CHARACTERIZATION OF THE HEMOLYSIN, FROM STACHYBOTRYS CHARTARUM

EPA Science Inventory

Stachybotrys chartarum is a toxigenic fungus that has been associated with human health concerns, including pulmonary hemorrhage and hemosiderosis. This fungus produces a hemolysin, stachylysin, which in its apparent monomeric form has a molecular mass of 11,920
Da as determ...

The Effect of Spaceflight on Growth of Ulocladium chartarum Colonies on the International Space Station

PubMed Central

Gomoiu, Ioana; Chatzitheodoridis, Elias; Vadrucci, Sonia; Walther, Isabelle

2013-01-01

The objectives of this 14 days experiment were to investigate the effect of spaceflight on the growth of Ulocladium chartarum, to study the viability of the aerial and submerged mycelium and to put in evidence changes at the cellular level. U. chartarum was chosen for the spaceflight experiment because it is well known to be involved in biodeterioration of organic and inorganic substrates covered with organic deposits and expected to be a possible contaminant in Spaceships. Colonies grown on the International Space Station (ISS) and on Earth were analysed post-flight. This study clearly indicates that U. chartarum is able to grow under spaceflight conditions developing, as a response, a complex colony morphotype never mentioned previously. We observed that spaceflight reduced the rate of growth of aerial mycelium, but stimulated the growth of submerged mycelium and of new microcolonies. In Spaceships and Space Stations U. chartarum and other fungal species could find a favourable environment to grow invasively unnoticed in the depth of surfaces containing very small amount of substrate, posing a risk factor for biodegradation of structural components, as well as a direct threat for crew health. The colony growth cycle of U. chartarum provides a useful eukaryotic system for the study of fungal growth under spaceflight conditions. PMID:23637980

IMMUNOCYTOCHEMICAL LOCALIZATION OF STACHYLYSIN IN STACHYBOTRYS CHARTARUM SPORES AND SPORE-IMPACTED MOUSE AND RAT LUNG TISSUES

EPA Science Inventory

Stachylysin is a proteinaceous hemolytic agent that is producted by S. chartarum. Stachylysin was found, using immunohistochemistical and immunocytochemical methods, to be localized in S. chartarum spores/mycelia primarily in the inner wall suggesting that it is constitutively ...

Identification of a novel fungus, Leptosphaerulina chartarum SJTU59 and characterization of its xylanolytic enzymes.

PubMed

Wu, Qiong; Li, Yaqian; Li, Yingying; Gao, Shigang; Wang, Meng; Zhang, Tailong; Chen, Jie

2013-01-01

Xylanolytic enzymes are widely used in processing industries, e.g., pulp and paper, food, livestock feeds, and textile. Furthermore, certain xylanotic enzymes have demonstrated the capability to improve the resistance and immunity of plants. Screening of high-yield microbial xylanolytic enzyme producers is significant for improving large-scale cost-effective xylanolytic enzyme production. This study provided new evidence of high-level xylanolytic enzyme production by a novel fungus, designated Leptosphaerulina chartarum SJTU59. Under laboratory conditions, L. chartarum SJTU59 produced xylanolytic enzymes of up to 17.566 U/mL (i.e., 878.307 U/g substrate). The enzyme solution was relatively stable over a wide range of pH (pH 3.0 to pH 9.0) and temperature (40°C to 65°C) while showing high resistance to the majority of metal ions tested. Composition analysis of the hydrolytic products of xylan showed sufficient degradation by xylanolytic enzymes from L. chartarum SJTU59, mainly the monosaccharide xylose, and a small amount of xylobiose were enzymatically produced; whereas in the presence of sufficient xylan substrates, mainly xylooligosaccharides, an emerging prebiotic used in food industry, were produced. In addition, the xylanolytic enzyme preparation from L. chartarum SJTU59 could initiate tissue necrosis and oxidative burst in tobacco leaves, which may be related to enhanced plant defense to adversity and disease. L. chartarum SJTU59 possessed a complex xylanolytic enzyme system, from which two novel endo-β-1,4-xylanases of the glycoside hydrolase (GH) family 10, one novel endo-β-1,4-xylanase of the GH family 11, and one novel β-xylosidase of the GH family 43 were obtained via rapid amplification of complementary DNA ends. Given the high yield and stable properties of xylanolytic enzymes produced by L. chartarum SJTU59, future studies will be conducted to characterize the properties of individual xylanolytic enzymes from L. chartarum SJTU59. xylanolytic

ELISA MEASUREMENT OF STACHYLYSIN IN SERUM TO QUANTIFY HUMAN EXPOSURES TO THE INDOOR MOLD STACHYBOTRYS CHARTARUM

EPA Science Inventory

Problem- To develop a measurable indicator of human exposure to Stachybotys chartarum.

Methods- Antibodies were produced against the hemolytic agent stachylysin obtained from the mold S. chartarum. These antibodies were used to develop two enzyme-linked immunosorbent ass...

Method for detection of Stachybotrys chartarum in pure culture and field samples using quantitative polymerase chain reaction

DOEpatents

Cruz-Perez, Patricia; Buttner, Mark P.

2004-05-11

A method for detecting the fungus Stachybotrys chartarum includes isolating DNA from a sample suspected of containing the fungus Stachybotrys chartarum. The method further includes subjecting the DNA to polymerase chain reaction amplification utilizing at least one of several primers, the several primers each including one of the base sequences 5'GTTGCTTCGGCGGGAAC3', 5'TTTGCGTTTGCCACTCAGAG3', 5'ACCTATCGTTGCTTCGGCG3', and 5'GCGTTTGCCACTCAGAGAATACT3'. The method additionally includes detecting the fungus Stachybotrys chartarum by visualizing the product of the polymerase chain reaction.

CHARACTERIZATION OF THE HEMOLYSIN, STACHYLYSIN, FROM STACHYBOTRYS CHARTARUM

EPA Science Inventory

Stachybotrys chartarum is a toxigenic fungus that has been associated with human health concerns, including pulmonary hemorrhage/hemosiderosis. This fungus produces a hemolysin, stachylysin, which in its monomeric form, has a molecular wieght of 11,920 daltons as determined by m...

Prototheca species and Pithomyces chartarum as Causative Agents of Rhinitis and/or Sinusitis in Horses.

PubMed

Schöniger, S; Roschanski, N; Rösler, U; Vidovic, A; Nowak, M; Dietz, O; Wittenbrink, M M; Schoon, H-A

2016-01-01

Pyogranulomatous rhinitis associated with an algal infection was diagnosed in a 25-year-old gelding and a 23-year-old mare had necrotizing sinusitis with intralesional algae and pigmented fungi. Algae were identified immunohistochemically in both cases as Prototheca spp. In the gelding, further characterization by polymerase chain reaction and sequencing revealed that the organism was Prototheca zopfii genotype 2. Fungi from the mare were identified as Pithomyces chartarum by molecular analysis. Prototheca species are achlorophyllous algae and P. chartarum represents a dematiaceous fungus; they are saprophytes and facultative pathogens. Prototheca spp. and P. chartarum should be considered as rare respiratory pathogens of horses. Copyright © 2016 Elsevier Ltd. All rights reserved.

Biomechanics of conidial dispersal in the toxic mold Stachybotrys chartarum

PubMed Central

Tucker, Kathryn; Stolze, Jessica L.; Kennedy, Aaron H.; Money, Nicholas P.

2007-01-01

Conidial dispersal in Stachybotrys chartarum in response to low-velocity airflow was studied using a microflow apparatus. The maximum rate of spore release occurred during the first 5 min of airflow, followed by a dramatic reduction in dispersal that left more than 99% of the conidia attached to their conidiophores. Micromanipulation of undisturbed colonies showed that micronewton (μN) forces were needed to dislodge spore clusters from their supporting conidiophores. Calculations show that airspeeds that normally prevail in the indoor environment disturb colonies with forces that are 1,000-fold lower, in the nanonewton (nN) range. Low-velocity airflow does not, therefore, cause sufficient disturbance to disperse a large proportion of the conidia of S. chartarum. PMID:17267247

Microbial volatile organic compound emissions from Stachybotrys chartarum growing on gypsum wallboard and ceiling tile.

PubMed

Betancourt, Doris A; Krebs, Ken; Moore, Scott A; Martin, Shayna M

2013-12-05

Stachybotrys chartarum is a filamentous mold frequently identified among the mycobiota of water-damaged building materials. Growth of S. chartarum on suitable substrates and under favorable environmental conditions leads to the production of secondary metabolites such as mycotoxins and microbial volatile organic compounds (MVOCs). The aim of this study was to characterize MVOC emission profiles of seven toxigenic strains of S. chartarum, isolated from water-damaged buildings, in order to identify unique MVOCs generated during growth on gypsum wallboard and ceiling tile coupons. Inoculated coupons were incubated and monitored for emissions and growth using a closed glass environmental growth chamber maintained at a constant room temperature. Gas samples were collected from the headspace for three to four weeks using Tenax TA tubes. Most of the MVOCs identified were alcohols, ketones, ethers and esters. The data showed that anisole (methoxybenzene) was emitted from all of the S. chartarum strains tested on both types of substrates. Maximum anisole concentration was detected after seven days of incubation. MVOCs are suitable markers for fungal identification because they easily diffuse through weak barriers like wallpaper, and could be used for early detection of mold growth in hidden cavities. This study identifies the production of anisole by seven toxigenic strains of Stachybotrys chartarum within a period of one week of growth on gypsum wallboard and ceiling tiles. These data could provide useful information for the future construction of a robust MVOC library for the early detection of this mold.

Value of phagocyte function screening for immunotoxicity of nanoparticles in vivo.

PubMed

Fröhlich, Eleonore

2015-01-01

Nanoparticles (NPs) present in the environment and in consumer products can cause immunotoxic effects. The immune system is very complex, and in vivo studies are the gold standard for evaluation. Due to the increased amount of NPs that are being developed, cellular screening assays to decrease the amount of NPs that have to be tested in vivo are highly needed. Effects on the unspecific immune system, such as effects on phagocytes, might be suitable for screening for immunotoxicity because these cells mediate unspecific and specific immune responses. They are present at epithelial barriers, in the blood, and in almost all organs. This review summarizes the effects of carbon, metal, and metal oxide NPs used in consumer and medical applications (gold, silver, titanium dioxide, silica dioxide, zinc oxide, and carbon nanotubes) and polystyrene NPs on the immune system. Effects in animal exposures through different routes are compared to the effects on isolated phagocytes. In addition, general problems in the testing of NPs, such as unknown exposure doses, as well as interference with assays are mentioned. NPs appear to induce a specific immunotoxic pattern consisting of the induction of inflammation in normal animals and aggravation of pathologies in disease models. The evaluation of particle action on several phagocyte functions in vitro may provide an indication on the potency of the particles to induce immunotoxicity in vivo. In combination with information on realistic exposure levels, in vitro studies on phagocytes may provide useful information on the health risks of NPs.

Microbial volatile organic compound emissions from Stachybotrys chartarum growing on gypsum wallboard and ceiling tile

PubMed Central

2013-01-01

Background Stachybotrys chartarum is a filamentous mold frequently identified among the mycobiota of water-damaged building materials. Growth of S. chartarum on suitable substrates and under favorable environmental conditions leads to the production of secondary metabolites such as mycotoxins and microbial volatile organic compounds (MVOCs). The aim of this study was to characterize MVOC emission profiles of seven toxigenic strains of S. chartarum, isolated from water-damaged buildings, in order to identify unique MVOCs generated during growth on gypsum wallboard and ceiling tile coupons. Inoculated coupons were incubated and monitored for emissions and growth using a closed glass environmental growth chamber maintained at a constant room temperature. Gas samples were collected from the headspace for three to four weeks using Tenax TA tubes. Results Most of the MVOCs identified were alcohols, ketones, ethers and esters. The data showed that anisole (methoxybenzene) was emitted from all of the S. chartarum strains tested on both types of substrates. Maximum anisole concentration was detected after seven days of incubation. Conclusions MVOCs are suitable markers for fungal identification because they easily diffuse through weak barriers like wallpaper, and could be used for early detection of mold growth in hidden cavities. This study identifies the production of anisole by seven toxigenic strains of Stachybotrys chartarum within a period of one week of growth on gypsum wallboard and ceiling tiles. These data could provide useful information for the future construction of a robust MVOC library for the early detection of this mold. PMID:24308451

Volatile metabolites produced by three strains of Stachybotrys chartarum cultivated on rice and gypsum board.

PubMed

Gao, Pengfei; Martin, Jennifer

2002-06-01

Stachybotrys chartarum (atra) is a toxigenic fungus frequently found in water-damaged buildings. Although microbial volatile organic compounds (MVOCs) produced by Aspergillus, Penicillium, and other fungi have been investigated extensively, little information exists on what MVOCs can be produced by S. chartarum. In this study, three strains of S. chartarum isolated from water-damaged residential homes in Cleveland, Ohio, were cultivated on rice and gypsum board. Air samples were collected after one, two, three, four, and six weeks of cultivation using Tenax TA tubes. Unique MVOCs were determined and other alcohols, ketones, and terpenes were also investigated using gas chromatography/mass spectrometry after thermal desorption from the sampling tube. Four unique MVOCs, 1-butanol, 3-methyl-1-butanol, 3-methyl-2-butanol, and thujopsene, were detected on rice cultures, and only one of them (1-butanol) was detected on gypsum board cultures. For a given strain, volatiles were considerably different with different cultivation media. Concentration profiles of the volatile compounds varied among compounds; however, each compound exhibited corresponding concentration trends between the strains. In comparison with our previous studies of five Aspergillus species on gypsum board under the same experimental conditions, fewer unique MVOCs were produced by S. chartarum, and they were quite different. It thus may be possible to use marker-unique MVOCs as a fingerprint to distinguish fungi in indoor environments once enough information becomes available. Our findings also indicate that volatiles produced by S. chartarum may represent a relatively small fraction of the total volatiles present in problem buildings where Aspergillus spp., Penicillium spp., and other fungi usually coexist.

Value of phagocyte function screening for immunotoxicity of nanoparticles in vivo

PubMed Central

Fröhlich, Eleonore

2015-01-01

Nanoparticles (NPs) present in the environment and in consumer products can cause immunotoxic effects. The immune system is very complex, and in vivo studies are the gold standard for evaluation. Due to the increased amount of NPs that are being developed, cellular screening assays to decrease the amount of NPs that have to be tested in vivo are highly needed. Effects on the unspecific immune system, such as effects on phagocytes, might be suitable for screening for immunotoxicity because these cells mediate unspecific and specific immune responses. They are present at epithelial barriers, in the blood, and in almost all organs. This review summarizes the effects of carbon, metal, and metal oxide NPs used in consumer and medical applications (gold, silver, titanium dioxide, silica dioxide, zinc oxide, and carbon nanotubes) and polystyrene NPs on the immune system. Effects in animal exposures through different routes are compared to the effects on isolated phagocytes. In addition, general problems in the testing of NPs, such as unknown exposure doses, as well as interference with assays are mentioned. NPs appear to induce a specific immunotoxic pattern consisting of the induction of inflammation in normal animals and aggravation of pathologies in disease models. The evaluation of particle action on several phagocyte functions in vitro may provide an indication on the potency of the particles to induce immunotoxicity in vivo. In combination with information on realistic exposure levels, in vitro studies on phagocytes may provide useful information on the health risks of NPs. PMID:26060398

Rhein Induces Oxidative Stress and Apoptosis in Mouse Blastocysts and Has Immunotoxic Effects during Embryonic Development.

PubMed

Huang, Chien-Hsun; Chan, Wen-Hsiung

2017-09-20

Rhein, a glucoside chemical compound found in a traditional Chinese medicine derived from the roots of rhubarb, induces cell apoptosis and is considered to have high potential as an antitumor drug. Several previous studies showed that rhein can inhibit cell proliferation and trigger mitochondria-related or endoplasmic reticulum (ER) stress-dependent apoptotic processes. However, the side effects of rhein on pre- and post-implantation embryonic development remain unclear. Here, we show that rhein has cytotoxic effects on blastocyst-stage mouse embryos and induces oxidative stress and immunotoxicity in mouse fetuses. Blastocysts incubated with 5-20 μM rhein showed significant cell apoptosis, as well as decreases in their inner cell mass cell numbers and total cell numbers. An in vitro development assay showed that rhein affected the developmental potentials of both pre- and post-implantation embryos. Incubation of blastocysts with 5-20 μM rhein was associated with increased resorption of post-implantation embryos and decreased fetal weight in an embryo transfer assay. Importantly, in an in vivo model, intravenous injection of dams with rhein (1, 3, and 5 mg/kg body weight/day) for four days resulted in apoptosis of blastocyst-stage embryos, early embryonic developmental injury, and decreased fetal weight. Intravenous injection of dams with 5 mg/kg body weight/day rhein significantly increased the total reactive oxygen species (ROS) content of fetuses and the transcription levels of antioxidant proteins in fetal livers. Additional work showed that rhein induced apoptosis through ROS generation, and that prevention of apoptotic processes effectively rescued the rhein-induced injury effects on embryonic development. Finally, the transcription levels of the innate-immunity related genes, CXCL1 , IL-1 β and IL-8 , were down-regulated in the fetuses of dams that received intravenous injections of rhein. These results collectively show that rhein has the potential to

Antibodies against Stachybotrys chartarum extract and its antigenic components, Stachyhemolysin and Stachyrase-A: a new clinical biomarker.

PubMed

Vojdani, Aristo

2005-05-01

IgG and IgE antibodies against Stachybotrys extract have been reported in allergic patients and residents of water-damaged buildings. Detection of these antibodies in blood was partially attributed to cross-reacting proteins from other fungi. There is a need for a specific method to detect antibodies against characteristic components of S. chartarum. We measured IgG and IgE antibodies against Stachybotrys hemolysin and proteinase-Stachyrase-A by ELISA and ELISA-inhibition techniques. Of 50 reference sera with IgE greater than 500 IU ml and positive against different mold extracts used in this study, significant elevation in IgG or IgE antibodies against S. chartarum extract was present in 25 and 21 specimens. Of these specimens 20 (80%) and 10 (40%) were positive for IgG anti-Stachybotrys hemolysin and anti-Stachyrase-A, while 8 out of 21 sera (38%) and 17 out of 21 (81%) specimens were positive for IgE anti-Stachybotrys hemolysin and anti-Stachyrase-A respectively. Inhibition studies using Stachybotrys hemolysin and Stachyrase-A at a concentration of 50 microg/ml prevented binding of anti-Stachybotrys to S. chartarum extract. Detection of IgG as well as IgE antibodies against Stachybotrys hemolysin and Stachyrase-A and inhibition of anti-Stachybotrys binding to Stachybotrys antigens indicate that Stachybotrys hemolysin and Stachyrase-A are two major antigenic components of S. chartarum extract, which can be used in antibody assays. Measurement of antibodies against these characteristic components of S. chartarum may be considered for demonstration of exposure and possibly allergy to the fungus.

STACHYLYSIN MAY BE CAUSE OF HEMORRAHAGING IN STACHYBOTRYS CHARTARUM EXPOSURES

EPA Science Inventory

Stachybotrys chartarum is a toxigenic fungus that has been associated with human health concerns like nasal bleeding in adults and pulmonary hemosiderosis (PH) in infants. Stachylysin is a glycosylated protein, with the deglycosylated molecular mass of 21.5 kDa. Seven of eight ...

Molecular and phenotypic descriptions of Stachybotrys chlorohalonata sp. nov. and two chemotypes of Stachybotrys chartarum found in water-damaged buildings.

PubMed

Andersen, Birgitte; Nielsen, Kristian F; Thrane, Ulf; Szaro, Tim; Taylor, John W; Jarvis, Bruce B

2003-01-01

Twenty-five Stachybotrys isolates from two previous studies have been examined and compared, using morphological, chemical and phylogenetic methods. The results show that S. chartarum sensu lato can be segregated into two chemotypes and one new species. The new species, S. chlorohalonata, differs morphologically from S. chartarum by having smooth conidia, being more restricted in growth and producing a green extracellular pigment on the medium CYA. S. chlorohalonata and S. chartarum also have different tri5, chs1 and tub1 gene fragment sequences. The two chemotypes of S. chartarum, chemotype S and chemotype A, have similar morphology but differ in production of metabolites. Chemotype S produces macrocyclic trichothecenes, satratoxins and roridins, while chemotype A produces atranones and dolabellanes. There is no difference between the two chemotypes in the tub1 gene fragment, but there is a one nucleotide difference in each of the tri5 and the chs1 gene fragments.

CHARACTERIZATION OF MICROBIAL VOLATILE ORGANIC COMPOUNDS (MVOC) EMITTED BY STACHYBOTRYS CHARTARUM

EPA Science Inventory

Stachybotrys chartarum is a filamentous fungi usually found in water-damaged buildings. Severe illnesses have been reported after indoor exposure to this mold. Toxicity has caused the production of secondary metabolites or mycotoxins, and the emission of by-products, specifically...

Introduction to Immunotoxicity

EPA Science Inventory

Recognition that the immune system is vulnerable to adverse effects after exposure to xenobiotics led to the discipline of immunotoxicology and the subsequent addition of immunotoxicology testing to regulatory guidelines for toxicity. Immunotoxic effects can result in immunosuppr...

From immunotoxicity to carcinogenicity: the effects of carbamate pesticides on the immune system.

PubMed

Dhouib, Ines; Jallouli, Manel; Annabi, Alya; Marzouki, Soumaya; Gharbi, Najoua; Elfazaa, Saloua; Lasram, Mohamed Montassar

2016-05-01

The immune system can be the target of many chemicals, with potentially severe adverse effects on the host's health. In the literature, carbamate (CM) pesticides have been implicated in the increasing prevalence of diseases associated with alterations of the immune response, such as hypersensitivity reactions, some autoimmune diseases and cancers. CMs may initiate, facilitate, or exacerbate pathological immune processes, resulting in immunotoxicity by induction of mutations in genes coding for immunoregulatory factors and modifying immune tolerance. In the present study, direct immunotoxicity, endocrine disruption and inhibition of esterases activities have been introduced as the main mechanisms of CMs-induced immune dysregulation. Moreover, the evidence on the relationship between CM pesticide exposure, dysregulation of the immune system and predisposition to different types of cancers, allergies, autoimmune and infectious diseases is criticized. In addition, in this review, we will discuss the relationship between immunotoxicity and cancer, and the advances made toward understanding the basis of cancer immune evasion.

Health and immunology study following exposure to toxigenic fungi (Stachybotrys chartarum) in a water-damaged office environment.

PubMed

Johanning, E; Biagini, R; Hull, D; Morey, P; Jarvis, B; Landsbergis, P

1996-01-01

There is growing concern about adverse health effects of fungal bio-aerosols on occupants of water-damaged buildings. Accidental, occupational exposure in a nonagricultural setting has not been investigated using modern immunological laboratory tests. The objective of this study was to evaluate the health status of office workers after exposure to fungal bio-aerosols, especially Stachybotrys chartarum (atra) (S. chartarum) and its toxigenic metabolites (satratoxins), and to study laboratory parameters or biomarkers related to allergic or toxic human health effects. Exposure characterization and quantification were performed using microscopic, culture, and chemical techniques. The study population (n = 53) consisted of 39 female and 14 male employees (mean age 34.8 years) who had worked for a mean of 3.1 years at a problem office site; a control group comprised 21 persons (mean age 37.5 years) without contact with the problem office site. Health complaints were surveyed with a 187-item standardized questionnaire. A comprehensive test battery was used to study the red and white blood cell system, serum chemistry, immunology/antibodies, lymphocyte enumeration and function. Widespread fungal contamination of water-damaged, primarily cellulose material with S. chartarum was found. S. chartarum produced a macrocyclic trichothecene, satratoxin H, and spirocyclic lactones. Strong associations with exposure indicators and significant differences between employees (n = 53) and controls (n = 21) were found for lower respiratory system symptoms, dermatological symptoms, eye symptoms, constitutional symptoms, chronic fatigue symptoms and several enumeration and function laboratory tests, mainly of the white blood cell system. The proportion of mature T-lymphocyte cells (CD3%) was lower in employees than in controls, and regression analyses showed significantly lower CD3% among those reporting a history of upper respiratory infections. Specific S. chartarum antibody tests (Ig

Quantification of Siderophore and Hemolysin from Stachybotrys chartarum Strains, Including a Strain Isolated from the Lung of a Child with Pulmonary Hemorrhage and Hemosiderosis

PubMed Central

Vesper, Stephen J.; Dearborn, Dorr G.; Elidemir, Okan; Haugland, Richard A.

2000-01-01

A strain of Stachybotrys chartarum was recently isolated from the lung of a pulmonary hemorrhage and hemosiderosis (PH) patient in Texas (designated the Houston strain). This is the first time that S. chartarum has been isolated from the lung of a PH patient. In this study, the Houston strain and 10 strains of S. chartarum isolated from case (n = 5) or control (n = 5) homes in Cleveland were analyzed for hemolytic activity, siderophore production, and relatedness as measured by random amplified polymorphic DNA analysis. PMID:10831457

Immunotoxicity in green mussels under perfluoroalkyl substance (PFAS) exposure: Reversible response and response model development.

PubMed

Liu, Changhui; Gin, Karina Yew-Hoong

2018-04-01

The immunotoxicity of 4 commonly detected perfluoroalkyl substances (PFASs), namely, perfluorooctanesulfonate (PFOS), perfluorooctanoic acid (PFOA), perfluorononanoic acid (PFNA), and perfluorodecanoic acid (PFDA) was investigated by measuring biomarkers of the immune profile of green mussels, Perna viridis. The biomarkers included neutral red retention, phagocytosis, and spontaneous cytotoxicity, all of which were tested on mussel hemocytes. Hemocytes are an important component of the invertebrate immune system. We found that exposure to PFASs could lead to reduced hemocyte cell viability and suppress immune function by up to 50% of normal performance within the experimental exposure range. The results indicate that PFASs have an immunotoxic potential and thus could pose severe health risks to aquatic organisms. The reported immunotoxicity is likely to result from the compounds' direct and indirect interactions with the hemocyte membrane, and therefore likely to affect the functionality of these cells. The immunotoxic response was found to be related to the organism's burden of PFASs, and was reversible when the compounds were removed from the test organisms. Based on this relationship, models using an organism's PFAS concentration and bioaccumulation factor (BAF) as the independent variables were established to quantify PFAS-induced immunotoxicity. The models help us to gain a better understanding of the toxic mechanism of PFASs, and provide a tool to evaluate adverse effects for the whole group of compounds with one mathematical equation. Environ Toxicol Chem 2018;37:1138-1145. © 2018 SETAC. © 2018 SETAC.

Testing antimicrobial cleaner efficacy on gypsum wallboard contaminated with Stachybotrys chartarum.

PubMed

Menetrez, Marc Y; Foarde, Karin K; Webber, Tricia D; Dean, Timothy R; Betancourt, Doris A

2007-11-01

Reducing occupant exposure to indoor mold is the goal of this research, through the efficacy testing of antimicrobial cleaners. Often mold contaminated building materials are not properly removed, but instead surface cleaners are applied in an attempt to alleviate the problem. The efficacy of antimicrobial cleaners to remove, eliminate or control mold growth on surfaces can easily be tested on non-porous surfaces. However, the testing of antimicrobial cleaner efficacy on porous surfaces, such as those found in the indoor environment such as gypsum board can be more complicated and prone to incorrect conclusions regarding residual organisms. The mold Stachybotrys chartarum has been found to be associated with idiopathic pulmonary hemorrhage in infants and has been studied for toxin production and its occurrence in water damaged buildings. Growth of S. chartarum on building materials such as gypsum wallboard has been frequently documented. Research to control S. chartarum growth using 13 separate antimicrobial cleaners on contaminated gypsum wallboard has been performed in laboratory testing. Popular brands of cleaning products were tested by following directions printed on the product packaging. A variety of gypsum wallboard surfaces were used to test these cleaning products at high relative humidity. The results indicate differences in antimicrobial efficacy for the six month period of testing. Results for the six types of GWB surfaces varied extensively. However, three cleaning products exhibited significantly better results than others. Lysol All-Purpose Cleaner-Orange Breeze (full strength) demonstrated results which ranked among the best in five of the six surfaces tested. Both Borax and Orange Glo Multipurpose Degreaser demonstrated results which ranked among the best in four of the six surfaces tested. The best antimicrobial cleaner to choose is often dependent on the type of surface to be cleaned of S. chartarum contamination. For Plain GWB, no paint, the

Role of Glutathione Conjugation in 1-Bromobutane-induced Immunotoxicity in Mice.

PubMed

Lee, Sang Kyu; Lee, Dong Ju; Jeon, Tae Won; Ko, Gyu Sub; Yoo, Se Hyun; Ha, Hyun Woo; Kang, Mi Jeong; Kang, Wonku; Kim, Sang Kyum; Jeong, Tae Cheon

2010-06-01

Halogenated organic compounds, such as 1-bromobutane (1-BB) , have been used as cleaning agents, agents for chemical syntheses or extraction solvents in workplace. In the present study, immunotoxic effects of 1-BB and its conjugation with glutathione (GSH) were investigated in female BALB/c mice. Animals were treated orally with 1-BB at 375, 750 and 1500 mg/kg in corn oil once for dose response or treated orally with 1-BB at 1500 mg/kg for 6, 12, 24 and 48 hr for time course. S-Butyl GSH was identified in spleen by liquid chromatography-electrospray ionization tandem mass spectrometry. Splenic GSH levels were significantly reduced by single treatment with 1-BB. S-Butyl GSH conjugates were detected in spleen from 6 hr after treatment. Oral 1-BB significantly suppressed the antibody response to a T-dependent antigen and the production of splenic intracellular interlukin-2 in response to Con A. Our present results suggest that 1-BB could cause immunotoxicity as well as reduction of splenic GSH content, due to the formation of GSH conjugates in mice. The present results would be useful to understand molecular toxic mechanism of low molecular weight haloalkanes and to develop biological markers for exposure to haloalkanes.

Detection of airborne Stachybotrys chartarum macrocyclic trichothecene mycotoxins in the indoor environment.

PubMed

Brasel, T L; Martin, J M; Carriker, C G; Wilson, S C; Straus, D C

2005-11-01

The existence of airborne mycotoxins in mold-contaminated buildings has long been hypothesized to be a potential occupant health risk. However, little work has been done to demonstrate the presence of these compounds in such environments. The presence of airborne macrocyclic trichothecene mycotoxins in indoor environments with known Stachybotrys chartarum contamination was therefore investigated. In seven buildings, air was collected using a high-volume liquid impaction bioaerosol sampler (SpinCon PAS 450-10) under static or disturbed conditions. An additional building was sampled using an Andersen GPS-1 PUF sampler modified to separate and collect particulates smaller than conidia. Four control buildings (i.e., no detectable S. chartarum growth or history of water damage) and outdoor air were also tested. Samples were analyzed using a macrocyclic trichothecene-specific enzyme-linked immunosorbent assay (ELISA). ELISA specificity was tested using phosphate-buffered saline extracts of the fungal genera Aspergillus, Chaetomium, Cladosporium, Fusarium, Memnoniella, Penicillium, Rhizopus, and Trichoderma, five Stachybotrys strains, and the indoor air allergens Can f 1, Der p 1, and Fel d 1. For test buildings, the results showed that detectable toxin concentrations increased with the sampling time and short periods of air disturbance. Trichothecene values ranged from <10 to >1,300 pg/m3 of sampled air. The control environments demonstrated statistically significantly (P < 0.001) lower levels of airborne trichothecenes. ELISA specificity experiments demonstrated a high specificity for the trichothecene-producing strain of S. chartarum. Our data indicate that airborne macrocyclic trichothecenes can exist in Stachybotrys-contaminated buildings, and this should be taken into consideration in future indoor air quality investigations.

Walnut Polyphenol Extract Attenuates Immunotoxicity Induced by 4-Pentylphenol and 3-methyl-4-nitrophenol in Murine Splenic Lymphocyte.

PubMed

Yang, Lubing; Ma, Sihui; Han, Yu; Wang, Yuhan; Guo, Yan; Weng, Qiang; Xu, Meiyu

2016-05-12

4-pentylphenol (PP) and 3-methyl-4-nitrophenol (PNMC), two important components of vehicle emissions, have been shown to confer toxicity in splenocytes. Certain natural products, such as those derived from walnuts, exhibit a range of antioxidative, antitumor, and anti-inflammatory properties. Here, we investigated the effects of walnut polyphenol extract (WPE) on immunotoxicity induced by PP and PNMC in murine splenic lymphocytes. Treatment with WPE was shown to significantly enhance proliferation of splenocytes exposed to PP or PNMC, characterized by increases in the percentages of splenic T lymphocytes (CD3+ T cells) and T cell subsets (CD4+ and CD8+ T cells), as well as the production of T cell-related cytokines and granzymes (interleukin-2, interleukin-4, and granzyme-B) in cells exposed to PP or PNMC. These effects were associated with a decrease in oxidative stress, as evidenced by changes in OH, SOD, GSH-Px, and MDA levels. The total phenolic content of WPE was 34,800 ± 200 mg gallic acid equivalents/100 g, consisting of at least 16 unique phenols, including ellagitannins, quercetin, valoneic acid dilactone, and gallic acid. Taken together, these results suggest that walnut polyphenols significantly attenuated PP and PNMC-mediated immunotoxicity and improved immune function by inhibiting oxidative stress.

Walnut Polyphenol Extract Attenuates Immunotoxicity Induced by 4-Pentylphenol and 3-methyl-4-nitrophenol in Murine Splenic Lymphocyte

PubMed Central

Yang, Lubing; Ma, Sihui; Han, Yu; Wang, Yuhan; Guo, Yan; Weng, Qiang; Xu, Meiyu

2016-01-01

4-pentylphenol (PP) and 3-methyl-4-nitrophenol (PNMC), two important components of vehicle emissions, have been shown to confer toxicity in splenocytes. Certain natural products, such as those derived from walnuts, exhibit a range of antioxidative, antitumor, and anti-inflammatory properties. Here, we investigated the effects of walnut polyphenol extract (WPE) on immunotoxicity induced by PP and PNMC in murine splenic lymphocytes. Treatment with WPE was shown to significantly enhance proliferation of splenocytes exposed to PP or PNMC, characterized by increases in the percentages of splenic T lymphocytes (CD3+ T cells) and T cell subsets (CD4+ and CD8+ T cells), as well as the production of T cell-related cytokines and granzymes (interleukin-2, interleukin-4, and granzyme-B) in cells exposed to PP or PNMC. These effects were associated with a decrease in oxidative stress, as evidenced by changes in OH, SOD, GSH-Px, and MDA levels. The total phenolic content of WPE was 34,800 ± 200 mg gallic acid equivalents/100 g, consisting of at least 16 unique phenols, including ellagitannins, quercetin, valoneic acid dilactone, and gallic acid. Taken together, these results suggest that walnut polyphenols significantly attenuated PP and PNMC-mediated immunotoxicity and improved immune function by inhibiting oxidative stress. PMID:27187455

QUANTIFICATION OF SIDEROPHORE AND HEMOLYSIN FROM STACHYBOTRYS CHARTARUM STRAINS, INCLUDING A STRAIN ISOLATED FROM THE LUNG OF A CHILD WITH PULMONARY HEMORRHAGE AND HEMOSIDEROSIS

EPA Science Inventory

A strain of Stachybotrys chartarum was recently isolated from the lung of a pulmonary hemorrhage and hemosiderosis (PH) patient in Texas (designated the Houston strain). This is the first time that S. chartarum has been isolated from the lung of a PH patient. In this study, the ...

High dispersity of carbon nanotubes diminishes immunotoxicity in spleen.

PubMed

Lee, Soyoung; Khang, Dongwoo; Kim, Sang-Hyun

2015-01-01

From the various physiochemical material properties, the chemical functionalization order of single-walled carbon nanotubes (swCNTs) has not been considered as a critical factor for modulating immunological responses and toxicological aspects in drug delivery applications. Although most nanomaterials, including carbon nanotubes, are specifically accumulated in spleen, few studies have focused on spleen immunotoxicity. For this reason, this study demonstrated that the dispersity of swCNTs significantly influenced immunotoxicity in vitro and in vivo. For cytotoxicity of swCNTs, MTT assay, reactive oxygen species production, superoxide dismutase activity, cellular uptake, and confocal microscopy were used in macrophages. In the in vivo study, female BALB/c mice were intravenously administered with 1 mg/kg/day of swCNTs for 2 weeks. The body weight, organ weight, hematological change, reverse-transcription polymerase chain reaction, and lymphocyte population were evaluated. Different orders of chemical functionalization of swCNTs controlled immunotoxicity. In short, less-dispersed swCNTs caused cytotoxicity in macrophages and abnormalities in immune organs such as spleen, whereas highly dispersed swCNTs did not result in immunotoxicity. This study clarified that increasing carboxyl groups on swCNTs significantly mitigated immunotoxicity in vitro and in vivo. Our findings clarified the effective immunotoxicological factors of swCNTs by increasing dispersity of swCNTs and provided useful guidelines for the effective use of nanomaterials.

INITIAL CHARACTERIZATION OF MONOCLONAL ANTIBODIES AGAINST THE FUNGAL HEMOLYSIN STACHYLYSIN FROM STACHYBOTRYS CHARTARUM

EPA Science Inventory

Stachybotrys chartarum is known to produce the hemolysin stachylysin and its detection in human serum has been proposed as a biomarker for exposure to the fungus. In this study we report the initial characterization of monoclonal antibodies (mAbs) against stachylysin and the dev...

Genotoxic and immunotoxic effects of cellulose nanocrystals in vitro.

PubMed

Catalán, Julia; Ilves, Marit; Järventaus, Hilkka; Hannukainen, Kati-Susanna; Kontturi, Eero; Vanhala, Esa; Alenius, Harri; Savolainen, Kai M; Norppa, Hannu

2015-03-01

Nanocellulosics are among the most promising innovations for a wide-variety of applications in materials science. Although nanocellulose is presently produced only on a small scale, its possible toxic effects should be investigated at this early stage. The aim of the present study was to examine the potential genotoxicity and immunotoxicity of two celluloses in vitro - cellulose nanocrystals (CNC; mean fibril length 135 nm, mean width 7.3 nm) and a commercially available microcrystalline (non-nanoscale) cellulose (MCC; particle size ∼50 µm). Both celluloses showed 55% cytotoxicity at approximately 100 µg/ml after 4-h, 24-h, and 48-h treatment of human bronchial epithelial BEAS 2B cells, as determined by luminometric detection of ATP and cell count (dead cells identified by propidium iodide). Neither of the materials was able to induce micronuclei (MN) in binucleate or mononucleate BEAS 2B cells after a 48-h treatment (2.5-100 µg/ml). In human monocyte-derived macrophages, MCC induced a release (measured by enzyme-linked immunosorbent assay; ELISA) of the pro-inflammatory cytokines tumor necrosis factor α (TNF-α) and (after lipopolysaccharide-priming) interleukin 1β (IL-1β) after a 6-h exposure to a dose of 300 µg/ml, but CNC (30-300 µg/ml) did not. In conclusion, our results show that nanosized CNC is neither genotoxic nor immunotoxic under the conditions tested, whereas non-nanosized MCC is able to induce an inflammatory response. More studies are needed, especially in vivo, to further assess if CNC and other nanocelluloses induce secondary genotoxic effects mediated by inflammation. © 2014 Wiley Periodicals, Inc.

Comparison of immunotoxic effects induced by the extracts from methanol and gasoline engine exhausts in vitro.

PubMed

Che, Wangjun; Liu, Guiming; Qiu, Hong; Zhang, Hao; Ran, Yun; Zeng, Xianggui; Wen, Weihua; Shu, Ya

2010-06-01

Gasoline engine exhaust has been considered as a major source of air pollution in China. Due to lower cyto- and geno-toxicity effects of methanol engine exhaust, methanol is regarded as a potential substitute for gasoline. We have previously compared cyto- and geno-toxicities of gasoline engine exhaust with that of methanol engine exhaust in A549 cells (Zhang et al., 2007).To characterize the immunotoxic effects for gasoline and methanol engine exhausts in immune cell, in this study, we further compared effects of gasoline and methanol engine exhausts on immune function in RAW264.7 cell and rabbit alveolar macrophages. Results showed that both gasoline and methanol engine exhaust could evidently inhibit RAW264.7 cell proliferation, promote RAW264.7 cell apoptosis, decrease E-rosette formation rate and inhibit anti-tumor effects of alveolar macrophages, at the same time, these effects of gasoline engine exhaust were far stronger than those of methanol engine exhaust. In addition, gasoline engine exhaust could significantly inhibit activities of ADCC of alveolar macrophages, but methanol engine exhaust could not. These results suggested that both gasoline and methanol engine exhausts might be immunotoxic atmospheric pollutants, but some effects of gasoline engine exhaust on immunotoxicities may be far stronger than that of methanol engine exhaust. Copyright 2010 Elsevier Ltd. All rights reserved.

Testing antimicrobial paint efficacy on gypsum wallboard contaminated with Stachybotrys chartarum.

PubMed

Menetrez, M Y; Foarde, K K; Webber, T D; Dean, T R; Betancourt, D A

2008-02-01

The goal of this research was to reduce occupant exposure to indoor mold through the efficacy testing of antimicrobial paints. An accepted method for handling Stachybotrys chartarum-contaminated gypsum wallboard (GWB) is removal and replacement. This practice is also recommended for water-damaged or mold-contaminated GWB but is not always followed completely. The efficacy of antimicrobial paints to eliminate or control mold regrowth on surfaces can be tested easily on nonporous surfaces. The testing of antimicrobial efficacy on porous surfaces found in the indoor environment, such as gypsum wallboard, can be more complicated and prone to incorrect conclusions regarding residual organisms. The mold S. chartarum has been studied for toxin production and its occurrence in water-damaged buildings. Research to control its growth using seven different antimicrobial paints and two commonly used paints on contaminated, common gypsum wallboard was performed in laboratory testing at high relative humidity. The results indicate differences in antimicrobial efficacy for the period of testing, and that proper cleaning and resurfacing of GWB with an antimicrobial paint can be an option in those unique circumstances when removal may not be possible.

Immunotoxicity of trenbolone acetate in Japanese quail

USGS Publications Warehouse

Quinn, M.J.; McKernan, M.; Lavoie, E.T.; Ottinger, M.A.

2007-01-01

Trenbolone acetate is a synthetic androgen that is currently used as a growth promoter in many meat-exporting countries. Despite industry laboratories classifying trenbolone as nonteratogenic, data showed that embryonic exposure to this androgenic chemical altered development of the immune system in Japanese quail. Trenbolone is lipophilic, persistent, and released into the environment in manure used as soil fertilizer. This is the first study to date to assess this chemical's immunotoxic effects in an avian species. A one-time injection of trenbolone into yolks was administered to mimic maternal deposition, and subsequent effects on the development and function of the immune system were determined in chicks and adults. Development of the bursa of Fabricius, an organ responsible for development of the humoral arm of the immune system, was disrupted, as indicated by lower masse, and smaller and fewer follicles at day 1 of hatch. Morphological differences in the bursas persisted in adults, although no differences in either two measures of immune function were observed. Total numbers of circulating leukocytes were reduced and heterophil-lymphocyte ratios were elevated in chicks but not adults. This study shows that trenbolone acetate is teratogenic and immunotoxic in Japanese quail, and provides evidence that the quail immune system may be fairly resilient to embryonic endocrine-disrupting chemical-induced alterations following no further exposure posthatch.

Study on the impact of lead acetate pollutant on immunotoxicity produced by thiamethoxam pesticide

PubMed Central

Sinha, Suprita; Thaker, A. M.

2014-01-01

Objective: The curtailed knowledge about neonicotinoids that it has low affinity for vertebrate relative to insect nicotinic receptors is a major factor for its widespread use assuming that it is much safer than the previous generation insecticides. But literature regarding effect of thiamethoxam (second generation neonicotinoid)on immune system is not available. Also, there might be chances of interaction of heavy persistent metals in the water table with these pesticides. So, this study was undertaken with the objective to find immunotoxic alterations of lead acetate after exposure with thiamethoxam in animal model. Materials and Methods: For this albino mice were randomly divided into 6 groups (numbered I to VI) each containing 6 mice. Animals of groups I and II were administered 87.1 mg/kg b.w.(body weight) and 43.5 mg/kg b.w. respectively of thiamethoxam. Group III animals, lead acetate was administered orally and IV and V mice were administered combination of lead acetate and thiamethoxam at higher and lower dose level for 28 days. The group VI was control group. On 29th day and humoral and cell mediated immune responses, TLC (Total leukocyte count), DLC (Differential leukocyte count), serum total protein, globulin and albumin, and histopathological studies were conducted. Result: The result obtained clearly indicated that on oral administration of thiamethoxam immunotoxicity was induced in mice in dose related manner. Lead acetate when administered for 28 days showed immunotoxic potential. Thiamethoxam and lead acetate when administered together did not lead to any new altered immunotoxic response but additive toxic effects of both were observed. PMID:25538329

Approaches and considerations for the assessment of immunotoxicity for environmental chemicals: a workshop summary.

PubMed

Boverhof, Darrell R; Ladics, Greg; Luebke, Bob; Botham, Jane; Corsini, Emanuela; Evans, Ellen; Germolec, Dori; Holsapple, Michael; Loveless, Scott E; Lu, Haitian; van der Laan, Jan Willem; White, Kimber L; Yang, Yung

2014-02-01

As experience is gained with toxicology testing and as new assays and technologies are developed, it is critical for stakeholders to discuss opportunities to advance our overall testing strategies. To facilitate these discussions, a workshop on practices for assessing immunotoxicity for environmental chemicals was held with the goal of sharing perspectives on immunotoxicity testing strategies and experiences, developmental immunotoxicity (DIT), and integrated and alternative approaches to immunotoxicity testing. Experiences across the chemical and pharmaceutical industries suggested that standard toxicity studies, combined with triggered-based testing approaches, represent an effective and efficient approach to evaluate immunotoxic potential. Additionally, discussions on study design, critical windows, and new guideline approaches and experiences identified important factors to consider before initiating DIT evaluations including assay choice and timing and the impact of existing adult data. Participants agreed that integrating endpoints into standard repeat-dose studies should be considered for fulfilling any immunotoxicity testing requirements, while also maximizing information and reducing animal use. Participants also acknowledged that in vitro evaluation of immunosuppression is complex and may require the use of multiple assays that are still being developed. These workshop discussions should contribute to developing an effective but more resource and animal efficient approach for evaluating chemical immunotoxicity. Copyright © 2013 Elsevier Inc. All rights reserved.

Investigations into the Immunotoxicity and Allergic Potential Induced by Topical Application of N-Butylbenzenesulfonamide (NBBS) in a Murine Model

PubMed Central

Marrocco, Antonella; Meade, B. Jean; Long, Carrie M.; Lukomska, Ewa; Marshall, Nikki B.; Anderson, Stacey E.

2015-01-01

N-Butylbenzene sulfonamide (NBBS) is a commonly used plasticizer found in numerous products. Due to its extensive use, lack of adequate toxicological data, and suspicion of toxicity based on the presence of structural alerts, it was nominated to the National Toxicology Program for comprehensive toxicological testing. The purpose of this study was to evaluate the potential for hypersensitivity and immune suppression following dermal exposure to NBBS using a murine model. NBBS tested negative in a combined irritancy/local lymph node assay (LLNA), classifying it as nonirritating and nonsensitizing. To estimate the immunosuppressive potential of NBBS, assays that assessed immunotoxicity were performed, including the immumnoglobulin (Ig) M response to T-cell-dependent antigen sheep red blood cells (SRBC), using the plaque-forming cell (PFC) assay and immune cell phenotyping. After a 28-d treatment with NBBS, mice exposed to the lowest concentration (25% NBBS) showed a significant increase in IgM-producing B cells in the spleen. No marked changes were identified in immune cell markers in the lymph node. In contrast to body weight, a significant elevation in kidney and liver weight was observed following dermal exposure to all concentrations of NBBS. These results demonstrate that dermal exposure to NBBS, other than liver and kidney toxicity, did not apparently induce immunotoxicity in a murine model. PMID:26291892

Microbial Volatile Organic Compound Emissions from Stachybotrys chartarum growing on Gypsum Wallboard and Ceiling tile

EPA Science Inventory

This study compared seven toxigenic strains of S. chartarum found in water-damaged buildings to characterize the microbial volatile organic compound (MVOC) emissions profile while growing on gypsum wallboard (W) and ceiling tile (C) coupons. The inoculated coupons with their sub...

Immunotoxicity -- The Risk is Real

EPA Science Inventory

Several papers published over the last year represent significant progress in closing the gap between rodent immunotoxicity data and human risk and indicate that, at least for the developing immune system, the concern raised by rodent data is justified. The studies reviewed here...

Investigation of the Hepatotoxic and Immunotoxic Effects of the Peroxisome Proliferator Perfluorodecanoic Acid

DTIC Science & Technology

1991-04-30

np. A #127 6Investigation of the Hepatotoxic and OHIO Immunotoxic Effects of the Peroxisome AJE Proliferator Perfluorodecanoic Acid Donald E. Frazier...Investigation of the Hepatotoxic and Immunotoxic Effects G-AFOSR 90-0371 of the Peroxisome Proliferator Perfluorodecanoic Acid TA - 2312/A5 L AUTMOS) Donald E...involved evaluation of the immunotoxic and toxic effects of perfluorodecanoic acid (PFDA). Eight day exposure to PFDA caused thymic atrophy with marked

PERFLUORINATED COMPOUNDS: EMERGING POPs WITH POTENTIAL IMMUNOTOXICITY

PubMed Central

Corsini, Emanuela; Luebke, Robert W.; Germolec, Dori R.; DeWitt, Jamie C.

2015-01-01

Perfluorinated compounds (PFCs) have been recognized as an important class of environmental contaminants commonly detected in blood samples of both wildlife and humans. These compounds have been in use for more than 60 years as surface treatment chemicals, polymerization aids, and surfactants. They possess a strong carbon-fluorine bond, which leads to their environmental persistence. There is evidence from both epidemiology and laboratory studies that PFCs may be immunotoxic, affecting both cell-mediated and humoral immunity. Reported effects of PFCs include decreased spleen and thymus weights and cellularity, reduced antibody production, reduced survival after influenza infection, and altered cytokine production. Immunosuppression is a critical effect associated with exposure to PFCs, as it has been reported to reduce antibody responses to vaccination in children. Mounting evidence suggests that immunotoxicity in experimental animals can occur at serum concentrations below, within, or just above the reported range for highly exposed humans and wildlife. Considering bioaccumulation and exposure to multiple PFCs, the risk of immunotoxicity for humans and wildlife cannot be discounted. This review will discuss current and recently published work exploring the immunomodulatory effects of PFCs in experimental animals and humans. PMID:24503008

Evaluation of Stachybotrys chartarum in the house of an infant with pulmonary hemorrhage: quantitative assessment before, during, and after remediation.

PubMed

Vesper, S; Dearborn, D G; Yike, I; Allan, T; Sobolewski, J; Hinkley, S F; Jarvis, B B; Haugland, R A

2000-03-01

Stachybotrys chartarum is an indoor mold that has been associated with pulmonary hemorrhage cases in the Cleveland, Ohio, area. This study applied two new quantitative measurements to air samples from a home in which an infant developed PH. Quantitative polymerase chain reaction and a protein synthesis inhibition assay were used to determine the level of S. chartarum spores and their toxicity in air samples taken before, during, and after a remediation program was implemented to remove the fungus. Initial spore concentrations were between 0.1 and 9.3 spores/m3 of air, and the toxicity of air particulates was correspondingly low. However, the dust in the house contained between 0.4 and 2.1 x 10(3) spores/mg (as determined by hemocytometer counts). The remediation program removed all contaminated wallboard, paneling, and carpeting in the water-damaged areas of the home. In addition, a sodium hypochlorite solution was used to spray all surfaces during remediation. Although spore counts and toxicity were high during remediation, air samples taken postremediation showed no detectable levels of S. chartarum or related toxicity. Nine isolates of S. chartarum obtained from the home were analyzed for spore toxicity, hemolytic activity, and random amplified polymorphic DNA banding patterns. None of the isolates produced highly toxic spores (>90 microg T2 toxin equivalents per gram wet weight spores) after growth for 10 and 30 days on wet wallboard, but three isolates were hemolytic consistently. DNA banding patterns suggested that at least one of these isolates was related to isolates from homes of infants with previously investigated cases.

Differential Immunotoxicity Induced by Two Different Windows of Developmental Trichloroethylene Exposure

PubMed Central

Gilbert, Kathleen M.; Woodruff, William; Blossom, Sarah J.

2014-01-01

Developmental exposure to environmental toxicants may induce immune system alterations that contribute to adult stage autoimmune disease. We have shown that continuous exposure of MRL+/+ mice to trichloroethylene (TCE) from gestational day (GD) 0 to postnatal day (PND) 49 alters several aspects of CD4+ T cell function. This window of exposure corresponds to conception-adolescence/young adulthood in humans. More narrowly defining the window of TCE developmental exposure causes immunotoxicity that would establish the stage at which avoidance and/or intervention would be most effective. The current study divided continuous TCE exposure into two separate windows, namely, gestation only (GD0 to birth (PND0)) and early-life only (PND0-PND49). The mice were examined for specific alterations in CD4+ T cell function at PND49. One potentially long-lasting effect of developmental exposure, alterations in retrotransposon expression indicative of epigenetic alterations, was found in peripheral CD4+ T cells from both sets of developmentally exposed mice. Interestingly, certain other effects, such as alterations in thymus cellularity, were only found in mice exposed to TCE during gestation. In contrast, expansion of memory/activation cell subset of peripheral CD4+ T cells were only found in mice exposed to TCE during early life. Different windows of developmental TCE exposure can have different functional consequences. PMID:24696780

Subacute immunotoxicity of the marine phycotoxin yessotoxin in rats.

PubMed

Ferreiro, Sara F; Vilariño, Natalia; Carrera, Cristina; Louzao, M Carmen; Santamarina, Germán; Cantalapiedra, Antonio G; Cifuentes, J Manuel; Vieira, Andrés C; Botana, Luis M

2017-04-01

Yessotoxin (YTX) is a marine phycotoxin produced by dinoflagellates and accumulated in filter feeding shellfish. YTX content in shellfish is regulated by many food safety authorities to protect human health, although currently no human intoxication episodes have been unequivocally related to YTX presence in food. The immune system has been proposed as one of the target organs of YTX due to alterations of lymphoid tissues and cellular and humoral components. The aim of the present study was to explore subacute immunotoxicity of YTX in rats by evaluating the haematological response, inflammatory cytokine biomarkers and the presence of YTX-induced structural alterations in the spleen and thymus. The results showed that repeated administrations of YTX caused a decrease of lymphocyte percentage and an increase of neutrophil counts, a reduction in interleukine-6 (IL-6) plasmatic levels and histopathological splenic alterations in rats after four intraperitoneal injections of YTX at doses of 50 or 70 μg/kg that were administered every 4 days along a period of 15 days. Therefore, for the first time, subacute YTX-immunotoxicity is reported in rats, suggesting that repeated exposures to low amounts of YTX might also suppose a threat to human health, especially in immuno-compromised populations. Copyright © 2017 Elsevier Ltd. All rights reserved.

Acute exposure to waterborne cadmium induced oxidative stress and immunotoxicity in the brain, ovary and liver of zebrafish (Danio rerio).

PubMed

Zheng, Jia-Lang; Yuan, Shuang-Shuang; Wu, Chang-Wen; Lv, Zhen-Ming

2016-11-01

Cadmium (Cd) is an environmental contaminant that poses serious risks to aquatic organisms and their associated ecosystem. The mechanisms underlying Cd-induced oxidative stress and immunotoxicity in fish remain largely unknown. In this study, adult female zebrafish were exposed to 0 (control), 1mgL -1 Cd for 24h and 96h, and the oxidative stress and inflammatory responses induced by Cd were evaluated in the brain, liver and ovary. Reactive oxygen species (ROS), nitric oxide (NO), and malondialdehyde (MDA) increased in a time-dependent manner after treatment with Cd in the brain and liver. The increase may result from the disturbance of genes including copper and zinc superoxide dismutase (Cu/Zn-SOD), catalase (CAT), inducible nitric oxide synthase (iNOS), and ciclooxigenase-2 (COX-2) at mRNA, protein and activity levels. Although ROS, NO and MDA were not significantly affected by Cd in the ovary, the up-regulation of Cu/Zn-SOD, CAT, iNOS, and COX-2 was observed. Exposure to Cd induced a sharp increase in the protein levels of tumor necrosis factor alpha (TNF-α) in the brain, liver and ovary, possibly contributing to activate inflammatory responses. Furthermore, we also found a dramatic increase in mRNA levels of NF-E2-related factor 2 (Nrf2) and nuclear transcription factor κB (NF-κB) at 24h in the liver and ovary. The corresponding changes in the mRNA levels of Kelch-like-ECH-associated protein 1 (Keap1a and Keap1b) and the inhibitor of κBα (IκBαa and IκBαb) may contribute to regulate the transcriptional activity of Nrf2 and NF-κB, respectively. Contrarily, mRNA levels of Nrf2, NF-κB, Keap1, Keap1b, IκBαa and IκBαb remained stable at 24 and 96h in the brain. Taken together, we demonstrated Cd-induced oxidative stress and immunotoxicity in fish, possibly through transcriptional regulation of Nrf2 and NF-κB and gene modifications at transcriptional, translational, post-translational levels, which would greatly extend our understanding on the Cd

Indoor mold, toxigenic fungi, and Stachybotrys chartarum: infectious disease perspective.

PubMed

Kuhn, D M; Ghannoum, M A

2003-01-01

Damp buildings often have a moldy smell or obvious mold growth; some molds are human pathogens. This has caused concern regarding health effects of moldy indoor environments and has resulted in many studies of moisture- and mold-damaged buildings. Recently, there have been reports of severe illness as a result of indoor mold exposure, particularly due to Stachybotrys chartarum. While many authors describe a direct relationship between fungal contamination and illness, close examination of the literature reveals a confusing picture. Here, we review the evidence regarding indoor mold exposure and mycotoxicosis, with an emphasis on S. chartarum. We also examine possible end-organ effects, including pulmonary, immunologic, neurologic, and oncologic disorders. We discuss the Cleveland infant idiopathic pulmonary hemorrhage reports in detail, since they provided important impetus for concerns about Stachybotrys. Some valid concerns exist regarding the relationship between indoor mold exposure and human disease. Review of the literature reveals certain fungus-disease associations in humans, including ergotism (Claviceps species), alimentary toxic aleukia (Fusarium), and liver disease (Aspergillys). While many papers suggest a similar relationship between Stachybotrys and human disease, the studies nearly uniformly suffer from significant methodological flaws, making their findings inconclusive. As a result, we have not found well-substantiated supportive evidence of serious illness due to Stachybotrys exposure in the contemporary environment. To address issues of indoor mold-related illness, there is an urgent need for studies using objective markers of illness, relevant animal models, proper epidemiologic techniques, and examination of confounding factors.

DESTRUCTION OF ASPERGILLUS VERSICOLOR, PENICILLIUM CRYSOGENUM, STACHYBOTRYS CHARTARUM, AND CLADOSPORIUM CLADOSPORIDES SPORES USING CHEMICAL OXIDATION TREATMENT PROCESS

EPA Science Inventory

The survival of aqueous suspensions of Penicillium chrysogenum, Stachybotrys chartarum, Aspergillus versicolor, and Cladosporium cladosporioides spores was evaluated using various combinations of hydrogen peroxide and iron (II) as catalyst. Spores were suspended in water and trea...

The relative allergenicity of Stachybotrys chartarum compared to house dust mite extracts in a mouse model

EPA Science Inventory

A report by the Institute of Medicine suggested that more research is needed to better understand mold effects on allergic disease, particularly asthma development. The authors compared the ability of the fungus Stachybotrys chartarum (SCE) and house dust mite (HDM) extracts to i...

Analysis of pulmonary surfactant by Fourier-transform infrared spectroscopy following exposure to Stachybotrys chartarum (atra) spores.

PubMed

McCrae, K C; Rand, T; Shaw, R A; Mason, C; Oulton, M R; Hastings, C; Cherlet, T; Thliveris, J A; Mantsch, H H; MacDonald, J; Scott, J E

2001-03-01

Lung cells are among the first tissues of the body to be exposed to air-borne environmental contaminants. Consequently the function of these cells may be altered before other cells are affected. As gas exchange takes place in the lungs, changes in cellular function may have serious implications for the processes of oxygen uptake and carbon dioxide elimination. In order for these processes to occur, the lung must maintain a high degree of expandability. This latter function is accomplished in part by the pulmonary surfactant which is synthesized and released by alveolar type II cells. Earlier studies have shown that exposure to gas phase materials such as smoke or organic solvents can alter the composition and function of the surfactant. The present study examines the ability of highly toxigenic mold spores to alter surfactant composition. Stachybotrys chartarum spores suspended in saline were instilled into mouse trachea as described earlier. After 24 h, the lungs were lavaged and the different processing stages of surfactant isolated by repeated centrifugation. Intracellular surfactant was isolated from the homogenized lung tissue by centrifugation on a discontinuous sucrose gradient. Samples were extracted into chloroform-methanol, dried and analyzed by Fourier-Transform infrared spectroscopy (FTIR). Exposure to S. chartarum induced an overall reduction of phospholipid among the three surfactant subfractions. The intermediate and spent surfactant fractions in particular were reduced to about half of the values observed in the saline-treated group. The relative distribution of phospholipid was also altered by spore exposure. Within the intracellular surfactant pool, higher levels of phospholipid were detected after spore exposure. In addition, changes were observed in the nature of the phospholipids. In particular strong intramolecular hydrogen bonding, together with other changes, suggested that spore exposure was associated with absence of an acyl chain

ELISA MEASUREMENT OF STACHYLYSIN (TM) IN SERUM TO QUANTIFY HUMAN EXPOSURES TO THE INDOOR MOLD STACHYBOTRYS CHARTARUM

EPA Science Inventory

Antibodies were produced against the hemolytic agent stachylysin obtained from the mold Stachybotryis chartarum. These antibodies were used to develop two enzyme-linked immunosorbent assay (ELISA) methods for the analysis of stachylysin in human and rat sera and environmental sa...

Indoor Mold, Toxigenic Fungi, and Stachybotrys chartarum: Infectious Disease Perspective

PubMed Central

Kuhn, D. M.; Ghannoum, M. A.

2003-01-01

Damp buildings often have a moldy smell or obvious mold growth; some molds are human pathogens. This has caused concern regarding health effects of moldy indoor environments and has resulted in many studies of moisture- and mold-damaged buildings. Recently, there have been reports of severe illness as a result of indoor mold exposure, particularly due to Stachybotrys chartarum. While many authors describe a direct relationship between fungal contamination and illness, close examination of the literature reveals a confusing picture. Here, we review the evidence regarding indoor mold exposure and mycotoxicosis, with an emphasis on S. chartarum. We also examine possible end-organ effects, including pulmonary, immunologic, neurologic, and oncologic disorders. We discuss the Cleveland infant idiopathic pulmonary hemorrhage reports in detail, since they provided important impetus for concerns about Stachybotrys. Some valid concerns exist regarding the relationship between indoor mold exposure and human disease. Review of the literature reveals certain fungus-disease associations in humans, including ergotism (Claviceps species), alimentary toxic aleukia (Fusarium), and liver disease (Aspergillys). While many papers suggest a similar relationship between Stachybotrys and human disease, the studies nearly uniformly suffer from significant methodological flaws, making their findings inconclusive. As a result, we have not found well-substantiated supportive evidence of serious illness due to Stachybotrys exposure in the contemporary environment. To address issues of indoor mold-related illness, there is an urgent need for studies using objective markers of illness, relevant animal models, proper epidemiologic techniques, and examination of confounding factors. PMID:12525430

In vitro characterization of the immunotoxic potential of several perfluorinated compounds (PFCs).

PubMed

Corsini, Emanuela; Sangiovanni, Enrico; Avogadro, Anna; Galbiati, Valentina; Viviani, Barbara; Marinovich, Marina; Galli, Corrado L; Dell'Agli, Mario; Germolec, Dori R

2012-01-15

We have previously shown that PFOA and PFOS directly suppress cytokine secretion in immune cells, with different mechanisms of action. In particular, we have demonstrated a role for PPAR-α in PFOA-induced immunotoxicity, and that PFOS has an inhibitory effect on LPS-induced I-κB degradation. These studies investigate the immunomodulatory effects of four other PFCs, namely PFBS, PFOSA, PFDA, and fluorotelomer using in vitro assays. The release of the pro-inflammatory cytokines IL-6 and TNF-α was evaluated in lipolysaccharide (LPS)-stimulated human peripheral blood leukocytes (hPBL) and in the human promyelocytic cell line THP-1, while the release of IL-10 and IFN-γ was evaluated in phytohemagglutinin (PHA)-stimulated hPBL. All PFCs suppressed LPS-induced TNF-α production in hPBL and THP-1 cells, while IL-6 production was suppressed by PFOSA, PFOS, PFDA and fluorotelomer. PFBS, PFOSA, PFOS, PFDA and fluorotelomer inhibited PHA-induced IL-10 release, while IFN-γ secretion was affected by PFOSA, PFOS, PFDA and fluorotelomer. Leukocytes obtained from female donors appear to be more sensitive to the in vitro immunotoxic effects of PFCs when their responses are compared to the results obtained using leukocytes from male donors. Mechanistic investigations demonstrated that inhibition of TNF-α release in THP-1 cells occurred at the transcriptional level. All PFCs, including PFOA and PFOS, decreased LPS-induced NF-κB activation. With the exception of PFOA, none of the PFCs tested was able to activate PPARα driven transcription in transiently transfected THP-1 cells, excluding a role for PPARα in the immunomodulation observed. PFBS and PFDA prevented LPS-induced I-κB degradation. Overall, these studies suggest that PFCs affect NF-κB activation, which directly suppresses cytokine secretion by immune cells. Our results indicate that PFOA is the least active of the PFCs examined followed by PFBS, PFDA, PFOS, PFOSA and fluorotelomer. Copyright © 2011 Elsevier Inc

In vivo immunotoxicity evaluation of Gd2O3 nanoprobes prepared by laser ablation in liquid for MRI preclinical applications

NASA Astrophysics Data System (ADS)

Tian, Xiumei; Guan, Xiaoying; Luo, Ningqi; Yang, Fanwen; Chen, Dihu; Peng, Ye; Zhu, Jixiang; He, Fupo; Li, Li; Chen, Xiaoming

2014-09-01

Gd2O3 nanoprobes prepared by laser ablation in liquid can be used as magnetic resonance imaging contrast agent. However, their immunotoxicity in vivo remains unknown. In this article, the in vitro biocompatibility of the Gd2O3 nanoprobe was evaluated in terms of cell uptake, cell viability, and apoptosis. In vivo immunotoxicity was detected by monitoring the levels of the immunity mediator, cluster of differentiation (CD) markers in Balb/c mice. The results show that no in vitro cytotoxicity was observed, and no significant changes in the expression levels of CD206 and CD69 between the nanoprobe-injected group and the Gd-DTPA group in mice were observed. Importantly, the immunotoxicity data revealed significant differences in the expression levels of CD40, CD80, CD11b, and reactive oxygen species. In addition, transmission electron microscopy images showed that few Gd2O3 nanoprobes were localized in phagosomes by the endocytic pathway. In conclusion, the toxic effects of our Gd2O3 nanoprobe may be due to endocytosis during which the microstructure or ultrastructure of cells is slightly damaged and induces the generation of an oxidative stress reaction that further stimulates the innate immune response. Therefore, it is important to use a sensitive assay for the in vivo immunotoxicity measurements to evaluate the risk assessment of Gd2O3-based biomaterials at the molecular level.

Immunotoxicity and allergic potential induced by topical application of dimethyl carbonate (DMC) in a murine model

PubMed Central

Anderson, Stacey E.; Franko, Jennifer; Anderson, Katie L.; Munson, Albert E.; Lukomska, Ewa; Meade, B. Jean

2015-01-01

Dimethyl carbonate (DMC) is an industrial chemical, used as a paint and adhesive solvent, with the potential for significant increases in production. Using select immune function assays, the purpose of these studies was to evaluate the immunotoxicity of DMC following dermal exposure using a murine model. Following a 28-day exposure, DMC produced a significant decrease in thymus weight at concentrations of 75% and greater. No effects on body weight, hematological parameters (erythrocytes, leukocytes, and their differentials), or immune cell phenotyping (B-cells, T-cells, and T-cell sub-sets) were identified. The IgM antibody response to sheep red blood cell (SRBC) was significantly reduced in the spleen but not the serum. DMC was not identified to be an irritant and evaluation of the sensitization potential, conducted using the local lymph node assay (LLNA) at concentrations ranging from 50–100%, did not identify increases in lymphocyte proliferation. These results demonstrate that dermal exposure to DMC induces immune suppression in a murine model and raise concern about potential human exposure and the need for occupational exposure regulations. PMID:22953780

RESPIRATORY PHYSIOLOGICAL AND ALLERGIC-TYPE RESPONSES TO AN EXTRACT OF STACHYBOTRYS CHARTARUM IN BALB/C MICE

EPA Science Inventory

RESPIRATORY PHYSIOLOGICAL AND ALLERGIC-TYPE RESPONSES TO AN EXTRACT OF Stachybotrys chartarum IN BALB/C MICE. ME Viana1, N Haykal-Coates2, S H Gavett2, MJ Selgrade2, and M D W Ward2. 1APR/CVM, NCSU, Raleigh, NC, USA. 2NHEERL, ORD, US EPA, RTP, NC, USA.
Rationale: assess the ab...

Hemolysis, Toxicity, and Randomly Amplified Polymorphic DNA Analysis of Stachybotrys chartarum Strains

PubMed Central

Vesper, Stephen J.; Dearborn, Dorr G.; Yike, Iwona; Sorenson, W. G.; Haugland, Richard A.

1999-01-01

Stachybotrys chartarum is an indoor air, toxigenic fungus that has been associated with a number of human and veterinary health problems. Most notable among these has been a cluster of idiopathic pulmonary hemorrhage cases that were observed in the Cleveland, Ohio, area. In this study, 16 strains of S. chartarum isolated from case (n = 8) or control (n = 8) homes in Cleveland and 12 non-Cleveland strains from diverse geographic locations were analyzed for hemolytic activity, conidial toxicity, and randomly amplified polymorphic DNA banding patterns. In tests for hemolytic activity, strains were grown at 23°C on wet wallboard pieces for an 8-week test period. Conidia from these wallboard pieces were subcultured on sheep’s blood agar once a week over this period and examined for growth and clearing of the medium at 37 or 23°C. Five of the Cleveland strains (all from case homes) showed hemolytic activity at 37°C throughout the 8-week test compared to 3 of the non-Cleveland strains. Five of the Cleveland strains, compared to two of the non-Cleveland strains, produced highly toxic conidia (>90 μg of T2 toxin equivalents per g [wet weight] of conidia) after 10 and 30 days of growth on wet wallboard. Only 3 of the 28 strains examined both were consistently hemolytic and produced highly toxic conidia. Each of these strains was isolated from a house in Cleveland where an infant had idiopathic pulmonary hemorrhage. PMID:10388719

Hemolysis, toxicity, and randomly amplified polymorphic DNA analysis of Stachybotrys chartarum strains.

PubMed

Vesper, S J; Dearborn, D G; Yike, I; Sorenson, W G; Haugland, R A

1999-07-01

Stachybotrys chartarum is an indoor air, toxigenic fungus that has been associated with a number of human and veterinary health problems. Most notable among these has been a cluster of idiopathic pulmonary hemorrhage cases that were observed in the Cleveland, Ohio, area. In this study, 16 strains of S. chartarum isolated from case (n = 8) or control (n = 8) homes in Cleveland and 12 non-Cleveland strains from diverse geographic locations were analyzed for hemolytic activity, conidial toxicity, and randomly amplified polymorphic DNA banding patterns. In tests for hemolytic activity, strains were grown at 23 degrees C on wet wallboard pieces for an 8-week test period. Conidia from these wallboard pieces were subcultured on sheep's blood agar once a week over this period and examined for growth and clearing of the medium at 37 or 23 degrees C. Five of the Cleveland strains (all from case homes) showed hemolytic activity at 37 degrees C throughout the 8-week test compared to 3 of the non-Cleveland strains. Five of the Cleveland strains, compared to two of the non-Cleveland strains, produced highly toxic conidia (>90 microgram of T2 toxin equivalents per g [wet weight] of conidia) after 10 and 30 days of growth on wet wallboard. Only 3 of the 28 strains examined both were consistently hemolytic and produced highly toxic conidia. Each of these strains was isolated from a house in Cleveland where an infant had idiopathic pulmonary hemorrhage.

AMP-Conjugated Quantum Dots: Low Immunotoxicity Both In Vitro and In Vivo

NASA Astrophysics Data System (ADS)

Dai, Tongcheng; Li, Na; Liu, Lu; Liu, Qin; Zhang, Yuanxing

2015-11-01

Quantum dots (QDs) are engineered nanoparticles that possess special optical and electronic properties and have shown great promise for future biomedical applications. In this work, adenosine 5'-monophosphate (AMP), a small biocompatible molecular, was conjugated to organic QDs to produce hydrophilic AMP-QDs. Using macrophage J774A.1 as the cell model, AMP-QDs exhibited both prior imaging property and low toxicity, and more importantly, triggered limited innate immune responses in macrophage, indicating low immunotoxicity in vitro. Using BALB/c mice as the animal model, AMP-QDs were found to be detained in immune organs but did not evoke robust inflammation responses or obvious histopathological abnormalities, which reveals low immunotoxicity in vivo. This work suggests that AMP is an excellent surface ligand with low immunotoxicity, and potentially used in surface modification for more extensive nanoparticles.

Investigations of immunotoxicity and allergic potential induced by topical application of triclosan in mice

PubMed Central

Anderson, Stacey E.; Meade, B. Jean; Long, Carrie M.; Lukomska, Ewa; Marshall, Nikki B.

2016-01-01

Triclosan is an antimicrobial chemical commonly used occupationally and by the general public. Using select immune function assays, the purpose of these studies was to evaluate the immunotoxicity of triclosan following dermal exposure using a murine model. Triclosan was not identified to be a sensitizer in the murine local lymph node assay (LLNA) when tested at concentrations ranging from 0.75–3.0%. Following a 28-day exposure, triclosan produced a significant increase in liver weight at concentrations of ≥ 1.5%. Exposure to the high dose (3.0%) also produced a significant increase in spleen weights and number of platelets. The absolute number of B-cells, T-cells, dendritic cells and NK cells were significantly increased in the skin draining lymph node, but not the spleen. An increase in the frequency of dendritic cells was also observed in the lymph node following exposure to 3.0% triclosan. The IgM antibody response to sheep red blood cells (SRBC) was significantly increased at 0.75% – but not at the higher concentrations – in the spleen and serum. These results demonstrate that dermal exposure to triclosan induces stimulation of the immune system in a murine model and raise concerns about potential human exposure. PMID:25812624

N-acetylcysteine reverses immunotoxic effects of methyl mercury and augments murine lymphocyte proliferation in vitro

DOE Office of Scientific and Technical Information (OSTI.GOV)

Omara, F.; Fournier, M.; Bernier, J.

1995-12-31

N-Acetylcysteine (NAC) is a thiol antioxidant used clinically to treat chronic inflammatory lung disorders and acetaminophen poisoning in humans. The authors evaluated in vitro the effect of NAC on mitogen-induced blastogenesis in C57BI/6 mouse splenocytes by {sup 3}H-thymidine uptake, and its ability to protect against the immunotoxic effects of methyl mercury on lymphocyte proliferation. Lymphocyte proliferation stimulated by optimal and suboptimal concentrations of concanavalin A (Con A), lipopolysaccharide (LPS), or a combination of calcium ionophore A23187 and phorbol-12-myristate-13-acetate (PMA) were markedly enhanced by NAC. NAC itself was a weak mitogen. The kinetics of the NAC effect on splenocyte proliferation weremore » mitogen dependent. NAC enhanced Con A-induced splenocyte proliferation in a dose-dependent and linear manner but enhanced the LPS-induced response at 50--400 {micro}g/ml of NAC followed by a decline in response to control value at higher concentrations. In splenocytes stimulated with PMA plus A23187, NAC increased proliferation at 50--200 pg/ml followed by a constant response at 200--1,000 {micro}g/ml NAC. When splenocytes were stimulated with higher concentrations of Con A (10 {micro}g/ml) or LPS (150 {micro}g/ml) which markedly suppress splenocyte proliferation, NAC significantly enhanced the Con A-induced response and reversed the inhibitory effect of high concentrations of LPS. NAC also protected lymphocytes against mitogen activation-induced cell death. Methyl mercury at 5 {times} 10{sup {minus}7}--1 {times} 10{sup {minus}6} suppressed Con A- and LPS-induced splenocyte proliferation by over 80%. However, NAC completely reversed the immunotoxic effects of methyl mercury on the mitogen-induced splenocyte proliferation even when the cells were pre-incubated with methyl mercury for 6 or 24 hr before stimulation with the mitogens.« less

QUANTITATIVE MEASUREMENT OF STACHYBOTRYS CHARTARUM CONIDIA USING REAL TIME DETECTION OF PCR PRODUCTS WITH THE TAQMAN TM FLUOROGENIC PROBE SYSTEM

EPA Science Inventory

The occurence of Stachybotrys chartarum in indoor environments has been associated with a number of human health concerns, including fatal pulmonary haemosiderosis in infants. Currently used culture-based and microscopic methods of fungal species identification are poorly suited ...

