:23549679

  5. DNA fragmentation in developing lung fibroblasts exposed to Stachybotrys chartarum (atra) toxins.

    PubMed

    McCrae, K C; Rand, T G; Shaw, R A; Mantsch, H H; Sowa, M G; Thliveris, J A; Scott, J E

    2007-07-01

    Stachybotrys chartarum (atra) is a toxic mold that grows on water-damaged cellulose-based materials. Research has revealed also that inhalation of S. chartarum spores caused marked changes in respiratory epithelium, especially to developing lungs. We analyzed the epigenetic potential of S. chartarum spore toxins on developing rat lung fibroblasts using single cell gel electrophoresis (comet assay). Isolated fetal lung fibroblasts were exposed to S. chartarum spore toxins for 15 min, 3, 14, or 24 hr and control cells were exposed to saline under the same conditions. Cells were embedded in agarose, electrophoresed under alkaline conditions and silver stained. DNA damage was assessed in terms of fragmentation as measured by comet tail length (DNA migration) and intensity (% DNA contained within head and tail). Upon visual inspection, control fibroblasts showed no DNA fragmentation whereas S. chartarum-treated cells had definable comets of various degrees depending upon the time-course. Analyses of the comets revealed that exposure to S. chartarum spore toxins for at least 15 min to 14 hr, induced increased DNA fragmentation in a time-dependent manner. The fact that exposure to toxins for 24 hr showed less damage suggested that developing lung fibroblasts may have the capability of repairing DNA fragmentation.

  6. The role of interleukin family in perfluorooctanoic acid (PFOA)-induced immunotoxicity.

    PubMed

    Zhang, Hangjun; Fang, Wendi; Wang, Dandan; Gao, Nana; Ding, Ying; Chen, Chao

    2014-09-15

    Perfluorooctanoic acid (PFOA), a prominent perfluorinated compound (PFC), has been widely detected in natural water bodies worldwide. In this study, zebrafish (Danio rerio) was exposed to nominal concentrations of PFOA (0.05, 0.1, 0.5, and 1 mg/L) for 21 d. After exposure, each fish was decapitated, and the spleen was removed to detect the expression patterns of P65 transcription factor, myeloid differentiation 88, relative interleukins (ILs), and antibody genes. PFOA can stimulate pro-inflammatory cytokine at a low exposure concentration (0.05 mg/L) and can inhibit pro-inflammatory cytokine at higher exposure concentrations (≥ 0.1mg/L). The results of linear correlation analysis indicate that Myd88/NF-κB pathway is one of the important pathways to mediate inflammatory cytokine (IL-1β and IL-21) in zebrafish spleen. Additionally, the relative mRNA expression level of toll-like receptor 2 (TLR2) at 1mg/L PFOA group was decreased to 56% of its corresponding level in the control. IL secretion disorder is possibly closely related to PFOA-induced TLR2 damage in zebrafish spleen. Furthermore, data show that the trends of PFOA-induced IL secretion have a relationship with Ig-secreting trend. This study demonstrates that PFOA can affect IL expression level through NF-κB, and ILs have an important function in the mediation of Ig secretion. Copyright © 2014 Elsevier B.V. All rights reserved.

  7. Potential immunotoxic effects of trichloroethylene-induced IV allergic reaction in renal impairment

    PubMed Central

    Yu, Jun-Feng; Feng, Yan-Yan

    2017-01-01

    Trichloroethylene (TCE) is known to induce allergic contact dermatitis and subsequent occupational medicamentosa-like dermatitis (OMLD) with multi-system injuries, including liver, kidney, and skin injuries. However, the mechanisms underlying immune system dysfunction that result in organ injury have not yet been clearly elucidated. In the present study, we measured the levels of secreted cytokines by effect or T cells in TCE-treated guinea pigs to better understand the contribution of allergic disorders in renal injuries. We immunized guinea pigs with trichloroethylene using the Guinea Pig Maximization Test (GPMT) and scored the inflammation on the guinea pigs’ skin. The kidney function and ultra-structural changes in the kidneys were detected using biochemical methods and electron microscopy. The deposition of cytokines was determined using immunohistochemistry. The sensitization rate was 63.16% in the TCE-sensitized groups. The electron microscopy results showed tubular epithelial cell mitochondrial swelling, vacuolar degeneration, and atrophy of the microvillus in the sensitized groups. A high degree of cytokine deposition was observed in the renal tubular proximal epithelial cells in the TCE-sensitized groups. As observed in this study, the variation in the level of immune system activation not only indicates that TCE can largely magnify the immune reaction but also suggests a potential role of immune dysfunction in renal impairment. PMID:28867961

  8. Strain Differences Influence Murine Pulmonary Responses to Stachybotrys chartarum

    PubMed Central

    Rosenblum Lichtenstein, Jamie H.; Molina, Ramon M.; Donaghey, Thomas C.; Brain, Joseph D.

    2006-01-01

    When the fungus Stachybotrys chartarum is inhaled, its mycotoxins may cause lung injury and inflammation. The severity of human responses to S. chartarum in both occupational and home settings varies widely. To explore these differences, we intratracheally instilled C3H/HeJ, BALB/c, and C57BL/6J mice with S. chartarum spores suspended in saline. One day later, the mice were humanely killed, bronchoalveolar lavage (BAL) was performed, and biochemical and cellular indicators of lung injury and inflammation were measured. BALB/c mice showed the highest myeloperoxidase activity, albumin and hemoglobin levels, and neutrophil numbers in their BAL among the three strains. BALB/c was the only strain to show significant increases in keratinocyte-derived cytokine (KC), monocyte chemotactic protein (MCP)-1, MCP-3, macrophage inflammatory protein (MIP)-1α, MIP-1β, MIP-1γ, MIP-2, RANTES, IL-1α, IL-1β, IL-3, IL-6, IL-18, leukemia inhibitory factor, macrophage colony-stimulating factor, and TNF-α. A model of allergen-induced airway inflammation was examined to assess whether underlying allergic inflammation might contribute to increased susceptibility to S. chartarum–induced pulmonary inflammation and injury. Surprisingly, in BALB/c mice, ovalbumin-induced airway inflammation produced a protective effect against some S. chartarum–induced pulmonary responses. This is the first report of mammalian strain differences affecting responses to S. chartarum. These responses differ from those reported for LPS and other fungi. Analogous underlying genetic differences may contribute to the wide range of sensitivity to Stachybotrys among humans. PMID:16690987

  9. Immunotoxicity of air pollutants

    SciTech Connect

    Graham, J.A.; Gardner, D.E.

    1984-01-01

    The most common ubiquitous air pollutants, as well as some point source (e.g. metals) air pollutants, decrease the function of pulmonary host defense mechanisms against infection. Most of this knowledge is based on animal studies and involves cellular antibacterial defenses such as alveolar macrophages and mucociliary clearance. Information on viral infectivity is more sparse. Since there is no routine treatment for viral infections which have a relatively high rate of occurrence, this gap in knowledge is of concern. Given the major gaps in knowledge, resaonably accurate assessment of the immunotoxicity of air pollutants is not possible. When the limited data base is reviewed relative to ambient levels of the common pollutants, it appears that acute exposures to O3 and H2SO4 and chronic exposures to NO2 are the major exposures of concern for immunotoxic effects. It is critical to point out, however, that until information is available for chronic exposures to low levels of metals and for exposures to common organic vapors, the immunotoxicity of air pollutants cannot be assessed adequately.

  10. Potential for amelioration of aflatoxin B1-induced immunotoxic effects in progeny of White Leghorn breeder hens co-exposed to vitamin E.

    PubMed

    Khan, Wajid Arshad; Khan, Muhammad Zargham; Khan, Ahrar; Ul Hassan, Zahoor; Saleemi, Muhammad Kashif

    2014-01-01

    This study was designed to evaluate the protective activity of Vitamin E (Vit E) on the immunotoxic effects induced by aflatoxin B1 (AFB1) in the progeny of breeder hens. For this purpose, 192 White Leghorn (WL) layer breeder hens were divided into 12 groups (A-L) and then fed test diets for either 1, 2 or 3 weeks. Group A was kept on basal feed (2900 Kcal/kg metabolizable energy) and served as control, while group B was offered a feed supplemented with Vit E at 100 mg/Kg. Groups C-G were offered feed containing 0.1, 0.5, 2.5, 5.0, and 10.0 mg/Kg AFB1, respectively, whereas groups H-L were offered the same dietary levels of AFB1 along with 100 mg/Kg Vit E supplementation. Hatching eggs were shifted to an incubator on a weekly basis to get progeny chicks. Hatched chicks in each group were maintained on basal ration and then subjected to different immunological assays. Lymphoproliferative responses (against PHA-P), antibody titers (against SRBC), oxidative damage to RBC, as well as phagocytic and nitrite production potential of the peritoneal macrophages from the chicks, were all adversely impacted by hen exposure to the higher doses of AFB1 or by increased intake (time) by the hens at a given dose of the toxin. No consistent ameliorative effects from Vit E were noted in these studies, i.e. effects seen against lower AFB1 doses were no longer apparent with the highest doses of AFB1. As such, for now it can be concluded that, with this particular single dose level of Vit E, AFB1-associated immunotoxic effects in progeny chicks can potentially be mitigated by dietary intake of Vit E by their hen dams. However, this is clearly an outcome that is driven by the level of the mycotoxin present in the feed. Future studies need to examine what impact higher Vit E doses than those employed herein might have in these ameliorative outcomes.

  11. Protective effects of meat from lambs on selenium nanoparticle supplemented diet in a mouse model of polycyclic aromatic hydrocarbon-induced immunotoxicity.

    PubMed

    Ungvári, Éva; Monori, István; Megyeri, Attila; Csiki, Zoltán; Prokisch, József; Sztrik, Attila; Jávor, András; Benkő, Ilona

    2014-02-01

    Increased environmental oxidative stress caused primarily by chemicals like polycyclic aromatic hydrocarbons, plays significant role in human diseases. A representative compound, 7,12-dimethylbenz(a)anthracene (DMBA), was used for modeling oxidative damages including the significant decrease of the antioxidant capacity of the blood. Selenium has antioxidant effects but with a narrow therapeutic window. In our current studies to avoid accidental overdose and toxicity selenium was given to meat-producing animals. The standard rodent diet of mice was replaced by meat from lambs either on standard or selenium-enriched diet. Selenium concentration of lamb meat was enhanced three times by nano-selenium administration and an increase in the antioxidant capacity of the blood of mice was measured after the indirect selenium supplementation. Protective effects were also observed against DMBA-induced immunotoxicity. Twice the amount of white blood cells and among them three times more phagocytes survived. Similarly, in their renewal system in bone marrow twice the amount of cells survived and regenerative capacity of granulopoiesis was four times higher than in control DMBA-damaged mice. Our findings suggest functional dietary benefits of lamb meat enriched with selenium by feeding lambs with nanoparticle selenium supplements.

  12. The role of fungal proteinases in pathophysiology of Stachybotrys chartarum.

    PubMed

    Yike, Iwona; Rand, Thomas; Dearborn, Dorr G

    2007-10-01

    The adverse health effects of Stachybotrys chartarum have often been linked to exposure to the trichothecene mycotoxins. Recent studies have shown that in addition to mycotoxins this fungus is capable of producing and secreting in vivo proteins such as hemolysins and proteinases. Spore extracts obtained from a high trichothecene producing isolate JS 58-17 exhibited a significantly lower proteolytic activity compared to the low trichothecene producer, JS 58-06. Growing isolates on rice or potato dextrose agar results in higher proteolytic activity of the spores compared to those grown on drywall. Proteinases in the spore extracts can hydrolyze gelatin and collagen I and IV. Analysis of zymograms shows the presence of several proteins with proteolytic activity in the spores of S. chartarum. Human tracheal epithelial cells exposed to spore extracts produced significantly higher levels of IL-6, IL-8, and TNF-alpha than control cells. This stimulation of cytokine production was completely abolished by Pefabloc, a serine protease inhibitor. Neutrophil numbers and proinflammatory cytokine (IL1-beta and TNF-alpha) concentrations were highly elevated in the lungs of 7 day old rat pups exposed intratracheally to 4 x 10(4) spores/gm body weight compared to control. No significant differences in those inflammatory indices in vivo were noted between the treatments with the high trichothecene producer, isolate JS 58-17 and JS 58-06, which does not produce macrocyclic trichothecenes. Immunohistochemistry revealed reduced collagen IV labeling in spore-induced lung granulomas in rat pups exposed to both isolates. These results suggest that proteinases from S. chartarum spores significantly contribute to lung inflammation and injury.

  13. DNA damage, redox changes, and associated stress-inducible signaling events underlying the apoptosis and cytotoxicity in murine alveolar macrophage cell line MH-S by methanol-extracted Stachybotrys chartarum toxins.

    PubMed

    Wang, Huiyan; Yadav, Jagjit S

    2006-08-01

    Spore-extracted toxins of the indoor mold Stachybotrys chartarum (SC) caused cytotoxicity (release of lactate dehydrogenase), inhibition of cell proliferation, and cell death in murine alveolar macrophage cell line MH-S in a dose- and time-dependent manner. Apoptotic cell death, confirmed based on morphological changes, DNA ladder formation, and caspase 3/7 activation, was detectable as early as at 3 h during treatment with a toxin concentration of 1 spore equivalent/macrophage and was preceded by DNA damage beginning at 15 min, as evidenced by DNA comet formation in single cell gel electrophoresis assay. The apoptotic dose of SC toxins did not induce detectable nitric oxide and pro-inflammatory cytokines (IL-1beta, IL-6, and TNF-alpha) but showed exacerbated cytotoxicity in presence of a non-apoptotic dose of the known pro-inflammatory agent LPS (10 ng/ml). Intracellular reduced glutathione (GSH) level showed a significant decrease beginning at 9 h of the toxin treatment whereas oxidized glutathione (GSSG) showed a corresponding significant increase, indicating a delayed onset of oxidative stress in the apoptosis process. The toxin-treated macrophages accumulated p53, an indicator of DNA damage response, and showed activation of the stress-inducible MAP kinases, JNK, and p38, in a time-dependent manner. Chemical blocking of either p38 or p53 inhibited in part the SC toxin-induced apoptosis whereas blocking of JNK did not show any such effect. This study constitutes the first report on induction of DNA damage and associated p53 activation by SC toxins, and demonstrates the involvement of p38- and p53-mediated signaling events in SC toxin-induced apoptosis of alveolar macrophages.

  14. DNA damage, redox changes, and associated stress-inducible signaling events underlying the apoptosis and cytotoxicity in murine alveolar macrophage cell line MH-S by methanol-extracted Stachybotrys chartarum toxins

    SciTech Connect

    Wang Huiyan; Yadav, Jagjit S. . E-mail: Jagjit.Yadav@uc.edu

    2006-08-01

    Spore-extracted toxins of the indoor mold Stachybotrys chartarum (SC) caused cytotoxicity (release of lactate dehydrogenase), inhibition of cell proliferation, and cell death in murine alveolar macrophage cell line MH-S in a dose- and time-dependent manner. Apoptotic cell death, confirmed based on morphological changes, DNA ladder formation, and caspase 3/7 activation, was detectable as early as at 3 h during treatment with a toxin concentration of 1 spore equivalent/macrophage and was preceded by DNA damage beginning at 15 min, as evidenced by DNA comet formation in single cell gel electrophoresis assay. The apoptotic dose of SC toxins did not induce detectable nitric oxide and pro-inflammatory cytokines (IL-1{beta}, IL-6, and TNF-{alpha}) but showed exacerbated cytotoxicity in presence of a non-apoptotic dose of the known pro-inflammatory agent LPS (10 ng/ml). Intracellular reduced glutathione (GSH) level showed a significant decrease beginning at 9 h of the toxin treatment whereas oxidized glutathione (GSSG) showed a corresponding significant increase, indicating a delayed onset of oxidative stress in the apoptosis process. The toxin-treated macrophages accumulated p53, an indicator of DNA damage response, and showed activation of the stress-inducible MAP kinases, JNK, and p38, in a time-dependent manner. Chemical blocking of either p38 or p53 inhibited in part the SC toxin-induced apoptosis whereas blocking of JNK did not show any such effect. This study constitutes the first report on induction of DNA damage and associated p53 activation by SC toxins, and demonstrates the involvement of p38- and p53-mediated signaling events in SC toxin-induced apoptosis of alveolar macrophages.

  15. CHARACTERIZATION OF THE HEMOLYSIN, FROM STACHYBOTRYS CHARTARUM

    EPA Science Inventory

    Stachybotrys chartarum is a toxigenic fungus that has been associated with human health concerns, including pulmonary hemorrhage and hemosiderosis. This fungus produces a hemolysin, stachylysin, which in its apparent monomeric form has a molecular mass of 11,920
    Da as determ...

  16. CHARACTERIZATION OF THE HEMOLYSIN, FROM STACHYBOTRYS CHARTARUM

    EPA Science Inventory

    Stachybotrys chartarum is a toxigenic fungus that has been associated with human health concerns, including pulmonary hemorrhage and hemosiderosis. This fungus produces a hemolysin, stachylysin, which in its apparent monomeric form has a molecular mass of 11,920
    Da as determ...

  17. Ultraviolet germicidal irradiation disinfection of Stachybotrys chartarum.

    PubMed

    Green, Christopher F; Davidson, Craig S; Scarpino, Pasquale V; Gibbs, Shawn G

    2005-09-01

    The ultraviolet germicidal irradiation (UVGI) dose necessary to inactivate fungal spores on an agar surface and the efficacy of UVGI were determined for cultures of Stachybotrys chartarum (ATCC 208877). This study employed a UVGI testing unit consisting of four chambers with a 9-W, Phillips, low pressure, mercury UVGI lamp in each chamber. The testing unit's apertures were adjusted to provide 50, 100, 150, and 200 microW/cm2 of uniform flux to the Petri dish surfaces, resulting in a total UVGI surface dose ranging from 12 to 144 mJ/cm2. The UVGI dose necessary to inactivate 90% of the S. chartarum was greater than the maximum dose of 144 mJ/cm2 evaluated in this study. While UVGI has been used to inactivate several strains of culturable fungal spores, S. chartarum was not susceptible to an appropriate dose of UVGI. The results of this study may not correlate directly to the effect of UVGI on airborne fungal spores. However, they indicate that current technology may not be efficacious as a supplement to ventilation unless it can provide higher doses of UVGI to kill spores, such as S. chartarum, traveling through the irradiated zone.

  18. Effect of Plasterboard Composition on Stachybotrys chartarum Growth and Biological Activity of Spores

    PubMed Central

    Murtoniemi, Timo; Nevalainen, Aino; Hirvonen, Maija-Riitta

    2003-01-01

    The effects of plasterboard composition on the growth and sporulation of Stachybotrys chartarum as well as on the inflammatory potential of the spores were studied. S. chartarum was grown on 13 modified plasterboards under saturated humidity conditions. The biomass was estimated by measuring the ergosterol content of the S. chartarum culture while the spore-induced cytotoxicity and production of nitric oxide (NO), tumor necrosis factor alpha (TNF-α), and interleukin-6 in mouse macrophages was used to illustrate the bioactivity of spores. The ergosterol content of S. chartarum correlated with the number of spores collected from plasterboards. The growth and sporulation decreased compared to that of the reference board in those cases where (i) the liner was treated with biocide, (ii) starch was removed from the plasterboard, or (iii) desulfurization gypsum was used in the core. Spores collected from all the plasterboards were toxic to the macrophages. The biocide added to the core did not reduce the growth; in fact, the spores collected from that board evoked the highest cytotoxicity. The conventional additives used in the core had inhibitory effects on growth. Recycled plasterboards used in the core and the board lacking the starch triggered spore-induced TNF-α production in macrophages. In summary, this study shows that the growth of a strain of S. chartarum on plasterboard and the subsequent bioactivity of spores were affected by minor changes to the composition of the core or liners, but it could not be totally prevented without resorting to the use of biocides. However, incomplete prevention of microbial growth by biocides even increased the cytotoxic potential of the spores. PMID:12839740

  19. Arsenic immunotoxicity: a review.

    PubMed

    Dangleben, Nygerma L; Skibola, Christine F; Smith, Martyn T

    2013-09-02

    Exposure to arsenic (As) is a global public health problem because of its association with various cancers and numerous other pathological effects, and millions of people worldwide are exposed to As on a regular basis. Increasing lines of evidence indicate that As may adversely affect the immune system, but its specific effects on immune function are poorly understood. Therefore, we conducted a literature search of non-cancer immune-related effects associated with As exposure and summarized the known immunotoxicological effects of As in humans, animals and in vitro models. Overall, the data show that chronic exposure to As has the potential to impair vital immune responses which could lead to increased risk of infections and chronic diseases, including various cancers. Although animal and in vitro models provide some insight into potential mechanisms of the As-related immunotoxicity observed in human populations, further investigation, particularly in humans, is needed to better understand the relationship between As exposure and the development of disease.

  20. Arsenic immunotoxicity: a review

    PubMed Central

    2013-01-01

    Exposure to arsenic (As) is a global public health problem because of its association with various cancers and numerous other pathological effects, and millions of people worldwide are exposed to As on a regular basis. Increasing lines of evidence indicate that As may adversely affect the immune system, but its specific effects on immune function are poorly understood. Therefore, we conducted a literature search of non-cancer immune-related effects associated with As exposure and summarized the known immunotoxicological effects of As in humans, animals and in vitro models. Overall, the data show that chronic exposure to As has the potential to impair vital immune responses which could lead to increased risk of infections and chronic diseases, including various cancers. Although animal and in vitro models provide some insight into potential mechanisms of the As-related immunotoxicity observed in human populations, further investigation, particularly in humans, is needed to better understand the relationship between As exposure and the development of disease. PMID:24004508

  1. Immunotoxicity -- The Risk is Real

    EPA Science Inventory

    Several papers published over the last year represent significant progress in closing the gap between rodent immunotoxicity data and human risk and indicate that, at least for the developing immune system, the concern raised by rodent data is justified. The studies reviewed here...

  2. PARTIAL CHARACTERIZATION OF ALLERGENS IN EXTRACTS OF STACHYBOTRYS CHARTARUM

    EPA Science Inventory

    PARTIAL CHARACTERIZATION OF ALLERGENS IN EXTRACTS OF Stachybotrys chartarum. M E Viana1, MJ Selgrade2, and M D Ward2. 1NCSU, Raleigh, NC, USA. 2NHEERL, ORD, US EPA, RTP, NC, USA.

    Exposure to Stachybotrys chartarum has been associated with the development of serious health ...

  3. Genome sequence of Stachybotrys chartarum Strain 51-11

    EPA Science Inventory

    Stachybotrys chartarum strain 51-11 genome was sequenced by shotgun sequencing utilizing Illumina Hiseq 2000 and PacBio long read technology. Since Stachybotrys chartarum has been implicated in health impacts within water-damaged buildings, any information extracted from the geno...

  4. Genome sequence of Stachybotrys chartarum Strain 51-11

    EPA Science Inventory

    Stachybotrys chartarum strain 51-11 genome was sequenced by shotgun sequencing utilizing Illumina Hiseq 2000 and PacBio long read technology. Since Stachybotrys chartarum has been implicated in health impacts within water-damaged buildings, any information extracted from the geno...

  5. Immunotoxicity of trenbolone acetate in Japanese quail

    USGS Publications Warehouse

    Quinn, M.J.; McKernan, M.; Lavoie, E.T.; Ottinger, M.A.

    2007-01-01

    Trenbolone acetate is a synthetic androgen that is currently used as a growth promoter in many meat-exporting countries. Despite industry laboratories classifying trenbolone as nonteratogenic, data showed that embryonic exposure to this androgenic chemical altered development of the immune system in Japanese quail. Trenbolone is lipophilic, persistent, and released into the environment in manure used as soil fertilizer. This is the first study to date to assess this chemical's immunotoxic effects in an avian species. A one-time injection of trenbolone into yolks was administered to mimic maternal deposition, and subsequent effects on the development and function of the immune system were determined in chicks and adults. Development of the bursa of Fabricius, an organ responsible for development of the humoral arm of the immune system, was disrupted, as indicated by lower masse, and smaller and fewer follicles at day 1 of hatch. Morphological differences in the bursas persisted in adults, although no differences in either two measures of immune function were observed. Total numbers of circulating leukocytes were reduced and heterophil-lymphocyte ratios were elevated in chicks but not adults. This study shows that trenbolone acetate is teratogenic and immunotoxic in Japanese quail, and provides evidence that the quail immune system may be fairly resilient to embryonic endocrine-disrupting chemical-induced alterations following no further exposure posthatch.

  6. Inflammatory and haematotoxic potential of indoor Stachybotrys chartarum (Ehrenb.) Hughes metabolites.

    PubMed

    Piecková, Elena; Hurbánková, Marta; Cerná, Silvia; Lisková, Aurélia; Kováciková, Zuzana; Kolláriková, Zuzana; Wimmerová, Sona

    2009-12-01

    Mould Stachybotrys chartarum (Ehrenb.) Hughes is known to pose a health risk in indoor environments. Most of its strains can produce several intra- and extracellular trichothecene mycotoxins. Complex secondary metabolites of stachybotrys isolates from mouldy dwellings/public buildings in Slovakia were intratracheally instilled in Wistar male rats (4 microg in 0.2 mL of 0.2 % dimethylsulphoxide; diacetoxyscirpenol as the positive control). After three days, haematological parameters were measured in peripheral blood and inflammatory response biomarkers in bronchoalveolar lavage fluid (BALF), and the results were statistically analysed. Exometabolites proved to suppress red blood cell (RBC), decreasing the total RBC count, haemoglobin, and haematocrit. The exposed rats showed significantly higher total BALF cell count, indicating inflammation, lower alveolar macrophage counts, and increased granulocyte count related to the BALF cells. Due to haematotoxic and inflammation-inducing properties, metabolites of S. chartarum can cause damage to the airways and haematological disorders in occupants of mouldy buildings.

  7. In vitro testing for direct immunotoxicity: state of the art.

    PubMed

    Lankveld, D P K; Van Loveren, H; Baken, K A; Vandebriel, R J

    2010-01-01

    Immunotoxicity is defined as the toxicological effects of xenobiotics including pharmaceuticals on the functioning of the immune system and can be induced in either direct or indirect ways. Direct immunotoxicity is caused by the effects of chemicals on the immune system, leading to immunosuppression and subsequently to reduced resistance to infectious diseases or certain forms of nongenotoxic carcinogenicity.In vitro testing has several advantages over in vivo testing, such as detailed mechanistic understanding, species extrapolation (parallelogram approach), and reduction, refinement, and replacement of animal experiments. In vitro testing for direct immunotoxicity can be done in a two-tiered approach, the first tier measuring myelotoxicity. If this type of toxicity is apparent, the compound can be designated immunotoxic. If not, the compound is tested for lymphotoxicity (second tier). Several in vitro assays for lymphotoxicity exist, each comprising specific functions of the immune system (cytokine production, cell proliferation, cytotoxic T-cell activity, natural killer cell activity, antibody production, and dendritic cell maturation). A brief description of each assay is provided. Only one assay, the human whole blood cytokine release assay, has undergone formal prevalidation, while another one, the lymphocyte proliferation assay, is progressing towards that phase.Progress in in vitro testing for direct immunotoxicity includes prevalidation of existing assays and selection of the assay (or combination of assays) that performs best. To avoid inter-species extrapolation, assays should preferably use human cells. Furthermore, the use of whole blood has the advantage of comprising multiple cell types in their natural proportion and environment. The so-called "omics" techniques provide additional mechanistic understanding and hold promise for the characterization of classes of compounds and prediction of specific toxic effects. Technical innovations such as high

  8. Acrylamide induces immunotoxicity through reactive oxygen species production and caspase-dependent apoptosis in mice splenocytes via the mitochondria-dependent signaling pathways.

    PubMed

    Zamani, Ehsan; Shaki, Fatemeh; AbedianKenari, Saeid; Shokrzadeh, Mohammad

    2017-10-01

    Acrylamide (AA), a well-known food neo-contamination, can be produced during food preparing at high temperature. The immunotoxicity of AA have been revealed in the experimental animals. In this study, we explored the molecular mechanism responsible for the immunotoxicity of AA. The mice splenocytes exposed to AA concentrations (0,5,10 and 25 mM) and apoptosis cell death was measured through Annexin V/Propidium Iodide staining by flow cytometry method. The role of extrinsic and intrinsic pathways were evaluated respectively by activity of caspase-8 and-9. Furthermore, the spleen mitochondria were obtained using differential centrifugation from mice and mitochondrial toxicity endpoints were determined after AA exposure. Exposure of splenocytes to AA increased the splenocytes' apoptotic cell death. Also, increased activation of both caspase-8 and-9 were observed in mice splenocytes after AA exposure. Treatment of isolated mitochondria with AA lead to disturbance in activity of complex I and III of mitochondrial electron transfer chain that result in increased reactive oxygen species (ROS) production, lipid peroxidation and glutathione oxidation. These events were accompanied by mitochondrial membrane swelling, collapse of mitochondrial membrane potential and significant falling of mitochondrial activity. AA-mediated mitochondrial dysfunction along with mitochondrial oxidative damage seems to be critical events leading to activation of caspase cascade and apoptotic cell death in spleen that finally can attenuate immune system's function. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  9. Stachybotrys chartarum alters surfactant-related phospholipid synthesis and CTP:cholinephosphate cytidylyltransferase activity in isolated fetal rat type II cells.

    PubMed

    Hastings, C; Rand, T; Bergen, H T; Thliveris, J A; Shaw, A R; Lombaert, G A; Mantsch, H H; Giles, B L; Dakshinamurti, S; Scott, J E

    2005-03-01

    Stachybotry chartarum, a fungal contaminant of water-damaged buildings commonly grows on damp cellulose-containing materials. It produces a complex array of mycotoxins. Their mechanisms of action on the pulmonary system are not entirely clear. Previous studies suggest spore products may depress formation of disaturated phosphatidylcholine (DSPC), the major surface-active component of pulmonary surfactant (PS). If S. chartarum can indeed affect formation of this phospholipid, then mold exposure may be a significant issue for pulmonary function in both mature lung and developing fetal lung. To address this possibility, fetal rat type II cells, the principal source of DSPC, were used to assess effects of S. chartarum extract on formation of DSPC. Isolated fetal rat lung type II cells prelabeled with 3H-choline and incubated with spore extract showed decreased incorporation of 3H-choline into DSPC. The activity of CTP:cholinephosphate cytidylyltransferase (CPCT), the rate-limiting enzyme in phosphatidylcholine synthesis was reduced by approximately 50% by a 1:10 dilution of spore extract. Two different S. chartarum extracts (isolates from S. chartarum (Cleveland) and S. chartarum (Hawaiian)) were used to compare activity of CPCT in the presence of phosphatidylglycerol (PG), a known activator. PG produced an approximate two-fold increase in CPCT activity. The spore isolate from Hawaii did not alter enzyme activity. S. chartarum (Cleveland) eliminated the PG-induced activation of CPCT. These results support previous observations that mold products alter PS metabolism and may pose a risk in developing lung, inhibiting surfactant synthesis. Different isolates of the same species of fungus are not equivalent in terms of potential exposure risks.

  10. Use of contact hypersensitivity in immunotoxicity testing.

    PubMed

    Descotes, Jacques

    2010-01-01

    The histopathological examination of lymphoid organs together with a T-dependent antibody (TDAR) assay are the primary components of preclinical immunotoxicity assessment. Additional testing including measurement of cellular immunity may be considered. Besides ex vivo lymphocyte proliferation assays, either delayed or contact hypersensitivity models can be used. Contact hypersensitivity testing is typically performed either in mice or in guinea pigs and is directly derived from classical models used for the detection of contact sensitizing chemicals. Whatever the selected model, it is comprised of a sensitizing phase where the animals are applied a strong contact sensitizer topically, then a rest phase, and finally an eliciting phase where sensitized animals are challenged topically with the same contact sensitizer.In mice, the ear-swelling test is the reference procedure in which mice are sensitized to the ear or shaved abdominal skin and then challenged on the ear. Ear swelling usually measured from ear thickness reflects a cell-mediated immune response. In guinea pigs, a strong sensitizer is applied on the shaved skin of the abdomen or the interscapular area. The sensitized animals are challenged on another area of the shaved abdomen, and the cell-mediated response is assessed semiquantitatively from the magnitude of induced erythema inconsistently associated with edema. Treatment or exposure with immunosuppressive chemicals can result in a significantly decreased ear swelling or skin reaction. Contact hypersensitivity models are seldom used nowadays in preclinical immunotoxicity testing, most likely because of the lack of standardization and extensive validation as well as their use being restricted to mice or guinea pigs.

  11. Modulation of Benzo[a]pyrene induced immunotoxicity in mice actively immunized with a B[a]P-diphtheria toxoid conjugate

    SciTech Connect

    Schellenberger, Mario T.; Grova, Nathalie; Willieme, Stephanie; Farinelle, Sophie; Prodhomme, Emmanuel J.F.

    2009-10-01

    Benzo[a]pyrene (B[a]P) is a small molecular weight carcinogen and the prototype of polycyclic aromatic hydrocarbons (PAHs). While these compounds are primarily known for their carcinogenicity, B[a]P and its metabolites are also toxic for mammalian immune cells. To develop a prophylactic immune strategy against detrimental effects of B[a]P, we have immunized mice with a B[a]P-diphtheria toxoid conjugate vaccine. We showed that high levels of antibodies against B[a]P and its metabolites modulate the redistribution of these PAHs in the blood. After immunization, increased levels of B[a]P and its metabolites were recovered in the blood. B[a]P significantly suppressed the proliferative response of both T and B cells after a sub-acute administration, an effect that was completely reversed by vaccination. In immunized mice also the immunotoxic effect of B[a]P on IFN-{gamma}, IL-12, TNF-{alpha} production and the reduced B cell activation was restored. Finally, our results showed that specific antibodies inhibited the induction of Cyp1a1 by B[a]P in lymphocytes and Cyp1b1 in the liver, enzymes that are known to convert the procarcinogen B[a]P to the ultimate DNA-adduct forming metabolite, a major risk factor of chemical carcinogenesis. Thus, we demonstrate that vaccination with a B[a]P conjugate vaccine based on a carrier protein used in licensed human vaccines reduces immunotoxicity and possibly other detrimental effects associated with B[a]P.

  12. Complete Genome of Stachybotrys chartarum strain 51-11

    EPA Pesticide Factsheets

    Complete genome sequence of the fungus Stachybotrys chartarum. Sequences can be used to identify genes, genetic pathways, gene clusters, genetic organization, etc. utilizing appropriate bioinformatics software.This dataset is associated with the following publication:Betancourt , D., T. Dean , J. Kim, and J. Levy. Genome sequence of Stachybotrys chartarum Strain 51-11. Genome Announcements. American Society for Microbiology, Washington, DC, USA, 3(6): 1114-1115, (2015).

  13. Stachybotrys chartarum (chartarum = atra = alternans) and other problems caused by allergenic fungi.

    PubMed

    Chapman, Jean A

    2003-01-01

    Stachybotrys chartarum is a cellulose-decaying fungus with worldwide distribution. It grows well at room temperature and with humidity above 93%. S. chatarum requires special media high in cellulose and low in sugar and nitrogen to compete with Penicillium and Aspergillus. Ninety percent of field-collected spores are not culturable. S. chartarum can produce macrocyclic trichothecenes but is highly dependent on strain and environmental conditions. In strains implicated in mycotoxicosis, not all produce detectable trichothecenes. Therefore, the presence of S. chartarum is not proof of toxin presence. Trichothecenes are potent inhibitors of protein and DNA synthesis. By the inhalation route, occupational stachybotrytoxicosis causes chest and upper airway symptoms, fever, leucopenia, dermatitis; starts in 2-3 days of exposure; and lasts 3 weeks. Investigation of the environment of the cluster of pulmonary hemorrhage in 10 infants in Cleveland, Ohio, and similar cases elsewhere are presented. The Centers for Disease Control and Prevention considers S. chartarum a serious health threat. However, even though there are now techniques of measuring S. chartarum conidia and estimating trichothecene mycotoxin in indoor air samples, no standards exist that relate to health effects. Those standards available are numerical or comparison of indoor/outdoor counts or both. Upper limit of noncontaminated indoor environment is 100-1000 colony-forming units (CFU) m3. There is no compelling evidence that exposures expected in most mold-contaminated indoor environments are likely to result in measurable health effects. However, when the health care worker suspects a problem in the home environment, a questionnaire and home visit may be helpful. High indoor exposures are associated with infrequent ventilation or vacuuming, pets, visible mold, and old carpets. To screen the indoor air, an experienced pollen and mold counter could use a Burkard personal air sampler. Health-based exposure

  14. Use of SRBC antibody responses for immunotoxicity testing.

    PubMed

    Ladics, Gregory S

    2007-01-01

    The production of antigen-specific antibodies represents a major defense mechanism of humoral immune responses and involves the cooperation and interaction of several immune cell types: antigen presenting cells, T helper cells, and B cells. Thus, there are several cells or cell products (e.g., interleukins) that may be altered following xenobiotic exposure, making assays that evaluate the production of antigen specific antibody a relatively comprehensive and sensitive assessment of immune function. Data suggest that the primary antibody response to SRBC may be one of the most sensitive endpoints available to assess chemical-induced alterations to the immune system. As a result, this endpoint has become the cornerstone of several recently established guidelines for assessing the potential immunotoxicity of xenobiotics. Five types of antibody may be produced in a humoral immune response (i.e., IgGs of various subtypes, IgM, IgD, IgA, or IgE). For immunotoxicity assessment, the focus has primarily been on assays that assess production of IgM antibodies. Although a number of assays have been developed to evaluate antibody production, the antibody forming cell (AFC) assay and enzyme-linked immunosorbent assay (ELISA) are the two most frequently employed to evaluate the potential immunotoxicity of a xenobiotic. In this manuscript, background information, as well as the pros and cons of each of these assays are discussed and detailed methods on conducting each assay are provided.

  15. [Persistant perfluorinated compounds cause immunotoxic effects].

    PubMed

    Heilmann, Carsten; Jensen, Lise; Weihe, Pal; Nielsen, Flemming; Knudsen, Lisbeth E; Budtz-Jørgensen, Esben; Mølbak, Kåre; Grandjean, Philippe

    2014-02-24

    Perfluorinated compounds are highly stable and useful industrial chemicals. Both perfluorooctane sulfonic acid and perfluorooctanoic acid cause immunotoxic effects in animal models at serum concentrations similar to human levels. In children who have undergone routine vaccinations, serum concentrations of these substances are inversely associated with concentrations of antibodies against diphtheria and tetanus. Prevention of such effects will require a decrease of exposure limits by at least 100-fold. Immunotoxicity is not included in routine testing of industrial chemicals but urgently needs attention.

  16. The Peptide Toxin Amylosin of Bacillus amyloliquefaciens from Moisture-Damaged Buildings Is Immunotoxic, Induces Potassium Efflux from Mammalian Cells, and Has Antimicrobial Activity

    PubMed Central

    Teplova, Vera V.; Andersson, Maria A.; Mikkola, Raimo; Kankkunen, Päivi; Matikainen, Sampsa; Gahmberg, Carl G.; Andersson, Leif C.; Salkinoja-Salonen, Mirja

    2015-01-01

    Amylosin, a heat-stable channel-forming non-ribosomally synthesized peptide toxin produced by strains of Bacillus amyloliquefaciens isolated from moisture-damaged buildings, is shown in this paper to have immunotoxic and cytotoxic effects on human cells as well as antagonistic effects on microbes. Human macrophages exposed to 50 ng of amylosin ml−1 secreted high levels of cytokines interleukin-1β (IL-1β) and IL-18 within 2 h, indicating activation of the NLRP3 inflammasome, an integral part of the innate immune system. At the same exposure level, expression of IL-1β and IL-18 mRNA increased. Amylosin caused dose-dependent potassium ion efflux from all tested mammalian cells (human monocytes and keratinocytes and porcine sperm cells) at 1 to 2 μM exposure. Amylosin also inhibited the motility of porcine sperm cells and depolarized the mitochondria of human keratinocytes. Amylosin may thus trigger the activation of the NLRP3 inflammasome and subsequently cytokine release by causing potassium efflux from exposed cells. The results of this study indicate that exposure to amylosin activates the innate immune system, which could offer an explanation for the inflammatory symptoms experienced by occupants of moisture-damaged buildings. In addition, the amylosin-producing B. amyloliquefaciens inhibited the growth of both prokaryotic and eukaryotic indoor microbes, and purified amylosin also had an antimicrobial effect. These antimicrobial effects could make amylosin producers dominant and therefore significant causal agents of health problems in some moisture-damaged sites. PMID:25681192

  17. The peptide toxin amylosin of Bacillus amyloliquefaciens from moisture-damaged buildings is immunotoxic, induces potassium efflux from mammalian cells, and has antimicrobial activity.

    PubMed

    Rasimus-Sahari, Stiina; Teplova, Vera V; Andersson, Maria A; Mikkola, Raimo; Kankkunen, Päivi; Matikainen, Sampsa; Gahmberg, Carl G; Andersson, Leif C; Salkinoja-Salonen, Mirja

    2015-04-01

    Amylosin, a heat-stable channel-forming non-ribosomally synthesized peptide toxin produced by strains of Bacillus amyloliquefaciens isolated from moisture-damaged buildings, is shown in this paper to have immunotoxic and cytotoxic effects on human cells as well as antagonistic effects on microbes. Human macrophages exposed to 50 ng of amylosin ml(-1) secreted high levels of cytokines interleukin-1β (IL-1β) and IL-18 within 2 h, indicating activation of the NLRP3 inflammasome, an integral part of the innate immune system. At the same exposure level, expression of IL-1β and IL-18 mRNA increased. Amylosin caused dose-dependent potassium ion efflux from all tested mammalian cells (human monocytes and keratinocytes and porcine sperm cells) at 1 to 2 μM exposure. Amylosin also inhibited the motility of porcine sperm cells and depolarized the mitochondria of human keratinocytes. Amylosin may thus trigger the activation of the NLRP3 inflammasome and subsequently cytokine release by causing potassium efflux from exposed cells. The results of this study indicate that exposure to amylosin activates the innate immune system, which could offer an explanation for the inflammatory symptoms experienced by occupants of moisture-damaged buildings. In addition, the amylosin-producing B. amyloliquefaciens inhibited the growth of both prokaryotic and eukaryotic indoor microbes, and purified amylosin also had an antimicrobial effect. These antimicrobial effects could make amylosin producers dominant and therefore significant causal agents of health problems in some moisture-damaged sites.

  18. Differential immunotoxicities of poly(ethylene glycol)-vs. poly(carboxybetaine)-coated nanoparticles

    PubMed Central

    Elsabahy, Mahmoud; Li, Ang; Zhang, Fuwu; Sultan, Deborah; Liu, Yongjian; Wooley, Karen L.

    2013-01-01

    Although the careful selection of shell-forming polymers for the construction of nanoparticles is an obvious parameter to consider for shielding of core materials and their payloads, providing for prolonged circulation in vivo by limiting uptake by the immune organs, and thus, allowing accumulation at the target sites, the immunotoxicities that such shielding layers elicit is often overlooked. For instance, we have previously performed rigorous in vitro and in vivo comparisons between two sets of nanoparticles coated with either non-ionic poly(ethylene glycol) (PEG) or zwitterionic poly(carboxybetaine) (PCB), but only now report the immunotoxicity and anti-biofouling properties of both polymers, as homopolymers or nanoparticle-decorating shell, in comparison to the uncoated nanoparticles, and Cremophor-EL, a well-known low molecular weight surfactant used for formulation of several drugs. It was found that both PEG and PCB polymers could induce the expression of cytokines in vitro and in vivo, with PCB being more immunotoxic than PEG, which corroborates the in vivo pharmacokineties and biodistribution profiles of the two sets of nanoparticles. This is the first study to report on the ability of PEG, the most commonly utilized polymer to coat nanomaterials, and PCB, an emerging zwitterionic anti-biofouling polymer, to induce the secretion of cytokines and be of potential immunotoxicity. Furthermore, we report here on the possible use of immunotoxicity assays to partially predict in vivo pharmacokineties and biodistribution of nanomaterials. PMID:24056145

  19. Occurrence of Stachybotrys chartarum chemotype S in dried culinary herbs.

    PubMed

    Biermaier, Barbara; Gottschalk, Christoph; Schwaiger, Karin; Gareis, Manfred

    2015-02-01

    Stachybotrys (S.) chartarum is an omnipresent cellulolytic mould which produces secondary metabolites, such as the highly toxic macrocyclic trichothecenes. While it is known to occur in animal feed like hay and straw as well as in water-damaged indoor environments, there is little knowledge about the occurrence of S. chartarum and its secondary metabolites in food. The objective of the present study was to examine selected dried culinary herbs for the presence of S. chartarum chemotype S, to assess the potential risk of a contamination of foods with macrocyclic trichothecenes. In total, 50 Stachybotrys isolates from different types of culinary herbs (n=100) such as marjoram (Origanum majorana Linné (L.)), oregano (Origanum vulgare L.), thyme (Thymus vulgaris L.), and savory (Satureja hortensis L.) were examined by MTT-cell culture test (effect-based bioassay), ELISA, and by liquid chromatography tandem mass spectrometry (LC-MS/MS). Selected toxic and non-toxic isolates (n=15) were genetically characterized by PCR and sequencing. Five isolates (10%) were highly toxic in the MTT-cell culture test, and the production of macrocyclic trichothecenes was proven by ELISA and LC-MS/MS. These five isolates were genetically confirmed as S. chartarum chemotype S. To the best of our knowledge, this is the first report about a contamination of dried culinary herbs with toxigenic S. chartarum.

  20. PURIFICATION AND COMPARATIVE NEUROTOXICITY OF THE TRICHOTHECENES SATRATOXIN G AND RORIDIN L2 FROM STACHYBOTRYS CHARTARUM

    PubMed Central

    Islam, Zahidul; Shinozuka, Junko; Harkema, Jack R.; Pestka, James J.

    2009-01-01

    Satratoxin G (SG), a macrocyclic trichothecene produced by Stachybotrys chartarum, induces apoptosis in cultured neuronal cells as well as nasal olfactory sensory neurons (OSN) in the nose and brain of mice exposed intranasally to this toxin. The purpose of this study was to (1) develop a facile method for production and purification of both SG, and its putative biosynthetic precursor, roridin L2 (RL2), from S. chartarum cultures and (2) compare their relative neurotoxicity in vitro and in vivo. S. chartarum 29-58-17 was cultured in Fernbach flasks on rice (5×105 spores /250g rice) for 4 to 6 weeks. Following extraction with acetonitrile, the extract was dried, dissolved in dichloromethane and subjected to Michel-Miller silica gel chromatography using a stepwise acetonitrile-dichloromethane gradient with SG and RL2 eluting in the 30 and 40% acetonitrile fractions, respectively. Purification of the two compounds was completed by C18 semi-preparative reverse phase liquid chromatography using an acetonitrile-water gradient and purity confirmed by electrospray ionization/collision-induced dissociation (ESI-CID) tandem mass spectroscopy. Although viability significantly decreased in PC-12 neuronal cells treated with 10 to 25 ng/ml of SG, RL2 at concentrations up to 1000 ng/ml were not toxic. Flow cytometry and agarose DNA fragmentation assays revealed that SG at 10 to 25 ng/ml induced apoptotic death in the PC-12 cells while RL2 at concentrations up to 1000 ng/ml were without effect. In similar fashion, intranasal exposure of mice (female B6C3F1) to SG at 100 µg/kg bw induced marked OSN apoptosis and atrophy of the olfactory epithelium whereas RL2 at the equivalent dose did not exhibit toxicity. Taken together, an optimized protocol for production and isolation of trichothecenes from S. chartarum cultures is described and further demonstrates that while the macrocyclic SG was neurotoxic in vitro and in vivo, its biosynthetic precursor, RL2 was non-toxic. PMID:20077192

  1. Purification and comparative neurotoxicity of the trichothecenes satratoxin G and roridin L2 from Stachybotrys chartarum.

    PubMed

    Islam, Zahidul; Shinozuka, Junko; Harkema, Jack R; Pestka, James J

    2009-01-01

    Satratoxin G (SG), a macrocyclic trichothecene produced by Stachybotrys chartarum, induces apoptosis in cultured neuronal cells as well as nasal olfactory sensory neurons (OSN) in the nose and brain of mice exposed intranasally to this toxin. The purposes of this study were to (1) develop a facile method for production and purification of both SG and its putative biosynthetic precursor, roridin L2 (RL2), from S. chartarum cultures and (2) compare their relative neurotoxicity in vitro and in vivo. Stachybotrys chartarum 29-58-17 was cultured in Fernbach flasks on rice (5 x 10(5) spores/250 g rice) for 4 to 6 wk. Following extraction with acetonitrile, the extract was dried, dissolved in dichloromethane, and subjected to Michel-Miller silica-gel chromatography using a stepwise acetonitrile-dichloromethane gradient with SG and RL2 eluting in the 30 and 40% acetonitrile fractions, respectively. Purification of the two compounds was completed by C18 semipreparative reverse-phase liquid chromatography using an acetonitrile-water gradient, and purity was confirmed by electrospray ionization/collision-induced dissociation (ESI-CID) tandem mass spectroscopy. Although viability significantly decreased in PC-12 neuronal cells treated with 10 to 25 ng/ml of SG, RL2 at concentrations up to 1000 ng/ml was not toxic. Flow cytometry and agarose DNA fragmentation assays revealed that SG at 10 to 25 ng/ml induced apoptotic death in the PC-12 cells, while RL2 at concentrations up to 1000 ng/ml was without effect. In a similar fashion, intranasal exposure of mice (female B6C3F1) to SG at 100 microg/kg body weight (bw) induced marked OSN apoptosis and atrophy of the olfactory epithelium, whereas RL2 at the equivalent dose did not exhibit toxicity. Taken together, an optimized protocol for production and isolation of trichothecenes from S. chartarum cultures is described and further demonstrates that while the macrocyclic SG was neurotoxic in vitro and in vivo, its biosynthetic

  2. Characterization of an extracellular laccase of Leptosphaerulina chartarum.

    PubMed

    Sajben-Nagy, Enikő; Manczinger, László; Škrbić, Biljana; Živančev, Jelena; Antić, Igor; Krisch, Judit; Vágvölgyi, Csaba

    2014-09-01

    Laccase-producing fungi were isolated from air, using selective media with a chromogenic substrate to indicate enzyme activity. The best laccase producer strain proved to be a Leptosphaerulina chartarum isolate. Laccase production was investigated in the presence of various inducers in different cultivation conditions. The extracellular laccase was purified for further investigations. SDS-PAGE showed that this laccase is a monomeric protein of 38 kDa molecular weight. The enzyme is active in the pH-range of 3.5-6, with an optimum at pH 3.8. It is active in the 10-60 °C temperature range, with an optimum at 40 °C. After 20 min incubation at temperatures above 70 °C the enzyme lost its activity. Degradation of seven aniline and phenol compounds (2,4-dichlorophenol; 2-methyl-4-chlorophenol; 3-chloroaniline; 4-chloroaniline; 2,6-dimethylaniline; 3,4-dichloroaniline and 3-chloro-4-methylaniline) was investigated, with or without guaiacol (2-methoxyphenol) as mediator molecule. Addition of a mediator to the system significantly increased the degradation levels. These results confirmed that the isolated laccase is able to convert these harmful xenobiotics at in vitro conditions.

  3. From immunotoxicity to carcinogenicity: the effects of carbamate pesticides on the immune system.

    PubMed

    Dhouib, Ines; Jallouli, Manel; Annabi, Alya; Marzouki, Soumaya; Gharbi, Najoua; Elfazaa, Saloua; Lasram, Mohamed Montassar

    2016-05-01

    The immune system can be the target of many chemicals, with potentially severe adverse effects on the host's health. In the literature, carbamate (CM) pesticides have been implicated in the increasing prevalence of diseases associated with alterations of the immune response, such as hypersensitivity reactions, some autoimmune diseases and cancers. CMs may initiate, facilitate, or exacerbate pathological immune processes, resulting in immunotoxicity by induction of mutations in genes coding for immunoregulatory factors and modifying immune tolerance. In the present study, direct immunotoxicity, endocrine disruption and inhibition of esterases activities have been introduced as the main mechanisms of CMs-induced immune dysregulation. Moreover, the evidence on the relationship between CM pesticide exposure, dysregulation of the immune system and predisposition to different types of cancers, allergies, autoimmune and infectious diseases is criticized. In addition, in this review, we will discuss the relationship between immunotoxicity and cancer, and the advances made toward understanding the basis of cancer immune evasion.

  4. Synergistic interaction in simultaneous exposure to Streptomyces californicus and Stachybotrys chartarum.

    PubMed Central

    Huttunen, Kati; Pelkonen, Jukka; Nielsen, Kristian Fogg; Nuutinen, Ulla; Jussila, Juha; Hirvonen, Maija-Riitta

    2004-01-01

    The microbial exposure associated with health complaints in moldy houses consists of a heterogeneous group of components, including both living and dead bacteria, fungi, and their metabolites and active compounds. However, little is known about the interactions between different microbes and their metabolites, although the cytotoxicity and inflammatory potential of certain individual microbes have been reported. In this study, we investigated the inflammatory responses of mouse RAW264.7 macrophages after exposure to six indoor air microbes (Aspergillus versicolor, Penicillium spinulosum, Stachybotrys chartarum, Bacillus cereus, Mycobacterium terrae, and Pseudomonas fluorescens) alone and together with the actinomycete Streptomyces californicus. The production of nitric oxide, levels of the proinflammatory cytokines tumor necrosis factor alpha (TNF-alpha) and interleukin-6 (IL-6), and cytotoxicity were measured. The coexposure to Sta. chartarum and Str. californicus caused a synergistic increase in the production of IL-6 but not other cytokines. In further experiments, the metabolites from Sta. chartarum or from closely related fungi (atranones B and E, satratoxin G, trichodermin, 7-alpha-hydroxytrichodermol, staplabin, and SMTP-7) and the known fungal toxins sterigmatocystin, citrinin, and ochratoxin A were each tested with Str. californicus. The testing revealed a synergistic response in TNF-alpha and IL-6 production after coexposure to Str. californicus with both trichodermin and 7-alpha-hydroxytrichodermol. Finally, the synergistic inflammatory response caused by Str. californicus and trichodermin together was studied by analyzing for the presence of nuclear factor-kappa-B (NF-kappa-B) in nuclear extracts of the exposed cells. The exposure to Str. californicus induced the binding of NF-kappa-B proteins to the NF-kappa-B consensus sequence as well as to the natural NF-kappa-B site of the IL-6 promoter. Adding trichodermin to the exposure did not increase the DNA

  5. Stachybotrys chartarum, trichothecene mycotoxins, and damp building-related illness: new insights into a public health enigma.

    PubMed

    Pestka, James J; Yike, Iwona; Dearborn, Dorr G; Ward, Marsha D W; Harkema, Jack R

    2008-07-01

    Damp building-related illnesses (DBRI) include a myriad of respiratory, immunologic, and neurologic symptoms that are sometimes etiologically linked to aberrant indoor growth of the toxic black mold, Stachybotrys chartarum. Although supportive evidence for such linkages is limited, there are exciting new findings about this enigmatic organism relative to its environmental dissemination, novel bioactive components, unique cellular targets, and molecular mechanisms of action which provide insight into the S. chartarum's potential to evoke allergic sensitization, inflammation, and cytotoxicity in the upper and lower respiratory tracts. Macrocyclic trichothecene mycotoxins, produced by one chemotype of this fungus, are potent translational inhibitors and stress kinase activators that appear to be a critical underlying cause for a number of adverse effects. Notably, these toxins form covalent protein adducts in vitro and in vivo and, furthermore, cause neurotoxicity and inflammation in the nose and brain of the mouse. A second S. chartarum chemotype has recently been shown to produce atranones-mycotoxins that can induce pulmonary inflammation. Other biologically active products of this fungus that might contribute to pathophysiologic effects include proteinases, hemolysins, beta-glucan, and spirocyclic drimanes. Solving the enigma of whether Stachybotrys inhalation indeed contributes to DBRI will require studies of the pathophysiologic effects of low dose chronic exposure to well-characterized, standardized preparations of S. chartarum spores and mycelial fragments, and, coexposures with other environmental cofactors. Such studies must be linked to improved assessments of human exposure to this fungus and its bioactive constituents in indoor air using both state-of-the-art sampling/analytical methods and relevant biomarkers.

  6. Coexposure to mercury increases immunotoxicity of trichloroethylene.

    PubMed

    Gilbert, Kathleen M; Rowley, Benjamin; Gomez-Acevedo, Horacio; Blossom, Sarah J

    2011-02-01

    We have shown previously that chronic (32 weeks) exposure to occupationally relevant concentrations of the environmental pollutant trichloroethylene (TCE) induced autoimmune hepatitis (AIH) in autoimmune-prone MRL+/+ mice. In real-life, individuals are never exposed to only one chemical such as TCE. However, very little is known about the effects of chemical mixtures on the immune system. The current study examined whether coexposure to another known immunotoxicant, mercuric chloride (HgCl(2)), altered TCE-induced AIH. Female MRL+/+ mice were treated for only 8 weeks with TCE (9.9 or 186.9 mg/kg/day in drinking water) and/or HgCl(2) (260 μg/kg/day, sc). Unlike mice exposed to either TCE or HgCl(2) alone, mice exposed to both toxicants for 8 weeks developed significant liver pathology commensurate with early stages of AIH. Disease development in the coexposed mice was accompanied by a unique pattern of anti-liver and anti-brain antibodies that recognized, among others, a protein of approximately 90 kDa. Subsequent immunoblotting showed that sera from the coexposed mice contained antibodies specific for heat shock proteins, a chaperone protein targeted by antibodies in patients with AIH. Thus, although TCE can promote autoimmune disease following chronic exposure, a shorter exposure to a binary mixture of TCE and HgCl(2) accelerated disease development. Coexposure to TCE and HgCl(2) also generated a unique liver-specific antibody response not found in mice exposed to a single toxicant. This finding stresses the importance of including mixtures in assessments of chemical immunotoxicity.

  7. STACHYLYSIN MAY BE CAUSE OF HEMORRAHAGING IN STACHYBOTRYS CHARTARUM EXPOSURES

    EPA Science Inventory

    Stachybotrys chartarum is a toxigenic fungus that has been associated with human health concerns like nasal bleeding in adults and pulmonary hemosiderosis (PH) in infants. Stachylysin is a glycosylated protein, with the deglycosylated molecular mass of 21.5 kDa. Seven of eight ...

  8. CHARACTERIZATION OF THE HEMOLYSIN, STACHYLYSIN, FROM STACHYBOTRYS CHARTARUM

    EPA Science Inventory

    Stachybotrys chartarum is a toxigenic fungus that has been associated with human health concerns, including pulmonary hemorrhage/hemosiderosis. This fungus produces a hemolysin, stachylysin, which in its monomeric form, has a molecular wieght of 11,920 daltons as determined by m...

  9. CHARACTERIZATION OF THE HEMOLYSIN, STACHYLYSIN, FROM STACHYBOTRYS CHARTARUM

    EPA Science Inventory

    Stachybotrys chartarum is a toxigenic fungus that has been associated with human health concerns, including pulmonary hemorrhage/hemosiderosis. This fungus produces a hemolysin, stachylysin, which in its monomeric form, has a molecular wieght of 11,920 daltons as determined by m...

  10. STACHYLYSIN MAY BE CAUSE OF HEMORRAHAGING IN STACHYBOTRYS CHARTARUM EXPOSURES

    EPA Science Inventory

    Stachybotrys chartarum is a toxigenic fungus that has been associated with human health concerns like nasal bleeding in adults and pulmonary hemosiderosis (PH) in infants. Stachylysin is a glycosylated protein, with the deglycosylated molecular mass of 21.5 kDa. Seven of eight ...

  11. Inhalation of Stachybotrys chartarum causes pulmonary arterial hypertension in mice

    PubMed Central

    Ochiai, Eri; Kamei, Katsuhiko; Watanabe, Akira; Nagayoshi, Masaru; Tada, Yuji; Nagaoka, Tetsutaro; Sato, Koichi; Sato, Ayaka; Shibuya, Kazutoshi

    2008-01-01

    Inhalation of Stachybotrys chartarum, a ubiquitous fungus in our living environment, has been suspected as a cause of acute idiopathic pulmonary haemorrhage in infants, but its relation to human diseases is not yet known. The aim of present study was to investigate the effect of repeated intratracheal injection of the fungus into mice, paying special attention to the pulmonary vascular system. Spores of S. chartarum were injected into the trachea of mice from 6 to 18 times over 4–12 weeks, and the lungs were examined by histopathology, morphometrics and haemodynamics. When 1 × 104 spores/mouse were injected, histopathological examination showed the development of pulmonary arterial hypertension (PAH). Symmetrical thickening of the intima and media of the pulmonary arterial walls was seen after six injections over 4 weeks. Right ventricular hypertrophy was also evident after 12 injections. PAH was confirmed by the elevation of right ventricular systolic pressure (20.1 ± 5.7 mmHg in the injected group vs. 12.0 ± 2.4 mmHg in the control group, P < 0.01). This study showed that the inhalation of S. chartarum caused PAH in mice, suggesting a potential of S. chartarum as a cause of human health problem such as PAH. PMID:18460072

  12. Inhalation of Stachybotrys chartarum causes pulmonary arterial hypertension in mice.

    PubMed

    Ochiai, Eri; Kamei, Katsuhiko; Watanabe, Akira; Nagayoshi, Masaru; Tada, Yuji; Nagaoka, Tetsutaro; Sato, Koichi; Sato, Ayaka; Shibuya, Kazutoshi

    2008-06-01

    Inhalation of Stachybotrys chartarum, a ubiquitous fungus in our living environment, has been suspected as a cause of acute idiopathic pulmonary haemorrhage in infants, but its relation to human diseases is not yet known. The aim of present study was to investigate the effect of repeated intratracheal injection of the fungus into mice, paying special attention to the pulmonary vascular system. Spores of S. chartarum were injected into the trachea of mice from 6 to 18 times over 4-12 weeks, and the lungs were examined by histopathology, morphometrics and haemodynamics. When 1 x 10(4) spores/mouse were injected, histopathological examination showed the development of pulmonary arterial hypertension (PAH). Symmetrical thickening of the intima and media of the pulmonary arterial walls was seen after six injections over 4 weeks. Right ventricular hypertrophy was also evident after 12 injections. PAH was confirmed by the elevation of right ventricular systolic pressure (20.1 +/- 5.7 mmHg in the injected group vs. 12.0 +/- 2.4 mmHg in the control group, P < 0.01). This study showed that the inhalation of S. chartarum caused PAH in mice, suggesting a potential of S. chartarum as a cause of human health problem such as PAH.

  13. [A comparative analysis of Stachybotrys chartarum strains isolated in Russia].

    PubMed

    Elanskiĭ, S N; Petrunina, Ia V; Lavrova, O I; Likhachev, A N

    2004-01-01

    This work deals with a comparative analysis of Stachybotrys chartarum strains isolated from various artificial cellulose-containing materials and natural substrates in the geographically distant regions of Russia. The analysis included the determination of the spore size, the strain toxicity to Paramecium caudatum, the strain resistance to the fungicides Benomil, Olilen, and Tilt, and the PCR study of the genome structure with the aid of a primer that was complementary to the core sequence of the SINE retrotransposon. It was found that some of the strains that were isolated from different areas and from different substrates differ in their toxicity, fungicide resistance, and genome structure. The PCR analysis showed the absence of any correlation between the genome structure, the strain properties, the geographic area, and the substrates from which the strains were isolated. The pheno- and genotypic diversity of the strains and their different vegetative compatibility suggest the existence of an intraspecies diversity of the S. chartarum strains that were isolated in different geographic areas. The absence of any correlation between the pheno- and genotypic properties of the strains and the substrates from which they were isolated implies that the colonization of artificial substrates by S. chartarum occurred occasionally from natural habitats. The S. chartarum populations that live on artificial substrates are unlikely to have their own evolutionary history.

  14. Value of phagocyte function screening for immunotoxicity of nanoparticles in vivo

    PubMed Central

    Fröhlich, Eleonore

    2015-01-01

    Nanoparticles (NPs) present in the environment and in consumer products can cause immunotoxic effects. The immune system is very complex, and in vivo studies are the gold standard for evaluation. Due to the increased amount of NPs that are being developed, cellular screening assays to decrease the amount of NPs that have to be tested in vivo are highly needed. Effects on the unspecific immune system, such as effects on phagocytes, might be suitable for screening for immunotoxicity because these cells mediate unspecific and specific immune responses. They are present at epithelial barriers, in the blood, and in almost all organs. This review summarizes the effects of carbon, metal, and metal oxide NPs used in consumer and medical applications (gold, silver, titanium dioxide, silica dioxide, zinc oxide, and carbon nanotubes) and polystyrene NPs on the immune system. Effects in animal exposures through different routes are compared to the effects on isolated phagocytes. In addition, general problems in the testing of NPs, such as unknown exposure doses, as well as interference with assays are mentioned. NPs appear to induce a specific immunotoxic pattern consisting of the induction of inflammation in normal animals and aggravation of pathologies in disease models. The evaluation of particle action on several phagocyte functions in vitro may provide an indication on the potency of the particles to induce immunotoxicity in vivo. In combination with information on realistic exposure levels, in vitro studies on phagocytes may provide useful information on the health risks of NPs. PMID:26060398

  15. Taxonomic history and current status of Stachybotrys chartarum and related species.

    PubMed

    Li, D-W; Yang, C S

    2005-01-01

    The fungus Stachybotrys chartarum is the type species of the genus Stachybotrys. It is a cellulolytic saprophyte with a worldwide distribution and is frequently recovered in water-damaged buildings. Three isolates of S. chartarum were studied morphologically from single-spore isolations. Significant differences were found with the sizes, lengths, width, and L/W ratio of conidia and phialides among the isolates. QPCR analysis on S. chartarum, S. yunnanensis, S. chlorohalonata, S. elegans, S. microspora, and S. nephrospora showed that the primers and probe for detecting S. chartarum used by commercial laboratories were not able to differentiate S. chartarum from S. chlorohalonata and S. yunnanensis. Results suggested that S. chartarum may not be well delineated even after S. chlorohalonata was recently segregated from the species complex. Further study on the taxonomic status of the epithet S. chartarum is necessary. Six species of Stachybotrys are present indoors. Differentiation of Stachybotrys chartarum from S. chlorohalonata, and S. yunnanensis can be challenging using either morphological or QPCR methods. Caution should be taken to identify S. chartarum and closely related species and to explain their health effects implication for indoor air quality investigations.

  16. IMMUNOCYTOCHEMICAL LOCALIZATION OF STACHYLYSIN IN STACHYBOTRYS CHARTARUM SPORES AND SPORE-IMPACTED MOUSE AND RAT LUNG TISSUES

    EPA Science Inventory

    Stachylysin is a proteinaceous hemolytic agent that is producted by S. chartarum. Stachylysin was found, using immunohistochemistical and immunocytochemical methods, to be localized in S. chartarum spores/mycelia primarily in the inner wall suggesting that it is constitutively ...

  17. IMMUNOCYTOCHEMICAL LOCALIZATION OF STACHYLYSIN IN STACHYBOTRYS CHARTARUM SPORES AND SPORE-IMPACTED MOUSE AND RAT LUNG TISSUES

    EPA Science Inventory

    Stachylysin is a proteinaceous hemolytic agent that is producted by S. chartarum. Stachylysin was found, using immunohistochemistical and immunocytochemical methods, to be localized in S. chartarum spores/mycelia primarily in the inner wall suggesting that it is constitutively ...

