Science.gov

Sample records for chartarum induce immunotoxic

  1. Co-cultivated damp building related microbes Streptomyces californicus and Stachybotrys chartarum induce immunotoxic and genotoxic responses via oxidative stress.

    PubMed

    Markkanen Penttinen, Piia; Pelkonen, Jukka; Tapanainen, Maija; Mäki-Paakkanen, Jorma; Jalava, Pasi I; Hirvonen, Maija-Riitta

    2009-08-01

    Oxidative stress has been proposed to be one mechanism behind the adverse health outcomes associated with living in a damp indoor environment. In the present study, the capability of damp building-related microbes Streptomyces californicus and Stachybotrys chartarum to induce oxidative stress was evaluated in vitro. In addition, the role of oxidative stress in provoking the detected cytotoxic, genotoxic, and inflammatory responses was studied by inhibiting the production of reactive oxygen species (ROS) using N-acetyl-l-cysteine (NAC). RAW264.7 macrophages were exposed in a dose- and time-dependent manner to the spores of co-cultivated S. californicus and S. chartarum, to their separately cultivated spore-mixture, or to the spores of these microbes alone. The intracellular peroxide production and cytotoxicity were measured by flow cytometric analysis, nitric oxide production was analyzed by the Griess method, DNA damage was determined by the comet assay, and cytokine production was measured by an immunochemical ELISA (enzyme-linked immunosorbent assay). All the studied microbial exposures triggered oxidative stress and subsequent cellular damage in RAW264.7 macrophages. The ROS scavenger, NAC, prevented growth arrest, apoptosis, DNA damage, and cytokine production induced by the co-culture since it reduced the intracellular level of ROS within macrophages. In contrast, the DNA damage and cell cycle arrest induced by the spores of S. californicus alone could not be prevented by NAC. Bioaerosol-induced oxidative stress in macrophages may be an important mechanism behind the frequent respiratory symptoms and diseases suffered by residents of moisture damaged buildings. Furthermore, microbial interactions during co-cultivation stimulate the production of highly toxic compound(s) which may significantly increase oxidative damage. PMID:19459771

  2. Co-cultivation of Streptomyces californicus and Stachybotrys chartarum stimulates the production of cytostatic compound(s) with immunotoxic properties

    SciTech Connect

    Penttinen, Piia . E-mail: Piia.Penttinen@ktl.fi; Pelkonen, Jukka; Huttunen, Kati; Hirvonen, Maija-Riitta

    2006-12-15

    We have recently shown that the actinobacterium Streptomyces californicus and the fungus Stachybotrys chartarum originating from moisture damaged buildings possess both immunotoxic and immunostimulatory characteristics, which are synergistically potentiated by microbial interaction. In the search for the causative agent(s) behind the immunotoxicity, the cytostatic effects of the co-cultivated spores of S. californicus and S. chartarum were compared to those caused by widely used cytostatic agents produced by streptomycetes. The RAW264.7 macrophages were exposed to four doses of doxorubicin (DOX), actinomycin D (AMD), mitomycin C (MMC) or phleomycin (PHLEO) for 24 h. Kinetics of the spores of the co-cultivated and the separately cultivated microbes (1 x 10{sup 6} spores/ml) was compared to DOX (0.15 {mu}M). Apoptotic responses were analyzed by measuring DNA content and mitochondria membrane depolarization with flow cytometer, and by the fluorometric caspase-3 assay. The present data indicate that interactions during co-cultivation of S. californicus and S. chartarum stimulate the production of an unidentified cytostatic compound(s) capable of inducing mitochondria mediated apoptosis and cell cycle arrest at S-G{sub 2}/M. The spores of co-cultivated microbes caused a 4-fold collapse of mitochondrial membrane potential and an almost 6-fold caspase-3 activation and DNA fragmentation when compared to control. Similar responses were induced by DNA cleaving compounds, especially DOX and AMD, at the relatively low concentrations, but not the spores of the same microbes when they were grown separately. These data suggest that when growing in the same habitat, interactions between S. californicus and S. chartarum stimulates the production of an unknown cytostatic compound(s) which evoke immunotoxic effects similar to those by chemotherapeutic drugs.

  3. Stachybotrys chartarum-Induced Hypersensitivity Pneumonitis Is TLR9 Dependent

    PubMed Central

    Bhan, Urvashi; Newstead, Michael J.; Zeng, Xianying; Ballinger, Megan N.; Standiford, Louis R.; Standiford, Theodore J.

    2011-01-01

    Hypersensitivity pneumonitis (HP), an inflammatory lung disease, develops after repeated exposure to inhaled particulate antigen and is characterized by a vigorous T helper type 1-mediated immune response, resulting in the release of IL-12 and interferon (IFN)-γ. These T helper type 1 cytokines may participate in the pathogenesis of HP. Stachybotrys chartarum (SC) is a dimorphic fungus implicated in a number of respiratory illnesses, including HP. Here, we have developed a murine model of SC-induced HP that reproduces pathology observed in human HP and hypothesized that toll receptor-like 9 (TLR9)-mediated dendritic cell responses are required for the generation of granulomatous inflammation induced by inhaled SC. Mice sensitized and challenged with 106 SC spores develop granulomatous inflammation with multinucleate giant cells, accompanied by increased accumulation of neutrophils and CD4+ and CD8+ T cells. SC sensitization and challenge resulted in robust pulmonary expression of tumor necrosis factor-α, IL-12, and IFN-γ. SC-mediated granulomatous inflammation required IFN-γ and was TLR9 dependent, because TLR9−/− mice displayed reduced peribronchial inflammation, decreased accumulation and/or activation of polymorphonuclear (PMN) and CD4+ and CD8+ T cells, and reduced lung expression of type 1 cytokines and chemokines. T-cell production of IFN-γ was IL-12 dependent. Our studies suggest that TLR9 is critical for dendritic cell-mediated development of a type 1 granulomatous inflammation in the lung in response to SC. PMID:21982832

  4. Aquatic pollution-induced immunotoxicity in wildlife species.

    PubMed

    Luebke, R W; Hodson, P V; Faisal, M; Ross, P S; Grasman, K A; Zelikoff, J

    1997-05-01

    The potential for chemicals to adversely affect human immunologic health has traditionally been evaluated in rodents, under laboratory conditions. These laboratory studies have generated valuable hazard identification and immunotoxicologic mechanism data; however, genetically diverse populations exposed in the wild may better reflect both human exposure conditions and may provide insight into potential immunotoxic effects in humans. In addition, comparative studies of species occupying reference and impacted sites provide important information on the effects of environmental pollution on the immunologic health of wildlife populations. In this symposium overview, Peter Hodson describes physiological changes in fish collected above or below the outflows of paper mills discharging effluent from the bleaching process (BKME). Effects attributable to BKME were identified, as were physiological changes attributable to other environmental factors. In this context, he discussed the problems of identifying true cause and effect relationships in field studies. Mohamed Faisal described changes in immune function of fish collected from areas with high levels of polyaromatic hydrocarbon contamination. His studies identified a contaminant-related decreases in the ability of anterior kidney leukocytes to bind to and kill tumor cell line targets, as well as changes in lymphocyte proliferation in response to mitogens. Altered proliferative responses of fish from the contaminated site were partially reversed by maintaining fish in water from the reference site. Peter Ross described studies in which harbor seals were fed herring obtained from relatively clean (Atlantic Ocean) and contaminated (Baltic Sea) waters. Decreased natural killer cell activity and lymphoproliferative responses to T and B cell mitogens, as well as depressed antibody and delayed hypersensitivity responses to injected antigens, were identified in seals fed contaminated herring. In laboratory studies, it was

  5. Effect of thyroidectomy and thyroxine on 2,3,7,8-tetrachlorodibenzo-p-dioxin-induced immunotoxicity

    SciTech Connect

    Pazdernik, T.L.; Rozman, K.K.

    1985-02-18

    Radiothyroidectomy protected against 2,3,7,8-tetrachloro dibenzo-p-dioxin (TCDD)-induced immunotoxicity in rats as assessed by the spleen anti-SRBC plaque-forming cell assay. Thyroxin (T/sub 4/) replacement therapy partially reversed the effects of thyroidectomy on T/sub 4/ and triiodothyronine (T/sub 3/) serum levels, body weight and immune function as well as restored TCDD-induced immunotoxicity. Thus, hypothyroidism induced by TCDD exposure can be viewed as a protective response of the organism to reduce the insult caused by TCDD.

  6. TLR9-Dependent IL-23/IL-17 is Required for the Generation of Stachybotrys chartarum-induced Hypersensitivity Pneumonitis

    PubMed Central

    Bhan, Urvashi; Newstead, Michael J.; Zeng, Xianying; Podsaid, Amy; Goswami, Moloy; Ballinger, Megan N.; Kunkel, Steven L.; Standiford, Theodore J.

    2012-01-01

    Hypersensitivity pneumonitis (HP) is an inflammatory lung disease that develops following repeated exposure to inhaled particulate antigen. Stachybotrys chartarum (SC) is a dimorphic fungus that has been implicated in a number of respiratory illnesses, including HP (1). In this study we have developed a murine model of SC- induced HP that reproduces pathology observed in human HP and hypothesized that TLR9–mediated IL-23/IL-17 responses are required for the generation of granulomatous inflammation induced by inhaled SC. Mice that undergo i.p. sensitization and i.t. challenge with 106 SC spores developed granulomatous inflammation with multinucleate giant cells, accompanied by increased accumulation of T cells. SC sensitization and challenge resulted in robust pulmonary expression of IL-17 and IL-23. SC-mediated granulomatous inflammation required intact IL-23/IL-17 responses and required TLR9, as TLR9−/− mice displayed reduced IL-17 and IL-23 expression in whole lung associated with decreased accumulation of IL-17 expressing CD4+ and γδ T cells. As compared to SC-sensitized dendritic cells (DC) isolated from WT mice, DC isolated from TLR9−/− mice had a reduced ability to produce IL-23 in responses to SC. Moreover, shRNA knockdown of IL-23 in DC abolished IL-17 production from splenocytes in response to antigen challenge. Finally, the i.t. reconstitution of IL-23 in TLR9−/− mice recapitulated the immunopathology observed in WT mice. In conclusion, our studies suggest that TLR9 is critical for development of Th17-mediated granulomatous inflammation in the lung in response to SC. PMID:23180821

  7. Interactions between Streptomyces californicus and Stachybotrys chartarum can induce apoptosis and cell cycle arrest in mouse RAW264.7 macrophages

    SciTech Connect

    Penttinen, Piia . E-mail: Piia.Penttinen@ktl.fi; Pelkonen, Jukka; Huttunen, Kati; Toivola, Mika; Hirvonen, Maija-Riitta

    2005-02-01

    Exposure to complex mixtures of bacteria and fungi in moisture-damaged buildings is a potential cause of inflammatory related symptoms among occupants. The present study assessed interactions between two characteristic moldy house microbes Streptomyces californicus and Stachybotrys chartarum. Differences in cytotoxic and inflammatory responses in mouse (RAW264.7) macrophages were studied after exposure to the spores of co-cultivated microbes, the mixture of separately cultivated spores, and the spores of either of these microbes cultivated alone. The RAW264.7 cells were exposed to six doses (1 x 10{sup 4} to 3 x 10{sup 6} spores/ml) for 24 h, and the time course of the induced responses was evaluated after 4, 8, 16, and 24 h of exposure (1 x 10{sup 6} spores/ml). The cytotoxic potential of the spores was characterized by the MTT test, DNA content analysis, and enzyme assay for caspase-3 activity. The production of cytokines (IL-1{beta}, IL-6, IL-10, TNF{alpha}, and MIP2) was measured immunochemically and nitric oxide by the Griess method. Co-cultivation increased the ability of the spores to cause apoptosis by more than 4-fold and the proportion of RAW264.7 cells at the G{sub 2}/M stage increased nearly 2-fold when compared to the response induced by the mixture of spores. In contrast, co-cultivation decreased significantly the ability of the spores to trigger the production of NO and IL-6 in RAW264.7 cells. In conclusion, these data suggest that co-culture of S. californicus and S. chartarum can result in microbial interactions that significantly potentiate the ability of the spores to cause apoptosis and cell cycle arrest in mammalian cells.

  8. Embryonic exposure to cypermethrin induces apoptosis and immunotoxicity in zebrafish (Danio rerio).

    PubMed

    Jin, Yuanxiang; Zheng, Shanshan; Fu, Zhengwei

    2011-01-01

    Cypermethrin (CYP) is widely used for control of indoor and field pests. As a result, CYP is one of the most common contaminants in freshwater aquatic systems. In the present study, we investigated the effects of CYP exposure on the induction of apoptosis and immunotoxicity in zebrafish during the embryo developmental stage. The mRNA levels of some key genes including P53, Puma, Bax, Apaf1, Cas9 and Cas3 on the mitochondrial pathway of cell apoptosis were significantly up-regulated at the concentration of 3 and 10 μg/l CYP. Correspondingly, the activities of Cas3 and Cas9 increased significantly after exposure to 3 or 10 μg/l CYP. In addition, the mRNA levels of iNOS and the total content of NO were also up-regulated significantly after CYP exposure. Moreover, it was also observed that the mRNA levels of IFN, CXCL-Clc, CC-chem and C3, which are closely related to the innate immune system, were affected in newly hatched zebrafish when exposed to 3 and 10 μg/l CYP, exhibiting CYP's prominent impacts on the innate immune system of zebrafish. Taken together, our results suggest that CYP has the potential to induce cell apoptosis and cause innate immune system disruption in zebrafish during the embryo stage. The information presented in this study will help elucidate the mechanism of CYP-induced toxicity in fish. PMID:21316461

  9. IS YOUR STACHYBOTRYS CHARTARUM A GENUINE S. CHARTARUM?

    EPA Science Inventory

    The fungus Stachybotrys chartarum is the type species of the genus Stachybotrys. Certain strains of the species are known to produce trichothecene mycotoxins,. It is a celluolytic saprophyte with worldwide distribution and frequently discovered in water-damaged buildings. Evid...

  10. Immunotoxicity and allergic potential induced by topical application of dimethyl carbonate (DMC) in a murine model.

    PubMed

    Anderson, Stacey E; Franko, Jennifer; Anderson, Katie L; Munson, Albert E; Lukomska, Ewa; Meade, B Jean

    2013-01-01

    Dimethyl carbonate (DMC) is an industrial chemical, used as a paint and adhesive solvent, with the potential for significant increases in production. Using select immune function assays, the purpose of these studies was to evaluate the immunotoxicity of DMC following dermal exposure using a murine model. Following a 28-day exposure, DMC produced a significant decrease in thymus weight at concentrations of 75% and greater. No effects on body weight, hematological parameters (erythrocytes, leukocytes, and their differentials), or immune cell phenotyping (B-cells, T-cells, and T-cell sub-sets) were identified. The IgM antibody response to sheep red blood cell (SRBC) was significantly reduced in the spleen but not the serum. DMC was not identified to be an irritant and evaluation of the sensitization potential, conducted using the local lymph node assay (LLNA) at concentrations ranging from 50-100%, did not identify increases in lymphocyte proliferation. These results demonstrate that dermal exposure to DMC induces immune suppression in a murine model and raise concern about potential human exposure and the need for occupational exposure regulations. PMID:22953780

  11. Copper-induced immunotoxicity involves cell cycle arrest and cell death in the liver.

    PubMed

    Keswani, Tarun; Mitra, Soham; Bhattacharyya, Arindam

    2015-04-01

    Inorganic copper, such as that in drinking water and copper supplements, largely bypasses the liver and enters the free copper pool of the blood directly and that promote immunosuppression. According to our previous in vivo report, we evaluate the details of the apoptotic mechanism in liver, we have investigated how copper regulates apoptotic pathways in liver. We have analyzed different protein expression by Western blotting and immunohistochemistry expression. We have also have measured mitochondrial trans-membrane potential, Annexin V assay, ROS, and CD4(+) and CD8(+) population in hepatocyte cells by flow cytometry. Copper-treated mice evidenced immunotoxicity as indicated by dose-related, distinct histomorphological changes in liver. Flow cytometric analyses revealed a dose-related increase in the percentages of hepatocyte cells in the Sub-G0/G1 state, further confirmed by Annexin V binding assay. In addition, the copper treatments altered the expression of apoptotic markers, further ROS generation and mitochondrial trans-membrane potential changes promote intrinsic pathway of apoptosis that was p53 independent. Apart from the role of inflammation, our findings also have identified the role of other partially responsible apoptotic molecules p73 that differentially changed due to copper treatment. Our study demonstrates how apoptotic pathways regulate copper-induced immunosuppression in liver.

  12. Investigations of immunotoxicity and allergic potential induced by topical application of triclosan in mice

    PubMed Central

    Anderson, Stacey E.; Meade, B. Jean; Long, Carrie M.; Lukomska, Ewa; Marshall, Nikki B.

    2016-01-01

    Triclosan is an antimicrobial chemical commonly used occupationally and by the general public. Using select immune function assays, the purpose of these studies was to evaluate the immunotoxicity of triclosan following dermal exposure using a murine model. Triclosan was not identified to be a sensitizer in the murine local lymph node assay (LLNA) when tested at concentrations ranging from 0.75–3.0%. Following a 28-day exposure, triclosan produced a significant increase in liver weight at concentrations of ≥ 1.5%. Exposure to the high dose (3.0%) also produced a significant increase in spleen weights and number of platelets. The absolute number of B-cells, T-cells, dendritic cells and NK cells were significantly increased in the skin draining lymph node, but not the spleen. An increase in the frequency of dendritic cells was also observed in the lymph node following exposure to 3.0% triclosan. The IgM antibody response to sheep red blood cells (SRBC) was significantly increased at 0.75% – but not at the higher concentrations – in the spleen and serum. These results demonstrate that dermal exposure to triclosan induces stimulation of the immune system in a murine model and raise concerns about potential human exposure. PMID:25812624

  13. Differential Immunotoxicity Induced by Two Different Windows of Developmental Trichloroethylene Exposure

    PubMed Central

    Gilbert, Kathleen M.; Woodruff, William; Blossom, Sarah J.

    2014-01-01

    Developmental exposure to environmental toxicants may induce immune system alterations that contribute to adult stage autoimmune disease. We have shown that continuous exposure of MRL+/+ mice to trichloroethylene (TCE) from gestational day (GD) 0 to postnatal day (PND) 49 alters several aspects of CD4+ T cell function. This window of exposure corresponds to conception-adolescence/young adulthood in humans. More narrowly defining the window of TCE developmental exposure causes immunotoxicity that would establish the stage at which avoidance and/or intervention would be most effective. The current study divided continuous TCE exposure into two separate windows, namely, gestation only (GD0 to birth (PND0)) and early-life only (PND0-PND49). The mice were examined for specific alterations in CD4+ T cell function at PND49. One potentially long-lasting effect of developmental exposure, alterations in retrotransposon expression indicative of epigenetic alterations, was found in peripheral CD4+ T cells from both sets of developmentally exposed mice. Interestingly, certain other effects, such as alterations in thymus cellularity, were only found in mice exposed to TCE during gestation. In contrast, expansion of memory/activation cell subset of peripheral CD4+ T cells were only found in mice exposed to TCE during early life. Different windows of developmental TCE exposure can have different functional consequences. PMID:24696780

  14. Investigations of immunotoxicity and allergic potential induced by topical application of triclosan in mice.

    PubMed

    Anderson, Stacey E; Meade, B Jean; Long, Carrie M; Lukomska, Ewa; Marshall, Nikki B

    2016-01-01

    Triclosan is an antimicrobial chemical commonly used occupationally and by the general public. Using select immune function assays, the purpose of these studies was to evaluate the immunotoxicity of triclosan following dermal exposure using a murine model. Triclosan was not identified to be a sensitizer in the murine local lymph node assay (LLNA) when tested at concentrations ranging from 0.75-3.0%. Following a 28-day exposure, triclosan produced a significant increase in liver weight at concentrations of ≥ 1.5%. Exposure to the high dose (3.0%) also produced a significant increase in spleen weights and number of platelets. The absolute number of B-cells, T-cells, dendritic cells and NK cells were significantly increased in the skin draining lymph node, but not the spleen. An increase in the frequency of dendritic cells was also observed in the lymph node following exposure to 3.0% triclosan. The IgM antibody response to sheep red blood cells (SRBC) was significantly increased at 0.75% - but not at the higher concentrations - in the spleen and serum. These results demonstrate that dermal exposure to triclosan induces stimulation of the immune system in a murine model and raise concerns about potential human exposure.

  15. Immunotoxicity and allergic potential induced by topical application of dimethyl carbonate (DMC) in a murine model

    PubMed Central

    Anderson, Stacey E.; Franko, Jennifer; Anderson, Katie L.; Munson, Albert E.; Lukomska, Ewa; Meade, B. Jean

    2015-01-01

    Dimethyl carbonate (DMC) is an industrial chemical, used as a paint and adhesive solvent, with the potential for significant increases in production. Using select immune function assays, the purpose of these studies was to evaluate the immunotoxicity of DMC following dermal exposure using a murine model. Following a 28-day exposure, DMC produced a significant decrease in thymus weight at concentrations of 75% and greater. No effects on body weight, hematological parameters (erythrocytes, leukocytes, and their differentials), or immune cell phenotyping (B-cells, T-cells, and T-cell sub-sets) were identified. The IgM antibody response to sheep red blood cell (SRBC) was significantly reduced in the spleen but not the serum. DMC was not identified to be an irritant and evaluation of the sensitization potential, conducted using the local lymph node assay (LLNA) at concentrations ranging from 50–100%, did not identify increases in lymphocyte proliferation. These results demonstrate that dermal exposure to DMC induces immune suppression in a murine model and raise concern about potential human exposure and the need for occupational exposure regulations. PMID:22953780

  16. Tunisian radish (Raphanus sativus) extract prevents cadmium-induced immunotoxic and biochemical alterations in rats.

    PubMed

    ben Salah-Abbès, Jalila; Abbès, Samir; Zohra, Haous; Oueslati, Ridha

    2015-01-01

    Cadmium (Cd), a known carcinogen and potent immunotoxicant in humans and animals, is dispersed throughout the environment as a result of pollution from a variety of sources. Tunisian radish (Raphanus sativus) extract (TRE) is a known anti-oxidant and free radical scavenger that has been shown to help alleviate immune system disorders, including some induced by environmental toxicants. The present study was undertaken to investigate potential protective effects of TRE against Cd-induced immunotoxicities (and general toxicities) in situ. Cadmium chloride (at 2.5 mg CdCl2/kg BW) and TRE (5, 10, or 15 mg/kg BW) were given (alone or in combination [actually, in sequence of Cd and then TRE]) to rats daily by oral gavage for 2 weeks. Results indicated that treatment with CdCl2 alone resulted in significant decreases in plasma levels of total protein, triglycerides, creatine kinase, creatinine, IgG and IgA, T-lymphocyte sub-types (CD4(+), CD3(+), CD56(+), and CD8(+)), and in thymic and hepatic indices (relative weights). In contrast, CdCl2 treatment caused significant increases in serum LDH, AST, and ALT, in the formation/release of pro-inflammatory cytokines (IL-1 and TNFα), and in the relative weights of host spleen and kidneys. Rats treated with TRE alone had no discernable changes compared to the controls with regard to all test parameters. Combined treatment of CdCl2 and TRE-at any dose-resulted in a significant improvement of all test parameters compared to those seen with Cd alone. These results illustrated (and provided further support for a continuing belief in) the beneficial effects of TRE in reducing the harmful outcomes of commonly encountered toxicants (like Cd) on the immune system and on overall host health status.

  17. Immunotoxicity in mice induced by short-term exposure to methoxychlor, parathion, or piperonyl butoxide.

    PubMed

    Fukuyama, Tomoki; Kosaka, Tadashi; Hayashi, Koichi; Miyashita, Lisa; Tajima, Yukari; Wada, Kunio; Nishino, Risako; Ueda, Hideo; Harada, Takanori

    2013-01-01

    Exposure to environmental agents can compromise numerous immunological functions. Immunotoxicology focuses on the evaluation of the potential adverse effects of xenobiotics on immune mechanisms that can lead to harmful changes in host responses such as: increased susceptibility to infectious diseases and tumorigenesis; the induction of hypersensitivity reactions; or an increased incidence of autoimmune disease. In order to assess the immunosuppressive response to short-term exposure to some commonly used pesticides, the studies here focused on the response of mice after exposures to the organochlorine pesticide methoxychlor, the organophosphorus pesticide parathion, or the agricultural insecticide synergist piperonyl butoxide. In these studies, 7-week-old mice were orally administered (by gavage) methoxychlor, parathion, or piperonyl butoxide daily for five consecutive days. On Day 2, all mice in each group were immunized with sheep red blood cells (SRBC), and their SRBC-specific IgM responses were subsequently assessed. In addition, levels of B-cells in the spleen of each mouse were also analyzed via surface antigen expression. The results of these studies indicated that treatments with these various pesticides induced marked decreases in the production of SRBC-specific IgM antibodies as well as in the expression of surface antigens in IgM- and germinal center-positive B-cells. Based on these outcomes, it is concluded that the short-term exposure protocol was able to detect potential immunosuppressive responses to methoxychlor, parathion, and piperonyl butoxide in situ, and, as a result, may be useful for detecting other environmental chemical-related immunotoxicities.

  18. Satratoxin-G from the black mold Stachybotrys chartarum induces rhinitis and apoptosis of olfactory sensory neurons in the nasal airways of rhesus monkeys.

    PubMed

    Carey, Stephan A; Plopper, Charles G; Hyde, Dallas M; Islam, Zahidul; Pestka, James J; Harkema, Jack R

    2012-08-01

    Satratoxin-G (SG) is a trichothecene mycotoxin of Stachybotrys chartarum, the black mold suggested to contribute etiologically to illnesses associated with water-damaged buildings. We have reported that intranasal exposure to SG evokes apoptosis of olfactory sensory neurons (OSNs) and acute inflammation in the nose and brain of laboratory mice. To further assess the potential human risk of nasal airway injury and neurotoxicity, we developed a model of SG exposure in monkeys, whose nasal airways more closely resemble those of humans. Adult, male rhesus macaques received a single intranasal instillation of 20 µg SG (high dose, n = 3), or 5 µg SG daily for four days (repeated low dose, n = 3) in one nasal passage, and saline vehicle in the contralateral nasal passage. Nasal tissues were examined using light and electron microscopy and morphometric analysis. SG induced acute rhinitis, atrophy of the olfactory epithelium (OE), and apoptosis of OSNs in both groups. High-dose and repeated low-dose SG elicited a 13% and 66% reduction in OSN volume density, and a 14-fold and 24-fold increase in apoptotic cells of the OE, respectively. This model provides new insight into the potential risk of nasal airway injury and neurotoxicity caused by exposure to water-damaged buildings.

  19. Inducible headkidney cytochrome P450 contributes to endosulfan immunotoxicity in walking catfish Clarias gariepinus.

    PubMed

    Kumari, Usha; Srivastava, Nidhi; Shelly, Asha; Khatri, Preeti; N, Sarat; Singh, Dileep Kumar; Mazumder, Shibnath

    2016-10-01

    The effect of endosulfan metabolites on fish immune system is not well known. It is also not clear whether endosulfan accumulates in fish immune organs and undergoes metabolic biotransformation in situ. In the present study we investigated the role of headkidney (HK), an important fish immune organ on endosulfan metabolism and the long term effects of endosulfan metabolites on the fish immune system. C. gariepinus (walking catfish) were exposed to 2.884ppb of endosulfan (1/10th LC50) for 30d followed by their maintenance in endosulfan-free water for 30d for recovery. Endosulfan induced time-dependent reduction in the HK somatic index and histo-pathological changes in renal and hemopoietic components of the organ. At cellular level, exposure to endosulfan led to death of HK leucocytes. Gas-liquid-chromatography documented the presence of both α- and β-isomers of endosulfan along with the toxic metabolite endosulfan sulfate (ESS) in the HK of exposed fishes. We report that β-endosulfan accumulates more readily in the HK. Depuration studies suggested the persistence of ESS in the HK. Enzyme-immunoassay and qPCR results demonstrated direct relationship between cytochrome P450 1A (CYP1A) expression and ESS levels in the HK. Pre-treatment of HKL with CYP1A specific inhibitor α-Naphthoflavone (ANF) led to reduction in CYP1A mRNA, protein levels, and inhibited ESS formation together implicating the role of CYP1A on endosulfan metabolism. When the exposed fish were transferred to endosulfan-free water ('recovered fish') it was observed that after 30d of recovery period the concentration of endosulfan and its metabolite in the HK were significantly reduced, compared to 30-d exposed fish. We also observed improvement in HK histo-architecture but no significant recovery in HKL number and viability. Collectively, our findings suggest that HK plays an important role in endosulfan metabolism. We propose that endosulfan induces the activation of CYP1A in HK which led to the

  20. Comparison of immunotoxic effects induced by the extracts from methanol and gasoline engine exhausts in vitro.

    PubMed

    Che, Wangjun; Liu, Guiming; Qiu, Hong; Zhang, Hao; Ran, Yun; Zeng, Xianggui; Wen, Weihua; Shu, Ya

    2010-06-01

    Gasoline engine exhaust has been considered as a major source of air pollution in China. Due to lower cyto- and geno-toxicity effects of methanol engine exhaust, methanol is regarded as a potential substitute for gasoline. We have previously compared cyto- and geno-toxicities of gasoline engine exhaust with that of methanol engine exhaust in A549 cells (Zhang et al., 2007).To characterize the immunotoxic effects for gasoline and methanol engine exhausts in immune cell, in this study, we further compared effects of gasoline and methanol engine exhausts on immune function in RAW264.7 cell and rabbit alveolar macrophages. Results showed that both gasoline and methanol engine exhaust could evidently inhibit RAW264.7 cell proliferation, promote RAW264.7 cell apoptosis, decrease E-rosette formation rate and inhibit anti-tumor effects of alveolar macrophages, at the same time, these effects of gasoline engine exhaust were far stronger than those of methanol engine exhaust. In addition, gasoline engine exhaust could significantly inhibit activities of ADCC of alveolar macrophages, but methanol engine exhaust could not. These results suggested that both gasoline and methanol engine exhausts might be immunotoxic atmospheric pollutants, but some effects of gasoline engine exhaust on immunotoxicities may be far stronger than that of methanol engine exhaust.

  1. Walnut Polyphenol Extract Attenuates Immunotoxicity Induced by 4-Pentylphenol and 3-methyl-4-nitrophenol in Murine Splenic Lymphocyte

    PubMed Central

    Yang, Lubing; Ma, Sihui; Han, Yu; Wang, Yuhan; Guo, Yan; Weng, Qiang; Xu, Meiyu

    2016-01-01

    4-pentylphenol (PP) and 3-methyl-4-nitrophenol (PNMC), two important components of vehicle emissions, have been shown to confer toxicity in splenocytes. Certain natural products, such as those derived from walnuts, exhibit a range of antioxidative, antitumor, and anti-inflammatory properties. Here, we investigated the effects of walnut polyphenol extract (WPE) on immunotoxicity induced by PP and PNMC in murine splenic lymphocytes. Treatment with WPE was shown to significantly enhance proliferation of splenocytes exposed to PP or PNMC, characterized by increases in the percentages of splenic T lymphocytes (CD3+ T cells) and T cell subsets (CD4+ and CD8+ T cells), as well as the production of T cell-related cytokines and granzymes (interleukin-2, interleukin-4, and granzyme-B) in cells exposed to PP or PNMC. These effects were associated with a decrease in oxidative stress, as evidenced by changes in OH, SOD, GSH-Px, and MDA levels. The total phenolic content of WPE was 34,800 ± 200 mg gallic acid equivalents/100 g, consisting of at least 16 unique phenols, including ellagitannins, quercetin, valoneic acid dilactone, and gallic acid. Taken together, these results suggest that walnut polyphenols significantly attenuated PP and PNMC-mediated immunotoxicity and improved immune function by inhibiting oxidative stress. PMID:27187455

  2. Investigations into the Immunotoxicity and Allergic Potential Induced by Topical Application of N-Butylbenzenesulfonamide (NBBS) in a Murine Model

    PubMed Central

    Marrocco, Antonella; Meade, B. Jean; Long, Carrie M.; Lukomska, Ewa; Marshall, Nikki B.; Anderson, Stacey E.

    2015-01-01

    N-Butylbenzene sulfonamide (NBBS) is a commonly used plasticizer found in numerous products. Due to its extensive use, lack of adequate toxicological data, and suspicion of toxicity based on the presence of structural alerts, it was nominated to the National Toxicology Program for comprehensive toxicological testing. The purpose of this study was to evaluate the potential for hypersensitivity and immune suppression following dermal exposure to NBBS using a murine model. NBBS tested negative in a combined irritancy/local lymph node assay (LLNA), classifying it as nonirritating and nonsensitizing. To estimate the immunosuppressive potential of NBBS, assays that assessed immunotoxicity were performed, including the immumnoglobulin (Ig) M response to T-cell-dependent antigen sheep red blood cells (SRBC), using the plaque-forming cell (PFC) assay and immune cell phenotyping. After a 28-d treatment with NBBS, mice exposed to the lowest concentration (25% NBBS) showed a significant increase in IgM-producing B cells in the spleen. No marked changes were identified in immune cell markers in the lymph node. In contrast to body weight, a significant elevation in kidney and liver weight was observed following dermal exposure to all concentrations of NBBS. These results demonstrate that dermal exposure to NBBS, other than liver and kidney toxicity, did not apparently induce immunotoxicity in a murine model. PMID:26291892

  3. Immunotoxicity and hematotoxicity induced by tetrachloroethylene in egyptian dry cleaning workers.

    PubMed

    Emara, Ashraf M; Abo El-Noor, Mona M; Hassan, Neven A; Wagih, Ayman A

    2010-02-01

    The immune and hematological systems can be a target for environmental contaminants with potential adverse effects, so the purpose of this study is to provide documentation on immunotoxicity and hematotoxicity of tetrachloroethylene, which is widely used in dry cleaning in Egypt. This study was carried out on 80 adult males. Subjects designated as controls (n = 40) were healthy persons and others were tetrachloroethylene-exposed dry-cleaning workers (n = 40). The controls and tetrachloroethylene-exposed workers were then divided into four equal groups (20 individuals/group): group I, control group never smoking; group II, smoking control group; and groups III and IV, tetrachloroethylene-exposed nonsmoking and smoking workers, respectively. Blood level of tetrachloroethylene, complete blood count, immunoglobulins (IgA, IgM, IgG, and IgE), the total numbers of white blood cells (WBC), and leukocyte differential counts, as well as interferon gamma (IFN-gamma) and interleukin-4 (IL-4), were measured. The immunotoxicity of tetrachloroethylene appeared in the form of an increase in serum immunoglobulin E in nonsmoking and smoking tetrachloroethylene-exposed workers, while the serum immunoglobulins A, M, and G levels showed no significant change in all studied groups. In addition, our results demonstrated a significant increase in white cell count, lymphocytes, natural killer (NK; CD3+CD16CD56+) cells, and B (CD19+) lymphocytes. The increase in WBC and lymphocytes may be attributed to allergic reaction. Moreover, serum and lymphocytic interlukin-4 levels were significantly increased in nonsmoking and smoking tetrachloroethylene-exposed workers. Tetrachloroethylene exposure is associated with immunotoxicity, which may lead to the augmentation of allergic diseases or appearance of autoimmune reaction.

  4. Carbendazim has the potential to induce oxidative stress, apoptosis, immunotoxicity and endocrine disruption during zebrafish larvae development.

    PubMed

    Jiang, Jinhua; Wu, Shenggan; Wang, Yanhua; An, Xuehua; Cai, Leiming; Zhao, Xueping; Wu, Changxing

    2015-10-01

    Increasing evidence have suggested deleterious effects of carbendazim on reproduction, apoptosis, immunotoxicity and endocrine disruption in mice and rats, however, the developmental toxicity of carbendazim to aquatic organisms remains obscure. In the present study, we utilized zebrafish as an environmental monitoring model to characterize the effects of carbendazim on expression of genes related to oxidative stress, apoptosis, immunotoxicity and endocrine disruption during larval development. Different trends in gene expression were observed upon exposing the larvae to 4, 20, 100, and 500 μg/L carbendazim for 4 and 8d. The mRNA levels of catalase, glutathione peroxidase and manganese superoxide dismutase (CAT, GPX, and Mn/SOD) were up-regulated after exposure to different concentrations of carbendazim for 4 or 8d. The up-regulation of p53, Apaf1, Cas8 and the down-regulation of Bcl2, Mdm2, Cas3 in the apoptosis pathway, as well as the increased expression of cytokines and chemokines, including CXCL-C1C, CCL1, IL-1b, IFN, IL-8, and TNFα, suggested carbendazim might trigger apoptosis and immune response during zebrafish larval development. In addition, the alteration of mRNA expression of VTG, ERα, ERβ1, ERβ2, TRα, TRβ, Dio1, and Dio2 indicated the potential of carbendazim to induce endocrine disruption in zebrafish larvae. These data suggested that carbendazim could simultaneously induce multiple responses during zebrafish larval development, and bidirectional interactions among oxidative stress, apoptosis pathway, immune and endocrine systems might be present. PMID:26055223

  5. Assessing a theoretical risk of dolutegravir-induced developmental immunotoxicity in juvenile rats.

    PubMed

    Rhodes, Melissa; Laffan, Susan; Genell, Caroline; Gower, Jill; Maier, Curtis; Fukushima, Tamio; Nichols, Garrett; Bassiri, Ashlyn Eaton

    2012-11-01

    HIV-1 integrase inhibitors (INIs) are a promising class of antiretrovirals for the treatment of HIV in adults; there is interest in expanding their use into pediatric populations. A theoretical concern for developmental immunotoxicity was raised after a publication suggested that two HIV INI tool compounds inhibited in vitro cleavage activity of recombination activating genes 1 and 2 (RAG1/2) through the inhibition of their binding to recombination signal sequences. RAG1/2 are required for the development of mature B and T lymphocyte populations. The potential effects of the investigational INI dolutegravir on RAG1/2 were addressed by developing assays in juvenile rats to measure T cell receptor (TCR) Vβ usage by flow cytometry as an indicator of TCR repertoire diversity and a T cell dependent antibody response (TDAR) as an indicator of immunosuppression. These endpoints were incorporated into a juvenile rat toxicity study, along with immunophenotyping, hematology, and histopathology of immunologic organs. Dose levels of 0, 0.5, 2, or 75mg/kg/day dolutegravir were given via oral gavage from postnatal day 4 through 66. At the highest dose, there was decreased body weight gain and two preweanling deaths; however, there were no treatment-related effects on developmental parameters. There were no effects on immunologic competence, as measured by TDAR, and no effects on lymphocyte subsets or CD4 and CD8 TCR Vβ usage in peripheral blood. Histopathology of immunologic organs (spleen, thymus, lymph nodes) and hematology evaluation revealed no effects. The no observed adverse effect level for immunotoxicity endpoints was 75mg/kg/day.

  6. DNA fragmentation in developing lung fibroblasts exposed to Stachybotrys chartarum (atra) toxins.

    PubMed

    McCrae, K C; Rand, T G; Shaw, R A; Mantsch, H H; Sowa, M G; Thliveris, J A; Scott, J E

    2007-07-01

    Stachybotrys chartarum (atra) is a toxic mold that grows on water-damaged cellulose-based materials. Research has revealed also that inhalation of S. chartarum spores caused marked changes in respiratory epithelium, especially to developing lungs. We analyzed the epigenetic potential of S. chartarum spore toxins on developing rat lung fibroblasts using single cell gel electrophoresis (comet assay). Isolated fetal lung fibroblasts were exposed to S. chartarum spore toxins for 15 min, 3, 14, or 24 hr and control cells were exposed to saline under the same conditions. Cells were embedded in agarose, electrophoresed under alkaline conditions and silver stained. DNA damage was assessed in terms of fragmentation as measured by comet tail length (DNA migration) and intensity (% DNA contained within head and tail). Upon visual inspection, control fibroblasts showed no DNA fragmentation whereas S. chartarum-treated cells had definable comets of various degrees depending upon the time-course. Analyses of the comets revealed that exposure to S. chartarum spore toxins for at least 15 min to 14 hr, induced increased DNA fragmentation in a time-dependent manner. The fact that exposure to toxins for 24 hr showed less damage suggested that developing lung fibroblasts may have the capability of repairing DNA fragmentation. PMID:17534970

  7. Pretilachlor has the potential to induce endocrine disruption, oxidative stress, apoptosis and immunotoxicity during zebrafish embryo development.

    PubMed

    Jiang, Jinhua; Chen, Yanhong; Yu, Ruixian; Zhao, Xueping; Wang, Qiang; Cai, Leiming

    2016-03-01

    The objectives of the present study were to investigate the toxic effects of pretilachlor on zebrafish during its embryo development. The results demonstrated that the transcription of genes involved in the hypothalamic-pituitary-gonadal/thyroid (HPG/HPT) axis was increased after exposure to 50, 100, 200 μg/L pretilachlor for 96 h, the aromatase activity, vitellogenin (VTG) and thyroid hormones T3 and T4 levels in zebrafish were also up-regulated simultaneously. Pretilachlor exposure induced a noticeable increase in ROS level, increased the transcription and level of antioxidant proteins (e.g., CAT, SOD and GPX). Moreover, the up-regulation of P53, Mdm2, Bbc3 expression and Caspase3 and Caspase9 activities in the apoptosis pathway suggested pretilachlor might trigger cell apoptosis in zebrafish. In addition, the transcription of CXCL-C1C, IL-1β and IL-8 related to the innate immunity was down-regulated after pretilachlor exposure. These data suggested that pretilachlor could simultaneously induce endocrine disruption, apoptosis, oxidative stress and immunotoxicity during zebrafish embryo development.

  8. Pretilachlor has the potential to induce endocrine disruption, oxidative stress, apoptosis and immunotoxicity during zebrafish embryo development.

    PubMed

    Jiang, Jinhua; Chen, Yanhong; Yu, Ruixian; Zhao, Xueping; Wang, Qiang; Cai, Leiming

    2016-03-01

    The objectives of the present study were to investigate the toxic effects of pretilachlor on zebrafish during its embryo development. The results demonstrated that the transcription of genes involved in the hypothalamic-pituitary-gonadal/thyroid (HPG/HPT) axis was increased after exposure to 50, 100, 200 μg/L pretilachlor for 96 h, the aromatase activity, vitellogenin (VTG) and thyroid hormones T3 and T4 levels in zebrafish were also up-regulated simultaneously. Pretilachlor exposure induced a noticeable increase in ROS level, increased the transcription and level of antioxidant proteins (e.g., CAT, SOD and GPX). Moreover, the up-regulation of P53, Mdm2, Bbc3 expression and Caspase3 and Caspase9 activities in the apoptosis pathway suggested pretilachlor might trigger cell apoptosis in zebrafish. In addition, the transcription of CXCL-C1C, IL-1β and IL-8 related to the innate immunity was down-regulated after pretilachlor exposure. These data suggested that pretilachlor could simultaneously induce endocrine disruption, apoptosis, oxidative stress and immunotoxicity during zebrafish embryo development. PMID:26851375

  9. Cryptic species in Stachybotrys chartarum.

    PubMed

    Cruse, Michael; Telerant, Robin; Gallagher, Thomas; Lee, Thomas; Taylor, John W

    2002-01-01

    Stachybotrys chartarum has received much attention as a possible cause of sick-building syndrome. Because morphological species recognition in fungi can hide diversity, we applied a phylogenetic approach to search for cryptic species. We examined 23 isolates from the San Francisco Bay Area, and another seven from around the US. Using markers we developed for three polymorphic protein coding loci (chitin synthase 1, beta-tubulin 2, and trichodiene synthase 5), we infer that two distinct phylogenetic species exist within the single described morphological species. We have found no correlation between genetic isolation and geographic distance. PMID:21156555

  10. Allergic Potential and Immunotoxicity Induced by Topical Application of 1-Chloro-4-(Trifluoromethyl)Benzene (PCBTF) in a Murine Model

    PubMed Central

    Franko, Jennifer; Jackson, Laurel G.; Meade, B. Jean; Anderson, Stacey E.

    2011-01-01

    The purpose of the studies in this paper was to evaluate the allergic potential, immunotoxicity, and irritancy of the occupationally relevant chemical, 1-chloro-4-(trifluoromethyl)benzene, also known as parachlorobenzotrifluoride (PCBTF), following dermal exposure in a murine model. Evaluation of the sensitization potential, conducted using the local lymph node assay (LLNA) at concentrations ranging from 50% to 100%, identified a dose-dependent increase in lymphocyte proliferation with a calculated EC3 value of 53.1%. While no elevations in total or specific IgE were observed after exposure to any concentration of the chemical, significant increases in IFN-γ protein production by stimulated draining lymphoid cells were observed, indicating a T-cell-mediated response. Dermal exposure to PCBTF was not found to alter the immune response to a T-cell-dependant antigen. These results demonstrate that PCBTF has the potential to induce allergic sensitization following dermal exposure and based on LLNA results would be classified as a weak sensitizer. PMID:21747864

  11. Embryonic exposure to carbendazim induces the transcription of genes related to apoptosis, immunotoxicity and endocrine disruption in zebrafish (Danio rerio).

    PubMed

    Jiang, Jinhua; Wu, Shenggan; Wu, Changxing; An, Xuehua; Cai, Leiming; Zhao, Xueping

    2014-12-01

    Carbendazim is one of the most widespread environmental contaminant that can cause major concern to human and animal reproductive system. To date, very few studies have been conducted on the toxic effect of carbendazim in the non-target organism zebrafish (Danio rerio). The study presented here aimed to assess how carbendazim triggers apoptosis, immunotoxicity and endocrine disruption pathways in zebrafish during its embryo development. Our results demonstrated that the expression patterns of many key genes involved in cell apoptosis pathway (e.g. P53, Mdm2, Bbc3 and Cas8) were significantly up-regulated upon the exposure to carbendazim at the concentration of 500 μg/L, while the Bcl2 and Cas3 were down-regulated at the same concentration, interestingly, the expression level of Ogg1 decreased at all the exposure concentrations. It was also observed that the mRNA levels of CXCL-C1C, CCL1, IL-1b and TNFα which were closely related to the innate immune system, were affected in newly hatched zebrafish after exposed to different concentrations of carbendazim. Moreover, the expression of genes that are involved in the hypothalamic-pituitary-gonadal/thyroid (HPG/HPT) axis including VTG, ERα, ERβ2, Dio1, Dio2, Thraa and Thrb were all down-regulated significantly after the exposure to carbendazim. The expression levels of two cytochrome P450 aromatases CYP19a and CYP19b were increased significantly after 20 and 100 μg/L carbendazim exposure, respectively. Taken together, our results indicated that carbendazim had the potential to induce cell apoptosis and cause immune toxicity as well as endocrine disruption in zebrafish during the embryo developmental stage. The information presented here also help to elucidate the environmental risks caused by the carbendazim-induced toxicity in aquatic organisms.

  12. Embryonic exposure to carbendazim induces the transcription of genes related to apoptosis, immunotoxicity and endocrine disruption in zebrafish (Danio rerio).

    PubMed

    Jiang, Jinhua; Wu, Shenggan; Wu, Changxing; An, Xuehua; Cai, Leiming; Zhao, Xueping

    2014-12-01

    Carbendazim is one of the most widespread environmental contaminant that can cause major concern to human and animal reproductive system. To date, very few studies have been conducted on the toxic effect of carbendazim in the non-target organism zebrafish (Danio rerio). The study presented here aimed to assess how carbendazim triggers apoptosis, immunotoxicity and endocrine disruption pathways in zebrafish during its embryo development. Our results demonstrated that the expression patterns of many key genes involved in cell apoptosis pathway (e.g. P53, Mdm2, Bbc3 and Cas8) were significantly up-regulated upon the exposure to carbendazim at the concentration of 500 μg/L, while the Bcl2 and Cas3 were down-regulated at the same concentration, interestingly, the expression level of Ogg1 decreased at all the exposure concentrations. It was also observed that the mRNA levels of CXCL-C1C, CCL1, IL-1b and TNFα which were closely related to the innate immune system, were affected in newly hatched zebrafish after exposed to different concentrations of carbendazim. Moreover, the expression of genes that are involved in the hypothalamic-pituitary-gonadal/thyroid (HPG/HPT) axis including VTG, ERα, ERβ2, Dio1, Dio2, Thraa and Thrb were all down-regulated significantly after the exposure to carbendazim. The expression levels of two cytochrome P450 aromatases CYP19a and CYP19b were increased significantly after 20 and 100 μg/L carbendazim exposure, respectively. Taken together, our results indicated that carbendazim had the potential to induce cell apoptosis and cause immune toxicity as well as endocrine disruption in zebrafish during the embryo developmental stage. The information presented here also help to elucidate the environmental risks caused by the carbendazim-induced toxicity in aquatic organisms. PMID:25304545

  13. Introduction to Immunotoxicity

    EPA Science Inventory

    Recognition that the immune system is vulnerable to adverse effects after exposure to xenobiotics led to the discipline of immunotoxicology and the subsequent addition of immunotoxicology testing to regulatory guidelines for toxicity. Immunotoxic effects can result in immunosuppr...

  14. Cytokines as biomarkers of nanoparticle immunotoxicity

    PubMed Central

    Elsabahy, Mahmoud; Wooley, Karen L.

    2013-01-01

    Nanoscale objects, whether of biologic origin or synthetically created, are being developed into devices for a variety of bionanotechnology diagnostic and pharmaceutical applications. However, the potential immunotoxicity of these nanomaterials and mechanisms by which they may induce adverse reactions have not received sufficient attention. Nanomaterials, depending on their characteristics and compositions, can interact with the immune system in several ways and either enhance or suppress immune system function. Cytokines perform pleiotropic functions to mediate and regulate the immune response and are generally recognized as biomarkers of immunotoxicity. While the specificity and validity of certain cytokines as markers of adverse immune response has been established for chemicals, small and macromolecular drugs, research on their applicability for predicting and monitoring the immunotoxicity of engineered nanomaterials is still ongoing. The goal of this review is to provide guidelines as to important cytokines that can be utilized for evaluating the immunotoxicity of nanomaterials and to highlight the role of those cytokines in mediating adverse reactions, which is of particular importance for the clinical development of nanopharmaceuticals and other nanotechnology-based products. Importantly, the rational design of nanomaterials of low immunotoxicity will be discussed, focusing on synthetic nanodevices, with emphasis on both the nanoparticle-forming materials and the embedded cargoes. PMID:23549679

  15. Assessment of immunotoxicity induced by chemicals in human precision-cut lung slices (PCLS).

    PubMed

    Lauenstein, L; Switalla, S; Prenzler, F; Seehase, S; Pfennig, O; Förster, C; Fieguth, H; Braun, A; Sewald, K

    2014-06-01

    Occupational asthma can be induced by a number of chemicals at the workplace. Risk assessment of potential sensitizers is mostly performed in animal experiments. With increasing public demand for alternative methods, human precision-cut lung slices (PCLS) have been developed as an ex vivo model. Human PCLS were exposed to increasing concentrations of 20 industrial chemicals including 4 respiratory allergens, 11 contact allergens, and 5 non-sensitizing irritants. Local respiratory irritation was characterized and expressed as 75% (EC25) and 50% (EC50) cell viability with respect to controls. Dose-response curves of all chemicals except for phenol were generated. Local respiratory inflammation was quantified by measuring the production of cytokines and chemokines. TNF-α and IL-1α were increased significantly in human PCLS after exposure to the respiratory sensitizers trimellitic anhydride (TMA) and ammonium hexachloroplatinate (HClPt) at subtoxic concentrations, while contact sensitizers and non-sensitizing irritants failed to induce the release of these cytokines to the same extent. Interestingly, significant increases in T(H)1/T(H)2 cytokines could be detected only after exposure to HClPt at a subtoxic concentration. In conclusion, allergen-induced cytokines were observed but not considered as biomarkers for the differentiation between respiratory and contact sensitizers. Our preliminary results show an ex vivo model which might be used for prediction of chemical-induced toxicity, but is due to its complex three-dimensional structure not applicable for a simple screening of functional and behavior changes of certain cell populations such as dendritic cells and T-cells in response to allergens.