Carcinogenicity and Immunotoxicity of Embedded Depleted Uranium and Heavy-Metal Tungsten Alloy in Rodents

DTIC Science & Technology

2006-10-01

Embedded Depleted Uranium and Heavy-Metal Tungsten Alloy in Rodents PRINCIPAL INVESTIGATOR: John F. Kalinich, Ph.D...Carcinogenicity and Immunotoxicity of Embedded Depleted Uranium and Heavy- Metal Tungsten Alloy in Rodents 5b. GRANT NUMBER DAMD17-01-1-0821 5c...ABSTRACT This study investigated the carcinogenic and immunotoxic potential of embedded fragments of depleted uranium (DU) and a heavy-metal tungsten

EVALUATION OF STACHYBOTRYS CHARTARUM IN THE HOUSE OF AN INFANT WITH PULMONARY HEMORRHAGE: QUANTITATIVE ASSESSMENT BEFORE, DURING, AND AFTER REMEDIATION

EPA Science Inventory

Stachybotrys chartarum is an indoor mold that has been associated with pulmonary hemorrhage (PH) cases in the Cleveland, Ohio area. This study applied two new quantitative measurements to air samples from a home where an infant developed PH. Quantitative polymerase chain reacti...

Satratoxin-G from the black mold Stachybotrys chartarum induces rhinitis and apoptosis of olfactory sensory neurons in the nasal airways of rhesus monkeys.

PubMed

Carey, Stephan A; Plopper, Charles G; Hyde, Dallas M; Islam, Zahidul; Pestka, James J; Harkema, Jack R

2012-08-01

Satratoxin-G (SG) is a trichothecene mycotoxin of Stachybotrys chartarum, the black mold suggested to contribute etiologically to illnesses associated with water-damaged buildings. We have reported that intranasal exposure to SG evokes apoptosis of olfactory sensory neurons (OSNs) and acute inflammation in the nose and brain of laboratory mice. To further assess the potential human risk of nasal airway injury and neurotoxicity, we developed a model of SG exposure in monkeys, whose nasal airways more closely resemble those of humans. Adult, male rhesus macaques received a single intranasal instillation of 20 µg SG (high dose, n = 3), or 5 µg SG daily for four days (repeated low dose, n = 3) in one nasal passage, and saline vehicle in the contralateral nasal passage. Nasal tissues were examined using light and electron microscopy and morphometric analysis. SG induced acute rhinitis, atrophy of the olfactory epithelium (OE), and apoptosis of OSNs in both groups. High-dose and repeated low-dose SG elicited a 13% and 66% reduction in OSN volume density, and a 14-fold and 24-fold increase in apoptotic cells of the OE, respectively. This model provides new insight into the potential risk of nasal airway injury and neurotoxicity caused by exposure to water-damaged buildings.

In vitro characterization of the immunotoxic potential of several perfluorinated compounds (PFCs)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Corsini, Emanuela, E-mail: emanuela.corsini@unimi.it; Sangiovanni, Enrico; Avogadro, Anna

2012-01-15

We have previously shown that PFOA and PFOS directly suppress cytokine secretion in immune cells, with different mechanisms of action. In particular, we have demonstrated a role for PPAR-α in PFOA-induced immunotoxicity, and that PFOS has an inhibitory effect on LPS-induced I-κB degradation. These studies investigate the immunomodulatory effects of four other PFCs, namely PFBS, PFOSA, PFDA, and fluorotelomer using in vitro assays. The release of the pro-inflammatory cytokines IL-6 and TNF-α was evaluated in lipolysaccharide (LPS)-stimulated human peripheral blood leukocytes (hPBL) and in the human promyelocytic cell line THP-1, while the release of IL-10 and IFN-γ was evaluated inmore » phytohemagglutinin (PHA)-stimulated hPBL. All PFCs suppressed LPS-induced TNF-α production in hPBL and THP-1 cells, while IL-6 production was suppressed by PFOSA, PFOS, PFDA and fluorotelomer. PFBS, PFOSA, PFOS, PFDA and fluorotelomer inhibited PHA-induced IL-10 release, while IFN-γ secretion was affected by PFOSA, PFOS, PFDA and fluorotelomer. Leukocytes obtained from female donors appear to be more sensitive to the in vitro immunotoxic effects of PFCs when their responses are compared to the results obtained using leukocytes from male donors. Mechanistic investigations demonstrated that inhibition of TNF-α release in THP-1 cells occurred at the transcriptional level. All PFCs, including PFOA and PFOS, decreased LPS-induced NF-κB activation. With the exception of PFOA, none of the PFCs tested was able to activate PPARα driven transcription in transiently transfected THP-1 cells, excluding a role for PPARα in the immunomodulation observed. PFBS and PFDA prevented LPS-induced I-κB degradation. Overall, these studies suggest that PFCs affect NF-κB activation, which directly suppresses cytokine secretion by immune cells. Our results indicate that PFOA is the least active of the PFCs examined followed by PFBS, PFDA, PFOS, PFOSA and fluorotelomer. -- Research Highlights: �

The immunotoxicity of 3,3{prime},4,4{prime},5-pentachlorobiphenyl (PeCB) and tributyltin (TBT) in channel catfish, Ictalurus punctatus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rice, C.D.; Banes, M.M.; Hurt, K.L.

1994-12-31

There is considerable evidence that planar PCBs and Tributyltin (TBT) may be immunotoxic to fish. Apparently the immune system is a target organ for both compounds in rodents. The mechanisms of action are different as PeCB immunotoxicity is associated with cytosolic Ah-R binding and induction of several nuclear response elements while TBT immunotoxicity is associated with membrane perturbation and layered calcium homeostasis. The authors have investigated the effects of a single i.p. dose of PeCB and TBT at 0.01, 0.1, 1.0 mg/kg on several innate immune responses including non-specific cytotoxic cell activity, neutrophil activation, and lymphocyte mitogenesis, as well asmore » baseline hematology at days 3 and 7 post treatment. Hematocrits were affected in TBT treated fish at 1.0 mg/kg while neutrophilia and leukopenia were noted at 0.01 and 1.0 mg/kg. These observations are typical of stress hemograms. PeCB had no adverse effect on hematocrits or leukocyte % but did induce neutrophilia at 1.0 mg/kg. Neutrophil activation was suppressed in both PeCB and TBT treated animals but only at 1.0 mg/kg. NCC activity was suppressed at all three doses of PECB but only 1.0 mg/kg in TBT treated animals. Lymphocyte mitogenesis was affected by both compounds but only at 1.0 mg/kg. A note of interest is that both compounds have the same molecular weight and therefore their immunotoxic effects can be compared on a {micro}mole/kg basis.« less

Allergic Potential and Immunotoxicity Induced by Topical Application of 1-Chloro-4-(Trifluoromethyl)Benzene (PCBTF) in a Murine Model

PubMed Central

Franko, Jennifer; Jackson, Laurel G.; Meade, B. Jean; Anderson, Stacey E.

2011-01-01

The purpose of the studies in this paper was to evaluate the allergic potential, immunotoxicity, and irritancy of the occupationally relevant chemical, 1-chloro-4-(trifluoromethyl)benzene, also known as parachlorobenzotrifluoride (PCBTF), following dermal exposure in a murine model. Evaluation of the sensitization potential, conducted using the local lymph node assay (LLNA) at concentrations ranging from 50% to 100%, identified a dose-dependent increase in lymphocyte proliferation with a calculated EC3 value of 53.1%. While no elevations in total or specific IgE were observed after exposure to any concentration of the chemical, significant increases in IFN-γ protein production by stimulated draining lymphoid cells were observed, indicating a T-cell-mediated response. Dermal exposure to PCBTF was not found to alter the immune response to a T-cell-dependant antigen. These results demonstrate that PCBTF has the potential to induce allergic sensitization following dermal exposure and based on LLNA results would be classified as a weak sensitizer. PMID:21747864

IMMUNOTOXICITY OF INDIVIDUAL ORGANOTIN COMPOUNDS IN SPRAGUE-DAWLEY RATS

EPA Science Inventory

Organotins, used as stabilizers for polyvinyl chloride pipe, leach into drinking water from supply pipes and may cause multisystem toxicity, including immunotoxicity. We assessed immune function in Sprague-Dawley rats exposed to dibutyltin dichloride (DBTC) or dimethyltin dichlor...

Biological Responses of Raw 264.7 Macrophage Exposed to Two Strains of Stachybotrys chartarum Spores Grown on Four Different Wallboard Types

EPA Science Inventory

The focus of this research was to provide a better understanding of the health impacts caused by Stachybotrys chartarum (Houston and 51-11) spores grown on four gypsum products two of which were resistant to microbes. Raw 264.7 cells were exposed to whole spores and fragmented 51...

Detection of airborne Stachybotrys chartarum macrocyclic trichothecene mycotoxins on particulates smaller than conidia.

PubMed

Brasel, T L; Douglas, D R; Wilson, S C; Straus, D C

2005-01-01

Highly respirable particles (diameter, <1 microm) constitute the majority of particulate matter found in indoor air. It is hypothesized that these particles serve as carriers for toxic compounds, specifically the compounds produced by molds in water-damaged buildings. The presence of airborne Stachybotrys chartarum trichothecene mycotoxins on particles smaller than conidia (e.g., fungal fragments) was therefore investigated. Cellulose ceiling tiles with confluent Stachybotrys growth were placed in gas-drying containers through which filtered air was passed. Exiting particulates were collected by using a series of polycarbonate membrane filters with decreasing pore sizes. Scanning electron microscopy was employed to determine the presence of conidia on the filters. A competitive enzyme-linked immunosorbent assay (ELISA) specific for macrocyclic trichothecenes was used to analyze filter extracts. Cross-reactivity to various mycotoxins was examined to confirm the specificity. Statistically significant (P < 0.05) ELISA binding was observed primarily for macrocyclic trichothecenes at concentrations of 50 and 5 ng/ml and 500 pg/ml (58.4 to 83.5% inhibition). Of the remaining toxins tested, only verrucarol and diacetylverrucarol (nonmacrocyclic trichothecenes) demonstrated significant binding (18.2 and 51.7% inhibition, respectively) and then only at high concentrations. The results showed that extracts from conidium-free filters demonstrated statistically significant (P < 0.05) antibody binding that increased with sampling time (38.4 to 71.9% inhibition, representing a range of 0.5 to 4.0 ng/ml). High-performance liquid chromatography analysis suggested the presence of satratoxin H in conidium-free filter extracts. These data show that S. chartarum trichothecene mycotoxins can become airborne in association with intact conidia or smaller particles. These findings may have important implications for indoor air quality assessment.

Immunotoxicity of ochratoxin A and aflatoxin B1 in combination is associated with the nuclear factor kappa B signaling pathway in 3D4/21 cells.

PubMed

Hou, Lili; Gan, Fang; Zhou, Xuan; Zhou, Yajiao; Qian, Gang; Liu, Zixuan; Huang, Kehe

2018-05-01

The co-contamination of cereals, grains, crops, and animal feeds by mycotoxins is a universal problem. Humans and animals are exposed to several mycotoxins simultaneously as evidenced by extensive studies on this topic. Yet, most studies have addressed the effects of mycotoxins individually. Aflatoxin B1 and ochratoxin A can induce immunotoxicity. However, it remains unclear whether a combination of these mycotoxins aggravates immunotoxicity and the potential mechanism underlying this effect. In this study, we used the cell line 3D4/21, swine alveolus macrophages and innate immune cell. The results showed that the percentage of cell inhibition, annexin V/PI-positive rates, and the expression of pro-inflammatory cytokines (tumor necrosis factor alpha and interleukin-6) significantly increased and the release of lactate dehydrogenase and phagocytotic index were significantly decreased at different concentrations of aflatoxin B1 and ochratoxin A combination when compared with control. The combination of aflatoxin B1 and ochratoxin A significantly decreased the production of GSH and increased reactive oxygen species level. However, N-acetylcysteine suppressed the oxidative stress and alleviated the immunotoxicity induced by the combination. The combination of aflatoxin B1 and ochratoxin A markedly enhanced the degradation of IκBa, the phosphorylation of nuclear factor kappa B (p65), and the translocation of activated nuclear factor kappa B (NF-κB) into the nuclei as demonstrated by western blotting and confocal laser scanning microscopy. These effects could be reversed by BAY 11-7082, a specific inhibitor of NF-κB. Taken together, a combination of aflatoxin B1 and ochratoxin A could aggravate immunotoxicity by activating the NF-κB signaling pathway. Copyright © 2018 Elsevier Ltd. All rights reserved.

Modulatory role of dietary Chlorella vulgaris powder against arsenic-induced immunotoxicity and oxidative stress in Nile tilapia (Oreochromis niloticus).

PubMed

Zahran, Eman; Risha, Engy

2014-12-01

Arsenic intoxicant have long been regarded as an impending carcinogenic, genotoxic, and immunotoxic heavy metal to human and animals as well. In this respect, we evaluated biomarkers of the innate immune response and oxidative stress metabolism in gills and liver of Nile tilapia (Oreochromis niloticus) after arsenic exposure, and the protective role of Chlorella vulgaris (Ch) dietary supplementation were elucidated. Protective role of C. vulgaris (Ch), as supplementary feeds (5% and 10% of the diet) was studied in Nile tilapia (O. niloticus) against arsenic induced toxicity (NaAsO2 at 7 ppm) for 21 days exposure period. A significant down-regulation in innate immune response; including, respiratory burst, lysozyme, and bactericidal activity followed due to deliberately As(+3) exposure. Similarly, oxidative stress response; like nitric oxide (NO), catalase (CAT), glutathione (GSH), glutathione peroxidase (GPx), malondialdehyde (MDA) and hydrogen peroxide (H2O2) levels were significantly decreased. Combined treatment of Ch and As(+3) significantly enhanced the innate immune response and antioxidant activity. Strikingly, Ch supplementation at 10% has been considered the optimum for Nile tilapia since it exhibited enhancement of innate immune response and antioxidant activity over the level 5%, and even better than that of control level. Thus, our results concluded that dietary Ch supplementation could protect Nile tilapia against arsenic induced immunosuppression and oxidative stresses. Copyright © 2014 Elsevier Ltd. All rights reserved.

SOLVENT COMPARISON IN THE ISOLATION, SOLUBILIZATION, AND TOXICITY OF STACHYBOTRYS CHARTARUM SPORE TRICHOTHECENE MYCOTOXINS IN AN ESTABLISHED IN VITRO LUMINESCENCE PROTEIN TRANSLATION INHIBITION ASSAY

EPA Science Inventory

It is well known that non-viable mold contaminants such as macrocyclic trichothecene mycotoxins of Stachybotrys chartarum are highly toxinigenic to humans. However, there is no agreed upon method of recovering native mycotoxin. The purpose of this study was to provide quantitativ...

The influence of lime and nitrogen fertilisers on spore counts of Pithomyces chartarum in pasture.

PubMed

Cuttance, E L; Laven, R A; Mason, W A; Stevenson, M

2016-11-01

To determine whether the application of lime or nitrogen to pasture affected the spore counts of Pithomyces chartarum. The lime application studies were undertaken on a spring-calving, pasture-based, commercial dairy farm near Te Awamutu, New Zealand. On 6 November 2012, five randomly selected paddocks were split into three equal sections. In two of the sections, lime was applied at either 1.5 or 2.5 t/ha, and the central section was left as an untreated control. Each section was sampled for spore counting weekly from 16 January to 15 May 2013. Starting in January 2013, five other randomly selected paddocks were monitored for spore counts. On 20 March 2013 the average spore counts in three paddocks were >100,000 spores/g of pasture. These paddocks were then divided into three equal sections and lime was applied as described above. Spore counting in each section continued weekly until 15 May 2013. The nitrogen application study was carried out on three commercial dairy farms near Te Awamutu, New Zealand. Two randomly selected paddocks on each farm were divided into three equal sections and, on 20 December 2012, nitrogen in the form of urea was applied at either 50 or 80 kg urea/ha to two of the sections; the central section remained as an untreated control. Each section was sampled for spore counting weekly from 16 January to 15 May 2013. Following pre-summer lime application, treatment at 1.5 or 2.5 t/ha did not affect spore counts over time compared with the control section (p>0.26). Similarly following autumn lime application, treatment at 1.5 or 2.5 t/ha did not affect spore counts over time compared with the control section (p>0.11). Following nitrogen application median spore counts remained <20,000 spores/g pasture throughout the trial period and there was no effect of treatment on spore counts over time (p>0.49). This study found that application of lime before the risk period for facial eczema, in November, application of lime after a spore count

ENVIRONMENTAL POLLUTION AND THE IMMUNE SYSTEM: MECHANISMS OF IMMUNOTOXICITY ACROSS PHYLA

EPA Science Inventory

Environmental pollution and the immune system: Mechanisms of immunotoxicity across phyla. Bob Luebke and Dori Germolec, US EPA, RTP, NC and NIEHS, RTP, NC

Our current understanding of immunotoxicology comes largely from studies done in rodents or using in vitro systems, a...

[Expert consensus post-marketing evaluation scheme to detect immunotoxicity of Chinese medicine in clinical populations (draft version for comments)].

PubMed

Xie, Yan-Ming; Zhao, Yu-Bin; Jiang, Jun-Jie; Chang, Yan-Peng; Zhang, Wen; Shen, Hao; Lu, Peng-Fei

2013-09-01

Through consensus, establish a post-marketing scheme and the technical processes to evaluate Chinese medicine's immunotoxicity on a population, as well as its beneficial influences on the immune system. Provide regulations on the collection, storage and transportation of serum samples. This article applies to the post-marketing scientific evaluation of the immunotoxicity of parenterally administered, and for other ways of taking Chinese medicine.

Potential for amelioration of aflatoxin B1-induced immunotoxic effects in progeny of White Leghorn breeder hens co-exposed to vitamin E.

PubMed

Khan, Wajid Arshad; Khan, Muhammad Zargham; Khan, Ahrar; Ul Hassan, Zahoor; Saleemi, Muhammad Kashif

2014-01-01

This study was designed to evaluate the protective activity of Vitamin E (Vit E) on the immunotoxic effects induced by aflatoxin B1 (AFB1) in the progeny of breeder hens. For this purpose, 192 White Leghorn (WL) layer breeder hens were divided into 12 groups (A-L) and then fed test diets for either 1, 2 or 3 weeks. Group A was kept on basal feed (2900 Kcal/kg metabolizable energy) and served as control, while group B was offered a feed supplemented with Vit E at 100 mg/Kg. Groups C-G were offered feed containing 0.1, 0.5, 2.5, 5.0, and 10.0 mg/Kg AFB1, respectively, whereas groups H-L were offered the same dietary levels of AFB1 along with 100 mg/Kg Vit E supplementation. Hatching eggs were shifted to an incubator on a weekly basis to get progeny chicks. Hatched chicks in each group were maintained on basal ration and then subjected to different immunological assays. Lymphoproliferative responses (against PHA-P), antibody titers (against SRBC), oxidative damage to RBC, as well as phagocytic and nitrite production potential of the peritoneal macrophages from the chicks, were all adversely impacted by hen exposure to the higher doses of AFB1 or by increased intake (time) by the hens at a given dose of the toxin. No consistent ameliorative effects from Vit E were noted in these studies, i.e. effects seen against lower AFB1 doses were no longer apparent with the highest doses of AFB1. As such, for now it can be concluded that, with this particular single dose level of Vit E, AFB1-associated immunotoxic effects in progeny chicks can potentially be mitigated by dietary intake of Vit E by their hen dams. However, this is clearly an outcome that is driven by the level of the mycotoxin present in the feed. Future studies need to examine what impact higher Vit E doses than those employed herein might have in these ameliorative outcomes.

Computational tool for immunotoxic assessment of pyrethroids toward adaptive immune cell receptors.

PubMed

Kumar, Anoop; Behera, Padma Charan; Rangra, Naresh Kumar; Dey, Suddhasattya; Kant, Kamal

2018-01-01

Pyrethroids have prominently known for their insecticidal actions worldwide, but recent reports as anticancer and antiviral applications gained a lot of interest to further understand their safety and immunotoxicity. This encouraged us to carry out our present study to evaluate the interactions of pyrethroids toward adaptive immune cell receptors. Type 1 and Type 2 pyrethroids were tested on T (CD4 and CD8) and B (CD28 and CD45) immune cell receptors using Maestro 9.3 (Schrödinger, LLC, Cambridge, USA). In addition, top-ranked tested ligands were too explored for toxicity prediction in rodents using ProTOX tool. Pyrethroids (specifically type 2) such as fenvalerate (-5.534 kcal/mol: CD8), fluvalinate (-4.644 and - 4.431 kcal/mol: CD4 and CD45), and cypermethrin (-3.535 kcal/mol: CD28) have outcome in less energy or more affinity for B-cell and T-cell immune receptors which may later result in the immunosuppressive and hypersensitivity reactions. The current findings have uncovered that there is a further need to assess the Type 2 pyrethroids with wet laboratory experiments to understand the chemical nature of pyrethroid-induced immunotoxicity. Fenvalerate showed apex glide score toward CD8 immune receptor, while fluvalinate confirmed top-ranked binding with CD4 and CD45 immune proteinsIn addition, cypermethrin outcame in top glide score against CD28 immune receptorTop dock hits (Type 2) pyrethroids have shown probable toxicity targets toward AOFA: Amine oxidase (flavin-containing) A and PGH1: Prostaglandin G/H synthase 1, respectively. Abbreviations used: PDB: Protein Data Bank; AOFA: Amine oxidase (flavin-containing) A; PGH 1: Prostaglandin G/H synthase 1.

Immunotoxicity and genotoxicity testing for in-flight experiments under microgravity

NASA Astrophysics Data System (ADS)

Hansen, Peter-Diedrich; Hansen, Peter-Diedrich; Unruh, Eckehardt

Life Sciences as Related to Space (F) Influence of Spaceflight Environment on Biological Systems (F44) Immunotoxicity and genotoxicity testing for In-flight experiments under microgravity Sensing approaches for ecosystem and human health Author: Peter D. Hansen Technische Universit¨t Berlin, Faculty VI - Planen, Bauen, Umwelt, a Institute for Ecological Research and Technology, Department for Ecotoxicology, Berlin, Germany Peter-diedrich.hansen@tu-berlin.de Eckehardt Unruh Technische Universit¨t Berlin, Faculty VI - Planen, Bauen, Umwelt, Institute a for Ecological Research and Technology, Department for Ecotoxicology, Berlin, Germany An immune response by mussel hemocytes is the selective reaction to particles which are identified as foreign by its immune system shown by phagocytosis. Phagocytotic activity is based on the chemotaxis and adhesion, ingestion and phagosome formation. The attachment at the surface of the hemocytes and consequently the uptake of the particles or bacteria can be directly quantified in the format of a fluorescent assay. Another relevant endpoint of phagocytosis is oxidative burst measured by luminescence. Phagocytosis-related production of ROS will be stimulated with opsonised zymosan. The hemocytes will be stored frozen at -80oC and reconstituted in-flight for the experiment. The assay system of the TRIPLELUX-B Experiment has been performed with a well-defined quantification and evaluation of the immune function phagocytosis. The indicator cells are the hemocytes of blue mussels (Mytilus edulis). The signals of the immuno cellular responses are translated into luminescence as a rapid optical reporter system. The results expected will determine whether the observed responses are caused by microgravity and/or radiation (change in permeability, endpoints in genotoxicity: DNA unwinding). The samples for genotoxicity will be processed after returning to earth. The immune system of invertebrates has not been studied so far in space. The

IMMUNOTOXICITY OF 2-METHOXYETHANOL FOLLOWING ORAL ADMINISTRATION IN FISCHER 344 RATS

EPA Science Inventory

The immunotoxicity of the glycol ether 2-methoxyethanol (ME) as evaluated in adult Fischer 344 rats using a variety of in vitro and in vivo immune function assays. n the first phase of this study, male rats are dosed by oral gavage with ME in water, at dosages ranging from 50 to ...

Inhalation exposure to methylene chloride does not induce systemic immunotoxicity in rats.

PubMed

Warbrick, E V; Kilgour, J D; Dearman, R J; Kimber, I; Dugard, P H

2003-07-11

Methylene chloride (dichloromethane) is used in a variety of industrial applications. To date, there has been no formal assessment of immunotoxicity attributed to methylene chloride. Studies were undertaken to examine whether methylene chloride has any potential to influence the integrity of immune function. For this purpose, Sprague-Dawley rats of both genders were exposed by inhalation to a single high dose (5000 ppm) of methylene chloride for 6 h/d, 5 d/wk for 28 d. This was considered the relevant route of administration, as not only is inhalation a primary route for human exposure to methylene chloride, but, also, the chemical is absorbed rapidly via the lungs. Under these conditions of exposure, methylene chloride failed to influence absolute or relative thymus weights in either gender and produced a significant reduction in relative, but not absolute, spleen weight in female rats only. Immunocompetence was measured as a function of the ability of treated animals to mount immunoglobulin M (IgM) antibody responses to sheep red blood cells (SRBC) as determined by enzyme-linked immunosorbent assay (ELISA). Exposure to methylene chloride did not affect antibody production. Evidence indicates that under these conditions of exposure, methylene chloride did not compromise immune function.

Computational tool for immunotoxic assessment of pyrethroids toward adaptive immune cell receptors

PubMed Central

Kumar, Anoop; Behera, Padma Charan; Rangra, Naresh Kumar; Dey, Suddhasattya; Kant, Kamal

2018-01-01

Background: Pyrethroids have prominently known for their insecticidal actions worldwide, but recent reports as anticancer and antiviral applications gained a lot of interest to further understand their safety and immunotoxicity. Objective: This encouraged us to carry out our present study to evaluate the interactions of pyrethroids toward adaptive immune cell receptors. Materials and Methods: Type 1 and Type 2 pyrethroids were tested on T (CD4 and CD8) and B (CD28 and CD45) immune cell receptors using Maestro 9.3 (Schrödinger, LLC, Cambridge, USA). In addition, top-ranked tested ligands were too explored for toxicity prediction in rodents using ProTOX tool. Results: Pyrethroids (specifically type 2) such as fenvalerate (−5.534 kcal/mol: CD8), fluvalinate (−4.644 and − 4.431 kcal/mol: CD4 and CD45), and cypermethrin (−3.535 kcal/mol: CD28) have outcome in less energy or more affinity for B-cell and T-cell immune receptors which may later result in the immunosuppressive and hypersensitivity reactions. Conclusion: The current findings have uncovered that there is a further need to assess the Type 2 pyrethroids with wet laboratory experiments to understand the chemical nature of pyrethroid-induced immunotoxicity. SUMMARY Fenvalerate showed apex glide score toward CD8 immune receptor, while fluvalinate confirmed top-ranked binding with CD4 and CD45 immune proteinsIn addition, cypermethrin outcame in top glide score against CD28 immune receptorTop dock hits (Type 2) pyrethroids have shown probable toxicity targets toward AOFA: Amine oxidase (flavin-containing) A and PGH1: Prostaglandin G/H synthase 1, respectively. Abbreviations used: PDB: Protein Data Bank; AOFA: Amine oxidase (flavin-containing) A; PGH 1: Prostaglandin G/H synthase 1. PMID:29576712

Neurotoxicity and Immunotoxicity Outcomes following Gestational Exposure to Four Lab Drinking Water Concentrates

EPA Science Inventory

To evaluate whether developmental exposure to drinking water concentrates altered other endpoints, standard neuro- and immunotoxicity tests were conducted on the offspring. Male and female offspring (10/sex/treatment) exposed to chlorinated concentrated water (CCW) or reverse os...

Modulation of Benzo[a]pyrene induced immunotoxicity in mice actively immunized with a B[a]P-diphtheria toxoid conjugate

DOE Office of Scientific and Technical Information (OSTI.GOV)

Schellenberger, Mario T.; Grova, Nathalie; Willieme, Stephanie

2009-10-01

Benzo[a]pyrene (B[a]P) is a small molecular weight carcinogen and the prototype of polycyclic aromatic hydrocarbons (PAHs). While these compounds are primarily known for their carcinogenicity, B[a]P and its metabolites are also toxic for mammalian immune cells. To develop a prophylactic immune strategy against detrimental effects of B[a]P, we have immunized mice with a B[a]P-diphtheria toxoid conjugate vaccine. We showed that high levels of antibodies against B[a]P and its metabolites modulate the redistribution of these PAHs in the blood. After immunization, increased levels of B[a]P and its metabolites were recovered in the blood. B[a]P significantly suppressed the proliferative response of bothmore » T and B cells after a sub-acute administration, an effect that was completely reversed by vaccination. In immunized mice also the immunotoxic effect of B[a]P on IFN-{gamma}, IL-12, TNF-{alpha} production and the reduced B cell activation was restored. Finally, our results showed that specific antibodies inhibited the induction of Cyp1a1 by B[a]P in lymphocytes and Cyp1b1 in the liver, enzymes that are known to convert the procarcinogen B[a]P to the ultimate DNA-adduct forming metabolite, a major risk factor of chemical carcinogenesis. Thus, we demonstrate that vaccination with a B[a]P conjugate vaccine based on a carrier protein used in licensed human vaccines reduces immunotoxicity and possibly other detrimental effects associated with B[a]P.« less

Metabolic profiling study on potential toxicity and immunotoxicity-biomarker discovery in rats treated with cyclophosphamide using HPLC-ESI-IT-TOF-MS.

PubMed

Li, Jing; Lin, Wensi; Lin, Weiwei; Xu, Peng; Zhang, Jianmei; Yang, Haisong; Ling, Xiaomei

2015-05-01

Despite the recent advances in understanding toxicity mechanism of cyclophosphamide (CTX), the development of biomarkers is still essential. CTX-induced immunotoxicity in rats by a metabonomics approach was investigated using high-performance liquid chromatography coupled with ion trap time-of-flight mass spectrometry (HPLC-ESI-IT-TOF-MS). The rats were orally administered CTX (30 mg/kg/day) for five consecutive days, and on the fifth day samples of urine, thymus and spleen were collected and analyzed. A significant difference in metabolic profiling was observed between the CTX-treated group and the control group by partial least squares-discriminant analysis (PLS-DA), which indicated that metabolic disturbances of immunotoxicity in CTX-treated rats had occurred. One potential biomarker in spleen, three in urine and three in thymus were identified. It is suggested that the CTX-toxicity mechanism may involve the modulation of tryptophan metabolism, phospholipid metabolism and energy metabolism. This research can help to elucidate the CTX-influenced pathways at a low dose and can further help to indicate the patients' pathological status at earlier stages of toxicological progression after drug administration. Copyright © 2014 John Wiley & Sons, Ltd.

Ecological impacts of the deepwater horizon oil spill: implications for immunotoxicity.

PubMed

Barron, Mace G

2012-01-01

The Deepwater Horizon (DWH) oil spill was the largest environmental disaster and response effort in U.S. history, with nearly 800 million liters of crude oil spilled. Vast areas of the Gulf of Mexico were contaminated with oil, including deep-ocean communities and over 1,600 kilometers of shoreline. Multiple species of pelagic, tidal, and estuarine organisms; sea turtles; marine mammals; and birds were affected, and over 20 million hectares of the Gulf of Mexico were closed to fishing. Several large-scale field efforts were performed, including assessments of shoreline and wildlife oiling and of coastal waters and sediments. The assessment of injuries, damages, and restoration options for the DWH spill is ongoing. Although petroleum and the polycyclic aromatic hydrocarbon component of oils are known to affect the immune systems of aquatic organisms and wildlife, immunotoxicity is not typically assessed during oil spills and has not been a focus of the DHW assessment. The effects of oil spill contaminants on immune responses are variable and often exposure dependent, but immunotoxic effects seem likely from the DHW spill based on the reported effects of a variety of oils on both aquatic and wildlife species.

Immunotoxicity assessment for the novel Spleen tyrosine kinase inhibitor R406

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhu Yanhong; Herlaar, Ellen; Masuda, Esteban S.

2007-06-15

Spleen tyrosine kinase (Syk) is a novel pharmaceutical target for treatment of allergic, autoimmune, and neoplastic disorders. Previous studies have indicated that Syk signaling plays critical roles in regulating the lymphohematopoietic system. These observations prompted us to investigate whether inhibition of Syk would promote immunotoxicity. In a series of studies, rats were treated orally with R406, at dose levels up to and including 100 mg/kg/day (or its prodrug R788 at dose levels up to and including 100 mg/kg/day, reduced to 50 mg/kg/day for females as MTD was exceeded), a potent Syk inhibitor, twice daily for 28 days. In addition tomore » standard toxicological assessments, immunophenotyping by flow cytometric analysis, and a study of humoral immune response measuring anti-KLH IgM and IgG levels, were undertaken. Other immunotoxicity studies included three host resistance models in female Balb/c mice to further ascertain effects of R406 on innate and acquired immunity. Following R406 treatment, expected immunomodulating effects (e.g., decreased thymic and spleen weight, hypocellularity of bone marrow, and reduced lymphocyte counts, including T and B cells) were observed in the rat studies. These changes essentially resolved during a 14-day treatment-free recovery period. A KLH challenge in rats demonstrated no adverse effects on IgG or IgM response. R788/406, administered orally at dose levels up to and including 80 mg/kg/day for 28 days, did not affect bacterial or viral clearance in the Listeria, Streptococcal, or Influenza host resistance mouse models, respectively. This correlated with previous in vitro macrophage and neutrophil function assays (assessing migration, phagocytosis, oxidative burst and microbicidal activity), which revealed that R406 did not adversely affect macrophage or neutrophil function in innate immune responses. Collectively, these results demonstrate that R406 has minimal functional immunotoxicity notwithstanding its

The effect of ozonization on furniture dust: microbial content and immunotoxicity in vitro.

PubMed

Huttunen, Kati; Kauhanen, Eeva; Meklin, Teija; Vepsäläinen, Asko; Hirvonen, Maija-Riitta; Hyvärinen, Anne; Nevalainen, Aino

2010-05-01

Moisture and mold problems in buildings contaminate also the furniture and other movable property. If cleaning of the contaminated furniture is neglected, it may continue to cause problems to the occupants even after the moisture-damage repairs. The aim of this study was to determine the effectiveness of high-efficiency ozone treatment in cleaning of the furniture from moisture-damaged buildings. In addition, the effectiveness of two cleaning methods was compared. Samples were vacuumed from the padded areas before and after the treatment. The microbial flora and concentrations in the dust sample were determined by quantitative cultivation and QPCR-methods. The immunotoxic potential of the dust samples was analyzed by measuring effects on cell viability and production of inflammatory mediators in vitro. Concentrations of viable microbes decreased significantly in most of the samples after cleaning. Cleaning with combined steam wash and ozonisation was more effective method than ozonising alone, but the difference was not statistically significant. Detection of fungal species with PCR showed a slight but nonsignificant decrease in concentrations after the cleaning. The immunotoxic potential of the collected dust decreased significantly in most of the samples. However, in a small subgroup of samples, increased concentrations of microbes and immunotoxicological activity were detected. This study shows that a transportable cleaning unit with high-efficiency ozonising is in most cases effective in decreasing the concentrations of viable microbes and immunotoxicological activity of the furniture dust. However, the method does not destroy or remove all fungal material present in the dust, as detected with QPCR analysis, and in some cases the cleaning procedure may increase the microbial concentrations and immunotoxicity of the dust. Copyright 2010 Elsevier B.V. All rights reserved.

Protective effects of meat from lambs on selenium nanoparticle supplemented diet in a mouse model of polycyclic aromatic hydrocarbon-induced immunotoxicity.

PubMed

Ungvári, Éva; Monori, István; Megyeri, Attila; Csiki, Zoltán; Prokisch, József; Sztrik, Attila; Jávor, András; Benkő, Ilona

2014-02-01

Increased environmental oxidative stress caused primarily by chemicals like polycyclic aromatic hydrocarbons, plays significant role in human diseases. A representative compound, 7,12-dimethylbenz(a)anthracene (DMBA), was used for modeling oxidative damages including the significant decrease of the antioxidant capacity of the blood. Selenium has antioxidant effects but with a narrow therapeutic window. In our current studies to avoid accidental overdose and toxicity selenium was given to meat-producing animals. The standard rodent diet of mice was replaced by meat from lambs either on standard or selenium-enriched diet. Selenium concentration of lamb meat was enhanced three times by nano-selenium administration and an increase in the antioxidant capacity of the blood of mice was measured after the indirect selenium supplementation. Protective effects were also observed against DMBA-induced immunotoxicity. Twice the amount of white blood cells and among them three times more phagocytes survived. Similarly, in their renewal system in bone marrow twice the amount of cells survived and regenerative capacity of granulopoiesis was four times higher than in control DMBA-damaged mice. Our findings suggest functional dietary benefits of lamb meat enriched with selenium by feeding lambs with nanoparticle selenium supplements. Copyright © 2013 Elsevier Ltd. All rights reserved.

Developmental toxicity, oxidative stress and immunotoxicity induced by three strobilurins (pyraclostrobin, trifloxystrobin and picoxystrobin) in zebrafish embryos.

PubMed

Li, Hui; Cao, Fangjie; Zhao, Feng; Yang, Yang; Teng, Miaomiao; Wang, Chengju; Qiu, Lihong

2018-05-25

Strobilurins is the most widely used class of fungicides, but is reported highly toxic to some aquatic organisms. In this study, zebrafish embryos were exposed to a range concentrations of three strobilurins (pyraclostrobin, trifloxystrobin and picoxystrobin) for 96 h post-fertilization (hpf) to assess their aquatic toxicity. The 96-h LC 50 values of pyraclostrobin, trifloxystrobin and picoxystrobin to embryos were 61, 55, 86 μg/L, respectively. A series of symptoms were observed in developmental embryos during acute exposure, including decreased heartbeat, hatching inhibition, growth regression, and morphological deformities. Moreover, the three fungicides induced oxidative stress in embryos through increasing reactive oxygen species (ROS) and malonaldehyde (MDA) contents, inhibiting superoxide dismutase (SOD) activity and glutathione (GSH) content as well as differently changing catalase (CAT) activity and mRNA levels of genes related to antioxidant system (Mn-sod, Cu/Zn-sod, Cat, Nrf2, Ucp2 and Bcl2). In addition, exposure to the three strobilurins resulted in significant upregulation of IFN and CC-chem as well as differently changed expressions of TNFa, IL-1b, C1C and IL-8, which related to the innate immune system, suggesting that these fungicides caused immunotoxicity during zebrafish embryo development. The different response of enzymes and genes in embryos exposed to the three fungicides might be the cause that leads to the difference of their toxicity. This work made a comparison of the toxicity of three strobilurins to zebrafish embryos on multi-levels and would provide a better understanding of the toxic effects of strobilurins on aquatic organisms. Copyright © 2018 Elsevier Ltd. All rights reserved.

[Oxidative damage and immunotoxicity effect of people who exposed to electronic waste].

PubMed

Zhang, Ronghua; Xu, Caiju; Shen, Haitao; Tang, Yun; Meng, Jia; Lu, Wei; Wang, Xiaofeng; Lou, Xiaoming; Song, Yanhua; Han, Guangen; Cai, Delei; Ding, Gangqiang

2012-03-01

To investigate the relationship between risk factors and the effects of antioxidation and immune function in adults who exposed to electronic waste( e-waste). The exposed group was chosen from the people who lived in the e-waste disposing areas of Zhejiang province. The control group was chosen from people who lived in unpolluted area. Anticoagulation and coagulation peripheral venous blood samples were collected from 40 exposed persons (22 employees, 18 non-employees) and 36 exposed persons respectively. The oxidative, immune, Cd, Pb, Cr, Hg, and PCB indexes were detected. The contents of Cd, total PCB, MDA statistically increased in exposed group comparing with the control group (P < 0.05). The activity of SOD, GSH-Px, the percentage of helper/inducer T lymphocytes (CD4+) and the content of Cr in exposed group were less than those in the controlgroup (P < 0.05). Oxidative damage and immunotoxicity were observed in the group that lived in e-waste disposing areas. These effects were mainly related to the increase of Cd content or Cd and Pb contents in peripheral venous blood.

Embryonic exposure to carbendazim induces the transcription of genes related to apoptosis, immunotoxicity and endocrine disruption in zebrafish (Danio rerio).

PubMed

Jiang, Jinhua; Wu, Shenggan; Wu, Changxing; An, Xuehua; Cai, Leiming; Zhao, Xueping

2014-12-01

Carbendazim is one of the most widespread environmental contaminant that can cause major concern to human and animal reproductive system. To date, very few studies have been conducted on the toxic effect of carbendazim in the non-target organism zebrafish (Danio rerio). The study presented here aimed to assess how carbendazim triggers apoptosis, immunotoxicity and endocrine disruption pathways in zebrafish during its embryo development. Our results demonstrated that the expression patterns of many key genes involved in cell apoptosis pathway (e.g. P53, Mdm2, Bbc3 and Cas8) were significantly up-regulated upon the exposure to carbendazim at the concentration of 500 μg/L, while the Bcl2 and Cas3 were down-regulated at the same concentration, interestingly, the expression level of Ogg1 decreased at all the exposure concentrations. It was also observed that the mRNA levels of CXCL-C1C, CCL1, IL-1b and TNFα which were closely related to the innate immune system, were affected in newly hatched zebrafish after exposed to different concentrations of carbendazim. Moreover, the expression of genes that are involved in the hypothalamic-pituitary-gonadal/thyroid (HPG/HPT) axis including VTG, ERα, ERβ2, Dio1, Dio2, Thraa and Thrb were all down-regulated significantly after the exposure to carbendazim. The expression levels of two cytochrome P450 aromatases CYP19a and CYP19b were increased significantly after 20 and 100 μg/L carbendazim exposure, respectively. Taken together, our results indicated that carbendazim had the potential to induce cell apoptosis and cause immune toxicity as well as endocrine disruption in zebrafish during the embryo developmental stage. The information presented here also help to elucidate the environmental risks caused by the carbendazim-induced toxicity in aquatic organisms. Copyright © 2014 Elsevier Ltd. All rights reserved.

Immunotoxicity testing: Implementation of mechanistic understanding, key pathways of toxicological concern and components of these pathways.

EPA Science Inventory

At present, several animal-based assays are used to assess immunotoxic effects such as immunosuppression and sensitization. Growing societal and ethical concerns, European legislation and current research demands by industry are driving animal-based toxicity testing towards new a...

In vitro studies on immunotoxic potential of Orange II in splenocytes.

PubMed

Yadav, Ashish; Kumar, Arvind; Dwivedi, Premendra Dhar; Tripathi, Anurag; Das, Mukul

2012-02-05

Orange II, an azo dye, is not permitted in food preparations, but high levels of the dye have been detected in different food commodities. Though there are reports on the toxicity of Orange II but knowledge based on the immunomodulatory properties of Orange II is scanty. The present investigation was undertaken to study the in vitro immunotoxic potential of Orange II in splenocytes. Splenocytes were isolated, cultured and subjected to immunophenotypic analysis, mixed lymphocyte reaction (MLR) assay or stimulated with lipopolysaccharide (LPS) or concanavalin A (Con A) for 72 h. The supernatant was collected for cytokine assays. Orange II showed cytotoxic effects at 100-1000μg/ml concentrations and 50μg/ml was determined as the highest non-cytotoxic dose. Orange II at the non-cytotoxic dose (50μg/ml) significantly altered the relative distribution of T and B-cells, MLR response and the mitogen induced proliferative response of T-cells and B-cells. Consistent with the hypo-responsiveness of the T and B-lymphocytes, Orange II induced a concomitant decline in the secretion of cytokines IL-2, IL-4, IL-6, IFN-γ, TNF-α and IL-17. On the contrary, there was an increase in the production of IL-10, an anti-inflammatory regulatory cytokine, which may be one of the causative factor for immunosuppressive property of Orange II. These results suggest that non-cytotoxic dose of Orange II may have immunomodulatory effects. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

Differential immunotoxic effects of ethanol on murine EL-4 lymphoma and normal lymphocytes is mediated through increased ROS production and activation of p38MAPK.

PubMed

Premachandran, Sudha; Khan, Nazir M; Thakur, Vikas S; Shukla, Jyoti; Poduval, T B

2012-08-01

Ethanol has been used to achieve thymic depletion in myasthenia gravis patients. Ethanol (95%) has also been used widely in the therapy of many tumors including hepatocellular carcinoma. In light of these findings, we delineated the differential immunotoxic behavior and mechanism of lower concentration of ethanol towards murine EL-4 lymphoma and its normal counterpart lymphocytes. EL-4 lymphoma and normal lymphocytes were cultured with ethanol (0%-5%) for 6 h and cytotoxicity was measured by various methods. EL-4 cells treated with ethanol showed concentration-dependent loss of viability at 2%-5% ethanol concentration and exhibit proliferative arrest at preG1 stage. Acridine-orange and ethidium-bromide staining indicated that ethanol induced death in EL-4 cells, by induction of both apoptosis and necrosis which was further supported by findings of DNA-fragmentation and trypan blue dye exclusion test. However, treatment of lymphocytes with similar concentration of ethanol did not show any death-associated parameters. Furthermore, ethanol induced significantly higher ROS generation in EL-4 cells as compared to lymphocytes and caused PARP cleavage and activation of apoptotic proteins like p53 and Bax, in EL-4 cells and not in normal lymphocytes. In addition, ethanol exposure to EL-4 cells led to phosphorylation of p38MAPK, and upregulation of death receptor Fas (CD95). Taken together, these results suggest that ethanol upto a concentration of 5% caused no significant immunotoxicity towards normal lymphocytes and induced cell death in EL-4 cells via phosphorylation of p38MAPK and regulation of p53 leading to further activation of both extrinsic (Fas) and intrinsic (Bax) apoptotic markers.

Validation of a Candida albicans delayed-type hypersensitivity (DTH) model in female juvenile rats for use in immunotoxicity assessments.

PubMed

Collinge, Mark; Thorn, Mitchell; Peachee, Vanessa; White, Kimber

2013-01-01

Establishing an in vivo cell-mediated immunity (CMI) assay, such as the delayed-type hypersensitivity (DTH) assay, has been identified as an important gap and recommended to receive highest priority for new model development in several workshops on developmental immunotoxicity. A Candida albicans DTH model has recently been developed that has the advantage over other DTH models, which use alternative sensitizing antigens, in that antigen-specific antibodies, which may interfere with the assay, are not produced. In addition, the in vivo C. albicans DTH model was demonstrated to be more sensitive in detecting immunosuppression than DTH models using keyhole limpet hemocyanin (KLH) or sheep red blood cells as antigens, as well as some ex vivo CMI assays. While KLH and sheep red blood cells are non-physiological immunogens, C. albicans is an important human pathogen. The present studies were conducted in order to optimize and validate the C. albicans DTH model for use in developmental immunotoxicity studies using juvenile rats. Three known immunosuppressive compounds with different mechanisms of action were tested in this model, cyclosprorin A (CsA), cyclophosphamide (CPS), and dexamethasone (DEX). Animals were sensitized with formalin-fixed C. albicans on postnatal day (PND) 28 and challenged with chitosan on PND 38. Drug was administered beginning on PND 23 and continued until PND 37. Exposure to each of the three immunotoxicants resulted in statistically significant decreases in the DTH response to C. albicans-derived chitosan. Decreases in footpad swelling were observed at ≥10 mg CsA/kg/day, ≥5 mg CPS/kg/day, and ≥0.03 mg DEX/kg/day. These results demonstrate that the C. albicans DTH model, optimized for use in juvenile rats, can be used to identify immunotoxic compounds, and fills the need for a sensitive in vivo CMI model for assessments of developmental immunotoxicity. Abbreviations Ab, antibody APC, antigen presenting cell BSA, bovine serum albumin C

Immunotoxicity evaluation of jet a jet fuel in female rats after 28-day dermal exposure.

PubMed

Mann, Cynthia M; Peachee, Vanessa L; Trimmer, Gary W; Lee, Ji-Eun; Twerdok, Lorraine E; White, Kimber L

2008-01-01

The potential for jet fuel to modulate immune functions has been reported in mice following dermal, inhalation, and oral routes of exposure; however, a functional evaluation of the immune system in rats following jet fuel exposure has not been conducted. In this study potential effects of commercial jet fuel (Jet A) on the rat immune system were assessed using a battery of functional assays developed to screen potential immunotoxic compounds. Jet A was applied to the unoccluded skin of 6- to 7-wk-old female Crl:CD (SD)IGS BR rats at doses of 165, 330, or 495 mg/kg/d for 28 d. Mineral oil was used as a vehicle to mitigate irritation resulting from repeated exposure to jet fuel. Cyclophosphamide and anti-asialo GM1 were used as positive controls for immunotoxic effects. In contrast to reported immunotoxic effects of jet fuel in mice, dermal exposure of rats to Jet A did not result in alterations in spleen or thymus weights, splenic lymphocyte subpopulations, immunoglobulin (Ig) M antibody-forming cell response to the T-dependent antigen, sheep red blood cells (sRBC), spleen cell proliferative response to anti-CD3 antibody, or natural killer (NK) cell activity. In each of the immunotoxicological assays conducted, the positive control produced the expected results, demonstrating the assay was capable of detecting an effect if one had occurred. Based on the immunological parameters evaluated under the experimental conditions of the study, Jet A did not adversely affect immune responses of female rats. It remains to be determined whether the observed difference between this study and some other studies reflects a difference in the immunological response of rats and mice or is the result of other factors.

Development and evaluation of the mallard duck as a model to investigate the immunotoxicity of environmental chemicals

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fowles, J.R.

Studies were conducted to characterize the mallard duck (Anas platyrhyncos) as a model for evaluating the immunotoxic effects of environmental chemicals. A battery of immunotoxicity tests was validated for the mallard, including natural killer cell (NKC) activity, lymphocyte mitogenesis, antibody titers to sheep erythrocytes, peripheral differential leukocyte counts, macrophage phagocytosis and prostaglandin-E[sub 2] (PGE2) production. To investigate potential hormonal-immune axes, dexamethasone (DEX), methimazole, and thyroxine (T4) were used to study the influence of glucocorticoid excess, hypo-, and hyperthyroidism on immunity, respectively. Subsequently, the effects of polychlorinated biphenyls (PCBs, Aroclor 1254) on immune, endocrine, and hepatic cytochrome-P450 function were evaluated andmore » interpreted using results from the endocrine/immune studies. Results of these studies showed that antibody production was susceptible to suppression by DEX at doses which also caused significant changes in clinical plasma biochemistry values. NKC activity was enhanced by exposure to DEX in vivo, a phenomenon due to the inhibition of PGE2 production by adherent peripheral blood cells by DEX and mimicked in vitro with addition of indomethacin or DEX. Macrophage phagocytosis was significantly suppressed by DEX in vitro. Macrophage production of PGE2 ex vivo was suppressed in birds treated with DEX. In contrast to DEX, T4 or methimazole treatment elicited only slight physiologic changes in plasma albumin and cholesterol levels. No immune/thyroid axis was observed in mallards. Exposure to Aroclor 1254 induced significant hepatic microsomal ethoxy- and pentoxy-resorufin-O-deethylase activities in addition to increasing total cytochrome P450 content, but did not affect immune function, plasma corticosterone, or clinical biochemistry values. Total triiodothyronine, but not T4, was dose-dependently suppressed by PCB treatment.« less

Developmental immunotoxicity (DIT): assays for evaluating effects of exogenous agents on development of the immune system.

PubMed

DeWitt, Jamie C; Peden-Adams, Margie M; Keil, Deborah E; Dietert, Rodney R

2012-02-01

Developmental immunotoxicity (DIT) occurs when exposure to environmental risk factors prior to adulthood, including chemical, biological, physical, or physiological factors, alters immune system development. DIT may elicit suppression, hyperactivation, or misregulation of immune responses and may present clinically as decreased resistance to pathogens, allergic and autoimmune diseases, and inflammatory diseases. Immunotoxicity testing guidelines established by the Environmental Protection Agency for adult animals (OPPTS 8703.7800) require functional tests and immunophenotyping that are suitable for detecting immunomodulation, especially immunosuppression. However, evaluating immune function in offspring that are not fully immunocompetent yields results that are challenging to interpret. Therefore, this unit will describe an optimum exposure scenario, reference two assays (immunophenotyping and histopathology) appropriate for detecting immunomodulation in weaning-age offspring, and reference four assays (immunophenotyping, histopathology, T cell-dependent antibody responses, and delayed-type hypersensitivity) appropriate for detecting immunomodulation in immunocompetent offspring. The protocol also will reference other assays (natural killer cell and cytotoxic T lymphocyte) with potential utility for assessing DIT. © 2012 by John Wiley & Sons, Inc.

Lack of immunotoxicity of saquinavir (Ro 31-8959) used alone or in double or triple combination with AZT and ddC.

PubMed

Viora, M; Di Genova, G; Quaranta, M G; Boirivant, M; Camponeschi, B

1998-09-01

Saquinavir (Ro 31-8959; SQV) has been demonstrated to be a potent inhibitor of human immunodeficiency virus (HIV) proteinases and acts synergistically with dideoxynucleoside analogues. The aim of this study was to investigate the in vitro immunomodulatory effects of SQV on normal human peripheral blood mononuclear cells (PBMC) and on lamina propria mononuclear cells (LPMC). We used the drug either alone or in double and triple combination with AZT and ddC to assess whether SQV enhances the immunomodulatory effects induced by AZT and ddC that we previously observed. We demonstrated that SQV did not induce any modulation of the proliferative response either in PBMC or in LPMC. Similarly, NK cell-mediated cytotoxic activity and cytokine production were not modified by SQV. More importantly, SQV/AZT, SQV/ddC, and SQV/AZT/ddC combinations did not strengthen neither the inhibition of PBMC and LPMC proliferative response or the modulation of cytokine production induced by AZT, ddC, and AZT/ddC. On the other hand, the increased IL-2 production induced by AZT and ddC was not observed adding SQV to the dideoxynucleoside analogues. In conclusion, we demonstrated that SQV used in combination with AZT and ddC did not add any further immunotoxicity.

Satratoxin G from the Black Mold Stachybotrys chartarum Evokes Olfactory Sensory Neuron Loss and Inflammation in the Murine Nose and Brain

PubMed Central

Islam, Zahidul; Harkema, Jack R.; Pestka, James J.

2006-01-01

Satratoxin G (SG) is a macrocyclic trichothecene mycotoxin produced by Stachybotrys chartarum, the “black mold” suggested to contribute etiologically to illnesses associated with water-damaged buildings. Using an intranasal instillation model in mice, we found that acute SG exposure specifically induced apoptosis of olfactory sensory neurons (OSNs) in the olfactory epithelium. Dose–response analysis revealed that the no-effect and lowest-effect levels at 24 hr postinstillation (PI) were 5 and 25 μg/kg body weight (bw) SG, respectively, with severity increasing with dose. Apoptosis of OSNs was identified using immunohistochemistry for caspase-3 expression, electron microscopy for ultrastructural cellular morphology, and real-time polymerase chain reaction for elevated expression of the proapoptotic genes Fas, FasL, p75NGFR, p53, Bax, caspase-3, and CAD. Time-course studies with a single instillation of SG (500 μg/kg bw) indicated that maximum atrophy of the olfactory epithelium occurred at 3 days PI. Exposure to lower doses (100 μg/kg bw) for 5 consecutive days resulted in similar atrophy and apoptosis, suggesting that in the short term, these effects are cumulative. SG also induced an acute, neutrophilic rhinitis as early as 24 hr PI. Elevated mRNA expression for the proinflammatory cytokines tumor necrosis factor-α, interleukin-6 (IL-6), and IL-1 and the chemokine macrophage-inflammatory protein-2 (MIP-2) were detected at 24 hr PI in both the ethmoid turbinates of the nasal airways and the adjacent olfactory bulb of the brain. Marked atrophy of the olfactory nerve and glomerular layers of the olfactory bulb was also detectable by 7 days PI along with mild neutrophilic encephalitis. These findings suggest that neurotoxicity and inflammation within the nose and brain are potential adverse health effects of exposure to satratoxins and Stachybotrys in the indoor air of water-damaged buildings. PMID:16835065

Satratoxin G from the black mold Stachybotrys chartarum evokes olfactory sensory neuron loss and inflammation in the murine nose and brain.

PubMed

Islam, Zahidul; Harkema, Jack R; Pestka, James J

2006-07-01

Satratoxin G (SG) is a macrocyclic trichothecene mycotoxin produced by Stachybotrys chartarum, the "black mold" suggested to contribute etiologically to illnesses associated with water-damaged buildings. Using an intranasal instillation model in mice, we found that acute SG exposure specifically induced apoptosis of olfactory sensory neurons (OSNs) in the olfactory epithelium. Dose-response analysis revealed that the no-effect and lowest-effect levels at 24 hr postinstillation (PI) were 5 and 25 microg/kg body weight (bw) SG, respectively, with severity increasing with dose. Apoptosis of OSNs was identified using immunohistochemistry for caspase-3 expression, electron microscopy for ultrastructural cellular morphology, and real-time polymerase chain reaction for elevated expression of the proapoptotic genes Fas, FasL, p75NGFR, p53, Bax, caspase-3, and CAD. Time-course studies with a single instillation of SG (500 microg/kg bw) indicated that maximum atrophy of the olfactory epithelium occurred at 3 days PI. Exposure to lower doses (100 microg/kg bw) for 5 consecutive days resulted in similar atrophy and apoptosis, suggesting that in the short term, these effects are cumulative. SG also induced an acute, neutrophilic rhinitis as early as 24 hr PI. Elevated mRNA expression for the proinflammatory cytokines tumor necrosis factor-alpha, interleukin-6 (IL-6) , and IL-1 and the chemokine macrophage-inflammatory protein-2 (MIP-2) were detected at 24 hr PI in both the ethmoid turbinates of the nasal airways and the adjacent olfactory bulb of the brain. Marked atrophy of the olfactory nerve and glomerular layers of the olfactory bulb was also detectable by 7 days PI along with mild neutrophilic encephalitis. These findings suggest that neurotoxicity and inflammation within the nose and brain are potential adverse health effects of exposure to satratoxins and Stachybotrys in the indoor air of water-damaged buildings.

Indicators of immunotoxicity in populations of cotton rats (Sigmodon hispidus) inhabiting an abandoned oil refinery.

PubMed

McMurry, S T; Lochmiller, R L; McBee, K; Qualls, C W

1999-03-01

Wildlife species inhabiting contaminated sites are often exposed to complex mixtures of chemicals, many of which have known effects on physiological and biochemical function. Although sensitivity of the immune system to chemical exposure has been documented in laboratory animal and wildlife species, little work has been conducted on feral wildlife populations inhabiting contaminated sites. Immune function was measured in populations of wild cotton rats (Sigmodon hispidus) inhabiting replicated reference and contaminated study sites at an abandoned oil refinery in Oklahoma four times from 1991 to 1992. Several measures of immunocompetence were examined including immune organ mass and cellularity, hematology, in vivo hypersensitivity, macrophage function, killer cell activity, and lymphoproliferative responsiveness. In vitro proliferation of splenocytes, either spontaneous or induced with concanavalin A (Con A), was the most consistent and reliable indicator of immunotoxicity. Spontaneous proliferation of splenocytes was 48 and 24% higher for cotton rats collected from contaminated than reference sites in September 1991 and September 1992, respectively. Likewise, Con A-induced proliferation of splenocytes ranged form 20 to 53% higher in animals collected from contaminated than reference sites in three of four collection periods. The percentage of splenocytes (mean+/-SE) staining positive for Con A receptors was lower on contaminated sites (73.7+/-1.2%) than reference sites (77.0+/-1.4%) in September 1991. Other measures of immune function including macrophage metabolism, hypersensitivity, blood cellularity, and mass and cellularity of immune organs varied between contaminated and reference sites. Copyright 1999 Academic Press.

Immunotoxical evaluation of St. Lawrence beluga whales (Deiphinapterus leucas)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Guise, S. De; Fournier, M.; Martineau, D.

1995-12-31

An isolated population of beluga whales live in the St. Lawrence estuary. From approximately 5,000 at the beginning of the century, they now number 500 and their number has not increased since the last 10 years. High concentrations of environmental contaminants including organohalogens (mostly PCBs and DDT), as well as heavy metals (mostly mercury and lead) and HAP exposure have been demonstrated in tissues of these animals. A high incidence of diverse and severe lesions including infections with mildly pathogenic bacteria and numerous tumors were found upon examination of carcasses from the same population. An immunotoxicological evaluation of St. Lawrencemore » beluga whales compared to relatively unpolluted Arctic animals was undertaken to study the possibility of a contaminants induced immunosuppression which would explain the diversity and severity of those lesions. As a first step, several assays were developed to evaluate immune functions in beluga whales, and baseline data were established using Arctic animals. In vitro exposure of Arctic beluga lymphocytes to single contaminants present in St. Lawrence beluga blubber were also performed and showed a suppression of proliferation of lymphocytes with concentrations of mercury below those found in liver of adult St. Lawrence animals. Animal models were also developed to evaluate the immunotoxic potential of the mixture of contaminants found in blubber of St. Lawrence belugas. Rats were fed lipids from either St. Lawrence or Arctic belugas or a mixture of the two groups, and immune functions will be evaluated in these animals. Finally, the last step of the study will be to catch belugas in the St. Lawrence, evaluate their immune functions, compare them to those of Arctic animals and relate them to concentrations of the different contaminants measured in their blubber and plasma.« less

Tier-2 studies on monocrotaline immunotoxicity in C57BL/6 mice.

PubMed

Deyo, J A; Kerkvliet, N I

1991-01-01

Monocrotaline (MCT) is a member of a class of naturally occurring phytotoxins known as pyrrolizidine alkaloids, and is a toxicological concern to both man and his livestock. The purpose of these studies was to evaluate the effect of a 14-day oral MCT (0-100 mg/kg per day) exposure on the functional integrity of various immunocyte effector systems in C57BL/6 mice, as well as to investigate potential mechanisms for its immunotoxicity. Decreases in lymphoid organ weights and cellularity, and resident peritoneal exudate cell (PEC) number were only observed after exposure to the highest dose of 100 mg/kg MCT. This dose also inhibited NK cell cytotoxicity, while the total number of NK lytic units per spleen was decreased (-53%) after exposure to 50 mg/kg MCT. Following i.p. injection of SRBC, the percentage of PEC macrophages containing engulfed SRBC was significantly increased in MCT-exposed mice, while the percentage of large vacuolated (activated) macrophages was decreased in a dose-dependent manner. Exposure to MCT significantly decreased the total number of Ig+ cells without altering the number of CD4+ and CD8+ cells. The antibody responses (PFC/10(6) spleen cells) to two T cell-independent antigens, TNP-LPS and DNP-Ficoll, were significantly decreased at all MCT doses, and the degree of suppression of both responses was identical at coincident doses. MCT exposure (25 mg/kg) significantly suppressed the blastogenic response to the T cell mitogen concanavalin A (-38%), and to the B cell mitogen lipopolysaccharide (-58%). These results indicate that exposure to MCT can alter the functional integrity of various immune effector responses in a dose-dependent manner, and suggest that the B cell may be a relatively more sensitive target of MCT immunotoxicity compared to T cells, macrophages and NK cells.

Biological and immunotoxicity evaluation of antimicrobial peptide-loaded coatings using a layer-by-layer process on titanium

PubMed Central

Shi, Jue; Liu, Yu; Wang, Ying; Zhang, Jing; Zhao, Shifang; Yang, Guoli

2015-01-01

The prevention and control of peri-implantitis is a challenge in dental implant surgery. Dental implants with sustained antimicrobial coating are an ideal way of preventing peri-implantitis. This study reports development of a non- immunotoxicity multilayered coating on a titanium surface that had sustained antimicrobial activity and limited early biofilm formation. In this study, the broad spectrum AMP, Tet213, was linked to collagen IV through sulfo-SMPB and has been renamed as AMPCol. The multilayer AMPCol coatings were assembled on smooth titanium surfaces using a LBL technique. Using XPS, AFM, contact angle analysis, and QCM, layer-by-layer accumulation of coating thickness was measured and increased surface wetting compared to controls was confirmed. Non-cytotoxicity to HaCaT and low erythrocyte hemolysis by the AMPCol coatings was observed. In vivo immunotoxicity assays showed IP administration of AMPCol did not effect serum immunoglobulin levels. This coating with controlled release of AMP decreased the growth of both a Gram-positive aerobe (Staphylococcus aureus) and a Gram-negative anaerobe (Porphyromonas gingivalis) up to one month. Early S. aureus biofilm formation was inhibited by the coating. The excellent long-term sustained antimicrobial activity of this multilayer coating is a potential method for preventing peri-implantitis through coated on the neck of implants before surgery. PMID:26548760

Solvent comparison in the isolation, solubilization, and toxicity of Stachybotrys chartarum spore trichothecene mycotoxins in an established in vitro luminescence protein translation inhibition assay.

PubMed

Black, J A; Foarde, K K; Menetrez, M Y

2006-08-01

It is well known that non-viable mold contaminants such as macrocyclic trichothecene mycotoxins of Stachybotrys chartarum are highly toxinigenic to humans. However, the method of recovering native mycotoxin has been without consensus. Inconsistencies occur in the methods of isolation, suspension, preparation, and quantitation of the mycotoxin from the spores. The purpose of this study was to provide quantitatively comparative data on three concurrent preparations of 10(6)S. chartarum spores. The experiments were designed to specifically evaluate a novel method of mycotoxin extraction, solubilization, and the subsequent inhibitory effect in an established in vitro luminescence protein translation assay from 30 day-old spores. The mycotoxin-containing spores swabbed from wallboard cultures were milled with and without glass beads in 100% methanol, 95% ethanol, or water. Milled spore lysates were cleared of cell debris by filter centrifugation followed by a second centrifugation through a 5000 MWCO filter to remove interfering proteins and RNases. Cleared lysate was concentrated by centrivap and suspended in either alcohol or water as described. The suspensions were used immediately in the in vitro luminescence protein translation assay with the trichothecene, T-2 toxin, as a control. Although, mycotoxin is reported to be alcohol soluble, the level of translation inhibition was not reliably satisfactory for either the methanol or ethanol preparations. In fact, the methanol and ethanol control reactions were not significantly different than the alcohol prepared spore samples. In addition, we observed that increasing amounts of either alcohol inhibited the reaction in a dose dependent manner. This suggests that although alcohol isolation of mycotoxin is desirable in terms of time and labor, the presence of alcohol in the luminescence protein translation reaction was not acceptable. Conversely, water extraction of mycotoxin demonstrated a dose dependent response, and

Acute pulmonary hemorrhage during isoflurane anesthesia in two cats exposed to toxic black mold (Stachybotrys chartarum).

PubMed

Mader, Douglas R; Yike, Iwona; Distler, Anne M; Dearborn, Dorr G

2007-09-01

Acute pulmonary hemorrhage developed during isoflurane anesthesia in 2 Himalayan cats undergoing routine dental cleaning and prophylaxis. The cats were siblings and lived together. In both cats, results of pre-operative physical examinations and laboratory testing were unremarkable. Blood pressure and oxygen saturation were within reference ranges throughout the dental procedure. Approximately 15 to 20 minutes after administration of isoflurane was begun, frothy blood was noticed within the endotracheal tube. Blood was suctioned from the endotracheal tube, and the cats were allowed to recover from anesthesia. 1 cat initially responded to supportive care but developed a second episode of spontaneous pulmonary hemorrhage approximately 30 hours later and died. The other cat responded to supportive care and was discharged after 4 days, but its condition deteriorated, and the cat died 10 days later. Subsequently, it was discovered that the home was severely contaminated with mold as a result of storm damage that had occurred approximately 7 months previously. Retrospective analysis of banked serum from the cats revealed satratoxin G, a biomarker for Stachybotrys chartarum, commonly referred to as "toxic black mold." Findings highlight the potential risk of acute pulmonary hemorrhage in animals living in an environment contaminated with mold following flood damage.

Size distribution effects of cadmium tellurium quantum dots (CdS/CdTe) immunotoxicity on aquatic organisms.

PubMed

Bruneau, A; Fortier, M; Gagne, F; Gagnon, C; Turcotte, P; Tayabali, A; Davis, T L; Auffret, M; Fournier, M

2013-03-01

The increasing use of products derived from nanotechnology has raised concern about their potential toxicity to aquatic life. This study sought to examine the comparative immunotoxicity of capped cadmium sulphide/cadmium telluride (CdS/CdTe) quantum dots (QDs) and possible impact of particle/aggregate size on two bivalves (Mytilus edulis and Elliptio complanata) and a fish (Oncorhynchus mykiss). The QDs were dispersed in sterile water and fractionated using a series of micro/ultrafiltration membranes of decreasing pore size: 450 nm, 100 nm, 50 nm, 25 nm, 100 kDa (6.8 nm), 30 kDa (4.6 nm), 10 kDa (3.2 nm) and 1 kDa (1.5 nm). The total concentrations of cadmium and tellurium were determined for the filtered material and for that retained on the filters (retentate). The immunotoxicity was determined by measuring cell viability and phagocytosis. Results revealed that nanoparticles retained on the ultrafilters had a higher Cd/Te ratio compared to the permeate fraction (ratio of 5 and 2 respectively) which could indicate that the CdS core was not associated with the permeable fraction of Cd. Our results demonstrate that the toxicity of CdS/CdTe QDs was concentration and size dependent. Large CdS/CdTe QD aggregates (25 nm < size < 100 nm) reduced phagocytosis more than did smaller nanoparticles (<25 nm). Moreover, our results revealed that the different species responded differently to these fractions. Mytilus edulis hemocytes were less sensitive to CdS/CdTe QDs than the Oncorhynchus mykiss macrophage and Elliptio complanata hemocytes.

Systemic and immunotoxicity of pristine and PEGylated multi-walled carbon nanotubes in an intravenous 28 days repeated dose toxicity study

PubMed Central

Zhang, Ting; Tang, Meng; Zhang, Shanshan; Hu, Yuanyuan; Li, Han; Zhang, Tao; Xue, Yuying; Pu, Yuepu

2017-01-01

The numerous increasing use of carbon nanotubes (CNTs) derived from nanotechnology has raised concerns about their biosafety and potential toxicity. CNTs cause immunologic dysfunction and limit the application of CNTs in biomedicine. The immunological responses induced by pristine multi-walled carbon nanotubes (p-MWCNTs) and PEGylated multi-walled carbon nanotubes (MWCNTs-PEG) on BALB/c mice via an intravenous administration were investigated. The results reflect that the p-MWCNTs induced significant increases in spleen, thymus, and lung weight. Mice treated with p-MWCNTs showed altered lymphocyte populations (CD3+, CD4+, CD8+, and CD19+) in peripheral blood and increased serum IgM and IgG levels, and splenic macrophage ultrastructure indicated mitochondria swelling. p-MWCNTs inhibited humoral and cellular immunity function and were associated with decreased immune responses against sheep erythrocytes and serum hemolysis level. Natural killer (NK) activity was not modified by two types of MWCNTs. In comparison with two types of MWCNTs, for a same dose, p-MWCNTs caused higher levels of inflammation and immunosuppression than MWCNTs-PEG. The results of immunological function suggested that after intravenous administration with p-MWCNTs caused more damage to systemic immunity than MWCNTs-PEG. Here, we demonstrated that a surface functional modification on MWCNTs reduces their immune perturbations in vivo. The chemistry-modified MWCNTs change their preferred immune response in vivo and reduce the immunotoxicity of p-MWCNTs. PMID:28280324

Systemic and immunotoxicity of pristine and PEGylated multi-walled carbon nanotubes in an intravenous 28 days repeated dose toxicity study.

PubMed

Zhang, Ting; Tang, Meng; Zhang, Shanshan; Hu, Yuanyuan; Li, Han; Zhang, Tao; Xue, Yuying; Pu, Yuepu

2017-01-01

The numerous increasing use of carbon nanotubes (CNTs) derived from nanotechnology has raised concerns about their biosafety and potential toxicity. CNTs cause immunologic dysfunction and limit the application of CNTs in biomedicine. The immunological responses induced by pristine multi-walled carbon nanotubes (p-MWCNTs) and PEGylated multi-walled carbon nanotubes (MWCNTs-PEG) on BALB/c mice via an intravenous administration were investigated. The results reflect that the p-MWCNTs induced significant increases in spleen, thymus, and lung weight. Mice treated with p-MWCNTs showed altered lymphocyte populations (CD3 + , CD4 + , CD8 + , and CD19 + ) in peripheral blood and increased serum IgM and IgG levels, and splenic macrophage ultrastructure indicated mitochondria swelling. p-MWCNTs inhibited humoral and cellular immunity function and were associated with decreased immune responses against sheep erythrocytes and serum hemolysis level. Natural killer (NK) activity was not modified by two types of MWCNTs. In comparison with two types of MWCNTs, for a same dose, p-MWCNTs caused higher levels of inflammation and immunosuppression than MWCNTs-PEG. The results of immunological function suggested that after intravenous administration with p-MWCNTs caused more damage to systemic immunity than MWCNTs-PEG. Here, we demonstrated that a surface functional modification on MWCNTs reduces their immune perturbations in vivo. The chemistry-modified MWCNTs change their preferred immune response in vivo and reduce the immunotoxicity of p-MWCNTs.

Vitamin C Modulates the Immunotoxic Effect of 17α-Methyltestosterone in Nile Tilapia.

PubMed

Abo-Al-Ela, Haitham G; El-Nahas, Abeer F; Mahmoud, Shawky; Ibrahim, Essam M

2017-04-11

The synthetic androgen 17α-methyltestosterone (MT) is profusely used and practically needed in the production of all-male Nile tilapia fry; however, such androgenic hormones badly disrupt the immune system. This study aimed to alleviate or counteract the immunotoxic effect of MT using vitamin C (ascorbic acid or vit C). Our results show that the highest phagocytic activity (PA), phagocytic index (PI), and lysozyme activity were detected in the vit C group and the MT plus vit C group. Furthermore, PA and PI were significantly suppressed, but lysozyme activity was stronger in the MT group than in the control. No differences were detected in the differential leukocyte count among the studied groups. Moreover, vit C obviously reduced the upregulated expression level of the innate immune-related genes, interleukin 1β (il1β), interleukin 8 (il8), tumor necrosis factor α (tnfα), CC-chemokine, Toll-like receptor 7 (tlr7), immunoglobulin M (IgM) heavy chain, and cellular apoptosis susceptibility (cas) induced by MT, excluding tnfα in the liver and CC-chemokine and tlr7 in the kidney. The micronucleus frequency was found to significantly improve in the vit C plus MT group in comparison to that in the MT group. Normal histoarchitecture of the liver, kidney, and spleen was observed in all the groups, except for the frequently observed melanomacrophage centers in the spleen and kidney of the fish that were treated with vit C and vit C plus MT. More importantly, our findings demonstrate that the upregulation of immune-related genes is not necessarily a sign of a stimulated or enhanced immune system.

Jet fuel-induced immunotoxicity.

PubMed

Harris, D T; Sakiestewa, D; Titone, D; Robledo, R F; Young, R S; Witten, M

2000-09-01

Chronic exposure to jet fuel has been shown to cause human liver dysfunction, emotional dysfunction, abnormal electroencephalograms, shortened attention spans, and to decrease sensorimotor speed (3-5). Exposure to potential environmental toxicants such as jet fuel may have significant effects on host systems beyond those readily visible (e.g., physiology, cardiology, respiratory, etc.), e.g., the immune system. Significant changes in immune function, even if short-lived, may have serious consequences for the exposed host that may impinge affect susceptibility to infectious agents. Major alterations in immune function that are long lasting may result in an increased likelihood of development and/or progression of cancer, as well as autoimmune diseases. In the current study mice were exposed 1 h/day for 7 days to a 1000-mg/m3 concentration of aerosolized jet fuel obtained from various sources (JP-8, JP-8+100 and Jet A1) and of differing compositions to simulate occupational exposures. Twenty-four hours after the last exposure the mice were analyzed for effects on the immune system. It was observed that exposure to all jet fuel sources examined had detrimental effects on the immune system. Decreases in viable immune cell numbers and immune organ weights were found. Jet fuel exposure resulted in differential losses of immune cell populations in the thymus. Further, jet fuel exposure resulted in significantly decreased immune function, as analyzed by mitogenesis assays. Suppressed immune function could not be overcome by the addition of exogenous growth factors known to stimulate immune function. Thus, short-term, low-concentration exposure of mice to aerosolized jet fuel, regardless of source or composition, caused significant deleterious effects on the immune system.