  18. A comparison of immunotoxic effects of nanomedicinal products with regulatory immunotoxicity testing requirements

    PubMed Central

    Giannakou, Christina; Park, Margriet VDZ; de Jong, Wim H; van Loveren, Henk; Vandebriel, Rob J; Geertsma, Robert E

    2016-01-01

    Nanomaterials (NMs) are attractive for biomedical and pharmaceutical applications because of their unique physicochemical and biological properties. A major application area of NMs is drug delivery. Many nanomedicinal products (NMPs) currently on the market or in clinical trials are most often based on liposomal products or polymer conjugates. NMPs can be designed to target specific tissues, eg, tumors. In virtually all cases, NMPs will eventually reach the immune system. It has been shown that most NMs end up in organs of the mononuclear phagocytic system, notably liver and spleen. Adverse immune effects, including allergy, hypersensitivity, and immunosuppression, have been reported after NMP administration. Interactions of NMPs with the immune system may therefore constitute important side effects. Currently, no regulatory documents are specifically dedicated to evaluate the immunotoxicity of NMs or NMPs. Their immunotoxicity assessment is performed based on existing guidelines for conventional substances or medicinal products. Due to the unique properties of NMPs when compared with conventional medicinal products, it is uncertain whether the currently prescribed set of tests provides sufficient information for an adequate evaluation of potential immunotoxicity of NMPs. The aim of this study was therefore, to compare the current regulatory immunotoxicity testing requirements with the accumulating knowledge on immunotoxic effects of NMPs in order to identify potential gaps in the safety assessment. This comparison showed that immunotoxic effects, such as complement activation-related pseudoallergy, myelosuppression, inflammasome activation, and hypersensitivity, are not readily detected by using current testing guidelines. Immunotoxicity of NMPs would be more accurately evaluated by an expanded testing strategy that is equipped to stratify applicable testing for the various types of NMPs. PMID:27382281

  19. A comparison of immunotoxic effects of nanomedicinal products with regulatory immunotoxicity testing requirements.

    PubMed

    Giannakou, Christina; Park, Margriet Vdz; de Jong, Wim H; van Loveren, Henk; Vandebriel, Rob J; Geertsma, Robert E

    2016-01-01

    Nanomaterials (NMs) are attractive for biomedical and pharmaceutical applications because of their unique physicochemical and biological properties. A major application area of NMs is drug delivery. Many nanomedicinal products (NMPs) currently on the market or in clinical trials are most often based on liposomal products or polymer conjugates. NMPs can be designed to target specific tissues, eg, tumors. In virtually all cases, NMPs will eventually reach the immune system. It has been shown that most NMs end up in organs of the mononuclear phagocytic system, notably liver and spleen. Adverse immune effects, including allergy, hypersensitivity, and immunosuppression, have been reported after NMP administration. Interactions of NMPs with the immune system may therefore constitute important side effects. Currently, no regulatory documents are specifically dedicated to evaluate the immunotoxicity of NMs or NMPs. Their immunotoxicity assessment is performed based on existing guidelines for conventional substances or medicinal products. Due to the unique properties of NMPs when compared with conventional medicinal products, it is uncertain whether the currently prescribed set of tests provides sufficient information for an adequate evaluation of potential immunotoxicity of NMPs. The aim of this study was therefore, to compare the current regulatory immunotoxicity testing requirements with the accumulating knowledge on immunotoxic effects of NMPs in order to identify potential gaps in the safety assessment. This comparison showed that immunotoxic effects, such as complement activation-related pseudoallergy, myelosuppression, inflammasome activation, and hypersensitivity, are not readily detected by using current testing guidelines. Immunotoxicity of NMPs would be more accurately evaluated by an expanded testing strategy that is equipped to stratify applicable testing for the various types of NMPs.

  20. Subacute immunotoxicity of the marine phycotoxin yessotoxin in rats.

    PubMed

    Ferreiro, Sara F; Vilariño, Natalia; Carrera, Cristina; Louzao, M Carmen; Santamarina, Germán; Cantalapiedra, Antonio G; Cifuentes, J Manuel; Vieira, Andrés C; Botana, Luis M

    2017-04-01

    Yessotoxin (YTX) is a marine phycotoxin produced by dinoflagellates and accumulated in filter feeding shellfish. YTX content in shellfish is regulated by many food safety authorities to protect human health, although currently no human intoxication episodes have been unequivocally related to YTX presence in food. The immune system has been proposed as one of the target organs of YTX due to alterations of lymphoid tissues and cellular and humoral components. The aim of the present study was to explore subacute immunotoxicity of YTX in rats by evaluating the haematological response, inflammatory cytokine biomarkers and the presence of YTX-induced structural alterations in the spleen and thymus. The results showed that repeated administrations of YTX caused a decrease of lymphocyte percentage and an increase of neutrophil counts, a reduction in interleukine-6 (IL-6) plasmatic levels and histopathological splenic alterations in rats after four intraperitoneal injections of YTX at doses of 50 or 70 μg/kg that were administered every 4 days along a period of 15 days. Therefore, for the first time, subacute YTX-immunotoxicity is reported in rats, suggesting that repeated exposures to low amounts of YTX might also suppose a threat to human health, especially in immuno-compromised populations. Copyright © 2017 Elsevier Ltd. All rights reserved.

  1. The relative allergenicity of Stachybotrys chartarum compared to house dust mite extracts in a mouse model.

    PubMed

    Chung, Yong Joo; Copeland, Lisa B; Doerfler, Donald L; Ward, Marsha D W

    2010-05-01

    A report by the Institute of Medicine suggested that more research is needed to better understand mold effects on allergic disease, particularly asthma development. The authors compared the ability of the fungus Stachybotrys chartarum (SCE) and house dust mite (HDM) extracts to induce allergic responses in BALB/c mice. The extracts were administered by intratracheal aspiration (IA) at several doses (0, 2.5, 5, 10, 20, 40, and 80 microg) 4 times over a 4-week period. Three days after the last IA exposure, serum and bronchoalveolar lavage fluid (BALF) were collected. The relative allergenicity of the extracts was evaluated based on the lowest dose that induced a significant response compared to control (0 microg) and the linear regression slope analysis across the dose range. SCE induced a more robust response than HDM for BALF some inflammatory cells (macrophage and neutrophils), whereas HDM induced more robust BALF lymphocyte and eosinophil responses. Although SCE induced a more robust serum total immunoglobulin E (IgE) response than did HDM, the induction of a similar response in a functional, antigen-specific IgE assay required approximately twice as much SCE as HDM. Even though SCE demonstrates the ability to induce allergic responses in the mouse model, considering the importance and relevance of eosinophil, lymphocyte, and antigen-specific IgE in allergic airway disease, it is concluded that HDM is more potent than SCE in the induction of allergic responses. These data suggest a threshold dose for SCE allergy induction. Furthermore, in damp water-damaged environments, exposure to S. chartarum might easily exceed the sensitization threshold for a susceptible population.

  2. Biomechanics of conidial dispersal in the toxic mold Stachybotrys chartarum.

    PubMed

    Tucker, Kathryn; Stolze, Jessica L; Kennedy, Aaron H; Money, Nicholas P

    2007-07-01

    Conidial dispersal in Stachybotrys chartarum in response to low-velocity airflow was studied using a microflow apparatus. The maximum rate of spore release occurred during the first 5 min of airflow, followed by a dramatic reduction in dispersal that left more than 99% of the conidia attached to their conidiophores. Micromanipulation of undisturbed colonies showed that micronewton (microN) forces were needed to dislodge spore clusters from their supporting conidiophores. Calculations show that airspeeds that normally prevail in the indoor environment disturb colonies with forces that are 1000-fold lower, in the nanonewton (nN) range. Low-velocity airflow does not, therefore, cause sufficient disturbance to disperse a large proportion of the conidia of S. chartarum.

  3. Biomechanics of conidial dispersal in the toxic mold Stachybotrys chartarum

    PubMed Central

    Tucker, Kathryn; Stolze, Jessica L.; Kennedy, Aaron H.; Money, Nicholas P.

    2007-01-01

    Conidial dispersal in Stachybotrys chartarum in response to low-velocity airflow was studied using a microflow apparatus. The maximum rate of spore release occurred during the first 5 min of airflow, followed by a dramatic reduction in dispersal that left more than 99% of the conidia attached to their conidiophores. Micromanipulation of undisturbed colonies showed that micronewton (μN) forces were needed to dislodge spore clusters from their supporting conidiophores. Calculations show that airspeeds that normally prevail in the indoor environment disturb colonies with forces that are 1,000-fold lower, in the nanonewton (nN) range. Low-velocity airflow does not, therefore, cause sufficient disturbance to disperse a large proportion of the conidia of S. chartarum. PMID:17267247

  4. Pulmonary cytotoxicity of secondary metabolites of Stachybotrys chartarum (Ehrenb.) Hughes.

    PubMed

    Pieckova, Elena; Hurbankova, Marta; Cerna, Silvia; Pivovarova, Zuzana; Kovacikova, Zuzana

    2006-01-01

    Damp dwellings represent suitable conditions for extended indoor moulds. A cellulolytic micromycete Stachybotrys chartarum (Ehrenb.) Hughes is considered to be a tertiary colonizer of surfaces in affected buildings. Known adverse health effects of S. chartarum result from its toxins--trichothecenes or atranones, as well as spirolactams. Mechanism of their potential pathological effects on the respiratory tract has not yet been sufficiently clarified. The cytotoxic effects of complex chloroform-extractable endo- (in biomass) and exometabolites (in cultivation medium) of an indoor S. chartarum isolate of an atranone chemotype, grown on a liquid medium with yeast extract and sucrose at 25 degrees C for 14 d, on lung tissue were evaluated in the 3-day experiment. For the purpose, 4 mg of toxicants were intratracheally instilled in 200 g Wistar male rats. A trichothecene mycotoxin diacetoxyscirpenol was used as the positive control. Bronchoalveolar lavage (BAL) parameters--viability and phagocytic activity of alveolar macrophages (AM), activity of lactate dehydrogenase, acid phosphatase and cathepsin D in cell-free BAL fluid (BALF), as well as in BAL cells, were measured. Acute exposure to the metabolites caused statistically significant changes, indicating lung tissue injury in the experimental animals. Decreased AM viability and increased activity of lysosomal enzyme cathepsin D in BAL cells after fungal exometabolite exposure were the most impressive. As toxic principles were found predominantly in the growth medium, toxins were more likely responsible for lung cell damage than e.g. fungal cell wall components. S. chartarum toxic metabolites can contribute to the ill health of occupants of mouldy building after inhalation of contaminated aerosol.

  5. FACTORS RELATING TO THE RELEASE OF STACHYBOTRYS CHARTARUM SPORES FROM CONTAMINATED SOURCES

    EPA Science Inventory

    The paper describes preliminary results of a research project to determine the factors that control the release of S. chartarum spores from a contaminated source and test ways to reduce spore release and thus exposure. As anticipated, S. chartarum spore emissions from gypsum boar...

  6. GROWTH RESPONSE OF STACHYBOTRYS CHARTARUM TO MOISTURE VARIATION ON COMMON BUILDING MATERIALS

    EPA Science Inventory

    The mold Stachybotrys chartarum has been found to be associated with idiopathic pulmonary hemorrhage in infants and has been studied for toxin production and its occurrence in water damaged buildings. Growth of S. chartarum on building materials such as drywall has been frequentl...

  7. ELISA MEASUREMENT OF STACHYLYSIN IN SERUM TO QUANTIFY HUMAN EXPOSURES TO THE INDOOR MOLD STACHYBOTRYS CHARTARUM

    EPA Science Inventory

    Problem- To develop a measurable indicator of human exposure to Stachybotys chartarum.

    Methods- Antibodies were produced against the hemolytic agent stachylysin obtained from the mold S. chartarum. These antibodies were used to develop two enzyme-linked immunosorbent ass...

  8. AN EXTRACT OF STACHYBOTRYS CHARTARUM CAUSES ALLERGIC RESPONSE IN A BALB/C MOUSE MODEL

    EPA Science Inventory

    ABSTRACT
    Environmental exposure to Stachybotrys chartarum has been associated with adverse health effects in humans. The goal of this study was to assess soluble components of this fungus for allergenic potential. Five isolates of S. chartarum were combined and extracted to fo...

  9. Isolation and Properties of Stachyrase A, a Chymotrypsin-Like Serine Proteinase from Stachybotrys chartarum

    PubMed Central

    Kordula, Tomasz; Banbula, Agnieszka; Macomson, Jeremy; Travis, James

    2002-01-01

    A strain of the common mold Stachybotrys chartarum has been isolated from the lung of a child with pulmonary hemorrhage. We report the purification of stachyrase A, a new serine chymotrypsin-like proteinase from S. chartarum. This enzyme cleaves major protease inhibitors, several biologically active peptides, and collagen, all of which are found in the lung. PMID:11748212

  10. FACTORS RELATING TO THE RELEASE OF STACHYBOTRYS CHARTARUM SPORES FROM CONTAMINATED SOURCES

    EPA Science Inventory

    The paper describes preliminary results of a research project to determine the factors that control the release of S. chartarum spores from a contaminated source and test ways to reduce spore release and thus exposure. As anticipated, S. chartarum spore emissions from gypsum boar...

  11. ELISA MEASUREMENT OF STACHYLYSIN IN SERUM TO QUANTIFY HUMAN EXPOSURES TO THE INDOOR MOLD STACHYBOTRYS CHARTARUM

    EPA Science Inventory

    Problem- To develop a measurable indicator of human exposure to Stachybotys chartarum.

    Methods- Antibodies were produced against the hemolytic agent stachylysin obtained from the mold S. chartarum. These antibodies were used to develop two enzyme-linked immunosorbent ass...

  12. GROWTH RESPONSE OF STACHYBOTRYS CHARTARUM TO MOISTURE VARIATION ON COMMON BUILDING MATERIALS

    EPA Science Inventory

    The mold Stachybotrys chartarum has been found to be associated with idiopathic pulmonary hemorrhage in infants and has been studied for toxin production and its occurrence in water damaged buildings. Growth of S. chartarum on building materials such as drywall has been frequentl...

  13. GERMINATION, VIABILITY AND CLEARANCE OF STACHYBOTRYS CHARTARUM IN THE LUNGS OF INFANT RATS

    EPA Science Inventory

    The fungus Stachybotrys chartarum has been associated with many adverse health effects including the condition known as idiopathic pulmonary hemorrhage in infants. In order to gain some insight into possible mechanisms, viable conidia of S. chartarum were instilled into the lung...

  14. GERMINATION, VIABILITY AND CLEARANCE OF STACHYBOTRYS CHARTARUM IN THE LUNGS OF INFANT RATS

    EPA Science Inventory

    The fungus Stachybotrys chartarum has been associated with many adverse health effects including the condition known as idiopathic pulmonary hemorrhage in infants. In order to gain some insight into possible mechanisms, viable conidia of S. chartarum were instilled into the lung...

  15. AN EXTRACT OF STACHYBOTRYS CHARTARUM CAUSES ALLERGIC RESPONSE IN A BALB/C MOUSE MODEL

    EPA Science Inventory

    ABSTRACT
    Environmental exposure to Stachybotrys chartarum has been associated with adverse health effects in humans. The goal of this study was to assess soluble components of this fungus for allergenic potential. Five isolates of S. chartarum were combined and extracted to fo...

  16. PERFLUORINATED COMPOUNDS: EMERGING POPs WITH POTENTIAL IMMUNOTOXICITY

    PubMed Central

    Corsini, Emanuela; Luebke, Robert W.; Germolec, Dori R.; DeWitt, Jamie C.

    2015-01-01

    Perfluorinated compounds (PFCs) have been recognized as an important class of environmental contaminants commonly detected in blood samples of both wildlife and humans. These compounds have been in use for more than 60 years as surface treatment chemicals, polymerization aids, and surfactants. They possess a strong carbon-fluorine bond, which leads to their environmental persistence. There is evidence from both epidemiology and laboratory studies that PFCs may be immunotoxic, affecting both cell-mediated and humoral immunity. Reported effects of PFCs include decreased spleen and thymus weights and cellularity, reduced antibody production, reduced survival after influenza infection, and altered cytokine production. Immunosuppression is a critical effect associated with exposure to PFCs, as it has been reported to reduce antibody responses to vaccination in children. Mounting evidence suggests that immunotoxicity in experimental animals can occur at serum concentrations below, within, or just above the reported range for highly exposed humans and wildlife. Considering bioaccumulation and exposure to multiple PFCs, the risk of immunotoxicity for humans and wildlife cannot be discounted. This review will discuss current and recently published work exploring the immunomodulatory effects of PFCs in experimental animals and humans. PMID:24503008

  17. Perfluorinated compounds: emerging POPs with potential immunotoxicity.

    PubMed

    Corsini, Emanuela; Luebke, Robert W; Germolec, Dori R; DeWitt, Jamie C

    2014-10-15

    Perfluorinated compounds (PFCs) have been recognized as an important class of environmental contaminants commonly detected in blood samples of both wildlife and humans. These compounds have been in use for more than 60 years as surface treatment chemicals, polymerization aids, and surfactants. They possess a strong carbon-fluorine bond, which leads to their environmental persistence. There is evidence from both epidemiology and laboratory studies that PFCs may be immunotoxic, affecting both cell-mediated and humoral immunity. Reported effects of PFCs include decreased spleen and thymus weights and cellularity, reduced specific antibody production, reduced survival after influenza infection, and altered cytokine production. Immunosuppression is a critical effect associated with exposure to PFCs, as it has been reported to reduce antibody responses to vaccination in children. Mounting evidence suggests that immunotoxicity in experimental animals can occur at serum concentrations below, within, or just above the reported range for highly exposed humans and wildlife. Considering bioaccumulation and exposure to multiple PFCs, the risk of immunotoxicity for humans and wildlife cannot be discounted. This review will discuss current and recently published work exploring the immunomodulatory effects of PFCs in experimental animals and humans. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  18. In vitro evaluation of the immunotoxic potential of perfluorinated compounds (PFCs).

    PubMed

    Corsini, Emanuela; Avogadro, Anna; Galbiati, Valentina; dell'Agli, Mario; Marinovich, Marina; Galli, Corrado L; Germolec, Dori R

    2011-01-15

    There is evidence from both epidemiology and laboratory studies that perfluorinated compounds may be immunotoxic, affecting both cell-mediated and humoral immunity. The overall goal of this study was to investigate the mechanisms underlying the immunotoxic effects of perfluorooctane sulfonate (PFOS) and perfluorooctane acid (PFOA), using in vitro assays. The release of the pro-inflammatory cytokines IL-6, IL-8, and TNF-α was evaluated in lipolysaccharide (LPS)-stimulated human peripheral blood leukocytes and in the human promyelocytic cell line THP-1, while the release of IL-4, IL-10 and IFN-γ was evaluated in phytohaemagglutinin (PHA)-stimulated peripheral blood leukocytes. PFOA and PFOS suppressed LPS-induced TNF-α production in primary human cultures and THP-1 cells, while IL-8 was suppressed only in THP-1 cells. IL-6 release was decreased only by PFOS. Both PFOA and PFOS decreased T-cell derived, PHA-induced IL-4 and IL-10 release, while IFN-γ release was affected only by PFOS. In all instances, PFOS was more potent than PFOA. Mechanistic investigations carried out in THP-1 cells demonstrated that the effect on cytokine release was pre-transcriptional, as assessed by a reduction in LPS-induced TNF-α mRNA expression. Using siRNA, a role for PPAR-α could be demonstrated for PFOA-induced immunotoxicity, while an inhibitory effect on LPS-induced I-κB degradation could explain the immunomodulatory effect of PFOS. The dissimilar role of PPAR-α in PFOA and PFOS-induced immunotoxicity was consistent with the differing effects observed on LPS-induced MMP-9 release: PFOA, as the PPAR-α agonist fenofibrate, modulated the release, while PFOS had no effect. Overall, these studies suggest that PFCs directly suppress cytokine secretion by immune cells, and that PFOA and PFOS have different mechanisms of action.

  19. In vitro evaluation of the immunotoxic potential of perfluorinated compounds (PFCs)

    SciTech Connect

    Corsini, Emanuela; Avogadro, Anna; Galbiati, Valentina; Dell'Agli, Mario; Marinovich, Marina; Galli, Corrado L.; Germolec, Dori R.

    2011-01-15

    There is evidence from both epidemiology and laboratory studies that perfluorinated compounds may be immunotoxic, affecting both cell-mediated and humoral immunity. The overall goal of this study was to investigate the mechanisms underlying the immunotoxic effects of perfluorooctane sulfonate (PFOS) and perfluorooctane acid (PFOA), using in vitro assays. The release of the pro-inflammatory cytokines IL-6, IL-8, and TNF-{alpha} was evaluated in lipolysaccharide (LPS)-stimulated human peripheral blood leukocytes and in the human promyelocytic cell line THP-1, while the release of IL-4, IL-10 and IFN-{gamma} was evaluated in phytohaemagglutinin (PHA)-stimulated peripheral blood leukocytes. PFOA and PFOS suppressed LPS-induced TNF-{alpha} production in primary human cultures and THP-1 cells, while IL-8 was suppressed only in THP-1 cells. IL-6 release was decreased only by PFOS. Both PFOA and PFOS decreased T-cell derived, PHA-induced IL-4 and IL-10 release, while IFN-{gamma} release was affected only by PFOS. In all instances, PFOS was more potent than PFOA. Mechanistic investigations carried out in THP-1 cells demonstrated that the effect on cytokine release was pre-transcriptional, as assessed by a reduction in LPS-induced TNF-{alpha} mRNA expression. Using siRNA, a role for PPAR-{alpha} could be demonstrated for PFOA-induced immunotoxicity, while an inhibitory effect on LPS-induced I-{kappa}B degradation could explain the immunomodulatory effect of PFOS. The dissimilar role of PPAR-{alpha} in PFOA and PFOS-induced immunotoxicity was consistent with the differing effects observed on LPS-induced MMP-9 release: PFOA, as the PPAR-{alpha} agonist fenofibrate, modulated the release, while PFOS had no effect. Overall, these studies suggest that PFCs directly suppress cytokine secretion by immune cells, and that PFOA and PFOS have different mechanisms of action.

  20. An in vitro study of the toxic effects of Stachybotrys chartarum metabolites on lung cells.

    PubMed

    Kováciková, Zuzana; Tátrai, Erzsébet; Piecková, Elena; Tulinská, Jana; Pivovarová, Zuzana; Matausic-Pisl, Mirjana; Kuricová, Miroslava; Wsolová, Ladislava

    2007-03-01

    During a study of indoor fungal colonisation, several isolates of Stachybotrys chartarum were recovered, and the effects of metabolites from four isolates on lung epithelial Type II cells and alveolar macrophages were studied in vitro. All the isolates showed toxic effects on both cell types, and they differed only in the extent of the changes induced. In Type II cells, the number of alkaline phosphatase positive cells was reduced, the pattern of Maclura pomifera agglutinin (MPA) binding was changed, and acid phosphatase activity in alveolar macrophages was diminished. In both cell types, the production of monocyte chemotactic protein-1 (MCP-1) and tumour necrosis factor-alpha (TNF-alpha) was changed, and parameters related to antioxidant status (superoxide dismutase, glutathione peroxidase, glutathione) were decreased.

  1. Immunotoxic effects of gold and silver nanoparticles: Inhibition of mitogen-induced proliferative responses and viability of human and murine lymphocytes in vitro.

    PubMed

    Devanabanda, Mallaiah; Latheef, Shaik Abdul; Madduri, Ramanadham

    2016-11-01

    Understanding the effects of nanoparticles (NP) on immune cell functions is essential in designing safe and effective NP-based in vivo drug delivery systems. The immunomodulatory potential of gold nanoparticles (GNP) and silver nanoparticles (SNP) was investigated in vitro using murine splenic and human peripheral blood lymphocytes (PBL) in terms of effects on viability and mitogen-induced proliferation. Hydrodynamic size and number of NP were characterized using NP tracking analysis (NTA); modal diameters of GNP and SNP were 28 (±1.5) and 66 (± 2.7) nm, respectively, with a unimodal distribution. Lymphocytes were incubated with GNP or SNP in the presence/absence of B- or T-cell mitogens and proliferative responses then determined using [(3)H]-thymidine incorporation. Concanavalin A (T-cell-specific) and lipopolysaccharide- (B-cell-specific) stimulated responses of murine splenic lymphocytes, as well as phytohemagglutinin (T-cell-specific) and pokeweed mitogen- (B-and T-cell specific) induced responses of human lymphocytes, were significantly inhibited by GNP (25-200 μg/ml) and SNP (12.5-50 μg/ml). However, [(3)H]-thymidine incorporation by unstimulated lymphocytes was unaffected in the presence of GNP or SNP. Viability of lymphocytes was determined using trypan blue dye exclusion and was significantly inhibited only at 200 μg GNP/ml and 25 or 50 μg SNP/ml. As mitogen responses are most useful to provide supportive mechanistic information on primary immunotoxicologic functional observations, and so far more comprehensive data (in vivo and in vitro) is still needed, the results nevertheless suggest to us that GNP and SNP might potentially be able to modulate immune responses by impacting on lymphocyte activation.

  2. Comparison of two guidelines on immunotoxicity testing of medicinal products.

    PubMed

    Dujmović, Ivana Hanzl

    2005-09-01

    Despite the lack of formal immunotoxicity testing guidelines, the assessment of immune function has been a routine component of toxicity testing for over twenty years. The European Agency for the Evaluation of Medicinal Products (EMEA) and The US Food and Drug Administration (FDA) have recently adopted new guidelines for immunotoxicity testing of new medicinal products. These two guidelines are compared in this article.

  3. Immunotoxic Effect of Low-Dose Methylmercury Is Negligible in Mouse Models of Ovalbumin or Mite-Induced Th2 Allergy.

    PubMed

    Nakamura, Ryosuke; Takanezawa, Yasukazu; Sone, Yuka; Uraguchi, Shimpei; Sakabe, Kou; Kiyono, Masako

    2016-01-01

    Methylmercury (MeHg) is one of the most toxic environmental pollutants and presents a serious hazard to health worldwide. Although the adverse effects of MeHg, including neurotoxicity, have been studied, its effects on immune function, in particular the immune response, remain unclear. This study examined the effects of low-dose MeHg on immune responses in mice. Mice were orally immunized with ovalbumin (OVA) or subcutaneously injected with mite extract to induce a T-helper 2 (Th2) allergic response. They were then exposed to MeHg (0, 0.02, 1.0, or 5.0 mg·kg(-1)·d(-1)). Immunization with oral OVA or subcutaneous mite extract increased serum levels of OVA-specific immunoglobulin (Ig) E (OVA-IgE), OVA-IgG1, interleukin (IL)-4, and IL-13, and total IgE, total IgG, and IL-13 when compared with levels in non-immunized mice. However, no interferon (IFN)-γ was detected. By contrast, serum levels of OVA-IgE, OVA-IgG1, IL-4, and IL-13, or total IgE, total IgG, and IL-13 in Th2 allergy model mice subsequently treated with MeHg were no higher than those in MeHg-untreated mice. These results suggest that MeHg exposure has no adverse effects on Th2 immune responses in antigen-immunized mice.

  4. Immunotoxicity of mercury: Pathological and toxicological effects.

    PubMed

    Maqbool, Faheem; Niaz, Kamal; Hassan, Fatima Ismail; Khan, Fazlullah; Abdollahi, Mohammad

    2017-01-02

    Mercury (Hg) is toxic and hazardous metal that causes natural disasters in the earth's crust. Exposure to Hg occurs via various routes; like oral (fish), inhalation, dental amalgams, and skin from cosmetics. In this review, we have discussed the sources of Hg and its potential for causing toxicity in humans. In addition, we also review its bio-chemical cycling in the environment; its systemic, immunotoxic, genotoxic/carcinogenic, and teratogenic health effects; and the dietary influences; as well as the important considerations in risk assessment and management of Hg poisoning have been discussed in detail. Many harmful outcomes have been reported, which will provide more awareness.

  5. Indoor Mold, Toxigenic Fungi, and Stachybotrys chartarum: Infectious Disease Perspective

    PubMed Central

    Kuhn, D. M.; Ghannoum, M. A.

    2003-01-01

    Damp buildings often have a moldy smell or obvious mold growth; some molds are human pathogens. This has caused concern regarding health effects of moldy indoor environments and has resulted in many studies of moisture- and mold-damaged buildings. Recently, there have been reports of severe illness as a result of indoor mold exposure, particularly due to Stachybotrys chartarum. While many authors describe a direct relationship between fungal contamination and illness, close examination of the literature reveals a confusing picture. Here, we review the evidence regarding indoor mold exposure and mycotoxicosis, with an emphasis on S. chartarum. We also examine possible end-organ effects, including pulmonary, immunologic, neurologic, and oncologic disorders. We discuss the Cleveland infant idiopathic pulmonary hemorrhage reports in detail, since they provided important impetus for concerns about Stachybotrys. Some valid concerns exist regarding the relationship between indoor mold exposure and human disease. Review of the literature reveals certain fungus-disease associations in humans, including ergotism (Claviceps species), alimentary toxic aleukia (Fusarium), and liver disease (Aspergillys). While many papers suggest a similar relationship between Stachybotrys and human disease, the studies nearly uniformly suffer from significant methodological flaws, making their findings inconclusive. As a result, we have not found well-substantiated supportive evidence of serious illness due to Stachybotrys exposure in the contemporary environment. To address issues of indoor mold-related illness, there is an urgent need for studies using objective markers of illness, relevant animal models, proper epidemiologic techniques, and examination of confounding factors. PMID:12525430

  6. Indoor mold, toxigenic fungi, and Stachybotrys chartarum: infectious disease perspective.

    PubMed

    Kuhn, D M; Ghannoum, M A

    2003-01-01

    Damp buildings often have a moldy smell or obvious mold growth; some molds are human pathogens. This has caused concern regarding health effects of moldy indoor environments and has resulted in many studies of moisture- and mold-damaged buildings. Recently, there have been reports of severe illness as a result of indoor mold exposure, particularly due to Stachybotrys chartarum. While many authors describe a direct relationship between fungal contamination and illness, close examination of the literature reveals a confusing picture. Here, we review the evidence regarding indoor mold exposure and mycotoxicosis, with an emphasis on S. chartarum. We also examine possible end-organ effects, including pulmonary, immunologic, neurologic, and oncologic disorders. We discuss the Cleveland infant idiopathic pulmonary hemorrhage reports in detail, since they provided important impetus for concerns about Stachybotrys. Some valid concerns exist regarding the relationship between indoor mold exposure and human disease. Review of the literature reveals certain fungus-disease associations in humans, including ergotism (Claviceps species), alimentary toxic aleukia (Fusarium), and liver disease (Aspergillys). While many papers suggest a similar relationship between Stachybotrys and human disease, the studies nearly uniformly suffer from significant methodological flaws, making their findings inconclusive. As a result, we have not found well-substantiated supportive evidence of serious illness due to Stachybotrys exposure in the contemporary environment. To address issues of indoor mold-related illness, there is an urgent need for studies using objective markers of illness, relevant animal models, proper epidemiologic techniques, and examination of confounding factors.

  7. Multigene phylogeny reveals new lineage for Stachybotrys chartarum, the indoor air fungus.

    PubMed

    Castlebury, Lisa A; Rossman, Amy Y; Sung, Gi-Ho; Hyten, Aimee S; Spatafora, Joseph W

    2004-08-01

    Stachybotrys chartarum is an asexually reproducing fungus commonly isolated from soil and litter that is also known to occur in indoor environments and is implicated as the cause of serious illness and even death in humans. Despite its economic importance, higher level phylogenetic relationships of Stachybotrys have not been determined nor has a sexual state for S. chartarum been reported. DNA sequences from four nuclear and one mitochondrial gene were analyzed to determine the ordinal and familial placement of Stachybotrys within the Euascomycota. These data reveal that species of Stachybotrys including S. chartarum, S. albipes, for which the sexual state Melanopsamma pomiformis is reported, species of Myrothecium, and two other tropical hypocrealean species form a previously unknown monophyletic lineage within the Hypocreales. These results suggest that Stachybotrys and Myrothecium are closely related and share characteristics with other hypocrealean fungi. In addition, S. chartarum may have a sexual state in nature that consists of small, black, fleshy perithecia similar to Melanopsamma.

  8. Study on the impact of lead acetate pollutant on immunotoxicity produced by thiamethoxam pesticide.

    PubMed

    Sinha, Suprita; Thaker, A M

    2014-01-01

    The curtailed knowledge about neonicotinoids that it has low affinity for vertebrate relative to insect nicotinic receptors is a major factor for its widespread use assuming that it is much safer than the previous generation insecticides. But literature regarding effect of thiamethoxam (second generation neonicotinoid)on immune system is not available. Also, there might be chances of interaction of heavy persistent metals in the water table with these pesticides. So, this study was undertaken with the objective to find immunotoxic alterations of lead acetate after exposure with thiamethoxam in animal model. For this albino mice were randomly divided into 6 groups (numbered I to VI) each containing 6 mice. Animals of groups I and II were administered 87.1 mg/kg b.w.(body weight) and 43.5 mg/kg b.w. respectively of thiamethoxam. Group III animals, lead acetate was administered orally and IV and V mice were administered combination of lead acetate and thiamethoxam at higher and lower dose level for 28 days. The group VI was control group. On 29(th) day and humoral and cell mediated immune responses, TLC (Total leukocyte count), DLC (Differential leukocyte count), serum total protein, globulin and albumin, and histopathological studies were conducted. The result obtained clearly indicated that on oral administration of thiamethoxam immunotoxicity was induced in mice in dose related manner. Lead acetate when administered for 28 days showed immunotoxic potential. Thiamethoxam and lead acetate when administered together did not lead to any new altered immunotoxic response but additive toxic effects of both were observed.

  9. Study on the impact of lead acetate pollutant on immunotoxicity produced by thiamethoxam pesticide

    PubMed Central

    Sinha, Suprita; Thaker, A. M.

    2014-01-01

    Objective: The curtailed knowledge about neonicotinoids that it has low affinity for vertebrate relative to insect nicotinic receptors is a major factor for its widespread use assuming that it is much safer than the previous generation insecticides. But literature regarding effect of thiamethoxam (second generation neonicotinoid)on immune system is not available. Also, there might be chances of interaction of heavy persistent metals in the water table with these pesticides. So, this study was undertaken with the objective to find immunotoxic alterations of lead acetate after exposure with thiamethoxam in animal model. Materials and Methods: For this albino mice were randomly divided into 6 groups (numbered I to VI) each containing 6 mice. Animals of groups I and II were administered 87.1 mg/kg b.w.(body weight) and 43.5 mg/kg b.w. respectively of thiamethoxam. Group III animals, lead acetate was administered orally and IV and V mice were administered combination of lead acetate and thiamethoxam at higher and lower dose level for 28 days. The group VI was control group. On 29th day and humoral and cell mediated immune responses, TLC (Total leukocyte count), DLC (Differential leukocyte count), serum total protein, globulin and albumin, and histopathological studies were conducted. Result: The result obtained clearly indicated that on oral administration of thiamethoxam immunotoxicity was induced in mice in dose related manner. Lead acetate when administered for 28 days showed immunotoxic potential. Thiamethoxam and lead acetate when administered together did not lead to any new altered immunotoxic response but additive toxic effects of both were observed. PMID:25538329

  10. Method for detection of Stachybotrys chartarum in pure culture and field samples using quantitative polymerase chain reaction

    DOEpatents

    Cruz-Perez, Patricia; Buttner, Mark P.

    2004-05-11

    A method for detecting the fungus Stachybotrys chartarum includes isolating DNA from a sample suspected of containing the fungus Stachybotrys chartarum. The method further includes subjecting the DNA to polymerase chain reaction amplification utilizing at least one of several primers, the several primers each including one of the base sequences 5'GTTGCTTCGGCGGGAAC3', 5'TTTGCGTTTGCCACTCAGAG3', 5'ACCTATCGTTGCTTCGGCG3', and 5'GCGTTTGCCACTCAGAGAATACT3'. The method additionally includes detecting the fungus Stachybotrys chartarum by visualizing the product of the polymerase chain reaction.

  11. Pulmonary Responses to Stachybotrys chartarum and Its Toxins: Mouse Strain Affects Clearance and Macrophage Cytotoxicity

    PubMed Central

    Lichtenstein, Jamie H. Rosenblum; Molina, Ramon M.; Donaghey, Thomas C.; Amuzie, Chidozie J.; Pestka, James J.; Coull, Brent A.; Brain, Joseph D.

    2010-01-01

    We investigated differences in the pulmonary and systemic clearance of Stachybotrys chartarum spores in two strains of mice, BALB/c and C57BL/6J. To evaluate clearance, mice were intratracheally instilled with a suspension of radiolabeled S. chartarum spores or with unlabeled spores. The lungs of C57BL/6J mice showed more rapid spore clearance than the lungs of BALB/c mice, which correlated with increased levels of spore-associated radioactivity in the GI tracts of C57BL/6J as compared with BALB/c mice. To identify mechanisms responsible for mouse strain differences in spore clearance and previously described lung inflammatory responses, we exposed alveolar macrophages (AMs) lavaged from BALB/c and C57BL/6J mice to S. chartarum spores, S. chartarum spore toxin (SST), and satratoxin G (SG) in vitro. The S. chartarum spores were found to be highly toxic with most cells from either mouse strain being killed within 24 h when exposed to a spore:cell ratio of 1:75. The spores were more lethal to AMs from C57BL/6J than those from BALB/c mice. In mice, the SST elicited many of the same inflammatory responses as the spores in vivo, including AM recruitment, pulmonary hemorrhage, and cytokine production. Our data suggest that differences in pulmonary spore clearance may contribute to the differences in pulmonary responses to S. chartarum between BALB/c and C57BL/6J mice. Enhanced AM survival and subsequent macrophage-mediated inflammation may also contribute to the higher susceptibility of BALB/c mice to S. chartarum pulmonary effects. Analogous genetic differences among humans may contribute to reported variable sensitivity to S. chartarum. PMID:20385656

  12. Pulmonary responses to Stachybotrys chartarum and its toxins: mouse strain affects clearance and macrophage cytotoxicity.

    PubMed

    Lichtenstein, Jamie H Rosenblum; Molina, Ramon M; Donaghey, Thomas C; Amuzie, Chidozie J; Pestka, James J; Coull, Brent A; Brain, Joseph D

    2010-07-01

    We investigated differences in the pulmonary and systemic clearance of Stachybotrys chartarum spores in two strains of mice, BALB/c and C57BL/6J. To evaluate clearance, mice were intratracheally instilled with a suspension of radiolabeled S. chartarum spores or with unlabeled spores. The lungs of C57BL/6J mice showed more rapid spore clearance than the lungs of BALB/c mice, which correlated with increased levels of spore-associated radioactivity in the GI tracts of C57BL/6J as compared with BALB/c mice. To identify mechanisms responsible for mouse strain differences in spore clearance and previously described lung inflammatory responses, we exposed alveolar macrophages (AMs) lavaged from BALB/c and C57BL/6J mice to S. chartarum spores, S. chartarum spore toxin (SST), and satratoxin G (SG) in vitro. The S. chartarum spores were found to be highly toxic with most cells from either mouse strain being killed within 24 h when exposed to a spore:cell ratio of 1:75. The spores were more lethal to AMs from C57BL/6J than those from BALB/c mice. In mice, the SST elicited many of the same inflammatory responses as the spores in vivo, including AM recruitment, pulmonary hemorrhage, and cytokine production. Our data suggest that differences in pulmonary spore clearance may contribute to the differences in pulmonary responses to S. chartarum between BALB/c and C57BL/6J mice. Enhanced AM survival and subsequent macrophage-mediated inflammation may also contribute to the higher susceptibility of BALB/c mice to S. chartarum pulmonary effects. Analogous genetic differences among humans may contribute to reported variable sensitivity to S. chartarum.

  13. IMMUNOTOXICITY OF INDIVIDUAL ORGANOTIN COMPOUNDS IN SPRAGUE-DAWLEY RATS

    EPA Science Inventory

    Organotins, used as stabilizers for polyvinyl chloride pipe, leach into drinking water from supply pipes and may cause multisystem toxicity, including immunotoxicity. We assessed immune function in Sprague-Dawley rats exposed to dibutyltin dichloride (DBTC) or dimethyltin dichlor...

  14. IMMUNOTOXICITY OF INDIVIDUAL ORGANOTIN COMPOUNDS IN SPRAGUE-DAWLEY RATS

    EPA Science Inventory

    Organotins, used as stabilizers for polyvinyl chloride pipe, leach into drinking water from supply pipes and may cause multisystem toxicity, including immunotoxicity. We assessed immune function in Sprague-Dawley rats exposed to dibutyltin dichloride (DBTC) or dimethyltin dichlor...

  15. Partial amino acid sequence of a cellulase-like component with IgE-binding properties from Stachybotrys chartarum.

    PubMed

    Kärkkäinen, Marja; Raunio, Päivi; Rautiainen, Jaakko; Auriola, Seppo; Hinke, Kaj; Pasanen, Anna-Liisa

    2004-02-01

    The aim of this study was to characterize the amino acid sequence of a selected Stachybotrys chartarum component and to investigate human IgE reactivity against components of S. chartarum and nine other fungal species. Human IgE reactivity against S. chartarum and nine other fungal extracts was investigated by the immunoblotting method. For automated amino acid sequencing analyses, the S. chartarum extract was purified by ion exchange chromatography prior to in-gel alkylation and digestion with modified trypsin. Human IgE reactivity was detected against eight components in the S. chartarum extract. Over 80% of the sera from the exposed subjects and less than 50% of the control sera recognized the 33-, 48- and 50-kD S. chartarum components. The human sera detected a 48- to 50-kD component from the extracts of eight fungal species. Nineteen peptide sequences were identified from the 48-kD component of S. chartarum. An analysis of the peptide sequences revealed homology with known fungal glycoside hydrolase enzymes (cellulases). The data showed human IgE reactivity against several S. chartarum components, including one at 48 kD. On the other hand, the human sera recognized 48- to 50-kD components from seven other fungal species, suggesting shared antigenic components (e.g. enolase) between the fungi. Thus, to our knowledge, this is the first antigen identified from S. chartarum. Copyright 2004 S. Karger AG, Basel

  16. In vivo immunotoxicity evaluation of Gd2O3 nanoprobes prepared by laser ablation in liquid for MRI preclinical applications

    NASA Astrophysics Data System (ADS)

    Tian, Xiumei; Guan, Xiaoying; Luo, Ningqi; Yang, Fanwen; Chen, Dihu; Peng, Ye; Zhu, Jixiang; He, Fupo; Li, Li; Chen, Xiaoming

    2014-09-01

    Gd2O3 nanoprobes prepared by laser ablation in liquid can be used as magnetic resonance imaging contrast agent. However, their immunotoxicity in vivo remains unknown. In this article, the in vitro biocompatibility of the Gd2O3 nanoprobe was evaluated in terms of cell uptake, cell viability, and apoptosis. In vivo immunotoxicity was detected by monitoring the levels of the immunity mediator, cluster of differentiation (CD) markers in Balb/c mice. The results show that no in vitro cytotoxicity was observed, and no significant changes in the expression levels of CD206 and CD69 between the nanoprobe-injected group and the Gd-DTPA group in mice were observed. Importantly, the immunotoxicity data revealed significant differences in the expression levels of CD40, CD80, CD11b, and reactive oxygen species. In addition, transmission electron microscopy images showed that few Gd2O3 nanoprobes were localized in phagosomes by the endocytic pathway. In conclusion, the toxic effects of our Gd2O3 nanoprobe may be due to endocytosis during which the microstructure or ultrastructure of cells is slightly damaged and induces the generation of an oxidative stress reaction that further stimulates the innate immune response. Therefore, it is important to use a sensitive assay for the in vivo immunotoxicity measurements to evaluate the risk assessment of Gd2O3-based biomaterials at the molecular level.

  17. The immunotoxic effects of dual exposure to PCP and TCDD.

    PubMed

    Chen, Hsiu-Min; Lee, Yu-Hsuan; Chen, Rong-Jane; Chiu, Hui-Wen; Wang, Bour-Jr; Wang, Ying-Jan

    2013-11-25

    Pentachlorophenol (PCP) was a commonly used fungicide, herbicide, insecticide, and bactericide in industrial, agricultural, and domestic settings; however, it was also contaminated with polychlorinated dibenzo-p-dioxins (PCDDs) and polychlorinated dibenzofurans (PCDFs). It has been reported that technical grade PCP had immunosuppressive effects and that the immune system was the major target of PCDD/PCDFs toxicity. Although the immune response after exposure to PCP or 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) has been studied, the toxic effects of exposure to both PCP and TCDD have not yet been reported. The aim of this study was to evaluate the effects on immune cells from mice intraperitoneally immunized with OVA and subsequently treated with PCP or TCDD alone or in combination by gavage. The animals were terminated on day 7 and 14, and the spleen and plasma samples were collected for immunotoxicity evaluation. The numbers and populations of splenocytes, T cell-derived cytokines produced by splenocytes, splenocyte-generated cytotoxicity and OVA-specific antibodies in plasma were investigated. Our results indicate that the spleen/body weight ratio and splenocyte number was reduced by TCDD alone; in addition, this reduction was enhanced when TCDD was combined with PCP. Exposure to TCDD alone or in conjunction with PCP suppressed many ovalbumin (OVA)-stimulated cytokines, including IL-2, IFN-γ, IL-4, IL-5, and IL-10. Furthermore, the immunoglobulins IgG and IgM were suppressed in mice administered by PCP alone, but the suppressive effects were greater in mice treated with TCDD alone or in combination with PCP. Co-exposure to PCP and TCDD resulted in an antagonistic effect on TCDD-induced suppression of IFN-γ and IL-10. Our results demonstrate that PCP alone is immunotoxic, regardless of the presence of TCDD. PCP led to mild changes in cytokine secretion, and it compromised splenocyte-generated cytotoxicity and IgM and IgG antibody production on day 7. The finding

  18. Initial Characterization of the Hemolysin Stachylysin from Stachybotrys chartarum

    PubMed Central

    Vesper, Stephen J.; Magnuson, Matthew L.; Dearborn, Dorr G.; Yike, Iwona; Haugland, Richard A.

    2001-01-01

    Stachybotrys chartarum is a toxigenic fungus that has been associated with human health concerns, including pulmonary hemorrhage and hemosiderosis. This fungus produces a hemolysin, stachylysin, which in its apparent monomeric form has a molecular mass of 11,920 Da as determined by matrix-assisted laser desorption ionization–time of flight mass spectrometry. However, it appears to form polydispersed aggregates, which confounds understanding of the actual hemolytically active form. Exhaustive dialysis or heat treatment at 60°C for 30 min inactivated stachylysin. Stachylysin is composed of about 40% nonpolar amino acids and contains two cysteine residues. Purified stachylysin required more than 6 h to begin lysing sheep erythrocytes, but by 48 h, lysis was complete. Stachylysin also formed pores in sheep erythrocyte membranes. PMID:11159985

  19. Identification of putative sequence specific PCR primers for detection of the toxigenic fungal species Stachybotrys chartarum.

    PubMed

    Haugland, R A; Heckman, J L

    1998-12-01

    The nucleotide sequence of a c 936 bp segment of the nuclear rRNA gene operon was determined for the toxigenic fungal species Stachybotrys chartarum and for other species of Stachybotrys and the related genus Memnoniella. This information was used to infer the phylogenetic relationships of these organisms and to search for sequence specific polymerase chain reaction (PCR) primers for S. chartarum in the internal transcribed spacer (ITS) regions. Searches for candidate primers were performed both by computer using the commercially available Oligo(R) v5.0 primer analysis software package and by manual inspection of the aligned sequences. Primers identified in both types of searches were evaluated for their specificities using a priming efficiency analysis algorithm available in the Oligo(R) 5.0 software. The automated computer searches were unsuccessful in finding S. chartarum-specific primers but did identify a group-specific reverse primer (designated as StacR4) for a phylogenetically related cluster of species that included S. chartarum. Manual searches led to the identification of a reverse primer (designated as StacR3) that was predicted to be specific for only S. chartarum and one other species of Stachybotrys. Experimental PCR analyses using these primers in conjunction with a universal forward primer indicated that the computer-generated amplification efficiency predictions were correct in most instances. A notable exception was the finding that StacR3 was specific only for S. chartarum. The relative merits of different PCR strategies for the detection of S. chartarum employing either one or both of the primers identified in this study are discussed.

  20. AN EXTRACT OF STACHYBOTRYS CHARTARUM CAUSES ALLERGIC RESPONSES IN A BALB/C MOUSE MODEL: I. BIOCHEMICAL AND PATHOLOGICAL RESPONSES

    EPA Science Inventory

    Environmental exposure to Stachybotrys chartarum has been associated with adverse health effects in humans. The goal of this study was to assess soluble components of this fungus for allergenic potential. Five isolates of S. chartarum were combined and extracted to form a crude...

  1. AN EXTRACT OF STACHYBOTRYS CHARTARUM CAUSES ALLERGIC RESPONSES IN A BALB/C MOUSE MODEL: I. BIOCHEMICAL AND PATHOLOGICAL RESPONSES

    EPA Science Inventory

    Environmental exposure to Stachybotrys chartarum has been associated with adverse health effects in humans. The goal of this study was to assess soluble components of this fungus for allergenic potential. Five isolates of S. chartarum were combined and extracted to form a crude...

  2. Microbial volatile organic compound emissions from Stachybotrys chartarum growing on gypsum wallboard and ceiling tile

    PubMed Central

    2013-01-01

    Background Stachybotrys chartarum is a filamentous mold frequently identified among the mycobiota of water-damaged building materials. Growth of S. chartarum on suitable substrates and under favorable environmental conditions leads to the production of secondary metabolites such as mycotoxins and microbial volatile organic compounds (MVOCs). The aim of this study was to characterize MVOC emission profiles of seven toxigenic strains of S. chartarum, isolated from water-damaged buildings, in order to identify unique MVOCs generated during growth on gypsum wallboard and ceiling tile coupons. Inoculated coupons were incubated and monitored for emissions and growth using a closed glass environmental growth chamber maintained at a constant room temperature. Gas samples were collected from the headspace for three to four weeks using Tenax TA tubes. Results Most of the MVOCs identified were alcohols, ketones, ethers and esters. The data showed that anisole (methoxybenzene) was emitted from all of the S. chartarum strains tested on both types of substrates. Maximum anisole concentration was detected after seven days of incubation. Conclusions MVOCs are suitable markers for fungal identification because they easily diffuse through weak barriers like wallpaper, and could be used for early detection of mold growth in hidden cavities. This study identifies the production of anisole by seven toxigenic strains of Stachybotrys chartarum within a period of one week of growth on gypsum wallboard and ceiling tiles. These data could provide useful information for the future construction of a robust MVOC library for the early detection of this mold. PMID:24308451

  3. Microbial volatile organic compound emissions from Stachybotrys chartarum growing on gypsum wallboard and ceiling tile.

    PubMed

    Betancourt, Doris A; Krebs, Ken; Moore, Scott A; Martin, Shayna M

    2013-12-05

    Stachybotrys chartarum is a filamentous mold frequently identified among the mycobiota of water-damaged building materials. Growth of S. chartarum on suitable substrates and under favorable environmental conditions leads to the production of secondary metabolites such as mycotoxins and microbial volatile organic compounds (MVOCs). The aim of this study was to characterize MVOC emission profiles of seven toxigenic strains of S. chartarum, isolated from water-damaged buildings, in order to identify unique MVOCs generated during growth on gypsum wallboard and ceiling tile coupons. Inoculated coupons were incubated and monitored for emissions and growth using a closed glass environmental growth chamber maintained at a constant room temperature. Gas samples were collected from the headspace for three to four weeks using Tenax TA tubes. Most of the MVOCs identified were alcohols, ketones, ethers and esters. The data showed that anisole (methoxybenzene) was emitted from all of the S. chartarum strains tested on both types of substrates. Maximum anisole concentration was detected after seven days of incubation. MVOCs are suitable markers for fungal identification because they easily diffuse through weak barriers like wallpaper, and could be used for early detection of mold growth in hidden cavities. This study identifies the production of anisole by seven toxigenic strains of Stachybotrys chartarum within a period of one week of growth on gypsum wallboard and ceiling tiles. These data could provide useful information for the future construction of a robust MVOC library for the early detection of this mold.

  4. The Effect of Spaceflight on Growth of Ulocladium chartarum Colonies on the International Space Station

    PubMed Central

    Gomoiu, Ioana; Chatzitheodoridis, Elias; Vadrucci, Sonia; Walther, Isabelle

    2013-01-01

    The objectives of this 14 days experiment were to investigate the effect of spaceflight on the growth of Ulocladium chartarum, to study the viability of the aerial and submerged mycelium and to put in evidence changes at the cellular level. U. chartarum was chosen for the spaceflight experiment because it is well known to be involved in biodeterioration of organic and inorganic substrates covered with organic deposits and expected to be a possible contaminant in Spaceships. Colonies grown on the International Space Station (ISS) and on Earth were analysed post-flight. This study clearly indicates that U. chartarum is able to grow under spaceflight conditions developing, as a response, a complex colony morphotype never mentioned previously. We observed that spaceflight reduced the rate of growth of aerial mycelium, but stimulated the growth of submerged mycelium and of new microcolonies. In Spaceships and Space Stations U. chartarum and other fungal species could find a favourable environment to grow invasively unnoticed in the depth of surfaces containing very small amount of substrate, posing a risk factor for biodegradation of structural components, as well as a direct threat for crew health. The colony growth cycle of U. chartarum provides a useful eukaryotic system for the study of fungal growth under spaceflight conditions. PMID:23637980

  5. The effect of spaceflight on growth of Ulocladium chartarum colonies on the international space station.

    PubMed

    Gomoiu, Ioana; Chatzitheodoridis, Elias; Vadrucci, Sonia; Walther, Isabelle

    2013-01-01

    The objectives of this 14 days experiment were to investigate the effect of spaceflight on the growth of Ulocladium chartarum, to study the viability of the aerial and submerged mycelium and to put in evidence changes at the cellular level. U. chartarum was chosen for the spaceflight experiment because it is well known to be involved in biodeterioration of organic and inorganic substrates covered with organic deposits and expected to be a possible contaminant in Spaceships. Colonies grown on the International Space Station (ISS) and on Earth were analysed post-flight. This study clearly indicates that U. chartarum is able to grow under spaceflight conditions developing, as a response, a complex colony morphotype never mentioned previously. We observed that spaceflight reduced the rate of growth of aerial mycelium, but stimulated the growth of submerged mycelium and of new microcolonies. In Spaceships and Space Stations U. chartarum and other fungal species could find a favourable environment to grow invasively unnoticed in the depth of surfaces containing very small amount of substrate, posing a risk factor for biodegradation of structural components, as well as a direct threat for crew health. The colony growth cycle of U. chartarum provides a useful eukaryotic system for the study of fungal growth under spaceflight conditions.

  6. Evaluation of Apoptosis in Immunotoxicity Testing

    PubMed Central

    Nagarkatti, Mitzi; Rieder, Sadiye Amcaoglu; Vakharia, Dilip; Nagarkatti, Prakash S.

    2014-01-01

    Immunotoxicity testing is important in determining the toxic effects of chemical substances, medicinal products, airborne pollutants, cosmetics, medical devices, and food additives. The immune system of the host is a direct target of these toxicants, and the adverse effects include serious health complications such as susceptibility to infections, cancer, allergic reactions, and autoimmune diseases. One way to investigate the harmful effects of different chemicals is to study apoptosis in immune cell populations. Apoptosis is defined as the programmed cell death, and in general, this process helps in development and maintains homeostasis. However, in the case of an insult by a toxicant, apoptosis of the immune cells can lead to immunosuppression resulting in the development of cancer and the inability to fight infections. Apoptosis is characterized by cell shrinkage, nuclear condensation, changes in cell membrane and mitochondria, DNA fragmentation into 200 base oligomers, and protein degradation by caspases. Various methods are employed in order to investigate apoptosis. These methods include direct measurement of apoptotic cells with flow cytometry and in situ labeling, as well as RNA, DNA, and protein assays that are indicative of apoptotic molecules. PMID:19967519

  7. Prototheca species and Pithomyces chartarum as Causative Agents of Rhinitis and/or Sinusitis in Horses.

    PubMed

    Schöniger, S; Roschanski, N; Rösler, U; Vidovic, A; Nowak, M; Dietz, O; Wittenbrink, M M; Schoon, H-A

    2016-01-01

    Pyogranulomatous rhinitis associated with an algal infection was diagnosed in a 25-year-old gelding and a 23-year-old mare had necrotizing sinusitis with intralesional algae and pigmented fungi. Algae were identified immunohistochemically in both cases as Prototheca spp. In the gelding, further characterization by polymerase chain reaction and sequencing revealed that the organism was Prototheca zopfii genotype 2. Fungi from the mare were identified as Pithomyces chartarum by molecular analysis. Prototheca species are achlorophyllous algae and P. chartarum represents a dematiaceous fungus; they are saprophytes and facultative pathogens. Prototheca spp. and P. chartarum should be considered as rare respiratory pathogens of horses. Copyright © 2016 Elsevier Ltd. All rights reserved.

  8. Reduction of Pulmonary Toxicity of Stachybotrys chartarum Spores by Methanol Extraction of Mycotoxins

    PubMed Central

    Rao, Carol Y.; Brain, Joseph D.; Burge, Harriet A.

    2000-01-01

    The fungus Stachybotrys chartarum has been implicated in cases of nonspecific indoor air quality complaints in adults and in cases of pulmonary hemorrhaging in infants. The effects that have been described have been attributed to mycotoxins. Previous dose-effect studies focused on exposure to a single mycotoxin in a solvent, a strategy which is unlikely to accurately characterize the effects of inhaled spores. In this study we examined the role of mycotoxins in the pulmonary effects caused by S. chartarum spores and the dose dependency of these effects. S. chartarum spores were extracted in methanol to reduce the mycotoxin content of the spores. Then either untreated (toxin-containing) or methanol-extracted S. chartarum spores were intratracheally instilled into male 10-week-old Charles River-Dawley rats. After 24 h, the lungs were lavaged, and the bronchoalveolar lavage fluid was analyzed to determine differences in lactic dehydrogenase, albumin, hemoglobin, myeloperoxidase, and leukocyte differential counts. Weight change was also monitored. Our data show that methanol extraction dramatically reduced the toxicity of S. chartarum spores. No statistically significant effects were observed in the bronchoalveolar lavage fluids of the animals that were treated with methanol-extracted spores at any dose. Conversely, dose-dependent effects of the toxin-containing spores were observed when we examined the lactic dehydrogenase, albumin, and hemoglobin concentrations, the polymorphonuclear leukocyte counts, and weight loss. Our findings show that a single, intense exposure to toxin-containing S. chartarum spores results in pulmonary inflammation and injury in a dose-dependent manner. Importantly, the effects are related to methanol-soluble toxins in the spores. PMID:10877773

  9. The development of species-specific immunodiagnostics for Stachybotrys chartarum: the role of cross-reactivity.

    PubMed

    Schmechel, Detlef; Simpson, Janet P; Beezhold, Donald; Lewis, Daniel M

    2006-02-20

    Mold contamination and exposure to fungi in indoor environments has been associated with various adverse health effects but little is known about the significance of individual fungal species in the initiation or exacerbation of such effects. Using Stachybotrys chartarum as a model fungus we sought to demonstrate that monoclonal antibodies (mAbs) can provide species-specific diagnostic reagents and also be used to investigate immunological cross-reactivity patterns among fungi. Mice were immunized with S. chartarum spore walls and monoclonal antibodies were screened against 60 fungal species and 24 different isolates of S. chartarum using an indirect ELISA. One species-specific mAb (IgG(1)) reacted only with spore preparations but not mycelium of S. chartarum or propagules of any other fungus. Five cross-reactive mAbs (IgM) documented extensive cross-reactivity among nine related Stachybotrys species and several non-related genera including several species of Cladosporium, Memnoniella, Myrothecium and Trichoderma. We also found that the ELISA reactivity for cross-reactive antigens and different isolates of S. chartarum differed considerably for normalized total amounts of mycelial antigen. We demonstrate that mAbs and immunoassays have the potential to detect S. chartarum species-specifically. The observed reactivity patterns with cross-reactive mAbs suggest that several fungi may share common antigens and that the majority of antigens are expressed by spores and mycelia. The observed cross-reactivity patterns need to be considered for accurate interpretations of environmental and serological analyses.

  10. Assessment of immunotoxicity using precision-cut tissue slices

    PubMed Central

    2013-01-01

    1. When the immune system encounters incoming infectious agents, this generally leads to immunity. The evoked immune response is usually robust, but can be severely perturbed by potentially harmful environmental agents such as chemicals, pharmaceuticals and allergens. 2. Immunosuppression, hypersensitivity and autoimmunity may occur due to changed immune activity. Evaluation of the immunotoxic potency of agents as part of risk assessment is currently established in vivo with animal models and in vitro with cell lines or primary cells. 3. Although in vivo testing is usually the most relevant situation for many agents, more and more in vitro models are being developed for assessment of immunotoxicity. In this context, hypersensitivity and immunosuppression are considered to be a primary focus for developing in vitro methods. Three-dimensional organotypic tissue models are also part of current research in immunotoxicology. 4. In recent years, there has been a revival of interest in organotypic tissue models. In the context of immunotoxicity testing, precision-cut lung slices in particular have been intensively studied. Therefore, this review is very much focused on pulmonary immunotoxicology. Respiratory hypersensitivity and inflammation are further highlighted aspects of this review. Immunotoxicity assessment currently is of limited use in other tissue models, which are therefore described only briefly within this review. PMID:23199366

  11. Immunotoxical evaluation of St. Lawrence beluga whales (Deiphinapterus leucas)

    SciTech Connect

    Guise, S. De; Fournier, M.; Martineau, D.; Beland, P.

    1995-12-31

    An isolated population of beluga whales live in the St. Lawrence estuary. From approximately 5,000 at the beginning of the century, they now number 500 and their number has not increased since the last 10 years. High concentrations of environmental contaminants including organohalogens (mostly PCBs and DDT), as well as heavy metals (mostly mercury and lead) and HAP exposure have been demonstrated in tissues of these animals. A high incidence of diverse and severe lesions including infections with mildly pathogenic bacteria and numerous tumors were found upon examination of carcasses from the same population. An immunotoxicological evaluation of St. Lawrence beluga whales compared to relatively unpolluted Arctic animals was undertaken to study the possibility of a contaminants induced immunosuppression which would explain the diversity and severity of those lesions. As a first step, several assays were developed to evaluate immune functions in beluga whales, and baseline data were established using Arctic animals. In vitro exposure of Arctic beluga lymphocytes to single contaminants present in St. Lawrence beluga blubber were also performed and showed a suppression of proliferation of lymphocytes with concentrations of mercury below those found in liver of adult St. Lawrence animals. Animal models were also developed to evaluate the immunotoxic potential of the mixture of contaminants found in blubber of St. Lawrence belugas. Rats were fed lipids from either St. Lawrence or Arctic belugas or a mixture of the two groups, and immune functions will be evaluated in these animals. Finally, the last step of the study will be to catch belugas in the St. Lawrence, evaluate their immune functions, compare them to those of Arctic animals and relate them to concentrations of the different contaminants measured in their blubber and plasma.

  12. Transcriptome-based functional classifiers for direct immunotoxicity.

    PubMed

    Shao, Jia; Berger, Laura F; Hendriksen, Peter J M; Peijnenburg, Ad A C M; van Loveren, Henk; Volger, Oscar L

    2014-03-01

    Current screening methods for direct immunotoxic chemicals are mainly based on general toxicity studies with rodents. The present study aimed to identify transcriptome-based functional classifiers that can eventually be exploited for the development of in vitro screening assays for direct immunotoxicity. To this end, a toxicogenomics approach was applied in which gene expression changes in human Jurkat lymphoblastic T cells were investigated in response to a wide range of compounds, including direct immunotoxicants, immunosuppressive drugs, and non-immunotoxic control chemicals. On the basis of DNA microarray data previously obtained by the exposure of Jurkat cells to 31 test compounds (Shao et al. in Toxicol Sci 135(2):328-346, 2013), we identified a set of 93 genes, of which 80 were significantly regulated (|numerical ratio| ≥1.62) by at least three compounds and the other 13 genes were significantly regulated by either one single compound or compound class. A total of 28 most differentially regulated genes were selected for qRT-PCR verification using a training set of 44 compounds consisting of the above-mentioned 31 compounds (23 immunotoxic and 8 non-immunotoxic) and 13 additional immunotoxicants. Good correlation between the results of microarray and qRT-PCR (Pearson's correlation, R ≥ 0.69) was found for 27 out of the 28 genes. Redundancy analysis of these 27 potential classifiers led to a final set of 25 genes. To assess the performance of these genes, Jurkat cells were exposed to 20 additional compounds (external verification set) followed by qRT-PCR. The classifier set of 25 genes gave a good performance in the external verification: accuracy 85 %, true positive rate (sensitivity) 88 %, and true negative rate (specificity) 67 %. Furthermore, on the basis of the gene ontology annotation of the 25 classifier genes, the immunotoxicants examined in this study could be categorized into distinct functional subclasses. In conclusion, we have identified and

  13. Immunotoxic effects of chemicals: A matrix for occupational and environmental epidemiological studies.

    PubMed

    Veraldi, Angela; Costantini, Adele Seniori; Bolejack, Vanessa; Miligi, Lucia; Vineis, Paolo; van Loveren, Henk

    2006-12-01

    Many biological and chemical agents have the capacity to alter the way the immune system functions in human and animals. This study evaluates the immunotoxicity of 20 substances used widely in work environments. A systematic literature search on the immunotoxicity of 20 chemicals was performed. The first step was to review literature on immunotoxicity testing and testing schemes adopted for establishing immunotoxicity in humans. The second step consisted of providing a documentation on immunotoxicity of substances that are widely used in work environment, by building tables for each chemical of interest (benzene, trichloroethylene, PAHs, crystalline silica, diesel exhausts, welding fumes, asbestos, styrene, formaldehyde, toluene, vinyl chloride monomer, tetrachloroethylene, chlorophenols, 1,3-butadiene, mineral oils, P-dichlorobenzene, dichloromethane, xylene, 1,1,1-trichloroethane, ethylene oxide). The third step was the classification of substances; an index (strong, intermediate, weak, nil) was assigned on the basis of the evidence of toxicity and type of immunotoxic effects (immunosuppression, autoimmunity, hypersensitivity) on the basis of the immune responses. Finally substances were assigned a score of immunotoxic power. Tables have been produced that include information for the 20 substances of interest, based on 227 animal studies and 94 human studies. Each substance was assigned an index of immunotoxic evidence, a score of immunotoxic power and type of immunotoxic effect. This matrix can represent a tool to identify chemicals with similar properties concerning the toxicity for the immune system, and to interpret epidemiological studies on immune-related diseases.

  14. The relative allergenicity of Stachybotrys chartarum compared to house dust mite extracts in a mouse model

    EPA Science Inventory

    A report by the Institute of Medicine suggested that more research is needed to better understand mold effects on allergic disease, particularly asthma development. The authors compared the ability of the fungus Stachybotrys chartarum (SCE) and house dust mite (HDM) extracts to i...

  15. CHARACTERIZATION OF MICROBIAL VOLATILE ORGANIC COMPOUNDS (MVOC) EMITTED BY STACHYBOTRYS CHARTARUM

    EPA Science Inventory

    Stachybotrys chartarum is a filamentous fungi usually found in water-damaged buildings. Severe illnesses have been reported after indoor exposure to this mold. Toxicity has caused the production of secondary metabolites or mycotoxins, and the emission of by-products, specifically...

  16. The relative allergenicity of Stachybotrys chartarum compared to house dust mite extracts in a mouse model

    EPA Science Inventory

    A report by the Institute of Medicine suggested that more research is needed to better understand mold effects on allergic disease, particularly asthma development. The authors compared the ability of the fungus Stachybotrys chartarum (SCE) and house dust mite (HDM) extracts to i...

  17. IDENTIFICATION OF SEQUENCE SPECIFIC PCR PRIMERS FOR DETECTION OF THE TOXIGENIC FUNGAL SPECIES STACHYBOTRYS CHARTARUM

    EPA Science Inventory

    The nucleotide sequence of a 936 bp segment of the nuclear rRNA gene operon was determined for the toxigenic fungal species Stachybotrys chartarum and for other species of Stachybotrys and the related genus Memnoniella. This information was used to infer the phylogenitic relati...