  16. CHARACTERIZATION OF THE HEMOLYSIN, FROM STACHYBOTRYS CHARTARUM

    EPA Science Inventory

    Stachybotrys chartarum is a toxigenic fungus that has been associated with human health concerns, including pulmonary hemorrhage and hemosiderosis. This fungus produces a hemolysin, stachylysin, which in its apparent monomeric form has a molecular mass of 11,920
    Da as determ...

  17. DNA damage, redox changes, and associated stress-inducible signaling events underlying the apoptosis and cytotoxicity in murine alveolar macrophage cell line MH-S by methanol-extracted Stachybotrys chartarum toxins

    SciTech Connect

    Wang Huiyan; Yadav, Jagjit S. . E-mail: Jagjit.Yadav@uc.edu

    2006-08-01

    Spore-extracted toxins of the indoor mold Stachybotrys chartarum (SC) caused cytotoxicity (release of lactate dehydrogenase), inhibition of cell proliferation, and cell death in murine alveolar macrophage cell line MH-S in a dose- and time-dependent manner. Apoptotic cell death, confirmed based on morphological changes, DNA ladder formation, and caspase 3/7 activation, was detectable as early as at 3 h during treatment with a toxin concentration of 1 spore equivalent/macrophage and was preceded by DNA damage beginning at 15 min, as evidenced by DNA comet formation in single cell gel electrophoresis assay. The apoptotic dose of SC toxins did not induce detectable nitric oxide and pro-inflammatory cytokines (IL-1{beta}, IL-6, and TNF-{alpha}) but showed exacerbated cytotoxicity in presence of a non-apoptotic dose of the known pro-inflammatory agent LPS (10 ng/ml). Intracellular reduced glutathione (GSH) level showed a significant decrease beginning at 9 h of the toxin treatment whereas oxidized glutathione (GSSG) showed a corresponding significant increase, indicating a delayed onset of oxidative stress in the apoptosis process. The toxin-treated macrophages accumulated p53, an indicator of DNA damage response, and showed activation of the stress-inducible MAP kinases, JNK, and p38, in a time-dependent manner. Chemical blocking of either p38 or p53 inhibited in part the SC toxin-induced apoptosis whereas blocking of JNK did not show any such effect. This study constitutes the first report on induction of DNA damage and associated p53 activation by SC toxins, and demonstrates the involvement of p38- and p53-mediated signaling events in SC toxin-induced apoptosis of alveolar macrophages.

  18. Biomarkers of immunotoxicity in man.

    PubMed

    Descotes, J; Nicolas, B; Vial, T; Nicolas, J F

    1996-01-01

    Abstract The immunotoxic consequences of chemical exposures include direct immunotoxicity (namely immunosuppression and immunostimulation), hypersensitivity and autoimmunity, and because the mechanisms involved are markedly different, no single immune parameter is likely to ever predict or assess all three types of immunotoxicity. A fairly large number of immunological endpoints have been proposed for use as biomarkers of immunotoxicity in man. Unfortunately, they are often not sensitive enough and/or poorly standardized, so that their relevance for assessing immunotoxic effects in humans is debatable, and actually debated. Immune-mediated sentinel events detected in individuals with a defined history of chemical exposure, may prove helpful until methodological advances, notably with the introduction of technologies derived from molecular biology, provide reliable parameters to be used as biomarkers of immunotoxicity. PMID:23888916

  19. Genome Sequence of Stachybotrys chartarum Strain 51-11.

    PubMed

    Betancourt, Doris A; Dean, Timothy R; Kim, Jean; Levy, Josh

    2015-01-01

    The Stachybotrys chartarum strain 51-11 genome was sequenced by shotgun sequencing utilizing Illumina HiSeq 2000 and PacBio technologies. Since S. chartarum has been implicated as having health impacts within water-damaged buildings, any information extracted from the genomic sequence data relating to toxins or the metabolism of the fungus might be useful.

  20. Genome sequence of Stachybotrys chartarum Strain 51-11

    EPA Science Inventory

    Stachybotrys chartarum strain 51-11 genome was sequenced by shotgun sequencing utilizing Illumina Hiseq 2000 and PacBio long read technology. Since Stachybotrys chartarum has been implicated in health impacts within water-damaged buildings, any information extracted from the geno...

  1. PARTIAL CHARACTERIZATION OF ALLERGENS IN EXTRACTS OF STACHYBOTRYS CHARTARUM

    EPA Science Inventory

    PARTIAL CHARACTERIZATION OF ALLERGENS IN EXTRACTS OF Stachybotrys chartarum. M E Viana1, MJ Selgrade2, and M D Ward2. 1NCSU, Raleigh, NC, USA. 2NHEERL, ORD, US EPA, RTP, NC, USA.

    Exposure to Stachybotrys chartarum has been associated with the development of serious health ...

  2. Arsenic immunotoxicity: a review.

    PubMed

    Dangleben, Nygerma L; Skibola, Christine F; Smith, Martyn T

    2013-01-01

    Exposure to arsenic (As) is a global public health problem because of its association with various cancers and numerous other pathological effects, and millions of people worldwide are exposed to As on a regular basis. Increasing lines of evidence indicate that As may adversely affect the immune system, but its specific effects on immune function are poorly understood. Therefore, we conducted a literature search of non-cancer immune-related effects associated with As exposure and summarized the known immunotoxicological effects of As in humans, animals and in vitro models. Overall, the data show that chronic exposure to As has the potential to impair vital immune responses which could lead to increased risk of infections and chronic diseases, including various cancers. Although animal and in vitro models provide some insight into potential mechanisms of the As-related immunotoxicity observed in human populations, further investigation, particularly in humans, is needed to better understand the relationship between As exposure and the development of disease. PMID:24004508

  3. Arsenic immunotoxicity: a review.

    PubMed

    Dangleben, Nygerma L; Skibola, Christine F; Smith, Martyn T

    2013-01-01

    Exposure to arsenic (As) is a global public health problem because of its association with various cancers and numerous other pathological effects, and millions of people worldwide are exposed to As on a regular basis. Increasing lines of evidence indicate that As may adversely affect the immune system, but its specific effects on immune function are poorly understood. Therefore, we conducted a literature search of non-cancer immune-related effects associated with As exposure and summarized the known immunotoxicological effects of As in humans, animals and in vitro models. Overall, the data show that chronic exposure to As has the potential to impair vital immune responses which could lead to increased risk of infections and chronic diseases, including various cancers. Although animal and in vitro models provide some insight into potential mechanisms of the As-related immunotoxicity observed in human populations, further investigation, particularly in humans, is needed to better understand the relationship between As exposure and the development of disease.

  4. Arsenic immunotoxicity: a review

    PubMed Central

    2013-01-01

    Exposure to arsenic (As) is a global public health problem because of its association with various cancers and numerous other pathological effects, and millions of people worldwide are exposed to As on a regular basis. Increasing lines of evidence indicate that As may adversely affect the immune system, but its specific effects on immune function are poorly understood. Therefore, we conducted a literature search of non-cancer immune-related effects associated with As exposure and summarized the known immunotoxicological effects of As in humans, animals and in vitro models. Overall, the data show that chronic exposure to As has the potential to impair vital immune responses which could lead to increased risk of infections and chronic diseases, including various cancers. Although animal and in vitro models provide some insight into potential mechanisms of the As-related immunotoxicity observed in human populations, further investigation, particularly in humans, is needed to better understand the relationship between As exposure and the development of disease. PMID:24004508

  5. Occurrence of Stachybotrys chartarum chemotype S in dried culinary herbs.

    PubMed

    Biermaier, Barbara; Gottschalk, Christoph; Schwaiger, Karin; Gareis, Manfred

    2015-02-01

    Stachybotrys (S.) chartarum is an omnipresent cellulolytic mould which produces secondary metabolites, such as the highly toxic macrocyclic trichothecenes. While it is known to occur in animal feed like hay and straw as well as in water-damaged indoor environments, there is little knowledge about the occurrence of S. chartarum and its secondary metabolites in food. The objective of the present study was to examine selected dried culinary herbs for the presence of S. chartarum chemotype S, to assess the potential risk of a contamination of foods with macrocyclic trichothecenes. In total, 50 Stachybotrys isolates from different types of culinary herbs (n=100) such as marjoram (Origanum majorana Linné (L.)), oregano (Origanum vulgare L.), thyme (Thymus vulgaris L.), and savory (Satureja hortensis L.) were examined by MTT-cell culture test (effect-based bioassay), ELISA, and by liquid chromatography tandem mass spectrometry (LC-MS/MS). Selected toxic and non-toxic isolates (n=15) were genetically characterized by PCR and sequencing. Five isolates (10%) were highly toxic in the MTT-cell culture test, and the production of macrocyclic trichothecenes was proven by ELISA and LC-MS/MS. These five isolates were genetically confirmed as S. chartarum chemotype S. To the best of our knowledge, this is the first report about a contamination of dried culinary herbs with toxigenic S. chartarum. PMID:25346283

  6. PURIFICATION AND COMPARATIVE NEUROTOXICITY OF THE TRICHOTHECENES SATRATOXIN G AND RORIDIN L2 FROM STACHYBOTRYS CHARTARUM

    PubMed Central

    Islam, Zahidul; Shinozuka, Junko; Harkema, Jack R.; Pestka, James J.

    2009-01-01

    Satratoxin G (SG), a macrocyclic trichothecene produced by Stachybotrys chartarum, induces apoptosis in cultured neuronal cells as well as nasal olfactory sensory neurons (OSN) in the nose and brain of mice exposed intranasally to this toxin. The purpose of this study was to (1) develop a facile method for production and purification of both SG, and its putative biosynthetic precursor, roridin L2 (RL2), from S. chartarum cultures and (2) compare their relative neurotoxicity in vitro and in vivo. S. chartarum 29-58-17 was cultured in Fernbach flasks on rice (5×105 spores /250g rice) for 4 to 6 weeks. Following extraction with acetonitrile, the extract was dried, dissolved in dichloromethane and subjected to Michel-Miller silica gel chromatography using a stepwise acetonitrile-dichloromethane gradient with SG and RL2 eluting in the 30 and 40% acetonitrile fractions, respectively. Purification of the two compounds was completed by C18 semi-preparative reverse phase liquid chromatography using an acetonitrile-water gradient and purity confirmed by electrospray ionization/collision-induced dissociation (ESI-CID) tandem mass spectroscopy. Although viability significantly decreased in PC-12 neuronal cells treated with 10 to 25 ng/ml of SG, RL2 at concentrations up to 1000 ng/ml were not toxic. Flow cytometry and agarose DNA fragmentation assays revealed that SG at 10 to 25 ng/ml induced apoptotic death in the PC-12 cells while RL2 at concentrations up to 1000 ng/ml were without effect. In similar fashion, intranasal exposure of mice (female B6C3F1) to SG at 100 µg/kg bw induced marked OSN apoptosis and atrophy of the olfactory epithelium whereas RL2 at the equivalent dose did not exhibit toxicity. Taken together, an optimized protocol for production and isolation of trichothecenes from S. chartarum cultures is described and further demonstrates that while the macrocyclic SG was neurotoxic in vitro and in vivo, its biosynthetic precursor, RL2 was non-toxic. PMID:20077192

  7. Immunotoxicity -- The Risk is Real

    EPA Science Inventory

    Several papers published over the last year represent significant progress in closing the gap between rodent immunotoxicity data and human risk and indicate that, at least for the developing immune system, the concern raised by rodent data is justified. The studies reviewed here...

  8. Immunotoxicity of trenbolone acetate in Japanese quail

    USGS Publications Warehouse

    Quinn, M.J.; McKernan, M.; Lavoie, E.T.; Ottinger, M.A.

    2007-01-01

    Trenbolone acetate is a synthetic androgen that is currently used as a growth promoter in many meat-exporting countries. Despite industry laboratories classifying trenbolone as nonteratogenic, data showed that embryonic exposure to this androgenic chemical altered development of the immune system in Japanese quail. Trenbolone is lipophilic, persistent, and released into the environment in manure used as soil fertilizer. This is the first study to date to assess this chemical's immunotoxic effects in an avian species. A one-time injection of trenbolone into yolks was administered to mimic maternal deposition, and subsequent effects on the development and function of the immune system were determined in chicks and adults. Development of the bursa of Fabricius, an organ responsible for development of the humoral arm of the immune system, was disrupted, as indicated by lower masse, and smaller and fewer follicles at day 1 of hatch. Morphological differences in the bursas persisted in adults, although no differences in either two measures of immune function were observed. Total numbers of circulating leukocytes were reduced and heterophil-lymphocyte ratios were elevated in chicks but not adults. This study shows that trenbolone acetate is teratogenic and immunotoxic in Japanese quail, and provides evidence that the quail immune system may be fairly resilient to embryonic endocrine-disrupting chemical-induced alterations following no further exposure posthatch.

  9. CHARACTERIZATION OF THE HEMOLYSIN, STACHYLYSIN, FROM STACHYBOTRYS CHARTARUM

    EPA Science Inventory

    Stachybotrys chartarum is a toxigenic fungus that has been associated with human health concerns, including pulmonary hemorrhage/hemosiderosis. This fungus produces a hemolysin, stachylysin, which in its monomeric form, has a molecular wieght of 11,920 daltons as determined by m...

  10. STACHYLYSIN MAY BE CAUSE OF HEMORRAHAGING IN STACHYBOTRYS CHARTARUM EXPOSURES

    EPA Science Inventory

    Stachybotrys chartarum is a toxigenic fungus that has been associated with human health concerns like nasal bleeding in adults and pulmonary hemosiderosis (PH) in infants. Stachylysin is a glycosylated protein, with the deglycosylated molecular mass of 21.5 kDa. Seven of eight ...

  11. Stachybotrys chartarum, trichothecene mycotoxins, and damp building-related illness: new insights into a public health enigma.

    PubMed

    Pestka, James J; Yike, Iwona; Dearborn, Dorr G; Ward, Marsha D W; Harkema, Jack R

    2008-07-01

    Damp building-related illnesses (DBRI) include a myriad of respiratory, immunologic, and neurologic symptoms that are sometimes etiologically linked to aberrant indoor growth of the toxic black mold, Stachybotrys chartarum. Although supportive evidence for such linkages is limited, there are exciting new findings about this enigmatic organism relative to its environmental dissemination, novel bioactive components, unique cellular targets, and molecular mechanisms of action which provide insight into the S. chartarum's potential to evoke allergic sensitization, inflammation, and cytotoxicity in the upper and lower respiratory tracts. Macrocyclic trichothecene mycotoxins, produced by one chemotype of this fungus, are potent translational inhibitors and stress kinase activators that appear to be a critical underlying cause for a number of adverse effects. Notably, these toxins form covalent protein adducts in vitro and in vivo and, furthermore, cause neurotoxicity and inflammation in the nose and brain of the mouse. A second S. chartarum chemotype has recently been shown to produce atranones-mycotoxins that can induce pulmonary inflammation. Other biologically active products of this fungus that might contribute to pathophysiologic effects include proteinases, hemolysins, beta-glucan, and spirocyclic drimanes. Solving the enigma of whether Stachybotrys inhalation indeed contributes to DBRI will require studies of the pathophysiologic effects of low dose chronic exposure to well-characterized, standardized preparations of S. chartarum spores and mycelial fragments, and, coexposures with other environmental cofactors. Such studies must be linked to improved assessments of human exposure to this fungus and its bioactive constituents in indoor air using both state-of-the-art sampling/analytical methods and relevant biomarkers.

  12. IMMUNOCYTOCHEMICAL LOCALIZATION OF STACHYLYSIN IN STACHYBOTRYS CHARTARUM SPORES AND SPORE-IMPACTED MOUSE AND RAT LUNG TISSUES

    EPA Science Inventory

    Stachylysin is a proteinaceous hemolytic agent that is producted by S. chartarum. Stachylysin was found, using immunohistochemistical and immunocytochemical methods, to be localized in S. chartarum spores/mycelia primarily in the inner wall suggesting that it is constitutively ...

  13. Transcriptional Profiling of Dibenzo[def,p]chrysene-induced Spleen Atrophy Provides Mechanistic Insights into its Immunotoxicity in MutaMouse.

    PubMed

    Chepelev, Nikolai L; Long, Alexandra S; Williams, Andrew; Kuo, Byron; Gagné, Rémi; Kennedy, Dean A; Phillips, David H; Arlt, Volker M; White, Paul A; Yauk, Carole L

    2016-01-01

    Dibenzo[def,p]chrysene (DBC) is the most carcinogenic polycyclic aromatic hydrocarbon (PAH) examined to date. We investigated the immunotoxicity of DBC, manifested as spleen atrophy, following acute exposure of adult MutaMouse males by oral gavage. Mice were exposed to 0, 2.0, 6.2, or 20.0 mg DBC /kg-bw per day, for 3 days. Genotoxic endpoints (DBC-DNA adducts and lacZ mutant frequency in spleen and bone marrow, and red blood cell micronucleus frequency) and global gene expression changes were measured. All of the genotoxicity measures increased in a dose-dependent manner in spleen and bone marrow. Gene expression analysis showed that DBC activates p53 signaling pathways related to cellular growth and proliferation, which was evident even at the low dose. Strikingly, the expression profiles of DBC exposed mouse spleens were highly inversely correlated with the expression profiles of the only published toxicogenomics dataset of enlarged mouse spleen. This analysis suggested a central role for Bnip3l, a pro-apoptotic protein involved in negative regulation of erythroid maturation. RT-PCR confirmed expression changes in several genes related to apoptosis, iron metabolism, and aryl hydrocarbon receptor signaling that are regulated in the opposite direction during spleen atrophy versus benzo[a]pyrene-mediated splenomegaly. In addition, benchmark dose modeling of toxicogenomics data yielded toxicity estimates that are very close to traditional toxicity endpoints. This work illustrates the power of toxicogenomics to reveal rich mechanistic information for immunotoxic compounds and its ability to provide information that is quantitatively similar to that derived from standard toxicity methods in health risk assessment.

  14. Modulation of Benzo[a]pyrene induced immunotoxicity in mice actively immunized with a B[a]P-diphtheria toxoid conjugate

    SciTech Connect

    Schellenberger, Mario T.; Grova, Nathalie; Willieme, Stephanie; Farinelle, Sophie; Prodhomme, Emmanuel J.F.

    2009-10-01

    Benzo[a]pyrene (B[a]P) is a small molecular weight carcinogen and the prototype of polycyclic aromatic hydrocarbons (PAHs). While these compounds are primarily known for their carcinogenicity, B[a]P and its metabolites are also toxic for mammalian immune cells. To develop a prophylactic immune strategy against detrimental effects of B[a]P, we have immunized mice with a B[a]P-diphtheria toxoid conjugate vaccine. We showed that high levels of antibodies against B[a]P and its metabolites modulate the redistribution of these PAHs in the blood. After immunization, increased levels of B[a]P and its metabolites were recovered in the blood. B[a]P significantly suppressed the proliferative response of both T and B cells after a sub-acute administration, an effect that was completely reversed by vaccination. In immunized mice also the immunotoxic effect of B[a]P on IFN-{gamma}, IL-12, TNF-{alpha} production and the reduced B cell activation was restored. Finally, our results showed that specific antibodies inhibited the induction of Cyp1a1 by B[a]P in lymphocytes and Cyp1b1 in the liver, enzymes that are known to convert the procarcinogen B[a]P to the ultimate DNA-adduct forming metabolite, a major risk factor of chemical carcinogenesis. Thus, we demonstrate that vaccination with a B[a]P conjugate vaccine based on a carrier protein used in licensed human vaccines reduces immunotoxicity and possibly other detrimental effects associated with B[a]P.

  15. Modulation of benzo[a]pyrene induced immunotoxicity in mice actively immunized with a B[a]P-diphtheria toxoid conjugate.

    PubMed

    Schellenberger, Mario T; Grova, Nathalie; Willième, Stéphanie; Farinelle, Sophie; Prodhomme, Emmanuel J F; Muller, Claude P

    2009-10-01

    Benzo[a]pyrene (B[a]P) is a small molecular weight carcinogen and the prototype of polycyclic aromatic hydrocarbons (PAHs). While these compounds are primarily known for their carcinogenicity, B[a]P and its metabolites are also toxic for mammalian immune cells. To develop a prophylactic immune strategy against detrimental effects of B[a]P, we have immunized mice with a B[a]P-diphtheria toxoid conjugate vaccine. We showed that high levels of antibodies against B[a]P and its metabolites modulate the redistribution of these PAHs in the blood. After immunization, increased levels of B[a]P and its metabolites were recovered in the blood. B[a]P significantly suppressed the proliferative response of both T and B cells after a sub-acute administration, an effect that was completely reversed by vaccination. In immunized mice also the immunotoxic effect of B[a]P on IFN-gamma, IL-12, TNF-alpha production and the reduced B cell activation was restored. Finally, our results showed that specific antibodies inhibited the induction of Cyp1a1 by B[a]P in lymphocytes and Cyp1b1 in the liver, enzymes that are known to convert the procarcinogen B[a]P to the ultimate DNA-adduct forming metabolite, a major risk factor of chemical carcinogenesis. Thus, we demonstrate that vaccination with a B[a]P conjugate vaccine based on a carrier protein used in licensed human vaccines reduces immunotoxicity and possibly other detrimental effects associated with B[a]P.

  16. Transcriptional Profiling of Dibenzo[def,p]chrysene-induced Spleen Atrophy Provides Mechanistic Insights into its Immunotoxicity in MutaMouse.

    PubMed

    Chepelev, Nikolai L; Long, Alexandra S; Williams, Andrew; Kuo, Byron; Gagné, Rémi; Kennedy, Dean A; Phillips, David H; Arlt, Volker M; White, Paul A; Yauk, Carole L

    2016-01-01

    Dibenzo[def,p]chrysene (DBC) is the most carcinogenic polycyclic aromatic hydrocarbon (PAH) examined to date. We investigated the immunotoxicity of DBC, manifested as spleen atrophy, following acute exposure of adult MutaMouse males by oral gavage. Mice were exposed to 0, 2.0, 6.2, or 20.0 mg DBC /kg-bw per day, for 3 days. Genotoxic endpoints (DBC-DNA adducts and lacZ mutant frequency in spleen and bone marrow, and red blood cell micronucleus frequency) and global gene expression changes were measured. All of the genotoxicity measures increased in a dose-dependent manner in spleen and bone marrow. Gene expression analysis showed that DBC activates p53 signaling pathways related to cellular growth and proliferation, which was evident even at the low dose. Strikingly, the expression profiles of DBC exposed mouse spleens were highly inversely correlated with the expression profiles of the only published toxicogenomics dataset of enlarged mouse spleen. This analysis suggested a central role for Bnip3l, a pro-apoptotic protein involved in negative regulation of erythroid maturation. RT-PCR confirmed expression changes in several genes related to apoptosis, iron metabolism, and aryl hydrocarbon receptor signaling that are regulated in the opposite direction during spleen atrophy versus benzo[a]pyrene-mediated splenomegaly. In addition, benchmark dose modeling of toxicogenomics data yielded toxicity estimates that are very close to traditional toxicity endpoints. This work illustrates the power of toxicogenomics to reveal rich mechanistic information for immunotoxic compounds and its ability to provide information that is quantitatively similar to that derived from standard toxicity methods in health risk assessment. PMID:26496743

  17. ELISA MEASUREMENT OF STACHYLYSIN IN SERUM TO QUANTIFY HUMAN EXPOSURES TO THE INDOOR MOLD STACHYBOTRYS CHARTARUM

    EPA Science Inventory

    Problem- To develop a measurable indicator of human exposure to Stachybotys chartarum.

    Methods- Antibodies were produced against the hemolytic agent stachylysin obtained from the mold S. chartarum. These antibodies were used to develop two enzyme-linked immunosorbent ass...

  18. AN EXTRACT OF STACHYBOTRYS CHARTARUM CAUSES ALLERGIC RESPONSE IN A BALB/C MOUSE MODEL

    EPA Science Inventory

    ABSTRACT
    Environmental exposure to Stachybotrys chartarum has been associated with adverse health effects in humans. The goal of this study was to assess soluble components of this fungus for allergenic potential. Five isolates of S. chartarum were combined and extracted to fo...

  19. FACTORS RELATING TO THE RELEASE OF STACHYBOTRYS CHARTARUM SPORES FROM CONTAMINATED SOURCES

    EPA Science Inventory

    The paper describes preliminary results of a research project to determine the factors that control the release of S. chartarum spores from a contaminated source and test ways to reduce spore release and thus exposure. As anticipated, S. chartarum spore emissions from gypsum boar...

  20. GROWTH RESPONSE OF STACHYBOTRYS CHARTARUM TO MOISTURE VARIATION ON COMMON BUILDING MATERIALS

    EPA Science Inventory

    The mold Stachybotrys chartarum has been found to be associated with idiopathic pulmonary hemorrhage in infants and has been studied for toxin production and its occurrence in water damaged buildings. Growth of S. chartarum on building materials such as drywall has been frequentl...

  1. GERMINATION, VIABILITY AND CLEARANCE OF STACHYBOTRYS CHARTARUM IN THE LUNGS OF INFANT RATS

    EPA Science Inventory

    The fungus Stachybotrys chartarum has been associated with many adverse health effects including the condition known as idiopathic pulmonary hemorrhage in infants. In order to gain some insight into possible mechanisms, viable conidia of S. chartarum were instilled into the lung...

  2. Prototheca species and Pithomyces chartarum as Causative Agents of Rhinitis and/or Sinusitis in Horses.

    PubMed

    Schöniger, S; Roschanski, N; Rösler, U; Vidovic, A; Nowak, M; Dietz, O; Wittenbrink, M M; Schoon, H-A

    2016-01-01

    Pyogranulomatous rhinitis associated with an algal infection was diagnosed in a 25-year-old gelding and a 23-year-old mare had necrotizing sinusitis with intralesional algae and pigmented fungi. Algae were identified immunohistochemically in both cases as Prototheca spp. In the gelding, further characterization by polymerase chain reaction and sequencing revealed that the organism was Prototheca zopfii genotype 2. Fungi from the mare were identified as Pithomyces chartarum by molecular analysis. Prototheca species are achlorophyllous algae and P. chartarum represents a dematiaceous fungus; they are saprophytes and facultative pathogens. Prototheca spp. and P. chartarum should be considered as rare respiratory pathogens of horses. PMID:27394651

  3. From immunotoxicity to carcinogenicity: the effects of carbamate pesticides on the immune system.

    PubMed

    Dhouib, Ines; Jallouli, Manel; Annabi, Alya; Marzouki, Soumaya; Gharbi, Najoua; Elfazaa, Saloua; Lasram, Mohamed Montassar

    2016-05-01

    The immune system can be the target of many chemicals, with potentially severe adverse effects on the host's health. In the literature, carbamate (CM) pesticides have been implicated in the increasing prevalence of diseases associated with alterations of the immune response, such as hypersensitivity reactions, some autoimmune diseases and cancers. CMs may initiate, facilitate, or exacerbate pathological immune processes, resulting in immunotoxicity by induction of mutations in genes coding for immunoregulatory factors and modifying immune tolerance. In the present study, direct immunotoxicity, endocrine disruption and inhibition of esterases activities have been introduced as the main mechanisms of CMs-induced immune dysregulation. Moreover, the evidence on the relationship between CM pesticide exposure, dysregulation of the immune system and predisposition to different types of cancers, allergies, autoimmune and infectious diseases is criticized. In addition, in this review, we will discuss the relationship between immunotoxicity and cancer, and the advances made toward understanding the basis of cancer immune evasion.

  4. Indoor Mold, Toxigenic Fungi, and Stachybotrys chartarum: Infectious Disease Perspective

    PubMed Central

    Kuhn, D. M.; Ghannoum, M. A.

    2003-01-01

    Damp buildings often have a moldy smell or obvious mold growth; some molds are human pathogens. This has caused concern regarding health effects of moldy indoor environments and has resulted in many studies of moisture- and mold-damaged buildings. Recently, there have been reports of severe illness as a result of indoor mold exposure, particularly due to Stachybotrys chartarum. While many authors describe a direct relationship between fungal contamination and illness, close examination of the literature reveals a confusing picture. Here, we review the evidence regarding indoor mold exposure and mycotoxicosis, with an emphasis on S. chartarum. We also examine possible end-organ effects, including pulmonary, immunologic, neurologic, and oncologic disorders. We discuss the Cleveland infant idiopathic pulmonary hemorrhage reports in detail, since they provided important impetus for concerns about Stachybotrys. Some valid concerns exist regarding the relationship between indoor mold exposure and human disease. Review of the literature reveals certain fungus-disease associations in humans, including ergotism (Claviceps species), alimentary toxic aleukia (Fusarium), and liver disease (Aspergillys). While many papers suggest a similar relationship between Stachybotrys and human disease, the studies nearly uniformly suffer from significant methodological flaws, making their findings inconclusive. As a result, we have not found well-substantiated supportive evidence of serious illness due to Stachybotrys exposure in the contemporary environment. To address issues of indoor mold-related illness, there is an urgent need for studies using objective markers of illness, relevant animal models, proper epidemiologic techniques, and examination of confounding factors. PMID:12525430

  5. Pulmonary Responses to Stachybotrys chartarum and Its Toxins: Mouse Strain Affects Clearance and Macrophage Cytotoxicity

    PubMed Central

    Lichtenstein, Jamie H. Rosenblum; Molina, Ramon M.; Donaghey, Thomas C.; Amuzie, Chidozie J.; Pestka, James J.; Coull, Brent A.; Brain, Joseph D.

    2010-01-01

    We investigated differences in the pulmonary and systemic clearance of Stachybotrys chartarum spores in two strains of mice, BALB/c and C57BL/6J. To evaluate clearance, mice were intratracheally instilled with a suspension of radiolabeled S. chartarum spores or with unlabeled spores. The lungs of C57BL/6J mice showed more rapid spore clearance than the lungs of BALB/c mice, which correlated with increased levels of spore-associated radioactivity in the GI tracts of C57BL/6J as compared with BALB/c mice. To identify mechanisms responsible for mouse strain differences in spore clearance and previously described lung inflammatory responses, we exposed alveolar macrophages (AMs) lavaged from BALB/c and C57BL/6J mice to S. chartarum spores, S. chartarum spore toxin (SST), and satratoxin G (SG) in vitro. The S. chartarum spores were found to be highly toxic with most cells from either mouse strain being killed within 24 h when exposed to a spore:cell ratio of 1:75. The spores were more lethal to AMs from C57BL/6J than those from BALB/c mice. In mice, the SST elicited many of the same inflammatory responses as the spores in vivo, including AM recruitment, pulmonary hemorrhage, and cytokine production. Our data suggest that differences in pulmonary spore clearance may contribute to the differences in pulmonary responses to S. chartarum between BALB/c and C57BL/6J mice. Enhanced AM survival and subsequent macrophage-mediated inflammation may also contribute to the higher susceptibility of BALB/c mice to S. chartarum pulmonary effects. Analogous genetic differences among humans may contribute to reported variable sensitivity to S. chartarum. PMID:20385656

  6. Biomarkers of immunotoxicity in fish and other non-mammalian sentinel species: predictive value for mammals?

    PubMed

    Zelikoff, J T

    1998-08-01

    Through the efforts of different laboratories, a battery of immunological assays is available to predict the immunotoxicity of xenobiotics. These assays, originally developed in rodents, have been adapted for use in a variety of animal species and are now used routinely in these models to assess the immunotoxicity of different chemical classes. For example, our laboratory has employed assays that measure antibody-forming cell response to T-dependent antigens, T- and B-cell lymphoproliferation, macrophage function, and host resistance against infectious bacteria to assess metal-induced immunotoxicity in laboratory-reared Japanese medaka (Oryzias latipes); immunologically-related assays measuring antioxidant activity have also been used in this capacity. Results of the aforementioned investigations have shown the usefulness of these endpoints to reliably demonstrate chemical-mediated immunotoxicity in teleost systems. Many of these same endpoints have also proved successful for predicting the immunotoxic effects of contaminated aquatic environments in feral fish populations. For example, smallmouth bass collected from a chlorinated hydrocarbon-contaminated site demonstrated significant changes in blood cell profiles and kidney phagocyte function compared to fish collected from a 'clean water' reference site. Some of these same immune parameters have also been used successfully to predict the immunotoxicity of polluted aquatic environments in feral populations of fish-eating birds and harbor seals. While interspecies extrapolation is difficult and should be approached with caution due to variables such as metabolism and pharmacokinetics, results from these studies demonstrate the usefulness of these immune assays to predict the immunomodulating effects of xenobiotics in fish and other wildlife species, as well as the applicability of fish to serve as additional/alternate animal models for mammalian species in immunotoxicological studies. PMID:9769111

  7. Method for detection of Stachybotrys chartarum in pure culture and field samples using quantitative polymerase chain reaction

    DOEpatents

    Cruz-Perez, Patricia; Buttner, Mark P.

    2004-05-11

    A method for detecting the fungus Stachybotrys chartarum includes isolating DNA from a sample suspected of containing the fungus Stachybotrys chartarum. The method further includes subjecting the DNA to polymerase chain reaction amplification utilizing at least one of several primers, the several primers each including one of the base sequences 5'GTTGCTTCGGCGGGAAC3', 5'TTTGCGTTTGCCACTCAGAG3', 5'ACCTATCGTTGCTTCGGCG3', and 5'GCGTTTGCCACTCAGAGAATACT3'. The method additionally includes detecting the fungus Stachybotrys chartarum by visualizing the product of the polymerase chain reaction.

  8. Immunotoxicogenomics: The potential of genomics technology in the immunotoxicity risk assessment process

    PubMed Central

    Luebke, Robert W.; Holsapple, Michael P.; Ladics, Gregory S.; Luster, Michael I.; Selgrade, MaryJane; Smialowicz, Ralph J.; Woolhiser, Michael R.; Germolec, Dori R.

    2007-01-01

    Evaluation of xenobiotic-induced changes in gene expression as a method to identify and classify potential toxicants is being pursued by industry and regulatory agencies worldwide. A workshop was held at the Research Triangle Park campus of the Environmental Protection Agency to discuss the current state of the science of “immunotoxicogenomics”, and to explore the potential role of genomics techniques for immunotoxicity testing. The genesis of the workshop was the current lack of widely accepted triggering criteria for Tier 1 immunotoxicity testing in the context of routine toxicity testing data, the realization that traditional screening methods would require an inordinate number of animals and are inadequate to handle the number of chemicals that may need to be screened (e.g., high production volume compounds) and the absence of an organized effort to address the state of the science of toxicogenomics in the identification of immunotoxic compounds. The major focus of the meeting was on the theoretical and practical utility of genomics techniques to 1) replace or supplement current immunotoxicity screening procedures, 2) provide insight into potential modes or mechanisms of action, and 3) provide data suitable for immunotoxicity hazard identification or risk assessment. The latter goal is of considerable interest to a variety of stakeholders as a means to reduce animal use and to decrease the cost of conducting and interpreting standard toxicity tests. A number of data gaps were identified that included a lack of dose response and kinetic data for known immunotoxic compounds and a general lack of data correlating genomic alterations to functional changes observed in vivo. Participants concluded that a genomics approach to screen chemicals for immunotoxic potential or to generate data useful to risk assessors holds promise, but that routine use of these methods is years in the future. However, recent progress in molecular immunology has made mode and mechanism

  9. Value of phagocyte function screening for immunotoxicity of nanoparticles in vivo.

    PubMed

    Fröhlich, Eleonore

    2015-01-01

    Nanoparticles (NPs) present in the environment and in consumer products can cause immunotoxic effects. The immune system is very complex, and in vivo studies are the gold standard for evaluation. Due to the increased amount of NPs that are being developed, cellular screening assays to decrease the amount of NPs that have to be tested in vivo are highly needed. Effects on the unspecific immune system, such as effects on phagocytes, might be suitable for screening for immunotoxicity because these cells mediate unspecific and specific immune responses. They are present at epithelial barriers, in the blood, and in almost all organs. This review summarizes the effects of carbon, metal, and metal oxide NPs used in consumer and medical applications (gold, silver, titanium dioxide, silica dioxide, zinc oxide, and carbon nanotubes) and polystyrene NPs on the immune system. Effects in animal exposures through different routes are compared to the effects on isolated phagocytes. In addition, general problems in the testing of NPs, such as unknown exposure doses, as well as interference with assays are mentioned. NPs appear to induce a specific immunotoxic pattern consisting of the induction of inflammation in normal animals and aggravation of pathologies in disease models. The evaluation of particle action on several phagocyte functions in vitro may provide an indication on the potency of the particles to induce immunotoxicity in vivo. In combination with information on realistic exposure levels, in vitro studies on phagocytes may provide useful information on the health risks of NPs. PMID:26060398

  10. Value of phagocyte function screening for immunotoxicity of nanoparticles in vivo

    PubMed Central

    Fröhlich, Eleonore

    2015-01-01

    Nanoparticles (NPs) present in the environment and in consumer products can cause immunotoxic effects. The immune system is very complex, and in vivo studies are the gold standard for evaluation. Due to the increased amount of NPs that are being developed, cellular screening assays to decrease the amount of NPs that have to be tested in vivo are highly needed. Effects on the unspecific immune system, such as effects on phagocytes, might be suitable for screening for immunotoxicity because these cells mediate unspecific and specific immune responses. They are present at epithelial barriers, in the blood, and in almost all organs. This review summarizes the effects of carbon, metal, and metal oxide NPs used in consumer and medical applications (gold, silver, titanium dioxide, silica dioxide, zinc oxide, and carbon nanotubes) and polystyrene NPs on the immune system. Effects in animal exposures through different routes are compared to the effects on isolated phagocytes. In addition, general problems in the testing of NPs, such as unknown exposure doses, as well as interference with assays are mentioned. NPs appear to induce a specific immunotoxic pattern consisting of the induction of inflammation in normal animals and aggravation of pathologies in disease models. The evaluation of particle action on several phagocyte functions in vitro may provide an indication on the potency of the particles to induce immunotoxicity in vivo. In combination with information on realistic exposure levels, in vitro studies on phagocytes may provide useful information on the health risks of NPs. PMID:26060398

  11. A comparison of immunotoxic effects of nanomedicinal products with regulatory immunotoxicity testing requirements

    PubMed Central

    Giannakou, Christina; Park, Margriet VDZ; de Jong, Wim H; van Loveren, Henk; Vandebriel, Rob J; Geertsma, Robert E

    2016-01-01

    Nanomaterials (NMs) are attractive for biomedical and pharmaceutical applications because of their unique physicochemical and biological properties. A major application area of NMs is drug delivery. Many nanomedicinal products (NMPs) currently on the market or in clinical trials are most often based on liposomal products or polymer conjugates. NMPs can be designed to target specific tissues, eg, tumors. In virtually all cases, NMPs will eventually reach the immune system. It has been shown that most NMs end up in organs of the mononuclear phagocytic system, notably liver and spleen. Adverse immune effects, including allergy, hypersensitivity, and immunosuppression, have been reported after NMP administration. Interactions of NMPs with the immune system may therefore constitute important side effects. Currently, no regulatory documents are specifically dedicated to evaluate the immunotoxicity of NMs or NMPs. Their immunotoxicity assessment is performed based on existing guidelines for conventional substances or medicinal products. Due to the unique properties of NMPs when compared with conventional medicinal products, it is uncertain whether the currently prescribed set of tests provides sufficient information for an adequate evaluation of potential immunotoxicity of NMPs. The aim of this study was therefore, to compare the current regulatory immunotoxicity testing requirements with the accumulating knowledge on immunotoxic effects of NMPs in order to identify potential gaps in the safety assessment. This comparison showed that immunotoxic effects, such as complement activation-related pseudoallergy, myelosuppression, inflammasome activation, and hypersensitivity, are not readily detected by using current testing guidelines. Immunotoxicity of NMPs would be more accurately evaluated by an expanded testing strategy that is equipped to stratify applicable testing for the various types of NMPs. PMID:27382281

  12. Immunotoxicity of zinc oxide nanoparticles with different size and electrostatic charge.

    PubMed

    Kim, Cheol-Su; Nguyen, Hai-Duong; Ignacio, Rosa Mistica; Kim, Jae-Hyun; Cho, Hyeon-Cheol; Maeng, Eun Ho; Kim, Yu-Ri; Kim, Meyoung-Kon; Park, Bae-Keun; Kim, Soo-Ki

    2014-01-01

    While zinc oxide (ZnO) nanoparticles (NPs) have been recognized to have promising applications in biomedicine, their immunotoxicity has been inconsistent and even contradictory. To address this issue, we investigated whether ZnO NPs with different size (20 or 100 nm) and electrostatic charge (positive or negative) would cause immunotoxicity in vitro and in vivo, and explored their underlying molecular mechanism. Using Raw 264.7 cell line, we examined the immunotoxicity mechanism of ZnO NPs as cell viability. We found that in a cell viability assay, ZnO NPs with different size and charge could induce differential cytotoxicity to Raw 264.7 cells. Specifically, the positively charged ZnO NPs exerted higher cytotoxicity than the negatively charged ones. Next, to gauge systemic immunotoxicity, we assessed immune responses of C57BL/6 mice after oral administration of 750 mg/kg/day dose of ZnO NPs for 2 weeks. In parallel, ZnO NPs did not alter the cell-mediated immune response in mice but suppressed innate immunity such as natural killer cell activity. The CD4(+)/CD8(+) ratio, a marker for matured T-cells was slightly reduced, which implies the alteration of immune status induced by ZnO NPs. Accordingly, nitric oxide production from splenocyte culture supernatant in ZnO NP-fed mice was lower than control. Consistently, serum levels of pro/anti-inflammatory (interleukin [IL]-1β, tumor necrosis factor-α, and IL-10) and T helper-1 cytokines (interferon-γ and IL-12p70) in ZnO NP-fed mice were significantly suppressed. Collectively, our results indicate that different sized and charged ZnO NPs would cause in vitro and in vivo immunotoxicity, of which nature is an immunosuppression. PMID:25565837

  13. Immunotoxicity of zinc oxide nanoparticles with different size and electrostatic charge

    PubMed Central

    Kim, Cheol-Su; Nguyen, Hai-Duong; Ignacio, Rosa Mistica; Kim, Jae-Hyun; Cho, Hyeon-Cheol; Maeng, Eun Ho; Kim, Yu-Ri; Kim, Meyoung-Kon; Park, Bae-Keun; Kim, Soo-Ki

    2014-01-01

    While zinc oxide (ZnO) nanoparticles (NPs) have been recognized to have promising applications in biomedicine, their immunotoxicity has been inconsistent and even contradictory. To address this issue, we investigated whether ZnO NPs with different size (20 or 100 nm) and electrostatic charge (positive or negative) would cause immunotoxicity in vitro and in vivo, and explored their underlying molecular mechanism. Using Raw 264.7 cell line, we examined the immunotoxicity mechanism of ZnO NPs as cell viability. We found that in a cell viability assay, ZnO NPs with different size and charge could induce differential cytotoxicity to Raw 264.7 cells. Specifically, the positively charged ZnO NPs exerted higher cytotoxicity than the negatively charged ones. Next, to gauge systemic immunotoxicity, we assessed immune responses of C57BL/6 mice after oral administration of 750 mg/kg/day dose of ZnO NPs for 2 weeks. In parallel, ZnO NPs did not alter the cell-mediated immune response in mice but suppressed innate immunity such as natural killer cell activity. The CD4+/CD8+ ratio, a marker for matured T-cells was slightly reduced, which implies the alteration of immune status induced by ZnO NPs. Accordingly, nitric oxide production from splenocyte culture supernatant in ZnO NP-fed mice was lower than control. Consistently, serum levels of pro/anti-inflammatory (interleukin [IL]-1β, tumor necrosis factor-α, and IL-10) and T helper-1 cytokines (interferon-γ and IL-12p70) in ZnO NP-fed mice were significantly suppressed. Collectively, our results indicate that different sized and charged ZnO NPs would cause in vitro and in vivo immunotoxicity, of which nature is an immunosuppression. PMID:25565837

  14. AN EXTRACT OF STACHYBOTRYS CHARTARUM CAUSES ALLERGIC RESPONSES IN A BALB/C MOUSE MODEL: I. BIOCHEMICAL AND PATHOLOGICAL RESPONSES

    EPA Science Inventory

    Environmental exposure to Stachybotrys chartarum has been associated with adverse health effects in humans. The goal of this study was to assess soluble components of this fungus for allergenic potential. Five isolates of S. chartarum were combined and extracted to form a crude...

  15. The Effect of Spaceflight on Growth of Ulocladium chartarum Colonies on the International Space Station

    PubMed Central

    Gomoiu, Ioana; Chatzitheodoridis, Elias; Vadrucci, Sonia; Walther, Isabelle

    2013-01-01

    The objectives of this 14 days experiment were to investigate the effect of spaceflight on the growth of Ulocladium chartarum, to study the viability of the aerial and submerged mycelium and to put in evidence changes at the cellular level. U. chartarum was chosen for the spaceflight experiment because it is well known to be involved in biodeterioration of organic and inorganic substrates covered with organic deposits and expected to be a possible contaminant in Spaceships. Colonies grown on the International Space Station (ISS) and on Earth were analysed post-flight. This study clearly indicates that U. chartarum is able to grow under spaceflight conditions developing, as a response, a complex colony morphotype never mentioned previously. We observed that spaceflight reduced the rate of growth of aerial mycelium, but stimulated the growth of submerged mycelium and of new microcolonies. In Spaceships and Space Stations U. chartarum and other fungal species could find a favourable environment to grow invasively unnoticed in the depth of surfaces containing very small amount of substrate, posing a risk factor for biodegradation of structural components, as well as a direct threat for crew health. The colony growth cycle of U. chartarum provides a useful eukaryotic system for the study of fungal growth under spaceflight conditions. PMID:23637980

  16. The effect of spaceflight on growth of Ulocladium chartarum colonies on the international space station.

    PubMed

    Gomoiu, Ioana; Chatzitheodoridis, Elias; Vadrucci, Sonia; Walther, Isabelle

    2013-01-01

    The objectives of this 14 days experiment were to investigate the effect of spaceflight on the growth of Ulocladium chartarum, to study the viability of the aerial and submerged mycelium and to put in evidence changes at the cellular level. U. chartarum was chosen for the spaceflight experiment because it is well known to be involved in biodeterioration of organic and inorganic substrates covered with organic deposits and expected to be a possible contaminant in Spaceships. Colonies grown on the International Space Station (ISS) and on Earth were analysed post-flight. This study clearly indicates that U. chartarum is able to grow under spaceflight conditions developing, as a response, a complex colony morphotype never mentioned previously. We observed that spaceflight reduced the rate of growth of aerial mycelium, but stimulated the growth of submerged mycelium and of new microcolonies. In Spaceships and Space Stations U. chartarum and other fungal species could find a favourable environment to grow invasively unnoticed in the depth of surfaces containing very small amount of substrate, posing a risk factor for biodegradation of structural components, as well as a direct threat for crew health. The colony growth cycle of U. chartarum provides a useful eukaryotic system for the study of fungal growth under spaceflight conditions.

  17. In vitro evaluation of the immunotoxic potential of perfluorinated compounds (PFCs)

    SciTech Connect

    Corsini, Emanuela; Avogadro, Anna; Galbiati, Valentina; Dell'Agli, Mario; Marinovich, Marina; Galli, Corrado L.; Germolec, Dori R.

    2011-01-15

    There is evidence from both epidemiology and laboratory studies that perfluorinated compounds may be immunotoxic, affecting both cell-mediated and humoral immunity. The overall goal of this study was to investigate the mechanisms underlying the immunotoxic effects of perfluorooctane sulfonate (PFOS) and perfluorooctane acid (PFOA), using in vitro assays. The release of the pro-inflammatory cytokines IL-6, IL-8, and TNF-{alpha} was evaluated in lipolysaccharide (LPS)-stimulated human peripheral blood leukocytes and in the human promyelocytic cell line THP-1, while the release of IL-4, IL-10 and IFN-{gamma} was evaluated in phytohaemagglutinin (PHA)-stimulated peripheral blood leukocytes. PFOA and PFOS suppressed LPS-induced TNF-{alpha} production in primary human cultures and THP-1 cells, while IL-8 was suppressed only in THP-1 cells. IL-6 release was decreased only by PFOS. Both PFOA and PFOS decreased T-cell derived, PHA-induced IL-4 and IL-10 release, while IFN-{gamma} release was affected only by PFOS. In all instances, PFOS was more potent than PFOA. Mechanistic investigations carried out in THP-1 cells demonstrated that the effect on cytokine release was pre-transcriptional, as assessed by a reduction in LPS-induced TNF-{alpha} mRNA expression. Using siRNA, a role for PPAR-{alpha} could be demonstrated for PFOA-induced immunotoxicity, while an inhibitory effect on LPS-induced I-{kappa}B degradation could explain the immunomodulatory effect of PFOS. The dissimilar role of PPAR-{alpha} in PFOA and PFOS-induced immunotoxicity was consistent with the differing effects observed on LPS-induced MMP-9 release: PFOA, as the PPAR-{alpha} agonist fenofibrate, modulated the release, while PFOS had no effect. Overall, these studies suggest that PFCs directly suppress cytokine secretion by immune cells, and that PFOA and PFOS have different mechanisms of action.

  18. PERFLUORINATED COMPOUNDS: EMERGING POPs WITH POTENTIAL IMMUNOTOXICITY

    PubMed Central

    Corsini, Emanuela; Luebke, Robert W.; Germolec, Dori R.; DeWitt, Jamie C.