Immunotoxicity evaluation of novel bioactive composites in male mice as promising orthopaedic implants

PubMed Central

El-Bassyouni, Gehan T.; Eshak, Mariam G.; Barakat, Ibrahim A.H.

2017-01-01

Objective In orthopaedics, novel bioactive composites are largely needed to improve the synthetic achievement of the implants. In this work, semiconducting metal oxides such as SiO2, TiO2, and ZrO2 particles (Ps) were used individually and in different ratios to obtain different biphasic composites. The immunotoxicity of these composites was tested to inspect the potential toxicity prior to their use in further medical applications. Materials and methods In vitro mineralisation ability was inspected by soaking the composites in simulated body fluid (SBF). Additionally, in vivo experiments were performed consuming male mice using ISSR-PCR, micronucleus (MN) test, comet assay, glutathione peroxidase activity, and determination of albumin, globulin, lymphocyte population, ALT, and AST levels. Several groups of adult male albino mice were treated with 100, 200, and 400 mg/kg body weight of SiO2, TiO2, and ZrO2-Ps in pure or mixed forms. Results Our findings revealed that treatment of mice with low and medium doses of SiO2, TiO2, and ZrO2-Ps in pure or mixed form revealed values relatively similar to the control group. However, using 400 mg/kg especially from TiO2-Ps in genuine form or mixed with SiO2 showed proliferation in the toxicity rates compared with the high dose of SiO2 and ZrO2-Ps. Conclusions The results suggest that TiO2 composite induced in vivo toxicity, oxidative DNA damage, bargain of the antioxidant enzymes, and variations in the levels of albumin, globulin, lymphocyte population, ALT, and AST in a dose-dependent manner. However, SiO2, and ZrO2 composites revealed a lower toxicity in mice compared with that of TiO2. PMID:28680331

Thymus-directed immunotoxicity of airborne dust particles from Upper Silesia (Poland) under acute extrapulmonary studies in mice

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kozlowska, E.; Krzystniak, K.; Drela, N.

1996-12-27

Industrial air pollutants from Upper Silesia, Poland, contain over 250 polycyclic and heterocyclic aromatic hydrocarbons and heavy metals, including mutagenic and carcinogenic chemicals that have been shown to from DNA adducts. Over 4 million habitants of Silesia are permanently exposed to the industrial pollution by pulmonary and dermal routes and by contaminated food and water. These chemicals, when examined separately in animals models, were proven immunotoxic. We studied the extrapulmonary immunotoxic potential of a typical mixture of Silesian filter-suspended matter from a selected area, over a specific season and time period. Early changes in the immune system were analyzed inmore » BALB/c mice exposed ip to acute doses of 20-330 mg dust mixture/kg body weight (0.06-1.0 LD50). No major changes were noted for weight and the cellularity of spleen, liver and kidneys. However, dramatic decrease in thymus weight index and thymocyte cell count were noted as early as 24-72 h postexposure, which correlated with almost complete depletion of immature, double-positive CD4{sup +}CD8{sup +} thymocytes. Changes in spleen were less profound; however, increased depletion of B cells over T cells was noted at high doses of the suspended matter. Exposure to the airborne dust also decreased cytokine production by spleen cells, such as interferon-{gamma} (IFN-{gamma}) and tumor necrosis factor-{alpha} (TNF-{alpha}). Overall, a single exposure to Silesian dust, even at the relatively low 0.06 LD50 dose, affected lymphokine production, suppressed B-cell proliferative response, and depleted thymuses of immature, double-positive CD4{sup +}CD8{sup +} cells. A chemical synergism is suspected. To our knowledge, none of the known components of Silesian suspended matter, when examined as a single chemical, was shown to exert such a profound biological effect. 32 refs., 5 figs.« less

Visualization of the structural changes in plywood and gypsum board during the growth of Chaetomium globosum and Stachybotrys chartarum.

PubMed

Lewinska, Anna M; Hoof, Jakob B; Peuhkuri, Ruut H; Rode, Carsten; Lilje, Osu; Foley, Matthew; Trimby, Patrick; Andersen, Birgitte

2016-10-01

Fungal growth in indoor environments is associated with many negative health effects. Many studies focus on brown- and white-rot fungi and their effect on wood, but there is none that reveals the influence of soft-rot fungi, such as Stachybotrys spp. and Chaetomium spp., on the structure of building materials such as plywood and gypsum wallboard. This study focuses on using micro-computed tomography (microCT) to investigate changes of the structure of plywood and gypsum wallboard during fungal degradation by S. chartarum and C. globosum. Changes in the materials as a result of dampness and fungal growth were determined by measuring porosity and pore shape via microCT. The results show that the composition of the building material influenced the level of penetration by fungi as shown by scanning electron microscopy (SEM). Plywood appeared to be the most affected, with the penetration of moisture and fungi throughout the whole thickness of the sample. Conversely, fungi grew only on the top cardboard in the gypsum wallboard and they did not have significant influence on the gypsum wallboard structure. The majority of the observed changes in gypsum wallboard occurred due to moisture. This paper suggests that the mycelium distribution within building materials and the structural changes, caused by dampness and fungal growth, depend on the type of the material. Copyright © 2016 Elsevier B.V. All rights reserved.

Innate immune parameters and haemolymph protein expression profile to evaluate the immunotoxicity of tributyltin on abalone (Haliotis diversicolor supertexta).

PubMed

Zhou, Jin; Cai, Zhong-Hua; Zhu, Xiao-Shan; Li, Lei; Gao, Yun-Feng

2010-10-01

The immunotoxicity of tributyltin (TBT) on marine gastropods has been comparatively little studied although risks to wildlife associated with this compound are well known. In this study, a 30-day trial was conducted to evaluate the immunotoxic effects on abalone (Haliotis diversicolor supertexta) by exposing a range of doses of TBT (0, 2, 10, and 50 ng/L). Innate immune parameters, including phagocytic ability (PA), lysozyme activity, phenoloxidase (PO) level and superoxide dismutase (SOD) activity were monitored at intervals of 5, 15 and 30 days. Haemolymph protein expression profile was also examined at the end of the experiment. The results showed that PA value, lysozyme activity and PO level significantly decreased compared with the controls (P < 0.05), which indicated that TBT exposure markedly suppressed non-specific immune competence. Exposure to TBT also caused variation in protein expression patterns of haemolymph. Among the protein spots of differential expressions, seven proteins from the haemolymph of TBT-treated abalone were successfully identified by MALDI-TOF-MS analysis. Three protein spots increased and were identified as carrier-like peptide, peroxidase 21 precursor and creatine phosphokinase. These proteins are believed to up-regulate in expression as a response to detoxification and antioxidative stress mechanisms. The other four protein spots that down-regulated in TBT-treated groups were identified as aromatase-like protein, protein kinase C, ceruloplasmin and microtubule-actin crosslinking factor 1, and these proteins play an important role in endocrine regulation and immune defense. Taken together, the results demonstrate that TBT impair abalone immunological ability and is a potential immune disruptor. 2010 Elsevier Ltd. All rights reserved.

Biomarkers of Methylmercury Exposure Immunotoxicity among Fish Consumers in Amazonian Brazil

PubMed Central

Fillion, Myriam; Barbosa, Fernando; Shirley, Devon L.; Chine, Chiameka; Lemire, Melanie; Mergler, Donna; Silbergeld, Ellen K.

2011-01-01

Background: Mercury (Hg) is a ubiquitous environmental contaminant with neurodevelopmental and immune system effects. An informative biomarker of Hg-induced immunotoxicity could aid studies on the potential contribution to immune-related health effects. Objectives: Our objectives were to test the hypothesis that methylmercury (MeHg) exposures affect levels of serum biomarkers and to examine interactions between Hg and selenium (Se) in terms of these responses. Methods: This cross-sectional epidemiological study assessed adults living along the Tapajós River, a system long affected by MeHg. We measured antinuclear (ANA) and antinucleolar (ANoA) autoantibody levels and eight cytokines in serum samples (n = 232). Total Hg (including MeHg) and Se were measured in blood, plasma, hair, and urine. Results: The median (range) total Hg concentrations were 14.1 μg/g (1.1–62.4), 53.5 μg/L (4.3–288.9), 8.8 μg/L (0.2–40), and 3.0 μg/L (0.2–16.1) for hair, blood, plasma, and urine, respectively. Elevated titers of ANA (but not ANoA) were positively associated with MeHg exposure (log-transformed, for blood and plasma), unadjusted [odds ratio (OR) = 2.6; 95% confidence interval (CI): 1.1, 6.2] and adjusted for sex and age (OR = 2.9; 95% CI: 1.1, 7.5). Proinflammatory [interleukin (IL)-6 and interferon (IFN)-©], anti-inflammatory (IL-4), and IL-17 cytokine levels were increased with MeHg exposure; however, in the subset of the population with elevated ANA, proinflammatory IL-1®, IL-6, IFN-©, and tumor necrosis factor (TNF)-〈 and anti-inflammatory (IL-4) cytokine levels were decreased with MeHg exposure. Although Se status was associated with MeHg level (correlation coefficient = 0.86; 95% CI: 0.29, 1.43), Se status was not associated with any changes in ANA and did not modify associations between Hg and ANA titers. Conclusions: MeHg exposure was associated with an increased ANA and changes in serum cytokine profile. Moreover, alterations in serum cytokine profiles

Biomarkers of methylmercury exposure immunotoxicity among fish consumers in Amazonian Brazil.

PubMed

Nyland, Jennifer F; Fillion, Myriam; Barbosa, Fernando; Shirley, Devon L; Chine, Chiameka; Lemire, Melanie; Mergler, Donna; Silbergeld, Ellen K

2011-12-01

Mercury (Hg) is a ubiquitous environmental contaminant with neurodevelopmental and immune system effects. An informative biomarker of Hg-induced immunotoxicity could aid studies on the potential contribution to immune-related health effects. Our objectives were to test the hypothesis that methylmercury (MeHg) exposures affect levels of serum biomarkers and to examine interactions between Hg and selenium (Se) in terms of these responses. This cross-sectional epidemiological study assessed adults living along the Tapajós River, a system long affected by MeHg. We measured antinuclear (ANA) and antinucleolar (ANoA) autoantibody levels and eight cytokines in serum samples (n = 232). Total Hg (including MeHg) and Se were measured in blood, plasma, hair, and urine. The median (range) total Hg concentrations were 14.1 μg/g (1.1-62.4), 53.5 μg/L (4.3-288.9), 8.8 μg/L (0.2-40), and 3.0 μg/L (0.2-16.1) for hair, blood, plasma, and urine, respectively. Elevated titers of ANA (but not ANoA) were positively associated with MeHg exposure (log-transformed, for blood and plasma), unadjusted [odds ratio (OR) = 2.6; 95% confidence interval (CI): 1.1, 6.2] and adjusted for sex and age (OR = 2.9; 95% CI: 1.1, 7.5). Proinflammatory [interleukin (IL)-6 and interferon (IFN)-γ], anti-inflammatory (IL-4), and IL-17 cytokine levels were increased with MeHg exposure; however, in the subset of the population with elevated ANA, proinflammatory IL-1β, IL-6, IFN-γ, and tumor necrosis factor (TNF)-α and anti-inflammatory (IL-4) cytokine levels were decreased with MeHg exposure. Although Se status was associated with MeHg level (correlation coefficient = 0.86; 95% CI: 0.29, 1.43), Se status was not associated with any changes in ANA and did not modify associations between Hg and ANA titers. MeHg exposure was associated with an increased ANA and changes in serum cytokine profile. Moreover, alterations in serum cytokine profiles differed based on ANA response, suggesting a specific phenotype

Assessment of immunotoxicity in female Fischer 344/N and Sprague Dawley rats and female B6C3F1 mice exposed to hexavalent chromium via the drinking water.

PubMed

Shipkowski, Kelly A; Sheth, Christopher M; Smith, Matthew J; Hooth, Michelle J; White, Kimber L; Germolec, Dori R

2017-12-01

Sodium dichromate dihydrate (SDD), an inorganic compound containing hexavalent chromium (Cr(VI)), is a common environmental contaminant of groundwater sources due to widespread industrial use. There are indications in the literature that Cr(VI) may induce immunotoxic effects following dermal exposure, including acting as both an irritant and a sensitizer; however, the potential immunomodulatory effects of Cr(VI) following oral exposure are relatively unknown. Following the detection of Cr(VI) in drinking water sources, the National Toxicology Program (NTP) conducted extensive evaluations of the toxicity and carcinogenicity of SDD following drinking water exposure, including studies to assess the potential for Cr(VI) to modulate immune function. For the immunotoxicity assessments, female Fischer 344/N (F344/N) and Sprague Dawley (SD) rats and female B 6 C 3 F 1 mice were exposed to SDD in drinking water for 28 consecutive days and evaluated for alterations in cellular and humoral immune function as well as innate immunity. Rats were exposed to concentrations of 0, 14.3, 57.3, 172, or 516 ppm SDD while mice were exposed to concentrations of 0, 15.6, 31.3, 62.5, 125, or 250 ppm SDD. Final mean body weight and body weight gain were decreased relative to controls in 250 ppm B 6 C 3 F 1 mice and 516 ppm SD rats. Water consumption was significantly decreased in F344/N and SD rats exposed to 172 and 516 ppm SDD; this was attributed to poor palatability of the SDD drinking water solutions. Several red blood cell-specific parameters were significantly (5-7%) decreased in 250 ppm mice; however, these parameters were unaffected in rats. Sporadic increases in the spleen IgM antibody response to sheep red blood cells (SRBC) were observed, however, these increases were not dose-dependent and were not reproducible. No significant effects were observed in the other immunological parameters evaluated. Overall, exposure to Cr(VI) in drinking water had limited effects on

Health assessment of gasoline and fuel oxygenate vapors: immunotoxicity evaluation.

PubMed

White, Kimber L; Peachee, Vanessa L; Armstrong, Sarah R; Twerdok, Lorraine E; Clark, Charles R; Schreiner, Ceinwen A

2014-11-01

Female Sprague Dawley rats were exposed via inhalation to vapor condensates of either gasoline or gasoline combined with various fuel oxygenates to assess potential immunotoxicity of evaporative emissions. Test articles included vapor condensates prepared from "baseline gasoline" (BGVC), or gasoline combined with methyl tertiary butyl ether (G/MTBE), ethyl t-butyl ether (G/ETBE), t-amyl methyl ether (G/TAME), diisopropyl ether (G/DIPE), ethanol (G/EtOH), or t-butyl alcohol (G/TBA). Target concentrations were 0, 2000, 10,000 or 20,000mg/mg(3) administered for 6h/day, 5days/week for 4weeks. The antibody-forming cell (AFC) response to the T-dependent antigen, sheep erythrocyte (sRBC), was used to determine the effects of the gasoline vapor condensates on the humoral components of the immune system. Exposure to BGVC, G/MTBE, G/TAME, and G/TBA did not result in significant changes in the IgM AFC response to sRBC, when evaluated as either specific activity (AFC/10(6) spleen cells) or as total spleen activity (AFC/spleen). Exposure to G/EtOH and G/DIPE resulted in a dose-dependent decrease in the AFC response, reaching the level of statistical significance only at the high 20,000mg/m(3) level. Exposure to G/ETBE resulted in a statistically significant decrease in the AFC response at the middle (10,000mg/m(3)) and high (20,000mg/m(3)) exposure concentrations. Copyright © 2014 Elsevier Inc. All rights reserved.

Tributyltin induces mitochondrial fission through Mfn1 degradation in human induced pluripotent stem cells.

PubMed

Yamada, Shigeru; Asanagi, Miki; Hirata, Naoya; Itagaki, Hiroshi; Sekino, Yuko; Kanda, Yasunari

2016-08-01

Organotin compounds, such as tributyltin (TBT), are well-known endocrine disruptors. TBT is also known to cause various forms of cytotoxicity, including neurotoxicity and immunotoxicity. However, TBT toxicity has not been identified in normal stem cells. In the present study, we examined the effects of TBT on cell growth in human induced pluripotent stem cells (iPSCs). We found that exposure to nanomolar concentrations of TBT decreased intracellular ATP levels and inhibited cell viability in iPSCs. Because TBT suppressed energy production, which is a critical function of the mitochondria, we further assessed the effects of TBT on mitochondrial dynamics. Staining with MitoTracker revealed that nanomolar concentrations of TBT induced mitochondrial fragmentation. TBT also reduced the expression of mitochondrial fusion protein mitofusin 1 (Mfn1), and this effect was abolished by knockdown of the E3 ubiquitin ligase membrane-associated RING-CH 5 (MARCH5), suggesting that nanomolar concentrations of TBT could induce mitochondrial dysfunction via MARCH5-mediated Mfn1 degradation in iPSCs. Thus, mitochondrial function in normal stem cells could be used to assess cytotoxicity associated with metal exposure. Copyright © 2016 Elsevier Ltd. All rights reserved.

Immunotoxic effects of environmental pollutants in marine mammals.

PubMed

Desforges, Jean-Pierre W; Sonne, Christian; Levin, Milton; Siebert, Ursula; De Guise, Sylvain; Dietz, Rune

2016-01-01

immune function in marine mammals exposed to environmental contaminants. Exposure to immunotoxic contaminants may have significant population level consequences as a contributing factor to increasing anthropogenic stress in wildlife and infectious disease outbreaks.

Immunotoxicity of aflatoxin B1: Impairment of the cell-mediated response to vaccine antigen and modulation of cytokine expression

DOE Office of Scientific and Technical Information (OSTI.GOV)

Meissonnier, Guylaine M.; Alltech-France, European Regulatory Department, F-92593 Levallois-Perret; Pinton, Philippe

Aflatoxin B1 (AFB1), a mycotoxin produced by Aspergillus flavus or A. parasiticus, is a frequent contaminant of food and feed. This toxin is hepatotoxic and immunotoxic. The present study analyzed in pigs the influence of AFB1 on humoral and cellular responses, and investigated whether the immunomodulation observed is produced through interference with cytokine expression. For 28 days, pigs were fed a control diet or a diet contaminated with 385, 867 or 1807 {mu}g pure AFB1/kg feed. At days 4 and 15, pigs were vaccinated with ovalbumin. AFB1 exposure, confirmed by an observed dose-response in blood aflatoxin-albumin adduct, had no majormore » effect on humoral immunity as measured by plasma concentrations of total IgA, IgG and IgM and of anti-ovalbumin IgG. Toxin exposure did not impair the mitogenic response of lymphocytes but delayed and decreased their specific proliferation in response to the vaccine antigen, suggesting impaired lymphocyte activation in pigs exposed to AFB1. The expression level of pro-inflammatory (TNF-{alpha}, IL-1{beta}, IL-6, IFN-{gamma}) and regulatory (IL-10) cytokines was assessed by real-time PCR in spleen. A significant up-regulation of all 5 cytokines was observed in spleen from pigs exposed to the highest dose of AFB1. In pigs exposed to the medium dose, IL-6 expression was increased and a trend towards increased IFN-{gamma} and IL-10 was observed. In addition we demonstrate that IL-6 impaired in vitro the antigenic- but not the mitogenic-induced proliferation of lymphocytes from control pigs vaccinated with ovalbumin. These results indicate that AFB1 dietary exposure decreases cell-mediated immunity while inducing an inflammatory response. These impairments in the immune response could participate in failure of vaccination protocols and increased susceptibility to infections described in pigs exposed to AFB1.« less

In vitro characterization of cutaneous immunotoxicity of immortalized human keratinocytes (HaCaT) exposed to reactive and disperse textile dyes.

PubMed

Leme, Daniela Morais; Sehr, Andrea; Grummt, Tamara; Gonçalves, Jenifer Pendiuk; Jacomasso, Thiago; Winnischofer, Sheila Maria Brochado; Potrich, Francine Bittencourt; Oliveira, Carolina Camargo de; Trindade, Edvaldo da Silva; de Oliveira, Danielle Palma

2018-05-01

Several synthetic dyes are used by textile industry for supplying the market of colored clothes. However, these chemicals have been associated with a variety of adverse human health effects, including textile dermatitis. Thus, there is a growing concern to identify textile dyes potentially as skin immunotoxicants. The aim of this in vitro study was to characterize the immunotoxic potential of reactive (Reactive Green 19 [RG19], Reactive Blue 2 [RB2], Reactive Black 5 [RB5]) and disperse (Disperse Red 1 [DR1]) textile dyes using a dermal cell line. For this purpose, a cell-based approach was conducted with immortalized human keratinocytes (KC) (HaCaT) using selected biomarkers of cutaneous inflammation including modulation of matrix metalloproteinases (MMP), oxidative stress such as reactive oxygen species (ROS) generation, and inflammatory cytokine profile. DR1 was the only dye able to trigger an immune response such as release of IL-12 cytokine, a potent co-stimulator of T helper 1 cell, which may be considered as a skin immunotoxicant. The reactive dyes including RB5 that were previously reported as skin sensitizers failed to induce inflammatory reactions under the conditions tested. The reactive dyes studied may pose a risk to human KC by induction of effects related to modulation of MMP-2 (RB5) and -9 (RB5 and RB2) and generation of ROS (RG19 and RB2). Thus, all these dyes need to be used with caution to avoid undesirable effects to consumers who may be exposed dermally.

Effects of diazinon on the lymphocytic cholinergic system of Nile tilapia fish (Oreochromis niloticus).

PubMed

Toledo-Ibarra, G A; Díaz-Resendiz, K J G; Pavón-Romero, L; Rojas-García, A E; Medina-Díaz, I M; Girón-Pérez, M I

2016-08-01

Fish rearing under intensive farming conditions can be easily disturbed by pesticides, substances that have immunotoxic properties and may predispose to infections. Organophosphorus pesticides (OPs) are widely used in agricultural activities; however, the mechanism of immunotoxicity of these substances is unclear. The aim of this study was to evaluate the effect of diazinon pesticides (OPs) on the cholinergic system of immune cells as a possible target of OP immunotoxicity. We evaluated ACh levels and cholinergic (nicotinic and muscarinic) receptor concentration. Additionally, AChE activity was evaluated in mononuclear cells of Nile tilapia (Oreochromis niloticus), a freshwater fish mostly cultivated in tropical regions around the world. The obtained results indicate that acute exposure to diazinon induces an increase in ACh concentration and a decrease in nAChR and mAChR concentrations and AChE activity in fish immune cells, This suggests that the non-neuronal lymphocytic cholinergic system may be the main target in the mechanism of OP immunotoxicity. This study contributes to the understanding of the mechanisms of immunotoxicity of pollutants and may help to take actions for animal health improvement. Copyright © 2016 Elsevier B.V. All rights reserved.

Developmental immunotoxicity of chemicals in rodents and its possible regulatory impact.

PubMed

Hessel, Ellen V S; Tonk, Elisa C M; Bos, Peter M J; van Loveren, Henk; Piersma, Aldert H

2015-01-01

Around 25% of the children in developed countries are affected with immune-based diseases. Juvenile onset diseases such as allergic, inflammatory and autoimmune diseases have shown increasing prevalences in the last decades. The role of chemical exposures in these phenomena is unclear. It is thought that the developmental immune system is more susceptible to toxicants than the mature situation. Developmental immunotoxicity (DIT) testing is nowadays not or minimally included in regulatory toxicology requirements. We reviewed whether developmental immune parameters in rodents would provide relatively sensitive endpoints of toxicity, whose inclusion in regulatory toxicity testing might improve hazard identification and risk assessment of chemicals. For each of the nine reviewed toxicants, the developing immune system was found to be at least as sensitive or more sensitive than the general (developmental) toxicity parameters. Functional immune (antigen-challenged) parameters appear more affected than structural (non-challenged) immune parameters. Especially, antibody responses to immune challenges with keyhole limpet hemocyanine or sheep red blood cells and delayed-type hypersensitivity responses appear to provide sensitive parameters of developmental immune toxicity. Comparison with current tolerable daily intakes (TDI) and their underlying overall no observed adverse effect levels showed that for some of the compounds reviewed, the TDI may need reconsideration based on developmental immune parameters. From these data, it can be concluded that the developing immune system is very sensitive to the disruption of toxicants independent of study design. Consideration of including functional DIT parameters in current hazard identification guidelines and wider application of relevant study protocols is warranted.

CHARACTERISTIC GROWTH REQUIREMENTS OF THE TOXIC MOLD STACHYBOTRYS CHARTARAM

EPA Science Inventory

The paper discusses the results of a study of the environmental factors leading to the growth of the mold Stachybotrys chartarum. S. chartarum has been found to be associated with idiopathic pulmonary hemorrhage in infants, and its toxin production and occurrence in water damaged...

In vitro immunotoxicity assessment of culture-derived extracellular vesicles in human monocytes

PubMed Central

Rosas, Lucia E.; Elgamal, Ola A.; Mo, Xiaokui; Phelps, Mitch A.; Schmittgen, Thomas D.; Papenfuss, Tracey L.

2016-01-01

The potential to engineer extracellular vesicles (EV) that target specific cells and deliver a therapeutic payload has propelled a growing interest in their development as promising therapeutics. These EV are often produced from cultured cells. Very little is known about the interaction of cell culture-derived EV with cells of the immune system and their potential immunomodulatory effects. The present study evaluated potential immunotoxic effects of HEK293T-derived EV on the human monocytic cell lines THP-1 and U937. Incubation of cells with different doses of EV for 16–24 h was followed by assessment of cytotoxicity and cell function by flow cytometry. Changes in cell functionality were evaluated by the capacity of cells to phagocytize fluorescent microspheres. In addition, the internalization of labeled EV in THP-1 and U937 cells was evaluated. Exposure to EV did not affect the viability of THP-1 or U937 cells. Although lower doses of the EV increased phagocytic capacity in both cell lines, phagocytic efficiency of individual cells was not affected by EV exposure at any of the doses evaluated. This study also demonstrated that THP-1 and U937 monocytic cells are highly permissive to EV entry in a dose-response manner. These results suggest that, although HEK293T-derived EV are efficiently internalized by human monocytic cells, they do not exert a cytotoxic effect or alter phagocytic efficiency on the cell lines evaluated. PMID:27075513

Biological responses of Raw 264.7 macrophage exposed to two strains of Stachybotrys chartarum spores grown on four different wallboard types.

PubMed

Kim, J H; Harvey, L A; Evans, A L; Byfield, G E; Betancourt, D A; Dean, T R

2016-06-01

The many benefits of building "green" have motivated the use of sustainable products in the design and execution of the built environment. However, the use of these natural or recycled materials, some of which have been treated with antimicrobials, provides a growth opportunity for microorganisms with the potential to elicit adverse health effects especially in the presence of an antimicrobial. The focus of this research was to determine the effects of Stachybotrys chartarum (strains Houston and 51-11) grown under different conditions on a macrophage cell line (Raw 264.7) using endpoints, including cytotoxicity, and those associated with immunity specifically inflammation and MHC class II expression. The fungi were grown on four different gypsum products, and macrophages were exposed to whole spores of both strains and fragmented spores of strain 51-11. Whole spores of the Houston strain elicited no cytotoxicity with some level of inflammation, while exposure to whole spores of 51-11 caused variable responses depending on the wallboard type supporting the fungal growth. High concentrations of fragmented 51-11 spores primarily resulted in the apoptosis of macrophage with no inflammation. None of the fungal strains caused elevated levels of major histocompatibility complex (MHC) class II expression on the surface of Raw cells. Mycotoxin levels of 51-11 spores from all of the wallboard types measured  >250 ng/μL of T2 equivalent toxin based on activity. Collectively, the data demonstrated that all of the wallboard types supported growth of fungi with the ability to elicit harmful biological responses with the potential to negatively impact human health.

The relation between growth of four microbes on six different plasterboards and biological activity of spores.

PubMed

Murtoniemi, T; Hirvonen, M-R; Nevalainen, A; Suutari, M

2003-03-01

Microbial growth on water-damaged building materials is commonly associated with adverse health effects in the occupants. We examined the growth of Stachybotrys chartarum, Aspergillus versicolor, Penicillium spinulosum, and Streptomyces californicus, isolated from water-damaged buildings, on six different brands of plasterboards. The microbial growth was compared with the biological activity of the spores, that is the potential to induce cytotoxicity and proinflammatory mediators in RAW264.7 macrophages. These results showed that the microbial growth on plasterboard depended on both the microbial strain and the brand of plasterboard used. The biological activity of spores appeared to be regulated by different growth conditions on plasterboards so that good microbial growth was associated with a low bioactivity of the spores, whereas the spores collected from plasterboard supporting only weak growth usually were biologically active. Cytotoxicity of either S. chartarum or A. versicolor did not correlate with any particular growth conditions or induced inflammatory responses. Instead, there were positive correlations between cytotoxicity and levels of induced proinflammatory cytokines for P. spinulosum and S. californicus. These data suggest that both the microbial growth on plasterboard and the resulting bioactivity of spores vary and might be affected by changing the growth conditions provided by the plasterboards.

Stachybotrys: An unusual mold associated with water-damaged buildings.

PubMed

Jarvis, B; Hinkley, S; Nielsen, K

2000-03-01

Chemical analyses of extracts of cultures ofS. chartarum show that this fungus has two chemotypes: producers of the potent cytotoxic macrocyclic trichothecenes (e. g. satratoxins) and those that produce the diterpenoid atranones and the simple trichothecenes, trichodermol and trichodermin. All isolates ofS. chartarum produce the immunosuppressant spirocyclic drimanes.

Production of proinflammatory mediators by indoor air bacteria and fungal spores in mouse and human cell lines.

PubMed

Huttunen, Kati; Hyvärinen, Anne; Nevalainen, Aino; Komulainen, Hannu; Hirvonen, Maija-Riitta

2003-01-01

We compared the inflammatory and cytotoxic responses caused by household mold and bacteria in human and mouse cell lines. We studied the fungi Aspergillus versicolor, Penicillium spinulosum, and Stachybotrys chartarum and the bacteria Bacillus cereus, Pseudomonas fluorescens, and Streptomyces californicus for their cytotoxicity and ability to stimulate the production of inflammatory mediators in mouse RAW264.7 and human 28SC macrophage cell lines and in the human A549 lung epithelial cell line in 24-hr exposure to 10(5), 10(6), and 10(7) microbes/mL. We studied time dependency by terminating the exposure to 10(6) microbes/mL after 3, 6, 12, 24, and 48 hr. We analyzed production of the cytokines tumor necrosis factor-alpha and interleukins 6 and 1ss (TNF-alpha, IL-6, IL-1ss, respectively) and measured nitric oxide production using the Griess method, expression of inducible NO-synthase with Western Blot analysis, and cytotoxicity with the MTT-test. All bacteria strongly induced the production of TNF-alpha, IL-6 and, to a lesser extent, the formation of IL-1ss in mouse macrophages. Only the spores of Str. californicus induced the production of NO and IL-6 in both human and mouse cells. In contrast, exposure to fungal strains did not markedly increase the production of NO or any cytokine in the studied cell lines except for Sta. chartarum, which increased IL-6 production somewhat in human lung epithelial cells. These microbes were less cytotoxic to human cells than to mouse cells. On the basis of equivalent numbers of bacteria and spores of fungi added to cell cultures, the overall potency to stimulate the production of proinflammatory mediators decreased in the order Ps. fluorescens > Str. californicus > B. cereus > Sta. chartarum > A. versicolor > P. spinulosum. These data suggest that bacteria in water-damaged buildings should also be considered as causative agents of adverse inflammatory effects.

Production of proinflammatory mediators by indoor air bacteria and fungal spores in mouse and human cell lines.

PubMed Central

Huttunen, Kati; Hyvärinen, Anne; Nevalainen, Aino; Komulainen, Hannu; Hirvonen, Maija-Riitta

2003-01-01

We compared the inflammatory and cytotoxic responses caused by household mold and bacteria in human and mouse cell lines. We studied the fungi Aspergillus versicolor, Penicillium spinulosum, and Stachybotrys chartarum and the bacteria Bacillus cereus, Pseudomonas fluorescens, and Streptomyces californicus for their cytotoxicity and ability to stimulate the production of inflammatory mediators in mouse RAW264.7 and human 28SC macrophage cell lines and in the human A549 lung epithelial cell line in 24-hr exposure to 10(5), 10(6), and 10(7) microbes/mL. We studied time dependency by terminating the exposure to 10(6) microbes/mL after 3, 6, 12, 24, and 48 hr. We analyzed production of the cytokines tumor necrosis factor-alpha and interleukins 6 and 1ss (TNF-alpha, IL-6, IL-1ss, respectively) and measured nitric oxide production using the Griess method, expression of inducible NO-synthase with Western Blot analysis, and cytotoxicity with the MTT-test. All bacteria strongly induced the production of TNF-alpha, IL-6 and, to a lesser extent, the formation of IL-1ss in mouse macrophages. Only the spores of Str. californicus induced the production of NO and IL-6 in both human and mouse cells. In contrast, exposure to fungal strains did not markedly increase the production of NO or any cytokine in the studied cell lines except for Sta. chartarum, which increased IL-6 production somewhat in human lung epithelial cells. These microbes were less cytotoxic to human cells than to mouse cells. On the basis of equivalent numbers of bacteria and spores of fungi added to cell cultures, the overall potency to stimulate the production of proinflammatory mediators decreased in the order Ps. fluorescens > Str. californicus > B. cereus > Sta. chartarum > A. versicolor > P. spinulosum. These data suggest that bacteria in water-damaged buildings should also be considered as causative agents of adverse inflammatory effects. PMID:12515684

Potential preventive role of lactic acid bacteria against aflatoxin M₁ immunotoxicity and genotoxicity in mice.

PubMed

Ben Salah-Abbès, Jalila; Abbès, Samir; Jebali, Rania; Haous, Zohra; Oueslati, Ridha

2015-01-01

Aflatoxin M1 (AFM1) is a mycotoxin produced by numerous Aspergillus species in pre- or post-harvest cereals and milk. Exposure to AFM1 imparts potent economic losses in the livestock industry. Toxicologically, it also causes severe immune system problems. The aims of this study were to evaluate a new AFM1-binding/degrading microorganism for biologic detoxification, to examine its ability to degrade AFM1 in liquid medium, and to evaluate its potential for in vivo preventative effects against AFM1-induced immunotoxicity and genotoxicity in mice. Lactobacillus plantarum MON03 (LP) isolated from Tunisian artisanal butter was found to display significant binding ability to AFM1 in PBS (93%) within 24 h of incubation. Further, the LP was able to tolerate gastric acidity, bile salts, and adhere efficiently to Caco-3 cells in vitro. The in vivo study used Balb/c mice that received either vehicle (control), LP only (at 1 × 10(9)CFU/L, ∼1 mg/kg bw), AFM1 (100 mg/kg bw), or AFM1 + LP daily for 15 days (by gavage); two other groups received a single dose of colchicine (4 mg/kg) or mitomycin C (1 mg/kg) as positive controls for induction of micronuclei and chromosomal aberrations, respectively. The results showed that, compared to in control mice, AFM1 treatment led to significantly decreased body weight gains, and caused cytotoxic/genotoxic effects as indicated by increases in frequencies of polychromatic erythrocytes, as well as those with micronucleation (PCEMN) and chromosomal aberrations, among bone marrow cells. The concurrent administration of LP with AFM1 strongly reduced the adverse effects of AFM1 on each parameter. Mice receiving AFM1 + LP co-treatment displayed no significant differences in the assayed parameters as compared to the control mice. By itself, the bacteria caused no adverse effects. Based on the data, it is concluded that the test bacteria could potentially be beneficial in the detoxification of AFM1-contaminated foods and feeds

Immunotoxic effects of sodium tungstate dihydrate on female B6C3F1/N mice when administered in drinking water.

PubMed

Frawley, Rachel P; Smith, Matthew J; White, Kimber L; Elmore, Susan A; Herbert, Ron; Moore, Rebecca; Staska, Lauren M; Behl, Mamta; Hooth, Michelle J; Kissling, Grace E; Germolec, Dori R

2016-09-01

Tungsten is a naturally occurring, high-tensile strength element that has been used in a number of consumer products. Tungsten has been detected in soil, waterways, groundwater, and human tissue and body fluids. Elevated levels of tungsten in urine were reported for populations exposed to tungstate in drinking water in areas where natural tungsten formations were prevalent. Published reports indicated that sodium tungstate may modulate hematopoiesis, immune cell populations, and immune responses in rodent models. The objective of this study was to assess potential immunotoxicity of sodium tungstate dihydrate (STD), a drinking water contaminant. Female B6C3F1/N mice received 0-2000 mg STD/L in their drinking water for 28 d, and were evaluated for effects on immune cell populations in spleen and bone marrow, and humoral-mediated, cell-mediated, and innate immunity. Three different parameters of cell-mediated immunity were similarly affected at 1000 mg STD/L. T-cell proliferative responses against allogeneic leukocytes and anti-CD3 were decreased 32%, and 21%, respectively. Cytotoxic T-lymphocyte activity was decreased at all effector:target cell ratios examined. At 2000 mg STD/L, the absolute numbers of CD3(+) T-cell progenitor cells in bone marrow were increased 86%, but the alterations in B-lymphocyte and other progenitor cells were not significant. There were no effects on bone marrow DNA synthesis or colony forming capabilities. STD-induced effects on humoral-mediated immunity, innate immunity, and splenocyte sub-populations were limited. Enhanced histopathology did not detect treatment-related lesions in any of the immune tissues. These data suggest exposure to STD in drinking water may adversely affect cell-mediated immunity.

Immunotoxic Effects of Sodium Tungstate Dihydrate on Female B6C3F1/N Mice When Administered in Drinking Water

PubMed Central

Frawley, Rachel P.; Smith, Matthew J.; White, Kimber L; Elmore, Susan; Herbert, Ron; Moore, Rebecca; Staska, Lauren M.; Behl, Mamta; Hooth, Michelle J.; Kissling, Grace E.; Germolec, Dori R.

2018-01-01

Tungsten is a naturally occurring, high tensile strength element that has been used in a number of consumer products. Tungsten has been detected in soil, waterways, groundwater, and human tissue and body fluids. Elevated levels of tungsten in urine were reported for populations exposed to tungstate in drinking water in areas where natural tungsten formations were prevalent. Published reports indicated that sodium tungstate may modulate hematopoiesis, immune cell populations, and immune responses in rodent models. The objective of this study was to assess potential immunotoxicity of sodium tungstate dihydrate (STD), a drinking water contaminant. Female B6C3F1/N mice received 0–2000 mg STD/L in their drinking water for 28 days, and were evaluated for effects on immune cell populations in spleen and bone marrow, and humoral-mediated, cell-mediated, and innate immunity. Three different parameters of cell-mediated immunity were similarly affected at 1000 mg STD/L. T-cell proliferative responses against allogeneic leukocytes and anti-CD3 were decreased 32%, and 21%, respectively. Cytotoxic T-lymphocyte activity was decreased at all effector:target cell ratios examined. At 2000 mg STD/L, the absolute numbers of CD3+ T-cell progenitor cells in bone marrow were increased 86%, but the alterations in B-lymphocyte and other progenitor cells were not significant. There were no effects on bone marrow DNA synthesis or colony forming capabilities. STD-induced effects on humoral-mediated immunity, innate immunity, and splenocyte sub-populations were limited. Enhanced histopathology did not detect treatment-related lesions in any of the immune tissues. These data suggest exposure to STD in drinking water may adversely effect cell-mediated immunity. PMID:27223060

Culturability and toxicity of sick building syndrome-related fungi over time.

PubMed

Wilson, Stephen C; Carriker, Curtis G; Brasel, Trevor L; Karunasena, Enusha; Douglas, David R; Wu, Chunfa; Andriychuk, Larysa A; Fogle, Matthew R; Martin, Jared M; Straus, David C

2004-08-01

Two experiments were conducted regarding the culturability and toxicity of fungi located on building materials over time and the efficacy of seven laboratory techniques in recovering culturable fungi from sample swabs. In the first experiment, eight sections of drywall were inoculated with Stachybotrys chartarum and stored at 25 +/- 5 degrees Celsius and 20-60% relative humidity (RH) for up to two years. Another eight sections of ceiling tile were stored at 100% RH for 1 year. Six sections of ceiling tile and 15 swabs were also inoculated with Penicillium chrysogenum and S. chartarum respectively and stored under the same conditions for 8 months and 3.3 years. All materials were tested for culturability at the end of the storage period. S. chartarum-inoculated samples were also tested for toxicity. In the second experiment (replicated twice), S. chartarum and Chaetomium globosum were inoculated onto 84 swabs each. Storage was up to 266 days at 25 +/- 5 degrees Celsius and 20-60% RH. Seven techniques were compared regarding the recovery of culturable fungi from the swabs over different time points. Results for Experiment 1 showed that all samples were culturable after the storage period and that the S. chartarum-inoculated drywall samples were toxic. In Experiment 2, all techniques showed high rates of recovery. These data show that despite being without a water source, these organisms can be culturable and toxic after long periods of time under conditions similar to human-occupied dwellings and that a number of preparation techniques are suitable for the recovery of these fungi from inoculated swabs.

Deoxynivalenol induces apoptosis in chicken splenic lymphocytes via the reactive oxygen species-mediated mitochondrial pathway.

PubMed

Ren, Zhihua; Wang, Yachao; Deng, Huidan; Deng, Youtian; Deng, Junliang; Zuo, Zhicai; Wang, Ya; Peng, Xi; Cui, Hengmin; Shen, Liuhong

2015-01-01

We investigated the immunotoxicity and cytotoxicity of deoxynivalenol (DON), a mycotoxin, and the mechanism by which it induces apoptosis. Chicken splenic lymphocytes treated with 0-50μg/mL DON for 48h inhibited growth of splenic lymphocytes in a dose-dependent manner, as revealed by the Cell Counting Kit-8 (CCK-8) bioassay. Annexin V-fluorescein isothiocyanate staining indicated that the number of apoptotic and necrotic cells were significantly higher compared with the control (P<0.01). DON treatment induced ROS accumulation, resulting in reduced mitochondrial transmembrane potential, as detected by flow cytometry and 2',7'-dichlorofluorescein acetate and rhodamine 123 labeling, respectively. Enzyme linked immunosorbent assays revealed that the concentrations of p53, Bax, Bak-1, and Caspase-3 increased with increasing DON concentration (P<0.05 or P<0.01), whereas the concentrations of Bcl-2 decreased (P<0.01) compared with the control. These data suggest that DON induces apoptosis in splenic lymphocytes via a ROS-mediated mitochondrial pathway. Copyright © 2014. Published by Elsevier B.V.

Immunotoxicity of surface waters contaminated by municipal effluents to the snail Lymnaea stagnalis.

PubMed

Gust, M; Fortier, M; Garric, J; Fournier, M; Gagné, F

2013-01-15

The immunotoxic effects of surface waters contaminated by a municipal effluent dispersion plume were examined in the snail Lymnaea stagnalis. Snails were exposed to surface waters where changes in hemocyte counts, viability, levels of reactive oxygen species (ROS), reduced thiols and phagocytic activity were tracked following exposure periods of 3h and 3 and 7d. Changes in mRNA expression of some genes in the hemocytes were also assessed after 7d of exposure, as follows: genes coding for catalase (CAT), superoxide dismutase (SOD), glutathione reductase (GSR), selenium-dependent glutathione peroxidase (SeGPX), two isoforms of the nitric oxide synthetase (NOS1 and NOS2), molluscan defensive molecule (MDM), toll-like receptor 4 (TLR4), allograft inflammatory factor-1 (AIF), and heat-shock protein 70 (HSP70). At the sites closest to the discharge point, exposure led to impaired hemocyte viability and intracellular thiol levels and also an increase of hemocyte count, ROS levels and phagocytosis. Phagocytosis and ROS levels in hemocytes were correlated with heterotrophic bacterial counts in snails. We found four genes with increased mRNA expression as a response to exposure of municipal wastewaters: TLR4 (6-fold), HSP70 (2-fold), SeGPx (4-fold) and CAT (2-fold). Immunocompetence responses were analyzed by canonical analysis to seek out relationships with mRNA expression of the genes involved in stress, pattern recognition, cellular and humoral responses. The data revealed that genes involved in oxidative stress were strongly involved with immunocompetence and that the resulting immune responses were influenced both by the bacterial and pollutant loadings of the effluent. Copyright © 2012 Elsevier B.V. All rights reserved.

Composition and immunotoxicity activity of essential oils from leaves of Zingiber officinale Roscoe against Aedes aegypti L.

PubMed

Moon, Hyung-In; Cho, Sang-Buem; Kim, Soo-Ki

2011-03-01

The leaves of Zingiber officinale Roscoe were extracted and the major essential oil composition and immunotoxicity effects were studied. The analyses were conducted by gas chromatography and mass spectroscopy (GC-MS) revealed that the essential oils of Z. officinale leaves. The Z. officinale essential oil yield was 0.26%, and GC/MS analysis revealed that its major constituents were Camphene (5.26%), Phellandrene (6.58%), Zingiberene (36.48%), Geranial (4.32%), β-gurjunene (2.74%), and Citronellol β-sesguiphellandrene (12.31%). The essential oil had a significant toxic effect against early fourth-stage larvae of Aedes aegypti L with an LC(50) value of 46.38 ppm and an LC(90) value of 84.32 ppm. Also, Camphene (≥95.0%), Phellandrene (≥95.0%), Zingiberene (≥95.0%), Geranial (≥95.0%), β-gurjunene (≥97.0%), and Citronellol (≥95.0%) were tested against the F21 laboratory strain of A. aegypti. Zingiberene (≥95.0%) and Citronellol (≥95.0%) have medium activity with an LC(50) value of 99.55 ppm and 141.45 ppm. This indicates that other major compounds may play a more important role in the toxicity of essential oil.

Potential immunotoxic effects of trichloroethylene-induced IV allergic reaction in renal impairment

PubMed Central

Yu, Jun-Feng; Feng, Yan-Yan

2017-01-01

Trichloroethylene (TCE) is known to induce allergic contact dermatitis and subsequent occupational medicamentosa-like dermatitis (OMLD) with multi-system injuries, including liver, kidney, and skin injuries. However, the mechanisms underlying immune system dysfunction that result in organ injury have not yet been clearly elucidated. In the present study, we measured the levels of secreted cytokines by effect or T cells in TCE-treated guinea pigs to better understand the contribution of allergic disorders in renal injuries. We immunized guinea pigs with trichloroethylene using the Guinea Pig Maximization Test (GPMT) and scored the inflammation on the guinea pigs’ skin. The kidney function and ultra-structural changes in the kidneys were detected using biochemical methods and electron microscopy. The deposition of cytokines was determined using immunohistochemistry. The sensitization rate was 63.16% in the TCE-sensitized groups. The electron microscopy results showed tubular epithelial cell mitochondrial swelling, vacuolar degeneration, and atrophy of the microvillus in the sensitized groups. A high degree of cytokine deposition was observed in the renal tubular proximal epithelial cells in the TCE-sensitized groups. As observed in this study, the variation in the level of immune system activation not only indicates that TCE can largely magnify the immune reaction but also suggests a potential role of immune dysfunction in renal impairment. PMID:28867961

Characterization of Stachybotrys from water-damaged buildings based on morphology, growth, and metabolite production.

PubMed

Andersen, Birgitte; Nielsen, Kristian F; Jarvis, Bruce B

2002-01-01

Stachybotrys was found to be associated with idiopathic pulmonary hemorrhage in infants in Cleveland, Ohio. Since that time, considerable effort has been put into finding the toxic components responsible for the disease. The name Stachybotrys chartarum has been applied to most of these isolates, but inconsistent toxicity results and taxonomic confusion prompted the present study. In this study, 122 Stachybotrys isolates, mainly from water-damaged buildings, were characterized and identified by combining three different approaches: morphology, colony characteristics, and metabolite production. Two different Stachybotrys taxa, S. chartarum and one undescribed species, were found in water-damaged buildings regardless of whether the buildings were in Denmark, Finland, or the USA. Furthermore, two chemotypes could be distinguished in S. chartarum. One chemotype produced atranones, whereas the other was a macrocyclic trichothecene-producer. The second undescribed taxon produced atranones and could be differentiated from S. chartarum by its growth characteristics and pigment production. Our results correlate with different inflammatory and toxicological properties reported for these same isolates and show that the three taxa/chemotypes should be treated separately. The co-occurrence of these three taxa/chemotypes in water-damaged buildings explains the inconsistent results in the literature concerning toxicity of Stachybotrys isolated from that environment.

In vitro assessment of silver nanoparticles immunotoxicity.

PubMed

Galbiati, Valentina; Cornaghi, Laura; Gianazza, Elisabetta; Potenza, Marco A; Donetti, Elena; Marinovich, Marina; Corsini, Emanuela

2018-02-01

This study aimed to characterize unwanted immune effects of nanoparticles (NP) using THP-1 cells, human whole blood and enriched peripheral blood monocytes. Commercially available silver NP (AgNP < 100 nm, also confirmed by Single Particle Extinction and Scattering) were used as prototypical NP. Cells were treated with AgNP alone or in combination with classical immune stimuli (i.e. LPS, PHA, PWM) and cytokine assessed; in addition, CD54 and CD86 expression was evaluated in THP-1 cells. AgNP alone induced dose-related IL-8 production in all models, with higher response observed in THP-1 cells, possibly connected to different protein corona formation in bovine versus human serum. AgNP potentiated LPS-induced IL-8 and TNF-α, but not LPS-induced IL-10. AgNP alone induced slight increase in IL-4, and no change in IFN-γ production. While responses to PHA in term of IL-4 and IFN-γ production were not affected, increased PWM-induced IL-4 and IFN-γ production were observed, suggesting potentiation of humoral response. Reduction in PHA-induced IL-10 was observed. Overall, results indicate immunostimulatory effects. THP-1 cells work as well as primary cells, representing a useful and practical alternative, with the awareness that from a physiological point of view the whole blood assay is the one that comes closest to reality. Copyright © 2018 Elsevier Ltd. All rights reserved.

78 FR 8156 - National Institute of Environmental Health Sciences; Notice of Closed Meeting

Federal Register 2010, 2011, 2012, 2013, 2014

2013-02-05

... Environmental Health Sciences; Notice of Closed Meeting Pursuant to section 10(d) of the Federal Advisory... Environmental Health Sciences Special Emphasis Panel; Studies of Environmental Agents to Induce Immunotoxicity... McGee, Associate Scientific Review Administrator, Scientific Review Branch, Division of Extramural...

The comparative immunotoxicity of mesoporous silica nanoparticles and colloidal silica nanoparticles in mice

PubMed Central

Lee, Soyoung; Kim, Mi-Sun; Lee, Dakeun; Kwon, Taeg Kyu; Khang, Dongwoo; Yun, Hui-Suk; Kim, Sang-Hyun

2013-01-01

Background Mesoporous silica (MPS) nanoparticles (NPs), which have a unique pore structure and extremely large surface area and pore volume, have received much attention because of their biomedical application potential. Using MPS NPs for biomedical devices requires the verification of their biocompatibility because the surface area of NPs is one of the most important determinants of toxicity, including the cellular uptake and immune response. We have previously reported that the cytotoxicity and inflammation potential of MPS NPs have been shown to be lower than those of general amorphous colloidal silica (Col) NPs in macrophages, but the low cytotoxicity does not guarantee high biocompatibility in vivo. In this study, we compared the in vivo immunotoxicity of MPS and Col NPs in the mouse model to define the effects of pore structural conditions of silica NPs. Materials and methods Both MPS and Col NPs (2, 20, and 50 mg/kg/day) were intraperitoneally administered in female BALB/c mice for 4 weeks, and clinical toxicity, lymphocyte population, serum IgG/IgM levels, and histological changes were examined. Results There was no overt sign of clinical toxicity in either MPS- or Col-treated mice. However, MPS NPs led to significant increases in liver and spleen weight and splenocyte proliferation. Mice treated with MPS NPs showed altered lymphocyte populations (CD3+, CD45+, CD4+, and CD8+) in the spleen, increased serum IgG and IgM levels, and histological changes. Despite slight changes in lymphocyte populations in the spleen, Col NPs did not alter other immunological factors. Conclusion The results indicate that in vivo exposure to MPS NPs caused more damage to systemic immunity than that of Col NPs through the dysregulation of the spleen. The results for in vivo data are inconsistent with those for in vitro data, which show lower cytotoxicity for MPS NPs. These results suggest the importance of verifying biocompatibility both in vitro and in vivo during the design of

HPMA copolymer-bound doxorubicin induces immunogenic tumor cell death.

PubMed

Sirova, M; Kabesova, M; Kovar, L; Etrych, T; Strohalm, J; Ulbrich, K; Rihova, B

2013-01-01

Treatment of murine EL4 T cell lymphoma with N-(2-hydroxypropyl)methacrylamide (HPMA) copolymer conjugates of doxorubicin (Dox) leads to complete tumor regression and to the development of therapy-dependent longlasting cancer resistance. This phenomenon occurs with two types of Dox conjugates tested, despite differences in the covalent linkage of Dox to the polymer carrier. Such a cancer resistance cannot fully express in conventional treatment with free Dox, due to substantial immunotoxicity of the treatment, which was not observed in the polymer conjugates. In this study, calreticulin (CRT) translocation and high mobility group box-1 protein (HMGB1) release was observed in EL4 cells treated with a conjugate releasing Dox by a pH-dependent manner. As a result, the treated tumor cells were engulfed by dendritic cells (DC) in vitro, and induced their expression of CD80, CD86, and MHC II maturation markers. Conjugates with Dox bound via an amide bond only increased translocation of HSPs to the membrane, which led to an elevated phagocytosis but was not sufficient to induce increase of the maturation markers on DCs in vitro. Both types of conjugates induced engulfment of the target tumor cells in vivo, that was more intense than that seen with free Dox. It means that the induction of anti-tumor immunity documented upon treatment of EL4 lymphoma with HPMA-bound Dox conjugates does not rely solely on CRT-mediated cell death, but involves multiple mechanisms.

Immunotoxicity of clonazepam in adult albino rats.

PubMed

Rabei, Hanan Mostafa

2013-01-01

Clonazepam as an addictive drug is studied to elucidate its destructive effects on rats' immune system. The aim of the current work was to study the immunologic changes induced by sub-chronic administration of clonazepam for three weeks followed by a withdrawal period in adult male albino rats. Seventy-two Sprague Dawley rats were divided into three equal groups. The first group was used as control; the second and third groups were treated with clonazepam. Six rats from each group were sacrificed weekly. Data showed that clonazepam induced a significant suppression in the level of IFN-gamma cortisol production, total splenocytes count and lymphocytes transformation induced by PHA mitogen along the experimental period especially in the third group. However, subchronic doses of clonazepam increased the production of IL-10 in both treated groups. Moreover, significant DNA damage in the peripheral blood lymphocytes of both treated groups was observed along the duration of the study. In conclusion, the immune system responses can be adversely affected to a greater extent by sub-chronic administration of clonazepam and should be prescribed cautiously as patients may turn addict to it.

Effects of T-2 toxin on turkey herpesvirus–induced vaccinal immunity against Marek’s disease

USDA-ARS?s Scientific Manuscript database

T-2 toxin, a very potent immunotoxic Type A trichothecene, is a secondary metabolite produced primarily by Fusarium spp., which grows on cereal grains and can lead to contaminated livestock feed. Repeated exposure to T-2 toxin has been shown to cause immunosuppression and decrease the resistance of ...

CYP1A2 IS NOT REQUIRED FOR 2, 3, 7, 8-TETRACHLORODIBENZO-P-DIOXIN-INDUCED IMMUNOSUPPRESSION

EPA Science Inventory

ABSTRACT
One of the most sensitive and reproducible immunotoxic endpoints of 2,3,7,8-tetrachloro-dibenzo-p-dioxin (TCDD) exposure is suppression of the antibody response to sheep red blood cells (SRBCs) in mice. Immunosuppression occurs in concert with hepatomegaly and associ...

Trichothecenes NIV and DON modulate the maturation of murine dendritic cells.

PubMed

Luongo, D; Severino, L; Bergamo, P; D'Arienzo, R; Rossi, M

2010-01-01

Nivalenol (NIV) and Deoxynivalenol (DON), mycotoxins of the trichothecene family are considered very common food contaminants. In this work, we investigated whether the immunotoxic effects ascribed to these trichothecenes may be mediated by perturbations in the activity of dendritic cells (DCs). Murine bone marrow-derived DCs were used to evaluate the effects of NIV and DON on the LPS-induced maturation process. We found that the expression of the class II MHC and of the accessory CD11c molecules, but not of the costimulatory CD86 marker, was down-regulated by NIV and DON exposure in LPS-treated DCs, as well as nitric oxide (NO) production. Interestingly, NIV, but not DON, induced DC necrosis. Moreover, the analysis of the cytokine pattern showed that IL-12 and IL-10 expressions induced by LPS exposure were suppressed by both trichothecenes in a dose-dependent fashion. On the other hand, the secretion of the proinflammatory cytokine TNF-alpha was increased as a direct consequence of DON and NIV exposure. Taken together, our data indicated that the immunotoxicity of NIV and DON was related to the capacity of both trichothecenes to interfere with phenotypic and functional features of maturing DCs.

Immunotoxicity and biodistribution analysis of arsenic trioxide in C57Bl/6 mice following a 2-week inhalation exposure

DOE Office of Scientific and Technical Information (OSTI.GOV)

Burchiel, Scott W., E-mail: Sburchiel@salud.unm.ed; Mitchell, Leah A.; Lauer, Fredine T.

2009-12-15

In these studies the immunotoxicity of arsenic trioxide (ATO, As{sub 2}O{sub 3}) was evaluated in mice following 14 days of inhalation exposures (nose only, 3 h per day) at concentrations of 50 mug/m{sup 3} and 1 mg/m{sup 3}. A biodistribution analysis performed immediately after inhalation exposures revealed highest levels of arsenic in the kidneys, bladder, liver, and lung. Spleen cell levels were comparable to those found in the blood, with the highest concentration of arsenic detected in the spleen being 150 mug/g tissue following the 1 mg/m{sup 3} exposures. No spleen cell cytotoxicity was observed at either of the twomore » exposure levels. There were no changes in spleen cell surface marker expression for B cells, T cells, macrophages, and natural killer (NK) cells. There were also no changes detected in the B cell (LPS-stimulated) and T cell (Con A-stimulated) proliferative responses of spleen cells, and no changes were found in the NK-mediated lysis of Yac-1 target cells. The primary T-dependent antibody response was, however, found to be highly susceptible to ATO suppression. Both the 50 mug/m{sup 3} and 1 mg/m{sup 3} exposures produced greater than 70% suppression of the humoral immune response to sheep red blood cells. Thus, the primary finding of this study is that the T-dependent humoral immune response is extremely sensitive to suppression by ATO and assessment of humoral immune responses should be considered in evaluating the health effects of arsenic containing agents.« less

Fungal DNA in hotel rooms in Europe and Asia--associations with latitude, precipitation, building data, room characteristics and hotel ranking.

PubMed

Norbäck, Dan; Cai, Gui-Hong

2011-10-01

There is little information on the indoor environment in hotels. Analysis of fungal DNA by quantitative PCR (qPCR) is a new method which can detect general and specific sequences. Dust was collected through swab sampling of door frames in 69 hotel rooms in 20 countries in Europe and Asia (2007-2009). Five sequences were detected by qPCR: total fungal DNA, Aspergillus and Penicillium DNA (Asp/Pen DNA), Aspergillus versicolor (A. versicolor DNA), Stachybotrys chartarum (S. chartarum DNA) and Streptomyces spp. (Streptomyces DNA). Associations were analysed by multiple linear regression. Total fungal DNA (GM = 1.08 × 10(8) cell equivalents m(-2); GSD = 6.36) and Asp/Pen DNA (GM = 1.79 × 10(7) cell equivalents m(-2); GSD = 10.12) were detected in all rooms. A. versicolor DNA, S. chartarum DNA and Streptomyces DNA were detected in 84%, 28% and 47% of the samples. In total, 20% of the rooms had observed dampness/mould, and 30% had odour. Low latitude (range 1.5-64.2 degrees) was a predictor of Asp/Pen DNA. Seaside location, lack of mechanical ventilation, and dampness or mould were other predictors of total fungal DNA and Asp/Pen DNA. Hotel ranking (Trip Advisor) or self-rated quality of the interior of the hotel room was a predictor of total fungal DNA, A. versicolor DNA and Streptomyces DNA. Odour was a predictor of S. chartarum DNA. In conclusion, fungal DNA in swab samples from hotel rooms was related to latitude, seaside location, ventilation, visible dampness and indoor mould growth. Hotels in tropical areas may have 10-100 times higher levels of common moulds such as Aspergillus and Penicillium species, as compared to a temperate climate zone.

Ameliorative effect of nanoencapsulated flavonoid against chlorpyrifos-induced hepatic oxidative damage and immunotoxicity in Wistar rats.

PubMed

Suke, Sanvidhan G; Sherekar, Prasad; Kahale, Vivek; Patil, Shaktipal; Mundhada, Dharmendra; Nanoti, Vivek M

2018-04-18

The theme of the present work is to evaluate the protective effect of nanoencapsulated quercetin (NEQ) against chlorpyrifos (CPF)-induced hepatic damage and immune alterations in animals. Nanoparticles (NP) drug encapsulation was prepared. Forty male Wistar rats were divided into eight groups. Two groups served as control and CPF (13.5 mg/kg) treatment for 28 days. Other three groups were free quercetin (QC), NP and NEQ treated with 3 mg/kg respectively for 15 days; whereas remaining three groups received treatment of CPF and QC, NP, NEQ, respectively, for 15 days. The results show that significantly altered oxidative stress in the liver tissue and liver enzyme parameters in blood and immune responses in CPF-treated rats compared to controls. Administration of NEQ attenuated biochemical and immunological parameters. The liver histopathological analysis confirmed pathological improvement. Hence, use of NEQ appeared to be beneficial to a great extent in attenuating and restoring hepatic oxidative damage and immune alteration sustained by pesticide exposure. © 2018 Wiley Periodicals, Inc.

Platelet activating factor receptor binding plays a critical role in jet fuel-induced immune suppression.

PubMed

Ramos, Gerardo; Kazimi, Nasser; Nghiem, Dat X; Walterscheid, Jeffrey P; Ullrich, Stephen E

2004-03-15

Applying military jet fuel (JP-8) or commercial jet fuel (Jet-A) to the skin of mice suppresses the immune response in a dose-dependent manner. The release of biological response modifiers, particularly prostaglandin E2 (PGE2), is a critical step in activating immune suppression. Previous studies have shown that injecting selective cyclooxygenase-2 inhibitors into jet fuel-treated mice blocks immune suppression. Because the inflammatory phospholipid mediator, platelet-activating factor (PAF), up-regulates cyclooxygenase-2 production and PGE2 synthesis by keratinocytes, we tested the hypothesis that PAF-receptor binding plays a role in jet fuel-induced immune suppression. Treating keratinocyte cultures with PAF and/or jet fuel (JP-8 and Jet-A) stimulates PGE2 secretion. Jet fuel-induced PGE2 production was suppressed by treating the keratinocytes with specific PAF-receptor antagonists. Injecting mice with PAF, or treating the skin of the mice with JP-8, or Jet-A, induced immune suppression. Jet fuel-induced immune suppression was blocked when the jet fuel-treated mice were injected with PAF-receptor antagonists before treatment. Jet fuel treatment has been reported to activate oxidative stress and treating the mice with anti-oxidants (Vitamins C, or E or beta-hydroxy toluene), before jet fuel application, interfered with immune suppression. These findings confirm previous studies showing that PAF-receptor binding can modulate immune function. Furthermore, they suggest that PAF-receptor binding may be an early event in the induction of immune suppression by immunotoxic environmental agents that target the skin.

Genotoxicity induced by monomethylarsonous acid (MMA+3) in mouse thymic developing T cells.

PubMed

Xu, Huan; Medina, Sebastian; Lauer, Fredine T; Douillet, Christelle; Liu, Ke Jian; Stýblo, Miroslav; Burchiel, Scott W

2017-09-05

Drinking water exposure to arsenic is known to cause immunotoxicity. Our previous studies demonstrated that monomethylarsonous acid (MMA +3 ) was the major arsenical species presented in mouse thymus cells after a 30 d drinking water exposure to arsenite (As +3 ). MMA +3 was also showed to be ten times more toxic than As +3 on the suppression of IL-7/STAT5 signaling in the double negative (DN) thymic T cells. In order to examine the genotoxicity induced by low to moderate doses of MMA +3 , isolated mouse thymus cells were treated with 5, 50 and 500nMMMA +3 for 18h in vitro. MMA +3 suppressed the proliferation of thymus cells in a dose dependent manner. MMA +3 at 5nM induced DNA damage in DN not double positive (DP) cells. Differential sensitivity to double strand breaks and reactive oxygen species generation was noticed between DN and DP cells at 50nM, but the effects were not seen at the high dose (500nM). A stronger apoptotic effect induced by MMA +3 was noticed in DN cells than DP cells at low doses (5 and 50nM), which was negated by the strong apoptosis induction at the high dose (500nM). Analysis of intracellular MMA +3 concentrations in DN and DP cells, revealed that more MMA +3 accumulated in the DN cells after the in vitro treatment. Collectively, these results suggested that MMA +3 could directly induce strong genotoxicity in the early developing T cells in the thymus. The DN cells were much more sensitive to MMA +3 induced genotoxicity and apoptosis than DP cells, probably due to the higher intracellular levels of MMA +3 . Copyright © 2017 Elsevier B.V. All rights reserved.

Protective Effects of Diallyl Sulfide against Thioacetamide-Induced Toxicity: A Possible Role of Cytochrome P450 2E1.

PubMed

Kim, Nam Hee; Lee, Sangkyu; Kang, Mi Jeong; Jeong, Hye Gwang; Kang, Wonku; Jeong, Tae Cheon

2014-02-01

Effects of diallyl sulfide (DAS) on thioacetamide-induced hepatotoxicity and immunotoxicity were investigated. When male Sprague-Dawley rats were treated orally with 100, 200 and 400 mg/kg of DAS in corn oil for three consecutive days, the activity of cytochrome P450 (CYP) 2E1-selective p-nitrophenol hydroxylase was dose-dependently suppressed. In addition, the activities of CYP 2B-selective benzyloxyresorufin O-debenzylase and pentoxyresorufin O-depentylase were significantly induced by the treatment with DAS. Western immunoblotting analyses also indicated the suppression of CYP 2E1 protein and/or the induction of CYP 2B protein by DAS. To investigate a possible role of metabolic activation by CYP enzymes in thioacetamide-induced hepatotoxicity, rats were pre-treated with 400 mg/kg of DAS for 3 days, followed by a single intraperitoneal treatment with 100 and 200 mg/kg of thioacetamide in saline for 24 hr. The activities of serum alanine aminotransferase and aspartate aminotransferase significantly elevated by thioacetamide were protected in DAS-pretreated animals. Likewise, the suppressed antibody response to sheep erythrocytes by thioacetamide was protected by DAS pretreatment in female BALB/c mice. Taken together, our present results indicated that thioacetamide might be activated to its toxic metabolite(s) by CYP 2E1, not by CYP 2B, in rats and mice.

Caspase-10 Is the Key Initiator Caspase Involved in Tributyltin-Mediated Apoptosis in Human Immune Cells

PubMed Central

Krug, Harald F.

2012-01-01

Tributyltin (TBT) is one of the most toxic compounds produced by man and distributed in the environment. A multitude of toxic activities have been described, for example, immunotoxic, neurotoxic, and endocrine disruptive effects. Moreover, it has been shown for many cell types that they undergo apoptosis after treatment with TBT and the cell death of immune cells could be the molecular background of its immunotoxic effect. As low as 200 nM up to 1 μM of TBT induces all signs of apoptosis in Jurkat T cells within 1 to 24 hrs of treatment. When compared to Fas-ligand control stimulation, the same sequence of events occurs: membrane blebbing, phosphatidylserine externalisation, the activation of the “death-inducing signalling complex,” and the following sequence of cleavage processes. In genetically modified caspase-8-deficient Jurkat cells, the apoptotic effects are only slightly reduced, whereas, in FADD-negative Jurkat cells, the TBT effect is significantly diminished. We could show that caspase-10 is recruited by the TRAIL-R2 receptor and apoptosis is totally prevented when caspase-10 is specifically inhibited in all three cell lines. PMID:22287961

Exposure Cessation During Adulthood Did Not Prevent Immunotoxicity Caused by Developmental Exposure to Low-Level Trichloroethylene in Drinking Water.

PubMed

Gilbert, Kathleen M; Bai, Shasha; Barnette, Dustyn; Blossom, Sarah J

2017-06-01

Exposure to the water pollutant trichloroethylene (TCE) can promote autoimmunity in both humans and rodents. Using a mouse model we have shown that chronic adult exposure to TCE at 500 μg/ml in drinking water generates autoimmune hepatitis in female MRL+/+ mice. There is increasing evidence that developmental exposure to certain chemicals can be more toxic than adult exposure. This study was designed to test whether exposure to a much lower level of TCE (0.05 μg/ml) during gestation, lactation, and early life generated autoimmunity similar to that found following adult exposure to higher concentrations of TCE. When female MRL+/+ mice were examined at postnatal day (PND) 259 we found that developmental/early life exposure [gestational day 0 to PND 154] to TCE at a concentration 10 000 fold lower than that shown to be effective for adult exposure triggered autoimmune hepatitis. This effect was observed despite exposure cessation at PND 154. In concordance with the liver pathology, female MRL+/+ exposed during development and early life to TCE (0.05 or 500 μg/ml) generated a range of antiliver antibodies detected by Western blotting. Expression of proinflammatory cytokines by CD4+ T cells was also similarly observed at PND 259 in the TCE-exposed mice regardless of concentration. Thus, exposure to TCE at approximately environmental levels from gestational day 0 to PND 154 generated tissue pathology and CD4+ T cell alterations that required higher concentrations if exposure was limited to adulthood. TCE exposure cessation at PND 154 did not prevent the immunotoxicity. © The Author 2017. Published by Oxford University Press on behalf of the Society of Toxicology. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Immunoprotective activity and antioxidant properties of cactus (Opuntia ficus indica) extract against chlorpyrifos toxicity in rats.

PubMed

Smida, Amani; Ncibi, Saida; Taleb, Jihen; Ben Saad, Anouar; Ncib, Sana; Zourgui, Lazhar

2017-04-01

Opuntia ficus indica (family Cactaceae) is a typical Mediterranean plant, mainly used in food and traditional folk medicine. The present study was designed to evaluate the protective effect of Opuntia ficus indica extract against chlorpyrifos (CPF)-induced immunotoxicity in rats. The experimental animals consisted of four groups of Wistar rats (5-6 weeks old) of eight each: a control group, a group treated with CPF (10mg/kg), a group treated with Opuntia ficus indica extract (100mg/kg), and a group treated with cactus extract then treated with CPF. These components were daily administered by gavage for 30days. After treatment, immunotoxicity was estimated by a count of thymocytes, splenocytes, stem cells in the bone marrow, relative weights of thymus and spleen, DNA aspects, and oxidative stress status in these organs. Results showed that CPF could induce thymus atrophy, splenomegaly, and a decrease in the cell number in the bone marrow. It also increased the oxidative stress markers resulting in elevated levels of the lipid peroxidation with a concomitant decrease in the levels of enzymatic antioxidants (SOD, CAT, GPx) in both spleen and thymus, and also degradation of thymocyte and splenocyte DNA. Consistent histological changes were found in the spleen and thymus under CPF treatment. However, administration of Opuntia ficus indica extract was found to alleviate this CPF-induced damage. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

Global protein phosphorylation dynamics during deoxynivalenol-induced ribotoxic stress response in the macrophage

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pan, Xiao; Center for Integrative Toxicology, Michigan State University, East Lansing, MI 48824; Whitten, Douglas A.

Deoxynivalenol (DON), a trichothecene mycotoxin produced by Fusarium that commonly contaminates food, is capable of activating mononuclear phagocytes of the innate immune system via a process termed the ribotoxic stress response (RSR). To encapture global signaling events mediating RSR, we quantified the early temporal (≤ 30 min) phosphoproteome changes that occurred in RAW 264.7 murine macrophage during exposure to a toxicologically relevant concentration of DON (250 ng/mL). Large-scale phosphoproteomic analysis employing stable isotope labeling of amino acids in cell culture (SILAC) in conjunction with titanium dioxide chromatography revealed that DON significantly upregulated or downregulated phosphorylation of 188 proteins at bothmore » known and yet-to-be functionally characterized phosphosites. DON-induced RSR is extremely complex and goes far beyond its prior known capacity to inhibit translation and activate MAPKs. Transcriptional regulation was the main target during early DON-induced RSR, covering over 20% of the altered phosphoproteins as indicated by Gene Ontology annotation and including transcription factors/cofactors and epigenetic modulators. Other biological processes impacted included cell cycle, RNA processing, translation, ribosome biogenesis, monocyte differentiation and cytoskeleton organization. Some of these processes could be mediated by signaling networks involving MAPK-, NFκB-, AKT- and AMPK-linked pathways. Fuzzy c-means clustering revealed that DON-regulated phosphosites could be discretely classified with regard to the kinetics of phosphorylation/dephosphorylation. The cellular response networks identified provide a template for further exploration of the mechanisms of trichothecenemycotoxins and other ribotoxins, and ultimately, could contribute to improved mechanism-based human health risk assessment. - Highlights: ► Mycotoxin deoxynivalenol (DON) induces immunotoxicity via ribotoxic stress response. ► SILAC

Composition of the essential oil constituents from leaves and stems of Korean Coriandrum sativum and their immunotoxicity activity on the Aedes aegypti L.

PubMed

Chung, Ill-Min; Ahmad, Ateeque; Kim, Sun-Jin; Naik, Poornanand Madhava; Nagella, Praveen

2012-02-01

The leaves and stems of Coriandrum sativum were extracted and the essential oil composition and immunotoxicity effects were studied. The analyses were conducted by gas chromatography-mass spectroscopy (GC-MS), which revealed the essential oils of C. sativum leaves and stems. Thirty-nine components representing 99.62% of the total oil were identified from the leaves. The major components are cyclododecanol (23.11%), tetradecanal (17.86%), 2-dodecenal (9.93%), 1-decanol (7.24%), 13-tetradecenal (6.85%), 1-dodecanol (6.54%), dodecanal (5.16%), 1-undecanol (2.28%), and decanal (2.33%). Thirty-eight components representing 98.46% of the total oil were identified from the stems of the coriander. The major components are phytol (61.86%), 15-methyltricyclo[6.5.2(13,14),0(7,15)]-pentadeca-1,3,5,7,9,11,13-heptene (7.01%), dodecanal (3.18%), and 1-dodecanol (2.47%). The leaf oil had significant toxic effects against the larvae of Aedes aegypti with an LC₅₀ value of 26.93 ppm and an LC₉₀ value of 37.69 ppm and the stem oil has toxic effects against the larvae of A. aegypti with an LC₅₀ value of 29.39 ppm and an LC₉₀ value of 39.95 ppm. Also, the above data indicate that the major compounds may play an important role in the toxicity of essential oils.