  18. IDENTIFICATION OF PUTATIVE SEQUENCE SPECIFIC PCR PRIMERS FOR DETECTION OF THE TOXIGENIC FUNGAL SPECIES STACHYBOTRYS CHARTARUM

    EPA Science Inventory

    The nucleotide sequence of a c 936 bp segment of the nuclear rRNA gene operon was determined for the toxigenic fungal species Stachybotrys chartarum and for other species of Stachbotrys and the related genus Memnoniella. This information was used to infer the phylogenetic relatio...

  19. Microbial Volatile Organic Compound Emissions from Stachybotrys chartarum growing on Gypsum Wallboard and Ceiling tile

    EPA Science Inventory

    This study compared seven toxigenic strains of S. chartarum found in water-damaged buildings to characterize the microbial volatile organic compound (MVOC) emissions profile while growing on gypsum wallboard (W) and ceiling tile (C) coupons. The inoculated coupons with their sub...

  20. INITIAL CHARACTERIZATION OF MONOCLONAL ANTIBODIES AGAINST THE FUNGAL HEMOLYSIN STACHYLYSIN FROM STACHYBOTRYS CHARTARUM

    EPA Science Inventory

    Stachybotrys chartarum is known to produce the hemolysin stachylysin and its detection in human serum has been proposed as a biomarker for exposure to the fungus. In this study we report the initial characterization of monoclonal antibodies (mAbs) against stachylysin and the dev...

  1. Microbial Volatile Organic Compound Emissions from Stachybotrys chartarum growing on Gypsum Wallboard and Ceiling tile

    EPA Science Inventory

    This study compared seven toxigenic strains of S. chartarum found in water-damaged buildings to characterize the microbial volatile organic compound (MVOC) emissions profile while growing on gypsum wallboard (W) and ceiling tile (C) coupons. The inoculated coupons with their sub...

  2. IDENTIFICATION OF PUTATIVE SEQUENCE SPECIFIC PCR PRIMERS FOR DETECTION OF THE TOXIGENIC FUNGAL SPECIES STACHYBOTRYS CHARTARUM

    EPA Science Inventory

    The nucleotide sequence of a c 936 bp segment of the nuclear rRNA gene operon was determined for the toxigenic fungal species Stachybotrys chartarum and for other species of Stachbotrys and the related genus Memnoniella. This information was used to infer the phylogenetic relatio...

  3. IDENTIFICATION OF SEQUENCE SPECIFIC PCR PRIMERS FOR DETECTION OF THE TOXIGENIC FUNGAL SPECIES STACHYBOTRYS CHARTARUM

    EPA Science Inventory

    The nucleotide sequence of a 936 bp segment of the nuclear rRNA gene operon was determined for the toxigenic fungal species Stachybotrys chartarum and for other species of Stachybotrys and the related genus Memnoniella. This information was used to infer the phylogenitic relati...

  4. CHARACTERIZATION OF MICROBIAL VOLATILE ORGANIC COMPOUNDS (MVOC) EMITTED BY STACHYBOTRYS CHARTARUM

    EPA Science Inventory

    Stachybotrys chartarum is a filamentous fungi usually found in water-damaged buildings. Severe illnesses have been reported after indoor exposure to this mold. Toxicity has caused the production of secondary metabolites or mycotoxins, and the emission of by-products, specifically...

  5. INITIAL CHARACTERIZATION OF MONOCLONAL ANTIBODIES AGAINST THE FUNGAL HEMOLYSIN STACHYLYSIN FROM STACHYBOTRYS CHARTARUM

    EPA Science Inventory

    Stachybotrys chartarum is known to produce the hemolysin stachylysin and its detection in human serum has been proposed as a biomarker for exposure to the fungus. In this study we report the initial characterization of monoclonal antibodies (mAbs) against stachylysin and the dev...

  6. Identification of a novel fungus, Leptosphaerulina chartarum SJTU59 and characterization of its xylanolytic enzymes.

    PubMed

    Wu, Qiong; Li, Yaqian; Li, Yingying; Gao, Shigang; Wang, Meng; Zhang, Tailong; Chen, Jie

    2013-01-01

    Xylanolytic enzymes are widely used in processing industries, e.g., pulp and paper, food, livestock feeds, and textile. Furthermore, certain xylanotic enzymes have demonstrated the capability to improve the resistance and immunity of plants. Screening of high-yield microbial xylanolytic enzyme producers is significant for improving large-scale cost-effective xylanolytic enzyme production. This study provided new evidence of high-level xylanolytic enzyme production by a novel fungus, designated Leptosphaerulina chartarum SJTU59. Under laboratory conditions, L. chartarum SJTU59 produced xylanolytic enzymes of up to 17.566 U/mL (i.e., 878.307 U/g substrate). The enzyme solution was relatively stable over a wide range of pH (pH 3.0 to pH 9.0) and temperature (40°C to 65°C) while showing high resistance to the majority of metal ions tested. Composition analysis of the hydrolytic products of xylan showed sufficient degradation by xylanolytic enzymes from L. chartarum SJTU59, mainly the monosaccharide xylose, and a small amount of xylobiose were enzymatically produced; whereas in the presence of sufficient xylan substrates, mainly xylooligosaccharides, an emerging prebiotic used in food industry, were produced. In addition, the xylanolytic enzyme preparation from L. chartarum SJTU59 could initiate tissue necrosis and oxidative burst in tobacco leaves, which may be related to enhanced plant defense to adversity and disease. L. chartarum SJTU59 possessed a complex xylanolytic enzyme system, from which two novel endo-β-1,4-xylanases of the glycoside hydrolase (GH) family 10, one novel endo-β-1,4-xylanase of the GH family 11, and one novel β-xylosidase of the GH family 43 were obtained via rapid amplification of complementary DNA ends. Given the high yield and stable properties of xylanolytic enzymes produced by L. chartarum SJTU59, future studies will be conducted to characterize the properties of individual xylanolytic enzymes from L. chartarum SJTU59. xylanolytic

  7. Identification of a Novel Fungus, Leptosphaerulina chartarum SJTU59 and Characterization of Its Xylanolytic Enzymes

    PubMed Central

    Wu, Qiong; Li, Yaqian; Li, Yingying; Gao, Shigang; Wang, Meng; Zhang, Tailong; Chen, Jie

    2013-01-01

    Xylanolytic enzymes are widely used in processing industries, e.g., pulp and paper, food, livestock feeds, and textile. Furthermore, certain xylanotic enzymes have demonstrated the capability to improve the resistance and immunity of plants. Screening of high-yield microbial xylanolytic enzyme producers is significant for improving large-scale cost-effective xylanolytic enzyme production. This study provided new evidence of high-level xylanolytic enzyme production by a novel fungus, designated Leptosphaerulina chartarum SJTU59. Under laboratory conditions, L. chartarum SJTU59 produced xylanolytic enzymes of up to 17.566 U/mL (i.e., 878.307 U/g substrate). The enzyme solution was relatively stable over a wide range of pH (pH 3.0 to pH 9.0) and temperature (40°C to 65°C) while showing high resistance to the majority of metal ions tested. Composition analysis of the hydrolytic products of xylan showed sufficient degradation by xylanolytic enzymes from L. chartarum SJTU59, mainly the monosaccharide xylose, and a small amount of xylobiose were enzymatically produced; whereas in the presence of sufficient xylan substrates, mainly xylooligosaccharides, an emerging prebiotic used in food industry, were produced. In addition, the xylanolytic enzyme preparation from L. chartarum SJTU59 could initiate tissue necrosis and oxidative burst in tobacco leaves, which may be related to enhanced plant defense to adversity and disease. L. chartarum SJTU59 possessed a complex xylanolytic enzyme system, from which two novel endo-β-1,4-xylanases of the glycoside hydrolase (GH) family 10, one novel endo-β-1,4-xylanase of the GH family 11, and one novel β-xylosidase of the GH family 43 were obtained via rapid amplification of complementary DNA ends. Given the high yield and stable properties of xylanolytic enzymes produced by L. chartarum SJTU59, future studies will be conducted to characterize the properties of individual xylanolytic enzymes from L. chartarum SJTU59. xylanolytic

  8. Consecutive evaluation of graphene oxide and reduced graphene oxide nanoplatelets immunotoxicity on monocytes.

    PubMed

    Yan, Junyan; Chen, Liliang; Huang, Chih-Ching; Lung, Shih-Chun Candice; Yang, Lingyan; Wang, Wen-Cheng; Lin, Po-Hsiung; Suo, Guangli; Lin, Chia-Hua

    2017-05-01

    The biocompatibilities of graphene-family nanomaterials (GFNs) should be thoroughly evaluated before their application in drug delivery and anticancer therapy. The present study aimed to consecutively assess the immunotoxicity of graphene oxide nanoplatelets (GONPs) and reduced GONPs (rGONPs) on THP-1 cells, a human acute monocytic leukemia cell line. GONPs induced the expression of antioxidative enzymes and inflammatory factors, whereas rGONPs had substantially higher cellular uptake rate, higher levels of NF-κB expression. These distinct toxic mechanisms were observed because the two nanomaterials differ in their oxidation state, which imparts different affinities for the cell membrane. Because GONPs have a higher cell membrane affinity and higher impact on membrane proteins compared with rGONPs, macrophages (THP-1a) derived from GONPs treated THP-1cells showed a severer effect on phagocytosis. By consecutive evaluation the effects of GONPs and rGONPs on THP-1 and THP-1a, we demonstrated that their surface oxidation states may cause GFNs to behave differently and cause different immunotoxic effects. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. Assessment of Immunotoxicity of Dextran Coated Ferrite Nanoparticles in Albino Mice

    PubMed Central

    Syama, Santhakumar; Gayathri, Viswanathan; Mohanan, Parayanthala Valappil

    2015-01-01

    In this study, dextran coated ferrite nanoparticles (DFNPs) of size <25 nm were synthesized, characterized, and evaluated for cytotoxicity, immunotoxicity, and oxidative stress by in vitro and in vivo methods. Cytotoxicity was performed in vitro using splenocytes with different concentrations of DFNPs. Gene expression of selected cytokines (IL-1, IL-10, and TNF β) secretion by splenocytes was evaluated. Also, 100 mg of DFNPs was injected intraperitoneally to 18 albino mice for immunological stimulations. Six animals each were sacrificed at the end of 7, 14, and 21 days. Spleen was subjected to immunotoxic response and liver was analyzed for antioxidant parameters (lipid peroxidation, reduced glutathione, glutathione peroxidase, superoxide dismutase, and glutathione reductase). The results indicated that DFNPs failed to induce any immunological reactions and no significant alternation in antioxidant defense mechanism. Also, mRNA expression of the cytokines revealed an increase in IL-10 expression and subsequent decreased expression of IL-1 and TNF β. Eventually, DNA sequencing of liver actin gene revealed base alteration in nonconserved regions (10–20 bases) of all the treated groups when compared to control samples. Hence, it can be concluded that the DFNPs were nontoxic at the cellular level and nonimmunotoxic when exposed intraperitoneally to mice. PMID:26576301

  10. Effects of Stachybotrys chartarum (atra) conidia and isolated toxin on lung surfactant production and homeostasis.

    PubMed

    Mason, C D; Rand, T G; Oulton, M; MacDonald, J M; Scott, J E

    1998-01-01

    This study evaluated the effects of Stachybotrys chartarum conidia and a trichothecene, isosatratoxin-F, on choline incorporation into DSPC by fetal rabbit alveolar type II cells and on alveolar surfactant subtypes in mice. Exposure of fetal rabbit type II cells to S. chartarum conidia at concentrations of 10(3) to 10(6) conidia ml(-1) significantly depressed [3H] choline incorporation after 24 h of exposure. Exposure of the rabbit cells to 10(5) to 10(6) conidia ml(-1) also resulted in significantly depressed [3H] choline uptake after 48 h. Additionally, fetal rabbit alveolar type II cells exposed to isosatratoxin-F in concentrations ranging from 10(-9) to 10(-4) M showed a significant reduction in [3H] choline incorporation into DSPC. Alveolar surfactant phospholipid concentrations in the different metabolic subfractions of lung lavage fluid of mice intratracheally exposed to either 50 microl of 10(7) ml(-1) S. chartarum conidia or 50 microl 10(-7) M isosatratoxin-F showed some significant changes at 12, 24, 48, and 72 h post-exposure, compared to the surfactant subfractions of control mice which were either untreated, exposed to saline or to 50 microl of 10(-7) ml(-1) Cladosporium cladosporioides conidia. In both the S. chartarum- and the isosatratoxin-F-treated mice, exposure significantly increased P10, P100, and S100 phospholipid concentrations, while the P60 phospholipid concentrations were depressed. In contrast, C. cladosporioides-treated mice showed only one significant change in subfraction phospholipid concentration: P60 was depressed at 48 h post-exposure. These results reveal that alveolar type II cells are sensitive to exposure to S. chartarum conidia and to isosatratoxin F. Sensitivity is manifest by alterations in the normal metabolic processing of alveolar surfactant. In exposed mice, this effect appears to involve a significant increase in newly secreted surfactant and an accumulation of the used surfactant forms.

  11. Mycotoxin Adducts on Human Serum Albumin: Biomarkers of Exposure to Stachybotrys chartarum

    PubMed Central

    Yike, Iwona; Distler, Anne M.; Ziady, Assem G.; Dearborn, Dorr G.

    2006-01-01

    Objective Despite the growing body of evidence showing adverse health effects from inhalation exposure to the trichothecene-producing mold Stachybotrys chartarum, controversy remains. Currently, there are no reliable assays suitable for clinical diagnosis of exposure. We hypothesized that satratoxin G (SG)–albumin adducts may serve as biomarkers of exposure to this fungus. Design We studied the formation of adducts of SG with serum albumin in vitro using Western blots and mass spectrometry (MS) and searched for similar adducts formed in vivo using human and animal serum. Results Samples of purified human serum albumin that had been incubated with increasing concentrations of SG showed concentration-dependent albumin bands in Western blots developed with anti-SG antibodies. MS analysis found that as many as 10 toxin molecules can be bound in vitro to one albumin molecule. The sequencing of albumin-adduct tryptic peptides and the analysis of pronase/aminopeptidase digests demonstrated that lysyl, cysteinyl, and histidyl residues are involved in the formation of these adducts. Serum samples from three patients with documented exposure to S. chartarum similarly revealed lysine–, cysteine–, and histidine–SG adducts after exhaustive digestion, affinity column enrichment, and MS analysis. These adducts were also found in the sera from rats exposed to the spores of S. chartarum in contrast to control human subjects and control animals. Conclusions These data document the occurrence of SG–albumin adducts in both in vitro experiments and in vivo human and animal exposures to S. chartarum. Relevance to clinical practice SG–amino acid adducts may serve as reliable dosimeter biomarkers for detection of exposure to S. chartarum. PMID:16882529

  12. Mycotoxin adducts on human serum albumin: biomarkers of exposure to Stachybotrys chartarum.

    PubMed

    Yike, Iwona; Distler, Anne M; Ziady, Assem G; Dearborn, Dorr G

    2006-08-01

    Despite the growing body of evidence showing adverse health effects from inhalation exposure to the trichothecene-producing mold Stachybotrys chartarum, controversy remains. Currently, there are no reliable assays suitable for clinical diagnosis of exposure. We hypothesized that satratoxin G (SG) -albumin adducts may serve as biomarkers of exposure to this fungus. We studied the formation of adducts of SG with serum albumin in vitro using Western blots and mass spectrometry (MS) and searched for similar adducts formed in vivo using human and animal serum. Samples of purified human serum albumin that had been incubated with increasing concentrations of SG showed concentration-dependent albumin bands in Western blots developed with anti-SG antibodies. MS analysis found that as many as 10 toxin molecules can be bound in vitro to one albumin molecule. The sequencing of albumin-adduct tryptic peptides and the analysis of pronase/aminopeptidase digests demonstrated that lysyl, cysteinyl, and histidyl residues are involved in the formation of these adducts. Serum samples from three patients with documented exposure to S. chartarum similarly revealed lysine-, cysteine-, and histidine-SG adducts after exhaustive digestion, affinity column enrichment, and MS analysis. These adducts were also found in the sera from rats exposed to the spores of S. chartarum in contrast to control human subjects and control animals. These data document the occurrence of SG-albumin adducts in both in vitro experiments and in vivo human and animal exposures to S. chartarum. SG-amino acid adducts may serve as reliable dosimeter biomarkers for detection of exposure to S. chartarum.

  13. DNA damage and DNA damage responses in THP-1 monocytes after exposure to spores of either Stachybotrys chartarum or Aspergillus versicolor or to T-2 toxin.

    PubMed

    Rakkestad, Kirsten E; Skaar, Ida; Ansteinsson, Vibeke E; Solhaug, Anita; Holme, Jørn A; Pestka, James J; Samuelsen, Jan T; Dahlman, Hans J; Hongslo, Jan K; Becher, Rune

    2010-05-01

    We have characterized cell death in THP-1 cells after exposure to heat-treated spores from satratoxin G-producing Stachybotrys chartarum isolate IBT 9631, atranone-producing S. chartarum isolate IBT 9634, and sterigmatocystin-producing Aspergillus versicolor isolate IBT 3781, as well as the trichothecenes T-2 and satratoxin G. Spores induced cell death within 3-6 h, with Stachybotrys appearing most potent. IBT 9631 induced both apoptosis and necrosis, while IBT 9634 and IBT 3781 induced mostly necrosis. T-2 toxin and satratoxin G caused mainly apoptosis. Comet assay +/- formamidopyrimidine DNA glycosylase showed that only the spore exposures induced early (3h) oxidative DNA damage. Likewise, only the spores increased the formation of reactive oxygen species (ROS), suggesting that spores as particles may induce ROS formation and oxidative DNA damage. Increased Ataxia Telangiectasia Mutated (ATM) phosphorylation, indicating DNA damage, was observed after all exposures. The DNA damage response induced by IBT 9631 as well as satratoxin G was characterized by rapid (15 min) activation of p38 and H2AX. The p38 inhibitor SB 202190 reduced IBT 9631-induced H2AX activation. Both IBT 9631 and T-2 induced activation of Chk2 and H2AX after 3 h. The ATM inhibitor KU 55933, as well as transfection of cells with ATM siRNA, reduced this activation, suggesting a partial role for ATM as upstream activator for Chk2 and H2AX. In conclusion, activation of Chk2 and H2AX correlated with spore- and toxin-induced apoptosis. For IBT 9631 and satratoxin G, additional factors may be involved in triggering apoptosis, most notably p38 activation.

  14. DNA Damage and DNA Damage Responses in THP-1 Monocytes after Exposure to Spores of either Stachybotrys chartarum or Aspergillus versicolor or to T-2 toxin

    PubMed Central

    Rakkestad, Kirsten E.; Skaar, Ida; Ansteinsson, Vibeke E.; Solhaug, Anita; Holme, Jørn A.; Pestka, James J.; Samuelsen, Jan T.; Dahlman, Hans J.; Hongslo, Jan K.; Becher, Rune

    2010-01-01

    We have characterized cell death in THP-1 cells after exposure to heat-treated spores from satratoxin G–producing Stachybotrys chartarum isolate IBT 9631, atranone-producing S. chartarum isolate IBT 9634, and sterigmatocystin-producing Aspergillus versicolor isolate IBT 3781, as well as the trichothecenes T-2 and satratoxin G. Spores induced cell death within 3–6 h, with Stachybotrys appearing most potent. IBT 9631 induced both apoptosis and necrosis, while IBT 9634 and IBT 3781 induced mostly necrosis. T-2 toxin and satratoxin G caused mainly apoptosis. Comet assay ± formamidopyrimidine DNA glycosylase showed that only the spore exposures induced early (3h) oxidative DNA damage. Likewise, only the spores increased the formation of reactive oxygen species (ROS), suggesting that spores as particles may induce ROS formation and oxidative DNA damage. Increased Ataxia Telangiectasia Mutated (ATM) phosphorylation, indicating DNA damage, was observed after all exposures. The DNA damage response induced by IBT 9631 as well as satratoxin G was characterized by rapid (15 min) activation of p38 and H2AX. The p38 inhibitor SB 202190 reduced IBT 9631–induced H2AX activation. Both IBT 9631 and T-2 induced activation of Chk2 and H2AX after 3 h. The ATM inhibitor KU 55933, as well as transfection of cells with ATM siRNA, reduced this activation, suggesting a partial role for ATM as upstream activator for Chk2 and H2AX. In conclusion, activation of Chk2 and H2AX correlated with spore- and toxin-induced apoptosis. For IBT 9631 and satratoxin G, additional factors may be involved in triggering apoptosis, most notably p38 activation. PMID:20150440

  15. DESTRUCTION OF ASPERGILLUS VERSICOLOR, PENICILLIUM CRYSOGENUM, STACHYBOTRYS CHARTARUM, AND CLADOSPORIUM CLADOSPORIDES SPORES USING CHEMICAL OXIDATION TREATMENT PROCESS

    EPA Science Inventory

    The survival of aqueous suspensions of Penicillium chrysogenum, Stachybotrys chartarum, Aspergillus versicolor, and Cladosporium cladosporioides spores was evaluated using various combinations of hydrogen peroxide and iron (II) as catalyst. Spores were suspended in water and trea...

  16. QUANTITATIVE MEASUREMENT OF STACHYBOTRYS CHARTARUM CONIDIA USING REAL TIME DETECTION OF PCR PRODUCTS WITH THE TAQMAN TM FLUOROGENIC PROBE SYSTEM

    EPA Science Inventory

    The occurence of Stachybotrys chartarum in indoor environments has been associated with a number of human health concerns, including fatal pulmonary haemosiderosis in infants. Currently used culture-based and microscopic methods of fungal species identification are poorly suited ...

  17. DESTRUCTION OF ASPERGILLUS VERSICOLOR, PENICILLIUM CRYSOGENUM, STACHYBOTRYS CHARTARUM, AND CLADOSPORIUM CLADOSPORIDES SPORES USING CHEMICAL OXIDATION TREATMENT PROCESS

    EPA Science Inventory

    The survival of aqueous suspensions of Penicillium chrysogenum, Stachybotrys chartarum, Aspergillus versicolor, and Cladosporium cladosporioides spores was evaluated using various combinations of hydrogen peroxide and iron (II) as catalyst. Spores were suspended in water and trea...

  18. Identification and Characterisation of a Novel Protein FIP-sch3 from Stachybotrys chartarum

    PubMed Central

    Li, Shuying; Zhao, Leiming; Xu, Wenyi; Jiang, Zhonghao; Kang, Jun; Wang, Fengzhong; Xin, Fengjiao

    2016-01-01

    In this study, a novel FIP named FIP-sch3 has been identified and characterised. FIP-sch3 was identified in the ascomycete Stachybotrys chartarum, making it the second FIP to be identified outside the order of Basidiomycota. Recombinant FIP-sch3 (rFIP-shc3) was produced in Escherichia coli and purified using GST-affinity magnetic beads. The bioactive characteristics of FIP-sch3 were compared to those of well-known FIPs LZ-8 from Ganoderma lucidum and FIP-fve from Flammulina velutipes, which were produced and purified using the same method. The purified rFIP-sch3 exhibited a broad spectrum of anti-tumour activity in several types of tumour cells but had no cytotoxicity in normal human embryonic kidney 293 cells. Assays that were implemented to study these properties indicated that rFIP-sch3 significantly suppressed cell proliferation, induced apoptosis and inhibited cell migration in human lung adenocarcinoma A549 cells. The anti-tumour effects of rFIP-sch3 in A549 cells were comparable to those of rLZ-8, but they were significantly greater than those of rFIP-fve. Molecular assays that were built on real-time PCR further revealed potential mechanisms related to apoptosis and migration and that underlie phenotypic effects. These results indicate that FIP-shc3 has a unique anti-tumour bioactive profile, as do other FIPs, which provide a foundation for further studies on anti-tumour mechanisms. Importantly, this study also had convenient access to FIP-sch3 with potential human therapeutic applications. PMID:27997578

  19. Identification and Characterisation of a Novel Protein FIP-sch3 from Stachybotrys chartarum.

    PubMed

    Li, Shuying; Zhao, Leiming; Xu, Wenyi; Jiang, Zhonghao; Kang, Jun; Wang, Fengzhong; Xin, Fengjiao

    2016-01-01

    In this study, a novel FIP named FIP-sch3 has been identified and characterised. FIP-sch3 was identified in the ascomycete Stachybotrys chartarum, making it the second FIP to be identified outside the order of Basidiomycota. Recombinant FIP-sch3 (rFIP-shc3) was produced in Escherichia coli and purified using GST-affinity magnetic beads. The bioactive characteristics of FIP-sch3 were compared to those of well-known FIPs LZ-8 from Ganoderma lucidum and FIP-fve from Flammulina velutipes, which were produced and purified using the same method. The purified rFIP-sch3 exhibited a broad spectrum of anti-tumour activity in several types of tumour cells but had no cytotoxicity in normal human embryonic kidney 293 cells. Assays that were implemented to study these properties indicated that rFIP-sch3 significantly suppressed cell proliferation, induced apoptosis and inhibited cell migration in human lung adenocarcinoma A549 cells. The anti-tumour effects of rFIP-sch3 in A549 cells were comparable to those of rLZ-8, but they were significantly greater than those of rFIP-fve. Molecular assays that were built on real-time PCR further revealed potential mechanisms related to apoptosis and migration and that underlie phenotypic effects. These results indicate that FIP-shc3 has a unique anti-tumour bioactive profile, as do other FIPs, which provide a foundation for further studies on anti-tumour mechanisms. Importantly, this study also had convenient access to FIP-sch3 with potential human therapeutic applications.

  20. Current status and burning issues in immunotoxicity testing of drugs

    SciTech Connect

    Laan, Jan Willem van der . E-mail: jan-willem.van.der.laan@rivm.nl; Loveren, Henk van

    2005-09-01

    Besides pathology endpoints, additional immune function endpoints have been included in the Note for Guidance on Repeated Dose Toxicity by the European Union (July 2001), which concern the analysis of antibody responses to a T-cell-dependent antigen. Guidance papers of other regulatory authorities are published as well. The main issue is the need for functional immunotoxicity testing to detect unintended immunosuppression. The International Conference on Harmonization (ICH) has surveyed studies from the files of the pharmaceutical industry to find the proportion of compounds that can be detected by additional immunotoxicity testing. Preliminary analysis shows that 10-15% of the compounds in the survey only react positively to the additional tests. More data are requested from the pharmaceutical industry. The Expert Working Group of the ICH has decided to choose a cause-for-concern approach to immmunotoxicity rather than a routine-screening approach. The causes for concern are to be defined during ICH negotiations.

  1. Immunotoxic effects of prolonged dietary exposure of male rats to 2,3,7,8-tetrachlorodibenzo-p-dioxin.

    PubMed

    Badesha, J S; Maliji, G; Flaks, B

    1995-12-07

    The effects of low level exposure of rats to 2,3,7,8-tetrachlorodibenzo-p- dioxin (TCDD) on their immune system was investigated Dietary administration to young adult male Leeds strain rats of a total dose of 3 micrograms/kg body weight of TCDD resulted in an exposure duration-dependent reduction of in vitro lipopolysaccharide-induced production of interleukin (IL)-1 in cultures of their splenic macrophages. A 30-day exposure produced approximately 30% suppression and 180-day exposure produced approximately 52% suppression. This reduction did not negatively influence lipopolysaccharide- induced proliferation of B cells, instead an enhancement of B cell proliferation was observed after 30 days exposure. A 180 day exposure significantly suppressed the generation of IL-2 by either concanavalin A or phorbol myristate acetate/calcium ionophore stimulation, and reduced the lectin-induced proliferation of splenic T cells. The 30-day TCDD exposure showed no such immunotoxicity. TCDD at both exposure durations suppressed the expression of the alpha chain of the IL-2 receptor in concanavalin A-activated T cells, without affecting the CD4+/CD8+ ratio. The results suggest that exposure to a low dietary dose of TCDD suppresses the functions of several T cell subsets, some of the immunotoxic effects being produced early, while others require a longer exposure also down-regulates the IL-1 production function of macrophages. A common mechanism of TCDD immunotoxicity may be on the multifunctional signal transduction pathways downstream to the activation of protein kinase C and Ca2+ flux.

  2. Stachylysin May Be a Cause of Hemorrhaging in Humans Exposed to Stachybotrys chartarum

    PubMed Central

    Vesper, Stephen J.; Vesper, Mary Jo

    2002-01-01

    Stachybotrys chartarum is a toxigenic fungus that has been associated with human health concerns such as nasal bleeding in adults and pulmonary hemosiderosis (PH) in infants. Seven of eight strains of S. chartarum isolated from homes of infants with PH in Cleveland, Ohio, and the strain from the lung of an infant with PH in Texas produced stachylysin in tryptic soy broth (TSB), whereas only one out of eight strains isolated from control homes produced stachylysin. However, all strains produced stachylysin when grown on TSB with 0.7% sheep's blood. When stachylysin was injected into Lumbricus terrestis, the erythrocruorin hemoglobin (absorbance peaks at 280 and 415 nm) was released, resulting in a lethal effect. These results support the hypothesis that stachylysin may be one agent responsible for hemorrhaging in humans. PMID:11895972

  3. QUANTIFICATION OF SIDEROPHORE AND HEMOLYSIN FROM STACHYBOTRYS CHARTARUM STRAINS, INCLUDING A STRAIN ISOLATED FROM THE LUNG OF A CHILD WITH PULMONARY HEMORRHAGE AND HEMOSIDEROSIS

    EPA Science Inventory

    A strain of Stachybotrys chartarum was recently isolated from the lung of a pulmonary hemorrhage and hemosiderosis (PH) patient in Texas (designated the Houston strain). This is the first time that S. chartarum has been isolated from the lung of a PH patient. In this study, the ...

  4. MALDI-TOF mass spectrometry fingerprinting: A diagnostic tool to differentiate dematiaceous fungi Stachybotrys chartarum and Stachybotrys chlorohalonata.

    PubMed

    Gruenwald, Maike; Rabenstein, Andreas; Remesch, Markko; Kuever, Jan

    2015-08-01

    Stachybotrys chartarum and Stachybotrys chlorohalonata are two closely related species. Unambiguous identification of these two species is a challenging task if relying solely on morphological criteria and therefore smarter and less labor-intensive approaches are needed. Here we show that even such closely related species of fungi as S. chartarum and S. chlorohalonata are unequivocally discriminated by their highly reproducible MALDI-TOF-MS fingerprints (matrix assisted laser desorption/ionization time-of-flight mass spectrometry fingerprints). We examined 19 Stachybotrys and one Aspergillus isolate by MALDI-TOF-MS. All but one isolate produced melanin containing conidia on malt extract agar. Mass spectra were obtained in good quality from the analysis of hyaline and darkly pigmented conidia by circumventing the property of melanin which causes signal suppression. MALDI-TOF fingerprint analysis clearly discriminated not only the two morphologically similar species S. chartarum and S. chlorohalonata from each other but separated them precisely from Stachybotrys bisbyi and Aspergillus versicolor isolates. Furthermore, even S. chartarum chemotypes A and S could be differentiated into two distinct groups by their MALDI-TOF fingerprints. The chemotypes of S. chartarum isolates were identified by trichodiene synthase 5 (tri5) sequences prior to mass spectra analysis. Additionally, species identities of all isolates were verified by their 18S rRNA and tri5 gene sequences. Copyright © 2015 Elsevier B.V. All rights reserved.

  5. Safety and immunotoxicity assessment of immunomodulatory monoclonal antibodies

    PubMed Central

    Morton, Laura Dill; Spindeldreher, Sebastian; Kiessling, Andrea; Allenspach, Roy; Hey, Adam; Muller, Patrick Y; Frings, Werner; Sims, Jennifer

    2010-01-01

    Most therapeutic monoclonal antibodies (mAbs) licensed for human use or in clinical development are indicated for treatment of patients with cancer and inflammatory/autoimmune disease and as such, are designed to directly interact with the immune system. A major hurdle for the development and early clinical investigation of many of these immunomodulatory mAbs is their inherent risk for adverse immune-mediated drug reactions in humans such as infusion reactions, cytokine storms, immunosuppression and autoimmunity. A thorough understanding of the immunopharmacology of a mAb in humans and animals is required to both anticipate the clinical risk of adverse immunotoxicological events and to select a safe starting dose for first-in-human (FIH) clinical studies. This review summarizes the most common adverse immunotoxicological events occurring in humans with immunomodulatory mAbs and outlines non-clinical strategies to define their immunopharmacology and assess their immunotoxic potential, as well as reduce the risk of immunotoxicity through rational mAb design. Tests to assess the relative risk of mAb candidates for cytokine release syndrome, innate immune system (dendritic cell) activation and immunogenicity in humans are also described. The importance of selecting a relevant and sensitive toxicity species for human safety assessment in which the immunopharmacology of the mAb is similar to that expected in humans is highlighted, as is the importance of understanding the limitations of the species selected for human safety assessment and supplementation of in vivo safety assessment with appropriate in vitro human assays. A tiered approach to assess effects on immune status, immune function and risk of infection and cancer, governed by the mechanism of action and structural features of the mAb, is described. Finally, the use of immunopharmacology and immunotoxicity data in determining a minimum anticipated biologic effect Level (MABEL) and in the selection of safe human

  6. Approaches and considerations for the assessment of immunotoxicity for environmental chemicals: a workshop summary.

    PubMed

    Boverhof, Darrell R; Ladics, Greg; Luebke, Bob; Botham, Jane; Corsini, Emanuela; Evans, Ellen; Germolec, Dori; Holsapple, Michael; Loveless, Scott E; Lu, Haitian; van der Laan, Jan Willem; White, Kimber L; Yang, Yung

    2014-02-01

    As experience is gained with toxicology testing and as new assays and technologies are developed, it is critical for stakeholders to discuss opportunities to advance our overall testing strategies. To facilitate these discussions, a workshop on practices for assessing immunotoxicity for environmental chemicals was held with the goal of sharing perspectives on immunotoxicity testing strategies and experiences, developmental immunotoxicity (DIT), and integrated and alternative approaches to immunotoxicity testing. Experiences across the chemical and pharmaceutical industries suggested that standard toxicity studies, combined with triggered-based testing approaches, represent an effective and efficient approach to evaluate immunotoxic potential. Additionally, discussions on study design, critical windows, and new guideline approaches and experiences identified important factors to consider before initiating DIT evaluations including assay choice and timing and the impact of existing adult data. Participants agreed that integrating endpoints into standard repeat-dose studies should be considered for fulfilling any immunotoxicity testing requirements, while also maximizing information and reducing animal use. Participants also acknowledged that in vitro evaluation of immunosuppression is complex and may require the use of multiple assays that are still being developed. These workshop discussions should contribute to developing an effective but more resource and animal efficient approach for evaluating chemical immunotoxicity. Copyright © 2013 Elsevier Inc. All rights reserved.

  7. In vitro characterization of the immunotoxic potential of several perfluorinated compounds (PFCs)

    SciTech Connect

    Corsini, Emanuela; Sangiovanni, Enrico; Avogadro, Anna; Galbiati, Valentina; Viviani, Barbara; Marinovich, Marina; Galli, Corrado L.; Dell'Agli, Mario; Germolec, Dori R.

    2012-01-15

    We have previously shown that PFOA and PFOS directly suppress cytokine secretion in immune cells, with different mechanisms of action. In particular, we have demonstrated a role for PPAR-α in PFOA-induced immunotoxicity, and that PFOS has an inhibitory effect on LPS-induced I-κB degradation. These studies investigate the immunomodulatory effects of four other PFCs, namely PFBS, PFOSA, PFDA, and fluorotelomer using in vitro assays. The release of the pro-inflammatory cytokines IL-6 and TNF-α was evaluated in lipolysaccharide (LPS)-stimulated human peripheral blood leukocytes (hPBL) and in the human promyelocytic cell line THP-1, while the release of IL-10 and IFN-γ was evaluated in phytohemagglutinin (PHA)-stimulated hPBL. All PFCs suppressed LPS-induced TNF-α production in hPBL and THP-1 cells, while IL-6 production was suppressed by PFOSA, PFOS, PFDA and fluorotelomer. PFBS, PFOSA, PFOS, PFDA and fluorotelomer inhibited PHA-induced IL-10 release, while IFN-γ secretion was affected by PFOSA, PFOS, PFDA and fluorotelomer. Leukocytes obtained from female donors appear to be more sensitive to the in vitro immunotoxic effects of PFCs when their responses are compared to the results obtained using leukocytes from male donors. Mechanistic investigations demonstrated that inhibition of TNF-α release in THP-1 cells occurred at the transcriptional level. All PFCs, including PFOA and PFOS, decreased LPS-induced NF-κB activation. With the exception of PFOA, none of the PFCs tested was able to activate PPARα driven transcription in transiently transfected THP-1 cells, excluding a role for PPARα in the immunomodulation observed. PFBS and PFDA prevented LPS-induced I-κB degradation. Overall, these studies suggest that PFCs affect NF-κB activation, which directly suppresses cytokine secretion by immune cells. Our results indicate that PFOA is the least active of the PFCs examined followed by PFBS, PFDA, PFOS, PFOSA and fluorotelomer. -- Research Highlights: ► PFCs

  8. In vitro characterization of the immunotoxic potential of several perfluorinated compounds (PFCs).

    PubMed

    Corsini, Emanuela; Sangiovanni, Enrico; Avogadro, Anna; Galbiati, Valentina; Viviani, Barbara; Marinovich, Marina; Galli, Corrado L; Dell'Agli, Mario; Germolec, Dori R

    2012-01-15

    We have previously shown that PFOA and PFOS directly suppress cytokine secretion in immune cells, with different mechanisms of action. In particular, we have demonstrated a role for PPAR-α in PFOA-induced immunotoxicity, and that PFOS has an inhibitory effect on LPS-induced I-κB degradation. These studies investigate the immunomodulatory effects of four other PFCs, namely PFBS, PFOSA, PFDA, and fluorotelomer using in vitro assays. The release of the pro-inflammatory cytokines IL-6 and TNF-α was evaluated in lipolysaccharide (LPS)-stimulated human peripheral blood leukocytes (hPBL) and in the human promyelocytic cell line THP-1, while the release of IL-10 and IFN-γ was evaluated in phytohemagglutinin (PHA)-stimulated hPBL. All PFCs suppressed LPS-induced TNF-α production in hPBL and THP-1 cells, while IL-6 production was suppressed by PFOSA, PFOS, PFDA and fluorotelomer. PFBS, PFOSA, PFOS, PFDA and fluorotelomer inhibited PHA-induced IL-10 release, while IFN-γ secretion was affected by PFOSA, PFOS, PFDA and fluorotelomer. Leukocytes obtained from female donors appear to be more sensitive to the in vitro immunotoxic effects of PFCs when their responses are compared to the results obtained using leukocytes from male donors. Mechanistic investigations demonstrated that inhibition of TNF-α release in THP-1 cells occurred at the transcriptional level. All PFCs, including PFOA and PFOS, decreased LPS-induced NF-κB activation. With the exception of PFOA, none of the PFCs tested was able to activate PPARα driven transcription in transiently transfected THP-1 cells, excluding a role for PPARα in the immunomodulation observed. PFBS and PFDA prevented LPS-induced I-κB degradation. Overall, these studies suggest that PFCs affect NF-κB activation, which directly suppresses cytokine secretion by immune cells. Our results indicate that PFOA is the least active of the PFCs examined followed by PFBS, PFDA, PFOS, PFOSA and fluorotelomer.

  9. Vanadium carcinogenic, immunotoxic and neurotoxic effects: a review of in vitro studies.

    PubMed

    Zwolak, Iwona

    2014-01-01

    Deleterious health effects induced by inorganic vanadium compounds are linked with carcinogenic, immunotoxic and neurotoxic insults. The goal of this review is to provide a summary of mammalian cell culture studies (from the 1990s to most recent) looking into the mode of the above-mentioned adverse actions of vanadium. Regarding the carcinogenicity potential, the key cell-based studies have evidenced the ability of vanadium to induce genotoxic lesions, cell morphological transformation and anti-apoptotic effects in a certain type of cells. Two contradictory effects of vanadium on the immune functions of cells have been observed in cell culture studies. The first effect involves reduction of cell immune responses such as vanadium-dependent inhibition of cytokine-inducible functions, which may underlie the mechanism of vanadium-induced immunosuppression. The second one involves stimulation of immune activity, for example, a vanadium-mediated increase in cytokine production, which may contribute to vanadium-related inflammation. So far, an in vitro evaluation of vanadium neurotoxicity has only been reported in few articles. These papers indicate probable cytotoxic mechanisms resulting from exposure of neurons and glial cells to vanadium. In summary, this literature review collects in vitro reports on adverse vanadium effects and thus provides vanadium researchers with a single, concise source of data.

  10. The immunotoxicity of 3,3{prime},4,4{prime},5-pentachlorobiphenyl (PeCB) and tributyltin (TBT) in channel catfish, Ictalurus punctatus

    SciTech Connect

    Rice, C.D.; Banes, M.M.; Hurt, K.L.

    1994-12-31

    There is considerable evidence that planar PCBs and Tributyltin (TBT) may be immunotoxic to fish. Apparently the immune system is a target organ for both compounds in rodents. The mechanisms of action are different as PeCB immunotoxicity is associated with cytosolic Ah-R binding and induction of several nuclear response elements while TBT immunotoxicity is associated with membrane perturbation and layered calcium homeostasis. The authors have investigated the effects of a single i.p. dose of PeCB and TBT at 0.01, 0.1, 1.0 mg/kg on several innate immune responses including non-specific cytotoxic cell activity, neutrophil activation, and lymphocyte mitogenesis, as well as baseline hematology at days 3 and 7 post treatment. Hematocrits were affected in TBT treated fish at 1.0 mg/kg while neutrophilia and leukopenia were noted at 0.01 and 1.0 mg/kg. These observations are typical of stress hemograms. PeCB had no adverse effect on hematocrits or leukocyte % but did induce neutrophilia at 1.0 mg/kg. Neutrophil activation was suppressed in both PeCB and TBT treated animals but only at 1.0 mg/kg. NCC activity was suppressed at all three doses of PECB but only 1.0 mg/kg in TBT treated animals. Lymphocyte mitogenesis was affected by both compounds but only at 1.0 mg/kg. A note of interest is that both compounds have the same molecular weight and therefore their immunotoxic effects can be compared on a {micro}mole/kg basis.

  11. Detection of airborne Stachybotrys chartarum macrocyclic trichothecene mycotoxins in the indoor environment.

    PubMed

    Brasel, T L; Martin, J M; Carriker, C G; Wilson, S C; Straus, D C

    2005-11-01

    The existence of airborne mycotoxins in mold-contaminated buildings has long been hypothesized to be a potential occupant health risk. However, little work has been done to demonstrate the presence of these compounds in such environments. The presence of airborne macrocyclic trichothecene mycotoxins in indoor environments with known Stachybotrys chartarum contamination was therefore investigated. In seven buildings, air was collected using a high-volume liquid impaction bioaerosol sampler (SpinCon PAS 450-10) under static or disturbed conditions. An additional building was sampled using an Andersen GPS-1 PUF sampler modified to separate and collect particulates smaller than conidia. Four control buildings (i.e., no detectable S. chartarum growth or history of water damage) and outdoor air were also tested. Samples were analyzed using a macrocyclic trichothecene-specific enzyme-linked immunosorbent assay (ELISA). ELISA specificity was tested using phosphate-buffered saline extracts of the fungal genera Aspergillus, Chaetomium, Cladosporium, Fusarium, Memnoniella, Penicillium, Rhizopus, and Trichoderma, five Stachybotrys strains, and the indoor air allergens Can f 1, Der p 1, and Fel d 1. For test buildings, the results showed that detectable toxin concentrations increased with the sampling time and short periods of air disturbance. Trichothecene values ranged from <10 to >1,300 pg/m3 of sampled air. The control environments demonstrated statistically significantly (P < 0.001) lower levels of airborne trichothecenes. ELISA specificity experiments demonstrated a high specificity for the trichothecene-producing strain of S. chartarum. Our data indicate that airborne macrocyclic trichothecenes can exist in Stachybotrys-contaminated buildings, and this should be taken into consideration in future indoor air quality investigations.

  12. Detection of Airborne Stachybotrys chartarum Macrocyclic Trichothecene Mycotoxins in the Indoor Environment

    PubMed Central

    Brasel, T. L.; Martin, J. M.; Carriker, C. G.; Wilson, S. C.; Straus, D. C.

    2005-01-01

    The existence of airborne mycotoxins in mold-contaminated buildings has long been hypothesized to be a potential occupant health risk. However, little work has been done to demonstrate the presence of these compounds in such environments. The presence of airborne macrocyclic trichothecene mycotoxins in indoor environments with known Stachybotrys chartarum contamination was therefore investigated. In seven buildings, air was collected using a high-volume liquid impaction bioaerosol sampler (SpinCon PAS 450-10) under static or disturbed conditions. An additional building was sampled using an Andersen GPS-1 PUF sampler modified to separate and collect particulates smaller than conidia. Four control buildings (i.e., no detectable S. chartarum growth or history of water damage) and outdoor air were also tested. Samples were analyzed using a macrocyclic trichothecene-specific enzyme-linked immunosorbent assay (ELISA). ELISA specificity was tested using phosphate-buffered saline extracts of the fungal genera Aspergillus, Chaetomium, Cladosporium, Fusarium, Memnoniella, Penicillium, Rhizopus, and Trichoderma, five Stachybotrys strains, and the indoor air allergens Can f 1, Der p 1, and Fel d 1. For test buildings, the results showed that detectable toxin concentrations increased with the sampling time and short periods of air disturbance. Trichothecene values ranged from <10 to >1,300 pg/m3 of sampled air. The control environments demonstrated statistically significantly (P < 0.001) lower levels of airborne trichothecenes. ELISA specificity experiments demonstrated a high specificity for the trichothecene-producing strain of S. chartarum. Our data indicate that airborne macrocyclic trichothecenes can exist in Stachybotrys-contaminated buildings, and this should be taken into consideration in future indoor air quality investigations. PMID:16269780

  13. Study on fungi in archives of offices, with a particular focus on Stachybotrys chartarum.

    PubMed

    Foladi, S; Hedayati, M T; Shokohi, T; Mayahi, S

    2013-12-01

    This study aimed at evaluating fungi in archives of different offices in Sari city the capital of Mazandaran, a northern province of Iran, with a particular focus on Stachybotrys chartarum. The samples were collected from twenty archives of offices and controls (n=7) using a SKC single-stage impactor which draws air at 20L/min (100L) and impacts the sampled material onto Petri dishes containing malt extract agar (MEA) (n=22) and also cellulose agar (CA) (n=22). Surface samples were also collected by pressing a sterile cotton swab on different areas of archives and cultured on MEA and CA. The grown fungi were identified by standard mycological techniques. The counted fungal colonies were converted to CFUs per cubic meter. In indoor air of archives, Cladosporium spp (25.1%), Aspergillus spp (22.9%) and Penicillium spp (22.9%) had the most frequencies. Stachybotrys chartarum (7.9%) was the fourth most common fungus isolated from the surface samples. Cladosporium spp had the highest total CFU concentration in indoor air of archive samples (1227/m(3)). Stachybotrys chartarum was recovered from surface collected samples of 4 archives of offices on CA. Out of the 22 rooms of archives, 45.4%, 45.4% and 9.1% had concentration level < 170 CFU/m(3), > 170 < 560 CFU/m(3) and > 560 < 1000 CFU/m(3), respectively. The results of our study have shown the high concentration levels of airborne fungi in some archives of offices that might put the workers at risk from respiratory diseases. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

  14. Toxicity screening of materials from buildings with fungal indoor air quality problems (Stachybotrys chartarum).

    PubMed

    E, J; M, G; S, Y C; E-L, H; M, N; B, J; R, D

    1998-06-01

    Samples of building materials visibly contaminated with moisture-related fungi (drywall, fiberglass, wallpaper, wood) were tested with indirect (FFL) and direct (MTT) cytotoxicity screening tests that are particularly sensitive toStachybotrys chartarum toxins. In addition, microscopic, chemical, immunochemical (Roridin A enzyme immunoassay) and mycological culture analyses were performed. In all cases in which building occupants had reported verifiable skin, mucous membrane, respiratory, central nervous system or neuropsychological abnormalities, cytotoxicity was identified. Results of a cytotoxicity screening test of field samples, such as the direct MTT test method, will give investigators of health problems related to indoor air quality problems important toxicity information.

  15. Testing antimicrobial cleaner efficacy on gypsum wallboard contaminated with Stachybotrys chartarum.

    PubMed

    Menetrez, Marc Y; Foarde, Karin K; Webber, Tricia D; Dean, Timothy R; Betancourt, Doris A

    2007-11-01

    Reducing occupant exposure to indoor mold is the goal of this research, through the efficacy testing of antimicrobial cleaners. Often mold contaminated building materials are not properly removed, but instead surface cleaners are applied in an attempt to alleviate the problem. The efficacy of antimicrobial cleaners to remove, eliminate or control mold growth on surfaces can easily be tested on non-porous surfaces. However, the testing of antimicrobial cleaner efficacy on porous surfaces, such as those found in the indoor environment such as gypsum board can be more complicated and prone to incorrect conclusions regarding residual organisms. The mold Stachybotrys chartarum has been found to be associated with idiopathic pulmonary hemorrhage in infants and has been studied for toxin production and its occurrence in water damaged buildings. Growth of S. chartarum on building materials such as gypsum wallboard has been frequently documented. Research to control S. chartarum growth using 13 separate antimicrobial cleaners on contaminated gypsum wallboard has been performed in laboratory testing. Popular brands of cleaning products were tested by following directions printed on the product packaging. A variety of gypsum wallboard surfaces were used to test these cleaning products at high relative humidity. The results indicate differences in antimicrobial efficacy for the six month period of testing. Results for the six types of GWB surfaces varied extensively. However, three cleaning products exhibited significantly better results than others. Lysol All-Purpose Cleaner-Orange Breeze (full strength) demonstrated results which ranked among the best in five of the six surfaces tested. Both Borax and Orange Glo Multipurpose Degreaser demonstrated results which ranked among the best in four of the six surfaces tested. The best antimicrobial cleaner to choose is often dependent on the type of surface to be cleaned of S. chartarum contamination. For Plain GWB, no paint, the

  16. Chartarlactams A-P, phenylspirodrimanes from the sponge-associated fungus Stachybotrys chartarum with antihyperlipidemic activities.

    PubMed

    Li, Yong; Wu, Chongming; Liu, Dong; Proksch, Peter; Guo, Peng; Lin, Wenhan

    2014-01-24

    Chemical examination of the solid culture of the endophytic fungus Stachybotrys chartarum isolated from the sponge Niphates recondita resulted in the isolation of 16 new phenylspirodrimanes, named chartarlactams A-P (1-16), together with eight known analogues. Their structures were determined on the basis of extensive spectroscopic analysis, including X-ray single-crystal diffraction for the determination of the absolute configurations. The isoindolone-drimane dimer chartarlactam L (12) was determined as a new skeleton. Compounds 1-6 and 8-24 were evaluated for antihyperlipidemic effects in HepG2 cells, and the primary structure-activity relationships are discussed.

  17. Neurotoxicity and Immunotoxicity Outcomes following Gestational Exposure to Four Lab Drinking Water Concentrates

    EPA Science Inventory

    To evaluate whether developmental exposure to drinking water concentrates altered other endpoints, standard neuro- and immunotoxicity tests were conducted on the offspring. Male and female offspring (10/sex/treatment) exposed to chlorinated concentrated water (CCW) or reverse os...

  18. Neurotoxicity and Immunotoxicity Outcomes following Gestational Exposure to Four Lab Drinking Water Concentrates

    EPA Science Inventory

    To evaluate whether developmental exposure to drinking water concentrates altered other endpoints, standard neuro- and immunotoxicity tests were conducted on the offspring. Male and female offspring (10/sex/treatment) exposed to chlorinated concentrated water (CCW) or reverse os...

  19. Quantification of Siderophore and Hemolysin from Stachybotrys chartarum Strains, Including a Strain Isolated from the Lung of a Child with Pulmonary Hemorrhage and Hemosiderosis

    PubMed Central

    Vesper, Stephen J.; Dearborn, Dorr G.; Elidemir, Okan; Haugland, Richard A.

    2000-01-01

    A strain of Stachybotrys chartarum was recently isolated from the lung of a pulmonary hemorrhage and hemosiderosis (PH) patient in Texas (designated the Houston strain). This is the first time that S. chartarum has been isolated from the lung of a PH patient. In this study, the Houston strain and 10 strains of S. chartarum isolated from case (n = 5) or control (n = 5) homes in Cleveland were analyzed for hemolytic activity, siderophore production, and relatedness as measured by random amplified polymorphic DNA analysis. PMID:10831457

  20. Successful validation of genomic biomarkers for human immunotoxicity in Jurkat T cells in vitro.

    PubMed

    Schmeits, Peter C J; Shao, Jia; van der Krieken, Danique A; Volger, Oscar L; van Loveren, Henk; Peijnenburg, Ad A C M; Hendriksen, Peter J M

    2015-07-01

    Previously, we identified 25 classifier genes that were able to assess immunotoxicity using human Jurkat T cells. The present study aimed to validate these classifiers. For that purpose, Jurkat cells were exposed for 6 h to subcytotoxic doses of nine immunotoxicants, five non-immunotoxicants and four compounds for which human immunotoxicity has not yet been fully established. RNA was isolated and subjected to Fluidigm quantitative real time (qRT)-PCR analysis. The sensitivity, specificity and accuracy of the screening assay as based on the nine immunotoxicants and five non-immunotoxicants used in this study were 100%, 80% and 93%, respectively, which is better than the performance in our previous study. Only one compound was classified as false positive (benzo-e-pyrene). Of the four potential (non-)immunotoxicants, chlorantraniliprole and Hidrasec were classified immunotoxic and Sunset yellow and imidacloprid as non-immunotoxic. ToxPi analysis of the PCR data provided insight in the molecular pathways that were affected by the compounds. The immunotoxicants 2,3-dichloro-propanol and cypermethrin, although structurally different, affected protein metabolism and cholesterol biosynthesis and transport. In addition, four compounds, i.e. chlorpyrifos, aldicarb, benzo-e-pyrene and anti-CD3, affected genes in cholesterol metabolism and transport, protein metabolism and transcription regulation. qRT-PCR on eight additional genes coding for similar processes as defined in ToxPi analyzes, supported these results. In conclusion, the 25 immunotoxic classifiers performed very well in a screening with new non-immunotoxic and immunotoxic compounds. Therefore, the Jurkat screening assay has great promise to be applied within a tiered approach for animal free testing of human immunotoxicity.

  1. Investigation of the Hepatotoxic and Immunotoxic Effects of the Peroxisome Proliferator Perfluorodecanoic Acid

    DTIC Science & Technology

    1991-04-30

    perfluorooctanoic acid and perfluorodecanoic acid in male rats and the effects on tissue fatty acids . Toxicol. Appl. Pharmacol. 70, 362-372. Reddy, J.K...np. A #127 6Investigation of the Hepatotoxic and OHIO Immunotoxic Effects of the Peroxisome AJE Proliferator Perfluorodecanoic Acid Donald E. Frazier...Investigation of the Hepatotoxic and Immunotoxic Effects G-AFOSR 90-0371 of the Peroxisome Proliferator Perfluorodecanoic Acid TA - 2312/A5 L AUTMOS) Donald E

  2. Zearalenone, an estrogenic mycotoxin, is an immunotoxic compound.

    PubMed

    Hueza, Isis M; Raspantini, Paulo Cesar F; Raspantini, Leonila Ester R; Latorre, Andreia O; Górniak, Silvana L

    2014-03-13

    The aim of this study was to assess the toxic effects of zearalenone (ZEA) on the immune function. Ovariectomised rats were treated daily by gavage with 3.0 mg/kg of ZEA for 28 days. Body weight gain, food consumption, haemotological parameters, lymphoid organs, and their cellularities were evaluated. Moreover, acquired immune responses and macrophage activity were also assessed. ZEA promoted reduction in body weight gain, which is not fully explained by diminished food consumption. Despite no effect on haematological parameters, ZEA caused thymic atrophy with histological and thymocyte phenotype changes and decrease in the B cell percentage in the spleen. With respect to acquired and innate immune responses, no statistically significant differences in delayed-type hypersensitivity were noticed; however, in the ZEA-treated rats, antibody production and peroxide release by macrophages were impaired. The observed results could be related to ZEA activity on ERs; thus, ZEA is an immunotoxic compound similar to estrogen and some endocrine disruptors.

  3. In vivo immunotoxicity of perfluorooctane sulfonate in BALB/c mice: Identification of T-cell receptor and calcium-mediated signaling pathway disruption through gene expression profiling of the spleen.

    PubMed

    Lv, Qi-Yan; Wan, Bin; Guo, Liang-Hong; Yang, Yu; Ren, Xiao-Min; Zhang, Hui

    2015-10-05

    Perfluorooctane sulfonate (PFOS) is a persistent organic pollutant that is used worldwide and is continuously being detected in biota and the environment, thus presenting potential threats to the ecosystem and human health. Although PFOS is highly immunotoxic, its underlying molecular mechanisms remain largely unknown. The present study examined PFOS-induced immunotoxicity in the mouse spleen and explored its underlying mechanisms by gene expression profiling. Oral exposure of male BALB/c mice for three weeks followed by one-week recovery showed that a 10 mg/kg/day PFOS exposure damaged the splenic architecture, inhibited T-cell proliferation in response to mitogen, and increased the percentages of T helper (CD3(+)CD4(+)) and cytotoxic T (CD3(+)CD8(+)) cells, despite the decrease in the absolute number of these cells. A delayed type of PFOS immunotoxicity was observed, which mainly occurred during the recovery period. Global gene expression profiling of mouse spleens and QRT-PCR analyses suggest that PFOS inhibited the expression of genes involved in cell cycle regulation and NRF2-mediated oxidative stress response, and upregulated those in TCR signaling, calcium signaling, and p38/MAPK signaling pathways. Western blot analysis confirmed that the expressions of CAMK4, THEMIS, and CD3G, which were involved in the upregulated pathways, were induced upon PFOS exposure. Acute PFOS exposure modulated calcium homoeostasis in splenocytes. These results indicate that PFOS exposure can activate TCR signaling and calcium ion influx, which provides a clue for the potential mechanism of PFOS immunotoxicity. The altered signaling pathways by PFOS treatment as revealed in the present study might facilitate in better understanding PFOS immunotoxicity and explain the association between immune disease and PFOS exposure.

  4. ELISA MEASUREMENT OF STACHYLYSIN (TM) IN SERUM TO QUANTIFY HUMAN EXPOSURES TO THE INDOOR MOLD STACHYBOTRYS CHARTARUM

    EPA Science Inventory

    Antibodies were produced against the hemolytic agent stachylysin obtained from the mold Stachybotryis chartarum. These antibodies were used to develop two enzyme-linked immunosorbent assay (ELISA) methods for the analysis of stachylysin in human and rat sera and environmental sa...

  5. EVALUATION OF STACHYBOTRYS CHARTARUM IN THE HOUSE OF AN INFANT WITH PULMONARY HEMORRHAGE: QUANTITATIVE ASSESSMENT BEFORE, DURING, AND AFTER REMEDIATION

    EPA Science Inventory

    Stachybotrys chartarum is an indoor mold that has been associated with pulmonary hemorrhage (PH) cases in the Cleveland, Ohio area. This study applied two new quantitative measurements to air samples from a home where an infant developed PH. Quantitative polymerase chain reacti...

  6. ELISA MEASUREMENT OF STACHYLYSIN (TM) IN SERUM TO QUANTIFY HUMAN EXPOSURES TO THE INDOOR MOLD STACHYBOTRYS CHARTARUM

    EPA Science Inventory

    Antibodies were produced against the hemolytic agent stachylysin obtained from the mold Stachybotryis chartarum. These antibodies were used to develop two enzyme-linked immunosorbent assay (ELISA) methods for the analysis of stachylysin in human and rat sera and environmental sa...

  7. RESPIRATORY PHYSIOLOGICAL AND ALLERGIC-TYPE RESPONSES TO AN EXTRACT OF STACHYBOTRYS CHARTARUM IN BALB/C MICE

    EPA Science Inventory

    RESPIRATORY PHYSIOLOGICAL AND ALLERGIC-TYPE RESPONSES TO AN EXTRACT OF Stachybotrys chartarum IN BALB/C MICE. ME Viana1, N Haykal-Coates2, S H Gavett2, MJ Selgrade2, and M D W Ward2. 1APR/CVM, NCSU, Raleigh, NC, USA. 2NHEERL, ORD, US EPA, RTP, NC, USA.
    Rationale: assess the ab...

  8. EVALUATION OF STACHYBOTRYS CHARTARUM IN THE HOUSE OF AN INFANT WITH PULMONARY HEMORRHAGE: QUANTITATIVE ASSESSMENT BEFORE, DURING, AND AFTER REMEDIATION

    EPA Science Inventory

    Stachybotrys chartarum is an indoor mold that has been associated with pulmonary hemorrhage (PH) cases in the Cleveland, Ohio area. This study applied two new quantitative measurements to air samples from a home where an infant developed PH. Quantitative polymerase chain reacti...

  9. Selenium reverses Pteridium aquilinum-induced immunotoxic effects

    USDA-ARS?s Scientific Manuscript database

    We have previously shown that bracken fern (Pteridium aquilinum) has immunomodulatory effects on mouse natural killer (NK) cells by reducing cytotoxicity. Alternatively, it has been demonstrated that selenium can enhance NK cell activity. Therefore, the aims of the present study were to evaluate if ...

  10. Inhalation of Stachybotrys chartarum evokes pulmonary arterial remodeling in mice, attenuated by Rho-kinase inhibitor.

    PubMed

    Nagayoshi, Masaru; Tada, Yuji; West, James; Ochiai, Eri; Watanabe, Akira; Toyotome, Takahito; Tanabe, Nobuhiro; Takiguchi, Yuichi; Shigeta, Ayako; Yasuda, Tadashi; Shibuya, Kazutoshi; Kamei, Katsuhiko; Tatsumi, Koichiro

    2011-07-01

    Stachybotrys chartarum, a ubiquitous fungus in our environment, has been suspected of causing respiratory symptoms in humans, such as acute infant pulmonary hemorrhage and asthma. We previously established a mouse model in which repeated inhalation of Stachybotrys chartarum spores caused pulmonary hypertension. To further investigate the model, particularly in the pulmonary circulation, mice were intra-tracheally injected with spores, 18 times over 12 weeks. Severe muscularization was observed in the small- to medium-sized pulmonary arteries. Bronchoalveolar lavage fluid revealed an increase in eosinophils accompanied by high concentrations of Th2-associated cytokines, IL-4, IL-5, but not Th1-associated IFN-γ. The remodeling was temporary, resolving after cessation of spore inhalation. Chronic inhibition of the RhoA/Rho-kinase pathway by fasudil attenuated pulmonary arterial remodeling. These data suggest that Stachybotrys-mediated remodeling is caused by Th2-associated inflammation and can be resolved by Rho-kinase inhibition, either through direct effects on smooth muscle hypertrophy or through indirect effects on vascular inflammation. These data also show that extensive pulmonary vascular remodeling, often thought of as a fixed lesion, will spontaneously resolve in the absence of underlying molecular etiology.

  11. Hemolysis, Toxicity, and Randomly Amplified Polymorphic DNA Analysis of Stachybotrys chartarum Strains

    PubMed Central

    Vesper, Stephen J.; Dearborn, Dorr G.; Yike, Iwona; Sorenson, W. G.; Haugland, Richard A.

    1999-01-01

    Stachybotrys chartarum is an indoor air, toxigenic fungus that has been associated with a number of human and veterinary health problems. Most notable among these has been a cluster of idiopathic pulmonary hemorrhage cases that were observed in the Cleveland, Ohio, area. In this study, 16 strains of S. chartarum isolated from case (n = 8) or control (n = 8) homes in Cleveland and 12 non-Cleveland strains from diverse geographic locations were analyzed for hemolytic activity, conidial toxicity, and randomly amplified polymorphic DNA banding patterns. In tests for hemolytic activity, strains were grown at 23°C on wet wallboard pieces for an 8-week test period. Conidia from these wallboard pieces were subcultured on sheep’s blood agar once a week over this period and examined for growth and clearing of the medium at 37 or 23°C. Five of the Cleveland strains (all from case homes) showed hemolytic activity at 37°C throughout the 8-week test compared to 3 of the non-Cleveland strains. Five of the Cleveland strains, compared to two of the non-Cleveland strains, produced highly toxic conidia (>90 μg of T2 toxin equivalents per g [wet weight] of conidia) after 10 and 30 days of growth on wet wallboard. Only 3 of the 28 strains examined both were consistently hemolytic and produced highly toxic conidia. Each of these strains was isolated from a house in Cleveland where an infant had idiopathic pulmonary hemorrhage. PMID:10388719

  12. Inflammatory Cytokine Gene Expression in THP-1 Cells Exposed to Stachybotrys chartarum and Aspergillus versicolor

    PubMed Central

    Pei, Ruoting; Gunsch, Claudia K.

    2013-01-01

    Very little is known about the mechanisms which occur in human cells upon exposure to fungi as well as their mycotoxins. A better understanding of toxin-regulated gene expression would be helpful to identify safe levels of exposure and could eventually be the basis for establishing guidelines for remediation scenarios following a water intrusion event. In this research, cytokine mRNA expression patterns were investigated in the human monocytic THP-1 cell line exposed to fungal extracts of various fragment sizes obtained from Stachybotrys chartarum RTI 5802 and/or Aspergillus versicolor RTI 3843, two common and well studied mycotoxin producing fungi. Cytokine mRNA expression was generally upregulated 2 to 10 times following a 24-hour exposure to fungal extracts. Expression of the proinflammatory interleukin-1β (IL-1β), Interleukin-8 (IL-8) and tumor necrosis factor-α (TNFα) genes increased while the anti-inflammatory gene Interleukin-10 (IL-10) also increased albeit at very low level, suggesting that negative feedback regulation mechanism of production of pro-inflammatory cytokines initiated upon 24 hours of incubation. In addition, submicron size extracts of A. versicolor caused significant death of THP-1 cells whereas extracts of S. chartarum caused no cell death while the mixture of the two fungi had an intermediate effect. There was no general correlation between gene expression and fragment sizes, which suggests that all submicron fragments may contribute to inflammatory response. PMID:21384497

  13. Testing antimicrobial paint efficacy on gypsum wallboard contaminated with Stachybotrys chartarum.

    PubMed

    Menetrez, M Y; Foarde, K K; Webber, T D; Dean, T R; Betancourt, D A

    2008-02-01

    The goal of this research was to reduce occupant exposure to indoor mold through the efficacy testing of antimicrobial paints. An accepted method for handling Stachybotrys chartarum-contaminated gypsum wallboard (GWB) is removal and replacement. This practice is also recommended for water-damaged or mold-contaminated GWB but is not always followed completely. The efficacy of antimicrobial paints to eliminate or control mold regrowth on surfaces can be tested easily on nonporous surfaces. The testing of antimicrobial efficacy on porous surfaces found in the indoor environment, such as gypsum wallboard, can be more complicated and prone to incorrect conclusions regarding residual organisms. The mold S. chartarum has been studied for toxin production and its occurrence in water-damaged buildings. Research to control its growth using seven different antimicrobial paints and two commonly used paints on contaminated, common gypsum wallboard was performed in laboratory testing at high relative humidity. The results indicate differences in antimicrobial efficacy for the period of testing, and that proper cleaning and resurfacing of GWB with an antimicrobial paint can be an option in those unique circumstances when removal may not be possible.