    2015-01-01

    Perfluorinated compounds (PFCs) have been recognized as an important class of environmental contaminants commonly detected in blood samples of both wildlife and humans. These compounds have been in use for more than 60 years as surface treatment chemicals, polymerization aids, and surfactants. They possess a strong carbon-fluorine bond, which leads to their environmental persistence. There is evidence from both epidemiology and laboratory studies that PFCs may be immunotoxic, affecting both cell-mediated and humoral immunity. Reported effects of PFCs include decreased spleen and thymus weights and cellularity, reduced antibody production, reduced survival after influenza infection, and altered cytokine production. Immunosuppression is a critical effect associated with exposure to PFCs, as it has been reported to reduce antibody responses to vaccination in children. Mounting evidence suggests that immunotoxicity in experimental animals can occur at serum concentrations below, within, or just above the reported range for highly exposed humans and wildlife. Considering bioaccumulation and exposure to multiple PFCs, the risk of immunotoxicity for humans and wildlife cannot be discounted. This review will discuss current and recently published work exploring the immunomodulatory effects of PFCs in experimental animals and humans. PMID:24503008

  19. Immunotoxic Effect of Low-Dose Methylmercury Is Negligible in Mouse Models of Ovalbumin or Mite-Induced Th2 Allergy.

    PubMed

    Nakamura, Ryosuke; Takanezawa, Yasukazu; Sone, Yuka; Uraguchi, Shimpei; Sakabe, Kou; Kiyono, Masako

    2016-01-01

    Methylmercury (MeHg) is one of the most toxic environmental pollutants and presents a serious hazard to health worldwide. Although the adverse effects of MeHg, including neurotoxicity, have been studied, its effects on immune function, in particular the immune response, remain unclear. This study examined the effects of low-dose MeHg on immune responses in mice. Mice were orally immunized with ovalbumin (OVA) or subcutaneously injected with mite extract to induce a T-helper 2 (Th2) allergic response. They were then exposed to MeHg (0, 0.02, 1.0, or 5.0 mg·kg(-1)·d(-1)). Immunization with oral OVA or subcutaneous mite extract increased serum levels of OVA-specific immunoglobulin (Ig) E (OVA-IgE), OVA-IgG1, interleukin (IL)-4, and IL-13, and total IgE, total IgG, and IL-13 when compared with levels in non-immunized mice. However, no interferon (IFN)-γ was detected. By contrast, serum levels of OVA-IgE, OVA-IgG1, IL-4, and IL-13, or total IgE, total IgG, and IL-13 in Th2 allergy model mice subsequently treated with MeHg were no higher than those in MeHg-untreated mice. These results suggest that MeHg exposure has no adverse effects on Th2 immune responses in antigen-immunized mice. PMID:27476942

  20. Microbial Volatile Organic Compound Emissions from Stachybotrys chartarum growing on Gypsum Wallboard and Ceiling tile

    EPA Science Inventory

    This study compared seven toxigenic strains of S. chartarum found in water-damaged buildings to characterize the microbial volatile organic compound (MVOC) emissions profile while growing on gypsum wallboard (W) and ceiling tile (C) coupons. The inoculated coupons with their sub...

  1. IDENTIFICATION OF SEQUENCE SPECIFIC PCR PRIMERS FOR DETECTION OF THE TOXIGENIC FUNGAL SPECIES STACHYBOTRYS CHARTARUM

    EPA Science Inventory

    The nucleotide sequence of a 936 bp segment of the nuclear rRNA gene operon was determined for the toxigenic fungal species Stachybotrys chartarum and for other species of Stachybotrys and the related genus Memnoniella. This information was used to infer the phylogenitic relati...

  2. IDENTIFICATION OF PUTATIVE SEQUENCE SPECIFIC PCR PRIMERS FOR DETECTION OF THE TOXIGENIC FUNGAL SPECIES STACHYBOTRYS CHARTARUM

    EPA Science Inventory

    The nucleotide sequence of a c 936 bp segment of the nuclear rRNA gene operon was determined for the toxigenic fungal species Stachybotrys chartarum and for other species of Stachbotrys and the related genus Memnoniella. This information was used to infer the phylogenetic relatio...

  3. CHARACTERIZATION OF MICROBIAL VOLATILE ORGANIC COMPOUNDS (MVOC) EMITTED BY STACHYBOTRYS CHARTARUM

    EPA Science Inventory

    Stachybotrys chartarum is a filamentous fungi usually found in water-damaged buildings. Severe illnesses have been reported after indoor exposure to this mold. Toxicity has caused the production of secondary metabolites or mycotoxins, and the emission of by-products, specifically...

  4. The relative allergenicity of Stachybotrys chartarum compared to house dust mite extracts in a mouse model

    EPA Science Inventory

    A report by the Institute of Medicine suggested that more research is needed to better understand mold effects on allergic disease, particularly asthma development. The authors compared the ability of the fungus Stachybotrys chartarum (SCE) and house dust mite (HDM) extracts to i...

  5. INITIAL CHARACTERIZATION OF MONOCLONAL ANTIBODIES AGAINST THE FUNGAL HEMOLYSIN STACHYLYSIN FROM STACHYBOTRYS CHARTARUM

    EPA Science Inventory

    Stachybotrys chartarum is known to produce the hemolysin stachylysin and its detection in human serum has been proposed as a biomarker for exposure to the fungus. In this study we report the initial characterization of monoclonal antibodies (mAbs) against stachylysin and the dev...

  6. Identification of a novel fungus, Leptosphaerulina chartarum SJTU59 and characterization of its xylanolytic enzymes.

    PubMed

    Wu, Qiong; Li, Yaqian; Li, Yingying; Gao, Shigang; Wang, Meng; Zhang, Tailong; Chen, Jie

    2013-01-01

    Xylanolytic enzymes are widely used in processing industries, e.g., pulp and paper, food, livestock feeds, and textile. Furthermore, certain xylanotic enzymes have demonstrated the capability to improve the resistance and immunity of plants. Screening of high-yield microbial xylanolytic enzyme producers is significant for improving large-scale cost-effective xylanolytic enzyme production. This study provided new evidence of high-level xylanolytic enzyme production by a novel fungus, designated Leptosphaerulina chartarum SJTU59. Under laboratory conditions, L. chartarum SJTU59 produced xylanolytic enzymes of up to 17.566 U/mL (i.e., 878.307 U/g substrate). The enzyme solution was relatively stable over a wide range of pH (pH 3.0 to pH 9.0) and temperature (40°C to 65°C) while showing high resistance to the majority of metal ions tested. Composition analysis of the hydrolytic products of xylan showed sufficient degradation by xylanolytic enzymes from L. chartarum SJTU59, mainly the monosaccharide xylose, and a small amount of xylobiose were enzymatically produced; whereas in the presence of sufficient xylan substrates, mainly xylooligosaccharides, an emerging prebiotic used in food industry, were produced. In addition, the xylanolytic enzyme preparation from L. chartarum SJTU59 could initiate tissue necrosis and oxidative burst in tobacco leaves, which may be related to enhanced plant defense to adversity and disease. L. chartarum SJTU59 possessed a complex xylanolytic enzyme system, from which two novel endo-β-1,4-xylanases of the glycoside hydrolase (GH) family 10, one novel endo-β-1,4-xylanase of the GH family 11, and one novel β-xylosidase of the GH family 43 were obtained via rapid amplification of complementary DNA ends. Given the high yield and stable properties of xylanolytic enzymes produced by L. chartarum SJTU59, future studies will be conducted to characterize the properties of individual xylanolytic enzymes from L. chartarum SJTU59. xylanolytic

  7. Identification of a Novel Fungus, Leptosphaerulina chartarum SJTU59 and Characterization of Its Xylanolytic Enzymes

    PubMed Central

    Wu, Qiong; Li, Yaqian; Li, Yingying; Gao, Shigang; Wang, Meng; Zhang, Tailong; Chen, Jie

    2013-01-01

    Xylanolytic enzymes are widely used in processing industries, e.g., pulp and paper, food, livestock feeds, and textile. Furthermore, certain xylanotic enzymes have demonstrated the capability to improve the resistance and immunity of plants. Screening of high-yield microbial xylanolytic enzyme producers is significant for improving large-scale cost-effective xylanolytic enzyme production. This study provided new evidence of high-level xylanolytic enzyme production by a novel fungus, designated Leptosphaerulina chartarum SJTU59. Under laboratory conditions, L. chartarum SJTU59 produced xylanolytic enzymes of up to 17.566 U/mL (i.e., 878.307 U/g substrate). The enzyme solution was relatively stable over a wide range of pH (pH 3.0 to pH 9.0) and temperature (40°C to 65°C) while showing high resistance to the majority of metal ions tested. Composition analysis of the hydrolytic products of xylan showed sufficient degradation by xylanolytic enzymes from L. chartarum SJTU59, mainly the monosaccharide xylose, and a small amount of xylobiose were enzymatically produced; whereas in the presence of sufficient xylan substrates, mainly xylooligosaccharides, an emerging prebiotic used in food industry, were produced. In addition, the xylanolytic enzyme preparation from L. chartarum SJTU59 could initiate tissue necrosis and oxidative burst in tobacco leaves, which may be related to enhanced plant defense to adversity and disease. L. chartarum SJTU59 possessed a complex xylanolytic enzyme system, from which two novel endo-β-1,4-xylanases of the glycoside hydrolase (GH) family 10, one novel endo-β-1,4-xylanase of the GH family 11, and one novel β-xylosidase of the GH family 43 were obtained via rapid amplification of complementary DNA ends. Given the high yield and stable properties of xylanolytic enzymes produced by L. chartarum SJTU59, future studies will be conducted to characterize the properties of individual xylanolytic enzymes from L. chartarum SJTU59. xylanolytic

  8. DESTRUCTION OF ASPERGILLUS VERSICOLOR, PENICILLIUM CRYSOGENUM, STACHYBOTRYS CHARTARUM, AND CLADOSPORIUM CLADOSPORIDES SPORES USING CHEMICAL OXIDATION TREATMENT PROCESS

    EPA Science Inventory

    The survival of aqueous suspensions of Penicillium chrysogenum, Stachybotrys chartarum, Aspergillus versicolor, and Cladosporium cladosporioides spores was evaluated using various combinations of hydrogen peroxide and iron (II) as catalyst. Spores were suspended in water and trea...

  9. Study on the impact of lead acetate pollutant on immunotoxicity produced by thiamethoxam pesticide

    PubMed Central

    Sinha, Suprita; Thaker, A. M.

    2014-01-01

    Objective: The curtailed knowledge about neonicotinoids that it has low affinity for vertebrate relative to insect nicotinic receptors is a major factor for its widespread use assuming that it is much safer than the previous generation insecticides. But literature regarding effect of thiamethoxam (second generation neonicotinoid)on immune system is not available. Also, there might be chances of interaction of heavy persistent metals in the water table with these pesticides. So, this study was undertaken with the objective to find immunotoxic alterations of lead acetate after exposure with thiamethoxam in animal model. Materials and Methods: For this albino mice were randomly divided into 6 groups (numbered I to VI) each containing 6 mice. Animals of groups I and II were administered 87.1 mg/kg b.w.(body weight) and 43.5 mg/kg b.w. respectively of thiamethoxam. Group III animals, lead acetate was administered orally and IV and V mice were administered combination of lead acetate and thiamethoxam at higher and lower dose level for 28 days. The group VI was control group. On 29th day and humoral and cell mediated immune responses, TLC (Total leukocyte count), DLC (Differential leukocyte count), serum total protein, globulin and albumin, and histopathological studies were conducted. Result: The result obtained clearly indicated that on oral administration of thiamethoxam immunotoxicity was induced in mice in dose related manner. Lead acetate when administered for 28 days showed immunotoxic potential. Thiamethoxam and lead acetate when administered together did not lead to any new altered immunotoxic response but additive toxic effects of both were observed. PMID:25538329

  10. IMMUNOTOXICITY OF INDIVIDUAL ORGANOTIN COMPOUNDS IN SPRAGUE-DAWLEY RATS

    EPA Science Inventory

    Organotins, used as stabilizers for polyvinyl chloride pipe, leach into drinking water from supply pipes and may cause multisystem toxicity, including immunotoxicity. We assessed immune function in Sprague-Dawley rats exposed to dibutyltin dichloride (DBTC) or dimethyltin dichlor...

  11. MALDI-TOF mass spectrometry fingerprinting: A diagnostic tool to differentiate dematiaceous fungi Stachybotrys chartarum and Stachybotrys chlorohalonata.

    PubMed

    Gruenwald, Maike; Rabenstein, Andreas; Remesch, Markko; Kuever, Jan

    2015-08-01

    Stachybotrys chartarum and Stachybotrys chlorohalonata are two closely related species. Unambiguous identification of these two species is a challenging task if relying solely on morphological criteria and therefore smarter and less labor-intensive approaches are needed. Here we show that even such closely related species of fungi as S. chartarum and S. chlorohalonata are unequivocally discriminated by their highly reproducible MALDI-TOF-MS fingerprints (matrix assisted laser desorption/ionization time-of-flight mass spectrometry fingerprints). We examined 19 Stachybotrys and one Aspergillus isolate by MALDI-TOF-MS. All but one isolate produced melanin containing conidia on malt extract agar. Mass spectra were obtained in good quality from the analysis of hyaline and darkly pigmented conidia by circumventing the property of melanin which causes signal suppression. MALDI-TOF fingerprint analysis clearly discriminated not only the two morphologically similar species S. chartarum and S. chlorohalonata from each other but separated them precisely from Stachybotrys bisbyi and Aspergillus versicolor isolates. Furthermore, even S. chartarum chemotypes A and S could be differentiated into two distinct groups by their MALDI-TOF fingerprints. The chemotypes of S. chartarum isolates were identified by trichodiene synthase 5 (tri5) sequences prior to mass spectra analysis. Additionally, species identities of all isolates were verified by their 18S rRNA and tri5 gene sequences. PMID:26036596

  12. [Photosensitization in cattle grazing on pastures of Brahciaria decumbens Stapf infested with Pithomyces chartarum (Berk. & Curt.) M.B. Ellis].

    PubMed

    Andrade, S O; da Silva Lopes, H O; de Almeida Barros, M; Leite, G G; Dias, S M; Saueressig, M; Nobre, D; Temperini, J A

    1978-01-01

    Aspects of photosensitization in bovines grazing on pastures of Brachiaria decumbens Stapf infested with Pithomyces chartarum (Berk. & Curt.) M.B. Ellis infested all pastures 45(2):117-136, 1978. This paper reports experimental studies on photosensitization in bovines grazing on different pastures of Brachiaria decumbens Stapf in the "Cerrados" region (Planaltina, DF). Climatic conditions, zinc content and occurence of fungi on pastures were investigated. Pithomyces chartarum (Berk. & Curt.) M.B. Ellis infested all pastures examined. Photosensitization was observed in one animal maintained on a pasture of B. decumbens formed with seeds from Australia. Clinical and necropsy data were similar to those related in literature for sporidesmin-intoxicated animals. An isolate of P. chartarum and samples of bovine bile were assayed for sporidesmin presence.

  13. [Photosensitization in cattle grazing on pastures of Brahciaria decumbens Stapf infested with Pithomyces chartarum (Berk. & Curt.) M.B. Ellis].

    PubMed

    Andrade, S O; da Silva Lopes, H O; de Almeida Barros, M; Leite, G G; Dias, S M; Saueressig, M; Nobre, D; Temperini, J A

    1978-01-01

    Aspects of photosensitization in bovines grazing on pastures of Brachiaria decumbens Stapf infested with Pithomyces chartarum (Berk. & Curt.) M.B. Ellis infested all pastures 45(2):117-136, 1978. This paper reports experimental studies on photosensitization in bovines grazing on different pastures of Brachiaria decumbens Stapf in the "Cerrados" region (Planaltina, DF). Climatic conditions, zinc content and occurence of fungi on pastures were investigated. Pithomyces chartarum (Berk. & Curt.) M.B. Ellis infested all pastures examined. Photosensitization was observed in one animal maintained on a pasture of B. decumbens formed with seeds from Australia. Clinical and necropsy data were similar to those related in literature for sporidesmin-intoxicated animals. An isolate of P. chartarum and samples of bovine bile were assayed for sporidesmin presence. PMID:573108

  14. Oxidative stress and immunotoxic effects of lead and their amelioration with myrrh (Commiphora molmol) emulsion.

    PubMed

    Ashry, Khaled M; El-Sayed, Yasser S; Khamiss, Rania M; El-Ashmawy, Ibrahim M

    2010-01-01

    The possible role of Commiphora molmol emulsion (CME) in protecting against lead (PbAc)-induced hepatotoxicity, oxidative stress and immunotoxicity in rabbits was assessed. Six groups of animals were used: groups I (control) and II (PbAc) were not supplemented with CME. Groups III (CME50) and IV (CME50+PbAc) were administered with CME in a dose rate of 50mg/kg bwt, while groups V (CME100) and VI (CME100+PbAc) were received 100mg CME/kg bwt daily p.o for successive 14 weeks. Groups II, IV and VI were given 80 mg PbAc/kg bwt/day orally for 6 weeks starting from the 9th week. At the 12th week, animals were subjected to immunization by a single dose of sheep RBCs. The PbAc-group showed 220% increase in hepatic malondialdehyde levels, while glutathione, glutathione s-transferase and glutathione peroxidase levels decreased. Lead-acetate induced hypoproteinemia and hypoalbuminemia, and increased aminotransferases activity. It reduced the values of lymphocyte transformation test, phagocytic activity, phagocytic index and antibody titer against sheep SRBCs. Interestingly, pretreatment with CME attenuated these adverse effects in a dose-dependent protection. CME, therefore, is a potent antioxidant, and can protect against PbAc-induced hepatic oxidative damage and immunotoxicity by reducing lipid peroxidation and enhancing the antioxidant and immune defense mechanisms. PMID:19818824

  15. Immunotoxical evaluation of St. Lawrence beluga whales (Deiphinapterus leucas)

    SciTech Connect

    Guise, S. De; Fournier, M.; Martineau, D.; Beland, P.

    1995-12-31

    An isolated population of beluga whales live in the St. Lawrence estuary. From approximately 5,000 at the beginning of the century, they now number 500 and their number has not increased since the last 10 years. High concentrations of environmental contaminants including organohalogens (mostly PCBs and DDT), as well as heavy metals (mostly mercury and lead) and HAP exposure have been demonstrated in tissues of these animals. A high incidence of diverse and severe lesions including infections with mildly pathogenic bacteria and numerous tumors were found upon examination of carcasses from the same population. An immunotoxicological evaluation of St. Lawrence beluga whales compared to relatively unpolluted Arctic animals was undertaken to study the possibility of a contaminants induced immunosuppression which would explain the diversity and severity of those lesions. As a first step, several assays were developed to evaluate immune functions in beluga whales, and baseline data were established using Arctic animals. In vitro exposure of Arctic beluga lymphocytes to single contaminants present in St. Lawrence beluga blubber were also performed and showed a suppression of proliferation of lymphocytes with concentrations of mercury below those found in liver of adult St. Lawrence animals. Animal models were also developed to evaluate the immunotoxic potential of the mixture of contaminants found in blubber of St. Lawrence belugas. Rats were fed lipids from either St. Lawrence or Arctic belugas or a mixture of the two groups, and immune functions will be evaluated in these animals. Finally, the last step of the study will be to catch belugas in the St. Lawrence, evaluate their immune functions, compare them to those of Arctic animals and relate them to concentrations of the different contaminants measured in their blubber and plasma.

  16. Transcriptome-based functional classifiers for direct immunotoxicity.

    PubMed

    Shao, Jia; Berger, Laura F; Hendriksen, Peter J M; Peijnenburg, Ad A C M; van Loveren, Henk; Volger, Oscar L

    2014-03-01

    Current screening methods for direct immunotoxic chemicals are mainly based on general toxicity studies with rodents. The present study aimed to identify transcriptome-based functional classifiers that can eventually be exploited for the development of in vitro screening assays for direct immunotoxicity. To this end, a toxicogenomics approach was applied in which gene expression changes in human Jurkat lymphoblastic T cells were investigated in response to a wide range of compounds, including direct immunotoxicants, immunosuppressive drugs, and non-immunotoxic control chemicals. On the basis of DNA microarray data previously obtained by the exposure of Jurkat cells to 31 test compounds (Shao et al. in Toxicol Sci 135(2):328-346, 2013), we identified a set of 93 genes, of which 80 were significantly regulated (|numerical ratio| ≥1.62) by at least three compounds and the other 13 genes were significantly regulated by either one single compound or compound class. A total of 28 most differentially regulated genes were selected for qRT-PCR verification using a training set of 44 compounds consisting of the above-mentioned 31 compounds (23 immunotoxic and 8 non-immunotoxic) and 13 additional immunotoxicants. Good correlation between the results of microarray and qRT-PCR (Pearson's correlation, R ≥ 0.69) was found for 27 out of the 28 genes. Redundancy analysis of these 27 potential classifiers led to a final set of 25 genes. To assess the performance of these genes, Jurkat cells were exposed to 20 additional compounds (external verification set) followed by qRT-PCR. The classifier set of 25 genes gave a good performance in the external verification: accuracy 85 %, true positive rate (sensitivity) 88 %, and true negative rate (specificity) 67 %. Furthermore, on the basis of the gene ontology annotation of the 25 classifier genes, the immunotoxicants examined in this study could be categorized into distinct functional subclasses. In conclusion, we have identified and

  17. ELISA MEASUREMENT OF STACHYLYSIN (TM) IN SERUM TO QUANTIFY HUMAN EXPOSURES TO THE INDOOR MOLD STACHYBOTRYS CHARTARUM

    EPA Science Inventory

    Antibodies were produced against the hemolytic agent stachylysin obtained from the mold Stachybotryis chartarum. These antibodies were used to develop two enzyme-linked immunosorbent assay (ELISA) methods for the analysis of stachylysin in human and rat sera and environmental sa...

  18. RESPIRATORY PHYSIOLOGICAL AND ALLERGIC-TYPE RESPONSES TO AN EXTRACT OF STACHYBOTRYS CHARTARUM IN BALB/C MICE

    EPA Science Inventory

    RESPIRATORY PHYSIOLOGICAL AND ALLERGIC-TYPE RESPONSES TO AN EXTRACT OF Stachybotrys chartarum IN BALB/C MICE. ME Viana1, N Haykal-Coates2, S H Gavett2, MJ Selgrade2, and M D W Ward2. 1APR/CVM, NCSU, Raleigh, NC, USA. 2NHEERL, ORD, US EPA, RTP, NC, USA.
    Rationale: assess the ab...

  19. EVALUATION OF STACHYBOTRYS CHARTARUM IN THE HOUSE OF AN INFANT WITH PULMONARY HEMORRHAGE: QUANTITATIVE ASSESSMENT BEFORE, DURING, AND AFTER REMEDIATION

    EPA Science Inventory

    Stachybotrys chartarum is an indoor mold that has been associated with pulmonary hemorrhage (PH) cases in the Cleveland, Ohio area. This study applied two new quantitative measurements to air samples from a home where an infant developed PH. Quantitative polymerase chain reacti...

  20. The ICH S8 immunotoxicity guidance. Immune function assessment and toxicological pathology: autonomous or synergistic methods to predict immunotoxicity?

    PubMed

    Spanhaak, Steven

    2006-07-01

    The new ICH S8 guideline on Immunotoxicology Studies for Human Pharmaceuticals indicates that additional, functional testing of pharmaceuticals is not mandatory to screen for unintended immunotoxicity. The usefulness of conventional parameters like clinical pathology, organ weights and histopathology as measured in Standard Toxicity Studies (STS) to screen for potential unintended immunotoxicity was investigated in an ICH survey. Data of this survey appear to support the notion that properly evaluated STS endpoints would be sufficient for the detection of the majority of unintended immunosuppression by investigational pharmaceutical compounds. Thus the ICH S8 guideline was based on a cause for concern approach using a weight of evidence review of various factors like: findings from STS, pharmacological properties of the drug, intended patient population, structural similarities to known immunomodulators, drug disposition and/or clinical information. Overall the S8 guideline allows for more flexible approaches, and requires a weight of evidence review for which there is no given set of rules. For a proper use this asks for a sensible, realistic and above all a responsible approach both from Industry and Regulators. Some examples regarding the use of clinical pathology parameters like immunoglobulin levels and lymphocyte phenotyping have been included to illustrate this. In conclusion, to detect and evaluate potential immunotoxic effects of human pharmaceuticals the ICH S8 guideline allows for a more flexible, scientifically sound approach. For a proper evaluation of potential immunotoxic effects integration of data from standard toxicological parameters like clinical pathology, histopathology and functional assays are important.

  1. N-acetylcysteine reverses immunotoxic effects of methyl mercury and augments murine lymphocyte proliferation in vitro

    SciTech Connect

    Omara, F.; Fournier, M.; Bernier, J.; Blakley, B.

    1995-12-31

    N-Acetylcysteine (NAC) is a thiol antioxidant used clinically to treat chronic inflammatory lung disorders and acetaminophen poisoning in humans. The authors evaluated in vitro the effect of NAC on mitogen-induced blastogenesis in C57BI/6 mouse splenocytes by {sup 3}H-thymidine uptake, and its ability to protect against the immunotoxic effects of methyl mercury on lymphocyte proliferation. Lymphocyte proliferation stimulated by optimal and suboptimal concentrations of concanavalin A (Con A), lipopolysaccharide (LPS), or a combination of calcium ionophore A23187 and phorbol-12-myristate-13-acetate (PMA) were markedly enhanced by NAC. NAC itself was a weak mitogen. The kinetics of the NAC effect on splenocyte proliferation were mitogen dependent. NAC enhanced Con A-induced splenocyte proliferation in a dose-dependent and linear manner but enhanced the LPS-induced response at 50--400 {micro}g/ml of NAC followed by a decline in response to control value at higher concentrations. In splenocytes stimulated with PMA plus A23187, NAC increased proliferation at 50--200 pg/ml followed by a constant response at 200--1,000 {micro}g/ml NAC. When splenocytes were stimulated with higher concentrations of Con A (10 {micro}g/ml) or LPS (150 {micro}g/ml) which markedly suppress splenocyte proliferation, NAC significantly enhanced the Con A-induced response and reversed the inhibitory effect of high concentrations of LPS. NAC also protected lymphocytes against mitogen activation-induced cell death. Methyl mercury at 5 {times} 10{sup {minus}7}--1 {times} 10{sup {minus}6} suppressed Con A- and LPS-induced splenocyte proliferation by over 80%. However, NAC completely reversed the immunotoxic effects of methyl mercury on the mitogen-induced splenocyte proliferation even when the cells were pre-incubated with methyl mercury for 6 or 24 hr before stimulation with the mitogens.

  2. Assessment of Immunotoxicity of Dextran Coated Ferrite Nanoparticles in Albino Mice

    PubMed Central

    Syama, Santhakumar; Gayathri, Viswanathan; Mohanan, Parayanthala Valappil

    2015-01-01

    In this study, dextran coated ferrite nanoparticles (DFNPs) of size <25 nm were synthesized, characterized, and evaluated for cytotoxicity, immunotoxicity, and oxidative stress by in vitro and in vivo methods. Cytotoxicity was performed in vitro using splenocytes with different concentrations of DFNPs. Gene expression of selected cytokines (IL-1, IL-10, and TNF β) secretion by splenocytes was evaluated. Also, 100 mg of DFNPs was injected intraperitoneally to 18 albino mice for immunological stimulations. Six animals each were sacrificed at the end of 7, 14, and 21 days. Spleen was subjected to immunotoxic response and liver was analyzed for antioxidant parameters (lipid peroxidation, reduced glutathione, glutathione peroxidase, superoxide dismutase, and glutathione reductase). The results indicated that DFNPs failed to induce any immunological reactions and no significant alternation in antioxidant defense mechanism. Also, mRNA expression of the cytokines revealed an increase in IL-10 expression and subsequent decreased expression of IL-1 and TNF β. Eventually, DNA sequencing of liver actin gene revealed base alteration in nonconserved regions (10–20 bases) of all the treated groups when compared to control samples. Hence, it can be concluded that the DFNPs were nontoxic at the cellular level and nonimmunotoxic when exposed intraperitoneally to mice. PMID:26576301

  3. Toxigenic diversity of two different RAPD groups of Stachybotrys chartarum isolates analyzed by potential for trichothecene production and for boar sperm cell motility inhibition.

    PubMed

    Peltola, J; Niessen, L; Nielsen, K F; Jarvis, B B; Andersen, B; Salkinoja-Salonen, M; Möller, E M

    2002-11-01

    Thirty-one isolates of Stachybotrys chartarum from indoor and outdoor environments were analyzed for the presence of the trichodiene synthase (Tri5) gene, trichothecenes, boar sperm cell motility inhibition, and randomly amplified polymorphic DNA banding patterns (RAPDs). Twenty-two S. chartarum isolates tested positive for the Tri5 gene and nine were negative when tested using novel Tri5 gene-specific PCR primer pair. The Tri5 gene positive isolates contained satratoxins (five isolates) or the simple trichothecene, trichodermol (11 isolates). The Tri5 gene negative isolates did not produce satratoxins or trichodermol. Nineteen S. chartarum isolates, distributed among the Tri5 gene negative and positive groups, inhibited boar spermatozoan motility at concentrations of < or = 60 microg of crude cell extract/mL. The inhibition of motility was independent of satratoxins or atranones. Unweighted pair group method of arithmetic averages (UPGMA) cluster analysis of RAPD fragments clustered the 31 S. chartarum isolates in two distinct groups designated as RAPD groups 1 and 2. The grouping of S. chartarum isolates obtained by UPGMA cluster analysis of RAPD fragments was identical to the grouping obtained by Tri5 gene-specific PCR. This indicates that the S. chartarum isolates belonging to different groups were genetically distinct in a much wider area than just the Tri5 gene. PMID:12556129

  4. Protein translation inhibition by Stachybotrys chartarum conidia with and without the mycotoxin containing polysaccharide matrix.

    PubMed

    Karunasena, Enusha; Cooley, J Danny; Straus, Douglas; Straus, David C

    2004-07-01

    Recent studies have correlated the presence of Stachybotrys chartarum in structures with SBS. S. chartarum produces mycotoxins that are thought to produce some of the symptoms reported in sick-building syndrome (SBS). The conidia (spores) produced by Stachybotrys species are not commonly found in the air of buildings that have been found to contain significant interior growth of this organism. This could be due in part to the large size of the Stachybotrys spores, or the organism growing in hidden areas such as wall cavities. However, individuals in buildings with significant Stachybotrys growth frequently display symptoms that may be attributed to exposure to the organism's mycotoxins. In addition, Stachybotrys colonies produce a "slime" or polysaccharide (carbohydrate) matrix that coats the hyphae and the spores. The intent of this project was to determine whether the carbohydrate matrix and the mycotoxins embedded in it could be removed from the spores by repeated washings with either aqueous or organic solvents. The results demonstrated that the process of spore washing removed compounds that were toxic in a protein translation assay as compared to spores that were washed with an organic solution, however a correlation between carbohydrate removal during the washing process and the removal of mycotoxins from the spore surface was not observed. These data demonstrated that mycotoxins are not likely to be found exclusively in the carbohydrate matrix of the spores. Therefore, mycotoxin removal from the spore surface can occur without significant loss of polysaccharide. We also showed that toxic substances may be removed from the spore surface with an aqueous solution. These results suggest that satratoxins are soluble in aqueous solutions without being bound to water-soluble moieties, such as the carbohydrate slime matrix. PMID:15487326

  5. Comparison of four different methods for extraction of Stachybotrys chartarum spore DNA and verification by real-time PCR.

    PubMed

    Black, J A; Foarde, K K

    2007-07-01

    A comparison of four different methods for the extraction of spore DNA from Stachybotrys chartarum was conducted. Spore DNA was extracted and purified using either one of three different commercial kits or water. All preparations utilized bead milling. Genomic DNA extracted from 10(1) to 10(7) spores was assessed by both agarose gel electrophoresis and real-time quantitative polymerase chain reaction (qPCR) performed against multi-copy (rRNA) and single-(tubulin) gene targets. The spore isolation technique we employed was verified to be pure by light microscopy. Although all preparatory methods led to successful detection by qPCR, S. chartarum spore DNA prepared using the Qiagen Plant kit was notably better over the extraction range.

  6. IL-15 Superagonist–Mediated Immunotoxicity: Role of NK Cells and IFN-γ

    PubMed Central

    Guo, Yin; Luan, Liming; Rabacal, Whitney; Bohannon, Julia K.; Fensterheim, Benjamin A.; Hernandez, Antonio

    2015-01-01

    IL-15 is currently undergoing clinical trials to assess its efficacy for treatment of advanced cancers. The combination of IL-15 with soluble IL-15Rα generates a complex termed IL-15 superagonist (IL-15 SA) that possesses greater biological activity than IL-15 alone. IL-15 SA is considered an attractive antitumor and antiviral agent because of its ability to selectively expand NK and memory CD8+ T (mCD8+ T) lymphocytes. However, the adverse consequences of IL-15 SA treatment have not been defined. In this study, the effect of IL-15 SA on physiologic and immunologic functions of mice was evaluated. IL-15 SA caused dose- and time-dependent hypothermia, weight loss, liver injury, and mortality. NK (especially the proinflammatory NK subset), NKT, and mCD8+ T cells were preferentially expanded in spleen and liver upon IL-15 SA treatment. IL-15 SA caused NK cell activation as indicated by increased CD69 expression and IFN-γ, perforin, and granzyme B production, whereas NKT and mCD8+ T cells showed minimal, if any, activation. Cell depletion and adoptive transfer studies showed that the systemic toxicity of IL-15 SA was mediated by hyperproliferation of activated NK cells. Production of the proinflammatory cytokine IFN-γ, but not TNF-α or perforin, was essential to IL-15 SA–induced immunotoxicity. The toxicity and immunological alterations shown in this study are comparable to those reported in recent clinical trials of IL-15 in patients with refractory cancers and advance current knowledge by providing mechanistic insights into IL-15 SA–mediated immunotoxicity. PMID:26216888

  7. Safety and immunotoxicity assessment of immunomodulatory monoclonal antibodies

    PubMed Central

    Morton, Laura Dill; Spindeldreher, Sebastian; Kiessling, Andrea; Allenspach, Roy; Hey, Adam; Muller, Patrick Y; Frings, Werner; Sims, Jennifer

    2010-01-01

    Most therapeutic monoclonal antibodies (mAbs) licensed for human use or in clinical development are indicated for treatment of patients with cancer and inflammatory/autoimmune disease and as such, are designed to directly interact with the immune system. A major hurdle for the development and early clinical investigation of many of these immunomodulatory mAbs is their inherent risk for adverse immune-mediated drug reactions in humans such as infusion reactions, cytokine storms, immunosuppression and autoimmunity. A thorough understanding of the immunopharmacology of a mAb in humans and animals is required to both anticipate the clinical risk of adverse immunotoxicological events and to select a safe starting dose for first-in-human (FIH) clinical studies. This review summarizes the most common adverse immunotoxicological events occurring in humans with immunomodulatory mAbs and outlines non-clinical strategies to define their immunopharmacology and assess their immunotoxic potential, as well as reduce the risk of immunotoxicity through rational mAb design. Tests to assess the relative risk of mAb candidates for cytokine release syndrome, innate immune system (dendritic cell) activation and immunogenicity in humans are also described. The importance of selecting a relevant and sensitive toxicity species for human safety assessment in which the immunopharmacology of the mAb is similar to that expected in humans is highlighted, as is the importance of understanding the limitations of the species selected for human safety assessment and supplementation of in vivo safety assessment with appropriate in vitro human assays. A tiered approach to assess effects on immune status, immune function and risk of infection and cancer, governed by the mechanism of action and structural features of the mAb, is described. Finally, the use of immunopharmacology and immunotoxicity data in determining a minimum anticipated biologic effect Level (MABEL) and in the selection of safe human

  8. In vitro characterization of the immunotoxic potential of several perfluorinated compounds (PFCs)

    SciTech Connect

    Corsini, Emanuela; Sangiovanni, Enrico; Avogadro, Anna; Galbiati, Valentina; Viviani, Barbara; Marinovich, Marina; Galli, Corrado L.; Dell'Agli, Mario; Germolec, Dori R.

    2012-01-15

    We have previously shown that PFOA and PFOS directly suppress cytokine secretion in immune cells, with different mechanisms of action. In particular, we have demonstrated a role for PPAR-α in PFOA-induced immunotoxicity, and that PFOS has an inhibitory effect on LPS-induced I-κB degradation. These studies investigate the immunomodulatory effects of four other PFCs, namely PFBS, PFOSA, PFDA, and fluorotelomer using in vitro assays. The release of the pro-inflammatory cytokines IL-6 and TNF-α was evaluated in lipolysaccharide (LPS)-stimulated human peripheral blood leukocytes (hPBL) and in the human promyelocytic cell line THP-1, while the release of IL-10 and IFN-γ was evaluated in phytohemagglutinin (PHA)-stimulated hPBL. All PFCs suppressed LPS-induced TNF-α production in hPBL and THP-1 cells, while IL-6 production was suppressed by PFOSA, PFOS, PFDA and fluorotelomer. PFBS, PFOSA, PFOS, PFDA and fluorotelomer inhibited PHA-induced IL-10 release, while IFN-γ secretion was affected by PFOSA, PFOS, PFDA and fluorotelomer. Leukocytes obtained from female donors appear to be more sensitive to the in vitro immunotoxic effects of PFCs when their responses are compared to the results obtained using leukocytes from male donors. Mechanistic investigations demonstrated that inhibition of TNF-α release in THP-1 cells occurred at the transcriptional level. All PFCs, including PFOA and PFOS, decreased LPS-induced NF-κB activation. With the exception of PFOA, none of the PFCs tested was able to activate PPARα driven transcription in transiently transfected THP-1 cells, excluding a role for PPARα in the immunomodulation observed. PFBS and PFDA prevented LPS-induced I-κB degradation. Overall, these studies suggest that PFCs affect NF-κB activation, which directly suppresses cytokine secretion by immune cells. Our results indicate that PFOA is the least active of the PFCs examined followed by PFBS, PFDA, PFOS, PFOSA and fluorotelomer. -- Research Highlights: ► PFCs

  9. Approaches and considerations for the assessment of immunotoxicity for environmental chemicals: a workshop summary.

    PubMed

    Boverhof, Darrell R; Ladics, Greg; Luebke, Bob; Botham, Jane; Corsini, Emanuela; Evans, Ellen; Germolec, Dori; Holsapple, Michael; Loveless, Scott E; Lu, Haitian; van der Laan, Jan Willem; White, Kimber L; Yang, Yung

    2014-02-01

    As experience is gained with toxicology testing and as new assays and technologies are developed, it is critical for stakeholders to discuss opportunities to advance our overall testing strategies. To facilitate these discussions, a workshop on practices for assessing immunotoxicity for environmental chemicals was held with the goal of sharing perspectives on immunotoxicity testing strategies and experiences, developmental immunotoxicity (DIT), and integrated and alternative approaches to immunotoxicity testing. Experiences across the chemical and pharmaceutical industries suggested that standard toxicity studies, combined with triggered-based testing approaches, represent an effective and efficient approach to evaluate immunotoxic potential. Additionally, discussions on study design, critical windows, and new guideline approaches and experiences identified important factors to consider before initiating DIT evaluations including assay choice and timing and the impact of existing adult data. Participants agreed that integrating endpoints into standard repeat-dose studies should be considered for fulfilling any immunotoxicity testing requirements, while also maximizing information and reducing animal use. Participants also acknowledged that in vitro evaluation of immunosuppression is complex and may require the use of multiple assays that are still being developed. These workshop discussions should contribute to developing an effective but more resource and animal efficient approach for evaluating chemical immunotoxicity.

  10. Vanadium carcinogenic, immunotoxic and neurotoxic effects: a review of in vitro studies.

    PubMed

    Zwolak, Iwona

    2014-01-01

    Deleterious health effects induced by inorganic vanadium compounds are linked with carcinogenic, immunotoxic and neurotoxic insults. The goal of this review is to provide a summary of mammalian cell culture studies (from the 1990s to most recent) looking into the mode of the above-mentioned adverse actions of vanadium. Regarding the carcinogenicity potential, the key cell-based studies have evidenced the ability of vanadium to induce genotoxic lesions, cell morphological transformation and anti-apoptotic effects in a certain type of cells. Two contradictory effects of vanadium on the immune functions of cells have been observed in cell culture studies. The first effect involves reduction of cell immune responses such as vanadium-dependent inhibition of cytokine-inducible functions, which may underlie the mechanism of vanadium-induced immunosuppression. The second one involves stimulation of immune activity, for example, a vanadium-mediated increase in cytokine production, which may contribute to vanadium-related inflammation. So far, an in vitro evaluation of vanadium neurotoxicity has only been reported in few articles. These papers indicate probable cytotoxic mechanisms resulting from exposure of neurons and glial cells to vanadium. In summary, this literature review collects in vitro reports on adverse vanadium effects and thus provides vanadium researchers with a single, concise source of data.

  11. Neurotoxicity and Immunotoxicity Outcomes following Gestational Exposure to Four Lab Drinking Water Concentrates

    EPA Science Inventory

    To evaluate whether developmental exposure to drinking water concentrates altered other endpoints, standard neuro- and immunotoxicity tests were conducted on the offspring. Male and female offspring (10/sex/treatment) exposed to chlorinated concentrated water (CCW) or reverse os...

  12. Oxidative stress and immunotoxic effects of bisphenol A on the larvae of rare minnow Gobiocypris rarus.

    PubMed

    Tao, Shiyu; Zhang, Yingying; Yuan, Cong; Gao, Jiancao; Wu, Feili; Wang, Zaizhao

    2016-02-01

    Bisphenol A (BPA), a known endocrine disrupting chemical, is ubiquitous in the aquatic environment and can pose risk to the health of aquatic organisms. Studies on immunotoxicity of BPA in aquatic organisms are limited. In this study, rare minnow (Gobiocypris rarus) larvae were exposed to 1, 225 and 1000μg/L BPA for 7 days. Inflammatory effects of BPA exposure were assessed from the increased production of nitric oxide (NO) and reactive oxygen species (ROS), the change of iNOS mRNA and other TLRs-associated immune gene expression. Our findings provide evidences that different concentrations of BPA can induce a toxic response in fish to produce reactive free radicals which can affect the function of T lymphocytes and decrease the transcription levels of cytokine genes. The excess production of H2O2, induced oxidative stress and suppressed TLR4/NF-κB signaling, leading to immunosuppressive effects in fish larvae. The present results suggest that BPA has the potential to induce oxidative stress accompanied by immunosuppression in rare minnow larvae. PMID:26595511

  13. Selenium reverses Pteridium aquilinum-induced immunotoxic effects

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We have previously shown that bracken fern (Pteridium aquilinum) has immunomodulatory effects on mouse natural killer (NK) cells by reducing cytotoxicity. Alternatively, it has been demonstrated that selenium can enhance NK cell activity. Therefore, the aims of the present study were to evaluate if ...

  14. Histological and histometrical evidences for phenol immunotoxicity in mice.

    PubMed

    Louei Monfared, Ali; Jaafari, Afsaneh; Sheibani, Mohammad Taghi

    2014-01-01

    Phenol is a common industrial and ubiquitous environmental chemical which is used to synthesize resins and plastics. Due to its anesthetic and disinfectant properties, phenol is also widely used in pharmaceutical products. Since there were no adequate data about phenol immunotoxicity, the purpose of the present study is to investigate its toxic effects on the histological structures of the lymphoid organs in the mice. A total of 80 mice were randomly distributed into one control group and three experimental groups. The control group received only distilled water, whereas experimental groups were orally administered phenol at the concentrations of 80, 180, and 320 mg/kg/day, respectively. After 28 consecutive days, tissue samples were taken and histological changes of the spleens, thymuses, adrenal glands, and lymph nodes were examined using optical microscopy. The results showed that in the phenol treated animals; splenic megakaryocyte counts increased, the diameter of the splenic follicles decreased, the thymocyte population in both cortex and medulla reduced, the thickness of the reticular layers of adrenal gland increased and lymphatic cells populations in the lymph node were reduced, significantly (P < 0.01). Also, remarkable histological changes were noted in the various lymphatic organs of the treated mice. Overall, present findings give some histological evidences that selected qualitative and quantitative parameters of the lymphatic organs were significantly altered by phenol administration. In conclusion, the significant decreases of the immune cell populations together with histological alterations in the immunocompetent organs of the mice exposed to phenol indicate the immunosuppressive and immunotoxic properties of this chemical material. PMID:24829551

  15. Satratoxin G from the black mold Stachybotrys chartarum evokes olfactory sensory neuron loss and inflammation in the murine nose and brain.

    PubMed

    Islam, Zahidul; Harkema, Jack R; Pestka, James J

    2006-07-01

    Satratoxin G (SG) is a macrocyclic trichothecene mycotoxin produced by Stachybotrys chartarum, the "black mold" suggested to contribute etiologically to illnesses associated with water-damaged buildings. Using an intranasal instillation model in mice, we found that acute SG exposure specifically induced apoptosis of olfactory sensory neurons (OSNs) in the olfactory epithelium. Dose-response analysis revealed that the no-effect and lowest-effect levels at 24 hr postinstillation (PI) were 5 and 25 microg/kg body weight (bw) SG, respectively, with severity increasing with dose. Apoptosis of OSNs was identified using immunohistochemistry for caspase-3 expression, electron microscopy for ultrastructural cellular morphology, and real-time polymerase chain reaction for elevated expression of the proapoptotic genes Fas, FasL, p75NGFR, p53, Bax, caspase-3, and CAD. Time-course studies with a single instillation of SG (500 microg/kg bw) indicated that maximum atrophy of the olfactory epithelium occurred at 3 days PI. Exposure to lower doses (100 microg/kg bw) for 5 consecutive days resulted in similar atrophy and apoptosis, suggesting that in the short term, these effects are cumulative. SG also induced an acute, neutrophilic rhinitis as early as 24 hr PI. Elevated mRNA expression for the proinflammatory cytokines tumor necrosis factor-alpha, interleukin-6 (IL-6) , and IL-1 and the chemokine macrophage-inflammatory protein-2 (MIP-2) were detected at 24 hr PI in both the ethmoid turbinates of the nasal airways and the adjacent olfactory bulb of the brain. Marked atrophy of the olfactory nerve and glomerular layers of the olfactory bulb was also detectable by 7 days PI along with mild neutrophilic encephalitis. These findings suggest that neurotoxicity and inflammation within the nose and brain are potential adverse health effects of exposure to satratoxins and Stachybotrys in the indoor air of water-damaged buildings.

  16. Satratoxin G from the Black Mold Stachybotrys chartarum Evokes Olfactory Sensory Neuron Loss and Inflammation in the Murine Nose and Brain

    PubMed Central

    Islam, Zahidul; Harkema, Jack R.; Pestka, James J.

    2006-01-01

    Satratoxin G (SG) is a macrocyclic trichothecene mycotoxin produced by Stachybotrys chartarum, the “black mold” suggested to contribute etiologically to illnesses associated with water-damaged buildings. Using an intranasal instillation model in mice, we found that acute SG exposure specifically induced apoptosis of olfactory sensory neurons (OSNs) in the olfactory epithelium. Dose–response analysis revealed that the no-effect and lowest-effect levels at 24 hr postinstillation (PI) were 5 and 25 μg/kg body weight (bw) SG, respectively, with severity increasing with dose. Apoptosis of OSNs was identified using immunohistochemistry for caspase-3 expression, electron microscopy for ultrastructural cellular morphology, and real-time polymerase chain reaction for elevated expression of the proapoptotic genes Fas, FasL, p75NGFR, p53, Bax, caspase-3, and CAD. Time-course studies with a single instillation of SG (500 μg/kg bw) indicated that maximum atrophy of the olfactory epithelium occurred at 3 days PI. Exposure to lower doses (100 μg/kg bw) for 5 consecutive days resulted in similar atrophy and apoptosis, suggesting that in the short term, these effects are cumulative. SG also induced an acute, neutrophilic rhinitis as early as 24 hr PI. Elevated mRNA expression for the proinflammatory cytokines tumor necrosis factor-α, interleukin-6 (IL-6), and IL-1 and the chemokine macrophage-inflammatory protein-2 (MIP-2) were detected at 24 hr PI in both the ethmoid turbinates of the nasal airways and the adjacent olfactory bulb of the brain. Marked atrophy of the olfactory nerve and glomerular layers of the olfactory bulb was also detectable by 7 days PI along with mild neutrophilic encephalitis. These findings suggest that neurotoxicity and inflammation within the nose and brain are potential adverse health effects of exposure to satratoxins and Stachybotrys in the indoor air of water-damaged buildings. PMID:16835065

  17. Biological Responses of Raw 264.7 Macrophage Exposed to Two Strains of Stachybotrys chartarum Spores Grown on Four Different Wallboard Types

    EPA Science Inventory

    The focus of this research was to provide a better understanding of the health impacts caused by Stachybotrys chartarum (Houston and 51-11) spores grown on four gypsum products two of which were resistant to microbes. Raw 264.7 cells were exposed to whole spores and fragmented 51...

  18. SOLVENT COMPARISON IN THE ISOLATION, SOLUBILIZATION, AND TOXICITY OF STACHYBOTRYS CHARTARUM SPORE TRICHOTHECENE MYCOTOXINS IN AN ESTABLISHED IN VITRO LUMINESCENCE PROTEIN TRANSLATION INHIBITION ASSAY

    EPA Science Inventory

    It is well known that non-viable mold contaminants such as macrocyclic trichothecene mycotoxins of Stachybotrys chartarum are highly toxinigenic to humans. However, there is no agreed upon method of recovering native mycotoxin. The purpose of this study was to provide quantitativ...

  19. Embryonic exposure to butachlor in zebrafish (Danio rerio): endocrine disruption, developmental toxicity and immunotoxicity.

    PubMed

    Tu, Wenqing; Niu, Lili; Liu, Weiping; Xu, Chao

    2013-03-01

    Butachlor is a chloroacetanilide herbicide widely employed in weeding important crops. Recently, the study of the possible toxic effects of butachlor in non-target organisms has increased substantially. However, the endocrine disruption, developmental toxicity and immunotoxicity effects of butachlor in fish have not been fully investigated in previous studies. In the present study, zebrafish embryos were exposed to a range of butachlor concentrations from 4 to 20 μM to evaluate the embryonic toxicity of butachlor until 84 hours postfertilization (hpf). The results demonstrated that butachlor was highly toxic to zebrafish embryos, hindering the hatching process, resulting in a series of malformations and followed by mortality. The malformations observed included pericardial edema (PE) and yolk sac edema (YSE), which showed concentration-dependent responses. The analysis of endocrine gene transcription indicated that butachlor significantly induced the expression of the estrogen-responsive gene Vtg1 but had no effect on the expression of the ERα gene. The innate immune system appeared to be another possible target of butachlor. At 72 hpf, butachlor significantly up-regulated the innate immune system-related genes, including IL-1β, CC-chem, CXCL-C1c and IL-8. These data suggest that butachlor causes developmental toxicity, endocrine disruption and immune toxicity in the zebrafish embryo. Bidirectional interactions between the endocrine system and the immune system might be present, and further studies are needed to determine these possible pathways.

  20. Embryonic exposure to butachlor in zebrafish (Danio rerio): endocrine disruption, developmental toxicity and immunotoxicity.