Zinc protects HepG2 cells against the oxidative damage and DNA damage induced by ochratoxin A

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zheng, Juanjuan; Zhang, Yu; Xu, Wentao, E-mail: xuwentaoboy@sina.com

Oxidative stress and DNA damage are the most studied mechanisms by which ochratoxin A (OTA) induces its toxic effects, which include nephrotoxicity, hepatotoxicity, immunotoxicity and genotoxicity. Zinc, which is an essential trace element, is considered a potential antioxidant. The aim of this paper was to investigate whether zinc supplement could inhibit OTA-induced oxidative damage and DNA damage in HepG2 cells and the mechanism of inhibition. The results indicated that that exposure of OTA decreased the intracellular zinc concentration; zinc supplement significantly reduced the OTA-induced production of reactive oxygen species (ROS) and decrease in superoxide dismutase (SOD) activity but did notmore » affect the OTA-induced decrease in the mitochondrial membrane potential (Δψ{sub m}). Meanwhile, the addition of the zinc chelator N,N,N′,N′-tetrakis(2-pyridylmethyl)ethylenediamine (TPEN) strongly aggravated the OTA-induced oxidative damage. This study also demonstrated that zinc helped to maintain the integrity of DNA through the reduction of OTA-induced DNA strand breaks, 8-hydroxy-2′-deoxyguanosine (8-OHdG) formation and DNA hypomethylation. OTA increased the mRNA expression of metallothionein1-A (MT1A), metallothionein2-A (MT2A) and Cu/Zn superoxide dismutase (SOD1). Zinc supplement further enhanced the mRNA expression of MT1A and MT2A, but it had no effect on the mRNA expression of SOD1 and catalase (CAT). Zinc was for the first time proven to reduce the cytotoxicity of OTA through inhibiting the oxidative damage and DNA damage, and regulating the expression of zinc-associated genes. Thus, the addition of zinc can potentially be used to reduce the OTA toxicity of contaminated feeds. - Highlights: ► OTA decreased the intracellular zinc concentration. ► OTA induced the formation of 8-OHdG in HepG2 cells. ► It was testified for the first time that OTA induced DNA hypomethylation. ► Zinc protects against the oxidative damage and DNA damage

ASSESSMENT OF STACHYBOTRYS REGROWTH ON CONTAMINATED WALLBOARD AFTER TREATMENT WITH COMMON SURFACE CLEANERS/DISINFECTANTS

EPA Science Inventory

The paper describes results of experiments assessing the efficacy of treating mold-contaminated gypsum wallboard with cleaners and/or disinfectants. Although the accepted recommendations for handling Stachybotrys chartarum contaminated gypsum wallboard are removal and replacement...

Production and characterization of IgM monoclonal antibodies against hyphal antigens of Stachybotrys species

EPA Science Inventory

Stachybotrys is a hydrophilic fungal genus that is well known for its ability to colonize water-damaged building materials in indoor environments. Personal exposure to Stachybotrys chartarum allergens, mycotoxins, cytolytic peptides, and other immunostimulatory macromolecules has...

Immunomodulatory effects of the herbicide propanil on cytokine production in humans: In vivo and in vitro exposure

DOE Office of Scientific and Technical Information (OSTI.GOV)

Corsini, Emanuela; Codeca, Ilaria; Mangiaratti, Simona

Propanil, 3,4-dichloropropionanilide, a commonly used herbicide, has been shown to induce effects on the mouse immune system. The aim of this study was to assess the immunotoxicity of propanil in occupationally exposed agricultural workers and to characterize its molecular mechanism of action. Seven agricultural workers intermittently exposed to propanil and 7 healthy matched controls entered the study. Data were collected through physical examination, and laboratory investigations addressed at the main serum, cellular, and functional immune parameters. The levels of exposure were assessed by determining the urine concentration of the major propanil metabolite, 3,4-dichloroaniline. The investigation of serum, cellular, and functionalmore » immune parameters suggested that propanil exposure results in a modest immunomodulatory effect, characterized by an increase in the plasma level of IgG{sub 1} and in LPS-induced IL-6 release and, by a reduction in PHA-induced IL-10 and IFN release, associated with a reduced IFN/IL-4 ratio. As observed, following in vivo exposure, in vitro treatment of human peripheral blood leukocytes with propanil resulted in a dose-dependent reduction in PHA-induced IFN-gamma and IL-10 production, while LPS-induced TNF-{alpha} production was not affected indicating a direct effect of propanil on selected immune parameters. We demonstrated that propanil interfering with PHA-induced intracellular calcium increase modulated IL-10 and IFN-gamma transcription and translation, which indicates that propanil acts on early events triggered by PHA. Overall, our results suggest that human exposure to propanil has slight immunomodulatory effects, and point out that the inhibition of the PHA-induced intracellular calcium rise is an important target of propanil. These findings improve our understanding of the mechanism underlying propanil-induced immunotoxicity.« less

Immunotoxicity of 2,3,7,8-tetrachlorodibenzo-p-dioxin in a complex environmental mixture from the Love Canal

DOE Office of Scientific and Technical Information (OSTI.GOV)

Silkworth, J.B.; Cutler, D.S.; Sack, G.

The organic phase of the leachate (OPL) from the Love Canal chemical dump site contains more than 100 organic compounds including 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). The immunotoxic potential of OPL was determined in two mouse strains which differ in their sensitivity to aromatic hydrocarbon (Ah) receptor-mediated toxicity. OPL was administered in corn oil in a single oral gavage to male BALB/cByJ (Ahb/Ahb) mice (0.5, 0.8, or 1.1 g/kg) and DBA/2J (Ahd/Ahd) mice (0.6, 0.9, or 1.3 g/kg). TCDD was similarly administered at 0.25, 1.0, 4.0, or 16.0 micrograms/kg. Two days later all mice were immunized with sheep erythrocytes (SRBC). The antibody responsemore » (PFC) and organ weights were evaluated 4 days later. OPL produced thymic atrophy and hepatomegaly in both strains at all dose levels. The PFC/spleen in BALB/cByJ mice was significantly reduced at the three doses to 34, 13, and 15%, respectively, of the control response. Serum anti-SRBC antibody levels and relative spleen weights were also reduced. The only immune effect in the DBA/2J mice was a decrease of the PFC/spleen to 58% of the control at the highest dose. TCDD decreased the relative thymus and spleen weights only in BALB/cByJ mice. However, TCDD produced hepatomegaly, a decrease in serum antibody, and a decrease in PFC/spleen in both BALB/cByJ and DBA/2J mice to 3 and 15%, respectively, at 16 micrograms/kg. Thus, the TCDD dose required to cause a 50% suppression (ED50) of PFC/spleen for the BALB/cByJ and DBA/2J strains was 1.84 and 3.89 micrograms/kg, respectively. The ED50 for OPL was 0.24 g/kg in BALB/cByJ mice. The TCDD concentration in the OPL was estimated to be 7.6 ppm, which agrees closely with the chemical analysis (3 ppm).« less

Effects of perinatal exposure to low doses of PCB 153 and PCB 126 on lymphocyte proliferation and hematology in goat kids.

PubMed

Lyche, Jan; Larsen, Hans; Skaare, Janneche Utne; Tverdal, Aage; Dahl, Ellen; Johansen, Grethe; Ropstad, Erik

2004-06-11

Pregnant does (10 goats/group) were dosed orally with either PCB 153 or PCB 126 dissolved in corn oil or only corn oil (control group) from day 60 of gestation until delivery. Effects on in vitro mitogen-induced lymphocyte proliferation and blood cell counts in their goat kids exposed to low levels of PCB 153 and PCB 126 during gestation and lactation were assessed. The concentrations of PCB 153 and PCB 126 in adipose tissue in the goat kids 9 mo postpartum were 5800 ng/g (fat weight) and 0.49 ng/g (fat weight), respectively. Kids exposed to PCB 153 had a significantly higher number of white blood cells, neutrophils, and lymphocytes at 2 wk of age compared to controls. In the kids exposed to PCB 126 there was a significantly lower concentration of monocytes at 2, 4, and 8 wk of age. The mean lymphocyte response to phytohemagglutinin (PHA) and to concanavalin A (Con A) was significant lower in the PCB 153 compared to the control group at wk 2, 4, and 8 postnatally. The results of the present study support previous reports on immunotoxic effects of PCB exposure in animals. However, this is the first report to demonstrate immunotoxicity in animals by using low doses of PCB 153. The difference in results between PCB 126 and PCB 153 treatment groups may strengthen the hypothesis that PCBs mediate immunotoxic effects through both AhR-dependent and -independent mechanisms.

Laboratory research on the efficacy of chlorine dioxide fumigation for the remediation of mold-contaminated buildings--conference paper

EPA Science Inventory

The purpose of this project was to determine the efficacy ofCl02 fumigation to inactivate viable mold, mycotoxins, and allergens on building materials. Alternaria alternata, Aspergillus versicolor, Aspergillus Jumigatus, Chaetomium globosum, and Stachybotrys chartarum were indivi...

A RAPID METHOD FOR THE EXTRACTION OF FUNGAL DNA FROM ENVIRONMENTAL SAMPLES: EVALUATION IN THE QUANTITATIVE ANALYSIS OF MEMNONIELLA ECHINATA CONIDIA USING REAL TIME DETECTION OF PCR PRODUCTS

EPA Science Inventory

New technologies are creating the potential for using nucleic acid sequence detection to perform routine microbiological analyses of environmental samples. Our laboratory has recently reported on the development of a method for the quantitative detection of Stachybotrys chartarum...

STACHYBOTRYS CHARTARU Trichothecene Mycotoxins and Damp Building-Related Illness: New Insights into a Public Health Enigma

EPA Science Inventory

Damp building-related illnesses (DBRI) include a myriad of respiratory, immunologic, and neurologic symptoms that are sometimes etiologically linked to aberrant indoor growth of the toxic black mold, Stachybotrys chartarum. Although supportive evidence for such linkages is limite...

Pre-contamination of new gypsum wallboard with potentially harmful fungal species.

PubMed

Andersen, B; Dosen, I; Lewinska, A M; Nielsen, K F

2017-01-01

Gypsum wallboard is a popular building material, but is also very frequently overgrown by Stachybotrys chartarum after severe and/or undetected water damage. The purpose of this study was to determine whether Stachybotrys and other fungi frequently isolated from wet gypsum wallboard are already present in the panels directly from the factory. Surface-disinfected gypsum disks were wetted with sterile water, sealed, and incubated for 70 days. The results showed that Neosartorya hiratsukae (≡ Aspergillus hiratsukae) was the most dominant fungus on the gypsum wallboard followed by Chaetomium globosum and Stachybotrys chartarum. Our results suggest that these three fungal species are already embedded in the materials, presumably in the paper/carton layer surrounding the gypsum core, before the panels reach the retailers/building site. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Current understanding of interactions between nanoparticles and the immune system

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dobrovolskaia, Marina A., E-mail: marina@mail.nih.

2016-05-15

The delivery of drugs, antigens, and imaging agents benefits from using nanotechnology-based carriers. The successful translation of nanoformulations to the clinic involves thorough assessment of their safety profiles, which, among other end-points, includes evaluation of immunotoxicity. The past decade of research focusing on nanoparticle interaction with the immune system has been fruitful in terms of understanding the basics of nanoparticle immunocompatibility, developing a bioanalytical infrastructure to screen for nanoparticle-mediated immune reactions, beginning to uncover the mechanisms of nanoparticle immunotoxicity, and utilizing current knowledge about the structure–activity relationship between nanoparticles' physicochemical properties and their effects on the immune system to guidemore » safe drug delivery. In the present review, we focus on the most prominent pieces of the nanoparticle–immune system puzzle and discuss the achievements, disappointments, and lessons learned over the past 15 years of research on the immunotoxicity of engineered nanomaterials. - Graphical abstract: API — active pharmaceutical ingredient; NP — nanoparticles; PCP — physicochemical properties, CARPA — complement activation-related pseudoallergy, ICH — International Conference on Harmonization. Display Omitted - Highlights: • Achievements, disappointments and lessons learned over past decade are reviewed. • Areas in focus include characterization, immunotoxicity and utility in drug delivery. • Future direction focusing on mechanistic immunotoxicity studies is proposed.« less

Bone marrow stromal-B cell interactions in polycyclic aromatic hydrocarbon-induced pro/pre-B cell apoptosis.

PubMed

Allan, Lenka L; Mann, Koren K; Matulka, Raymond A; Ryu, Heui-Young; Schlezinger, Jennifer J; Sherr, David H

2003-12-01

Environmental polycyclic aromatic hydrocarbons (PAH) and related halogenated hydrocarbons are immunotoxic in a variety of systems. In a model system of B lymphopoiesis, PAH exposure rapidly induces apoptosis in CD43- pre-B and CD43+ pro/pre-B cells. Apoptosis induction by 7,12-dimethylbenzo[a]anthracene (DMBA) is dependent upon AhR+ bone marrow stromal cells and likely involves DMBA metabolism within the stromal cell. However, it is not known if PAH-treated stromal cells release free metabolites or soluble factors that may directly induce B cell death or if the effector death signal is delivered by stromal cell-B cell contact. Here, we demonstrate that supernatants from DMBA-treated bone marrow stromal cells contain an activity capable of inducing apoptosis in pro/pre-B cells cocultured with stromal cells. This activity (1) is not produced when stromal cells are cotreated with DMBA and alpha-naphthoflavone (alpha-NF), an aryl hydrocarbon receptor (AhR) and cytochrome P-450 inhibitor, (2) is > or = 50 kDa, (3) is trypsin and heat sensitive, and (4) is dependent on AhR+ stromal cells, which in turn deliver the effector death signal to pro/pre-B cells. The results (1) argue against a role for a soluble, stromal cell-derived cytokine as the effector of PAH-induced pro/pre-B cell death, (2) exclude the possibility of a free metabolite acting directly on AhR- pro/pre-B cell targets, and (3) suggest the elaboration by stromal cells of a relatively stable, DMBA metabolite-protein complex capable of acting on other stromal cells at some distance. Collectively, these studies suggest that, while stromal cell products, e.g., metabolite-protein complexes, may affect the function of distant stromal cells, the effector death signal delivered by stromal cells to bone marrow B cells is mediated by cell-cell contact.

ELISA MEASUREMENT FOR STACHYLYSIN

EPA Science Inventory

The consumption of food commodities contaminated with the mold, Stachybotrys charatrum, has a long history of causing severe illness, and even death, in humans and animals. More recently, negative health effects have been linked to indoor inhalation exposures to S. chartarum. F...

ASSESSMENT OF ALLERGIC IMMUNE RESPONSES TO INDOOR AIR FUNGAL CONTAMINANTS

EPA Science Inventory

We are using a mouse model to assess immune and inflammatory responses as well as changes in respiratory function and pathology characteristic of allergic asthma to fungal extracts M. anisopliae (MACA), S. chartarum (SCE), and P. chrysogenum (PCE). This model will be useful to a...

MONITORING MYCOTOXIN PRODUCTION AT THE GENETIC LEVEL ON VARIOUS GROWTH SUBSTRATES USING QUANTITATIVE REVERSE TRANSCRIPTION POLYMERASE CHAIN REACTION?EXPERIMENT DESIGN

EPA Science Inventory

The paper describes a method of analyzing the production of mycotoxins at the genetic level by monitoring the intracellular levels of messenger RNA (mRNA). Initial work will focus on threshing out the mycotoxin gene clusters in Stachybotrys chartarum followed by analysis of toxin...

EMISSION EXPOSURE MODEL FOR TRANSPORT OF TOXIC MOLD

EPA Science Inventory

The paper presents the results of a study of the release of Stachybotrys chartarum spores from contaminated gypsum wallboard and of tests on the effects of environmental conditions on the release of viable and non-viable spores and fragments. Biocontaminants such as mold spores a...

Silymarin protects PBMC against B(a)P induced toxicity by replenishing redox status and modulating glutathione metabolizing enzymes-An in vitro study

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kiruthiga, P.V.; Pandian, S. Karutha; Devi, K. Pandima, E-mail: devikasi@yahoo.co

2010-09-01

PAHs are a ubiquitous class of environmental contaminants that have a large number of hazardous consequences on human health. An important prototype of PAHs, B(a)P, is notable for being the first chemical carcinogen to be discovered and the one classified by EPA as a probable human carcinogen. It undergoes metabolic activation to QD, which generate ROS by redox cycling system in the body and oxidatively damage the macromolecules. Hence, a variety of antioxidants have been tested as possible protectors against B(a)P toxicity. Silymarin is one such compound, which has high human acceptance, used clinically and consumed as dietary supplement aroundmore » the world for its strong anti-oxidant efficacy. Silymarin was employed as an alternative approach for treating B(a)P induced damage and oxidative stress in PBMC, with an emphasis to provide the molecular basis for the effect of silymarin against B(a)P induced toxicity. PBMC cells exposed to either benzopyrene (1 {mu}M) or silymarin (2.4 mg/ml) or both was monitored for toxicity by assessing LPO, PO, redox status (GSH/GSSG ratio), glutathione metabolizing enzymes GR and GPx and antioxidant enzymes CAT and SOD. This study also investigated the protective effect of silymarin against B(a)P induced biochemical alteration at the molecular level by FT-IR spectroscopy. Our findings were quite striking that silymarin possesses substantial protective effect against B(a)P induced oxidative stress and biochemical changes by restoring redox status, modulating glutathione metabolizing enzymes, hindering the formation of protein oxidation products, inhibiting LPO and further reducing ROS mediated damages by changing the level of antioxidant enzymes. The results suggest that silymarin exhibits multiple protections and it should be considered as a potential protective agent for environmental contaminant induced immunotoxicity.« less

The role of B7 costimulation in benzene immunotoxicity and its potential association with cancer risk.

PubMed

Sauer, Elisa; Gauer, Bruna; Nascimento, Sabrina; Nardi, Jessica; Göethel, Gabriela; Costa, Bárbara; Correia, Douglas; Matte, Ursula; Charão, Mariele; Arbo, Marcelo; Duschl, Albert; Moro, Angela; Garcia, Solange Cristina

2018-06-05

Benzene is a recognized human carcinogen; however, there are still some gaps in the knowledge regarding the mechanism of toxicity of this organic solvent and potential early biomarkers for the damage caused by it. In a previous study, our research group demonstrated that the adhesion molecules of the immune system (B7.1 and B7.2) could be potential biomarkers in the early detection of immunotoxicity caused by benzene exposure. Therefore, this study was developed to deepen the understanding regarding this important topic, aiming to contribute to the comprehension of the benzene toxicity mechanism mediated by B7.1 and B7.2 and its potential association with the risk of carcinogenicity. B7.1 and B7.2 protein expression in blood monocytes and B7.1 and B7.2 gene expression in PBMCs were evaluated. Additionally, complement C3 and C4 levels in serum were measured, as well as p53 gene expression in PBMCs. Seventy-four gas station workers (GSW group) and 71 non-occupationally exposed subjects (NEG) were evaluated. Our results demonstrated decreased levels of B7.1 and B7.2 protein and gene expression in the GSW group compared to the NEG (n = 71) (p < 0.01). Along the same lines, decreased levels of the complement system were observed in the GSW group (p < 0.01), demonstrating the impairment of this immune system pathway as well. Additionally, a reduction was observed in p53 gene expression in the GSA group (p < 0.01). These alterations were associated with both the benzene exposure biomarker evaluated, urinary trans, trans-muconic acid, and with exposure time (p < 0.05). Moreover, strong correlations were observed between the gene expression of p53 vs. B7.1 (r = 0.830; p < 0.001), p53 vs. B7.2 (r = 0.685; p < 0.001), and B7.1 vs. B7.2 (r = 0.702; p < 0.001). Taken together, these results demonstrate that the immune system co-stimulatory molecule pathway is affected by benzene exposure. Also, the decrease in p53 gene expression

Could nitrile derivatives of turnip (Brassica rapa) glucosinolates be Hepato-and/or cholangiotoxic in cattle?

USDA-ARS?s Scientific Manuscript database

Turnip (Brassica rapa ssp. rapa) and rape (Brassica napus ssp. biennis) and other brassica forage crops are generally regarded as “safe” feed for cattle during late summer and fall in New Zealand. However, when Pithomyces chartarum spore counts are high there are epidemics of sporidesmin toxicity (...

Immunotoxicity Studies

EPA Science Inventory

Immunotoxicology is a subdiscipline of toxicology that focuses on unintended modulation of the immune system. Effects that may occur include immunosuppression, immunostimulation, hypersensitivity, or autoimmunity, which may result in outcomes such as increased incidences of infec...

Developmental Immunotoxicity

EPA Science Inventory

Animal models suggest that the immature immune system is more susceptible to xenobiotics than the fully mature system, and sequelae of developmental immunotoxicant exposure may be persistent well into adulthood. Immune maturation may be delayed by xenobiotic exposure and recover...

IMMUNOTOXICITY STUDIES

EPA Science Inventory

Few D/DBPs have been evaluated for effects on the immune system, but certain studies suggest that immunosuppression may follow exposure to D/DBPs. Suppressed immune function is associated with increased susceptibility to infectious disease and certain types of cancer in humans a...

Microbial specialists in below-grade foundation walls in Scandinavia.

PubMed

Nunez, M; Hammer, H

2014-10-01

Below-grade foundation walls are often exposed to excessive moisture by water infiltration, condensation, leakage, or lack of ventilation. Microbial growth in these structures depends largely on environmental factors, elapsed time, and the type of building materials and construction setup. The ecological preferences of Actinomycetes (Actinobacteria) and the molds Ascotricha chartarum, Myxotrichum chartarum (Ascomycota), Geomyces pannorum, and Monocillium sp. (Hyphomycetes) have been addressed based on analyses of 1764 samples collected in below-grade spaces during the period of 2001-2012. Our results show a significant correlation between these taxa and moist foundation walls as ecological niches. Substrate preference was the strongest predictor of taxa distribution within the wall, but the taxa's physiological needs, together with gradients of abiotic factors within the wall structure, also played a role. Our study describes for the first time how the wall environment affects microbial growth. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Levin, Milton, E-mail: Milton.levin@uconn.edu

To better elucidate the potential immune-related health effects of exposure to environmentally persistent organic pollutants (POP), such as polychlorinated biphenyls (PCBs) and perfluoroalkyl substances (PFASs), in ringed seals (Pusa hispida), a sentinel Arctic species, we assessed 1) associations between mitogen-induced lymphocyte proliferation and in vivo tissue contaminant burdens, and 2) the concentration-response effects of in vitro exposure to PFASs and PCB congeners on mitogen-induced lymphocyte proliferation. Upon in vitro contaminant exposure, the non-coplanar PCB congeners CB 138, 153, and 180, but not the coplanar CB 169, significantly reduced lymphocyte proliferation between 10 and 20 µg g{sup −1} ww. The respectivemore » in vitro EC{sub 50} values for these congeners were 13.3, 20.7, 20.8, and 54.6 µg g{sup −1} ww. No modulation of lymphocyte proliferation was observed upon in vitro exposure to two individual PFASs, perfluorooctane sulphonic acid (PFOS) and perfluorooctanoic acid (PFOA), at concentrations up to 1000 ng g-1. In addition, no significant correlations were found between lymphocyte proliferation and any blood or blubber contaminant measured. Taken together, these data suggest this population of ringed seals is not currently at high risk of altered lymphocyte proliferation from exposure to the POPs or PFASs in this study. - Highlights: • Assess relationships between tissue contaminants and changes in immune function. • Risk for contaminant-induced immunotoxicity in East Greenland ringed seal is low. • Weight of evidence suggest non-coplanar PCBs are immunotoxic at high concentrations.« less

Dibutyltin Disrupts Glucocorticoid Receptor Function and Impairs Glucocorticoid-Induced Suppression of Cytokine Production

PubMed Central

Gumy, Christel; Chandsawangbhuwana, Charlie; Dzyakanchuk, Anna A.; Kratschmar, Denise V.; Baker, Michael E.; Odermatt, Alex

2008-01-01

Background Organotins are highly toxic and widely distributed environmental chemicals. Dibutyltin (DBT) is used as stabilizer in the production of polyvinyl chloride plastics, and it is also the major metabolite formed from tributyltin (TBT) in vivo. DBT is immunotoxic, however, the responsible targets remain to be defined. Due to the importance of glucocorticoids in immune-modulation, we investigated whether DBT could interfere with glucocorticoid receptor (GR) function. Methodology We used HEK-293 cells transiently transfected with human GR as well as rat H4IIE hepatoma cells and native human macrophages and human THP-1 macrophages expressing endogenous receptor to study organotin effects on GR function. Docking of organotins was used to investigate the binding mechanism. Principal Findings We found that nanomolar concentrations of DBT, but not other organotins tested, inhibit ligand binding to GR and its transcriptional activity. Docking analysis indicated that DBT inhibits GR activation allosterically by inserting into a site close to the steroid-binding pocket, which disrupts a key interaction between the A-ring of the glucocorticoid and the GR. DBT inhibited glucocorticoid-induced expression of phosphoenolpyruvate carboxykinase (PEPCK) and tyrosine-aminotransferase (TAT) and abolished the glucocorticoid-mediated transrepression of TNF-α-induced NF-κB activity. Moreover, DBT abrogated the glucocorticoid-mediated suppression of interleukin-6 (IL-6) and TNF-α production in lipopolysaccharide (LPS)-stimulated native human macrophages and human THP-1 macrophages. Conclusions DBT inhibits ligand binding to GR and subsequent activation of the receptor. By blocking GR activation, DBT may disturb metabolic functions and modulation of the immune system, providing an explanation for some of the toxic effects of this organotin. PMID:18958157

Dibutyltin disrupts glucocorticoid receptor function and impairs glucocorticoid-induced suppression of cytokine production.

PubMed

Gumy, Christel; Chandsawangbhuwana, Charlie; Dzyakanchuk, Anna A; Kratschmar, Denise V; Baker, Michael E; Odermatt, Alex

2008-01-01

Organotins are highly toxic and widely distributed environmental chemicals. Dibutyltin (DBT) is used as stabilizer in the production of polyvinyl chloride plastics, and it is also the major metabolite formed from tributyltin (TBT) in vivo. DBT is immunotoxic, however, the responsible targets remain to be defined. Due to the importance of glucocorticoids in immune-modulation, we investigated whether DBT could interfere with glucocorticoid receptor (GR) function. We used HEK-293 cells transiently transfected with human GR as well as rat H4IIE hepatoma cells and native human macrophages and human THP-1 macrophages expressing endogenous receptor to study organotin effects on GR function. Docking of organotins was used to investigate the binding mechanism. We found that nanomolar concentrations of DBT, but not other organotins tested, inhibit ligand binding to GR and its transcriptional activity. Docking analysis indicated that DBT inhibits GR activation allosterically by inserting into a site close to the steroid-binding pocket, which disrupts a key interaction between the A-ring of the glucocorticoid and the GR. DBT inhibited glucocorticoid-induced expression of phosphoenolpyruvate carboxykinase (PEPCK) and tyrosine-aminotransferase (TAT) and abolished the glucocorticoid-mediated transrepression of TNF-alpha-induced NF-kappaB activity. Moreover, DBT abrogated the glucocorticoid-mediated suppression of interleukin-6 (IL-6) and TNF-alpha production in lipopolysaccharide (LPS)-stimulated native human macrophages and human THP-1 macrophages. DBT inhibits ligand binding to GR and subsequent activation of the receptor. By blocking GR activation, DBT may disturb metabolic functions and modulation of the immune system, providing an explanation for some of the toxic effects of this organotin.

Computational Prediction of the Immunomodulatory Potential of RNA Sequences.

PubMed

Nagpal, Gandharva; Chaudhary, Kumardeep; Dhanda, Sandeep Kumar; Raghava, Gajendra Pal Singh

2017-01-01

Advances in the knowledge of various roles played by non-coding RNAs have stimulated the application of RNA molecules as therapeutics. Among these molecules, miRNA, siRNA, and CRISPR-Cas9 associated gRNA have been identified as the most potent RNA molecule classes with diverse therapeutic applications. One of the major limitations of RNA-based therapeutics is immunotoxicity of RNA molecules as it may induce the innate immune system. In contrast, RNA molecules that are potent immunostimulators are strong candidates for use in vaccine adjuvants. Thus, it is important to understand the immunotoxic or immunostimulatory potential of these RNA molecules. The experimental techniques for determining immunostimulatory potential of siRNAs are time- and resource-consuming. To overcome this limitation, recently our group has developed a web-based server "imRNA" for predicting the immunomodulatory potential of RNA sequences. This server integrates a number of modules that allow users to perform various tasks including (1) generation of RNA analogs with reduced immunotoxicity, (2) identification of highly immunostimulatory regions in RNA sequence, and (3) virtual screening. This server may also assist users in the identification of minimum mutations required in a given RNA sequence to minimize its immunomodulatory potential that is required for designing RNA-based therapeutics. Besides, the server can be used for designing RNA-based vaccine adjuvants as it may assist users in the identification of mutations required for increasing immunomodulatory potential of a given RNA sequence. In summary, this chapter describes major applications of the "imRNA" server in designing RNA-based therapeutics and vaccine adjuvants (http://www.imtech.res.in/raghava/imrna/).

Fluoride exposure abates pro-inflammatory response and induces in vivo apoptosis rendering zebrafish (Danio rerio) susceptible to bacterial infections.

PubMed

Singh, Rashmi; Khatri, Preeti; Srivastava, Nidhi; Jain, Shruti; Brahmachari, Vani; Mukhopadhyay, Asish; Mazumder, Shibnath

2017-04-01

The present study describes the immunotoxic effect of chronic fluoride exposure on adult zebrafish (Danio rerio). Zebrafish were exposed to fluoride (71.12 mg/L; 1/10 LC 50 ) for 30 d and the expression of selected genes studied. We observed significant elevation in the detoxification pathway gene cyp1a suggesting chronic exposure to non-lethal concentration of fluoride is indeed toxic to fish. Fluoride mediated pro-oxidative stress is implicated with the downregulation in superoxide dismutase 1 and 2 (sod1/2) genes. Fluoride affected DNA repair machinery by abrogating the expression of the DNA repair gene rad51 and growth arrest and DNA damage inducible beta a gene gadd45ba. The upregulated expression of casp3a coupled with altered Bcl-2 associated X protein/B-cell lymphoma 2 ratio (baxa/bcl2a) clearly suggested chronic fluoride exposure induced the apoptotic cascade in zebrafish. Fluoride-exposed zebrafish when challenged with non-lethal dose of fish pathogen A. hydrophila revealed gross histopathology in spleen, bacterial persistence and significant mortality. We report that fluoride interferes with system-level output of pro-inflammatory cytokines tumour necrosis factor-α, interleukin-1β and interferon-γ, as a consequence, bacteria replicate efficiently causing significant fish mortality. We conclude, chronic fluoride exposure impairs the redox balance, affects DNA repair machinery with pro-apoptotic implications and suppresses pro-inflammatory cytokines expression abrogating host immunity to bacterial infections. Copyright © 2017 Elsevier Ltd. All rights reserved.

Activating transcription factor 4 underlies the pathogenesis of arsenic trioxide-mediated impairment of macrophage innate immune functions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Srivastava, Ritesh K.; Li, Changzhao

Chronic arsenic exposure to humans is considered immunosuppressive with augmented susceptibility to several infectious diseases. The exact molecular mechanisms, however, remain unknown. Earlier, we showed the involvement of unfolded protein response (UPR) signaling in arsenic-mediated impairment of macrophage functions. Here, we show that activating transcription factor 4 (ATF4), a UPR transcription factor, regulates arsenic trioxide (ATO)-mediated dysregulation of macrophage functions. In ATO-treated ATF4{sup +/+} wild-type mice, a significant down-regulation of CD11b expression was associated with the reduced phagocytic functions of peritoneal and lung macrophages. This severe immuno-toxicity phenotype was not observed in ATO-treated ATF4{sup +/−} heterozygous mice. To confirm thesemore » observations, we demonstrated in Raw 264.7 cells that ATF4 knock-down rescues ATO-mediated impairment of macrophage functions including cytokine production, bacterial engulfment and clearance of engulfed bacteria. Sustained activation of ATF4 by ATO in macrophages induces apoptosis, while diminution of ATF4 expression protects against ATO-induced apoptotic cell death. Raw 264.7 cells treated with ATO also manifest dysregulated Ca{sup ++} homeostasis. ATO induces Ca{sup ++}-dependent calpain-1 and caspase-12 expression which together regulated macrophage apoptosis. Additionally, apoptosis was also induced by mitochondria-regulated pathway. Restoring ATO-impaired Ca{sup ++} homeostasis in ER/mitochondria by treatments with the inhibitors of inositol 1,4,5-trisphosphate receptor (IP3R) and voltage-dependent anion channel (VDAC) attenuate innate immune functions of macrophages. These studies identify a novel role for ATF4 in underlying pathogenesis of macrophage dysregulation and immuno-toxicity of arsenic. - Highlights: • ATF4 regulates arsenic-mediated impairment in macrophage functions. • Arsenic-mediated alterations in pulmonary macrophage are diminished in ATF4{sup +/�

Aerosolization of Particulate (1→3)-β-d-Glucan from Moldy Materials▿

PubMed Central

Seo, Sung-Chul; Reponen, Tiina; Levin, Linda; Borchelt, Tiffany; Grinshpun, Sergey A.

2008-01-01

Mold-damaged building materials may contain biologically active agents, such as (1→3)-β-d-glucan, allergens, and mycotoxins, which have been associated with adverse health effects. The release of these components from contaminated surfaces into the air is not well understood. The purpose of this study was to characterize the release of particulate (1→3)-β-d-glucan from the surface of artificially mold-contaminated materials. Aspergillus versicolor and Stachybotrys chartarum were grown on malt extract agar (MEA), white ceiling tiles, and a wall-papered gypsum board for 1 and 6 months. The (1→3)-β-d-glucan on the surfaces of moldy materials and in air samples collected from these materials was analyzed by the Limulus amebocyte lysate assay. The aerosolization ratio was defined as the amount of (1→3)-β-d-glucan in the air divided by the amount on the surface. The results showed that the aerosolization of particulate (1→3)-β-d-glucan was influenced mainly by the type of material and the fungal species. For A. versicolor, the aerosolization ratios of particulate (1→3)-β-d-glucan released from the three types of material were not significantly different. However, the ratios for S. chartarum released from ceiling tiles and gypsum board were significantly higher than the ratios for this organism released from MEA (P < 0.001) and were comparable to those for A. versicolor. These findings indicate that the use of MEA in aerosolization experiments is likely to underestimate the release of S. chartarum particles from building materials. These results provide important background information for design of future laboratory or animal experiments, as well as for interpretation of field measurement data. PMID:18065630

Evaluation of a novel delayed-type hypersensitivity assay to Candida albicans in adult and neonatal rats.

PubMed

Thorn, Mitchell; Hudson, Adam W; Kreeger, John; Kawabe, Thomas T; Bowman, Christopher J; Collinge, Mark

2015-01-01

Delayed-type hypersensitivity (DTH) is a T-cell-mediated immune response that may be used for immunotoxicity testing in non-clinical species. However, in some cases DTH assays using T-dependent antigens may be confounded by the production of antibodies to the antigen. The authors have previously modified a DTH assay, initially validated in the mouse, for use in juvenile rats to assess the effect of immunosuppressive drugs on the developing rat immune system. The assay measures footpad swelling induced by subcutaneous footpad injection of Candida albicans (C. albicans) derived-chitosan in rats previously sensitized with C. albicans. Antibodies to chitosan are not produced in this model. However, considerable inter-animal variability inherent in the footpad swelling assay can make it difficult to precisely quantify the magnitude of the immune response and inhibition by immunosuppressants, particularly if complete suppression is not observed. This report describes the development of an ex vivo assay to assess DTH in rats using interferon (IFN)-γ production by splenocytes, obtained from rats sensitized with C. albicans, as the quantifiable measure of the DTH response. Adult and neonatal rats administered dexamethasone (DEX), a known immunosuppressant, exhibited immunosuppression as evidenced by a reduction in ex vivo IFNγ production from splenocytes challenged with C. albicans-derived chitosan. Current data indicate that the ex vivo based DTH assay is more sensitive than the conventional footpad swelling assay due to a lower background response and the ability to detect a response as early as post-natal day (PND) 12. The ex vivo based rat DTH assay offers a highly sensitive and quantitative alternative to the footpad swelling assay for the assessment of the immunotoxic potential of drugs. The increased sensitivity of the ex vivo DTH assay may be useful for identifying smaller changes in response to immunotoxic drugs, as well as detecting responses earlier in animal

Profiling the immunotoxicity of chemicals based on in vitro evaluation by a combination of the Multi-ImmunoTox assay and the IL-8 Luc assay.

PubMed

Kimura, Yutaka; Fujimura, Chizu; Ito, Yumiko; Takahashi, Toshiya; Terui, Hitoshi; Aiba, Setsuya

2018-06-01

We established a luciferase reporter assay system, the Multi-ImmunoTox Assay (MITA), which can evaluate the effects of chemicals on the promoter activities of four cytokines: IL-2, IFN-γ, IL-1β, and IL-8. We previously reported that MITA correctly reflected the change in mRNA of human whole-blood cells treated with dexamethasone, cyclosporine, FK506, or several other immunosuppressive drugs. In this study, we combined MITA with the IL-8 Luc assay to detect skin sensitization chemicals (OECD 442E) (modified MITA: mMITA) and established a data set of 60 chemicals examined by mMITA. Using the mMITA results, chemicals can be classified based on the lowest observed effect level (LOEL) of chemicals in suppressing or augmenting the promoter activities of the four cytokines. Moreover, we demonstrated that K-means clustering and hierarchical clustering of the 60 chemicals based on the LOEL for their effects on IL-2 and IL-8 promoter activities and the judgment by the IL-8 Luc assay resulted in the same 6-cluster solution: cluster 1 with preferential suppression of IL-8, cluster 2 with suppression of IL-2 and a positive IL-8 Luc assay result, cluster 3 with suppression of both IL-2 and IL-8, cluster 4 with no effects on IL-2 or IL-8 and a negative IL-8 Luc assay result, cluster 5 with suppression of both IL-2 and IL-8 and a negative IL-8 Luc assay result, and cluster 6 with preferential suppression of IL-8. These data suggest that mMITA is a promising novel high-throughput approach for detecting unrecognized immunological effects of chemicals and for profiling their immunotoxic effects.

Exposure to tributyltin induces endoplasmic reticulum stress and the unfolded protein response in zebrafish.

PubMed

Komoike, Yuta; Matsuoka, Masato

2013-10-15

Tributyltin (TBT) is a major marine contaminant and causes endocrine disruption, hepatotoxicity, immunotoxicity, and neurotoxicity. However, the molecular mechanisms underlying the toxicity of TBT have not been fully elucidated. We examined whether exposure to TBT induces the endoplasmic reticulum (ER) stress response in zebrafish, a model organism. Zebrafish-derived BRF41 fibroblast cells were exposed to 0.5 or 1 μM TBT for 0.5-16 h and subsequently lysed and immunoblotted to detect ER stress-related proteins. Zebrafish embryos, grown until 32 h post fertilization (hpf), were exposed to 1 μM TBT for 16 h and used in whole mount in situ hybridization and immunohistochemistry to visualize the expression of ER chaperones and an ER stress-related apoptosis factor. Exposure of the BRF41 cells to TBT caused phosphorylation of the zebrafish homolog of protein kinase RNA-activated-like ER kinase (PERK), eukaryotic translation initiation factor 2 alpha (eIF2α), and inositol-requiring enzyme 1 (IRE1), characteristic splicing of X-box binding protein 1 (XBP1) mRNA, and enhanced expression of activating transcription factor 4 (ATF4) protein. In TBT-exposed zebrafish embryos, ectopic expression of the gene encoding zebrafish homolog of the 78 kDa glucose-regulating protein (GRP78) and gene encoding CCAAT/enhancer-binding protein homologous protein (CHOP) was detected in the precursors of the neuromast, which is a sensory organ for detecting water flow and vibration. Our in vitro and in vivo studies revealed that exposure of zebrafish to TBT induces the ER stress response via activation of both the PERK-eIF2α and IRE1-XBP1 pathways of the unfolded protein response (UPR) in an organ-specific manner. Copyright © 2013 Elsevier B.V. All rights reserved.

IMMUNOTOXICOGENOMICS: THE POTENTIAL OF GENOMICS TECHNOLOGY IN THE IMMUNOTOXICITY RISK ASSESSMENT PROCESS

EPA Science Inventory

Evaluation of xenobiotic-induced changes in gene expression as a method to identify and classify potential toxicants is being pursued by industry and regulatory agencies worldwide. A workshop was held at the Research Triangle Park campus of the Environmental Protection Agency to...

Mechanism of immunotoxicological effects of tributyltin chloride on murine thymocytes.

PubMed

Sharma, Neelima; Kumar, Anoop

2014-04-01

Tributyltin-chloride, a well-known organotin compound, is a widespread environmental toxicant. The immunotoxic effects of tributyltin-chloride on mammalian system and its mechanism is still unclear. This study is designed to explore the mode of action of tributyltin-induced apoptosis and other parallel apoptotic pathways in murine thymocytes. The earliest response in oxidative stress followed by mitochondrial membrane depolarization and caspase-3 activation has been observed. Pre-treatment with N-acetyl cysteine and buthionine sulfoximine effectively inhibited the tributyltin-induced apoptotic DNA and elevated the sub G1 population, respectively. Caspase inhibitors pretreatment prevent tributyltin-induced apoptosis. Western blot and flow cytometry indicate no translocation of apoptosis-inducing factor and endonuclease G in the nuclear fraction from mitochondria. Intracellular Ca(2+) levels are significantly raised by tributyltin chloride. These results clearly demonstrate caspase-dependent apoptotic pathway and support the role of oxidative stress, mitochondrial membrane depolarization, caspase-3 activation, and calcium during tributyltin-chloride (TBTC)-induced thymic apoptosis.

Sick building syndrome. III. Stachybotrys chartarum.

PubMed

Mahmoudi, M; Gershwin, M E

2000-04-01

Increasingly, physicians are being asked to evaluate patients with putative environmentally associated illnesses. These can include a variety of problems, including infectious illnesses (Legionnaire's disease), chemical exposure in the workplace, and sick building syndromes. The latter has been an issue particularly in asthma because of the association of mold and increased bronchial responsiveness. Recently, attention has been focused on the mold Stachybotrys in human disease. Stachybotrys was first identified more than 60 years ago following an epidemic of stomatitis, rhinitis, conjunctivitis, pancytopenia, neurologic disorders, and death in horses. Since then, Stachybotrys has been identified in several outbreaks of disease in animals. It has also attracted attention as a possible agent in idiopathic pulmonary hemorrhage in infants. Stachybotrys is a relatively uncommon fungus but has been isolated from a variety of sources, including contaminated grains, tobacco, indoor air, insulator foams, and water-damaged buildings with high humidity. This fungus is particularly important because it is one of a series of fungi that produces trichothecenes mycotoxins; these mycotoxins are biologically active and can produce a variety of physiological and pathologic changes in humans and animals, including modulation of inflammation and altered alveolar surfactant phospholipid concentrations. The presence of Stachybotrys in a building does not necessarily imply a cause-and-effect relationship with illness, but should alert physicians and healthcare professionals to do more vigorous environmental testing. Guidelines are presented herein for intervention measures in the maintenance of heating, ventilation, and air-conditioning systems.

The influence of hydrocarbon composition and exposure conditions on jet fuel-induced immunotoxicity.

PubMed

Hilgaertner, Jianhua W; He, Xianghui; Camacho, Daniel; Badowski, Michael; Witten, Mark; Harris, David T

2011-11-01

Chronic jet fuel exposure could be detrimental to the health and well-being of exposed personnel, adversely affect their work performance and predispose these individuals to increased incidences of infectious disease, cancer and autoimmune disorders. Short-term (7 day) JP-8 jet fuel exposure has been shown to cause lung injury and immune dysfunction. Physiological alterations can be influenced not only by jet fuel exposure concentration (absolute amount), but also are dependent on the type of exposure (aerosol versus vapor) and the composition of the jet fuel (hydrocarbon composition). In the current study, these variables were examined with relation to effects of jet fuel exposure on immune function. It was discovered that real-time, in-line monitoring of jet fuel exposure resulted in aerosol exposure concentrations that were approximately one-eighth the concentration of previously reported exposure systems. Further, the effects of a synthetic jet fuel designed to eliminate polycyclic aromatic hydrocarbons were also examined. Both of these changes in exposure reduced but did not eliminate the deleterious effects on the immune system of exposed mice.

Data points used to generate figures 2 through 6 in manuscript submission.

EPA Pesticide Factsheets

Excel files containing raw data used to generate figures throughout manuscript.This dataset is associated with the following publication:Dean , T., D. Betancourt , J. Kim, L. Harvey, A. Evans, and B. Grace. Biological Responses of Raw 264.7 Macrophage Exposed to Two Strains of Stachybotrys chartarum Spores Grown on Four Different Wallboard Types. INHALATION TOXICOLOGY. Taylor & Francis, Inc., Philadelphia, PA, USA, 28(7): 303-307, (2016).

ATP Mediates Neuroprotective and Neuroproliferative Effects in Mouse Olfactory Epithelium following Exposure to Satratoxin G In Vitro and In Vivo

PubMed Central

Jia, Cuihong; Sangsiri, Sutheera; Belock, Bethany; Iqbal, Tania R.; Pestka, James J.; Hegg, Colleen C.

2011-01-01

Intranasal aspiration of satratoxin G (SG), a mycotoxin produced by the black mold Stachybotrys chartarum, selectively induces apoptosis in olfactory sensory neurons (OSNs) in mouse olfactory epithelium (OE) through unknown mechanisms. Here, we show a dose-dependent induction of apoptosis 24 h post-SG exposure in vitro as measured by increased activated caspases in the OP6 olfactory placodal cell line and increased propidium iodide staining in primary OE cell cultures. Intranasal aspiration of SG increased TUNEL (Terminal dUTP Nick End Labeling) staining in the neuronal layer of the OE and significantly increased the latency to find a buried food pellet, confirming that SG selectively induces neuronal apoptosis and demonstrating that SG impairs the sense of smell. Next, we investigated whether ATP can prevent SG-induced OE toxicity. ATP did not decrease apoptosis under physiological conditions but significantly reduced SG-induced OSN apoptosis in vivo and in vitro. Furthermore, purinergic receptor inhibition significantly increased apoptosis in OE primary cell culture and in vivo. These data indicate that ATP is neuroprotective against SG-induced OE toxicity. The number of cells that incorporated 5′-bromodeoxyuridine, a measure of proliferation, was significantly increased 3 and 6 days post-SG aspiration. Treatment with purinergic receptor antagonists significantly reduced SG-induced cell proliferation, whereas post-treatment with ATP significantly potentiated SG-induced cell proliferation. These data indicate that ATP is released and promotes cell proliferation via activation of purinergic receptors in SG-induced OE injury. Thus, the purinergic system is a therapeutic target to alleviate or restore the loss of OSNs. PMID:21865290

Reactive oxygen species (ROS) induced cytokine production and cytotoxicity of PAMAM dendrimers in J774A.1 cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Naha, Pratap C., E-mail: pratap.naha@dit.i; NanoLab, Focas Research Institute, Dublin Institute of Technology, Kevin Street, Dublin 8; Davoren, Maria

2010-07-15

The immunotoxicity of three generations of polyamidoamine (PAMAM) dendrimers (G-4, G-5 and G-6) was evaluated in mouse macrophage cells in vitro. Using the Alamar blue and MTT assays, a generation dependent cytotoxicity of the PAMAM dendrimers was found whereby G-6 > G-5 > G-4. The toxic response of the PAMAM dendrimers correlated well with the number of surface primary amino groups, with increasing number resulting in an increase in toxic response. An assessment of intracellular ROS generation by the PAMAM dendrimers was performed by measuring the increased fluorescence as a result of intracellular oxidation of Carboxy H{sub 2}DCFDA to DCFmore » both quantitatively using plate reader and qualitatively by confocal laser scanning microscopy. The inflammatory mediators macrophage inflammatory protein-2 (MIP-2), tumour necrosis factor-{alpha} (TNF-{alpha}) and interleukin-6, (IL-6) were measured by the enzyme linked immunosorbant assay (ELISA) following exposure of mouse macrophage cells to PAMAM dendrimers. A generation dependent ROS and cytokine production was found, which correlated well with the cytotoxicological response and therefore number of surface amino groups. A clear time sequence of increased ROS generation (maximum at {approx} 4 h), TNF-{alpha} and IL-6 secretion (maximum at {approx} 24 h), MIP-2 levels and cell death ({approx} 72 h) was observed. The intracellular ROS generation and cytokine production induced cytotoxicity point towards the mechanistic pathway of cell death upon exposure to PAMAM dendrimers.« less

Facts about Stachybotrys chartarum and Other Molds

MedlinePlus

... buildings and homes? As part of routine building maintenance, buildings should be inspected for evidence of water ... Privacy FOIA No Fear Act OIG 1600 Clifton Road Atlanta , GA 30329-4027 USA 800-CDC-INFO ( ...

Evaluation of nanoparticle immunotoxicity

NASA Astrophysics Data System (ADS)

Dobrovolskaia, Marina A.; Germolec, Dori R.; Weaver, James L.

2009-07-01

The pharmaceutical industry is developing increasing numbers of drugs and diagnostics based on nanoparticles, and evaluating the immune response to these diverse formulations has become a challenge for scientists and regulatory agencies alike. An international panel of scientists and representatives from various agencies and companies reviewed the imitations of current tests at a workshop held at the National Cancer Institute in Frederick, Maryland. This article outlines practical strategies for identifying and controlling interferences in common evaluation methods and the implications for regulation.

ANIMAL MODELS FOR IMMUNOTOXICITY

EPA Science Inventory

Greater susceptibility to infection is a hallmark of compromised immune function in humans and animals, and is often considered the benchmark against which the predictive value of immune function tests are compared. This focus of this paper is resistance to infection with the pa...

Identification of informative features for predicting proinflammatory potentials of engine exhausts.

PubMed

Wang, Chia-Chi; Lin, Ying-Chi; Lin, Yuan-Chung; Jhang, Syu-Ruei; Tung, Chun-Wei

2017-08-18

The immunotoxicity of engine exhausts is of high concern to human health due to the increasing prevalence of immune-related diseases. However, the evaluation of immunotoxicity of engine exhausts is currently based on expensive and time-consuming experiments. It is desirable to develop efficient methods for immunotoxicity assessment. To accelerate the development of safe alternative fuels, this study proposed a computational method for identifying informative features for predicting proinflammatory potentials of engine exhausts. A principal component regression (PCR) algorithm was applied to develop prediction models. The informative features were identified by a sequential backward feature elimination (SBFE) algorithm. A total of 19 informative chemical and biological features were successfully identified by SBFE algorithm. The informative features were utilized to develop a computational method named FS-CBM for predicting proinflammatory potentials of engine exhausts. FS-CBM model achieved a high performance with correlation coefficient values of 0.997 and 0.943 obtained from training and independent test sets, respectively. The FS-CBM model was developed for predicting proinflammatory potentials of engine exhausts with a large improvement on prediction performance compared with our previous CBM model. The proposed method could be further applied to construct models for bioactivities of mixtures.

[Preclinical study of noopept toxicity].

PubMed

Kovalenko, L P; Smol'nikova, N M; Alekseeva, S V; Nemova, E P; Sorokina, A V; Miramedova, M G; Kurapova, S P; Sidorina, E I; Kulakova, A V; Daugel'-Dauge, N O

2002-01-01

Within the framework of a preclinical investigation, the new nootrope drug noopept (N-phenyl-acetyl-L-propyl-glycine ethylate) was tested for chronic toxicity upon peroral administration in a dose of 10 or 100 mg/kg over 6 months in both male and female rabbits. The results of observations showed that noopept administered in this dose range induced no irreversible pathologic changes in the organs and systems studied and exhibited no allergenic, immunotoxic, and mutagen activity. The drug affected neither the generative function nor the antenatal or postnatal progeny development. Noopept produced a dose-dependent suppression of inflammation reaction to concanavalin A and stimulated the cellular and humoral immune response in mice.

Implementation of the agmatine-controlled expression system for inducible gene expression in Lactococcus lactis.

PubMed

Linares, Daniel M; Alvarez-Sieiro, Patricia; del Rio, Beatriz; Ladero, Victor; Redruello, Begoña; Martin, Ma Cruz; Fernandez, Maria; Alvarez, Miguel A

2015-12-30

Lactococcus lactis has been safely consumed in fermented foods for millennia. This Gram-positive bacterium has now become of industrial importance as an expression host for the overproduction of lipopolysaccharide-free recombinant proteins used as food ingredients, therapeutic proteins and biotechnological enzymes. This paper reports an agmatine-controlled expression (ACE) system for L. lactis, comprising the lactococcal agmatine-sensor/transcriptional activator AguR and its target promoter P(aguB). The usefulness and efficiency of this system was checked via the reporter gene gfp and by producing PEP (Myxococcus xanthus prolyl-endopeptidase), an enzyme of biomedical interest able to degrade the immunotoxic peptides produced during the gastrointestinal breakdown of gluten. The ACE system developed in this work was suitable for the efficient expression of the functional recombinant proteins GFP and PEP. The expression system was tightly regulated by the agmatine concentration and allowed high protein production without leakiness.

Carcinogenicity and Immunotoxicity of Embedded Depleted Uranium and Heavy-Metal Tungsten Alloy in Rodents

DTIC Science & Technology

2006-10-01

the implantation site. In addition, WA-implanted rats (high-dose group) exhibited splenomegaly and hematological changes suggesting polycythemia ...controls. The hematological changes observed in the high-dose WA rats are suggestive of polycythemia . Cobalt has been used experimentally to induce... polycythemia in rats (Rakusan et al., 2001; Endoh et al., 2000) although the concentration required is far greater than found in the WA pellets. The

Carcinogenicity and Immunotoxicity of Embedded Depleted Uranium and Heavy-Metal Tungsten Alloy in Rodents

DTIC Science & Technology

2006-10-01

local metal- induced toxicity daily for two weeks following surgery and weekly thereafter for the duration of the study. Task 1 - Determine whether...A quick and simple method for the quantitation of lactate dehydrogenase release in measurements of cellular cytotoxicity and tumor necrosis factor...4 months, no signs of local or systemic toxic- ity were observed (Peuster et al. 2003). Studies on health effects of Ni and Co are more numerous

[Toxicological characteristics of Ochratoxin A and its impact on male reproduction].

PubMed

Zhang, Tian-Yu; Zhao, Yong; Li, Lan; Shen, Wei

2017-08-01

Ochratoxin A (OTA) is found not only nephrotoxic, teratogenic, neurotoxic, and immunotoxic, but also reprotoxic for human and animals. In the recent decade, more attention has been paid to the impact of OTA on human reproduction and the studies of its underlying mechanisms. Many studies show that OTA affects the function of the reproductive system by acting as an endocrine disrupter and, as a testicular toxin, decreases sperm quality and even induces testis cancer. This review summarizes the toxicological characteristics and toxicokinetic process of OTA as well as recent progress in the studies of various toxic effects of OTA and their underlying mechanisms, hoping to call the attention from more people to the toxicity of OTA to male reproductive health.

2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD) and long term immunologic memory.

PubMed

Sherr, David H

2004-06-01

The highlighted article by B. Paige Lawrence and Beth Vorderstrasse addresses an oft forgotten aspect of immunotoxicity, the effects of environmental toxins on immunologic memory. Here, the authors take a step towards filling that information gap by evaluating the effects of a prototypic environmental toxin, 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD), on memory responses to a real-world pathogen, influenza A virus, presented to an animal model in a physiologically relevant manner. Multiple outcomes are evaluated, the vast majority of which suggest important and long-term TCDD-induced changes in the immune system after both primary and secondary exposure to this pathogen. The implications of these studies with regard to the immuno-competence of TCDD-exposed individuals are far reaching.

Chronic exposure to water pollutant trichloroethylene increased epigenetic drift in CD4(+) T cells.

PubMed

Gilbert, Kathleen M; Blossom, Sarah J; Erickson, Stephen W; Reisfeld, Brad; Zurlinden, Todd J; Broadfoot, Brannon; West, Kirk; Bai, Shasha; Cooney, Craig A

2016-05-01

Autoimmune disease and CD4(+) T-cell alterations are induced in mice exposed to the water pollutant trichloroethylene (TCE). We examined here whether TCE altered gene-specific DNA methylation in CD4(+) T cells as a possible mechanism of immunotoxicity. Naive and effector/memory CD4(+) T cells from mice exposed to TCE (0.5 mg/ml in drinking water) for 40 weeks were examined by bisulfite next-generation DNA sequencing. A probabilistic model calculated from multiple genes showed that TCE decreased methylation control in CD4(+) T cells. Data from individual genes fitted to a quadratic regression model showed that TCE increased gene-specific methylation variance in both CD4 subsets. TCE increased epigenetic drift of specific CpG sites in CD4(+) T cells.

Tributyltin potentiates 3,3',4,4',5-pentachlorobiphenyl-induced cytochrome P-4501A-related activity.

PubMed

DeLong, G T; Rice, C D

1997-06-06

Induction of cytochrome P-4501A protein and induction of related enzyme activity are hallmark physiological responses following exposure to planar halogenated aromatic hydrocarbons (HAHs) such as 3,3',4,4',5-pentachlorobiphenyl (PCB 126; PeCB). Environments contaminated by HAHs are often contaminated by mixtures of anthropogenic contaminants, including organometallic compounds. Both HAHs and organometallics easily bioconcentrate and bioaccumulate in aquatic food chains that may ultimately be linked to humans through seafood consumption. Tributyltin (TBT), a marine biocide, has been detected in many aquatic environments due to its primary use as a marine antifoulant agent. Exposure to TBT, as well as several PCBs, has been associated with immunotoxicity, neurotoxicity, and endocrine disruption. Recently TBT has been shown to inhibit cytochrome P-4501A activity in vitro, but information concerning these effects in vivo and in combination with classical inducers of P-4501A, such PeCB, is lacking. We exposed female B6C3F1 mice to 0.01, 0.1, and 1.0 mg/kg PeCB, TBT, or both in combination, with corn oil (CO) serving as a carrier control. Cytochrome P-4501A protein levels and related benzo[a]pyrene hydroxylation (BaP-OHase) activity were measured following a single acute intraperitoneal (ip) dose or seven daily injections. Body, thymus, and liver weights were used to monitor general physiological responses following exposure. P-4501A levels and BaP-OHase activity were significantly elevated in mice exposed to PeCB alone. This effect was enhanced by coexposure to low levels of TBT; PeCB-induced P-4501A-related activity was potentiated at the low range of each. The highest dose of TBT, however, inhibited these activities when given in combination with PeCB. Thymic atrophy was evident only in mice exposed daily to 0:1 and 1.0 mg/kg PeCB alone, or to a combination of the lowest and highest dose of PeCB and TBT, respectively. Because environmental levels of TBT are not

PARTNERSHIPS TO IMPROVE IMMUNOTOXICITY TESTING

EPA Science Inventory

Research in ITB is focused on the effects that chemicals/environmental contaminants have on modulation of the immune system. Immune modulation may result in suppressed immune function, while exposure to certain contaminants may result in hypersensitivity reactions (e.g., asthma ...

Chronic exposure to water pollutant trichloroethylene increased epigenetic drift in CD4+ T cells

PubMed Central

Gilbert, Kathleen M; Blossom, Sarah J; Erickson, Stephen W; Reisfeld, Brad; Zurlinden, Todd J; Broadfoot, Brannon; West, Kirk; Bai, Shasha; Cooney, Craig A

2016-01-01

Aim: Autoimmune disease and CD4+ T-cell alterations are induced in mice exposed to the water pollutant trichloroethylene (TCE). We examined here whether TCE altered gene-specific DNA methylation in CD4+ T cells as a possible mechanism of immunotoxicity. Materials & methods: Naive and effector/memory CD4+ T cells from mice exposed to TCE (0.5 mg/ml in drinking water) for 40 weeks were examined by bisulfite next-generation DNA sequencing. Results: A probabilistic model calculated from multiple genes showed that TCE decreased methylation control in CD4+ T cells. Data from individual genes fitted to a quadratic regression model showed that TCE increased gene-specific methylation variance in both CD4 subsets. Conclusion: TCE increased epigenetic drift of specific CpG sites in CD4+ T cells. PMID:27092578

INCREASED SUSCEPTIBILITY OF ADULTS FOLLOWING DEVELOPMENT EXPOSURE TO NEUROTOXICANTS: ANOTHER SUSCEPTIBLE POPULATION?

EPA Science Inventory

There is considerable public and regulatory interest in the adverse outcomes of developmental exposure to toxicants. The 1996 Food Quality Protection Act spurred research on understanding potential neurotoxic, immunotoxic, and endocrine outcomes in susceptible populations, parti...

Fluorinated Compounds in U.S. Fast Food Packaging

EPA Science Inventory

Per- and polyfluoroalkyl substances (PFASs) are highly persistent synthetic chemicals, some of which have been associated with cancer, developmental toxicity, immunotoxicity, and other health effects. PFASs in grease-resistant food packaging can leach into food and increase dieta...

IMPORTANCE OF ENZYMATIC BIOTRANSFORMATION IN IMMUNOTOXICOLOGY

EPA Science Inventory

Many immunotoxic compounds, such as benzene and other organic solvents, pesticides, mycotoxins and polycyclic aromatic hydrocarbons, can alter immune function only after undergoing enzyme-mediated reactions within various tissues. In the review that follows, the role of enzymatic...

Immunotoxicant screening and prioritization in the 21st century

EPA Science Inventory

Current immunotoxicity testing guidance for drugs, high production volume chemicals and pesticides specifies the use of animal models that measure immune function or evaluation of general indicators of immune system health generated in routine toxicity testing. The assays are ...

EVALUATION OF ANTIMICROBIAL EFFICACY FOR CONTROL OF STACHYBOTRYS CHARTARUM

EPA Science Inventory

Biological contaminants in buildings are known to act as sources of indoor air pollution, discomfort, asthma and pulmonary disease to building occupants, Sick buildings are evidence of extremely problematic indoor air quality (lAO) often resulting from unacceptable concentration...

Cytotoxicity of lambda-cyhalothrin on the macrophage cell line RAW 264.7.

PubMed

Zhang, Quan; Wang, Cui; Sun, Liwei; Li, Ling; Zhao, Meirong

2010-01-01

The wide use and wide-spectrum toxicity of synthetic pyrethroids (SPs) insecticides make them an emerging ecotoxicological concern. Some previous studies showed that SPs possessed cytotoxicity in some immune cells such as human lymphocytes and rat bone marrow. However, the cytotoxicity of SPs to macrophages, which are crucial to innate immunity, has not been explored. In the present report, we investigated a new pyrethroid insecticide, lambda-cyhalothrin (LCT), which may increase the generation of reactive oxygen species (ROS) and DNA damage levels and cause cytotoxicity in RAW 264.7 cells in dose- and time-dependent manners. The results for the first time implicated increased endogenous ROS and DNA damage as co-mediators of LCT-induced cytotoxicity in macrophages. Our results also suggested that macrophages were involved in synthetic pyrethroid-induced adverse immune effects. Considering the ubiquitous environmental presence of SPs, this study provided new information relative to the potential long-term physiological and immunological effects associated with chronic exposure to SPs. Hence, the potential immunotoxicity of SPs should be considered in assessing the safety of these compounds in sensitive environmental compartments.

Immunomodulatory Activities of a Fungal Protein Extracted from Hericium erinaceus through Regulating the Gut Microbiota.

PubMed

Diling, Chen; Chaoqun, Zheng; Jian, Yang; Jian, Li; Jiyan, Su; Yizhen, Xie; Guoxiao, Lai

2017-01-01

A single-band protein (HEP3) was isolated from Hericium erinaceus using a chemical separation combined with pharmacodynamic evaluation methods. This protein exhibited immunomodulatory activity in lipopolysaccharide-activated RAW 264.7 macrophages by decreasing the overproduction of tumor necrosis factor-α, interleukin (IL)-1β, and IL-6, and downregulating the expression of inducible nitric oxide synthase and nuclear factor-κB p65. Further researches revealed that HEP3 could improve the immune system via regulating the composition and metabolism of gut microbiota to activate the proliferation and differentiation of T cells, stimulate the intestinal antigen-presenting cells in high-dose cyclophosphamide-induced immunotoxicity in mice, and play a prebiotic role in the case of excessive antibiotics in inflammatory bowel disease model mice. Aided experiments also showed that HEP3 could be used as an antitumor immune inhibitor in tumor-burdened mice. The results of the present study suggested that fungal protein from H. erinaceus could be used as a drug or functional food ingredient for immunotherapy because of its immunomodulatory activities.

Immunomodulatory Activities of a Fungal Protein Extracted from Hericium erinaceus through Regulating the Gut Microbiota

PubMed Central

Diling, Chen; Chaoqun, Zheng; Jian, Yang; Jian, Li; Jiyan, Su; Yizhen, Xie; Guoxiao, Lai

2017-01-01

A single-band protein (HEP3) was isolated from Hericium erinaceus using a chemical separation combined with pharmacodynamic evaluation methods. This protein exhibited immunomodulatory activity in lipopolysaccharide-activated RAW 264.7 macrophages by decreasing the overproduction of tumor necrosis factor-α, interleukin (IL)-1β, and IL-6, and downregulating the expression of inducible nitric oxide synthase and nuclear factor-κB p65. Further researches revealed that HEP3 could improve the immune system via regulating the composition and metabolism of gut microbiota to activate the proliferation and differentiation of T cells, stimulate the intestinal antigen-presenting cells in high-dose cyclophosphamide-induced immunotoxicity in mice, and play a prebiotic role in the case of excessive antibiotics in inflammatory bowel disease model mice. Aided experiments also showed that HEP3 could be used as an antitumor immune inhibitor in tumor-burdened mice. The results of the present study suggested that fungal protein from H. erinaceus could be used as a drug or functional food ingredient for immunotherapy because of its immunomodulatory activities. PMID:28713364

In vitro immunotoxic and genotoxic activities of particles emitted from two different small-scale wood combustion appliances

NASA Astrophysics Data System (ADS)

Tapanainen, Maija; Jalava, Pasi I.; Mäki-Paakkanen, Jorma; Hakulinen, Pasi; Happo, Mikko S.; Lamberg, Heikki; Ruusunen, Jarno; Tissari, Jarkko; Nuutinen, Kati; Yli-Pirilä, Pasi; Hillamo, Risto; Salonen, Raimo O.; Jokiniemi, Jorma; Hirvonen, Maija-Riitta

2011-12-01

Residential wood combustion appliances emit large quantities of fine particles which are suspected to cause a substantial health burden worldwide. Wood combustion particles contain several potential health-damaging metals and carbon compounds such as polycyclic aromatic hydrocarbons (PAH), which may determine the toxic properties of the emitted particles. The aim of the present study was to characterize in vitro immunotoxicological and chemical properties of PM 1 ( Dp ≤ 1 μm) emitted from a pellet boiler and a conventional masonry heater. Mouse RAW264.7 macrophages were exposed for 24 h to different doses of the emission particles. Cytotoxicity, production of the proinflammatory cytokine TNF-α and the chemokine MIP-2, apoptosis and phases of the cell cycle as well as genotoxic activity were measured after the exposure. The type of wood combustion appliance had a significant effect on emissions and chemical composition of the particles. All the studied PM 1 samples induced cytotoxic, genotoxic and inflammatory responses in a dose-dependent manner. The particles emitted from the conventional masonry heater were 3-fold more potent inducers of programmed cell death and DNA damage than those emitted from the pellet boiler. Furthermore, the particulate samples that induced extensive DNA damage contained also large amounts of PAH compounds. Instead, significant differences between the studied appliances were not detected in measurements of inflammatory mediators, although the chemical composition of the combustion particles differed considerably from each other. In conclusion, the present results show that appliances representing different combustion technology have remarkable effects on physicochemical and associated toxicological and properties of wood combustion particles. The present data indicate that the particles emitted from incomplete combustion are toxicologically more potent than those emitted from more complete combustion processes.

Immunotoxicant Screening and Prioritization in the 21st Century**

EPA Science Inventory

Current immunotoxicity testing guidance for drugs, high production volume chemicals and pesticides specifies the use of animal models to assess potential biomarkers of immune system effects (e.g., lymphoid organ and bone marrow indices, histopathology) or actual measures of immun...

SUPPRESSION OF IMMUNE FUNCTION AND SUSCEPTIBILITY TO INFECTIONS IN HUMANS: ASSOCIATION OF IMMUNE FUNCTION WITH CLINICAL DISEASE

EPA Science Inventory

ABSTRACT
A number of regulatory agencies in western Europe, Japan and the US now include guidelines for evaluating the potential immunotoxicity of chemicals, including drugs, as part of routine toxicity testing. Most testing guidelines recommend observational or functional as...

RISK ASSESSMENT OF THE INFLAMMOGENIC AND MUTAGENIC EFFECTS OF DIESEL EXHAUST PARTICLES: A SYSTEMS BIOLOGY APPROACH

EPA Science Inventory

Diesel exhaust particulate matter (DEP) is a ubiquitous ambient air contaminant derived from mobile and stationary diesel fuel combustion. Exposure to DEP is associated with carcinogenic and immunotoxic effects in humans and experimental animals. At the cellular level, these heal...

Immunotoxicant screening and prioritization in the 21st century*

EPA Science Inventory

Current immunotoxicity testing guidance for drugs, high production volume chemicals and pesticides specifies the use of animal models that measure immune function or evaluation of general indicators of immune system health generated in routine toxicity testing. The assays are r...

Identification of monoclonal antibodies cross-reactive with bottlenose dolphin orthologues of the major histocompatibility complex and leukocyte differentiation molecules

USDA-ARS?s Scientific Manuscript database

The slow progress in understanding immunotoxic effects of environmental contaminants and their influence on disease susceptibility and immunopathogenesis of the bottlenose dolphin (Tursiops truncates) and other species of cetaceans, is largely due to lack of monoclonal antibody (mAb) reagents. As re...

77 FR 40076 - National Institute of Environmental Health Sciences; Notice of Closed Meeting

Federal Register 2010, 2011, 2012, 2013, 2014

2012-07-06

... Environmental Health Sciences; Notice of Closed Meeting Pursuant to section 10(d) of the Federal Advisory... Health Sciences Special Emphasis Panel, Immunotoxicity Studies for the National Toxicology Program. Date... Officer, Scientific Review Branch, Division of Extramural Research and Training, Nat. Institute of...

Associating Changes in the Immune System with Clinical Diseases for Interpretation in Risk Assessment##

EPA Science Inventory

This overview is a revision to the unit originally published in 2004. While the basic tenants of immunotoxicity have not changed in the past 10 years, several publications have explored the application of immunotoxicological data to the risk assessment process. Therefore, the goa...

DIBUTYLTIN EXPOSURE ALTERS CIRCULATING BLOOD GROWTH FACTOR LEVELS.

EPA Science Inventory

Organotin compounds are commonly used as heat stabilizers in the manufacture of PVC plastics, in pesticides, and as preservatives for a wide variety of materials. Dibutyltin (DBT) is of particular interest due to its immunotoxic effects. In this study, we used ELISA assays to d...

Immunotoxicological profile of Chloramine in female B6C3FI mice when administered in the drinking water for 28 days

EPA Science Inventory

Monochloramine has been used to provide a disinfecting residual in water distribution systems where it is difficult to maintain a free chlorine residual or where disinfection by-product formation is of concern. The goal of this study was to characterize the immunotoxic effects of...

76 FR 38026 - Diethylene Glycol Mono Butyl Ether; Exemption From the Requirement of a Tolerance

Federal Register 2010, 2011, 2012, 2013, 2014

2011-06-29

... chemicals. Immunotoxicity studies were available for ethylene glycol mono butyl ether, also a glycol ether... the glycol ether class of chemicals which include structurally similar chemicals ethylene glycol and... potential to cause cancer. Based on the lack of evidence of carcinogenicity potential for ethylene glycol...

Immunotoxicity of Jet Fuels and Solvents

DTIC Science & Technology

2002-11-01

to determine health risk 7 assessments for regulatory decision making. These biologic measurements were described as part of the "state-of-the- art ...34 science in developing health risk management plans for the incredible assortment of environmental toxins to which humans can be exposed (Fowle and

40 CFR 799.9780 - TSCA immunotoxicity.

Code of Federal Regulations, 2012 CFR

2012-07-01

... quantitative analysis of the effects of a chemical on the numbers of cells in major lymphocyte populations and..., and the research sample shall be stored under conditions that maintain its purity and stability. Prior... type of effect. (ii) All observed results, quantitative and incidental, shall be evaluated by an...

40 CFR 799.9780 - TSCA immunotoxicity.

Code of Federal Regulations, 2013 CFR

2013-07-01

... quantitative analysis of the effects of a chemical on the numbers of cells in major lymphocyte populations and..., and the research sample shall be stored under conditions that maintain its purity and stability. Prior... type of effect. (ii) All observed results, quantitative and incidental, shall be evaluated by an...

40 CFR 799.9780 - TSCA immunotoxicity.

Code of Federal Regulations, 2010 CFR

2010-07-01

... quantitative analysis of the effects of a chemical on the numbers of cells in major lymphocyte populations and..., and the research sample shall be stored under conditions that maintain its purity and stability. Prior... type of effect. (ii) All observed results, quantitative and incidental, shall be evaluated by an...

40 CFR 799.9780 - TSCA immunotoxicity.

Code of Federal Regulations, 2014 CFR

2014-07-01

... quantitative analysis of the effects of a chemical on the numbers of cells in major lymphocyte populations and..., and the research sample shall be stored under conditions that maintain its purity and stability. Prior... type of effect. (ii) All observed results, quantitative and incidental, shall be evaluated by an...

40 CFR 799.9780 - TSCA immunotoxicity.

Code of Federal Regulations, 2011 CFR

2011-07-01

... quantitative analysis of the effects of a chemical on the numbers of cells in major lymphocyte populations and..., and the research sample shall be stored under conditions that maintain its purity and stability. Prior... type of effect. (ii) All observed results, quantitative and incidental, shall be evaluated by an...

Generation of oxyradicals (O2. and H2O2), mitochondrial activity and induction of apoptosis of PBMC of Cyprinus carpio carpio treated in vivo with halomethanes and with recombinant HSP60 kDa and with LPS of Klebsiella pneumoniae.

PubMed

Uraga-Tovar, D Italibi; Domínguez-López, M Lilia; Madera-Sandoval, Ruth L; Nájera-Martínez, Minerva; García-Latorre, Ethel; Vega-López, Armando

2014-10-01

Halomethanes (HM) can be immunotoxic in mammals; however, in the fish immune system HM effects are unknown. In the current study, we evaluated the mitochondrial activity (MA) by MTT, induction of apoptosis by SubG0 technique and quantified serum ROS concentration (O2. and H2O2) and ROS production in PBMC of Cyprinus carpio carpio treated i.p. with CH2Cl2, CHCl3 and BrCHCl2 (0.004-40.0 mg/kg) for 96 h. Positive controls were recombinant heat shock protein of 60 kDa (rHSP60 kDa) of Klebsiella pneumoniae and its LPS. In addition, for in vitro PBMC cultures, two culture media and two sources of sera were tested. Both positive controls increased the MA more than 4-fold as well as the production of O2. (26-fold) and H2O2 (5-fold) compared to their controls. HM induced different effects on MA, ROS production and an induction of apoptosis, depending on the chlorination patterns and the dose; however, a systemic damage prevails. To fish treated with CH2Cl2, the apoptosis was related with serum ROS concentration and with MA. In contrast, in fish dosed with CHCl3 relationships were not found, deducing a systemic damage. However, in fish treated with BrCHCl2, serum O2. concentration and in vitro ROS generation performed by PBMC were involved in the induction of apoptosis of these cells but not with MA suggesting also immunotoxic effects. The current study demonstrated that HMs are immunomodulators increasing an acute inflammatory response and that rHSP60kDA of K. pneumoniae and its LPS are appropriate antigens to assess the immune response of C. c. carpio.

[Evaluation of immunotoxicity tests using cyclosporin A-treated rats: the International Collaborative Immunotoxicity Study II (cyclosporin A)].

PubMed

Ochiai, T; Naito, K; Murakami, O; Ohno, K; Sekita, K; Furuya, T; Kurokawa, Y; Matsumoto, K; Saito, Y; Hachisuka, A

1993-01-01

Immunotoxicological effects of cyclosporin A (CsA) were studied by enhanced histopathological and functional tests in rats. Male F344 rats were orally administered with CsA in doses of 0, 2.5, 10, and 40 mg/kg/day for 28 successive days. Hematological examination revealed that the CsA treatment brought about a marked dose-dependent decrease in the number of WBCs, which was attributed to a decrease in the number of lymphocytes. In the femoral bone marrow, a significant reduction in the number of nucleated cells was observed, which was attributed to a decrease in the number of lymphocytes and erythroblasts. Histopathologically, diminution of thymic medullas, appearance of tangible body macrophages in thymic cortices, and calcification and basophilic changes in kidneys were observed in the middle and high dose groups. Immunohistological examination with anti-rat T lymphocyte antibody showed a decrease in the number of T cells at the periarterial lymphatic sheaths in the spleens. As for the functional tests, CsA treatment remarkably reduced the PFC number even in the low dose group. The Con A response of spleen cells was decreased in the middle and high dose groups. The STM response was reduced only in the high dose group. The NK activity was little affected. Thus, in the CsA-treated F344 rats, the enhanced histopathological and some functional tests which were proposed by ICICIS, were found to be useful to detect damages to the immune system.

Effect of indinavir used alone or in double or triple combination with AZT and ddC on human immune functions.