  14. Inflammatory cytokine gene expression in THP-1 cells exposed to Stachybotrys chartarum and Aspergillus versicolor.

    PubMed

    Pei, Ruoting; Gunsch, Claudia K

    2013-01-01

    Very little is known about the mechanisms that occur in human cells upon exposure to fungi as well as their mycotoxins. A better understanding of toxin-regulated gene expression would be helpful to identify safe levels of exposure and could eventually be the basis for establishing guidelines for remediation scenarios following a water intrusion event. In this research, cytokine mRNA expression patterns were investigated in the human monocytic THP-1 cell line exposed to fungal extracts of various fragment sizes obtained from Stachybotrys chartarum RTI 5802 and/or Aspergillus versicolor RTI 3843, two common and well-studied mycotoxin producing fungi. Cytokine mRNA expression was generally upregulated 2-10 times following a 24 h exposure to fungal extracts. Expression of the proinflammatory interleukin-1β, interleukin-8, and tumor necrosis factor-α genes increased while the anti-inflammatory gene interleukin-10 also increased albeit at very low level, suggesting that negative feedback regulation mechanism of production of proinflammatory cytokines initiated upon 24 h of incubation. In addition, submicron size extracts of A. versicolor caused significant death of THP-1 cells, whereas extracts of S. chartarum caused no cell death while the mixture of the two fungi had an intermediate effect. There was no general correlation between gene expression and fragment sizes, which suggests that all submicron fragments may contribute to inflammatory response. Copyright © 2011 Wiley Periodicals, Inc.

  15. Antibodies against Stachybotrys chartarum extract and its antigenic components, Stachyhemolysin and Stachyrase-A: a new clinical biomarker.

    PubMed

    Vojdani, Aristo

    2005-05-01

    IgG and IgE antibodies against Stachybotrys extract have been reported in allergic patients and residents of water-damaged buildings. Detection of these antibodies in blood was partially attributed to cross-reacting proteins from other fungi. There is a need for a specific method to detect antibodies against characteristic components of S. chartarum. We measured IgG and IgE antibodies against Stachybotrys hemolysin and proteinase-Stachyrase-A by ELISA and ELISA-inhibition techniques. Of 50 reference sera with IgE greater than 500 IU ml and positive against different mold extracts used in this study, significant elevation in IgG or IgE antibodies against S. chartarum extract was present in 25 and 21 specimens. Of these specimens 20 (80%) and 10 (40%) were positive for IgG anti-Stachybotrys hemolysin and anti-Stachyrase-A, while 8 out of 21 sera (38%) and 17 out of 21 (81%) specimens were positive for IgE anti-Stachybotrys hemolysin and anti-Stachyrase-A respectively. Inhibition studies using Stachybotrys hemolysin and Stachyrase-A at a concentration of 50 microg/ml prevented binding of anti-Stachybotrys to S. chartarum extract. Detection of IgG as well as IgE antibodies against Stachybotrys hemolysin and Stachyrase-A and inhibition of anti-Stachybotrys binding to Stachybotrys antigens indicate that Stachybotrys hemolysin and Stachyrase-A are two major antigenic components of S. chartarum extract, which can be used in antibody assays. Measurement of antibodies against these characteristic components of S. chartarum may be considered for demonstration of exposure and possibly allergy to the fungus.

  16. Molecular and phenotypic descriptions of Stachybotrys chlorohalonata sp. nov. and two chemotypes of Stachybotrys chartarum found in water-damaged buildings.

    PubMed

    Andersen, Birgitte; Nielsen, Kristian F; Thrane, Ulf; Szaro, Tim; Taylor, John W; Jarvis, Bruce B

    2003-01-01

    Twenty-five Stachybotrys isolates from two previous studies have been examined and compared, using morphological, chemical and phylogenetic methods. The results show that S. chartarum sensu lato can be segregated into two chemotypes and one new species. The new species, S. chlorohalonata, differs morphologically from S. chartarum by having smooth conidia, being more restricted in growth and producing a green extracellular pigment on the medium CYA. S. chlorohalonata and S. chartarum also have different tri5, chs1 and tub1 gene fragment sequences. The two chemotypes of S. chartarum, chemotype S and chemotype A, have similar morphology but differ in production of metabolites. Chemotype S produces macrocyclic trichothecenes, satratoxins and roridins, while chemotype A produces atranones and dolabellanes. There is no difference between the two chemotypes in the tub1 gene fragment, but there is a one nucleotide difference in each of the tri5 and the chs1 gene fragments.

  17. Ability of Lactobacillus rhamnosus GAF01 to remove AFM1 in vitro and to counteract AFM1 immunotoxicity in vivo.

    PubMed

    Abbès, Samir; Salah-Abbès, Jalila Ben; Sharafi, Hakimeh; Jebali, Rania; Noghabi, Kambiz Akbari; Oueslati, Ridha

    2013-01-01

    Aflatoxin M1 (AFM1) has been detected in many parts of the world both in raw milk and many dairy products, causing great economic losses and human disease. Unfortunately, there are few studies dealing with AFM1 immunotoxicity/interactions with lactic acid bacteria for potential application as a natural preventive agent. The aim of this study was to isolate (from dairy products) food-grade probiotic bacteria able to degrade/bind AFM1 in vitro and evaluate whether the same organism(s) could impart a protective role against AFM1-induced immunotoxicity in exposed Balb/c mice. Bacteria (Lactobacillus plantarum MON03 and L. rhamnosus GAF01) were isolated from Tunisian artisanal butter and then tested for abilities to eliminate AFM1 from phosphate-buffered saline (PBS) and reconstituted milk (containing 0.05, 0.10, and 0.20 µg AFM1/ml) after 0, 6, and 24 h at 37°C. Results showed that the selected bacteria could 'remove' AFM1 both in PBS and skimmed milk. The binding abilities of AFM1 by L. plantarum MON03 and L. rhamnosus GAF01 strains (at 10(8) CFU/ml) in PBS and reconstituted milk ranged, respectively, from 16.1-78.6% and 15.3-95.1%; overall, L. rhamnosus showed a better potential for removal than L. plantarum. 'Removal' appeared to be by simple binding; the bacteria/AFM1 complex was stable and only a very small proportion of mycotoxin was released back into the solution. L. rhamnosus GAF01 had the highest binding capacity and was selected for use in the in vivo study. Those results indicated that use of the organism prevented AFM1-induced effects on total white and red blood cells, and lymphocyte subtypes, after 15 days of host treatment. These studies clearly indicated that L. rhamnosus GAF01 was able to bind AFM1 in vitro and-by mechanisms that might also be related to a binding effect-counteract AFM1-induced immunotoxicity. Moreover, by itself, this bacterium was not toxic and could potentially be used as an additive in dairy products and in biotechnology for

  18. Subchronic Immunotoxicity Assessment of Genetically Modified Virus-Resistant Papaya in Rats.

    PubMed

    Lin, Hsin-Tang; Lee, Wei-Cheng; Tsai, Yi-Ting; Wu, Jhaol-Huei; Yen, Gow-Chin; Yeh, Shyi-Dong; Cheng, Ying-Huey; Chang, Shih-Chieh; Liao, Jiunn-Wang

    2016-07-27

    Papaya is an important fruit that provides a variety of vitamins with nutritional value and also holds some pharmacological properties, including immunomodulation. Genetically modified (GM) papaya plants resistant to Papaya ringspot virus (PRSV) infection have been generated by cloning the coat protein gene of the PRSV which can be used as a valuable strategy to fight PRSV infection and to increase papaya production. In order to assess the safety of GM papaya as a food, this subchronic study was conducted to assess the immunomodulatory responses of the GM papaya line 823-2210, when compared with its parent plant of non-GM papaya, Tainung-2 (TN-2), in Sprague-Dawley (SD) rats. Both non-GM and GM 823-2210 papaya fruits at low (1 g/kg bw) and high (2 g/kg bw) dosages were administered via daily oral gavage to male and female rats consecutively for 90 days. Immunophenotyping, mitogen-induced splenic cell proliferation, antigen-specific antibody response, and histopathology of the spleen and thymus were evaluated at the end of the experiment. Results of immunotoxicity assays revealed no consistent difference between rats fed for 90 days with GM 823-2210 papaya fruits, as opposed to those fed non-GM TN-2 papaya fruits, suggesting that with regard to immunomodulatory responses, GM 823-2210 papaya fruits maintain substantial equivalence to fruits of their non-GM TN-2 parent.

  19. The immunotoxicity of graphene oxides and the effect of PVP-coating.

    PubMed

    Zhi, Xiao; Fang, Hongliang; Bao, Chenchen; Shen, Guangxia; Zhang, Jiali; Wang, Kan; Guo, Shouwu; Wan, Tao; Cui, Daxiang

    2013-07-01

    Graphene oxide (GO) immunotoxicity is not clarified well up to date. Herein we reported the effects of GOs with and without polyvinylpyrrolidone (PVP) coating on human immune cells such as dendritic cells (DCs), T lymphocytes and macrophages. Human immune cells such as dendritic cells (DCs), T lymphocytes and macrophages were isolated from health donated bloods, PVP-coating GO (PVP-GO) exhibited lower immunogenicity compared with pure GO on the aspect of inducing differentiation and maturation of dendritic cells (DCs), the levels of secreted TNF-α and IL-1β had no obvious difference between two groups, yet the secretion of IL-6 remained in PVP-coating GO group. In addition, PVP-coating GO delayed significantly the apoptotic process of T lymphocytes, at the same time, and exhibited anti-phagocytosis ability against macrophages and markedly enhanced the physiological activity of macrophages. In conclusion, PVP-coating GO possesses good immunological biocompatibility and immunoenhancement effects in vitro, and is likely to be an available candidate of immunoadjuvant in the future.

  20. The influence of lime and nitrogen fertilisers on spore counts of Pithomyces chartarum in pasture.

    PubMed

    Cuttance, E L; Laven, R A; Mason, W A; Stevenson, M

    2016-11-01

    To determine whether the application of lime or nitrogen to pasture affected the spore counts of Pithomyces chartarum. The lime application studies were undertaken on a spring-calving, pasture-based, commercial dairy farm near Te Awamutu, New Zealand. On 6 November 2012, five randomly selected paddocks were split into three equal sections. In two of the sections, lime was applied at either 1.5 or 2.5 t/ha, and the central section was left as an untreated control. Each section was sampled for spore counting weekly from 16 January to 15 May 2013. Starting in January 2013, five other randomly selected paddocks were monitored for spore counts. On 20 March 2013 the average spore counts in three paddocks were >100,000 spores/g of pasture. These paddocks were then divided into three equal sections and lime was applied as described above. Spore counting in each section continued weekly until 15 May 2013. The nitrogen application study was carried out on three commercial dairy farms near Te Awamutu, New Zealand. Two randomly selected paddocks on each farm were divided into three equal sections and, on 20 December 2012, nitrogen in the form of urea was applied at either 50 or 80 kg urea/ha to two of the sections; the central section remained as an untreated control. Each section was sampled for spore counting weekly from 16 January to 15 May 2013. Following pre-summer lime application, treatment at 1.5 or 2.5 t/ha did not affect spore counts over time compared with the control section (p>0.26). Similarly following autumn lime application, treatment at 1.5 or 2.5 t/ha did not affect spore counts over time compared with the control section (p>0.11). Following nitrogen application median spore counts remained <20,000 spores/g pasture throughout the trial period and there was no effect of treatment on spore counts over time (p>0.49). This study found that application of lime before the risk period for facial eczema, in November, application of lime after a spore count

  1. Building-associated pulmonary disease from exposure to Stachybotrys chartarum and Aspergillus versicolor.

    PubMed

    Hodgson, M J; Morey, P; Leung, W Y; Morrow, L; Miller, D; Jarvis, B B; Robbins, H; Halsey, J F; Storey, E

    1998-03-01

    The authors present an outbreak of disease associated with exposure to Stachybotrys chartarum and Aspergillus species. A courthouse and two associated office buildings had generated discomfort among employees for two years since initial occupancy. Multiple interventions had been unsuccessful An initial evaluation of 14 individuals identified three with potential asthma and three with symptoms consistent with interstitial lung disease. A clinical screening protocol to identify individuals who should be removed from work identified three likely and seven possible cases of building-related asthma. Detailed environmental and engineering assessments of the building identified major problems in mechanical system design, building construction, and operational strategies leading to excess moisture and elevated relative humidities. Moisture-damaged interior surfaces in both buildings were contaminated with S. chartarum, A. versicolor, and Penicillium species. Aspergillus species, especially A. versicolor, at concentrations of 10(1) to 10(4)/m3 dominated the indoor air under normal operating conditions. Bulk samples also revealed large quantities of Stachybotrys. A questionnaire survey of the three case and two control buildings documented between three- and 15-fold increases in symptoms. A nested case-control study suggested emphysematous-like disease in individuals meeting questionnaire definitions for cases. Replication of analysis strategies used in similar previous investigations suggested an association between worsening symptoms and decreased diffusing capacity of the lung. Performance on neuropsychological measures was similar for both cases and controls, although workers with symptoms reported increased levels of current but not past psychiatric symptomatology. Chemical analyses demonstrated the presence of satratoxins G and H. Cytotoxic laboratory analyses demonstrated the presence of agents with biological effectiveness in bulk materials. No association was seen

  2. Protein translation inhibition by Stachybotrys chartarum conidia with and without the mycotoxin containing polysaccharide matrix.

    PubMed

    Karunasena, Enusha; Cooley, J Danny; Straus, Douglas; Straus, David C

    2004-07-01

    Recent studies have correlated the presence of Stachybotrys chartarum in structures with SBS. S. chartarum produces mycotoxins that are thought to produce some of the symptoms reported in sick-building syndrome (SBS). The conidia (spores) produced by Stachybotrys species are not commonly found in the air of buildings that have been found to contain significant interior growth of this organism. This could be due in part to the large size of the Stachybotrys spores, or the organism growing in hidden areas such as wall cavities. However, individuals in buildings with significant Stachybotrys growth frequently display symptoms that may be attributed to exposure to the organism's mycotoxins. In addition, Stachybotrys colonies produce a "slime" or polysaccharide (carbohydrate) matrix that coats the hyphae and the spores. The intent of this project was to determine whether the carbohydrate matrix and the mycotoxins embedded in it could be removed from the spores by repeated washings with either aqueous or organic solvents. The results demonstrated that the process of spore washing removed compounds that were toxic in a protein translation assay as compared to spores that were washed with an organic solution, however a correlation between carbohydrate removal during the washing process and the removal of mycotoxins from the spore surface was not observed. These data demonstrated that mycotoxins are not likely to be found exclusively in the carbohydrate matrix of the spores. Therefore, mycotoxin removal from the spore surface can occur without significant loss of polysaccharide. We also showed that toxic substances may be removed from the spore surface with an aqueous solution. These results suggest that satratoxins are soluble in aqueous solutions without being bound to water-soluble moieties, such as the carbohydrate slime matrix.

  3. Detection of Airborne Stachybotrys chartarum Macrocyclic Trichothecene Mycotoxins on Particulates Smaller than Conidia

    PubMed Central

    Brasel, T. L.; Douglas, D. R.; Wilson, S. C.; Straus, D. C.

    2005-01-01

    Highly respirable particles (diameter, <1 μm) constitute the majority of particulate matter found in indoor air. It is hypothesized that these particles serve as carriers for toxic compounds, specifically the compounds produced by molds in water-damaged buildings. The presence of airborne Stachybotrys chartarum trichothecene mycotoxins on particles smaller than conidia (e.g., fungal fragments) was therefore investigated. Cellulose ceiling tiles with confluent Stachybotrys growth were placed in gas-drying containers through which filtered air was passed. Exiting particulates were collected by using a series of polycarbonate membrane filters with decreasing pore sizes. Scanning electron microscopy was employed to determine the presence of conidia on the filters. A competitive enzyme-linked immunosorbent assay (ELISA) specific for macrocyclic trichothecenes was used to analyze filter extracts. Cross-reactivity to various mycotoxins was examined to confirm the specificity. Statistically significant (P < 0.05) ELISA binding was observed primarily for macrocyclic trichothecenes at concentrations of 50 and 5 ng/ml and 500 pg/ml (58.4 to 83.5% inhibition). Of the remaining toxins tested, only verrucarol and diacetylverrucarol (nonmacrocyclic trichothecenes) demonstrated significant binding (18.2 and 51.7% inhibition, respectively) and then only at high concentrations. The results showed that extracts from conidium-free filters demonstrated statistically significant (P < 0.05) antibody binding that increased with sampling time (38.4 to 71.9% inhibition, representing a range of 0.5 to 4.0 ng/ml). High-performance liquid chromatography analysis suggested the presence of satratoxin H in conidium-free filter extracts. These data show that S. chartarum trichothecene mycotoxins can become airborne in association with intact conidia or smaller particles. These findings may have important implications for indoor air quality assessment. PMID:15640178

  4. Detection of airborne Stachybotrys chartarum macrocyclic trichothecene mycotoxins on particulates smaller than conidia.

    PubMed

    Brasel, T L; Douglas, D R; Wilson, S C; Straus, D C

    2005-01-01

    Highly respirable particles (diameter, <1 microm) constitute the majority of particulate matter found in indoor air. It is hypothesized that these particles serve as carriers for toxic compounds, specifically the compounds produced by molds in water-damaged buildings. The presence of airborne Stachybotrys chartarum trichothecene mycotoxins on particles smaller than conidia (e.g., fungal fragments) was therefore investigated. Cellulose ceiling tiles with confluent Stachybotrys growth were placed in gas-drying containers through which filtered air was passed. Exiting particulates were collected by using a series of polycarbonate membrane filters with decreasing pore sizes. Scanning electron microscopy was employed to determine the presence of conidia on the filters. A competitive enzyme-linked immunosorbent assay (ELISA) specific for macrocyclic trichothecenes was used to analyze filter extracts. Cross-reactivity to various mycotoxins was examined to confirm the specificity. Statistically significant (P < 0.05) ELISA binding was observed primarily for macrocyclic trichothecenes at concentrations of 50 and 5 ng/ml and 500 pg/ml (58.4 to 83.5% inhibition). Of the remaining toxins tested, only verrucarol and diacetylverrucarol (nonmacrocyclic trichothecenes) demonstrated significant binding (18.2 and 51.7% inhibition, respectively) and then only at high concentrations. The results showed that extracts from conidium-free filters demonstrated statistically significant (P < 0.05) antibody binding that increased with sampling time (38.4 to 71.9% inhibition, representing a range of 0.5 to 4.0 ng/ml). High-performance liquid chromatography analysis suggested the presence of satratoxin H in conidium-free filter extracts. These data show that S. chartarum trichothecene mycotoxins can become airborne in association with intact conidia or smaller particles. These findings may have important implications for indoor air quality assessment.

  5. AMP-Conjugated Quantum Dots: Low Immunotoxicity Both In Vitro and In Vivo

    NASA Astrophysics Data System (ADS)

    Dai, Tongcheng; Li, Na; Liu, Lu; Liu, Qin; Zhang, Yuanxing

    2015-11-01

    Quantum dots (QDs) are engineered nanoparticles that possess special optical and electronic properties and have shown great promise for future biomedical applications. In this work, adenosine 5'-monophosphate (AMP), a small biocompatible molecular, was conjugated to organic QDs to produce hydrophilic AMP-QDs. Using macrophage J774A.1 as the cell model, AMP-QDs exhibited both prior imaging property and low toxicity, and more importantly, triggered limited innate immune responses in macrophage, indicating low immunotoxicity in vitro. Using BALB/c mice as the animal model, AMP-QDs were found to be detained in immune organs but did not evoke robust inflammation responses or obvious histopathological abnormalities, which reveals low immunotoxicity in vivo. This work suggests that AMP is an excellent surface ligand with low immunotoxicity, and potentially used in surface modification for more extensive nanoparticles.

  6. Comparison of four different methods for extraction of Stachybotrys chartarum spore DNA and verification by real-time PCR.

    PubMed

    Black, J A; Foarde, K K

    2007-07-01

    A comparison of four different methods for the extraction of spore DNA from Stachybotrys chartarum was conducted. Spore DNA was extracted and purified using either one of three different commercial kits or water. All preparations utilized bead milling. Genomic DNA extracted from 10(1) to 10(7) spores was assessed by both agarose gel electrophoresis and real-time quantitative polymerase chain reaction (qPCR) performed against multi-copy (rRNA) and single-(tubulin) gene targets. The spore isolation technique we employed was verified to be pure by light microscopy. Although all preparatory methods led to successful detection by qPCR, S. chartarum spore DNA prepared using the Qiagen Plant kit was notably better over the extraction range.

  7. Summary of a workshop on nonclinical and clinical immunotoxicity assessment of immunomodulatory drugs.

    PubMed

    Piccotti, Joseph R; Lebrec, Herve N; Evans, Ellen; Herzyk, Danuta J; Hastings, Kenneth L; Burns-Naas, Leigh Ann; Gourley, Ian S; Wierda, Daniel; Kawabata, Thomas T

    2009-03-01

    The number of anti-inflammatory and immunomodulatory drugs being developed in the pharmaceutical industry has increased considerably in the past decade. This increase in research and development has been paralleled by questions from both regulatory agencies and industry on how best to assess decreased host resistance to infections or adverse immunostimulation caused by immunomodulatory agents such as anti-cytokine antibodies (e.g., the tumor necrosis factor-alpha inhibitors), anti-adhesion molecule antibodies (e.g., anti-alpha-4 integrin inhibitors) and immunostimulatory molecules (e.g., anti-CD28 antibodies). Although several methods have been developed for nonclinical assessment of immunotoxicity, highly publicized adverse events have brought to light significant gaps in the application of nonclinical immunotoxicity testing in assessing potential risk in humans. Confounding this problem is inconsistent application of immunotoxicology methods for risk assessment within the scientific community, limited understanding of appropriate immunotoxicity testing strategy for immunomodulators and inconsistent testing requests by regulatory agencies. To address these concerns, The Immunotoxicology Technical Committee (ITC) of the International Life Science Institute (ILSI) Health and Environmental Sciences Institute (HESI) organized a workshop on Immunomodulators and Clinical Immunotoxicology in May 2007. The Workshop was convened to identify key gaps in nonclinical and clinical immunotoxicity testing of anti-inflammatory and immunomodulatory agents and to begin to develop consistent approaches for immunotoxicity testing and risk assessment. This paper summarizes the outcome of the HESI ITC Immunomodulators and Clinical Immunotoxicology Workshop. Topics not discussed at the Workshop were outside the scope of this report. Although more work is needed to develop consistent approaches for immunotoxicity assessment of immunomodulators, this Workshop provided the foundation for

  8. Development and evaluation of the mallard duck as a model to investigate the immunotoxicity of environmental chemicals

    SciTech Connect

    Fowles, J.R.

    1993-01-01

    Studies were conducted to characterize the mallard duck (Anas platyrhyncos) as a model for evaluating the immunotoxic effects of environmental chemicals. A battery of immunotoxicity tests was validated for the mallard, including natural killer cell (NKC) activity, lymphocyte mitogenesis, antibody titers to sheep erythrocytes, peripheral differential leukocyte counts, macrophage phagocytosis and prostaglandin-E[sub 2] (PGE2) production. To investigate potential hormonal-immune axes, dexamethasone (DEX), methimazole, and thyroxine (T4) were used to study the influence of glucocorticoid excess, hypo-, and hyperthyroidism on immunity, respectively. Subsequently, the effects of polychlorinated biphenyls (PCBs, Aroclor 1254) on immune, endocrine, and hepatic cytochrome-P450 function were evaluated and interpreted using results from the endocrine/immune studies. Results of these studies showed that antibody production was susceptible to suppression by DEX at doses which also caused significant changes in clinical plasma biochemistry values. NKC activity was enhanced by exposure to DEX in vivo, a phenomenon due to the inhibition of PGE2 production by adherent peripheral blood cells by DEX and mimicked in vitro with addition of indomethacin or DEX. Macrophage phagocytosis was significantly suppressed by DEX in vitro. Macrophage production of PGE2 ex vivo was suppressed in birds treated with DEX. In contrast to DEX, T4 or methimazole treatment elicited only slight physiologic changes in plasma albumin and cholesterol levels. No immune/thyroid axis was observed in mallards. Exposure to Aroclor 1254 induced significant hepatic microsomal ethoxy- and pentoxy-resorufin-O-deethylase activities in addition to increasing total cytochrome P450 content, but did not affect immune function, plasma corticosterone, or clinical biochemistry values. Total triiodothyronine, but not T4, was dose-dependently suppressed by PCB treatment.

  9. Recurrence of Stachybotrys chartarum during mycological and toxicological study of bioaerosols collected in a dairy cattle shed.

    PubMed

    Lanier, Caroline; André, Véronique; Séguin, Virginie; Heutte, Natacha; El Kaddoumi, Anne; Bouchart, Valérie; Picquet, Rachel; Garon, David

    2012-01-01

    Agricultural occupations associated with animal breeding and the processing of animal materials in confinement systems could potentially lead to bioaerosol exposures. Moulds and mycotoxins could be constituents of bioaerosols and should be studied because of their possible involvement in respiratory diseases and cancers. In order to characterize the fungal contamination of the indoor air in a dairy barn, bioaerosols were collected during 20 days in a cattle farm located in Normandy (France). Mycobiota, mycotoxins and the mutagenicity of bioaerosols were studied. The toxigenic ability of Aspergillus flavus group and Aspergillus fumigatus isolates was also evaluated in vitro. The prevalent airborne moulds were from the following potentially toxigenic species: Aspergillus flavus group, Aspergillus fumigatus, Penicillium chrysogenum, Stachybotrys chartarum, and the allergenic species Ulocladium chartarum, Cladosporium cladosporioides. In comparison with harvesting, grain handling or broiler breeding, the concentrations of viable moulds were lower in the cattle shed. Seasonal variations in levels of several species were also observed. This study revealed that aflatoxins were detected in bioaerosols and, for the first time, showed that farmers are possibly exposed to Stachybotrys chartarum during routine barn work. Moreover, the finding of mutagenicity from bioaerosols needs further investigations on bioaerosol composition.

  10. Health assessment of gasoline and fuel oxygenate vapors: immunotoxicity evaluation.

    PubMed

    White, Kimber L; Peachee, Vanessa L; Armstrong, Sarah R; Twerdok, Lorraine E; Clark, Charles R; Schreiner, Ceinwen A

    2014-11-01

    Female Sprague Dawley rats were exposed via inhalation to vapor condensates of either gasoline or gasoline combined with various fuel oxygenates to assess potential immunotoxicity of evaporative emissions. Test articles included vapor condensates prepared from "baseline gasoline" (BGVC), or gasoline combined with methyl tertiary butyl ether (G/MTBE), ethyl t-butyl ether (G/ETBE), t-amyl methyl ether (G/TAME), diisopropyl ether (G/DIPE), ethanol (G/EtOH), or t-butyl alcohol (G/TBA). Target concentrations were 0, 2000, 10,000 or 20,000mg/mg(3) administered for 6h/day, 5days/week for 4weeks. The antibody-forming cell (AFC) response to the T-dependent antigen, sheep erythrocyte (sRBC), was used to determine the effects of the gasoline vapor condensates on the humoral components of the immune system. Exposure to BGVC, G/MTBE, G/TAME, and G/TBA did not result in significant changes in the IgM AFC response to sRBC, when evaluated as either specific activity (AFC/10(6) spleen cells) or as total spleen activity (AFC/spleen). Exposure to G/EtOH and G/DIPE resulted in a dose-dependent decrease in the AFC response, reaching the level of statistical significance only at the high 20,000mg/m(3) level. Exposure to G/ETBE resulted in a statistically significant decrease in the AFC response at the middle (10,000mg/m(3)) and high (20,000mg/m(3)) exposure concentrations. Copyright © 2014 Elsevier Inc. All rights reserved.

  11. Immunotoxic effects of environmental pollutants in marine mammals.

    PubMed

    Desforges, Jean-Pierre W; Sonne, Christian; Levin, Milton; Siebert, Ursula; De Guise, Sylvain; Dietz, Rune

    2016-01-01

    immune function in marine mammals exposed to environmental contaminants. Exposure to immunotoxic contaminants may have significant population level consequences as a contributing factor to increasing anthropogenic stress in wildlife and infectious disease outbreaks.

  12. ENVIRONMENTAL POLLUTION AND THE IMMUNE SYSTEM: MECHANISMS OF IMMUNOTOXICITY ACROSS PHYLA

    EPA Science Inventory

    Environmental pollution and the immune system: Mechanisms of immunotoxicity across phyla. Bob Luebke and Dori Germolec, US EPA, RTP, NC and NIEHS, RTP, NC

    Our current understanding of immunotoxicology comes largely from studies done in rodents or using in vitro systems, a...

  13. Immunotoxicity testing: Implementation of mechanistic understanding, key pathways of toxicological concern and components of these pathways.

    EPA Science Inventory

    At present, several animal-based assays are used to assess immunotoxic effects such as immunosuppression and sensitization. Growing societal and ethical concerns, European legislation and current research demands by industry are driving animal-based toxicity testing towards new a...

  14. ENVIRONMENTAL POLLUTION AND THE IMMUNE SYSTEM: MECHANISMS OF IMMUNOTOXICITY ACROSS PHYLA

    EPA Science Inventory

    Environmental pollution and the immune system: Mechanisms of immunotoxicity across phyla. Bob Luebke and Dori Germolec, US EPA, RTP, NC and NIEHS, RTP, NC

    Our current understanding of immunotoxicology comes largely from studies done in rodents or using in vitro systems, a...

  15. Immunotoxicity testing: Implementation of mechanistic understanding, key pathways of toxicological concern and components of these pathways.

    EPA Science Inventory

    At present, several animal-based assays are used to assess immunotoxic effects such as immunosuppression and sensitization. Growing societal and ethical concerns, European legislation and current research demands by industry are driving animal-based toxicity testing towards new a...

  16. Hebb-Williams performance and scopolamine challenge in rats with partial immunotoxic hippocampal cholinergic deafferentation.

    PubMed

    Marques Pereira, Patricia; Cosquer, Brigitte; Schimchowitsch, Sarah; Cassel, Jean-Christophe

    2005-01-15

    Recent studies suggested that the cholinergic innervation of the hippocampus is not crucial for spatial learning, but it might be important for other forms of learning. This study assessed the effects of partial immunotoxic cholinergic lesions in the medial septum and concurrent scopolamine challenge in a complex learning task, the Hebb-Williams maze. Long-Evans rats were given intraseptal injections of 192 IgG-saporin (SAPO). Rats injected with phosphate-buffered saline (PBS) served as controls. Starting 25 days after surgery, behavioural performance was assessed in the Hebb-Williams maze test without prior or after injection of scopolamine (0.17 or 0.5 mg/kg, i.p.). In SAPO rats, histochemical analysis showed a 40-45% decrease in the density of hippocampal AChE staining. The number of ChAT-positive cell bodies in the medial septum was also significantly decreased (-56%) and there was a non-significant reduction of the number of parvalbumine-positive neurons. The behavioural results demonstrated that the lesions induced small but significant learning deficits. At 0.17 mg/kg, scopolamine produced more impairments in SAPO rats than in PBS-injected rats, suggesting an additive effect between the partial lesion and the drug. These observations indicate that the Hebb-Williams test may be more sensitive to alterations of septohippocampal cholinergic function, than radial- or water-maze tasks. They also show that subtle learning deficits can be detected after partial lesions of the cholinergic septohippocampal pathways. Finally, the data from the scopolamine challenge are in keeping with clinical results showing higher sensitivity to muscarinic blockade in aged subjects in whom weaker cholinergic functions can be presumed.

  17. Immunotoxicity of dibromoacetic acid administered via drinking water to female B₆C₃F₁ mice.

    PubMed

    Smith, Matthew J; Germolec, Dori R; Luebke, Robert W; Sheth, Christopher M; Auttachoat, Wimolnut; Guo, Tai L; White, Kimber L

    2010-01-01

    Dibromoacetic acid (DBA) is a disinfection by-product commonly found in drinking water as a result of chlorination/ ozonation processes. The Environmental Protection Agency estimates that more than 200 million people consume disinfected water in the United States. This study was conducted to evaluate the potential immunotoxicological effects of DBA exposure when administered for 28 days via drinking water to B₆C₃F₁ mice, at concentrations of 125, 500, and 1000 mg/L. Multiple endpoints were evaluated to assess innate, humoral, and cell-mediated immune components, as well as host resistance. Standard toxicological parameters were unaffected, with the exception of a dose-responsive increase in liver weight and a decrease in thymus weight at the two highest exposure levels. Splenocyte differentials were affected, although the effects were not dose-responsive. Exposure to DBA did not significantly affect humoral immunity (immunoglobulin M [IgM] plaque assay and serum IgM anti-sheep erythrocyte titers) or cell-mediated immunity (mixed-leukocyte response). No effects were observed on innate immune function in either interferon-γ-induced in vitro macrophage cytotoxic activity or basal natural killer (NK)-cell activity. Augmented NK-cell activity (following exposure to polyinosinic-polycytidylic acid) was decreased at the low dose, however the effect was not dose-responsive. Finally, DBA exposure had no effect on resistance to infection with either Streptococcus pneumoniae or Plasmodium yoelii, or challenge with B16F10 melanoma cells. With the exception of changes in thymus weight, these results indicate that DBA exposure resulted in no immunotoxic effects at concentrations much larger than those considered acceptable in human drinking water.

  18. Vitamin C Modulates the Immunotoxic Effect of 17α-Methyltestosterone in Nile Tilapia.

    PubMed

    Abo-Al-Ela, Haitham G; El-Nahas, Abeer F; Mahmoud, Shawky; Ibrahim, Essam M

    2017-04-11

    The synthetic androgen 17α-methyltestosterone (MT) is profusely used and practically needed in the production of all-male Nile tilapia fry; however, such androgenic hormones badly disrupt the immune system. This study aimed to alleviate or counteract the immunotoxic effect of MT using vitamin C (ascorbic acid or vit C). Our results show that the highest phagocytic activity (PA), phagocytic index (PI), and lysozyme activity were detected in the vit C group and the MT plus vit C group. Furthermore, PA and PI were significantly suppressed, but lysozyme activity was stronger in the MT group than in the control. No differences were detected in the differential leukocyte count among the studied groups. Moreover, vit C obviously reduced the upregulated expression level of the innate immune-related genes, interleukin 1β (il1β), interleukin 8 (il8), tumor necrosis factor α (tnfα), CC-chemokine, Toll-like receptor 7 (tlr7), immunoglobulin M (IgM) heavy chain, and cellular apoptosis susceptibility (cas) induced by MT, excluding tnfα in the liver and CC-chemokine and tlr7 in the kidney. The micronucleus frequency was found to significantly improve in the vit C plus MT group in comparison to that in the MT group. Normal histoarchitecture of the liver, kidney, and spleen was observed in all the groups, except for the frequently observed melanomacrophage centers in the spleen and kidney of the fish that were treated with vit C and vit C plus MT. More importantly, our findings demonstrate that the upregulation of immune-related genes is not necessarily a sign of a stimulated or enhanced immune system.

  19. Stachybotrysins A-G, Phenylspirodrimane Derivatives from the Fungus Stachybotrys chartarum.

    PubMed

    Zhao, Jinlian; Feng, Jiamin; Tan, Zhen; Liu, Jimei; Zhao, Jianyuan; Chen, Ridao; Xie, Kebo; Zhang, Dewu; Li, Yan; Yu, Liyan; Chen, Xiaoguang; Dai, Jungui

    2017-06-23

    Seven new phenylspirodrimane derivatives named stachybotrysins A-G (2-8), together with five known compounds (1, 9-12), were isolated from Stachybotrys chartarum CGMCC 3.5365. Stachybotrysin D (5) is the first reported example of a naturally occurring alcoholic O-sulfation of a phenylspirodrimane, and stachybotrysins F and G (7 and 8) are the first examples possessing an isobenzotetrahydrofuran ring with an acetonyl moiety attached. The structures of these compounds were elucidated on the basis of extensive spectroscopic data analysis and by comparison with reported data. The absolute configurations of 1-8 were determined by X-ray single-crystal diffraction, electronic circular dichroism (ECD), and calculated ECD. Compounds 1 and 8 displayed anti-HIV activity with IC50 values of 15.6 and 18.1 μM, respectively, and 2, 7, 9, and 11 showed inhibitory effect on influenza A virus with IC50 values ranging from 12.4 to 18.9 μM.

  20. Acute pulmonary hemorrhage during isoflurane anesthesia in two cats exposed to toxic black mold (Stachybotrys chartarum).

    PubMed

    Mader, Douglas R; Yike, Iwona; Distler, Anne M; Dearborn, Dorr G

    2007-09-01

    Acute pulmonary hemorrhage developed during isoflurane anesthesia in 2 Himalayan cats undergoing routine dental cleaning and prophylaxis. The cats were siblings and lived together. In both cats, results of pre-operative physical examinations and laboratory testing were unremarkable. Blood pressure and oxygen saturation were within reference ranges throughout the dental procedure. Approximately 15 to 20 minutes after administration of isoflurane was begun, frothy blood was noticed within the endotracheal tube. Blood was suctioned from the endotracheal tube, and the cats were allowed to recover from anesthesia. 1 cat initially responded to supportive care but developed a second episode of spontaneous pulmonary hemorrhage approximately 30 hours later and died. The other cat responded to supportive care and was discharged after 4 days, but its condition deteriorated, and the cat died 10 days later. Subsequently, it was discovered that the home was severely contaminated with mold as a result of storm damage that had occurred approximately 7 months previously. Retrospective analysis of banked serum from the cats revealed satratoxin G, a biomarker for Stachybotrys chartarum, commonly referred to as "toxic black mold." Findings highlight the potential risk of acute pulmonary hemorrhage in animals living in an environment contaminated with mold following flood damage.

  1. Acute inflammatory responses to Stachybotrys chartarum in the lungs of infant rats: time course and possible mechanisms.

    PubMed

    Yike, Iwona; Rand, Thomas G; Dearborn, Dorr G

    2005-04-01

    Stachybotrys chartarum has been linked to building-related respiratory problems including pulmonary hemorrhage in infants. The macrocyclic trichothecenes produced by S. chartarum have been the primary focus of many investigations. However, in addition to trichothecenes this fungus is capable of producing other secondary metabolites and a number of protein factors. This study examines the effects of intact, autoclaved, and ethanol-extracted spores on the lungs of infant rats as an approach to differentiate between secondary metabolites and protein factors. Seven-day-old infant rats were exposed intratracheally to 1 x 10(5) spores/g body weight (toxic strain JS58-17) and sacrificed at various times up to 72 h. The inflammatory response was measured by morphometric analysis of the lungs and determination of inflammatory cells and cytokine concentrations in bronchoalveolar lavage (BAL) fluid. Alveolar space was greatly reduced in animals exposed to fungal spores compared to phosphate buffered saline (PBS)-treated controls. The largest effects were observed in pups treated with intact spores where alveolar space 24 h after treatment was 42.1% compared to 56.8% for autoclaved spores, 51.1% for ethanol-extracted spores, and 60.6% for PBS-treated controls. The effects of different spore preparations on inflammatory cells, cytokine, and protein concentrations in the BAL fluid can be ranked as intact > autoclaved > extracted. Tumor necrosis factor alfa (TNF-alpha), interleukin 1-beta (IL-1beta), and neutrophils were the most sensitive indicators of inflammation. The difference between autoclaved (100% trichothecene toxicity, denatured/enzymatically inactive proteins) and intact (100% trichothecene activity, unaltered/released proteins) spores indicates the involvement of fungal proteins in the inflammatory response to S. chartarum and sheds new light on the clinical importance of "nontoxic" strains.

  2. Characterization of human antigenic proteins SchS21 and SchS34 from Stachybotrys chartarum.

    PubMed

    Shi, Chunhua; Smith, Myron L; Miller, J David

    2011-01-01

    SchS21 and SchS34 are proteins from Stachybotrys chartarum sensu latto that are antigenic in goats, mice and humans. Monoclonal antibodies to these proteins react with spores of S. chartarum and S. chlorohalonata but do not cross-react with a diverse taxonomic and ecological array of other fungi. Based on partial sequences of the 21- and 34-kDa proteins, obtained from tandem mass spectra and Edman degradation, degenerate primers were designed for touchdown PCR and the resulting amplicons were sequenced. Subsequently, inverse-PCR was used to obtain genomic DNA sequences encoding SchS21 and SchS34. RT-PCR products were sequenced to predict the mature protein sequences of SchS21 and SchS34. Based on the speculation that SchS21 protein was a DNase, the enzymatic properties were investigated. Sequences of 435 and 666 bp in length were obtained from SchS21 and SchS34 cDNAs. The SchS21 open reading frame encodes a mature protein of 144 amino acids, while that of SchS34 is 221 amino acids in length. SchS21 is a secretory, alkaline, Mg-dependent exodeoxyribonuclease, while SchS34 is a secretory protein of unknown function. His-tagged forms of the mature SchS21 and SchS34 proteins were separately overexpressed in Escherichia coli and purified using Ni-NTA columns (0.5 mg/l yield). Based on Western blots, the expressed proteins were similar in molecular weight and bound to the respective monoclonal antibodies to SchS21 and SchS34 proteins from S. chartarum. Interactions with human sera IgE confirmed the expressed forms of SchS21 and SchS34 as naturally occurring allergens. Copyright © 2010 S. Karger AG, Basel.

  3. Characterization of monoclonal antibodies to an antigenic protein from Stachybotrys chartarum and its measurement in house dust.

    PubMed

    Xu, Jianping; Liang, Yinan; Belisle, Donald; Miller, J David

    2008-03-20

    Using sera from atopic patients we have isolated an extracellular protein, which is antigenic in humans, from Stachybotrys chartarum sesu lato. Here we report the production of monoclonal antibodies to the protein and the development of a sensitive and specific assay to the target protein as well as analyses in house dust samples spiked with spores. The detection limit for the target antigen in house dust was approximately 0.2 ng/g dry weight house dust. This detection limit is comparable to those for house dust mite allergen and the allergen of the fungus Aspergillus fumigatus but lower than that for the fungus Alternaria alternata.

  4. Immunotoxic effects of thymus in mice following exposure to nanoparticulate TiO2.

    PubMed

    Hong, Fashui; Zhou, Yaoming; Zhou, Yingjun; Wang, Ling

    2017-10-01

    Titanium dioxide nanoparticles (TiO2 NPs) have been extensively used in industry, medicine, and daily life, and have shown potential toxic effects for animals or humans. We noted that the effects of TiO2 NPs on the immune system and its mechanism of action in animals or humans have not been elucidated. Thus, mice were exposed to the TiO2 NPs (0, 1.25, 2.5, or 5 mg kg(-1) body weight) for 9 consecutive months. Exposure to TiO2 NPs was accumulated in the thymus, leading to a decrease in body weight and increases in the weight of the thymus or thymus indices. In the blood, exposure to TiO2 NPs significantly decreased white blood cell, red blood cell, reticulocyte, haemoglobin, and mean corpuscular haemoglobin concentration; and increased mean corpuscular volume, mean corpuscular haemoglobin, platelets, and mean platelet volume. The reductions of lymphocyte subsets, including CD3+, CD4+, CD8+, B cell, and natural killer cell, were observed in the TiO2 NP-treated mouse thymus. Appearance of starry-sky aspect of the cortex that is given by the body of macrophages, bleeding, severe hemolysis or congestion, fatty degeneration, and cell apoptosis or necrosis were observed in the thymus following TiO2 NPs exposure. Importantly, TiO2 NPs increased expression of nucleic factor-κB(NF-κB), IκB kinase1/2, interleukin-1β, interleukin -4, regulated upon activation normal T-cell expressed and secreted, cyclooxygenase 2, neutrophil gelatinase-associated lipocalin, purinergic receptors-7, interferon-inducible protein 10, hypoxia inducible factor 1-α, p-c-Jun N-terminal kinase, p-p38, and p-extracellular signal-regulated kinase 1/2 protein, respectively; whereas suppressed expression of IκB, peroxisome proliferater-activated receptor-γ, trefoil factor 1, peroxisome proliferator activated receptor gamma coactivator-1α, and prostaglandin E2 proteins in the thymus, respectively. Taken together, these results suggest that TiO2 NPs exerts toxic effects on lymphoid organs and T cell

  5. Satratoxin G from the Black Mold Stachybotrys chartarum Evokes Olfactory Sensory Neuron Loss and Inflammation in the Murine Nose and Brain

    PubMed Central

    Islam, Zahidul; Harkema, Jack R.; Pestka, James J.

    2006-01-01

    Satratoxin G (SG) is a macrocyclic trichothecene mycotoxin produced by Stachybotrys chartarum, the “black mold” suggested to contribute etiologically to illnesses associated with water-damaged buildings. Using an intranasal instillation model in mice, we found that acute SG exposure specifically induced apoptosis of olfactory sensory neurons (OSNs) in the olfactory epithelium. Dose–response analysis revealed that the no-effect and lowest-effect levels at 24 hr postinstillation (PI) were 5 and 25 μg/kg body weight (bw) SG, respectively, with severity increasing with dose. Apoptosis of OSNs was identified using immunohistochemistry for caspase-3 expression, electron microscopy for ultrastructural cellular morphology, and real-time polymerase chain reaction for elevated expression of the proapoptotic genes Fas, FasL, p75NGFR, p53, Bax, caspase-3, and CAD. Time-course studies with a single instillation of SG (500 μg/kg bw) indicated that maximum atrophy of the olfactory epithelium occurred at 3 days PI. Exposure to lower doses (100 μg/kg bw) for 5 consecutive days resulted in similar atrophy and apoptosis, suggesting that in the short term, these effects are cumulative. SG also induced an acute, neutrophilic rhinitis as early as 24 hr PI. Elevated mRNA expression for the proinflammatory cytokines tumor necrosis factor-α, interleukin-6 (IL-6), and IL-1 and the chemokine macrophage-inflammatory protein-2 (MIP-2) were detected at 24 hr PI in both the ethmoid turbinates of the nasal airways and the adjacent olfactory bulb of the brain. Marked atrophy of the olfactory nerve and glomerular layers of the olfactory bulb was also detectable by 7 days PI along with mild neutrophilic encephalitis. These findings suggest that neurotoxicity and inflammation within the nose and brain are potential adverse health effects of exposure to satratoxins and Stachybotrys in the indoor air of water-damaged buildings. PMID:16835065

  6. Satratoxin G from the black mold Stachybotrys chartarum evokes olfactory sensory neuron loss and inflammation in the murine nose and brain.

    PubMed

    Islam, Zahidul; Harkema, Jack R; Pestka, James J

    2006-07-01

    Satratoxin G (SG) is a macrocyclic trichothecene mycotoxin produced by Stachybotrys chartarum, the "black mold" suggested to contribute etiologically to illnesses associated with water-damaged buildings. Using an intranasal instillation model in mice, we found that acute SG exposure specifically induced apoptosis of olfactory sensory neurons (OSNs) in the olfactory epithelium. Dose-response analysis revealed that the no-effect and lowest-effect levels at 24 hr postinstillation (PI) were 5 and 25 microg/kg body weight (bw) SG, respectively, with severity increasing with dose. Apoptosis of OSNs was identified using immunohistochemistry for caspase-3 expression, electron microscopy for ultrastructural cellular morphology, and real-time polymerase chain reaction for elevated expression of the proapoptotic genes Fas, FasL, p75NGFR, p53, Bax, caspase-3, and CAD. Time-course studies with a single instillation of SG (500 microg/kg bw) indicated that maximum atrophy of the olfactory epithelium occurred at 3 days PI. Exposure to lower doses (100 microg/kg bw) for 5 consecutive days resulted in similar atrophy and apoptosis, suggesting that in the short term, these effects are cumulative. SG also induced an acute, neutrophilic rhinitis as early as 24 hr PI. Elevated mRNA expression for the proinflammatory cytokines tumor necrosis factor-alpha, interleukin-6 (IL-6) , and IL-1 and the chemokine macrophage-inflammatory protein-2 (MIP-2) were detected at 24 hr PI in both the ethmoid turbinates of the nasal airways and the adjacent olfactory bulb of the brain. Marked atrophy of the olfactory nerve and glomerular layers of the olfactory bulb was also detectable by 7 days PI along with mild neutrophilic encephalitis. These findings suggest that neurotoxicity and inflammation within the nose and brain are potential adverse health effects of exposure to satratoxins and Stachybotrys in the indoor air of water-damaged buildings.

  7. Role of alterations in Ca{sup 2+}-associated signaling pathways in the immunotoxicity of polycyclic aromatic hydrocarbons

    SciTech Connect

    Davila, D.R.; Davs, D.P.; Campbell, K.

    1995-08-01

    Polycyclic aromatic hydrocarbons (PAHs) are an important class of environmental pollutants that are known to be carcinogenic and immunotoxic. The effects of PAHs on the immune system of various animals and models have been studied for at least 30 yr. Despite these efforts, the mechanism or mechanisms by which PAHs exert their effects on the immune system are still largely unknown. During recent years, the molecular events associated with lymphocyte activation and receptor-mediated signaling have become increasingly clear. Substantial progress has been made in understanding the molecular and cellular bases for toxicant-induced immune cell injury. Understanding mechanisms of drug or chemical effects on the immune system is an important area of research in the field of immunotoxicology, and indeed in all fields of toxicology. Mechanistic toxicology plays an important role in risk assessment and extrapolation of potential human health effects. In this review, we have summarized recent evidence that has examined the effects of PAHs on the immune system of animals and humans. In particular, we have focused on the effects of PAHs on cell signaling in lymphoid cells and have examined the hypothesis that PAHs alter lymphocyte activation via calcium-dependent mechanisms. Previously published reports are discussed, and new data obtained with murine B cells and cell lines are presented demonstrating the relationship between alterations in intracellular calcium and immune dysregulation. These data demonstrate a strong association between PAH-induced alterations in B- and T-lymphocyte activation and changes in calcium homeostasis. 111 refs., 6 figs., 1 tab.

  8. Immunotoxicity activity of sesquiterpenoids from black galingale (Kaempferia parviflora Wall. Ex. Baker) against Aedes aegypti L.

    PubMed

    Moon, Hyung-In; Cho, Sang-Buem; Lee, Jun-Hyeong; Paik, Hyun-Dong; Kim, Soo-Ki

    2011-06-01

    The roots of black galingale (Kaempferia parviflora) were chloroform-extracted and the isolated two sesquiterpene and immunotoxicity effects were studied. The structures and stereochemistry of these compounds were established on the basis of analysis of spectra including UV, MS, (1)H-NMR, and (13)C-NMR as follows: 1 (4α-acetoxycadina-2,9-diene-1,8-dione), 2 (1α,3α,4β-trihydroxy-9-cadinen-8-one). Compound 2 had a significant toxic effect against early fourth-stage larvae of Aedes aegypti L. with an LC(50) value of 0.7 μM and an LC(90) value of 3.8 μM. The results could be useful in search for newer, safer, and more effective natural immunotoxicity agents against A. aegypti.

  9. Biological Responses of Raw 264.7 Macrophage Exposed to Two Strains of Stachybotrys chartarum Spores Grown on Four Different Wallboard Types

    EPA Science Inventory

    The focus of this research was to provide a better understanding of the health impacts caused by Stachybotrys chartarum (Houston and 51-11) spores grown on four gypsum products two of which were resistant to microbes. Raw 264.7 cells were exposed to whole spores and fragmented 51...

  10. SOLVENT COMPARISON IN THE ISOLATION, SOLUBILIZATION, AND TOXICITY OF STACHYBOTRYS CHARTARUM SPORE TRICHOTHECENE MYCOTOXINS IN AN ESTABLISHED IN VITRO LUMINESCENCE PROTEIN TRANSLATION INHIBITION ASSAY

    EPA Science Inventory

    It is well known that non-viable mold contaminants such as macrocyclic trichothecene mycotoxins of Stachybotrys chartarum are highly toxinigenic to humans. However, there is no agreed upon method of recovering native mycotoxin. The purpose of this study was to provide quantitativ...

  11. Biological Responses of Raw 264.7 Macrophage Exposed to Two Strains of Stachybotrys chartarum Spores Grown on Four Different Wallboard Types

    EPA Science Inventory

    The focus of this research was to provide a better understanding of the health impacts caused by Stachybotrys chartarum (Houston and 51-11) spores grown on four gypsum products two of which were resistant to microbes. Raw 264.7 cells were exposed to whole spores and fragmented 51...

  12. SOLVENT COMPARISON IN THE ISOLATION, SOLUBILIZATION, AND TOXICITY OF STACHYBOTRYS CHARTARUM SPORE TRICHOTHECENE MYCOTOXINS IN AN ESTABLISHED IN VITRO LUMINESCENCE PROTEIN TRANSLATION INHIBITION ASSAY

    EPA Science Inventory

    It is well known that non-viable mold contaminants such as macrocyclic trichothecene mycotoxins of Stachybotrys chartarum are highly toxinigenic to humans. However, there is no agreed upon method of recovering native mycotoxin. The purpose of this study was to provide quantitativ...

  13. The influence of water activity and temperature on germination, growth and sporulation of Stachybotrys chartarum strains.

    PubMed

    Frazer, Schale; Magan, Naresh; Aldred, David

    2011-07-01

    The objectives were to determine the influence of water activity (a(w), 0.997-0.92) and temperature (10-37°C) and their interactions on conidial germination, mycelial growth and sporulation of two strains of Stachybotrys chartarum in vitro on a potato dextrose medium. Studies were carried out by modifying the medium with glycerol and either spread plating with conidia to evaluate germination and germ tube extension or centrally inoculating treatment media for measuring mycelial growth rates and harvesting whole colonies for determining sporulation. Overall, germination of conidia was significantly influenced by a(w) and temperature and was fastest at 0.997-0.98 a(w) between 15 and 30°C with complete germination within 24 h. Germ tube extension was found to be most rapid at similar a(w) levels and 25-30°C. Mycelial growth rates of both strains were optimal at 0.997 a(w) between 25 and 30°C, with very little growth at 37°C. Sporulation was optimum at 30°C at 0.997 a(w). However, under drier conditions, this was optimum at 25°C. This shows that there are differences in the ranges of a(w) x temperature for germination and growth and for sporulation. This may help in understanding the role of this fungal species in damp buildings and conditions under which immune-compromised patients may be at risk when exposed to such contaminants in the indoor air environment.

  14. 'Fluorescent Cell Chip' for immunotoxicity testing: Development of the c-fos expression reporter cell lines

    SciTech Connect

    Trzaska, Dominika; Zembek, Patrycja; Olszewski, Maciej; Adamczewska, Violetta; Ulleras, Erik; Dastych, JarosIaw . E-mail: jdastych@cbm.pan.pl

    2005-09-01

    The Fluorescent Cell Chip for in vitro immunotoxicity testing employs cell lines derived from lymphocytes, mast cells, and monocytes-macrophages transfected with various EGFP cytokine reporter gene constructs. While cytokine expression is a valid endpoint for in vitro immunotoxicity screening, additional marker for the immediate-early response gene expression level could be of interest for further development and refinement of the Fluorescent Cell Chip. We have used BW.5147.3 murine thymoma transfected with c-fos reporter constructs to obtain reporter cell lines expressing ECFP under the control of murine c-fos promoter. These cells upon serum withdrawal and readdition and incubation with heavy metal compounds showed paralleled induction of c-Fos expression as evidenced by Real-Time PCR and ECFP fluorescence as evidenced by computer-supported fluorescence microscopy. In conclusion, we developed fluorescent reporter cell lines that could be employed in a simple and time-efficient screening assay for possible action of chemicals on c-Fos expression in lymphocytes. The evaluation of usefulness of these cells for the Fluorescent Cell Chip-based detection of immunotoxicity will require additional testing with a larger number of chemicals.

  15. Potential preventive role of lactic acid bacteria against aflatoxin M₁ immunotoxicity and genotoxicity in mice.

    PubMed

    Ben Salah-Abbès, Jalila; Abbès, Samir; Jebali, Rania; Haous, Zohra; Oueslati, Ridha

    2015-01-01

    Aflatoxin M1 (AFM1) is a mycotoxin produced by numerous Aspergillus species in pre- or post-harvest cereals and milk. Exposure to AFM1 imparts potent economic losses in the livestock industry. Toxicologically, it also causes severe immune system problems. The aims of this study were to evaluate a new AFM1-binding/degrading microorganism for biologic detoxification, to examine its ability to degrade AFM1 in liquid medium, and to evaluate its potential for in vivo preventative effects against AFM1-induced immunotoxicity and genotoxicity in mice. Lactobacillus plantarum MON03 (LP) isolated from Tunisian artisanal butter was found to display significant binding ability to AFM1 in PBS (93%) within 24 h of incubation. Further, the LP was able to tolerate gastric acidity, bile salts, and adhere efficiently to Caco-3 cells in vitro. The in vivo study used Balb/c mice that received either vehicle (control), LP only (at 1 × 10(9)CFU/L, ∼1 mg/kg bw), AFM1 (100 mg/kg bw), or AFM1 + LP daily for 15 days (by gavage); two other groups received a single dose of colchicine (4 mg/kg) or mitomycin C (1 mg/kg) as positive controls for induction of micronuclei and chromosomal aberrations, respectively. The results showed that, compared to in control mice, AFM1 treatment led to significantly decreased body weight gains, and caused cytotoxic/genotoxic effects as indicated by increases in frequencies of polychromatic erythrocytes, as well as those with micronucleation (PCEMN) and chromosomal aberrations, among bone marrow cells. The concurrent administration of LP with AFM1 strongly reduced the adverse effects of AFM1 on each parameter. Mice receiving AFM1 + LP co-treatment displayed no significant differences in the assayed parameters as compared to the control mice. By itself, the bacteria caused no adverse effects. Based on the data, it is concluded that the test bacteria could potentially be beneficial in the detoxification of AFM1-contaminated foods and feeds

  16. Biomarkers of Methylmercury Exposure Immunotoxicity among Fish Consumers in Amazonian Brazil

    PubMed Central

    Fillion, Myriam; Barbosa, Fernando; Shirley, Devon L.; Chine, Chiameka; Lemire, Melanie; Mergler, Donna; Silbergeld, Ellen K.

    2011-01-01

    Background: Mercury (Hg) is a ubiquitous environmental contaminant with neurodevelopmental and immune system effects. An informative biomarker of Hg-induced immunotoxicity could aid studies on the potential contribution to immune-related health effects. Objectives: Our objectives were to test the hypothesis that methylmercury (MeHg) exposures affect levels of serum biomarkers and to examine interactions between Hg and selenium (Se) in terms of these responses. Methods: This cross-sectional epidemiological study assessed adults living along the Tapajós River, a system long affected by MeHg. We measured antinuclear (ANA) and antinucleolar (ANoA) autoantibody levels and eight cytokines in serum samples (n = 232). Total Hg (including MeHg) and Se were measured in blood, plasma, hair, and urine. Results: The median (range) total Hg concentrations were 14.1 μg/g (1.1–62.4), 53.5 μg/L (4.3–288.9), 8.8 μg/L (0.2–40), and 3.0 μg/L (0.2–16.1) for hair, blood, plasma, and urine, respectively. Elevated titers of ANA (but not ANoA) were positively associated with MeHg exposure (log-transformed, for blood and plasma), unadjusted [odds ratio (OR) = 2.6; 95% confidence interval (CI): 1.1, 6.2] and adjusted for sex and age (OR = 2.9; 95% CI: 1.1, 7.5). Proinflammatory [interleukin (IL)-6 and interferon (IFN)-©], anti-inflammatory (IL-4), and IL-17 cytokine levels were increased with MeHg exposure; however, in the subset of the population with elevated ANA, proinflammatory IL-1®, IL-6, IFN-©, and tumor necrosis factor (TNF)-〈 and anti-inflammatory (IL-4) cytokine levels were decreased with MeHg exposure. Although Se status was associated with MeHg level (correlation coefficient = 0.86; 95% CI: 0.29, 1.43), Se status was not associated with any changes in ANA and did not modify associations between Hg and ANA titers. Conclusions: MeHg exposure was associated with an increased ANA and changes in serum cytokine profile. Moreover, alterations in serum cytokine profiles

  17. Differential immunotoxic effects of ethanol on murine EL-4 lymphoma and normal lymphocytes is mediated through increased ROS production and activation of p38MAPK.

    PubMed

    Premachandran, Sudha; Khan, Nazir M; Thakur, Vikas S; Shukla, Jyoti; Poduval, T B

    2012-08-01

    Ethanol has been used to achieve thymic depletion in myasthenia gravis patients. Ethanol (95%) has also been used widely in the therapy of many tumors including hepatocellular carcinoma. In light of these findings, we delineated the differential immunotoxic behavior and mechanism of lower concentration of ethanol towards murine EL-4 lymphoma and its normal counterpart lymphocytes. EL-4 lymphoma and normal lymphocytes were cultured with ethanol (0%-5%) for 6 h and cytotoxicity was measured by various methods. EL-4 cells treated with ethanol showed concentration-dependent loss of viability at 2%-5% ethanol concentration and exhibit proliferative arrest at preG1 stage. Acridine-orange and ethidium-bromide staining indicated that ethanol induced death in EL-4 cells, by induction of both apoptosis and necrosis which was further supported by findings of DNA-fragmentation and trypan blue dye exclusion test. However, treatment of lymphocytes with similar concentration of ethanol did not show any death-associated parameters. Furthermore, ethanol induced significantly higher ROS generation in EL-4 cells as compared to lymphocytes and caused PARP cleavage and activation of apoptotic proteins like p53 and Bax, in EL-4 cells and not in normal lymphocytes. In addition, ethanol exposure to EL-4 cells led to phosphorylation of p38MAPK, and upregulation of death receptor Fas (CD95). Taken together, these results suggest that ethanol upto a concentration of 5% caused no significant immunotoxicity towards normal lymphocytes and induced cell death in EL-4 cells via phosphorylation of p38MAPK and regulation of p53 leading to further activation of both extrinsic (Fas) and intrinsic (Bax) apoptotic markers.

  18. Immunotoxic effects of single and combined pharmaceuticals exposure on a harbor seal (Phoca vitulina) B lymphoma cell line.

    PubMed

    Kleinert, Christine; Lacaze, Emilie; Mounier, Méryl; De Guise, Sylvain; Fournier, Michel

    2017-03-02

    The potential risk of pharmaceuticals in the environment to top-predators is still largely unknown. In this study, we assessed the immunotoxic effects of ten pharmaceuticals individually and as mixtures on a harbor seal (Phoca vitulina) B lymphoma cell line. A significant reduction in lymphocyte transformation was observed following an exposure to 12,500μg/L 17α-ethinyl estradiol and 25,000μg/L naproxen. Exposure to 12,500μg/L 17α-ethinyl estradiol decreased the percentage of cell in the G0/G1 phase of the cell cycle while increasing the percentage of cells in the S phase. Carbamazepine exposure increased the amount of cells in the G2/M phase. Binary mixtures showed synergistic effects in lymphocyte transformation, cell cycle and apoptosis assays. Concentrations inducing toxic effects in the cell line were similar to those affecting fish in previous studies. A reduction of functional activities of the immune system may lead to altered host resistance to pathogens in free-ranging pinnipeds.

  19. The effect of ozonization on furniture dust: microbial content and immunotoxicity in vitro.

    PubMed

    Huttunen, Kati; Kauhanen, Eeva; Meklin, Teija; Vepsäläinen, Asko; Hirvonen, Maija-Riitta; Hyvärinen, Anne; Nevalainen, Aino

    2010-05-01

    Moisture and mold problems in buildings contaminate also the furniture and other movable property. If cleaning of the contaminated furniture is neglected, it may continue to cause problems to the occupants even after the moisture-damage repairs. The aim of this study was to determine the effectiveness of high-efficiency ozone treatment in cleaning of the furniture from moisture-damaged buildings. In addition, the effectiveness of two cleaning methods was compared. Samples were vacuumed from the padded areas before and after the treatment. The microbial flora and concentrations in the dust sample were determined by quantitative cultivation and QPCR-methods. The immunotoxic potential of the dust samples was analyzed by measuring effects on cell viability and production of inflammatory mediators in vitro. Concentrations of viable microbes decreased significantly in most of the samples after cleaning. Cleaning with combined steam wash and ozonisation was more effective method than ozonising alone, but the difference was not statistically significant. Detection of fungal species with PCR showed a slight but nonsignificant decrease in concentrations after the cleaning. The immunotoxic potential of the collected dust decreased significantly in most of the samples. However, in a small subgroup of samples, increased concentrations of microbes and immunotoxicological activity were detected. This study shows that a transportable cleaning unit with high-efficiency ozonising is in most cases effective in decreasing the concentrations of viable microbes and immunotoxicological activity of the furniture dust. However, the method does not destroy or remove all fungal material present in the dust, as detected with QPCR analysis, and in some cases the cleaning procedure may increase the microbial concentrations and immunotoxicity of the dust.

  20. Toxicogenomic Profiles in Relation to Maternal Immunotoxic Exposure and Immune Functionality in Newborns

    PubMed Central

    Hochstenbach, Kevin

    2012-01-01

    A crucial period for the development of the immune system occurs in utero. This results in a high fetal vulnerability to immunotoxic exposure, and indeed, immunotoxic effects have been reported, demonstrating negative effects on immune-related health outcomes and immune functionality. Within the NewGeneris cohort BraMat, a subcohort of the Norwegian Mother and Child Cohort Study (MoBa), immunotoxicity was demonstrated for polychlorinated biphenyls and dioxins, showing associations between estimated maternal intake levels and reduced measles vaccination responses in the offspring at the age of 3. The present study aimed to investigate this link at the transcriptomic level within the same BraMat cohort. To this end, whole-genome gene expression in cord blood was investigated and found to be associated with maternal Food Frequency Questionnaires–derived exposure estimates and with vaccination responses in children at 3 years of age. Because the literature reports gender specificity in the innate, humoral, and cell-mediated responses to viral vaccines, separate analysis for males and females was conducted. Separate gene sets for male and female neonates were identified, comprising genes significantly correlating with both 2,3,7,8-tetrachlorodibenzodioxin (TCDD) and polychlorinated biphenyls (PCB) exposure and with measles vaccination response. Noteworthy, genes correlating negatively with exposure in general show positive correlations with antibody levels and vice versa. For both sexes, these included immune-related genes, suggesting immunosuppressive effects of maternal exposure to TCDD and PCB at the transcriptomic level in neonates in relation to measles vaccination response 3 years later. PMID:22738990

  1. Immunotoxicity and genotoxicity testing for in-flight experiments under microgravity

    NASA Astrophysics Data System (ADS)

    Hansen, Peter-Diedrich; Hansen, Peter-Diedrich; Unruh, Eckehardt

    Life Sciences as Related to Space (F) Influence of Spaceflight Environment on Biological Systems (F44) Immunotoxicity and genotoxicity testing for In-flight experiments under microgravity Sensing approaches for ecosystem and human health Author: Peter D. Hansen Technische Universit¨t Berlin, Faculty VI - Planen, Bauen, Umwelt, a Institute for Ecological Research and Technology, Department for Ecotoxicology, Berlin, Germany Peter-diedrich.hansen@tu-berlin.de Eckehardt Unruh Technische Universit¨t Berlin, Faculty VI - Planen, Bauen, Umwelt, Institute a for Ecological Research and Technology, Department for Ecotoxicology, Berlin, Germany An immune response by mussel hemocytes is the selective reaction to particles which are identified as foreign by its immune system shown by phagocytosis. Phagocytotic activity is based on the chemotaxis and adhesion, ingestion and phagosome formation. The attachment at the surface of the hemocytes and consequently the uptake of the particles or bacteria can be directly quantified in the format of a fluorescent assay. Another relevant endpoint of phagocytosis is oxidative burst measured by luminescence. Phagocytosis-related production of ROS will be stimulated with opsonised zymosan. The hemocytes will be stored frozen at -80oC and reconstituted in-flight for the experiment. The assay system of the TRIPLELUX-B Experiment has been performed with a well-defined quantification and evaluation of the immune function phagocytosis. The indicator cells are the hemocytes of blue mussels (Mytilus edulis). The signals of the immuno cellular responses are translated into luminescence as a rapid optical reporter system. The results expected will determine whether the observed responses are caused by microgravity and/or radiation (change in permeability, endpoints in genotoxicity: DNA unwinding). The samples for genotoxicity will be processed after returning to earth. The immune system of invertebrates has not been studied so far in space. The

  2. Comparison of immunomodulator mRNA and protein expression in the lungs of Stachybotrys chartarum spore-exposed mice.

    PubMed

    Hudson, B; Flemming, J; Sun, G; Rand, T G

    2005-08-13

    Stachybotrys chartarum is an important toxigenic fungus that has been associated with respiratory disease onset in animals and humans. It can be separated into macrocyclic trichothecene-producing and nonproducing chemotypes based on secondary metabolite production. However, effects of spores of the two chemotypes on lung inflammatory responses are poorly understood. In this study, real-time reverse-transcription polymerase chain reaction (RT-PCR) and enzyme linked immunosorbent assay (ELISA) were used to investigate time-course (1, 3, 6, 24, and 48 h post-instillation [PI]) relationships in mice intratracheally exposed to 300 spores/g body weight of a macrocyclic trichothecene-producing (JS 58-17) and a nonproducing (JS 58-06) S. chartarum isolate and of Cladosporium cladosporioides. There were marked differences in the magnitude and temporal patterns of mouse lung immune responses to intratracheal exposure to spores of these species at this spore dose. Both macrophage inflammatory protein 2 (MIP-2) and surfactant protein-D (SP-D) mRNA expression were significantly upregulated in lungs of JS 58-17-treated animals compared to that of all other treatment animals at 6 and 24 h PI. Heightened mRNA expression of these immunomodulators combined with comparatively depressed MIP-2 and tumor necrosis factor (TNF)-a protein expression suggests that the action of macrocyclic trichothecenes sequestered in 58-17 spores is involved. Interestingly, TNF-a protein expression in all spore treatment animal groups was also significantly increased over that in saline controls. Similarities in expression among all spore treatment animals suggest that chemicals other than toxic secondary metabolites, and possibly spore-sequestered 1,3-beta-D-glucan, may contribute to lung pathogenesis.