    PubMed

    Tu, Wenqing; Niu, Lili; Liu, Weiping; Xu, Chao

    2013-03-01

    Butachlor is a chloroacetanilide herbicide widely employed in weeding important crops. Recently, the study of the possible toxic effects of butachlor in non-target organisms has increased substantially. However, the endocrine disruption, developmental toxicity and immunotoxicity effects of butachlor in fish have not been fully investigated in previous studies. In the present study, zebrafish embryos were exposed to a range of butachlor concentrations from 4 to 20 μM to evaluate the embryonic toxicity of butachlor until 84 hours postfertilization (hpf). The results demonstrated that butachlor was highly toxic to zebrafish embryos, hindering the hatching process, resulting in a series of malformations and followed by mortality. The malformations observed included pericardial edema (PE) and yolk sac edema (YSE), which showed concentration-dependent responses. The analysis of endocrine gene transcription indicated that butachlor significantly induced the expression of the estrogen-responsive gene Vtg1 but had no effect on the expression of the ERα gene. The innate immune system appeared to be another possible target of butachlor. At 72 hpf, butachlor significantly up-regulated the innate immune system-related genes, including IL-1β, CC-chem, CXCL-C1c and IL-8. These data suggest that butachlor causes developmental toxicity, endocrine disruption and immune toxicity in the zebrafish embryo. Bidirectional interactions between the endocrine system and the immune system might be present, and further studies are needed to determine these possible pathways. PMID:23294635

  1. Subchronic Immunotoxicity Assessment of Genetically Modified Virus-Resistant Papaya in Rats.

    PubMed

    Lin, Hsin-Tang; Lee, Wei-Cheng; Tsai, Yi-Ting; Wu, Jhaol-Huei; Yen, Gow-Chin; Yeh, Shyi-Dong; Cheng, Ying-Huey; Chang, Shih-Chieh; Liao, Jiunn-Wang

    2016-07-27

    Papaya is an important fruit that provides a variety of vitamins with nutritional value and also holds some pharmacological properties, including immunomodulation. Genetically modified (GM) papaya plants resistant to Papaya ringspot virus (PRSV) infection have been generated by cloning the coat protein gene of the PRSV which can be used as a valuable strategy to fight PRSV infection and to increase papaya production. In order to assess the safety of GM papaya as a food, this subchronic study was conducted to assess the immunomodulatory responses of the GM papaya line 823-2210, when compared with its parent plant of non-GM papaya, Tainung-2 (TN-2), in Sprague-Dawley (SD) rats. Both non-GM and GM 823-2210 papaya fruits at low (1 g/kg bw) and high (2 g/kg bw) dosages were administered via daily oral gavage to male and female rats consecutively for 90 days. Immunophenotyping, mitogen-induced splenic cell proliferation, antigen-specific antibody response, and histopathology of the spleen and thymus were evaluated at the end of the experiment. Results of immunotoxicity assays revealed no consistent difference between rats fed for 90 days with GM 823-2210 papaya fruits, as opposed to those fed non-GM TN-2 papaya fruits, suggesting that with regard to immunomodulatory responses, GM 823-2210 papaya fruits maintain substantial equivalence to fruits of their non-GM TN-2 parent. PMID:27396727

  2. Subchronic Immunotoxicity Assessment of Genetically Modified Virus-Resistant Papaya in Rats.

    PubMed

    Lin, Hsin-Tang; Lee, Wei-Cheng; Tsai, Yi-Ting; Wu, Jhaol-Huei; Yen, Gow-Chin; Yeh, Shyi-Dong; Cheng, Ying-Huey; Chang, Shih-Chieh; Liao, Jiunn-Wang

    2016-07-27

    Papaya is an important fruit that provides a variety of vitamins with nutritional value and also holds some pharmacological properties, including immunomodulation. Genetically modified (GM) papaya plants resistant to Papaya ringspot virus (PRSV) infection have been generated by cloning the coat protein gene of the PRSV which can be used as a valuable strategy to fight PRSV infection and to increase papaya production. In order to assess the safety of GM papaya as a food, this subchronic study was conducted to assess the immunomodulatory responses of the GM papaya line 823-2210, when compared with its parent plant of non-GM papaya, Tainung-2 (TN-2), in Sprague-Dawley (SD) rats. Both non-GM and GM 823-2210 papaya fruits at low (1 g/kg bw) and high (2 g/kg bw) dosages were administered via daily oral gavage to male and female rats consecutively for 90 days. Immunophenotyping, mitogen-induced splenic cell proliferation, antigen-specific antibody response, and histopathology of the spleen and thymus were evaluated at the end of the experiment. Results of immunotoxicity assays revealed no consistent difference between rats fed for 90 days with GM 823-2210 papaya fruits, as opposed to those fed non-GM TN-2 papaya fruits, suggesting that with regard to immunomodulatory responses, GM 823-2210 papaya fruits maintain substantial equivalence to fruits of their non-GM TN-2 parent.

  3. Prospects for developmental immunotoxicity guidance and an update on ICH S8.

    PubMed

    Hastings, Kenneth L

    2005-10-01

    Potential adverse effects of drug exposure on the developing immune system had been a relatively neglected area of toxicology until fairly recently. However, with the recent regulatory emphasis on evaluation of drugs for use in pediatric patients, juvenile animal studies have been considered in much more detail than in the past in order to enable clinical trials. Assessment of immunotoxicity potential in these juvenile animal studies has been a natural consequence of drug development for pediatric patients. Unfortunately, the efforts to evaluate developmental immunotoxicity studies have not kept pace with the writing of an immunotoxicology guidance for the International Conference on Harmonisation of Technical Requirements for Registration of Human Pharmaceuticals (ICH). This document has recently reached Step 4 in the approval process: it is thus likely that juvenile animal studies for immunotoxicity would be recommended based on considerations enumerated in the ICH Safety Number 8 (S8) guidance. Sufficient flexibility exists in this document to cover the issue of developmental immunotoxicity. ICH S8 advocates a weight-of-evidence approach, which should be interpreted to indicate that immunotoxicity testing would be conducted based on identified cause(s) for concern rather than as a routine screening method. The presentation reflecting these issues, as presented to attendees of the Pharmaceutical Education Associates workshop on Innovative Methods and Applications for Risk Assessment in Pharmaceutical Development is summarized herein.

  4. Acephate immunotoxicity in White Leghorn cockerel chicks upon experimental exposure

    USGS Publications Warehouse

    Tripathi, Syamantak Mani; Thaker, A. M.; Joshi, C. G.; Sankhala, Laxmi Narayan

    2012-01-01

    Immunotoxicity for subacute exposure to acephate (O,S-dimethyl-acetylphosphoramidothioate) was assessed in day old White Leghorn (WLH) cockerel chicks. The chicks were divided into five groups. Groups C1 and C2 served as plain control and vehicle control respectively. Chicks of groups T1, T2 and T3 were administered acephate suspended in groundnut oil at 21.3 mg/kg, 28.4 mg/kg and 42.6 mg/kg respectively orally for 28 days. A non-significant reduction in total leukocyte count was observed. Although, anti-Newcastle Disease Virus (NDV) antibody titer, serum total protein (TP), serum globulin, serum albumin and organ:body weight ratios of immune organs were significantly suppressed. The delayed type hypersensitivity response to 2,4-dinitro-1-chlorobenzene (DNCB) was not significantly altered. Histopathologically, bursa and spleen showed mild depletion of lymphocytes. Furthermore, DNA fragmentation assay was performed and detected ladder pattern (180 bp) in DNA. It was concluded that subacute acephate exposure at low concentrations may affect immune responses in avian species.

  5. Cytotoxicity and immunotoxicity of cyclopiazonic acid on human cells.

    PubMed

    Hymery, Nolwenn; Masson, Floriane; Barbier, Georges; Coton, Emmanuel

    2014-08-01

    In this study, in vitro cytotoxicity and immunotoxicity of the mycotoxin cyclopiazonic acid (CPA) was evaluated on human cells. To evaluate cytoxicity, several cellular targets were used (CD34+, monocytes, THP-1 and Caco-2). Monocytes were more sensitive to CPA than the THP-1 monocytic cell line after 48h of incubation in the tested conditions. Half maximal inhibitory concentration (IC50) were determined to be 8.5 × 10(-8) and 1.75 × 10(-7)M for monocytes and THP1, respectively, while IC50>1.25 × 10(-7)M was observed for Caco-2 and CD34+ cells. The CPA effect on macrophage differentiation was also examined at non-cytotoxic concentrations. The monocyte differentiation process was markedly disturbed in the presence of CPA. After 6 days of culture, CD71 expression was downregulated, while CD14 and CD11a expressions did not change. Moreover, activated macrophages showed a raised burst activity and TNF-α secretion. Overall, the results indicated that CPA exhibited toxicity on various human cellular models. Moreover, at non-cytotoxic concentrations, CPA disturbed human monocytes differentiation into macrophages. This work contributes to understanding the immunosuppressive properties of this food-related toxin. PMID:24747294

  6. Cytotoxicity and immunotoxicity of cyclopiazonic acid on human cells.

    PubMed

    Hymery, Nolwenn; Masson, Floriane; Barbier, Georges; Coton, Emmanuel

    2014-08-01

    In this study, in vitro cytotoxicity and immunotoxicity of the mycotoxin cyclopiazonic acid (CPA) was evaluated on human cells. To evaluate cytoxicity, several cellular targets were used (CD34+, monocytes, THP-1 and Caco-2). Monocytes were more sensitive to CPA than the THP-1 monocytic cell line after 48h of incubation in the tested conditions. Half maximal inhibitory concentration (IC50) were determined to be 8.5 × 10(-8) and 1.75 × 10(-7)M for monocytes and THP1, respectively, while IC50>1.25 × 10(-7)M was observed for Caco-2 and CD34+ cells. The CPA effect on macrophage differentiation was also examined at non-cytotoxic concentrations. The monocyte differentiation process was markedly disturbed in the presence of CPA. After 6 days of culture, CD71 expression was downregulated, while CD14 and CD11a expressions did not change. Moreover, activated macrophages showed a raised burst activity and TNF-α secretion. Overall, the results indicated that CPA exhibited toxicity on various human cellular models. Moreover, at non-cytotoxic concentrations, CPA disturbed human monocytes differentiation into macrophages. This work contributes to understanding the immunosuppressive properties of this food-related toxin.

  7. Perinatal Immunotoxicity: Why Adult Exposure Assessment Fails to Predict Risk

    PubMed Central

    Dietert, Rodney R.; Piepenbrink, Michael S.

    2006-01-01

    Recent research has pointed to the developing immune system as a remarkably sensitive toxicologic target for environmental chemicals and drugs. In fact, the perinatal period before and just after birth is replete with dynamic immune changes, many of which do not occur in adults. These include not only the basic maturation and distribution of immune cell types and selection against autoreactive lymphocytes but also changes designed specifically to protect the pregnancy against immune-mediated miscarriage. The newborn is then faced with critical immune maturational adjustments to achieve an immune balance necessary to combat myriad childhood and later-life diseases. All these processes set the fetus and neonate completely apart from the adult regarding immunotoxicologic risk. Yet for decades, safety evaluation has relied almost exclusively upon exposure of the adult immune system to predict perinatal immune risk. Recent workshops and forums have suggested a benefit in employing alternative exposures that include exposure throughout early life stages. However, issues remain concerning when and where such applications might be required. In this review we discuss the reasons why immunotoxic assessment is important for current childhood diseases and why adult exposure assessment cannot predict the effect of xenobiotics on the developing immune system. It also provides examples of developmental immunotoxicants where age-based risk appears to differ. Finally, it stresses the need to replace adult exposure assessment for immune evaluation with protocols that can protect the developing immune system. PMID:16581533

  8. Immunotoxic effects of an industrial waste incineration site on groundwater in rainbow trout (Oncorhynchus mykiss).

    PubMed

    Benchalgo, Nadjet; Gagné, François; Fournier, Michel

    2014-05-01

    The discharge of organic waste from the petrochemical industry into the Mercier lagoons caused major groundwater contamination. The objective of this study was to determine the immunotoxic potential of three groundwater wells at increasing distance from the incinerator dumping site (1.17, 2.74 and 5.40 km). Rainbow Trout were exposed to increasing concentrations of water from three groundwater wells for 14 days. Immunocompetence was characterized by phagocytosis, mitogen-stimulated proliferation of lymphocytes, cell cycle analysis and apoptosis. A significant increase in innate (phagocytosis) and specific immune response (B lymphocyte proliferation) was observed in trout exposed to water collected from the well at 2.74 km. However, phagocytosis activity was suppressed in groups at 1.17 and 5.40 km. The proportion of lymphocytes in S phase was significantly increased in groups at 2.74 and 5.40 km, while lymphocytes in G0/G1 phase were decreased in all three exposure groups. Additionally, dexamethasone (DEX)-induced apoptosis of lymphocytes was significantly reduced in the group at 2.74 km, which suggests decreased lymphocyte turnover. Furthermore, the ratio of DEX-induced apoptosis/apoptosis was lower in the groups at 2.74 and 5.40 km. In summary, our experiments have shown that exposure to the mixture of organic compounds present in Mercier groundwater modulates phagocytosis and cell proliferation, disrupts the cell cycle and reduces the ratio of DEX-induced apoptosis/apoptosis. It is concluded that groundwater collected in the vicinity of an incinerator containment field could impact immunocompetence in fish.

  9. Coplanar and non-coplanar congener-specificity of PCB bioaccumulation and immunotoxicity in sea stars.

    PubMed

    Danis, Bruno; Cattini, Chantal; Teyssié, Jean-Louis; Villeneuve, Jean-Pierre; Fowler, Scott W; Warnau, Michel

    2006-08-23

    The sea star Asterias rubens (L.), a representative species of the North Sea benthic environment, was exposed to a mixture of 10 selected PCB congeners (3 coplanar or c-PCBs, and 7 non-coplanar) via experimentally contaminated sediments. Both the degree of bioaccumulation and subsequent immunotoxic effects of these PCBs were determined. A strong congener-specificity for both bioaccumulation and immunotoxicity was found as well as a probable induction of a congener-specific detoxification mechanism resulting in the dramatic decrease in body levels of the three coplanar congeners tested (PCBs 77, 126 and 169). Moreover, a correlation was found between the bioaccumulation of c-PCBs and their immunotoxic effects. These findings suggest that coplanar congeners should be included in the list of congeners recommended to be analyzed for biological impact-oriented marine monitoring programmes.

  10. AMP-Conjugated Quantum Dots: Low Immunotoxicity Both In Vitro and In Vivo

    NASA Astrophysics Data System (ADS)

    Dai, Tongcheng; Li, Na; Liu, Lu; Liu, Qin; Zhang, Yuanxing

    2015-11-01

    Quantum dots (QDs) are engineered nanoparticles that possess special optical and electronic properties and have shown great promise for future biomedical applications. In this work, adenosine 5'-monophosphate (AMP), a small biocompatible molecular, was conjugated to organic QDs to produce hydrophilic AMP-QDs. Using macrophage J774A.1 as the cell model, AMP-QDs exhibited both prior imaging property and low toxicity, and more importantly, triggered limited innate immune responses in macrophage, indicating low immunotoxicity in vitro. Using BALB/c mice as the animal model, AMP-QDs were found to be detained in immune organs but did not evoke robust inflammation responses or obvious histopathological abnormalities, which reveals low immunotoxicity in vivo. This work suggests that AMP is an excellent surface ligand with low immunotoxicity, and potentially used in surface modification for more extensive nanoparticles.

  11. Development and evaluation of the mallard duck as a model to investigate the immunotoxicity of environmental chemicals

    SciTech Connect

    Fowles, J.R.

    1993-01-01

    Studies were conducted to characterize the mallard duck (Anas platyrhyncos) as a model for evaluating the immunotoxic effects of environmental chemicals. A battery of immunotoxicity tests was validated for the mallard, including natural killer cell (NKC) activity, lymphocyte mitogenesis, antibody titers to sheep erythrocytes, peripheral differential leukocyte counts, macrophage phagocytosis and prostaglandin-E[sub 2] (PGE2) production. To investigate potential hormonal-immune axes, dexamethasone (DEX), methimazole, and thyroxine (T4) were used to study the influence of glucocorticoid excess, hypo-, and hyperthyroidism on immunity, respectively. Subsequently, the effects of polychlorinated biphenyls (PCBs, Aroclor 1254) on immune, endocrine, and hepatic cytochrome-P450 function were evaluated and interpreted using results from the endocrine/immune studies. Results of these studies showed that antibody production was susceptible to suppression by DEX at doses which also caused significant changes in clinical plasma biochemistry values. NKC activity was enhanced by exposure to DEX in vivo, a phenomenon due to the inhibition of PGE2 production by adherent peripheral blood cells by DEX and mimicked in vitro with addition of indomethacin or DEX. Macrophage phagocytosis was significantly suppressed by DEX in vitro. Macrophage production of PGE2 ex vivo was suppressed in birds treated with DEX. In contrast to DEX, T4 or methimazole treatment elicited only slight physiologic changes in plasma albumin and cholesterol levels. No immune/thyroid axis was observed in mallards. Exposure to Aroclor 1254 induced significant hepatic microsomal ethoxy- and pentoxy-resorufin-O-deethylase activities in addition to increasing total cytochrome P450 content, but did not affect immune function, plasma corticosterone, or clinical biochemistry values. Total triiodothyronine, but not T4, was dose-dependently suppressed by PCB treatment.

  12. Immunotoxic effects of environmental pollutants in marine mammals.

    PubMed

    Desforges, Jean-Pierre W; Sonne, Christian; Levin, Milton; Siebert, Ursula; De Guise, Sylvain; Dietz, Rune

    2016-01-01

    immune function in marine mammals exposed to environmental contaminants. Exposure to immunotoxic contaminants may have significant population level consequences as a contributing factor to increasing anthropogenic stress in wildlife and infectious disease outbreaks.

  13. Immunotoxic effects of environmental pollutants in marine mammals.

    PubMed

    Desforges, Jean-Pierre W; Sonne, Christian; Levin, Milton; Siebert, Ursula; De Guise, Sylvain; Dietz, Rune

    2016-01-01

    immune function in marine mammals exposed to environmental contaminants. Exposure to immunotoxic contaminants may have significant population level consequences as a contributing factor to increasing anthropogenic stress in wildlife and infectious disease outbreaks. PMID:26590481

  14. Health assessment of gasoline and fuel oxygenate vapors: immunotoxicity evaluation.

    PubMed

    White, Kimber L; Peachee, Vanessa L; Armstrong, Sarah R; Twerdok, Lorraine E; Clark, Charles R; Schreiner, Ceinwen A

    2014-11-01

    Female Sprague Dawley rats were exposed via inhalation to vapor condensates of either gasoline or gasoline combined with various fuel oxygenates to assess potential immunotoxicity of evaporative emissions. Test articles included vapor condensates prepared from "baseline gasoline" (BGVC), or gasoline combined with methyl tertiary butyl ether (G/MTBE), ethyl t-butyl ether (G/ETBE), t-amyl methyl ether (G/TAME), diisopropyl ether (G/DIPE), ethanol (G/EtOH), or t-butyl alcohol (G/TBA). Target concentrations were 0, 2000, 10,000 or 20,000mg/mg(3) administered for 6h/day, 5days/week for 4weeks. The antibody-forming cell (AFC) response to the T-dependent antigen, sheep erythrocyte (sRBC), was used to determine the effects of the gasoline vapor condensates on the humoral components of the immune system. Exposure to BGVC, G/MTBE, G/TAME, and G/TBA did not result in significant changes in the IgM AFC response to sRBC, when evaluated as either specific activity (AFC/10(6) spleen cells) or as total spleen activity (AFC/spleen). Exposure to G/EtOH and G/DIPE resulted in a dose-dependent decrease in the AFC response, reaching the level of statistical significance only at the high 20,000mg/m(3) level. Exposure to G/ETBE resulted in a statistically significant decrease in the AFC response at the middle (10,000mg/m(3)) and high (20,000mg/m(3)) exposure concentrations. PMID:24793263

  15. Health assessment of gasoline and fuel oxygenate vapors: immunotoxicity evaluation.

    PubMed

    White, Kimber L; Peachee, Vanessa L; Armstrong, Sarah R; Twerdok, Lorraine E; Clark, Charles R; Schreiner, Ceinwen A

    2014-11-01

    Female Sprague Dawley rats were exposed via inhalation to vapor condensates of either gasoline or gasoline combined with various fuel oxygenates to assess potential immunotoxicity of evaporative emissions. Test articles included vapor condensates prepared from "baseline gasoline" (BGVC), or gasoline combined with methyl tertiary butyl ether (G/MTBE), ethyl t-butyl ether (G/ETBE), t-amyl methyl ether (G/TAME), diisopropyl ether (G/DIPE), ethanol (G/EtOH), or t-butyl alcohol (G/TBA). Target concentrations were 0, 2000, 10,000 or 20,000mg/mg(3) administered for 6h/day, 5days/week for 4weeks. The antibody-forming cell (AFC) response to the T-dependent antigen, sheep erythrocyte (sRBC), was used to determine the effects of the gasoline vapor condensates on the humoral components of the immune system. Exposure to BGVC, G/MTBE, G/TAME, and G/TBA did not result in significant changes in the IgM AFC response to sRBC, when evaluated as either specific activity (AFC/10(6) spleen cells) or as total spleen activity (AFC/spleen). Exposure to G/EtOH and G/DIPE resulted in a dose-dependent decrease in the AFC response, reaching the level of statistical significance only at the high 20,000mg/m(3) level. Exposure to G/ETBE resulted in a statistically significant decrease in the AFC response at the middle (10,000mg/m(3)) and high (20,000mg/m(3)) exposure concentrations.

  16. Immunotoxicity of dibromoacetic acid administered via drinking water to female B₆C₃F₁ mice.

    PubMed

    Smith, Matthew J; Germolec, Dori R; Luebke, Robert W; Sheth, Christopher M; Auttachoat, Wimolnut; Guo, Tai L; White, Kimber L

    2010-01-01

    Dibromoacetic acid (DBA) is a disinfection by-product commonly found in drinking water as a result of chlorination/ ozonation processes. The Environmental Protection Agency estimates that more than 200 million people consume disinfected water in the United States. This study was conducted to evaluate the potential immunotoxicological effects of DBA exposure when administered for 28 days via drinking water to B₆C₃F₁ mice, at concentrations of 125, 500, and 1000 mg/L. Multiple endpoints were evaluated to assess innate, humoral, and cell-mediated immune components, as well as host resistance. Standard toxicological parameters were unaffected, with the exception of a dose-responsive increase in liver weight and a decrease in thymus weight at the two highest exposure levels. Splenocyte differentials were affected, although the effects were not dose-responsive. Exposure to DBA did not significantly affect humoral immunity (immunoglobulin M [IgM] plaque assay and serum IgM anti-sheep erythrocyte titers) or cell-mediated immunity (mixed-leukocyte response). No effects were observed on innate immune function in either interferon-γ-induced in vitro macrophage cytotoxic activity or basal natural killer (NK)-cell activity. Augmented NK-cell activity (following exposure to polyinosinic-polycytidylic acid) was decreased at the low dose, however the effect was not dose-responsive. Finally, DBA exposure had no effect on resistance to infection with either Streptococcus pneumoniae or Plasmodium yoelii, or challenge with B16F10 melanoma cells. With the exception of changes in thymus weight, these results indicate that DBA exposure resulted in no immunotoxic effects at concentrations much larger than those considered acceptable in human drinking water.

  17. Immunotoxicity testing: Implementation of mechanistic understanding, key pathways of toxicological concern and components of these pathways.

    EPA Science Inventory

    At present, several animal-based assays are used to assess immunotoxic effects such as immunosuppression and sensitization. Growing societal and ethical concerns, European legislation and current research demands by industry are driving animal-based toxicity testing towards new a...

  18. ENVIRONMENTAL POLLUTION AND THE IMMUNE SYSTEM: MECHANISMS OF IMMUNOTOXICITY ACROSS PHYLA

    EPA Science Inventory

    Environmental pollution and the immune system: Mechanisms of immunotoxicity across phyla. Bob Luebke and Dori Germolec, US EPA, RTP, NC and NIEHS, RTP, NC

    Our current understanding of immunotoxicology comes largely from studies done in rodents or using in vitro systems, a...

  19. Correlations between polychlorinated biphenyl immunotoxicity, the aromatic hydrocarbon locus, and liver microsomal enzyme induction in C57BL/6 and DBA/2 mice.

    PubMed

    Silkworth, J B; Antrim, L; Kaminsky, L S

    1984-08-01

    The suppression of the antibody response by polychlorinated biphenyls (PCB) in mice is dependent on the planarity of the PCB molecule and on the expression of the aromatic hydrocarbon (Ah) receptor. In this study, the hypothesis that this form of immunotoxicity is a consequence of the activation of the Ah gene complex and that other compounds which are Ah receptor ligands would also be immunotoxic was tested. 2,2',4,4'-Tetrachlorobiphenyl (TCB), 2,3,3',4,4',5-hexachlorobiphenyl (HCB), phenobarbital (PB), or beta-naphthoflavone (BNF) was given ip to either C57BL/6 (B6,Ahb/Ahb) or DBA/2 (D2, Ahd/Ahd) mice 2 days before immunization with sheep erythrocytes. Organ weights, histopathology, hemagglutinating antibody titers, and the splenic direct antibody plaque-forming cell (PFC) response were evaluated on Day 5. Hepatic aryl hydrocarbon hydroxylase (AHH) induction by these compounds and by 2,2',5,5'-TCB and 3,3',4,4'-TCB was measured as an indicator of Ah receptor binding and subsequent activation of the Ah gene complex by methylcholanthrene-type inducers, while aminopyrine N-demethylase (APND) was measured as an indicator of PB-type induction. 2,2',4,4'-TCB and PB had no effects on the immune parameters of either strain but induced APND activity in both strains. 2,2',5,5'-TCB slightly induced APND activity in B6 mice. 2,3,3',4,4',5-HCB caused a 70% suppression of PFC per spleen, decreased the serum antibody titer, elevated cytochrome P-450 levels (193%), induced both APND (165%) and AHH (217%) activity in B6 mice, but it induced only APND (156%) activity in D2 mice. 3,3',4,4'-TCB elevated cytochrome P-450 levels (210%) and induced both APND (129%) and AHH (321%) activities in B6 mice but only increased APND activities (115%) in D2 mice. BNF elevated cytochrome P-450 (144%), caused a 49% suppression in PFC per spleen, and induced both APND (156%) and AHH (248%) activities but only in B6 mice. These results support the hypothesis that the immunotoxicity caused by

  20. Visualization of the structural changes in plywood and gypsum board during the growth of Chaetomium globosum and Stachybotrys chartarum.

    PubMed

    Lewinska, Anna M; Hoof, Jakob B; Peuhkuri, Ruut H; Rode, Carsten; Lilje, Osu; Foley, Matthew; Trimby, Patrick; Andersen, Birgitte

    2016-10-01

    Fungal growth in indoor environments is associated with many negative health effects. Many studies focus on brown- and white-rot fungi and their effect on wood, but there is none that reveals the influence of soft-rot fungi, such as Stachybotrys spp. and Chaetomium spp., on the structure of building materials such as plywood and gypsum wallboard. This study focuses on using micro-computed tomography (microCT) to investigate changes of the structure of plywood and gypsum wallboard during fungal degradation by S. chartarum and C. globosum. Changes in the materials as a result of dampness and fungal growth were determined by measuring porosity and pore shape via microCT. The results show that the composition of the building material influenced the level of penetration by fungi as shown by scanning electron microscopy (SEM). Plywood appeared to be the most affected, with the penetration of moisture and fungi throughout the whole thickness of the sample. Conversely, fungi grew only on the top cardboard in the gypsum wallboard and they did not have significant influence on the gypsum wallboard structure. The majority of the observed changes in gypsum wallboard occurred due to moisture. This paper suggests that the mycelium distribution within building materials and the structural changes, caused by dampness and fungal growth, depend on the type of the material.

  1. Visualization of the structural changes in plywood and gypsum board during the growth of Chaetomium globosum and Stachybotrys chartarum.

    PubMed

    Lewinska, Anna M; Hoof, Jakob B; Peuhkuri, Ruut H; Rode, Carsten; Lilje, Osu; Foley, Matthew; Trimby, Patrick; Andersen, Birgitte

    2016-10-01

    Fungal growth in indoor environments is associated with many negative health effects. Many studies focus on brown- and white-rot fungi and their effect on wood, but there is none that reveals the influence of soft-rot fungi, such as Stachybotrys spp. and Chaetomium spp., on the structure of building materials such as plywood and gypsum wallboard. This study focuses on using micro-computed tomography (microCT) to investigate changes of the structure of plywood and gypsum wallboard during fungal degradation by S. chartarum and C. globosum. Changes in the materials as a result of dampness and fungal growth were determined by measuring porosity and pore shape via microCT. The results show that the composition of the building material influenced the level of penetration by fungi as shown by scanning electron microscopy (SEM). Plywood appeared to be the most affected, with the penetration of moisture and fungi throughout the whole thickness of the sample. Conversely, fungi grew only on the top cardboard in the gypsum wallboard and they did not have significant influence on the gypsum wallboard structure. The majority of the observed changes in gypsum wallboard occurred due to moisture. This paper suggests that the mycelium distribution within building materials and the structural changes, caused by dampness and fungal growth, depend on the type of the material. PMID:27476483

  2. Immunotoxicity activity of the major essential oils of Valeriana fauriei Briq against Aedes aegypti L.

    PubMed

    Chung, Ill-Min; Kim, Eun-Hye; Moon, Hyung-In

    2011-03-01

    The rhizomes and roots of Valeriana fauriei were extracted and the major essential oil composition and immunotoxicity effects were studied. The analyses were conducted by gas chromatography-mass spectroscopy (GC-MS) revealed that the essential oils of V. fauriei. The V. fauriei essential oil (VFEO) yield was 1.93%, and GC/MS analysis revealed that its major constituents were bornyl acetate (32.83%), terpinyl acetate (3.82%), bornyl isovalerate (2.11%), β-sesquiphellandrene (2.21%), sesquiterpene alcohol (7.32%), and cedrol (2.45%). The essential oil had a significant toxic effect against early fourth-stage larvae of Aedes aegypti L with an LC(50) value of 30.44 ppm and an LC(90) value of 82.64 ppm. The results could be useful in search for newer, safer, and more effective natural immunotoxicity agents against Aedes aegypti L. PMID:20462349

  3. Immunotoxicity activity of the major essential oil of Filipendula glaberrima against Aedes aegypti L.

    PubMed

    Lee, Sung-Jae; Moon, Hyung-In

    2010-12-01

    The aerial parts of Filipendula glaberrima were extracted and the composition and immunotoxicity effects of major essential oils were studied. The analyses conducted by gas chromatography and mass spectroscopy (GC-MS) revealed the essential oils of F. glaberrima. The F. glaberrima essential oil (FGEO) yield was 0.046%, and GC/MS analysis revealed that its major constituents were β-farnesol (2.96%), l-α-terpineol (2.43%), benzenemethanol (2.87%), (Z)-3-hexen-1-ol (5.23%), and 2,6-bis(1,1-dimethylethyl)-4-methylphenol (1.91%). The essential oil had a significant toxic effect against early fourth stage larvae of Aedes aegypti L with an LC(50) value of 28.43 ppm and an LC(90) value of 76.21 ppm. The results could be useful in search for newer, safer, and more effective natural immunotoxicity agents against A. aegypti. PMID:20175741

  4. FR901459, a novel immunosuppressant isolated from Stachybotrys chartarum No. 19392. Taxonomy of the producing organism, fermentation, isolation, physico-chemical properties and biological activities.

    PubMed

    Sakamoto, K; Tsujii, E; Miyauchi, M; Nakanishi, T; Yamashita, M; Shigematsu, N; Tada, T; Izumi, S; Okuhara, M

    1993-12-01

    FR901459, a novel immunosuppressant, has been isolated from the fermentation broth of Stachybotrys chartarum No. 19392. The molecular formula of FR901459 was determined as C62H111N11O13. FR901459 was found to be a member of the cyclosporin family. However, it is structurally distinct from any other cyclosporins discovered so far, in that Leu is present at position 5 instead of Val. FR901459 was capable of prolonging the survival time of skin allografts in rats with one third the potency of cyclosporin A. PMID:8294235

  5. "Fluorescent Cell Chip" for immunotoxicity testing: development of the c-fos expression reporter cell lines.

    PubMed

    Trzaska, Dominika; Zembek, Patrycja; Olszewski, Maciej; Adamczewska, Violetta; Ullerås, Erik; Dastych, Jarosław

    2005-09-01

    The Fluorescent Cell Chip for in vitro immunotoxicity testing employs cell lines derived from lymphocytes, mast cells, and monocytes-macrophages transfected with various EGFP cytokine reporter gene constructs. While cytokine expression is a valid endpoint for in vitro immunotoxicity screening, additional marker for the immediate-early response gene expression level could be of interest for further development and refinement of the Fluorescent Cell Chip. We have used BW.5147.3 murine thymoma transfected with c-fos reporter constructs to obtain reporter cell lines expressing ECFP under the control of murine c-fos promoter. These cells upon serum withdrawal and readdition and incubation with heavy metal compounds showed paralleled induction of c-Fos expression as evidenced by Real-Time PCR and ECFP fluorescence as evidenced by computer-supported fluorescence microscopy. In conclusion, we developed fluorescent reporter cell lines that could be employed in a simple and time-efficient screening assay for possible action of chemicals on c-Fos expression in lymphocytes. The evaluation of usefulness of these cells for the Fluorescent Cell Chip-based detection of immunotoxicity will require additional testing with a larger number of chemicals.

  6. The toxicity of chlorpyrifos on the early life stage of zebrafish: a survey on the endpoints at development, locomotor behavior, oxidative stress and immunotoxicity.

    PubMed

    Jin, Yuanxiang; Liu, Zhenzhen; Peng, Tao; Fu, Zhengwei

    2015-04-01

    Chlorpyrifos (CPF) is one of the most toxic pesticides in aquatic ecosystem, but its toxicity mechanisms to fish are still not fully understood. This study examined the toxicity targets of CPF in early life stage of zebrafish on the endpoints at developmental toxicity, neurotoxicity, oxidative stress and immunotoxicity. Firstly, CPF exposure decreased the body length, inhibited the hatchability and heart rate, and resulted in a number of morphological abnormalities, primarily spinal deformities (SD) and pericardial edema (PE), in larval zebrafish. Secondly, the free swimming activities and the swimming behaviors of the larvae in response to the stimulation of light-to-dark photoperiod transition were significantly influenced by the exposure to 100 and 300 μg/L CPF. In addition, the activity of acetylcholinesterase (AChE) and the transcription of some genes related to neurotoxicity were also influenced by CPF exposure. Thirdly, CPF exposure induced oxidative stress in the larval zebrafish. The malondialdehyde (MDA) levels increased and the glutathione (GSH) contents decreased significantly in a concentration-dependent manner after the exposure to CPF for 96 hours post fertilization (hpf). CPF affected not only the activities of superoxide dismutase (SOD), catalase (CAT), glutathione peroxidase (GPX) and glutathione S-transferase (GST), but also the transcriptional levels of their respective genes. Finally, the mRNA levels of the main cytokines including tumor necrosis factor α (Tnfα), interferon (Ifn), interleukin-1 beta (Il-1β), interleukin 6 (Il6), complement factor 4 (C4) in the larvae increased significantly after the exposure to 100 or 300 μg/L CPF for 96 hpf, suggesting that the innate immune system disturbed by CPF in larvae. Taken together, our results suggested that CPF had the potential to cause developmental toxicity, behavior alterations, oxidative stress and immunotoxicity in the larval zebrafish.

  7. Immunotoxic effects of environmental toxicants in fish - how to assess them?

    PubMed

    Segner, Helmut; Wenger, Michael; Möller, Anja Maria; Köllner, Bernd; Casanova-Nakayama, Ayako

    2011-08-01

    Numerous environmental chemicals, both long-known toxicants such as persistent organic pollutants as well as emerging contaminants such as pharmaceuticals, are known to modulate immune parameters of wildlife species, what can have adverse consequences for the fitness of individuals including their capability to resist pathogen infections. Despite frequent field observations of impaired immunocompetence and increased disease incidence in contaminant-exposed wildlife populations, the potential relevance of immunotoxic effects for the ecological impact of chemicals is rarely considered in ecotoxicological risk assessment. A limiting factor in the assessment of immunotoxic effects might be the complexity of the immune system what makes it difficult (1) to select appropriate exposure and effect parameters out of the many immune parameters which could be measured, and (2) to evaluate the significance of the selected parameters for the overall fitness and immunocompetence of the organism. Here, we present - on the example of teleost fishes - a brief discussion of how to assess chemical impact on the immune system using parameters at different levels of complexity and integration: immune mediators, humoral immune effectors, cellular immune defenses, macroscopical and microscopical responses of lymphoid tissues and organs, and host resistance to pathogens. Importantly, adverse effects of chemicals on immunocompetence may be detectable only after immune system activation, e.g., after pathogen challenge, but not in the resting immune system of non-infected fish. Current limitations to further development and implementation of immunotoxicity assays and parameters in ecotoxicological risk assessment are not primarily due to technological constraints, but are related from insufficient knowledge of (1) possible modes of action in the immune system, (2) the importance of intra- and inter-species immune system variability for the response against chemical stressors, and (3

  8. Immunotoxicity of aflatoxin B1: Impairment of the cell-mediated response to vaccine antigen and modulation of cytokine expression

    SciTech Connect

    Meissonnier, Guylaine M.; Pinton, Philippe; Laffitte, Joelle; Cossalter, Anne-Marie; Gong, Yun Yun; Wild, Christopher P.; Bertin, Gerard; Galtier, Pierre; Oswald, Isabelle P.

    2008-09-01

    Aflatoxin B1 (AFB1), a mycotoxin produced by Aspergillus flavus or A. parasiticus, is a frequent contaminant of food and feed. This toxin is hepatotoxic and immunotoxic. The present study analyzed in pigs the influence of AFB1 on humoral and cellular responses, and investigated whether the immunomodulation observed is produced through interference with cytokine expression. For 28 days, pigs were fed a control diet or a diet contaminated with 385, 867 or 1807 {mu}g pure AFB1/kg feed. At days 4 and 15, pigs were vaccinated with ovalbumin. AFB1 exposure, confirmed by an observed dose-response in blood aflatoxin-albumin adduct, had no major effect on humoral immunity as measured by plasma concentrations of total IgA, IgG and IgM and of anti-ovalbumin IgG. Toxin exposure did not impair the mitogenic response of lymphocytes but delayed and decreased their specific proliferation in response to the vaccine antigen, suggesting impaired lymphocyte activation in pigs exposed to AFB1. The expression level of pro-inflammatory (TNF-{alpha}, IL-1{beta}, IL-6, IFN-{gamma}) and regulatory (IL-10) cytokines was assessed by real-time PCR in spleen. A significant up-regulation of all 5 cytokines was observed in spleen from pigs exposed to the highest dose of AFB1. In pigs exposed to the medium dose, IL-6 expression was increased and a trend towards increased IFN-{gamma} and IL-10 was observed. In addition we demonstrate that IL-6 impaired in vitro the antigenic- but not the mitogenic-induced proliferation of lymphocytes from control pigs vaccinated with ovalbumin. These results indicate that AFB1 dietary exposure decreases cell-mediated immunity while inducing an inflammatory response. These impairments in the immune response could participate in failure of vaccination protocols and increased susceptibility to infections described in pigs exposed to AFB1.

  9. Immunotoxicity of aflatoxin B1: impairment of the cell-mediated response to vaccine antigen and modulation of cytokine expression.

    PubMed

    Meissonnier, Guylaine M; Pinton, Philippe; Laffitte, Joëlle; Cossalter, Anne-Marie; Gong, Yun Yun; Wild, Christopher P; Bertin, Gérard; Galtier, Pierre; Oswald, Isabelle P

    2008-09-01

    Aflatoxin B1 (AFB1), a mycotoxin produced by Aspergillus flavus or A. parasiticus, is a frequent contaminant of food and feed. This toxin is hepatotoxic and immunotoxic. The present study analyzed in pigs the influence of AFB1 on humoral and cellular responses, and investigated whether the immunomodulation observed is produced through interference with cytokine expression. For 28 days, pigs were fed a control diet or a diet contaminated with 385, 867 or 1807 microg pure AFB1/kg feed. At days 4 and 15, pigs were vaccinated with ovalbumin. AFB1 exposure, confirmed by an observed dose-response in blood aflatoxin-albumin adduct, had no major effect on humoral immunity as measured by plasma concentrations of total IgA, IgG and IgM and of anti-ovalbumin IgG. Toxin exposure did not impair the mitogenic response of lymphocytes but delayed and decreased their specific proliferation in response to the vaccine antigen, suggesting impaired lymphocyte activation in pigs exposed to AFB1. The expression level of pro-inflammatory (TNF-alpha, IL-1beta, IL-6, IFN-gamma) and regulatory (IL-10) cytokines was assessed by real-time PCR in spleen. A significant up-regulation of all 5 cytokines was observed in spleen from pigs exposed to the highest dose of AFB1. In pigs exposed to the medium dose, IL-6 expression was increased and a trend towards increased IFN-gamma and IL-10 was observed. In addition we demonstrate that IL-6 impaired in vitro the antigenic- but not the mitogenic-induced proliferation of lymphocytes from control pigs vaccinated with ovalbumin. These results indicate that AFB1 dietary exposure decreases cell-mediated immunity while inducing an inflammatory response. These impairments in the immune response could participate in failure of vaccination protocols and increased susceptibility to infections described in pigs exposed to AFB1.

  10. Immunotoxicity and genotoxicity testing for in-flight experiments under microgravity

    NASA Astrophysics Data System (ADS)

    Hansen, Peter-Diedrich; Hansen, Peter-Diedrich; Unruh, Eckehardt

    Life Sciences as Related to Space (F) Influence of Spaceflight Environment on Biological Systems (F44) Immunotoxicity and genotoxicity testing for In-flight experiments under microgravity Sensing approaches for ecosystem and human health Author: Peter D. Hansen Technische Universit¨t Berlin, Faculty VI - Planen, Bauen, Umwelt, a Institute for Ecological Research and Technology, Department for Ecotoxicology, Berlin, Germany Peter-diedrich.hansen@tu-berlin.de Eckehardt Unruh Technische Universit¨t Berlin, Faculty VI - Planen, Bauen, Umwelt, Institute a for Ecological Research and Technology, Department for Ecotoxicology, Berlin, Germany An immune response by mussel hemocytes is the selective reaction to particles which are identified as foreign by its immune system shown by phagocytosis. Phagocytotic activity is based on the chemotaxis and adhesion, ingestion and phagosome formation. The attachment at the surface of the hemocytes and consequently the uptake of the particles or bacteria can be directly quantified in the format of a fluorescent assay. Another relevant endpoint of phagocytosis is oxidative burst measured by luminescence. Phagocytosis-related production of ROS will be stimulated with opsonised zymosan. The hemocytes will be stored frozen at -80oC and reconstituted in-flight for the experiment. The assay system of the TRIPLELUX-B Experiment has been performed with a well-defined quantification and evaluation of the immune function phagocytosis. The indicator cells are the hemocytes of blue mussels (Mytilus edulis). The signals of the immuno cellular responses are translated into luminescence as a rapid optical reporter system. The results expected will determine whether the observed responses are caused by microgravity and/or radiation (change in permeability, endpoints in genotoxicity: DNA unwinding). The samples for genotoxicity will be processed after returning to earth. The immune system of invertebrates has not been studied so far in space. The

  11. Validation of an eight parameter immunophenotyping panel in adult canines for assessment of immunotoxicity.

    PubMed

    Zeigler, Brandon M; Boyle-Holmes, Yvonne; Falzone, Deanna; Farmer, John

    2013-07-15

    Analysis of peripheral blood leukocyte populations by flow cytometry in adult beagles is a critical component of immunotoxicity assessment in regulated pre-clinical toxicology studies. In this study, data is presented utilizing a single panel, six-color method to simultaneously enumerate absolute cell counts and determine the relative percentage of leukocytes. A GLP validation was performed to determine intra- and inter-assay variance, inter-instrument variance, and pre- and post-fixation stability for the target populations. The results demonstrated all samples met acceptance criteria, CV values less than 25%, for all precision and stability intervals assessed. The intra and inter-assay data demonstrated the single panel method generated acceptable precision. Furthermore, stability results indicated whole blood samples and processed samples may be stored without a statistically significant difference in the data compared to samples immediately processed and analyzed after blood collection. This assay will provide researchers a more precise and efficient tool to evaluate the immunotoxic effects of a test article on canine peripheral blood leukocytes during pre-clinical drug testing.

  12. Ecological impacts of the deepwater horizon oil spill: implications for immunotoxicity.

    PubMed

    Barron, Mace G

    2012-01-01

    The Deepwater Horizon (DWH) oil spill was the largest environmental disaster and response effort in U.S. history, with nearly 800 million liters of crude oil spilled. Vast areas of the Gulf of Mexico were contaminated with oil, including deep-ocean communities and over 1,600 kilometers of shoreline. Multiple species of pelagic, tidal, and estuarine organisms; sea turtles; marine mammals; and birds were affected, and over 20 million hectares of the Gulf of Mexico were closed to fishing. Several large-scale field efforts were performed, including assessments of shoreline and wildlife oiling and of coastal waters and sediments. The assessment of injuries, damages, and restoration options for the DWH spill is ongoing. Although petroleum and the polycyclic aromatic hydrocarbon component of oils are known to affect the immune systems of aquatic organisms and wildlife, immunotoxicity is not typically assessed during oil spills and has not been a focus of the DHW assessment. The effects of oil spill contaminants on immune responses are variable and often exposure dependent, but immunotoxic effects seem likely from the DHW spill based on the reported effects of a variety of oils on both aquatic and wildlife species.

  13. Immunotoxicity activity from the essential oils of coriander (Coriandrum sativum) seeds.

    PubMed

    Chung, Ill-Min; Ahmad, Ateeque; Kim, Eun-Hye; Kim, Seung-Hyun; Jung, Woo-Suk; Kim, Jin-Hoi; Nayeem, Abdul; Nagella, Praveen

    2012-06-01

    The seeds of the Coriandrum sativum were extracted and the essential oil composition and immunotoxicity effects were studied. The analysis of the essential oil was conducted by gas chromatography-mass spectroscopy, which revealed 33 components, representing 99.99% of the total oil from the seeds of coriander. The major components are linalool (55.09%), α-pinene (7.49%), 2,6-Octadien-1-ol, 3,7-dimethyl-, acetate, (E)- (5.70%), geraniol (4.83%), 3-Cyclohexene-1-methanol, α,α,4-trimethyl- (4.72%), hexadecanoic acid (2.65%), tetradecanoic acid (2.49%), 2-α-pinene (2.39%), citronellyl acetate (1.77%), and undecanal (1.29%). The seed oil had significant toxic effects against the larvae of Aedes aegypti with an LC(50) value of 21.55 ppm and LC(90) value of 38.79 ppm. The above data indicate that the major components in the essential oil of coriander play an important role as immunotoxicity on the A. aegypti.

  14. Optimal Method to Stimulate Cytokine Production and Its Use in Immunotoxicity Assessment

    PubMed Central

    Ai, Wenchao; Li, Haishan; Song, Naining; Li, Lei; Chen, Huiming

    2013-01-01

    Activation of lymphocytes can effectively produce a large amount of cytokines. The types of cytokines produced may depend on stimulating reagents and treatments. To find an optimal method to stimulate cytokine production and evaluate its effect on immunotoxicity assessments, the authors analyzed production of IL-2, IL-4, IL-6, IL-10, IL-13, IFN-γ, TNF-α, GM-CSF, RANTES and TGF-β in undiluted rat whole blood culture (incubation for 0, 2, 4, 6, 8 or 10 h) with different concentrations of PMA/ionomycin, PHA, Con A, LPS and PWM. We also evaluated the effects of cyclosporin A and azathioprine on cytokine production. The results revealed a rapid increase of IL-2, IFN-γ, TNF-α, RANTES and TGF-β secretion within 6 h after stimulation with 25 ng/mL PMA and 1 μg/mL ionomycin. The inhibition of these cytokine profiles reflected the effects of immunosuppressants on the immune system. Therefore, the results of this is study recommend the detection of cytokine profiles in undiluted whole blood stimulated 6 h with 25 ng/mL PMA and 1 μg/mL ionomycin as a powerful immunotoxicity assessment method. PMID:23985769

  15. Immunotoxicity of the organochlorine pesticide methoxychlor in female ICR, BALB/c, and C3H/He mice.

    PubMed

    Hayashi, Koichi; Fukuyama, Tomoki; Ohnuma, Aya; Tajima, Yukari; Kashimoto, Yukiko; Yoshida, Toshinori; Kosaka, Tadashi

    2013-01-01

    Several types of pesticides, including organochlorines, are known to suppress or modulate immune responses. The present study evaluated the immunotoxicity of the organochlorine pesticide methoxychlor (MXC) in female BALB/c, C3H/He, and ICR mice. Mice were given oral MXC doses of 0, 30, 100, and 300 mg/kg each day for 7 consecutive days. On day 4, the mice also received an intravenous injection of sheep red blood cells (SRBC). The splenic plaque-forming cell (PFC) IgM response and the serum anti-SRBC IgM antibody titer were evaluated while splenic lymphocytes were counted by flow cytometry and the spleen underwent histopathological analysis. Significant decreases in IgM PFC responses were seen in BALB/c, C3H/He, and ICR mice that received MXC doses of 100 and 300 mg/kg. Similar changes in serum anti-SRBC IgM antibody titers occurred in three strain mice. Flow cytometric analysis revealed significantly decreased splenic T-cell (CD3+) populations in a dose dependent manner in BALB/c mice, and in the 300 mg/kg of MXC-treated group of C3H/He mice. Germinal center (GC) B-cell (CD19+PNA+) populations were significantly decreased in the 300 mg/kg of MXC-treated groups of all three mouse strains and in the 30 and 100 mg/kg of MXC-treated groups of BALB/c and C3H/He strain mice. Histopathological analysis revealed decreased cellularity of the periarteriolar lymphoid sheath (PALS; T-cell area) and decreased GC development in all three strains of mice treated with 300 mg/kg MXC. These results suggest that MXC has an immune-suppressive effect in mice, and that our protocol may be useful for rapidly detecting immunosuppression induced by environmental chemicals.

  16. Acute and subchronic toxic effects of atrazine and chlorpyrifos on common carp (Cyprinus carpio L.): Immunotoxicity assessments.