PubMed

Mattioli, Benedetta; Giordani, Luciana; Quaranta, Maria Giovanna; Viora, Marina

2004-03-19

Indinavir (IDV) is a potent and selective human immunodeficiency virus type 1 (HIV-1) protease inhibitor (PI) widely used in antiretroviral therapy, but its effects on the immune system are relatively unknown. In this study we have investigated the in vitro effect of IDV on normal human peripheral blood mononuclear cells (PBMC). We used the drug alone or in double and triple combination with AZT and ddC to assess whether IDV interferes with the previously observed immunomodulatory effects induced by AZT and ddC. We found that proliferative response, induction of immunoglobulins (Ig) production and cytokine production was not modulated by IDV. More importantly, IDV used in double or triple combination with AZT and ddC, does not further strenghten the inhibition of proliferative response induced by AZT and is able to abrogate the inhibitory effect induced by ddC on proliferative response. Similarly, IDV/AZT, IDV/ddC and IDV/AZT/ddC combinations does not strenghten the modulation of TNF-alpha, IFN-gamma and IL-4 induced by AZT, ddC and AZT/ddC. On the other hand, IDV neutralizes the up-regulating effects of AZT on IL-2 production while the up-regulating effects of ddC on IL-2 production is not affected. These data suggest that IDV used in combination with AZT and ddC did not add any further immunotoxicity.

Time-response characteristic and potential biomarker identification of heavy metal induced toxicity in zebrafish.

PubMed

Yin, Jian; Wang, Ai-Ping; Li, Wan-Fang; Shi, Rui; Jin, Hong-Tao; Wei, Jin-Feng

2018-01-01

The present work aims to explore the time-response (from 24 h to 96 h) characteristic and identify early potential sensitive biomarkers of copper (Cu) (as copper chloride dihydrate), cadmium (Cd) (as cadmium acetate), lead (Pb) (as lead nitrate) and chromium (Cr) (as potassium dichromate) exposure in adult zebrafish, focusing on reactive oxygen species (ROS), SOD activity, lipid peroxidation and gene expression related to oxidative stress and inflammatory response. Furthermore, the survival rate decreased apparently by a concentration-dependent manner after Cu, Cr, Cd and Pb exposure, and we selected non-lethal concentrations 0.05 mg/L for Cu, 15 mg/L for Cr, 3 mg/L for Cd and 93.75μg/L for Pb to test the effect on the following biological indicators. Under non-lethal concentration, the four heavy metals have no apparent histological change in adult zebrafish gills. Similar trends in ROS production, MDA level and SOD activity were up-regulated by the four heavy metals, while MDA level responded more sensitive to Pb by time-dependent manner than the other three heavy metals. In addition, mRNA levels related to antioxidant system (SOD1, SOD2 and Nrf2) were up-regulated by non-lethal concentration Cu, Cr, Cd and Pb exposure. MDA level and SOD1 gene have a more delayed response to heavy metals. Genes related to immunotoxicity were increased significantly after heavy metals exposure at non-lethal concentrations. TNF-α and IL-1β gene have similar sensibility to the four heavy metals, while IL-8 gene was more responsive to Cr, Cd and Pb exposure at 48 h groups and IFN-γ gene showed more sensitivity to Cu at 48 h groups than the other heavy metals. In conclusion, the present works have suggested that the IFN-γ gene may applied as early sensitive biomarker to identify Cu-induced toxicity, while MDA content and IL-8 gene may use as early sensitive biomarkers for evaluating the risk of Pb exposure. Moreover, IL-8 and IFN-γ gene were more responsive to heavy

Antifungal properties of silver nanoparticles against indoor mould growth.

PubMed

Ogar, Anna; Tylko, Grzegorz; Turnau, Katarzyna

2015-07-15

The presence of moulds in indoor environments causes serious diseases and acute or chronic toxicological syndromes. In order to inhibit or prevent the growth of microorganisms on building materials, the disruption of their vital processes or the reduction of reproduction is required. The development of novel techniques that impair the growth of microorganisms on building materials is usually based on silver nanoparticles (AgNPs). It makes them an alternative to other biocides. AgNPs have proven antibacterial activity and became promising in relation to fungi. The aim of the study was to assess growth and morphology of mycelia of typical indoor fungal species: Penicillium brevicompactum, Aspergillus fumigatus, Cladosporium cladosporoides, Chaetomium globosum and Stachybotrys chartarum as well as Mortierella alpina, cultured on agar media. The antifungal activity of AgNPs was also tested in relation to C. globosum and S. chartarum grown on the surface of gypsum drywall. It was found that the presence of AgNPs in concentrations of 30-200mg/l significantly decreased the growth of fungi. However, in the case of M. alpina, AgNPs stimulated its growth. Moreover, strong changes in moulds morphology and colour were observed after administration of AgNPs. Parameters of conidiophores/sporangiophores varied depending on mould region and changed significantly after treatment with AgNPs. The experiments have shown antifungal properties of AgNPs against common indoor mould species. Their application to building materials could effectively protect indoor environments from mould development. However, consideration must be given to the fact that the growth of some fungal strains might be stimulated by AgNPs. Copyright © 2015 Elsevier B.V. All rights reserved.

Associating Changes in the Immune System with Clinical Diseases for Interpretation in Risk Assessment

PubMed Central

Germolec, Dori R.; Luebke, Robert W.; Johnson, Victor J.

2016-01-01

This overview is an update of the unit originally published in 2004. While the basic tenants of immunotoxicity have not changed in the past 10 years, several publications have explored the application of immunotoxicological data to the risk assessment process. Therefore, the goal of this unit is still to highlight relationships between xenobiotic-induced immunosuppression and risk of clinical diseases progression. In immunotoxicology, this may require development of models to equate moderate changes in markers of immune functions to potential changes in incidence or severity of infectious diseases. For most xenobiotics, exposure levels and disease incidence data are rarely available and safe exposure levels must be estimated based on observations from experimental models or human biomarker studies. Thus, it is important to establish a scientifically sound framework that allows accurate and quantitative interpretation of experimental or biomarker data in the risk assessment process. PMID:26828330

The ascidian Styela plicata hemocytes as a potential biomarker of marine pollution: In vitro effects of seawater and organic mercury.

PubMed

Parrinello, D; Bellante, A; Parisi, M G; Sanfratello, M A; Indelicato, S; Piazzese, D; Cammarata, M

2017-02-01

Toxic metals, such as mercury, contribute substantially to anthropogenic pollution in many estuarine environments. Animals living in those environments, particularly invertebrate filter feeders like tunicates, can be used as bioindicators. In an attempt to identify cellular markers for revealing pollution, this study examined in vitro the effects of different concentrations of methyl mercury on Styela plicata hemocytes. The harvested hemocytes from S. plicata that were exposed to the metal had a significant mortality, cellular count and morphometric alterations. These findings provided evidence of MeHg immunotoxic effects on S. plicata, resulting in hemocyte death and morphological changes induced by cytoskeleton alterations. Thus, a morphometric cellular parameter, such as spreading ability, was used as a complementary method for differentiation between hemocytes treated with a marine solution (as a negative control) and hemocytes incubated with methylmercury and/or Sicilian seawater samples. Copyright © 2016 Elsevier Inc. All rights reserved.

Associating Changes in the Immune System with Clinical Diseases for Interpretation in Risk Assessment.

PubMed

DeWitt, Jamie C; Germolec, Dori R; Luebke, Robert W; Johnson, Victor J

2016-02-01

This overview is an update of the unit originally published in 2004. While the basic tenets of immunotoxicity have not changed in the past 10 years, several publications have explored the application of immunotoxicological data to the risk assessment process. Therefore, the goal of this unit is still to highlight relationships between xenobiotic-induced immunosuppression and risk of clinical diseases progression. In immunotoxicology, this may require development of models to equate moderate changes in markers of immune functions to potential changes in incidence or severity of infectious diseases. For most xenobiotics, exposure levels and disease incidence data are rarely available, and safe exposure levels must be estimated based on observations from experimental models or human biomarker studies. Thus, it is important to establish a scientifically sound framework that allows accurate and quantitative interpretation of experimental or biomarker data in the risk assessment process. Copyright © 2016 John Wiley & Sons, Inc.

77 FR 39962 - Difenzoquat; Proposed Data Call-in Order for Pesticide Tolerance

Federal Register 2010, 2011, 2012, 2013, 2014

2012-07-06

... wheat (40 CFR 180.369). Since there are currently no domestic registrations for difenzoquat, these...; residue data for wheat hay, wheat forage, and barley hay; and an immunotoxicity study. These data [[Page... Field Trials (860.1500)--(wheat hay, wheat forage, and barley hay) Rationale. EPA does not have crop...

Immunotoxicological Profile of Chloroform in Female B6c3f1 Mice When Administered In Drinking Water

EPA Science Inventory

Chloroform can be formed as a disinfection by-product during water chlorination, one of the primary modalities for purifying municipal water supplies for human consumption. The goal of this study was to characterize the immunotoxic effects of chloroform in female B6C3F1 mice when...

Investigation of microgravity effects on basic imune functions on the cellular level - The TRIPLELUX-B experiment

NASA Astrophysics Data System (ADS)

Unruh, Eckehardt; Hansen, Peter-Diedrich

Hemocytes are the primary defence of the Blue Mussel against invading microorganisms and foreign particles. The hemocytes of mussels as part of the immune system of invertebrates has not been studied so far in space. The choice of the phagocytes from invertebrates is justified by the claim to study the universal validity of innate immune responses. The hemocytes of mussels have a lot in common with macrophages of higher organisms. They are able to detect the presence of microorganisms and kill these microorganisms by phagocytosis. The phagocy-tosis related production of ROS will be stimulated with opsonised zymosan. The hemocytes will be stored frozen and reconstituted in-flight for the experiment. The signals of the im-muno cellular responses are translated into luminescence as a rapid optical reporter system. The primary aim of Triplelux B is to investigate under space flight conditions the effect of microgravity on the ability of isolated Blue Mussel hemocytes to perform phagocytosis. As a secondery objectiv, the results expected will allow to conclude whether the observed responses are caused by microgravity and/or radiation (change in permeability, endpoints in genotoxicity: DNA unwinding). The TRIPLELUX-B Experiment contributes to risk assessment concerning immunotoxicity under space flight conditions. The components of the fully automated AEC (Advanced Experimental Containment) will be demonstrated. The AEC of the TRIPLELUX-B experiment will contribute to a real time operational monitoring for immunotoxicity testing for earth. Blue mussels have been used repeatedly for monitoring imunotoxicity and genotoxicity in coastal waters. Based on the AEC an automatet measuring device will allow "real time monitoring" providing observations of immunotoxicity in coastal and inland waters.

Dietary n-3 PUFAs augment caspase 8 activation in Staphylococcal aureus enterotoxin B stimulated T-cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gill, R.

Epidemiological studies have linked consumption of n-3 PUFAs with a variety of beneficial health benefits, particularly with respect to putative anti-inflammatory effects. Unfortunately, many of these results remain somewhat controversial because in most instances there has not been a linkage to specific molecular mechanisms. For instance, dietary exposure to low levels of mercury has been shown to be damaging to neural development, but concomitant ingestion of n-3 PUFAs as occurs during consumption of fish, has been shown to counteract the detrimental effects. As the mechanisms mediating the neurotoxicity of environmental mercury are not fully delineated, it is difficult to conceptualizemore » a testable molecular mechanism explaining how n-3 PUFAs negate its neurotoxic effects. However, environmental exposure to mercury also has been linked to increased autoimmunity. By way of a molecular understanding of this immuno-toxic association, disruption of CD95 signaling is well established as a triggering factor for autoimmunity, and we have previously shown that environmentally relevant in vitro and dietary exposures to mercury interfere with CD95 signaling. In particular we have shown that activation of caspase 8, as well as downstream activation of caspase 3, in response to CD95 agonist stimulation is depressed by mercury. More recently we have shown in vitro that the n-3 PUFA docosahexaenoic acid counteracts the negative effect of mercury on CD95 signaling by restoring caspase activity. We hypothesized that concomitant ingestion of n-3 PUFAs with mercury might be protective from the immuno-toxic effects of mercury, as it is with mercury's neuro-toxic effects, and in the case of immuno-toxicity this would be related to restoration of CD95 signal strength. We now show that dietary ingestion of n-3 PUFAs generally promotes CD95 signaling by upregulating caspase 8 activation. Apart from accounting for the ability of n-3 PUFAs to specifically counteract autoimmune

Use of the local lymph node assay in assessment of immune function.

PubMed

van den Berg, Femke A; Baken, Kirsten A; Vermeulen, Jolanda P; Gremmer, Eric R; van Steeg, Harry; van Loveren, Henk

2005-07-01

The murine local lymph node assay (LLNA) was originally developed as a predictive test method for the identification of chemicals with sensitizing potential. In this study we demonstrated that an adapted LLNA can also be used as an immune function assay by studying the effects of orally administered immunomodulating compounds on the T-cell-dependent immune response induced by the contact sensitizer 2,4-dinitrochlorobenzene (DNCB). C57Bl/6 mice were treated with the immunotoxic compounds cyclosporin A (CsA), bis(tri-n-butyltin)oxide (TBTO) or benzo[a]pyrene, (B[a]P). Subsequently, cell proliferation and interferon-gamma (IFN-gamma) and interleukin (IL)-4 release were determined in the auricular lymph nodes (LNs) after DNCB application on both ears. Immunosuppression induced by CsA, TBTO and B[a]P was clearly detectable in this application of the LLNA. Cytokine release measurements proved valuable to confirm the results of the cell proliferation assay and to obtain an indication of the effect on Th1/Th2 balance. We believe to have demonstrated the applicability of an adapted LLNA as an immune function assay in the mouse.

IMMUNOTOXICOLOGIC ASSESSMENT OF SUBACUTE EXPOSURE OF RATS TO CARBON TETRACHLORIDE WITH COMPARISON TO HEPATOXICITY AND NEPHROTOXICITY

EPA Science Inventory

The immunotoxicity, hepatoxicity and nephrotoxicity of subacute exposure to carbon tetrachloride (CCl4) was evaluated In young adult (8-9 week old) male Fischer 344 rats, dosed by gavage with CCl4 for ten consecutive days at 0, 5, 10, 20 or 40 mg/kg/day. wo days following the las...

78 FR 57289 - Difenzoquat; Denial of Objections

Federal Register 2010, 2011, 2012, 2013, 2014

2013-09-18

...) of FFDCA requires that a data call-in order contain the following elements: i. A requirement that one... Call-In Order and statutory obligations, the final Data Call-In Order included the following elements... Immunotoxicity. EPA 712-C-98-351. Available at http://www.regulations.gov . 10. EPA. Residue Chemistry Test...

Potential of the volatile-producing fungus Muscodor albus for control of building molds.

PubMed

Mercier, Julien; Jiménez, Jorge I

2007-03-01

The possibility of using the volatile-producing fungus Muscodor albus for biofumigation against building molds was investigated. Several species of Aspergillus and Penicillium as well as fungi belonging to nine other genera were inhibited or killed in vitro by volatiles produced by potato dextrose agar or rye grain cultures of M. albus. Trichoderma viride was the only fungus that was not inhibited by M. albus volatiles. To test biofumigation as a preventative treatment against fungal colonization of building material, dry pieces of gypsum drywall were fumigated with grain cultures of M. albus in closed boxes. After a simulated water damage and incubation under saturated humidity for 2 weeks, untreated drywall developed natural fungal populations of about 10(5)-10(6) cfu/cm2, while drywall fumigated with M. albus culture (20 g/11 L) had nondetectable fungal populations. To test for curative ability, moist pieces of drywall heavily colonized with Cladosporium cladosporioides, Aspergillus niger, or Stachybotrys chartarum were fumigated for 48 h with grain cultures of M. albus. Cladosporium cladosporioides was eliminated within 48 h, while A. niger and S. chartarum were usually more resistant. However, a longer curative fumigation of 96 h was effective in reducing A. niger or naturally occurring mold populations by about 5 log values. The production of volatile organic compounds from 20 g of rye grain culture in 11 L containers was monitored by solid-phase micro extraction and gas chromatography. Concentrations of isobutyric acid, the most abundant volatile, increased gradually in the headspace until it reached 25 microg/L (m/v) within 96 h. The second and third most abundant compounds, 2-methyl-1-butanol and isobutanol, peaked at about 10 and 5 microg/L (m/v), respectively, within the first 24 h and declined gradually afterwards.

Relationship between size and surface modification of silica particles and enhancement and suppression of inflammatory cytokine production by lipopolysaccharide- or peptidoglycan-stimulated RAW264.7 macrophages

NASA Astrophysics Data System (ADS)

Uemura, Eiichiro; Yoshioka, Yasuo; Hirai, Toshiro; Handa, Takayuki; Nagano, Kazuya; Higashisaka, Kazuma; Tsutsumi, Yasuo

2016-06-01

Although nanomaterials are used in an increasing number of commodities, the relationships between their immunotoxicity and physicochemical properties such as size or surface characteristics are not fully understood. Here we demonstrated that pretreatment with amorphous silica particles (SPs) of various sizes (diameters of 10-1000 nm), with or without amine surface modification, significantly decreased interleukin 6 production by RAW264.7 macrophages following lipopolysaccharide or peptidoglycan stimulation. Furthermore, nanosized, but not microsized, SPs significantly enhanced tumor necrosis factor-α production in macrophages stimulated with lipopolysaccharide. This altered cytokine response was distinct from the inflammatory responses induced by treatment with the SPs alone. Additionally, the uptake of SPs into macrophages by phagocytosis was found to be crucial for the suppression of macrophage immune response to occur, irrespective of particle size or surface modification. Together, these results suggest that SPs may not only increase susceptibility to microbial infection, but that they may also be potentially effective immunosuppressants.

Physiological effects of brominated flame retardants on NC/Nga mice.

PubMed

Tanaka, Michitaka; Inoue, Ken-Ichiro; Shimada, Akinori; Takano, Hirohisa

2018-02-01

Brominated flame retardants (BFRs) are used as an additive or reactive components in various materials. Regarding their health concerns, their immunotoxicity have not been clarified yet. In the current study, we examined the effects of systemic exposure to two types of BFRs, DE71 and DE79, on pathophysiologic traits of murine atopic dermatitis (AD). Male NC/Nga mice were repeatedly injected intraperitoneally with DE71 and DE79 and/or mite allergen (Dermatophagoides pteronyssinus: Dp) into their right ears. Thereafter, clinical scores, macroscopic findings of inflammatory foci, and Ig values in serum were examined. Both DEs significantly aggravated clinical scores induced by mite allergen including skin dryness and edema. Total IgE titer was significantly greater in the Dp + DE79 group than in the Dp group. Taken together, exposure to BFRs can exacerbate AD-like skin lesions related to mite allergen in mice. The accentuating effects may be mediated, at least in part, through hyperproduction of IgE.

The humoral immune response of mice exposed to simulated road paving-like asphalt fumes.

PubMed

Anderson, Stacey E; Munson, Albert E; Tomblyn, Seth; Meade, B Jean; Diotte, Nicole M

2008-07-01

Asphalt is a complex mixture of organic molecules, including polycyclic aromatic hydrocarbons (PAH), which have been reported to cause serious adverse health effects in humans. Workers in manufacturing and construction trades exposed to asphalt are potentially at risk for being exposed to asphalt fumes and PAHs. Epidemiological investigations have collected mounting evidence that chemicals found in asphalt fumes present carcinogenic and possibly immunotoxic hazards. Studies evaluating the immunotoxic effects of asphalt fume are limited due to the large number of variables associated with asphalt fume exposures. This work investigates the immuno-toxic effects of road paving-like asphalt fume by analyzing the in vivo IgM response to a T-dependent antigen after exposure to whole, vapor, and particulate phase road paving-like asphalt fumes and asphalt fume condensate. Systemic exposures via intraperitoneal injection of asphalt fume condensate (at 0.625 mg/kg) and the particulate phase (at 5 mg/kg) resulted in significant reductions in the specific spleen IgM response to SRBC. Pharyngeal aspiration of the asphalt fume condensate (at 5 mg/kg) also resulted in significant suppression of the IgM response to SRBC. A significant reduction in the specific spleen IgM activity was observed after inhalation exposure to whole asphalt fumes (35 mg/m(3)) and the vapor components (11 mg/m(3)). Dermal exposures to the asphalt fume condensate resulted in significant reductions in the total (at 50 mg/kg) and specific (at 250 mg/kg) spleen IgM response to SRBC. These results demonstrate that exposure to road paving-like asphalt fumes is immunosuppressive through systemic, respiratory, and dermal routes of exposure in a murine model and raise concerns regarding the potential for adverse immunological effects.

Molecular and Immunological Characterization of Gluten Proteins Isolated from Oat Cultivars That Differ in Toxicity for Celiac Disease

PubMed Central

Real, Ana; Comino, Isabel; de Lorenzo, Laura; Merchán, Francisco; Gil-Humanes, Javier; Giménez, María J.; López-Casado, Miguel Ángel; Cebolla, Ángel; Sousa, Carolina; Barro, Francisco; Pistón, Fernando

2012-01-01

A strict gluten-free diet (GFD) is the only currently available therapeutic treatment for patients with celiac disease (CD). Traditionally, treatment with a GFD has excluded wheat, barley and rye, while the presence of oats is a subject of debate. The most-recent research indicates that some cultivars of oats can be a safe part of a GFD. In order to elucidate the toxicity of the prolamins from oat varieties with low, medium, and high CD toxicity, the avenin genes of these varieties were cloned and sequenced, and their expression quantified throughout the grain development. At the protein level, we have accomplished an exhaustive characterization and quantification of avenins by RP-HPLC and an analysis of immunogenicity of peptides present in prolamins of different oat cultivars. Avenin sequences were classified into three different groups, which have homology with S-rich prolamins of Triticeae. Avenin proteins presented a lower proline content than that of wheat gliadin; this may contribute to the low toxicity shown by oat avenins. The expression of avenin genes throughout the development stages has shown a pattern similar to that of prolamins of wheat and barley. RP-HPLC chromatograms showed protein peaks in the alcohol-soluble and reduced-soluble fractions. Therefore, oat grains had both monomeric and polymeric avenins, termed in this paper gliadin- and glutenin-like avenins. We found a direct correlation between the immunogenicity of the different oat varieties and the presence of the specific peptides with a higher/lower potential immunotoxicity. The specific peptides from the oat variety with the highest toxicity have shown a higher potential immunotoxicity. These results suggest that there is wide range of variation of potential immunotoxicity of oat cultivars that could be due to differences in the degree of immunogenicity in their sequences. PMID:23284616

Nanoamplifiers synthesized from gadolinium and gold nanocomposites for magnetic resonance imaging

NASA Astrophysics Data System (ADS)

Tian, Xiumei; Shao, Yuanzhi; He, Haoqiang; Liu, Huan; Shen, Yingying; Huang, Wenlin; Li, Li

2013-03-01

We have synthesized an efficient and highly sensitive nanoamplifier composed of gadolinium-doped silica nanoparticles and gold nanoparticles (AuNPs). Magnetic resonance imaging (MRI) in vitro and in vivo assays revealed enhancement of signal sensitivity, which may be explained by electron transfer between water and gadolinium-doped nanoparticles, apparent in the presence of gold. In vitro and in vivo evaluation demonstrated nanoamplifier incurred minimal cytotoxicity and immunotoxicity, increased stability, and gradual excretion patterns. Tumor targeted properties were preliminarily determined when the nanoamplifier was injected into mouse models of colon cancer liver metastasis. Furthermore, although AuNPs departed from the nanoamplifiers in specific mice tissues, optical and magnetic resonance imaging was efficient, especially in metastatic tumors. These assays validate our nanoamplifier as an effective MRI signal enhancer with sensitive cancer diagnosis potential.We have synthesized an efficient and highly sensitive nanoamplifier composed of gadolinium-doped silica nanoparticles and gold nanoparticles (AuNPs). Magnetic resonance imaging (MRI) in vitro and in vivo assays revealed enhancement of signal sensitivity, which may be explained by electron transfer between water and gadolinium-doped nanoparticles, apparent in the presence of gold. In vitro and in vivo evaluation demonstrated nanoamplifier incurred minimal cytotoxicity and immunotoxicity, increased stability, and gradual excretion patterns. Tumor targeted properties were preliminarily determined when the nanoamplifier was injected into mouse models of colon cancer liver metastasis. Furthermore, although AuNPs departed from the nanoamplifiers in specific mice tissues, optical and magnetic resonance imaging was efficient, especially in metastatic tumors. These assays validate our nanoamplifier as an effective MRI signal enhancer with sensitive cancer diagnosis potential. Electronic supplementary information

Sarin (GB, O-isopropyl methylphosphonofluoridate) neurotoxicity: critical review

PubMed Central

Abou-Donia, Mohamed B.; Siracuse, Briana; Gupta, Natasha; Sokol, Ashly Sobel

2017-01-01

Sarin (GB, O-isopropyl methylphosphonofluoridate) is a potent organophosphorus (OP) nerve agent that inhibits acetylcholinesterase (AChE) irreversibly. The subsequent build-up of acetylcholine (ACh) in the central nervous system (CNS) provokes seizures and, at sufficient doses, centrally-mediated respiratory arrest. Accumulation of ACh at peripheral autonomic synapses leads to peripheral signs of intoxication and overstimulation of the muscarinic and nicotinic receptors, which is described as “cholinergic crisis” (i.e. diarrhea, sweating, salivation, miosis, bronchoconstriction). Exposure to high doses of sarin can result in tremors, seizures, and hypothermia. More seriously, build-up of ACh at neuromuscular junctions also can cause paralysis and ultimately peripherally-mediated respiratory arrest which can lead to death via respiratory failure. In addition to its primary action on the cholinergic system, sarin possesses other indirect effects. These involve the activation of several neurotransmitters including gamma-amino-butyric acid (GABA) and the alteration of other signaling systems such as ion channels, cell adhesion molecules, and inflammatory regulators. Sarin exposure is associated with symptoms of organophosphate-induced delayed neurotoxicity (OPIDN) and organophosphate-induced chronic neurotoxicity (OPICN). Moreover, sarin has been involved in toxic and immunotoxic effects as well as organophosphate-induced endocrine disruption (OPIED). The standard treatment for sarin-like nerve agent exposure is post-exposure injection of atropine, a muscarinic receptor antagonist, accompanied by an oxime, an AChE reactivator, and diazepam. PMID:27705071

Perfluorinated Compounds: Emerging POPs with Potential Immunotoxicity

EPA Science Inventory

Perfluorinated compounds (PFCs) have been recognized as an important class of environmental contaminants commonly detected in blood samples of both wildlife and humans. These compounds have been in use for more than 60 years as surface treatment chemicals, polymerization aids, an...

Immune System Toxicity and Immunotoxicity Hazard Identification

EPA Science Inventory

Exposure to chemicals may alter immune system health, increasing the risk of infections, allergy and autoimmune diseases. The chapter provides a concise overview of the immune system, host factors that affect immune system heal, and the effects that xenobiotic exposure may have ...

Induced rotational motion with nonabutting inducing and induced stimuli: implications regarding two forms of induced motion.

PubMed

Reinhardt-Rutland, A H

2003-07-01

Induced motion is the illusory motion of a static stimulus in the opposite direction to a moving stimulus. Two types of induced motion have been distinguished: (a) when the moving stimulus is distant from the static stimulus and undergoes overall displacement, and (b) when the moving stimulus is pattern viewed within fixed boundaries that abut the static stimulus. Explanations of the 1st type of induced motion refer to mediating phenomena, such as vection, whereas the 2nd type is attributed to local processing by motion-sensitive neurons. The present research was directed to a display that elicited induced rotational motion with the characteristics of both types of induced motion: the moving stimulus lay within fixed boundaries, but the inducing and induced stimuli were distant from each other. The author investigated the properties that distinguished the two types of induced motion. In 3 experiments, induced motion persisted indefinitely, interocular transfer of the aftereffect of induced motion was limited to about 20%, and the time-course of the aftereffect of induced motion could not be attributed to vection. Those results were consistent with fixed-boundary induced motion. However, they could not be explained by local processing. Instead, the results might reflect the detection of object motion within a complex flow-field that resulted from the observer's motion.

Concurrent administration effect of antibiotic and anti-inflammatory drugs on the immunotoxicity of bacterial endotoxins.

PubMed

El Amir, Azza M; Tanious, Dalia G; Mansour, Hanaa A

2017-11-01

Pseudomonas aeruginosa (P. aeruginosa) is a gram-negative bacterium that causes a variety of diseases in compromised hosts. Bacterial endotoxins such as lipopolysaccharide (LPS) are the major outer surface membrane components that are present in almost all gram-negative bacteria and act as extremely strong stimulators of innate immunity and inflammation of the airway. This study was undertaken to determine the effect of combined administration of Gentamicin (GENT) as an antibiotic and Dexamethasone (DEXA) as an anti-inflammatory drug on some immunological and histological parameters. After determination of LD 50 of P. aeruginosa, mice groups were injected with DEXA, GENT and lipopolysaccharide alone or in combination. Lipopolysaccharide single injection caused a significant increase of total leukocyte count, lymphocytes, neutrophils and levels of IgM and IgG. DEXA induced an increase of neutrophilia and lymphopenia. Immunological examination demonstrated that combined treatment has a significant effect of decreasing lymphocytes and IgG levels than single treatment does. Histological examination demonstrated that the inflammation of thymus, spleen, lymph node and liver decreases in mice that received combined treatment than those that received individual treatment. Concurrent administration of DEXA and GENT has a great effect on protecting organs against damage in case of endotoxemia. Copyright © 2017 Elsevier B.V. All rights reserved.

The immunological effects of oil sands surface waters and naphthenic acids on rainbow trout (Oncorhynchus mykiss).

PubMed

Leclair, Liane A; MacDonald, Gillian Z; Phalen, Laura J; Köllner, Bernd; Hogan, Natacha S; van den Heuvel, Michael R

2013-10-15

There is concern surrounding the immunotoxic potential of naphthenic acids (NAs), a major organic constituent in waters influenced by oil sands contamination. To assess the immunological response to NAs, rainbow trout (Oncorhynchus mykiss) waterborne exposures were conducted with oil sands-influenced waters, NAs extracted and purified from oil sands tailings waters, and benzo[a]pyrene (BaP) as a positive control. After a 7d exposure, blood, spleen, head kidney, and gill samples were removed from a subset of fish in order to evaluate the distribution of thrombocytes, B-lymphocytes, myeloid cells, and T-lymphocytes using fluorescent antibodies specific for those cell types coupled with flow cytometry. The remaining trout in each experimental tank were injected with inactivated Aeromonas salmonicida and held in laboratory water for 21 d and subjected to similar lymphatic cell evaluation in addition to evaluation of antibody production. Fluorescent metabolites in bile as well as liver CYP1A induction were also determined after the 7 and 21 d exposure. Oil sands waters and extracted NAs exposures resulted in an increase in bile fluorescence at phenanthrene wavelengths, though liver CYP1A was not induced in those treatments as it was with the BaP positive control. Trout in the oil sands-influenced water exposure showed a decrease in B- and T-lymphocytes in blood as well as B-lymphocytes and myeloid cells in spleen and an increase in B-lymphocytes in head kidney. The extracted NAs exposure showed a decrease in thrombocytes in spleen at 8 mg/L and an increase in T-lymphocytes at 1mg/L in head kidney after 7d. There was a significant decrease in antibody production against A. salmonicida in both oil sands-influenced water exposures. Because oil sands-influenced waters affected multiple immune parameters, while extracted NAs impacts were limited, the NAs tested here are likely not the cause of immunotoxicity found in the oil sands-influenced water. Copyright © 2013 Elsevier

TESTING ANTIMICROBIAL CLEANER EFFICACY ON GYPSUM WALLBOARD CONTAMINATED WITH STACHYBOTRYS CHARTARUM

EPA Science Inventory

Reducing occupant exposure to indoor mold growth is the goal of this research, through the efficacy testing of antimicrobial cleaners. Often mold contaminated building materials are not properly removed, but instead surface cleaners are applied in an attempt to alleviate the prob...

TESTING ANTIMICROBIAL PAINT EFFICACY ON GYPSUM WALLBOARD CONTAMINATED WITH STACHYBOTRYS CHARTARUM

EPA Science Inventory

Often mold contaminated building materials are not properly removed, some surface cleaning is performed and paint is applied in an attempt to alleviate the problem. The efficacy of antimicrobial paints to eliminate or control mold regrowth on surfaces can easily be tested on non-...

A synthetic cannabinoid JWH-210 reduces lymphoid organ weights and T-cell activator levels in mice via CB2 receptors.

PubMed

Gu, Sun Mi; Lee, Hyun Jin; Lee, Tac-Hyung; Song, Yun Jeong; Kim, Young-Hoon; Han, Kyoung-Moon; Shin, Jisoon; Park, Hye-Kyung; Kim, Hyung Soo; Cha, Hye Jin; Yun, Jaesuk

2017-12-01

The problem of new psychoactive substances (NPS) is emerging globally. However, the immunotoxicity of synthetic cannabinoids is not evaluated extensively yet. The purpose of the present study was to investigate whether synthetic cannabinoids (JWH-210 and JWH-030) induce adverse effects on lymphoid organs, viability of splenocytes and thymocytes, and immune cell activator and cytokines in mice. JWH-210 (10 mg/kg, 3 days, i.p.) is more likely to have cytotoxicity and reduce lymphoid organ weight than JWH-030 of ICR mice in vivo. We also demonstrated that JWH-210 administration resulted in the decrease of expression levels of T-cell activator including Cd3e, Cd3g, Cd74p31, and Cd74p41, while JWH-030 increased Cd3g levels. In addition, JWH-210 reduced expression levels of cytokines, such as interleukin-3, interleukin-5, and interleukin-6. Furthermore, we demonstrated that a CB 2 receptor antagonist, AM630 inhibited JWH-210-induced cytotoxicity, whereas a CB 1 receptor antagonist, rimonabant did not in primary cultured splenocytes. These results suggest that JWH-210 has a cytotoxicity via CB 2 receptor action and results in decrement of lymphoid organ weights, T-cell activator, and cytokine mRNA expression levels.

Immune competence assessment in marine medaka (Orzyias melastigma)-a holistic approach for immunotoxicology.

PubMed

Ye, Roy R; Peterson, Drew R; Seemann, Frauke; Kitamura, Shin-Ichi; Lee, J S; Lau, Terrance C K; Tsui, Stephen K W; Au, Doris W T

2017-12-01

Many anthropogenic pollutants in coastal marine environments can induce immune impairments in wild fish and reduce their survival fitness. There is a pressing need to establish sensitive and high throughput in vivo tools to systematically evaluate the immunosuppressive effects of contaminants in marine teleosts. This study reviewed a battery of in vivo immune function detection technologies established for different biological hierarchies at molecular (immune function pathways and genes by next generation sequencing (NGS)), cellular (leukocytes profiles by flow cytometry), tissues/organ system (whole adult histo-array), and organism (host resistance assays (HRAs)) levels, to assess the immune competence of marine medaka Oryzias melastigma. This approach enables a holistic assessment of fish immune competence under different chemical exposure or environmental scenarios. The data obtained will also be useful to unravel the underlying immunotoxic mechanisms. Intriguingly, NGS analysis of hepatic immune gene expression profiles (male > female) are in support of the bacterial HRA findings, in which infection-induced mortality was consistently higher in females than in males. As such, reproductive stages and gender-specific responses must be taken into consideration when assessing the risk of immunotoxicants in the aquatic environment. The distinct phenotypic sexual dimorphism and short generation time (3 months) of marine medaka offer additional advantages for sex-related immunotoxicological investigation.

Immune effects of nickel.

PubMed

Salsano, F; Francia, C; Roumpedaki, I; Proietti, M; Pisarri, S; Verna, N; Gabriele, E; Di Gioacchino, G; Di Gioacchino, M

2004-01-01

Data on nickel immunomodulation are contradictory. The most consistent immune effects are suppression of immune responses. It has been shown that T-lymphocytes and NK cells are more susceptible to nickel toxicity than are B lymphocytes or macrophages. Data reported about cytokine production in human and nickel reactive T-cell clones are also conflicting. Some authors studied showed a higher synthesis of IL4, IL5 and IL13 but not of IFN gamma and TNFalpha in Ni allergic subjects. We found that the addiction on NiSo4 to the PBMC cultures of non sensitised subjects induces a reduction of release of IL5, IFN gamma and TNFalpha. Our studies demonstrate a clear difference in the NK cell activity between nickel-tolerant and intolerant individuals. In particular NK cell activity in reduced in sensitised patients respect to the normal subjects and the addition of Ni has immunotoxic potential. Researches are in progress in an Attempt to correlate the present data with other immune parameters and to measure the effects of a Ni Free diet on the immune system of subjects with Ni intolerance. The comprehension of the mechanisms inducing these changes requires further studies in the uptake and intracellular distribution and binding of the metal.

Human Health Safety Evaluation of Halon Replacement Candidates

DTIC Science & Technology

2000-05-01

neurotoxicity, developmental neurotoxicity, immunotoxicity, and endocrine disruptor tests may be considered if there is reason to suspect alterations in...conclusion of the study), gross necropsy, and select organ weight measurements (e.g., liver, lungs, kidneys, adrenals, testes, brain) "* Preserve ...and evaluated in the study. The biological endpoints of a 90-day study include daily clinical observations; measurements of body weight, food

Strategy for selecting nanotechnology carriers to overcome immunological and hematological toxicities challenging clinical translation of nucleic acid-based therapeutics.

PubMed

Dobrovolskaia, Marina A; McNeil, Scott E

2015-07-01

Clinical translation of nucleic acid-based therapeutics (NATs) is hampered by assorted challenges in immunotoxicity, hematotoxicity, pharmacokinetics, toxicology and formulation. Nanotechnology-based platforms are being considered to help address some of these challenges due to the nanoparticles' ability to change drug biodistribution, stability, circulation half-life, route of administration and dosage. Addressing toxicology and pharmacology concerns by various means including NATs reformulation using nanotechnology-based carriers has been reviewed before. However, little attention was given to the immunological and hematological issues associated with nanotechnology reformulation. This review focuses on application of nanotechnology carriers for delivery of various types of NATs, and how reformulation using nanoparticles affects immunological and hematological toxicities of this promising class of therapeutic agents. NATs share several immunological and hematological toxicities with common nanotechnology carriers. In order to avoid synergy or exaggeration of undesirable immunological and hematological effects of NATs by a nanocarrier, it is critical to consider the immunological compatibility of the nanotechnology platform and its components. Since receptors sensing nucleic acids are located essentially in all cellular compartments, a strategy for developing a nanoformulation with reduced immunotoxicity should first focus on precise delivery to the target site/cells and then on optimizing intracellular distribution.

The risk assessment of Gd2O3:Yb3+/Er3+ nanocomposites as dual-modal nanoprobes for magnetic and fluorescence imaging

NASA Astrophysics Data System (ADS)

Huang, Long; Tian, Xiumei; Liu, Jun; Zheng, Cunjing; Xie, Fukang; Li, Li

2017-02-01

Our group has synthesized Gd2O3:Yb3+/Er3+ nanocomposites as magnetic/fluorescence imaging successfully in the previous study, which exhibit good uniformity and monodispersibility with a mean size of 7.4 nm. However, their systematic risk assessment remains unknown. In this article, the in vitro biocompatibility of the Gd2O3:Yb3+/Er3+ was assessed on the basis of cell viability and apoptosis. In vivo immunotoxicity was evaluated by monitoring the product of reactive oxygen species (ROS), clusters of differentiation (CD) markers, and superoxide dismutase (SOD) in Balb/c mice. No significant differences were found in cell viability, apoptosis, and immunotoxicity between our Gd2O3:Yb3+/Er3+ and gadodiamide which are used commonly in clinical. Few nanoprobes were localized in the phagosomes of the liver, heart, lung, spleen, kidney, brain, and tumor under the transmission electron microscopy (TEM) images. In addition, our products reveal good T1-weighted contrast enhancement of xenografted murine tumor. Therefore, the above results may contribute to the effective application of Gd2O3:Yb3+/Er3+ as molecular imaging contrast agents and dual-modal nanoprobes for cancer detection.

Occupational Exposure to Trichloroethylene and Serum Concentrations of IL-6, IL-10, and TNF-alpha

PubMed Central

Bassig, Bryan A.; Zhang, Luoping; Tang, Xiaojiang; Vermeulen, Roel; Shen, Min; Smith, Martyn T.; Qiu, Chuangyi; Ge, Yichen; Ji, Zhiying; Reiss, Boris; Hosgood, H. Dean; Liu, Songwang; Bagni, Rachel; Guo, Weihong; Purdue, Mark; Hu, Wei; Yue, Fei; Li, Laiyu; Huang, Hanlin; Rothman, Nathaniel; Lan, Qing

2015-01-01

To evaluate the immunotoxicity of trichloroethylene (TCE), we conducted a cross-sectional molecular epidemiology study in China of workers exposed to TCE. We measured serum levels of IL-6, IL-10, and TNF-α, which play a critical role in regulating various components of the immune system, in 71 exposed workers and 78 unexposed control workers. Repeated personal exposure measurements were taken in workers before blood collection using 3 M organic vapor monitoring badges. Compared to unexposed workers, the serum concentration of IL-10 in workers exposed to TCE was decreased by 70% (P = 0.001) after adjusting for potential confounders. Further, the magnitude of decline in IL-10 was >60% and statistically significant in workers exposed to <12 ppm as well as in workers with exposures ≥ 12 ppm of TCE, compared to unexposed workers. No significant differences in levels of IL-6 or TNF-α were observed among workers exposed to TCE compared to unexposed controls. Given that IL-10 plays an important role in immunologic processes, including mediating the Th1/Th2 balance, our findings provide additional evidence that TCE is immunotoxic in humans. PMID:23798002

Immune functions in the Fisher rat fed beluga whale (Delphinapterus leucas) blubber from the contaminated St. Lawrence estuary

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lapierre, P.; Guise, S. De; Muir, D.C.G.

1999-02-01

In order to assess the immunotoxic potential of food naturally contaminated with PCBs and other organohalogens, Fisher rats were fed a diet in which the lipids originated from the blubber of either a highly polluted St. Lawrence beluga or a relatively uncontaminated Arctic beluga. After a period of 2 months, different immune functions were evaluated, including lymphoblastic transformation, natural killer cell activity, plaque-forming cells, phagocytosis, oxidative burst, and immunophenotyping. For all assays, rats fed at St. Lawrence beluga blubber diet or a mixture of Arctic and St. Lawrence beluga blubber diet were not different from control rats fed a dietmore » containing Arctic beluga blubber. These results are inconsistent with the well-known immunosuppressive effects of organochlorines in numerous species and with the lesions suggestive of organochlorine-related immunosuppression that are observed in St. Lawrence belugas. The lack of observable immunotoxic effects in rats fed contaminated beluga blubber might be explained by antagonistic effects in the organohalogen mixture, by a response specific to the rat, by a strain-related lack of sensitivity to organochlorines, or by insufficient dose due to the shortness of the exposure period or the route of exposure.« less

Problems and challenges in the development and validation of human cell-based assays to determine nanoparticle-induced immunomodulatory effects

PubMed Central

2011-01-01

Background With the increasing use of nanomaterials, the need for methods and assays to examine their immunosafety is becoming urgent, in particular for nanomaterials that are deliberately administered to human subjects (as in the case of nanomedicines). To obtain reliable results, standardised in vitro immunotoxicological tests should be used to determine the effects of engineered nanoparticles on human immune responses. However, before assays can be standardised, it is important that suitable methods are established and validated. Results In a collaborative work between European laboratories, existing immunological and toxicological in vitro assays were tested and compared for their suitability to test effects of nanoparticles on immune responses. The prototypical nanoparticles used were metal (oxide) particles, either custom-generated by wet synthesis or commercially available as powders. Several problems and challenges were encountered during assay validation, ranging from particle agglomeration in biological media and optical interference with assay systems, to chemical immunotoxicity of solvents and contamination with endotoxin. Conclusion The problems that were encountered in the immunological assay systems used in this study, such as chemical or endotoxin contamination and optical interference caused by the dense material, significantly affected the data obtained. These problems have to be solved to enable the development of reliable assays for the assessment of nano-immunosafety. PMID:21306632

Modulation of Immune Response by Organophosphorus Pesticides: Fishes as a Potential Model in Immunotoxicology

PubMed Central

Díaz-Resendiz, K. J. G.; Toledo-Ibarra, G. A.; Girón-Pérez, M. I.

2015-01-01

Immune response is modulated by different substances that are present in the environment. Nevertheless, some of these may cause an immunotoxic effect. In this paper, the effect of organophosphorus pesticides (frequent substances spilled in aquatic ecosystems) on the immune system of fishes and in immunotoxicology is reviewed. Furthermore, some cellular and molecular mechanisms that might be involved in immunoregulation mechanisms of organophosphorus pesticides are discussed. PMID:25973431

Validation of the Candida albicans delayed-type hypersensitivity (DTH) model in the female B₆C₃F₁ mouse for use in immunotoxicological investigations.

PubMed

White, Kimber L; McLoughlin, Colleen E; Auttachoat, Wimolnut; Smith, Matthew J

2012-01-01

Although numerous models are used to evaluate the immunotoxic effects of xenobiotics on cell-mediated immunity (CMI), no holistic model for evaluating such effects on the delayed-type hypersensitivity (DTH) response has gained widespread acceptance. Due to a lack of interference from antigen-specific antibody production, the Candida albicans DTH model has recently been demonstrated to be a more appropriate model for assessing effects on CMI than other DTH models that utilize different sensitizing antigens, such as sheep erythrocytes (SRBC) or keyhole limpet hemocyanin (KLH). The present studies were conducted to validate the C. albicans DTH model for its ability to detect suppression (or the lack thereof) of CMI following exposure for 28 days to well-characterized immunosuppressive drugs, each having a different mechanism of action. The compounds evaluated included azathioprine (AZA), cyclophosphamide (CPS), cyclosporin A (CSA), dexamethasone (DEX), and the non-immunotoxic compound, benzo[e]pyrene (B[e]P). Exposure to each of the four known immunotoxicants resulted in statistically significant decreases in the DTH response to C. albicans. Footpad swelling was decreased following exposure to AZA at ≥ 20 mg/kg but not at 10 mg/kg, CPS at ≥ 10 mg/kg but not at 5 mg/kg, CSA at ≥ 3 mg/kg but not at 1 mg/kg, or DEX at ≥ 0.3 mg/kg (intermittently at 0.1 mg/kg) but not at 0.03 mg/kg. As expected, exposure to B[e]P for 28 days at doses up to 40 mg/kg had no effect on the DTH response. These results demonstrated that the C. albicans DTH assay in the B₆C₃F₁ mouse was capable of appropriately classifying each test article as to its immunotoxic effects on CMI. Furthermore, comparisons of these results with previous reports of effects on ex vivo CMI end points suggest that this DTH assay may be more sensitive than standard ex vivo assays at detecting immunosuppressive effects.

Immunotoxicity of gallium arsenide on antigen presentation: comparative study of intratracheal and intraperitoneal exposure routes.

PubMed

Hartmann, Constance B; Harrison, M Travis; McCoy, Kathleen L

2005-01-01

Gallium arsenide (GaAs) is a semiconductor utilized in electronics and computer industries. GaAs exposure of animals causes local inflammation and systemic immune suppression. Mice were administered 2 to 200 mg/kg GaAs. On day 5, intratracheal instillation increased lung weights in a dose-dependent manner and induced pulmonary inflammation exemplified by mononuclear cell infiltration and mild epithelial hyperplasia. No fibrosis, pneumocyte hyperplasia, proteinosis, or bronchial epithelial damage was observed in the lungs. Splenic cellularity and composition were unaffected. GaAs' effect on antigen presentation by macrophages was similar after intratracheal and intraperitoneal exposure, although the lowest observable adverse effect levels differed. Macrophages from the exposure site displayed an enhanced ability to activate an antigen-specific CD4(+) helper T-cell hybridoma compared with vehicle controls, whereas splenic macrophages were defective in this function. The chemical's impact on peritoneal macrophages depended on the exposure route. GaAs exposure augmented thiol cathepsins B and L activities in macrophages from the exposure site, but decreased proteolytic activities in splenic macrophages. Alveolar macrophages had increased expression of major histocompatibility complex (MHC) Class II molecules, whereas MHC Class II expression on splenic and peritoneal macrophages was unaffected. Modified thiol cathepsin activities statistically correlated with altered efficiency of antigen presentation, whereas MHC Class II expression did not. Our study is the first one to examine the functional capability of alveolar macrophages after intratracheal GaAs instillation. Therefore, thiol cathepsins may be potential target molecules by which GaAs exposure modulates antigen presentation.

Immunotoxic destruction of distinct catecholaminergic neuron populations disrupts the reproductive response to glucoprivation in female rats.

PubMed

I'Anson, Helen; Sundling, Lois A; Roland, Shannon M; Ritter, Sue

2003-10-01

We tested the hypothesis that hindbrain catecholamine (norepinephrine or epinephrine) neurons, in addition to their essential role in glucoprivic feeding, are responsible for suppressing estrous cycles during chronic glucoprivation. Normally cycling female rats were given bilateral injections of the retrogradely transported ribosomal toxin, saporin, conjugated to monoclonal dopamine beta-hydroxylase antibody (DSAP) into the paraventricular nucleus (PVN) of the hypothalamus to selectively destroy norepinephrine and epinephrine neurons projecting to the PVN. Controls were injected with unconjugated saporin. After recovery, we assessed the lesion effects on estrous cyclicity under basal conditions and found that DSAP did not alter estrous cycle length. Subsequently, we examined effects of chronic 2-deoxy-d-glucose-induced glucoprivation on cycle length. After two normal 4- to 5-d cycles, rats were injected with 2-deoxy-d-glucose (200 mg/kg every 6 h for 72 h) beginning 24 h after detection of estrus. Chronic glucoprivation increased cycle length in seven of eight unconjugated saporin rats but in only one of eight DSAP rats. Immunohistochemical results confirmed loss of dopamine beta-hydroxylase immunoreactivity in PVN. Thus, hindbrain catecholamine neurons with projections to the PVN are required for inhibition of reproductive function during chronic glucose deficit but are not required for normal estrous cyclicity when metabolic fuels are in abundance.

Immunotoxicity of a standardized citrus polymethoxylated flavone extract.

PubMed

Delaney, B; Phillips, K; Buswell, D; Mowry, B; Nickels, D; Cox, D; Wang, H B; Manthey, J

2001-11-01

Polymethoxylated flavones (PMFs) from citrus inhibit production of TNF-alpha and other pro-inflammatory cytokines. As TNF-alpha also modulates NK cell activity, the current studies were conducted to assess the potential for a standardized citrus PMF mixture to suppress humoral and innate immune functions. PMFs were isolated from orange peel oil using a procedure that obtained a consistent mixture of PMFs both in identity and proportion. The mixture consisted of nobiletin (30.7%), 3,3',4',5,6,7,8-heptamethoxyflavone (27.9%), trimethylscutellarein (14.5%), tangeretin (10.4%), sinensetin (5.8%), 5-demethyl-nobiletin (2.0%), hexa-O-methylquercetagetin (1.3%), 5-demethyl-tetramethylscutellarein (0.6%), and other flavonoids (2.7%). To assess the effect of the PMF mixture on humoral immune responses, female B(6)C(3)F(1) mice (n=8) were exposed to the PMF by gavage at 5, 50, 150 and 500 mg/kg/day for 28 days. On day 25, mice were sensitized to sRBC by tail vein injection and AFC response determined 4 days later. Humoral immunity was insensitive to suppression following exposure to all concentrations of the PMF mixture. Suppression of NK cell activity was observed only following 500 mg/kg/day for 28 days. Body weights were not affected by exposure to any concentration of the PMF mixture in sRBC immunized or non-immunized mice. However, in sRBC-immunized mice, higher concentrations of PMF were associated with a statistically insignificant increase in spleen weight (P>0.05). No change in spleen weight was observed in non-immunized mice. As anticipated, based on previously published in vitro observations, long-term, high-dose exposure to a standardized mixture of citrus PMFs caused a mild suppression of NK cell activity; however, humoral immunity was not sensitive to suppression at the same exposure levels.

EVALUATION OF PERFLUOROOCTANOIC ACID IMMUNOTOXICITY IN ADULT MICE.

EPA Science Inventory

Perfluorooctanoic acid (PFOA) is used in the manufacture of fluoropolymers and may be formed by metabolism or degradation of other perfluoroalkyl acids. Safety concerns led the U.S. EPA to conduct a risk assessment of PFOA and related compounds due to their environmental persist...

Immunotoxic effect of thiamethoxam in immunized mice with Brucella abortus cultural filtrate antigen

PubMed Central

Salema, L. H.; Alwan, M. J.; Yousif, Afaf Abdulrahman

2016-01-01

in the 2nd group (7.66±0.33). Phagocytic ratio results in the 1st group showed an increase to reach (18.55±0.44) than a ratio in the 2nd group (13.24±0.32) and the control group (5.46±0.25). Conclusion: It was concluded that TMX induced suppression of humoral and cellular immune responses in immunized mice with CFBAgs. PMID:28096613

Mycotoxins from mould infested building materials.

PubMed

Nielsen, K F

2000-03-01

Only limited documentation of non-allergenic, especially toxic reactions after inhalation of microfungal spores in water damaged buildings exists. Recently attention has been drawn to the mycotoxins as causal compounds, as some the dominating genera found in buildings are well known mycotoxin producers.Penicillium chrysogenum and A. ustus do not seem to produce any known mycotoxins when growing on building materials, whereasP. brevicompactum produces mycophenolic acid, someP. polonicum produces verrucosidin and verrucofortine,A. versicolor produces sterigmatocystins,A. niger produces nigragillin, orlandin, naphtho-γ-pyrones and tetracyclic compounds, someA. ochraceus produces ochratoxin A,Alternaria spp. produce alternariol and alternariol monomethyl ether,Chaetomium globosum produce chaetoglobosins, and finally 30-40% ofStachybotrys chartarum isolates from buildings produce macrocyclic trichothecenes and a number of other biologically active compounds.

Measurement of xenon diffusing capacity in the rat lung by hyperpolarized 129Xe MRI and dynamic spectroscopy in a single breath-hold.

PubMed

Abdeen, Nishard; Cross, Albert; Cron, Gregory; White, Steven; Rand, Thomas; Miller, David; Santyr, Giles

2006-08-01

We used the dual capability of hyperpolarized 129Xe for spectroscopy and imaging to develop new measures of xenon diffusing capacity in the rat lung that (analogously to the diffusing capacity of carbon monoxide or DLCO) are calculated as a product of total lung volume and gas transfer rate constants divided by the pressure gradient. Under conditions of known constant pressure breath-hold, the volume is measured by hyperpolarized 129Xe MRI, and the transfer rate is measured by dynamic spectroscopy. The new quantities (xenon diffusing capacity in lung parenchyma (DLXeLP)), xenon diffusing capacity in RBCs (DLXeRBC), and total lung xenon diffusing capacity (DLXe)) were measured in six normal rats and six rats with lung inflammation induced by instillation of fungal spores of Stachybotrys chartarum. DLXeLP, DLXeRBC, and DLXe were 56 +/- 10 ml/min/mmHg, 64 +/- 35 ml/min/mmHg, and 29 +/- 9 ml/min/mmHg, respectively, for normal rats, and 27 +/- 9 ml/min/mmHg, 42 +/- 27 ml/min/mmHg, and 16 +/- 7 ml/min/mmHg, respectively, for diseased rats. Lung volumes and gas transfer times for LP (TtrLP) were 16 +/- 2 ml and 22 +/- 3 ms, respectively, for normal rats and 12 +/- 2 ml and 35 +/- 8 ms, respectively, for diseased rats. Xenon diffusing capacities may be useful for measuring changes in gas exchange associated with inflammation and other lung diseases. Copyright 2006 Wiley-Liss, Inc.

Environmental Mold and Mycotoxin Exposures Elicit Specific Cytokine and Chemokine Responses

PubMed Central

Rosenblum Lichtenstein, Jamie H.; Hsu, Yi-Hsiang; Gavin, Igor M.; Donaghey, Thomas C.; Molina, Ramon M.; Thompson, Khristy J.; Chi, Chih-Lin; Gillis, Bruce S.; Brain, Joseph D.

2015-01-01

Background Molds can cause respiratory symptoms and asthma. We sought to use isolated peripheral blood mononuclear cells (PBMCs) to understand changes in cytokine and chemokine levels in response to mold and mycotoxin exposures and to link these levels with respiratory symptoms in humans. We did this by utilizing an ex vivo assay approach to differentiate mold-exposed patients and unexposed controls. While circulating plasma chemokine and cytokine levels from these two groups might be similar, we hypothesized that by challenging their isolated white blood cells with mold or mold extracts, we would see a differential chemokine and cytokine release. Methods and Findings Peripheral blood mononuclear cells (PBMCs) were isolated from blood from 33 patients with a history of mold exposures and from 17 controls. Cultured PBMCs were incubated with the most prominent Stachybotrys chartarum mycotoxin, satratoxin G, or with aqueous mold extract, ionomycin, or media, each with or without PMA. Additional PBMCs were exposed to spores of Aspergillus niger, Cladosporium herbarum and Penicillium chrysogenum. After 18 hours, cytokines and chemokines released into the culture medium were measured by multiplex assay. Clinical histories, physical examinations and pulmonary function tests were also conducted. After ex vivo PBMC exposures to molds or mycotoxins, the chemokine and cytokine profiles from patients with a history of mold exposure were significantly different from those of unexposed controls. In contrast, biomarker profiles from cells exposed to media alone showed no difference between the patients and controls. Conclusions These findings demonstrate that chronic mold exposures induced changes in inflammatory and immune system responses to specific mold and mycotoxin challenges. These responses can differentiate mold-exposed patients from unexposed controls. This strategy may be a powerful approach to document immune system responsiveness to molds and other inflammation-inducing

Genotoxic and Cytotoxic Effects on the Immune Cells of the Freshwater Bivalve Dreissena polymorpha Exposed to the Environmental Neurotoxin BMAA

PubMed Central

Milliote, Nadia; Bonnard, Marc; Palos-Ladeiro, Mélissa; Rioult, Damien; Bonnard, Isabelle; Bastien, Fanny; Geffard, Alain

2018-01-01

The environmental neurotoxin β-N-Methylamino-l-alanine (BMAA) has been pointed out to be involved in human neurodegenerative diseases. This molecule is known to be bioaccumulated by bivalves. However, little data about its toxic effects on freshwater mussels is available, particularly on the hemolymphatic compartment and its hemocyte cells involved in various physiological processes such as immune defenses, digestion and excretion, tissue repair, and shell production. Here we exposed Dreissena polymorpha to dissolved BMAA, at the environmental concentration of 7.5 µg of /mussel/3 days, during 21 days followed by 14 days of depuration in clear water, with the objective of assessing the BMAA presence in the hemolymphatic compartment, as well as the impact of the hemocyte cells in terms of potential cytotoxicity, immunotoxicity, and genotoxiciy. Data showed that hemocytes were in contact with BMAA. The presence of BMAA in hemolymph did not induce significant effect on hemocytes phagocytosis activity. However, significant DNA damage on hemocytes occurred during the first week (days 3 and 8) of BMAA exposure, followed by an increase of hemocyte mortality after 2 weeks of exposure. Those effects might be an indirect consequence of the BMAA-induced oxidative stress in cells. However, DNA strand breaks and mortality did not persist during the entire exposure, despite the BMAA persistence in the hemolymph, suggesting potential induction of some DNA-repair mechanisms. PMID:29494483

Assessing NLRP3 Inflammasome Activation by Nanoparticles.

PubMed

Sharma, Bhawna; McLeland, Christopher B; Potter, Timothy M; Stern, Stephan T; Adiseshaiah, Pavan P

2018-01-01

NLRP3 inflammasome activation is one of the initial steps in an inflammatory cascade against pathogen/danger-associated molecular patterns (PAMPs/DAMPs), such as those arising from environmental toxins or nanoparticles, and is essential for innate immune response. NLRP3 inflammasome activation in cells can lead to the release of IL-1β cytokine via caspase-1, which is required for inflammatory-induced programmed cell death (pyroptosis). Nanoparticles are commonly used as vaccine adjuvants and drug delivery vehicles to improve the efficacy and reduce the toxicity of chemotherapeutic agents. Several studies indicate that different nanoparticles (e.g., liposomes, polymer-based nanoparticles) can induce NLRP3 inflammasome activation. Generation of a pro-inflammatory response is beneficial for vaccine delivery to provide adaptive immunity, a necessary step for successful vaccination. However, similar immune responses for intravenously injected, drug-containing nanoparticles can result in immunotoxicity (e.g., silica nanoparticles). Evaluation of NLRP3-mediated inflammasome activation by nanoparticles may predict pro-inflammatory responses in order to determine if these effects may be mitigated for drug delivery or optimized for vaccine development. In this protocol, we outline steps to monitor the release of IL-1β using PMA-primed THP-1 cells, a human monocytic leukemia cell line, as a model system. IL-1β release is used as a marker of NLRP3 inflammasome activation.

Regulatory forum opinion piece*: immunotoxicology assessments in nonhuman primates--challenges and opportunities.

PubMed

Lebrec, Hervé N

2013-01-01

The immune system has been recognized for decades as a potential "target organ" of toxicity. Immune system activation can result in cytokine release resulting in severe systemic toxicity. Immunosuppression can result in impaired host defense and an increase in opportunistic infection, reemergence of latent infection, poor responses to vaccination, or increased risk of certain cancers. Several regulatory documents have addressed various aspects of immunotoxicity assessments. Nonhuman primates (NHPs) and in particular macaques are often the only relevant species for biotechnology-derived investigational new drugs based on cross-reactivity with human and NHP targets. This article reviews the challenges and opportunities associated with monitoring immune function in NHPs in the context of regulatory expectations. The article emphasizes how a comprehensive assessment of immunotoxicity remains a challenge due to interanimal variability associated with certain parameters (e.g., T-dependent antibody response)and it identifies gaps, such as the stage of development of certain assays (e.g., cytotoxic T-cell function). Despite these challenges, a thorough assessment of target biology-driven theoretical risks, in combination with proper integration of all information from the standard toxicology studies, and the refinement of certain assays should enable proper risk assessment. To this effect, emphasis should be placed on leveraging predictive in vitro assays using human cells.

Immune response to functionalized mesoporous silica nanoparticles for targeted drug delivery

NASA Astrophysics Data System (ADS)

Heidegger, Simon; Gößl, Dorothée; Schmidt, Alexandra; Niedermayer, Stefan; Argyo, Christian; Endres, Stefan; Bein, Thomas; Bourquin, Carole

2015-12-01

Multifunctional mesoporous silica nanoparticles (MSN) have attracted substantial attention with regard to their high potential for targeted drug delivery. For future clinical applications it is crucial to address safety concerns and understand the potential immunotoxicity of these nanoparticles. In this study, we assess the biocompatibility and functionality of multifunctional MSN in freshly isolated, primary murine immune cells. We show that the functionalized silica nanoparticles are rapidly and efficiently taken up into the endosomal compartment by specialized antigen-presenting cells such as dendritic cells. The silica nanoparticles showed a favorable toxicity profile and did not affect the viability of primary immune cells from the spleen in relevant concentrations. Cargo-free MSN induced only very low immune responses in primary cells as determined by surface expression of activation markers and release of pro-inflammatory cytokines such as Interleukin-6, -12 and -1β. In contrast, when surface-functionalized MSN with a pH-responsive polymer capping were loaded with an immune-activating drug, the synthetic Toll-like receptor 7 agonist R848, a strong immune response was provoked. We thus demonstrate that MSN represent an efficient drug delivery vehicle to primary immune cells that is both non-toxic and non-inflammagenic, which is a prerequisite for the use of these particles in biomedical applications.Multifunctional mesoporous silica nanoparticles (MSN) have attracted substantial attention with regard to their high potential for targeted drug delivery. For future clinical applications it is crucial to address safety concerns and understand the potential immunotoxicity of these nanoparticles. In this study, we assess the biocompatibility and functionality of multifunctional MSN in freshly isolated, primary murine immune cells. We show that the functionalized silica nanoparticles are rapidly and efficiently taken up into the endosomal compartment by specialized

Immunotoxicity of bisphenol S and F are similar to that of bisphenol A during zebrafish early development.

PubMed

Qiu, Wenhui; Shao, Haiyang; Lei, Penghui; Zheng, Chunmiao; Qiu, Cunxin; Yang, Ming; Zheng, Yi

2018-03-01

Bisphenol S (BPS) and bisphenol F (BPF) have been increasingly used as alternatives to bisphenol A (BPA) owing to health concerns. The present study aims to evaluate the impact of these two BPA analogs on oxidative stress and the immune system during zebrafish embryonic and larval development. Environmentally relevant levels of BPS and BPF exposure could increase reactive oxygen species (ROS) content, nitric oxide (NO) content, nitric oxide synthase (NOS) activity, and the expression of immunity-related genes in concentration dependent manners during the early developmental stages in zebrafish. At a concentration of 100 μg/L, BPS and BPF showed similar effects on the immune toxicity of zebrafish as that of BPA. Moreover, BPS and BPF induced both erα and nf-κb expression, and antagonists of estrogen receptor and NF-κB blocked the effects on immunity-related gene expression, providing evidence that the two pathways mediate the actions of BPS and BPF on fish immune response and functions. Thus we conclude that the presence of BPS and BPF in the environment, similar to BPA, may also pose risks to ecosystem and human health and cannot be widely used without limitations and precautions. Copyright © 2017 Elsevier Ltd. All rights reserved.

Induced Seismicity

NASA Astrophysics Data System (ADS)

Keranen, Katie M.; Weingarten, Matthew

2018-05-01

The ability of fluid-generated subsurface stress changes to trigger earthquakes has long been recognized. However, the dramatic rise in the rate of human-induced earthquakes in the past decade has created abundant opportunities to study induced earthquakes and triggering processes. This review briefly summarizes early studies but focuses on results from induced earthquakes during the past 10 years related to fluid injection in petroleum fields. Study of these earthquakes has resulted in insights into physical processes and has identified knowledge gaps and future research directions. Induced earthquakes are challenging to identify using seismological methods, and faults and reefs strongly modulate spatial and temporal patterns of induced seismicity. However, the similarity of induced and natural seismicity provides an effective tool for studying earthquake processes. With continuing development of energy resources, increased interest in carbon sequestration, and construction of large dams, induced seismicity will continue to pose a hazard in coming years.

Immunotoxic cholinergic lesions in the basal forebrain reverse the effects of entorhinal cortex lesions on conditioned odor aversion in the rat.

PubMed

Ferry, Barbara; Herbeaux, Karin; Cosquer, Brigitte; Traissard, Natalia; Galani, Rodrigue; Cassel, Jean-Christophe

2007-07-01

Conditioned odor aversion (COA) corresponds to the avoidance of an odorized-tasteless solution (conditioned stimulus, CS) previously paired with toxicosis. COA occurs only when the interstimulus interval (ISI) is kept short, suggesting that the memory trace of the odor is subject to rapid decay. Previous experiments have shown that the entorhinal cortex (EC) is involved in the acquisition of COA, since lesion of the EC rendered COA tolerant to long ISI. Because EC lesions induce a septo-hippocampal cholinergic sprouting, the present experiment investigated whether COA tolerance to long ISI may be linked to this sprouting reaction. In a first experiment, male Long-Evans rats subjected to bilateral excitotoxic EC lesions combined to intracerebroventricular infusions of the selective cholinergic immunotoxin 192 IgG-saporin were exposed to odor-toxicosis pairing using a long ISI (120 min). Results showed that EC-lesioned rats displayed COA with the long ISI but not the control groups. In rats with EC combined to 192 IgG-saporin lesions, histological analysis demonstrated no evidence for cholinergic septo-hippocampal sprouting. In a second experiment, animals with 192-IgG saporin lesion showed a marked COA with a short ISI (5 min). These results suggest that the COA with the long ISI found in rats with EC lesions might involve a functional activity related to the EC lesion-induced hippocampal cholinergic sprouting. As the injection of 192 IgG-saporin alone did not affect COA with a short ISI, our data also point to a possible role of hippocampal cholinergic neurons in the modulation of memory processes underlying COA.

Effect of the Aqueous Extract of Lantana grisebachii Stuck Against Bioaccumulated Arsenic-Induced Oxidative and Lipid Dysfunction in Rat Splenocytes.

PubMed

Ramos Elizagaray, Sabina I; Quiroga, Patricia L; Pérez, Roberto D; Sosa, Carlos; Pérez, Carlos A; Bongiovanni, Guillermina A; Soria, Elio A

2018-06-29

Arsenic (As) is a worldwide immunotoxic agent that is in contaminated waters and consumed by mammals. Phytotherapy may counteract its harmful effects. Lantana grisebachii Stuck (LG, Verbenaceae) and its extract are proposed as protective, given vvits in vitro bioactivity. The aim was to determine the protective capacity of the aqueous LG extract on splenocytes exposed in vivo to arsenic. Splenocytes were obtained from an arsenicosis model (Wistar rats consuming orally 0 [control; C] or 5 mg/Kg/d of As) that received 0-100 mg/Kg/d of LG extract for 30 days. As content (total reflection X-ray fluorescence), fatty acid profile (gas chromatography), γ-glutamyl transpeptidase activity (Szasz method), peroxides (xylenol orange-based assay), and nitrites (Griess reaction) were then assayed in viable splenocytes. Data were analyzed with ANOVA and the Tukey's test (p < .05). It was observed that the splenocytes contained 2.2 mg/Kg of this elemental arsenic. With γ-glutamyl transpeptidase inhibition and consequent triggering of hydroperoxides (p < .05), it was observed to increase saturated fatty acids and alter lipid profiles. LG treatment avoided damaging effects with values similar to unexposed C (p < .05), and cellular arsenic concentration (p < .0001). In conclusion, the aqueous extract of L. grisebachii counteracted arsenic toxicity in rat splenocytes by preventing its cellular accumulation and induction of lipid and redox disturbances, which may impair immune function.

Differentiation of Toxic Molds via Headspace SPME-GC/MS and Canine Detection

PubMed Central

Griffith, Robert T.; Jayachandran, Krishnaswamy; Shetty, Kateel G.; Whitstine, William; Furton, Kenneth G.

2007-01-01

Indoor mold growth has recently become a concern in the legal world in regards to insurance litigation. Hazardous mold exposure to humans has been linked to many acute and chronic adverse health effects including death. As it grows, mold produces several types of primary and secondary metabolites, including microbial volatile organic compounds (MVOCs). Microbial volatile organic compound emission may be used as a preliminary indication of a mold infestation that is invisible to the unaided eye. The objective of the study is to identify the unique odor signatures of three species of molds, Aspergillus versicolor, Penicillium chrysogenum, and Stachybotrys chartarum by SPME-GC/MS analysis. Determining the compounds that are emitted by the selected species has made it possible to conduct validation studies of canine detection of these mold species through a series of field tests.

Occurrence of itraconazole-tolerant micromycetes in the soil and food products.

PubMed

Piecková, E; Jesenská, Z

1999-01-01

Unexpected pathogens from the environment represent considerable risk for humans with impaired health. We examined the occurrence of itraconazole tolerant micromycetes in soil and in maize products. Five concentrations of itraconazole (2.5-12.5 micrograms/mL) selected according to known treatment schedules for human patients were incorporated into Sabouraud agar with chloramphenicol and Rose Bengal and diluted samples were inoculated onto the agar surface. After 7-d growth at 22 degrees C colonies of Alternaria sp., Aspergillus clavatus, A. glaucus group, A. flavus, A. fumigatus, A. niger group, A. ochraceus group, A. ochraceus, Chaetomium sp., Cladosporium cladosporioides, Cylindrocarpon sp., Doratomyces sp., Fusarium sp., F. moniliforme, F. oxysporum, F. solani, F. subglutinans, Marianaea elegans, Mortierella sp., Mucor sp., Myrothecium sp., Penicillium sp., Rhizopus sp., Scopulariopsis brevicaulis, Sepedonium sp., Stachybotrys chartarum, Stemphylium sp., Torula humicola and Trichoderma viride were isolated.

Inflammation-Induced Cell Proliferation Potentiates DNA Damage-Induced Mutations In Vivo

PubMed Central

Kiraly, Orsolya; Gong, Guanyu; Olipitz, Werner; Muthupalani, Sureshkumar; Engelward, Bevin P.

2015-01-01

Mutations are a critical driver of cancer initiation. While extensive studies have focused on exposure-induced mutations, few studies have explored the importance of tissue physiology as a modulator of mutation susceptibility in vivo. Of particular interest is inflammation, a known cancer risk factor relevant to chronic inflammatory diseases and pathogen-induced inflammation. Here, we used the fluorescent yellow direct repeat (FYDR) mice that harbor a reporter to detect misalignments during homologous recombination (HR), an important class of mutations. FYDR mice were exposed to cerulein, a potent inducer of pancreatic inflammation. We show that inflammation induces DSBs (γH2AX foci) and that several days later there is an increase in cell proliferation. While isolated bouts of inflammation did not induce HR, overlap between inflammation-induced DNA damage and inflammation-induced cell proliferation induced HR significantly. To study exogenously-induced DNA damage, animals were exposed to methylnitrosourea, a model alkylating agent that creates DNA lesions relevant to both environmental exposures and cancer chemotherapy. We found that exposure to alkylation damage induces HR, and importantly, that inflammation-induced cell proliferation and alkylation induce HR in a synergistic fashion. Taken together, these results show that, during an acute bout of inflammation, there is a kinetic barrier separating DNA damage from cell proliferation that protects against mutations, and that inflammation-induced cell proliferation greatly potentiates exposure-induced mutations. These studies demonstrate a fundamental mechanism by which inflammation can act synergistically with DNA damage to induce mutations that drive cancer and cancer recurrence. PMID:25647331

Exercise-Induced Asthma

MedlinePlus

... Videos for Educators Search English Español Exercise-Induced Asthma KidsHealth / For Parents / Exercise-Induced Asthma What's in ... Exercise-Induced Asthma Print What Is Exercise-Induced Asthma? Most kids and teens with asthma have symptoms ...

Neutrophhil function after exposure to polychlorinated biphenyls in vitro

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ganey, P.E.; Denison, M.; Roth, R.A.

1993-10-01

Polychlorinated biphenyls (PCBs) are known to be immunotoxic, yet the effects on neutrophil (PMN) function are not well characterized. We incubated PMNs isolated from rat peritoneum with a mixture of PCB congeners, Aroclor 1242, in the absence or presence of either phorbol myristate acetate (PMA) to stimulate generation of supoxide anion (O[sub 2]) or N-formyl-methionyl-leucyl-phenylalanine (fMLP) to induce degranulation (measured as release of [beta]-glucuronidase). Aroclor 1242 alone stimulated O[sub 2] production at a concentration of 10 [mu]g/ml. Significant cytotoxicity was not observed under these conditions. This concentration of Aroclor 1242 also increased O[sub 2] generation in PMNs activated with 20more » ng PMA/ml. In the presence of a concentration of PMA (2 ng/ml) that by itself did not stimulate production of O[sub 2], 1 [mu]g Aroclor 1242/ml caused significant generation of O[sub 2], indicating synergy between Aroclor 1242 and PMA. Aroclor 1242 caused release of [beta]-glucuronidase from quiescent PMNs; however, in PMNs stimulated with fMLP to undergo degranulation, Aroclor 1242 inhibited release of [beta]-glucuronidase.« less

Toxicity of Nanoparticles and an Overview of Current Experimental Models.

PubMed

Bahadar, Haji; Maqbool, Faheem; Niaz, Kamal; Abdollahi, Mohammad

2016-01-01

Nanotechnology is a rapidly growing field having potential applications in many areas. Nanoparticles (NPs) have been studied for cell toxicity, immunotoxicity, and genotoxicity. Tetrazolium-based assays such as MTT, MTS, and WST-1 are used to determine cell viability. Cell inflammatory response induced by NPs is checked by measuring inflammatory biomarkers, such as IL-8, IL-6, and tumor necrosis factor, using ELISA. Lactate dehydrogenase (LDH) assay is used for cell membrane integrity. Different types of cell cultures, including cancer cell lines have been employed as in vitro toxicity models. It has been generally agreed that NPs interfere with either assay materials or with detection systems. So far, toxicity data generated by employing such models are conflicting and inconsistent. Therefore, on the basis of available experimental models, it may be difficult to judge and list some of the more valuable NPs as more toxic to biological systems and vice versa. Considering the potential applications of NPs in many fields and the growing apprehensions of FDA about the toxic potential of nanoproducts, it is the need of the hour to look for new internationally agreed free of bias toxicological models by focusing more on in vivo studies.

Mercury and autoimmunity: implications for occupational and environmental health

DOE Office of Scientific and Technical Information (OSTI.GOV)

Silbergeld, Ellen K.; Silva, Ines A.; Nyland, Jennifer F.