  3. Immunotoxicity of aflatoxin B1: Impairment of the cell-mediated response to vaccine antigen and modulation of cytokine expression

    SciTech Connect

    Meissonnier, Guylaine M.; Pinton, Philippe; Laffitte, Joelle; Cossalter, Anne-Marie; Gong, Yun Yun; Wild, Christopher P.; Bertin, Gerard; Galtier, Pierre; Oswald, Isabelle P.

    2008-09-01

    Aflatoxin B1 (AFB1), a mycotoxin produced by Aspergillus flavus or A. parasiticus, is a frequent contaminant of food and feed. This toxin is hepatotoxic and immunotoxic. The present study analyzed in pigs the influence of AFB1 on humoral and cellular responses, and investigated whether the immunomodulation observed is produced through interference with cytokine expression. For 28 days, pigs were fed a control diet or a diet contaminated with 385, 867 or 1807 {mu}g pure AFB1/kg feed. At days 4 and 15, pigs were vaccinated with ovalbumin. AFB1 exposure, confirmed by an observed dose-response in blood aflatoxin-albumin adduct, had no major effect on humoral immunity as measured by plasma concentrations of total IgA, IgG and IgM and of anti-ovalbumin IgG. Toxin exposure did not impair the mitogenic response of lymphocytes but delayed and decreased their specific proliferation in response to the vaccine antigen, suggesting impaired lymphocyte activation in pigs exposed to AFB1. The expression level of pro-inflammatory (TNF-{alpha}, IL-1{beta}, IL-6, IFN-{gamma}) and regulatory (IL-10) cytokines was assessed by real-time PCR in spleen. A significant up-regulation of all 5 cytokines was observed in spleen from pigs exposed to the highest dose of AFB1. In pigs exposed to the medium dose, IL-6 expression was increased and a trend towards increased IFN-{gamma} and IL-10 was observed. In addition we demonstrate that IL-6 impaired in vitro the antigenic- but not the mitogenic-induced proliferation of lymphocytes from control pigs vaccinated with ovalbumin. These results indicate that AFB1 dietary exposure decreases cell-mediated immunity while inducing an inflammatory response. These impairments in the immune response could participate in failure of vaccination protocols and increased susceptibility to infections described in pigs exposed to AFB1.

  4. Detection of Stachybotrys chartarum using rRNA, tri5, and beta-tubulin primers and determining their relative copy number by real-time PCR.

    PubMed

    Black, Jonathan A; Dean, Timothy R; Foarde, Karin; Menetrez, Marc

    2008-07-01

    Highly conserved regions are attractive targets for detection and quantitation by PCR, but designing species-specific primer sets can be difficult. Ultimately, almost all primer sets are designed based upon literature searches in public domain databases, such as the National Center for Biotechnology Information (NCBI). Prudence suggests that the researcher needs to evaluate as many sequences as available for designing species-specific PCR primers. In this report, we aligned 11, 9, and 16 DNA sequences entered for Stachybotrys spp. rRNA, tri5, and beta-tubulin regions, respectively. Although we were able to align and determine consensus primer sets for the 9 tri5 and the 16 beta-tubulin sequences, there was no consensus sequence that could be derived from alignment of the 11 rRNA sequences. However, by judicious clustering of the sequences that aligned well, we were able to design three sets of primers for the rRNA region of S. chartarum. The two primer sets for tri5 and beta-tubulin produced satisfactory PCR results for all four strains of S. chartarum used in this study whereas only one rRNA primer set of three produced similar satisfactory results. Ultimately, we were able to show that rRNA copy number is approximately 2-log greater than for tri5 and beta-tubulin in the four strains of S. chartarum tested.

  5. Study of Toxin Production by Isolates of Stachybotrys chartarum and Memnoniella echinata Isolated during a Study of Pulmonary Hemosiderosis in Infants

    PubMed Central

    Jarvis, Bruce B.; Sorenson, W. G.; Hintikka, Eeva-Liisa; Nikulin, Marjo; Zhou, Yihong; Jiang, Jian; Wang, Shengun; Hinkley, Simon; Etzel, Ruth A.; Dearborn, D.

    1998-01-01

    A cluster of cases of pulmonary hemosiderosis among infants was reported in Cleveland, Ohio, during 1993 and 1994. These unusual cases appeared only in infants ranging in age from 1 to 8 months and were characterized by pulmonary hemorrhage, which caused the babies to cough up blood. A case-control study identified major home water damage (from plumbing leaks, roof leaks, or flooding) as a risk factor for development of pulmonary hemorrhage in these infants. Because of an interest in the possibility that trichothecene mycotoxins might be involved in this illness, a number of isolates of Stachybotrys chartarum were grown in the laboratory on rice, and extracts were prepared and analyzed both for cytotoxicity and for specific toxins. Two isolates of Memnoniella echinata, a fungus closely related to S. chartarum, were also included in these studies. S. chartarum isolates collected from the homes were shown to produce a number of highly toxic compounds, and the profiles of toxic compounds from M. echinata were similar; the most notable difference was the fact that the principal metabolites produced by M. echinata were griseofulvins. PMID:9758776

  6. Immunotoxic and Genotoxic Potential of Arsenic and its Chemical Species in Goats

    PubMed Central

    Patra, Pabitra Hriday; Bandyopadhyay, Samiran; Bandyopadhyay, Manik Chandra; Mandal, Tapan Kumar

    2013-01-01

    The study investigated the immunotoxic and genotoxic effect of arsenic and its different species on goats. It was found that arsenic causes haematological crisis. Histopathological changes in spleen and reduced serum immunoglobulin G level without any changes in formazan production in arsenic-treated animals indicated that arsenic is toxic to the humoral immune system. Increased caspase-3 production and higher number of TUNEL (terminal deoxynucleotidyl transferase-mediated dUTP nick-end labelling)-positive bone marrow cells along with oligonucleosomal DNA fragmentation on agarose gel suggested apoptosis induction by arsenic in the bone marrow cells of goat. Total arsenic concentration in the plasma, bone marrow, and spleen of the exposed group was, respectively, 1.22 ± 0.11, 2.20 ± 0.21, and 3.39 ± 0.14 ppm. Speciation study revealed that arsenite and organoarsenic were the major arsenic species in these samples, suggesting their role in immunotoxic and genotoxic potential in goats. PMID:23833431

  7. Immunotoxic and genotoxic potential of arsenic and its chemical species in goats.

    PubMed

    Patra, Pabitra Hriday; Bandyopadhyay, Samiran; Bandyopadhyay, Manik Chandra; Mandal, Tapan Kumar

    2013-01-01

    The study investigated the immunotoxic and genotoxic effect of arsenic and its different species on goats. It was found that arsenic causes haematological crisis. Histopathological changes in spleen and reduced serum immunoglobulin G level without any changes in formazan production in arsenic-treated animals indicated that arsenic is toxic to the humoral immune system. Increased caspase-3 production and higher number of TUNEL (terminal deoxynucleotidyl transferase-mediated dUTP nick-end labelling)-positive bone marrow cells along with oligonucleosomal DNA fragmentation on agarose gel suggested apoptosis induction by arsenic in the bone marrow cells of goat. Total arsenic concentration in the plasma, bone marrow, and spleen of the exposed group was, respectively, 1.22 ± 0.11, 2.20 ± 0.21, and 3.39 ± 0.14 ppm. Speciation study revealed that arsenite and organoarsenic were the major arsenic species in these samples, suggesting their role in immunotoxic and genotoxic potential in goats.

  8. Assessment of the immunotoxic potential of the fungicide dinocap in mice

    SciTech Connect

    Smialowicz, R.J.; Luebke, R.W.; Riddle, M.M.

    1992-01-01

    The immunotoxic potential of dinocap was evaluated in female C57BL/6J mice following in vivo and in vitro exposure to the fungicide. In in vivo studies, groups of mice were dosed with technical grade dinocap at dosages ranging from 12.5 to 50 mg/kg/d and selected immune functions examined. Twelve days of dosing with dinocap at 25 mg/kg/d resulted in decreased thymus weights and cellularity, and increased spleen weights. Lymphoproliferative responses to concanavalin A (Con A) and phytohemagglutinin (PHA) were reduced in thymocytes from mice dosed at 25 mg/kg/d dinocap. The cytotoxic T lymphocyte (CTL) response to P815 mastocytoma cells was enhanced in mice exposed for 7 days to 25 mg/kg/d dinocap. In vitro studies using murine thymocytes cultured with dinocap (10 ug/ml for 72 hr) resulted in suppression of the proliferative response to Con A and PHA. These results suggest that dinocap is immunotoxic in the mouse, causing effects on T lymphocytes.

  9. Oral subchronic immunotoxicity study of ethyl tertiary butyl ether in the rat.

    PubMed

    Banton, Marcy I; Peachee, Vanessa L; White, Kimber L; Padgett, Eric L

    2011-01-01

    The potential for immunotoxicological effects of ethyl tertiary butyl ether (ETBE, CAS RN 637-92-3) was studied in young adult female Crl:CD(SD) rats following subchronic oral exposures. Rats were exposed by gavage once daily for 28 consecutive days to 0, 250, 500, or 1000 mg ETBE/kg body weight (BW)/day; a concurrent positive control group received four intraperitoneal injections of at 50 mg cyclophosphamide monohydrate (CPS)/kg/day on study Days 24-27. Immunotoxicity was evaluated using a splenic antibody-forming cell (AFC) assay to assess T-cell-dependent antibody responses in rats sensitized with sheep red blood cells (SRBC). All rats survived to the scheduled necropsy. There were no effects on clinical observations, body weights, feed or water consumption, or macroscopic pathology findings in the ETBE-treated rats. No ETBE-related effects were observed on absolute or relative (to final body weight) spleen or thymus weights, spleen cellularity, or on the specific (AFC/10(6) spleen cells) or total activity (AFC/spleen) of splenic IgM AFC to the T-cell-dependent antigen SRBC. CPS produced expected effects consistent with its known immunosuppressive properties and validated the appropriateness of the AFC assay. Based on the results of this study, ETBE did not suppress the humoral component of the immune system in female rats. The no-observed-effect level for immunotoxicity was the highest dosage tested at 1000 mg/kg/day.

  10. Immunotoxicity activity from the essential oils of coriander (Coriandrum sativum) seeds.

    PubMed

    Chung, Ill-Min; Ahmad, Ateeque; Kim, Eun-Hye; Kim, Seung-Hyun; Jung, Woo-Suk; Kim, Jin-Hoi; Nayeem, Abdul; Nagella, Praveen

    2012-06-01

    The seeds of the Coriandrum sativum were extracted and the essential oil composition and immunotoxicity effects were studied. The analysis of the essential oil was conducted by gas chromatography-mass spectroscopy, which revealed 33 components, representing 99.99% of the total oil from the seeds of coriander. The major components are linalool (55.09%), α-pinene (7.49%), 2,6-Octadien-1-ol, 3,7-dimethyl-, acetate, (E)- (5.70%), geraniol (4.83%), 3-Cyclohexene-1-methanol, α,α,4-trimethyl- (4.72%), hexadecanoic acid (2.65%), tetradecanoic acid (2.49%), 2-α-pinene (2.39%), citronellyl acetate (1.77%), and undecanal (1.29%). The seed oil had significant toxic effects against the larvae of Aedes aegypti with an LC(50) value of 21.55 ppm and LC(90) value of 38.79 ppm. The above data indicate that the major components in the essential oil of coriander play an important role as immunotoxicity on the A. aegypti.

  11. Ecological impacts of the deepwater horizon oil spill: implications for immunotoxicity.

    PubMed

    Barron, Mace G

    2012-01-01

    The Deepwater Horizon (DWH) oil spill was the largest environmental disaster and response effort in U.S. history, with nearly 800 million liters of crude oil spilled. Vast areas of the Gulf of Mexico were contaminated with oil, including deep-ocean communities and over 1,600 kilometers of shoreline. Multiple species of pelagic, tidal, and estuarine organisms; sea turtles; marine mammals; and birds were affected, and over 20 million hectares of the Gulf of Mexico were closed to fishing. Several large-scale field efforts were performed, including assessments of shoreline and wildlife oiling and of coastal waters and sediments. The assessment of injuries, damages, and restoration options for the DWH spill is ongoing. Although petroleum and the polycyclic aromatic hydrocarbon component of oils are known to affect the immune systems of aquatic organisms and wildlife, immunotoxicity is not typically assessed during oil spills and has not been a focus of the DHW assessment. The effects of oil spill contaminants on immune responses are variable and often exposure dependent, but immunotoxic effects seem likely from the DHW spill based on the reported effects of a variety of oils on both aquatic and wildlife species.

  12. Acute and subchronic toxic effects of atrazine and chlorpyrifos on common carp (Cyprinus carpio L.): Immunotoxicity assessments.

    PubMed

    Xing, Houjuan; Liu, Tao; Zhang, Ziwei; Wang, Xiaolong; Xu, Shiwen

    2015-08-01

    Atrazine (ATR) and chlorpyrifos (CPF) are widely used pesticides in agricultural practices throughout world. It has resulted in a series of toxicological and environmental problems, such as impacts on many non-target aquatic species, including fish. The spleen and head kidney in the bony fish are the major hematopoietic organs, and play a crucial part in immune responses. This study evaluated the subchronic effects of ATR and CPF on the mRNA and protein levels of HSP60, HSP70 and HSP90 in the immune organs of common carp and compared the acute and subchronic effects of ATR and CPF on the swimming speed (SS) of common carp. The results of acute toxicity tests showed that the 96 h-LC50 of ATR and CPF for common carp was determined to be 2.142 and 0.582 mg/L, respectively. Meanwhile, acute and subacute toxicity of ATR and CPF in common carp resulted in hypoactivity. We also found that the mRNA and protein levels of HSP60, HSP70 and HSP90 genes were induced in the spleen and head kidney of common carp exposed to ATR and CPF in the subchronic toxicity test. Our results indicate that ATR and CPF are highly toxic to common carp, and hypoactivity in common carp by acute and subchronic toxicity of ATR and CPF may provide a useful tool for assessing the toxicity of triazine herbicide and organophosphorous pesticides to aquatic organisms. In addition, the results from the subchronic toxicity test exhibited that increasing concentration of ATR and CPF in the environment causes considerable stress for common carp, suggesting that ATR and CPF exposure cause immunotoxicity to common carp.

  13. Immunotoxicity of washing soda in a freshwater sponge of India.

    PubMed

    Mukherjee, Soumalya; Ray, Mitali; Ray, Sajal

    2015-03-01

    The natural habitat of sponge, Eunapius carteri faces an ecotoxicological threat of contamination by washing soda, a common household cleaning agent of India. Washing soda is chemically known as sodium carbonate and is reported to be toxic to aquatic organisms. Domestic effluent, drain water and various human activities in ponds and lakes have been identified as the major routes of washing soda contamination of water. Phagocytosis and generation of cytotoxic molecules are important immunological responses offered by the cells of sponges against environmental toxins and pathogens. Present study involves estimation of phagocytic response and generation of cytotoxic molecules like superoxide anion, nitric oxide and phenoloxidase in E. carteri under the environmentally realistic concentrations of washing soda. Sodium carbonate exposure resulted in a significant decrease in the phagocytic response of sponge cells under 4, 8, 16 mg/l of the toxin for 96h and all experimental concentrations of the toxin for 192h. Washing soda exposure yielded an initial increase in the generation of the superoxide anion and nitric oxide followed by a significant decrease in generation of these cytotoxic agents. Sponge cell generated a high degree of phenoloxidase activity under the experimental exposure of 2, 4, 8, 16 mg/l of sodium carbonate for 96 and 192 h. Washing soda induced alteration of phagocytic and cytotoxic responses of E. carteri was indicative to an undesirable shift in their immune status leading to the possible crises of survival and propagation of sponges in their natural habitat.

  14. Immunotoxicity assessment for the novel Spleen tyrosine kinase inhibitor R406

    SciTech Connect

    Zhu Yanhong; Herlaar, Ellen; Masuda, Esteban S.; Burleson, Gary R.; Nelson, Andrew J.; Grossbard, Elliott B.; Clemens, George R. . E-mail: gclemens@rigel.com

    2007-06-15

    Spleen tyrosine kinase (Syk) is a novel pharmaceutical target for treatment of allergic, autoimmune, and neoplastic disorders. Previous studies have indicated that Syk signaling plays critical roles in regulating the lymphohematopoietic system. These observations prompted us to investigate whether inhibition of Syk would promote immunotoxicity. In a series of studies, rats were treated orally with R406, at dose levels up to and including 100 mg/kg/day (or its prodrug R788 at dose levels up to and including 100 mg/kg/day, reduced to 50 mg/kg/day for females as MTD was exceeded), a potent Syk inhibitor, twice daily for 28 days. In addition to standard toxicological assessments, immunophenotyping by flow cytometric analysis, and a study of humoral immune response measuring anti-KLH IgM and IgG levels, were undertaken. Other immunotoxicity studies included three host resistance models in female Balb/c mice to further ascertain effects of R406 on innate and acquired immunity. Following R406 treatment, expected immunomodulating effects (e.g., decreased thymic and spleen weight, hypocellularity of bone marrow, and reduced lymphocyte counts, including T and B cells) were observed in the rat studies. These changes essentially resolved during a 14-day treatment-free recovery period. A KLH challenge in rats demonstrated no adverse effects on IgG or IgM response. R788/406, administered orally at dose levels up to and including 80 mg/kg/day for 28 days, did not affect bacterial or viral clearance in the Listeria, Streptococcal, or Influenza host resistance mouse models, respectively. This correlated with previous in vitro macrophage and neutrophil function assays (assessing migration, phagocytosis, oxidative burst and microbicidal activity), which revealed that R406 did not adversely affect macrophage or neutrophil function in innate immune responses. Collectively, these results demonstrate that R406 has minimal functional immunotoxicity notwithstanding its lymphocytopenic

  15. Immunotoxicity of silicon dioxide nanoparticles with different sizes and electrostatic charge.

    PubMed

    Kim, Jae-Hyun; Kim, Cheol-Su; Ignacio, Rosa Mistica Coles; Kim, Dong-Heui; Sajo, Ma Easter Joy; Maeng, Eun Ho; Qi, Xu-Feng; Park, Seong-Eun; Kim, Yu-Ri; Kim, Meyoung-Kon; Lee, Kyu-Jae; Kim, Soo-Ki

    2014-01-01

    Silicon dioxide (SiO2) nanoparticles (NPs) have been widely used in the biomedical field, such as in drug delivery and gene therapy. However, little is known about the biological effects and potential hazards of SiO2. Herein, the colloidal SiO2 NPs with two different sizes (20 nm and 100 nm) and different charges (L-arginine modified: SiO2 (EN20[R]), SiO2 (EN100[R]); and negative: SiO2 (EN20[-]), SiO2 (EN100[-]) were orally administered (750 mg/kg/day) in female C57BL/6 mice for 14 days. Assessments of immunotoxicity include hematology profiling, reactive oxygen species generation and their antioxidant effect, stimulation assays for B- and T-lymphocytes, the activity of natural killer (NK) cells, and cytokine profiling. In vitro toxicity was also investigated in the RAW 264.7 cell line. When the cellularity of mouse spleen was evaluated, there was an overall decrease in the proliferation of B- and T-cells for all the groups fed with SiO2 NPs. Specifically, the SiO2 (EN20(-)) NPs showed the most pronounced reduction. In addition, the nitric oxide production and NK cell activity in SiO2 NP-fed mice were significantly suppressed. Moreover, there was a decrease in the serum concentration of inflammatory cytokines such as interleukin (IL)-1β, IL-12 (p70), IL-6, tumor necrosis factor-α, and interferon-γ. To elucidate the cytotoxicity mechanism of SiO2 in vivo, an in vitro study using the RAW 264.7 cell line was performed. Both the size and charge of SiO2 using murine macrophage RAW 264.7 cells decreased cell viability dose-dependently. Collectively, our data indicate that different sized and charged SiO2 NPs would cause differential immunotoxicity. Interestingly, the small-sized and negatively charged SiO2 NPs showed the most potent in vivo immunotoxicity by way of suppressing the proliferation of lymphocytes, depressing the killing activity of NK cells, and decreasing proinflammatory cytokine production, thus leading to immunosuppression.

  16. Immunotoxicity of silicon dioxide nanoparticles with different sizes and electrostatic charge

    PubMed Central

    Kim, Jae-Hyun; Kim, Cheol-Su; Ignacio, Rosa Mistica Coles; Kim, Dong-Heui; Sajo, Ma Easter Joy; Maeng, Eun Ho; Qi, Xu-Feng; Park, Seong-Eun; Kim, Yu-Ri; Kim, Meyoung-Kon; Lee, Kyu-Jae; Kim, Soo-Ki

    2014-01-01

    Silicon dioxide (SiO2) nanoparticles (NPs) have been widely used in the biomedical field, such as in drug delivery and gene therapy. However, little is known about the biological effects and potential hazards of SiO2. Herein, the colloidal SiO2 NPs with two different sizes (20 nm and 100 nm) and different charges (L-arginine modified: SiO2EN20[R], SiO2EN100[R]; and negative: SiO2EN20[−], SiO2EN100[−] were orally administered (750 mg/kg/day) in female C57BL/6 mice for 14 days. Assessments of immunotoxicity include hematology profiling, reactive oxygen species generation and their antioxidant effect, stimulation assays for B- and T-lymphocytes, the activity of natural killer (NK) cells, and cytokine profiling. In vitro toxicity was also investigated in the RAW 264.7 cell line. When the cellularity of mouse spleen was evaluated, there was an overall decrease in the proliferation of B- and T-cells for all the groups fed with SiO2 NPs. Specifically, the SiO2EN20(−) NPs showed the most pronounced reduction. In addition, the nitric oxide production and NK cell activity in SiO2 NP-fed mice were significantly suppressed. Moreover, there was a decrease in the serum concentration of inflammatory cytokines such as interleukin (IL)-1β, IL-12 (p70), IL-6, tumor necrosis factor-α, and interferon-γ. To elucidate the cytotoxicity mechanism of SiO2 in vivo, an in vitro study using the RAW 264.7 cell line was performed. Both the size and charge of SiO2 using murine macrophage RAW 264.7 cells decreased cell viability dose-dependently. Collectively, our data indicate that different sized and charged SiO2 NPs would cause differential immunotoxicity. Interestingly, the small-sized and negatively charged SiO2 NPs showed the most potent in vivo immunotoxicity by way of suppressing the proliferation of lymphocytes, depressing the killing activity of NK cells, and decreasing proinflammatory cytokine production, thus leading to immunosuppression. PMID:25565836

  17. Overlapping gene expression profiles of model compounds provide opportunities for immunotoxicity screening

    SciTech Connect

    Baken, Kirsten A. Pennings, Jeroen L.A.; Jonker, Martijs J.; Schaap, Mirjam M.; Vries, Annemieke de; Steeg, Harry van; Breit, Timo M.; Loveren, Henk van

    2008-01-01

    In order to investigate immunotoxic effects of a set of model compounds in mice, a toxicogenomics approach was combined with information on macroscopical and histopathological effects on spleens and on modulation of immune function. Bis(tri-n-butyltin)oxide (TBTO), cyclosporin A (CsA), and benzo[a]pyrene (B[a]P) were administered to C57BL/6 mice at immunosuppressive dose levels. Acetaminophen (APAP) was included in the study since indications of immunomodulating properties of this compound have appeared in the literature. TBTO exposure caused the most pronounced effect on gene expression and also resulted in the most severe reduction of body weight gain and induction of splenic irregularities. All compounds caused inhibition of cell division in the spleen as shown by microarray analysis as well as by suppression of lymphocyte proliferation after application of a contact sensitizer as demonstrated in an immune function assay that was adapted from the local lymph node assay. The immunotoxicogenomics approach applied in this study thus pointed to immunosuppression through cell cycle arrest as a common mechanism of action of immunotoxicants, including APAP. Genes related to cell division such as Ccna2, Brca1, Birc5, Incenp, and Cdkn1a (p21) were identified as candidate genes to indicate anti-proliferative effects of xenobiotics in immune cells for future screening assays. The results of our experiments also show the value of group wise pathway analysis for detection of more subtle transcriptional effects and the potency of evaluation of effects in the spleen to demonstrate immunotoxicity.

  18. Immunotoxicity of β-Diketone Antibiotic Mixtures to Zebrafish (Danio rerio) by Transcriptome Analysis

    PubMed Central

    Li, Fanghui; Wang, Hui; Liu, Jinfeng; Lin, Jiebo; Zeng, Aibing; Ai, Weiming; Wang, Xuedong; Dahlgren, Randy A.; Wang, Huili

    2016-01-01

    Fluoroquinolones and tetracyclines are known as β-diketone antibiotics (DKAs) because of bearing a diketone group in their molecular structure. DKAs are the most widely used antibiotics to prevent generation of disease in humans and animals and to suppress bacterial growth in aquaculture. In recent years, overuse of DKAs has caused serious environmental risk due to their pseudo-persistence in the environment, even though their half-lives are not long. So far, no reports were concerned with the joint immunotoxicity of DKAs. Herein, we reported on the immunotoxicity of DKAs on zebrafish after a 3-month DKAs exposure using transcriptomic techniques. According to transcriptome sequencing, 10 differentially expressed genes were screened out among the genes related to KEGG pathways with high enrichment. The identified 7 genes showed to be consistent between RNA-seq and qRT-PCR. Due to DKAs exposure, the content or activity for a series of immune-related biomarkers (Complement 3, lysozyme, IgM and AKP) showed the inconsistent changing trends as compared with the control group. Histopathological observations showed that the number of goblet cells increased sharply, the columnar epithelial cells swelled, the nucleus became slender in intestinal villi, and numerous brown metachromatic granules occurred in spleens of DKAs-exposed groups. Overall, both detection of biomarkers and histopathological observation corroborated that chronic DKAs exposure could result in abnormal expression of immune genes and enzymes, and variable levels of damage to immune-related organs. These complex effects of DKAs may lead to zebrafish dysfunction and occurrence of diseases related to the immune system. PMID:27046191

  19. Retrospective evaluation of the impact of functional immunotoxicity testing on pesticide hazard identification and risk assessment.

    PubMed

    Gehen, Sean C; Blacker, Ann M; Boverhof, Darrell R; Hanley, Thomas R; Hastings, Charles E; Ladics, Gregory S; Lu, Haitian; O'Neal, Fredrick O

    2014-05-01

    Conduct of a T-cell-dependent antibody response (TDAR) assay in rodents according to Environmental Protection Agency (EPA) Test Guideline OPPTS 870.7800 is now required for chemical pesticide active ingredients registered in the United States. To assess potential regulatory impact, a retrospective analysis was developed using TDAR tests conducted on 78 pesticide chemicals from 46 separate chemical classes. The objective of the retrospective analysis was to examine the frequency of positive responses and determine the potential for the TDAR to yield lower endpoints than those utilized to calculate reference doses (RfDs). A reduction in the TDAR response was observed at only the high-dose level in five studies, while it was unaltered in the remaining studies. Importantly, for all 78 pesticide chemicals, the TDAR no-observed-adverse-effect levels (TDAR NOAELs) were greater than the NOAELS currently in use as risk assessment endpoints. The TDAR NOAELs were higher than the current EPA-selected endpoints for the chronic RfD, short-term, intermediate and long-term exposure scenarios by 3-27,000, 3-1,688, 3-1,688 and 4.9-1,688 times, respectively. Based on this analysis, conduct of the TDAR assay had minimal impact on hazard identification and did not impact human health risk assessments for the pesticides included in this evaluation. These data strongly support employment of alternative approaches including initial weight-of-evidence analysis for immunotoxic potential prior to conducting functional immunotoxicity testing for pesticide active ingredients.

  20. Visualization of the structural changes in plywood and gypsum board during the growth of Chaetomium globosum and Stachybotrys chartarum.

    PubMed

    Lewinska, Anna M; Hoof, Jakob B; Peuhkuri, Ruut H; Rode, Carsten; Lilje, Osu; Foley, Matthew; Trimby, Patrick; Andersen, Birgitte

    2016-10-01

    Fungal growth in indoor environments is associated with many negative health effects. Many studies focus on brown- and white-rot fungi and their effect on wood, but there is none that reveals the influence of soft-rot fungi, such as Stachybotrys spp. and Chaetomium spp., on the structure of building materials such as plywood and gypsum wallboard. This study focuses on using micro-computed tomography (microCT) to investigate changes of the structure of plywood and gypsum wallboard during fungal degradation by S. chartarum and C. globosum. Changes in the materials as a result of dampness and fungal growth were determined by measuring porosity and pore shape via microCT. The results show that the composition of the building material influenced the level of penetration by fungi as shown by scanning electron microscopy (SEM). Plywood appeared to be the most affected, with the penetration of moisture and fungi throughout the whole thickness of the sample. Conversely, fungi grew only on the top cardboard in the gypsum wallboard and they did not have significant influence on the gypsum wallboard structure. The majority of the observed changes in gypsum wallboard occurred due to moisture. This paper suggests that the mycelium distribution within building materials and the structural changes, caused by dampness and fungal growth, depend on the type of the material. Copyright © 2016 Elsevier B.V. All rights reserved.

  1. Immunohistochemical and immunocytochemical detection of SchS34 antigen in Stachybotrys chartarum spores and spore impacted mouse lungs.

    PubMed

    Rand, Thomas G; Miller, J David

    2008-02-01

    The purpose of this study was to evaluate the distribution of a 34 kD antigen isolated from S. chartarum sensu lato in spores and in the mouse lung 48 h after intra-tracheal instillation of spores by immuno-histochemistry. This antigen was localized in spore walls, primarily in the outer and inner wall layers and on the external wall surfaces with modest labelling observed in cytoplasm. Immuno-histochemistry revealed that in spore impacted mouse lung, antigen was again observed in spore walls, along the outside surface of the outer wall and in the intercellular space surrounding spores. In lung granulomas the labelled antigen formed a diffusate, some 2-3x the size of the long axis of spores, with highest concentrations nearest to spores. Collectively, these observations indicated that this protein not only displayed a high degree of specificity with respect to its location in spores and wall fragments, but also that it slowly diffuses into surrounding lungs.

  2. Phenylspirodrimanes with anti-HIV activity from the sponge-derived fungus Stachybotrys chartarum MXH-X73.

    PubMed

    Ma, Xinhua; Li, Letao; Zhu, Tianjiao; Ba, Mingyu; Li, Guoqiang; Gu, Qianqun; Guo, Ying; Li, Dehai

    2013-12-27

    Seven new phenylspirodrimanes, named stachybotrins D-F (1, 3, 4), stachybocins E and F (5, 6), and stachybosides A and B (7, 8), and four known compounds (2, 9-11), were isolated from the sponge-derived fungus Stachybotrys chartarum MXH-X73. Their structures were determined by detailed analysis of spectroscopic data. The absolute configurations of 1-8 were determined by chemical hydrolysis and modified Mosher's and Marfey's methods. All compounds were tested in an anti-HIV activity assay, and compound 1 showed an inhibitory effect on HIV-1 replication by targeting reverse transcriptase. Further study exhibited that 1 could block NNRTIs-resistant strains (HIV-1RT-K103N, HIV-1RT-L100I,K103N, HIV-1RT-K103N,V108I, HIV-1RT-K103N,G190A, and HIV-1RT-K103N,P225H) as well as wild-type HIV-1 (HIV-1wt) with EC50 values of 7.0, 23.8, 13.3, 14.2, 6.2, and 8.4 μM, respectively.

  3. Developmental Immunotoxicity

    EPA Science Inventory

    Animal models suggest that the immature immune system is more susceptible to xenobiotics than the fully mature system, and sequelae of developmental immunotoxicant exposure may be persistent well into adulthood. Immune maturation may be delayed by xenobiotic exposure and recover...

  4. Immunotoxicity Studies

    EPA Science Inventory

    Immunotoxicology is a subdiscipline of toxicology that focuses on unintended modulation of the immune system. Effects that may occur include immunosuppression, immunostimulation, hypersensitivity, or autoimmunity, which may result in outcomes such as increased incidences of infec...

  5. Developmental Immunotoxicity

    EPA Science Inventory

    Animal models suggest that the immature immune system is more susceptible to xenobiotics than the fully mature system, and sequelae of developmental immunotoxicant exposure may be persistent well into adulthood. Immune maturation may be delayed by xenobiotic exposure and recover...

  6. Immunotoxicity Studies

    EPA Science Inventory

    Immunotoxicology is a subdiscipline of toxicology that focuses on unintended modulation of the immune system. Effects that may occur include immunosuppression, immunostimulation, hypersensitivity, or autoimmunity, which may result in outcomes such as increased incidences of infec...

  7. Systemic and immunotoxicity of pristine and PEGylated multi-walled carbon nanotubes in an intravenous 28 days repeated dose toxicity study.

    PubMed

    Zhang, Ting; Tang, Meng; Zhang, Shanshan; Hu, Yuanyuan; Li, Han; Zhang, Tao; Xue, Yuying; Pu, Yuepu

    2017-01-01

    The numerous increasing use of carbon nanotubes (CNTs) derived from nanotechnology has raised concerns about their biosafety and potential toxicity. CNTs cause immunologic dysfunction and limit the application of CNTs in biomedicine. The immunological responses induced by pristine multi-walled carbon nanotubes (p-MWCNTs) and PEGylated multi-walled carbon nanotubes (MWCNTs-PEG) on BALB/c mice via an intravenous administration were investigated. The results reflect that the p-MWCNTs induced significant increases in spleen, thymus, and lung weight. Mice treated with p-MWCNTs showed altered lymphocyte populations (CD3(+), CD4(+), CD8(+), and CD19(+)) in peripheral blood and increased serum IgM and IgG levels, and splenic macrophage ultrastructure indicated mitochondria swelling. p-MWCNTs inhibited humoral and cellular immunity function and were associated with decreased immune responses against sheep erythrocytes and serum hemolysis level. Natural killer (NK) activity was not modified by two types of MWCNTs. In comparison with two types of MWCNTs, for a same dose, p-MWCNTs caused higher levels of inflammation and immunosuppression than MWCNTs-PEG. The results of immunological function suggested that after intravenous administration with p-MWCNTs caused more damage to systemic immunity than MWCNTs-PEG. Here, we demonstrated that a surface functional modification on MWCNTs reduces their immune perturbations in vivo. The chemistry-modified MWCNTs change their preferred immune response in vivo and reduce the immunotoxicity of p-MWCNTs.

  8. Systemic and immunotoxicity of pristine and PEGylated multi-walled carbon nanotubes in an intravenous 28 days repeated dose toxicity study

    PubMed Central

    Zhang, Ting; Tang, Meng; Zhang, Shanshan; Hu, Yuanyuan; Li, Han; Zhang, Tao; Xue, Yuying; Pu, Yuepu

    2017-01-01

    The numerous increasing use of carbon nanotubes (CNTs) derived from nanotechnology has raised concerns about their biosafety and potential toxicity. CNTs cause immunologic dysfunction and limit the application of CNTs in biomedicine. The immunological responses induced by pristine multi-walled carbon nanotubes (p-MWCNTs) and PEGylated multi-walled carbon nanotubes (MWCNTs-PEG) on BALB/c mice via an intravenous administration were investigated. The results reflect that the p-MWCNTs induced significant increases in spleen, thymus, and lung weight. Mice treated with p-MWCNTs showed altered lymphocyte populations (CD3+, CD4+, CD8+, and CD19+) in peripheral blood and increased serum IgM and IgG levels, and splenic macrophage ultrastructure indicated mitochondria swelling. p-MWCNTs inhibited humoral and cellular immunity function and were associated with decreased immune responses against sheep erythrocytes and serum hemolysis level. Natural killer (NK) activity was not modified by two types of MWCNTs. In comparison with two types of MWCNTs, for a same dose, p-MWCNTs caused higher levels of inflammation and immunosuppression than MWCNTs-PEG. The results of immunological function suggested that after intravenous administration with p-MWCNTs caused more damage to systemic immunity than MWCNTs-PEG. Here, we demonstrated that a surface functional modification on MWCNTs reduces their immune perturbations in vivo. The chemistry-modified MWCNTs change their preferred immune response in vivo and reduce the immunotoxicity of p-MWCNTs. PMID:28280324

  9. Effects of immunotoxic activity of the major essential oil of Angelica purpuraefolia Chung against Aedes aegypti L.

    PubMed

    Park, Yool-Jin; Chung, Ill-Min; Moon, Hyung-In

    2010-12-01

    The rhizomes parts of Angelica purpuraefolia were extracted and the major essential oils composition and immunotoxic effects were studied. The analyses were conducted by gas chromatography and mass spectroscopy (GC-MS) revealed that the essential oils of A. purpuraefolia. The A. purpuraefolia essential oil (APEO) yield was 0.37%, and GC/MS analysis revealed that its major constituents were β-Phellandrene (32.11%), Nerolidol (10.11%), Pyrimidine derivative (27.33%), Heptadecane (4.33%), and Celorbicol (6.33%). The essential oil had a significant toxic effect against early fourth-stage larvae of Aedes aegypti L with an LC(50) value of 31.21 ppm and an LC(90) value of 87.22 ppm. The results could be useful in search for newer, safer, and more effective natural immunotoxic agents against A. aegypti.

  10. 'of Mice and men' (John steinbeck)-How do we determine the potential for immunotoxicity in humans?

    PubMed

    Burns; Burns; Holsapple

    2000-10-01

    PURPOSE: Immunotoxicology is most simply defined as the study of adverse effects on the immune system resulting from exposure to drugs, environmental and industrial chemicals, and in some instances, biological materials. The science of immunotoxicology has validated animal models to conduct risk assessment. However, approaches to characterize immunotoxicity in humans are poorly defined. Animal models have indicated that a primary immune response is most predictive of immunotoxicity. Because vaccines can trigger a primary immune response, this approach may have utility in humans. The purpose of this project was to determine if the response to the influenza vaccine can be validated as an objective measurement of immune status in the workplace.METHODS: We randomly selected employees to receive the influenza vaccine and employees, matched according to age and gender, to receive the placebo. The participants (32 test group and 19 placebo group) completed a brief questionnaire to identify potential confounding factors. Specific anti-influenza antibodies were measured in the serum via an ELISA 30 days after administering the vaccine or placebo.RESULTS: Only 50% (16 of 32 subjects) produced a positive response which is defined by the Centers for Disease Control as a four-fold increase in serum titers. Not unexpectedly, all samples contained antibody to influenza prior to vaccination, and a number of the participants who did not achieve a positive response started with high serum titers.CONCLUSIONS: The influenza vaccine was originally selected for this study because of costs, acceptability to the population and proven safety and efficacy. However, the results of the present investigation suggest that this approach will have little utility as a workplace monitor of human immunotoxicity because most individuals would not be making a primary antibody response. Other technical limitations with the influenza vaccine will be presented; and the alternatives for other biomonitors

  11. Genotoxic and immunotoxic potential effects of selected psychotropic drugs and antibiotics on blue mussel (Mytilus edulis) hemocytes.

    PubMed

    Lacaze, Emilie; Pédelucq, Julie; Fortier, Marlène; Brousseau, Pauline; Auffret, Michel; Budzinski, Hélène; Fournier, Michel

    2015-07-01

    The potential toxicity of pharmaceuticals towards aquatic invertebrates is still poorly understood and sometimes controversial. This study aims to document the in vitro genotoxicity and immunotoxicity of psychotropic drugs and antibiotics on Mytilus edulis. Mussel hemocytes were exposed to fluoxetine, paroxetine, venlafaxine, carbamazepine, sulfamethoxazole, trimethoprim and erythromycin, at concentrations ranging from μg/L to mg/L. Paroxetine at 1.5 μg/L led to DNA damage while the same concentration of venlafaxine caused immunomodulation. Fluoxetine exposure resulted in genotoxicity, immunotoxicity and cytotoxicity. In the case of antibiotics, trimethoprim was genotoxic at 200 μg/L and immunotoxic at 20 mg/L whereas erythromycin elicited same detrimental effects at higher concentrations. DNA metabolism seems to be a highly sensitive target for psychotropic drugs and antibiotics. Furthermore, these compounds affect the immune system of bivalves, with varying intensity. This attests the relevance of these endpoints to assess the toxic mode of action of pharmaceuticals in the aquatic environment. Copyright © 2015 Elsevier Ltd. All rights reserved.

  12. Characterization of human lymphoblastoid cell lines as a novel in vitro test system to predict the immunotoxicity of xenobiotics.

    PubMed

    Markovič, Tijana; Gobec, Martina; Gurwitz, David; Mlinarič-Raščan, Irena

    2015-02-17

    Evaluating immunomodulatory effects of xenobiotics is an important component of the toxicity studies. Herein we report on the establishment of a novel invitro test system for the immunotoxicity screening of xenobiotics based on human lymphoblastoid cell lines (LCLs). Four immunotoxic compounds; tributyltin chloride, cyclosporine A, benzo(a)pyrene and verapamil hydrochloride, as well as three immune-inert compounds; urethane, furosemide and mannitol were selected for characterization. The treatment of LCLs with immunosuppressive compounds resulted in reduced viability. The IC50 values determined in human LCLs were in agreement with the data obtained for human peripheral mononuclear cells. Since cytokine production reflects lymphocytes responses to external stimuli, we evaluated the functional responses of LCLs by monitoring their pro-inflammatory and immunoregulatory cytokine production. Our findings prove that LCLs allowed for reliable differentiation between immunomodulatory and immune-inert compounds. Hence, pre-treatment with immunomodulatory compounds led to a decrease in the production of pro-inflammatory TNFα, IL-6 and immunoregulatory IL-2, IL-4, IL-10 and IFNγ cytokines, when compared to untreated ionomycin/PMA stimulated cells. Moreover, testing a panel of ten LCLs derived from unrelated healthy individuals reflects inter-individual variability in response to immunomodulatory xenobiotics. In conclusion, LCLs provide a novel alternative method for the testing of the immunotoxic effects of xenobiotics.

  13. Vitamin E pretreatment prevents the immunotoxicity of dithiocarbamate pesticide mancozeb in vitro: A comparative age-related assessment in mice and chick.

    PubMed

    Singh, Saurabh Kumar; Bano, Farhad; Mohanty, Banalata

    2016-01-01

    Pesticides used for crop protection cause life-threatening diseases affecting the immune system of non-target organisms including birds and mammals. Functionality of immune system is age-dependent; early- as well as old-life stages are more susceptible to toxic exposures because of less competent immune system. Vitamins are so far known to reduce toxic effect of several pesticides and/or xenobiotics. The present in vitro study elucidated immunotoxicity of fungicide mancozeb through comparable stages of immune system maturation in mice (1, 3, and 12months) and chicks (4, 8, and 11weeks). In vitro splenocytes viability on exposure to mancozeb was quantitatively assessed by MTT assay and qualitatively by acridine orange and ethidium bromide (AO/EB) double fluorescence staining. Mancozeb exposure dose dependently (250, 500, 1000, 2500, 5000 and 10,000ng/ml) decreased the splenocytes viability. The in vitro preventive effect of Vitamin E has also been explored on toxicity induced by mancozeb. The increased susceptibility observed both in early and aged groups was due to less/decline competence of the immune system.

  14. Lysozyme activity in earthworm (Lumbricus terrestris) coelomic fluid and coelomocytes: Enzyme assay for immunotoxicity of xenobiotics

    SciTech Connect

    Goven, A.J.; Chen, S.C.; Fitzpatrick, L.C. . Dept. of Biological Sciences); Venables, B.J. . Dept. of Biological Sciences TRAC Laboratories Inc., Denton, TX )

    1994-04-01

    Lysozyme activity in earthworm (Lumbricus terrestris) coelomic fluid and coelomocytes appears sufficiently sensitive for use as a nonmammalian biomarker to detect toxic effects of sublethal body burdens of Cu[sup 2+]. Lysozyme, a phylogenetically conserved enzyme, is capable of bactericidal activity via action on peptidoglycan of gram-positive bacterial cell walls and functions as a component of an organism's innate antimicrobial defense mechanism. Coelomic fluid and coelomocyte lysozyme activities, which exhibit temperature-response patterns similar to those of human saliva, plasma, serum and leukocyte extracts, were sensitive to Cu[sup 2+] exposure. Lysozyme activity of coelomic fluid and coelomocyte extracts from earthworms exposed for 5 d to CuSO[sub 4], using filter paper contact exposure, decreased with increasing sublethal Cu[sup 2+] concentrations of 0.05 and 0.1 [mu]g/cm[sup 2]. Compared to controls, coelomic fluid lysozyme activity was suppressed significantly at both exposure concentrations, whereas coelomocyte extract lysozyme activity was suppressed significantly at the 0.1-[mu]g/cm[sup 2] exposure concentration. Low inherent natural variability and sensitivity to sublethal Cu[sup 2+] body burdens indicate that lysozyme activity has potential as a biomarker for assaying immunotoxicity of metals.

  15. Immunotoxicity activity from various essential oils of Angelica genus from South Korea against Aedes aegypti L.

    PubMed

    Chung, Ill-Min; Kim, Eun-Hye; Lee, Jai-Heon; Lee, Young-Choon; Moon, Hyung-In

    2012-02-01

    The leaves of Angelica anomala Lallemant, Angelica cartilagino-marginata var. distans (Nakai) Kitag, Angelica czernevia (Fisch. et Meyer) Kitagawa, Angelica dahurica Benth. et Hooker, Angelica decursiva (Miq.) Franch. & Sav, Angelica fallax Boissieu, Angelica gigas Nakai, Angelica japonica A. gray were essential oil extracted and immunotoxicity effects were studied. The Angelica anomala, A. cartilagino-marginata var. distans, A. czernevia, A. dahurica, A. decursiva, A. fallax, A. gigas, A. japonica essential oil yield were 4.13, 4.83, 4.45, 3.25, 4.11, 4.73, 4.34 and 4.21%. The A. dahurica essential oil had a significant toxic effect against early fourth-stage larvae of Aedes aegypti L with a lethal concentration 50 (LC₅₀) value of 43.12 ppm and an LC₉₀ value of 65.23 ppm. The above indicates that essential oil contents may play a more important role in the toxicity of essential oil.

  16. Phagocytosis in earthworms: An environmentally acceptable endpoint to assess immunotoxic potential of contaminated soils

    SciTech Connect

    Giggleman, M.A.; Fitzpatrick, L.C.; Goven, A.J.; Venables, B.J.; Callahan, C.A.

    1995-12-31

    Phagocytosis, a host-defense mechanism phylogenetically conserved throughout the animal kingdom, by earthworm (Lumbricus terrestris) coelomocytes has potential as a surrogate for vertebrates to be used as an environmentally acceptable endpoint to assess sublethal immunotoxic risks of contaminated soils to environmental (eg. higher wildlife) and public health. Coelomocytes can be exposed in vivo to complex contaminated parent soils by placing earthworms in situ at hazardous waste sites (HWS) or into soil samples and their dilutions with artificial soil (AS) in the laboratory, or in vitro to soil extracts and their fractionations. Here the authors report on phagocytosis by coelomocytes in earthworms exposed to pentachlorophenol (PCP) contaminated soils from a wood treatment HWS, PCP-spiked AS and PCP treated filter paper (FP). HWS soil was diluted to 25% with AS to a sublethal concentration (ca. 125 mg kg{sup {minus}1}) and earthworms exposed for 14d at 10 C under light conditions. AS was spiked at ca. 125 mg kg{sup {minus}1} PCP and earthworms were similarly exposed. Controls for both consisted of earthworms exposed to 100% AS. Earthworms were exposed to FP treated with a sublethal PCP concentration (15 {micro}g cm{sup {minus}2}) at 10 C under dark conditions for 96H. Controls were similarly exposed without PCP. Phagocytosis by coelomocytes in earthworms exposed to HWS soil, spiked AS and treated FP was suppressed 37, 41 and 29%, respectively. Results are discussed in terms of PCP body burdens and exposure protocols.

  17. In vitro immunotoxicity assessment of culture-derived extracellular vesicles in human monocytes

    PubMed Central

    Rosas, Lucia E.; Elgamal, Ola A.; Mo, Xiaokui; Phelps, Mitch A.; Schmittgen, Thomas D.; Papenfuss, Tracey L.

    2016-01-01

    The potential to engineer extracellular vesicles (EV) that target specific cells and deliver a therapeutic payload has propelled a growing interest in their development as promising therapeutics. These EV are often produced from cultured cells. Very little is known about the interaction of cell culture-derived EV with cells of the immune system and their potential immunomodulatory effects. The present study evaluated potential immunotoxic effects of HEK293T-derived EV on the human monocytic cell lines THP-1 and U937. Incubation of cells with different doses of EV for 16–24 h was followed by assessment of cytotoxicity and cell function by flow cytometry. Changes in cell functionality were evaluated by the capacity of cells to phagocytize fluorescent microspheres. In addition, the internalization of labeled EV in THP-1 and U937 cells was evaluated. Exposure to EV did not affect the viability of THP-1 or U937 cells. Although lower doses of the EV increased phagocytic capacity in both cell lines, phagocytic efficiency of individual cells was not affected by EV exposure at any of the doses evaluated. This study also demonstrated that THP-1 and U937 monocytic cells are highly permissive to EV entry in a dose-response manner. These results suggest that, although HEK293T-derived EV are efficiently internalized by human monocytic cells, they do not exert a cytotoxic effect or alter phagocytic efficiency on the cell lines evaluated. PMID:27075513

  18. Arsenic Exposure and Immunotoxicity: a Review Including the Possible Influence of Age and Sex.

    PubMed

    Ferrario, Daniele; Gribaldo, Laura; Hartung, Thomas

    2016-03-01

    Increasing evidence suggests that inorganic arsenic, a major environmental pollutant, exerts immunosuppressive effects in epidemiological, in vitro, and animal models. The mechanisms, however, remain unclear, and little is known about variation in susceptibilities due to age and sex. We performed a review of the experimental and epidemiologic evidence on the association of arsenic exposure and immune diseases. The majority of the studies described arsenic as a potent immunosuppressive compound, though others have reported an increase in allergy and autoimmune diseases, suggesting that arsenic may also act as an immune system stimulator, depending on the dose or timing of exposure. Limited information, due to either the high concentrations of arsenic used in in vitro studies or the use of non-human data for predicting human risks, is available from experimental studies. Moreover, although there is emerging evidence that health effects of arsenic manifest differently between men and women, we found limited information on sex differences on the immunotoxic effects of arsenic. In conclusion, preliminary data show that chronic early-life exposure to arsenic might impair immune responses, potentially leading to increased risk of infections and inflammatory-like diseases during childhood and in adulthood. Further investigation to evaluate effects of arsenic exposure on the developing immune system of both sexes, particularly in human cells and using concentrations relevant to human exposure, should be a research priority.

  19. Efficacy of Nigella sativa in alleviating benzo[a]pyrene-induced immunotoxicity in broilers.

    PubMed

    Latif, I K; Karim, A J; Zuki, A B Z; Zamri-Saad, M; Niu, J P; Noordin, M M

    2011-06-01

    The immune response of broiler chickens exposed to intra-tracheal (i.t.) administration of benzo[a]pyrene (BaP) with and without Nigella sativa (Ns) supplementation was investigated. A total of 120 day-old chicks were divided into four groups comprising 30 birds each, into a control, Ns, BaP, and BaP+Ns group. Immune responses to Newcastle disease (ND) were evaluated by haemagglutination inhibition (HI), phytohaemagglutinin (PHA) skin test and carbon clearance assay (CCA). In most instances, there was a significant increase (p<0.05) in the ND-HI antibody titers, PHA skin-swelling response and phagocytic activity in the BaP + Ns group compared to that of the BaP group. Likewise, organ weight and indices of the spleen, bursa of Fabricius and thymus of birds from the BaP + Ns group were also higher (p<0.05) than that of the BaP group from day 1 until day 21. It is concluded that exposure to BaP may exert adverse effects on the immune system of broilers which may increase their susceptibility to disease, and Ns supplementation significantly reduces these alterations.

  20. Data Mining as a Guide for the Construction of Cross-Linked Nanoparticles with Low Immunotoxicity via Control of Polymer Chemistry and Supramolecular Assembly.

    PubMed

    Elsabahy, Mahmoud; Wooley, Karen L

    2015-06-16

    The potential immunotoxicity of nanoparticles that are currently being approved, in different phases of clinical trials, or undergoing rigorous in vitro and in vivo characterizations in several laboratories has recently raised special attention. Products with no apparent in vitro or in vivo toxicity may still trigger various components of the immune system unintentionally and lead to serious adverse reactions. Cytokines are one of the useful biomarkers for predicting the effect of biotherapeutics on modulation of the immune system and for screening the immunotoxicity of nanoparticles both in vitro and in vivo, and they were recently found to partially predict the in vivo pharmacokinetics and biodistribution of nanomaterials. Control of polymer chemistry and supramolecular assembly provides a great opportunity for the construction of biocompatible nanoparticles for biomedical clinical applications. However, the sources of data collected regarding immunotoxicities of nanomaterials are diverse, and experiments are usually conducted using different assays under specific conditions. As a result, making direct comparisons nearly impossible, and thus, tailoring the properties of nanomaterials on the basis of the available data is challenging. In this Account, the effects of chemical structure, cross-linking, degradability, morphology, concentration, and surface chemistry on the immunotoxicity of an expansive array of polymeric nanomaterials will be highlighted, with a focus on assays conducted using the same in vitro and in vivo models and experimental conditions. Furthermore, numerical descriptive values have been utilized uniquely to stand for induction of cytokines by nanoparticles. This treatment of available data provides a simple way to compare the immunotoxicities of various nanomaterials, and the values were found to correlate well with published data. On the basis of the polymeric systems investigated in this study, valuable information has been collected that

  1. Data Mining as a Guide for the Construction of Crosslinked Nanoparticles with Low Immunotoxicity via Controlling Polymer Chemistry and Supramolecular Assembly

    PubMed Central

    Elsabahy, Mahmoud; Wooley, Karen L.

    2015-01-01

    CONSPECTUS The potential immunotoxicity of nanoparticles that are currently being approved or in different phases of clinical trials or under rigorous in vitro and in vivo characterizations in several laboratories has recently raised special attention. Products with no apparent in vitro or in vivo toxicity may still trigger the various components of the immune system, unintentionally, and lead to serious adverse reactions. Cytokines are one of the useful biomarkers to predict the effect of biotherapeutics on modulating the immune system and for screening the immunotoxicity of nanoparticles, both in vitro and in vivo, and were found recently to partially predict the in vivo pharmacokinetics and biodistribution of nanomaterials. Control of polymer chemistry and supramolecular assembly provides a great opportunity for construction of biocompatible nanoparticles for biomedical clinical applications. However, the sources of data collected regarding immunotoxicities of nanomaterials are diverse and experiments are usually conducted using different assays and under specific conditions, making direct comparisons nearly impossible and, thus, tailoring properties of nanomaterials based on the available data is challenging. In this account, the effects of chemical structure, crosslinking, degradability, morphology, concentration and surface chemistry on the immunotoxicity of an expansive array of polymeric nanomaterials will be highlighted, with focus being given on assays conducted using the same in vitro and in vivo models and experimental conditions. Furthermore, numerical descriptive values have been utilized, uniquely, to stand for induction of cytokines by nanoparticles. This treatment of available data provides a simple and easy way to compare the immunotoxicity of various nanomaterials, and the values were found to correlate-well with published data. Based on the investigated polymeric systems in this study, valuable information has been collected that aids in the

  2. Immunotoxic effects of in vitro exposure of dolphin lymphocytes to Louisiana sweet crude oil and Corexit™.

    PubMed

    White, Natasha D; Godard-Codding, Celine; Webb, Sarah J; Bossart, Gregory D; Fair, Patricia A

    2016-11-20

    The Deepwater Horizon oil spill was one of the worst environmental disasters on record in the United States. Response efforts to reduce the magnitude of the oil slick included the use of thousands of gallons of the chemical dispersant Corexit™ in surface and deep-water environments. The immunotoxicity of Louisiana sweet crude oil and the chemical dispersant Corexit was examined using lymphocyte proliferation (LP) and natural killer cell (NK) assays as measures of impact on the adaptive (LP) and innate (NK) immune response in bottlenose dolphins. Study results show that both high-energy media-accommodated fractions (MAF) and chemically enhanced MAF (CEMAF) mixtures modulate immune function. Following exposure to Louisiana sweet crude, both B- and T-cell proliferation of white blood cells was increased for all exposure concentrations, compared to control; however, this increase was only significant for the 50% and 100% treatments. In contrast, exposure of white blood cells to the CEMAF mixture significantly decreased both T- and B-cell proliferation in the 25%, 50% and 100% treatments. NK cell activity was enhanced significantly by CEMAF mixtures for the 50% and 100% treatments. The immunosuppression of LP at environmentally relevant concentrations of oil and dispersant suggests that marine mammals may be unable to mount an adequate defense against xenobiotic threats following exposure to oil and dispersant, leaving them more susceptible to disease. In contrast, NK cell activity was significantly enhanced, which may increase an organism's tumor or viral surveillance ability by mounting an enhanced immune response. Copyright © 2016 John Wiley & Sons, Ltd.

  3. Effect of Different Selenium Supplementation Levels on Oxidative Stress, Cytokines, and Immunotoxicity in Chicken Thymus.

    PubMed

    Wang, Yachao; Jiang, Li; Li, Yuanfeng; Luo, Xuegang; He, Jian

    2016-08-01

    This study assessed the effects of different selenium (Se) supplementation levels on oxidative stress, cytokines, and immunotoxicity in chicken thymus. A total of 180 laying hens (1 day old; Mianyang, China) were randomly divided into 4 groups (n = 45). The chickens were maintained either on a basic diet (control group) containing 0.2 mg/kg Se, a low-supplemented diet containing 5 mg/kg Se, a medium-supplemented diet containing 10 mg/kg Se, or a high-supplemented diet containing 15 mg/kg Se for 15, 30, and 45 days, respectively. Over the entire experimental period, serum and thymus samples were collected and used for the detection of the experimental index. The results indicated that the antioxidative enzyme activities and messenger RNA (mRNA) levels of antioxidative enzymes, IFN-γ and IL-2 in the thymus, and the content of IFN-γ and IL-2 in the serum of excessive-Se-treated chickens at all time points (except for the 5 mg/kg Se supplement group at 15 days) were significantly decreased (P < 0.05) compared to the corresponding control groups. Interestingly, a significantly increase (P < 0.05) in the content of IFN-γ was observed in the serum and thymus in the 5 mg/kg Se supplement group at 15 and 30 days compared to the corresponding control groups. In histopathological examination, the thymus tissue from excessive-Se-treated chickens revealed different degrees of cortex drop, incrassation of the medulla, and degeneration of the reticular cells. These results suggested that the excessive Se could result in a decrease in immunity, an increase in oxidative damage, and a series of clinical pathology changes, such as cortex drop, incrassation of the medulla, and degeneration of the reticular cells.

  4. Solvent comparison in the isolation, solubilization, and toxicity of Stachybotrys chartarum spore trichothecene mycotoxins in an established in vitro luminescence protein translation inhibition assay.

    PubMed

    Black, J A; Foarde, K K; Menetrez, M Y

    2006-08-01

    It is well known that non-viable mold contaminants such as macrocyclic trichothecene mycotoxins of Stachybotrys chartarum are highly toxinigenic to humans. However, the method of recovering native mycotoxin has been without consensus. Inconsistencies occur in the methods of isolation, suspension, preparation, and quantitation of the mycotoxin from the spores. The purpose of this study was to provide quantitatively comparative data on three concurrent preparations of 10(6)S. chartarum spores. The experiments were designed to specifically evaluate a novel method of mycotoxin extraction, solubilization, and the subsequent inhibitory effect in an established in vitro luminescence protein translation assay from 30 day-old spores. The mycotoxin-containing spores swabbed from wallboard cultures were milled with and without glass beads in 100% methanol, 95% ethanol, or water. Milled spore lysates were cleared of cell debris by filter centrifugation followed by a second centrifugation through a 5000 MWCO filter to remove interfering proteins and RNases. Cleared lysate was concentrated by centrivap and suspended in either alcohol or water as described. The suspensions were used immediately in the in vitro luminescence protein translation assay with the trichothecene, T-2 toxin, as a control. Although, mycotoxin is reported to be alcohol soluble, the level of translation inhibition was not reliably satisfactory for either the methanol or ethanol preparations. In fact, the methanol and ethanol control reactions were not significantly different than the alcohol prepared spore samples. In addition, we observed that increasing amounts of either alcohol inhibited the reaction in a dose dependent manner. This suggests that although alcohol isolation of mycotoxin is desirable in terms of time and labor, the presence of alcohol in the luminescence protein translation reaction was not acceptable. Conversely, water extraction of mycotoxin demonstrated a dose dependent response, and

  5. Biological and immunotoxicity evaluation of antimicrobial peptide-loaded coatings using a layer-by-layer process on titanium

    NASA Astrophysics Data System (ADS)

    Shi, Jue; Liu, Yu; Wang, Ying; Zhang, Jing; Zhao, Shifang; Yang, Guoli

    2015-11-01

    The prevention and control of peri-implantitis is a challenge in dental implant surgery. Dental implants with sustained antimicrobial coating are an ideal way of preventing peri-implantitis. This study reports development of a non- immunotoxicity multilayered coating on a titanium surface that had sustained antimicrobial activity and limited early biofilm formation. In this study, the broad spectrum AMP, Tet213, was linked to collagen IV through sulfo-SMPB and has been renamed as AMPCol. The multilayer AMPCol coatings were assembled on smooth titanium surfaces using a LBL technique. Using XPS, AFM, contact angle analysis, and QCM, layer-by-layer accumulation of coating thickness was measured and increased surface wetting compared to controls was confirmed. Non-cytotoxicity to HaCaT and low erythrocyte hemolysis by the AMPCol coatings was observed. In vivo immunotoxicity assays showed IP administration of AMPCol did not effect serum immunoglobulin levels. This coating with controlled release of AMP decreased the growth of both a Gram-positive aerobe (Staphylococcus aureus) and a Gram-negative anaerobe (Porphyromonas gingivalis) up to one month. Early S. aureus biofilm formation was inhibited by the coating. The excellent long-term sustained antimicrobial activity of this multilayer coating is a potential method for preventing peri-implantitis through coated on the neck of implants before surgery.

  6. Biological and immunotoxicity evaluation of antimicrobial peptide-loaded coatings using a layer-by-layer process on titanium

    PubMed Central

    Shi, Jue; Liu, Yu; Wang, Ying; Zhang, Jing; Zhao, Shifang; Yang, Guoli

    2015-01-01

    The prevention and control of peri-implantitis is a challenge in dental implant surgery. Dental implants with sustained antimicrobial coating are an ideal way of preventing peri-implantitis. This study reports development of a non- immunotoxicity multilayered coating on a titanium surface that had sustained antimicrobial activity and limited early biofilm formation. In this study, the broad spectrum AMP, Tet213, was linked to collagen IV through sulfo-SMPB and has been renamed as AMPCol. The multilayer AMPCol coatings were assembled on smooth titanium surfaces using a LBL technique. Using XPS, AFM, contact angle analysis, and QCM, layer-by-layer accumulation of coating thickness was measured and increased surface wetting compared to controls was confirmed. Non-cytotoxicity to HaCaT and low erythrocyte hemolysis by the AMPCol coatings was observed. In vivo immunotoxicity assays showed IP administration of AMPCol did not effect serum immunoglobulin levels. This coating with controlled release of AMP decreased the growth of both a Gram-positive aerobe (Staphylococcus aureus) and a Gram-negative anaerobe (Porphyromonas gingivalis) up to one month. Early S. aureus biofilm formation was inhibited by the coating. The excellent long-term sustained antimicrobial activity of this multilayer coating is a potential method for preventing peri-implantitis through coated on the neck of implants before surgery. PMID:26548760

  7. An organotin mixture found in polyvinyl chloride (PVC) pipe is not immunotoxic to adult Sprague-Dawley rats.

    PubMed

    DeWitt, Jamie C; Copeland, Carey B; Luebke, Robert W

    2008-01-01

    Organotin compounds used in polyvinyl chloride (PVC) pipe production are of concern to the U.S. Environmental Protection Agency (EPA) because they leach from supply pipes into drinking water and are reported multisystem toxicants. Immune function was assessed in male Sprague-Dawley rats exposed to the mixture of organotins used in PVC pipe production. Although several of these organotins are reported immunotoxicants, their immunotoxicity as a mixture when given by drinking water has not been evaluated. Adult male rats were given drinking water for 28 d containing a mixture of dibutyltin dichloride (DBTC), dimethyltin dichloride (DMTC), monobutyltin trichloride (MBT), and monomethyltin trichloride (MMT) in a 2:2:1:1 ratio, respectively, at 3 different concentrations (5:5:2.5:2.5, 10:10:5:5, or 20:20:10:10 mg organotin/L), MMT alone (20 or 40 mg MMT/L), or plain water as a control. Delayed-type hypersensitivity, antibody synthesis, and natural killer cell cytotoxicity were evaluated in separate endpoint groups (n = 8/dose; 24/endpoint) immediately after exposure ended. The evaluated immune functions were not affected by the mixture or by MMT alone. Our data suggest that immunotoxicity is unlikely to result from the concentration of organotins present in drinking water delivered via PVC pipes, as the concentrations used were several orders of magnitude higher than those expected to leach from PVC pipes.

  8. Biological and immunotoxicity evaluation of antimicrobial peptide-loaded coatings using a layer-by-layer process on titanium.

    PubMed

    Shi, Jue; Liu, Yu; Wang, Ying; Zhang, Jing; Zhao, Shifang; Yang, Guoli

    2015-11-09

    The prevention and control of peri-implantitis is a challenge in dental implant surgery. Dental implants with sustained antimicrobial coating are an ideal way of preventing peri-implantitis. This study reports development of a non- immunotoxicity multilayered coating on a titanium surface that had sustained antimicrobial activity and limited early biofilm formation. In this study, the broad spectrum AMP, Tet213, was linked to collagen IV through sulfo-SMPB and has been renamed as AMPCol. The multilayer AMPCol coatings were assembled on smooth titanium surfaces using a LBL technique. Using XPS, AFM, contact angle analysis, and QCM, layer-by-layer accumulation of coating thickness was measured and increased surface wetting compared to controls was confirmed. Non-cytotoxicity to HaCaT and low erythrocyte hemolysis by the AMPCol coatings was observed. In vivo immunotoxicity assays showed IP administration of AMPCol did not effect serum immunoglobulin levels. This coating with controlled release of AMP decreased the growth of both a Gram-positive aerobe (Staphylococcus aureus) and a Gram-negative anaerobe (Porphyromonas gingivalis) up to one month. Early S. aureus biofilm formation was inhibited by the coating. The excellent long-term sustained antimicrobial activity of this multilayer coating is a potential method for preventing peri-implantitis through coated on the neck of implants before surgery.