    PubMed

    Xing, Houjuan; Liu, Tao; Zhang, Ziwei; Wang, Xiaolong; Xu, Shiwen

    2015-08-01

    Atrazine (ATR) and chlorpyrifos (CPF) are widely used pesticides in agricultural practices throughout world. It has resulted in a series of toxicological and environmental problems, such as impacts on many non-target aquatic species, including fish. The spleen and head kidney in the bony fish are the major hematopoietic organs, and play a crucial part in immune responses. This study evaluated the subchronic effects of ATR and CPF on the mRNA and protein levels of HSP60, HSP70 and HSP90 in the immune organs of common carp and compared the acute and subchronic effects of ATR and CPF on the swimming speed (SS) of common carp. The results of acute toxicity tests showed that the 96 h-LC50 of ATR and CPF for common carp was determined to be 2.142 and 0.582 mg/L, respectively. Meanwhile, acute and subacute toxicity of ATR and CPF in common carp resulted in hypoactivity. We also found that the mRNA and protein levels of HSP60, HSP70 and HSP90 genes were induced in the spleen and head kidney of common carp exposed to ATR and CPF in the subchronic toxicity test. Our results indicate that ATR and CPF are highly toxic to common carp, and hypoactivity in common carp by acute and subchronic toxicity of ATR and CPF may provide a useful tool for assessing the toxicity of triazine herbicide and organophosphorous pesticides to aquatic organisms. In addition, the results from the subchronic toxicity test exhibited that increasing concentration of ATR and CPF in the environment causes considerable stress for common carp, suggesting that ATR and CPF exposure cause immunotoxicity to common carp.

  17. Immunotoxicity of washing soda in a freshwater sponge of India.

    PubMed

    Mukherjee, Soumalya; Ray, Mitali; Ray, Sajal

    2015-03-01

    The natural habitat of sponge, Eunapius carteri faces an ecotoxicological threat of contamination by washing soda, a common household cleaning agent of India. Washing soda is chemically known as sodium carbonate and is reported to be toxic to aquatic organisms. Domestic effluent, drain water and various human activities in ponds and lakes have been identified as the major routes of washing soda contamination of water. Phagocytosis and generation of cytotoxic molecules are important immunological responses offered by the cells of sponges against environmental toxins and pathogens. Present study involves estimation of phagocytic response and generation of cytotoxic molecules like superoxide anion, nitric oxide and phenoloxidase in E. carteri under the environmentally realistic concentrations of washing soda. Sodium carbonate exposure resulted in a significant decrease in the phagocytic response of sponge cells under 4, 8, 16 mg/l of the toxin for 96h and all experimental concentrations of the toxin for 192h. Washing soda exposure yielded an initial increase in the generation of the superoxide anion and nitric oxide followed by a significant decrease in generation of these cytotoxic agents. Sponge cell generated a high degree of phenoloxidase activity under the experimental exposure of 2, 4, 8, 16 mg/l of sodium carbonate for 96 and 192 h. Washing soda induced alteration of phagocytic and cytotoxic responses of E. carteri was indicative to an undesirable shift in their immune status leading to the possible crises of survival and propagation of sponges in their natural habitat.

  18. Immunotoxicity assessment for the novel Spleen tyrosine kinase inhibitor R406

    SciTech Connect

    Zhu Yanhong; Herlaar, Ellen; Masuda, Esteban S.; Burleson, Gary R.; Nelson, Andrew J.; Grossbard, Elliott B.; Clemens, George R. . E-mail: gclemens@rigel.com

    2007-06-15

    Spleen tyrosine kinase (Syk) is a novel pharmaceutical target for treatment of allergic, autoimmune, and neoplastic disorders. Previous studies have indicated that Syk signaling plays critical roles in regulating the lymphohematopoietic system. These observations prompted us to investigate whether inhibition of Syk would promote immunotoxicity. In a series of studies, rats were treated orally with R406, at dose levels up to and including 100 mg/kg/day (or its prodrug R788 at dose levels up to and including 100 mg/kg/day, reduced to 50 mg/kg/day for females as MTD was exceeded), a potent Syk inhibitor, twice daily for 28 days. In addition to standard toxicological assessments, immunophenotyping by flow cytometric analysis, and a study of humoral immune response measuring anti-KLH IgM and IgG levels, were undertaken. Other immunotoxicity studies included three host resistance models in female Balb/c mice to further ascertain effects of R406 on innate and acquired immunity. Following R406 treatment, expected immunomodulating effects (e.g., decreased thymic and spleen weight, hypocellularity of bone marrow, and reduced lymphocyte counts, including T and B cells) were observed in the rat studies. These changes essentially resolved during a 14-day treatment-free recovery period. A KLH challenge in rats demonstrated no adverse effects on IgG or IgM response. R788/406, administered orally at dose levels up to and including 80 mg/kg/day for 28 days, did not affect bacterial or viral clearance in the Listeria, Streptococcal, or Influenza host resistance mouse models, respectively. This correlated with previous in vitro macrophage and neutrophil function assays (assessing migration, phagocytosis, oxidative burst and microbicidal activity), which revealed that R406 did not adversely affect macrophage or neutrophil function in innate immune responses. Collectively, these results demonstrate that R406 has minimal functional immunotoxicity notwithstanding its lymphocytopenic

  19. Immunotoxicity of silicon dioxide nanoparticles with different sizes and electrostatic charge.

    PubMed

    Kim, Jae-Hyun; Kim, Cheol-Su; Ignacio, Rosa Mistica Coles; Kim, Dong-Heui; Sajo, Ma Easter Joy; Maeng, Eun Ho; Qi, Xu-Feng; Park, Seong-Eun; Kim, Yu-Ri; Kim, Meyoung-Kon; Lee, Kyu-Jae; Kim, Soo-Ki

    2014-01-01

    Silicon dioxide (SiO2) nanoparticles (NPs) have been widely used in the biomedical field, such as in drug delivery and gene therapy. However, little is known about the biological effects and potential hazards of SiO2. Herein, the colloidal SiO2 NPs with two different sizes (20 nm and 100 nm) and different charges (L-arginine modified: SiO2 (EN20[R]), SiO2 (EN100[R]); and negative: SiO2 (EN20[-]), SiO2 (EN100[-]) were orally administered (750 mg/kg/day) in female C57BL/6 mice for 14 days. Assessments of immunotoxicity include hematology profiling, reactive oxygen species generation and their antioxidant effect, stimulation assays for B- and T-lymphocytes, the activity of natural killer (NK) cells, and cytokine profiling. In vitro toxicity was also investigated in the RAW 264.7 cell line. When the cellularity of mouse spleen was evaluated, there was an overall decrease in the proliferation of B- and T-cells for all the groups fed with SiO2 NPs. Specifically, the SiO2 (EN20(-)) NPs showed the most pronounced reduction. In addition, the nitric oxide production and NK cell activity in SiO2 NP-fed mice were significantly suppressed. Moreover, there was a decrease in the serum concentration of inflammatory cytokines such as interleukin (IL)-1β, IL-12 (p70), IL-6, tumor necrosis factor-α, and interferon-γ. To elucidate the cytotoxicity mechanism of SiO2 in vivo, an in vitro study using the RAW 264.7 cell line was performed. Both the size and charge of SiO2 using murine macrophage RAW 264.7 cells decreased cell viability dose-dependently. Collectively, our data indicate that different sized and charged SiO2 NPs would cause differential immunotoxicity. Interestingly, the small-sized and negatively charged SiO2 NPs showed the most potent in vivo immunotoxicity by way of suppressing the proliferation of lymphocytes, depressing the killing activity of NK cells, and decreasing proinflammatory cytokine production, thus leading to immunosuppression.

  20. Immunotoxicity of silicon dioxide nanoparticles with different sizes and electrostatic charge

    PubMed Central

    Kim, Jae-Hyun; Kim, Cheol-Su; Ignacio, Rosa Mistica Coles; Kim, Dong-Heui; Sajo, Ma Easter Joy; Maeng, Eun Ho; Qi, Xu-Feng; Park, Seong-Eun; Kim, Yu-Ri; Kim, Meyoung-Kon; Lee, Kyu-Jae; Kim, Soo-Ki

    2014-01-01

    Silicon dioxide (SiO2) nanoparticles (NPs) have been widely used in the biomedical field, such as in drug delivery and gene therapy. However, little is known about the biological effects and potential hazards of SiO2. Herein, the colloidal SiO2 NPs with two different sizes (20 nm and 100 nm) and different charges (L-arginine modified: SiO2EN20[R], SiO2EN100[R]; and negative: SiO2EN20[−], SiO2EN100[−] were orally administered (750 mg/kg/day) in female C57BL/6 mice for 14 days. Assessments of immunotoxicity include hematology profiling, reactive oxygen species generation and their antioxidant effect, stimulation assays for B- and T-lymphocytes, the activity of natural killer (NK) cells, and cytokine profiling. In vitro toxicity was also investigated in the RAW 264.7 cell line. When the cellularity of mouse spleen was evaluated, there was an overall decrease in the proliferation of B- and T-cells for all the groups fed with SiO2 NPs. Specifically, the SiO2EN20(−) NPs showed the most pronounced reduction. In addition, the nitric oxide production and NK cell activity in SiO2 NP-fed mice were significantly suppressed. Moreover, there was a decrease in the serum concentration of inflammatory cytokines such as interleukin (IL)-1β, IL-12 (p70), IL-6, tumor necrosis factor-α, and interferon-γ. To elucidate the cytotoxicity mechanism of SiO2 in vivo, an in vitro study using the RAW 264.7 cell line was performed. Both the size and charge of SiO2 using murine macrophage RAW 264.7 cells decreased cell viability dose-dependently. Collectively, our data indicate that different sized and charged SiO2 NPs would cause differential immunotoxicity. Interestingly, the small-sized and negatively charged SiO2 NPs showed the most potent in vivo immunotoxicity by way of suppressing the proliferation of lymphocytes, depressing the killing activity of NK cells, and decreasing proinflammatory cytokine production, thus leading to immunosuppression. PMID:25565836

  1. Effect of CYP2E1 induction by ethanol on the immunotoxicity and genotoxicity of extended low-level benzene exposure.

    PubMed

    Daiker, D H; Shipp, B K; Schoenfeld, H A; Klimpel, G R; Witz, G; Moslen, M T; Ward, J B

    2000-02-11

    Potential additive effects of ethanol consumption, a common life-style factor, and low-level benzene exposure, a ubiquitous environmental pollutant, were investigated. Ethanol is a potent inducer of the cytochrome P-450 2E1 (CYP2E1) enzyme, which bioactivates benzene to metabolites with known genotoxicity and immunotoxicity. A liquid diet containing 4.1% ethanol was used to induce hepatic CYP2E1 activity by 4-fold in female CD-1 mice. Groups of ethanol-treated or pair-fed control mice were exposed to benzene or filtered air in inhalation chambers for 7 h/d, 5 d/wk for 6 or 11 wk. The initial experiment focused on immunotoxicity endpoints based on literature reports that ethanol enhances high-dose benzene effects on spleen, thymus, and bone marrow cellularity and on peripheral red blood cell (RBC) and white blood cell (WBC) counts. No statistically significant alterations were found in spleen lymphocyte cellularity, subtype profile, or function (mitogen-induced proliferation, cytokine production, or natural killer cell lytic activity) after 6 wk of ethanol diet, 0.44 ppm benzene exposure, or both. This observed absence of immunomodulation by ethanol alone, a potential confounding factor, further validates our previously established murine model of sustained CYP2E1 induction by dietary ethanol. Subsequent experiments involved a 10-fold higher benzene level for a longer time of 11 wk and focused on genotoxic endpoints in known target tissues. Bone marrow and spleen cells were evaluated for DNA-protein cross-links, a sensitive transient index of genetic damage, and spleen lymphocytes were monitored for hprt-mutant frequency, a biomarker of cumulative genetic insult. No treatment-associated changes in either genotoxic endpoint were detected in animals exposed to 4.4 ppm benzene for 6 or 11 wk with or without coexposure to ethanol. Thus, our observations suggest an absence of genetic toxicity in CD-1 mice exposed to environmentally relevant levels of benzene with or

  2. In situ (mesocosm) assessment of immunotoxicity risks to small mammals inhabiting petrochemical waste sites.

    PubMed

    Propst, T L; Lochmiller, R L; Qualls, C W; McBee, K

    1999-02-01

    Oil refineries inadvertently deposit a variety of complex mixtures of organic hydrocarbons and heavy metals in the soil, many of which are thought to be potent immunotoxicants. Terrestrial ecosystems such as this have not been adequately investigated with respect to wild rodent populations. The primary objective of this study was to use mesocosms to assess the immunotoxicity risks to feral small mammal populations associated with soils contaminated with petroleum refinery wastes. A series of 4-week and 8-week exposure trials using laboratory raised cotton rats (Sigmodon hispidus) were conducted in situ on three contaminated and three reference sites on the Oklahoma Refining Company Superfund Waste Site, Cyril, Oklahoma. Cotton rats exposed to these soils showed significant alterations in selected morphological traits, in vivo humoral immune responses, complement activity, and macrophage activity. However, immune alterations were not great, suggesting that resident small mammals may be a better biomonitoring choice than using mesocosms.

  3. Composition and immunotoxicity activity of essential oils from Lindera obtusiloba Blume against Aedes aegypti L.

    PubMed

    Chung, Ill-Min; Moon, Hyung-In

    2011-03-01

    The leaves of Lindera obtusiloba Blume var. obtusiloba were extracted and the major essential oil composition and immunotoxicity effects were studied. The analyses were conducted by gas chromatography and mass spectroscopy (GC-MS) revealed that the essential oils of L. obtusiloba. The L. obtusiloba essential oil yield was 4.23%, and GC/MS analysis revealed that its major constituents were α-copaene (31.42%), β-caryophyllene (32.11%), α-humulene (4.12%), β-farnesene (4.15%), α- cadinene (3.21%) and Nerolidol (6.84%). The essential oil had a significant toxic effect against early fourth-stage larvae of Aedes aegypti L with an LC(50) value of 24.32 ppm and an LC(90) value of 36.42 ppm. PMID:20477554

  4. Immunotoxicity of β-Diketone Antibiotic Mixtures to Zebrafish (Danio rerio) by Transcriptome Analysis

    PubMed Central

    Li, Fanghui; Wang, Hui; Liu, Jinfeng; Lin, Jiebo; Zeng, Aibing; Ai, Weiming; Wang, Xuedong; Dahlgren, Randy A.; Wang, Huili

    2016-01-01

    Fluoroquinolones and tetracyclines are known as β-diketone antibiotics (DKAs) because of bearing a diketone group in their molecular structure. DKAs are the most widely used antibiotics to prevent generation of disease in humans and animals and to suppress bacterial growth in aquaculture. In recent years, overuse of DKAs has caused serious environmental risk due to their pseudo-persistence in the environment, even though their half-lives are not long. So far, no reports were concerned with the joint immunotoxicity of DKAs. Herein, we reported on the immunotoxicity of DKAs on zebrafish after a 3-month DKAs exposure using transcriptomic techniques. According to transcriptome sequencing, 10 differentially expressed genes were screened out among the genes related to KEGG pathways with high enrichment. The identified 7 genes showed to be consistent between RNA-seq and qRT-PCR. Due to DKAs exposure, the content or activity for a series of immune-related biomarkers (Complement 3, lysozyme, IgM and AKP) showed the inconsistent changing trends as compared with the control group. Histopathological observations showed that the number of goblet cells increased sharply, the columnar epithelial cells swelled, the nucleus became slender in intestinal villi, and numerous brown metachromatic granules occurred in spleens of DKAs-exposed groups. Overall, both detection of biomarkers and histopathological observation corroborated that chronic DKAs exposure could result in abnormal expression of immune genes and enzymes, and variable levels of damage to immune-related organs. These complex effects of DKAs may lead to zebrafish dysfunction and occurrence of diseases related to the immune system. PMID:27046191

  5. Overlapping gene expression profiles of model compounds provide opportunities for immunotoxicity screening

    SciTech Connect

    Baken, Kirsten A. Pennings, Jeroen L.A.; Jonker, Martijs J.; Schaap, Mirjam M.; Vries, Annemieke de; Steeg, Harry van; Breit, Timo M.; Loveren, Henk van

    2008-01-01

    In order to investigate immunotoxic effects of a set of model compounds in mice, a toxicogenomics approach was combined with information on macroscopical and histopathological effects on spleens and on modulation of immune function. Bis(tri-n-butyltin)oxide (TBTO), cyclosporin A (CsA), and benzo[a]pyrene (B[a]P) were administered to C57BL/6 mice at immunosuppressive dose levels. Acetaminophen (APAP) was included in the study since indications of immunomodulating properties of this compound have appeared in the literature. TBTO exposure caused the most pronounced effect on gene expression and also resulted in the most severe reduction of body weight gain and induction of splenic irregularities. All compounds caused inhibition of cell division in the spleen as shown by microarray analysis as well as by suppression of lymphocyte proliferation after application of a contact sensitizer as demonstrated in an immune function assay that was adapted from the local lymph node assay. The immunotoxicogenomics approach applied in this study thus pointed to immunosuppression through cell cycle arrest as a common mechanism of action of immunotoxicants, including APAP. Genes related to cell division such as Ccna2, Brca1, Birc5, Incenp, and Cdkn1a (p21) were identified as candidate genes to indicate anti-proliferative effects of xenobiotics in immune cells for future screening assays. The results of our experiments also show the value of group wise pathway analysis for detection of more subtle transcriptional effects and the potency of evaluation of effects in the spleen to demonstrate immunotoxicity.

  6. Enteric reovirus infection as a probe to study immunotoxicity of the gastrointestinal tract.

    PubMed

    Cuff, C F; Fulton, J R; Barnett, J B; Boyce, C S

    1998-04-01

    The gastrointestinal (GI) tract contains a complex immune system that defends the host against a wide range of pathogens and toxins. The GI tract is also exposed to many environmental toxins that could adversely affect intestinal immunity, and few systems to study immunotoxicity of the GI tract have been described. We demonstrate that intestinal reovirus infection can be used as a system to assess the effects of toxins on intestinal and systemic immunity. Mice were given various doses of cyclophosphamide (CY) for 5 days at doses ranging from 100 to 500 mg/kg by the oral route or 200 mg/kg by the intraperitoneal route. On day 3 of dosing, mice were orally infected with reovirus serotype 1, strain Lang. The effects of CY on viral clearance, intestinal and systemic immune responses, and distribution of intestinal lymphocytes were assessed. Mice treated with CY failed to clear the virus in a dose-dependent manner, and serum anti-reovirus antibody titers were suppressed. Virus-specific IgA in cultures of intestinal tissue from CY-treated mice was significantly reduced compared to controls, although total IgA production was not affected. The virus-specific cytotoxic T-cell response in spleen was also suppressed in CY-treated animals. Cyclophosphamide treatment reduced the number and percentage of B-cells in Peyer's patches. Reovirus infection did not increase cellularity of Peyer's patches in CY-treated mice. Cyclophosphamide treatment also had little effect on the phenotype of intestinal intraepithelial lymphocytes. These data demonstrate that intestinal reovirus infection is useful in studying exposure of the GI tract to immunotoxic agents. PMID:9579022

  7. A role for associated transition metals in the immunotoxicity of inhaled ambient particulate matter.

    PubMed Central

    Zelikoff, Judith T; Schermerhorn, Kimberly R; Fang, Kaijie; Cohen, Mitchell D; Schlesinger, Richard B

    2002-01-01

    Epidemiologic studies demonstrate that infection, specifically pneumonia, contributes substantially to the increased morbidity and mortality among elderly individuals following exposure to ambient particulate matter (PM). This laboratory has previously demonstrated that a single inhalation exposure of Streptococcus pneumoniae-infected rats to concentrated ambient PM(2.5) (particulate matter with aerodynamic diameter < or =2.5 microm) from New York City (NYC) air exacerbates the infection process and alters pulmonary and systemic immunity. Although these results provide some basis for explaining the epidemiologic findings, the identity of specific PM constituents that might have been responsible for the worsening pneumonia in exposed hosts remains unclear. Thus, studies were performed to correlate the physicochemical attributes of ambient PM(2.5) with its in vivo immunotoxicity to identify and characterize the role of constitutive transition metals in exacerbating an ongoing streptococcal infection. Uninfected or previously infected rats were exposed in the laboratory to soluble divalent Fe, Mn, or Ni chloride salts. After exposure, uninfected rats were sacrificed and their lungs were lavaged. Lungs from infected hosts were used to evaluate changes in bacterial clearance and effects of exposure on the extent/severity of infection. Results demonstrated that inhalation of Fe altered innate and adaptive immunity in uninfected hosts, and both Fe and Ni reduced pulmonary bacterial clearance in previously infected rats. The effects on clearance produced in infected Fe-exposed rats were similar to those seen in infected rats exposed to ambient NYC PM. Taken together, these studies demonstrate that inhaled ambient PM can worsen the outcome of an ongoing pulmonary infection and that associated Fe may play some role in the immunotoxicity. PMID:12426150

  8. Immunotoxicity Studies

    EPA Science Inventory

    Immunotoxicology is a subdiscipline of toxicology that focuses on unintended modulation of the immune system. Effects that may occur include immunosuppression, immunostimulation, hypersensitivity, or autoimmunity, which may result in outcomes such as increased incidences of infec...

  9. Developmental Immunotoxicity

    EPA Science Inventory

    Animal models suggest that the immature immune system is more susceptible to xenobiotics than the fully mature system, and sequelae of developmental immunotoxicant exposure may be persistent well into adulthood. Immune maturation may be delayed by xenobiotic exposure and recover...

  10. Effects of immunotoxic activity of the major essential oil of Angelica purpuraefolia Chung against Aedes aegypti L.

    PubMed

    Park, Yool-Jin; Chung, Ill-Min; Moon, Hyung-In

    2010-12-01

    The rhizomes parts of Angelica purpuraefolia were extracted and the major essential oils composition and immunotoxic effects were studied. The analyses were conducted by gas chromatography and mass spectroscopy (GC-MS) revealed that the essential oils of A. purpuraefolia. The A. purpuraefolia essential oil (APEO) yield was 0.37%, and GC/MS analysis revealed that its major constituents were β-Phellandrene (32.11%), Nerolidol (10.11%), Pyrimidine derivative (27.33%), Heptadecane (4.33%), and Celorbicol (6.33%). The essential oil had a significant toxic effect against early fourth-stage larvae of Aedes aegypti L with an LC(50) value of 31.21 ppm and an LC(90) value of 87.22 ppm. The results could be useful in search for newer, safer, and more effective natural immunotoxic agents against A. aegypti. PMID:20163192

  11. Characterization of human lymphoblastoid cell lines as a novel in vitro test system to predict the immunotoxicity of xenobiotics.

    PubMed

    Markovič, Tijana; Gobec, Martina; Gurwitz, David; Mlinarič-Raščan, Irena

    2015-02-17

    Evaluating immunomodulatory effects of xenobiotics is an important component of the toxicity studies. Herein we report on the establishment of a novel invitro test system for the immunotoxicity screening of xenobiotics based on human lymphoblastoid cell lines (LCLs). Four immunotoxic compounds; tributyltin chloride, cyclosporine A, benzo(a)pyrene and verapamil hydrochloride, as well as three immune-inert compounds; urethane, furosemide and mannitol were selected for characterization. The treatment of LCLs with immunosuppressive compounds resulted in reduced viability. The IC50 values determined in human LCLs were in agreement with the data obtained for human peripheral mononuclear cells. Since cytokine production reflects lymphocytes responses to external stimuli, we evaluated the functional responses of LCLs by monitoring their pro-inflammatory and immunoregulatory cytokine production. Our findings prove that LCLs allowed for reliable differentiation between immunomodulatory and immune-inert compounds. Hence, pre-treatment with immunomodulatory compounds led to a decrease in the production of pro-inflammatory TNFα, IL-6 and immunoregulatory IL-2, IL-4, IL-10 and IFNγ cytokines, when compared to untreated ionomycin/PMA stimulated cells. Moreover, testing a panel of ten LCLs derived from unrelated healthy individuals reflects inter-individual variability in response to immunomodulatory xenobiotics. In conclusion, LCLs provide a novel alternative method for the testing of the immunotoxic effects of xenobiotics.

  12. Genotoxic and immunotoxic potential effects of selected psychotropic drugs and antibiotics on blue mussel (Mytilus edulis) hemocytes.

    PubMed

    Lacaze, Emilie; Pédelucq, Julie; Fortier, Marlène; Brousseau, Pauline; Auffret, Michel; Budzinski, Hélène; Fournier, Michel

    2015-07-01

    The potential toxicity of pharmaceuticals towards aquatic invertebrates is still poorly understood and sometimes controversial. This study aims to document the in vitro genotoxicity and immunotoxicity of psychotropic drugs and antibiotics on Mytilus edulis. Mussel hemocytes were exposed to fluoxetine, paroxetine, venlafaxine, carbamazepine, sulfamethoxazole, trimethoprim and erythromycin, at concentrations ranging from μg/L to mg/L. Paroxetine at 1.5 μg/L led to DNA damage while the same concentration of venlafaxine caused immunomodulation. Fluoxetine exposure resulted in genotoxicity, immunotoxicity and cytotoxicity. In the case of antibiotics, trimethoprim was genotoxic at 200 μg/L and immunotoxic at 20 mg/L whereas erythromycin elicited same detrimental effects at higher concentrations. DNA metabolism seems to be a highly sensitive target for psychotropic drugs and antibiotics. Furthermore, these compounds affect the immune system of bivalves, with varying intensity. This attests the relevance of these endpoints to assess the toxic mode of action of pharmaceuticals in the aquatic environment.

  13. Vitamin E pretreatment prevents the immunotoxicity of dithiocarbamate pesticide mancozeb in vitro: A comparative age-related assessment in mice and chick.

    PubMed

    Singh, Saurabh Kumar; Bano, Farhad; Mohanty, Banalata

    2016-01-01

    Pesticides used for crop protection cause life-threatening diseases affecting the immune system of non-target organisms including birds and mammals. Functionality of immune system is age-dependent; early- as well as old-life stages are more susceptible to toxic exposures because of less competent immune system. Vitamins are so far known to reduce toxic effect of several pesticides and/or xenobiotics. The present in vitro study elucidated immunotoxicity of fungicide mancozeb through comparable stages of immune system maturation in mice (1, 3, and 12months) and chicks (4, 8, and 11weeks). In vitro splenocytes viability on exposure to mancozeb was quantitatively assessed by MTT assay and qualitatively by acridine orange and ethidium bromide (AO/EB) double fluorescence staining. Mancozeb exposure dose dependently (250, 500, 1000, 2500, 5000 and 10,000ng/ml) decreased the splenocytes viability. The in vitro preventive effect of Vitamin E has also been explored on toxicity induced by mancozeb. The increased susceptibility observed both in early and aged groups was due to less/decline competence of the immune system. PMID:26778438

  14. Detection of benzo[a]pyrene-induced immunotoxicity in orange spotted grouper (Epinephelus coioides).

    PubMed

    Khaniyan, Maryam; Salamat, Negin; Safahieh, Alireza; Movahedinia, Abdolali

    2016-03-01

    This study aimed to investigate the effects of benzo[a]pyrene (BaP) on immune status of orange spotted grouper (Epinephelus coioides). Fish were injected with 2, 20 and 35 mg/kg-bw of BaP and were kept under laboratory conditions for 14 days. Blood samples were taken at days 1, 4, 7, and 14 and changes in total WBC and RBC, phagocytosis, lysozyme activity, lysosomal membrane stability, immunoglobulin M (IgM) level and antibacterial activity were evaluated. Also BaP bioaccumulation in fish muscle was measured. BaP concentration in the muscle of treated fish reached a maximum level after 4 days (P < 0.05). Exposure of fish to BaP resulted in a significant decrease of total RBC and WBC, lysozyme activity, lysosomal membrane stability, IgM level and antibacterial activity after 4 days and phagocytosis after 7 days of the experiment (P < 0.05). Totally, the results revealed BaP ability to suppress the fish immune function.

  15. Major essential oils composition and immunotoxicity activity from leaves of Foeniculum vulgare against Aedes aegypti L.

    PubMed

    Chung, Ill-Min; Ro, Hee-Myong; Moon, Huyng-In

    2011-09-01

    The leaves of Foeniculum vulgare (Umbelliferae) were extracted and the major essential oil composition and immunotoxicity effects were studied. The analyses conducted by gas chromatography and mass spectroscopy (GC-MS) revealed the essential oils of F. vulgare leaves. The F. vulgare essential oil yield was 0.97%, and GC/MS analysis revealed that its major constituents were methyl clavicol (46.3%), α-phellandrene (18.2%), fenchone (10.6%), (E)-anethole (11.3%), myrcene (3.4%), and α-pinene (2.1%). The essential oil had a significant toxic effect against early fourth-stage larvae of Aedes aegypti L with an LC(50) value of 41.23 ppm and an LC(90) value of 65.24 ppm. Also, methyl clavicol (≥98.0%), α-phellandrene (≥95.0%), fenchone (≥98.0%), (E)-anethole (≥99.0%), myrcene (≥99.0%), and α-pinene (≥99.0%) were tested against the F(21) laboratory strain of A. aegypti. Fenchone (≥98.0%) and (E)-anethole (≥99.0%) have medium activity with an LC(50) value of 73.11 ppm and 102.41 ppm. The above data indicate that major compounds interaction may play a more important role in the toxicity of essential oil.

  16. Major essential oils composition and immunotoxicity activity from leaves of Foeniculum vulgare against Aedes aegypti L.

    PubMed

    Chung, Ill-Min; Ro, Hee-Myong; Moon, Huyng-In

    2011-09-01

    The leaves of Foeniculum vulgare (Umbelliferae) were extracted and the major essential oil composition and immunotoxicity effects were studied. The analyses conducted by gas chromatography and mass spectroscopy (GC-MS) revealed the essential oils of F. vulgare leaves. The F. vulgare essential oil yield was 0.97%, and GC/MS analysis revealed that its major constituents were methyl clavicol (46.3%), α-phellandrene (18.2%), fenchone (10.6%), (E)-anethole (11.3%), myrcene (3.4%), and α-pinene (2.1%). The essential oil had a significant toxic effect against early fourth-stage larvae of Aedes aegypti L with an LC(50) value of 41.23 ppm and an LC(90) value of 65.24 ppm. Also, methyl clavicol (≥98.0%), α-phellandrene (≥95.0%), fenchone (≥98.0%), (E)-anethole (≥99.0%), myrcene (≥99.0%), and α-pinene (≥99.0%) were tested against the F(21) laboratory strain of A. aegypti. Fenchone (≥98.0%) and (E)-anethole (≥99.0%) have medium activity with an LC(50) value of 73.11 ppm and 102.41 ppm. The above data indicate that major compounds interaction may play a more important role in the toxicity of essential oil. PMID:21077804

  17. Arsenic Exposure and Immunotoxicity: a Review Including the Possible Influence of Age and Sex.

    PubMed

    Ferrario, Daniele; Gribaldo, Laura; Hartung, Thomas

    2016-03-01

    Increasing evidence suggests that inorganic arsenic, a major environmental pollutant, exerts immunosuppressive effects in epidemiological, in vitro, and animal models. The mechanisms, however, remain unclear, and little is known about variation in susceptibilities due to age and sex. We performed a review of the experimental and epidemiologic evidence on the association of arsenic exposure and immune diseases. The majority of the studies described arsenic as a potent immunosuppressive compound, though others have reported an increase in allergy and autoimmune diseases, suggesting that arsenic may also act as an immune system stimulator, depending on the dose or timing of exposure. Limited information, due to either the high concentrations of arsenic used in in vitro studies or the use of non-human data for predicting human risks, is available from experimental studies. Moreover, although there is emerging evidence that health effects of arsenic manifest differently between men and women, we found limited information on sex differences on the immunotoxic effects of arsenic. In conclusion, preliminary data show that chronic early-life exposure to arsenic might impair immune responses, potentially leading to increased risk of infections and inflammatory-like diseases during childhood and in adulthood. Further investigation to evaluate effects of arsenic exposure on the developing immune system of both sexes, particularly in human cells and using concentrations relevant to human exposure, should be a research priority.

  18. Immunotoxicity activity from various essential oils of Angelica genus from South Korea against Aedes aegypti L.

    PubMed

    Chung, Ill-Min; Kim, Eun-Hye; Lee, Jai-Heon; Lee, Young-Choon; Moon, Hyung-In

    2012-02-01

    The leaves of Angelica anomala Lallemant, Angelica cartilagino-marginata var. distans (Nakai) Kitag, Angelica czernevia (Fisch. et Meyer) Kitagawa, Angelica dahurica Benth. et Hooker, Angelica decursiva (Miq.) Franch. & Sav, Angelica fallax Boissieu, Angelica gigas Nakai, Angelica japonica A. gray were essential oil extracted and immunotoxicity effects were studied. The Angelica anomala, A. cartilagino-marginata var. distans, A. czernevia, A. dahurica, A. decursiva, A. fallax, A. gigas, A. japonica essential oil yield were 4.13, 4.83, 4.45, 3.25, 4.11, 4.73, 4.34 and 4.21%. The A. dahurica essential oil had a significant toxic effect against early fourth-stage larvae of Aedes aegypti L with a lethal concentration 50 (LC₅₀) value of 43.12 ppm and an LC₉₀ value of 65.23 ppm. The above indicates that essential oil contents may play a more important role in the toxicity of essential oil. PMID:21506693

  19. Pre-clinical immunotoxicity studies of nanotechnology-formulated drugs: Challenges, considerations and strategy.

    PubMed

    Dobrovolskaia, Marina A

    2015-12-28

    Assorted challenges in physicochemical characterization, sterilization, depyrogenation, and in the assessment of pharmacology, safety, and efficacy profiles accompany pre-clinical development of nanotechnology-formulated drugs. Some of these challenges are not unique to nanotechnology and are common in the development of other pharmaceutical products. However, nanoparticle-formulated drugs are biochemically sophisticated, which causes their translation into the clinic to be particularly complex. An understanding of both the immune compatibility of nanoformulations and their effects on hematological parameters is now recognized as an important step in the (pre)clinical development of nanomedicines. An evaluation of nanoparticle immunotoxicity is usually performed as a part of a traditional toxicological assessment; however, it often requires additional in vitro and in vivo specialized immuno- and hematotoxicity tests. Herein, I review literature examples and share the experience with the NCI Nanotechnology Characterization Laboratory assay cascade used in the early (discovery-level) phase of pre-clinical development to summarize common challenges in the immunotoxicological assessment of nanomaterials, highlight considerations and discuss solutions to overcome problems that commonly slow or halt the translation of nanoparticle-formulated drugs toward clinical trials. Special attention will be paid to the grand-challenge related to detection, quantification and removal of endotoxin from nanoformulations, and practical considerations related to this challenge.

  20. Lysozyme activity in earthworm (Lumbricus terrestris) coelomic fluid and coelomocytes: Enzyme assay for immunotoxicity of xenobiotics

    SciTech Connect

    Goven, A.J.; Chen, S.C.; Fitzpatrick, L.C. . Dept. of Biological Sciences); Venables, B.J. . Dept. of Biological Sciences TRAC Laboratories Inc., Denton, TX )

    1994-04-01

    Lysozyme activity in earthworm (Lumbricus terrestris) coelomic fluid and coelomocytes appears sufficiently sensitive for use as a nonmammalian biomarker to detect toxic effects of sublethal body burdens of Cu[sup 2+]. Lysozyme, a phylogenetically conserved enzyme, is capable of bactericidal activity via action on peptidoglycan of gram-positive bacterial cell walls and functions as a component of an organism's innate antimicrobial defense mechanism. Coelomic fluid and coelomocyte lysozyme activities, which exhibit temperature-response patterns similar to those of human saliva, plasma, serum and leukocyte extracts, were sensitive to Cu[sup 2+] exposure. Lysozyme activity of coelomic fluid and coelomocyte extracts from earthworms exposed for 5 d to CuSO[sub 4], using filter paper contact exposure, decreased with increasing sublethal Cu[sup 2+] concentrations of 0.05 and 0.1 [mu]g/cm[sup 2]. Compared to controls, coelomic fluid lysozyme activity was suppressed significantly at both exposure concentrations, whereas coelomocyte extract lysozyme activity was suppressed significantly at the 0.1-[mu]g/cm[sup 2] exposure concentration. Low inherent natural variability and sensitivity to sublethal Cu[sup 2+] body burdens indicate that lysozyme activity has potential as a biomarker for assaying immunotoxicity of metals.

  1. Phagocytosis in earthworms: An environmentally acceptable endpoint to assess immunotoxic potential of contaminated soils

    SciTech Connect

    Giggleman, M.A.; Fitzpatrick, L.C.; Goven, A.J.; Venables, B.J.; Callahan, C.A.

    1995-12-31

    Phagocytosis, a host-defense mechanism phylogenetically conserved throughout the animal kingdom, by earthworm (Lumbricus terrestris) coelomocytes has potential as a surrogate for vertebrates to be used as an environmentally acceptable endpoint to assess sublethal immunotoxic risks of contaminated soils to environmental (eg. higher wildlife) and public health. Coelomocytes can be exposed in vivo to complex contaminated parent soils by placing earthworms in situ at hazardous waste sites (HWS) or into soil samples and their dilutions with artificial soil (AS) in the laboratory, or in vitro to soil extracts and their fractionations. Here the authors report on phagocytosis by coelomocytes in earthworms exposed to pentachlorophenol (PCP) contaminated soils from a wood treatment HWS, PCP-spiked AS and PCP treated filter paper (FP). HWS soil was diluted to 25% with AS to a sublethal concentration (ca. 125 mg kg{sup {minus}1}) and earthworms exposed for 14d at 10 C under light conditions. AS was spiked at ca. 125 mg kg{sup {minus}1} PCP and earthworms were similarly exposed. Controls for both consisted of earthworms exposed to 100% AS. Earthworms were exposed to FP treated with a sublethal PCP concentration (15 {micro}g cm{sup {minus}2}) at 10 C under dark conditions for 96H. Controls were similarly exposed without PCP. Phagocytosis by coelomocytes in earthworms exposed to HWS soil, spiked AS and treated FP was suppressed 37, 41 and 29%, respectively. Results are discussed in terms of PCP body burdens and exposure protocols.

  2. Immunotoxicity activity from various essential oils of Angelica genus from South Korea against Aedes aegypti L.

    PubMed

    Chung, Ill-Min; Kim, Eun-Hye; Lee, Jai-Heon; Lee, Young-Choon; Moon, Hyung-In

    2012-02-01

    The leaves of Angelica anomala Lallemant, Angelica cartilagino-marginata var. distans (Nakai) Kitag, Angelica czernevia (Fisch. et Meyer) Kitagawa, Angelica dahurica Benth. et Hooker, Angelica decursiva (Miq.) Franch. & Sav, Angelica fallax Boissieu, Angelica gigas Nakai, Angelica japonica A. gray were essential oil extracted and immunotoxicity effects were studied. The Angelica anomala, A. cartilagino-marginata var. distans, A. czernevia, A. dahurica, A. decursiva, A. fallax, A. gigas, A. japonica essential oil yield were 4.13, 4.83, 4.45, 3.25, 4.11, 4.73, 4.34 and 4.21%. The A. dahurica essential oil had a significant toxic effect against early fourth-stage larvae of Aedes aegypti L with a lethal concentration 50 (LC₅₀) value of 43.12 ppm and an LC₉₀ value of 65.23 ppm. The above indicates that essential oil contents may play a more important role in the toxicity of essential oil.

  3. Immunotoxicity in plaice exposed to marine sediments in Baie des Anglais on the St. Lawrence Estuary

    SciTech Connect

    Lacroix, A.; Nagler, J.; Lee, K.; Lebeuf, M.; Cyr, D.; Fournier, M. |

    1995-12-31

    The sediments of Baie des Anglais on the St. Lawrence Estuary have a history of environmental contamination. The purpose of the present study was to determine whether or not the immune system of American Plaice (Hippoglossoides Platessoides) could be affected following in-situ exposure at three different sites in and near Baie des Anglais. These sites vary with their proximity to local industry, Sites 1 and 2 (within the bay) being the closest and Site 3 (outside the bay) the furthest away. Fishes placed in cages at each site for three weeks, displayed head kidney cell immune responses (i.e., phagocytosis) modifications indicating that Site 1 was most immunotoxic and site 3 the least. Sediment chemical analysis show a gradient in contaminant concentrations with the highest levels recorded at Site 1, about 10-fold less at Site 2 and 100-fold less at Site 3. Organics predominated (PAHs, PCBs, PCDFs) with heavy metal concentrations low and representative of background levels for the St. Lawrence Estuary. The results obtained indicate that contaminants present in the sediments are bioavailable to fish and significantly affect their immune system.

  4. Immunotoxicity Assessment of Rice-Derived Recombinant Human Serum Albumin Using Human Peripheral Blood Mononuclear Cells

    PubMed Central

    Fu, Kai; Cheng, Qin; Liu, Zhenwei; Chen, Zhen; Wang, Yan; Ruan, Honggang; Zhou, Lu; Xiong, Jie; Xiao, Ruijing; Liu, Shengwu; Zhang, Qiuping; Yang, Daichang

    2014-01-01

    Human serum albumin (HSA) is extensively used in clinics to treat a variety of diseases, such as hypoproteinemia, hemorrhagic shock, serious burn injuries, cirrhotic ascites and fetal erythroblastosis. To address supply shortages and high safety risks from limited human donors, we recently developed recombinant technology to produce HSA from rice endosperm. To assess the risk potential of HSA derived from Oryza sativa (OsrHSA) before a First-in-human (FIH) trial, we compared OsrHSA and plasma-derived HSA (pHSA), evaluating the potential for an immune reaction and toxicity using human peripheral blood mononuclear cells (PBMCs). The results indicated that neither OsrHSA nor pHSA stimulated T cell proliferation at 1x and 5x dosages. We also found no significant differences in the profiles of the CD4+ and CD8+ T cell subsets between OsrHSA- and pHSA-treated cells. Furthermore, the results showed that there were no significant differences between OsrHSA and pHSA in the production of cytokines such as interferon-gamma (IFN-γ), tumor necrosis factor-alpha (TNF-α), interleukin (IL)-10 and IL-4. Our results demonstrated that OsrHSA has equivalent immunotoxicity to pHSA when using the PBMC model. Moreover, this ex vivo system could provide an alternative approach to predict potential risks in novel biopharmaceutical development. PMID:25099245

  5. Data Mining as a Guide for the Construction of Crosslinked Nanoparticles with Low Immunotoxicity via Controlling Polymer Chemistry and Supramolecular Assembly

    PubMed Central

    Elsabahy, Mahmoud; Wooley, Karen L.

    2015-01-01

    CONSPECTUS The potential immunotoxicity of nanoparticles that are currently being approved or in different phases of clinical trials or under rigorous in vitro and in vivo characterizations in several laboratories has recently raised special attention. Products with no apparent in vitro or in vivo toxicity may still trigger the various components of the immune system, unintentionally, and lead to serious adverse reactions. Cytokines are one of the useful biomarkers to predict the effect of biotherapeutics on modulating the immune system and for screening the immunotoxicity of nanoparticles, both in vitro and in vivo, and were found recently to partially predict the in vivo pharmacokinetics and biodistribution of nanomaterials. Control of polymer chemistry and supramolecular assembly provides a great opportunity for construction of biocompatible nanoparticles for biomedical clinical applications. However, the sources of data collected regarding immunotoxicities of nanomaterials are diverse and experiments are usually conducted using different assays and under specific conditions, making direct comparisons nearly impossible and, thus, tailoring properties of nanomaterials based on the available data is challenging. In this account, the effects of chemical structure, crosslinking, degradability, morphology, concentration and surface chemistry on the immunotoxicity of an expansive array of polymeric nanomaterials will be highlighted, with focus being given on assays conducted using the same in vitro and in vivo models and experimental conditions. Furthermore, numerical descriptive values have been utilized, uniquely, to stand for induction of cytokines by nanoparticles. This treatment of available data provides a simple and easy way to compare the immunotoxicity of various nanomaterials, and the values were found to correlate-well with published data. Based on the investigated polymeric systems in this study, valuable information has been collected that aids in the

  6. Developmental immunotoxicity of chemicals in rodents and its possible regulatory impact.

    PubMed

    Hessel, Ellen V S; Tonk, Elisa C M; Bos, Peter M J; van Loveren, Henk; Piersma, Aldert H

    2015-01-01

    Around 25% of the children in developed countries are affected with immune-based diseases. Juvenile onset diseases such as allergic, inflammatory and autoimmune diseases have shown increasing prevalences in the last decades. The role of chemical exposures in these phenomena is unclear. It is thought that the developmental immune system is more susceptible to toxicants than the mature situation. Developmental immunotoxicity (DIT) testing is nowadays not or minimally included in regulatory toxicology requirements. We reviewed whether developmental immune parameters in rodents would provide relatively sensitive endpoints of toxicity, whose inclusion in regulatory toxicity testing might improve hazard identification and risk assessment of chemicals. For each of the nine reviewed toxicants, the developing immune system was found to be at least as sensitive or more sensitive than the general (developmental) toxicity parameters. Functional immune (antigen-challenged) parameters appear more affected than structural (non-challenged) immune parameters. Especially, antibody responses to immune challenges with keyhole limpet hemocyanine or sheep red blood cells and delayed-type hypersensitivity responses appear to provide sensitive parameters of developmental immune toxicity. Comparison with current tolerable daily intakes (TDI) and their underlying overall no observed adverse effect levels showed that for some of the compounds reviewed, the TDI may need reconsideration based on developmental immune parameters. From these data, it can be concluded that the developing immune system is very sensitive to the disruption of toxicants independent of study design. Consideration of including functional DIT parameters in current hazard identification guidelines and wider application of relevant study protocols is warranted. PMID:25372701

  7. Investigation of neurotoxic and immunotoxic effects of some plant growth regulators at subacute and subchronic applications on rats.

    PubMed

    Isik, Ismail; Celik, Ismail

    2015-12-01

    The present study was aimed to investigate the effects of subacute and subchronic treatment of some plant growth regulators (PGRs), such as abscisic acid (ABA) and gibberellic acid (GA3), on neurological and immunological biomarkers in various tissues of rats. The activities of acetylcholinesterase (AChE) and butrylcholinesterase (BChE) were selected as biomarkers for neurotoxic biomarkers. Adenosine deaminase (ADA) and myeloperoxidase (MPO) were measured as indicators for immunotoxic investigation purpose. Wistar albino rats were orally administered with 25 and 50 ppm of PGRs ad libitum for 25-50 days continuously with drinking water. The treatment of PGRs caused different effects on the activities of enzymes. Results showed that the administrations of ABA and GA3 increased AChE and BChE activities in some tissues of rats treated with both the dosages and periods of ABA and GA3. With regard to the immunotoxic effects, ADA activity fluctuated, while MPO activity increased after subacute and subchronic exposure of treated rat tissues to both dosages when compared with the controls. The observations presented led us to conclude that the administrations of PGRs at subacute and subchronic exposure increased AChE, BChE, and MPO activities, while fluctuating the ADA activity in various tissues of rats. This may reflect the potential role of these parameters as useful biomarkers for toxicity of PGRs.

  8. Immunotoxicity activity of 1,2,4-trimethoxybenzene from the Paulownia coreana Uyeki. against Aedes aegypti L.

    PubMed

    Chung, Ill-Min; Moon, Hyung-In

    2011-03-01

    The flower parts of Paulownia coreana were extracted and the major essential oils composition and immunotoxicity effects were studied. The analyses were conducted by gas chromatography-mass spectroscopy (GC-MS) revealed that the essential oils of P. coreana. The P. coreana essential oil (PCEO) yield was 0.175%, and GC/MS analysis revealed that its major constituents were benzyl alcohol (13.72%), phenol, 3,4-dimethoxy-methyl ester (3.64%), phenol, 2-methoxy-3-(2-popenyl)-methyl ester (6.24%), 1,2,4-Trimethoxybenzene (8.32%), tricosane (3.28%), and pentacosane (3.26%). The essential oil had a significant toxic effect against early fourth-stage larvae of Aedes aegypti L with an LC(50) value of 31.64 ppm and an LC(90) value of 56.43 ppm. 1,2,4-Trimethoxybenzene was the most toxic among the major components with an LC(50) value near 23.1 ppm. The results could be useful in search for newer, safer, and more effective natural immunotoxicity agents against A. aegypti. PMID:20476845

  9. Biological and immunotoxicity evaluation of antimicrobial peptide-loaded coatings using a layer-by-layer process on titanium

    NASA Astrophysics Data System (ADS)

    Shi, Jue; Liu, Yu; Wang, Ying; Zhang, Jing; Zhao, Shifang; Yang, Guoli

    2015-11-01

    The prevention and control of peri-implantitis is a challenge in dental implant surgery. Dental implants with sustained antimicrobial coating are an ideal way of preventing peri-implantitis. This study reports development of a non- immunotoxicity multilayered coating on a titanium surface that had sustained antimicrobial activity and limited early biofilm formation. In this study, the broad spectrum AMP, Tet213, was linked to collagen IV through sulfo-SMPB and has been renamed as AMPCol. The multilayer AMPCol coatings were assembled on smooth titanium surfaces using a LBL technique. Using XPS, AFM, contact angle analysis, and QCM, layer-by-layer accumulation of coating thickness was measured and increased surface wetting compared to controls was confirmed. Non-cytotoxicity to HaCaT and low erythrocyte hemolysis by the AMPCol coatings was observed. In vivo immunotoxicity assays showed IP administration of AMPCol did not effect serum immunoglobulin levels. This coating with controlled release of AMP decreased the growth of both a Gram-positive aerobe (Staphylococcus aureus) and a Gram-negative anaerobe (Porphyromonas gingivalis) up to one month. Early S. aureus biofilm formation was inhibited by the coating. The excellent long-term sustained antimicrobial activity of this multilayer coating is a potential method for preventing peri-implantitis through coated on the neck of implants before surgery.