Mercury (Hg) has long been recognized as a neurotoxicant; however, recent work in animal models has implicated Hg as an immunotoxicant. In particular, Hg has been shown to induce autoimmune disease in susceptible animals with effects including overproduction of specific autoantibodies and pathophysiologic signs of lupus-like disease. However, these effects are only observed at high doses of Hg that are above the levels to which humans would be exposed through contaminated fish consumption. While there is presently no evidence to suggest that Hg induces frank autoimmune disease in humans, a recent epidemiological study has demonstrated a link between occupational Hgmore » exposure and lupus. In our studies, we have tested the hypothesis that Hg does not cause autoimmune disease directly, but rather that it may interact with triggering events, such as genetic predisposition, exposure to antigens, or infection, to exacerbate disease. Treatment of mice that are not susceptible to Hg-induced autoimmune disease with very low doses and short term exposures of inorganic Hg (20-200 {mu}g/kg) exacerbates disease and accelerates mortality in the graft versus host disease model of chronic lupus in C57Bl/6 x DBA/2 mice. Furthermore, low dose Hg exposure increases the severity and prevalence of experimental autoimmune myocarditis (induced by immunization with cardiac myosin peptide in adjuvant) in A/J mice. To test our hypothesis further, we examined sera from Amazonian populations exposed to Hg through small-scale gold mining, with and without current or past malaria infection. We found significantly increased prevalence of antinuclear and antinucleolar antibodies and a positive interaction between Hg and malaria. These results suggest a new model for Hg immunotoxicity, as a co-factor in autoimmune disease, increasing the risks and severity of clinical disease in the presence of other triggering events, either genetic or acquired.« less

Minocycline suppresses morphine-induced respiratory depression, suppresses morphine-induced reward, and enhances systemic morphine-induced analgesia

PubMed Central

Hutchinson, Mark R.; Northcutt, Alexis L.; Chao, Lindsey W.; Kearney, Jeffrey J.; Zhang, Yingning; Berkelhammer, Debra L.; Loram, Lisa C.; Rozeske, Robert R.; Bland, Sondra T.; Maier, Steven F.; Gleeson, Todd T.; Watkins, Linda R.

2008-01-01

Recent data suggest that opioids can activate immune-like cells of the central nervous system (glia). This opioid-induced glial activation is associated with decreased analgesia, owing to the release of proinflammatory mediators. Here we examine in rats whether the putative microglial inhibitor, minocycline, may affect morphine-induced respiratory depression and/or morphine-induced reward (conditioned place preference). Systemic co-administration of minocycline significantly attenuated morphine-induced reductions in tidal volume, minute volume, inspiratory force and expiratory force, but did not affect morphine-induced reductions in respiratory rate. Minocycline attenuation of respiratory depression was also paralleled with significant attenuation by minocycline of morphine-induced reductions in blood oxygen saturation. Minocycline also attenuated morphine conditioned place preference. Minocycline did not simply reduce all actions of morphine, as morphine analgesia was significantly potentiated by minocycline co-administration. Lastly, morphine dose-dependently increased cyclooxygenase-1 gene expression in a rat microglial cell line, an effect that was dose-dependently blocked by minocycline. Together, these data support that morphine can directly activate microglia in a minocycline-suppressible manner and suggest a pivotal role for minocycline-sensitive processes in the mechanisms of morphine-induced respiration depression, reward, and pain modulation. PMID:18706994

Purification, immunotoxic effects, and cellular uptake of trichothecene mycotoxins

DOE Office of Scientific and Technical Information (OSTI.GOV)

Witt, M.F.

1989-01-01

Studies were carried out to better understand how the trichothecenes alter immune function in animals and humans. Deoxynivalenol (DON) was purified for use in animal feeding studies. Dietary exposure to DON for 8 weeks altered the serum immunoglobulin profile in mice and decreased the splenic plaque-forming cell response to the antigen sheep red blood cells. The uptake of ({sup 3}H)T-2 toxin by a murine B-cell hybridoma was studied in order to learn more about the way in which trichothecenes interact with immune cells. A simple procedure was developed for the laboratory production and purification of gram quantities of crystalline DON.more » When Fusarium graminearum R6576 was grown on rice, concentrations of 600 to 700 ppm DON accumulated after 13 to 18 days of incubation. A DON derivative, 15-acetylDON, was also found at concentrations of 100 to 300 ppm after 7 to 10 days. DON was purified from crude culture extracts by water-saturated silica gel chromatography. Alpha-({sup 3}H)T-2 toxin of 99% chemical and radiochemical purity was prepared for use in uptake studies. Both the rate of uptake of ({sup 3}H)T-2 toxin by hybridomas and the time required for accumulation of ({sup 3}H)T-2 to reach equilibrium were proportional to the concentration of ({sup 3}H)T-2. ({sup 3}H)T-2 toxin accumulated by hybridomas was proportional to the concentration of ({sup 3}H)T-2 between 10{sup {minus}8} and 10{sup {minus}3} M. The rate of uptake of ({sup 3}H)jT-2 toxin by hybridomas was inhibited by the trichothecenes T-2 toxin, DON, verrucarin A, and roridin A, as well as the antibiotic anisomycin. The kinetics and concentration dependence of accumulation, along with the inhibition patterns, suggest that uptake of ({sup 3}H)T-2 toxin by hybridomas is mediated by binding of toxin to ribosomes.« less

IMMUNOTOXICITY OF ORGANOTINS USED AS STABILIZERS IN PVC PIPE

EPA Science Inventory

Organotins, used as stabilizers in the production of PVC drinking water supply pipe, are known to leach into water, particularly from new pipe. Certain organotins (dibutyl-, dioctyl- and tributyltins) are known to suppress immune function following acute and subchronic exposure o...

Immunotoxicity and environment: immunodysregulation and systemic inflammation in children.

PubMed

Calderón-Garcidueñas, Lilian; Macías-Parra, Mercedes; Hoffmann, Hans J; Valencia-Salazar, Gildardo; Henríquez-Roldán, Carlos; Osnaya, Norma; Monte, Ofelia Camacho-Del; Barragán-Mejía, Gerardo; Villarreal-Calderon, Rodolfo; Romero, Lina; Granada-Macías, Margarita; Torres-Jardón, Ricardo; Medina-Cortina, Humberto; Maronpot, Robert R

2009-02-01

Environmental pollutants, chemicals, and drugs have an impact on children's immune system development. Mexico City (MC) children exposed to significant concentrations of air pollutants exhibit chronic respiratory inflammation, systemic inflammation, neuroinflammation, and cognitive deficits. We tested the hypothesis that exposure to severe air pollution plays a role in the immune responses of asymptomatic, apparently healthy children. Blood measurements for markers of immune function, inflammatory mediators, and molecules interacting with the lipopolysaccharide recognition complex were obtained from two cohorts of matched children (aged 9.7 +/- 1.2 years) from southwest Mexico City (SWMC) (n = 66) and from a control city (n = 93) with criteria pollutant levels below current standards. MC children exhibited significant decreases in the numbers of natural killer cells (p = .003) and increased numbers of mCD14+ monocytes (p < .001) and CD8+ cells (p = .02). Lower concentrations of interferon gamma (p = .009) and granulocyte-macrophage colony-stimulating factor (p < .001), an endotoxin tolerance-like state, systemic inflammation, and an anti-inflammatory response were also present in the highly exposed children. C-reactive protein and the prostaglandin E metabolite levels were positively correlated with twenty-four- and forty-eight-hour cumulative concentrations of PM(2.5). Exposure to urban air pollution is associated with immunodysregulation and systemic inflammation in children and is a major health threat.

Alteration in the cytokine levels and histopathological damage in common carp induced by glyphosate.

PubMed

Ma, Junguo; Li, Xiaoyu

2015-06-01

Glyphosate is one of the most frequently used herbicides, and it has been demonstrated to generate a series of toxicological problems in animals and humans. However, relatively little is known about the effects of glyphosate on the immune system of fish. In the present study, the acute toxicity of glyphosate on common carp was first determined; then, the contents of interferon-γ (IFN-γ), interleukin-1β (IL-1β), and tumor necrosis factor -α (TNF-α) and histopathological alterations in the liver, kidneys, and spleen of common carp exposed to 52.08 or 104.15 mg L(-1) of glyphosate for 168 h were also determined and evaluated. The results of the acute toxicity tests showed that the 96 h LC50 of glyphosate for common carp was 520.77 mg L(-1). Moreover, sub-acute exposure of glyphosate altered the contents of IFN-γ, IL-1β, and TNF-α in fish immune organs. For example, there was a remarkable increase in the IFN-γ content in the kidneys, while there was a decrease in the liver and spleen. The IL-1β content increased in liver and kidneys, but it decreased in the spleen, and TNF-α mainly increased in the fish liver, kidneys, and spleen. In addition, glyphosate-exposure also caused remarkable histopathological damage in the fish liver, kidneys, and spleen. These results suggest that glyphosate-caused cytokine alterations may result in an immune suppression or excessive activation in the treated common carp as well as may cause immune dysfunction or reduced immunity. In conclusion, glyphosate has immunotoxic effects on common carp. Copyright © 2015 Elsevier Ltd. All rights reserved.

Evaluation of Furfuryl Alcohol Sensitization Potential Following Dermal and Pulmonary Exposure: Enhancement of Airway Responsiveness

PubMed Central

Franko, Jennifer; Jackson, Laurel G.; Hubbs, Ann; Kashon, Michael; Meade, B. J.; Anderson, Stacey E.

2015-01-01

Furfuryl alcohol is considered by the U.S. Environmental Protection Agency to be a high volume production chemical, with over 1 million pounds produced annually. Due to its high production volume and its numerous industrial and consumer uses, there is considerable potential for work-related exposure, as well as exposure to the general population, through pulmonary, oral, and dermal routes of exposure. Human exposure data report a high incidence of asthma in foundry mold workers exposed to furan resins, suggesting potential immunologic effects. Although furfuryl alcohol was nominated and evaluated for its carcinogenic potential by the National Toxicology Program, studies evaluating its immunotoxicity are lacking. The studies presented here evaluated the immunotoxic potential of furfuryl alcohol following exposure by the dermal and pulmonary routes using a murine model. When tested in a combined irritancy local lymph node assay, furfuryl alcohol was identified to be an irritant and mild sensitizer (EC3 = 25.6%). Pulmonary exposure to 2% furfuryl alcohol resulted in enhanced airway hyperreactivity, eosinophilic infiltration into the lungs, and enhanced cytokine production (IL-4, IL-5, and interferon-γ) by ex vivo stimulated lung-associated draining lymphoid cells. Airway hyperreactivity and eosinophilic lung infiltration were augmented by prior dermal exposure to furfuryl alcohol. These results suggest that furfuryl alcohol may play a role in the development of allergic airway disease and encourage the need for additional investigation. PMID:22003193

Immunotoxicological profile of chloramine in female B6C3F1 mice when administered in the drinking water for 28 days.

PubMed

Guo, Tai L; Germolec, Dori R; Collins, Bradley J; Luebke, Robert W; Auttachoat, Wimolnut; Smith, Matthew J; White, Kimber L

2011-01-01

Monochloramine has been used to provide a disinfecting residual in water distribution systems where it is difficult to maintain an adequate free-chlorine residual or where disinfection by-product formation is of concern. The goal of this study was to characterize the immunotoxic effects of chloramine in female B(6)C(3)F(1) mice when administered via the drinking water. Mice were exposed to chloramine-containing deionized tap water at 2, 10, 20, 100, or 200 ppm for 28 days. No statistically significant differences in drinking water consumption, body weight, body weight gain, organ weights, or hematological parameters between the exposed and control animals were noted during the experimental period. There were no changes in the percentages and numbers of total B-lymphocytes, T-lymphocytes, CD4(+) and CD8(+) T-lymphocytes, natural killer (NK) cells, and macrophages in the spleen. Exposure to chloramine did not affect the IgM antibody-forming cell response to sheep red blood cells (SRBC) or anti-SRBC IgM antibody production. Minimal effects, judged to be biologically insignificant, were observed in the mixed-leukocyte response and NK activity. In conclusion, chloramine produced no toxicological and immunotoxic effects in female B(6)C(3)F(1) mice when administered for 28 days in the drinking water at concentrations ranging from 2-200 ppm.

The humoral immune response of mice exposed to manual metal arc stainless steel-welding fumes.

PubMed

Anderson, Stacey E; Meade, B Jean; Butterworth, Leon F; Munson, Albert E

2007-01-01

Arc welding is one of the most common forms of welding and includes the use of stainless steel electrodes that emit fumes containing chromium and nickel. Epidemological studies suggest a correlation between arc welding and adverse respiratory health effects. Studies evaluating the immunotoxic effects of welding fumes are limited due to the large number of variables associated with welding. This work investigates the immunotoxic effects of welding fumes by analyzing the in vivo and in vitro IgM response to a T-dependent antigen after welding fume exposure. Significant decreases in the total IgM activity/10(6) viable cells and total IgM activity/well were observed in splenocytes exposed to 5 mu g/ml of either total or soluble welding fumes. A significant reduction in the specific IgM activity in lung associated lymph node cells was also observed following four pharyngeal aspirations of 10 mg/kg total or soluble welding fumes to mice. Significant elevations in the absolute lymph node cell numbers for both B- and T-cells including the CD4(+) and CD8(+) subsets were observed. These results demonstrate that exposure to manual metal-stainless steel welding fumes is immunosuppressive in the presence of increased lymphoctye numbers in mice and raises concerns regarding the potential for adverse immunological effects to impact respiratory health in humans.

Mini review on photosensitization by plants in grazing herbivores.

PubMed

Hussain, Syeda M; Herling, Valdo Rodrigues; Rodrigues, Paulo Henrique Mazza; Naz, Ishrat; Khan, Hamayun; Khan, Muhammad Tahir

2018-06-01

Photosensitization is severe dermatitis or oxidative/chemical changes in the epidermal tissues activated by the light-induced excitation of molecules within the tissue. It is a series of reactions mediated through light receptors and is more common when the plant-produced metabolites are heterocyclic/polyphenols in nature. The areas affected are exposed body parts and mostly non-pigmented areas with least ultraviolet protection. Similarly, cellular alteration also occurs in the affected animal's dermal tissues and body parts and grazing animals by the accumulation and activation of photodynamic molecules. Photo-oxidation can also occur within the plant due to the generation of reactive oxygen species causing damage and degradation in the form of free radicals and DNA. During the last few decades, many new tropical grass species have been introduced in the grazing lands which are genetically modified, and the animals grazing on them are facing various forms of toxicity including photosensitization. The plant's secondary metabolites/drugs may cause toxicity when bacteria, viral agents, fungi (Pithomyces chartarum), or neoplasia injures the liver and prevents the phylloerythrin excretion. All these may disturb the liver enzymes and blood profile causing a decrease in weight and production (wool and milk etc.) with severe dermal, digestive, and nervous problems. Recent advancements in OMICS (cellomics, ethomics, metabolomics, metabonomics, and glycomics) have enabled us to detect and identify the plants' secondary metabolites and changes in the animal's physiology and histopathology as a causative of photosensitivity. The review focuses on types of photosensitization, reasons, secondary metabolic compounds, chemistry, and environmental effect on plants.

Expression of immunoregulatory genes and its relationship to lead exposure and lead-mediated oxidative stress in wild ungulates from an abandoned mining area.

PubMed

Rodríguez-Estival, Jaime; de la Lastra, José M Pérez; Ortiz-Santaliestra, Manuel E; Vidal, Dolors; Mateo, Rafael

2013-04-01

Lead (Pb) is a highly toxic metal that can induce oxidative stress and affect the immune system by modifying the expression of immunomodulator-related genes. The aim of the present study was to investigate the association between Pb exposure and the transcriptional profiles of some cytokines, as well as the relationship between Pb exposure and changes in oxidative stress biomarkers observed in the spleen of wild ungulates exposed to mining pollution. Red deer and wild boar from the mining area studied had higher spleen, liver, and bone Pb levels than controls, indicating a chronic exposure to Pb pollution. Such exposure caused a depletion of spleen glutathione levels in both species and disrupted the activity of antioxidant enzymes, suggesting the generation of oxidative stress conditions. Deer from the mining area also showed an induced T-helper (Th )-dependent immune response toward the Th 2 pathway, whereas boar from the mining area showed a cytokine profile suggesting an inclination of the immune response toward the Th 1 pathway. These results indicate that environmental exposure to Pb may alter immune responses in wild ungulates exposed to mining pollution. However, evidence of direct relationships between Pb-mediated oxidative stress and the changes detected in immune responses were not found. Further research is needed to evaluate the immunotoxic potential of Pb pollution, also considering the prevalence of chronic infectious diseases in wildlife in environments affected by mining activities. Copyright © 2013 SETAC.

Gender differences in the disposition and toxicity of metals

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vahter, Marie; Akesson, Agneta; Liden, Carola

There is increasing evidence that health effects of toxic metals differ in prevalence or are manifested differently in men and women. However, the database is small. The present work aims at evaluating gender differences in the health effects of cadmium, nickel, lead, mercury and arsenic. There is a markedly higher prevalence of nickel-induced allergy and hand eczema in women compared to men, mainly due to differences in exposure. Cadmium retention is generally higher in women than in men, and the severe cadmium-induced Itai-itai disease was mainly a woman's disease. Gender differences in susceptibility at lower exposure are uncertain, but recentmore » data indicate that cadmium has estrogenic effects and affect female offspring. Men generally have higher blood lead levels than women. Lead accumulates in bone and increased endogenous lead exposure has been demonstrated during periods of increased bone turnover, particularly in women in pregnancy and menopause. Lead and mercury, in the form of mercury vapor and methylmercury, are easily transferred from the pregnant women to the fetus. Recent data indicate that boys are more susceptible to neurotoxic effects of lead and methylmercury following exposure early in life, while experimental data suggest that females are more susceptible to immunotoxic effects of lead. Certain gender differences in the biotransformation of arsenic by methylation have been reported, and men seem to be more affected by arsenic-related skin effect than women. Experimental studies indicate major gender differences in arsenic-induced cancer. Obviously, research on gender-related differences in health effects caused by metals needs considerable more focus in the future.« less

Characterization of a novel, ubiquitous fungal endophyte from the rhizosphere and root endosphere of Populus trees

DOE PAGES

Vélez, Jessica M.; Tschaplinski, Timothy J.; Vilgalys, Rytas; ...

2017-04-07

Here, we examined variation in growth rate, patterns of nitrogen utilization, and competitive interactions of Atractiellarhizophila isolates from the roots of Populus hosts. Atractiella grew significantly faster on media substituted with inorganic nitrogen sources and slower in the presence of another fungal genus. In order to determine plausible causal mechanisms we used metabolomics to explore competitive interactions between Atractiella strains and Fusarium oxysporum or Leptosphaerulina chartarum. Metabolomic screening of potential microbial inhibitors showed increased levels of glycosides produced in vitro by Atractiella when grown with a different fungal genus, relative to when grown alone. Overall, our results suggest Atractiella ismore » a poor competitor with other fungi via direct routes e.g. faster growth rates, but may utilize chemical interactions and possibly nitrogen sources to defend itself, and niche partition its way to abundance in the plant host root and rhizosphere.« less

Characterization of a novel, ubiquitous fungal endophyte from the rhizosphere and root endosphere of Populus trees

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vélez, Jessica M.; Tschaplinski, Timothy J.; Vilgalys, Rytas

Here, we examined variation in growth rate, patterns of nitrogen utilization, and competitive interactions of Atractiellarhizophila isolates from the roots of Populus hosts. Atractiella grew significantly faster on media substituted with inorganic nitrogen sources and slower in the presence of another fungal genus. In order to determine plausible causal mechanisms we used metabolomics to explore competitive interactions between Atractiella strains and Fusarium oxysporum or Leptosphaerulina chartarum. Metabolomic screening of potential microbial inhibitors showed increased levels of glycosides produced in vitro by Atractiella when grown with a different fungal genus, relative to when grown alone. Overall, our results suggest Atractiella ismore » a poor competitor with other fungi via direct routes e.g. faster growth rates, but may utilize chemical interactions and possibly nitrogen sources to defend itself, and niche partition its way to abundance in the plant host root and rhizosphere.« less

Cavitation-resistant inducer

DOEpatents

Dunn, Charlton; Subbaraman, Maria R.

1989-01-01

An improvement in an inducer for a pump wherein the inducer includes a hub, a plurality of radially extending substantially helical blades and a wall member extending about and encompassing an outer periphery of the blades. The improvement comprises forming adjacent pairs of blades and the hub to provide a substantially rectangular cross-sectional flow area which cross-sectional flow area decreases from the inlet end of the inducer to a discharge end of the inducer, resulting in increased inducer efficiency improved suction performance, reduced susceptibility to cavitation, reduced susceptibility to hub separation and reduced fabrication costs.

Cavitation-resistant inducer

DOEpatents

Dunn, C.; Subbaraman, M.R.

1989-06-13

An improvement in an inducer for a pump is disclosed wherein the inducer includes a hub, a plurality of radially extending substantially helical blades and a wall member extending about and encompassing an outer periphery of the blades. The improvement comprises forming adjacent pairs of blades and the hub to provide a substantially rectangular cross-sectional flow area which cross-sectional flow area decreases from the inlet end of the inducer to a discharge end of the inducer, resulting in increased inducer efficiency improved suction performance, reduced susceptibility to cavitation, reduced susceptibility to hub separation and reduced fabrication costs. 11 figs.

Deoxynivalenol-induced cytokines and related genes in concanavalin A-stimulated primary chicken splenic lymphocytes.

PubMed

Ren, Zhihua; Wang, Yachao; Deng, Huidan; Deng, Youtian; Deng, Junliang; Zuo, Zhicai; Wang, Ya; Peng, Xi; Cui, Hengmin; Shen, Liuhong; Ma, Xiaoping; Fang, Jing

2015-04-01

Deoxynivalenol (DON) immunotoxicity and its induction of cytokines and related genes in the splenic lymphocytes of chickens have not been completely elucidated. In the present study, we aimed to evaluate the effects of 48 h of different DON treatments (0 μg/mL, 0.2 μg/mL, 0.8 μg/mL, 3.2 μg/mL, 12.5 μg/mL, and 50 μg/mL) on the secretion and the mRNA expressions of some cytokine genes, such as interleukin-1beta (IL-1β), IL-1RI, IL-2, IL-4, IL-6, IL-10, IL-12β, and IFN-γ in chicken splenic lymphocytes. The concentrations of IL-1RI, IL-6, IL-10, and IFN-γ were increased with the DON concentrations increasing (P<0.05 or P<0.01). However, the concentrations of IL-1β, IL-2, IL-4, and IL-12β were decreased with the DON concentrations increasing (P<0.05 or P<0.01). Except IL-1β, the mRNA expressions of the other cytokines were up-regulated by DON. The highest mRNA expressions values of IL-1RI, IL-4, IL-10, IL-12β, and IFN-γ were at 50 μg/mL DON treatment groups (P<0.05 or P<0.01), while the highest mRNA expressions values of IL-2 and IL-6 were at 12.5 μg/mL DON treatment groups (P<0.05 or P<0.01). Our data revealed that the potent effects of DON in affecting the secretion and the mRNA expression of the related cytokines in chicken splenic lymphocytes in vitro. Copyright © 2014 Elsevier Ltd. All rights reserved.

Inflammatory and oxidative stress-related effects associated with neurotoxicity are maintained after exclusively prenatal trichloroethylene exposure

PubMed Central

Blossom, Sarah J.; Melnyk, Stepan B.; Li, Ming; Wessinger, William D.; Cooney, Craig A.

2016-01-01

Trichloroethylene (TCE) is a widespread environmental toxicant with immunotoxic and neurotoxic potential. Previous studies have shown that continuous developmental exposure to TCE encompassing gestation and early life as well as postnatal only exposure in the drinking water of MRL+/+ mice promoted CD4+ T cell immunotoxicity, glutathione depletion and oxidative stress in the cerebellum, as well increased locomotor activity in male offspring. The purpose of this study was to characterize the effects of exclusively prenatal exposure on these parameters. Another goal was to investigate potential plasma oxidative stress/inflammatory biomarkers to possibly be used as predictors of TCE-mediated neurotoxicity. In the current study, 6 week old male offspring of dams exposed gestationally to 0, 0.01, and 0.1 mg/ml TCE in the drinking water were evaluated. Our results confirmed that the oxidized phenotype in plasma and cerebellum was maintained after exclusively prenatal exposure. A Phenotypic analysis by flow cytometry revealed that TCE exposure expanded the effector/memory subset of peripheral CD4+ T cells in association with increased production of pro-inflammatory cytokines IFN-γ and IL-17. Serum biomarkers of oxidative stress and inflammation were also elevated in plasma suggesting that systemic effects are important and may be used to predict neurotoxicity in our model. These results suggested that the prenatal period is a critical stage of life by which the developing CNS and immune system are susceptible to long-lasting changes mediated by TCE. PMID:26812193

Copper induces vasorelaxation and antagonizes noradrenaline-induced vasoconstriction in rat mesenteric artery.

PubMed

Wang, Yu-Chun; Hu, Chao-Wei; Liu, Ming-Yu; Jiang, Hong-Chao; Huo, Rong; Dong, De-Li

2013-01-01

Copper is an essential trace element for normal cellular function and contributes to critical physiological or pathological processes. The aim of the study was to investigate the effects of copper on vascular tone of rat mesenteric artery and compare the effects of copper on noradrenaline (NA) and high K(+) induced vasoconstriction. The rat mesenteric arteries were isolated and the vessel tone was measured by using multi wire myograph system in vitro. Blood pressure of carotid artery in rabbits was measured by using physiological data acquisition and analysis system in vivo. Copper dose-dependently blunted NA-induced vasoconstriction of rat mesenteric artery. Copper-induced vasorelaxation was inhibited when the vessels were pretreated with NG-nitro-L-arginine methyl ester (L-NAME). Copper did not blunt high K(+)-induced vasoconstriction. Copper preincubation inhibited NA-evoked vasoconstriction and the inhibition was not affected by the presence of L-NAME. Copper preincubation showed no effect on high K(+)-evoked vasoconstriction. Copper chelator diethyldithiocarbamate trihydrate (DTC) antagonized the vasoactivity induced by copper in rat mesenteric artery. In vivo experiments showed that copper injection (iv) significantly decreased blood pressure of rabbits and NA or DTC injection (iv) did not rescue the copper-induced hypotension and animal death. Copper blunted NA but not high K(+)-induced vasoconstriction of rat mesenteric artery. The acute effect of copper on NA-induced vasoconstriction was depended on nitric oxide (NO), but the effect of copper pretreatment on NA-induced vasoconstriction was independed on NO, suggesting that copper affected NA-induced vasoconstriction by two distinct mechanisms. © 2013 S. Karger AG, Basel.

Exercise-Induced Bronchoconstriction Quiz

MedlinePlus

... navigation Home ▸ Conditions & Treatments ▸ Asthma ▸ EIB Quiz Share | Exercise-Induced Bronchoconstriction or Exercise-Induced Asthma Quiz Exercise-Induced Bronchoconstriction (also called ...

Repeated dose 90-day oral toxicity test of G-7% NANA in rats: An application of new criterion for toxicity determination to test article-induced changes.

PubMed

Heo, Hye Seon; An, MinJi; Lee, Ji Sun; Kim, Hee Kyong; Park, Yeong-Chul

2018-06-01

G-7% NANA is N-acetylneuraminic acid(NANA) containing 7% sialic acid isolated from glycomacropeptide (GMP), a compound of milk. Since NANA is likely to have immunotoxicity, the need to ensure safety for long-term administration has been raised. In this study, a 90-day repeated oral dose toxicity test was performed in rats using G-7% NANA in the dosages of 0, 1250, 2500 and 5000 mg/kg/day.A toxicity determination criterion based on the significant change caused by the administration of the substancewas developed for estimating NOEL, NOAEL and LOAELapplied to this study. When analyzing the immunological markers, no significant changes were observed, even if other significant changes were observed in the high dose group. In accordance with the toxicity determination criterion developed, the NOEL in male and female has been determined as 2500 mg/kg/day, and the NOAEL in females has been determined as 5000 mg/kg/day. The toxicity determination criterion, applied for the first time in the repeated dose toxicity tests, could provide a basis for distinguishing NOEL and NOAEL more clearly; nevertheless, the toxicity determination criterion needs to be supplemented by adding differentiating adverse effects and non-adverse effects based on more experiences of the repeated dose toxicity tests. Copyright © 2018 Elsevier Inc. All rights reserved.

Mold growth on gypsum wallboard--a summary of three techniques.

PubMed

Menetrez, M Y; Foarde, K K; Webber, T D; Dean, T R; Betancourt, D A

2009-01-01

Reducing occupant exposure to mold growing on damp gypsum wallboard and controlling mold contamination in the indoor environment was studied through 1) delineation of environmental conditions required to promote and avoid mold growth and 2) efficacy testing of antimicrobial products, specifically cleaners and paints, on gypsum wallboard (GWB) surfaces. The effects of moisture and relative humidity (RH) on mold growth and transport are important in avoiding and eliminating problems. These effects have been demonstrated on GWB and are discussed in this article for use as control guidance. The authors discuss the efficacy of antimicrobial cleaners and paints to remove, eliminate, or control mold growth on GWB. Research to control Stachybotrys chartarum growth using 13 separate antimicrobial cleaners and nine varieties of antimicrobial paint on contaminated GWB was performed in laboratory testing. GWB surfaces were subjected to high RH. GWB control measures are summarized and combined, and the antimicrobial product results are explained.

Mycoflora and mycotoxin-producing fungi of air-dust particles from Egypt.

PubMed

Abdel-Hafez, S I; Shoreit, A A; Abdel-Hafez, A I; el Maghraby, O M

1986-01-01

Using the dilution-plate method, 27 genera and 64 species were collected from 20 air-dust samples on glucose - (24 genera and 57 species) and cellulose - (21 genera and 45 species) Czapek's agar at 28 degrees C. There are basic similarities between the mycoflora of air-dust on the two media and the most prevalent species were Aspergillus niger, A. flavus, A. ochraceus, A. terreus, A. versicolor, Penicillium chrysogenum, P. funiculosum, Alternaria alternata, Cladosporium herbarum, Fusarium oxysporum, Rhizopus stolonifer and Trichoderma viride. Chaetomium globosum, Stachybotrys chartarum, Humicola grisea and Arthrobotrys oligospora were common only on cellulose agar plates. Extracts of mycelium from 25 isolates were tested with brine schrimp (Artemia salina); of these 23 displayed varying degrees of toxicity. Thin layer chromatographic analysis of 12 isolates of Aspergillus flavus revealed that 4 strains were producing detectable aflatoxin. Zearalenone production was noted for 3 out of 5 strains of Fusarium oxysporum and 2 out of 5 strains of F. solani.

Exposure to perchlorate induces the formation of macrophage aggregates in the trunk kidney of zebrafish and mosquitofish

USGS Publications Warehouse

Capps, T.; Mukhi, S.; Rinchard, J.J.; Theodorakis, C.W.; Blazer, V.S.; Patino, R.

2004-01-01

Environmental contamination of ground and surface waters by perchlorate, derived from ammonium perchlorate (AP) and other perchlorate salts, is of increasing concern. Exposure to perchlorate can impair the thyroid endocrine system, which is thought to modulate renal and immune function in vertebrates. This study with zebrafish Danio rerio and eastern mosquitofish Gambusia holbrooki examined the histological effects of perchlorate on the trunk kidney, which in teleosts serves excretory and hemopoietic functions and therefore may be a target of perchlorate effects. Adult zebrafish of both sexes were exposed in the laboratory to waterborne, AP-derived perchlorate at measured concentrations of 18 mg/L for 8 weeks. Adult male mosquitofish were exposed to waterborne sodium perchlorate at measured perchlorate concentrations of 1-92 mg/L for 8 weeks. Control fish were kept in untreated water. The region of the body cavity containing the trunk kidney was processed from each fish for histological analysis. Macrophage aggregates (MAs), possible markers of contaminant exposure or immunotoxic effect, were present in the hemopoietic region of the kidney in both species exposed to perchlorate. The estimated percent area of kidney sections occupied by MAs was greater in zebrafish exposed to perchlorate at 18 mg/L (P < 0.05) than in controls. In male mosquitofish, the incidence of renal MAs increased proportionally with sodium perchlorate concentration and was significantly different from that of controls at 92 mg/L (P < 0.05). These observations confirm that in fish the kidney is affected by exposure to perchlorate. The concentrations of perchlorate at which the effects were noted are relatively high but within the range reported in some contaminated habitats.

Diet-induced obesity attenuates fasting-induced hyperphagia.

PubMed

Briggs, D I; Lemus, M B; Kua, E; Andrews, Z B

2011-07-01

Obesity impairs arcuate (ARC) neuropeptide Y (NPY)/agouti-releated peptide (AgRP) neuronal function and renders these homeostatic neurones unresponsive to the orexigenic hormone ghrelin. In the present study, we investigated the effect of diet-induced obesity (DIO) on feeding behaviour, ARC neuronal activation and mRNA expression following another orexigenic stimulus, an overnight fast. We show that 9 weeks of high-fat feeding attenuates fasting-induced hyperphagia by suppressing ARC neuronal activation and hypothalamic NPY/AgRP mRNA expression. Thus, the lack of appropriate feeding responses in DIO mice to a fast is caused by failure ARC neurones to recognise and/or respond to orexigenic cues. We propose that fasting-induced hyperphagia is regulated not by homeostatic control of appetite in DIO mice, but rather by changes in the reward circuitry. © 2011 The Authors. Journal of Neuroendocrinology © 2011 Blackwell Publishing Ltd.

NEW METHODS FOR THE ASSESSMENT OF IMMUNOTOXICITY OF CHEMICAL SUBSTANCES

EPA Science Inventory

The immune system is a target of toxic insult following subchronic or chronic exposure to environmental chemicals, therapeutic drugs or abused drugs. nteraction of xenobiotics with the immune system may result in undesirable effects of three principal types; (a) those manifested ...

IMMUNOTOXICITY STUDIES ON SELECTED DRINKING WATER DISINFECTION BY-PRODUCTS (DBPS)

EPA Science Inventory

Few DBPs have been evaluated for effects on the immune system, but certain studies suggest that immunosuppression may follow exposure to DBPs. Suppressed immune function is associated with increasesd susceptibility to infectious disease and certain types of cancer in humans and l...

THE DEVELOPMENTAL IMMUNOTOXICITY OF DIBUTYLTIN DICHLORIDE IN SPRAGUE-DAWLEY RATS

EPA Science Inventory

Methyl- and butyltin compounds used as stabilizers in polyvinyl chloride (PVC) pipe production are of concern as they leach from supply pipes into drinking water and have been associated with multisystem toxicity. This study assessed immune function in Sprague-Dawley (CD) rats d...

Splenic immunotoxicity in developing cane toads (Rhinella marina) from Bermuda.

PubMed

Fort, Douglas J; Mathis, Michael; Fort, Chelsea E; Fort, Hayley M; Fort, Troy D; Linzey, Donald W; Bacon, Jamie P

2016-10-01

The impacts of contaminated sediment from 2 ponds in Bermuda on immune function in newly metamorphosed cane toads were examined. In the present study, a partial life-cycle experiment exposing Gosner stage 20 cane toad tadpoles to pond sediment and laboratory culture water through metamorphosis and into a juvenile state was performed. A basic immunology battery, including general necropsy, spleen somatic index, spleen white pulp content, splenocyte tissue density, and splenocyte viability, was conducted in newly metamorphosed Rhinella marina exposed to Bermuda freshwater sediment and baseline specimens collected from 2 separate populations in south Texas and south Florida, USA. Immune function was evaluated using a lymphocyte proliferation assay with subset specimens infected with Mycobacterium chelonae. In the Bermuda population exposed to pond sediment, splenocyte tissue density was markedly lower and lymphocyte proliferation substantially less relative to cohorts exposed to control sediment and to the North American populations. Considerable increases in spleen weight and liver and spleen lesions related to M. chelonae infection were recorded in challenged Bermuda R. marina compared with unchallenged specimens. Overall, immune function in Bermuda R. marina was compromised compared with North American mainland R. marina regardless of treatment but more dramatically in specimens exposed to Bermuda pond sediments. Environ Toxicol Chem 2016;35:2604-2612. © 2016 SETAC. © 2016 SETAC.

Development of inducer-free expression plasmids based on IPTG-inducible promoters for Bacillus subtilis.

PubMed

Tran, Dinh Thi Minh; Phan, Trang Thi Phuong; Huynh, Thanh Kieu; Dang, Ngan Thi Kim; Huynh, Phuong Thi Kim; Nguyen, Tri Minh; Truong, Tuom Thi Tinh; Tran, Thuoc Linh; Schumann, Wolfgang; Nguyen, Hoang Duc

2017-07-25

Besides Escherichia coli, Bacillus subtilis is an important bacterial species for the production of recombinant proteins. Recombinant genes are inserted into shuttle expression vectors which replicate in both E. coli and in B. subtilis. The ligation products are first transformed into E. coli cells, analyzed for correct insertions, and the correct recombinant plasmids are then transformed into B. subtilis. A major problem using E. coli cells can be the strong basal level of expression of the recombinant protein which may interfere with the stability of the cells. To minimize this problem, we developed strong expression vectors being repressed in E. coli and inducer-free in B. subtilis. In general, induction of IPTG-inducible expression vectors is determined by the regulatory lacI gene encoding the LacI repressor in combination with the lacO operator on the promoter. To investigate the inducer-free properties of the vectors, we constructed inducer-free expression plasmids by removing the lacI gene and characterized their properties. First, we examined the ability to repress a reporter gene in E. coli, which is a prominent property facilitating the construction of the expression vectors carrying a target gene. The β-galactosidase (bgaB gene) basal levels expressed from Pgrac01-bgaB could be repressed at least twice in the E. coli cloning strain. Second, the inducer-free production of BgaB from four different plasmids with the Pgrac01 promoter in B. subtilis was investigated. As expected, BgaB expression levels of inducer-free constructs are at least 37 times higher than that of the inducible constructs in the absence of IPTG, and comparable to those in the presence of the inducer. Third, using efficient IPTG-inducible expression vectors containing the strong promoter Pgrac100, we could convert them into inducer-free expression plasmids. The BgaB production levels from the inducer-free plasmid in the absence of the inducer were at least 4.5 times higher than that of

Kinetics of Satratoxin G Tissue Distribution and Excretion Following Intranasal Exposure in the Mouse

PubMed Central

Amuzie, Chidozie J.; Islam, Zahidul; Kim, Jae Kyung; Seo, Ji-Hyun; Pestka, James J.

2010-01-01

Intranasal exposure of mice to satratoxin G (SG), a macrocyclic trichothecene produced by the indoor air mold Stachybotrys chartarum, selectively induces apoptosis in olfactory sensory neurons (OSNs) of the nose and brain. The purpose of this study was to measure the kinetics of distribution and clearance of SG in the mouse. Following intranasal instillation of female C57B16 mice with SG (500 μg/kg bw), the toxin was detectable from 5 to 60 min in blood and plasma, with the highest concentrations, 30 and 19 ng/ml, respectively, being observed at 5 min. SG clearance from plasma was rapid and followed single-compartment kinetics (t1/2 = 20 min) and differed markedly from that of other tissues. SG concentrations were maximal at 15–30 min in nasal turbinates (480 ng/g), kidney (280 ng/g), lung (250 ng/g), spleen (200 ng/g), liver (140 ng/g), thymus (90 ng/g), heart (70 ng/g), olfactory bulb (14 ng/g), and brain (3 ng/g). The half-lives of SG in the nasal turbinate and thymus were 7.6 and 10.1 h, respectively, whereas in other organs, these ranged from 2.3 to 4.4 h. SG was detectable in feces and urine, but cumulative excretion over 5 days via these routes accounted for less than 0.3% of the total dose administered. Taken together, SG was rapidly taken up from the nose, distributed to tissues involved in respiratory, immune, and neuronal function, and subsequently cleared. However, a significant amount of the toxin was retained in the nasal turbinate, which might contribute to SG’s capacity to evoke OSN death. PMID:20466779

Arabidopsis thaliana defense response to the ochratoxin A-producing strain (Aspergillus ochraceus 3.4412).

PubMed

Hao, Junran; Wu, Weihong; Wang, Yan; Yang, Zhuojun; Liu, Yang; Lv, Yangjun; Zhai, Yanan; Yang, Jing; Liang, Zhihong; Huang, Kunlun; Xu, Wentao

2015-05-01

OTA-producing strain Aspergillus ochraceus induced necrotic lesions, ROS accumulation and defense responses in Arabidopsis . Primary metabolic and defense-related proteins changed in proteomics. Ascorbate-glutathione cycle and voltage-dependent anion-selective channel proteins fluctuated. Mycotoxigenic fungi, as widespread contaminants by synthesizing mycotoxins in pre-/post-harvest infected plants and even stored commercial cereals, could usually induce plant-fungi defense responses. Notably, ochratoxin A (OTA) is a nephrotoxic, hepatotoxic, teratogenic, immunotoxic and phytotoxic mycotoxin. Herein, defense responses of model system Arabidopsis thaliana detached leaves to infection of Aspergillus ochraceus 3.4412, an OTA high-producing strain, were studied from physiological, proteomic and transcriptional perspectives. During the first 72 h after inoculation (hai), the newly formed hypersensitive responses-like lesions, decreased chlorophyll content, accumulated reactive oxygen species and upregulated defense genes expressions indicated the defense response was induced in the leaves with the possible earlier motivated jasmonic acid/ethylene signaling pathways and the later salicylic acid-related pathway. Moreover, proteomics using two-dimensional gel electrophoresis 72 hai showed 16 spots with significantly changed abundance and 13 spots corresponding to 12 unique proteins were successfully identified by MALDI-TOF/TOF MS/MS. Of these, six proteins were involved in basic metabolism and four in defense-related processes, which included glutathione-S-transferase F7, voltage-dependent anion-selective channel protein 3 (VDAC-3), osmotin-like protein OSM34 and blue copper-binding protein. Verified from proteomic and/or transcriptional perspectives, it is concluded that the primary metabolic pathways were suppressed with the ascorbate-glutathione cycle fluctuated in response to A. ochraceus and the modulation of VDACs suggested the possibility of structural damage and

Health Effects in Fish of Long-Term Exposure to Effluents from Wastewater Treatment Works

PubMed Central

Liney, Katherine E.; Hagger, Josephine A.; Tyler, Charles R.; Depledge, Michael H.; Galloway, Tamara S.; Jobling, Susan

2006-01-01

Concern has been raised in recent years that exposure to wastewater treatment effluents containing estrogenic chemicals can disrupt the endocrine functioning of riverine fish and cause permanent alterations in the structure and function of the reproductive system. Reproductive disorders may not necessarily arise as a result of estrogenic effects alone, and there is a need for a better understanding of the relative importance of endocrine disruption in relation to other forms of toxicity. Here, the integrated health effects of long-term effluent exposure are reported (reproductive, endocrine, immune, genotoxic, nephrotoxic). Early life-stage roach, Rutilus rutilus, were exposed for 300 days to treated wastewater effluent at concentrations of 0, 15.2, 34.8, and 78.7% (with dechlorinated tap water as diluent). Concentrations of treated effluents that induced feminization of male roach, measured as vitellogenin induction and histological alteration to gonads, also caused statistically significant alterations in kidney development (tubule diameter), modulated immune function (differential cell count, total number of thrombocytes), and caused genotoxic damage (micronucleus induction and single-strand breaks in gill and blood cells). Genotoxic and immunotoxic effects occurred at concentrations of wastewater effluent lower than those required to induce recognizable changes in the structure and function of the reproductive endocrine system. These findings emphasize the need for multiple biological end points in tests that assess the potential health effects of wastewater effluents. They also suggest that for some effluents, genotoxic and immune end points may be more sensitive than estrogenic (endocrine-mediated) end points as indicators of exposure in fish. PMID:16818251

Measuring attention using induced motion.

PubMed

Gogel, W C; Sharkey, T J

1989-01-01

Attention was measured by means of its effect upon induced motion. Perceived horizontal motion was induced in a vertically moving test spot by the physical horizontal motion of inducing objects. All stimuli were in a frontoparallel plane. The induced motion vectored with the physical motion to produce a clockwise or counterclockwise tilt in the apparent path of motion of the test spot. Either a single inducing object or two inducing objects moving in opposite directions were used. Twelve observers were instructed to attend to or to ignore the single inducing object while fixating the test object and, when the two opposing inducing objects were present, to attend to one inducing object while ignoring the other. Tracking of the test spot was visually monitored. The tilt of the path of apparent motion of the test spot was measured by tactile adjustment of a comparison rod. It was found that the measured tilt was substantially larger when the single inducing object was attended rather than ignored. For the two inducing objects, attending to one while ignoring the other clearly increased the effectiveness of the attended inducing object. The results are analyzed in terms of the distinction between voluntary and involuntary attention. The advantages of measuring attention by its effect on induced motion as compared with the use of a precueing procedure, and a hypothesis regarding the role of attention in modifying perceived spatial characteristics are discussed.

Mechanism of deoxynivalenol effects on the reproductive system and fetus malformation: Current status and future challenges.

PubMed

Yu, Miao; Chen, Liangkai; Peng, Zhao; Nüssler, Andreas K; Wu, Qinghua; Liu, Liegang; Yang, Wei

2017-06-01

Deoxynivalenol (DON) is a toxic fungal secondary metabolite produced by molds of the Fusarium genus, and it is known to cause a spectrum of diseases both in humans and animals, such as emesis, diarrhea, anorexia, immunotoxicity, hematological disorders, impairment of maternal reproduction, and fetal development. The recently revealed teratogenic potential of DON has received much attention. In various animal models, it has been shown that DON led to skeletal deformities of the fetus. However, the underlying mechanisms are not yet fully understood, and toxicological data are also scarce. Several animal research studies highlight the potential link between morphological abnormalities and changes of autophagy in the reproductive system. Because autophagy is involved in fetal development, maintenance of placental function, and bone remodeling, this mechanism has become a high priority for future research. The general aim of the present review is to deliver a comprehensive overview of the current state of knowledge of DON-induced reproductive toxicity in different animal models and to provide some prospective ideas for further research. The focus of the current review is to summarize toxic and negative effects of DON exposure on the reproductive system and the potential underlying molecular mechanisms in various animal models. Copyright © 2017 Elsevier B.V. All rights reserved.

Real and perceived risks for mycotoxin contamination in foods and feeds: challenges for food safety control.

PubMed

Milićević, Dragan R; Skrinjar, Marija; Baltić, Tatjana

2010-04-01

Mycotoxins are toxic compounds, produced by the secondary metabolism of toxigenic moulds in the Aspergillus, Alternaria, Claviceps, Fusarium, Penicillium and Stachybotrys genera occurring in food and feed commodities both pre- and post-harvest. Adverse human health effects from the consumption of mycotoxins have occurred for many centuries. When ingested, mycotoxins may cause a mycotoxicosis which can result in an acute or chronic disease episode. Chronic conditions have a much greater impact, numerically, on human health in general, and induce diverse and powerful toxic effects in test systems: some are carcinogenic, mutagenic, teratogenic, estrogenic, hemorrhagic, immunotoxic, nephrotoxic, hepatotoxic, dermotoxic and neurotoxic. Although mycotoxin contamination of agricultural products still occurs in the developed world, the application of modern agricultural practices and the presence of a legislatively regulated food processing and marketing system have greatly reduced mycotoxin exposure in these populations. However, in developing countries, where climatic and crop storage conditions are frequently conducive to fungal growth and mycotoxin production, much of the population relies on subsistence farming or on unregulated local markets. Therefore both producers and governmental control authorities are directing their efforts toward the implementation of a correct and reliable evaluation of the real status of contamination of a lot of food commodity and, consequently, of the impact of mycotoxins on human and animal health.

Bolstering cholesteryl ester hydrolysis in liver: A hepatocyte-targeting gene delivery strategy for potential alleviation of atherosclerosis

PubMed Central

He, Hongliang; Lancina, Michael G.; Wang, Jing; Korzun, William J.; Yang, Hu; Ghosh, Shobha

2017-01-01

Current atherosclerosis treatment strategies primarily focus on limiting further cholesteryl esters (CE) accumulation by reducing endogenous synthesis of cholesterol in the liver. No therapy is currently available to enhance the removal of CE, a crucial step to reduce the burden of the existing disease. Given a central role of hepatic cholesteryl ester hydrolase (CEH) in intrahepatic hydrolysis of CE and subsequent removal of the resulting free cholesterol, in this work, we applied galactose-functionalized polyamidoamine (PAMAM) dendrimer G5 (Gal-G5) for hepatocyte-specific delivery of CEH expression vector. The data presented herein show increased specific uptake of Gal-G5 by the hepatocytes in vitro and in vivo. Furthermore, the upregulated CEH expression in the hepatocytes significantly enhanced intracellular hydrolysis of HDL-CE and subsequent conversion/secretion of hydrolyzed free cholesterol (FC) as bile acids. Increased CEH expression in the liver significantly increased the flux of HDL-CE to biliary as well as fecal FC and bile acids. Meanwhile, Gal-G5 did not induce hepatic or renal toxicity. It was not immunotoxic. Because of these encouraging pre-clinical testing results, using this safe and highly efficient hepatocyte-specific gene delivery platform to enhance the hepatic processes involved in cholesterol elimination is a promising strategy for alleviation of atherosclerosis. PMID:28349866

SUPPRESSION OF HUMORAL IMMUNE RESPONSES BY 2,3,7,8-TETRACHLORODIBENZO-p-DIOXIN INTERCALATED IN SMECTITE CLAY

PubMed Central

Boyd, Stephen A.; Johnston, Cliff T.; Pinnavaia, Thomas J.; Kaminski, Norbert E.; Teppen, Brian J.; Li, Hui; Khan, Bushra; Crawford, Robert B.; Kovalova, Natalia; Kim, Seong-Su; Shao, Hua; Gu, Cheng; Kaplan, Barbara L.F.

2018-01-01

2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD) is a highly toxic environmental contaminant found in soils and sediments. Because of its exceptionally low water solubility, this compound exists predominantly in the sorbed state in natural environments. Clay minerals, especially expandable smectite clays, are one of the major component geosorbents in soils and sediments that can function as an effective adsorbent for environmental dioxins, including TCDD. In this study, TCDD was intercalated in the smectite clay saponite by an incipient wetness method. The primary goal of this study was to intercalate TCDD in natural K-saponite clay and evaluate its immunotoxic effects in vivo. The relative bioavailability of TCDD was evaluated by comparing the metabolic activity of TCDD administered in the adsorbed state as an intercalate in saponite and freely dissolved in corn oil. This comparison revealed nearly identical TCDD-induced suppression of humoral immunity, a well-established and sensitive sequela, in a mammalian (mouse) model. This result suggests that TCDD adsorbed by clays is likely to be available for biouptake and biodistribution in mammals, consistent with previous observations of TCDD in livestock exposed to dioxin-contaminated ball clays that were used as feed additives. Adsorption of TCDD by clay minerals does not appear to mitigate risk associated with TCDD exposure substantially. PMID:21994089

Advances in mechanisms and signaling pathways of carbon nanotube toxicity

PubMed Central

Dong, Jie; Ma, Qiang

2015-01-01

Carbon nanotubes (CNT) have been developed into new materials with a variety of industrial and commercial applications. In contrast, the physicochemical properties of CNT at the nanoscale render them the potency to generate toxic effects. Indeed, the potential health impacts of CNT have drawn a great deal of attention in recent years, owing to their identified toxicological and pathological consequences including cytotoxicity, inflammation, fibrosis, genotoxicity, tumorigenesis, and immunotoxicity. Understanding the mechanisms by which CNT induce toxicity and pathology is thus urgently needed for accurate risk assessment of CNT exposure in humans, and for safe and responsible development and commercialization of nanotechnology. Here, we summarize and discuss recent advances in this area with a focus on the molecular interactions between CNT and mammalian systems, and the signaling pathways important for the development of CNT toxicity such as the NF-κB, NLRP3 inflammasome, TGF-β1, MAPK, and p53 signaling cascades. With the current mechanistic evidence summarized in this review, we expect to provide new insights into CNT toxicology at the molecular level and offer new clues to the prevention of health effects resulting from CNT exposure. Moreover, we disclose questions and issues that remain in this rapidly advancing field of nanotoxicology, which would facilitate ascertaining future research directions. PMID:25676622

[Glucocorticoids induced neuropsychiatric disorders].

PubMed

Cornic, Françoise; Rousset, Inqrid

2008-03-15

Glucocorticoids induced psychiatric disorders mostly emerge within the first weeks of corticotherapy. They occur in a variety of qualitatively distinct forms. Manic symptoms are among the most important manifestations of corticosteroids-induced psychiatric toxicity. The incidence of moderate to severe induced reactions is estimated at 5%. Acute cognitive induced disorders are common although moderate. These cognitive alterations specifically affect hippocampal dependant memory process. Chronic cognitive disorders are uncommon, complex, and inconsistent with an isolated alteration of the hippocampal structure. Corticotherapy stop also induced frequent psychiatric withdrawal symptoms, which are mostly depressive symptoms. Occurrence of such symptoms is likely to explain the addictive potentialities of glucocorticoids.

Trauma-induced systemic inflammatory response versus exercise-induced immunomodulatory effects.

PubMed

Fehrenbach, Elvira; Schneider, Marion E

2006-01-01

Accidental trauma and heavy endurance exercise, both induce a kind of systemic inflammatory response, also called systemic inflammatory response syndrome (SIRS). Exercise-related SIRS is conditioned by hyperthermia and concomitant heat shock responses, whereas trauma-induced SIRS manifests concomitantly with tissue necrosis and immune activation, secondarily followed by fever. Inflammatory cytokines are common denominators in both trauma and exercise, although there are marked quantitative differences. Different anti-inflammatory cytokines may be involved in the control of inflammation in trauma- and exercise-induced stress. Exercise leads to a balanced equilibrium between inflammatory and anti-inflammatory responses. Intermittent states of rest, as well as anti-oxidant capacity, are lacking or minor in trauma but are high in exercising individuals. Regular training may enhance immune competence, whereas trauma-induced SIRS often paves the way for infectious complications, such as sepsis.

Are There Frame-Distortion Contributions to Collision-Induced Absorption and Collision-Induced Light Scattering?

NASA Astrophysics Data System (ADS)

Hohm, Uwe

2007-12-01

Collision-induced spectroscopy, such as collision-induced absorption (CIA) and collision-induced light scattering (CILS), can give valuable information on permanent electric moments, polarizabilities and intermolecular-interaction potentials. In general the collision-induced spectra of the pure rare-gases and their binary mixtures are understood fairly well. However if at least one of the collision partners is a molecule then in some cases the spectra show features which can hardly be explained by current theories which deal with the case of undistorted molecules. Here we discuss the possibility of collision-induced frame distortion as an additional effect to be considered in collision-induced spectroscopy.

Apoptosis-inducing factor (Aif1) mediates anacardic acid-induced apoptosis in Saccharomyces cerevisiae.

PubMed

Muzaffar, Suhail; Chattoo, Bharat B

2017-03-01

Anacardic acid is a medicinal phytochemical that inhibits proliferation of fungal as well as several types of cancer cells. It induces apoptotic cell death in various cell types, but very little is known about the mechanism involved in the process. Here, we used budding yeast Saccharomyces cerevisiae as a model to study the involvement of some key elements of apoptosis in the anacardic acid-induced cell death. Plasma membrane constriction, chromatin condensation, DNA degradation, and externalization of phosphatidylserine (PS) indicated that anacardic acid induces apoptotic cell death in S. cerevisiae. However, the exogenous addition of broad-spectrum caspase inhibitor Z-VAD-FMK or deletion of the yeast caspase Yca1 showed that the anacardic acid-induced cell death is caspase independent. Apoptosis-inducing factor (AIF1) deletion mutant was resistant to the anacardic acid-induced cell death, suggesting a key role of Aif1. Overexpression of Aif1 made cells highly susceptible to anacardic acid, further confirming that Aif1 mediates anacardic acid-induced apoptosis. Interestingly, instead of the increase in the intracellular reactive oxygen species (ROS) normally observed during apoptosis, anacardic acid caused a decrease in the intracellular ROS levels. Quantitative real-time PCR analysis showed downregulation of the BIR1 survivin mRNA expression during the anacardic acid-induced apoptosis.

Chemical-induced Vitiligo

PubMed Central

Harris, John E.

2016-01-01

Synopsis Chemical-induced depigmentation of the skin has been recognized for over 75 years, first as an occupational hazard but then extending to those using household commercial products as common as hair dyes. Since their discovery, these chemicals have been used therapeutically in patients with severe vitiligo to depigment their remaining skin and improve their appearance. The importance of recognizing this phenomenon was highlighted during an outbreak of vitiligo in Japan during the summer of 2013, when over 16,000 users of a new skin lightening cosmetic cream developed skin depigmentation at the site of contact with the cream and many in remote areas as well. Depigmenting chemicals appear to be analogs of the amino acid tyrosine that disrupt melanogenesis and result in autoimmunity and melanocyte destruction. Because chemical-induced depigmentation is clinically and histologically indistinguishable from non-chemically induced vitiligo, and because these chemicals appear to induce melanocyte autoimmunity, this phenomenon should be known as “chemical-induced vitiligo”, rather than less accurate terms that have been previously used. PMID:28317525

Drug-Induced Hematologic Syndromes

PubMed Central

Mintzer, David M.; Billet, Shira N.; Chmielewski, Lauren

2009-01-01

Objective. Drugs can induce almost the entire spectrum of hematologic disorders, affecting white cells, red cells, platelets, and the coagulation system. This paper aims to emphasize the broad range of drug-induced hematological syndromes and to highlight some of the newer drugs and syndromes. Methods. Medline literature on drug-induced hematologic syndromes was reviewed. Most reports and reviews focus on individual drugs or cytopenias. Results. Drug-induced syndromes include hemolytic anemias, methemoglobinemia, red cell aplasia, sideroblastic anemia, megaloblastic anemia, polycythemia, aplastic anemia, leukocytosis, neutropenia, eosinophilia, immune thrombocytopenia, microangiopathic syndromes, hypercoagulability, hypoprothrombinemia, circulating anticoagulants, myelodysplasia, and acute leukemia. Some of the classic drugs known to cause hematologic abnormalities have been replaced by newer drugs, including biologics, accompanied by their own syndromes and unintended side effects. Conclusions. Drugs can induce toxicities spanning many hematologic syndromes, mediated by a variety of mechanisms. Physicians need to be alert to the potential for iatrogenic drug-induced hematologic complications. PMID:19960059

Immune response induced by major environmental pollutants through altering neutrophils in zebrafish larvae.

PubMed

Xu, Hongyan; Zhang, Xiaoyan; Li, Hankun; Li, Caixia; Huo, Xiao-Jing; Hou, Li-Ping; Gong, Zhiyuan

2018-06-06

Environmental pollutants may cause adverse effects on the immune system of aquatic organisms. However, the cellular effects of pollutants on fish immune system are largely unknown. Here, we exploited the transgenic zebrafish Tg(lysC:DsRed2) larva as a preliminary screening system to evaluate the potential inflammatory effects of environmental pollutants. Tg(lysC:DsRED2) larvae aged 7-day-postfertilization (7 dpf) were treated with selected environmental chemicals for 24 h (24 h) and the number of neutrophils were quantified using both image analysis and fluorescence activated cell sorting (FACS). We found that the numbers of neutrophils in the Tg(lysC:DsRED2) larvae were significantly increased by most of the organic chemicals tested, including E2 (17β-estradiol), BPA (Bisphenol-A), NDEA (N-nitrosodiethylamine), 4-NP (4-Nitrophenol) and Lindane (γ-hexachlorocyclohexane). Neutrophil numbers were also increased by all the metals tested (Na2HAsO4· 7H2O, Pb(NO3)2, HgCl 2 , CdCl2, CuSO 4 ·5H 2 O, ZnSO4, and K2Cr2O7). The only exception was TCDD (2,3,7,8-tetrachlorodibenzo-p-dioxin), which significantly reduced the number of neutrophils after exposure. Additionally, the transcription of genes (lyz, mpo, tnfα and il8) related to fish immune system were significantly modulated upon exposure to some of the selected chemicals such as E2, TCDD, Cu and Cd. This study revealed that representatives of major categories of environmental pollutants could cause an acute inflammatory response in zebrafish larvae as shown by alterations in the neutrophils, which may imply a common immunotoxicity mechanism for most environmental pollutants. This study has also demonstrated that Tg(lyz:DsRed2) transgenic zebrafish is an excellent tool for screening environmental chemicals with potential inflammatory effects through FACS-facilitated neutrophil counting. Copyright © 2018 Elsevier B.V. All rights reserved.

[Amiodarone-induced thyrotoxicosis].

PubMed

Bogazzi, Fausto; Tomisti, Luca; Di Bello, Vitantonio; Martino, Enio

2017-03-01

Amiodarone-induced thyroid dysfunction occurs in about 15-20% of patients under amiodarone therapy. Amiodarone-induced hypothyroidism (AIH) can develop in patients with an apparently normal thyroid gland or in those with an underlying chronic autoimmune thyroiditis. On a clinical ground, AIH is not challenging and can be easily treated with L-thyroxine therapy. Amiodarone-induced thyrotoxicosis (AIT) can occur in patients with (AIT 1) or without (AIT 2) an underlying thyroid disease. AIT 1 is a true iodine-induced hyperthyroidism occurring in patients with an underlying thyroid autonomy while AIT 2 is a drug-induced destructive thyroiditis. According to the different pathogenetic mechanism, AIT 2 is treated with glucocorticoids while AIT 1 usually responds to thionamides. Thyroidectomy should be considered when AIT represents an imminent risk for cardiac conditions, when patients require a prompt resolution of thyrotoxicosis or when they do not respond to the medical therapy. An effective collaboration between cardiologists and endocrinologists is crucial in each part of the management of AIT patients, including the evaluation of cardiological conditions with regard to thyroid hormone excess and whether, or not, it is necessary to continue amiodarone therapy.

Induction of p53-mediated apoptosis in splenocytes and thymocytes of C57BL/6 mice exposed to perfluorooctane sulfonate (PFOS)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dong, Guang-Hui, E-mail: ghdong@mail.cmu.edu.cn; Wang, Jing; Zhang, Ying-Hua

2012-10-15

Perfluorooctane sulfonate (PFOS) is a persistent environmental contaminant found in human and wildlife tissues. It has been reported that PFOS can cause atrophy of the immune organs and apoptosis of immunocytes in rodents. However, the mechanism behind such cause is still unclear. To understand the model of cell death and its mechanism on lymphoid cells in vivo, we conducted a dose/response experiment in which 4 groups of male adult C57BL/6 mice (12 mice per group) were dosed daily by oral gavage with PFOS at 0, 0.0167, 0.0833, or 0.8333 mg/kg/day, yielding targeted Total Administered Dose (TAD) of 0, 1, 5,more » or 50 mg PFOS/kg, respectively, over 60 days. The results showed that spleen and thymus weight were significantly reduced in the highest PFOS-dose-group (TAD 50 mg PFOS/kg) compared to the control group, whereas liver weight was significantly increased. We analyzed the cell death via apoptosis with an annexin-V/propidium iodide assay by flow cytometry, and observed that both the percentage of apoptosis and the expression of the pro-apoptotic proteins p53 in splenocytes and thymocytes increased in a dose-related manner after PFOS treatment. We also observed that PFOS induced p53-dependent apoptosis through the cooperation between the Bcl-xl down regulation without changing the Bcl-2 and Bax expression. The down regulation of Bcl-xl was strongly indicating mitochondrial involvement in apoptosis. It is confirmed by the release of cytochrome c and activation of caspase-3. All of these findings establish an important role of p53 and mitochondrial function in PFOS induced toxic environment in the host. -- Highlights: ► PFOS immunotoxicity is caused by induction of apoptosis via the p53 activation. ► PFOS exposure can induce down regulation of Bcl-xl. ► Mitochondria are involved in PFOS-induced apoptosis. ► PFOS exposure can cause the release of cytochrome c and activation of caspase-3.« less

Effects of metal compounds with distinct physicochemical properties on iron homeostasis and antibacterial activity in the lungs: chromium and vanadium.

PubMed

Cohen, Mitchell D; Sisco, Maureen; Prophete, Colette; Yoshida, Kotaro; Chen, Lung-chi; Zelikoff, Judith T; Smee, Jason; Holder, Alvin A; Stonehuerner, Jacqueline; Crans, Debbie C; Ghio, Andrew J

2010-02-01

In situ reactions of metal ions or their compounds are important mechanisms by which particles alter lung immune responses. The authors hypothesized that major determinants of the immunomodulatory effect of any metal include its redox behavior/properties, oxidation state, and/or solubility, and that the toxicities arising from differences in physicochemical parameters are manifest, in part, via differential shifts in lung iron (Fe) homeostasis. To test the hypotheses, immunomodulatory potentials for both pentavalent vanadium (VV; as soluble metavanadate or insoluble vanadium pentoxide) and hexavalent chromium (CrVI; as soluble sodium chromate or insoluble calcium chromate) were quantified in rats after inhalation (5h/day for 5 days) of each at 100 microg metal/m3. Differences in effects on local bacterial resistance between the two VV, and between each CrVI, agents suggested that solubility might be a determinant of in situ immunotoxicity. For the soluble forms, VV had a greater impact on resistance than CrVI, indicating that redox behavior/properties was likely also a determinant. The soluble VV agent was the strongest immunomodulant. Regarding Fe homeostasis, both VV agents had dramatic effects on airway Fe levels. Both also impacted local immune/airway epithelial cell Fe levels in that there were significant increases in production of select cytokines/chemokines whose genes are subject to regulation by HIF-1 (whose intracellular longevity is related to cell Fe status). Our findings contribute to a better understanding of the role that metal compound properties play in respiratory disease pathogenesis and provide a rationale for differing pulmonary immunotoxicities of commonly encountered ambient metal pollutants.

Metal(loid) levels in biological matrices from human populations exposed to mining contamination--Panasqueira Mine (Portugal).

PubMed

Coelho, Patrícia; Costa, Solange; Silva, Susana; Walter, Alan; Ranville, James; Sousa, Ana C A; Costa, Carla; Coelho, Marta; García-Lestón, Julia; Pastorinho, M Ramiro; Laffon, Blanca; Pásaro, Eduardo; Harrington, Chris; Taylor, Andrew; Teixeira, João Paulo

2012-01-01

Mining activities may affect the health of miners and communities living near mining sites, and these health effects may persist even when the mine is abandoned. During mining processes various toxic wastes are produced and released into the surrounding environment, resulting in contamination of air, drinking water, rivers, plants, and soils. In a geochemical sampling campaign undertaken in the Panasqueira Mine area of central Portugal, an anomalous distribution of several metals and arsenic (As) was identified in various environmental media. Several potentially harmful elements, including As, cadmium (Cd), chromium (Cr), manganese (Mn), nickel (Ni), lead (Pb), and selenium (Se), were quantified in blood, urine, hair, and nails (toe and finger) from a group of individuals living near the Panasqueira Mine who were environmentally and occupationally exposed. A group with similar demographic characteristics without known exposure to mining activities was also compared. Genotoxicity was evaluated by means of T-cell receptor (TCR) mutation assay, and percentages of different lymphocyte subsets were selected as immunotoxicity biomarkers. Inductively coupled plasma-mass spectrometry (ICP-MS) and inductively coupled plasma-atomic emission spectrometry (ICP-AES) analysis showed elevated levels of As, Cd, Cr, Mn, and Pb in all biological samples taken from populations living close to the mine compared to controls. Genotoxic and immunotoxic differences were also observed. The results provide evidence of an elevated potential risk to the health of populations, with environmental and occupational exposures resulting from mining activities. Further, the results emphasize the need to implement preventive measures, remediation, and rehabilitation plans for the region.

Inflammatory and oxidative stress-related effects associated with neurotoxicity are maintained after exclusively prenatal trichloroethylene exposure.

PubMed

Blossom, Sarah J; Melnyk, Stepan B; Li, Ming; Wessinger, William D; Cooney, Craig A

2017-03-01

Trichloroethylene (TCE) is a widespread environmental toxicant with immunotoxic and neurotoxic potential. Previous studies have shown that continuous developmental exposure to TCE encompassing gestation and early life as well as postnatal only exposure in the drinking water of MRL+/+ mice promoted CD4 + T cell immunotoxicity, glutathione depletion and oxidative stress in the cerebellum, as well increased locomotor activity in male offspring. The purpose of this study was to characterize the effects of exclusively prenatal exposure on these parameters. Another goal was to investigate potential plasma oxidative stress/inflammatory biomarkers to possibly be used as predictors of TCE-mediated neurotoxicity. In the current study, 6 week old male offspring of dams exposed gestationally to 0, 0.01, and 0.1mg/ml TCE in the drinking water were evaluated. Our results confirmed that the oxidized phenotype in plasma and cerebellum was maintained after exclusively prenatal exposure. A Phenotypic analysis by flow cytometry revealed that TCE exposure expanded the effector/memory subset of peripheral CD4 + T cells in association with increased production of pro-inflammatory cytokines IFN-γ and IL-17. Serum biomarkers of oxidative stress and inflammation were also elevated in plasma suggesting that systemic effects are important and may be used to predict neurotoxicity in our model. These results suggested that the prenatal period is a critical stage of life by which the developing CNS and immune system are susceptible to long-lasting changes mediated by TCE. Copyright © 2016 Elsevier B.V. All rights reserved.

Induced abortion in Taiwan.

PubMed

Wang, P D; Lin, R S

1995-04-01

Induced abortion is widely practised in Taiwan; however, it had been illegal until 1985. It was of interest to investigate induced abortion practices in Taiwan after its legalization in 1985 in order to calculate the prevalence rate and ratio of induced abortion to live births and to pregnancies in Taiwan. A study using questionnaires through personal interviews was conducted on more than seventeen thousand women who attended a family planning service in Taipei metropolitan areas between 1991 and 1992. The reproductive history and sexual behaviour of the subjects were especially focused on during the interviews. Preliminary findings showed that 46% of the women had a history of having had an induced abortion. Among them, 54.8% had had one abortion, 29.7% had had two, and 15.5% had had three or more. The abortion ratio was 379 induced abortions per 1,000 live births and 255 per 1,000 pregnancies. The abortion ratio was highest for women younger than 20 years of age, for aboriginal women and for nulliparous women. When logistic regression was used to control for confounding variables, we found that the number of previous live births is the strongest predictor relating to women seeking induced abortion. In addition, a significant positive association exists between increasing number of induced abortions and cervical dysplasia.

Study of cavitating inducer instabilities

NASA Technical Reports Server (NTRS)

Young, W. E.; Murphy, R.; Reddecliff, J. M.

1972-01-01

An analytic and experimental investigation into the causes and mechanisms of cavitating inducer instabilities was conducted. Hydrofoil cascade tests were performed, during which cavity sizes were measured. The measured data were used, along with inducer data and potential flow predictions, to refine an analysis for the prediction of inducer blade suction surface cavitation cavity volume. Cavity volume predictions were incorporated into a linearized system model, and instability predictions for an inducer water test loop were generated. Inducer tests were conducted and instability predictions correlated favorably with measured instability data.

Warfarin-induced Venous Limb Gangrene

PubMed Central

Grim Hostetler, Sarah; Sopkovich, Jennifer; Dean, Steven

2012-01-01

Warfarin is a commonly used anticoagulant that has been associated with several significant cutaneous side effects, most notably warfarin-induced skin necrosis. A lesser known adverse reaction to warfarin is warfarin-induced venous limb gangrene. Both cutaneous adverse effects share the same pathophysiology, but are clinically quite different. The majority of cases of warfarin-induced venous limb gangrene has been in patients with cancer or heparin-induced thrombocytopenia. However, other hypercoagulable disease states, such as the antiphospholipid antibody syndrome, can be associated with venous limb gangrene. In order to increase recognition of this important condition, the authors report a case of warfarin-induced venous limb gangrene in a patient with presumed antiphospholipid antibody syndrome and review the literature on warfarin-induced venous limb gangrene. PMID:23198012

Plant Immunity Inducer Development and Application.

PubMed

Dewen, Qiu; Yijie, Dong; Yi, Zhang; Shupeng, Li; Fachao, Shi

2017-05-01

Plant immunity inducers represent a new and rapidly developing field in plant-protection research. In this paper, we discuss recent research on plant immunity inducers and their development and applications in China. Plant immunity inducers include plant immunity-inducing proteins, chitosan oligosaccharides, and microbial inducers. These compounds and microorganisms can trigger defense responses and confer disease resistance in plants. We also describe the mechanisms of plant immunity inducers and how they promote plant health. Furthermore, we summarize the current situation in plant immunity inducer development in China and the global marketplace. Finally, we also deeply analyze the development trends and application prospects of plant immunity inducers in environmental protection and food safety.

Validating induced seismicity forecast models—Induced Seismicity Test Bench

NASA Astrophysics Data System (ADS)

Király-Proag, Eszter; Zechar, J. Douglas; Gischig, Valentin; Wiemer, Stefan; Karvounis, Dimitrios; Doetsch, Joseph

2016-08-01

Induced earthquakes often accompany fluid injection, and the seismic hazard they pose threatens various underground engineering projects. Models to monitor and control induced seismic hazard with traffic light systems should be probabilistic, forward-looking, and updated as new data arrive. In this study, we propose an Induced Seismicity Test Bench to test and rank such models; this test bench can be used for model development, model selection, and ensemble model building. We apply the test bench to data from the Basel 2006 and Soultz-sous-Forêts 2004 geothermal stimulation projects, and we assess forecasts from two models: Shapiro and Smoothed Seismicity (SaSS) and Hydraulics and Seismics (HySei). These models incorporate a different mix of physics-based elements and stochastic representation of the induced sequences. Our results show that neither model is fully superior to the other. Generally, HySei forecasts the seismicity rate better after shut-in but is only mediocre at forecasting the spatial distribution. On the other hand, SaSS forecasts the spatial distribution better and gives better seismicity rate estimates before shut-in. The shut-in phase is a difficult moment for both models in both reservoirs: the models tend to underpredict the seismicity rate around, and shortly after, shut-in.

Injection-induced earthquakes

USGS Publications Warehouse

Ellsworth, William L.

2013-01-01

Earthquakes in unusual locations have become an important topic of discussion in both North America and Europe, owing to the concern that industrial activity could cause damaging earthquakes. It has long been understood that earthquakes can be induced by impoundment of reservoirs, surface and underground mining, withdrawal of fluids and gas from the subsurface, and injection of fluids into underground formations. Injection-induced earthquakes have, in particular, become a focus of discussion as the application of hydraulic fracturing to tight shale formations is enabling the production of oil and gas from previously unproductive formations. Earthquakes can be induced as part of the process to stimulate the production from tight shale formations, or by disposal of wastewater associated with stimulation and production. Here, I review recent seismic activity that may be associated with industrial activity, with a focus on the disposal of wastewater by injection in deep wells; assess the scientific understanding of induced earthquakes; and discuss the key scientific challenges to be met for assessing this hazard.

The mechanism of dioxin toxicity: relationship to risk assessment.

PubMed Central

Birnbaum, L S

1994-01-01

Risk characterization involves hazard identification, determination of dose-response relationships, and exposure assessment. Improvement of the risk assessment process requires inclusion of the best available science. Recent findings in the area of dioxin toxicity have led to a major effort to reassess its risk. 2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD), commonly referred to as "dioxin," is the most toxic member of a class of related chemicals including the polyhalogenated dibenzo-p-dioxins, dibenzofurans, biphenyls, naphthalenes, azo- and azoxy-benzenes, whose toxicities can be expressed as fractional equivalencies of TCDD. These chemicals exert their effects through interaction with a specific intracellular protein, the Ah receptor. While binding to the receptor is necessary, it is not sufficient to bring about a chain of events leading to various responses including enzyme induction, immunotoxicity, reproductive and endocrine effects, developmental toxicity, chloracne, tumor promotion, etc. Some of these responses appear to be linear at low doses. Immunotoxicity and effects on the reproductive system appear to be among the most sensitive responses. The Ah receptor functions as a transcriptional enhancer, interacting with a number of other regulatory proteins (heat shock proteins, kinases, translocases, DNA binding species). Interaction with specific base sequences in the DNA appear to be modulated by the presence of other growth factors, hormones and their receptors as well as other regulatory proteins. Thus, dioxin appears to function as a hormone, initiating a cascade of events that is dependent upon the environment of each cell and tissue. While Ah receptor variants exist, all vertebrates examined have demonstrated such a protein with similar numbers of receptors and binding affinity for TCDD. Most species respond similarly to dioxin and related compounds. While a given species may be an outlier for a given response, it will behave like other animals for

Second-order nonlinearity induced transparency.