  9. Immunotoxic effects of sodium tungstate dihydrate on female B6C3F1/N mice when administered in drinking water.

    PubMed

    Frawley, Rachel P; Smith, Matthew J; White, Kimber L; Elmore, Susan A; Herbert, Ron; Moore, Rebecca; Staska, Lauren M; Behl, Mamta; Hooth, Michelle J; Kissling, Grace E; Germolec, Dori R

    2016-09-01

    Tungsten is a naturally occurring, high-tensile strength element that has been used in a number of consumer products. Tungsten has been detected in soil, waterways, groundwater, and human tissue and body fluids. Elevated levels of tungsten in urine were reported for populations exposed to tungstate in drinking water in areas where natural tungsten formations were prevalent. Published reports indicated that sodium tungstate may modulate hematopoiesis, immune cell populations, and immune responses in rodent models. The objective of this study was to assess potential immunotoxicity of sodium tungstate dihydrate (STD), a drinking water contaminant. Female B6C3F1/N mice received 0-2000 mg STD/L in their drinking water for 28 d, and were evaluated for effects on immune cell populations in spleen and bone marrow, and humoral-mediated, cell-mediated, and innate immunity. Three different parameters of cell-mediated immunity were similarly affected at 1000 mg STD/L. T-cell proliferative responses against allogeneic leukocytes and anti-CD3 were decreased 32%, and 21%, respectively. Cytotoxic T-lymphocyte activity was decreased at all effector:target cell ratios examined. At 2000 mg STD/L, the absolute numbers of CD3(+) T-cell progenitor cells in bone marrow were increased 86%, but the alterations in B-lymphocyte and other progenitor cells were not significant. There were no effects on bone marrow DNA synthesis or colony forming capabilities. STD-induced effects on humoral-mediated immunity, innate immunity, and splenocyte sub-populations were limited. Enhanced histopathology did not detect treatment-related lesions in any of the immune tissues. These data suggest exposure to STD in drinking water may adversely affect cell-mediated immunity.

  10. In vitro immunotoxicity of untreated and treated urban wastewaters using various treatment processes to rainbow trout leucocytes.

    PubMed

    Gagné, François; Fortier, Marlène; Fournier, Michel; Smyth, Shirley-Anne

    2013-07-01

    Municipal effluents are known to impede the immune system of aquatic organisms. The purpose of this study was to examine the immunotoxicity of urban wastewaters before and after 6 treatment processes from 12 cities toward trout leucocytes. Freshly prepared trout leucocytes were exposed to increasing concentrations of solid phase (C18) extracts of wastewaters for 24 hr at 150C. Immunocompetence was determined by following changes in leucocyte viability and the proportion of cells able to ingest at least one (immunoactivity) and at least three (immunoefficiency) fluorescent beads. The influents were treated by six different treatment strategies consisting of facultative aerated lagoons, activated sludge, biological aerated filter, biological nutrient removal, chemically-assisted physical treatment and trickling filter/solid contact. Water quality parameters of the wastewaters revealed that the plants effectively removed total suspended solids and reduced the chemical oxygen demand. The results revealed that the effluents' immunotoxic properties were generally more influenced by the properties of the untreated wastewaters than by the treatment processes. About half of the incoming influents decreased leucocyte viability while 4 treatment plants were able to reduce toxicity. The influents readily increased phagocytosis activity for 8/12 influents while it was decreased in 4/12 influents. This increase was abolished for 4/12 of the effluents using treatments involving biological and oxidative processes. In conclusion, municipal effluents have the potential to alter the immune system in fish and more research will be needed to improve the treatments of wastewaters to better protect the quality of the aquatic environment.

  11. Size distribution effects of cadmium tellurium quantum dots (CdS/CdTe) immunotoxicity on aquatic organisms.

    PubMed

    Bruneau, A; Fortier, M; Gagne, F; Gagnon, C; Turcotte, P; Tayabali, A; Davis, T L; Auffret, M; Fournier, M

    2013-03-01

    The increasing use of products derived from nanotechnology has raised concern about their potential toxicity to aquatic life. This study sought to examine the comparative immunotoxicity of capped cadmium sulphide/cadmium telluride (CdS/CdTe) quantum dots (QDs) and possible impact of particle/aggregate size on two bivalves (Mytilus edulis and Elliptio complanata) and a fish (Oncorhynchus mykiss). The QDs were dispersed in sterile water and fractionated using a series of micro/ultrafiltration membranes of decreasing pore size: 450 nm, 100 nm, 50 nm, 25 nm, 100 kDa (6.8 nm), 30 kDa (4.6 nm), 10 kDa (3.2 nm) and 1 kDa (1.5 nm). The total concentrations of cadmium and tellurium were determined for the filtered material and for that retained on the filters (retentate). The immunotoxicity was determined by measuring cell viability and phagocytosis. Results revealed that nanoparticles retained on the ultrafilters had a higher Cd/Te ratio compared to the permeate fraction (ratio of 5 and 2 respectively) which could indicate that the CdS core was not associated with the permeable fraction of Cd. Our results demonstrate that the toxicity of CdS/CdTe QDs was concentration and size dependent. Large CdS/CdTe QD aggregates (25 nm < size < 100 nm) reduced phagocytosis more than did smaller nanoparticles (<25 nm). Moreover, our results revealed that the different species responded differently to these fractions. Mytilus edulis hemocytes were less sensitive to CdS/CdTe QDs than the Oncorhynchus mykiss macrophage and Elliptio complanata hemocytes.

  12. In Vivo Immunotoxicity of SiO2@(Y0.5Gd0.45Eu0.05)2O3 as Dual-Modality Nanoprobes

    PubMed Central

    Tian, Xiumei; Li, Ermao; Yang, Fanwen; Peng, Ye; Zhu, Jixiang; He, Fupo; Chen, Xiaoming

    2014-01-01

    We have successfully synthesized SiO2@(Y0.5Gd0.45Eu0.05)2O3 nanocomposites as a potential dual-modality nanoprobe for molecular imaging in vitro. However, their immunotoxicity assessment in vivo remains unknown. In this article, the in vitro biocompatibility of our dual-modality nanoprobes was assayed in terms of cell viability and apoptosis. In vivo immunotoxicity was investigated by monitoring the generation of reactive oxygen species (ROS), cluster of differentiation (CD) markers and cytokines in Balb/c mice. The data show that the in vitro biocompatibility was satisfactory. In addition, the immunotoxicity data revealed there are no significant changes in the expression levels of CD11b and CD71 between the nanoprobe group and the Gd in a diethylenetriaminepentaacetic acid (DTPA) chelator (Gd-DTPA) group 24 h after injection in Balb/c mice (p > 0.05). Importantly, there are significant differences in the expression levels of CD206 and CD25 as well as the secretion of IL-4 and the generation of ROS 24 h after injection (p < 0.05). Transmission electron microscopy (TEM) images showed that few nanoprobes were localized in the phagosomes of liver and lung. In conclusion, the toxic effects of our nanoprobes may mainly result from the aggregation of particles in phagosomes. This accumulation may damage the microstructure of the cells and generate oxidative stress reactions that further stimulate the immune response. Therefore, it is important to evaluate the in vivo immunotoxicity of these rare earth-based biomaterials at the molecular level before molecular imaging in vivo. PMID:25105724

  13. Inhibition of cytochrome P-450 with 2-diethylamino-ethyl-2,2-diphenylpropylacetate (SKF-525A) reduces immunotoxicity of chlorinated carbohydrates.

    PubMed

    Zabrodskii, P F; Mandych, V G; Germanchuk, V G

    2006-09-01

    Experiments on outbred albino rats showed that single intraperitoneal injection of cytochrome P-450 inhibitor 2-diethylaminoethyl-2,2-diphenylpropylacetate (SKF-525A) in a dose of 50 mg/kg before acute poisoning with 1,2-dichloroethane and trichloroethane in a dose of 1.0 LD(50), metabolized in the body to compounds with higher toxicity (the phenomenon of "lethal synthesis") reduced their immunotoxicity by decreasing the formation of their biotransformation products.

  14. In vivo immunotoxicity of SiO2@(Y0.5Gd0.45Eu0.05)2O3 as dual-modality nanoprobes.

    PubMed

    Tian, Xiumei; Li, Ermao; Yang, Fanwen; Peng, Ye; Zhu, Jixiang; He, Fupo; Chen, Xiaoming

    2014-08-07

    We have successfully synthesized SiO2@(Y0.5Gd0.45Eu0.05)2O3 nanocomposites as a potential dual-modality nanoprobe for molecular imaging in vitro. However, their immunotoxicity assessment in vivo remains unknown. In this article, the in vitro biocompatibility of our dual-modality nanoprobes was assayed in terms of cell viability and apoptosis. In vivo immunotoxicity was investigated by monitoring the generation of reactive oxygen species (ROS), cluster of differentiation (CD) markers and cytokines in Balb/c mice. The data show that the in vitro biocompatibility was satisfactory. In addition, the immunotoxicity data revealed there are no significant changes in the expression levels of CD11b and CD71 between the nanoprobe group and the Gd in a diethylenetriaminepentaacetic acid (DTPA) chelator (Gd-DTPA) group 24 h after injection in Balb/c mice (p>0.05). Importantly, there are significant differences in the expression levels of CD206 and CD25 as well as the secretion of IL-4 and the generation of ROS 24 h after injection (p<0.05). Transmission electron microscopy (TEM) images showed that few nanoprobes were localized in the phagosomes of liver and lung. In conclusion, the toxic effects of our nanoprobes may mainly result from the aggregation of particles in phagosomes. This accumulation may damage the microstructure of the cells and generate oxidative stress reactions that further stimulate the immune response. Therefore, it is important to evaluate the in vivo immunotoxicity of these rare earth-based biomaterials at the molecular level before molecular imaging in vivo.

  15. Subchronic toxicity and immunotoxicity of MeO-PEG-poly(D,L-lactic-co-glycolic acid)-PEG-OMe triblock copolymer nanoparticles delivered intravenously into rats.

    PubMed

    Liao, Longfei; Zhang, Mengtian; Liu, Huan; Zhang, Xuanmiao; Xie, Zhaolu; Zhang, Zhirong; Gong, Tao; Sun, Xun

    2014-06-20

    Although monomethoxy(polyethyleneglycol)-poly (D,L-lactic-co-glycolic acid)-monomethoxy (PELGE) nanoparticles have been widely studied as a drug delivery system, little is known about their toxicity in vivo. Here we examined the subchronic toxicity and immunotoxicity of different doses of PELGE nanoparticles with diameters of 50 and 200 nm (PELGE50 and PELGE200) in rats. Neither size of PELGE nanoparticles showed obvious subchronic toxic effects during 28 d of continuous intravenous administration based on clinical observation, body weight, hematology parameters and histopathology analysis. PELGE200 nanoparticles showed no overt signs of immunotoxicity based on organ coefficients, histopathology analysis, immunoglobulin levels, blood lymphocyte subpopulations and splenocyte cytokines. Conversely, PELGE50 nanoparticles were associated with an increased organ coefficient and histopathological changes in the spleen, increased serum IgM and IgG levels, alterations in blood lymphocyte subpopulations and enhanced expression of spleen interferon-γ. Taken together, these results suggest that PELGE nanoparticles show low subchronic toxicity but substantial immunotoxicity, which depends strongly on particle size. These findings will be useful for safe application of PELGE nanoparticles in drug delivery systems.

  16. Subchronic toxicity and immunotoxicity of MeO-PEG-poly(D,L-lactic-co-glycolic acid)-PEG-OMe triblock copolymer nanoparticles delivered intravenously into rats

    NASA Astrophysics Data System (ADS)

    Liao, Longfei; Zhang, Mengtian; Liu, Huan; Zhang, Xuanmiao; Xie, Zhaolu; Zhang, Zhirong; Gong, Tao; Sun, Xun

    2014-06-01

    Although monomethoxy(polyethyleneglycol)-poly (D,L-lactic-co-glycolic acid)-monomethoxy (PELGE) nanoparticles have been widely studied as a drug delivery system, little is known about their toxicity in vivo. Here we examined the subchronic toxicity and immunotoxicity of different doses of PELGE nanoparticles with diameters of 50 and 200 nm (PELGE50 and PELGE200) in rats. Neither size of PELGE nanoparticles showed obvious subchronic toxic effects during 28 d of continuous intravenous administration based on clinical observation, body weight, hematology parameters and histopathology analysis. PELGE200 nanoparticles showed no overt signs of immunotoxicity based on organ coefficients, histopathology analysis, immunoglobulin levels, blood lymphocyte subpopulations and splenocyte cytokines. Conversely, PELGE50 nanoparticles were associated with an increased organ coefficient and histopathological changes in the spleen, increased serum IgM and IgG levels, alterations in blood lymphocyte subpopulations and enhanced expression of spleen interferon-γ. Taken together, these results suggest that PELGE nanoparticles show low subchronic toxicity but substantial immunotoxicity, which depends strongly on particle size. These findings will be useful for safe application of PELGE nanoparticles in drug delivery systems.

  17. Interaction of aflatoxin B1 and fumonisin B1 in mice causes immunotoxicity and oxidative stress: Possible protective role using lactic acid bacteria.

    PubMed

    Abbès, Samir; Ben Salah-Abbès, Jalila; Jebali, Rania; Younes, Ridha Ben; Oueslati, Ridha

    2016-01-01

    Aflatoxins (AF) are important foodborne mycotoxins implicated in human health and have immunocytotoxic effects. The aims of this study were to evaluate a new aflatoxin B1 (AFB1) and fumonisin B1 (FB1)-binding/degrading micro-organism for biological detoxification, to examine its ability to degrade AFB1 and FB1 in liquid medium, and to evaluate its potential in vivo protective role against any combined effects from AFB1 and FB1 on host splenocyte caspase-3 activity (reflecting DNA damage/cell death) and mRNA levels of select inflammation-regulating cytokines. Balb/c mice were divided into groups (10/group) and treated daily for 2 weeks by oral gavage with AFB1 (80 µg/kg BW), FB1 (100 µg/kg), AFB1 + FB1, or lactic acid bacteria (Lactobacillus paracasei BEJ01, 2 × 10(9) CFU/L, ∼2 mg/kg) - alone or in combination with the AFB1 and/or FB1. After the exposures, spleens were collected for measures of caspase-3 activity, lipid peroxidation (LP), and glutathione (GSH) content, expression of anti-oxidation protective enzymes (GPx and SOD), and mRNA levels of inflammation-regulating cytokines (e.g. IL-10, IL-4, IFNγ, TNFα). Thymii were also removed for analysis of apoptosis. The results indicated that, in the spleen, exposure to the mycotoxins led to increased caspase-3 activity, LP, and IL-10 and IL-4 mRNA levels, but decreased GSH content and down-regulated expression of GPx and SOD, and of IFNγ and TNFα mRNA. Co-treatment using Lactic Acid Bacteria (LAB) with AFB1 or FB1 suppressed levels of DNA fragmentation, normalized splenic LP and increased GSH levels, up-regulated expression of GPx and SOD, and normalized mRNA levels of the analyzed cytokines. It is concluded that AFB1 and FB1 might have combinational (synergistic moreso than additive) toxic effects in situ. Further, it can be seen that use of LAB induced protective effects against the oxidative stress and (immuno)toxicity of these agents in part through adhesion (and so likely diminished

  18. Immunotoxicity of 2,3,7,8-tetrachlorodibenzo-p-dioxin in a complex environmental mixture from the Love Canal.

    PubMed

    Silkworth, J B; Cutler, D S; Sack, G

    1989-02-01

    The organic phase of the leachate (OPL) from the Love Canal chemical dump site contains more than 100 organic compounds including 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). The immunotoxic potential of OPL was determined in two mouse strains which differ in their sensitivity to aromatic hydrocarbon (Ah) receptor-mediated toxicity. OPL was administered in corn oil in a single oral gavage to male BALB/cByJ (Ahb/Ahb) mice (0.5, 0.8, or 1.1 g/kg) and DBA/2J (Ahd/Ahd) mice (0.6, 0.9, or 1.3 g/kg). TCDD was similarly administered at 0.25, 1.0, 4.0, or 16.0 micrograms/kg. Two days later all mice were immunized with sheep erythrocytes (SRBC). The antibody response (PFC) and organ weights were evaluated 4 days later. OPL produced thymic atrophy and hepatomegaly in both strains at all dose levels. The PFC/spleen in BALB/cByJ mice was significantly reduced at the three doses to 34, 13, and 15%, respectively, of the control response. Serum anti-SRBC antibody levels and relative spleen weights were also reduced. The only immune effect in the DBA/2J mice was a decrease of the PFC/spleen to 58% of the control at the highest dose. TCDD decreased the relative thymus and spleen weights only in BALB/cByJ mice. However, TCDD produced hepatomegaly, a decrease in serum antibody, and a decrease in PFC/spleen in both BALB/cByJ and DBA/2J mice to 3 and 15%, respectively, at 16 micrograms/kg. Thus, the TCDD dose required to cause a 50% suppression (ED50) of PFC/spleen for the BALB/cByJ and DBA/2J strains was 1.84 and 3.89 micrograms/kg, respectively. The ED50 for OPL was 0.24 g/kg in BALB/cByJ mice. The TCDD concentration in the OPL was estimated to be 7.6 ppm, which agrees closely with the chemical analysis (3 ppm). The results suggest that the immunosuppression caused by OPL in BALB/cByJ mice was primarily due to TCDD, that the non-TCDD components of OPL diminished the TCDD immunotoxicity in the DBA/2J strain, and that the thymic atrophy and hepatomegaly were caused primarily by the non

  19. Composition and immunotoxicity activity of essential oils from leaves of Zingiber officinale Roscoe against Aedes aegypti L.

    PubMed

    Moon, Hyung-In; Cho, Sang-Buem; Kim, Soo-Ki

    2011-03-01

    The leaves of Zingiber officinale Roscoe were extracted and the major essential oil composition and immunotoxicity effects were studied. The analyses were conducted by gas chromatography and mass spectroscopy (GC-MS) revealed that the essential oils of Z. officinale leaves. The Z. officinale essential oil yield was 0.26%, and GC/MS analysis revealed that its major constituents were Camphene (5.26%), Phellandrene (6.58%), Zingiberene (36.48%), Geranial (4.32%), β-gurjunene (2.74%), and Citronellol β-sesguiphellandrene (12.31%). The essential oil had a significant toxic effect against early fourth-stage larvae of Aedes aegypti L with an LC(50) value of 46.38 ppm and an LC(90) value of 84.32 ppm. Also, Camphene (≥95.0%), Phellandrene (≥95.0%), Zingiberene (≥95.0%), Geranial (≥95.0%), β-gurjunene (≥97.0%), and Citronellol (≥95.0%) were tested against the F21 laboratory strain of A. aegypti. Zingiberene (≥95.0%) and Citronellol (≥95.0%) have medium activity with an LC(50) value of 99.55 ppm and 141.45 ppm. This indicates that other major compounds may play a more important role in the toxicity of essential oil.

  20. Role of Metabolism by Intestinal Bacteria in Arbutin-Induced Suppression of Lymphoproliferative Response in vitro

    PubMed Central

    Kang, Mi Jeong; Ha, Hyun Woo; Kim, Ghee Hwan; Lee, Sang Kyu; Ahn, Young Tae; Kim, Dong Hyun; Jeong, Hye Gwang; Jeong, Tae Cheon

    2012-01-01

    Role of metabolism by intestinal bacteria in arbutin-induced immunotoxicity was investigated in splenocyte cultures. Following an incubation of arbutin with 5 different intestinal bacteria for 24 hr, its aglycone hydroquinone could be produced and detected in the bacterial culture media with different amounts. Toxic effects of activated arbutin by intestinal bacteria on lymphoproliferative response were tested in splenocyte cultures from normal mice. Lipopolysaccharide and concanavalin A were used as mitogens for B- and T-cells, respectively. When bacteria cultured medium with arbutin was treated into the splenocytes for 3 days, the medium cultured with bacteria producing large amounts of hydroquinone induced suppression of lymphoproliferative responses, indicating that metabolic activation by intestinal bacteria might be required in arbutin-induced toxicity. The results indicated that the present testing system might be applied for determining the possible role of metabolism by intestinal bacteria in certain chemical-induced immunotoxicity in animal cell cultures. PMID:24116295

  1. IMMUNOTOXICOGENOMICS: THE POTENTIAL OF GENOMICS TECHNOLOGY IN THE IMMUNOTOXICITY RISK ASSESSMENT PROCESS

    EPA Science Inventory

    Evaluation of xenobiotic-induced changes in gene expression as a method to identify and classify potential toxicants is being pursued by industry and regulatory agencies worldwide. A workshop was held at the Research Triangle Park campus of the Environmental Protection Agency to...

  2. IMMUNOTOXICOGENOMICS: THE POTENTIAL OF GENOMICS TECHNOLOGY IN THE IMMUNOTOXICITY RISK ASSESSMENT PROCESS

    EPA Science Inventory

    Evaluation of xenobiotic-induced changes in gene expression as a method to identify and classify potential toxicants is being pursued by industry and regulatory agencies worldwide. A workshop was held at the Research Triangle Park campus of the Environmental Protection Agency to...

  3. Immunotoxicity of skin acid secretion produced by the sea slug Berthellina citrina in mice spleen: Histological and Immunohistochemical study.

    PubMed

    Awaad, Aziz; Moustafa, Alaa Y

    2016-07-01

    Acid secretion containing sulfuric and hydrochloric acids is a fascinating defensive phenomenon within many groups of marine organisms. This study aimed to investigate the mice spleen histology and immunotoxicity using skin acid secretion (SAS) of the sea slug Berthellina citrina after oral administration. The spleen showed atrophy in the white pulp, decrease in the splenocytes density, megakaryocytes cytoplasmic degeneration as well as inflammatory cells infiltrations. The white and red pulp splenocytes number decreased time-dependently in the treated spleens. Additionally, the size of the megakaryocytes increased as compared with the control. The administration with SAS increased the number of the IgA(+) cells aggregation in the splenic red pulp. Furthermore, after 7days of the administration, large number of dispersed IgA(+) cells were distributed in splenic parenchyma. The IgA(+) cells numbers increased time-dependently as compared with those in the control. The aggregation sizes and number of the F4/80(+) cell in the splenic red pulp were increased. Furthermore the F4/80(+) cells numbers increased time-dependently as compared with those in the control. The UEAI(+) cells were found as free cells but not in aggregations in the control splenic red pulp. Contradictory to the number of IgA(+) cells and F4/80(+) cells the number of the UEAI(+) cells decreased time-dependently after administration with SAS. Hematologically, abnormal numbers of WBCs different cells were observed after administration with SAS. This study provides new insight about the toxicity of a marine extract may be used in natural products industry or medical applications. Copyright © 2016 Elsevier GmbH. All rights reserved.

  4. Immunotoxicity and biodistribution analysis of arsenic trioxide in C57Bl/6 mice following a 2-week inhalation exposure

    SciTech Connect

    Burchiel, Scott W.; Mitchell, Leah A.; Lauer, Fredine T.; Sun Xi; McDonald, Jacob D.; Hudson, Laurie G.; Liu Kejian

    2009-12-15

    In these studies the immunotoxicity of arsenic trioxide (ATO, As{sub 2}O{sub 3}) was evaluated in mice following 14 days of inhalation exposures (nose only, 3 h per day) at concentrations of 50 mug/m{sup 3} and 1 mg/m{sup 3}. A biodistribution analysis performed immediately after inhalation exposures revealed highest levels of arsenic in the kidneys, bladder, liver, and lung. Spleen cell levels were comparable to those found in the blood, with the highest concentration of arsenic detected in the spleen being 150 mug/g tissue following the 1 mg/m{sup 3} exposures. No spleen cell cytotoxicity was observed at either of the two exposure levels. There were no changes in spleen cell surface marker expression for B cells, T cells, macrophages, and natural killer (NK) cells. There were also no changes detected in the B cell (LPS-stimulated) and T cell (Con A-stimulated) proliferative responses of spleen cells, and no changes were found in the NK-mediated lysis of Yac-1 target cells. The primary T-dependent antibody response was, however, found to be highly susceptible to ATO suppression. Both the 50 mug/m{sup 3} and 1 mg/m{sup 3} exposures produced greater than 70% suppression of the humoral immune response to sheep red blood cells. Thus, the primary finding of this study is that the T-dependent humoral immune response is extremely sensitive to suppression by ATO and assessment of humoral immune responses should be considered in evaluating the health effects of arsenic containing agents.

  5. IMMUNOTOXICITY AND BIODISTRIBUTION ANALYSIS OF ARSENIC TRIOXIDE IN C57Bl/6 MICE FOLLOWING A TWO-WEEK INHALATION EXPOSURE

    PubMed Central

    Burchiel, Scott W.; Mitchell, Leah A.; Lauer, Fredine T.; Sun, Xi; McDonald, Jacob D.; Hudson, Laurie G.; Liu, Ke Jian

    2010-01-01

    In these studies the immunotoxicity of arsenic trioxide (ATO, As2O3) was evaluated in mice following 14 days of inhalation exposures (nose only, 3 hrs per day) at concentrations of 50 μg/m3 and 1 mg/m3. A biodistribution analysis performed immediately after inhalation exposures revealed highest levels of arsenic in the kidneys, bladder, liver, and lung. Spleen cell levels were comparable to those found in the blood, with the highest concentration of arsenic detected in the spleen being 150 μg/mg tissue following the 1 mg/m3 exposures. No spleen cell cytotoxicity was observed at either of the two exposure levels. There were no changes in spleen cell surface marker expression for B cells, T cells, macrophages, and natural killer (NK) cells. There were also no changes detected in the B cell (LPS-stimulated) and T cell (Con A-stimulated) proliferative responses of spleen cells, and no changes were found in the NK-mediated lysis of Yac-1 target cells. The primary T-dependent antibody response was, however, found to be highly susceptible to ATO suppression. Both the 50 μg/m3 and 1 mg/m3 exposures produced greater than 70% suppression of the humoral immune response to sheep red blood cells. Thus, the primary finding of this study is that the T-dependent humoral immune response is extremely sensitive to suppression by ATO and assessment of humoral immune responses should be considered in evaluating the health effects of arsenic containing agents. PMID:19800901

  6. Carcinogenicity and Immunotoxicity of Embedded Depleted Uranium and Heavy-Metal Tungsten Alloy in Rodents

    DTIC Science & Technology

    2005-10-01

    the Year 3 report, rats implanted with 20 pellets of WA (high dose group) exhibited characteristics of polycythemia (elevated red blood cell counts...hematologic changes, indicative of polycythemia , were also observed in the high-dose WA- military of many nations to replace DU in implanted rats. These...210. to induce polycythemia in rats (Endoh et al. sis. Recently, the role of tungsten in human Miller AC, Mog S, McKinney L, Luo L, Allen J, Xu J, et

  7. Surface Charges and Shell Crosslinks Each Play Significant Roles in Mediating Degradation, Biofouling, Cytotoxicity and Immunotoxicity for Polyphosphoester-based Nanoparticles

    PubMed Central

    Elsabahy, Mahmoud; Zhang, Shiyi; Zhang, Fuwu; Deng, Zhou J.; Lim, Young H.; Wang, Hai; Parsamian, Perouza; Hammond, Paula T.; Wooley, Karen L.

    2013-01-01

    The construction of nanostructures from biodegradable precursors and shell/core crosslinking have been pursued as strategies to solve the problems of toxicity and limited stability, respectively. Polyphosphoester (PPE)-based micelles and crosslinked nanoparticles with non-ionic, anionic, cationic, and zwitterionic surface characteristics for potential packaging and delivery of therapeutic and diagnostic agents, were constructed using a quick and efficient synthetic strategy, and importantly, demonstrated remarkable differences in terms of cytotoxicity, immunotoxicity, and biofouling properties, as a function of their surface characteristics and also with dependence on crosslinking throughout the shell layers. For instance, crosslinking of zwitterionic micelles significantly reduced the immunotoxicity, as evidenced from the absence of secretions of any of the 23 measured cytokines from RAW 264.7 mouse macrophages treated with the nanoparticles. The micelles and their crosslinked analogs demonstrated lower cytotoxicity than several commercially-available vehicles, and their degradation products were not cytotoxic to cells at the range of the tested concentrations. PPE-nanoparticles are expected to have broad implications in clinical nanomedicine as alternative vehicles to those involved in several of the currently available medications. PMID:24264796

  8. Surface charges and shell crosslinks each play significant roles in mediating degradation, biofouling, cytotoxicity and immunotoxicity for polyphosphoester-based nanoparticles.

    PubMed

    Elsabahy, Mahmoud; Zhang, Shiyi; Zhang, Fuwu; Deng, Zhou J; Lim, Young H; Wang, Hai; Parsamian, Perouza; Hammond, Paula T; Wooley, Karen L

    2013-11-22

    The construction of nanostructures from biodegradable precursors and shell/core crosslinking have been pursued as strategies to solve the problems of toxicity and limited stability, respectively. Polyphosphoester (PPE)-based micelles and crosslinked nanoparticles with non-ionic, anionic, cationic, and zwitterionic surface characteristics for potential packaging and delivery of therapeutic and diagnostic agents, were constructed using a quick and efficient synthetic strategy, and importantly, demonstrated remarkable differences in terms of cytotoxicity, immunotoxicity, and biofouling properties, as a function of their surface characteristics and also with dependence on crosslinking throughout the shell layers. For instance, crosslinking of zwitterionic micelles significantly reduced the immunotoxicity, as evidenced from the absence of secretions of any of the 23 measured cytokines from RAW 264.7 mouse macrophages treated with the nanoparticles. The micelles and their crosslinked analogs demonstrated lower cytotoxicity than several commercially-available vehicles, and their degradation products were not cytotoxic to cells at the range of the tested concentrations. PPE-nanoparticles are expected to have broad implications in clinical nanomedicine as alternative vehicles to those involved in several of the currently available medications.

  9. Surface Charges and Shell Crosslinks Each Play Significant Roles in Mediating Degradation, Biofouling, Cytotoxicity and Immunotoxicity for Polyphosphoester-based Nanoparticles

    NASA Astrophysics Data System (ADS)

    Elsabahy, Mahmoud; Zhang, Shiyi; Zhang, Fuwu; Deng, Zhou J.; Lim, Young H.; Wang, Hai; Parsamian, Perouza; Hammond, Paula T.; Wooley, Karen L.

    2013-11-01

    The construction of nanostructures from biodegradable precursors and shell/core crosslinking have been pursued as strategies to solve the problems of toxicity and limited stability, respectively. Polyphosphoester (PPE)-based micelles and crosslinked nanoparticles with non-ionic, anionic, cationic, and zwitterionic surface characteristics for potential packaging and delivery of therapeutic and diagnostic agents, were constructed using a quick and efficient synthetic strategy, and importantly, demonstrated remarkable differences in terms of cytotoxicity, immunotoxicity, and biofouling properties, as a function of their surface characteristics and also with dependence on crosslinking throughout the shell layers. For instance, crosslinking of zwitterionic micelles significantly reduced the immunotoxicity, as evidenced from the absence of secretions of any of the 23 measured cytokines from RAW 264.7 mouse macrophages treated with the nanoparticles. The micelles and their crosslinked analogs demonstrated lower cytotoxicity than several commercially-available vehicles, and their degradation products were not cytotoxic to cells at the range of the tested concentrations. PPE-nanoparticles are expected to have broad implications in clinical nanomedicine as alternative vehicles to those involved in several of the currently available medications.

  10. Immunotoxicity of the colour additive caramel colour III; a review on complicated issues in the safety evaluation of a food additive.

    PubMed

    Houben, G F; Penninks, A H

    1994-08-12

    Food additives can be regarded as the safest constituents of our daily food. Nevertheless, complicated issues with respect to their safety evaluation do also occur. In this review paper, some of these issues are illustrated by the description and evaluation of the research on the immunotoxicity of the food additive Caramel Colour III. Caramel Colour III is commonly used as a color additive in many products for human consumption. Toxicity studies conducted in the seventies demonstrated that administration of Caramel Colour III can cause a reduction in total white blood cell counts in rats, due to reduced lymphocyte counts. Studies reviewed in this paper demonstrated several other effects of Caramel Colour III on the immune system of rodents, including disturbed immune functions and changed resistance in infection models. In addition, studies in rats demonstrated that most of the effects occur only when the animals are fed a diet low in vitamin B6. The imidazole derivative 2-acetyl-4(5)-(1,2,3,4-tetrahydroxy-butyl)-imidazole (THI) was found to be responsible for the immunotoxicity. Issues such as the mechanism of action of THI and the role of vitamin B6 are discussed. Finally, the results of a human intervention study and the observed effect levels of THI in rats are discussed in terms of safety of the use of Caramel Colour III in our daily food supply.

  11. Fate of silver nanoparticles in wastewater and immunotoxic effects on rainbow trout.

    PubMed

    Bruneau, A; Turcotte, P; Pilote, M; Gagné, F; Gagnon, C

    2016-05-01

    Silver nanoparticles (AgNPs) are currently used in technology, medicine and consumer products, even though the fate and the ecotoxicological risks on aquatic organisms of these new materials are not well known. The purpose of this study was to investigate the fate, bioavailability of AgNPs and their effects on fish in presence of municipal effluents. Juvenile rainbow trout were exposed for 96h to 40μg/L of AgNPs or 4μg/L of dissolved silver (AgNO3) in diluted (10%) municipal wastewater. Silver (Ag) concentrations were measured both on water samples and fish tissues (liver and gills). Toxicity was investigated by following immunological parameters in the pronephros (viability, phagocytosis) and biomarkers in liver and gills (cyclooxygenase activity, lipid peroxidation, glutathione-S-transferase, metallothioneins, DNA strand breaks and labile zinc). Results indicated that AgNPs appeared as small non-charged aggregates in wastewaters (11.7±1.4nm). In gills, the exposure to AgNPs induced morphological modifications without visible nanoparticle bioaccumulation. Dissolved Ag(+) was bioavailable in diluted effluent and induced oxidative stress (lipid peroxidation), labile zinc and a marginal decrease in superoxide dismutase in fish gills. Ag(+) also increased significantly metallothionein levels and inhibited the DNA repair activity in the liver. Finally, the two silver forms were found in liver and induced immunosuppression and inflammation (increase in cyclooxygenase activity). This study demonstrated that both forms of Ag produced harmful effects and AgNPs in wastewater were bioavailable to fish despite of their formation of aggregates.

  12. Immunotoxicity in ascidians: antifouling compounds alternative to organotins-IV. The case of zinc pyrithione.

    PubMed

    Cima, Francesca; Ballarin, Loriano

    2015-03-01

    New biocides such as the organometallic compound zinc pyrithione (ZnP) have been massively introduced by many countries in formulations of antifouling paints following the ban on tributyltin (TBT). The effects of sublethal concentrations (LC50=82.5 μM, i.e., 26.2 mg/l) on cultured haemocytes of the ascidian Botryllus schlosseri have been investigated and compared with TBT. The percentage of haemocytes with amoeboid morphology and containing phagocytised yeast cells were significantly (p<0.05) reduced after exposure to 0.1 (31.7 μg/l) and 0.5 μM (158 μg/l), respectively. An antagonistic interaction in inducing cytoskeletal alterations was observed when ZnP and TBT were co-present in the exposure medium. ZnP affected only the actin component. As caused by TBT, ZnP induced apoptosis and inhibited both oxidative phosphorylation and lysosomal activities. In contrast to the case of TBT, a decrement in Ca(2+)-ATPase activity and a decrease in cytosolic Ca(2+) were detected after incubation at the highest concentration (1 μM, i.e., 317.7 μg/l) used. In comparison with other antifouling compounds, ZnP shows as much toxicity as TBT to cultured haemocytes at extremely low concentrations interfering with fundamental cell activities.

  13. Functionalized porous silica&maghemite core-shell nanoparticles for applications in medicine: design, synthesis, and immunotoxicity.

    PubMed

    Zasonska, Beata A; Líškova, Aurelia; Kuricova, Miroslava; Tulinska, Jana; Pop-Georgievski, Ognen; Čiampor, Fedor; Vavra, Ivo; Dušinska, Maria; Ilavska, Silvia; Horvathova, Mira; Horák, Daniel

    2016-04-23

    To determine cytotoxicity and effect of silica-coated magnetic nanoparticles (MNPs) on immune response, in particular lymphocyte proliferative activity, phagocytic activity, and leukocyte respiratory burst and in vitro production of interleukin-6 (IL-6) and 8 (IL-8), interferon-gamma (IFN-γ), tumor necrosis factor-alpha (TNF-α), and granulocyte macrophage colony stimulating factor (GM-CSF). Maghemite was prepared by coprecipitation of iron salts with ammonia, oxidation with NaOCl and modified by tetramethyl orthosilicate and aminosilanes. Particles were characterized by transmission electron microscopy (TEM), dynamic light scattering (DLS), Fourier-transform infrared (FTIR), and X-ray photoelectron spectroscopy (XPS). Cytotoxicity and lymphocyte proliferative activity were assessed using [3H]-thymidine incorporation into DNA of proliferating human peripheral blood cells. Phagocytic activity and leukocyte respiratory burst were measured by flow cytometry; cytokine levels in cell supernatants were determined by ELISA. γ-Fe2O3&SiO2-NH2 MNPs were 13 nm in size. According to TEM, they were localized in the cell cytoplasm and extracellular space. Neither cytotoxic effect nor significant differences in T-lymphocyte and T-dependent B-cell proliferative response were found at particle concentrations 0.12-75 μg/cm2 after 24, 48, and 72 h incubation. Significantly increased production of IL-6 and 8, and GM-CSF cytokines was observed in the cells treated with 3, 15, and 75 µg of particles/cm2 for 48 h and stimulated with pokeweed mitogen (PHA). No significant changes in TNF-α and IFN-γ production were observed. MNPs did not affect phagocytic activity of monocytes and granulocytes when added to cells for 24 and 48 h. Phagocytic respiratory burst was significantly enhanced in the cultures exposed to 75 µg MNPs/cm2 for 48 h. The cytotoxicity and in vitro immunotoxicity were found to be minimal in the newly developed porous core-shell γ-Fe2O3&SiO2-NH2 magnetic

  14. Functionalized porous silica&maghemite core-shell nanoparticles for applications in medicine: design, synthesis, and immunotoxicity

    PubMed Central

    Zasońska, Beata A.; Líšková, Aurélia; Kuricová, Miroslava; Tulinská, Jana; Pop-Georgievski, Ognen; Čiampor, Fedor; Vávra, Ivo; Dušinská, Mária; Ilavská, Silvia; Horváthová, Mira; Horák, Daniel

    2016-01-01

    Aim To determine cytotoxicity and effect of silica-coated magnetic nanoparticles (MNPs) on immune response, in particular lymphocyte proliferative activity, phagocytic activity, and leukocyte respiratory burst and in vitro production of interleukin-6 (IL-6) and 8 (IL-8), interferon-gamma (IFN-γ), tumor necrosis factor-alpha (TNF-α), and granulocyte macrophage colony stimulating factor (GM-CSF). Methods Maghemite was prepared by coprecipitation of iron salts with ammonia, oxidation with NaOCl and modified by tetramethyl orthosilicate and aminosilanes. Particles were characterized by transmission electron microscopy (TEM), dynamic light scattering (DLS), Fourier-transform infrared (FTIR), and X-ray photoelectron spectroscopy (XPS). Cytotoxicity and lymphocyte proliferative activity were assessed using [3H]-thymidine incorporation into DNA of proliferating human peripheral blood cells. Phagocytic activity and leukocyte respiratory burst were measured by flow cytometry; cytokine levels in cell supernatants were determined by ELISA. Results γ-Fe2O3&SiO2-NH2 MNPs were 13 nm in size. According to TEM, they were localized in the cell cytoplasm and extracellular space. Neither cytotoxic effect nor significant differences in T-lymphocyte and T-dependent B-cell proliferative response were found at particle concentrations 0.12-75 μg/cm2 after 24, 48, and 72 h incubation. Significantly increased production of IL-6 and 8, and GM-CSF cytokines was observed in the cells treated with 3, 15, and 75 µg of particles/cm2 for 48 h and stimulated with pokeweed mitogen (PHA). No significant changes in TNF-α and IFN-γ production were observed. MNPs did not affect phagocytic activity of monocytes and granulocytes when added to cells for 24 and 48 h. Phagocytic respiratory burst was significantly enhanced in the cultures exposed to 75 µg MNPs/cm2 for 48 h. Conclusions The cytotoxicity and in vitro immunotoxicity were found to be minimal in the newly developed porous core-shell γ-Fe2

  15. Immunotoxicity of 2,3,7,8-tetrachlorodibenzo-p-dioxin in a complex environmental mixture from the Love Canal

    SciTech Connect

    Silkworth, J.B.; Cutler, D.S.; Sack, G.

    1989-02-01

    The organic phase of the leachate (OPL) from the Love Canal chemical dump site contains more than 100 organic compounds including 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). The immunotoxic potential of OPL was determined in two mouse strains which differ in their sensitivity to aromatic hydrocarbon (Ah) receptor-mediated toxicity. OPL was administered in corn oil in a single oral gavage to male BALB/cByJ (Ahb/Ahb) mice (0.5, 0.8, or 1.1 g/kg) and DBA/2J (Ahd/Ahd) mice (0.6, 0.9, or 1.3 g/kg). TCDD was similarly administered at 0.25, 1.0, 4.0, or 16.0 micrograms/kg. Two days later all mice were immunized with sheep erythrocytes (SRBC). The antibody response (PFC) and organ weights were evaluated 4 days later. OPL produced thymic atrophy and hepatomegaly in both strains at all dose levels. The PFC/spleen in BALB/cByJ mice was significantly reduced at the three doses to 34, 13, and 15%, respectively, of the control response. Serum anti-SRBC antibody levels and relative spleen weights were also reduced. The only immune effect in the DBA/2J mice was a decrease of the PFC/spleen to 58% of the control at the highest dose. TCDD decreased the relative thymus and spleen weights only in BALB/cByJ mice. However, TCDD produced hepatomegaly, a decrease in serum antibody, and a decrease in PFC/spleen in both BALB/cByJ and DBA/2J mice to 3 and 15%, respectively, at 16 micrograms/kg. Thus, the TCDD dose required to cause a 50% suppression (ED50) of PFC/spleen for the BALB/cByJ and DBA/2J strains was 1.84 and 3.89 micrograms/kg, respectively. The ED50 for OPL was 0.24 g/kg in BALB/cByJ mice. The TCDD concentration in the OPL was estimated to be 7.6 ppm, which agrees closely with the chemical analysis (3 ppm).

  16. Sensitivity of wild cotton rats (Sigmodon hispidus) to the immunotoxic effects of low-level arsenic exposure.

    PubMed

    Savabieasfahani, M; Lochmiller, R L; Rafferty, D P; Sinclair, J A

    1998-04-01

    Arsenic is a ubiquitous contaminant of many toxic waste sites around the country and experimental animal trials have indicated that arsenic may be immunotoxic to laboratory rodents. Because wild rodents such as the herbivorous cotton rat (Sigmodon hispidus) reside on many of these toxic waste sites, we explored the sensitivity of their immune systems to oral exposures of environmentally relevant concentrations of inorganic arsenic. We exposed adult male cotton rats (n = 36) to either 0 (controls), 5 (low dose), or 10 (high dose) ppm sodium arsenite in drinking water for 6 weeks. Daily food intake decreased in a dose-dependent manner, ranging from an average of 10.03 +/- 0.45 in the high-dose group to 11.27 +/- 0.42 (SE) g/animal/day in the control group. Mass of testes in the low-dose group increased significantly compared to controls, but there was no difference between the high-dose and control groups. Masses of liver, kidney, adrenals, popliteal lymph nodes, spleen, epididymides, and seminal vesicles and selected hematological parameters were unaffected by arsenic exposure. In vivo cell-mediated immunity, as measured by a phytohemagglutinin-hypersensitivity response to an intradermal challenge, was suppressed 30% in the low-dose group compared to controls; however, responses of those receiving a high dose of arsenic were similar to controls. Arsenic treatment did not have a measurable impact on lymphoproliferative responses of cultured splenocytes to the mitogens Concanavalin A and Pokeweed mitogen, or to the lymphokine interleukin-2. We also observed no impact of low-level arsenic exposure on macrophage phagocytic activity and tumoricidal activity of lymphokine-activated killer cells in vitro. It is possible that malnutrition caused by decreased food intake may eventually lead to atrophy of lymphoid organs and render animals more susceptible to environmental pathogens. However, direct effects of low-level arsenic exposure on immune function of cotton rats was

  17. Antimicrobial silver-filled silica nanorattles with low immunotoxicity in dendritic cells.

    PubMed

    Priebe, Magdalena; Widmer, Jérôme; Suhartha Löwa, Nina; Abram, Sarah-Luise; Mottas, Inès; Woischnig, Anne-Kathrin; Brunetto, Priscilla S; Khanna, Nina; Bourquin, Carole; Fromm, Katharina M

    2017-01-01

    The progression in the use of orthopedic implants has led to an increase in the absolute number of implant infections, triggering a search for more effective antibacterial coatings. Nanorattles have recently gained interest in biomedical applications such as drug delivery, as encapsulation of the cargo inside the hollow structure provides a physical protection from the surrounding environment. Here, silver-containing silica nanorattles (Ag@SiO2) were evaluated for their antimicrobial potential and for their impact on cells of the immune system. We show that Ag@SiO2 nanorattles exhibited a clear antibacterial effect against Escherichia coli as well as Staphylococcus aureus found in post-operative infections. Immunotoxicological analyses showed that the particles were taken up through an active phagocytic process by dendritic cells of the immune system and did not affect their viability nor induce unwanted immunological effects. Silver-containing silica nanorattles thus fulfill several prerequisites for an antibacterial coating on surgical implants. Copyright © 2016 Elsevier Inc. All rights reserved.

  18. Concurrent administration effect of antibiotic and anti-inflammatory drugs on the immunotoxicity of bacterial endotoxins.

    PubMed

    El Amir, Azza M; Tanious, Dalia G; Mansour, Hanaa A

    2017-09-16

    Pseudomonas aeruginosa (P. aeruginosa) is a gram-negative bacterium that causes a variety of diseases in compromised hosts. Bacterial endotoxins such as lipopolysaccharide (LPS) are the major outer surface membrane components that are present in almost all gram-negative bacteria and act as extremely strong stimulators of innate immunity and inflammation of the airway. This study was undertaken to determine the effect of combined administration of Gentamicin (GENT) as an antibiotic and Dexamethasone (DEXA) as an anti-inflammatory drug on some immunological and histological parameters. After determination of LD50 of P. aeruginosa, mice groups were injected with DEXA, GENT and lipopolysaccharide alone or in combination. Lipopolysaccharide single injection caused a significant increase of total leukocyte count, lymphocytes, neutrophils and levels of IgM and IgG. DEXA induced an increase of neutrophilia and lymphopenia. Immunological examination demonstrated that combined treatment has a significant effect of decreasing lymphocytes and IgG levels than single treatment does. Histological examination demonstrated that the inflammation of thymus, spleen, lymph node and liver decreases in mice that received combined treatment than those that received individual treatment. Concurrent administration of DEXA and GENT has a great effect on protecting organs against damage in case of endotoxemia. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. Arsenic immunotoxicity and immunomodulation by phytochemicals: potential relations to develop chemopreventive approaches.

    PubMed

    Ramos Elizagaray, Sabina I; Soria, Elio A

    2014-01-01

    Arsenic (As) contaminates drinking water worldwide, and As exposure, hypersensitivity and deficiency are involved in the immunopathogenesis of various health problems. Its chemoprevention thus has a high health impact. Given its oxidative potential, antioxidant compounds are good candidates to counteract arsenic's deleterious effects on humans. Phytochemicals (e.g., phenolics, carotenoids, etc.) act through free radical chelation activity and regulation of cellular targets. Consequently, they are appropriate for developing anti-As strategies derived from plants, and Argentinean flora is rich in useful species. Several molecular pathways involved in immune regulation are at the same time targets of exogenous agents, and oxidative stress itself is a modulating phenomenon of immunity. Since xenohormesis has been described as the organic enhancement of resistance to stress conditions (e.g., oxidation, pollution, etc.) by consuming xenobiotics, immunoxenohormesis implies also defense improvement. This review focuses on recent patents on the development of vegetable redox-related immunomodulating agents, which might be applied in As-induced dysfunctions, with their scientific basis being reviewed.

  20. Immunotoxicity of trichloroethylene: a study with MRL-lpr/lpr mice.

    PubMed

    Kaneko, T; Saegusa, M; Tasaka, K; Sato, A

    2000-01-01

    In recent immunological studies, it has been suggested that trichloroethylene (TCE) participates in the onset of pneumatosis cystoides intestinalis (PCI) through a certain mechanism; however, the mechanism by which it develops remains unknown. Based on findings that secondary PCI is often linked with autoimmune disease, the possibility that some genetic or immunological mechanisms are involved in the development of PCI has been proposed. Pneumatosis cystoides intestinalis is not a type of disease where a dose-response relationship with TCE exposure can be recognized and it is difficult to reproduce its physiopathology through TCE exposure in ordinary experimental animals. In the present study, immunological changes caused by TCE exposure were investigated by employing MRL-lpr/lpr mice that are genetically labile to autoimmune diseases. To observe changes in B cell functions, serum antibody titres were measured; and for the T cell function, T cell subsets were examined. The animals were exposed to TCE at dosages of 0, 500, 1000 and 2000 ppm through inhalation 4 h a day, 6 days a week, for 8 weeks. It was found that only IgG production capacity was suppressed and there were no changes in T cell subsets with TCE concentrations up to 1000 ppm. At a concentration of 2000 ppm, changes were noted in both T and B cell functions. Typical organs that are responsible for immunological functions were examined for their morphological changes under a light microscope: the spleen and liver exhibited dose-response changes at a concentration of 500 ppm or greater. The development of immunoblastoid cells at a concentration of 1000 ppm indicated a possibility that a change has occurred in the immunological system. These findings show that exposure to TCE at high concentrations affects the immune system, but the study failed to induce PCI in the experimental animals. Further studies on TCE exposure at lower concentrations for longer periods are needed.

  1. Immunotoxicity of the xenoestrogen 4-nonylphenol to the cockle Cerastoderma glaucum.

    PubMed

    Matozzo, Valerio; Rova, Giulio; Ricciardi, Francesco; Marin, Maria Gabriella

    2008-01-01

    The in vivo effects of 4-nonylphenol (NP) on functional responses of haemocytes from the cockle Cerastoderma glaucum were investigated after 7 days exposure to sublethal NP concentrations (0, 0+acetone, 0.0125, 0.025, 0.05 and 0.1 mg/l NP). Haemocytes from both controls and exposed cockles were collected, and the effects of NP on total haemocyte count (THC) and volume of circulating cells, intracellular superoxide anion (O(2)(-)) levels, acid phosphatase and lysozyme-like activities in both haemocyte lysate (HL) and cell-free haemolymph (CFH) were evaluated. Exposure of cockles to 0.1mg/l NP significantly increased THC (p<0.05) with respect to controls. Analysis of haemocyte size frequency distribution showed that the haemocyte fraction of about 7-8 microm in diameter and 250 femtolitres in volume increased markedly in cockles exposed to the highest NP concentration tested. Apoptosis resulting in cell volume reduction in NP-exposed animals cannot be excluded. No statistically significant variation in intracellular O(2)(-) levels was observed. Conversely, significant increases (p<0.05) in acid phosphatase activity were observed in CFH from 0.05 and 0.1mg/l NP-exposed animals; no significant differences in enzyme activity were recorded in HL. Lysozyme-like activity also increased significantly in CFH from cockles exposed to 0.05 mg/l NP (p<0.05) and 0.1 mg/l NP (p<0.001). Instead, lysozyme-like activity decreased significantly (p<0.05) in the HL of animals exposed to 0.05 mg/lNP. Our results suggest that NP induces variations in the functional responses of haemocytes of C. glaucum, mainly by reducing cell membrane stability and promoting cell degranulation.

  2. An investigation of the immunotoxicity of oil sands processed water and leachates in trout leukocytes.

    PubMed

    Gagné, F; Bruneau, A; Turcotte, P; Gagnon, C; Lacaze, E

    2017-03-14

    Increased oil sands (OS) mining activity has raised concerns about impacts on aquatic organisms. This study sought to examine the effects of single representative compounds from OS (benzo(a)pyrene, naphthalene), a mixture of naphthenic acids (NAs), OS-processed water (OSPW) and OS leachate (OSL) extracts on rainbow trout leukocytes. Primary cultures of trout leukocytes were exposed to increasing concentrations of benzo(a)pyrene, naphthalene, NAs, OSPW and OSL for 48h at 18°C. Immunocompetence was followed by measuring changes in lymphocyte and macrophage viability and phagocytosis. Changes in the expression of 10 transcripts were also followed: interleukin 1, 2 and 6 (Il-1, Il-2 and Il-6), calreticulin (CRT), caspase 9 (Cas9), aryl hydrocarbon receptor (AhR), cyclooxygenase-2 (COX2), glutathione S-transferase (GST), catalase (CAT) and p53 tumor suppressor. The results revealed that exposure to OSPW extracts decreased the capacity of macrophages to engulf three beads or more, while the other compounds generally increased phagocytosis activity. Lymphocyte apoptosis was increased by all compounds and mixtures except naphthalene. Both OSPW and OSL induced apoptosis in macrophages. At the gene expression level, Cas9, CRT, Il-1 (inhibition) and Il-2 were specifically influenced by OSPW, while CAT, p53, COX2 and Il-1 (induction) transcripts were specifically expressed by OSL. Leukocyte exposure to OSPW produced characteristic changes in immunocompetence and genes involved in proinflammatory, apoptosis and protein damage (CRT) pathways which could not be explained by OSL, benzo(a)pyrene, naphthalene and NA mixture.

  3. Immunotoxic effect of thiamethoxam in immunized mice with Brucella abortus cultural filtrate antigen

    PubMed Central

    Salema, L. H.; Alwan, M. J.; Yousif, Afaf Abdulrahman

    2016-01-01

    in the 2nd group (7.66±0.33). Phagocytic ratio results in the 1st group showed an increase to reach (18.55±0.44) than a ratio in the 2nd group (13.24±0.32) and the control group (5.46±0.25). Conclusion: It was concluded that TMX induced suppression of humoral and cellular immune responses in immunized mice with CFBAgs. PMID:28096613

  4. Comparative immunotoxicity assessment of N4-Trimethoxybenzoyl-5'-deoxy-5- fluorocytidine (Ro 09-1390) and 5'-deoxy-5-fluorouridine (5'-DFUR) in BDF1 mice.

    PubMed

    Inoue, T; Anderson, T D; Hayes, T J; Horii, I

    1996-02-01

    N4-Trimethoxybenzoyl-5'-deoxy-5-fluorocytidine (Ro 09-1390) and 5'-deoxy-5-fluorouridine (5'-DFUR) are 5-fluorouracil (5-FU) derivatives developed as anti-tumor pharmaceuticals. To evaluate immunotoxicities of these compounds, BDF1 mice were administered vehicle, 300-2700 mg (0.68-6.14 mmol)/kg/day of Ro 09-1390, or 100-900 mg (0.41-3.66 mmol)/kg/day of 5'-DFUR for 1 to 7 days, and effects on cellularity in lymphoid organs were assessed by immunohistochemistry as well as general toxicologic parameters. To distinguish compound-specific direct action from nonspecific indirect action caused by dietary reduction, dietary restriction groups were also included as control groups. Final body weight, thymus weight, bone marrow cell number (BMC), and leukocyte number were reduced with high dose of both compounds. Reduction of BMC in groups administered with Ro 09-1390 or 5'-DFUR was more severe than in dietary restriction groups given comparative amount of diet with compound-administered groups. Diffuse thymic cortical hypoplasia was observed in the highest dose of both compounds and more apparent in the Ro 09-1390 than in the 5'-DFUR. Focal nodular thymocyte hyperplasia was observed especially in the lower dose of 5'-DFUR. The results indicate that immunotoxic profiles of Ro 09-1390 and 5'-DFUR are very similar and characterized primarily by myelotoxicity and Ro 09-1390 is approximately two-times less toxic than 5'-DFUR on a molar basis in BDF1 mice.

  5. Oral Exposure to Atrazine Induces Oxidative Stress and Calcium Homeostasis Disruption in Spleen of Mice

    PubMed Central

    Wang, Zhichun; Zhang, Chonghua; Jia, Liming

    2016-01-01

    The widely used herbicide atrazine (ATR) can cause many adverse effects including immunotoxicity, but the underlying mechanisms are not fully understood. The current study investigated the role of oxidative stress and calcium homeostasis in ATR-induced immunotoxicity in mice. ATR at doses of 0, 100, 200, or 400 mg/kg body weight was administered to Balb/c mice daily for 21 days by oral gavage. The studies performed 24 hr after the final exposure showed that ATR could induce the generation of reactive oxygen species in the spleen of the mice, increase the level of advanced oxidation protein product (AOPP) in the host serum, and cause the depletion of reduced glutathione in the serum, each in a dose-related manner. In addition, DNA damage was observed in isolated splenocytes as evidenced by increase in DNA comet tail formation. ATR exposure also caused increases in intracellular Ca2+ within splenocytes. Moreover, ATR treatment led to increased expression of genes for some antioxidant enzymes, such as HO-1 and Gpx1, as well as increased expression of NF-κB and Ref-1 proteins in the spleen. In conclusion, it appears that oxidative stress and disruptions in calcium homeostasis might play an important role in the induction of immunotoxicity in mice by ATR. PMID:27957240

  6. Atrazine-induced apoptosis of splenocytes in BALB/C mice

    PubMed Central

    2011-01-01

    Background Atrazine (2-chloro-4-ethytlamino-6-isopropylamine-1,3,5-triazine; ATR), is the most commonly applied broad-spectrum herbicide in the world. Unintentional overspray of ATR poses an immune function health hazard. The biomolecular mechanisms responsible for ATR-induced immunotoxicity, however, are little understood. This study presents on our investigation into the apoptosis of splenocytes in mice exposed to ATR as we explore possible immunotoxic mechanisms. Methods Oral doses of ATR were administered to BALB/C mice for 21 days. The histopathology, lymphocyte apoptosis and the expression of apoptosis-related proteins from the Fas/Fas ligand (FasL) apoptotic pathway were examined from spleen samples. Results Mice administered ATR exhibited a significant decrease in spleen and thymus weight. Electron microscope histology of ultrathin sections of spleen revealed degenerative micromorphology indicative of apoptosis of splenocytes. Flow cytometry revealed that the percentage of apoptotic lymphocytes increased in a dose-dependent manner after ATR treatment. Western blots identified increased expression of Fas, FasL and active caspase-3 proteins in the treatment groups. Conclusions ATR is capable of inducing splenocytic apoptosis mediated by the Fas/FasL pathway in mice, which could be the potential mechanism underlying the immunotoxicity of ATR. PMID:22032520

  7. ANIMAL MODELS FOR IMMUNOTOXICITY

    EPA Science Inventory

    Greater susceptibility to infection is a hallmark of compromised immune function in humans and animals, and is often considered the benchmark against which the predictive value of immune function tests are compared. This focus of this paper is resistance to infection with the pa...

  8. ANIMAL MODELS FOR IMMUNOTOXICITY

    EPA Science Inventory

    Greater susceptibility to infection is a hallmark of compromised immune function in humans and animals, and is often considered the benchmark against which the predictive value of immune function tests are compared. This focus of this paper is resistance to infection with the pa...

  9. European medicinal and edible plants associated with subacute and chronic toxicity part II: Plants with hepato-, neuro-, nephro- and immunotoxic effects.

    PubMed

    Kristanc, Luka; Kreft, Samo

    2016-06-01

    A tremendous surge of public interest in natural therapies has been reported in the past several decades in both developing and developed countries. Furthermore, edible wild-growing plants whose use had long been associated with poverty and famine have also gained in popularity among people in developed countries. An important fraction of herbal products evade all control measures and are generally perceived as safe. However, this may not always be true. It is important to recognize that some plants are not associated with acute toxicity but rather produce more insidious problems, which develop only with long-term exposure. In this review, we continue a systematic analysis of the subacute and chronic toxicity associated with the use of herbal preparations. The hepato-, neuro-, nephro- and immunotoxicity of plant species that either grow natively or are cultivated in Europe are discussed in some detail. The basic concepts regarding the molecular mechanisms implicated in their nonacute toxicity and their pathophysiological, clinical and epidemiological characteristics are included. Among others, we discuss the hepatotoxicity of pyrrolizidine alkaloids, the nephrotoxicity of aristolochic acid, the lathyrism associated with neurotoxin swainsonine, thiamine depletion and thyroid dysfunction of herbal cause, and finally address also the immunosuppressive effects of cannabinoids. Copyright © 2016 Elsevier Ltd. All rights reserved.

  10. Immunotoxic effects of cis-urocanic acid exposure in C57BL/6N and C3H/HeN mice.

    PubMed

    Prater, M Renee; Gogal, Robert M; De Fabo, Edward C; Longstreth, Janice; Holladay, Steven D

    2003-04-01

    Exposure to ultraviolet radiation results in increased levels of intradermal cis-urocanic acid (cUCA) and alters cutaneous immunity by interfering with processing and presentation of antigen by Langerhans cells. Reports on effects of systemic immunotoxicity with 30 day cUCA exposure in laboratory rodents include thymic atrophy, thymic hypocellularity and decreased T-cell-mediated immunity; however, immune effects of single exposure or 5 day cUCA administration, which may better mimic human exposures, are poorly defined. The present study initially evaluated immune effects of single, 5 day, and 4 week cUCA exposure in C57BL/6N mice. Single administration of intradermal cUCA resulted in decreased splenocyte phagocytosis that persisted for 30 days after cUCA exposure. Five day consecutive cUCA exposure decreased numbers of phenotypically mature CD4(+)CD8(-) and CD4(-)CD8(+) (single positive) thymocytes, increased CD4(+)CD8(+) (double positive) immature thymocytes and increased splenocyte proliferation. Prolonged cUCA exposure (4 weeks) caused profound thymic hypocellularity and splenic hypercellularity and increased splenic macrophage chemiluminescence. Because of this apparent sensitivity of C57BL/6N mice to cUCA, thymic hypocellularity was compared between C57BL/6N and C3H/HeN mice dosed with cUCA, and was found to be more pronounced in the C57BL/6N strain. These results are an extension of previous conclusions on immune modulation caused by cUCA in the spleen and thymus. Further, the observed variation in sensitivity between the mouse strains is consistent with known genetic susceptibility of these strains to the immunomodulatory effects of exposure to sunlight.

  11. Composition of the essential oil constituents from leaves and stems of Korean Coriandrum sativum and their immunotoxicity activity on the Aedes aegypti L.

    PubMed

    Chung, Ill-Min; Ahmad, Ateeque; Kim, Sun-Jin; Naik, Poornanand Madhava; Nagella, Praveen

    2012-02-01

    The leaves and stems of Coriandrum sativum were extracted and the essential oil composition and immunotoxicity effects were studied. The analyses were conducted by gas chromatography-mass spectroscopy (GC-MS), which revealed the essential oils of C. sativum leaves and stems. Thirty-nine components representing 99.62% of the total oil were identified from the leaves. The major components are cyclododecanol (23.11%), tetradecanal (17.86%), 2-dodecenal (9.93%), 1-decanol (7.24%), 13-tetradecenal (6.85%), 1-dodecanol (6.54%), dodecanal (5.16%), 1-undecanol (2.28%), and decanal (2.33%). Thirty-eight components representing 98.46% of the total oil were identified from the stems of the coriander. The major components are phytol (61.86%), 15-methyltricyclo[6.5.2(13,14),0(7,15)]-pentadeca-1,3,5,7,9,11,13-heptene (7.01%), dodecanal (3.18%), and 1-dodecanol (2.47%). The leaf oil had significant toxic effects against the larvae of Aedes aegypti with an LC₅₀ value of 26.93 ppm and an LC₉₀ value of 37.69 ppm and the stem oil has toxic effects against the larvae of A. aegypti with an LC₅₀ value of 29.39 ppm and an LC₉₀ value of 39.95 ppm. Also, the above data indicate that the major compounds may play an important role in the toxicity of essential oils.

  12. Four-week inhalation toxicity, mutagenicity and immunotoxicity studies of Keum-Yeon-Cho (NosmoQ), tobacco substitute composition, in mice.

    PubMed

    Kim, Min-Young; Yoo, Gi-Yong; Yoo, Won-Ha; Choi, Jin-Hyuk; Bae, Mi-Ok; Kim, Jun-Sung; Kim, Hyun-Woo; Moon, Seo-Hyun; Kim, Jung-Hyun; Han, Kyu-Tae; Chae, Chan-Hee; Kim, Myung-Soo; Cho, Myung-Haing

    2003-01-01

    Safety of Keum-Yeon-Cho (NosmoQ), a tobacco substitute composition, was evaluated in terms of acute- and 4 weeks repeated-inhalation toxicity, mutagenicity, and immunotoxicity using Balb/c mice. The air inside the inhalation chamber was collected and analyzed by GC-MS. In acute inhalation toxicity test, male and female mice were exposed to 40 Keum-Yeon-Cho cigarettes. The 50% lethal concentration (LC(50)) of NosmoQ was considered to be much higher than 40 cigarettes in both sexes. In 4-week repeated inhalation toxicity test, male and female mice were exposed for 6 h/day, 5 days/week for 4 weeks to 10 and 20 cigarettes per day, while control mice were exposed to filtered air. Our data indicated that no observed adverse effect level (NOAEL) of Keum-Yeon-Cho should be over 20 cigarettes per day. Results of Salmonella typhimurium reversion assay with/without histidine moiety, in vivo chromosomal aberration and in vivo micronucleus assays using mouse bone marrow cells revealed that Keum-Yeon-Cho has no mutagenicity. Evaluation of peripheral cellular immunity of mice treated with Keum-Yeon-Cho using in vitro lymphocyte proliferation assay showed no significant difference in mean stimulation index (SI) between mice exposed to Keum-Yeon-Cho and control mice. Mean CO concentrations and total particulate matter contents of 10 and 20 cigarettes were 21.1±1.23 and 40.7±1.21 ppm (mean±S.D., n=5), and 25.7±3.09 and 59.0±4.0 mg dry weight (mean±S.D., n=5), respectively. Although at negligible concentration (less than ppb level) several polycyclic aromatic hydrocarbons (PAHs) were also detected, these results indicate that NosmoQ has no toxic effect on mice.

  13. Aged garlic extract ameliorates immunotoxicity, hematotoxicity and impaired burn-healing in malathion- and carbaryl-treated male albino rats.

    PubMed

    Ramadan, Gamal; El-Beih, Nadia M; Ahmed, Rehab S A

    2017-03-01

    Malathion and carbaryl are the most widely used organophosphate and carbamate insecticides, respectively, especially in developing countries; they pose a potential health hazard for both humans and animals. Here, we evaluated the protective effects of an odorless (free from allicin) Kyolic aged garlic extract (AGE, containing 0.1% S-allylcysteine; 200 mg/kg body weight) on the toxicity induced by 0.1 LD50 of malathion (89.5 mg/kg body weight) and/or carbaryl (33.9 mg/kg body weight) in male Wistar rats. Doses were orally administered to animals for four consecutive weeks. The present study showed that AGE completely modulated most adverse effects induced by malathion and/or carbaryl in rats including the normocytic normochromic anemia, immunosuppression, and the delay in the skin-burning healing process through normalizing the count of blood cells (erythrocytes, leucocytes and platelets), hemoglobin content, hematocrit value, blood glucose-6-phosphodehydrogenase activity, weights and cellularity of lymphoid organs, serum γ-globulin concentration, and the delayed type of hypersensitivity response to the control values, and accelerating the inflammatory and proliferative phases of burn-healing. In addition, AGE completely modulated the decrease in serum reduced glutathione (GSH) concentration and the increase in clotting time in malathion alone and carbaryl alone treated rats. Moreover, AGE induced a significant increase (P < 0.001) in serum GSH concentration (above the normal value) and accelerating burn-healing process in healthy rats. In conclusion, AGE was effective in modulating most adverse effects induced in rats by malathion and carbaryl, and hence may be useful as a dietary adjunct for alleviating the toxicity in highly vulnerable people to insecticides intoxication. © 2016 Wiley Periodicals, Inc. Environ Toxicol 32: 789-798, 2017.