  10. Biological and immunotoxicity evaluation of antimicrobial peptide-loaded coatings using a layer-by-layer process on titanium

    PubMed Central

    Shi, Jue; Liu, Yu; Wang, Ying; Zhang, Jing; Zhao, Shifang; Yang, Guoli

    2015-01-01

    The prevention and control of peri-implantitis is a challenge in dental implant surgery. Dental implants with sustained antimicrobial coating are an ideal way of preventing peri-implantitis. This study reports development of a non- immunotoxicity multilayered coating on a titanium surface that had sustained antimicrobial activity and limited early biofilm formation. In this study, the broad spectrum AMP, Tet213, was linked to collagen IV through sulfo-SMPB and has been renamed as AMPCol. The multilayer AMPCol coatings were assembled on smooth titanium surfaces using a LBL technique. Using XPS, AFM, contact angle analysis, and QCM, layer-by-layer accumulation of coating thickness was measured and increased surface wetting compared to controls was confirmed. Non-cytotoxicity to HaCaT and low erythrocyte hemolysis by the AMPCol coatings was observed. In vivo immunotoxicity assays showed IP administration of AMPCol did not effect serum immunoglobulin levels. This coating with controlled release of AMP decreased the growth of both a Gram-positive aerobe (Staphylococcus aureus) and a Gram-negative anaerobe (Porphyromonas gingivalis) up to one month. Early S. aureus biofilm formation was inhibited by the coating. The excellent long-term sustained antimicrobial activity of this multilayer coating is a potential method for preventing peri-implantitis through coated on the neck of implants before surgery. PMID:26548760

  11. Immunotoxic effects of sodium tungstate dihydrate on female B6C3F1/N mice when administered in drinking water.

    PubMed

    Frawley, Rachel P; Smith, Matthew J; White, Kimber L; Elmore, Susan A; Herbert, Ron; Moore, Rebecca; Staska, Lauren M; Behl, Mamta; Hooth, Michelle J; Kissling, Grace E; Germolec, Dori R

    2016-09-01

    Tungsten is a naturally occurring, high-tensile strength element that has been used in a number of consumer products. Tungsten has been detected in soil, waterways, groundwater, and human tissue and body fluids. Elevated levels of tungsten in urine were reported for populations exposed to tungstate in drinking water in areas where natural tungsten formations were prevalent. Published reports indicated that sodium tungstate may modulate hematopoiesis, immune cell populations, and immune responses in rodent models. The objective of this study was to assess potential immunotoxicity of sodium tungstate dihydrate (STD), a drinking water contaminant. Female B6C3F1/N mice received 0-2000 mg STD/L in their drinking water for 28 d, and were evaluated for effects on immune cell populations in spleen and bone marrow, and humoral-mediated, cell-mediated, and innate immunity. Three different parameters of cell-mediated immunity were similarly affected at 1000 mg STD/L. T-cell proliferative responses against allogeneic leukocytes and anti-CD3 were decreased 32%, and 21%, respectively. Cytotoxic T-lymphocyte activity was decreased at all effector:target cell ratios examined. At 2000 mg STD/L, the absolute numbers of CD3(+) T-cell progenitor cells in bone marrow were increased 86%, but the alterations in B-lymphocyte and other progenitor cells were not significant. There were no effects on bone marrow DNA synthesis or colony forming capabilities. STD-induced effects on humoral-mediated immunity, innate immunity, and splenocyte sub-populations were limited. Enhanced histopathology did not detect treatment-related lesions in any of the immune tissues. These data suggest exposure to STD in drinking water may adversely affect cell-mediated immunity. PMID:27223060

  12. Immunotoxic effects of sodium tungstate dihydrate on female B6C3F1/N mice when administered in drinking water.

    PubMed

    Frawley, Rachel P; Smith, Matthew J; White, Kimber L; Elmore, Susan A; Herbert, Ron; Moore, Rebecca; Staska, Lauren M; Behl, Mamta; Hooth, Michelle J; Kissling, Grace E; Germolec, Dori R

    2016-09-01

    Tungsten is a naturally occurring, high-tensile strength element that has been used in a number of consumer products. Tungsten has been detected in soil, waterways, groundwater, and human tissue and body fluids. Elevated levels of tungsten in urine were reported for populations exposed to tungstate in drinking water in areas where natural tungsten formations were prevalent. Published reports indicated that sodium tungstate may modulate hematopoiesis, immune cell populations, and immune responses in rodent models. The objective of this study was to assess potential immunotoxicity of sodium tungstate dihydrate (STD), a drinking water contaminant. Female B6C3F1/N mice received 0-2000 mg STD/L in their drinking water for 28 d, and were evaluated for effects on immune cell populations in spleen and bone marrow, and humoral-mediated, cell-mediated, and innate immunity. Three different parameters of cell-mediated immunity were similarly affected at 1000 mg STD/L. T-cell proliferative responses against allogeneic leukocytes and anti-CD3 were decreased 32%, and 21%, respectively. Cytotoxic T-lymphocyte activity was decreased at all effector:target cell ratios examined. At 2000 mg STD/L, the absolute numbers of CD3(+) T-cell progenitor cells in bone marrow were increased 86%, but the alterations in B-lymphocyte and other progenitor cells were not significant. There were no effects on bone marrow DNA synthesis or colony forming capabilities. STD-induced effects on humoral-mediated immunity, innate immunity, and splenocyte sub-populations were limited. Enhanced histopathology did not detect treatment-related lesions in any of the immune tissues. These data suggest exposure to STD in drinking water may adversely affect cell-mediated immunity.

  13. Advantages of Papio anubis for preclinical testing of immunotoxicity of candidate therapeutic antagonist antibodies targeting CD28.

    PubMed

    Poirier, Nicolas; Mary, Caroline; Le Bas-Bernardet, Stephanie; Daguin, Veronique; Belarif, Lyssia; Chevalier, Melanie; Hervouet, Jeremy; Minault, David; Ville, Simon; Charpy, Vianney; Blancho, Gilles; Vanhove, Bernard

    2014-01-01

    Antagonist anti-CD28 antibodies prevent T-cell costimulation and are functionally different from CTLA4Ig since they cannot block CTLA-4 and PDL-1 co-inhibitory signals. They demonstrated preclinical efficacy in suppressing effector T cells while enhancing immunoregulatory mechanisms. Because a severe cytokine release syndrome was observed during the Phase 1 study with the superagonist anti-CD28 TGN1412, development of other anti-CD28 antibodies requires careful preclinical evaluation to exclude any potential immunotoxicity side-effects. The failure to identify immunological toxicity of TGN1412 using macaques led us to investigate more relevant preclinical models. We report here that contrary to macaques, and like in man, all baboon CD4-positive T lymphocytes express CD28 in their effector memory cells compartment, a lymphocyte subtype that is the most prone to releasing cytokines after reactivation. Baboon lymphocytes are able to release pro-inflammatory cytokines in vitro in response to agonist or superagonist anti-CD28 antibodies. Furthermore, we compared the reactivity of human and baboon lymphocytes after transfer into non obese diabetic/severe combined immunodeficiency (NOD/SCID) interleukin-2rγ knockout mice and confirmed that both cell types could release inflammatory cytokines in situ after injection of agonistic anti-CD28 antibodies. In contrast, FR104, a monovalent antagonistic anti-CD28 antibody, did not elicit T cell activation in these assays, even in the presence of anti-drug antibodies. Infusion to baboons also resulted in an absence of cytokine release. In conclusion, the baboon represents a suitable species for preclinical immunotoxicity evaluation of anti-CD28 antibodies because their effector memory T cells do express CD28 and because cytokine release can be assessed in vitro and trans vivo.

  14. In vitro immunotoxicity of untreated and treated urban wastewaters using various treatment processes to rainbow trout leucocytes.

    PubMed

    Gagné, François; Fortier, Marlène; Fournier, Michel; Smyth, Shirley-Anne

    2013-07-01

    Municipal effluents are known to impede the immune system of aquatic organisms. The purpose of this study was to examine the immunotoxicity of urban wastewaters before and after 6 treatment processes from 12 cities toward trout leucocytes. Freshly prepared trout leucocytes were exposed to increasing concentrations of solid phase (C18) extracts of wastewaters for 24 hr at 150C. Immunocompetence was determined by following changes in leucocyte viability and the proportion of cells able to ingest at least one (immunoactivity) and at least three (immunoefficiency) fluorescent beads. The influents were treated by six different treatment strategies consisting of facultative aerated lagoons, activated sludge, biological aerated filter, biological nutrient removal, chemically-assisted physical treatment and trickling filter/solid contact. Water quality parameters of the wastewaters revealed that the plants effectively removed total suspended solids and reduced the chemical oxygen demand. The results revealed that the effluents' immunotoxic properties were generally more influenced by the properties of the untreated wastewaters than by the treatment processes. About half of the incoming influents decreased leucocyte viability while 4 treatment plants were able to reduce toxicity. The influents readily increased phagocytosis activity for 8/12 influents while it was decreased in 4/12 influents. This increase was abolished for 4/12 of the effluents using treatments involving biological and oxidative processes. In conclusion, municipal effluents have the potential to alter the immune system in fish and more research will be needed to improve the treatments of wastewaters to better protect the quality of the aquatic environment. PMID:24218853

  15. In Vivo Immunotoxicity of SiO2@(Y0.5Gd0.45Eu0.05)2O3 as Dual-Modality Nanoprobes

    PubMed Central

    Tian, Xiumei; Li, Ermao; Yang, Fanwen; Peng, Ye; Zhu, Jixiang; He, Fupo; Chen, Xiaoming

    2014-01-01

    We have successfully synthesized SiO2@(Y0.5Gd0.45Eu0.05)2O3 nanocomposites as a potential dual-modality nanoprobe for molecular imaging in vitro. However, their immunotoxicity assessment in vivo remains unknown. In this article, the in vitro biocompatibility of our dual-modality nanoprobes was assayed in terms of cell viability and apoptosis. In vivo immunotoxicity was investigated by monitoring the generation of reactive oxygen species (ROS), cluster of differentiation (CD) markers and cytokines in Balb/c mice. The data show that the in vitro biocompatibility was satisfactory. In addition, the immunotoxicity data revealed there are no significant changes in the expression levels of CD11b and CD71 between the nanoprobe group and the Gd in a diethylenetriaminepentaacetic acid (DTPA) chelator (Gd-DTPA) group 24 h after injection in Balb/c mice (p > 0.05). Importantly, there are significant differences in the expression levels of CD206 and CD25 as well as the secretion of IL-4 and the generation of ROS 24 h after injection (p < 0.05). Transmission electron microscopy (TEM) images showed that few nanoprobes were localized in the phagosomes of liver and lung. In conclusion, the toxic effects of our nanoprobes may mainly result from the aggregation of particles in phagosomes. This accumulation may damage the microstructure of the cells and generate oxidative stress reactions that further stimulate the immune response. Therefore, it is important to evaluate the in vivo immunotoxicity of these rare earth-based biomaterials at the molecular level before molecular imaging in vivo. PMID:25105724

  16. Subchronic toxicity and immunotoxicity of MeO-PEG-poly(D,L-lactic-co-glycolic acid)-PEG-OMe triblock copolymer nanoparticles delivered intravenously into rats

    NASA Astrophysics Data System (ADS)

    Liao, Longfei; Zhang, Mengtian; Liu, Huan; Zhang, Xuanmiao; Xie, Zhaolu; Zhang, Zhirong; Gong, Tao; Sun, Xun

    2014-06-01

    Although monomethoxy(polyethyleneglycol)-poly (D,L-lactic-co-glycolic acid)-monomethoxy (PELGE) nanoparticles have been widely studied as a drug delivery system, little is known about their toxicity in vivo. Here we examined the subchronic toxicity and immunotoxicity of different doses of PELGE nanoparticles with diameters of 50 and 200 nm (PELGE50 and PELGE200) in rats. Neither size of PELGE nanoparticles showed obvious subchronic toxic effects during 28 d of continuous intravenous administration based on clinical observation, body weight, hematology parameters and histopathology analysis. PELGE200 nanoparticles showed no overt signs of immunotoxicity based on organ coefficients, histopathology analysis, immunoglobulin levels, blood lymphocyte subpopulations and splenocyte cytokines. Conversely, PELGE50 nanoparticles were associated with an increased organ coefficient and histopathological changes in the spleen, increased serum IgM and IgG levels, alterations in blood lymphocyte subpopulations and enhanced expression of spleen interferon-γ. Taken together, these results suggest that PELGE nanoparticles show low subchronic toxicity but substantial immunotoxicity, which depends strongly on particle size. These findings will be useful for safe application of PELGE nanoparticles in drug delivery systems.

  17. Immunotoxicity of 2,3,7,8-tetrachlorodibenzo-p-dioxin in a complex environmental mixture from the Love Canal.

    PubMed

    Silkworth, J B; Cutler, D S; Sack, G

    1989-02-01

    The organic phase of the leachate (OPL) from the Love Canal chemical dump site contains more than 100 organic compounds including 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). The immunotoxic potential of OPL was determined in two mouse strains which differ in their sensitivity to aromatic hydrocarbon (Ah) receptor-mediated toxicity. OPL was administered in corn oil in a single oral gavage to male BALB/cByJ (Ahb/Ahb) mice (0.5, 0.8, or 1.1 g/kg) and DBA/2J (Ahd/Ahd) mice (0.6, 0.9, or 1.3 g/kg). TCDD was similarly administered at 0.25, 1.0, 4.0, or 16.0 micrograms/kg. Two days later all mice were immunized with sheep erythrocytes (SRBC). The antibody response (PFC) and organ weights were evaluated 4 days later. OPL produced thymic atrophy and hepatomegaly in both strains at all dose levels. The PFC/spleen in BALB/cByJ mice was significantly reduced at the three doses to 34, 13, and 15%, respectively, of the control response. Serum anti-SRBC antibody levels and relative spleen weights were also reduced. The only immune effect in the DBA/2J mice was a decrease of the PFC/spleen to 58% of the control at the highest dose. TCDD decreased the relative thymus and spleen weights only in BALB/cByJ mice. However, TCDD produced hepatomegaly, a decrease in serum antibody, and a decrease in PFC/spleen in both BALB/cByJ and DBA/2J mice to 3 and 15%, respectively, at 16 micrograms/kg. Thus, the TCDD dose required to cause a 50% suppression (ED50) of PFC/spleen for the BALB/cByJ and DBA/2J strains was 1.84 and 3.89 micrograms/kg, respectively. The ED50 for OPL was 0.24 g/kg in BALB/cByJ mice. The TCDD concentration in the OPL was estimated to be 7.6 ppm, which agrees closely with the chemical analysis (3 ppm). The results suggest that the immunosuppression caused by OPL in BALB/cByJ mice was primarily due to TCDD, that the non-TCDD components of OPL diminished the TCDD immunotoxicity in the DBA/2J strain, and that the thymic atrophy and hepatomegaly were caused primarily by the non

  18. Role of Metabolism by Intestinal Bacteria in Arbutin-Induced Suppression of Lymphoproliferative Response in vitro

    PubMed Central

    Kang, Mi Jeong; Ha, Hyun Woo; Kim, Ghee Hwan; Lee, Sang Kyu; Ahn, Young Tae; Kim, Dong Hyun; Jeong, Hye Gwang; Jeong, Tae Cheon

    2012-01-01

    Role of metabolism by intestinal bacteria in arbutin-induced immunotoxicity was investigated in splenocyte cultures. Following an incubation of arbutin with 5 different intestinal bacteria for 24 hr, its aglycone hydroquinone could be produced and detected in the bacterial culture media with different amounts. Toxic effects of activated arbutin by intestinal bacteria on lymphoproliferative response were tested in splenocyte cultures from normal mice. Lipopolysaccharide and concanavalin A were used as mitogens for B- and T-cells, respectively. When bacteria cultured medium with arbutin was treated into the splenocytes for 3 days, the medium cultured with bacteria producing large amounts of hydroquinone induced suppression of lymphoproliferative responses, indicating that metabolic activation by intestinal bacteria might be required in arbutin-induced toxicity. The results indicated that the present testing system might be applied for determining the possible role of metabolism by intestinal bacteria in certain chemical-induced immunotoxicity in animal cell cultures. PMID:24116295

  19. Composition and immunotoxicity activity of essential oils from leaves of Zingiber officinale Roscoe against Aedes aegypti L.

    PubMed

    Moon, Hyung-In; Cho, Sang-Buem; Kim, Soo-Ki

    2011-03-01

    The leaves of Zingiber officinale Roscoe were extracted and the major essential oil composition and immunotoxicity effects were studied. The analyses were conducted by gas chromatography and mass spectroscopy (GC-MS) revealed that the essential oils of Z. officinale leaves. The Z. officinale essential oil yield was 0.26%, and GC/MS analysis revealed that its major constituents were Camphene (5.26%), Phellandrene (6.58%), Zingiberene (36.48%), Geranial (4.32%), β-gurjunene (2.74%), and Citronellol β-sesguiphellandrene (12.31%). The essential oil had a significant toxic effect against early fourth-stage larvae of Aedes aegypti L with an LC(50) value of 46.38 ppm and an LC(90) value of 84.32 ppm. Also, Camphene (≥95.0%), Phellandrene (≥95.0%), Zingiberene (≥95.0%), Geranial (≥95.0%), β-gurjunene (≥97.0%), and Citronellol (≥95.0%) were tested against the F21 laboratory strain of A. aegypti. Zingiberene (≥95.0%) and Citronellol (≥95.0%) have medium activity with an LC(50) value of 99.55 ppm and 141.45 ppm. This indicates that other major compounds may play a more important role in the toxicity of essential oil. PMID:20568951

  20. IMMUNOTOXICOGENOMICS: THE POTENTIAL OF GENOMICS TECHNOLOGY IN THE IMMUNOTOXICITY RISK ASSESSMENT PROCESS

    EPA Science Inventory

    Evaluation of xenobiotic-induced changes in gene expression as a method to identify and classify potential toxicants is being pursued by industry and regulatory agencies worldwide. A workshop was held at the Research Triangle Park campus of the Environmental Protection Agency to...

  1. Immunotoxicity of skin acid secretion produced by the sea slug Berthellina citrina in mice spleen: Histological and Immunohistochemical study.

    PubMed

    Awaad, Aziz; Moustafa, Alaa Y

    2016-07-01

    Acid secretion containing sulfuric and hydrochloric acids is a fascinating defensive phenomenon within many groups of marine organisms. This study aimed to investigate the mice spleen histology and immunotoxicity using skin acid secretion (SAS) of the sea slug Berthellina citrina after oral administration. The spleen showed atrophy in the white pulp, decrease in the splenocytes density, megakaryocytes cytoplasmic degeneration as well as inflammatory cells infiltrations. The white and red pulp splenocytes number decreased time-dependently in the treated spleens. Additionally, the size of the megakaryocytes increased as compared with the control. The administration with SAS increased the number of the IgA(+) cells aggregation in the splenic red pulp. Furthermore, after 7days of the administration, large number of dispersed IgA(+) cells were distributed in splenic parenchyma. The IgA(+) cells numbers increased time-dependently as compared with those in the control. The aggregation sizes and number of the F4/80(+) cell in the splenic red pulp were increased. Furthermore the F4/80(+) cells numbers increased time-dependently as compared with those in the control. The UEAI(+) cells were found as free cells but not in aggregations in the control splenic red pulp. Contradictory to the number of IgA(+) cells and F4/80(+) cells the number of the UEAI(+) cells decreased time-dependently after administration with SAS. Hematologically, abnormal numbers of WBCs different cells were observed after administration with SAS. This study provides new insight about the toxicity of a marine extract may be used in natural products industry or medical applications. PMID:27378377

  2. Immunotoxicity and biodistribution analysis of arsenic trioxide in C57Bl/6 mice following a 2-week inhalation exposure

    SciTech Connect

    Burchiel, Scott W.; Mitchell, Leah A.; Lauer, Fredine T.; Sun Xi; McDonald, Jacob D.; Hudson, Laurie G.; Liu Kejian

    2009-12-15

    In these studies the immunotoxicity of arsenic trioxide (ATO, As{sub 2}O{sub 3}) was evaluated in mice following 14 days of inhalation exposures (nose only, 3 h per day) at concentrations of 50 mug/m{sup 3} and 1 mg/m{sup 3}. A biodistribution analysis performed immediately after inhalation exposures revealed highest levels of arsenic in the kidneys, bladder, liver, and lung. Spleen cell levels were comparable to those found in the blood, with the highest concentration of arsenic detected in the spleen being 150 mug/g tissue following the 1 mg/m{sup 3} exposures. No spleen cell cytotoxicity was observed at either of the two exposure levels. There were no changes in spleen cell surface marker expression for B cells, T cells, macrophages, and natural killer (NK) cells. There were also no changes detected in the B cell (LPS-stimulated) and T cell (Con A-stimulated) proliferative responses of spleen cells, and no changes were found in the NK-mediated lysis of Yac-1 target cells. The primary T-dependent antibody response was, however, found to be highly susceptible to ATO suppression. Both the 50 mug/m{sup 3} and 1 mg/m{sup 3} exposures produced greater than 70% suppression of the humoral immune response to sheep red blood cells. Thus, the primary finding of this study is that the T-dependent humoral immune response is extremely sensitive to suppression by ATO and assessment of humoral immune responses should be considered in evaluating the health effects of arsenic containing agents.

  3. Fate of silver nanoparticles in wastewater and immunotoxic effects on rainbow trout.

    PubMed

    Bruneau, A; Turcotte, P; Pilote, M; Gagné, F; Gagnon, C

    2016-05-01

    Silver nanoparticles (AgNPs) are currently used in technology, medicine and consumer products, even though the fate and the ecotoxicological risks on aquatic organisms of these new materials are not well known. The purpose of this study was to investigate the fate, bioavailability of AgNPs and their effects on fish in presence of municipal effluents. Juvenile rainbow trout were exposed for 96h to 40μg/L of AgNPs or 4μg/L of dissolved silver (AgNO3) in diluted (10%) municipal wastewater. Silver (Ag) concentrations were measured both on water samples and fish tissues (liver and gills). Toxicity was investigated by following immunological parameters in the pronephros (viability, phagocytosis) and biomarkers in liver and gills (cyclooxygenase activity, lipid peroxidation, glutathione-S-transferase, metallothioneins, DNA strand breaks and labile zinc). Results indicated that AgNPs appeared as small non-charged aggregates in wastewaters (11.7±1.4nm). In gills, the exposure to AgNPs induced morphological modifications without visible nanoparticle bioaccumulation. Dissolved Ag(+) was bioavailable in diluted effluent and induced oxidative stress (lipid peroxidation), labile zinc and a marginal decrease in superoxide dismutase in fish gills. Ag(+) also increased significantly metallothionein levels and inhibited the DNA repair activity in the liver. Finally, the two silver forms were found in liver and induced immunosuppression and inflammation (increase in cyclooxygenase activity). This study demonstrated that both forms of Ag produced harmful effects and AgNPs in wastewater were bioavailable to fish despite of their formation of aggregates.

  4. Surface Charges and Shell Crosslinks Each Play Significant Roles in Mediating Degradation, Biofouling, Cytotoxicity and Immunotoxicity for Polyphosphoester-based Nanoparticles

    NASA Astrophysics Data System (ADS)

    Elsabahy, Mahmoud; Zhang, Shiyi; Zhang, Fuwu; Deng, Zhou J.; Lim, Young H.; Wang, Hai; Parsamian, Perouza; Hammond, Paula T.; Wooley, Karen L.

    2013-11-01

    The construction of nanostructures from biodegradable precursors and shell/core crosslinking have been pursued as strategies to solve the problems of toxicity and limited stability, respectively. Polyphosphoester (PPE)-based micelles and crosslinked nanoparticles with non-ionic, anionic, cationic, and zwitterionic surface characteristics for potential packaging and delivery of therapeutic and diagnostic agents, were constructed using a quick and efficient synthetic strategy, and importantly, demonstrated remarkable differences in terms of cytotoxicity, immunotoxicity, and biofouling properties, as a function of their surface characteristics and also with dependence on crosslinking throughout the shell layers. For instance, crosslinking of zwitterionic micelles significantly reduced the immunotoxicity, as evidenced from the absence of secretions of any of the 23 measured cytokines from RAW 264.7 mouse macrophages treated with the nanoparticles. The micelles and their crosslinked analogs demonstrated lower cytotoxicity than several commercially-available vehicles, and their degradation products were not cytotoxic to cells at the range of the tested concentrations. PPE-nanoparticles are expected to have broad implications in clinical nanomedicine as alternative vehicles to those involved in several of the currently available medications.

  5. Immunotoxicity activity of 2,6,10,15-tetrame-heptadecane from the essential oils of Clerodendron trichotomum Thunb. against Aedes aegypti L.

    PubMed

    Lee, Sung-Jae; Moon, Hyung-In

    2010-12-01

    The leaf parts of Clerodendron trichotomum were extracted and the major essential oils composition and immunotoxicity effects were studied. The analyses were conducted by gas chromatography-mass spectroscopy (GC-MS) revealed that the essential oils of C. trichotomum (CTEO). The CTEO yield was 0.071%, and GC/MS analysis revealed that its major constituents were Hexanal (3.31%), 5-Me-3-heptanone (1.71%), 2,6,6-trime-cyclohexanone (2.23%), 2,6,10,15-tetrame-heptadecane (24.21%) and Linalool (31.2%). The essential oil had a significant toxic effect against early fourth-stage larvae of Aedes aegypti L with an LC(50) value of 32.78 ppm and an LC(90) value of 93.72 ppm. 2,6,10,15-tetrame-heptadecane was the most toxic among the two major components (2,6,10,15-tetrame-heptadecane and Linalool), with an LC(50) value near 43.9 ppm. The results could be useful in search for newer, safer, and more effective natural immunotoxicity agents against A. aegypti. PMID:20233126

  6. Surface Charges and Shell Crosslinks Each Play Significant Roles in Mediating Degradation, Biofouling, Cytotoxicity and Immunotoxicity for Polyphosphoester-based Nanoparticles

    PubMed Central

    Elsabahy, Mahmoud; Zhang, Shiyi; Zhang, Fuwu; Deng, Zhou J.; Lim, Young H.; Wang, Hai; Parsamian, Perouza; Hammond, Paula T.; Wooley, Karen L.

    2013-01-01

    The construction of nanostructures from biodegradable precursors and shell/core crosslinking have been pursued as strategies to solve the problems of toxicity and limited stability, respectively. Polyphosphoester (PPE)-based micelles and crosslinked nanoparticles with non-ionic, anionic, cationic, and zwitterionic surface characteristics for potential packaging and delivery of therapeutic and diagnostic agents, were constructed using a quick and efficient synthetic strategy, and importantly, demonstrated remarkable differences in terms of cytotoxicity, immunotoxicity, and biofouling properties, as a function of their surface characteristics and also with dependence on crosslinking throughout the shell layers. For instance, crosslinking of zwitterionic micelles significantly reduced the immunotoxicity, as evidenced from the absence of secretions of any of the 23 measured cytokines from RAW 264.7 mouse macrophages treated with the nanoparticles. The micelles and their crosslinked analogs demonstrated lower cytotoxicity than several commercially-available vehicles, and their degradation products were not cytotoxic to cells at the range of the tested concentrations. PPE-nanoparticles are expected to have broad implications in clinical nanomedicine as alternative vehicles to those involved in several of the currently available medications. PMID:24264796

  7. Immunotoxicity in ascidians: antifouling compounds alternative to organotins-IV. The case of zinc pyrithione.

    PubMed

    Cima, Francesca; Ballarin, Loriano

    2015-03-01

    New biocides such as the organometallic compound zinc pyrithione (ZnP) have been massively introduced by many countries in formulations of antifouling paints following the ban on tributyltin (TBT). The effects of sublethal concentrations (LC50=82.5 μM, i.e., 26.2 mg/l) on cultured haemocytes of the ascidian Botryllus schlosseri have been investigated and compared with TBT. The percentage of haemocytes with amoeboid morphology and containing phagocytised yeast cells were significantly (p<0.05) reduced after exposure to 0.1 (31.7 μg/l) and 0.5 μM (158 μg/l), respectively. An antagonistic interaction in inducing cytoskeletal alterations was observed when ZnP and TBT were co-present in the exposure medium. ZnP affected only the actin component. As caused by TBT, ZnP induced apoptosis and inhibited both oxidative phosphorylation and lysosomal activities. In contrast to the case of TBT, a decrement in Ca(2+)-ATPase activity and a decrease in cytosolic Ca(2+) were detected after incubation at the highest concentration (1 μM, i.e., 317.7 μg/l) used. In comparison with other antifouling compounds, ZnP shows as much toxicity as TBT to cultured haemocytes at extremely low concentrations interfering with fundamental cell activities. PMID:25576186

  8. Immunotoxicity of 2,3,7,8-tetrachlorodibenzo-p-dioxin in a complex environmental mixture from the Love Canal

    SciTech Connect

    Silkworth, J.B.; Cutler, D.S.; Sack, G.

    1989-02-01

    The organic phase of the leachate (OPL) from the Love Canal chemical dump site contains more than 100 organic compounds including 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). The immunotoxic potential of OPL was determined in two mouse strains which differ in their sensitivity to aromatic hydrocarbon (Ah) receptor-mediated toxicity. OPL was administered in corn oil in a single oral gavage to male BALB/cByJ (Ahb/Ahb) mice (0.5, 0.8, or 1.1 g/kg) and DBA/2J (Ahd/Ahd) mice (0.6, 0.9, or 1.3 g/kg). TCDD was similarly administered at 0.25, 1.0, 4.0, or 16.0 micrograms/kg. Two days later all mice were immunized with sheep erythrocytes (SRBC). The antibody response (PFC) and organ weights were evaluated 4 days later. OPL produced thymic atrophy and hepatomegaly in both strains at all dose levels. The PFC/spleen in BALB/cByJ mice was significantly reduced at the three doses to 34, 13, and 15%, respectively, of the control response. Serum anti-SRBC antibody levels and relative spleen weights were also reduced. The only immune effect in the DBA/2J mice was a decrease of the PFC/spleen to 58% of the control at the highest dose. TCDD decreased the relative thymus and spleen weights only in BALB/cByJ mice. However, TCDD produced hepatomegaly, a decrease in serum antibody, and a decrease in PFC/spleen in both BALB/cByJ and DBA/2J mice to 3 and 15%, respectively, at 16 micrograms/kg. Thus, the TCDD dose required to cause a 50% suppression (ED50) of PFC/spleen for the BALB/cByJ and DBA/2J strains was 1.84 and 3.89 micrograms/kg, respectively. The ED50 for OPL was 0.24 g/kg in BALB/cByJ mice. The TCDD concentration in the OPL was estimated to be 7.6 ppm, which agrees closely with the chemical analysis (3 ppm).

  9. Functionalized porous silica&maghemite core-shell nanoparticles for applications in medicine: design, synthesis, and immunotoxicity

    PubMed Central

    Zasońska, Beata A.; Líšková, Aurélia; Kuricová, Miroslava; Tulinská, Jana; Pop-Georgievski, Ognen; Čiampor, Fedor; Vávra, Ivo; Dušinská, Mária; Ilavská, Silvia; Horváthová, Mira; Horák, Daniel

    2016-01-01

    Aim To determine cytotoxicity and effect of silica-coated magnetic nanoparticles (MNPs) on immune response, in particular lymphocyte proliferative activity, phagocytic activity, and leukocyte respiratory burst and in vitro production of interleukin-6 (IL-6) and 8 (IL-8), interferon-gamma (IFN-γ), tumor necrosis factor-alpha (TNF-α), and granulocyte macrophage colony stimulating factor (GM-CSF). Methods Maghemite was prepared by coprecipitation of iron salts with ammonia, oxidation with NaOCl and modified by tetramethyl orthosilicate and aminosilanes. Particles were characterized by transmission electron microscopy (TEM), dynamic light scattering (DLS), Fourier-transform infrared (FTIR), and X-ray photoelectron spectroscopy (XPS). Cytotoxicity and lymphocyte proliferative activity were assessed using [3H]-thymidine incorporation into DNA of proliferating human peripheral blood cells. Phagocytic activity and leukocyte respiratory burst were measured by flow cytometry; cytokine levels in cell supernatants were determined by ELISA. Results γ-Fe2O3&SiO2-NH2 MNPs were 13 nm in size. According to TEM, they were localized in the cell cytoplasm and extracellular space. Neither cytotoxic effect nor significant differences in T-lymphocyte and T-dependent B-cell proliferative response were found at particle concentrations 0.12-75 μg/cm2 after 24, 48, and 72 h incubation. Significantly increased production of IL-6 and 8, and GM-CSF cytokines was observed in the cells treated with 3, 15, and 75 µg of particles/cm2 for 48 h and stimulated with pokeweed mitogen (PHA). No significant changes in TNF-α and IFN-γ production were observed. MNPs did not affect phagocytic activity of monocytes and granulocytes when added to cells for 24 and 48 h. Phagocytic respiratory burst was significantly enhanced in the cultures exposed to 75 µg MNPs/cm2 for 48 h. Conclusions The cytotoxicity and in vitro immunotoxicity were found to be minimal in the newly developed porous core-shell γ-Fe2

  10. Characterizing creosote immunotoxicity in rainbow trout, Oncorhynchus mykiss: A mesocosm study

    SciTech Connect

    Karrow, N.A.; Dixon, D.G.; Bols, N.C.; Whyte, J.J.; Magdic, S.; Boermans, H.J.; Solomon, K.R.

    1995-12-31

    Immunocompetence was assessed in rainbow trout Oncorhynchus mykiss exposed on days 103 to 131 of a mesocosm study using initial liquid creosote concentrations of 0, 5, 9, 17, 31 and 56 ul/l. Oxidative burst, phagocytic activity, and lymphocyte blastogenic response were measured, as indicators of exposure, using pronephros leukocytes. Peripheral blood was used to measure surface immunoglobulin-positive (slg{sup +}) leukocyte count and lysozyme activity. Tissue residue and water concentration were used as dose surrogates. Pronephros leukocyte phagocytic activity and oxidative burst exhibited a significant dose-response relationship, as measured by flow cytometry. Oxidative burst was inhibited, while phagocytic activity was enhanced. A concentration dependent reduction in the number of slg + peripheral blood leukocytes was also observed using flow cytometry. Although no measurable change in lymphocyte proliferation was detected in response to phytohaemagglutinin (PHA) and concanavalin-A (ConA), lipopolysaccharide (LPS) induced blastogenesis was significantly inhibited. No change in lysozyme activity was observed at 28 d. The results from this study indicate that sediment bound creosote has the potential to alter immune response. Polycyclic aromatic hydrocarbons (PAHs), a major constituent of liquid creosote, are the suspected immunoalterating agents. PAHs are known to predispose fish to disease resulting from their immunosuppressive potentiality.

  11. Arsenic immunotoxicity and immunomodulation by phytochemicals: potential relations to develop chemopreventive approaches.

    PubMed

    Ramos Elizagaray, Sabina I; Soria, Elio A

    2014-01-01

    Arsenic (As) contaminates drinking water worldwide, and As exposure, hypersensitivity and deficiency are involved in the immunopathogenesis of various health problems. Its chemoprevention thus has a high health impact. Given its oxidative potential, antioxidant compounds are good candidates to counteract arsenic's deleterious effects on humans. Phytochemicals (e.g., phenolics, carotenoids, etc.) act through free radical chelation activity and regulation of cellular targets. Consequently, they are appropriate for developing anti-As strategies derived from plants, and Argentinean flora is rich in useful species. Several molecular pathways involved in immune regulation are at the same time targets of exogenous agents, and oxidative stress itself is a modulating phenomenon of immunity. Since xenohormesis has been described as the organic enhancement of resistance to stress conditions (e.g., oxidation, pollution, etc.) by consuming xenobiotics, immunoxenohormesis implies also defense improvement. This review focuses on recent patents on the development of vegetable redox-related immunomodulating agents, which might be applied in As-induced dysfunctions, with their scientific basis being reviewed. PMID:24948195

  12. Arsenic immunotoxicity and immunomodulation by phytochemicals: potential relations to develop chemopreventive approaches.

    PubMed

    Ramos Elizagaray, Sabina I; Soria, Elio A

    2014-01-01

    Arsenic (As) contaminates drinking water worldwide, and As exposure, hypersensitivity and deficiency are involved in the immunopathogenesis of various health problems. Its chemoprevention thus has a high health impact. Given its oxidative potential, antioxidant compounds are good candidates to counteract arsenic's deleterious effects on humans. Phytochemicals (e.g., phenolics, carotenoids, etc.) act through free radical chelation activity and regulation of cellular targets. Consequently, they are appropriate for developing anti-As strategies derived from plants, and Argentinean flora is rich in useful species. Several molecular pathways involved in immune regulation are at the same time targets of exogenous agents, and oxidative stress itself is a modulating phenomenon of immunity. Since xenohormesis has been described as the organic enhancement of resistance to stress conditions (e.g., oxidation, pollution, etc.) by consuming xenobiotics, immunoxenohormesis implies also defense improvement. This review focuses on recent patents on the development of vegetable redox-related immunomodulating agents, which might be applied in As-induced dysfunctions, with their scientific basis being reviewed.

  13. Immunotoxicity of the xenoestrogen 4-nonylphenol to the cockle Cerastoderma glaucum.

    PubMed

    Matozzo, Valerio; Rova, Giulio; Ricciardi, Francesco; Marin, Maria Gabriella

    2008-01-01

    The in vivo effects of 4-nonylphenol (NP) on functional responses of haemocytes from the cockle Cerastoderma glaucum were investigated after 7 days exposure to sublethal NP concentrations (0, 0+acetone, 0.0125, 0.025, 0.05 and 0.1 mg/l NP). Haemocytes from both controls and exposed cockles were collected, and the effects of NP on total haemocyte count (THC) and volume of circulating cells, intracellular superoxide anion (O(2)(-)) levels, acid phosphatase and lysozyme-like activities in both haemocyte lysate (HL) and cell-free haemolymph (CFH) were evaluated. Exposure of cockles to 0.1mg/l NP significantly increased THC (p<0.05) with respect to controls. Analysis of haemocyte size frequency distribution showed that the haemocyte fraction of about 7-8 microm in diameter and 250 femtolitres in volume increased markedly in cockles exposed to the highest NP concentration tested. Apoptosis resulting in cell volume reduction in NP-exposed animals cannot be excluded. No statistically significant variation in intracellular O(2)(-) levels was observed. Conversely, significant increases (p<0.05) in acid phosphatase activity were observed in CFH from 0.05 and 0.1mg/l NP-exposed animals; no significant differences in enzyme activity were recorded in HL. Lysozyme-like activity also increased significantly in CFH from cockles exposed to 0.05 mg/l NP (p<0.05) and 0.1 mg/l NP (p<0.001). Instead, lysozyme-like activity decreased significantly (p<0.05) in the HL of animals exposed to 0.05 mg/lNP. Our results suggest that NP induces variations in the functional responses of haemocytes of C. glaucum, mainly by reducing cell membrane stability and promoting cell degranulation.

  14. Atrazine-induced apoptosis of splenocytes in BALB/C mice

    PubMed Central

    2011-01-01

    Background Atrazine (2-chloro-4-ethytlamino-6-isopropylamine-1,3,5-triazine; ATR), is the most commonly applied broad-spectrum herbicide in the world. Unintentional overspray of ATR poses an immune function health hazard. The biomolecular mechanisms responsible for ATR-induced immunotoxicity, however, are little understood. This study presents on our investigation into the apoptosis of splenocytes in mice exposed to ATR as we explore possible immunotoxic mechanisms. Methods Oral doses of ATR were administered to BALB/C mice for 21 days. The histopathology, lymphocyte apoptosis and the expression of apoptosis-related proteins from the Fas/Fas ligand (FasL) apoptotic pathway were examined from spleen samples. Results Mice administered ATR exhibited a significant decrease in spleen and thymus weight. Electron microscope histology of ultrathin sections of spleen revealed degenerative micromorphology indicative of apoptosis of splenocytes. Flow cytometry revealed that the percentage of apoptotic lymphocytes increased in a dose-dependent manner after ATR treatment. Western blots identified increased expression of Fas, FasL and active caspase-3 proteins in the treatment groups. Conclusions ATR is capable of inducing splenocytic apoptosis mediated by the Fas/FasL pathway in mice, which could be the potential mechanism underlying the immunotoxicity of ATR. PMID:22032520

  15. ANIMAL MODELS FOR IMMUNOTOXICITY

    EPA Science Inventory

    Greater susceptibility to infection is a hallmark of compromised immune function in humans and animals, and is often considered the benchmark against which the predictive value of immune function tests are compared. This focus of this paper is resistance to infection with the pa...

  16. Evaluation of nanoparticle immunotoxicity

    NASA Astrophysics Data System (ADS)

    Dobrovolskaia, Marina A.; Germolec, Dori R.; Weaver, James L.

    2009-07-01

    The pharmaceutical industry is developing increasing numbers of drugs and diagnostics based on nanoparticles, and evaluating the immune response to these diverse formulations has become a challenge for scientists and regulatory agencies alike. An international panel of scientists and representatives from various agencies and companies reviewed the imitations of current tests at a workshop held at the National Cancer Institute in Frederick, Maryland. This article outlines practical strategies for identifying and controlling interferences in common evaluation methods and the implications for regulation.

  17. Composition and immunotoxicity activity of major essential oils from stems of Allium victorialis L. var. platyphyllum Makino against Aedes aegypti L.

    PubMed

    Chung, Ill-Min; Song, Hong-Keun; Yeo, Min-A; Moon, Hyung-In

    2011-09-01

    The stems of Allium victorialis L. var. platyphyllum were extracted and the major essential oil composition and immunotoxicity effects were studied. The analyses were conducted by gas chromatography and mass spectroscopy (GC-MS), which revealed the essential oils of A. victorialis L. var. platyphyllum stems. The A. victorialis L. var. platyphyllum essential oil yield was 1.45%, and GC/MS analysis revealed that its major constituents were allyl methyl disulfide (24.36%), dimethyl trisulfide (11.78%), allyl cis-1-propenyl disulfide (9.17%), allyl methyl trisulfide (4.13%), and dipropyl trisulfide (7.22%). The essential oil had a significant toxic effect against early fourth-stage larvae of Aedes aegypti L. with an LC(50) value of 24.12 ppm and an LC(90) value of 34.67 ppm. Also, allyl methyl disulfide (≥95.0%), dimethyl trisulfide (≥95.0%), allyl cis-1-propenyl disulfide (≥95.0%), allyl methyl trisulfide (≥95.0%), and dipropyl trisulfide (≥95.0%) were tested against the F(21) laboratory strain of A. aegypti. Allyl cis-1-propenyl disulfide (≥95.0%) has good activity with an LC(50) value of 15.35 ppm. Also, the above data indicate that other major compounds may play a more important role in the toxicity of essential oils. PMID:21162628

  18. European medicinal and edible plants associated with subacute and chronic toxicity part II: Plants with hepato-, neuro-, nephro- and immunotoxic effects.

    PubMed

    Kristanc, Luka; Kreft, Samo

    2016-06-01

    A tremendous surge of public interest in natural therapies has been reported in the past several decades in both developing and developed countries. Furthermore, edible wild-growing plants whose use had long been associated with poverty and famine have also gained in popularity among people in developed countries. An important fraction of herbal products evade all control measures and are generally perceived as safe. However, this may not always be true. It is important to recognize that some plants are not associated with acute toxicity but rather produce more insidious problems, which develop only with long-term exposure. In this review, we continue a systematic analysis of the subacute and chronic toxicity associated with the use of herbal preparations. The hepato-, neuro-, nephro- and immunotoxicity of plant species that either grow natively or are cultivated in Europe are discussed in some detail. The basic concepts regarding the molecular mechanisms implicated in their nonacute toxicity and their pathophysiological, clinical and epidemiological characteristics are included. Among others, we discuss the hepatotoxicity of pyrrolizidine alkaloids, the nephrotoxicity of aristolochic acid, the lathyrism associated with neurotoxin swainsonine, thiamine depletion and thyroid dysfunction of herbal cause, and finally address also the immunosuppressive effects of cannabinoids. PMID:27012588

  19. Facts about Stachybotrys chartarum and Other Molds

    MedlinePlus

    ... Program in Brief Related Issues Resources Quick Links Air Pollution & Respiratory Health Air Quality Asthma Mold What's New ... be removed. Â Top of Page Quick Links Air Pollution & Respiratory Health Air Quality Asthma Mold What's New ...

  20. Composition of the essential oil constituents from leaves and stems of Korean Coriandrum sativum and their immunotoxicity activity on the Aedes aegypti L.

    PubMed

    Chung, Ill-Min; Ahmad, Ateeque; Kim, Sun-Jin; Naik, Poornanand Madhava; Nagella, Praveen

    2012-02-01

    The leaves and stems of Coriandrum sativum were extracted and the essential oil composition and immunotoxicity effects were studied. The analyses were conducted by gas chromatography-mass spectroscopy (GC-MS), which revealed the essential oils of C. sativum leaves and stems. Thirty-nine components representing 99.62% of the total oil were identified from the leaves. The major components are cyclododecanol (23.11%), tetradecanal (17.86%), 2-dodecenal (9.93%), 1-decanol (7.24%), 13-tetradecenal (6.85%), 1-dodecanol (6.54%), dodecanal (5.16%), 1-undecanol (2.28%), and decanal (2.33%). Thirty-eight components representing 98.46% of the total oil were identified from the stems of the coriander. The major components are phytol (61.86%), 15-methyltricyclo[6.5.2(13,14),0(7,15)]-pentadeca-1,3,5,7,9,11,13-heptene (7.01%), dodecanal (3.18%), and 1-dodecanol (2.47%). The leaf oil had significant toxic effects against the larvae of Aedes aegypti with an LC₅₀ value of 26.93 ppm and an LC₉₀ value of 37.69 ppm and the stem oil has toxic effects against the larvae of A. aegypti with an LC₅₀ value of 29.39 ppm and an LC₉₀ value of 39.95 ppm. Also, the above data indicate that the major compounds may play an important role in the toxicity of essential oils.

  1. Immunotoxic effects of cis-urocanic acid exposure in C57BL/6N and C3H/HeN mice.

    PubMed

    Prater, M Renee; Gogal, Robert M; De Fabo, Edward C; Longstreth, Janice; Holladay, Steven D

    2003-04-01

    Exposure to ultraviolet radiation results in increased levels of intradermal cis-urocanic acid (cUCA) and alters cutaneous immunity by interfering with processing and presentation of antigen by Langerhans cells. Reports on effects of systemic immunotoxicity with 30 day cUCA exposure in laboratory rodents include thymic atrophy, thymic hypocellularity and decreased T-cell-mediated immunity; however, immune effects of single exposure or 5 day cUCA administration, which may better mimic human exposures, are poorly defined. The present study initially evaluated immune effects of single, 5 day, and 4 week cUCA exposure in C57BL/6N mice. Single administration of intradermal cUCA resulted in decreased splenocyte phagocytosis that persisted for 30 days after cUCA exposure. Five day consecutive cUCA exposure decreased numbers of phenotypically mature CD4(+)CD8(-) and CD4(-)CD8(+) (single positive) thymocytes, increased CD4(+)CD8(+) (double positive) immature thymocytes and increased splenocyte proliferation. Prolonged cUCA exposure (4 weeks) caused profound thymic hypocellularity and splenic hypercellularity and increased splenic macrophage chemiluminescence. Because of this apparent sensitivity of C57BL/6N mice to cUCA, thymic hypocellularity was compared between C57BL/6N and C3H/HeN mice dosed with cUCA, and was found to be more pronounced in the C57BL/6N strain. These results are an extension of previous conclusions on immune modulation caused by cUCA in the spleen and thymus. Further, the observed variation in sensitivity between the mouse strains is consistent with known genetic susceptibility of these strains to the immunomodulatory effects of exposure to sunlight. PMID:12733650

  2. Patterns of Immunotoxicity Associated with Chronic as Compared with Acute Exposure to Chemical or Physical Stressors and their Relevance with Regard to the Role of Stress and with Regard to Immunotoxicity Testing

    PubMed Central

    Pruett, Stephen B.; Fan, Ruping; Zheng, Qiang; Schwab, Carlton

    2009-01-01

    Previous studies have demonstrated that the stress response induced by some drugs and chemicals contributes in a predictable way to alteration of particular immunological parameters in mice. It has not been determined if mice can become tolerant or habituated with regard to the stress response and consequent immunological effects. Addressing this issue was the purpose of the present study. Mice were dosed daily for 28 days with atrazine, ethanol, propanil, or subjected to restraint, which are known to induce neuroendocrine stress responses and thereby to alter several immunological parameters. On day 29, a blood sample was taken and the spleen was removed for analysis of cellular phenotypes, differential cell counts (for blood), and natural killer (NK) cell activity. Corticosterone concentration at various times after dosing (or restraint) was also measured. Comparison of these results with results from previous studies with a single acute exposure revealed that the corticosterone response was almost completely absent in mice treated with ethanol, reduced in mice treated with restraint and propanil, and for atrazine the response was the same as noted for acute exposure. In most cases, the changes in immunological parameters were consistent with expectations based on these corticosterone responses. However, in a few cases (e.g., NK cell activity), it was clear that there were effects not mediated by stress. These results indicate that the nature of the stressor determines whether mice become tolerant with regard to the stress response and consequent immunological effects. This finding has practical implications for safety testing in mice. PMID:19357072

  3. Novel biomarkers of mercury-induced autoimmune dysfunction: a cross-sectional study in Amazonian Brazil.

    PubMed

    Motts, Jonathan A; Shirley, Devon L; Silbergeld, Ellen K; Nyland, Jennifer F

    2014-07-01

    Mercury is a ubiquitous environmental contaminant, causing both neurotoxicity and immunotoxicity. Given its ability to amalgamate gold, mercury is frequently used in small-scale artisanal gold mining. We have previously reported that elevated serum titers of antinuclear autoantibodies (ANA) are associated with mercury exposures of miners in gold mining. The goal of this project was to identify novel serum biomarkers of mercury-induced immunotoxicity and autoimmune dysregulation. We conducted an analysis of serum samples from a cross-sectional epidemiological study on miners working in Amazonian Brazil. In proteomic screening analyses, samples were stratified based on mercury concentrations and ANA titer and a subset of serum samples (N=12) were profiled using Immune Response Biomarker Profiling ProtoArray protein microarray for elevated autoantibodies. Of the up-regulated autoantibodies in the mercury-exposed cohort, potential target autoantibodies were selected based on relevance to pro-inflammatory and macrophage activation pathways. ELISAs were developed to test the entire sample cohort (N=371) for serum titers to the highest of these autoantibodies (anti-glutathione S-transferase alpha, GSTA1) identified in the high mercury/high ANA group. We found positive associations between elevated mercury exposure and up-regulated serum titers of 3760 autoantibodies as identified by ProtoArray. Autoantibodies identified as potential novel biomarkers of mercury-induced immunotoxicity include antibodies to the following proteins: GSTA1, tumor necrosis factor ligand superfamily member 13, linker for activation of T cells, signal peptide peptidase like 2B, stimulated by retinoic acid 13, and interferon induced transmembrane protein. ELISA analyses confirmed that mercury-exposed gold miners had significantly higher serum titers of anti-GSTA1 autoantibody [unadjusted odds ratio=89.6; 95% confidence interval: 27.2, 294.6] compared to emerald miners (referent population). Mercury

  4. Novel biomarkers of mercury-induced autoimmune dysfunction: a Cross-sectional study in Amazonian Brazil

    PubMed Central

    Motts, Jonathan A.; Shirley, Devon L.; Silbergeld, Ellen K.; Nyland, Jennifer F.