PubMed

Zhou, Y H; Zhang, S S; Shen, H Z; Yi, X X

2017-04-01

In analogy to electromagnetically induced transparency, optomechanically induced transparency was proposed recently in [Science330, 1520 (2010)SCIEAS0036-807510.1126/science.1195596]. In this Letter, we demonstrate another form of induced transparency enabled by second-order nonlinearity. A practical application of the second-order nonlinearity induced transparency is to measure the second-order nonlinear coefficient. Our scheme might find applications in quantum optics and quantum information processing.

An evaluation of a hubless inducer and a full flow hydraulic turbine driven inducer boost pump

NASA Technical Reports Server (NTRS)

Lindley, B. K.; Martinson, A. R.

1971-01-01

The purpose of the study was to compare the performance of several configurations of hubless inducers with a hydrodynamically similar conventional inducer and to demonstrate the performance of a full flow hydraulic turbine driven inducer boost pump using these inducers. A boost pump of this type consists of an inducer connected to a hydraulic turbine with a high speed rotor located in between. All the flow passes through the inducer, rotor, and hydraulic turbine, then into the main pump. The rotor, which is attached to the main pump shaft, provides the input power to drive the hydraulic turbine which, in turn, drives the inducer. The inducer, rotating at a lower speed, develops the necessary head to prevent rotor cavitation. The rotor speed is consistent with present main engine liquid hydrogen pump designs and the overall boost pump head rise is sufficient to provide adequate main pump suction head. This system would have the potential for operating at lower liquid hydrogen tank pressures.

Effects of scallop shell extract on scopolamine-induced memory impairment and MK801-induced locomotor activity.

PubMed

Hasegawa, Yasushi; Inoue, Tatsuro; Kawaminami, Satoshi; Fujita, Miho

2016-07-01

To evaluate the neuroprotective effects of the organic components of scallop shells (scallop shell extract) on memory impairment and locomotor activity induced by scopolamine or 5-methyl-10,11-dihydro-5H-dibenzo (a,d) cyclohepten-5,10-imine (MK801). Effect of the scallop shell extract on memory impairment and locomotor activity was investigated using the Y-maze test, the Morris water maze test, and the open field test. Scallop shell extract significantly reduced scopolamine-induced short-term memory impairment and partially reduced scopolamine-induced spatial memory impairment in the Morris water maze test. Scallop shell extract suppressed scopolamine-induced elevation of acetylcholine esterase activity in the cerebral cortex. Treatment with scallop shell extract reversed the increase in locomotor activity induced by scopolamine. Scallop shell extract also suppressed the increase in locomotor activity induced by MK801. Our results provide initial evidence that scallop shell extract reduces scopolamine-induced memory impairment and suppresses MK-801-induced hyperlocomotion. Copyright © 2016 Hainan Medical College. Production and hosting by Elsevier B.V. All rights reserved.

[Drug induced diarrhea].

PubMed

Morard, Isabelle; Hadengue, Antoine

2008-09-03

Diarrhea is a frequent adverse event involving the most frequently antibiotics, laxatives and NSAI. Drug induced diarrhea may be acute or chronic. It may be due to expected, dose dependant properties of the drug, to immuno-allergic or bio-genomic mechanisms. Several pathophysiological mechanisms have been described resulting in osmotic, secretory or inflammatory diarrhea, shortened transit time, or malabsorption. Histopathological lesions sometimes associated with drug induced diarrhea are usually non specific and include ulcerations, inflammatory or ischemic lesions, fibrous diaphragms, microscopic colitis and apoptosis. The diagnosis of drug induced diarrhea, sometimes difficult to assess, relies on the absence of other obvious causes and on the rapid disappearance of the symptoms after withdrawal of the suspected drug.

Drug-Induced Urinary Calculi

PubMed Central

Matlaga, Brian R; Shah, Ojas D; Assimos, Dean G

2003-01-01

Urinary calculi may be induced by a number of medications used to treat a variety of conditions. These medications may lead to metabolic abnormalities that facilitate the formation of stones. Drugs that induce metabolic calculi include loop diuretics; carbonic anhydrase inhibitors; and laxatives, when abused. Correcting the metabolic abnormality may eliminate or dramatically attenuate stone activity. Urinary calculi can also be induced by medications when the drugs crystallize and become the primary component of the stones. In this case, urinary supersaturation of the agent may promote formation of the calculi. Drugs that induce calculi via this process include magnesium trisilicate; ciprofloxacin; sulfa medications; triamterene; indinavir; and ephedrine, alone or in combination with guaifenesin. When this situation occurs, discontinuation of the medication is usually necessary. PMID:16985842

Quantum-rotor-induced polarization.

PubMed

Meier, Benno

2018-07-01

Quantum-rotor-induced polarization is closely related to para-hydrogen-induced polarization. In both cases, the hyperpolarized spin order derives from rotational interaction and the Pauli principle by which the symmetry of the rotational ground state dictates the symmetry of the associated nuclear spin state. In quantum-rotor-induced polarization, there may be several spin states associated with the rotational ground state, and the hyperpolarization is typically generated by hetero-nuclear cross-relaxation. This review discusses preconditions for quantum-rotor-induced polarization for both the 1-dimensional methyl rotor and the asymmetric rotor H 2 17 O@C 60 , that is, a single water molecule encapsulated in fullerene C 60 . Experimental results are presented for both rotors. Copyright © 2018 John Wiley & Sons, Ltd.

Effect of baclofen on morphine-induced conditioned place preference, extinction, and stress-induced reinstatement in chronically stressed mice.

PubMed

Meng, Shanshan; Quan, Wuxing; Qi, Xu; Su, Zhiqiang; Yang, Shanshan

2014-01-01

A stress-induced increase in excitability can result from a reduction in inhibitory neurotransmission. Modulation of gamma-aminobutyric acid (GABA)ergic transmission is an effective treatment for drug seeking and relapse. This study investigated whether baclofen, a GABA(B) receptor agonist, had an impact on morphine-induced conditioned place preference (CPP), extinction, and stress-induced relapse in chronically stressed mice. Chronic stress was induced by restraining mice for 2 h for seven consecutive days. We first investigated whether chronic stress influenced morphine-induced CPP, extinction, and stress-induced relapse in the stressed mice. Next, we investigated whether three different doses of baclofen influenced chronic stress as measured by the expression of morphine-induced CPP. We chose the most effective dose for subsequent extinction and reinstatement experiments. Reinstatement of morphine-induced CPP was induced by a 6-min forced swim stress. Locomotor activity was also measured for each test. Chronic stress facilitated the expression of morphine-induced CPP and prolonged extinction time. Forced swim stress primed the reinstatement of morphine-induced CPP in mice. Baclofen treatment affected the impact of chronic stress on different phases of morphine-induced CPP. Our results showed that baclofen antagonized the effects of chronic stress on morphine-induced CPP. These findings suggest the potential clinical utility of GABA(B) receptor-positive modulators as an anti-addiction agent in people suffering from chronic stress.

Health Impacts of Estrogens in the Environment, Considering Complex Mixture Effects

PubMed Central

Filby, Amy L.; Neuparth, Teresa; Thorpe, Karen L.; Owen, Richard; Galloway, Tamara S.; Tyler, Charles R.

2007-01-01

Background Environmental estrogens in wastewater treatment work (WwTW) effluents are well established as the principal cause of reproductive disruption in wild fish populations, but their possible role in the wider health effects of effluents has not been established. Objectives We assessed the contribution of estrogens to adverse health effects induced in a model fish species by exposure to WwTW effluents and compared effects of an estrogen alone and as part of a complex mixture (i.e., spiked into effluent). Methods Growth, genotoxic, immunotoxic, metabolic, and endocrine (feminized) responses were compared in fathead minnows (Pimephales promelas) exposed for 21 days to a potent estrogenic effluent, a weakly estrogenic effluent before and after spiking with a steroidal estrogen [17α-ethinyl-estradiol (EE2)], and to EE2 alone. Results In addition to endocrine disruption, effluent exposure induced genotoxic damage, modulated immune function, and altered metabolism; many of these effects were elicited in a sex-specific manner and were proportional to the estrogenic potencies of the effluents. A key finding was that some of the responses to EE2 were modified when it was present in a complex mixture (i.e., spiked into effluent), suggesting that mixture effects may not be easily modeled for effluent discharges or when the chemicals impact on a diverse array of biological axes. Conclusion These data reveal a clear link between estrogens present in effluents and diverse, adverse, and sex-related health impacts. Our findings also highlight the need for an improved understanding of interactive effects of chemical toxicants on biological systems for understanding health effects of environmental mixtures. PMID:18087587

Troglitazone induced apoptosis via PPARγ activated POX-induced ROS formation in HT29 cells.

PubMed

Wang, Jing; Lv, XiaoWen; Shi, JiePing; Hu, XiaoSong; DU, YuGuo

2011-08-01

In order to investigate the potential mechanisms in troglitazone-induced apoptosis in HT29 cells, the effects of PPARγ and POX-induced ROS were explored. [3- (4, 5)-dimethylthiazol-2-yl]-2, 5-diphenyltetrazolium bromide (MTT) assay, Annexin V and PI staining using FACS, plasmid transfection, ROS formation detected by DCFH staining, RNA interference, RT-PCR & RT-QPCR, and Western blotting analyses were employed to investigate the apoptotic effect of troglitazone and the potential role of PPARγ pathway and POX-induced ROS formation in HT29 cells. Troglitazone was found to inhibit the growth of HT29 cells by induction of apoptosis. During this process, mitochondria related pathways including ROS formation, POX expression and cytochrome c release increased, which were inhibited by pretreatment with GW9662, a specific antagonist of PPARγ. These results illustrated that POX upregulation and ROS formation in apoptosis induced by troglitazone was modulated in PPARγ-dependent pattern. Furthermore, the inhibition of ROS and apoptosis after POX siRNA used in troglitazone-treated HT29 cells indicated that POX be essential in the ROS formation and PPARγ-dependent apoptosis induced by troglitazone. The findings from this study showed that troglitazone-induced apoptosis was mediated by POX-induced ROS formation, at least partly, via PPARγ activation. Copyright © 2011 The Editorial Board of Biomedical and Environmental Sciences. Published by Elsevier B.V. All rights reserved.

High repetition rate laser induced fluorescence applied to Surfatron Induced Plasmas

NASA Astrophysics Data System (ADS)

van der Mullen, J. J. A. M.; Palomares, J. M.; Carbone, E. A. D.; Graef, W.; Hübner, S.

2012-05-01

The reaction kinetics in the excitation space of Ar and the conversion space of Ar-molecule mixtures are explored using a combination of high rep-rate YAG-Dye laser systems with a well defined and easily controllable Surfatron Induced Plasma set-up. Applying the method of Saturation Time Resolved Laser Induced Fluorescence (SaTiRe-LIF), we could trace excitation and conversion channels and determine rates of electron and heavy particle excitation kinetics. The time resolved density disturbances observed in the Ar excitation space, which are initiated by the laser, reveal the excitation channels and corresponding rates; responses of the molecular radiation in Ar-molecule mixtures corresponds to the presence of conversion processes induced by heavy particle excitation kinetics.

Space Station Induced Monitoring

NASA Technical Reports Server (NTRS)

Spann, James F. (Editor); Torr, Marsha R. (Editor)

1988-01-01

This report contains the results of a conference convened May 10-11, 1988, to review plans for monitoring the Space Station induced environment, to recommend primary components of an induced environment monitoring package, and to make recommendations pertaining to suggested modifications of the Space Station External Contamination Control Requirements Document JSC 30426. The contents of this report are divided as Follows: Monitoring Induced Environment - Space Station Work Packages Requirements, Neutral Environment, Photon Emission Environment, Particulate Environment, Surface Deposition/Contamination; and Contamination Control Requirements.

Differences between Drug-Induced and Contrast Media-Induced Adverse Reactions Based on Spontaneously Reported Adverse Drug Reactions.

PubMed

Ryu, JiHyeon; Lee, HeeYoung; Suh, JinUk; Yang, MyungSuk; Kang, WonKu; Kim, EunYoung

2015-01-01

We analyzed differences between spontaneously reported drug-induced (not including contrast media) and contrast media-induced adverse reactions. Adverse drug reactions reported by an in-hospital pharmacovigilance center (St. Mary's teaching hospital, Daejeon, Korea) from 2010-2012 were classified as drug-induced or contrast media-induced. Clinical patterns, frequency, causality, severity, Schumock and Thornton's preventability, and type A/B reactions were recorded. The trends among causality tools measuring drug and contrast-induced adverse reactions were analyzed. Of 1,335 reports, 636 drug-induced and contrast media-induced adverse reactions were identified. The prevalence of spontaneously reported adverse drug reaction-related admissions revealed a suspected adverse drug reaction-reporting rate of 20.9/100,000 (inpatient, 0.021%) and 3.9/100,000 (outpatients, 0.004%). The most common adverse drug reaction-associated drug classes included nervous system agents and anti-infectives. Dermatological and gastrointestinal adverse drug reactions were most frequently and similarly reported between drug and contrast media-induced adverse reactions. Compared to contrast media-induced adverse reactions, drug-induced adverse reactions were milder, more likely to be preventable (9.8% vs. 1.1%, p < 0.001), and more likely to be type A reactions (73.5% vs. 18.8%, p < 0.001). Females were over-represented among drug-induced adverse reactions (68.1%, p < 0.001) but not among contrast media-induced adverse reactions (56.6%, p = 0.066). Causality patterns differed between the two adverse reaction classes. The World Health Organization-Uppsala Monitoring Centre causality evaluation and Naranjo algorithm results significantly differed from those of the Korean algorithm version II (p < 0.001). We found differences in sex, preventability, severity, and type A/B reactions between spontaneously reported drug and contrast media-induced adverse reactions. The World Health Organization

Differences between Drug-Induced and Contrast Media-Induced Adverse Reactions Based on Spontaneously Reported Adverse Drug Reactions

PubMed Central

Suh, JinUk; Yang, MyungSuk; Kang, WonKu; Kim, EunYoung

2015-01-01

Objective We analyzed differences between spontaneously reported drug-induced (not including contrast media) and contrast media-induced adverse reactions. Methods Adverse drug reactions reported by an in-hospital pharmacovigilance center (St. Mary’s teaching hospital, Daejeon, Korea) from 2010–2012 were classified as drug-induced or contrast media-induced. Clinical patterns, frequency, causality, severity, Schumock and Thornton’s preventability, and type A/B reactions were recorded. The trends among causality tools measuring drug and contrast-induced adverse reactions were analyzed. Results Of 1,335 reports, 636 drug-induced and contrast media-induced adverse reactions were identified. The prevalence of spontaneously reported adverse drug reaction-related admissions revealed a suspected adverse drug reaction-reporting rate of 20.9/100,000 (inpatient, 0.021%) and 3.9/100,000 (outpatients, 0.004%). The most common adverse drug reaction-associated drug classes included nervous system agents and anti-infectives. Dermatological and gastrointestinal adverse drug reactions were most frequently and similarly reported between drug and contrast media-induced adverse reactions. Compared to contrast media-induced adverse reactions, drug-induced adverse reactions were milder, more likely to be preventable (9.8% vs. 1.1%, p < 0.001), and more likely to be type A reactions (73.5% vs. 18.8%, p < 0.001). Females were over-represented among drug-induced adverse reactions (68.1%, p < 0.001) but not among contrast media-induced adverse reactions (56.6%, p = 0.066). Causality patterns differed between the two adverse reaction classes. The World Health Organization–Uppsala Monitoring Centre causality evaluation and Naranjo algorithm results significantly differed from those of the Korean algorithm version II (p < 0.001). Conclusions We found differences in sex, preventability, severity, and type A/B reactions between spontaneously reported drug and contrast media-induced adverse

Ecological impacts of the Deepwater Horizon oil spill: implications for immunotoxicity

EPA Science Inventory

Summary of major Federal and multi-stake holder research efforts in response to the DWH spill, including laboratory oil dispersant testing, estimation of oil release rates and oil fate calculations, subsea monitoring, and post-spill assessments. Impacts from shoreline oiling, wil...

Induced Pluripotency and Epigenetic Reprogramming

PubMed Central

Hochedlinger, Konrad; Jaenisch, Rudolf

2015-01-01

SUMMARY Induced pluripotency defines the process by which somatic cells are converted into induced pluripotent stem cells (iPSCs) upon overexpression of a small set of transcription factors. In this article, we put transcription factor–induced pluripotency into a historical context, review current methods to generate iPSCs, and discuss mechanistic insights that have been gained into the process of reprogramming. In addition, we focus on potential therapeutic applications of induced pluripotency and emerging technologies to efficiently engineer the genomes of human pluripotent cells for scientific and therapeutic purposes. PMID:26626939

Drug-Induced Hyperglycaemia and Diabetes.

PubMed

Fathallah, Neila; Slim, Raoudha; Larif, Sofien; Hmouda, Houssem; Ben Salem, Chaker

2015-12-01

Drug-induced hyperglycaemia and diabetes is a global issue. It may be a serious problem, as it increases the risk of microvascular and macrovascular complications, infections, metabolic coma and even death. Drugs may induce hyperglycaemia through a variety of mechanisms, including alterations in insulin secretion and sensitivity, direct cytotoxic effects on pancreatic cells and increases in glucose production. Antihypertensive drugs are not equally implicated in increasing serum glucose levels. Glycaemic adverse events occur more frequently with thiazide diuretics and with certain beta-blocking agents than with calcium-channel blockers and inhibitors of the renin-angiotensin system. Lipid-modifying agents may also induce hyperglycaemia, and the diabetogenic effect seems to differ between the different types and daily doses of statins. Nicotinic acid may also alter glycaemic control. Among the anti-infectives, severe life-threatening events have been reported with fluoroquinolones, especially when high doses are used. Protease inhibitors and, to a lesser extent, nucleoside reverse transcriptase inhibitors have been reported to induce alterations in glucose metabolism. Pentamidine-induced hyperglycaemia seems to be related to direct dysfunction in pancreatic cells. Phenytoin and valproic acid may also induce hyperglycaemia. The mechanisms of second-generation antipsychotic-associated hyperglycaemia, diabetes mellitus and ketoacidosis are complex and are mainly due to insulin resistance. Antidepressant agents with high daily doses seem to be more frequently associated with an increased risk of diabetes. Ketoacidosis may occur in patients receiving beta-adrenergic stimulants, and theophylline may also induce hyperglycaemia. Steroid diabetes is more frequently associated with high doses of glucocorticoids. Some chemotherapeutic agents carry a higher risk of hyperglycaemia, and calcineurin inhibitor-induced hyperglycaemia is mainly due to a decrease in insulin secretion

Drug-induced apnea.

PubMed

Boutroy, M J

1994-01-01

Drugs have been in the past and will in the future still be liable to induce apnea in neonates, infants and older children. At these different stages of development, the child may be abnormally vulnerable to respiratory disorders and apnea, and doses of drugs, without any abnormal side effects in adult patients, can be harmful in younger subjects. Drugs responsible for apnea during development are numerous, but more than half of the problems are induced by sedatives and hypnotics, among which phenothiazines, barbiturates, benzodiazepines (included transplacentally acquired) and general anesthetics are a few. Other pharmacological families are apnea inducers in the neonatal period and childhood: analgesics and opioid narcotics, agents acting at the levels of neuromuscular function and autonomic ganglia, and cardiovascular agents. The pathogenesis of these apneas depends on the disturbance of any mechanism responsible for the respiratory activity: medullary centers and brain stem structures, afferent influx to CNS, sleep stages, upper airways, lungs and respiratory muscles. At key stages such as birth and infancy, drugs may emphasize the particular sensitivity of the mechanisms responsible for inducing apnea. This might explain unexpected respiratory disorders during development.

Epidemics of mold poisoning past and present.

PubMed

Meggs, William J

2009-01-01

Molds are ubiquitous throughout the biosphere of planet earth and cause infectious, allergic, and toxic diseases. Toxic diseases arise from exposure to mycotoxins produced by molds. Throughout history, there have been a number of toxic epidemics associated with exposure to mycotoxins. Acute epidemics of ergotism are caused by consumption of grain infested by fungi of the genus Claviceps, which produce the bioactive amine ergotamine that mimics the neurotransmitters norepinephrine, serotonin, and dopamine. Acute aflatoxin outbreaks have occurred from ingestion of corn stored in damp conditions that potentiate growth of the molds of the species Aspergillus. Contemporary construction methods that use cellulose substrates such as fiber board and indoor moisture have caused an outbreak of contaminated buildings with Stachybotrys chartarum, with the extent of health effects still a subject of debate and ongoing research. This article reviews several of the more prominent epidemics and discusses the nature of the toxins. Two diseases that were leading causes of childhood mortality in England in the 1970s and vanished with changing dietary habits, putrid malignant fever, and slow nervous fever were most likely toxic mold epidemics.

Drug-Induced Metabolic Acidosis

PubMed Central

Pham, Amy Quynh Trang; Xu, Li Hao Richie; Moe, Orson W.

2015-01-01

Metabolic acidosis could emerge from diseases disrupting acid-base equilibrium or from drugs that induce similar derangements. Occurrences are usually accompanied by comorbid conditions of drug-induced metabolic acidosis, and clinical outcomes may range from mild to fatal. It is imperative that clinicians not only are fully aware of the list of drugs that may lead to metabolic acidosis but also understand the underlying pathogenic mechanisms. In this review, we categorized drug-induced metabolic acidosis in terms of pathophysiological mechanisms, as well as individual drugs’ characteristics. PMID:26918138

Immunosuppression in harbour seals fed fish from the contaminated Baltic Sea

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ross, P.S.; Swart, R.L. de; Timmerman, H.H.

Environmental contaminants including dioxins and polychlorinated biphenyls have been shown to be immunotoxic in laboratory animals, but little information exists as to their possible effect on mammals in the natural environment. Recent virus-induced mass mortalities among marine mammals occupying high trophic levels have led to much speculation regarding a possible contributory role of pollutants in these events. The authors undertook a two-year captive feeding experiment with harbor seals, Phoca vitulina, where one group was fed herring from the contaminated Baltic Sea and a second group was fed relatively uncontaminated herring from the Atlantic Ocean. During the course of the experiment,more » they regularly sampled blood and undertook a series of immune function tests. They observed a significant impairment of natural killer cell activity and T-lymphocyte function, in vitro, in the group of seals fed the Baltic Sea fish. In addition, seals of this group were less able to mount a specific humoral and delayed type hypersensitivity response to a protein antigen, ovalbumin, upon immunization. Increased numbers of granulocytes in this group may have reflected periodic bacterial infections as a consequence of impaired immune function. Their results suggest that pollutants accumulated through the food chain in contaminated marine waters may suppress normal immune responses in marine mammals and lead to an increased susceptibility to opportunistic infection.« less

Real and Perceived Risks for Mycotoxin Contamination in Foods and Feeds: Challenges for Food Safety Control

PubMed Central

Milićević, Dragan R.; Škrinjar, Marija; Baltić, Tatjana

2010-01-01

Mycotoxins are toxic compounds, produced by the secondary metabolism of toxigenic moulds in the Aspergillus, Alternaria, Claviceps, Fusarium, Penicillium and Stachybotrys genera occurring in food and feed commodities both pre- and post-harvest. Adverse human health effects from the consumption of mycotoxins have occurred for many centuries. When ingested, mycotoxins may cause a mycotoxicosis which can result in an acute or chronic disease episode. Chronic conditions have a much greater impact, numerically, on human health in general, and induce diverse and powerful toxic effects in test systems: some are carcinogenic, mutagenic, teratogenic, estrogenic, hemorrhagic, immunotoxic, nephrotoxic, hepatotoxic, dermotoxic and neurotoxic. Although mycotoxin contamination of agricultural products still occurs in the developed world, the application of modern agricultural practices and the presence of a legislatively regulated food processing and marketing system have greatly reduced mycotoxin exposure in these populations. However, in developing countries, where climatic and crop storage conditions are frequently conducive to fungal growth and mycotoxin production, much of the population relies on subsistence farming or on unregulated local markets. Therefore both producers and governmental control authorities are directing their efforts toward the implementation of a correct and reliable evaluation of the real status of contamination of a lot of food commodity and, consequently, of the impact of mycotoxins on human and animal health. PMID:22069600

Fluorinated Compounds in US Fast Food Packaging | Science ...

EPA Pesticide Factsheets

Per- and polyfluoroalkyl substances (PFASs) are highly persistent synthetic chemicals, some of which have been associated with cancer, developmental toxicity, immunotoxicity, and other health effects. PFASs in grease-resistant food packaging can leach into food and increase dietary exposure. We collected ∼400 samples of food contact papers, paperboard containers, and beverage containers from fast food restaurants throughout the United States and measured total fluorine using particle-induced γ-ray emission (PIGE) spectroscopy. PIGE can rapidly and inexpensively measure total fluorine in solid-phase samples. We found that 46% of food contact papers and 20% of paperboard samples contained detectable fluorine (>16 nmol/cm2). Liquid chromatography/high-resolution mass spectrometry analysis of a subset of 20 samples found perfluorocarboxylates, perfluorosulfonates, and other known PFASs and/or unidentified polyfluorinated compounds (based on nontargeted analysis). The total peak area for PFASs was higher in 70% of samples (10 of 14) with a total fluorine level of >200 nmol/cm2 compared to six samples with a total fluorine level of <16 nmol/cm2. Samples with high total fluorine levels but low levels of measured PFASs may contain volatile PFASs, PFAS polymers, newer replacement PFASs, or other fluorinated compounds. The prevalence of fluorinated chemicals in fast food packaging demonstrates their potentially significant contribution to dietary PFAS exposure and envi

Sunset yellow FCF, a permitted food dye, alters functional responses of splenocytes at non-cytotoxic dose.

PubMed

Yadav, Ashish; Kumar, Arvind; Tripathi, Anurag; Das, Mukul

2013-03-13

Sunset yellow FCF (SY), a permitted food color, is extensively used in various food preparations and quite often exceeds the permissible levels (100-200 mg/kg). Several toxicity studies on SY are reported, however immunomodulatory properties have not been explored yet. To investigate the immunotoxic properties of SY, splenocytes were isolated, cultured and subjected to mitogen stimulated proliferation assay (lipopolysaccharide, LPS or concanavalin A, Con A), mixed lymphocyte reaction (MLR) assay, immunophenotypic analysis of cell surface receptor expression and assay for cytokines release in the culture supernatants were performed in the presence of SY. Since SY did not exhibit any cytotoxicity up to 250 μg/ml, this dose was used for further studies. It was observed that SY (250 μg/ml) significantly (p<0.05) suppressed the mitogen induced proliferation of splenocytes and MLR response. Further, immunophenotypic analysis revealed that SY alters the relative expression of CD3e/CD4/CD8 in T cells and CD19 in B-cells. Consistent with the suppression of T-cell and B-cell responses and altered surface receptor expression, SY also lowered the expression of IL2, IL4, IL6, IL-17, IFN-γ and TNF-α cytokines. These results suggest that non-cytotoxic dose of SY may have immunomodulatory effects. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

Effect of tributyltin on antioxidant ability and immune responses of zebrafish (Danio rerio).

PubMed

Zhang, Chun-Nuan; Zhang, Ji-Liang; Ren, Hong-Tao; Zhou, Bian-Hua; Wu, Qiu-Jue; Sun, Ping

2017-04-01

Tributyltin (TBT) is a toxic compound released into aquatic ecosystems through antifouling paints. This study was designed to examine the effects of TBT on antioxidant ability and immune responses of zebrafish (Danio rerio). Three hundred sixty healthy zebrafish were randomly grouped into four groups and exposed to different doses of TBT (0, 1, 10 and 100ngL -1 ). At the end of 8 weeks, the fish were sampled, and antioxidant capability, immune parameters and immune-related genes were assessed. The results showed that with an increase in TBT dose, the concentration of malonaldehyde in the liver was significantly increased (p<0.05), whereas the activities of total superoxide dismutase, catalase and glutathione peroxidase were significantly decreased (p<0.05) compared to the control. The activity and expression of lysozyme and the content of immunoglobulin M were significantly decreased compared to those of the fish exposed to 0ngL -1 TBT (p<0.05). However, the expression of the HSP70, HSP90, tumor necrosis factor-α(TNF-α), interleukins (IL-1β, IL-6), and nuclear factor-kappa B p65 (NF-κ B p65) genes were all enhanced with an increase in TBT dose. The results indicated that TBT induced oxidative stress and had immunotoxic effects on zebrafish. Copyright © 2016 Elsevier Inc. All rights reserved.

Suppression of humoral immune responses by 2,3,7,8-tetrachlorodibenzo-p-dioxin intercalated in smectite clay.

PubMed

Boyd, Stephen A; Johnston, Cliff T; Pinnavaia, Thomas J; Kaminski, Norbert E; Teppen, Brian J; Li, Hui; Khan, Bushra; Crawford, Robert B; Kovalova, Natalia; Kim, Seong-Su; Shao, Hua; Gu, Cheng; Kaplan, Barbara L F

2011-12-01

2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD) is a highly toxic environmental contaminant found in soils and sediments. Because of its exceptionally low water solubility, this compound exists predominantly in the sorbed state in natural environments. Clay minerals, especially expandable smectite clays, are one of the major component geosorbents in soils and sediments that can function as an effective adsorbent for environmental dioxins, including TCDD. In this study, TCDD was intercalated in the smectite clay saponite by an incipient wetness method. The primary goal of this study was to intercalate TCDD in natural K-saponite clay and evaluate its immunotoxic effects in vivo. The relative bioavailability of TCDD was evaluated by comparing the metabolic activity of TCDD administered in the adsorbed state as an intercalate in saponite and freely dissolved in corn oil. This comparison revealed nearly identical TCDD-induced suppression of humoral immunity, a well-established and sensitive sequela, in a mammalian (mouse) model. This result suggests that TCDD adsorbed by clays is likely to be available for biouptake and biodistribution in mammals, consistent with previous observations of TCDD in livestock exposed to dioxin-contaminated ball clays that were used as feed additives. Adsorption of TCDD by clay minerals does not appear to mitigate risk associated with TCDD exposure substantially. Copyright © 2011 SETAC.

Engineered hybrid spider silk particles as delivery system for peptide vaccines.

PubMed

Lucke, Matthias; Mottas, Inès; Herbst, Tina; Hotz, Christian; Römer, Lin; Schierling, Martina; Herold, Heike M; Slotta, Ute; Spinetti, Thibaud; Scheibel, Thomas; Winter, Gerhard; Bourquin, Carole; Engert, Julia

2018-07-01

The generation of strong T-cell immunity is one of the main challenges for the development of successful vaccines against cancer and major infectious diseases. Here we have engineered spider silk particles as delivery system for a peptide-based vaccination that leads to effective priming of cytotoxic T-cells. The recombinant spider silk protein eADF4(C16) was fused to the antigenic peptide from ovalbumin, either without linker or with a cathepsin cleavable peptide linker. Particles prepared from the hybrid proteins were taken up by dendritic cells, which are essential for T-cell priming, and successfully activated cytotoxic T-cells, without signs of immunotoxicity or unspecific immunostimulatory activity. Upon subcutaneous injection in mice, the particles were taken up by dendritic cells and accumulated in the lymph nodes, where immune responses are generated. Particles from hybrid proteins containing a cathepsin-cleavable linker induced a strong antigen-specific proliferation of cytotoxic T-cells in vivo, even in the absence of a vaccine adjuvant. We thus demonstrate the efficacy of a new vaccine strategy using a protein-based all-in-one vaccination system, where spider silk particles serve as carriers with an incorporated peptide antigen. Our study further suggests that engineered spider silk-based vaccines are extremely stable, easy to manufacture, and readily customizable. Copyright © 2018 Elsevier Ltd. All rights reserved.

The pINDUCER lentiviral toolkit for inducible RNA interference in vitro and in vivo

PubMed Central

Meerbrey, Kristen L.; Hu, Guang; Kessler, Jessica D.; Roarty, Kevin; Fang, Justin E.; Herschkowitz, Jason I.; Burrows, Anna E.; Ciccia, Alberto; Sun, Tingting; Schmitt, Earlene M.; Bernardi, Ronald J.; Fu, Xiaoyong; Bland, Christopher S.; Cooper, Thomas A.; Schiff, Rachel; Rosen, Jeffrey M.; Westbrook, Thomas F.; Elledge, Stephen J.

2011-01-01

The discovery of RNAi has revolutionized loss-of-function genetic studies in mammalian systems. However, significant challenges still remain to fully exploit RNAi for mammalian genetics. For instance, genetic screens and in vivo studies could be broadly improved by methods that allow inducible and uniform gene expression control. To achieve this, we built the lentiviral pINDUCER series of expression vehicles for inducible RNAi in vivo. Using a multicistronic design, pINDUCER vehicles enable tracking of viral transduction and shRNA or cDNA induction in a broad spectrum of mammalian cell types in vivo. They achieve this uniform temporal, dose-dependent, and reversible control of gene expression across heterogenous cell populations via fluorescence-based quantification of reverse tet-transactivator expression. This feature allows isolation of cell populations that exhibit a potent, inducible target knockdown in vitro and in vivo that can be used in human xenotransplantation models to examine cancer drug targets. PMID:21307310

Hypoxia-inducible factor 1α is a critical downstream mediator for hypoxia-induced mitogenic factor (FIZZ1/RELMα)-induced pulmonary hypertension

PubMed Central

Johns, Roger A.; Takimoto, Eiki; Meuchel, Lucas W.; Elsaigh, Esra; Zhang, Ailan; Heller, Nicola M.; Semenza, Gregg L.; Yamaji-Kegan, Kazuyo

2017-01-01

Objective Pulmonary hypertension (PH) is characterized by progressive elevation of pulmonary vascular resistance, right ventricular failure, and ultimately death. We have shown that in rodents, hypoxia-induced mitogenic factor (HIMF; also known as FIZZ1 or RELMα) causes PH by initiating lung vascular inflammation. We hypothesized that hypoxia-inducible factor-1 (HIF-1) is a critical downstream signal mediator of HIMF during PH development. Approach and Results In this study, we compared the degree of HIMF-induced pulmonary vascular remodeling and PH development in wild-type (HIF-1α+/+) and HIF-1α heterozygous null (HIF-1α+/−) mice. HIMF-induced PH was significantly diminished in HIF-1α+/− mice and was accompanied by a dysregulated VEGF-A–VEGF receptor 2 pathway. HIF-1α was critical for bone marrow-derived cell migration and vascular tube formation in response to HIMF. Furthermore, HIMF and its human homolog, resistin-like molecule-β (RELMβ), significantly increased IL-6 in macrophages and lung resident cells through a mechanism dependent on HIF-1α and, at least to some extent, on nuclear factor κB. Conclusions Our results suggest that HIF-1α is a critical downstream transcription factor for HIMF-induced pulmonary vascular remodeling and PH development. Importantly, both HIMF and human RELMβ significantly increased IL-6 in lung resident cells and increased perivascular accumulation of IL-6–expressing macrophages in the lungs of mice. These data suggest that HIMF can induce HIF-1, VEGF-A, and interleukin-6, which are critical mediators of both hypoxic inflammation and PH pathophysiology. PMID:26586659

Quinine-induced tinnitus in rats.

PubMed

Jastreboff, P J; Brennan, J F; Sasaki, C T

1991-10-01

Quinine ingestion reportedly induces tinnitus in humans. To expand our salicylate-based animal model of tinnitus, a series of conditioned suppression experiments was performed on 54 male-pigmented rats using quinine injections to induce tinnitus. Quinine induced changes in both the extent of suppression and recovery of licking, which followed a pattern that paralleled those produced after salicylate injections, and which may be interpreted as the result of tinnitus perception in animals. These changes depended on the dose and time schedule of quinine administration. Additionally, the calcium channel blocker, nimodipine, abolished the quinine-induced effect in a dose-dependent manner.

Monitoring of gluten-free diet compliance in celiac patients by assessment of gliadin 33-mer equivalent epitopes in feces123

PubMed Central

Comino, Isabel; Real, Ana; Vivas, Santiago; Síglez, Miguel Ángel; Caminero, Alberto; Nistal, Esther; Casqueiro, Javier; Rodríguez-Herrera, Alfonso; Cebolla, Ángel

2012-01-01

Background: Certain immunotoxic peptides from gluten are resistant to gastrointestinal digestion and can interact with celiac-patient factors to trigger an immunologic response. A gluten-free diet (GFD) is the only effective treatment for celiac disease (CD), and its compliance should be monitored to avoid cumulative damage. However, practical methods to monitor diet compliance and to detect the origin of an outbreak of celiac clinical symptoms are not available. Objective: We assessed the capacity to determine the gluten ingestion and monitor GFD compliance in celiac patients by the detection of gluten and gliadin 33-mer equivalent peptidic epitopes (33EPs) in human feces. Design: Fecal samples were obtained from healthy subjects, celiac patients, and subjects with other intestinal pathologies with different diet conditions. Gluten and 33EPs were analyzed by using immunochromatography and competitive ELISA with a highly sensitive antigliadin 33-mer monoclonal antibody. Results: The resistance of a significant part of 33EPs to gastrointestinal digestion was shown in vitro and in vivo. We were able to detect gluten peptides in feces of healthy individuals after consumption of a normal gluten-containing diet, after consumption of a GFD combined with controlled ingestion of a fixed amount of gluten, and after ingestion of <100 mg gluten/d. These methods also allowed us to detect GFD infringement in CD patients. Conclusions: Gluten-derived peptides could be sensitively detected in human feces in positive correlation with the amount of gluten intake. These techniques may serve to show GFD compliance or infringement and be used in clinical research in strategies to eliminate gluten immunotoxic peptides during digestion. This trial was registered at clinicaltrials.gov as NCT01478867. PMID:22258271

Quantification of Poly(I:C)-Mediated Protection against Genital Herpes Simplex Virus Type 2 Infection

PubMed Central

Herbst-Kralovetz, Melissa M.; Pyles, Richard B.

2006-01-01

Alternative strategies for controlling the growing herpes simplex virus type 2 (HSV-2) epidemic are needed. A novel class of immunomodulatory microbicides has shown promise as antiherpetics, including intravaginally applied CpG-containing oligodeoxynucleotides that stimulate toll-like receptor 9 (TLR9). In the current study, we quantified protection against experimental genital HSV-2 infection provided by an alternative nucleic acid-based TLR agonist, polyinosine-poly(C) (PIC) (TLR3 agonist). Using a protection quantification paradigm, groups of mice were PIC treated and then subdivided into groups challenged with escalating doses of HSV-2. Using this paradigm, a temporal window of PIC efficacy for single applications was defined as 1 day prior to (prophylactic) through 4 h after (therapeutic) viral challenge. PIC treatment within this window protected against 10-fold-higher HSV-2 challenges, as indicated by increased 50% infectious dose values relative to those for vehicle-treated controls. Disease resolution and survival were significantly enhanced by repetitive PIC doses. Using optimal PIC regimens, cytokine induction was evaluated in murine vaginal lavages and in human vaginal epithelial cells. Similar induction patterns were observed, with kinetics that explained the limited durability of PIC-afforded protection. Daily PIC delivery courses did not generate sustained cytokine levels in murine vaginal fluids that would be indicative of local immunotoxicity. No evidence of immunotoxicity was observed in selected organs that were analyzed following repetitive vaginal PIC doses. Animal and in vitro data indicate that PIC may prove to be a valuable preventative microbicide and/or therapeutic agent against genital herpes by increasing resistance to HSV-2 and enhancing disease resolution following a failure of prevention. PMID:17005677

Estimated exposures to perfluorinated compounds in infancy predict attenuated vaccine antibody concentrations at age 5-years.

PubMed

Grandjean, Philippe; Heilmann, Carsten; Weihe, Pal; Nielsen, Flemming; Mogensen, Ulla B; Timmermann, Amalie; Budtz-Jørgensen, Esben

2017-12-01

Perfluorinated alkylate substances (PFASs) are highly persistent and may cause immunotoxic effects. PFAS-associated attenuated antibody responses to childhood vaccines may be affected by PFAS exposures during infancy, where breastfeeding adds to PFAS exposures. Of 490 members of a Faroese birth cohort, 275 and 349 participated in clinical examinations and provided blood samples at ages 18 months and 5 years. PFAS concentrations were measured at birth and at the clinical examinations. Using information on duration of breastfeeding, serum-PFAS concentration profiles during infancy were estimated. As outcomes, serum concentrations of antibodies against tetanus and diphtheria vaccines were determined at age 5. Data from a previous cohort born eight years earlier were available for pooled analyses. Pre-natal exposure showed inverse associations with the antibody concentrations five years later, with decreases by up to about 20% for each two-fold higher exposure, while associations for serum concentrations at ages 18 months and 5 years were weaker. Modeling of serum-PFAS concentration showed levels for age 18 months that were similar to those measured. Concentrations estimated for ages 3 and 6 months showed the strongest inverse associations with antibody concentrations at age 5 years, particularly for tetanus. Joint analyses showed statistically significant decreases in tetanus antibody concentrations by 19-29% at age 5 for each doubling of the PFAS exposure in early infancy. These findings support the notion that the developing adaptive immune system is particularly vulnerable to immunotoxicity during infancy. This vulnerability appears to be the greatest during the first 6 months after birth, where PFAS exposures are affected by breast-feeding.

Quercetin attenuates toosendanin-induced hepatotoxicity through inducing the Nrf2/GCL/GSH antioxidant signaling pathway.

PubMed

Jin, Yao; Huang, Zhen-Lin; Li, Li; Yang, Yang; Wang, Chang-Hong; Wang, Zheng-Tao; Ji, Li-Li

2018-06-19

Toosendanin (TSN) is the main active compound in Toosendan Fructus and Meliae Cortex, two commonly used traditional Chinese medicines. TSN has been reported to induce hepatotoxicity, but its mechanism remains unclear. In this study, we demonstrated the critical role of nuclear factor erythroid 2-related factor 2 (Nrf2) in protecting against TSN-induced hepatotoxicity in mice and human normal liver L-02 cells. In mice, administration of TSN (10 mg/kg)-induced acute liver injury evidenced by increased serum alanine/aspartate aminotransferase (ALT/AST) and alkaline phosphatase (ALP) activities, and total bilirubin (TBiL) content as well as the histological changes. Furthermore, TSN markedly increased liver reactive oxygen species (ROS) and malondialdehyde (MDA) levels, and decreased liver glutathione (GSH) content and Nrf2 expression. In L-02 cells, TSN (2 μM) time-dependently reduced glutamate-cysteine ligase (GCL) activity and cellular expression of the catalytic/modify subunit of GCL (GCLC/GCLM). Moreover, TSN reduced cellular GSH content and the increased ROS formation, and time-dependently decreased Nrf2 expression and increased the expression of the Nrf2 inhibitor protein kelch-like ECH-associated protein-1 (Keap1). Pre-administration of quercetin (40, 80 mg/kg) effectively inhibited TSN-induced liver oxidative injury and reversed the decreased expression of Nrf2 and GCLC/GCLM in vivo and in vitro. In addition, the quercetin-provided protection against TSN-induced hepatotoxicity was diminished in Nrf2 knock-out mice. In conclusion, TSN decreases cellular GSH content by reducing Nrf2-mediated GCLC/GCLM expression via decreasing Nrf2 expression. Quercetin attenuates TSN-induced hepatotoxicity by inducing the Nrf2/GCL/GSH antioxidant signaling pathway. This study implies that inducing Nrf2 activation may be an effective strategy to prevent TSN-induced hepatotoxicity.

Statin-induced necrotizing myositis - a discrete autoimmune entity within the "statin-induced myopathy spectrum".

PubMed

Hamann, Philip D H; Cooper, Robert G; McHugh, Neil J; Chinoy, Hector

2013-10-01

Statin-induced necrotizing myositis is increasingly being recognised as part of the "statin-induced myopathy spectrum". As in other immune-mediated necrotizing myopathies, statin-induced myositis is characterised by proximal muscle weakness with marked serum creatinine kinase elevations and histological evidence of myonecrosis, with little or no inflammatory cell infiltration. Unlike other necrotizing myopathies, statin-induced myopathy is associated with the presence of autoantibodies directed against 3-hydroxy-3-methylglutaryl- coenzyme A reductase (the enzyme target of statin therapies), and with Human Leukocyte Antigen-DRB1*11. This article summarises the clinical presentation, investigations and management of this rare, but serious complication of statin therapy. © 2013 Elsevier B.V. All rights reserved.

GGPPS deficiency aggravates CCl4-induced liver injury by inducing hepatocyte apoptosis.

PubMed

Chen, Wei-Bo; Lai, Shan-Shan; Yu, De-Cai; Liu, Jia; Jiang, Shan; Zhao, Dan-Dan; Ding, Yi-Tao; Li, Chao-Jun; Xue, Bin

2015-04-28

GGPPS catalyses the expression of GGPP, a key protein in the mevalonate metabolic pathway. HMG-CoA reductase inhibitor statins can induce liver injury by inhibiting GGPP. However, the function of GGPPS in liver injury has not yet been revealed. In this study, we found that GGPPS increased in liver injury and that GGPPS deletion augmented liver injury and fibrosis. GGPPS inhibition induced hepatocyte apoptosis, inflammation and TGF-β1 secretion, which activated hepatic stellate cells. Our findings imply that GGPPS deletion induces hepatocyte apoptosis, which makes the liver vulnerable to hepatotoxicity. Copyright © 2015 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

Chronic lead exposure induces cochlear oxidative stress and potentiates noise-induced hearing loss.

PubMed

Jamesdaniel, Samson; Rosati, Rita; Westrick, Judy; Ruden, Douglas M

2018-08-01

Acquired hearing loss is caused by complex interactions of multiple environmental risk factors, such as elevated levels of lead and noise, which are prevalent in urban communities. This study delineates the mechanism underlying lead-induced auditory dysfunction and its potential interaction with noise exposure. Young-adult C57BL/6 mice were exposed to: 1) control conditions; 2) 2 mM lead acetate in drinking water for 28 days; 3) 90 dB broadband noise 2 h/day for two weeks; and 4) both lead and noise. Blood lead levels were measured by inductively coupled plasma mass spectrometry analysis (ICP-MS) lead-induced cochlear oxidative stress signaling was assessed using targeted gene arrays, and the hearing thresholds were assessed by recording auditory brainstem responses. Chronic lead exposure downregulated cochlear Sod1, Gpx1, and Gstk1, which encode critical antioxidant enzymes, and upregulated ApoE, Hspa1a, Ercc2, Prnp, Ccl5, and Sqstm1, which are indicative of cellular apoptosis. Isolated exposure to lead or noise induced 8-12 dB and 11-25 dB shifts in hearing thresholds, respectively. Combined exposure induced 18-30 dB shifts, which was significantly higher than that observed with isolated exposures. This study suggests that chronic exposure to lead induces cochlear oxidative stress and potentiates noise-induced hearing impairment, possibly through parallel pathways. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

Spironolactone-Induced Unilateral Gynecomastia

PubMed Central

Veeregowda, Sahana Hadihalli; Krishnamurthy, Jayakumar Jyothinagaram; Krishnaswamy, Bhuvana; Narayana, Sarala

2018-01-01

Gynecomastia is benign enlargement of male breast, drug-induced gynecomastia accounts for about 25%. We are reporting a case of spironolactone-induced unilateral gynecomastia. A 52-year-old male patient receiving multiple antihypertensives including hydrochlorothiazide presented with muscle weakness and easy fatigability. Investigations revealed hypokalemia; he was advised to stop hydrochlorothiazide and consume potassium-rich diet; since he did not respond to this, spironolactone was added. The patient improved symptomatically but developed painful swelling of the right breast after 12 months of treatment which was suspected to be spironolactone-induced gynecomastia. Within a month of stopping the drug, pain in the right breast subsided followed by decrease in size of swelling. Literature search indicates bilateral gynecomastia by spironolactone, but when clinician encounters unilateral presentation, they should consider the possibility of drug-induced etiology. Patients should be educated about this while prescribing, and eplerenone can be a safe alternative. PMID:29552536

Spironolactone-Induced Unilateral Gynecomastia.

PubMed

Veeregowda, Sahana Hadihalli; Krishnamurthy, Jayakumar Jyothinagaram; Krishnaswamy, Bhuvana; Narayana, Sarala

2018-01-01

Gynecomastia is benign enlargement of male breast, drug-induced gynecomastia accounts for about 25%. We are reporting a case of spironolactone-induced unilateral gynecomastia. A 52-year-old male patient receiving multiple antihypertensives including hydrochlorothiazide presented with muscle weakness and easy fatigability. Investigations revealed hypokalemia; he was advised to stop hydrochlorothiazide and consume potassium-rich diet; since he did not respond to this, spironolactone was added. The patient improved symptomatically but developed painful swelling of the right breast after 12 months of treatment which was suspected to be spironolactone-induced gynecomastia. Within a month of stopping the drug, pain in the right breast subsided followed by decrease in size of swelling. Literature search indicates bilateral gynecomastia by spironolactone, but when clinician encounters unilateral presentation, they should consider the possibility of drug-induced etiology. Patients should be educated about this while prescribing, and eplerenone can be a safe alternative.

The ovarian DNA damage repair response is induced prior to phosphoramide mustard-induced follicle depletion, and ataxia telangiectasia mutated inhibition prevents PM-induced follicle depletion

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ganesan, Shanthi, E-mail: shanthig@iastate.edu; Keating, Aileen F., E-mail: akeating@iastate.edu

Phosphoramide mustard (PM) is an ovotoxic metabolite of cyclophosphamide and destroys primordial and primary follicles potentially by DNA damage induction. The temporal pattern by which PM induces DNA damage and initiation of the ovarian response to DNA damage has not yet been well characterized. This study investigated DNA damage initiation, the DNA repair response, as well as induction of follicular demise using a neonatal rat ovarian culture system. Additionally, to delineate specific mechanisms involved in the ovarian response to PM exposure, utility was made of PKC delta (PKCδ) deficient mice as well as an ATM inhibitor (KU 55933; AI). Fishermore » 344 PND4 rat ovaries were cultured for 12, 24, 48 or 96 h in medium containing DMSO ± 60 μM PM or KU 55933 (48 h; 10 nM). PM-induced activation of DNA damage repair genes was observed as early as 12 h post-exposure. ATM, PARP1, E2F7, P73 and CASP3 abundance were increased but RAD51 and BCL2 protein decreased after 96 h of PM exposure. PKCδ deficiency reduced numbers of all follicular stages, but did not have an additive impact on PM-induced ovotoxicity. ATM inhibition protected all follicle stages from PM-induced depletion. In conclusion, the ovarian DNA damage repair response is active post-PM exposure, supporting that DNA damage contributes to PM-induced ovotoxicity. - Highlights: • PM exposure induces DNA damage repair gene expression. • Inhibition of ATM prevented PM-induced follicle depletion. • PKCδ deficiency did not impact PM-induced ovotoxicity.« less

Comparison of Sodium Chloride Tablets-Induced, Sodium Chloride Solution-Induced, and Glycerol-Induced Hyperhydration on Fluid Balance Responses in Healthy Men.

PubMed

Savoie, Félix A; Asselin, Audrey; Goulet, Eric D B

2016-10-01

Savoie, FA, Asselin, A, and Goulet, EDB. Comparison of sodium chloride tablets-induced, sodium chloride solution-induced, and glycerol-induced hyperhydration on fluid balance responses in healthy men. J Strength Cond Res 30(10): 2880-2891, 2016-Sodium chloride solution-induced hyperhydration (NaCl-SolIH) is a powerful strategy to increase body water before exercise. However, NaCl-SolIH is associated with an unpleasant salty taste, potentially dissuading some athletes from using it and coaches from recommending it. Therefore, we evaluated the hyperhydrating potential of sodium chloride tablets-induced hyperhydration (NaCl-TabIH), which bypasses the palatability issue of NaCl-SolIH without sacrificing sodium chloride content, and compared it to NaCl-SolIH and glycerol-induced hyperhydration (GIH). Sixteen healthy males (age: 21 ± 2 years; fat-free mass (FFM): 65 ± 6 kg) underwent three, 3-hour long passive hyperhydration protocols during which they drank, over the first 60 minutes, 30-ml·kg FFM of an artificially sweetened solution. During NaCl-TabIH, participants swallowed 7.5, 1 g each, sodium chloride tablets with every liter of solution. During NaCl-SolIH, an equal quantity of sodium chloride tablets was dissolved in each liter of solution. With GIH, the glycerol concentration was 46.7 g·L. Urine production, fluid retention, hemoglobin, hematocrit, plasma volume, and perceptual variables were monitored throughout the trials. Total fluid intake was 1948 ± 182 ml. After 3 hour, there were no significant differences among treatments for hemoglobin, hematocrit, and plasma volume changes. Fluid retention was significantly greater with NaCl-SolIH (1150 ± 287 ml) than NaCl-TabIH (905 ± 340 ml) or GIH (800 ± 211 ml), with no difference between NaCl-TabIH and GIH. No differences were found among treatments for perceptual variables. NaCl-TabIH and GIH are equally effective, but inferior than NaCl-SolIH. NaCl-TabIH represents an alternative to hyperhydration induced

[Chemotherapy-induced diarrhea].

PubMed

Kobayashi, Kunihiko

2003-06-01

Chemotherapy-induced diarrhea is a well-documented side effect of many cancer treatments and is associated with increased morbidity and mortality. Chemotherapy-induced diarrhea negatively impacts patient quality of life and treatment outcome by requiring dose limitations or treatment interruption. The chemotherapeutic agent CPT-11 (irinotecan) has shown promising results as a single agent and in combination chemotherapy for the treatment of colorectal and small cell lung cancer. However, delayed onset diarrhea is considered to be its major dose-limiting toxicity. In some cases, it can be life threatening. To prevent CPT-11-induced delayed diarrhea, oral alkalization (OA) and control of defecation (CD) [Int J Cancer 92: 269-275, 2001] were developed based on fundamental studies [Int J Cancer 83: 491-496, 1999; Cancer Res 62: 179-187, 2002]. Oral administration of antibiotics [Cancer Res 56: 3752-3757, 1996; Clin Cancer Res 7: 1136-1141, 2001] or kampo medicine [Jpn J Cancer Res 86: 978-984, 1995; Jpn J Cancer Res 86: 985-989, 1995] to decrease beta-glucuronidase activity derived from bacteria in the large intestine was also reported to be successful in preventing delayed diarrhea. When CPT-11-induced delayed diarrhea occurs, the conventional treatment is loperamide [J Natl Cancer Inst 86: 446-449, 1994], and the early recognition and treatment of diarrhea with this opioid has reduced, although not entirely eliminated, patient morbidity. Other therapies are needed to treat patients with loperamide-refractory CPT-11 induced diarrhea, and the successful use of the somatostatin analogue octreotide has been reported [Support Care Cancer 9: 258-260, 2001; Ann Oncol 12: 227-229, 2001; Proc Am Soc Clin Oncol 21: 387a, 2002].

Inducing autophagy

PubMed Central

Harder, Lea M; Bunkenborg, Jakob; Andersen, Jens S

2014-01-01

Autophagy is a lysosomal-mediated catabolic process, which through degradation of different cytoplasmic components aids in maintaining cellular homeostasis and survival during exposure to extra- or intracellular stresses. Ammonia is a potential toxic and stress-inducing byproduct of glutamine catabolism, which has recently been found to induce autophagy in an MTOR independent way and support cancer cell survival. In this study, quantitative phosphoproteomics was applied to investigate the initial signaling events linking ammonia to the induction of autophagy. The MTOR inhibitor rapamycin was used as a reference treatment to emphasize the differences between an MTOR-dependent and -independent autophagy-induction. By this means 5901 phosphosites were identified of which 626 were treatment-specific regulated and 175 were coregulated. Investigation of the ammonia-specific regulated sites supported that MTOR activity was not affected, but indicated increased MAPK3 activity, regulation of proteins involved in Rho signal transduction, and a novel phosphorylation motif, serine-proline-threonine (SPT), which could be linked to cytoskeleton-associated proteins. MAPK3 could not be identified as the primary driver of ammonia-induced autophagy but instead the data suggested an upregulation of AMPK and the unfolded protein response (UPR), which might link ammonia to autophagy induction. Support of UPR induction was further obtained from the finding of increased protein levels of the ER stress markers DDIT3/CHOP and HSPA5 during ammonia treatment. The large-scale data set presented here comprises extensive high-quality quantitative information on phosphoprotein regulation in response to 2 very different autophagy inducers and should therefore be considered a general resource for the community. PMID:24300666

Phagocytosis as a biomarker for stress responses

NASA Astrophysics Data System (ADS)

Huber, K.; Krotz-Fahning, M.; Hock, B.

2005-08-01

An in vitro test has been developed for the detection of immunotoxic events. It will be used within the project "TRIPLE LUX" on the International Space Station to investigate the effects of single and combined space flight conditions on mammalian phagocytes. The intensity of the respiratory burst during phagocytosis can be followed by the luminol-based chemiluminescence response after stimulation with zymosan. We adapted this test system for polymorphonuclear leukocytes, purified from sheep blood and stored by cryoconservation. In this report we show the immunostimulating effect of hydrocortisone and the immunosuppressive impact of cadmium as an example for alterations that can be detected by this test.

Induced Power of the Helicopter Rotor

NASA Technical Reports Server (NTRS)

Ormiston, Robert A.

2004-01-01

A simplified rotor model was used to explore fundamental behavior of lifting rotor induced power at moderate and high advance ratios. Several rotor inflow theories, including dynamic inflow theory and prescribed-wake vortex theory, together with idealized notional airfoil stall models were employed. A number of unusual results were encountered at high advance ratios including trim control reversal and multiple trim solutions. Significant increases in rotor induced power (torque) above the ideal minimum were observed for moderately high advance ratio. Very high induced power was observed near and above unity advance ratio. The results were sensitive to the stall characteristics of the airfoil models used. An equivalent wing analysis was developed to determine induced power from Prandtl lifting line theory and help interpret the rotor induced power behavior in terms of the spanwise airload distribution. The equivalent wing approach was successful in capturing the principal variations of induced power for different configurations and operating conditions. The effects blade root cutout were found to have a significant effect on rotor trim and induced power at high advance ratios.

Tobramycin-induced hepatotoxicity.

PubMed

Nisly, Sarah A; Ray, Shaunta' M; Moye, Robert A

2007-12-01

To report a case of tobramycin-induced hepatotoxicity. A 20-year-old female was hospitalized for treatment of Pseudomonas aeruginosa bacteremia and osteomyelitis. Empiric intravenous antibiotic therapy with piperacillin/tazobactam, vancomycin, and ciprofloxacin was started, and based on the results of culture and sensitivity testing, was changed to intravenous ceftazidime and tobramycin 70 mg every 8 hours on hospital day 3. Liver enzyme levels then increased over days 3-6. Tests for hepatitis A, B, and C were all nonreactive, and HIV testing was negative. On day 8, therapy was changed from ceftazidime to piperacillin/tazobactam and the tobramycin dose was increased to 100 mg every 8 hours. Due to a continued increase in total bilirubin, aspartate aminotransferase, and alanine aminotransferase, piperacillin/tazobactam was discontinued and aztreonam was started on day 10. All antibiotics were stopped on day 12 and the elevated liver parameters began to decrease. Aztreonam and ciprofloxacin were restarted on day 16, and most laboratory test results returned to baseline levels by day 19; total bilirubin and alkaline phosphatase decreased to lower than baseline values. This case illustrates a possible occurrence of tobramycin-induced hepatotoxicity. Liver enzymes rose when tobramycin therapy was initiated, markedly increased when the tobramycin dose was increased, then resolved upon discontinuation of therapy. Other medication-related causes were ruled out by temporal relationship or rechallenge (aztreonam). Use of the Naranjo probability scale indicated a possible relationship between hepatotoxicity and tobramycin therapy. Other adverse reaction scales specific for evaluation of drug-induced liver disease were also used. Both the Council for International Organizations of Medical Sciences and Maria and Victorino scales indicated a probable likelihood of tobramycin-induced hepatotoxicity. This patient was not rechallenged with tobramycin due to the highly suggestive

Morphine potentiates seizures induced by GABA antagonists and attenuates seizures induced by electroshock in the rat.

PubMed

Foote, F; Gale, K

1983-11-25

In a naloxone-reversible, dose-dependent manner, morphine (10-50 mg/kg i.p.) protected against seizures induced by maximal electroshock and increased the incidence and severity of seizures induced by bicuculline, in rats. Morphine also potentiated seizures induced by isoniazid and by picrotoxin. Thus, opiate activity influences the expression of seizures in contrasting ways depending upon the mode of seizure induction. Since morphine consistently potentiated seizures induced by interference with GABA transmission, it appears that GABAergic systems may be of particular significance for the elucidation of the varied effects of morphine on seizure susceptibility.

Tenofovir-induced kidney injury.

PubMed

Gitman, Michael D; Hirschwerk, David; Baskin, Cindy H; Singhal, Pravin C

2007-03-01

Tenofovir disoproxil fumarate is a nucleotide reverse transcriptase inhibitor with activity against both HIV and the hepatitis B virus. It has had minimal nephrotoxic effects in early clinical trials, but as clinical use has widened, case reports describing tenofovir-induced renal tubular damage, Fanconi's syndrome and diabetes insipidus have been described. The authors review the pharmacokinetics, mechanism of action and clinical uses of tenofovir disoproxil fumarate. The large clinical trials, as well as the case reports of tenofovir-induced kidney injury, are also reviewed. The potential mechanism of renal damage is discussed and recommendations for evaluation and treatment of tenofovir-induced kidney injury are given.

Induced Star Formation

NASA Astrophysics Data System (ADS)

Kennicutt, Robert C., Jr.

Overview: Induced Star Formation and Interactions Introduction Historical Background: First Hints Systematic Studies: Starbursts Interactions and Nuclear activity IRAS and Ultralumious starburst Galaxies The 1990's: HST, Supercomputers, and the Distant Universe Key Questions and Issues Organization of Lectures Star Formation Properties of Normal Galaxies Observational Techniques Results: Star Formation in Normal Galaxies Interpretation: Star Formation Histories Global Star Formation in interacting Galaxies A Gallery of Interactions and Mergers Star Formation Statistics: Guilt By Association Tests SFRs in Interacting vs Noninteracting Galaxies Kinematic Properties and Regulation of SFRs Induced Nuclear Activity and Star Formation Background: Nuclear Spectra and Classification Nuclear Star Formation and Starbursts Nuclear Star Formation and Interactions Induced AGN Activity: Statistics of Seyfert Galaxies Environments of Quasars Kinematic Clues to the Triggering of AGNs Infrared Luminous Galaxies and Starbursts Background: IR Luminous Galaxies and IRAS Infrared Luminosity Function and Spectra Infrared Structure and Morphology Interstellar Gas X-Ray Emission and Superwinds Optical, UV, and Near-Infrared Spectra Radio Continuum Emission Evidence for Interactions and Mergers The Power Source: Starbursts or Dusty AGNs? Spectral Diagnostics of Starbursts Evolutionary Synthesis Models Applications: Integrated Colors of Interacting Galaxies Applications: Hα Emission, Colors, and SFRs Applications: Spectral Modelling of Evolved Starbursts Infrared Starbursts and the IMF in starbursts Triggering and Regulation of Star Formation: The Problem Introduction: Star Formation as a Nonlinear Process The schmidt Law in Normal Galaxies Star Formation Regimes in Interacting Galaxies Summary Triggering and Regulation of Starbusts: Theoretical Ideas Gravitational Star Formation Thresholds Cloud Collision Models Radial Transport of Gas: Clues from Barred Galaxies Simulations of Starbursts

Ethanol-induced locomotor activity in adolescent rats and the relationship with ethanol-induced conditioned place preference and conditioned taste aversion.

PubMed

Acevedo, María Belén; Nizhnikov, Michael E; Spear, Norman E; Molina, Juan C; Pautassi, Ricardo M

2013-05-01

Adolescent rats exhibit ethanol-induced locomotor activity (LMA), which is considered an index of ethanol's motivational properties likely to predict ethanol self-administration, but few studies have reported or correlated ethanol-induced LMA with conditioned place preference (CPP) by ethanol at this age. The present study assessed age-related differences in ethanol's motor stimulating effects and analyzed the association between ethanol-induced LMA and conventional measures of ethanol-induced reinforcement. Experiment 1 compared ethanol-induced LMA in adolescent and adult rats. Subsequent experiments analyzed ethanol-induced CPP and conditioned taste aversion (CTA) in adolescent rats evaluated for ethanol-induced LMA. Adolescent rats exhibit a robust LMA after high-dose ethanol. Ethanol-induced LMA was fairly similar across adolescents and adults. As expected, adolescents were sensitive to ethanol's aversive reinforcement, but they also exhibited CPP. These measures of ethanol reinforcement, however, were not related to ethanol-induced LMA. Spontaneous LMA in an open field was, however, negatively associated with ethanol-induced CTA. Copyright © 2012 Wiley Periodicals, Inc.

Delayed brain ischemia tolerance induced by electroacupuncture pretreatment is mediated via MCP-induced protein 1

PubMed Central

2013-01-01

Background Emerging studies have demonstrated that pretreatment with electroacupuncture (EA) induces significant tolerance to focal cerebral ischemia. The present study seeks to determine the involvement of monocyte chemotactic protein-induced protein 1 (MCPIP1), a recently identified novel modulator of inflammatory reactions, in the cerebral neuroprotection conferred by EA pretreatment in the animal model of focal cerebral ischemia and to elucidate the mechanisms of EA pretreatment-induced ischemic brain tolerance. Methods Twenty-four hours after the end of the last EA pretreatment, focal cerebral ischemia was induced by middle cerebral artery occlusion (MCAO) for 90 minutes in male C57BL/6 mice and MCPIP1 knockout mice. Transcription and expression of MCPIP1 gene was monitored by qRT-PCR, Western blot and immunohistochemistry. The neurobehavioral scores, infarction volumes, proinflammatory cytokines and leukocyte infiltration in brain and NF-κB signaling were evaluated after ischemia/reperfusion. Results MCPIP1 protein and mRNA levels significantly increased specifically in mouse brain undergoing EA pretreatment. EA pretreatment significantly attenuated the infarct volume, neurological deficits, upregulation of proinflammatory cytokines and leukocyte infiltration in the brain of wild-type mice after MCAO compared with that of the non-EA group. MCPIP1-deficient mice failed to evoke EA pretreatment-induced tolerance compared with that of the control MCPIP1 knockout group without EA treatment. Furthermore, the activation of NF-κB signaling was significantly reduced in EA-pretreated wild-type mice after MCAO compared to that of the non-EA control group and MCPIP1-deficient mice failed to confer the EA pretreatment-induced inhibition of NF-κB signaling after MCAO. Conclusions Our data demonstrated that MCPIP1 deficiency caused significant lack of EA pretreatment-induced cerebral protective effects after MCAO compared with the control group and that MCPIP1 is

Prevalence of exercise-induced bronchoconstriction and exercise-induced laryngeal obstruction in a general adolescent population.

PubMed

Johansson, Henrik; Norlander, Katarina; Berglund, Lars; Janson, Christer; Malinovschi, Andrei; Nordvall, Lennart; Nordang, Leif; Emtner, Margareta

2015-01-01

Exercise-induced respiratory symptoms are common among adolescents. Exercise is a known stimulus for transient narrowing of the airways, such as exercise-induced bronchoconstriction (EIB) and exercise-induced laryngeal obstruction (EILO). Our aim was to investigate the prevalence of EIB and EILO in a general population of adolescents. In this cross-sectional study, a questionnaire on exercise-induced dyspnoea was sent to all adolescents born in 1997 and 1998 in Uppsala, Sweden (n=3838). A random subsample of 146 adolescents (99 with self-reported exercise-induced dyspnoea and 47 without this condition) underwent standardised treadmill exercise tests for EIB and EILO. The exercise test for EIB was performed while breathing dry air; a positive test was defined as a decrease of ≥10% in FEV1 from baseline. EILO was investigated using continuous laryngoscopy during exercise. The estimated prevalence of EIB and EILO in the total population was 19.2% and 5.7%, respectively. No gender differences were found. In adolescents with exercise-induced dyspnoea, 39.8% had EIB, 6% had EILO and 4.8% had both conditions. In this group, significantly more boys than girls had neither EIB nor EILO (64.7% vs 38.8%; p=0.026). There were no significant differences in body mass index, lung function, diagnosed asthma or medication between the participants with exercise-induced dyspnoea who had or did not have a positive EIB or EILO test result. Both EIB and EILO are common causes of exercise-induced dyspnoea in adolescents. EILO is equally common among girls and boys and can coexist with EIB. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

Characterization of Chemically-Induced Bacterial Ghosts (BGs) Using Sodium Hydroxide-Induced Vibrio parahaemolyticus Ghosts (VPGs).

PubMed

Park, Hyun Jung; Oh, Sung; Vinod, Nagarajan; Ji, Seongmi; Noh, Han Byul; Koo, Jung Mo; Lee, Su Hyeong; Kim, Sei Chang; Lee, Ki-Sung; Choi, Chang Won

2016-11-15

Acellular bacterial ghosts (BGs) are empty non-living bacterial cell envelopes, commonly generated by controlled expression of the cloned lysis gene E of bacteriophage PhiX174. In this study, Vibrio parahaemolyticus ghosts (VPGs) were generated by chemically-induced lysis and the method is based on minimum inhibitory concentration (MIC) of sodium hydroxide (NaOH), acetic acid, boric acid, citric acid, maleic acid, hydrochloric acid, and sulfuric acid. The MIC values of the respective chemicals were 3.125, 6.25, <50.0, 25.0, 6.25, 1.56, and 0.781 mg/mL. Except for boric acid, the lysis efficiency reached more than 99.99% at 5 min after treatment of all chemicals. Among those chemicals, NaOH-induced VPGs appeared completely DNA-free, which was confirmed by quantitative real-time PCR. Besides, lipopolysaccharides (LPS) extracted from the NaOH-induced VPGs showed no distinctive band on SDS-PAGE gel after silver staining. On the other hand, LPS extracted from wild-type bacterial cells, as well as the organic acids-induced VPGs showed triple major bands and LPS extracted from the inorganic acids-induced VPGs showed double bands. It suggests that some surface structures in LPS of the NaOH-induced VPGs may be lost, weakened, or modified by the MIC of NaOH. Nevertheless, Limulus amoebocyte lysate assay revealed that there is no significant difference in endotoxic activity between the NaOH-induced VPGs and wild-type bacterial cells. Macrophages exposed to the NaOH-induced VPGs at 0.5 × 10⁶ CFU/mL showed cell viability of 97.9%, however, the MIC of NaOH did not reduce the cytotoxic effect of wild-type bacterial cells. Like Escherichia coli LPS, the NaOH-induced VPGs are an excellent activator of pro-inflammatory cytokines (IL-1β and iNOS), anti-inflammatory cytokine (IL-10), and dual activities (IL-6) in the stimulated macrophage cells. On the other hand, the induction of TNF-α mRNA was remarkable in the macrophages exposed with wild-type cells. Scanning electron

Mechanistic review of drug-induced steatohepatitis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Schumacher, Justin D., E-mail: Justin.d.schumacher@rutgers.edu; Guo, Grace L.

Drug-induced steatohepatitis is a rare form of liver injury known to be caused by only a handful of compounds. These compounds stimulate the development of steatohepatitis through their toxicity to hepatocyte mitochondria; inhibition of beta-oxidation, mitochondrial respiration, and/or oxidative phosphorylation. Other mechanisms discussed include the disruption of phospholipid metabolism in lysosomes, prevention of lipid egress from hepatocytes, targeting mitochondrial DNA and topoisomerase, decreasing intestinal barrier function, activation of the adenosine pathway, increasing fatty acid synthesis, and sequestration of coenzyme A. It has been found that the majority of compounds that induce steatohepatitis have cationic amphiphilic structures; a lipophilic ring structuremore » with a side chain containing a cationic secondary or tertiary amine. Within the last decade, the ability of many chemotherapeutics to cause steatohepatitis has become more evident coining the term chemotherapy-associated steatohepatitis (CASH). The mechanisms behind drug-induced steatohepatitis are discussed with a focus on cationic amphiphilic drugs and chemotherapeutic agents. - Highlights: • Reviewed the mechanisms underlying drug-induced steatohepatitis for many compounds • Mitochondrial dysfunction is critical in the development of drug-induced steatohepatitis. • Majority of drugs that induce steatohepatitis are cationic amphiphilic drugs. • Chemotherapeutics that induce CASH are cationic amphiphilic drugs. • Majority of drugs that induce steatohepatitis are carnitine palmitoyltransferase-I inhibitors.« less

Non-fibrillar amyloid-{beta} peptide reduces NMDA-induced neurotoxicity, but not AMPA-induced neurotoxicity

DOE Office of Scientific and Technical Information (OSTI.GOV)

Niidome, Tetsuhiro, E-mail: tniidome@pharm.kyoto-u.ac.jp; Goto, Yasuaki; Kato, Masaru

2009-09-04

Amyloid-{beta} peptide (A{beta}) is thought to be linked to the pathogenesis of Alzheimer's disease. Recent studies suggest that A{beta} has important physiological roles in addition to its pathological roles. We recently demonstrated that A{beta}42 protects hippocampal neurons from glutamate-induced neurotoxicity, but the relationship between A{beta}42 assemblies and their neuroprotective effects remains largely unknown. In this study, we prepared non-fibrillar and fibrillar A{beta}42 based on the results of the thioflavin T assay, Western blot analysis, and atomic force microscopy, and examined the effects of non-fibrillar and fibrillar A{beta}42 on glutamate-induced neurotoxicity. Non-fibrillar A{beta}42, but not fibrillar A{beta}42, protected hippocampal neurons frommore » glutamate-induced neurotoxicity. Furthermore, non-fibrillar A{beta}42 decreased both neurotoxicity and increases in the intracellular Ca{sup 2+} concentration induced by N-methyl-D-aspartate (NMDA), but not by {alpha}-amino-3-hydrozy-5-methyl-4-isoxazole propionic acid (AMPA). Our results suggest that non-fibrillar A{beta}42 protects hippocampal neurons from glutamate-induced neurotoxicity through regulation of the NMDA receptor.« less

Estimating fisheries-induced selection: traditional gear selectivity research meets fisheries-induced evolution.

PubMed

Kuparinen, Anna; Kuikka, Sakari; Merilä, Juha

2009-05-01

The study of fisheries-induced evolution is a research field which is becoming recognized both as an important and interesting problem in applied evolution, as well as a practical management problem in fisheries. Much of the research in fisheries-induced evolution has focussed on quantifying and proving that an evolutionary response has taken place, but less effort has been invested on the actual processes and traits underlying capture of a fish by a fishing gear. This knowledge is not only needed to understand possible phenotypic selection associated to fishing but also to help to device sustainable fisheries and management strategies. Here, we draw attention to the existing knowledge about selectivity of fishing gears and outline the ways in which this information could be utilized in the context of fisheries-induced evolution. To these ends, we will introduce a mathematical framework commonly applied to quantify fishing gear selectivity, illustrate the link between gear selectivity and the change in the distribution of phenotypes induced by fishing, review what is known about selectivity of commonly used fishing gears, and discuss how this knowledge could be applied to improve attempts to predict evolutionary impacts of fishing.

ETHANOL-INDUCED LOCOMOTOR ACTIVITY IN ADOLESCENT RATS AND THE RELATIONSHIP WITH ETHANOL-INDUCED CONDITIONED PLACE PREFERENCE AND CONDITIONED TASTE AVERSION

PubMed Central

Acevedo, María Belén; Nizhnikov, Michael E.; Spear, Norman E.; Molina, Juan C.; Pautassi, Ricardo Marcos

2012-01-01

Adolescent rats exhibit ethanol-induced locomotor activity (LMA), which is considered an index of ethanol’s motivational properties likely to predict ethanol self-administration, but few studies have reported or correlated ethanol-induced LMA with conditioned place preference by ethanol at this age. The present study assessed age-related differences in ethanol’s motor stimulating effects and analysed the association between ethanol-induced LMA and conventional measures of ethanol-induced reinforcement. Experiment 1 compared ethanol-induced LMA in adolescent and adult rats. Subsequent experiments analyzed ethanol-induced conditioned place preference and conditioned taste aversion in adolescent rats evaluated for ethanol-induced LMA. Adolescent rats exhibit a robust LMA after high-dose ethanol. Ethanol-induced LMA was fairly similar across adolescents and adults. As expected, adolescents were sensitive to ethanol’s aversive reinforcement, but they also exhibited conditioned place preference. These measures of ethanol reinforcement, however, were not related to ethanol-induced LMA. Spontaneous LMA in an open field was, however, negatively associated with ethanol-induced CTA. PMID:22592597

Effect of acetochlor on transcription of genes associated with oxidative stress, apoptosis, immunotoxicity and endocrine disruption in the early life stage of zebrafish.