  14. In vitro immunotoxic and genotoxic activities of particles emitted from two different small-scale wood combustion appliances

    NASA Astrophysics Data System (ADS)

    Tapanainen, Maija; Jalava, Pasi I.; Mäki-Paakkanen, Jorma; Hakulinen, Pasi; Happo, Mikko S.; Lamberg, Heikki; Ruusunen, Jarno; Tissari, Jarkko; Nuutinen, Kati; Yli-Pirilä, Pasi; Hillamo, Risto; Salonen, Raimo O.; Jokiniemi, Jorma; Hirvonen, Maija-Riitta

    2011-12-01

    Residential wood combustion appliances emit large quantities of fine particles which are suspected to cause a substantial health burden worldwide. Wood combustion particles contain several potential health-damaging metals and carbon compounds such as polycyclic aromatic hydrocarbons (PAH), which may determine the toxic properties of the emitted particles. The aim of the present study was to characterize in vitro immunotoxicological and chemical properties of PM 1 ( Dp ≤ 1 μm) emitted from a pellet boiler and a conventional masonry heater. Mouse RAW264.7 macrophages were exposed for 24 h to different doses of the emission particles. Cytotoxicity, production of the proinflammatory cytokine TNF-α and the chemokine MIP-2, apoptosis and phases of the cell cycle as well as genotoxic activity were measured after the exposure. The type of wood combustion appliance had a significant effect on emissions and chemical composition of the particles. All the studied PM 1 samples induced cytotoxic, genotoxic and inflammatory responses in a dose-dependent manner. The particles emitted from the conventional masonry heater were 3-fold more potent inducers of programmed cell death and DNA damage than those emitted from the pellet boiler. Furthermore, the particulate samples that induced extensive DNA damage contained also large amounts of PAH compounds. Instead, significant differences between the studied appliances were not detected in measurements of inflammatory mediators, although the chemical composition of the combustion particles differed considerably from each other. In conclusion, the present results show that appliances representing different combustion technology have remarkable effects on physicochemical and associated toxicological and properties of wood combustion particles. The present data indicate that the particles emitted from incomplete combustion are toxicologically more potent than those emitted from more complete combustion processes.

  15. The bioflavonoid galangin blocks aryl hydrocarbon receptor activation and polycyclic aromatic hydrocarbon-induced pre-B cell apoptosis.

    PubMed

    Quadri, S A; Qadri, A N; Hahn, M E; Mann, K K; Sherr, D H

    2000-09-01

    Bioflavonoids are plant compounds touted for their potential to treat or prevent several diseases including cancers induced by common environmental chemicals. Much of the biologic activity of one such class of pollutants, polycyclic aromatic hydrocarbons (PAH), is mediated by the aryl hydrocarbon receptor/transcription factor (AhR). For example, the AhR regulates PAH immunotoxicity that manifests as pre-B cell apoptosis in models of B cell development. Because bioflavonoids block PAH-induced cell transformation and are structurally similar to AhR ligands, it was postulated that some of them would suppress PAH-induced, AhR-dependent immunotoxicity, possibly through a direct AhR blockade. This hypothesis was tested using a model of B cell development in which pre-B cells are cultured with and are dependent on bone marrow stromal or hepatic parenchymal cell monolayers. Of seven bioflavonoids screened, galangin (3,5,7-trihydroxyflavone) blocked PAH-induced but not C(2)-ceramide- or H(2)O(2)-induced pre-B cell apoptosis. Because galangin blocked AhR-dependent reporter gene expression, AhR complex-DNA binding, and AhR nuclear translocation, inhibition of a relatively early step in AhR signaling was implicated. This hypothesis was supported by the ability of galangin to bind the AhR and stabilize AhR-90-kDa heat shock protein complexes in the presence of AhR agonists. These studies demonstrate the utility of pre-B cell culture systems in identifying compounds capable of blocking PAH immunotoxicity, define at least one mechanism of galangin activity (i.e., repression of AhR activation), and motivate the use of this and similar dietary bioflavonoids as relatively nontoxic inhibitors of AhR agonist activity and as pharmacologic agents with which to dissect AhR signaling pathways.

  16. Arsenite exposure in human lymphoblastoid cell lines induces autophagy and coordinated induction of lysosomal genes.

    PubMed

    Bolt, Alicia M; Douglas, Randi M; Klimecki, Walter T

    2010-11-30

    Chronic exposure to inorganic arsenic is associated with diverse, complex diseases, making the identification of the mechanism underlying arsenic-induced toxicity a challenge. An increasing body of literature from epidemiological and in vitro studies has demonstrated that arsenic is an immunotoxicant, but the mechanism driving arsenic-induced immunotoxicity is not well established. We have previously demonstrated that in human lymphoblastoid cell lines (LCLs), arsenic-induced cell death is strongly associated with the induction of autophagy. In this study we utilized genome-wide gene expression analysis and functional assays to characterize arsenic-induced effects in seven LCLs that were exposed to an environmentally relevant, minimally cytotoxic, concentration of arsenite (0.75 μM) over an eight-day time course. Arsenic exposure resulted in inhibition of cellular growth and induction of autophagy (measured by expansion of acidic vesicles) over the eight-day exposure duration. Gene expression analysis revealed that arsenic exposure increased global lysosomal gene expression, which was associated with increased functional activity of the lysosome protease, cathepsin D. The arsenic-induced expansion of the lysosomal compartment in LCL represents a novel target that may offer insight into the immunotoxic effects of arsenic.

  17. Novel biomarkers of mercury-induced autoimmune dysfunction: a Cross-sectional study in Amazonian Brazil

    PubMed Central

    Motts, Jonathan A.; Shirley, Devon L.; Silbergeld, Ellen K.; Nyland, Jennifer F.

    2014-01-01

    Mercury is an ubiquitous environmental contaminant, causing both neurotoxicity and immunotoxicity. Given its ability to amalgamate gold, mercury is frequently used in small-scale artisanal gold mining. We have previously reported that elevated serum titers of antinuclear autoantibodies (ANA) are associated with mercury exposures of miners in gold mining. The goal of this project was to identify novel serum biomarkers of mercury-induced immunotoxicity and autoimmune dysregulation. We conducted an analysis of serum samples from a cross-sectional epidemiological study on miners working in Amazonian Brazil. In proteomic screening analyses, samples were stratified based on mercury concentrations and ANA titer and a subset of serum samples (N=12) were profiled using Immune Response Biomarker Profiling ProtoArray protein microarray for elevated autoantibodies. Of the up-regulated autoantibodies in the mercury-exposed cohort, potential target autoantibodies were selected based on relevance to pro-inflammatory and macrophage activation pathways. ELISAs were developed to test the entire sample cohort (N=371) for serum titers to the highest of these autoantibodies (anti-glutathione S-transferase alpha, GSTA1) identified in the high mercury/high ANA group. We found positive associations between elevated mercury exposure and up-regulated serum titers of 3760 autoantibodies as identified by ProtoArray. Autoantibodies identified as potential novel biomarkers of mercury-induced immunotoxicity include antibodies to the following proteins: GSTA1, tumor necrosis factor ligand superfamily member 13, linker for activation of T cells, signal peptide peptidase like 2B, stimulated by retinoic acid 13, and interferon induced transmembrane protein. ELISA analyses confirmed that mercury-exposed gold miners had significantly higher serum titers of anti-GSTA1 autoantibody [unadjusted odds ratio = 89.6; 95% confidence interval: 27.2, 294.6] compared to emerald miners (referent population

  18. GC-TOF/MS-based metabolomics approach to study the cellular immunotoxicity of deoxynivalenol on murine macrophage ANA-1 cells.

    PubMed

    Ji, Jian; Sun, Jiadi; Pi, Fuwei; Zhang, Shuang; Sun, Chao; Wang, Xiumei; Zhang, Yinzhi; Sun, Xiulan

    2016-08-25

    Gas chromatography-time of fly/mass spectrum (GC-TOF/MS) based complete murine macrophage ANA-1 cell metabolome strategy, including the endo-metabolome and the exo-metabolome, ANA-1 cell viability assays and apoptosis induced by diverse concentrations of DON were evaluated for selection of an optimized dose for in-depth metabolomic research. Using the optimized chromatography and mass spectrometry parameters, the metabolites detected by GC-TOF/MS were identified and processed with multivariate statistical analysis, including principal componentanalysis (PCA) and orthogonal projection to latent structures-discriminant analysis (OPLS-DA) analysis. The data sets were screened with a t-test (P) value < 0.05, VIP value > 1, similarity value > 500, leaving 16 exo-metabolite variables and 11 endo-metabolite variables for further pathway analysis. Implementing the integration of key metabolic pathways, the metabolism pathways were categorized into two dominating types, metabolism of amino acid and glycometabolism. Glycine, serine and threonine metabolism, phenylalanine, tyrosine and tryptophan biosynthesis and phenylalanine metabolism were the significant amino acids affected by the metabolic pathways, indicating statistically significant fold changes including pyruvate, serine, glycine, lactate and threonine. Glycolysis or gluconeogenesis, starch and sucrose metabolism, and galactose metabolism, belonging to glycometabolism, were the pathways that were found to be primarily affected, resulting in abnormal metabolites such as glucose-1P, Glucose, gluconic acid, myo-inositol, sorbitol and glycerol.

  19. Ability of Lactobacillus plantarum MON03 to mitigate aflatoxins (B1 and M1) immunotoxicities in mice.

    PubMed

    Jebali, Rania; Abbès, Samir; Salah-Abbès, Jalila Ben; Younes, Ridha Ben; Haous, Zohra; Oueslati, Ridha

    2015-01-01

    Aflatoxin B1 (AFB1) and M1 (AFM1) are mycotoxins produced by numerous Aspergillus species in pre- or post-harvest cereals and milk. AFB1 and AFM1 display a potent economic loss in livestock and also cause severe immunological problems. The aims of this study were to: evaluate a new AFB1 and AFM1-binding/degrading micro-organism for biological detoxification; examine its ability to degrade AFB1 and AFM1 in liquid medium; and evaluate its potential for in vivo preventative effects against AFB1- and AFM1-induced immunomodulation in mice. Lactobacillus plantarum MON03 (LP) isolated from Tunisian artisanal butter was found to display significant binding ability to AFB1 and AFM1 in PBS (i.e. 82% and 89%, respectively) within 24 h of incubation and able to tolerate gastric acidity, have strongly hydrophilic cells surface properties, and adhere efficacy to Caco-3 cells in vitro. The in vivo study was conducted using Balb/c mice that received by oral gavage vehicle (control), LP only (2 × 10(9) CFU/L, ~2 g/kg BW), AFB1 or AFM1 alone (0.25 and 0.27 mg/kg, respectively), or AFB1 + LP or AFM1 + LP daily for 15 days. Compared to in control mice, treatments with AFB1 and AFM1 led to significantly decreased body weight gains, histopathological changes, and decrements in all hematologic and immune parameters assessed. Co-treatment with LP strongly reduced the adverse effects of each mycotoxin. In fact, the mice receiving AFB1 + LP or AFM1 + LP co-treatment displayed no significant differences in the assayed parameters as compared to the control mice. By itself, the bacteria alone had no adverse effects in the mice. From these data, it is concluded that the tested bacteria could be beneficial in biotechnology detoxification of contaminated food and feed for humans and animals.

  20. PARTNERSHIPS TO IMPROVE IMMUNOTOXICITY TESTING

    EPA Science Inventory

    Research in ITB is focused on the effects that chemicals/environmental contaminants have on modulation of the immune system. Immune modulation may result in suppressed immune function, while exposure to certain contaminants may result in hypersensitivity reactions (e.g., asthma ...

  1. In vivo assessment of immunotoxicity

    PubMed Central

    Munson, Albert E.; Sanders, Virginia M.; Douglas, Kathryn A.; Sain, Larry E.; Kauffmann, Bernadine M.; White, Kimber L.

    1982-01-01

    The organs, tissues, and cells of the lymphoreticular system have received considerable attention as targets for chemicals causing adverse effects. A basic toxicological approach is described for assessing the risk of a chemical perturbing the immune system. CD-1 mice were exposed for 14 or 90 days to one of several chlorinated hydrocarbons: 1,2-dichloroethane, 1,2-dichloroethylene or 1,1,2-trichloroethylene. Other mice were exposed to dexamethasone, a known immunosuppressive agent. The immune system is evaluated against a background of the more standard toxicological parameters such as fluid consumption, body and organ weights, hematology, clinical chemistries, and blood coagulation. Reported here are the results for the male mice after 14-day exposure to three chlorinated hydrocarbons and after 90-day exposure to 1,2-dichloroethane and dexamethasone. Acute toxicity studies were performed to provide a basis for doses used in the subchronic studies. The LD50 values are reported. The status of the humoral immune system was determined by measuring the number of IgM spleen antibody-forming cells to sRBC, the serum antibody level to sRBC, and the lymphocyte response to the B-cell mitogen, LPS. Of the three chlorinated hydrocarbons, only dichloroethane produced a significant (p < 0.05) reduction in antibody-forming cells. The other two chemicals produced trends towards suppression. Mice exposed to dichloroethane in the drinking water for 90 days showed no alteration in AFC, serum antibody titers or response to the B-lymphocyte mitogen, LPS. Subchronic 90-day exposure to dexamethasone produced a dose-dependent inhibition of AFC/spleen but not AFC/106 spleen cells when measured on the peak day of response. Response to LPS was not altered, and spleen weight and spleen cell number were reduced as much as 42%. These data suggest that dexamethasone administered in the drinking water is nonspecifically cytotoxic to the spleen cells. Cell-mediated immunity was assessed by measuring the DTH response to sRBC and the response to the T-lymphocyte mitogen, concanavalin A. After 14 days of exposure, trichloroethylene produced a 15 and 60% suppression at 24 and 240 mg/kg, respectively. Dichloroethylene produced a non-dose-dependent inhibition at 4.9 and 49 mg/kg, which was slight, but significant (p < 0.05). Subchronic 90-day exposure to dichloroethane did not alter the DTH response or spleen lymphocyte response to concanavalin A. In contrast, dexamethasone produced a dose-dependent inhibition of the DTH response and a hyperresponsiveness to concanavalin A. Dichloroethane did not alter the functional activity of the reticuloendothelial system, as measured by the vascular clearance rate and tissue uptake of 51Cr sRBC. In the case of dexamethasone exposure, only the spleen and thymus showed decreased uptake of 51Cr sRBC, which was directly related to decrease in size. The approaches and results from these types of studies provide a basis for judging a chemical's potential risk to the immune system. PMID:7060547

  2. Facts about Stachybotrys chartarum and Other Molds

    MedlinePlus

    ... of materials and cleaning of walls and other flood-damaged items with commercial products, soap and water, ... contaminated with sewage. (See: After a Hurricane or Flood: Cleanup of Flood Water ) Moldy items should be ...

  3. Workshop report. Children as a special subpopulation: focus on immunotoxicity. Federal Institute for Health Protection of Consumers and Veterinary Medicine (BgVV), 15-16 November 2001, Berlin, Germany.

    PubMed

    Richter-Reichhelm, H B; Althoff, J; Schulte, A; Ewe, S; Gundert-Remy, U

    2002-07-01

    relevant aspects into existing test guidelines for testing developmental immunotoxicity. In this context, it is recommended that animals culled otherwise in one- and two-generation studies be examined for developmental immunotoxicity according to the valid methods and parameters discussed. The majority of participants agreed that a safety factor of 10 is too low in risk assessment and management to protect a sensitive subpopulation of children against man-made environmental pollutants.

  4. Visual agnosia and Klüver-Bucy syndrome in marmosets (Callithrix jacchus) following ablation of inferotemporal cortex, with additional mnemonic effects of immunotoxic lesions of cholinergic projections to medial temporal areas.

    PubMed

    Ridley, R M; Warner, K A; Maclean, C J; Gaffan, D; Baker, H F

    2001-04-13

    Inferotemporal ablations in the New World monkey, the common marmoset (Callithrix jacchus), produced a persistent impairment on visual discrimination learning and a florid, but transient, Klüver-Bucy syndrome. Monkeys with these ablations were impaired on acquisition of object discriminations to a high criterion and on concurrent discrimination learning, to a single high criterion across all trials. Neither the control monkeys nor the monkeys with inferotemporal ablations found acquisition more difficult when the component discriminations of a set were presented concurrently compared to consecutively, although the monkeys with inferotemporal ablations found acquisition under both these conditions somewhat more difficult than did control monkeys. This suggests that the severe impairment caused by inferotemporal ablations on concurrent learning measured across all trials is due to the need for sustained performance across a concurrent set rather than to the extra mnemonic demands of concurrent presentation. When immunotoxic lesions of the cholinergic projection to the hippocampal formation were added to the inferotemporal ablations, a further impairment on retention, and a differential impairment on concurrent, compared to consecutive, learning was observed. Previous studies have shown that lesions of the cholinergic projection to the hippocampus alone, or excitotoxic hippocampal lesions, do not affect simple visual discrimination learning. It is suggested that large inferotemporal ablations in monkeys produce a visual agnosia which causes severe 'psychic blindness' in the first instance, and a persistent impairment on visual discrimination learning. The hippocampus makes a contribution, which may be mnemonic, to discrimination performance after inferotemporal ablations.

  5. Comparative immunotoxicity of 2,2`-dichlorodiethyl sulfide and cyclophosphamide: Evaluation of L1210 tumor cell resistance, cell-mediated immunity, and humoral immunity. (Reannouncement with new availability information)

    SciTech Connect

    Blank, J.A.; Joiner, R.L.; Houchens, D.P.; Dill, G.S.; Hobson, D.W.

    1991-12-31

    The immunotoxicity of 2,2`-dichlorodiethyl sulfide (sulfur mustard, SM),on humoral and cell-mediated immunity was compared with that of the nitrogen mustard 2-(bis(2-chloroethyl) amino)tetrahydro- 2H-1,3,2-oxazophosphorine 2-oxide (cyclophosphamide, CP). SM and CP had similar effects on thymic and splenic weights, spleen cell number, and the formation of antibody producing cells to sheep red blood cells (sRBC) when examined 5 days after exposure, but differed in their effects on body weights. Although there were no differences in the delayed hypersensitivity response to keyhole limpet hemocyanin, CP and SM had different effects in the L1210 tumor cell allograft rejection assay. CP, but not SM, decreased the 28 day survival rate of allogeneic mice exposed to a sublethal L1210 tumor challenge. The differing effects on survival to the L1210 tumor challenge could not be attributed to a direct cytotoxic effect of SM on the L1210 tumor cells as SM did not increase the survival rate or mediansurvival time of syngeneic mice exposed to a lethal L1210 tumor cell challenge. In summary, SM and CP had immunosuppressive effects in the humoral immune assay. Although neither compound suppressed the delayed hypersensitivity response, CP was found to suppress host resistance to L1210 tumor cells.

  6. PEG-b-PPS-b-PEI micelles and PEG-b-PPS/PEG-b-PPS-b-PEI mixed micelles as non-viral vectors for plasmid DNA: tumor immunotoxicity in B16F10 melanoma.

    PubMed

    Velluto, Diana; Thomas, Susan N; Simeoni, Eleonora; Swartz, Melody A; Hubbell, Jeffrey A

    2011-12-01

    Cationic micelles formed from poly(ethylene glycol)-bl-poly(propylene sulfide)-bl-poly(ethylene imine) (PEG-b-PPS-b-PEI) and from mixtures of poly(ethylene glycol)-bl-poly(propylene sulfide) (PEG-b-PPS) with PEG-b-PPS-b-PEI were explored as non-viral vectors for plasmid DNA (pDNA) transfection in a tumor immunotoxicity model. Complexes with pDNA were found to be templated exclusively by the size of the pDNA-free micelles and ranged from 240 nm (for PEG-b-PPS-b-PEI) to 30 nm (for mixed micelles of PEG-b-PPS/PEG-b-PPS-b-PEI). Both formulations transfected melanoma cells well in vitro. As a model with a functional read-out of tumor cell death, one with likely only small bystander effects, tumors were transfected with an antigen transgene, using an antigen to which the recipient animals had been previously vaccinated with a Th1-biasing adjuvant. Reduction in tumor growth, increase in intratumoral infiltration of cytotoxic T lymphocytes and accumulation of Th1-biasing cytokines indicated that both micelle formulations transfected efficiently compared with naked pDNA and with low cytotoxicity.

  7. Effects of prior oral exposure to combinations of environmental immunosuppressive agents on ovalbumin allergen-induced allergic airway inflammation in Balb/c mice.

    PubMed

    Fukuyama, Tomoki; Nishino, Risako; Kosaka, Tadashi; Watanabe, Yuko; Kurosawa, Yoshimi; Ueda, Hideo; Harada, Takanori

    2014-08-01

    Abstract Humans are exposed daily to multiple environmental chemicals in the atmosphere, in food, and in commercial products. Therefore, hazard identification and risk management must account for exposure to chemical mixtures. The objective of the study reported here was to investigate the effects of combinations of three well-known environmental immunotoxic chemicals - methoxychlor (MXC), an organochlorine compound; parathion (PARA), an organophosphate compound; and piperonyl butoxide (PBO), an agricultural insecticide synergist - by using a mouse model of ovalbumin (OVA)-induced allergic airway inflammation. Four-week-old Balb/c mice were exposed orally to either one or two of the environmental immunotoxic chemicals for five consecutive days, prior to intraperitoneal sensitization with OVA and an inhalation challenge. We assessed IgE levels in serum, B-cell counts, and cytokine production in hilar lymph nodes, and differential cell counts and levels of related chemokines in bronchoalveolar lavage fluid (BALF). Mice treated with MXC + PARA or PBO + MXC showed marked increases in serum IgE, IgE-positive B-cells and cytokines in lymph nodes, and differential cell counts and related chemokines in BALF compared with mice that received the vehicle control or the corresponding individual test substances. These results suggest that simultaneous exposure to multiple environmental chemicals aggravates allergic airway inflammation more than exposure to individual chemicals. It is expected that the results of this study will help others in their evaluation of immunotoxic combinational effects when conducting assessments of the safety of environmental/occupational chemicals.

  8. Differential sensitivities of bone marrow, spleen and thymus to genotoxicity induced by environmentally relevant concentrations of arsenite.

    PubMed

    Xu, Huan; McClain, Shea; Medina, Sebastian; Lauer, Fredine T; Douillet, Christelle; Liu, Ke Jian; Hudson, Laurie G; Stýblo, Miroslav; Burchiel, Scott W

    2016-11-16

    It is known in humans and mouse models, that drinking water exposures to arsenite (As(+3)) leads to immunotoxicity. Previously, our group showed that certain types of immune cells are extremely sensitive to arsenic induced genotoxicity. In order to see if cells from different immune organs have differential sensitivities to As(+3), and if the sensitivities correlate with the intracellular concentrations of arsenic species, male C57BL/6J mice were dosed with 0, 100 and 500ppb As(+3)via drinking water for 30d. Oxidation State Specific Hydride Generation- Cryotrapping- Inductively Coupled Plasma- Mass Spectrometry (HG- CT- ICP- MS) was applied to analyze the intracellular arsenic species and concentrations in bone marrow, spleen and thymus cells isolated from the exposed mice. A dose-dependent increase in intracellular monomethylarsonous acid (MMA(+3)) was observed in both bone marrow and thymus cells, but not spleen cells. The total arsenic and MMA(+3) levels were correlated with an increase in DNA damage in bone marrow and thymus cells. An in vitro treatment of 5, 50 and 500nM As(+3) and MMA(+3) revealed that bone marrow cells are most sensitive to As(+3) treatment, and MMA(+3) is more genotoxic than As(+3). These results suggest that the differential sensitivities of the three immune organs to As(+3) exposure are due to the different intracellular arsenic species and concentrations, and that MMA(+3) may play a critical role in immunotoxicity. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  9. Viral protein R of HIV type-1 induces retrotransposition and upregulates glutamate synthesis by the signal transducer and activator of transcription 1 signaling pathway.

    PubMed

    Doi, Akihiro; Iijima, Kenta; Kano, Shigeyuki; Ishizaka, Yukihito

    2015-07-01

    Viral protein R (Vpr) of HIV-1 plays an important role in viral replication in macrophages. Various lines of evidence suggest that expression of Vpr in macrophages causes immunopathogenesis; however, the underlying mechanism is not yet fully understood. In this study, it was shown that recombinant Vpr (rVpr) induces retrotransposition of long interspersed element-1 in RAW264.7, a macrophage-like cell line, and activates reverse transcriptase-dependent immunotoxic cascades including production of IFN-β and phosphorylation of signal transducer and activator of transcription 1 (STAT1). Knockout experiments based on the CRISPR/Cas9 nickase system further demonstrated that cyclic guanosine monophosphate-adenosine monophosphate synthase (cGAS) and stimulator of interferon gene (STING) are responsible for IFN-β production and STAT1 phosphorylation, respectively. Moreover, rVpr was found to increase production of glutaminase C, a regulator of glutamate synthesis, which is also dependent on the cGAS-STING pathway. Taken together with reports that glutaminase C is involved in the pathogenesis of HIV-associated neurocognitive disorder (HAND) and that Vpr is detectable in the cerebrospinal fluid of HIV-1-positive patients, a possible role of Vpr-induced L1-RTP and immunotoxic cascades in the development of HAND is discussed.

  10. Immunotoxicity of nanoparticles: a computational study suggests that CNTs and C60 fullerenes might be recognized as pathogens by Toll-like receptors

    NASA Astrophysics Data System (ADS)

    Turabekova, M.; Rasulev, B.; Theodore, M.; Jackman, J.; Leszczynska, D.; Leszczynski, J.

    2014-03-01

    Over the last decade, a great deal of attention has been devoted to study the inflammatory response upon exposure to multi/single-walled carbon nanotubes (CNTs) and different fullerene derivatives. In particular, carbon nanoparticles are reported to provoke substantial inflammation in alveolar and bronchial epithelial cells, epidermal keratinocytes, cultured monocyte-macrophage cells, etc. We suggest a hypothetical model providing the potential mechanistic explanation for immune and inflammatory responses observed upon exposure to carbon nanoparticles. Specifically, we performed a theoretical study to analyze CNT and C60 fullerene interactions with the available X-ray structures of Toll-like receptors (TLRs) homo- and hetero-dimer extracellular domains. This assumption was based on the fact that similar to the known TLR ligands both CNTs and fullerenes induce, in cells, the secretion of certain inflammatory protein mediators, such as interleukins and chemokines. These proteins are observed within inflammation downstream processes resulted from the ligand molecule dependent inhibition or activation of TLR-induced signal transduction. Our computational studies have shown that the internal hydrophobic pockets of some TLRs might be capable of binding small-sized carbon nanostructures (5,5 armchair SWCNTs containing 11 carbon atom layers and C60 fullerene). High binding scores and minor structural alterations induced in TLR ectodomains upon binding C60 and CNTs further supported our hypothesis. Additionally, the proposed hypothesis is strengthened by the indirect experimental findings indicating that CNTs and fullerenes induce an excessive expression of specific cytokines and chemokines (i.e. IL-8 and MCP1).Over the last decade, a great deal of attention has been devoted to study the inflammatory response upon exposure to multi/single-walled carbon nanotubes (CNTs) and different fullerene derivatives. In particular, carbon nanoparticles are reported to provoke

  11. Immunotoxicity of nanoparticles: a computational study suggests that CNTs and C60 fullerenes might be recognized as pathogens by Toll-like receptors.

    PubMed

    Turabekova, M; Rasulev, B; Theodore, M; Jackman, J; Leszczynska, D; Leszczynski, J

    2014-04-07

    Over the last decade, a great deal of attention has been devoted to study the inflammatory response upon exposure to multi/single-walled carbon nanotubes (CNTs) and different fullerene derivatives. In particular, carbon nanoparticles are reported to provoke substantial inflammation in alveolar and bronchial epithelial cells, epidermal keratinocytes, cultured monocyte-macrophage cells, etc. We suggest a hypothetical model providing the potential mechanistic explanation for immune and inflammatory responses observed upon exposure to carbon nanoparticles. Specifically, we performed a theoretical study to analyze CNT and C60 fullerene interactions with the available X-ray structures of Toll-like receptors (TLRs) homo- and hetero-dimer extracellular domains. This assumption was based on the fact that similar to the known TLR ligands both CNTs and fullerenes induce, in cells, the secretion of certain inflammatory protein mediators, such as interleukins and chemokines. These proteins are observed within inflammation downstream processes resulted from the ligand molecule dependent inhibition or activation of TLR-induced signal transduction. Our computational studies have shown that the internal hydrophobic pockets of some TLRs might be capable of binding small-sized carbon nanostructures (5,5 armchair SWCNTs containing 11 carbon atom layers and C60 fullerene). High binding scores and minor structural alterations induced in TLR ectodomains upon binding C60 and CNTs further supported our hypothesis. Additionally, the proposed hypothesis is strengthened by the indirect experimental findings indicating that CNTs and fullerenes induce an excessive expression of specific cytokines and chemokines (i.e. IL-8 and MCP1).

  12. In vitro and in vivo comparison of the immunotoxicity of single- and multi-layered graphene oxides with or without pluronic F-127

    PubMed Central

    Cho, Young Chol; Pak, Pyo June; Joo, Yong Hoon; Lee, Hoi-Seon; Chung, Namhyun

    2016-01-01

    Graphene oxide (GO) has been a focus of research in the fields of electronics, energy, and biomedicine, including drug delivery. Thus, single- and multi-layered GO (SLGO and MLGO) have been produced and investigated. However, little information on their toxicity and biocompatibility is available. In the present study, we performed a comprehensive study of the size- and dose-dependent toxicity of GOs in the presence or absence of Pluronic F-127 on THP-1 cells by examining their viability, membrane integrity, levels of cytokine and ROS production, phagocytosis, and cytometric apoptosis. Moreover, as an extended study, a toxicity evaluation in the acute and chronic phases was performed in mice via intravenous injection of the materials. GOs exhibited dose- and size-dependent toxicity. Interestingly, SLGO induced ROS production to a lesser extent than MLGO. Cytometric analysis indicated that SLGO induced necrosis and apoptosis to a lesser degree than MLGO. In addition, cell damage and IL-1β production were influenced by phagocytosis. A histological animal study revealed that GOs of various sizes induced acute and chronic damage to the lung and kidney in the presence or absence of Pluronic F-127. These results will facilitate studies of GO prior to its biomedical application. PMID:27941848

  13. Satratoxin G–Induced Apoptosis in PC-12 Neuronal Cells is Mediated by PKR and Caspase Independent

    PubMed Central

    Islam, Zahidul; Hegg, Colleen C.; Bae, Hee Kyong; Pestka, James J.

    2008-01-01

    Satratoxin G (SG) is a macrocyclic trichothecene mycotoxin produced by Stachybotrys chartarum, a mold suggested to play an etiologic role in damp building-related illnesses. Acute intranasal exposure of mice to SG specifically induces apoptosis in olfactory sensory neurons of the nose. The PC-12 rat pheochromocytoma cell model was used to elucidate potential mechanisms of SG-induced neuronal cell death. Agarose gel electrophoresis revealed that exposure to SG at 10 ng/ml or higher for 48-h induced DNA fragmentation characteristic of apoptosis in PC-12 cells. SG-induced apoptosis was confirmed by microscopic morphology, hypodiploid fluorescence and annexin V-fluorescein isothiocyanate (FITC) uptake. Messenger RNA expression of the proapoptotic genes p53, double-stranded RNA–activated protein kinase (PKR), BAX, and caspase-activated DNAse was significantly elevated from 6 to 48 h after SG treatment. SG also induced apoptosis and proapoptotic gene expression in neural growth factor-differentiated PC-12 cells. Although SG-induced caspase-3 activation, caspase inhibition did not impair apoptosis. Moreover, SG induced nuclear translocation of apoptosis-inducing factor (AIF), a known contributor to caspase-independent neuronal cell death. SG-induced apoptosis was not affected by inhibitors of oxidative stress or mitogen-activated protein kinases but was suppressed by the PKR inhibitor C16 and by PKR siRNA transfection. PKR inhibition also blocked SG-induced apoptotic gene expression and AIF translocation but not caspase-3 activation. Taken together, SG-induced apoptosis in PC-12 neuronal cells is mediated by PKR via a caspase-independent pathway possibly involving AIF translocation. PMID:18535002

  14. The molecular mechanism of G2/M cell cycle arrest induced by AFB1 in the jejunum

    PubMed Central

    Yin, Heng; Jiang, Min; Peng, Xi; Cui, Hengmin; Zhou, Yi; He, Min; Zuo, Zhicai; Ouyang, Ping; Fan, Junde; Fang, Jing

    2016-01-01

    Aflatoxin B1 (AFB1) has potent hepatotoxic, carcinogenic, genotoxic, immunotoxic and other adverse effects in human and animals. The aim of this study was to investigate the molecular mechanism of G2/M cell cycle arrest induced by AFB1 in the jejunum of broilers. Broilers, as experimental animals, were fed 0.6 mg/kg AFB1 diet for 3 weeks. Our results showed that AFB1 reduced the jejunal villus height, villus height/crypt ratio and caused G2/M cell cycle arrest. The G2/M cell cycle was accompanied by the increase of ataxia telangiectasia mutated (ATM), p53, Chk2, p21 protein and mRNA expression, and the decrease of Mdm2, cdc25C, cdc2, cyclin B and proliferating cell nuclear antigen protein and mRNA expression. In conclusion, AFB1 blocked G2/M cell cycle by ATM pathway in the jejunum of broilers. PMID:27232757

  15. Immune System Toxicity and Immunotoxicity Hazard Identification

    EPA Science Inventory

    Exposure to chemicals may alter immune system health, increasing the risk of infections, allergy and autoimmune diseases. The chapter provides a concise overview of the immune system, host factors that affect immune system heal, and the effects that xenobiotic exposure may have ...

  16. Perfluorinated Compounds: Emerging POPs with Potential Immunotoxicity

    EPA Science Inventory

    Perfluorinated compounds (PFCs) have been recognized as an important class of environmental contaminants commonly detected in blood samples of both wildlife and humans. These compounds have been in use for more than 60 years as surface treatment chemicals, polymerization aids, an...

  17. Perfluorinated Compounds: Emerging POPs with Potential Immunotoxicity

    EPA Science Inventory

    Perfluorinated compounds (PFCs) have been recognized as an important class of environmental contaminants commonly detected in blood samples of both wildlife and humans. These compounds have been in use for more than 60 years as surface treatment chemicals, polymerization aids, an...

  18. Immune System Toxicity and Immunotoxicity Hazard Identification

    EPA Science Inventory

    Exposure to chemicals may alter immune system health, increasing the risk of infections, allergy and autoimmune diseases. The chapter provides a concise overview of the immune system, host factors that affect immune system heal, and the effects that xenobiotic exposure may have ...

  19. Quinones and Sulfhydryl-Dependent Immunotoxicity

    DTIC Science & Technology

    1983-08-01

    regulation of the final response (Rosenberg and Lipsky, 19,1; Yoshinaga et al., 1972; McClain and Edelman, 1980; Suthanthiren et al., 1980). Cell-cell... Yoshinaga et al., 1972; McClain and Edelman, 1980; Suthanthiren et al., 1980). These observations were the basis for developing an in vitro model for...1981; Yoshinaga et al., 1972; Sanderson. 1981; Ryser and Vassalli, 1981; Adams et al., 1982; Weissmann et al., 1981; Henson et al., 1981; Keller et

  20. Immunotoxicity of perfluorinated compounds: recent developments.

    PubMed

    DeWitt, Jamie C; Peden-Adams, Margie M; Keller, Jennifer M; Germolec, Dori R

    2012-01-01

    Perfluorinated compounds (PFCs) are environmentally widespread, persistent, and bioaccumulative chemicals with multiple toxicities reported in experimental models and wildlife, including immunomodulation. The two most commonly detected compounds, which also generally occur in the highest concentrations in environmentally exposed organisms, are perfluorooctanoic acid (PFOA) and perfluorooctane sulfonate (PFOS). PFOA and PFOS have been reported to alter inflammatory responses, production of cytokines, and adaptive and innate immune responses in rodent models, avian models, reptilian models, and mammalian and nonmammalian wildlife. Mounting evidence suggests that immune effects in laboratory animal models occur at serum concentrations below, within the reported range, or just above those reported for highly exposed humans and wildlife. Thus, the risk of immune effects for humans and wildlife exposed to PFCs cannot be discounted, especially when bioaccumulation and exposure to multiple PFCs are considered. This review contains brief descriptions of current and recently published work exploring immunomodulation by PFOA, PFOS, and other PFCs in rodent models, alternative laboratory models, and wildlife.

  1. 40 CFR 799.9780 - TSCA immunotoxicity.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... test animals are incubated with 51Cr-labeled YAC-1 lymphoma cells. The amount of radiolabel released... B cells in response to antigens, and bind specifically to the eliciting antigen. The different... extracellular fluids, such as serum, saliva, milk, and lymph. Most antibody responses are T cell-dependent, that...

  2. 40 CFR 799.9780 - TSCA immunotoxicity.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... test animals are incubated with 51Cr-labeled YAC-1 lymphoma cells. The amount of radiolabel released... B cells in response to antigens, and bind specifically to the eliciting antigen. The different... extracellular fluids, such as serum, saliva, milk, and lymph. Most antibody responses are T cell-dependent, that...

  3. 40 CFR 799.9780 - TSCA immunotoxicity.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... test animals are incubated with 51Cr-labeled YAC-1 lymphoma cells. The amount of radiolabel released... B cells in response to antigens, and bind specifically to the eliciting antigen. The different... extracellular fluids, such as serum, saliva, milk, and lymph. Most antibody responses are T cell-dependent, that...

  4. 40 CFR 799.9780 - TSCA immunotoxicity.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... test animals are incubated with 51Cr-labeled YAC-1 lymphoma cells. The amount of radiolabel released... B cells in response to antigens, and bind specifically to the eliciting antigen. The different... extracellular fluids, such as serum, saliva, milk, and lymph. Most antibody responses are T cell-dependent, that...

  5. 40 CFR 799.9780 - TSCA immunotoxicity.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... test animals are incubated with 51Cr-labeled YAC-1 lymphoma cells. The amount of radiolabel released... B cells in response to antigens, and bind specifically to the eliciting antigen. The different... extracellular fluids, such as serum, saliva, milk, and lymph. Most antibody responses are T cell-dependent, that...

  6. Immunotoxicity of Jet Fuels and Solvents

    DTIC Science & Technology

    2002-11-01

    as demonstrated by studies with tumor immunotherapy ( Kuby , 1992). Since the immune system is incredibly complex, it is difficult to discern the...significant factor in production and proliferation of T- cells, triggering and managing the immune response (Reid et al., 1994; Kuby , 1992). THI cells can...to produce IL-2 within 24 to 48 hours after activation by an antigen or mitogen ( Kuby , 1992). Mice given an intraperitoneal injection of benzene or

  7. Tetrabromobisphenol-A induces apoptotic death of auditory cells and hearing loss.

    PubMed

    Park, Channy; Kim, Se-Jin; Lee, Won Kyo; Moon, Sung Kyun; Kwak, SeongAe; Choe, Seong-Kyu; Park, Raekil

    2016-09-30

    Phenolic tetrabromobisphenol-A (TBBPA) and its derivatives are commonly used flame-retardants, in spite of reported toxic effects including neurotoxicity, immunotoxicity, nephrotoxicity, and hepatotoxicity. However, the effects of TBBPA on ototoxicity have not yet been reported. In this study, we investigated the effect of TBBPA on hearing function in vivo and in vitro. Auditory Brainstem Response (ABR) threshold was markedly increased in mice after oral administration of TBBPA, indicating that TBBPA causes hearing loss. In addition, TBBPA induced the loss of both zebrafish neuromasts and hair cells in the rat cochlea in a dose-dependent manner. Mechanistically, hearing loss is largely attributed to apoptotic cell death, as TBBPA increased the expression of pro-apoptotic genes but decreased the expression of anti-apoptotic genes. We also found that TBBPA induced oxidative stress, and importantly, pretreatment with NAC, an anti-oxidant reagent, reduced TBBPA-induced reactive oxygen species (ROS) generation and partially prevented cell death. Our results show that TBBPA-mediated ROS generation induces ototoxicity and hearing loss. These findings implicate TBBPA as a potential environmental ototoxin by exerting its hazardous effects on the auditory system. Copyright © 2016 Elsevier Inc. All rights reserved.

  8. Regulation of isocyanate-induced apoptosis, oxidative stress, and inflammation in cultured human neutrophils: isocyanate-induced neutrophils apoptosis.

    PubMed

    Mishra, P K; Khan, S; Bhargava, A; Panwar, H; Banerjee, S; Jain, S K; Maudar, K K

    2010-06-01

    Implications of environmental toxins on the regulation of neutrophil function are being significantly appraised. Such effects can be varied and markedly different depending on the type and extent of chemical exposure, which results in direct damage to the immune system. Isocyanates with functional group (-NCO), are considered as highly reactive molecules with diverse industrial applications. However, patho-physiological implications resulting from their occupational and accidental exposures have not been well delineated. The present study was carried out to assess the immunotoxic response of isocyanates and their mode of action at a molecular level on cultured human neutrophils isolated from healthy human volunteers. Studies were conducted to evaluate both dose- and time-dependent (n = 3) response using N-succinimidyl N-methylcarbamate, a chemical entity that mimics the effects of methyl isocyanate in vitro. Measure of apoptosis through annexin-V-FITC/PI assay, active caspase-3, apoptotic DNA ladder assay and mitochondrial depolarization; induction of oxidative stress by CM-H(2)DCFDA and formation of 8'-hydroxy-2'-deoxyguanosine; and levels of antioxidant defense system enzyme glutathione reductase, multiplex cytometric bead array analysis to quantify the secreted cytokine levels (interleukin-8, interleukin-1beta, interleukin-6, interleukin-10, interferon-gamma, tumor necrosis factor, and interleukin-12p70) parameters were evaluated. Our results demonstrate that isocyanates induce neutrophil apoptosis via activation of mitochondrial-mediated pathway along with reactive oxygen species production; depletion in antioxidant defense states; and elevated pro-inflammatory cytokine response.

  9. Does developmental exposure to perflurooctanoic acid (PFOA) induce immunopathologies commonly observed in neurodevelopmental disorders?

    PubMed

    Hu, Qing; Franklin, Jason N; Bryan, Ian; Morris, Erin; Wood, Andrew; DeWitt, Jamie C

    2012-12-01

    Immune comorbidities often are reported in subsets of patients with neurodevelopmental disorders, including autism spectrum disorders and attention-deficit hyperactivity disorder. A common immunopathology is an increase in serum autoantibodies against myelin basic protein (MBP) relative to control patients. Increases in autoantibodies suggest possible deficits in self-tolerance that may contribute to the formation of brain-specific autoantibodies and subsequent effects on the central nervous system (CNS). Oppositely, the formation of neuronal autoantibodies may be a reaction to neuronal injury or damage. Perfluorooctanoic acid (PFOA) is an environmental pollutant that induces multisystem toxicity in rodent models, including immunotoxicity and neurotoxicity. We hypothesized that developmental exposure to PFOA may induce immunotoxicity similar to that observed in subsets of patients with neurodevelopmental disorders. To test this hypothesis, we evaluated subsets of T cells from spleens, serum markers of autoreactivity, and levels of MBP and T cell infiltration in the cerebella of adult offspring exposed to 0.02, 0.2, or 2mg/kg of PFOA given to dams from gestation through lactation. Litter weights of offspring from dams exposed to 2mg/kg of PFOA were reduced by 32.6%, on average, from postnatal day one (PND1) through weaning (PND21). The percentage of splenic CD4+CD25+Foxp3+ T cells in male and female offspring from dams exposed to 2mg/kg of PFOA was reduced by 22% relative to the control percentage. Ex vivo co-cultures of splenic CD4+CD25+ T cells and CD4+CD25- T cells from dosed male offspring produced less IL-10 relative to control cells. Anti-ssDNA, a serum marker of autoreactivity, was decreased by 26%, on average, in female offspring from dams exposed to 0.02 and 2mg/kg PFOA. No other endpoints were statistically different by dose. These data suggest that developmental PFOA exposure may impact T cell responses and may be a possible route to downstream effects on

  10. Modulation of biochemical parameters by Hemidesmus indicus in cumene hydroperoxide-induced murine skin: possible role in protection against free radicals-induced cutaneous oxidative stress and tumor promotion.

    PubMed

    Sultana, Sarwat; Khan, Naghma; Sharma, Sonia; Alam, Aftab

    2003-03-01

    Hemidesmus indicus has been shown to possess significant activity against immunotoxicity and other pharmacological and physiological disorders. In this communication, we have shown the modulating effect of H. indicus on cumene hydroperoxide-mediated cutaneous oxidative stress and tumor promotion response in murine skin. Cumene hydroperoxide treatment (30 mg per animal) increased cutaneous microsomal lipid peroxidation and induction of xanthine oxidase activity which are accompanied by decrease in the activities of cutaneous antioxidant enzymes and depletion in the level of glutathione. Parallel to these changes a sharp decrease in the activities of phase II metabolizing enzymes was observed. Cumene hydroperoxide treatment also induced the ornithine decarboxylase activity and enhanced the [3H]-thymidine uptake in DNA synthesis in murine skin. Application of ethanolic extract of H. indicus at a dose level of 1.5 and 3.0mg/kg body weight in acetone prior to that of cumene hydroperoxide treatment resulted in significant inhibition of cumene hydroperoxide-induced cutaneous oxidative stress, epidermal ornithine decarboxylase activity and enhanced DNA synthesis in a dose-dependent manner. Enhanced susceptibility of cutaneous microsomal membrane for lipid peroxidation and xanthine oxidase activity were significantly reduced (P<0.01). In addition the depleted level of glutathione, inhibited activities of antioxidants and phase II metabolizing enzymes were recovered to significant level (P<0.05). In summary, our data suggest that H. indicus is an effective chemopreventive agent in skin and capable of ameliorating hydroperoxide-induced cutaneous oxidative stress and tumor promotion.

  11. Protective Effects of Diallyl Sulfide against Thioacetamide-Induced Toxicity: A Possible Role of Cytochrome P450 2E1

    PubMed Central

    Kim, Nam Hee; Lee, Sangkyu; Kang, Mi Jeong; Jeong, Hye Gwang; Kang, Wonku; Jeong, Tae Cheon

    2014-01-01

    Effects of diallyl sulfide (DAS) on thioacetamide-induced hepatotoxicity and immunotoxicity were investigated. When male Sprague-Dawley rats were treated orally with 100, 200 and 400 mg/kg of DAS in corn oil for three consecutive days, the activity of cytochrome P450 (CYP) 2E1-selective p-nitrophenol hydroxylase was dose-dependently suppressed. In addition, the activities of CYP 2B-selective benzyloxyresorufin O-debenzylase and pentoxyresorufin O-depentylase were significantly induced by the treatment with DAS. Western immunoblotting analyses also indicated the suppression of CYP 2E1 protein and/or the induction of CYP 2B protein by DAS. To investigate a possible role of metabolic activation by CYP enzymes in thioacetamide-induced hepatotoxicity, rats were pre-treated with 400 mg/kg of DAS for 3 days, followed by a single intraperitoneal treatment with 100 and 200 mg/kg of thioacetamide in saline for 24 hr. The activities of serum alanine aminotransferase and aspartate aminotransferase significantly elevated by thioacetamide were protected in DAS-pretreated animals. Likewise, the suppressed antibody response to sheep erythrocytes by thioacetamide was protected by DAS pretreatment in female BALB/c mice. Taken together, our present results indicated that thioacetamide might be activated to its toxic metabolite(s) by CYP 2E1, not by CYP 2B, in rats and mice. PMID:24753821

  12. Genotoxicity induced by monomethylarsonous acid (MMA(+3)) in mouse thymic developing T cells.

    PubMed

    Xu, Huan; Medina, Sebastian; Lauer, Fredine T; Douillet, Christelle; Liu, Ke Jian; Stýblo, Miroslav; Burchiel, Scott W

    2017-09-05

    Drinking water exposure to arsenic is known to cause immunotoxicity. Our previous studies demonstrated that monomethylarsonous acid (MMA(+3)) was the major arsenical species presented in mouse thymus cells after a 30 d drinking water exposure to arsenite (As(+3)). MMA(+3) was also showed to be ten times more toxic than As(+3) on the suppression of IL-7/STAT5 signaling in the double negative (DN) thymic T cells. In order to examine the genotoxicity induced by low to moderate doses of MMA(+3), isolated mouse thymus cells were treated with 5, 50 and 500nMMMA(+3) for 18h in vitro. MMA(+3) suppressed the proliferation of thymus cells in a dose dependent manner. MMA(+3) at 5nM induced DNA damage in DN not double positive (DP) cells. Differential sensitivity to double strand breaks and reactive oxygen species generation was noticed between DN and DP cells at 50nM, but the effects were not seen at the high dose (500nM). A stronger apoptotic effect induced by MMA(+3) was noticed in DN cells than DP cells at low doses (5 and 50nM), which was negated by the strong apoptosis induction at the high dose (500nM). Analysis of intracellular MMA(+3) concentrations in DN and DP cells, revealed that more MMA(+3) accumulated in the DN cells after the in vitro treatment. Collectively, these results suggested that MMA(+3) could directly induce strong genotoxicity in the early developing T cells in the thymus. The DN cells were much more sensitive to MMA(+3) induced genotoxicity and apoptosis than DP cells, probably due to the higher intracellular levels of MMA(+3). Copyright © 2017 Elsevier B.V. All rights reserved.

  13. Acacia ferruginea inhibits cyclophosphamide-induced immunosuppression and urotoxicity by modulating cytokines in mice.

    PubMed

    Sakthivel, K M; Guruvayoorappan, Chandrasekaran

    2015-01-01

    Cyclophosphamide (CTX), commonly used as an anti-neoplastic drug, can cause adverse side-effects including immunotoxicity and urotoxicity. Increasingly, plants have become sources of therapeutics that can help to restore host immunity to normal. In this study, Acacia ferruginea was assessed for an ability to protect mice against/mitigate CTX-induced toxicity. Co-administration of an extract of A. ferruginea (10 mg/kg BW, IP daily) for 10 consecutive days reduced CTX (25 mg/kg BW, IP daily)-induced toxicity. Apart from improvements in bladder and small intestine morphology, there was marked improvement in anti-oxidant (glutathione) levels in the bladder, suggesting a role for the anti-oxidant in reducing CTX-induced urotoxicity. Moreover, use of the extract significantly increased total leukocyte counts and bone marrow cellularity/α-esterase activity in CTX-treated mice which suggested a protective effect on the hematopoietic system. Co-treatment with the extract also prevented decreases in organ (liver, kidney, spleen, thymus) weight as well as body weight, thereby seemingly lessening the potential impact of CTX on the host immune system. Further, CTX-induced increases in serum aspartate transanimase, alanine transaminase, and alkaline phosphatase were reversed by extract co-treatment, as were alterations in in situ formation/release of interferon (IFN)-γ, interleukin (IL)-2, granulocyte-macrophage colony stimulating factor (GM-CSF), and tumor necrosis factor (TNF)-α. Overall, this study indicated there were some protective effects from use of an extract of A. ferruginea against CTX-induced toxicities, in part through modulation of levels of anti-oxidants and pro-inflammatory cytokines.

  14. [Joint effects of apoptosis induced by microcystins and bacterial lipopolysaccharides on grass carp (Ctenopharyngodon idellus) lymphocytes].

    PubMed

    Fang, Wen-Di; Zhang, Hang-Jun; Wu, Yu-Huan

    2014-02-01

    In this study, grass carp (Ctenopharyngodon idellus) lymphocytes were used as the vitro test object to demonstrate the joint effects of microcystins (MC-LR) and bacterial lipopolysaccharides (LPS) on fish immune system. The results showed that MC-LR and LPS in the single and combined exposure groups could both induce grass carp lymphocytes apoptosis with typical ladder-like DNA electrophoresis characteristics. However, comparing the apoptosis rate of the combined and single exposure groups, it was suggested that bacterial LPS could cooperate with MC-LR causing a higher rate of fish lymphocytes apoptosis (2.1 and 3.3-fold of that for the single exposure group I (MC-LR) and II (LPS), respectively), and there existed a significant dose-response relationship. The MC-LR cooperating with bacterial LPS decreased the activity of glutathione S-transferase (GST), increased the levels of intracellular reactive oxygen species (ROS) and malondialdehyde (MDA), resulted in DNA damage and cell arrest in G0 phase, which inhibited cell proliferation and accelerated apoptosis. It was proved that MC-LR exacerbated fish immunotoxicity by collaborating with LPS, which had a serious adverse effect on aquaculture industry.

  15. Quantitative alterations in the liver and adrenal gland in pregnant rats induced by Pyralene 3000

    SciTech Connect

    Vreci, M.; Sek, S.; Lorger, J.; Bavdek, S.; Pogacnik, A.

    1995-06-01

    Polychlorinated biphenyls (PCBs) are among the most widespread environmental pollutants known in the world. The half-life of PCBs is very long and, therefore, once released into the environment, they accumulate in food chains and tissues of various mammals, including man. Their presence can cause numerous toxic effects, e.g., hepatotoxicity, immunotoxicity, dermatotoxicity, neurotoxicity, and disorders of the reproductive system, among others. These effects depend on the distribution route in the organism, the rate of metabolism and excretion. Their characteristics are closely associated with the number and position of the chlorine atoms in the molecule. Previous studies of trichlorobiphenyl distributions in various tissues demonstrated that low chlorinated trichlorobiphenyls do no accumulate in endocrine organs, whereas higher chlorinated biphenyls, such as hexa- and octachlorobiphenyl, are deposited and retained in the adrenal gland. A selective distribution of radioabelled tetrachlorobiphenyl to the zona fasciculata, accompanied by morphometric evidence of the hypertrophy of the zona fasciculata, was also noted. The purpose of this study was to examine changes in the tissue structure of the pregnant rat liver and adrenal gland induced experimentally by Pyralene 3000 administration. We chose this commercial low chlorinated PCB because it was in use in Slovenia and, discharged from the electroindustrial plants, caused a serious incidence of environmental pollution in the region of Bela Krajina. Our further aim was to research the transplacental influences of Pyralene 3000 in rats. 17 refs., 1 fig., 3 tabs.

  16. Permethrin-induced oxidative stress and toxicity and metabolism. A review.

    PubMed

    Wang, Xu; Martínez, María-Aránzazu; Dai, Menghong; Chen, Dongmei; Ares, Irma; Romero, Alejandro; Castellano, Victor; Martínez, Marta; Rodríguez, José Luis; Martínez-Larrañaga, María-Rosa; Anadón, Arturo; Yuan, Zonghui

    2016-08-01

    Permethrin (PER), the most frequently used synthetic Type I pyrethroid insecticide, is widely used in the world because of its high activity as an insecticide and its low mammalian toxicity. It was originally believed that PER exhibited low toxicity on untargeted animals. However, as its use became more extensive worldwide, increasing evidence suggested that PER might have a variety of toxic effects on animals and humans alike, such as neurotoxicity, immunotoxicity, cardiotoxicity, hepatotoxicity, reproductive, genotoxic, and haematotoxic effects, digestive system toxicity, and cytotoxicity. A growing number of studies indicate that oxidative stress played critical roles in the various toxicities associated with PER. To date, almost no review has addressed the toxicity of PER correlated with oxidative stress. The focus of this article is primarily to summarise advances in the research associated with oxidative stress as a potential mechanism for PER-induced toxicity as well as its metabolism. This review summarises the research conducted over the past decade into the reactive oxygen species (ROS) generation and oxidative stress as a consequence of PER treatments, and ultimately their correlation with the toxicity and the metabolism of PER. The metabolism of PER involves various CYP450 enzymes, alcohol or aldehyde dehydrogenases for oxidation and the carboxylesterases for hydrolysis, through which oxidative stress might occur, and such metabolic factors are also reviewed. The protection of a variety of antioxidants against PER-induced toxicity is also discussed, in order to further understand the role of oxidative stress in PER-induced toxicity. This review will throw new light on the critical roles of oxidative stress in PER-induced toxicity, as well as on the blind spots that still exist in the understanding of PER metabolism, the cellular effects in terms of apoptosis and cell signaling pathways, and finally strategies to help to protect against its oxidative

  17. Reactive oxygen species (ROS) induced cytokine production and cytotoxicity of PAMAM dendrimers in J774A.1 cells

    SciTech Connect

    Naha, Pratap C.; Davoren, Maria; Lyng, Fiona M.; Byrne, Hugh J.

    2010-07-15

    The immunotoxicity of three generations of polyamidoamine (PAMAM) dendrimers (G-4, G-5 and G-6) was evaluated in mouse macrophage cells in vitro. Using the Alamar blue and MTT assays, a generation dependent cytotoxicity of the PAMAM dendrimers was found whereby G-6 > G-5 > G-4. The toxic response of the PAMAM dendrimers correlated well with the number of surface primary amino groups, with increasing number resulting in an increase in toxic response. An assessment of intracellular ROS generation by the PAMAM dendrimers was performed by measuring the increased fluorescence as a result of intracellular oxidation of Carboxy H{sub 2}DCFDA to DCF both quantitatively using plate reader and qualitatively by confocal laser scanning microscopy. The inflammatory mediators macrophage inflammatory protein-2 (MIP-2), tumour necrosis factor-{alpha} (TNF-{alpha}) and interleukin-6, (IL-6) were measured by the enzyme linked immunosorbant assay (ELISA) following exposure of mouse macrophage cells to PAMAM dendrimers. A generation dependent ROS and cytokine production was found, which correlated well with the cytotoxicological response and therefore number of surface amino groups. A clear time sequence of increased ROS generation (maximum at {approx} 4 h), TNF-{alpha} and IL-6 secretion (maximum at {approx} 24 h), MIP-2 levels and cell death ({approx} 72 h) was observed. The intracellular ROS generation and cytokine production induced cytotoxicity point towards the mechanistic pathway of cell death upon exposure to PAMAM dendrimers.

  18. Fluoride exposure abates pro-inflammatory response and induces in vivo apoptosis rendering zebrafish (Danio rerio) susceptible to bacterial infections.

    PubMed

    Singh, Rashmi; Khatri, Preeti; Srivastava, Nidhi; Jain, Shruti; Brahmachari, Vani; Mukhopadhyay, Asish; Mazumder, Shibnath

    2017-02-20

    The present study describes the immunotoxic effect of chronic fluoride exposure on adult zebrafish (Danio rerio). Zebrafish were exposed to fluoride (71.12 mg/L; 1/10 LC50) for 30 d and the expression of selected genes studied. We observed significant elevation in the detoxification pathway gene cyp1a suggesting chronic exposure to non-lethal concentration of fluoride is indeed toxic to fish. Fluoride mediated pro-oxidative stress is implicated with the downregulation in superoxide dismutase 1 and 2 (sod1/2) genes. Fluoride affected DNA repair machinery by abrogating the expression of the DNA repair gene rad51 and growth arrest and DNA damage inducible beta a gene gadd45ba. The upregulated expression of casp3a coupled with altered Bcl-2 associated X protein/B-cell lymphoma 2 ratio (baxa/bcl2a) clearly suggested chronic fluoride exposure induced the apoptotic cascade in zebrafish. Fluoride-exposed zebrafish when challenged with non-lethal dose of fish pathogen A. hydrophila revealed gross histopathology in spleen, bacterial persistence and significant mortality. We report that fluoride interferes with system-level output of pro-inflammatory cytokines tumour necrosis factor-α, interleukin-1β and interferon-γ, as a consequence, bacteria replicate efficiently causing significant fish mortality. We conclude, chronic fluoride exposure impairs the redox balance, affects DNA repair machinery with pro-apoptotic implications and suppresses pro-inflammatory cytokines expression abrogating host immunity to bacterial infections.

  19. Dioxin exposure of human CD34+ hemopoietic cells induces gene expression modulation that recapitulates its in vivo clinical and biological effects.

    PubMed

    Fracchiolla, Nicola Stefano; Todoerti, Katia; Bertazzi, Pier Alberto; Servida, Federica; Corradini, Paolo; Carniti, Cristiana; Colombi, Antonio; Cecilia Pesatori, Angela; Neri, Antonino; Deliliers, Giorgio Lambertenghi

    2011-04-28

    2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD) has a large number of biological effects, including skin, cardiovascular, neurologic diseases, diabetes, infertility, cancers and immunotoxicity. We analysed the in vitro TCDD effects on human CD34+ cells and tested the gene expression modulation by means of microarray analyses before and after TCDD exposure. We identified 257 differentially modulated probe sets, identifying 221 well characterized genes. A large part of these resulted associated to cell adhesion and/or angiogenesis and to transcription regulation. Synaptic transmission and visual perception functions, with the particular involvement of the GABAergic pathway were also significantly modulated. Numerous transcripts involved in cell cycle or cell proliferation, immune response, signal transduction, ion channel activity or calcium ion binding, tissue development and differentiation, female or male fertility or in several metabolic pathways were also affected after dioxin exposure. The transcriptional profile induced by TCDD treatment on human CD34+ cells strikingly reproduces the clinical and biological effects observed in individuals exposed to dioxin and in biological experimental systems. Our data support a role of dioxin in the neoplastic transformation of hemopoietic stem cells and in immune modulation processes after in vivo exposure, as indicated by the epidemiologic data in dioxin accidentally exposed populations, providing a molecular basis for it. In addition, TCDD alters genes associated to glucidic and lipidic metabolisms, to GABAergic transmission or involved in male and female fertility, thus providing a possible explanation of the diabetogenic, dyslipidemic, neurologic and fertility effects induced by TCDD in vivo exposure.

  20. Carbon fullerenes (C60s) can induce inflammatory responses in the lung of mice

    SciTech Connect

    Park, Eun-Jung; Kim, Hero; Kim, Younghun; Yi, Jongheop; Choi, Kyunghee; Park, Kwangsik

    2010-04-15

    Fullerenes (C60s) occur in the environment due to natural and anthropogenic sources such as volcanic eruptions, forest fires, and the combustion of carbon-based materials. Recently, production and application of engineered C60s have also rapidly increased in diverse industrial fields and biomedicine due to C60' unique physico-chemical properties, so toxicity assessment on environmental and human health is being evaluated as a valuable work. However, data related to the toxicity of C60s have not been abundant up to now. In this study, we studied the immunotoxic mechanism and change of gene expression caused by the instillation of C60s. As a result, C60s induced an increase in sub G1 and G1 arrest in BAL cells, an increase in pro-inflammatory cytokines such as IL-1, TNF-alpha, and IL-6, and an increase of Th1 cytokines such as IL-12 and IFN-r in BAL fluid. In addition, IgE reached the maximum at 1 day after treatment in both BAL fluid and the blood, and decreased in a time-dependent manner. Gene expression of the MHC class II (H2-Eb1) molecule was stronger than that of the MHC class I (H2-T23), and an increase in T cell distribution was also observed during the experiment period. Furthermore, cell infiltration and expression of tissue damage related genes in lung tissue were constantly observed during the experiment period. Based on this, C60s may induce inflammatory responses in the lung of mice.

  1. Low-Dose Inorganic Mercury Increases Severity and Frequency of Chronic Coxsackievirus-Induced Autoimmune Myocarditis in Mice

    PubMed Central

    Nyland, Jennifer F.; Fairweather, DeLisa; Shirley, Devon L.; Davis, Sarah E.; Rose, Noel R.; Silbergeld, Ellen K.

    2012-01-01

    Mercury is a widespread environmental contaminant with neurotoxic impacts that have been observed over a range of exposures. In addition, there is increasing evidence that inorganic mercury (iHg) and organic mercury (including methyl mercury) have a range of immunotoxic effects, including immune suppression and induction of autoimmunity. In this study, we investigated the effect of iHg on a model of autoimmune heart disease in mice induced by infection with coxsackievirus B3 (CVB3). We examined the role of timing of iHg exposure on disease; in some experiments, mice were pretreated with iHg (200 μg/kg, every other day for 15 days) before disease induction with virus inoculation, and in others, they were treated with iHg after the acute (viral) phase of disease but before the development of dilated cardiomyopathy (DCM). iHg alone had no effect on heart pathology. Pretreatment with iHg before CVB3 infection significantly increased the severity of chronic myocarditis and DCM compared with control animals receiving vehicle alone. In contrast, treatment with iHg after acute myocarditis did not affect the severity of chronic disease. The increased chronic myocarditis, fibrosis, and DCM induced by iHg pretreatment were not due to increased viral replication in the heart, which was unaltered by iHg treatment. iHg pretreatment induced a macrophage infiltrate and mixed cytokine response in the heart during acute myocarditis, including significantly increased interleukin (IL)-12, IL-17, interferon-γ, and tumor necrosis factor-α levels. IL-17 levels were also significantly increased in the spleen during chronic disease. Thus, we show for the first time that low-dose Hg exposure increases chronic myocarditis and DCM in a murine model. PMID:21984480

  2. (-)-Epigallocatechin-3-Gallate Inhibits Arsenic-Induced Inflammation and Apoptosis through Suppression of Oxidative Stress in Mice.

    PubMed

    Yu, Nan-Hui; Pei, Haiping; Huang, Yong-Pan; Li, Yu-Fei

    2017-01-01

    Exposure to arsenic in individuals has been found to be associated with various health-related problems including skin lesions, cancer, and cardiovascular and immunological disorders. (-)-Epigallocatechin-3-gallate (EGCG), the main and active polyphenolic catechin present in green tea, has shown potent antioxidant, anti-apoptotic and anti-inflammatory activity in vivo and in vitro. Thus, the present study was conducted to investigate the protective effects of EGCG against arsenic-induced inflammation and immunotoxicity in mice. Serum IL-1β, IL-6 and TNF-α were determined by ELISA, tissue catalase (CAT), malonyldialdehyde (MDA), superoxide dismutase (SOD), glutathione (GSH), nitric oxide and caspase 3 by commercial kits, mitochondrial membrane potential with Rh 123, mitochondrial ROS with 2',7'-dichlorofluorescin diacetate (DCFH-DA), apoptotic and necrotic cells and T-cell phenotyping with Flow cytometry analysis. The results showed that arsenic treatment significantly increased oxidative stress levels (as indicated by catalase, malonyldialdehyde, superoxide dismutase, glutathione and reactive oxygen species), increased levels of inflammatory cytokines and promoted apoptosis. Arsenic exposure increased the relative frequency of the CD8+(Tc) cell subpopulation (from 2.8 to 18.9%) and decreased the frequency of CD4+(Th) cells (from 5.2 to 2.7%). Arsenic exposure also significantly decreased the frequency of T(CD3) (from 32.5% to 19.2%) and B(CD19) cells (from 55.1 to 32.5%). All of these effects induced by NaAsO2 were attenuated by EGCG. The present in vitro findings indicate that EGCG attenuates not only NaAsO2-induced immunosuppression but also inflammation and apoptosis. © 2017 The Author(s)Published by S. Karger AG, Basel.

  3. Molecular mechanisms underlying mancozeb-induced inhibition of TNF-alpha production.

    PubMed

    Corsini, Emanuela; Viviani, Barbara; Birindelli, Sarah; Gilardi, Federica; Torri, Anna; Codecà, Ilaria; Lucchi, Laura; Bartesaghi, Stefano; Galli, Corrado L; Marinovich, Marina; Colosio, Claudio

    2006-04-15

    activity relative to control after mancozeb treatment, confirming NF-kappaB binding as an intracellular target of mancozeb. Overall, this study contributes to our understanding of the mechanism underlying mancozeb-induced immunotoxicity.