    2014-01-01

    Mercury is an ubiquitous environmental contaminant, causing both neurotoxicity and immunotoxicity. Given its ability to amalgamate gold, mercury is frequently used in small-scale artisanal gold mining. We have previously reported that elevated serum titers of antinuclear autoantibodies (ANA) are associated with mercury exposures of miners in gold mining. The goal of this project was to identify novel serum biomarkers of mercury-induced immunotoxicity and autoimmune dysregulation. We conducted an analysis of serum samples from a cross-sectional epidemiological study on miners working in Amazonian Brazil. In proteomic screening analyses, samples were stratified based on mercury concentrations and ANA titer and a subset of serum samples (N=12) were profiled using Immune Response Biomarker Profiling ProtoArray protein microarray for elevated autoantibodies. Of the up-regulated autoantibodies in the mercury-exposed cohort, potential target autoantibodies were selected based on relevance to pro-inflammatory and macrophage activation pathways. ELISAs were developed to test the entire sample cohort (N=371) for serum titers to the highest of these autoantibodies (anti-glutathione S-transferase alpha, GSTA1) identified in the high mercury/high ANA group. We found positive associations between elevated mercury exposure and up-regulated serum titers of 3760 autoantibodies as identified by ProtoArray. Autoantibodies identified as potential novel biomarkers of mercury-induced immunotoxicity include antibodies to the following proteins: GSTA1, tumor necrosis factor ligand superfamily member 13, linker for activation of T cells, signal peptide peptidase like 2B, stimulated by retinoic acid 13, and interferon induced transmembrane protein. ELISA analyses confirmed that mercury-exposed gold miners had significantly higher serum titers of anti-GSTA1 autoantibody [unadjusted odds ratio = 89.6; 95% confidence interval: 27.2, 294.6] compared to emerald miners (referent population

  5. Dietary selenium protect against redox-mediated immune suppression induced by methylmercury exposure.

    PubMed

    Li, Xuan; Yin, Daqiang; Yin, Jiaoyang; Chen, Qiqing; Wang, Rui

    2014-10-01

    The antagonism between selenium (Se) and mercury (Hg) has been widely recognized, however, the protective role of Se against methylmercury (MeHg) induced immunotoxicity and the underlying mechanism is still unclear. In the current study, MeHg exposure (0.01 mM via drinking water) significantly inhibited the lymphoproliferation and NK cells functions of the female Balb/c mice, while dietary Se supplementation (as Se-rich yeast) partly or fully recovered the observed immunotoxicity, indicating the protective role of Se against MeHg-induced immune suppression in mice. Besides, MeHg exposure promoted the generation of the reactive oxygen species (ROS), reduced the levels of nonenzymic and enzymic antioxidants in target organs, while dietary Se administration significantly diminished the MeHg-induced oxidative stress and subsequent cellular dysfunctions (lipid peroxidation and protein oxidation). Two possible mechanisms of Se's protective effects were further revealed. Firstly, the reduction of mercury concentrations (less than 25%, modulated by Se supplementation) in the target organs might contribute, but not fully explain the alleviated immune suppression. Secondly and more importantly, Se could help to maintain/or elevate the activities of several key antioxidants, therefore protect the immune cells against MeHg-induced oxidative damage.

  6. GC-TOF/MS-based metabolomics approach to study the cellular immunotoxicity of deoxynivalenol on murine macrophage ANA-1 cells.

    PubMed

    Ji, Jian; Sun, Jiadi; Pi, Fuwei; Zhang, Shuang; Sun, Chao; Wang, Xiumei; Zhang, Yinzhi; Sun, Xiulan

    2016-08-25

    Gas chromatography-time of fly/mass spectrum (GC-TOF/MS) based complete murine macrophage ANA-1 cell metabolome strategy, including the endo-metabolome and the exo-metabolome, ANA-1 cell viability assays and apoptosis induced by diverse concentrations of DON were evaluated for selection of an optimized dose for in-depth metabolomic research. Using the optimized chromatography and mass spectrometry parameters, the metabolites detected by GC-TOF/MS were identified and processed with multivariate statistical analysis, including principal componentanalysis (PCA) and orthogonal projection to latent structures-discriminant analysis (OPLS-DA) analysis. The data sets were screened with a t-test (P) value < 0.05, VIP value > 1, similarity value > 500, leaving 16 exo-metabolite variables and 11 endo-metabolite variables for further pathway analysis. Implementing the integration of key metabolic pathways, the metabolism pathways were categorized into two dominating types, metabolism of amino acid and glycometabolism. Glycine, serine and threonine metabolism, phenylalanine, tyrosine and tryptophan biosynthesis and phenylalanine metabolism were the significant amino acids affected by the metabolic pathways, indicating statistically significant fold changes including pyruvate, serine, glycine, lactate and threonine. Glycolysis or gluconeogenesis, starch and sucrose metabolism, and galactose metabolism, belonging to glycometabolism, were the pathways that were found to be primarily affected, resulting in abnormal metabolites such as glucose-1P, Glucose, gluconic acid, myo-inositol, sorbitol and glycerol.

  7. GC-TOF/MS-based metabolomics approach to study the cellular immunotoxicity of deoxynivalenol on murine macrophage ANA-1 cells.

    PubMed

    Ji, Jian; Sun, Jiadi; Pi, Fuwei; Zhang, Shuang; Sun, Chao; Wang, Xiumei; Zhang, Yinzhi; Sun, Xiulan

    2016-08-25

    Gas chromatography-time of fly/mass spectrum (GC-TOF/MS) based complete murine macrophage ANA-1 cell metabolome strategy, including the endo-metabolome and the exo-metabolome, ANA-1 cell viability assays and apoptosis induced by diverse concentrations of DON were evaluated for selection of an optimized dose for in-depth metabolomic research. Using the optimized chromatography and mass spectrometry parameters, the metabolites detected by GC-TOF/MS were identified and processed with multivariate statistical analysis, including principal componentanalysis (PCA) and orthogonal projection to latent structures-discriminant analysis (OPLS-DA) analysis. The data sets were screened with a t-test (P) value < 0.05, VIP value > 1, similarity value > 500, leaving 16 exo-metabolite variables and 11 endo-metabolite variables for further pathway analysis. Implementing the integration of key metabolic pathways, the metabolism pathways were categorized into two dominating types, metabolism of amino acid and glycometabolism. Glycine, serine and threonine metabolism, phenylalanine, tyrosine and tryptophan biosynthesis and phenylalanine metabolism were the significant amino acids affected by the metabolic pathways, indicating statistically significant fold changes including pyruvate, serine, glycine, lactate and threonine. Glycolysis or gluconeogenesis, starch and sucrose metabolism, and galactose metabolism, belonging to glycometabolism, were the pathways that were found to be primarily affected, resulting in abnormal metabolites such as glucose-1P, Glucose, gluconic acid, myo-inositol, sorbitol and glycerol. PMID:27350164

  8. PARTNERSHIPS TO IMPROVE IMMUNOTOXICITY TESTING

    EPA Science Inventory

    Research in ITB is focused on the effects that chemicals/environmental contaminants have on modulation of the immune system. Immune modulation may result in suppressed immune function, while exposure to certain contaminants may result in hypersensitivity reactions (e.g., asthma ...

  9. Melatonin Reverses Fas, E2F-1 and Endoplasmic Reticulum Stress Mediated Apoptosis and Dysregulation of Autophagy Induced by the Herbicide Atrazine in Murine Splenocytes

    PubMed Central

    Sharma, Shweta; Sarkar, Jayanta; Haldar, Chandana; Sinha, Sudhir

    2014-01-01

    Exposure to the herbicide Atrazine (ATR) can cause immunotoxicity, apart from other adverse consequences for animal and human health. We aimed at elucidating the apoptotic mechanisms involved in immunotoxicity of ATR and their attenuation by Melatonin (MEL). Young Swiss mice were divided into control, ATR and MEL+ATR groups based on daily (x14) intraperitoneal administration of the vehicle (normal saline), ATR (100 mg/kg body weight) and MEL (20 mg/kg body weight) with ATR. Isolated splenocytes were processed for detection of apoptosis by Annexin V-FITC and TUNEL assays, and endoplasmic reticulum (ER) stress by immunostaining. Key proteins involved in apoptosis, ER stress and autophagy were quantified by immunoblotting. ATR treatment resulted in Fas-mediated activation of caspases 8 and 3 and inactivation of PARP1 which were inhibited significantly by co-treatment with MEL. MEL also attenuated the ATR-induced, p53 independent mitochondrial apoptosis through upregulation of E2F-1 and PUMA and suppression of their downstream target Bax. An excessive ER stress triggered by ATR through overexpression of ATF-6α, spliced XBP-1, CREB-2 and GADD153 signals was reversed by MEL. MEL also reversed the ATR-induced impairment of autophagy which was indicated by a decline in BECN-1, along with significant enhancement in LC3B-II and p62 expressions. Induction of mitochondrial apoptosis, ER stress and autophagy dysregulation provide a new insight into the mechanism of ATR immunotoxicity. The cytoprotective role of MEL, on the other hand, was defined by attenuation of ER stress, Fas-mediated and p53 independent mitochondria-mediated apoptosis as well as autophagy signals. PMID:25259610

  10. Comparative study of respiratory tract immune toxicity induced by three sterilisation nanoparticles: silver, zinc oxide and titanium dioxide.

    PubMed

    Liu, Huanliang; Yang, Danfeng; Yang, Honglian; Zhang, Huashan; Zhang, Wei; Fang, Yanjun; Lin, Zhiqing; Tian, Lei; Lin, Bencheng; Yan, Jun; Xi, Zhuge

    2013-03-15

    Silver, zinc oxide, and titanium dioxide nanoparticles are used as sterilisation materials to enhance the performance of disinfectants. We investigated the respiratory tract immune toxicity ("immunotoxicity") of these nanoparticles in vivo and in vitro, and we explored the relationships between particle size, particle shape, chemical composition, chemical stability and the toxicological effects of these typical nanoparticles in rats. In vivo, the rats were exposed to nanoparticles by intratracheal instillation. Exposure to nanoparticles caused an increase in oxidative injury to the lungs and disorders in regulating the cytokine network, which were detected in the bronchoalveolar lavage fluid, suggesting that oxidative stress might be important for inducing the respiratory immunotoxicity of nanoparticles. In vitro, the phagocytic function of alveolar macrophages (AMs) was dose-dependently reduced by nanoparticles, and ZnO nanoparticles induced greater cytotoxicity than the silver and titanium-dioxide nanoparticles, which were coincident with the results of multiple measurements, such as a cell viability assay by WST-8 and LDH measurements. Comparative analyses demonstrated that particle composition and chemical stability most likely had a primary role in the biological effects of different nanoparticles.

  11. Satratoxin G–Induced Apoptosis in PC-12 Neuronal Cells is Mediated by PKR and Caspase Independent

    PubMed Central

    Islam, Zahidul; Hegg, Colleen C.; Bae, Hee Kyong; Pestka, James J.

    2008-01-01

    Satratoxin G (SG) is a macrocyclic trichothecene mycotoxin produced by Stachybotrys chartarum, a mold suggested to play an etiologic role in damp building-related illnesses. Acute intranasal exposure of mice to SG specifically induces apoptosis in olfactory sensory neurons of the nose. The PC-12 rat pheochromocytoma cell model was used to elucidate potential mechanisms of SG-induced neuronal cell death. Agarose gel electrophoresis revealed that exposure to SG at 10 ng/ml or higher for 48-h induced DNA fragmentation characteristic of apoptosis in PC-12 cells. SG-induced apoptosis was confirmed by microscopic morphology, hypodiploid fluorescence and annexin V-fluorescein isothiocyanate (FITC) uptake. Messenger RNA expression of the proapoptotic genes p53, double-stranded RNA–activated protein kinase (PKR), BAX, and caspase-activated DNAse was significantly elevated from 6 to 48 h after SG treatment. SG also induced apoptosis and proapoptotic gene expression in neural growth factor-differentiated PC-12 cells. Although SG-induced caspase-3 activation, caspase inhibition did not impair apoptosis. Moreover, SG induced nuclear translocation of apoptosis-inducing factor (AIF), a known contributor to caspase-independent neuronal cell death. SG-induced apoptosis was not affected by inhibitors of oxidative stress or mitogen-activated protein kinases but was suppressed by the PKR inhibitor C16 and by PKR siRNA transfection. PKR inhibition also blocked SG-induced apoptotic gene expression and AIF translocation but not caspase-3 activation. Taken together, SG-induced apoptosis in PC-12 neuronal cells is mediated by PKR via a caspase-independent pathway possibly involving AIF translocation. PMID:18535002

  12. Effects of prior oral exposure to combinations of environmental immunosuppressive agents on ovalbumin allergen-induced allergic airway inflammation in Balb/c mice.

    PubMed

    Fukuyama, Tomoki; Nishino, Risako; Kosaka, Tadashi; Watanabe, Yuko; Kurosawa, Yoshimi; Ueda, Hideo; Harada, Takanori

    2014-08-01

    Abstract Humans are exposed daily to multiple environmental chemicals in the atmosphere, in food, and in commercial products. Therefore, hazard identification and risk management must account for exposure to chemical mixtures. The objective of the study reported here was to investigate the effects of combinations of three well-known environmental immunotoxic chemicals - methoxychlor (MXC), an organochlorine compound; parathion (PARA), an organophosphate compound; and piperonyl butoxide (PBO), an agricultural insecticide synergist - by using a mouse model of ovalbumin (OVA)-induced allergic airway inflammation. Four-week-old Balb/c mice were exposed orally to either one or two of the environmental immunotoxic chemicals for five consecutive days, prior to intraperitoneal sensitization with OVA and an inhalation challenge. We assessed IgE levels in serum, B-cell counts, and cytokine production in hilar lymph nodes, and differential cell counts and levels of related chemokines in bronchoalveolar lavage fluid (BALF). Mice treated with MXC + PARA or PBO + MXC showed marked increases in serum IgE, IgE-positive B-cells and cytokines in lymph nodes, and differential cell counts and related chemokines in BALF compared with mice that received the vehicle control or the corresponding individual test substances. These results suggest that simultaneous exposure to multiple environmental chemicals aggravates allergic airway inflammation more than exposure to individual chemicals. It is expected that the results of this study will help others in their evaluation of immunotoxic combinational effects when conducting assessments of the safety of environmental/occupational chemicals.

  13. Comparative immunotoxicity of 2,2`-dichlorodiethyl sulfide and cyclophosphamide: Evaluation of L1210 tumor cell resistance, cell-mediated immunity, and humoral immunity. (Reannouncement with new availability information)

    SciTech Connect

    Blank, J.A.; Joiner, R.L.; Houchens, D.P.; Dill, G.S.; Hobson, D.W.

    1991-12-31

    The immunotoxicity of 2,2`-dichlorodiethyl sulfide (sulfur mustard, SM),on humoral and cell-mediated immunity was compared with that of the nitrogen mustard 2-(bis(2-chloroethyl) amino)tetrahydro- 2H-1,3,2-oxazophosphorine 2-oxide (cyclophosphamide, CP). SM and CP had similar effects on thymic and splenic weights, spleen cell number, and the formation of antibody producing cells to sheep red blood cells (sRBC) when examined 5 days after exposure, but differed in their effects on body weights. Although there were no differences in the delayed hypersensitivity response to keyhole limpet hemocyanin, CP and SM had different effects in the L1210 tumor cell allograft rejection assay. CP, but not SM, decreased the 28 day survival rate of allogeneic mice exposed to a sublethal L1210 tumor challenge. The differing effects on survival to the L1210 tumor challenge could not be attributed to a direct cytotoxic effect of SM on the L1210 tumor cells as SM did not increase the survival rate or mediansurvival time of syngeneic mice exposed to a lethal L1210 tumor cell challenge. In summary, SM and CP had immunosuppressive effects in the humoral immune assay. Although neither compound suppressed the delayed hypersensitivity response, CP was found to suppress host resistance to L1210 tumor cells.

  14. Visual agnosia and Klüver-Bucy syndrome in marmosets (Callithrix jacchus) following ablation of inferotemporal cortex, with additional mnemonic effects of immunotoxic lesions of cholinergic projections to medial temporal areas.

    PubMed

    Ridley, R M; Warner, K A; Maclean, C J; Gaffan, D; Baker, H F

    2001-04-13

    Inferotemporal ablations in the New World monkey, the common marmoset (Callithrix jacchus), produced a persistent impairment on visual discrimination learning and a florid, but transient, Klüver-Bucy syndrome. Monkeys with these ablations were impaired on acquisition of object discriminations to a high criterion and on concurrent discrimination learning, to a single high criterion across all trials. Neither the control monkeys nor the monkeys with inferotemporal ablations found acquisition more difficult when the component discriminations of a set were presented concurrently compared to consecutively, although the monkeys with inferotemporal ablations found acquisition under both these conditions somewhat more difficult than did control monkeys. This suggests that the severe impairment caused by inferotemporal ablations on concurrent learning measured across all trials is due to the need for sustained performance across a concurrent set rather than to the extra mnemonic demands of concurrent presentation. When immunotoxic lesions of the cholinergic projection to the hippocampal formation were added to the inferotemporal ablations, a further impairment on retention, and a differential impairment on concurrent, compared to consecutive, learning was observed. Previous studies have shown that lesions of the cholinergic projection to the hippocampus alone, or excitotoxic hippocampal lesions, do not affect simple visual discrimination learning. It is suggested that large inferotemporal ablations in monkeys produce a visual agnosia which causes severe 'psychic blindness' in the first instance, and a persistent impairment on visual discrimination learning. The hippocampus makes a contribution, which may be mnemonic, to discrimination performance after inferotemporal ablations.

  15. Protective effect of melatonin against propoxur-induced oxidative stress and suppression of humoral immune response in rats.

    PubMed

    Suke, Sanvidhan G; Kumar, Achint; Ahmed, Rafat S; Chakraborti, Ayanabha; Tripathi, A K; Mediratta, P K; Banerjee, B D

    2006-04-01

    Effect of melatonin in attenuation of propoxur induced oxidative stress and suppression of humoral immune response was studied in rats. Oral administration of propoxur (10 mg/kg) increased lipid peroxidation in serum after 28 days treatment. Superoxide dismutase, catalase and glutathione were also altered following propoxur exposure. In addition propoxur exposure markedly suppressed humoral immune response as assessed by antibody titre and plaque forming cell assay. Simultaneous treatment with melatonin (5 mg/kg, ip) markedly attenuated the effect of propoxur on (a) lipid peroxidation, (b) oxidative stress parameters and (c) immunotoxicity. Results have been discussed in the light of possible immunopotentiating and antioxidant effects of melatonin to understand the influence of oxidative stress on propoxur induced immunomodulation.

  16. Immunotoxicity of nanoparticles: a computational study suggests that CNTs and C60 fullerenes might be recognized as pathogens by Toll-like receptors

    NASA Astrophysics Data System (ADS)

    Turabekova, M.; Rasulev, B.; Theodore, M.; Jackman, J.; Leszczynska, D.; Leszczynski, J.

    2014-03-01

    Over the last decade, a great deal of attention has been devoted to study the inflammatory response upon exposure to multi/single-walled carbon nanotubes (CNTs) and different fullerene derivatives. In particular, carbon nanoparticles are reported to provoke substantial inflammation in alveolar and bronchial epithelial cells, epidermal keratinocytes, cultured monocyte-macrophage cells, etc. We suggest a hypothetical model providing the potential mechanistic explanation for immune and inflammatory responses observed upon exposure to carbon nanoparticles. Specifically, we performed a theoretical study to analyze CNT and C60 fullerene interactions with the available X-ray structures of Toll-like receptors (TLRs) homo- and hetero-dimer extracellular domains. This assumption was based on the fact that similar to the known TLR ligands both CNTs and fullerenes induce, in cells, the secretion of certain inflammatory protein mediators, such as interleukins and chemokines. These proteins are observed within inflammation downstream processes resulted from the ligand molecule dependent inhibition or activation of TLR-induced signal transduction. Our computational studies have shown that the internal hydrophobic pockets of some TLRs might be capable of binding small-sized carbon nanostructures (5,5 armchair SWCNTs containing 11 carbon atom layers and C60 fullerene). High binding scores and minor structural alterations induced in TLR ectodomains upon binding C60 and CNTs further supported our hypothesis. Additionally, the proposed hypothesis is strengthened by the indirect experimental findings indicating that CNTs and fullerenes induce an excessive expression of specific cytokines and chemokines (i.e. IL-8 and MCP1).Over the last decade, a great deal of attention has been devoted to study the inflammatory response upon exposure to multi/single-walled carbon nanotubes (CNTs) and different fullerene derivatives. In particular, carbon nanoparticles are reported to provoke

  17. Early phosphoproteomic changes in the mouse spleen during deoxynivalenol-induced ribotoxic stress.

    PubMed

    Pan, Xiao; Whitten, Douglas A; Wu, Ming; Chan, Christina; Wilkerson, Curtis G; Pestka, James J

    2013-09-01

    The trichothecene mycotoxin deoxynivalenol (DON) targets the innate immune system and is of public health significance because of its frequent presence in human and animal food. DON-induced proinflammatory gene expression and apoptosis in the lymphoid tissue have been associated with a ribotoxic stress response (RSR) that involves rapid phosphorylation of mitogen-activated protein kinases (MAPKs). To better understand the relationship between protein phosphorylation and DON's immunotoxic effects, stable isotope dimethyl labeling-based proteomics in conjunction with titanium dioxide chromatography was employed to quantitatively profile the immediate (≤ 30min) phosphoproteome changes in the spleens of mice orally exposed to 5mg/kg body weight DON. A total of 90 phosphoproteins indicative of novel phosphorylation events were significantly modulated by DON. In addition to critical branches and scaffolds of MAPK signaling being affected, DON exposure also altered phosphorylation of proteins that mediate phosphatidylinositol 3-kinase/AKT pathways. Gene ontology analysis revealed that DON exposure affected biological processes such as cytoskeleton organization, regulation of apoptosis, and lymphocyte activation and development, which likely contribute to immune dysregulation associated with DON-induced RSR. Consistent with these findings, DON impacted phosphorylation of proteins within diverse immune cell populations, including monocytes, macrophages, T cells, B cells, dendritic cells, and mast cells. Fuzzy c-means clustering analysis further indicated that DON evoked several distinctive temporal profiles of regulated phosphopeptides. Overall, the findings from this investigation can serve as a template for future focused exploration and modeling of cellular responses associated with the immunotoxicity evoked by DON and other ribotoxins.

  18. Early Phosphoproteomic Changes in the Mouse Spleen During Deoxynivalenol-Induced Ribotoxic Stress

    PubMed Central

    Pestka, James J.

    2013-01-01

    The trichothecene mycotoxin deoxynivalenol (DON) targets the innate immune system and is of public health significance because of its frequent presence in human and animal food. DON-induced proinflammatory gene expression and apoptosis in the lymphoid tissue have been associated with a ribotoxic stress response (RSR) that involves rapid phosphorylation of mitogen-activated protein kinases (MAPKs). To better understand the relationship between protein phosphorylation and DON’s immunotoxic effects, stable isotope dimethyl labeling–based proteomics in conjunction with titanium dioxide chromatography was employed to quantitatively profile the immediate (≤ 30min) phosphoproteome changes in the spleens of mice orally exposed to 5mg/kg body weight DON. A total of 90 phosphoproteins indicative of novel phosphorylation events were significantly modulated by DON. In addition to critical branches and scaffolds of MAPK signaling being affected, DON exposure also altered phosphorylation of proteins that mediate phosphatidylinositol 3-kinase/AKT pathways. Gene ontology analysis revealed that DON exposure affected biological processes such as cytoskeleton organization, regulation of apoptosis, and lymphocyte activation and development, which likely contribute to immune dysregulation associated with DON-induced RSR. Consistent with these findings, DON impacted phosphorylation of proteins within diverse immune cell populations, including monocytes, macrophages, T cells, B cells, dendritic cells, and mast cells. Fuzzy c-means clustering analysis further indicated that DON evoked several distinctive temporal profiles of regulated phosphopeptides. Overall, the findings from this investigation can serve as a template for future focused exploration and modeling of cellular responses associated with the immunotoxicity evoked by DON and other ribotoxins. PMID:23811945

  19. Effect of acetochlor on transcription of genes associated with oxidative stress, apoptosis, immunotoxicity and endocrine disruption in the early life stage of zebrafish.

    PubMed

    Jiang, Jinhua; Wu, Shenggan; Liu, Xinju; Wang, Yanhua; An, Xuehua; Cai, Leiming; Zhao, Xueping

    2015-09-01

    The study presented here aimed to characterize the effects of acetochlor on expression of genes related to endocrine disruption, oxidative stress, apoptosis and immune system in zebrafish during its embryo development. Different trends in gene expression were observed after exposure to 50, 100, 200μg/L acetochlor for 96h. Results demonstrated that the transcription patterns of many key genes involved in the hypothalamic-pituitary-gonadal/thyroid (HPG/HPT) axis (e.g., VTG1, ERβ1, CYP19a and TRα), cell apoptosis pathway (e.g., Bcl2, Bax, P53 and Cas8), as well as innate immunity (e.g., CXCL-C1C, IL-1β and TNFα) were affected in newly hatched zebrafish after exposure to acetochlor. In addition, the up-regulation of CAT, GPX, GPX1a, Cu/Zn-SOD and Ogg1 suggested acetochlor might trigger oxidative stress in zebrafish. These finding indicated that acetochlor could simultaneously induce multiple responses during zebrafish embryonic development, and bidirectional interactions among oxidative stress, apoptosis pathway, immune and endocrine systems might be present.

  20. Effect of acetochlor on transcription of genes associated with oxidative stress, apoptosis, immunotoxicity and endocrine disruption in the early life stage of zebrafish.

    PubMed

    Jiang, Jinhua; Wu, Shenggan; Liu, Xinju; Wang, Yanhua; An, Xuehua; Cai, Leiming; Zhao, Xueping

    2015-09-01

    The study presented here aimed to characterize the effects of acetochlor on expression of genes related to endocrine disruption, oxidative stress, apoptosis and immune system in zebrafish during its embryo development. Different trends in gene expression were observed after exposure to 50, 100, 200μg/L acetochlor for 96h. Results demonstrated that the transcription patterns of many key genes involved in the hypothalamic-pituitary-gonadal/thyroid (HPG/HPT) axis (e.g., VTG1, ERβ1, CYP19a and TRα), cell apoptosis pathway (e.g., Bcl2, Bax, P53 and Cas8), as well as innate immunity (e.g., CXCL-C1C, IL-1β and TNFα) were affected in newly hatched zebrafish after exposure to acetochlor. In addition, the up-regulation of CAT, GPX, GPX1a, Cu/Zn-SOD and Ogg1 suggested acetochlor might trigger oxidative stress in zebrafish. These finding indicated that acetochlor could simultaneously induce multiple responses during zebrafish embryonic development, and bidirectional interactions among oxidative stress, apoptosis pathway, immune and endocrine systems might be present. PMID:26318563

  1. In Vitro Nephrotoxicity Induced by Propanil

    PubMed Central

    Rankin, Gary O.; Racine, Christopher; Sweeney, Adam; Kraynie, Alyssa; Anestis, Dianne K.; Barnett, John B.

    2015-01-01

    Propanil is a postemergence herbicide used primarily in rice and wheat production in the United States. The reported toxicities for propanil exposure include methemoglobinemia, immunotoxicity, and nephrotoxicity. A major metabolite of propanil, 3,4-dichloroaniline (3,4-DCA), has been shown to be a nephrotoxicant in vivo and in vitro, but the nephrotoxic potential of propanil has not been examined in detail. The purpose of this study was to determine the nephrotoxic potential of propanil using an in vitro kidney model, determine whether in vitro propanil nephrotoxicity is due to metabolites arising from propanil hydrolysis, and examine mechanistic aspects of propanil nephrotoxicity in vitro. Propanil, 3,4-DCA, propionic acid (0.1–5.0 mM), or vehicle was incubated for 15–120 min with isolated renal cortical cells (IRCC; ~4 million cells/mL) obtained from untreated male Fischer 344 rats. Cytotoxicity was determined by measuring lactate dehydrogenase release from IRCC. In 120-min incubations, propanil induced cytotoxicity at concentrations >0.5 mM. At 1.0 mM, propanil induced cytotoxicity following 60- or 120-min exposure. Cytotoxicity was observed with 3,4-DCA (2.0 mM) at 60 and 120 min, while propionic acid (5.0 mM) induced cytotoxicity at 60 min. In IRCC pretreated with an antioxidant, cytochrome P450(CYP) inhibitor, flavin adenine dinucleotide monooxygenase activity modulator, or cyclooxygenase inhibitor before propanil exposure (1.0 mM; 120 min), only piperonyl butoxide (0.1 mM), a CYP inhibitor, pretreatment decreased propanil cytotoxicity. These results demonstrate that propanil is an in vitro nephrotoxicant in IRCC. Propanil nephrotoxicity is not primarily due to metabolites resulting from hydrolysis of propanil, but a metabolite resulting from propanil oxidation may contribute to propanil cytotoxicity. PMID:18214888

  2. Perfluorinated Compounds: Emerging POPs with Potential Immunotoxicity

    EPA Science Inventory

    Perfluorinated compounds (PFCs) have been recognized as an important class of environmental contaminants commonly detected in blood samples of both wildlife and humans. These compounds have been in use for more than 60 years as surface treatment chemicals, polymerization aids, an...

  3. Exploring the Immunotoxicity of Carbon Nanotubes

    NASA Astrophysics Data System (ADS)

    Yu, Yanmei; Zhang, Qiu; Mu, Qingxin; Zhang, Bin; Yan, Bing

    2008-08-01

    Mass production of carbon nanotubes (CNTs) and their applications in nanomedicine lead to the increased exposure risk of nanomaterials to human beings. Although reports on toxicity of nanomaterials are rapidly growing, there is still a lack of knowledge on the potential toxicity of such materials to immune systems. This article reviews some existing studies assessing carbon nanotubes’ toxicity to immune system and provides the potential mechanistic explanation.

  4. 40 CFR 799.9780 - TSCA immunotoxicity.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 40 CFR 799.9346. The exposure time for the anti-SRBC test shall be at least 28 days. (6) Observation... levels. (3) Test report. In addition to the reporting requirements as specified under 40 CFR part 792... study shall be conducted in compliance with the 40 CFR Part 792—Good Laboratory Practice. (j)...

  5. 40 CFR 799.9780 - TSCA immunotoxicity.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 40 CFR 799.9346. The exposure time for the anti-SRBC test shall be at least 28 days. (6) Observation... levels. (3) Test report. In addition to the reporting requirements as specified under 40 CFR part 792... study shall be conducted in compliance with the 40 CFR Part 792—Good Laboratory Practice. (j)...

  6. 40 CFR 799.9780 - TSCA immunotoxicity.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 40 CFR 799.9346. The exposure time for the anti-SRBC test shall be at least 28 days. (6) Observation... levels. (3) Test report. In addition to the reporting requirements as specified under 40 CFR part 792... study shall be conducted in compliance with the 40 CFR Part 792—Good Laboratory Practice. (j)...

  7. 40 CFR 799.9780 - TSCA immunotoxicity.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 40 CFR 799.9346. The exposure time for the anti-SRBC test shall be at least 28 days. (6) Observation... levels. (3) Test report. In addition to the reporting requirements as specified under 40 CFR part 792... study shall be conducted in compliance with the 40 CFR Part 792—Good Laboratory Practice. (j)...

  8. Immune System Toxicity and Immunotoxicity Hazard Identification

    EPA Science Inventory

    Exposure to chemicals may alter immune system health, increasing the risk of infections, allergy and autoimmune diseases. The chapter provides a concise overview of the immune system, host factors that affect immune system heal, and the effects that xenobiotic exposure may have ...

  9. 40 CFR 799.9780 - TSCA immunotoxicity.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... properties of the test substance. It is recommended that an aqueous solution should be used. If solubility is.... (ii) One lot of the test substance shall be used, if possible, throughout the duration of the study... of the animal's body weight. (iii) If the test substance is......

  10. Tetrabromobisphenol-A induces apoptotic death of auditory cells and hearing loss.

    PubMed

    Park, Channy; Kim, Se-Jin; Lee, Won Kyo; Moon, Sung Kyun; Kwak, SeongAe; Choe, Seong-Kyu; Park, Raekil

    2016-09-30

    Phenolic tetrabromobisphenol-A (TBBPA) and its derivatives are commonly used flame-retardants, in spite of reported toxic effects including neurotoxicity, immunotoxicity, nephrotoxicity, and hepatotoxicity. However, the effects of TBBPA on ototoxicity have not yet been reported. In this study, we investigated the effect of TBBPA on hearing function in vivo and in vitro. Auditory Brainstem Response (ABR) threshold was markedly increased in mice after oral administration of TBBPA, indicating that TBBPA causes hearing loss. In addition, TBBPA induced the loss of both zebrafish neuromasts and hair cells in the rat cochlea in a dose-dependent manner. Mechanistically, hearing loss is largely attributed to apoptotic cell death, as TBBPA increased the expression of pro-apoptotic genes but decreased the expression of anti-apoptotic genes. We also found that TBBPA induced oxidative stress, and importantly, pretreatment with NAC, an anti-oxidant reagent, reduced TBBPA-induced reactive oxygen species (ROS) generation and partially prevented cell death. Our results show that TBBPA-mediated ROS generation induces ototoxicity and hearing loss. These findings implicate TBBPA as a potential environmental ototoxin by exerting its hazardous effects on the auditory system. PMID:27592553

  11. Regulation of isocyanate-induced apoptosis, oxidative stress, and inflammation in cultured human neutrophils: isocyanate-induced neutrophils apoptosis.

    PubMed

    Mishra, P K; Khan, S; Bhargava, A; Panwar, H; Banerjee, S; Jain, S K; Maudar, K K

    2010-06-01

    Implications of environmental toxins on the regulation of neutrophil function are being significantly appraised. Such effects can be varied and markedly different depending on the type and extent of chemical exposure, which results in direct damage to the immune system. Isocyanates with functional group (-NCO), are considered as highly reactive molecules with diverse industrial applications. However, patho-physiological implications resulting from their occupational and accidental exposures have not been well delineated. The present study was carried out to assess the immunotoxic response of isocyanates and their mode of action at a molecular level on cultured human neutrophils isolated from healthy human volunteers. Studies were conducted to evaluate both dose- and time-dependent (n = 3) response using N-succinimidyl N-methylcarbamate, a chemical entity that mimics the effects of methyl isocyanate in vitro. Measure of apoptosis through annexin-V-FITC/PI assay, active caspase-3, apoptotic DNA ladder assay and mitochondrial depolarization; induction of oxidative stress by CM-H(2)DCFDA and formation of 8'-hydroxy-2'-deoxyguanosine; and levels of antioxidant defense system enzyme glutathione reductase, multiplex cytometric bead array analysis to quantify the secreted cytokine levels (interleukin-8, interleukin-1beta, interleukin-6, interleukin-10, interferon-gamma, tumor necrosis factor, and interleukin-12p70) parameters were evaluated. Our results demonstrate that isocyanates induce neutrophil apoptosis via activation of mitochondrial-mediated pathway along with reactive oxygen species production; depletion in antioxidant defense states; and elevated pro-inflammatory cytokine response.

  12. Protective effect of N-acetylcysteine against DNA damage and S-phase arrest induced by ochratoxin A in human embryonic kidney cells (HEK-293).

    PubMed

    Yang, Qian; Shi, Lei; Huang, Kunlun; Xu, Wentao

    2014-08-01

    N-acetylcysteine (NAC) has recently gained particular interest as a beneficial antioxidant. This study investigated the protective effects of NAC against ochratoxin A (OTA)-induced DNA damage and S-phase arrest in human embryonic kidney cells (HEK-293). OTA exposure results in nephrotoxicity, hepatotoxicity as well as immunotoxicity; and, in the present study, the toxicity of OTA toward HEK-293 cells was explored by analyzing the involvement of the oxidative pathway. It was found that OTA treatment led to oxidative damage; meanwhile, OTA treatment induced significant DNA damage and S-phase arrest by down-regulating cyclin A2, cyclin E1, and CDK2 expression. However, NAC pretreatment alleviated OTA-induced ROS overproduction, the loss of mitochondrial membrane potential (ΔΨm), and the decrease in superoxide dismutase (SOD) activity. NAC pretreatment was also discovered to attenuate OTA-induced DNA damage using the comet assay and by determining the expression of γ-H2AX. In addition, NAC pretreatment partly ameliorated OTA-induced S-phase arrest by preventing the down-regulation of cyclin A2, cyclin E1 and CDK2 expression in HEK-293 cells. All of these results demonstrated that oxidative damage was involved in OTA-induced DNA damage and cell cycle arrest in HEK-293 cells. Therefore, NAC has the potential to reverse the DNA damage and S-phase arrest induced by OTA.

  13. Multiple biomarkers of the cytotoxicity induced by BDE-47 in human embryonic kidney cells.

    PubMed

    Wu, Huifeng; Cao, Lulu; Li, Fei; Lian, Peiwen; Zhao, Jianmin

    2015-05-01

    Polybrominated diphenyl ethers (PBDEs) are widely used as brominated flame-retardants in a variety of industrial products. Among these PBDEs, 2,2',4,4'-tetra-bromodiphenyl ether (BDE-47) is one of the most predominant congeners inducing multiple toxicities, including hepatotoxicity, neurotoxicity, cytotoxicity, genotoxicity, carcinogenecity and immunotoxicity in human body. In this study, the cytotoxicity of BDE-47 in human embryonic kidney cells (HEK293) was investigated by a set of bioassays, including cell proliferation, apoptosis, oxidative stress and metabolic responses as well as gene expressions related to apoptosis. Results showed that BDE-47 induced an inverted U-shaped curve of cell proliferation in HEK293 cells from 10(-6) to 10(-4) M. Cell apoptosis and ROS overproduction were detected at 10(-5) M of BDE-47 (p<0.05). In addition, the expressions of Bcl-2 family-encoding genes (Bad, Hrk and Bcl-2) increased significantly in 10(-4)M group (p<0.05). Metabolic responses indicated that BDE-47 mainly caused disturbance in energy metabolism marked by differentially altered ethanol, glutathione, creatine, aspartate, UDP-glucose and NAD(+). The increased lactate/alanine ratios indicated the higher reductive state induced by BDE-47 in all exposures confirmed by the overproduction of ROS. PMID:25697951

  14. DNA damage and S phase arrest induced by Ochratoxin A in human embryonic kidney cells (HEK 293).

    PubMed

    Yang, Qian; He, Xiaoyun; Li, Xiaohong; Xu, Wentao; Luo, Yunbo; Yang, Xuan; Wang, Yan; Li, Yingcong; Huang, Kunlun

    2014-07-01

    Ochratoxin A (OTA) is a ubiquitous mycotoxin with potential nephrotoxic, hepatotoxic and immunotoxic effects. The mechanisms underlying the nephrotoxicity of OTA remain obscure. To investigate DNA damage and the changes of the cell cycle distribution induced by OTA, human embryonic kidney cells (HEK 293 cells) were incubated with various concentrations of OTA for 24h in vitro. The results indicated that OTA treatment led to the production of reactive oxygen species (ROS) and to a decrease of the mitochondrial membrane potential (ΔΨm). OTA-induced DNA damage in HEK 293 cells was evidenced by DNA comet tails formation and increased expression of γ-H2AX. In addition, OTA could induce cell cycle arrest at the S phase in HEK 293 cells. The expression of key cell cycle regulatory factors that were critical to the S phase, including cyclin A2, cyclin E1, and CDK2, were further detected. The expression of cyclin A2, cyclin E1, and CDK2 were significantly decreased by OTA treatment at both the mRNA and protein levels. The apoptosis of HEK 293 cells after OTA treatment was observed using Hoechst 33342 staining. The results confirmed that OTA did induce apoptosis in HEK 293 cells. In conclusion, our results provided new insights into the molecular mechanisms by which OTA might promote nephrotoxicity.

  15. Does developmental exposure to perflurooctanoic acid (PFOA) induce immunopathologies commonly observed in neurodevelopmental disorders?

    PubMed

    Hu, Qing; Franklin, Jason N; Bryan, Ian; Morris, Erin; Wood, Andrew; DeWitt, Jamie C

    2012-12-01

    Immune comorbidities often are reported in subsets of patients with neurodevelopmental disorders, including autism spectrum disorders and attention-deficit hyperactivity disorder. A common immunopathology is an increase in serum autoantibodies against myelin basic protein (MBP) relative to control patients. Increases in autoantibodies suggest possible deficits in self-tolerance that may contribute to the formation of brain-specific autoantibodies and subsequent effects on the central nervous system (CNS). Oppositely, the formation of neuronal autoantibodies may be a reaction to neuronal injury or damage. Perfluorooctanoic acid (PFOA) is an environmental pollutant that induces multisystem toxicity in rodent models, including immunotoxicity and neurotoxicity. We hypothesized that developmental exposure to PFOA may induce immunotoxicity similar to that observed in subsets of patients with neurodevelopmental disorders. To test this hypothesis, we evaluated subsets of T cells from spleens, serum markers of autoreactivity, and levels of MBP and T cell infiltration in the cerebella of adult offspring exposed to 0.02, 0.2, or 2mg/kg of PFOA given to dams from gestation through lactation. Litter weights of offspring from dams exposed to 2mg/kg of PFOA were reduced by 32.6%, on average, from postnatal day one (PND1) through weaning (PND21). The percentage of splenic CD4+CD25+Foxp3+ T cells in male and female offspring from dams exposed to 2mg/kg of PFOA was reduced by 22% relative to the control percentage. Ex vivo co-cultures of splenic CD4+CD25+ T cells and CD4+CD25- T cells from dosed male offspring produced less IL-10 relative to control cells. Anti-ssDNA, a serum marker of autoreactivity, was decreased by 26%, on average, in female offspring from dams exposed to 0.02 and 2mg/kg PFOA. No other endpoints were statistically different by dose. These data suggest that developmental PFOA exposure may impact T cell responses and may be a possible route to downstream effects on

  16. Protective Effects of Diallyl Sulfide against Thioacetamide-Induced Toxicity: A Possible Role of Cytochrome P450 2E1

    PubMed Central

    Kim, Nam Hee; Lee, Sangkyu; Kang, Mi Jeong; Jeong, Hye Gwang; Kang, Wonku; Jeong, Tae Cheon

    2014-01-01

    Effects of diallyl sulfide (DAS) on thioacetamide-induced hepatotoxicity and immunotoxicity were investigated. When male Sprague-Dawley rats were treated orally with 100, 200 and 400 mg/kg of DAS in corn oil for three consecutive days, the activity of cytochrome P450 (CYP) 2E1-selective p-nitrophenol hydroxylase was dose-dependently suppressed. In addition, the activities of CYP 2B-selective benzyloxyresorufin O-debenzylase and pentoxyresorufin O-depentylase were significantly induced by the treatment with DAS. Western immunoblotting analyses also indicated the suppression of CYP 2E1 protein and/or the induction of CYP 2B protein by DAS. To investigate a possible role of metabolic activation by CYP enzymes in thioacetamide-induced hepatotoxicity, rats were pre-treated with 400 mg/kg of DAS for 3 days, followed by a single intraperitoneal treatment with 100 and 200 mg/kg of thioacetamide in saline for 24 hr. The activities of serum alanine aminotransferase and aspartate aminotransferase significantly elevated by thioacetamide were protected in DAS-pretreated animals. Likewise, the suppressed antibody response to sheep erythrocytes by thioacetamide was protected by DAS pretreatment in female BALB/c mice. Taken together, our present results indicated that thioacetamide might be activated to its toxic metabolite(s) by CYP 2E1, not by CYP 2B, in rats and mice. PMID:24753821

  17. The pentachlorophenol metabolite tetrachlorohydroquinone induces massive ROS and prolonged p-ERK expression in splenocytes, leading to inhibition of apoptosis and necrotic cell death.

    PubMed

    Chen, Hsiu-Min; Zhu, Ben-Zhan; Chen, Rong-Jane; Wang, Bour-Jr; Wang, Ying-Jan

    2014-01-01

    Pentachlorophenol (PCP) has been used extensively as a biocide and a wood preservative and has been reported to be immunosuppressive in rodents and humans. Tetrachlorohydroquinone (TCHQ) is a major metabolite of PCP. TCHQ has been identified as the main cause of PCP-induced genotoxicity due to reactive oxidant stress (ROS). However, the precise mechanisms associated with the immunotoxic effects of PCP and TCHQ remain unclear. The aim of this study was to examine the effects of PCP and TCHQ on the induction of ROS and injury to primary mouse splenocytes. Our results shown that TCHQ was more toxic than PCP and that a high dose of TCHQ led to necrotic cell death of the splenocytes through induction of massive and sudden ROS and prolonged ROS-triggered ERK activation. Inhibition of ROS production by N-acetyl-cysteine (NAC) partially restored the mitochondrial membrane potential, inhibited ERK activity, elevated caspase-3 activity and PARP cleavage, and, eventually, switched the TCHQ-induced necrosis to apoptosis. We suggest that prolonged ERK activation is essential for TCHQ-induced necrosis, and that ROS play a pivotal role in the different TCHQ-induced cell death mechanisms. PMID:24586814

  18. Acacia ferruginea inhibits cyclophosphamide-induced immunosuppression and urotoxicity by modulating cytokines in mice.

    PubMed

    Sakthivel, K M; Guruvayoorappan, Chandrasekaran

    2015-01-01

    Cyclophosphamide (CTX), commonly used as an anti-neoplastic drug, can cause adverse side-effects including immunotoxicity and urotoxicity. Increasingly, plants have become sources of therapeutics that can help to restore host immunity to normal. In this study, Acacia ferruginea was assessed for an ability to protect mice against/mitigate CTX-induced toxicity. Co-administration of an extract of A. ferruginea (10 mg/kg BW, IP daily) for 10 consecutive days reduced CTX (25 mg/kg BW, IP daily)-induced toxicity. Apart from improvements in bladder and small intestine morphology, there was marked improvement in anti-oxidant (glutathione) levels in the bladder, suggesting a role for the anti-oxidant in reducing CTX-induced urotoxicity. Moreover, use of the extract significantly increased total leukocyte counts and bone marrow cellularity/α-esterase activity in CTX-treated mice which suggested a protective effect on the hematopoietic system. Co-treatment with the extract also prevented decreases in organ (liver, kidney, spleen, thymus) weight as well as body weight, thereby seemingly lessening the potential impact of CTX on the host immune system. Further, CTX-induced increases in serum aspartate transanimase, alanine transaminase, and alkaline phosphatase were reversed by extract co-treatment, as were alterations in in situ formation/release of interferon (IFN)-γ, interleukin (IL)-2, granulocyte-macrophage colony stimulating factor (GM-CSF), and tumor necrosis factor (TNF)-α. Overall, this study indicated there were some protective effects from use of an extract of A. ferruginea against CTX-induced toxicities, in part through modulation of levels of anti-oxidants and pro-inflammatory cytokines.

  19. Efficacy of histopathology in detecting petrochemical-induced toxicity in wild cotton rats (Sigmodon hispidus).

    PubMed

    Kim, S; Lochmiller, R L; Stair, E L; Lish, J W; Rafferty, D P; Qualls, C W

    2001-01-01

    A variety of chemical mixtures exist in the soil of petrochemical waste sites, and many of these compounds are known immunotoxicants that have been observed to induce immune alterations in wild rodents inhabiting many of these petrochemical waste sites. Conventional histopathological assessments have been widely used with considerable success to investigate immunotoxicity of various agents under laboratory conditions. We hypothesized that histopathologic assessments would be equally sensitive for detecting exposure to complex mixtures of toxicants in cotton rats (Sigmodon hispidus) residing in contaminated habitats. Histopathological parameters were examined from a total of 624 cotton rats that were seasonally collected from 13 petrochemical-contaminated waste sites and 13 ecologically matched reference sites in Oklahoma over a 3-year period. Histopathological examination did not reveal any lesion associated with exposure to petrochemical wastes except renal inclusion bodies. Prevalence and severity of histologic lesions in liver and kidneys of cotton rats were significantly influenced by season, where prevalence and severity were lower in winter than summer on all study sites. These results suggest that the evaluation of toxicity from exposure to contaminants in the soil of industrial waste sites using histopathological assessments is not sensitive enough to detect exposure to the low levels of environmental contaminants present on most waste sites.

  20. Quantitative alterations in the liver and adrenal gland in pregnant rats induced by Pyralene 3000

    SciTech Connect

    Vreci, M.; Sek, S.; Lorger, J.; Bavdek, S.; Pogacnik, A.

    1995-06-01

    Polychlorinated biphenyls (PCBs) are among the most widespread environmental pollutants known in the world. The half-life of PCBs is very long and, therefore, once released into the environment, they accumulate in food chains and tissues of various mammals, including man. Their presence can cause numerous toxic effects, e.g., hepatotoxicity, immunotoxicity, dermatotoxicity, neurotoxicity, and disorders of the reproductive system, among others. These effects depend on the distribution route in the organism, the rate of metabolism and excretion. Their characteristics are closely associated with the number and position of the chlorine atoms in the molecule. Previous studies of trichlorobiphenyl distributions in various tissues demonstrated that low chlorinated trichlorobiphenyls do no accumulate in endocrine organs, whereas higher chlorinated biphenyls, such as hexa- and octachlorobiphenyl, are deposited and retained in the adrenal gland. A selective distribution of radioabelled tetrachlorobiphenyl to the zona fasciculata, accompanied by morphometric evidence of the hypertrophy of the zona fasciculata, was also noted. The purpose of this study was to examine changes in the tissue structure of the pregnant rat liver and adrenal gland induced experimentally by Pyralene 3000 administration. We chose this commercial low chlorinated PCB because it was in use in Slovenia and, discharged from the electroindustrial plants, caused a serious incidence of environmental pollution in the region of Bela Krajina. Our further aim was to research the transplacental influences of Pyralene 3000 in rats. 17 refs., 1 fig., 3 tabs.

  1. Induced Abortion

    MedlinePlus

    ... Induced Abortion Patient Education FAQs Induced Abortion Patient Education Pamphlets - Spanish Induced Abortion FAQ043, May 2015 PDF Format Induced ... Your Practice Patient Safety & Quality Payment Reform (MACRA) Education & Events Annual ... Pamphlets Teen Health About ACOG About Us Leadership & ...