PubMed

Jiang, Jinhua; Wu, Shenggan; Liu, Xinju; Wang, Yanhua; An, Xuehua; Cai, Leiming; Zhao, Xueping

2015-09-01

The study presented here aimed to characterize the effects of acetochlor on expression of genes related to endocrine disruption, oxidative stress, apoptosis and immune system in zebrafish during its embryo development. Different trends in gene expression were observed after exposure to 50, 100, 200μg/L acetochlor for 96h. Results demonstrated that the transcription patterns of many key genes involved in the hypothalamic-pituitary-gonadal/thyroid (HPG/HPT) axis (e.g., VTG1, ERβ1, CYP19a and TRα), cell apoptosis pathway (e.g., Bcl2, Bax, P53 and Cas8), as well as innate immunity (e.g., CXCL-C1C, IL-1β and TNFα) were affected in newly hatched zebrafish after exposure to acetochlor. In addition, the up-regulation of CAT, GPX, GPX1a, Cu/Zn-SOD and Ogg1 suggested acetochlor might trigger oxidative stress in zebrafish. These finding indicated that acetochlor could simultaneously induce multiple responses during zebrafish embryonic development, and bidirectional interactions among oxidative stress, apoptosis pathway, immune and endocrine systems might be present. Copyright © 2015 Elsevier B.V. All rights reserved.

Smad7 induces tumorigenicity by blocking TGF-beta-induced growth inhibition and apoptosis.

PubMed

Halder, Sunil K; Beauchamp, R Daniel; Datta, Pran K

2005-07-01

Smad proteins play a key role in the intracellular signaling of the transforming growth factor beta (TGF-beta) superfamily of extracellular polypeptides that initiate signaling to regulate a wide variety of biological processes. The inhibitory Smad, Smad7, has been shown to function as intracellular antagonists of TGF-beta family signaling and is upregulated in several cancers. To determine the effect of Smad7-mediated blockade of TGF-beta signaling, we have stably expressed Smad7 in a TGF-beta-sensitive, well-differentiated, and non-tumorigenic cell line, FET, that was derived from human colon adenocarcinoma. Smad7 inhibits TGF-beta-induced transcriptional responses by blocking complex formation between Smad 2/3 and Smad4. While Smad7 has no effect on TGF-beta-induced activation of p38 MAPK and ERK, it blocks the phosphorylation of Akt by TGF-beta and enhances TGF-beta-induced phosphorylation of c-Jun. FET cells expressing Smad7 show anchorage-independent growth and enhance tumorigenicity in athymic nude mice. Smad7 blocks TGF-beta-induced growth inhibition by preventing TGF-beta-induced G1 arrest. Smad7 inhibits TGF-beta-mediated downregulation of c-Myc, CDK4, and Cyclin D1, and suppresses the expression of p21(Cip1). As a result, Smad7 inhibits TGF-beta-mediated downregulation of Rb phosphorylation. Furthermore, Smad7 inhibits the apoptosis of these cells. Together, Smad7 may increase the tumorigenicity of FET cells by blocking TGF-beta-induced growth inhibition and by inhibiting apoptosis. Thus, this study provides a mechanism by which a portion of human colorectal tumors may become refractory to tumor-suppressive actions of TGF-beta that might result in increased tumorigenicity.

Bowel injury following induced abortion.

PubMed

Jhobta, R S; Attri, A K; Jhobta, A

2007-01-01

Bowel injury is an uncommonly reported yet serious complication of induced abortion, which is often performed illegally by persons without any medical training in developing countries. A sudden increase in cases prompted the authors to analyze this problem. A retrospective review was done of 11 cases of bowel injury following induced abortion seen over 2 years at Government Medical College and Hospital, Chandigarh, India. Young, married women of low socioeconomic status with a strong preference for male children were the predominant recipients of induced abortion in India. The terminal ileum and pelvic colon were the most commonly injured portions of the bowel owing to their anatomic locations. Preoperative resuscitation, then resection with exteriorization of bowel and thorough peritoneal lavage, is the treatment for bowel injury incurred during induced abortion when the patient presents late.

Apoptosis inducing factor gene depletion inhibits zearalenone-induced cell death in a goat Leydig cell line.

PubMed

Yang, Diqi; Jiang, Tingting; Lin, Pengfei; Chen, Huatao; Wang, Lei; Wang, Nan; Zhao, Fan; Tang, Keqiong; Zhou, Dong; Wang, Aihua; Jin, Yaping

2017-01-01

Zearalenone (ZEA) is a contaminant of human food and animal feedstuffs that causes health hazards. However, the signal pathways underlying ZEA toxicity remain elusive. The aims of this study were to determine which pathways are involved in ZEA-induced cell death and investigate the effect of apoptosis inducing factor (AIF) on cell death during ZEA treatment in the immortalized goat Leydig cell line hTERT-GLC. This study showed that ZEA-induced cell death in hTERT-GLCs works via endoplasmic reticulum (ER) stress, the caspase-dependent pathway, the caspase-independent pathway and autophagy. Recombinant lentiviral vectors were constructed to silence AIF expression in hTERT-GLCs. Flow cytometry results showed that knockdown of AIF diminished ZEA-induced cell apoptosis in hTERT-GLCs. Furthermore, we found AIF depletion down-regulated phosphoIRE1α, GRP78, CHOP and promoted the switch of LC3-I to LC3-II. Therefore, ZEA induces cytotoxicity in hTERT-GLCs via different pathways, while AIF-mediated signaling plays a critical role in ZEA-induced cell death in hTERT-GLCs. Copyright © 2016 Elsevier Inc. All rights reserved.

Molecular mechanism of emotional stress-induced and catecholamine-induced heart attack.

PubMed

Ueyama, Takashi; Senba, Emiko; Kasamatsu, Ken; Hano, Takuzo; Yamamoto, Katsuhiro; Nishio, Ichiro; Tsuruo, Yoshihiro; Yoshida, Ken-ichi

2003-01-01

Emotional or physical stress triggers 'tako-tsubo' cardiomyopathy or 'transient left ventricular apical ballooning', but the pathogenesis is unclear. In response to the immobilization stress of rats, a useful model of emotional stress, rapid activation of p44/p42 mitogen-activated protein kinase was observed in the heart, followed by a transient upregulation of immediate early genes in the smooth muscle cells of coronary arteries, the endothelial cells and the myocardium. Heat shock protein 70 was induced in the aortic and coronary arterial smooth muscle cells and in the myocardium. Natriuretic peptide genes were also upregulated in the myocardium. Sequential gene expression can be considered as an adaptive response to emotional stress. Blocking of both alpha-adrenoceptors and beta-adrenoceptors eliminated the upregulation of immediate early genes induced by stress, while alpha-agonists and beta-agonists upregulated immediate early genes in the perfused heart. Activation of alpha-adrenoceptors and beta-adrenoceptors is the primary trigger of emotional stress-induced molecular changes in the heart.

Mechanisms of the hepatoprotective effects of tamoxifen against drug-induced and chemical-induced acute liver injuries

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yoshikawa, Yukitaka; Miyashita, Taishi; Higuchi, Satonori

Although estrogen receptor (ER)α agonists, such as estradiol and ethinylestradiol (EE2), cause cholestasis in mice, they also reduce the degree of liver injury caused by hepatotoxicants as well as ischemia–reperfusion. The functional mechanisms of ERα have yet to be elucidated in drug-induced or chemical-induced liver injury. The present study investigated the effects of an ERα agonist, selective ER modulators (SERMs) and an ER antagonist on drug-induced and chemical-induced liver injuries caused by acetaminophen, bromobenzene, diclofenac, and thioacetamide (TA). We observed hepatoprotective effects of EE2, tamoxifen (TAM) and raloxifene pretreatment in female mice that were exposed to a variety of hepatotoxicmore » compounds. In contrast, the ER antagonist did not show any hepatoprotective effects. DNA microarray analyses suggested that monocyte to macrophage differentiation-associated 2 (Mmd2) protein, which has an unknown function, is commonly increased by TAM and RAL pretreatment, but not by pretreatment with the ER antagonist. In ERα-knockout mice, the hepatoprotective effects of TAM and the increased expression of Mmd2 mRNA were not observed in TA-induced liver injury. To investigate the function of Mmd2, the expression level of Mmd2 mRNA was significantly knocked down to approximately 30% in mice by injection of siRNA for Mmd2 (siMmd2). Mmd2 knockdown resulted in a reduction of the protective effects of TAM on TA-induced liver injury in mice. This is the first report of the involvement of ERα in drug-induced or chemical-induced liver injury. Upregulation of Mmd2 protein in the liver was suggested as the mechanism of the hepatoprotective effects of EE2 and SERMs. -- Highlights: ► Liver injury induced by drugs or chemicals was investigated in mice. ► Liver injury was suppressed by pretreatment with tamoxifen in female mice. ► Mmd2, whose function was unknown, could be a candidate gene for liver protection. ► Tamoxifen up-regulated Mmd2 m

Rhodiola sachalinesis induces the expression of inducible nitric oxide synthase gene by murine fetal hepatocytes (BNL CL.2).

PubMed

Pae, H O; Seo, W G; Oh, G S; Kim, N Y; Kim, Y M; Kwon, T O; Shin, M K; Chai, K Y; Chung, H T

2001-02-01

We have examined the effect of the aqueous extract of Rhodiola sachalinensis root (RSE), a traditional herbal medicine, on nitric oxide (NO) synthesis in murine fetal hepatocytes (BNL CL.2) by measuring the stable end-product nitrite and the mRNA of inducible NO synthase (iNOS). Interferon-gamma (IFN-gamma) by itself failed to induce NO synthesis in BNL CL.2 cells. RSE also did not elicit NO synthesis at concentrations up to 1,000 microg/ml, but dose- and time-dependently induced NO synthesis in the presence of IFN-gamma in BNL CL.2 cells. Whereas RSE or IFN-gamma failed to induce detectable levels of iNOS mRNA, a combination of RSE and IFN-gamma markedly induced iNOS mRNA in BNL CL.2 cells. Thus, we found that RSE triggered IFN-gamma-primed BNL CL.2 cells to synthesize NO by inducing iNOS gene expression. The capability of RSE to induce NO synthesis might be related to the therapeutic efficacy of RSE on the liver diseases.

Bellows flow-induced vibrations

NASA Technical Reports Server (NTRS)

Tygielski, P. J.; Smyly, H. M.; Gerlach, C. R.

1983-01-01

The bellows flow excitation mechanism and results of comprehensive test program are summarized. The analytical model for predicting bellows flow induced stress is refined. The model includes the effects of an upstream elbow, arbitrary geometry, and multiple piles. A refined computer code for predicting flow induced stress is described which allows life prediction if a material S-N diagram is available.

[Drug-induced gynecomastia].

PubMed

Schirren, U; Hinz, B; Schirren, C

1986-01-01

Concerning four own observations by men in the age of 41-69 years it has been reported about the drug-induced gynecomastia. It can be demonstrated that the spironolactone induced gynecomastia disappeared after stopping this drug. The knowledge of such side effects is the condition for a pre-information of the patient at the beginning of therapy. The mode of action of spironolactone is discussed. It is referred about the important role of the disturbance of the relation androgen: estrogens under spironolactone as well as the peripheral antiandrogen effect of this substance.

Sleep-inducing factors.

PubMed

García-García, Fabio; Acosta-Peña, Eva; Venebra-Muñoz, Arturo; Murillo-Rodríguez, Eric

2009-08-01

Kuniomi Ishimori and Henri Piéron were the first researchers to introduce the concept and experimental evidence for a chemical factor that would presumably accumulate in the brain during waking and eventually induce sleep. This substance was named hypnotoxin. Currently, the variety of substances which have been shown to alter sleep includes peptides, cytokines, neurotransmitters and some substances of lipidic nature, many of which are well known for their involvement in other biological activities. In this chapter, we describe the sleep-inducing properties of the vasoactive intestinal peptide, prolactin, adenosine and anandamide.

The effects of varenicline on stress-induced and cue-induced craving for cigarettes.

PubMed

Ray, Lara A; Lunny, Katy; Bujarski, Spencer; Moallem, Nathasha; Krull, Jennifer L; Miotto, Karen

2013-07-01

Varenicline is a partial agonist of the α4β2 nicotinic acetylcholine receptor approved by the FDA for the treatment of nicotine dependence. While the clinical efficacy of varenicline for smoking cessation is well-supported, its biobehavioral mechanisms of action remain poorly understood. This randomized, crossover, placebo-controlled, human laboratory study combines guided imagery stress exposure with in vivo presentation of cigarette cues to test the effects of varenicline on stress-induced and cue-induced craving for cigarettes. A total of 40 (13 females) daily smokers (≥10 cigarettes per day) completed a guided imagery exposure (stress and neutral) followed by the presentation of cigarette cues at the target dose of varenicline (1mg twice per day) and on matched placebo. Multilevel regression models revealed a significant main effect of varenicline (p<.01) such that it reduced cigarette craving across the experimental paradigm, compared to placebo. There was also a significant medication×stress×trial interaction indicating that varenicline attenuated cue induced craving following neutral imagery but not when cues were preceded by stress induction (i.e., stress+cues). These results elucidate the biobehavioral effects of varenicline for nicotine dependence and suggest that varenicline-induced amelioration of cigarette craving is unique to tonic craving and cue-induced craving following neutral imagery but does not extend to the combination of stress plus cues. Copyright © 2013. Published by Elsevier Ireland Ltd.

Observations on instabilities of cavitating inducers

NASA Technical Reports Server (NTRS)

Braisted, D.; Brennen, C.

1978-01-01

Experimental observations of instability of cavitating inducers were made for two different inducers operating at different flow coefficients. In general, instability occurred just before head breakdown. Auto-oscillation and rotating cavitation were observed. Analysis of small-amplitude behavior of the inducer and hydraulic system is carried out, and analytical predictions of stability limits were compared with experiment.

Subsidence Induced by Underground Extraction

USGS Publications Warehouse

Galloway, Devin L.

2016-01-01

Subsidence induced by underground extraction is a class of human-induced (anthropogenic) land subsidence that principally is caused by the withdrawal of subsurface fluids (groundwater, oil, and gas) or by the underground mining of coal and other minerals.

Berberine Induces Caspase-Independent Cell Death in Colon Tumor Cells through Activation of Apoptosis-Inducing Factor

PubMed Central

Wang, Lihong; Liu, Liping; Shi, Yan; Cao, Hanwei; Chaturvedi, Rupesh; Calcutt, M. Wade; Hu, Tianhui; Ren, Xiubao; Wilson, Keith T.; Polk, D. Brent; Yan, Fang

2012-01-01

Berberine, an isoquinoline alkaloid derived from plants, is a traditional medicine for treating bacterial diarrhea and intestinal parasite infections. Although berberine has recently been shown to suppress growth of several tumor cell lines, information regarding the effect of berberine on colon tumor growth is limited. Here, we investigated the mechanisms underlying the effects of berberine on regulating the fate of colon tumor cells, specifically the mouse immorto-Min colonic epithelial (IMCE) cells carrying the Apc min mutation, and of normal colon epithelial cells, namely young adult mouse colonic epithelium (YAMC) cells. Berberine decreased colon tumor colony formation in agar, and induced cell death and LDH release in a time- and concentration-dependent manner in IMCE cells. In contrast, YAMC cells were not sensitive to berberine-induced cell death. Berberine did not stimulate caspase activation, and PARP cleavage and berberine-induced cell death were not affected by a caspase inhibitor in IMCE cells. Rather, berberine stimulated a caspase-independent cell death mediator, apoptosis-inducing factor (AIF) release from mitochondria and nuclear translocation in a ROS production-dependent manner. Amelioration of berberine-stimulated ROS production or suppression of AIF expression blocked berberine-induced cell death and LDH release in IMCE cells. Furthermore, two targets of ROS production in cells, cathepsin B release from lysosomes and PARP activation were induced by berberine. Blockage of either of these pathways decreased berberine-induced AIF activation and cell death in IMCE cells. Thus, berberine-stimulated ROS production leads to cathepsin B release and PARP activation-dependent AIF activation, resulting in caspase-independent cell death in colon tumor cells. Notably, normal colon epithelial cells are less susceptible to berberine-induced cell death, which suggests the specific inhibitory effects of berberine on colon tumor cell growth. PMID:22574158

Tributyltin chloride disrupts aortic vascular reactivity and increases reactive oxygen species production in female rats.

PubMed

Ximenes, Carolina Falcão; Rodrigues, Samya Mere Lima; Podratz, Priscila Lang; Merlo, Eduardo; de Araújo, Julia Fernandez Puñal; Rodrigues, Lívia Carla Melo; Coitinho, Juliana Barbosa; Vassallo, Dalton Valentim; Graceli, Jones Bernardes; Stefanon, Ivanita

2017-11-01

Organotin compounds, such as tributyltin (TBT), are environment contaminants that induce bioaccumulation and have potential toxic effects on marine species and mammals. TBT have been banned by the International Maritime Organization in 2003. However, the assessment of butyltin and metal contents in marine sediments has demonstrated high residual levels of TBT in some cases exceeding 7000 ng Sn g -1 . The acceptable daily intake (ADI) level for TBT established by the World Health Organization is 0.5 μg/kg bw/day is based on genotoxicity, reproduction, teratogenicity, immunotoxicity, and mainly neurotoxicity. However, their effect on the cardiovascular system is not well understood. In this study, female rats were exposed to 0.5 μg/kg/day of TBT for 15 days with the goal of understanding the effect of TBT on vascular function. Female Wistar rats were treated daily by gavage and divided into control (n = 10) and TBT (n = 10) groups. The aortic rings were incubated with phenylephrine in both the presence and absence of endothelium. The phenylephrine concentration-response curves were generated by exposing endothelium-intact samples to N G -nitro-L-arginine methyl ester (L-NAME), apocynin, superoxide dismutase (SOD), catalase, tiron, and allopurinol. Acetylcholine (ACh) and sodium nitroprusside (SNP) were used to evaluate the relaxation response. Exposure to TBT reduced serum 17β-estradiol E 2 levels and increased vascular reactivity. After incubation with L-NAME, the vascular reactivity to phenylephrine was significantly higher. Apocynin, SOD, catalase, and tiron decreased the vascular reactivity to phenylephrine to a significantly greater extent in TBT-treated rats than in the control rat. The relaxation induced by ACh and SNP was significantly reduced in TBT rats. Exposure to TBT induced aortic wall atrophy and increased superoxide anion production and collagen deposition. These results provide evidence that exposing rats to the current ADI for TBT (0.5�

Radiation-induced genomic instability

NASA Technical Reports Server (NTRS)

Kronenberg, A.

1994-01-01

Quantitative assessment of the heritable somatic effects of ionizing radiation exposures has relied upon the assumption that radiation-induced lesions were 'fixed' in the DNA prior to the first postirradiation mitosis. Lesion conversion was thought to occur during the initial round of DNA replication or as a consequence of error-prone enzymatic processing of lesions. The standard experimental protocols for the assessment of a variety of radiation-induced endpoints (cell death, specific locus mutations, neoplastic transformation and chromosome aberrations) evaluate these various endpoints at a single snapshot in time. In contrast with the aforementioned approaches, some studies have specifically assessed radiation effects as a function of time following exposure. Evidence has accumulated in support of the hypothesis that radiation exposure induces a persistent destabilization of the genome. This instability has been observed as a delayed expression of lethal mutations, as an enhanced rate of accumulation of non-lethal heritable alterations, and as a progressive intraclonal chromosomal heterogeneity. The genetic controls and biochemical mechanisms underlying radiation-induced genomic instability have not yet been delineated. The aim is to integrate the accumulated evidence that suggests that radiation exposure has a persistent effect on the stability of the mammalian genome.

Does stress induce bowel dysfunction?

PubMed

Chang, Yu-Ming; El-Zaatari, Mohamad; Kao, John Y

2014-08-01

Psychological stress is known to induce somatic symptoms. Classically, many gut physiological responses to stress are mediated by the hypothalamus-pituitary-adrenal axis. There is, however, a growing body of evidence of stress-induced corticotrophin-releasing factor (CRF) release causing bowel dysfunction through multiple pathways, either through the HPA axis, the autonomic nervous systems, or directly on the bowel itself. In addition, recent findings of CRF influencing the composition of gut microbiota lend support for the use of probiotics, antibiotics, and other microbiota-altering agents as potential therapeutic measures in stress-induced bowel dysfunction.

Halenaquinone inhibits RANKL-induced osteoclastogenesis.

PubMed

Tsukamoto, Sachiko; Takeuchi, Tomoharu; Kawabata, Tetsuro; Kato, Hikaru; Yamakuma, Michiko; Matsuo, Kanae; El-Desoky, Ahmed H; Losung, Fitje; Mangindaan, Remy E P; de Voogd, Nicole J; Arata, Yoichiro; Yokosawa, Hideyoshi

2014-11-15

Halenaquinone was isolated from the marine sponge Petrosia alfiani as an inhibitor of osteoclastogenic differentiation of murine RAW264 cells. It inhibited the RANKL (receptor activator of nuclear factor-κB ligand)-induced upregulation of TRAP (tartrate-resistant acid phosphatase) activity as well as the formation of multinuclear osteoclasts. In addition, halenaquinone substantially suppressed RANKL-induced IκB degradation and Akt phosphorylation. Thus, these results suggest that halenaquinone inhibits RANKL-induced osteoclastogenesis at least by suppressing the NF-κB and Akt signaling pathways. Copyright © 2014 Elsevier Ltd. All rights reserved.

Terbinafine-induced lichenoid drug eruption.

PubMed

Zheng, Yue; Zhang, Jie; Chen, Haiyan; Lai, Wei; Maibach, Howard I

2017-03-01

Drug-induced lichen planus has been induced by antibiotics, anticonvulsants, antidiabetics, antimalarials, antitubercular drugs, antihypertensives, psychiatric drugs, chemotherapeutic agents, diuretic, heavy metals, NSAIDs, etc. Terbinafine, an antifungal agent, is widely used for dermatophyte infections and onychomycosis. Cutaneous adverse effects of terbinafine are rarely reported. Here, we report a case of terbinafine-induced lichenoid drug eruption in a 22-year-old who presented with generalized lichenoid eruption 2 weeks after terbinafine initiation of. The body and lip cleared completely after 8 weeks of drug withdrawal; nail change cleared after 12 weeks.

Local bias-induced phase transitions

DOE PAGES

Seal, Katyayani; Baddorf, Arthur P.; Jesse, Stephen; ...

2008-11-27

Electrical bias-induced phase transitions underpin a wide range of applications from data storage to energy generation and conversion. The mechanisms behind these transitions are often quite complex and in many cases are extremely sensitive to local defects that act as centers for local transformations or pinning. Furthermore, using ferroelectrics as an example, we review methods for probing bias-induced phase transitions and discuss the current limitations and challenges for extending the methods to field-induced phase transitions and electrochemical reactions in energy storage, biological and molecular systems.

Pb exposure attenuates hypersensitivity in vivo by increasing regulatory T cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fang, Liang; Zhao, Fang; Shen, Xuefeng

Pb is a common environmental pollutant affecting various organs. Exposure of the immune system to Pb leads to immunosuppression or immunodysregulation. Although previous studies showed that Pb exposure can modulate the function of helper T cells, Pb immunotoxicity remains incompletely understood. In this study, we investigated the effect of Pb exposure on T cell development, and the underlying mechanism of Pb-induced suppression of the delayed-type hypersensitivity (DTH) response in vivo. Sprague–Dawley rats were exposed to 300 ppm Pb-acetate solution via the drinking water for six weeks, and we found that Pb exposure significantly increased Pb concentrations in the blood bymore » 4.2-fold (p < 0.05) as compared to those in the control rats. In Pb-exposed rats, the amount of thymic CD4{sup +}CD8{sup −} and peripheral CD4{sup +} T cells was significantly reduced, whereas, CD8{sup +} population was not affected. In contrast to conventional CD4{sup +} T cells, Foxp3{sup +} regulatory T cells (Tregs) were increased in both the thymus and peripheral lymphoid organs of Pb-exposed rats. In line with the increase of Tregs, the DTH response of Pb-exposed rats was markedly suppressed. Depletion of Tregs reversed the suppression of DTH response by Pb-exposed CD4{sup +} T cells in an adoptive transfer model, suggesting a critical role of the increased Tregs in suppressing the DTH response. Collectively, this study revealed that Pb-exposure may upregulate Tregs, thereby leading to immunosuppression. -- Highlights: ► Pb exposure impaired CD4{sup +} thymic T cell development. ► Peripheral T lymphocytes were reduced following Pb exposure. ► Pb exposure increases thymic and peripheral Treg cells in rats. ► Tregs played a critical role in Pb-exposure-induced immune suppression.« less

Genetics Home Reference: cold-induced sweating syndrome

MedlinePlus

... Health Conditions Cold-induced sweating syndrome Cold-induced sweating syndrome Printable PDF Open All Close All Enable ... view the expand/collapse boxes. Description Cold-induced sweating syndrome is characterized by problems with regulating body ...

In vitro immunotoxicology of quantum dots and comparison with dissolved cadmium and tellurium.

PubMed

Bruneau, Audrey; Fortier, Marlene; Gagne, Francois; Gagnon, Christian; Turcotte, Patrice; Tayabali, Azam; Davis, Thomas A; Auffret, Michel; Fournier, Michel

2015-01-01

The increasing use of products derived from nanotechnology has raised concerns about their potential toxicity, especially at the immunocompetence level in organisms. This study compared the immunotoxicity of cadmium sulfate/cadmium telluride (CdS/Cd-Te) mixture quantum dots (QDs) and their dissolved components, cadmium chloride (CdCl2 )/sodium telluride (NaTeO3 ) salts, and a CdCl2 /NaTeO3 mixture on four animal models commonly used in risk assessment studies: one bivalve (Mytilus edulis), one fish (Oncorhynchus mykiss), and two mammals (mice and humans). Our results of viability and phagocytosis biomarkers revealed that QDs were more toxic than dissolved metals for blue mussels. For other species, dissolved metals (Cd, Te, and Cd-Te mixture) were more toxic than the nanoparticles (NPs). The most sensitive species toward QDs, according to innate immune cells, was humans (inhibitory concentration [IC50 ] = 217 μg/mL). However, for adaptative immunity, lymphoblastic transformation in mice was decreased for small QD concentrations (EC50 = 4 μg/mL), and was more sensitive than other model species tested. Discriminant function analysis revealed that blue mussel hemocytes were able to discriminate the toxicity of QDs, Cd, Te, and Cd-Te mixture (Partial Wilk's λ = 0.021 and p < 0.0001). For rainbow trout and human cells, the immunotoxic effects of QDs were similar to those obtained with the dissolved fraction of Cd and Te mixture. For mice, the toxicity of QDs markedly differed from those observed with Cd, Te, and dissolved Cd-Te mixture. The results also suggest that aquatic species responded more differently than vertebrates to these compounds. The results lead to the recommendation that mussels and mice were most able to discriminate the effects of Cd-based NPs from the effects of dissolved Cd and Te at the immunocompetence level. © 2013 Wiley Periodicals, Inc.

Toxic effects of dietary methylmercury on immune function and hematology in American kestrels (Falco sparverius)

USGS Publications Warehouse

Fallacara, Dawn M.; Halbrook, Richard S.; French, John B.

2011-01-01

Fifty-nine adult male American kestrels (Falco sparverius) were assigned to one of three diet formulations including 0 (control), 0.6, and 3.9 μg/g (dry wt) methylmercury (MeHg). Kestrels received their diets daily for 13 weeks to assess the effects of dietary MeHg on immunocompetence. Immunotoxic endpoints included assessment of cell-mediated immunity (CMI) using the phytohemagglutinin (PHA) skin-swelling assay and primary and secondary antibody-mediated immune responses (IR) via the sheep red blood cell (SRBC) hemagglutination assay. Select hematology and histology parameters were evaluated to corroborate the results of functional assays and to assess immunosuppression of T and B cell-dependent components in spleen tissue. Kestrels in the 0.6 and 3.9 μg/g MeHg groups exhibited suppression of CMI, including lower PHA stimulation indexes (p = 0.019) and a 42 to 45% depletion of T cell-dependent splenic lymphoid tissue (p = 0.006). Kestrels in the 0.6 μg/g group exhibited suppression of the primary IR to SRBCs (p = 0.014). MeHg did not have a noticeable effect on the secondary IR (p = 0.166). Elevation of absolute heterophil counts (p p p = 0.003) was apparent in the 3.9 μg/g group at week 12. Heterophilia, or the excess of heterophils in peripheral blood above normal ranges, was apparent in seven of 17 (41%) kestrels in the 3.9 μg/g group and was indicative of an acute inflammatory response or physiological stress. This study revealed that adult kestrels were more sensitive to immunotoxic effects of MeHg at environmentally relevant dietary concentrations than they were to reproductive effects as previously reported.

Effect of in ovo exposure to an organochlorine mixture extracted from double crested cormorant eggs (Phalacrocorax auritus) and PCB 126 on immune function of juvenile chickens

USGS Publications Warehouse

Lavoie, E.T.; Wiley, F.; Grasman, K.A.; Tillitt, D.E.; Sikarskie, J.G.; Bowerman, W.W.

2007-01-01

Organochlorine (OC) contaminants including polychlorinated biphenyls (PCBs) and p, p'-dichlorodiphenyldichloroethylene (DDE) have been associated with immune modulation in wild fish-eating birds from the Great Lakes. The objective of this study was to evaluate the immune function of juvenile chickens after in ovo exposure to PCB 126 or an environmentally relevant OC mixture extracted from eggs of double crested cormorants (Phalacrocorax auritus) from Green Bay, Lake Michigan, USA. Fertile white leghorn chicken (Gallus domesticus) eggs were injected before incubation with 0.55-1.79 ng TCDD equivalents (TEQ)/egg PCB 126 and 1.2-4.9 ng TEQs/egg of cormorant egg extract into the air cell in two separate experiments. After hatching, the immune function was tested using in vivo phytohemagglutinin (PHA) skin response in 11-day-old chicks, antibody titers to immunization with sheep red blood cells (SRBC) in 28-day-old chicks, and, at necropsy, thymus and bursal mass and cellularity. PCB 126 decreased antibody titers at all doses and decreased the thymus and bursa index but not cellularity at 1.79 ng TEQ/egg. The cormorant egg extract caused no significant alterations in immune function even though it has been demonstrated as immunotoxic in chicken embryos. However, twofold to threefold increases in total anti-SRBC titers in 28-day-old chicks exposed to 1.2 or 2.4 ng TEQ/egg of cormorant extract were similar to elevations in anti-SRBC titer observed in Caspian tern (Sterna caspia) chicks from a highly OC-contaminated site in Saginaw Bay, Lake Huron. Posthatch exposure to OC through fish consumption in addition to in ovo OC exposure might be associated with the immune modulation reported in wild birds. Chicks in this study might have begun to compensate for embryonic immunotoxicity by the ages at which we studied them. ?? 2007 Springer Science+Business Media, LLC.

Polarization-induced interference within electromagnetically induced transparency for atoms of double-V linkage

NASA Astrophysics Data System (ADS)

Sun, Yuan; Liu, Chang; Chen, Ping-Xing; Liu, Liang

2018-02-01

People have been paying attention to the role of atoms' complex internal level structures in the research of electromagnetically induced transparency (EIT) for a long time, where the various degenerate Zeeman levels usually generate complex linkage patterns for the atomic transitions. It turns out, with special choices of the atomic states and the atomic transitions' linkage structure, clear signatures of quantum interference induced by the probe and coupling light's polarizations can emerge from a typical EIT phenomena. We propose to study a four-state system with double-V linkage pattern for the transitions and analyze the polarization-induced interference under the EIT condition. We show that such interference arises naturally under mild conditions on the optical field and atom manipulation techniques. Moreover, we construct a variation form of double-M linkage pattern where the polarization-induced interference enables polarization-dependent cross modulation between incident weak lights that can be effective even at the few-photon level. The theme is to gain more insight into the essential question: how can we build a nontrivial optical medium where incident lights experience polarization-dependent nonlinear optical interactions, valid for a wide range of incidence intensities down to the few-photon level?

Does a parthenogenesis-inducing Wolbachia induce vestigial cytoplasmic incompatibility?

NASA Astrophysics Data System (ADS)

Kraaijeveld, Ken; Reumer, Barbara M.; Mouton, Laurence; Kremer, Natacha; Vavre, Fabrice; van Alphen, Jacques J. M.

2011-03-01

Wolbachia is a maternally inherited bacterium that manipulates the reproduction of its host. Recent studies have shown that male-killing strains can induce cytoplasmic incompatibility (CI) when introgressed into a resistant host. Phylogenetic studies suggest that transitions between CI and other Wolbachia phenotypes have also occurred frequently, raising the possibility that latent CI may be widespread among Wolbachia. Here, we investigate whether a parthenogenesis-inducing Wolbachia strain can also induce CI. Parthenogenetic females of the parasitoid wasp Asobara japonica regularly produce a small number of males that may be either infected or not. Uninfected males were further obtained through removal of the Wolbachia using antibiotics and from a naturally uninfected strain. Uninfected females that had mated with infected males produced a slightly, but significantly more male-biased sex ratio than uninfected females that had mated with uninfected males. This effect was strongest in females that mated with males that had a relatively high Wolbachia titer. Quantitative PCR indicated that infected males did not show higher ratios of nuclear versus mitochondrial DNA content. Wolbachia therefore does not cause diploidization of cells in infected males. While these results are consistent with CI, other alternatives such as production of abnormal sperm by infected males cannot be completely ruled out. Overall, the effect was very small (9%), suggesting that if CI is involved it may have degenerated through the accumulation of mutations.

Autophagy degrades hypoxia inducible factors

PubMed Central

DePavia, Adela; Jonasch, Eric; Liu, Xian-De

2016-01-01

ABSTRACT Hypoxia inducible factors are subjected to degradation by the ubiquitin-proteasome system (UPS), macroautophagy, and chaperone-mediated autophagy. The E3 ligases, ubiquitination, autophagy receptor proteins, and oxygen are determinants that direct hypoxia-inducible factors to different degradation pathways. PMID:27308629

Drug-induced cholestasis: mechanisms, models, and markers.

PubMed

Chatterjee, Sagnik; Annaert, Pieter

2018-04-27

Drug-induced cholestasis is a risk factor in progression of drug candidates, and poses serious health hazard if not detected before going into human. Intrahepatic accumulation of bile acids (BAs) represents a characteristic phenomenon associated with drug-induced cholestasis. The major challenges in obtaining a complete understanding of drug-induced cholestasis lies in the complexity of BA-mediated toxicity mechanisms and the impact of bile acids at different 'targets' such as transporters, enzymes and nuclear receptors. At the same time, it is not trivial to have a relevant in vitro system that recapitulates these features. In addition, lack of sensitive and early preclinical biomarkers, relevant to the clinical situation, complicates proper detection of drug-induced cholestasis. Significant overlap in biomarker signatures between different mechanisms of drug-induced liver injury (DILI) precludes identification of specific mechanisms. Over the last decade the knowledge gaps in drug-induced cholestasis are closing due to growing mechanistic understanding of BA-mediated toxicity at (patho)physiologically relevant BA concentrations. Significant progress has been made in the mechanistic understanding of drug-induced cholestasis and associated toxicity, biomarkers and susceptibility factors. In addition, novel in vitro models are evolving which provide a holistic understanding of processes underlying drug-induced cholestasis. This review summarizes the challenges and recent understandings about drug-induced cholestasis with a potential path forward. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

Behavioral cross-sensitization between DOCA-induced sodium appetite and cocaine-induced locomotor behavior

PubMed Central

Acerbo, Martin J.; Johnson, Alan Kim

2011-01-01

Behavioral sensitization involves increases in the magnitude of a response to a stimulus after repeated exposures to the same response initiator. Administration of psychomotor stimulants and the induction of appetitive motivational states associated with natural reinforcers like sugar and salt are among experimental manipulations producing behavioral sensitization. In rats, repeated administration of the mineralocorticoid agonist deoxycorticosterone acetate (DOCA) initially induces incremental increases in daily hypertonic saline consumption (i.e., sensitization of sodium appetite) in spite of the retention of sodium. The present studies investigated whether sodium appetite sensitization induced by DOCA shares mechanisms similar to those of psychomotor stimulant-induced sensitization, and whether there is evidence for reciprocal cross-sensitization. In Experiments 1 and 3, rats received control or cocaine treatments to induce locomotor sensitization. A week later DOCA (or vehicle) was administered to generate a sodium appetite. Animals pretreated with cocaine showed a greater sodium appetite. In Experiment 2, the order of the putative sensitizing treatments was reversed. Rats first received either a series of DOCA or vehicle treatments either with or without access to saline and were later tested for sensitization of the locomotor response to cocaine. Animals pretreated with DOCA without access to saline showed greater locomotor responses to cocaine than animals receiving vehicle treatments. Together these experiments indicate that treatments generating a sustained salt appetite and producing cocaine-induced psychomotor responses show reciprocal behavioral cross-sensitization. The underlying mechanisms accounting for this relationship may be the fact that psychostimulants and an unresolved craving for sodium can act as potent stressors. PMID:21352848

Magnetic-flutter-induced pedestal plasma transport

NASA Astrophysics Data System (ADS)

Callen, J. D.; Hegna, C. C.; Cole, A. J.

2013-11-01

Plasma toroidal rotation can limit reconnection of externally applied resonant magnetic perturbation (RMP) fields δB on rational magnetic flux surfaces. Hence it causes the induced radial perturbations δBρ to be small there, thereby inhibiting magnetic island formation and stochasticity at the top of pedestals in high (H-mode) confinement tokamak plasmas. However, the δBρs induced by RMPs increase away from rational surfaces and are shown to induce significant sinusoidal radial motion (flutter) of magnetic field lines with a radial extent that varies linearly with δBρ and inversely with distance from the rational surface because of the magnetic shear. This produces a radial electron thermal diffusivity that is (1/2)(δBρ/B0)2 times a kinetically derived, electron-collision-induced, magnetic-shear-reduced, effective parallel electron thermal diffusivity in the absence of magnetic stochasticity. These low collisionality flutter-induced transport processes and thin magnetic island effects are shown to be highly peaked in the vicinity of rational surfaces at the top of low collisionality pedestals. However, the smaller but finite level of magnetic-flutter-induced electron heat transport midway between rational surfaces is the primary factor that determines the electron temperature difference between rational surfaces at the pedestal top. The magnetic-flutter-induced non-ambipolar electron density transport can be large enough to push the plasma toward an electron density transport root. Requiring ambipolar density transport is shown to determine the radial electric field, the plasma toroidal rotation (via radial force balance), a reduced electron thermal diffusivity and increased ambipolar density transport in the pedestal. At high collisionality the various flutter effects are less strongly peaked at rational surfaces and generally less significant. They are thus less likely to exhibit flutter-induced resonant behaviour and transition toward an electron

GFRA1 promotes cisplatin-induced chemoresistance in osteosarcoma by inducing autophagy

PubMed Central

Kim, Mihwa; Jung, Ji-Yeon; Choi, Seungho; Lee, Hyunseung; Morales, Liza D.; Koh, Jeong-Tae; Kim, Sun Hun; Choi, Yoo-Duk; Choi, Chan; Slaga, Thomas J.; Kim, Won Jae; Kim, Dae Joon

2017-01-01

ABSTRACT Recent progress in chemotherapy has significantly increased its efficacy, yet the development of chemoresistance remains a major drawback. In this study, we show that GFRA1/GFRα1 (GDNF family receptor α 1), contributes to cisplatin-induced chemoresistance by regulating autophagy in osteosarcoma. We demonstrate that cisplatin treatment induced GFRA1 expression in human osteosarcoma cells. Induction of GFRA1 expression reduced cisplatin-induced apoptotic cell death and it significantly increased osteosarcoma cell survival via autophagy. GFRA1 regulates AMPK-dependent autophagy by promoting SRC phosphorylation independent of proto-oncogene RET kinase. Cisplatin-resistant osteosarcoma cells showed NFKB1/NFκB-mediated GFRA1 expression. GFRA1 expression promoted tumor formation and growth in mouse xenograft models and inhibition of autophagy in a GFRA1-expressing xenograft mouse model during cisplatin treatment effectively reduced tumor growth and increased survival. In cisplatin-treated patients, treatment period and metastatic status were associated with GFRA1-mediated autophagy. These findings suggest that GFRA1-mediated autophagy is a promising novel target for overcoming cisplatin resistance in osteosarcoma. PMID:27754745

GFRA1 promotes cisplatin-induced chemoresistance in osteosarcoma by inducing autophagy.

PubMed

Kim, Mihwa; Jung, Ji-Yeon; Choi, Seungho; Lee, Hyunseung; Morales, Liza D; Koh, Jeong-Tae; Kim, Sun Hun; Choi, Yoo-Duk; Choi, Chan; Slaga, Thomas J; Kim, Won Jae; Kim, Dae Joon

2017-01-02

Recent progress in chemotherapy has significantly increased its efficacy, yet the development of chemoresistance remains a major drawback. In this study, we show that GFRA1/GFRα1 (GDNF family receptor α 1), contributes to cisplatin-induced chemoresistance by regulating autophagy in osteosarcoma. We demonstrate that cisplatin treatment induced GFRA1 expression in human osteosarcoma cells. Induction of GFRA1 expression reduced cisplatin-induced apoptotic cell death and it significantly increased osteosarcoma cell survival via autophagy. GFRA1 regulates AMPK-dependent autophagy by promoting SRC phosphorylation independent of proto-oncogene RET kinase. Cisplatin-resistant osteosarcoma cells showed NFKB1/NFκB-mediated GFRA1 expression. GFRA1 expression promoted tumor formation and growth in mouse xenograft models and inhibition of autophagy in a GFRA1-expressing xenograft mouse model during cisplatin treatment effectively reduced tumor growth and increased survival. In cisplatin-treated patients, treatment period and metastatic status were associated with GFRA1-mediated autophagy. These findings suggest that GFRA1-mediated autophagy is a promising novel target for overcoming cisplatin resistance in osteosarcoma.

Gemcitabine-induced CXCL8 expression counteracts its actions by inducing tumor neovascularization

DOE Office of Scientific and Technical Information (OSTI.GOV)

Song, Yao; Baba, Tomohisa; Li, Ying-Yi

Patients with pancreatic ductal adenocarcinoma (PDAC) are frequently complicated with metastatic disease or locally advanced tumors, and consequently need chemotherapy. Gemcitabine is commonly used for PDAC treatment, but with limited efficacy. The capacity of gemcitabine to generate reactive oxygen species (ROS) in human pancreatic cancer cells, prompted us to examine its effects on the expression of pro-inflammatory cytokines and chemokines. We observed that gemcitabine enhanced selectively the expression of CXCL8 in human pancreatic cancer cells through ROS generation and NF-κB activation. In vitro blocking of CXCL8 failed to modulate gemcitabine-mediated inhibition of cell proliferation in human pancreatic cancer cells. Gemcitabine alsomore » enhanced CXCL8 expression in pancreatic cancer cells in xenografted tumor tissues. Moreover, anti-CXCL8 antibody treatment in vivo attenuated tumor formation as well as intra-tumoral vascularity in nude mice, which were transplanted with Miapaca-2 cells and treated with gemcitabine. Thus, gemcitabine-induced CXCL8 may counteract the drug through inducing neovascularization. - Highlights: • Gemcitabine induced CXCL8 expression in human pancreatic cancer cells. • CXCL8 expression required ROS generation and NF-κB activation. • CXCL8 did not affect in vitro proliferation of human pancreatic cancer cells. • CXCL8 in vivo counteracted gemcitabine by inducing neovascularization.« less

Fermion-induced quantum critical points.

PubMed

Li, Zi-Xiang; Jiang, Yi-Fan; Jian, Shao-Kai; Yao, Hong

2017-08-22

A unified theory of quantum critical points beyond the conventional Landau-Ginzburg-Wilson paradigm remains unknown. According to Landau cubic criterion, phase transitions should be first-order when cubic terms of order parameters are allowed by symmetry in the Landau-Ginzburg free energy. Here, from renormalization group analysis, we show that second-order quantum phase transitions can occur at such putatively first-order transitions in interacting two-dimensional Dirac semimetals. As such type of Landau-forbidden quantum critical points are induced by gapless fermions, we call them fermion-induced quantum critical points. We further introduce a microscopic model of SU(N) fermions on the honeycomb lattice featuring a transition between Dirac semimetals and Kekule valence bond solids. Remarkably, our large-scale sign-problem-free Majorana quantum Monte Carlo simulations show convincing evidences of a fermion-induced quantum critical points for N = 2, 3, 4, 5 and 6, consistent with the renormalization group analysis. We finally discuss possible experimental realizations of the fermion-induced quantum critical points in graphene and graphene-like materials.Quantum phase transitions are governed by Landau-Ginzburg theory and the exceptions are rare. Here, Li et al. propose a type of Landau-forbidden quantum critical points induced by gapless fermions in two-dimensional Dirac semimetals.

Electron-Beam-Induced Current | Materials Science | NREL

Science.gov Websites

Electron-Beam-Induced Current Electron-Beam-Induced Current Photo of a GaAsP-on-Si solar cell. EBIC measure electron-beam-induced current (EBIC). In presence of an electrostatic field (p-n junction

Photobiological implications of melanin photoprotection after UVB-induced tanning of human skin but not UVA-induced tanning.

PubMed

Coelho, Sergio G; Yin, Lanlan; Smuda, Christoph; Mahns, Andre; Kolbe, Ludger; Hearing, Vincent J

2015-03-01

Repetitive suberythemal UVA and/or UVB exposures were used to generate comparable UV-induced tans in human skin over the course of 2 weeks. To evaluate the potential photoprotective values of those UVA- and/or UVB- induced tans and to avoid the confounding issue of residual UV-induced DNA damage, we waited 1 week before challenging those areas with a 1.5 MED of UVA+UVB after which we measure DNA damage. The results show that the type of UV used to induce skin pigmentation affects the redistribution of melanin in the skin and/or de novo melanin synthesis. The UVA-induced tans failed to even provide a minimal SPF of 1.5, which suggests that producing a tan with UVA-rich sunlamps prior to a holiday or vacation is completely counterproductive. Published 2014. This article is a US Government work and is in the public domain in the USA.

High-fat diet-induced obesity leads to resistance to leptin-induced cardiomyocyte contractile response.

PubMed

Ren, Jun; Zhu, Bang-Hao; Relling, David P; Esberg, Lucy B; Ceylan-Isik, Asli F

2008-11-01

Levels of the obese gene product leptin are often elevated in obesity and may contribute to obesity-induced cardiovascular complications. However, the role of leptin in obesity-associated cardiac abnormalities has not been clearly defined. This study was designed to determine the influence of high-fat diet-induced obesity on cardiac contractile response of leptin. Mechanical and intracellular Ca(2+) properties were evaluated using an IonOptix system in cardiomyocytes from adult rats fed low- and high-fat diets for 12 weeks. Cardiomyocyte contractile and intracellular Ca(2+) properties were examined including peak shortening, duration and maximal velocity of shortening/relengthening (TPS/TR(90), +/-dl/dt), Fura-2-fluorescence intensity change (DeltaFFI), and intracellular Ca(2+) decay rate (tau). Expression of the leptin receptor (Ob-R) was evaluated by western blot analysis. High-fat diet increased systolic blood pressure and plasma leptin levels. PS and +/-dl/dt were depressed whereas TPS and TR(90) were prolonged after high-fat diet feeding. Leptin elicited a concentration-dependent (0-1,000 nmol/l) inhibition of PS, +/-dl/dt, and DeltaFFI in low-fat but not high-fat diet-fed rat cardiomyocytes without affecting TPS and TR(90). The Janus kinase 2 (JAK2) inhibitor AG490, the mitogen-activated protein kinase (MAPK) inhibitor SB203580, and the nitric oxide synthase (NOS) inhibitor L-NAME abrogated leptin-induced cardiomyocyte contractile response in low-fat diet group without affecting the high-fat diet group. High-fat diet significantly downregulated cardiac expression of Ob-R. Elevation of extracellular Ca(2+) concentration nullified obesity-induced cardiomyocyte mechanical dysfunction and leptin-induced depression in PS. These data indicate presence of cardiac leptin resistance in diet-induced obesity possibly associated with impaired leptin receptor signaling.

From immunotoxicity to nanotherapy: the effects of nanomaterials on the immune system.

PubMed

Smith, Matthew J; Brown, Jared M; Zamboni, William C; Walker, Nigel J

2014-04-01

The potential for human exposure to the diverse and ever-changing world of nanoscale materials has raised concerns about their influence on health and disease. The novel physical and chemical properties of these materials, which are associated with their small size, complicate toxicological evaluations. Further, these properties may make engineered nanomaterials (ENMs) a prime target for interaction with the immune system following uptake by phagocytes. Undesired effects on antigen-presenting cells and other phagocytic cells are of concern due to the high likelihood of ENM uptake by these cells. In addition, ENM interactions with lymphocytes and other cell types can contribute to a varied spectrum of possible effects, including inflammation, hypersensitivity, and immunomodulation. Furthermore, the mast cell (a type of immune cell traditionally associated with allergy) appears to contribute to certain inflammatory and toxic effects associated with some ENMs. Although incidental exposure may be undesirable, nanomedicines engineered for various clinical applications provide opportunities to develop therapies that may or may not intentionally target the immune system. The interaction between ENMs and the immune system and the resulting pharmacokinetic and phenotypic responses are critical factors that dictate the balance between toxicity and clinical efficacy of nanotherapeutics.

Comparison of subchronic immunotoxicity of four different types of aluminum-based nanoparticles.

PubMed

Park, Eun-Jung; Lee, Sang Jin; Lee, Gwang-Hee; Kim, Dong-Wan; Yoon, Cheolho; Lee, Byoung-Seok; Kim, Younghun; Chang, Jaerak; Lee, Kyuhong

2018-04-01

Nanoparticles (NPs) have recently emerged as an inhalable pollutant, owing to their applications, aluminum-based NPs (Al-NPs) have been prioritized for toxicity testing. In the current study, we compared the pulmonary biopersistence and subsequent toxicity of four different types of Al-NPs (two rod-type aluminum oxide NPs [AlONPs] with different aspect ratios [short (S)- and long (L)-AlONPs], spherical aluminum cerium oxide NPs [AlCeO 3 , AlCeONPs] and spherical γ-aluminum oxide hydroxide nanoparticles [AlOOHNPs]) 13weeks after a single intratracheal instillation, considering the importance of their properties in their toxicity. We found that the pulmonary biopersistence of Al-NPs was strengthened by a high aspect ratio in the rod-type AlONPs and by the presence of hydroxyl groups in the spherical-type Al-NPs. The highest toxicity was observed in the mice treated with AlOOHNPs, which showed low biostability. More importantly, we identified that the commercially available AlCeONPs were Al 2 O 3 -coated CeO 2 NPs, but not AlCeO 3 NPs, although they have been sold under the trade name of AlCeONPs. In conclusion, the aspect ratio and biostability may be important factors in the determination of the biopersistence of NPs and the subsequent biological response. In addition, the physicochemical properties of NPs should be examined in detail before their release into the market to prevent unexpected adverse health effects. Copyright © 2017 John Wiley & Sons, Ltd.

THE COMPARATIVE IMMUNOTOXICITY OF FIVE SELCTED COMPOUNDS FOLLOWING DEVELOPMENTAL OR ADULT EXPOSURE

EPA Science Inventory

It is well established that human diseases associated with abnormal immune function, including some common infectious diseases and asthma, are considerably more prevalent at younger ages. Although not established absolutely, it is generally believed that development constitutes ...

Immunotoxicity of copper nanoparticle and copper sulfate in a common Indian earthworm.

PubMed

Gautam, Arunodaya; Ray, Abhishek; Mukherjee, Soumalya; Das, Santanu; Pal, Kunal; Das, Subhadeep; Karmakar, Parimal; Ray, Mitali; Ray, Sajal

2018-02-01

Copper oxide nanoparticles and copper sulfate are established contaminants of water and soil. Metaphire posthuma is a common variety of earthworm distributed in moist soil of Indian subcontinent. Comparative toxicity of copper nanoparticles and copper sulfate were investigated with reference to selected immune associated parameters of earthworm. Total count, phagocytic response, generation of cytotoxic molecules (superoxide anion, nitric oxide), activities of enzymes like phenoloxidase, superoxide dismutase, catalase, acid phosphatase, alkaline phosphatase and total protein of coelomocytes were estimated under the exposures of 100, 500, 1000mg of copper oxide nanoparticles and copper sulfate per kg of soil for 7 and 14 d. A significant decrease in the total coelomocyte count were recorded with maximum depletion as 15.45 ± 2.2 and 12.5 ± 2 × 10 4 cells/ml under the treatment of 1000mg/kg of copper nanoparticles and copper sulfate for 14 d respectively. A significant decrease in generation of nitric oxide and activity of phenoloxidase were recorded upon exposure of both toxins for 7 and 14 d indicating possible decline in cytotoxic status of the organism. A maximum inhibition of superoxide dismutase activity was recorded as 0.083 ± 0.0039 and 0.055 ± 0.0057 unit/mg protein/minute against 1000mg/kg of copper nanoparticles and copper sulfate treatment for 14 d respectively. Activities of catalase and alkaline phosphatase were inhibited by all experimental concentrations of both toxins in the coelomocytes of earthworm. These toxins were recorded to be modifiers of the major immune associated parameters of M. posthuma. Unrestricted contamination of soil by sulfate and oxide nanoparticles of copper may lead to an undesirable shift in the innate immunological status of earthworm leading to a condition of immune compromisation and shrinkage in population density of this species in its natural habitat. This article is the first time report of immunological toxicity of nanoparticles and sulfate salt of copper in M.posthuma inhabiting the soil of India, an agriculture based country. Copyright © 2017 Elsevier Inc. All rights reserved.

DEVELOPMENTAL EXPOSURE TO DI-N-BUTYLTIN DICHLORIDE (DBTC): IMMUNOTOXIC AND NEUROTOXIC EVALUATION

EPA Science Inventory

Organotins are incorporated as stabilizers in PVC water supply pipe. Particularly when new, mono- and di-substituted methyl- and butyltins leach from the pipe and are thus of regulatory concern to EPA. These contaminants have adverse effects on both the immune and nervous systems...

Immune response of greenback flounder Rhombosolea tapirina after exposure to contaminated marine sediment and diet.

PubMed

Mondon, J A; Duda, S; Nowak, B F

2000-01-01

Non-specific immune response of greenback flounder, Rhombosolea tapirina, exposed to contaminated marine sediments was examined. Reference sediments from Port Sorell and contaminated sediments from Deceitful Cove, Tasmania, Australia were investigated. Hatchery-reared flounder were exposed to reference sediment, contaminated sediment or contaminated sediment and diet for 6 weeks. Phagocytic capacity and lysozyme response in flounder were examined on cessation of exposure trial. Significant differences were found in phagocytic capacity and lysozyme response between treatments. Exposure to contaminated sediment, irrespective of diet or benthic disturbance elicited inhibition of phagocytic efficiency in flounder. Disturbance of contaminated sediment stimulated lysozyme activity. The immune response in flounder indicates potential immunotoxicity of sediment from Deceitful Cove.

Exercise induced asthma and endogenous opioids.

PubMed Central

Gaillard, R C; Bachman, M; Rochat, T; Egger, D; de Haller, R; Junod, A F

1986-01-01

Concentrations of endogenous opioid peptides in the plasma are increased during exercise and these substances have been implicated in the pathogenesis of asthma induced by chloropropramide and alcohol in diabetic patients. This work was undertaken to determine whether exercise induced asthma might be mediated by endogenous opioids. Plasma beta endorphin, met-enkephalin, and adrenocorticotrophic hormone (ACTH) concentrations were measured in five asthmatic patients and five normal volunteers breathing cold air during exercise. In four of the patients the effect of an infusion of naloxone on FEV1 was also measured during exercise induced asthma. Exercise produced acute bronchoconstriction in all asthmatics, characterised by a fall in FEV1; whereas no change occurred in normal subjects. There was no difference in plasma met-enkephalin, beta endorphin, and ACTH concentration between the two groups. Infusion of naloxone neither prevented nor worsened exercise induced asthma. These data suggest that endogenous opioids probably do not play a part in the development of exercise induced asthma. PMID:2944240

Vitamin D3-induced hypercalcemia increases carbon tetrachloride-induced hepatotoxicity through elevated oxidative stress in mice

PubMed Central

Usuda, Haruki; Miura, Nobuhiko; Fukuishi, Nobuyuki; Nonogaki, Tsunemasa; Onosaka, Satomi

2017-01-01

The aim of this study was to determine whether calcium potentiates acute carbon tetrachloride (CCl4) -induced toxicity. Elevated calcium levels were induced in mice by pre-treatment with cholecalciferol (vitamin D3; V.D3), a compound that has previously been shown to induce hypercalcemia in human and animal models. As seen previously, mice injected with CCl4 exhibited increased plasma levels of alanine aminotransferase, aspartate aminotransferase, and creatinine; transient body weight loss; and increased lipid peroxidation along with decreased total antioxidant power, glutathione, ATP, and NADPH. Pre-treatment of these animals with V.D3 caused further elevation of the values of these liver functional markers without altering kidney functional markers; continued weight loss; a lower lethal threshold dose of CCl4; and enhanced effects on lipid peroxidation and total antioxidant power. In contrast, exposure to V.D3 alone had no effect on plasma markers of liver or kidney damage or on total antioxidant power or lipid peroxidation. The potentiating effect of V.D3 was positively correlated with elevation of hepatic calcium levels. Furthermore, direct injection of CaCl2 also enhanced CCl4-induced hepatic injury. Since CaCl2 induced hypercalcemia transiently (within 3 h of injection), our results suggest that calcium enhances the CCl4-induced hepatotoxicity at an early stage via potentiation of oxidative stress. PMID:28448545

Single Low-Dose Radiation Induced Regulation of Keratinocyte Differentiation in Calcium-Induced HaCaT Cells.

PubMed

Hahn, Hyung Jin; Youn, Hae Jeong; Cha, Hwa Jun; Kim, Karam; An, Sungkwan; Ahn, Kyu Joong

2016-08-01

We are continually exposed to low-dose radiation (LDR) in the range 0.1 Gy from natural sources, medical devices, nuclear energy plants, and other industrial sources of ionizing radiation. There are three models for the biological mechanism of LDR: the linear no-threshold model, the hormetic model, and the threshold model. We used keratinocytes as a model system to investigate the molecular genetic effects of LDR on epidermal cell differentiation. To identify keratinocyte differentiation, we performed western blots using a specific antibody for involucrin, which is a precursor protein of the keratinocyte cornified envelope and a marker for keratinocyte terminal differentiation. We also performed quantitative polymerase chain reaction. We examined whether LDR induces changes in involucrin messenger RNA (mRNA) and protein levels in calcium-induced keratinocyte differentiation. Exposure of HaCaT cells to LDR (0.1 Gy) induced p21 expression. p21 is a key regulator that induces growth arrest and represses stemness, which accelerates keratinocyte differentiation. We correlated involucrin expression with keratinocyte differentiation, and examined the effects of LDR on involucrin levels and keratinocyte development. LDR significantly increased involucrin mRNA and protein levels during calcium-induced keratinocyte differentiation. These studies provide new evidence for the biological role of LDR, and identify the potential to utilize LDR to regulate or induce keratinocyte differentiation.

Single Low-Dose Radiation Induced Regulation of Keratinocyte Differentiation in Calcium-Induced HaCaT Cells

PubMed Central

Hahn, Hyung Jin; Youn, Hae Jeong; Cha, Hwa Jun; Kim, Karam; An, Sungkwan

2016-01-01

Background We are continually exposed to low-dose radiation (LDR) in the range 0.1 Gy from natural sources, medical devices, nuclear energy plants, and other industrial sources of ionizing radiation. There are three models for the biological mechanism of LDR: the linear no-threshold model, the hormetic model, and the threshold model. Objective We used keratinocytes as a model system to investigate the molecular genetic effects of LDR on epidermal cell differentiation. Methods To identify keratinocyte differentiation, we performed western blots using a specific antibody for involucrin, which is a precursor protein of the keratinocyte cornified envelope and a marker for keratinocyte terminal differentiation. We also performed quantitative polymerase chain reaction. We examined whether LDR induces changes in involucrin messenger RNA (mRNA) and protein levels in calcium-induced keratinocyte differentiation. Results Exposure of HaCaT cells to LDR (0.1 Gy) induced p21 expression. p21 is a key regulator that induces growth arrest and represses stemness, which accelerates keratinocyte differentiation. We correlated involucrin expression with keratinocyte differentiation, and examined the effects of LDR on involucrin levels and keratinocyte development. LDR significantly increased involucrin mRNA and protein levels during calcium-induced keratinocyte differentiation. Conclusion These studies provide new evidence for the biological role of LDR, and identify the potential to utilize LDR to regulate or induce keratinocyte differentiation. PMID:27489424

Andrographolide alleviates imiquimod-induced psoriasis in mice via inducing autophagic proteolysis of MyD88.

PubMed

Shao, Fenli; Tan, Tao; Tan, Yang; Sun, Yang; Wu, Xingxin; Xu, Qiang

2016-09-01

Psoriasis is a chronic inflammatory skin disease with excessive activation of toll-like receptors (TLRs), which play important roles in developing psoriasis. Targeting TLR signaling remains a challenge for treating psoriasis. Here, we found that andrographolide (Andro), a small-molecule natural product, alleviated imiquimod- but not interleukin 23 (IL-23)-induced psoriasis in mice with reducing expressions of IL-23 and IL-1β in the skin. The improvement in imiquimod-induced psoriasis by Andro was not observed in microtubule-associated protein 1 light chain 3 beta (MAP1LC3B) knockout mice. Furthermore, Andro inhibited mRNA expressions of IL-23, IL-6 and IL-1β but not CD80 and CD86 in bone-marrow derived dendritic cells (BMDCs) treated with lipopolysaccharide (LPS) in a MAP1LC3B-dependent manner. In addition, Andro inhibited imiquimod-induced mRNA expressions of IL-23, IL-6, IL-1β, CD80 and CD86 in BMDCs from mice. Interestingly, Andro induced a degradation of myeloid differentiation factor 88 (MyD88) and blocked the recruitment of TNF receptor-associated factor 6 (TRAF6) to MyD88 upon LPS stimulation in BMDCs from mice. Blockade of autophagic proteolysis using NH4Cl or MAP1LC3B(-/-) BMDCs abolished the Andro-induced MyD88 degradation. In conclusion, Andro controls activation of MyD88-dependent cytokines and alleviates psoriasis in mice via inducing autophagic proteolysis of MyD88, which could be a novel strategy to treat psoriasis. Copyright © 2016 Elsevier Inc. All rights reserved.

Carcinogen-Induced Microenvironment in Breast Cancer

DTIC Science & Technology

2000-04-01

unknown, the ability of radiation to induce TGF-P3 activation may gens , such as ionizing radiation, is to modify paracrine interactions indeed play a...radiation of the basement membrane proteins laminin and colla- induced proteases. In particular, tissue-type plasmino- gen IV were unchanged during the week...following gen activator is induced in a variety of irradiated cells radiation, marked changes in the periepithelial and and tissues (33) while plasmin

Food-Induced Acute Pancreatitis.

PubMed

Manohar, Murli; Verma, Alok K; Upparahalli Venkateshaiah, Sathisha; Goyal, Hemant; Mishra, Anil

2017-12-01

Food allergy, a commonly increasing problem worldwide, defined as an adverse immune response to food. A variety of immune-related effector cells such as mast cells, eosinophils, neutrophils, and T cells are involved in food-related allergic responses categorized as IgE mediated, non-IgE mediated, and mixed (IgE and non-IgE) depending upon underlying immunological mechanisms. The dietary antigens mainly target the gastrointestinal tract including pancreas that gets inflamed due to food allergy and leads acute pancreatitis. Reports indicate several food proteins induce pancreatitis; however, detailed underlying mechanism of food-induced pancreatitis is unexplored. The aim of the review is to understand and update the current scenario of food-induced pancreatitis. A comprehensive literature search of relevant research articles has been performed through PubMed, and articles were chosen based on their relevance to food allergen-mediated pancreatitis. Several cases in the literature indicate that acute pancreatitis has been provoked after the consumption of mustard, milk, egg, banana, fish, and kiwi fruits. Food-induced pancreatitis is an ignored and unexplored area of research. The review highlights the significance of food in the development of pancreatitis and draws the attention of physicians and scientists to consider food allergies as a possible cause for initiation of pancreatitis pathogenesis.

Olfactory-Induced Synesthesias: A Review and Model

ERIC Educational Resources Information Center

Stevenson, Richard J.; Tomiczek, Caroline

2007-01-01

Recent reviews of synesthesia concentrate upon rare neurodevelopmental examples and exclude common olfactory-induced experiences with which they may profitably be compared. Like the neurodevelopmental synesthesias, odor-induced experiences involve different sensory modalities; are reliable, asymmetric (concurrents cannot induce), and automatic;…

[Complications of induced abortion].

PubMed

Kretowicz, J

1984-03-26

The abortion problem has been a major topic of debate for many years. Polish legislation permitting abortion has both supporters and opponents. It appears that both groups fail to fully recognize the risks of the various medical complications of induced abortion. A literature review of the complications of abortion shows that these complications are often underestimated by the public and the medical community. The review clearly demonstrates that abortion adversely affects women's health. Inflammation of the genital system is the most frequent complication. The ocurrence of complications increases as the term of the pregnancy advances. It is concluded that the public is not fully aware of the immediate danger and aftereffects of induced abortion. Wider popularization of the extensive body of scientific information regarding the risks of induced abortion might change current perceptions about the "safety" of abortion.

Opioid-Induced Bowel Dysfunction

PubMed Central

Cheng, Vivian; Lembo, Anthony

2013-01-01

Opioid-induced bowel dysfunction (OIBD) is a potentially debilitating side effect of chronic opioid use. It refers to a collection of primarily gastrointestinal motility disorders induced by opioids, of which opioid-induced constipation (OIC) is the most common. Management of OIBD is difficult, and affected patients will often limit their opioid intake at the expense of experiencing more pain, to reduce the negative impact of OIBD on their quality of life. Effective pharmacologic therapy for OIC is considered an unmet need and several agents have recently been given priority review and approval for OIC. Furthermore, multiple agents currently in development show promise in treating OIC without significant impact on analgesia or precipitation of withdrawal symptoms. The approval and availability of such medications would represent a significant improvement in the management of OIC and OIBD in patients with chronic pain. PMID:23900996

Methylphenidate Actively Induces Emergence from General Anesthesia

PubMed Central

Solt, Ken; Cotten, Joseph F.; Cimenser, Aylin; Wong, Kin F.K.; Chemali, Jessica J.; Brown, Emery N.

2011-01-01

Background Although accumulating evidence suggests that arousal pathways in the brain play important roles in emergence from general anesthesia, the roles of monoaminergic arousal circuits are unclear. In this study we tested the hypothesis that methylphenidate (an inhibitor of dopamine and norepinephrine transporters) induces emergence from isoflurane anesthesia. Methods Using adult rats we tested the effect of methylphenidate IV on time to emergence from isoflurane anesthesia. We then performed experiments to test separately for methylphenidate-induced changes in arousal and changes in minute ventilation. A dose-response study was performed to test for methylphenidate–induced restoration of righting during continuous isoflurane anesthesia. Surface electroencephalogram recordings were performed to observe neurophysiological changes. Plethysmography recordings and arterial blood gas analysis were performed to assess methylphenidate-induced changes in respiratory function. Droperidol IV was administered to test for inhibition of methylphenidate's actions. Results Methylphenidate decreased median time to emergence from 280 to 91 s. The median difference in time to emergence without compared to with methylphenidate was 200 [155, 331] s (median, [95% confidence interval]). During continuous inhalation of isoflurane, methylphenidate induced return of righting in a dose-dependent manner, induced a shift in electroencephalogram power from delta to theta, and induced an increase in minute ventilation. Administration of droperidol (0.5 mg/kg IV) prior to methylphenidate (5 mg/kg IV) largely inhibited methylphenidate-induced emergence behavior, electroencephalogram changes, and changes in minute ventilation. Conclusions Methylphenidate actively induces emergence from isoflurane anesthesia by increasing arousal and respiratory drive, possibly through activation of dopaminergic and adrenergic arousal circuits. Our findings suggest that methylphenidate may be clinically

Modulation of Radiation-Induced Apoptosis by Thiolamines

NASA Technical Reports Server (NTRS)

Warters, R. L.; Roberts, J. C.; Wilmore, B. H.; Kelley, L. L.

1997-01-01

Exposure to the thiolamine radioprotector N-(2-mercaptoethyl)-1,3-propanediamine (WR-1065) induced apoptosis in the mouse TB8-3 hybridoma after 60-minute (LD(sub50) = 4.5mM) or during a 20-hour (LD(sub50) = 0.15 mM) exposure. In contrast, a 20-hour exposure to 17 mM L-cysteine or 10 mM cysteamine was required to induce 50 percent apoptosis within 20 hours. Apoptosis was not induced by either a 60-minute or 20-hour exposure to 10 mM of the thiazolidime prodrugs ribose-cysteine (RibCys) or ribose-cysteamine (RibCyst). Thiolamine-induced apoptosis appeared to be a p53-independent process since it was induced by WR-1065 exposure in human HL60 cells. Exposure to WR-1065 (4mM for 15 minutes) or cysteine (10mM for 60 minutes) before and during irradiation protected cells against the induction of both DNA double-strand breaks and apoptosis, while exposure to RibCys (10 mM for 3 hours) did not. Treatment with either WR-1065, cysteine, RibCys or RibCyst for 60 minutes beginning 60 minutes after irradiation did not affect the level of radiation-induced apoptosis. In contrast, treatment with either cysteine, cysteamine or RibCys for 20 hours beginning 60 minutes after irradiation enhanced radiation-induced apoptosis. Similar experiments could not be conducted with WR-1065 because of its extreme toxicity. Our results indicate that thiolamine enhancement of radiation-induced apoptosis is not involved in their previously reported capacity to reduce radiation-induced mutations.

Lower Blood Pressure-Induced Renal Hypoperfusion Promotes Cisplatin-Induced Nephrotoxicity.

PubMed

Mizuno, Tomohiro; Hayashi, Takahiro; Shimabukuro, Yuka; Murase, Maho; Hayashi, Hiroki; Ishikawa, Kazuhiro; Takahashi, Kazuo; Yuzawa, Yukio; Yamada, Shigeki; Nagamatsu, Tadashi

2016-01-01

Cisplatin-induced nephrotoxicity primarily occurs in the proximal tubules, and tubular injuries reduce glomerular filtration rates. Lower blood pressure causes renal hypoperfusion, which promotes ischemic acute kidney injury (AKI). Our study examined the relationship between lower blood pressure-induced renal hypoperfusion and cisplatin-induced nephrotoxicity. The relationship between cisplatin use and hypoalbuminemia is not clear. This study consisted of Japanese patients who received cisplatin as the first-line chemotherapy at Fujita Health University Hospital from April 2006 to December 2012. Hypoalbuminemia was defined as serum albumin levels ≤3.5 mg/dl. Patients who experienced lower blood pressure during chemotherapy were included in the lower blood pressure group (n = 229), and those who did not were included in the normal blood pressure group (n = 743). Total cisplatin dose in the normal blood pressure and lower blood pressure groups was 58.9 ± 23.8 and 55.0 ± 20.4 mg/m2, respectively. The rate of severe nephrotoxicity was higher and overall survival was shorter in the lower blood pressure group than in the normal blood pressure group. In a multivariable analysis, lower blood pressure significantly correlated with hypoalbuminemia. To prevent ischemic AKI, nutrition and cachexia controlling are important parts of cancer treatment. © 2016 S. Karger AG, Basel.

Noise-Induced Hearing Loss (NIHL).

ERIC Educational Resources Information Center

Seidman, Michael D.

1999-01-01

This article provides an overview of noise-induced hearing loss (NIHL), the leading cause of occupationally induced hearing loss in industrialized countries. It discusses causes of NIHL and compelling evidence that reactive oxygen metabolites and cochlear hypoprefusion are responsible for the destruction of cochlear hair cells. Prevention is also…

Thiamine deficiency induces endoplasmic reticulum stress and oxidative stress in human neurons derived from induced pluripotent stem cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, Xin; Xu, Mei; Frank, Jacqueline A.

Thiamine (vitamin B1) deficiency (TD) plays a major role in the etiology of Wernicke's encephalopathy (WE) which is a severe neurological disorder. TD induces selective neuronal cell death, neuroinflammation, endoplasmic reticulum (ER) stress and oxidative stress in the brain which are commonly observed in many aging-related neurodegenerative diseases, such as Alzheimer's disease (AD), Parkinson's disease (PD), Huntington's disease (HD) and progressive supranuclear palsy (PSP). However, the underlying cellular and molecular mechanisms remain unclear. The progress in this line of research is hindered due to the lack of appropriate in vitro models. The neurons derived for the human induced pluripotent stemmore » cells (hiPSCs) provide a relevant and powerful tool for the research in pharmaceutical and environmental neurotoxicity. In this study, we for the first time used human induced pluripotent stem cells (hiPSCs)-derived neurons (iCell neurons) to investigate the mechanisms of TD-induced neurodegeneration. We showed that TD caused a concentration- and duration-dependent death of iCell neurons. TD induced ER stress which was evident by the increase in ER stress markers, such as GRP78, XBP-1, CHOP, ATF-6, phosphorylated eIF2α, and cleaved caspase-12. TD also triggered oxidative stress which was shown by the increase in the expression 2,4-dinitrophenyl (DNP) and 4-hydroxynonenal (HNE). ER stress inhibitors (STF-083010 and salubrinal) and antioxidant N-acetyl cysteine (NAC) were effective in alleviating TD-induced death of iCell neurons, supporting the involvement of ER stress and oxidative stress. It establishes that the iCell neurons are a novel tool to investigate cellular and molecular mechanisms for TD-induced neurodegeneration. - Highlights: • Thiamine deficiency (TD) causes death of human neurons in culture. • TD induces both endoplasmic reticulum (ER) stress and oxidative stress. • Alleviating ER stress and oxidative stress reduces TD-induced

Arsenic toxicity induced endothelial dysfunction and dementia: Pharmacological interdiction by histone deacetylase and inducible nitric oxide synthase inhibitors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sharma, Bhupesh, E-mail: drbhupeshresearch@gmail.com; Sharma, P.M.

Arsenic toxicity has been reported to damage all the major organs including the brain and vasculature. Dementia including Alzheimer's disease (AD) and vascular dementia (VaD) are posing greater risk to the world population as it is now increasing at a faster rate. We have investigated the role of sodium butyrate, a selective histone deacetylase (HDAC) inhibitor and aminoguanidine, a selective inducible nitric oxide synthase (iNOS) inhibitor in pharmacological interdiction of arsenic toxicity induced vascular endothelial dysfunction and dementia in rats. Arsenic toxicity was done by administering arsenic drinking water to rats. Morris water-maze (MWM) test was used for assessment ofmore » learning and memory. Endothelial function was assessed using student physiograph. Oxidative stress (aortic superoxide anion, serum and brain thiobarbituric acid reactive species, brain glutathione) and nitric oxide levels (serum nitrite/nitrate) were also measured. Arsenic treated rats have shown impairment of endothelial function, learning and memory, reduction in serum nitrite/nitrate and brain GSH levels along with increase in serum and brain TBARS. Sodium butyrate as well as aminoguanidine significantly convalesce arsenic induced impairment of learning, memory, endothelial function, and alterations in various biochemical parameters. It may be concluded that arsenic induces endothelial dysfunction and dementia, whereas, sodium butyrate, a HDAC inhibitor as well as aminoguanidine, a selective iNOS inhibitor may be considered as potential agents for the management of arsenic induced endothelial dysfunction and dementia. - Highlights: • As has induced endothelial dysfunction (Edf) and vascular dementia (VaD). • As has increased oxidative stress, AChE activity and decreased serum NO. • Inhibitors of HDAC and iNOS have attenuated As induced Edf and VaD. • Both the inhibitors have attenuated As induced biochemical changes. • Inhibitor of HDAC and iNOS has shown good

Retrieval-Induced versus Context-Induced Forgetting: Does Retrieval-Induced Forgetting Depend on Context Shifts?

ERIC Educational Resources Information Center

Soares, Julia S.; Polack, Cody W.; Miller, Ralph R.

2016-01-01

Retrieval-induced forgetting (RIF) is the observation that retrieval of target information causes forgetting of related nontarget information. A number of accounts of this phenomenon have been proposed, including a context-shift-based account (Jonker, Seli, & Macleod, 2013). This account proposes that RIF occurs as a result of the context…