  4. Molecular mechanisms underlying mancozeb-induced inhibition of TNF-alpha production

    SciTech Connect

    Corsini, Emanuela . E-mail: emanuela.corsini@unimi.it; Viviani, Barbara; Birindelli, Sarah; Gilardi, Federica; Torri, Anna; Codeca, Ilaria; Lucchi, Laura; Bartesaghi, Stefano; Galli, Corrado L.; Marinovich, Marina; Colosio, Claudio

    2006-04-15

    luciferase activity relative to control after mancozeb treatment, confirming NF-{kappa}B binding as an intracellular target of mancozeb. Overall, this study contributes to our understanding of the mechanism underlying mancozeb-induced immunotoxicity.

  5. Silymarin protects PBMC against B(a)P induced toxicity by replenishing redox status and modulating glutathione metabolizing enzymes-An in vitro study

    SciTech Connect

    Kiruthiga, P.V.; Pandian, S. Karutha; Devi, K. Pandima

    2010-09-01

    PAHs are a ubiquitous class of environmental contaminants that have a large number of hazardous consequences on human health. An important prototype of PAHs, B(a)P, is notable for being the first chemical carcinogen to be discovered and the one classified by EPA as a probable human carcinogen. It undergoes metabolic activation to QD, which generate ROS by redox cycling system in the body and oxidatively damage the macromolecules. Hence, a variety of antioxidants have been tested as possible protectors against B(a)P toxicity. Silymarin is one such compound, which has high human acceptance, used clinically and consumed as dietary supplement around the world for its strong anti-oxidant efficacy. Silymarin was employed as an alternative approach for treating B(a)P induced damage and oxidative stress in PBMC, with an emphasis to provide the molecular basis for the effect of silymarin against B(a)P induced toxicity. PBMC cells exposed to either benzopyrene (1 {mu}M) or silymarin (2.4 mg/ml) or both was monitored for toxicity by assessing LPO, PO, redox status (GSH/GSSG ratio), glutathione metabolizing enzymes GR and GPx and antioxidant enzymes CAT and SOD. This study also investigated the protective effect of silymarin against B(a)P induced biochemical alteration at the molecular level by FT-IR spectroscopy. Our findings were quite striking that silymarin possesses substantial protective effect against B(a)P induced oxidative stress and biochemical changes by restoring redox status, modulating glutathione metabolizing enzymes, hindering the formation of protein oxidation products, inhibiting LPO and further reducing ROS mediated damages by changing the level of antioxidant enzymes. The results suggest that silymarin exhibits multiple protections and it should be considered as a potential protective agent for environmental contaminant induced immunotoxicity.

  6. Immunotoxicity Monitoring in a Population Exposed to Polychlorinated Biphenyls

    PubMed Central

    Haase, Hajo; Fahlenkamp, Astrid; Schettgen, Thomas; Esser, Andre; Gube, Monika; Ziegler, Patrick; Kraus, Thomas; Rink, Lothar

    2016-01-01

    The relationship between polychlorinated biphenyl (PCB) burden and several indicators of immune function was investigated as part of the HELPcB (Health Effects in High-Level Exposure to PCB) program, offering bio-monitoring to workers, relatives, and neighbors exposed to PCBs by a German transformers and capacitors recycling company. The present retrospective observational study evaluates the correlation of plasma levels of total PCBs, five indicator congeners (28, 101, 138, 153, 180), and seven dioxin-like congeners (105, 114, 118, 156, 157, 167, 189) with several parameters of immune function. The cross-sectional study was performed immediately after the end of exposure (258 subjects), and one (218 subjects), and two (177 subjects) years later. At the first time point, measurements showed significant positive correlation between congeners with low to medium chlorination and the relative proportion of CD19 positive B-cells among lymphocytes, as well as a negative correlation of PCB114 with serum IgM, and of PCB 28 with suppressor T-cell and NK-cell numbers. Congeners with a high degree of chlorination, in particular PCB157 and 189, were positively associated with expression of the activation marker CD25 on T-cells in the cohort of the second time point. No associations between PCB levels and IFN-y production by T-cells and killing by NK-cells were found. In conclusion, there were several effects on the cellular composition of adaptive immunity, affecting both T- and B-cells. However, the values were not generally outside the reference ranges for healthy adult individuals and did not indicate overt functional immunodeficiency, even in subjects with the uppermost PCB burden. PMID:27005643

  7. EVALUATION OF PERFLUOROOCTANOIC ACID IMMUNOTOXICITY IN ADULT MICE.

    EPA Science Inventory

    Perfluorooctanoic acid (PFOA) is used in the manufacture of fluoropolymers and may be formed by metabolism or degradation of other perfluoroalkyl acids. Safety concerns led the U.S. EPA to conduct a risk assessment of PFOA and related compounds due to their environmental persist...

  8. EVALUATION OF PERFLUOROOCTANOIC ACID IMMUNOTOXICITY IN ADULT MICE.

    EPA Science Inventory

    Perfluorooctanoic acid (PFOA) is used in the manufacture of fluoropolymers and may be formed by metabolism or degradation of other perfluoroalkyl acids. Safety concerns led the U.S. EPA to conduct a risk assessment of PFOA and related compounds due to their environmental persist...

  9. Purification, immunotoxic effects, and cellular uptake of trichothecene mycotoxins

    SciTech Connect

    Witt, M.F.

    1989-01-01

    Studies were carried out to better understand how the trichothecenes alter immune function in animals and humans. Deoxynivalenol (DON) was purified for use in animal feeding studies. Dietary exposure to DON for 8 weeks altered the serum immunoglobulin profile in mice and decreased the splenic plaque-forming cell response to the antigen sheep red blood cells. The uptake of ({sup 3}H)T-2 toxin by a murine B-cell hybridoma was studied in order to learn more about the way in which trichothecenes interact with immune cells. A simple procedure was developed for the laboratory production and purification of gram quantities of crystalline DON. When Fusarium graminearum R6576 was grown on rice, concentrations of 600 to 700 ppm DON accumulated after 13 to 18 days of incubation. A DON derivative, 15-acetylDON, was also found at concentrations of 100 to 300 ppm after 7 to 10 days. DON was purified from crude culture extracts by water-saturated silica gel chromatography. Alpha-({sup 3}H)T-2 toxin of 99% chemical and radiochemical purity was prepared for use in uptake studies. Both the rate of uptake of ({sup 3}H)T-2 toxin by hybridomas and the time required for accumulation of ({sup 3}H)T-2 to reach equilibrium were proportional to the concentration of ({sup 3}H)T-2. ({sup 3}H)T-2 toxin accumulated by hybridomas was proportional to the concentration of ({sup 3}H)T-2 between 10{sup {minus}8} and 10{sup {minus}3} M. The rate of uptake of ({sup 3}H)jT-2 toxin by hybridomas was inhibited by the trichothecenes T-2 toxin, DON, verrucarin A, and roridin A, as well as the antibiotic anisomycin. The kinetics and concentration dependence of accumulation, along with the inhibition patterns, suggest that uptake of ({sup 3}H)T-2 toxin by hybridomas is mediated by binding of toxin to ribosomes.

  10. Splenic immunotoxicity in developing cane toads (Rhinella marina) from Bermuda.

    PubMed

    Fort, Douglas J; Mathis, Michael; Fort, Chelsea E; Fort, Hayley M; Fort, Troy D; Linzey, Donald W; Bacon, Jamie P

    2016-10-01

    The impacts of contaminated sediment from 2 ponds in Bermuda on immune function in newly metamorphosed cane toads were examined. In the present study, a partial life-cycle experiment exposing Gosner stage 20 cane toad tadpoles to pond sediment and laboratory culture water through metamorphosis and into a juvenile state was performed. A basic immunology battery, including general necropsy, spleen somatic index, spleen white pulp content, splenocyte tissue density, and splenocyte viability, was conducted in newly metamorphosed Rhinella marina exposed to Bermuda freshwater sediment and baseline specimens collected from 2 separate populations in south Texas and south Florida, USA. Immune function was evaluated using a lymphocyte proliferation assay with subset specimens infected with Mycobacterium chelonae. In the Bermuda population exposed to pond sediment, splenocyte tissue density was markedly lower and lymphocyte proliferation substantially less relative to cohorts exposed to control sediment and to the North American populations. Considerable increases in spleen weight and liver and spleen lesions related to M. chelonae infection were recorded in challenged Bermuda R. marina compared with unchallenged specimens. Overall, immune function in Bermuda R. marina was compromised compared with North American mainland R. marina regardless of treatment but more dramatically in specimens exposed to Bermuda pond sediments. Environ Toxicol Chem 2016;35:2604-2612. © 2016 SETAC. © 2016 SETAC.

  11. Approaches to detecting immunotoxic effects of environmental contaminants in humans.

    PubMed Central

    Tryphonas, H

    2001-01-01

    Experimental animal studies indicate that environmental contaminants can have adverse effects on several organs and tissues of the immune system. Such effects are known to lead to increased host susceptibility to microbial infections and to compromised immunosurveillance mechanisms normally instrumental in the elimination of neoplastic cells and the prevention of autoimmune diseases. Evaluation of the potential risk environmental contaminants pose to the human immune system is currently accomplished via extrapolation of experimentally derived animal data to humans. Presently, this process requires that uncertainty factors such as interspecies differences and genetic variability be considered. Naturally, the process of risk assessment would be greatly facilitated if it were based on clinically relevant data derived from studying humans known to be exposed to environmental contaminants. However, the existing human data are scarce and often described as very limited in scope. To generate the much-needed human data we need to identify a set of clinically relevant immunologic end points that, when adequately standardized, can be incorporated easily into the design of prospective epidemiologic studies. PMID:11744506

  12. Immunotoxicity Monitoring in a Population Exposed to Polychlorinated Biphenyls.

    PubMed

    Haase, Hajo; Fahlenkamp, Astrid; Schettgen, Thomas; Esser, Andre; Gube, Monika; Ziegler, Patrick; Kraus, Thomas; Rink, Lothar

    2016-03-08

    The relationship between polychlorinated biphenyl (PCB) burden and several indicators of immune function was investigated as part of the HELPcB (Health Effects in High-Level Exposure to PCB) program, offering bio-monitoring to workers, relatives, and neighbors exposed to PCBs by a German transformers and capacitors recycling company. The present retrospective observational study evaluates the correlation of plasma levels of total PCBs, five indicator congeners (28, 101, 138, 153, 180), and seven dioxin-like congeners (105, 114, 118, 156, 157, 167, 189) with several parameters of immune function. The cross-sectional study was performed immediately after the end of exposure (258 subjects), and one (218 subjects), and two (177 subjects) years later. At the first time point, measurements showed significant positive correlation between congeners with low to medium chlorination and the relative proportion of CD19 positive B-cells among lymphocytes, as well as a negative correlation of PCB114 with serum IgM, and of PCB 28 with suppressor T-cell and NK-cell numbers. Congeners with a high degree of chlorination, in particular PCB157 and 189, were positively associated with expression of the activation marker CD25 on T-cells in the cohort of the second time point. No associations between PCB levels and IFN-y production by T-cells and killing by NK-cells were found. In conclusion, there were several effects on the cellular composition of adaptive immunity, affecting both T- and B-cells. However, the values were not generally outside the reference ranges for healthy adult individuals and did not indicate overt functional immunodeficiency, even in subjects with the uppermost PCB burden.

  13. Puerarin, isolated from Kudzu root (Willd.), attenuates hepatocellular cytotoxicity and regulates the GSK-3β/NF-κB pathway for exerting the hepatoprotection against chronic alcohol-induced liver injury in rats.

    PubMed

    Li, Rong; Liang, Tao; He, Qiaoling; Guo, Chao; Xu, Lingyuan; Zhang, Kefeng; Duan, Xiaoqun

    2013-09-01

    Puerarin (PR) has been utilized as a phytomedicine to managing liver disease in China. Thus, this study aimed to evaluate the potential PR-mediated hepatoprotective role against chronic alcohol-induced liver injury in rats. The results indicated that serum levels of alanine aminotransferase (ALT), aspartate aminotransferase (AST), alkaline phosphatase (ALP) and pro-inflammatory cytokines were significantly reduced following PR treatment, while the albumin (ALB) level was increased. Meanwhile, intrahepatic contents of alcohol dehydrogenase (ADH), aldehyde dehydrogenase (ALDH) were elevated. Pathological examination showed that alcohol-lesioned hepatocytes were mitigated through the PR treatment. In addition, the endogenous levels of glycogen synthase kinase-3β (GSK-3β) at the protein level and β-catenin expression at the mRNA level were notably down-regulated, whereas the tumor necrosis factor alpha (TNF-α) and nuclear factor-kappa B (NF-κB) proteins in the liver tissue were effectively decreased following the PR treatment. Together, these findings demonstrate that PR mediates hepatoprotection against alcohol-induced liver injury. The mechanisms underlying the cytoprotective effects of PR are associated with inhibiting immunotoxicity in hepatocytes and regulating the GSK-3β/NF-κB pathway, thereby maintaining metabolic homeostasis in the liver tissue.

  14. Global protein phosphorylation dynamics during deoxynivalenol-induced ribotoxic stress response in the macrophage

    SciTech Connect

    Pan, Xiao; Whitten, Douglas A.; Wu, Ming; Chan, Christina; Wilkerson, Curtis G.; Pestka, James J.

    2013-04-15

    Deoxynivalenol (DON), a trichothecene mycotoxin produced by Fusarium that commonly contaminates food, is capable of activating mononuclear phagocytes of the innate immune system via a process termed the ribotoxic stress response (RSR). To encapture global signaling events mediating RSR, we quantified the early temporal (≤ 30 min) phosphoproteome changes that occurred in RAW 264.7 murine macrophage during exposure to a toxicologically relevant concentration of DON (250 ng/mL). Large-scale phosphoproteomic analysis employing stable isotope labeling of amino acids in cell culture (SILAC) in conjunction with titanium dioxide chromatography revealed that DON significantly upregulated or downregulated phosphorylation of 188 proteins at both known and yet-to-be functionally characterized phosphosites. DON-induced RSR is extremely complex and goes far beyond its prior known capacity to inhibit translation and activate MAPKs. Transcriptional regulation was the main target during early DON-induced RSR, covering over 20% of the altered phosphoproteins as indicated by Gene Ontology annotation and including transcription factors/cofactors and epigenetic modulators. Other biological processes impacted included cell cycle, RNA processing, translation, ribosome biogenesis, monocyte differentiation and cytoskeleton organization. Some of these processes could be mediated by signaling networks involving MAPK-, NFκB-, AKT- and AMPK-linked pathways. Fuzzy c-means clustering revealed that DON-regulated phosphosites could be discretely classified with regard to the kinetics of phosphorylation/dephosphorylation. The cellular response networks identified provide a template for further exploration of the mechanisms of trichothecenemycotoxins and other ribotoxins, and ultimately, could contribute to improved mechanism-based human health risk assessment. - Highlights: ► Mycotoxin deoxynivalenol (DON) induces immunotoxicity via ribotoxic stress response. ► SILAC phosphoproteomics using

  15. Zinc protects HepG2 cells against the oxidative damage and DNA damage induced by ochratoxin A

    SciTech Connect

    Zheng, Juanjuan; Zhang, Yu; Xu, Wentao; Luo, YunBo; Hao, Junran; Shen, Xiao Li; Yang, Xuan; Li, Xiaohong; Huang, Kunlun

    2013-04-15

    Oxidative stress and DNA damage are the most studied mechanisms by which ochratoxin A (OTA) induces its toxic effects, which include nephrotoxicity, hepatotoxicity, immunotoxicity and genotoxicity. Zinc, which is an essential trace element, is considered a potential antioxidant. The aim of this paper was to investigate whether zinc supplement could inhibit OTA-induced oxidative damage and DNA damage in HepG2 cells and the mechanism of inhibition. The results indicated that that exposure of OTA decreased the intracellular zinc concentration; zinc supplement significantly reduced the OTA-induced production of reactive oxygen species (ROS) and decrease in superoxide dismutase (SOD) activity but did not affect the OTA-induced decrease in the mitochondrial membrane potential (Δψ{sub m}). Meanwhile, the addition of the zinc chelator N,N,N′,N′-tetrakis(2-pyridylmethyl)ethylenediamine (TPEN) strongly aggravated the OTA-induced oxidative damage. This study also demonstrated that zinc helped to maintain the integrity of DNA through the reduction of OTA-induced DNA strand breaks, 8-hydroxy-2′-deoxyguanosine (8-OHdG) formation and DNA hypomethylation. OTA increased the mRNA expression of metallothionein1-A (MT1A), metallothionein2-A (MT2A) and Cu/Zn superoxide dismutase (SOD1). Zinc supplement further enhanced the mRNA expression of MT1A and MT2A, but it had no effect on the mRNA expression of SOD1 and catalase (CAT). Zinc was for the first time proven to reduce the cytotoxicity of OTA through inhibiting the oxidative damage and DNA damage, and regulating the expression of zinc-associated genes. Thus, the addition of zinc can potentially be used to reduce the OTA toxicity of contaminated feeds. - Highlights: ► OTA decreased the intracellular zinc concentration. ► OTA induced the formation of 8-OHdG in HepG2 cells. ► It was testified for the first time that OTA induced DNA hypomethylation. ► Zinc protects against the oxidative damage and DNA damage induced by

  16. Deltamethrin-induced oxidative stress and mitochondrial caspase-dependent signaling pathways in murine splenocytes.

    PubMed

    Kumar, Anoop; Sasmal, D; Bhaskar, Amand; Mukhopadhyay, Kunal; Thakur, Aman; Sharma, Neelima

    2016-07-01

    Deltamethrin (DLM) is a well-known pyrethroid insecticide used extensively in pest control. Exposure to DLM has been demonstrated to cause apoptosis in various cells. However, the immunotoxic effects of DLM on mammalian system and its mechanism is still an open question to be explored. To explore these effects, this study has been designed to first observe the interactions of DLM to immune cell receptors and its effects on the immune system. The docking score revealed that DLM has strong binding affinity toward the CD45 and CD28 receptors. In vitro study revealed that DLM induces apoptosis in murine splenocytes in a concentration-dependent manner. The earliest markers of apoptosis such as enhanced reactive oxygen species and caspase 3 activation are evident as early as 1 h by 25 and 50 µM DLM. Western blot analysis demonstrated that p38 MAP kinase and Bax expression is increased in a concentration-dependent manner, whereas Bcl 2 expression is significantly reduced after 3 h of DLM treatment. Glutathione depletion has been also observed at 3 and 6 h by 25 and 50 µM concentration of DLM. Flow cytometry results imply that the fraction of hypodiploid cells has gradually increased with all the concentrations of DLM at 18 h. N-acetyl cysteine effectively reduces the percentage of apoptotic cells, which is increased by DLM. In contrast, buthionine sulfoxamine causes an elevation in the percentage of apoptotic cells. Phenotyping data imply the effect of DLM toxicity in murine splenocytes. In brief, the study demonstrates that DLM causes apoptosis through its interaction with CD45 and CD28 receptors, leading to oxidative stress and activation of the mitochondrial caspase-dependent pathways which ultimately affects the immune functions. This study provides mechanistic information by which DLM causes toxicity in murine splenocytes. © 2014 Wiley Periodicals, Inc. Environ Toxicol 31: 808-819, 2016.

  17. Oxidative damage of hepatopancreas induced by pollution depresses humoral immunity response in the freshwater crayfish Procambarus clarkii.

    PubMed

    Wei, Keqiang; Yang, Junxian

    2015-04-01

    Previous studies provide evidences for the possible oxidative damage of toxic environmental pollutants to tissue protein in fish and amphibian, but little information is available about their effects on immunity response in crustacean. In the present study, we evaluated the relationship between oxidative damage and immune response induced by both typical pollutants (viz. copper and beta-cypermethrin), by exposing the freshwater Procambarus clarkii to sub-lethal concentrations (1/40, 1/20, 1/10 and 1/5 of the 96 h LC50) up to 96 h. Five biomarkers of oxidative stress, i.e. reactive oxygen species (ROS), superoxide dismutase (SOD), catalase (CAT), malondialdehyde (MDA) and protein carbonyl in hepatopancreas, and two immune factors, i.e. phenoloxidase (PO) and hemocyanin in haemolymph were determined. The results indicated that there was a significant increase (P < 0.05) in the contents of ROS, MDA and protein carbonyl accompanied by markedly decreased (P < 0.05) PO and hemocyanin levels in a dose and time dependent manner. The significant and positive correlation (P < 0.01) between protein carbonyls induction and MDA formation was observed in crayfish hepatopancreas at 96 h. The production of these protein carbonyls could significantly depress (P < 0.01) the levels of phenoloxidase and hemocyanin in hemolymph. Higher contents of ROS enhanced the risk of lipid peroxidation, protein carbonylation and immunosuppression of crayfish, and hepatopancreas might play an important role in immune system of crustaceans. Protein oxidation may be one of the main mechanisms for pollution-induced immunotoxicity in P. clarkii.

  18. Effects of T-2 toxin on turkey herpesvirus–induced vaccinal immunity against Marek’s disease

    USDA-ARS?s Scientific Manuscript database

    T-2 toxin, a very potent immunotoxic Type A trichothecene, is a secondary metabolite produced primarily by Fusarium spp., which grows on cereal grains and can lead to contaminated livestock feed. Repeated exposure to T-2 toxin has been shown to cause immunosuppression and decrease the resistance of ...

  19. CYP1A2 IS NOT REQUIRED FOR 2, 3, 7, 8-TETRACHLORODIBENZO-P-DIOXIN-INDUCED IMMUNOSUPPRESSION

    EPA Science Inventory

    ABSTRACT
    One of the most sensitive and reproducible immunotoxic endpoints of 2,3,7,8-tetrachloro-dibenzo-p-dioxin (TCDD) exposure is suppression of the antibody response to sheep red blood cells (SRBCs) in mice. Immunosuppression occurs in concert with hepatomegaly and associ...

  20. CYP1A2 IS NOT REQUIRED FOR 2, 3, 7, 8-TETRACHLORODIBENZO-P-DIOXIN-INDUCED IMMUNOSUPPRESSION

    EPA Science Inventory

    ABSTRACT
    One of the most sensitive and reproducible immunotoxic endpoints of 2,3,7,8-tetrachloro-dibenzo-p-dioxin (TCDD) exposure is suppression of the antibody response to sheep red blood cells (SRBCs) in mice. Immunosuppression occurs in concert with hepatomegaly and associ...

  1. Inducements revisited.

    PubMed

    Wilkinson, Martin; Moore, Andrew

    1999-04-01

    The paper defends the permissibility of paying inducements to research subjects against objections not covered in an earlier paper in Bioethics. The objections are that inducements would cause inequity, crowd out research, and undesirably commercialize the researcher-subject relationship. The paper shows how these objections presuppose implausible factual and/or normative claims. The final position reached is a qualified defence of freedom of contract which not only supports the permissibility of inducements but also offers guidance to ethics committees in dealing with practical problems that might arise if inducements are offered.

  2. [Induced acne].

    PubMed

    Humbert, Philippe

    2002-04-15

    Induced acne belongs to the clinical forms of acne. Some dermatoses present with acne-like patterns. They can be induced or perpetuated by non physiological factors. Among these factors, medicines must always be considered, taken either topically (dermocorticoids, sulfur, anti-acneic topics) or generally (androgens, oral corticoids, ACTH, anti-epileptics, anti-depressive drugs, anti-tuberculosis medications). Halogens (iodine, bromine) found in inhaled or orally taken pharmaceutical products, or associated with occupational contact, can also induce acne. Acne of exogenous origin has been described in some specific occupations, and are induced by exposure to chlorine, industrial oils, tar. Sun exposure, PUVA therapy and ionizing radiation are potentially acneigenous. Finally acne caused by cosmetics includes acne cosmetica, brilliantine and oily creams acne and detergent acne.

  3. TESTING ANTIMICROBIAL CLEANER EFFICACY ON GYPSUM WALLBOARD CONTAMINATED WITH STACHYBOTRYS CHARTARUM

    EPA Science Inventory

    Reducing occupant exposure to indoor mold growth is the goal of this research, through the efficacy testing of antimicrobial cleaners. Often mold contaminated building materials are not properly removed, but instead surface cleaners are applied in an attempt to alleviate the prob...

  4. TESTING ANTIMICROBIAL PAINT EFFICACY ON GYPSUM WALLBOARD CONTAMINATED WITH STACHYBOTRYS CHARTARUM

    EPA Science Inventory

    Often mold contaminated building materials are not properly removed, some surface cleaning is performed and paint is applied in an attempt to alleviate the problem. The efficacy of antimicrobial paints to eliminate or control mold regrowth on surfaces can easily be tested on non-...

  5. TESTING ANTIMICROBIAL PAINT EFFICACY ON GYPSUM WALLBOARD CONTAMINATED WITH STACHYBOTRYS CHARTARUM

    EPA Science Inventory

    Often mold contaminated building materials are not properly removed, some surface cleaning is performed and paint is applied in an attempt to alleviate the problem. The efficacy of antimicrobial paints to eliminate or control mold regrowth on surfaces can easily be tested on non-...

  6. TESTING ANTIMICROBIAL CLEANER EFFICACY ON GYPSUM WALLBOARD CONTAMINATED WITH STACHYBOTRYS CHARTARUM

    EPA Science Inventory

    Reducing occupant exposure to indoor mold growth is the goal of this research, through the efficacy testing of antimicrobial cleaners. Often mold contaminated building materials are not properly removed, but instead surface cleaners are applied in an attempt to alleviate the prob...

  7. In Utero exposure to genistein enhanced intranasal house dust mite allergen-induced respiratory sensitization in young adult B6C3F1 mice.

    PubMed

    Guo, Tai L; Meng, Andrew H

    2016-06-24

    Despite many hypothesized benefits of dietary isoflavone genistein (GEN) deriving from soy-based products, questions surrounding GEN's developmental immunotoxic effects are increasing. To understand how in utero GEN exposure may modulate postnatal respiratory sensitization, we conducted a time course study using a common household allergen (house dust mites: HDM; 10μg/mouse) following intranasal instillation, a physiological route of allergen exposure. GEN was administered to dams by gavage from gestational day 14 to parturition at a physiologically relevant dose (20mg/kg bw). Female and male offspring were sensitized with HDM allergens beginning about one month prior to sacrifice followed by challenges with three weekly doses of HDM extracts, and they were euthanized at day 3 following the final HDM exposure at four different time points (postnatal day (PND) 80, 120, 160, and 200). In utero GEN combined with postnatal HDM exposures (GEN+HDM) increased total IgE production in both young female and male B6C3F1 offspring (e.g., PND 80 in females and PND 120 in males). Increased antigen-specific IgG1, IgG2a and IgG2b levels were also observed at various time points in both female and male offspring. In addition, increases in macrophage number in bronchoalveolar lavage fluid of both female and male GEN+HDM offspring at PND 80 and PND 120, respectively, were observed when compared to the vehicle group. For T cells, an increase over the vehicle in female GEN+HDM offspring was observed at PND 80. Due to similar patterns of increases, it seems likely that GEN+HDM-induced increases in total IgE and macrophages are related. Overall, in utero GEN plus later-life HDM exposures exert increases in total IgE and HDM-specific IgG production as well as macrophage recruitments to the lung in young adult mice.

  8. Tributyltin potentiates 3,3{prime},4,4{prime},5-pentachlorobiphenyl-induced cytochrome P-4501A-related activity

    SciTech Connect

    DeLong, G.T.; Rice, C.D.

    1997-10-01

    Induction of cytochrome P-4501A protein and induction of related enzyme activity are hallmark physiological responses following exposure to planar halogenated aromatic hydrocarbons (HAHs) such as 3,3{prime},4,4{prime},5-pentachlorobiphenyl (PCB 126; PeCB). Environments contaminated by HAHs are often contaminated by mixtures of anthropogenic contaminants, including organometallic compounds. Both HAHs and organometallics easily bioconcentrate in aquatic food chains that may be linked to humans through seafood consumption. Tributyltin (TBT), a marine biocide, has been detected in many aquatic environments. Exposure to TBT, as well as several PCBs, has been associated with immunotoxicity, neurotoxicity, and endocrine disruption. Recently TBT has been shown to inhibit cytochrome P-4501A activity in vitro. Female mice were exposed to 0.07, 0.1, and 1.0 mg/kg PeCB, TBT or both. P-4501A levels and BaP-OHase activity were significantly elevated in mice exposed to PeCB alone. This effect was enhanced by coexposure to low levels of TBT; PeCB-induced P-4501A-related activity was potentiated at the low range of each. The highest dose of TBT, however, inhibited these activities when given in combination with PeCB. Thymic atrophy was evident only in mice exposed daily to 0.1 and 1.0 mg/kg PeCB alone, or to a combination of the lowest and highest dose of PeCB and TBT, respectively. Because environmental levels of. TBT are not expected to be as high as the highest level used in our toxicological studies, we conclude that environmental exposure to TBT may potentiate, rather than inhibit, the activity of environmental levels of HAHs that are associated with P-4501A induction. 31 refs., 8 figs.

  9. Inducing labor

    MedlinePlus

    ... inducing labor is to "break the bag of waters" or rupture the membranes. Your health care provider will do a pelvic exam and will guide a small plastic probe with a hook on the end through your cervix to create a hole in the membrane. This does not hurt you ...

  10. Inducing autophagy

    PubMed Central

    Harder, Lea M; Bunkenborg, Jakob; Andersen, Jens S

    2014-01-01

    Autophagy is a lysosomal-mediated catabolic process, which through degradation of different cytoplasmic components aids in maintaining cellular homeostasis and survival during exposure to extra- or intracellular stresses. Ammonia is a potential toxic and stress-inducing byproduct of glutamine catabolism, which has recently been found to induce autophagy in an MTOR independent way and support cancer cell survival. In this study, quantitative phosphoproteomics was applied to investigate the initial signaling events linking ammonia to the induction of autophagy. The MTOR inhibitor rapamycin was used as a reference treatment to emphasize the differences between an MTOR-dependent and -independent autophagy-induction. By this means 5901 phosphosites were identified of which 626 were treatment-specific regulated and 175 were coregulated. Investigation of the ammonia-specific regulated sites supported that MTOR activity was not affected, but indicated increased MAPK3 activity, regulation of proteins involved in Rho signal transduction, and a novel phosphorylation motif, serine-proline-threonine (SPT), which could be linked to cytoskeleton-associated proteins. MAPK3 could not be identified as the primary driver of ammonia-induced autophagy but instead the data suggested an upregulation of AMPK and the unfolded protein response (UPR), which might link ammonia to autophagy induction. Support of UPR induction was further obtained from the finding of increased protein levels of the ER stress markers DDIT3/CHOP and HSPA5 during ammonia treatment. The large-scale data set presented here comprises extensive high-quality quantitative information on phosphoprotein regulation in response to 2 very different autophagy inducers and should therefore be considered a general resource for the community. PMID:24300666

  11. NKT cell modulates NAFLD potentiation of metabolic oxidative stress-induced mesangial cell activation and proximal tubular toxicity

    PubMed Central

    Alhasson, Firas; Dattaroy, Diptadip; Das, Suvarthi; Chandrashekaran, Varun; Seth, Ratanesh Kumar; Schnellmann, Rick G.

    2015-01-01

    Obesity and nonalcoholic fatty liver disease (NAFLD) are associated with the development and progression of chronic kidney disease. We recently showed that NAFLD induces liver-specific cytochrome P-450 (CYP)2E1-mediated metabolic oxidative stress after administration of the CYP2E1 substrate bromodichloromethane (BDCM) (Seth RK, Das S, Kumar A, Chanda A, Kadiiska MB, Michelotti G, Manautou J, Diehl AM, Chatterjee S. Toxicol Appl Pharmacol 274: 42–54, 2014; Seth RK, Kumar A, Das S, Kadiiska MB, Michelotti G, Diehl AM, Chatterjee S. Toxicol Sci 134:291–303, 2013). The present study examined the effects of CYP2E1-mediated oxidative stress in NAFLD leading to kidney toxicity. Mice were fed a high-fat diet for 12 wk to induce NAFLD. NAFLD mice were exposed to BDCM, a CYP2E1 substrate, for 4 wk. NAFLD + BDCM increased CYP2E1-mediated lipid peroxidation in proximal tubular cells compared with mice with NAFLD alone or BDCM-treated lean mice, thus ruling out the exclusive role of BDCM. Lipid peroxidation increased IL-1β, TNF-α, and interferon-γ. In parallel, mesangial cell activation was observed by increased α-smooth muscle actin and transforming growth factor-β, which was blocked by the CYP2E1 inhibitor diallyl sulphide both in vivo and in vitro. Mice lacking natural killer T cells (CD1d knockout mice) showed elevated (>4-fold) proinflammatory mediator release, increased Toll-like receptor (TLR)4 and PDGF2 mRNA, and mesangial cell activation in the kidney. Finally, NAFLD CD1D knockout mice treated with BDCM exhibited increased high mobility group box 1 and Fas ligand levels and TUNEL-positive nuclei, indicating that higher cell death was attenuated in TLR4 knockout mice. Tubular cells showed increased cell death and cytokine release when incubated with activated mesangial cells. In summary, an underlying condition of progressive NAFLD causes renal immunotoxicity and aberrant glomerular function possibly through high mobility group box 1-dependent TLR4 signaling

  12. Exercise-Induced Bronchoconstriction

    MedlinePlus

    ... Conditions & Treatments ▸ Conditions Dictionary ▸ Exercise-Induced Bronchoconstriction Share | Exercise-Induced Bronchoconstriction (EIB) « Back to A to Z Listing Exercise-Induced Bronchoconstriction, (EIB), often known as exercise-induced ...

  13. Exercise-Induced Asthma

    MedlinePlus

    ... Your 1- to 2-Year-Old Exercise-Induced Asthma KidsHealth > For Parents > Exercise-Induced Asthma Print A ... previous continue Tips for Kids With Exercise-Induced Asthma For the most part, kids with exercise-induced ...

  14. Isocyanates induces DNA damage, apoptosis, oxidative stress, and inflammation in cultured human lymphocytes.

    PubMed

    Mishra, Pradyumna Kumar; Panwar, Hariom; Bhargava, Arpit; Gorantla, Venkata Raghuram; Jain, Subodh Kumar; Banerjee, Smita; Maudar, Kewal Krishan

    2008-01-01

    Isocyanates, a group of low molecular weight aromatic and aliphatic compounds containing the isocyanate group (-NCO), are important raw materials with diverse industrial applications; however, pathophysiological implications resulting from occupational and accidental exposures of these compounds are hitherto unknown. Although preliminary evidence available in the literature suggests that isocyanates and their derivatives may have deleterious health effects including immunotoxicity, but molecular mechanisms underlying such an effect have never been addressed. The present study was carried out to assess the immunotoxic response of methyl isocyanate (MIC) on cultured human lymphocytes isolated from healthy human volunteers. Studies were conducted to evaluate both dose-dependent and time-course response (n = 3), using N-succinimidyl N-methylcarbamate, a surrogate chemical substitute to MIC. Evaluation of DNA damage by ataxia telangiectasia mutated (ATM) and gamma H2AX protein phosphorylation states; measure of apoptotic index through annexin-V/PI assay, apoptotic DNA ladder assay, and mitochondrial depolarization; induction of oxidative stress by CM-H2DCFDA and formation of 8-hydroxy-2' deoxy guanosine; levels of antioxidant defense system enzyme glutathione reductase; and multiplex cytometric bead array analysis to quantify the secreted levels of inflammatory cytokines, interleukin-8, interleukin-1beta, interleukin-6, interleukin-10, tumor necrosis factor, and interleukin-12p70 parameters were carried out. The results of the study showed a dose- and time-dependent response, providing evidence to hitherto unknown molecular mechanisms of immunotoxic consequences of isocyanate exposure at a genomic level. We anticipate these data along with other studies reported in the literature would help to design better approaches in risk assessment of occupational and accidental exposure to isocyanates.

  15. Avermectin induced autophagy in pigeon spleen tissues.

    PubMed

    Liu, Ci; Zhao, Yanbing; Chen, Lijie; Zhang, Ziwei; Li, Ming; Li, Shu

    2015-12-05

    The level of autophagy is considered as an indicator for monitoring the toxic impact of pesticide exposure. Avermectin (AVM), a widely used insecticide, has immunotoxic effects on the pigeon spleen. The aim of this study was to investigate the status of autophagy and the expression levels of microtubule-associated protein1 light chain 3 (LC3), beclin-1, dynein, autophagy associated gene (Atg) 4B, Atg5, target of rapamycin complex 1 (TORC1) and target of rapamycin complex 2 (TORC2) in AVM-treated pigeon spleens. Eighty two-month-old pigeons were randomly divided into four groups: a control group, a low-dose group, a medium-dose group and a high-dose group, which were fed a basal diet spiked with 0, 20, 40 and 60 mg AVM/kg diet, respectively. Microscopic cellular morphology revealed a significant increase in autophagic structures in the AVM-treated groups. The expression of LC3, beclin-1, dynein, Atg4B and Atg5 increased, while mRNA levels of TORC1 and TORC2 were decreased in the AVM-treated groups relative to the control groups at 30, 60 and 90 days in the pigeon spleen. These results indicated that AVM exposure could up-regulate the level of autophagy in a dose-time-dependent manner in the pigeon spleen.

  16. COMPARING IMMUNOTOXICITY IN RATS AFTER IN UTERO VERSUS AN ADULT EXPOSURE: IS DEVELOPMENTAL EXPOSURE MORE SENSITIVE?

    EPA Science Inventory

    Using a known immunosuppresant, dexamethasone (DEX), pregnant Sprague Dawley (SD) rats were given subcutaneous (s.c.) injections of DEX (0.0, 0.0375, 0.075, 0.15, 0.3 mg/kg) during gestation days 6 to 21. Both male and female offspring were tested for immune dysfunction. In a ...

  17. THE COMPARATIVE IMMUNOTOXICITY OF FIVE SELCTED COMPOUNDS FOLLOWING DEVELOPMENTAL OR ADULT EXPOSURE

    EPA Science Inventory

    It is well established that human diseases associated with abnormal immune function, including some common infectious diseases and asthma, are considerably more prevalent at younger ages. Although not established absolutely, it is generally believed that development constitutes ...

  18. Immunotoxicity of commercial-mixed glyphosate in broad snouted caiman (Caiman latirostris).

    PubMed

    Siroski, Pablo A; Poletta, Gisela L; Latorre, María A; Merchant, Mark E; Ortega, Hugo H; Mudry, Marta D

    2016-01-25

    The expansion and intensification of agriculture during the past 50 years is unprecedented, and thus environmental problems have been triggered at different scales. These transformations have caused the loss of habitat and biodiversity, and disruption of the structure and functioning of ecosystems. As a result of the expansion of the agricultural frontier in the recent past, many areas of the natural geographic distribution of the local wildlife, among them crocodilians and particularly the broad snouted caiman (Caiman latirostris), are being exposed to contaminants. The present study was designed to evaluate the effect of commercially-mixed glyphosate (RU) on some parameters of the immune system of C. latirostris. Two groups of caimans were exposed for two months to different concentrations of RU recommended for its application in the field, while one group was maintained as an unexposed control. The RU concentration was progressively decreased through the exposure period to simulate glyphosate degradation in water. After exposure, total and differential white blood cell (WBC), and complement system activity (CS) were determined. In addition, the animals were injected with a solution of lipopolysaccharide (LPS) from Escherichia coli to trigger an immune response and evaluate the parameters associated with it. The results showed that an effect of the herbicide on CS was observed, as animals exposed to RU showed a lower CS activity than animals from the negative control (NC) but not in total WBC. In the case of leukocyte population counts, differences were only found for heterophils and lymphocytes.

  19. Ecological impacts of the Deepwater Horizon oil spill: implications for immunotoxicity

    EPA Science Inventory

    Summary of major Federal and multi-stake holder research efforts in response to the DWH spill, including laboratory oil dispersant testing, estimation of oil release rates and oil fate calculations, subsea monitoring, and post-spill assessments. Impacts from shoreline oiling, wil...

  20. Carcinogenicity and Immunotoxicity of Embedded Depleted Uranium and Heavy-Metal Tungsten Alloy in Rodents

    DTIC Science & Technology

    2006-10-01

    Interstitial cell tumor (testes) Figure 21 Chronic nodular granulomatous steatitis Figure 22 Malignant pheochromocytoma (24 month DU high-dose rat...Malignant pheochromocytoma (24 month DU high-dose rat) Figure 23. Renal tubular carcinoma (24 month DU high-dose rat) Figure...metal Health Concerns about Military Use of DU and DU Surrogate Metals 21–20 NATO RTG-099 2005 cations, Journal of General Physiology 49: 937-961

  1. Exploratory behavior and recognition memory in medial septal electrolytic, neuro- and immunotoxic lesioned rats.

    PubMed

    Dashniani, M G; Burjanadze, M A; Naneishvili, T L; Chkhikvishvili, N C; Beselia, G V; Kruashvili, L B; Pochkhidze, N O; Chighladze, M R

    2015-01-01

    In the present study, the effect of the medial septal (MS) lesions on exploratory activity in the open field and the spatial and object recognition memory has been investigated. This experiment compares three types of MS lesions: electrolytic lesions that destroy cells and fibers of passage, neurotoxic - ibotenic acid lesions that spare fibers of passage but predominantly affect the septal noncholinergic neurons, and immunotoxin - 192 IgG-saporin infusions that only eliminate cholinergic neurons. The main results are: the MS electrolytic lesioned rats were impaired in habituating to the environment in the repeated spatial environment, but rats with immuno- or neurotoxic lesions of the MS did not differ from control ones; the MS electrolytic and ibotenic acid lesioned rats showed an increase in their exploratory activity to the objects and were impaired in habituating to the objects in the repeated spatial environment; rats with immunolesions of the MS did not differ from control rats; electrolytic lesions of the MS disrupt spatial recognition memory; rats with immuno- or neurotoxic lesions of the MS were normal in detecting spatial novelty; all of the MS-lesioned and control rats clearly reacted to the object novelty by exploring the new object more than familiar ones. Results observed across lesion techniques indicate that: (i) the deficits after nonselective damage of MS are limited to a subset of cognitive processes dependent on the hippocampus, (ii) MS is substantial for spatial, but not for object recognition memory - the object recognition memory can be supported outside the septohippocampal system; (iii) the selective loss of septohippocampal cholinergic or noncholinergic projections does not disrupt the function of the hippocampus to a sufficient extent to impair spatial recognition memory; (iv) there is dissociation between the two major components (cholinergic and noncholinergic) of the septohippocampal pathway in exploratory behavior assessed in the open field - the memory exhibited by decrements in exploration of repeated object presentations is affected by either electrolytic or ibotenic lesions, but not saporin.

  2. Approaches and Considerations for the Assessment of Immunotoxicity for Environmental Chemicals: A Workshop Summary

    EPA Science Inventory

    As additional experience is gained with current toxicology testing approaches and as new assays and technologies are developed, it is critical for all stakeholders to engage in active dialog about potential opportunities to advance our overall testing strategies. To facilitate t...

  3. INTRODUCTION: INHALATION EXPOSURE AND SYSTEMIC IMMUNOTOXICITY: MECHANISMS LINKING THE LUNG AND IMMUNE SYSTEM

    EPA Science Inventory


    Concerns regarding inhaled compounds, immune suppression and increased risk of disease have focused primarily on suppression of local immune responses in the lung and susceptibility to respiratory infections. However, a number of studies have shown that both gaseous (O3, NO2)...

  4. The effect of diesel (DE) exposure in utero on reproductive and developmental immunotoxicity

    EPA Science Inventory

    Epidemiology studies are beginning to show that in utero exposure to traffic related pollutants might increase the incidence of immune mediated lung diseases. Time pregnant BALB/c mice were exposed to air or two concentrations of diesel exhaust (0.5 and 2 mg/m3...

  5. Antibody-mediated immunotoxicity in American kestrels (Falco sparverius) exposed to polychlorinated biphenyls.

    PubMed

    Smits, J E; Bortolotti, G R

    2001-02-23

    Antibody-mediated immune function in adult and recently fledged (30 to 33 d old) American kestrels (Falco sparverius) was examined in birds exposed directly, or only in ovo, to polychlorinated biphenyls (PCBs). In 1998, 9 mature male and 9 female kestrels were fed PCBs, whereas 9 females and 10 males served as controls. A mixture of Aroclors 1248:1254:1260 suspended in safflower oil was injected into the kestrels' food items, while in control diets only the same volume of oil was added. The dosage of PCBs was approximately 7 mg/kg kestrel/d, beginning in March 1998 and continuing for 120 d. In 1998, the antibody-mediated immune response was stimulated by immunization and booster vaccinations of the kestrels using a nonpathogenic antigen, dinitrophenol-keyhole limpet hemocyanin (DNP-KLH). In 1999, offspring from three treatment groups based upon maternal exposure to PCBs were similarly tested for their antibody response. None of these mothers was vaccinated with DNP-KLH the previous year. The maternal groups were: (1) exposed to PCBs in 1998 for 120 d, (2) exposed in ovo in 1998 (i.e., mothers were produced by PCB-exposed parents), or (3) unexposed to PCBs. Serum antibody levels were determined using an enzyme-linked immunosorbent assay (ELISA). In 1998, PCB-exposed adult females had a significantly higher antibody response than did controls, whereas adult males exposed to PCBs had significantly suppressed antibody production. For the nestlings produced in 1999, maternal treatment significantly affected antibody response. Generally, the antibody response in the nestlings was much lower than that seen in adult kestrels. Yet both male and female offspring from mothers that had been fed PCBs the previous year had significantly higher postbooster anti-DNP-KLH titers than control and in ovo-exposed maternal groups, thus mimicking the response seen in the adult females the previous year. These sex-specific responses in PCB-exposed birds provide further evidence of the endocrine-disrupting behavior of PCBs. Both suppression and stimulation of the antibody response are undesirable because this indicates that the immune system is not able to respond normally to challenges by infectious or other disease-causing agents.

  6. Carcinogenicity and Immunotoxicity of Embedded Depleted Uranium and Heavy-Metal Tungsten Alloy in Rodents

    DTIC Science & Technology

    2006-10-01

    tumorigenic phenotype by heavy - metal tungsten-alloy metals : induction of genotoxic effects . Carcinogenesis 22:115–125. Miller AC, Xu J, Prasanna PGS...Page N. 2002. Potential late health effects of the heavy metals , depleted uranium and tungsten, used in armor piercing munitions: comparison of...Embedded Depleted Uranium and Heavy - Metal Tungsten Alloy in Rodents PRINCIPAL INVESTIGATOR: John F. Kalinich, Ph.D

  7. The impact of nanoparticle protein corona on cytotoxicity, immunotoxicity and target drug delivery

    PubMed Central

    Corbo, Claudia; Molinaro, Roberto; Parodi, Alessandro; Toledano Furman, Naama E; Salvatore, Francesco; Tasciotti, Ennio

    2016-01-01

    In a perfect sequence of events, nanoparticles (NPs) are injected into the bloodstream where they circulate until they reach the target tissue. The ligand on the NP surface recognizes its specific receptor expressed on the target tissue and the drug is released in a controlled manner. However, once injected in a physiological environment, NPs interact with biological components and are surrounded by a protein corona (PC). This can trigger an immune response and affect NP toxicity and targeting capabilities. In this review, we provide a survey of recent findings on the NP–PC interactions and discuss how the PC can be used to modulate both cytotoxicity and the immune response as well as to improve the efficacy of targeted delivery of nanocarriers. PMID:26653875

  8. DEVELOPMENTAL EXPOSURE TO DI-N-BUTYLTIN DICHLORIDE (DBTC): IMMUNOTOXIC AND NEUROTOXIC EVALUATION

    EPA Science Inventory

    Organotins are incorporated as stabilizers in PVC water supply pipe. Particularly when new, mono- and di-substituted methyl- and butyltins leach from the pipe and are thus of regulatory concern to EPA. These contaminants have adverse effects on both the immune and nervous systems...

  9. THE COMPARATIVE IMMUNOTOXICITY OF FIVE SELCTED COMPOUNDS FOLLOWING DEVELOPMENTAL OR ADULT EXPOSURE

    EPA Science Inventory

    It is well established that human diseases associated with abnormal immune function, including some common infectious diseases and asthma, are considerably more prevalent at younger ages. Although not established absolutely, it is generally believed that development constitutes ...

  10. Immunotoxicity of perfluorinated alkylates: calculation of benchmark doses based on serum concentrations in children.

    PubMed

    Grandjean, Philippe; Budtz-Jørgensen, Esben

    2013-04-19

    Immune suppression may be a critical effect associated with exposure to perfluorinated compounds (PFCs), as indicated by recent data on vaccine antibody responses in children. Therefore, this information may be crucial when deciding on exposure limits. Results obtained from follow-up of a Faroese birth cohort were used. Serum-PFC concentrations were measured at age 5 years, and serum antibody concentrations against tetanus and diphtheria toxoids were obtained at age 7 years. Benchmark dose results were calculated in terms of serum concentrations for 431 children with complete data using linear and logarithmic curves, and sensitivity analyses were included to explore the impact of the low-dose curve shape. Under different linear assumptions regarding dose-dependence of the effects, benchmark dose levels were about 1.3 ng/mL serum for perfluorooctane sulfonic acid and 0.3 ng/mL serum for perfluorooctanoic acid at a benchmark response of 5%. These results are below average serum concentrations reported in recent population studies. Even lower results were obtained using logarithmic dose-response curves. Assumption of no effect below the lowest observed dose resulted in higher benchmark dose results, as did a benchmark response of 10%. The benchmark dose results obtained are in accordance with recent data on toxicity in experimental models. When the results are converted to approximate exposure limits for drinking water, current limits appear to be several hundred fold too high. Current drinking water limits therefore need to be reconsidered.

  11. Development of a squamous cell carcinoma mouse model for immunotoxicity testing.

    PubMed

    Sominski, Devon D; Rafferty, Patricia; Brosnan, Kerry; Volk, Amy; Walker, Mindi; Capaldi, Dorie; Emmell, Eva; Johnson, Kjell; Weinstock, Daniel

    2016-01-01

    An important component of safety assessment of new pharmaceuticals is evaluation of their potential to increase the risk of developing cancer in humans. The traditional 2-year rodent bioassay often is not feasible or scientifically applicable for evaluation of biotherapeutics. Additionally, it has poor predictive value for non-genotoxic immunosuppressive compounds. Thus, there is a need for alternative testing strategies. A novel 3-stage tumor model in syngeneic C3H/HeN mice was evaluated here to study the effects of immunosuppressive drugs on tumor promotion and progression in vivo. The model employed a skin squamous cell carcinoma cell line (SCC VII) due to the increased prevalence of squamous cell carcinoma (SCC) in humans associated with immunosuppression after transplants. Local invasion, colonization and tumor progression were evaluated. The validation set of immunosuppressive drugs included: Cyclosporin (CSA), cyclophosphamide (CTX), azathioprine, etanercept, abatacept and prednisone. Local invasion was evaluated by histological assessment as well as fluorescence trafficking from Qdot(®)-labeled tumor cells from the site of inoculation to the draining lymph node. Colonization was evaluated by lung colony counts following intravenous inoculation. Tumor progression was assessed by morphometric analysis of lesion area, angiogenesis and growth fraction of established metastatic neoplasia. Immunosuppressive drugs in the validation set yielded mixed results, including decreased progression. The methods and results described herein using an in vivo syngeneic mouse tumor model can provide insight about the assessment of immunosuppressive drugs in carcinogenicity risk assessment.

  12. COMPARING IMMUNOTOXICITY IN RATS AFTER IN UTERO VERSUS AN ADULT EXPOSURE: IS DEVELOPMENTAL EXPOSURE MORE SENSITIVE?

    EPA Science Inventory

    Using a known immunosuppresant, dexamethasone (DEX), pregnant Sprague Dawley (SD) rats were given subcutaneous (s.c.) injections of DEX (0.0, 0.0375, 0.075, 0.15, 0.3 mg/kg) during gestation days 6 to 21. Both male and female offspring were tested for immune dysfunction. In a ...

  13. INTRODUCTION: INHALATION EXPOSURE AND SYSTEMIC IMMUNOTOXICITY: MECHANISMS LINKING THE LUNG AND IMMUNE SYSTEM

    EPA Science Inventory


    Concerns regarding inhaled compounds, immune suppression and increased risk of disease have focused primarily on suppression of local immune responses in the lung and susceptibility to respiratory infections. However, a number of studies have shown that both gaseous (O3, NO2)...

  14. THE DEVELOPMENTAL IMMUNOTOXICITY OF DIBUTYLTIN DICHLORIDE IN SPRAGUE-DAWLEY RATS

    EPA Science Inventory

    Methyl- and butyltin compounds used as stabilizers in polyvinyl chloride (PVC) pipe production are of concern as they leach from supply pipes into drinking water and have been associated with multisystem toxicity. This study assessed immune function in Sprague-Dawley (CD) rats d...

  15. THE DEVELOPMENTAL IMMUNOTOXICITY OF DIBUTYLTIN DICHLORIDE IN SPRAGUE-DAWLEY RATS

    EPA Science Inventory

    Methyl- and butyltin compounds used as stabilizers in polyvinyl chloride (PVC) pipe production are of concern as they leach from supply pipes into drinking water and have been associated with multisystem toxicity. This study assessed immune function in Sprague-Dawley (CD) rats d...

  16. DEVELOPMENTAL EXPOSURE TO DI-N-BUTYLTIN DICHLORIDE (DBTC): IMMUNOTOXIC AND NEUROTOXIC EVALUATION

    EPA Science Inventory

    Organotins are incorporated as stabilizers in PVC water supply pipe. Particularly when new, mono- and di-substituted methyl- and butyltins leach from the pipe and are thus of regulatory concern to EPA. These contaminants have adverse effects on both the immune and nervous systems...

  17. From immunotoxicity to nanotherapy: the effects of nanomaterials on the immune system.

    PubMed

    Smith, Matthew J; Brown, Jared M; Zamboni, William C; Walker, Nigel J

    2014-04-01

    The potential for human exposure to the diverse and ever-changing world of nanoscale materials has raised concerns about their influence on health and disease. The novel physical and chemical properties of these materials, which are associated with their small size, complicate toxicological evaluations. Further, these properties may make engineered nanomaterials (ENMs) a prime target for interaction with the immune system following uptake by phagocytes. Undesired effects on antigen-presenting cells and other phagocytic cells are of concern due to the high likelihood of ENM uptake by these cells. In addition, ENM interactions with lymphocytes and other cell types can contribute to a varied spectrum of possible effects, including inflammation, hypersensitivity, and immunomodulation. Furthermore, the mast cell (a type of immune cell traditionally associated with allergy) appears to contribute to certain inflammatory and toxic effects associated with some ENMs. Although incidental exposure may be undesirable, nanomedicines engineered for various clinical applications provide opportunities to develop therapies that may or may not intentionally target the immune system. The interaction between ENMs and the immune system and the resulting pharmacokinetic and phenotypic responses are critical factors that dictate the balance between toxicity and clinical efficacy of nanotherapeutics.

  18. Evaluation of the potential immunotoxicity of bromodichloromethane in rats and mice.

    PubMed

    French, A S; Copeland, C B; Andrews, D; Wiliams, W C; Riddle, M M; Luebke, R W

    1999-03-12

    In the past two decades, concern has been expressed over the potential carcinogenicity of disinfection by-products (DBPs) found in chlorinated drinking water. More recently, research efforts have expanded to include noncancer endpoints as well. The objective of the present studies was to evaluate the potential of bromodichloromethane (BDCM), one of the most prevalent DBPs, to adversely affect immune function in mice and rats following drinking water or gavage exposure. Antigen-specific immunity was assessed as the antibody response to sheep erythrocytes; responses to T- and B-cell mitogens were evaluated as a non-antigen-specific measure of the proliferative potential of splenic and mesenteric lymph node lymphocytes. In consideration of an exposure route relevant to humans, C57BL/6 mice received 0.05, 0.25, or 0.5 g BDCM/L and F344 rats received 0.07 or 0.7 g BDCM/L via drinking water. In order to evaluate the effects of higher doses, animals were administered 50, 125, or 250 mg BDCM/kg/d (mice) or 75, 150, or 300 mg BDCM/kg/d (rats) via gavage. Under the conditions of these studies, no significant adverse effects on immune function were observed in mice. Despite some changes that were observed in non-antigen-specific immunity in rats, these experiments suggest that the immune system is not a sensitive target organ for BDCM toxicity.

  19. Ecological impacts of the Deepwater Horizon oil spill: implications for immunotoxicity

    EPA Science Inventory

    Summary of major Federal and multi-stake holder research efforts in response to the DWH spill, including laboratory oil dispersant testing, estimation of oil release rates and oil fate calculations, subsea monitoring, and post-spill assessments. Impacts from shoreline oiling, wil...

  20. Immunotoxic effects of the color additive caramel color III: immune function studies in rats.

    PubMed

    Houben, G F; Penninks, A H; Seinen, W; Vos, J G; Van Loveren, H

    1993-01-01

    Administration of the color additive caramel color III (AC) may cause a reduction in total white blood cell counts in rats due to reduced lymphocyte counts. Beside lymphopenia, several other effects in rat have been described. The effects are caused by the imidazole derivative 2-acetyl-4(5)-(1,2,3,4-tetrahydroxybutyl)imidazole (THI) and occur in rats fed a diet low in vitamin B6. In the present paper, immune function studies on AC and THI with rats fed a diet low, but not deficient in vitamin B6 are presented and discussed. Rats were exposed to 0.4 or 4% AC or to 5.72 ppm THI in drinking water during and for 28 days prior to the start of immune function assays. Resistance to Trichinella spiralis was examined in an oral infection model and clearance of Listeria monocytogenes upon an intravenous infection was studied. In addition, natural cell-mediated cytotoxicity of splenic and nonadherent peritoneal cells and the antibody response to sheep red blood cells were studied. From the results it is concluded that exposure of rats to AC or THI influenced various immune function parameters. Thymus-dependent immunity was suppressed, while parameters of the nonspecific resistance were also affected, as shown by a decreased natural cell-mediated cytotoxicity in the spleen and an enhanced clearance of L. monocytogenes.

  1. Systemic immunotoxicity in AJ mice following 6-month whole body inhalation exposure to diesel exhaust.

    PubMed

    Burchiel, Scott W; Lauer, Fredine T; McDonald, Jacob D; Reed, Matthew D

    2004-05-01

    The purpose of these studies was to determine the effects of subchronic diesel exposure on indicators of systemic immunity in mice. AJ mice were exposed daily for 6 months (6 h/day) to atmospheres containing one of four concentrations (30, 100, 300, and 1000 microg/m(3)) of diluted diesel exhaust (DE) in whole body exposure chambers. The effects of DE were compared to chamber exposure controls receiving fresh air. DE was assessed for effects on systemic immunity by measuring the proliferative response of spleen cells following stimulation with T cell (phytohemagglutinin, or PHA) or B cell (lipopolysaccharide, or LPS) mitogens. The results showed that DE at all exposure levels suppressed the proliferative response of T cells. B cell proliferation was increased at 30 microg/m(3) and was unaffected at the 100, 300, and 1000 microg/m(3) exposures. Polycyclic aromatic hydrocarbons (PAHs) are known to suppress spleen cell mitogenic responses, and it has been hypothesized by several groups that PAHs and perhaps benzo(a)pyrene (BaP)-quinones (BPQs) may be responsible for the effects of DE or diesel exhaust particles (DEP). Therefore, a second purpose of these studies was to determine the effects of in vitro BPQs on AJ mouse spleen cell mitogenic responses and compare to DE in preliminary studies. Unlike DE, BPQs were found to increase T cell proliferation. In addition, analysis of chamber atmospheres showed that there was little if any PAH and BPQs in DE. Therefore, these results demonstrate that because of the absence of BPQs in DE, they are likely not responsible for the immunosuppressive effect of DE on murine spleen cell responses.

  2. A COMPARISON OF MULTIPLE TOXICITIES FOLLOWING DEVELOPMENTAL EXPOSURE TO PESTICIDES: NEUROTOXICITY, IMMUNOTOXICITY, AND REPRODUCTIVE TOXICITY.

    EPA Science Inventory

    The NAS report (Pesticides in the Diets of Infants and Children, 1993) called for significant research effort into the long-term effects of perinatal pesticide exposure on the nervous, immune, and reproductive systems. In response, the US EPA and NIEHS collaborated on a series o...

  3. Carcinogenicity and Immunotoxicity of Embedded Depleted Uranium and Heavy-Metal Tungsten Alloy in Rodents

    DTIC Science & Technology

    2006-10-01

    1990. Qualitative interfacial study between bone and tantalum , niobium or commercially pure titanium. Biomaterials 11:277–280. Kasprzak KS, Gabryel P...alloy (WA) consisting of tungsten, nickel, and cobalt. Male Fisher 344 rats were surgically implanted with pellets of DU, WA, tantalum (inert metal...subtypes of rhabdomyosarcomas. Eventually these tumors metastasized to the lung. Rats implanted with tantalum or DU pellets did not develop tumors at

  4. Approaches and Considerations for the Assessment of Immunotoxicity for Environmental Chemicals: A Workshop Summary

    EPA Science Inventory

    As additional experience is gained with current toxicology testing approaches and as new assays and technologies are developed, it is critical for all stakeholders to engage in active dialog about potential opportunities to advance our overall testing strategies. To facilitate t...

  5. [The effect of unithiol on the changes in immunotoxicity of 2-chloroethenylchloroarsine].

    PubMed

    Zabrodskiĭ, P F; Germanchuk, V G; Nodel', M L

    2002-01-01

    The results of experiments on Wistar rats under conditions of acute intoxication with 2-chloroethenyldichloroarsine (beta-chlorovinyldichloroarsine) (0.75 LD50) showed that unithiol increases antiinfectious nonspecific resistance (NSR) of the organism. This is manifested by improved NSR characteristics: increased activity of the natural killer cells, predominant formation of antibodies to thymus-dependent antigen, and development of delayed-type hypersensitivity. However, no complete recovery of the NSR parameters impaired by 2-chloroethenyldichloroarsine is observed.

  6. Malathion immunotoxicity in the American lobster (Homarus americanus) upon experimental exposure.

    PubMed

    De Guise, Sylvain; Maratea, Jennifer; Perkins, Christopher

    2004-03-10

    A lobster die-off reduced the 1999 fall landings in western Long Island Sound by up to more then 99%. The die-off corresponded in time with the application of pesticides for the control of mosquitoes that carried West Nile virus, a new emerging disease in North America at the time. In order to determine the possible implication of pesticide application as a direct cause or contributing factor in the die-off, we studied the effects of experimental exposure to malathion on the health of lobsters. Lobsters were exposed in 20 gallon tanks, and the direct toxicity as well as sub-lethal effects on the immune system were determined. The 96 h LC50 for malathion upon single exposure was 38 microg/l. Malathion degraded rapidly in sea water, with 65-77% lost after 1 day and 83-96% lost after 3 days. Phagocytosis was significantly decreased 3 days after a single exposure to initial water concentrations as low as 5 ppb, when measured water concentrations were as low as 0.55 ppb. Similarly, effects on phagocytosis were observed at 1, 2 and 3 weeks after the initiation of weekly exposures. Cell counts did not differ significantly upon exposure to malathion. Malathion was not detected in muscle and hepatopancreas of exposed lobsters. Evaluation of phagocytosis is a sensitive indicator of subtle sub-lethal effects of malathion, and relatively small concentrations of malathion (6-7 times lower than the LC50) can affect lobster defense mechanisms.

  7. Association between chronic organochlorine exposure and immunotoxicity in the round stingray (Urobatis halleri).

    PubMed

    Sawyna, Jillian M; Spivia, Weston R; Radecki, Kelly; Fraser, Deborah A; Lowe, Christopher G

    2017-04-01

    Chronic organochlorine (OC) exposure has been shown to cause immune impairment in numerous vertebrate species. To determine if elasmobranchs exhibited compromised immunity due to high OC contamination along the coastal mainland of southern California, innate immune function was compared in round stingrays (Urobatis halleri) collected from the mainland and Santa Catalina Island. Proliferation and phagocytosis of peripheral blood, splenic, and epigonal leukocytes were assessed. Percent phagocytosis and mean fluorescence intensity (MFI) were evaluated by quantifying % leukocytes positive for, and relative amounts of ingested fluorescent E. coli BioParticles. Total cell proliferation differed between sites, with mainland rays having a higher cell concentration in whole blood. ∑PCB load explained significantly higher % phagocytosis in blood of mainland rays, while ∑PCB and ∑pesticide loads described increased splenic % phagocytosis and MFI in the mainland population. Data provides evidence of strong OC-correlated immunostimulation; however, other site-specific environmental variables may be contributing to the observed effects.

  8. The effect of diesel (DE) exposure in utero on reproductive and developmental immunotoxicity

    EPA Science Inventory

    Epidemiology studies are beginning to show that in utero exposure to traffic related pollutants might increase the incidence of immune mediated lung diseases. Time pregnant BALB/c mice were exposed to air or two concentrations of diesel exhaust (0.5 and 2 mg/m3...

  9. IMMUNOTOXICITY IN CHANNEL CATFISH, ICTALURUS PUNCTATUS, FOLLOWING ACUTE EXPOSURE TO TRIBUTYLTIN. (R823881)

    EPA Science Inventory

    The perspectives, information and conclusions conveyed in research project abstracts, progress reports, final reports, journal abstracts and journal publications convey the viewpoints of the principal investigator and may not represent the views and policies of ORD and EPA. Concl...

  10. The impact of nanoparticle protein corona on cytotoxicity, immunotoxicity and target drug delivery.

    PubMed

    Corbo, Claudia; Molinaro, Roberto; Parodi, Alessandro; Toledano Furman, Naama E; Salvatore, Francesco; Tasciotti, Ennio

    2016-01-01

    In a perfect sequence of events, nanoparticles (NPs) are injected into the bloodstream where they circulate until they reach the target tissue. The ligand on the NP surface recognizes its specific receptor expressed on the target tissue and the drug is released in a controlled manner. However, once injected in a physiological environment, NPs interact with biological components and are surrounded by a protein corona (PC). This can trigger an immune response and affect NP toxicity and targeting capabilities. In this review, we provide a survey of recent findings on the NP-PC interactions and discuss how the PC can be used to modulate both cytotoxicity and the immune response as well as to improve the efficacy of targeted delivery of nanocarriers.

  11. Effect of the protein corona on nanoparticles for modulating cytotoxicity and immunotoxicity

    PubMed Central

    Lee, Yeon Kyung; Choi, Eun-Ju; Webster, Thomas J; Kim, Sang-Hyun; Khang, Dongwoo

    2015-01-01

    Although the cytotoxicity of nanoparticles (NPs) is greatly influenced by their interactions with blood proteins, toxic effects resulting from blood interactions are often ignored in the development and use of nanostructured biomaterials for in vivo applications. Protein coronas created during the initial reaction with NPs can determine the subsequent immunological cascade, and protein coronas formed on NPs can either stimulate or mitigate the immune response. Along these lines, the understanding of NP-protein corona formation in terms of physiochemical surface properties of the NPs and NP interactions with the immune system components in blood is an essential step for evaluating NP toxicity for in vivo therapeutics. This article reviews the most recent developments in NP-based protein coronas through the modification of NP surface properties and discusses the associated immune responses. PMID:25565807

  12. A COMPARISON OF MULTIPLE TOXICITIES FOLLOWING DEVELOPMENTAL EXPOSURE TO PESTICIDES: NEUROTOXICITY, IMMUNOTOXICITY, AND REPRODUCTIVE TOXICITY.

    EPA Science Inventory

    The NAS report (Pesticides in the Diets of Infants and Children, 1993) called for significant research effort into the long-term effects of perinatal pesticide exposure on the nervous, immune, and reproductive systems. In response, the US EPA and NIEHS collaborated on a series o...