  2. Permethrin-induced oxidative stress and toxicity and metabolism. A review.

    PubMed

    Wang, Xu; Martínez, María-Aránzazu; Dai, Menghong; Chen, Dongmei; Ares, Irma; Romero, Alejandro; Castellano, Victor; Martínez, Marta; Rodríguez, José Luis; Martínez-Larrañaga, María-Rosa; Anadón, Arturo; Yuan, Zonghui

    2016-08-01

    Permethrin (PER), the most frequently used synthetic Type I pyrethroid insecticide, is widely used in the world because of its high activity as an insecticide and its low mammalian toxicity. It was originally believed that PER exhibited low toxicity on untargeted animals. However, as its use became more extensive worldwide, increasing evidence suggested that PER might have a variety of toxic effects on animals and humans alike, such as neurotoxicity, immunotoxicity, cardiotoxicity, hepatotoxicity, reproductive, genotoxic, and haematotoxic effects, digestive system toxicity, and cytotoxicity. A growing number of studies indicate that oxidative stress played critical roles in the various toxicities associated with PER. To date, almost no review has addressed the toxicity of PER correlated with oxidative stress. The focus of this article is primarily to summarise advances in the research associated with oxidative stress as a potential mechanism for PER-induced toxicity as well as its metabolism. This review summarises the research conducted over the past decade into the reactive oxygen species (ROS) generation and oxidative stress as a consequence of PER treatments, and ultimately their correlation with the toxicity and the metabolism of PER. The metabolism of PER involves various CYP450 enzymes, alcohol or aldehyde dehydrogenases for oxidation and the carboxylesterases for hydrolysis, through which oxidative stress might occur, and such metabolic factors are also reviewed. The protection of a variety of antioxidants against PER-induced toxicity is also discussed, in order to further understand the role of oxidative stress in PER-induced toxicity. This review will throw new light on the critical roles of oxidative stress in PER-induced toxicity, as well as on the blind spots that still exist in the understanding of PER metabolism, the cellular effects in terms of apoptosis and cell signaling pathways, and finally strategies to help to protect against its oxidative

  3. Platelet activating factor receptor binding plays a critical role in jet fuel-induced immune suppression.

    PubMed

    Ramos, Gerardo; Kazimi, Nasser; Nghiem, Dat X; Walterscheid, Jeffrey P; Ullrich, Stephen E

    2004-03-15

    Applying military jet fuel (JP-8) or commercial jet fuel (Jet-A) to the skin of mice suppresses the immune response in a dose-dependent manner. The release of biological response modifiers, particularly prostaglandin E2 (PGE2), is a critical step in activating immune suppression. Previous studies have shown that injecting selective cyclooxygenase-2 inhibitors into jet fuel-treated mice blocks immune suppression. Because the inflammatory phospholipid mediator, platelet-activating factor (PAF), up-regulates cyclooxygenase-2 production and PGE2 synthesis by keratinocytes, we tested the hypothesis that PAF-receptor binding plays a role in jet fuel-induced immune suppression. Treating keratinocyte cultures with PAF and/or jet fuel (JP-8 and Jet-A) stimulates PGE2 secretion. Jet fuel-induced PGE2 production was suppressed by treating the keratinocytes with specific PAF-receptor antagonists. Injecting mice with PAF, or treating the skin of the mice with JP-8, or Jet-A, induced immune suppression. Jet fuel-induced immune suppression was blocked when the jet fuel-treated mice were injected with PAF-receptor antagonists before treatment. Jet fuel treatment has been reported to activate oxidative stress and treating the mice with anti-oxidants (Vitamins C, or E or beta-hydroxy toluene), before jet fuel application, interfered with immune suppression. These findings confirm previous studies showing that PAF-receptor binding can modulate immune function. Furthermore, they suggest that PAF-receptor binding may be an early event in the induction of immune suppression by immunotoxic environmental agents that target the skin. PMID:15020195

  4. EGFR-mediated Akt and MAPKs signal pathways play a crucial role in patulin-induced cell proliferation in primary murine keratinocytes via modulation of Cyclin D1 and COX-2 expression.

    PubMed

    Alam, Shamshad; Pal, Anu; Kumar, Rahul; Dwivedi, Premendra D; Das, Mukul; Ansari, Kausar M

    2014-12-01

    Patulin (PAT), a present day major contaminant of commercial apple and apple products is reported to be carcinogenic, embryotoxic, and immunotoxic. While oral and inhalation are considered to be the most prevalent routes of exposure to this toxin, exposure through skin is now being extensively investigated. Our previous study showed that short-term dermal exposure to PAT resulted in toxicological injury to the skin, while long-term exposure induced skin tumorigenesis. In this study, we explore the mechanism involve in proliferation of mouse keratinocytes by PAT. Our study revealed that PAT rapidly induces phosphorylation of EGFR, activation of the Ras/MAPKs, and Akt pathways. This in-turn leads to the activation of NF-κB/AP-1 transcription factors which then binds to the promoter region of the cell growth regulatory genes Cyclin D1 and COX-2 inducing their expression leading ultimately to PMKs proliferation. Inhibition of EGFR or the Ras/MAPKs, PI3/Akt pathways with different pharmacological inhibitors or knockdown of NF-κB, c-jun, c-fos, Cyclin D1, and COX-2 with siRNA inhibited PAT-induced PMKs proliferation. PMID:23813870

  5. Reactive oxygen species (ROS) induced cytokine production and cytotoxicity of PAMAM dendrimers in J774A.1 cells

    SciTech Connect

    Naha, Pratap C.; Davoren, Maria; Lyng, Fiona M.; Byrne, Hugh J.

    2010-07-15

    The immunotoxicity of three generations of polyamidoamine (PAMAM) dendrimers (G-4, G-5 and G-6) was evaluated in mouse macrophage cells in vitro. Using the Alamar blue and MTT assays, a generation dependent cytotoxicity of the PAMAM dendrimers was found whereby G-6 > G-5 > G-4. The toxic response of the PAMAM dendrimers correlated well with the number of surface primary amino groups, with increasing number resulting in an increase in toxic response. An assessment of intracellular ROS generation by the PAMAM dendrimers was performed by measuring the increased fluorescence as a result of intracellular oxidation of Carboxy H{sub 2}DCFDA to DCF both quantitatively using plate reader and qualitatively by confocal laser scanning microscopy. The inflammatory mediators macrophage inflammatory protein-2 (MIP-2), tumour necrosis factor-{alpha} (TNF-{alpha}) and interleukin-6, (IL-6) were measured by the enzyme linked immunosorbant assay (ELISA) following exposure of mouse macrophage cells to PAMAM dendrimers. A generation dependent ROS and cytokine production was found, which correlated well with the cytotoxicological response and therefore number of surface amino groups. A clear time sequence of increased ROS generation (maximum at {approx} 4 h), TNF-{alpha} and IL-6 secretion (maximum at {approx} 24 h), MIP-2 levels and cell death ({approx} 72 h) was observed. The intracellular ROS generation and cytokine production induced cytotoxicity point towards the mechanistic pathway of cell death upon exposure to PAMAM dendrimers.

  6. Dioxin exposure of human CD34+ hemopoietic cells induces gene expression modulation that recapitulates its in vivo clinical and biological effects.

    PubMed

    Fracchiolla, Nicola Stefano; Todoerti, Katia; Bertazzi, Pier Alberto; Servida, Federica; Corradini, Paolo; Carniti, Cristiana; Colombi, Antonio; Cecilia Pesatori, Angela; Neri, Antonino; Deliliers, Giorgio Lambertenghi

    2011-04-28

    2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD) has a large number of biological effects, including skin, cardiovascular, neurologic diseases, diabetes, infertility, cancers and immunotoxicity. We analysed the in vitro TCDD effects on human CD34+ cells and tested the gene expression modulation by means of microarray analyses before and after TCDD exposure. We identified 257 differentially modulated probe sets, identifying 221 well characterized genes. A large part of these resulted associated to cell adhesion and/or angiogenesis and to transcription regulation. Synaptic transmission and visual perception functions, with the particular involvement of the GABAergic pathway were also significantly modulated. Numerous transcripts involved in cell cycle or cell proliferation, immune response, signal transduction, ion channel activity or calcium ion binding, tissue development and differentiation, female or male fertility or in several metabolic pathways were also affected after dioxin exposure. The transcriptional profile induced by TCDD treatment on human CD34+ cells strikingly reproduces the clinical and biological effects observed in individuals exposed to dioxin and in biological experimental systems. Our data support a role of dioxin in the neoplastic transformation of hemopoietic stem cells and in immune modulation processes after in vivo exposure, as indicated by the epidemiologic data in dioxin accidentally exposed populations, providing a molecular basis for it. In addition, TCDD alters genes associated to glucidic and lipidic metabolisms, to GABAergic transmission or involved in male and female fertility, thus providing a possible explanation of the diabetogenic, dyslipidemic, neurologic and fertility effects induced by TCDD in vivo exposure.

  7. Carbon fullerenes (C60s) can induce inflammatory responses in the lung of mice.

    PubMed

    Park, Eun-Jung; Kim, Hero; Kim, Younghun; Yi, Jongheop; Choi, Kyunghee; Park, Kwangsik

    2010-04-15

    Fullerenes (C60s) occur in the environment due to natural and anthropogenic sources such as volcanic eruptions, forest fires, and the combustion of carbon-based materials. Recently, production and application of engineered C60s have also rapidly increased in diverse industrial fields and biomedicine due to C60' unique physico-chemical properties, so toxicity assessment on environmental and human health is being evaluated as a valuable work. However, data related to the toxicity of C60s have not been abundant up to now. In this study, we studied the immunotoxic mechanism and change of gene expression caused by the instillation of C60s. As a result, C60s induced an increase in sub G1 and G1 arrest in BAL cells, an increase in pro-inflammatory cytokines such as IL-1, TNF-alpha, and IL-6, and an increase of Th1 cytokines such as IL-12 and IFN-r in BAL fluid. In addition, IgE reached the maximum at 1 day after treatment in both BAL fluid and the blood, and decreased in a time-dependent manner. Gene expression of the MHC class II (H2-Eb1) molecule was stronger than that of the MHC class I (H2-T23), and an increase in T cell distribution was also observed during the experiment period. Furthermore, cell infiltration and expression of tissue damage related genes in lung tissue were constantly observed during the experiment period. Based on this, C60s may induce inflammatory responses in the lung of mice.

  8. Carbon fullerenes (C60s) can induce inflammatory responses in the lung of mice

    SciTech Connect

    Park, Eun-Jung; Kim, Hero; Kim, Younghun; Yi, Jongheop; Choi, Kyunghee; Park, Kwangsik

    2010-04-15

    Fullerenes (C60s) occur in the environment due to natural and anthropogenic sources such as volcanic eruptions, forest fires, and the combustion of carbon-based materials. Recently, production and application of engineered C60s have also rapidly increased in diverse industrial fields and biomedicine due to C60' unique physico-chemical properties, so toxicity assessment on environmental and human health is being evaluated as a valuable work. However, data related to the toxicity of C60s have not been abundant up to now. In this study, we studied the immunotoxic mechanism and change of gene expression caused by the instillation of C60s. As a result, C60s induced an increase in sub G1 and G1 arrest in BAL cells, an increase in pro-inflammatory cytokines such as IL-1, TNF-alpha, and IL-6, and an increase of Th1 cytokines such as IL-12 and IFN-r in BAL fluid. In addition, IgE reached the maximum at 1 day after treatment in both BAL fluid and the blood, and decreased in a time-dependent manner. Gene expression of the MHC class II (H2-Eb1) molecule was stronger than that of the MHC class I (H2-T23), and an increase in T cell distribution was also observed during the experiment period. Furthermore, cell infiltration and expression of tissue damage related genes in lung tissue were constantly observed during the experiment period. Based on this, C60s may induce inflammatory responses in the lung of mice.

  9. Enhancement of lipopolysaccharide-induced nitric oxide and interleukin-6 production by PEGylated gold nanoparticles in RAW264.7 cells

    NASA Astrophysics Data System (ADS)

    Liu, Zhimin; Li, Wenqing; Wang, Feng; Sun, Chunyang; Wang, Lu; Wang, Jun; Sun, Fei

    2012-10-01

    While the immunogenicity and cytotoxicity of gold nanoparticles (AuNPs) are noted by many researchers, the mechanisms by which AuNPs exert these effects are poorly understood. In this study, we investigated the effects of polyethylene glycolylated AuNPs (PEG@AuNPs) on lipopolysaccharide (LPS)-induced nitric oxide (NO) and interleukin-6 (IL-6) production and the associated molecular mechanism in RAW264.7 cells. The results showed that PEG@AuNPs were internalized more quickly by LPS-activated RAW264.7 cells than unstimulated cells, and they reached saturation within 24 hours. PEG@AuNPs enhanced LPS-induced production of NO and IL-6 and inducible nitric oxide synthase (iNOS) expression in RAW264.7 cells, partially by activating p38 mitogen-activated protein kinases (p38 MAPK) and nuclear factor-kappaB pathways. In addition, the p38 MAPK inhibitor SB203580 attenuated PEG@AuNP-enhanced LPS-induced NO production and iNOS expression. Overproduction of NO and IL-6 is known to be closely correlated with the pathology of many diseases and inflammations. Thus, it is speculated that the highly biocompatible gold nanoparticles can induce immunotoxicity due to their potency to stimulate macrophages to release aberrant or excessive pro-inflammatory mediators.While the immunogenicity and cytotoxicity of gold nanoparticles (AuNPs) are noted by many researchers, the mechanisms by which AuNPs exert these effects are poorly understood. In this study, we investigated the effects of polyethylene glycolylated AuNPs (PEG@AuNPs) on lipopolysaccharide (LPS)-induced nitric oxide (NO) and interleukin-6 (IL-6) production and the associated molecular mechanism in RAW264.7 cells. The results showed that PEG@AuNPs were internalized more quickly by LPS-activated RAW264.7 cells than unstimulated cells, and they reached saturation within 24 hours. PEG@AuNPs enhanced LPS-induced production of NO and IL-6 and inducible nitric oxide synthase (iNOS) expression in RAW264.7 cells, partially by activating

  10. Molecular mechanisms underlying mancozeb-induced inhibition of TNF-alpha production

    SciTech Connect

    Corsini, Emanuela . E-mail: emanuela.corsini@unimi.it; Viviani, Barbara; Birindelli, Sarah; Gilardi, Federica; Torri, Anna; Codeca, Ilaria; Lucchi, Laura; Bartesaghi, Stefano; Galli, Corrado L.; Marinovich, Marina; Colosio, Claudio

    2006-04-15

    luciferase activity relative to control after mancozeb treatment, confirming NF-{kappa}B binding as an intracellular target of mancozeb. Overall, this study contributes to our understanding of the mechanism underlying mancozeb-induced immunotoxicity.

  11. Silymarin protects PBMC against B(a)P induced toxicity by replenishing redox status and modulating glutathione metabolizing enzymes-An in vitro study

    SciTech Connect

    Kiruthiga, P.V.; Pandian, S. Karutha; Devi, K. Pandima

    2010-09-01

    PAHs are a ubiquitous class of environmental contaminants that have a large number of hazardous consequences on human health. An important prototype of PAHs, B(a)P, is notable for being the first chemical carcinogen to be discovered and the one classified by EPA as a probable human carcinogen. It undergoes metabolic activation to QD, which generate ROS by redox cycling system in the body and oxidatively damage the macromolecules. Hence, a variety of antioxidants have been tested as possible protectors against B(a)P toxicity. Silymarin is one such compound, which has high human acceptance, used clinically and consumed as dietary supplement around the world for its strong anti-oxidant efficacy. Silymarin was employed as an alternative approach for treating B(a)P induced damage and oxidative stress in PBMC, with an emphasis to provide the molecular basis for the effect of silymarin against B(a)P induced toxicity. PBMC cells exposed to either benzopyrene (1 {mu}M) or silymarin (2.4 mg/ml) or both was monitored for toxicity by assessing LPO, PO, redox status (GSH/GSSG ratio), glutathione metabolizing enzymes GR and GPx and antioxidant enzymes CAT and SOD. This study also investigated the protective effect of silymarin against B(a)P induced biochemical alteration at the molecular level by FT-IR spectroscopy. Our findings were quite striking that silymarin possesses substantial protective effect against B(a)P induced oxidative stress and biochemical changes by restoring redox status, modulating glutathione metabolizing enzymes, hindering the formation of protein oxidation products, inhibiting LPO and further reducing ROS mediated damages by changing the level of antioxidant enzymes. The results suggest that silymarin exhibits multiple protections and it should be considered as a potential protective agent for environmental contaminant induced immunotoxicity.

  12. Global protein phosphorylation dynamics during deoxynivalenol-induced ribotoxic stress response in the macrophage

    SciTech Connect

    Pan, Xiao; Whitten, Douglas A.; Wu, Ming; Chan, Christina; Wilkerson, Curtis G.; Pestka, James J.

    2013-04-15

    Deoxynivalenol (DON), a trichothecene mycotoxin produced by Fusarium that commonly contaminates food, is capable of activating mononuclear phagocytes of the innate immune system via a process termed the ribotoxic stress response (RSR). To encapture global signaling events mediating RSR, we quantified the early temporal (≤ 30 min) phosphoproteome changes that occurred in RAW 264.7 murine macrophage during exposure to a toxicologically relevant concentration of DON (250 ng/mL). Large-scale phosphoproteomic analysis employing stable isotope labeling of amino acids in cell culture (SILAC) in conjunction with titanium dioxide chromatography revealed that DON significantly upregulated or downregulated phosphorylation of 188 proteins at both known and yet-to-be functionally characterized phosphosites. DON-induced RSR is extremely complex and goes far beyond its prior known capacity to inhibit translation and activate MAPKs. Transcriptional regulation was the main target during early DON-induced RSR, covering over 20% of the altered phosphoproteins as indicated by Gene Ontology annotation and including transcription factors/cofactors and epigenetic modulators. Other biological processes impacted included cell cycle, RNA processing, translation, ribosome biogenesis, monocyte differentiation and cytoskeleton organization. Some of these processes could be mediated by signaling networks involving MAPK-, NFκB-, AKT- and AMPK-linked pathways. Fuzzy c-means clustering revealed that DON-regulated phosphosites could be discretely classified with regard to the kinetics of phosphorylation/dephosphorylation. The cellular response networks identified provide a template for further exploration of the mechanisms of trichothecenemycotoxins and other ribotoxins, and ultimately, could contribute to improved mechanism-based human health risk assessment. - Highlights: ► Mycotoxin deoxynivalenol (DON) induces immunotoxicity via ribotoxic stress response. ► SILAC phosphoproteomics using

  13. The role of the immune system in hexachlorobenzene-induced toxicity.

    PubMed Central

    Michielsen, C C; van Loveren, H; Vos, J G

    1999-01-01

    Hexachlorobenzene (HCB) is a persistent environmental pollutant. The toxicity of HCB has been extensively studied after an accidental human poisoning in Turkey and more recently it has been shown that HCB has immunotoxic properties in laboratory animals and probably also in man. Oral exposure of rats to HCB showed stimulatory effects on spleen and lymph node weights and histology, increased serum IgM levels, and an enhancement of several parameters of immune function. Moreover, more recent studies indicate that HCB-induced effects in the rat may be related to autoimmunity. In Wistar rats exposed to HCB, IgM antibodies against several autoantigens were elevated; in the Lewis rat, HCB differently modulated two experimental models of autoimmune disease. Oral exposure of rats to HCB induces skin and lung pathology in the rat. Recently several studies have been conducted to investigate whether these skin and lung lesions can be related to HCB-induced immunomodulation, and these studies will be discussed in this review. HCB-induced skin and lung lesions probably have a different etiology; pronounced strain differences and correlation of skin lesions with immune parameters suggest a specific involvement of the immune system in HCB-induced skin lesions. The induction of lung lesions by HCB was thymus independent. Thymus-dependent T cells were not likely to be required for the induction of skin lesions, although T cells enhanced the rate of induction and the progression of the skin lesions. No deposition of autoantibodies was observed in nonlesional or lesional skin of HCB-treated rats. Therefore, we concluded that it is unlikely that the mechanism by which most allergic or autoimmunogenic chemicals work, i.e., by binding to macromolecules of the body and subsequent T- and B-cell activation, is involved in the HCB-induced immunopathology in the rat. Such a thymus-independent immunopathology is remarkable, as HCB strongly modulates T-cell-mediated immune parameters. This

  14. Zinc protects HepG2 cells against the oxidative damage and DNA damage induced by ochratoxin A

    SciTech Connect

    Zheng, Juanjuan; Zhang, Yu; Xu, Wentao; Luo, YunBo; Hao, Junran; Shen, Xiao Li; Yang, Xuan; Li, Xiaohong; Huang, Kunlun

    2013-04-15

    Oxidative stress and DNA damage are the most studied mechanisms by which ochratoxin A (OTA) induces its toxic effects, which include nephrotoxicity, hepatotoxicity, immunotoxicity and genotoxicity. Zinc, which is an essential trace element, is considered a potential antioxidant. The aim of this paper was to investigate whether zinc supplement could inhibit OTA-induced oxidative damage and DNA damage in HepG2 cells and the mechanism of inhibition. The results indicated that that exposure of OTA decreased the intracellular zinc concentration; zinc supplement significantly reduced the OTA-induced production of reactive oxygen species (ROS) and decrease in superoxide dismutase (SOD) activity but did not affect the OTA-induced decrease in the mitochondrial membrane potential (Δψ{sub m}). Meanwhile, the addition of the zinc chelator N,N,N′,N′-tetrakis(2-pyridylmethyl)ethylenediamine (TPEN) strongly aggravated the OTA-induced oxidative damage. This study also demonstrated that zinc helped to maintain the integrity of DNA through the reduction of OTA-induced DNA strand breaks, 8-hydroxy-2′-deoxyguanosine (8-OHdG) formation and DNA hypomethylation. OTA increased the mRNA expression of metallothionein1-A (MT1A), metallothionein2-A (MT2A) and Cu/Zn superoxide dismutase (SOD1). Zinc supplement further enhanced the mRNA expression of MT1A and MT2A, but it had no effect on the mRNA expression of SOD1 and catalase (CAT). Zinc was for the first time proven to reduce the cytotoxicity of OTA through inhibiting the oxidative damage and DNA damage, and regulating the expression of zinc-associated genes. Thus, the addition of zinc can potentially be used to reduce the OTA toxicity of contaminated feeds. - Highlights: ► OTA decreased the intracellular zinc concentration. ► OTA induced the formation of 8-OHdG in HepG2 cells. ► It was testified for the first time that OTA induced DNA hypomethylation. ► Zinc protects against the oxidative damage and DNA damage induced by

  15. TESTING ANTIMICROBIAL PAINT EFFICACY ON GYPSUM WALLBOARD CONTAMINATED WITH STACHYBOTRYS CHARTARUM

    EPA Science Inventory

    Often mold contaminated building materials are not properly removed, some surface cleaning is performed and paint is applied in an attempt to alleviate the problem. The efficacy of antimicrobial paints to eliminate or control mold regrowth on surfaces can easily be tested on non-...

  16. TESTING ANTIMICROBIAL CLEANER EFFICACY ON GYPSUM WALLBOARD CONTAMINATED WITH STACHYBOTRYS CHARTARUM

    EPA Science Inventory

    Reducing occupant exposure to indoor mold growth is the goal of this research, through the efficacy testing of antimicrobial cleaners. Often mold contaminated building materials are not properly removed, but instead surface cleaners are applied in an attempt to alleviate the prob...

  17. Lupus-prone mice as models to study xenobiotic-induced acceleration of systemic autoimmunity.

    PubMed Central

    Pollard, K M; Pearson, D L; Hultman, P; Hildebrandt, B; Kono, D H

    1999-01-01

    The linkage between xenobiotic exposures and autoimmune diseases remains to be clearly defined. However, recent studies have raised the possibility that both genetic and environmental factors act synergistically at several stages or checkpoints to influence disease pathogenesis in susceptible populations. These observations predict that individuals susceptible to spontaneous autoimmunity should be more susceptible following xenobiotic exposure by virtue of the presence of predisposing background genes. To test this possibility, mouse strains with differing genetic susceptibility to murine lupus were examined for acceleration of autoimmune features characteristic of spontaneous systemic autoimmune disease following exposure to the immunostimulatory metals nickel and mercury. Although NiCl(2) exposure did not exacerbate autoimmunity, HgCl(2) significantly accelerated systemic disease in a strain-dependent manner. Mercury-exposed (NZB X NZW)F1 mice had accelerated lymphoid hyperplasia, hypergammaglobulinemia, autoantibodies, and immune complex deposits. Mercury also exacerbated immunopathologic manifestations in MRL+/+ and MR -lpr mice. However, there was less disease acceleration in lpr mice compared with MRL+/+ mice, likely due to the fact that environmental factors are less critical for disease induction when there is strong genetic susceptibility. Non-major histocompatibility complex genes also contributed to mercury-exacerbated disease, as the nonautoimmune AKR mice, which are H-2 identical with the MRL, showed less immunopathology than either the MRL/lpr or MRL+/+ strains. This study demonstrates that genetic susceptibility to spontaneous systemic autoimmunity can be a predisposing factor for HgCl(2)-induced exacerbation of autoimmunity. Such genetic predisposition may have to be considered when assessing the immunotoxicity of xenobiotics. Additional comparative studies using autoimmune-prone and nonautoimmune mice strains with different genetic backgrounds will

  18. Immunotoxicity Monitoring in a Population Exposed to Polychlorinated Biphenyls.

    PubMed

    Haase, Hajo; Fahlenkamp, Astrid; Schettgen, Thomas; Esser, Andre; Gube, Monika; Ziegler, Patrick; Kraus, Thomas; Rink, Lothar

    2016-03-08

    The relationship between polychlorinated biphenyl (PCB) burden and several indicators of immune function was investigated as part of the HELPcB (Health Effects in High-Level Exposure to PCB) program, offering bio-monitoring to workers, relatives, and neighbors exposed to PCBs by a German transformers and capacitors recycling company. The present retrospective observational study evaluates the correlation of plasma levels of total PCBs, five indicator congeners (28, 101, 138, 153, 180), and seven dioxin-like congeners (105, 114, 118, 156, 157, 167, 189) with several parameters of immune function. The cross-sectional study was performed immediately after the end of exposure (258 subjects), and one (218 subjects), and two (177 subjects) years later. At the first time point, measurements showed significant positive correlation between congeners with low to medium chlorination and the relative proportion of CD19 positive B-cells among lymphocytes, as well as a negative correlation of PCB114 with serum IgM, and of PCB 28 with suppressor T-cell and NK-cell numbers. Congeners with a high degree of chlorination, in particular PCB157 and 189, were positively associated with expression of the activation marker CD25 on T-cells in the cohort of the second time point. No associations between PCB levels and IFN-y production by T-cells and killing by NK-cells were found. In conclusion, there were several effects on the cellular composition of adaptive immunity, affecting both T- and B-cells. However, the values were not generally outside the reference ranges for healthy adult individuals and did not indicate overt functional immunodeficiency, even in subjects with the uppermost PCB burden.

  19. Purification, immunotoxic effects, and cellular uptake of trichothecene mycotoxins

    SciTech Connect

    Witt, M.F.

    1989-01-01

    Studies were carried out to better understand how the trichothecenes alter immune function in animals and humans. Deoxynivalenol (DON) was purified for use in animal feeding studies. Dietary exposure to DON for 8 weeks altered the serum immunoglobulin profile in mice and decreased the splenic plaque-forming cell response to the antigen sheep red blood cells. The uptake of ({sup 3}H)T-2 toxin by a murine B-cell hybridoma was studied in order to learn more about the way in which trichothecenes interact with immune cells. A simple procedure was developed for the laboratory production and purification of gram quantities of crystalline DON. When Fusarium graminearum R6576 was grown on rice, concentrations of 600 to 700 ppm DON accumulated after 13 to 18 days of incubation. A DON derivative, 15-acetylDON, was also found at concentrations of 100 to 300 ppm after 7 to 10 days. DON was purified from crude culture extracts by water-saturated silica gel chromatography. Alpha-({sup 3}H)T-2 toxin of 99% chemical and radiochemical purity was prepared for use in uptake studies. Both the rate of uptake of ({sup 3}H)T-2 toxin by hybridomas and the time required for accumulation of ({sup 3}H)T-2 to reach equilibrium were proportional to the concentration of ({sup 3}H)T-2. ({sup 3}H)T-2 toxin accumulated by hybridomas was proportional to the concentration of ({sup 3}H)T-2 between 10{sup {minus}8} and 10{sup {minus}3} M. The rate of uptake of ({sup 3}H)jT-2 toxin by hybridomas was inhibited by the trichothecenes T-2 toxin, DON, verrucarin A, and roridin A, as well as the antibiotic anisomycin. The kinetics and concentration dependence of accumulation, along with the inhibition patterns, suggest that uptake of ({sup 3}H)T-2 toxin by hybridomas is mediated by binding of toxin to ribosomes.

  20. Immunotoxicity Monitoring in a Population Exposed to Polychlorinated Biphenyls.

    PubMed

    Haase, Hajo; Fahlenkamp, Astrid; Schettgen, Thomas; Esser, Andre; Gube, Monika; Ziegler, Patrick; Kraus, Thomas; Rink, Lothar

    2016-03-01

    The relationship between polychlorinated biphenyl (PCB) burden and several indicators of immune function was investigated as part of the HELPcB (Health Effects in High-Level Exposure to PCB) program, offering bio-monitoring to workers, relatives, and neighbors exposed to PCBs by a German transformers and capacitors recycling company. The present retrospective observational study evaluates the correlation of plasma levels of total PCBs, five indicator congeners (28, 101, 138, 153, 180), and seven dioxin-like congeners (105, 114, 118, 156, 157, 167, 189) with several parameters of immune function. The cross-sectional study was performed immediately after the end of exposure (258 subjects), and one (218 subjects), and two (177 subjects) years later. At the first time point, measurements showed significant positive correlation between congeners with low to medium chlorination and the relative proportion of CD19 positive B-cells among lymphocytes, as well as a negative correlation of PCB114 with serum IgM, and of PCB 28 with suppressor T-cell and NK-cell numbers. Congeners with a high degree of chlorination, in particular PCB157 and 189, were positively associated with expression of the activation marker CD25 on T-cells in the cohort of the second time point. No associations between PCB levels and IFN-y production by T-cells and killing by NK-cells were found. In conclusion, there were several effects on the cellular composition of adaptive immunity, affecting both T- and B-cells. However, the values were not generally outside the reference ranges for healthy adult individuals and did not indicate overt functional immunodeficiency, even in subjects with the uppermost PCB burden. PMID:27005643

  1. EVALUATION OF PERFLUOROOCTANOIC ACID IMMUNOTOXICITY IN ADULT MICE.

    EPA Science Inventory

    Perfluorooctanoic acid (PFOA) is used in the manufacture of fluoropolymers and may be formed by metabolism or degradation of other perfluoroalkyl acids. Safety concerns led the U.S. EPA to conduct a risk assessment of PFOA and related compounds due to their environmental persist...

  2. Immunotoxicity Monitoring in a Population Exposed to Polychlorinated Biphenyls

    PubMed Central

    Haase, Hajo; Fahlenkamp, Astrid; Schettgen, Thomas; Esser, Andre; Gube, Monika; Ziegler, Patrick; Kraus, Thomas; Rink, Lothar

    2016-01-01

    The relationship between polychlorinated biphenyl (PCB) burden and several indicators of immune function was investigated as part of the HELPcB (Health Effects in High-Level Exposure to PCB) program, offering bio-monitoring to workers, relatives, and neighbors exposed to PCBs by a German transformers and capacitors recycling company. The present retrospective observational study evaluates the correlation of plasma levels of total PCBs, five indicator congeners (28, 101, 138, 153, 180), and seven dioxin-like congeners (105, 114, 118, 156, 157, 167, 189) with several parameters of immune function. The cross-sectional study was performed immediately after the end of exposure (258 subjects), and one (218 subjects), and two (177 subjects) years later. At the first time point, measurements showed significant positive correlation between congeners with low to medium chlorination and the relative proportion of CD19 positive B-cells among lymphocytes, as well as a negative correlation of PCB114 with serum IgM, and of PCB 28 with suppressor T-cell and NK-cell numbers. Congeners with a high degree of chlorination, in particular PCB157 and 189, were positively associated with expression of the activation marker CD25 on T-cells in the cohort of the second time point. No associations between PCB levels and IFN-y production by T-cells and killing by NK-cells were found. In conclusion, there were several effects on the cellular composition of adaptive immunity, affecting both T- and B-cells. However, the values were not generally outside the reference ranges for healthy adult individuals and did not indicate overt functional immunodeficiency, even in subjects with the uppermost PCB burden. PMID:27005643

  3. Oxidative damage of hepatopancreas induced by pollution depresses humoral immunity response in the freshwater crayfish Procambarus clarkii.

    PubMed

    Wei, Keqiang; Yang, Junxian

    2015-04-01

    Previous studies provide evidences for the possible oxidative damage of toxic environmental pollutants to tissue protein in fish and amphibian, but little information is available about their effects on immunity response in crustacean. In the present study, we evaluated the relationship between oxidative damage and immune response induced by both typical pollutants (viz. copper and beta-cypermethrin), by exposing the freshwater Procambarus clarkii to sub-lethal concentrations (1/40, 1/20, 1/10 and 1/5 of the 96 h LC50) up to 96 h. Five biomarkers of oxidative stress, i.e. reactive oxygen species (ROS), superoxide dismutase (SOD), catalase (CAT), malondialdehyde (MDA) and protein carbonyl in hepatopancreas, and two immune factors, i.e. phenoloxidase (PO) and hemocyanin in haemolymph were determined. The results indicated that there was a significant increase (P < 0.05) in the contents of ROS, MDA and protein carbonyl accompanied by markedly decreased (P < 0.05) PO and hemocyanin levels in a dose and time dependent manner. The significant and positive correlation (P < 0.01) between protein carbonyls induction and MDA formation was observed in crayfish hepatopancreas at 96 h. The production of these protein carbonyls could significantly depress (P < 0.01) the levels of phenoloxidase and hemocyanin in hemolymph. Higher contents of ROS enhanced the risk of lipid peroxidation, protein carbonylation and immunosuppression of crayfish, and hepatopancreas might play an important role in immune system of crustaceans. Protein oxidation may be one of the main mechanisms for pollution-induced immunotoxicity in P. clarkii.

  4. Induced Probabilities.

    ERIC Educational Resources Information Center

    Neel, John H.

    Induced probabilities have been largely ignored by educational researchers. Simply stated, if a new or random variable is defined in terms of a first random variable, then induced probability is the probability or density of the new random variable that can be found by summation or integration over the appropriate domains of the original random…

  5. Inducing Metaassociations and Induced Relationships

    NASA Astrophysics Data System (ADS)

    Burgués, Xavier; Franch, Xavier; Ribó, Josep M.

    In the last years, UML has been tailored to be used as a domain-specific modelling notation in several contexts. Extending UML with this purpose entails several advantages: the integration of the domain in a standard framework; its potential usage by the software engineering community; and the existence of supporting tools. In previous work, we explored one particular issue of heavyweight extensions, namely, the definition of inducing meta-associations in metamodels as a way to induce the presence of specific relation-ships in their instances. Those relationships were intended by the metamodel specifier but not forced by the metamodel itself. However, our work was restricted to the case of induced associations. This paper proposes an extension to the general case in which inducing metaassociations may force the existence of arbitrary relationships at M1. To attain this goal, we provide a general defini-tion of inducing metaassociation that covers all the possible cases. After revisi-ting induced associations, we show the inducement of the other relationship types defined in UML: association classes, generalization and dependencies.

  6. CYP1A2 IS NOT REQUIRED FOR 2, 3, 7, 8-TETRACHLORODIBENZO-P-DIOXIN-INDUCED IMMUNOSUPPRESSION

    EPA Science Inventory

    ABSTRACT
    One of the most sensitive and reproducible immunotoxic endpoints of 2,3,7,8-tetrachloro-dibenzo-p-dioxin (TCDD) exposure is suppression of the antibody response to sheep red blood cells (SRBCs) in mice. Immunosuppression occurs in concert with hepatomegaly and associ...

  7. Effects of T-2 toxin on turkey herpesvirus–induced vaccinal immunity against Marek’s disease

    Technology Transfer Automated Retrieval System (TEKTRAN)

    T-2 toxin, a very potent immunotoxic Type A trichothecene, is a secondary metabolite produced primarily by Fusarium spp., which grows on cereal grains and can lead to contaminated livestock feed. Repeated exposure to T-2 toxin has been shown to cause immunosuppression and decrease the resistance of ...

  8. Anatoxin-a induces apoptosis of leukocytes and decreases the proliferative ability of lymphocytes of common carp (Cyprinus carpio L.) in vitro.

    PubMed

    Bownik, A; Rymuszka, A; Sierosławska, A; Skowroński, T

    2012-01-01

    Cyanobacteria (Cyanophyta, Cyanoprocaryota, Cyanobacteria) (blue-green algae) are procaryotic phototrophic microorganisms playing an important ecological role in the freshwater and marine environment as primary producers. However, as a consequence of water eutrophication observed in many reservoirs in different parts of the world, these microorganisms form massive scums, known as water blooms, releasing cyanotoxins hazardous to fish and other aquatic organisms. Cyanotoxins are cyanobacterial secondary metabolites of various chemical structures harmful to humans, terrestial and aquatic animals such as fish. The most abundant cyanotoxins are microcystins and hepatotoxins inducing toxic changes in fish liver, kidney, gills, digestive tract and immune system. Very little is known on the effects of alkaloid neurotoxic anatoxin-a on fish and their immunity. The aim of this study was to assess the in vitro influence of anatoxin-a on immune cells isolated from the common carp (Cyprinus carpio L.). The leukocyte intracellular level of ATP was reduced only at the highest concentration of anatoxin-a. Apoptotic and necrotic leukocytes were observed at the lower and the highest concentrations of anatoxin-a, respectively. Elevated activity of caspases 3/7 after 2 hours and a concentration-dependent decrease in the proliferative ability of T and B lymphocytes was also observed. The results suggest that anatoxin-a could be a possible immunotoxic agent in the aquatic environment and may increase the susceptibility of fish to infectious and neoplastic diseases. Therefore, constant monitoring of anatoxin-a and its producers in lakes and fish ponds should be performed. PMID:23214375

  9. Exercise-Induced Bronchoconstriction

    MedlinePlus

    ... Conditions & Treatments ▸ Conditions Dictionary ▸ Exercise-Induced Bronchoconstriction Share | Exercise-Induced Bronchoconstriction (EIB) « Back to A to Z Listing Exercise-Induced Bronchoconstriction, (EIB), often known as exercise-induced ...

  10. Inducing puberty.

    PubMed

    Delemarre, Eveline M; Felius, Bram; Delemarre-van de Waal, Henriette A

    2008-12-01

    Puberty is the result of increasing pulsatile secretion of the hypothalamic gonadotropin releasing hormone (GnRH), which stimulates the release of gonadotropins and in turn gonadal activity. In general in females, development of secondary sex characteristics due to the activity of the gonadal axis, i.e., the growth of breasts, is the result of exposure to estrogens, while in boys testicular growth is dependent on gonadotropins and virilization on androgens. Hypogonadotropic hypogonadism is a rare disease. More common is the clinical picture of delayed puberty, often associated with a delay of growth and more often familial occurring. Especially, boys are referred because of the delay of growth and puberty. A short course (3-6 months) of androgens may help these boys to overcome the psychosocial repercussions, and during this period an increase in the velocity of height growth and some virilization will occur. Hypogonadotropic hypogonadism may present in a congenital form caused by developmental disorders, some of which are related to a genetic disorder, or secondary to hypothalamic-pituitary dysfunction due to, among others, a cerebral tumor. In hypogonadotropic hypogonadism puberty can be initiated by the use of pulsatile GnRH, gonadotropins, and sex steroids. Sex steroids will induce development of the secondary sex characteristics alone, while combined administration of gonadotropins and GnRH may induce gonadal development including fertility.

  11. [Induced "acarophobia"].

    PubMed

    Mester, H

    1975-01-01

    Although only ablut 240 cases of 'acarophobia' are on record in zoological and medical literature, it can be seen that this delusional syndrome without doubt leads to psychoses of association more frequently than any other mental disturbance. The literature contains many references, and the author can give two examples from personal esperience. At least every sixth patient suffering from delusions of parasitosis 'infects' relations. This really remarkable tendency to spread by psychological contagion on one or more dependent persons has been ignored by many writers. The supposition that such occurrences are very rare proves to be false. Sometimes the associated who acquired the symptons in an absolutely identical fashion seem to be more worried by the vermin they hallucinate than the initiators are. The number of patients constituting an affected group is following a Neyman distribution. Emphasis is laid on the finding that the proportion of consanguineous persons within the sample of patients who showed an induced delusion of parasitosis is by far less high than in other psychopathological forms of communicated insanity.

  12. Weather and plant age affect the levels of steroidal saponin and Pithomyces chartarum spores in Brachiaria grass

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Brachiaria species are cultivated worldwide in tropical and subtropical climates as the main forage source for ruminants. Numerous tropical and warm-season grasses cause hepatogenous photosensitization, among them several species of Brachiaria. Steroidal saponins present in these plants may be respo...

  13. [Heparin-induced thrombocytopenia].

    PubMed

    Franchini, Massimo; Veneri, Dino

    2005-09-01

    Heparin-induced thrombocytopenia is a serious and underestimated adverse drug effect. We briefly discuss the main features of heparin-induced thrombocytopenia, particularly analyzing the most recent advances in the pathophysiology, diagnosis and treatment of this syndrome.

  14. Avermectin induced autophagy in pigeon spleen tissues.

    PubMed

    Liu, Ci; Zhao, Yanbing; Chen, Lijie; Zhang, Ziwei; Li, Ming; Li, Shu

    2015-12-01

    The level of autophagy is considered as an indicator for monitoring the toxic impact of pesticide exposure. Avermectin (AVM), a widely used insecticide, has immunotoxic effects on the pigeon spleen. The aim of this study was to investigate the status of autophagy and the expression levels of microtubule-associated protein1 light chain 3 (LC3), beclin-1, dynein, autophagy associated gene (Atg) 4B, Atg5, target of rapamycin complex 1 (TORC1) and target of rapamycin complex 2 (TORC2) in AVM-treated pigeon spleens. Eighty two-month-old pigeons were randomly divided into four groups: a control group, a low-dose group, a medium-dose group and a high-dose group, which were fed a basal diet spiked with 0, 20, 40 and 60 mg AVM/kg diet, respectively. Microscopic cellular morphology revealed a significant increase in autophagic structures in the AVM-treated groups. The expression of LC3, beclin-1, dynein, Atg4B and Atg5 increased, while mRNA levels of TORC1 and TORC2 were decreased in the AVM-treated groups relative to the control groups at 30, 60 and 90 days in the pigeon spleen. These results indicated that AVM exposure could up-regulate the level of autophagy in a dose-time-dependent manner in the pigeon spleen.

  15. [Drug-induced dementia].

    PubMed

    Kojima, Taro; Akishita, Masahiro

    2016-03-01

    Many drugs have been reported to induce not only delirium but also cognitive impairment. Some types of drugs are reported to induce dementia, and prolonged hypotension or hypoglycemia induced by overuse of antihypertensive drugs or oral antidiabetic drugs could result in dementia. Recently, taking multiple drugs with anticholinergic activity are reported to cause cognitive decline and anticholinergic burden should be avoided especially in patients with dementia. Drug-induced dementia can be prevented by avoiding polypharmacy and adhering to the saying 'start low and go slow' . Early diagnosis of drug-induced dementia and withdrawal of the offending drug is essential to improve cognitive function. PMID:27025096

  16. Cavitation-resistant inducer

    DOEpatents

    Dunn, C.; Subbaraman, M.R.

    1989-06-13

    An improvement in an inducer for a pump is disclosed wherein the inducer includes a hub, a plurality of radially extending substantially helical blades and a wall member extending about and encompassing an outer periphery of the blades. The improvement comprises forming adjacent pairs of blades and the hub to provide a substantially rectangular cross-sectional flow area which cross-sectional flow area decreases from the inlet end of the inducer to a discharge end of the inducer, resulting in increased inducer efficiency improved suction performance, reduced susceptibility to cavitation, reduced susceptibility to hub separation and reduced fabrication costs. 11 figs.

  17. Cavitation-resistant inducer

    DOEpatents

    Dunn, Charlton; Subbaraman, Maria R.

    1989-01-01

    An improvement in an inducer for a pump wherein the inducer includes a hub, a plurality of radially extending substantially helical blades and a wall member extending about and encompassing an outer periphery of the blades. The improvement comprises forming adjacent pairs of blades and the hub to provide a substantially rectangular cross-sectional flow area which cross-sectional flow area decreases from the inlet end of the inducer to a discharge end of the inducer, resulting in increased inducer efficiency improved suction performance, reduced susceptibility to cavitation, reduced susceptibility to hub separation and reduced fabrication costs.

  18. Flow-induced vibration

    SciTech Connect

    Blevins, R.D.

    1990-01-01

    This book reports on dimensional analysis; ideal fluid models; vortex-induced vibration; galloping and flutter; instability of tube and cylinder arrays; vibrations induced by oscillating flow; vibration induced by turbulence and sound; damping of structures; sound induced by vortex shedding; vibrations of a pipe containing a fluid flow; indices. It covers the analysis of the vibrations of structures exposed to fluid flows; explores applications for offshore platforms and piping; wind-induced vibration of buildings, bridges, and towers; and acoustic and mechanical vibration of heat exchangers, power lines, and process ducting.

  19. Induced pluripotency with endogenous and inducible genes

    SciTech Connect

    Duinsbergen, Dirk; Eriksson, Malin; Hoen, Peter A.C. 't; Frisen, Jonas; Mikkers, Harald

    2008-10-15

    The recent discovery that two partly overlapping sets of four genes induce nuclear reprogramming of mouse and even human cells has opened up new possibilities for cell replacement therapies. Although the combination of genes that induce pluripotency differs to some extent, Oct4 and Sox2 appear to be a prerequisite. The introduction of four genes, several of which been linked with cancer, using retroviral approaches is however unlikely to be suitable for future clinical applications. Towards developing a safer reprogramming protocol, we investigated whether cell types that express one of the most critical reprogramming genes endogenously are predisposed to reprogramming. We show here that three of the original four pluripotency transcription factors (Oct4, Klf4 and c-Myc or MYCER{sup TAM}) induced reprogramming of mouse neural stem (NS) cells exploiting endogenous SoxB1 protein levels in these cells. The reprogrammed neural stem cells differentiated into cells of each germ layer in vitro and in vivo, and contributed to mouse development in vivo. Thus a combinatorial approach taking advantage of endogenously expressed genes and inducible transgenes may contribute to the development of improved reprogramming protocols.

  20. [Isoniazid-induced myopathy].

    PubMed

    Chaouch, N; Mejid, M; Zarrouk, M; Racil, H; Rouhou, S Cheikh; El Euch, G; Chabbou, A

    2011-12-01

    Drug-induced muscle disorders are now well known and vary from a simple isolated increase in muscle enzymes to severe drug-induced myopathy. The list of drugs inducing myopathy is very long and continues to grow. The onset of muscle disorders under isoniazid often falls within a drug-induced neuropathy or a drug-induced lupus. However, the occurrence of isolated isoniazid-induced drug myopathy without neuropathy is an extremely rare condition especially with non-toxic doses. The authors report the case of a 28-year-old man, without a previous medical history, hospitalized for pulmonary tuberculosis. After initiating tuberculosis treatment for five days, he presented muscle pain, fasciculation and weakness initially involving the lower left limb that quickly propagated to all four limbs. The physical examination noted a left ankle flush, a swollen left calf and fasciculation of both calves while the neurological examination was normal. The CPK was normal. Electromyography confirmed the myopathy without neuropathic findings. Isoniazid withdrawal was marked by the rapid disappearance of the symptoms. The reintroduction of a half-dose of isoniazid only induced a few transitional muscular fasciculations. The onset of the symptoms under tuberculosis treatment, the absence of later muscle disorders, the absence of any other cause of myopathy and the total disappearance of the symptoms after isoniazid withdrawal confirmed the diagnosis of isoniazid-induced myopathy.

  1. Space Station Induced Monitoring

    NASA Technical Reports Server (NTRS)

    Spann, James F. (Editor); Torr, Marsha R. (Editor)

    1988-01-01

    This report contains the results of a conference convened May 10-11, 1988, to review plans for monitoring the Space Station induced environment, to recommend primary components of an induced environment monitoring package, and to make recommendations pertaining to suggested modifications of the Space Station External Contamination Control Requirements Document JSC 30426. The contents of this report are divided as Follows: Monitoring Induced Environment - Space Station Work Packages Requirements, Neutral Environment, Photon Emission Environment, Particulate Environment, Surface Deposition/Contamination; and Contamination Control Requirements.

  2. Noise-Induced Hearing Loss

    MedlinePlus

    ... Info » Hearing, Ear Infections, and Deafness Noise-Induced Hearing Loss On this page: What is noise-induced hearing ... additional information about NIHL? What is noise-induced hearing loss? Every day, we experience sound in our environment, ...

  3. From immunotoxicity to nanotherapy: the effects of nanomaterials on the immune system.

    PubMed

    Smith, Matthew J; Brown, Jared M; Zamboni, William C; Walker, Nigel J

    2014-04-01

    The potential for human exposure to the diverse and ever-changing world of nanoscale materials has raised concerns about their influence on health and disease. The novel physical and chemical properties of these materials, which are associated with their small size, complicate toxicological evaluations. Further, these properties may make engineered nanomaterials (ENMs) a prime target for interaction with the immune system following uptake by phagocytes. Undesired effects on antigen-presenting cells and other phagocytic cells are of concern due to the high likelihood of ENM uptake by these cells. In addition, ENM interactions with lymphocytes and other cell types can contribute to a varied spectrum of possible effects, including inflammation, hypersensitivity, and immunomodulation. Furthermore, the mast cell (a type of immune cell traditionally associated with allergy) appears to contribute to certain inflammatory and toxic effects associated with some ENMs. Although incidental exposure may be undesirable, nanomedicines engineered for various clinical applications provide opportunities to develop therapies that may or may not intentionally target the immune system. The interaction between ENMs and the immune system and the resulting pharmacokinetic and phenotypic responses are critical factors that dictate the balance between toxicity and clinical efficacy of nanotherapeutics.

  4. A COMPARISON OF MULTIPLE TOXICITIES FOLLOWING DEVELOPMENTAL EXPOSURE TO PESTICIDES: NEUROTOXICITY, IMMUNOTOXICITY, AND REPRODUCTIVE TOXICITY.

    EPA Science Inventory

    The NAS report (Pesticides in the Diets of Infants and Children, 1993) called for significant research effort into the long-term effects of perinatal pesticide exposure on the nervous, immune, and reproductive systems. In response, the US EPA and NIEHS collaborated on a series o...

  5. DEVELOPMENTAL EXPOSURE TO DI-N-BUTYLTIN DICHLORIDE (DBTC): IMMUNOTOXIC AND NEUROTOXIC EVALUATION

    EPA Science Inventory

    Organotins are incorporated as stabilizers in PVC water supply pipe. Particularly when new, mono- and di-substituted methyl- and butyltins leach from the pipe and are thus of regulatory concern to EPA. These contaminants have adverse effects on both the immune and nervous systems...

  6. Ecological impacts of the Deepwater Horizon oil spill: implications for immunotoxicity

    EPA Science Inventory

    Summary of major Federal and multi-stake holder research efforts in response to the DWH spill, including laboratory oil dispersant testing, estimation of oil release rates and oil fate calculations, subsea monitoring, and post-spill assessments. Impacts from shoreline oiling, wil...

  7. Evaluation of the potential immunotoxicity of chlorinated drinking water in mice.

    PubMed

    French, A S; Copeland, C B; Andrews, D L; Wiliams, W C; Riddle, M M; Luebke, R W

    1998-01-16

    Recent epidemiological studies have reported associations between the consumption of chlorinated drinking water and various types of human cancer; in addition, exposure to chlorine (Cl-) in drinking water has been reported to suppress certain immune functions in laboratory animals. The current studies were conducted to extend our knowledge of the effects of drinking water exposure to Cl-. Female C57BL/6 mice were administered hyperchlorinated drinking water (7.5, 15, or 30 ppm Cl-) for 2 weeks prior to sacrifice for evaluation of spleen and thymus weights, the plaque-forming cell (PFC) response, hemagglutination (HA) titer, and lymphocyte proliferation (LP). Significant reductions in organ weights and immune response were observed in the positive control groups (i.e. dexamethasone- or cyclophosphamide-exposed mice). No consistent differences were observed between the Cl--exposed animals and vehicle control mice for the evaluated parameters. Thus, under the conditions of these experiments, 2 weeks of exposure to hyperchlorinated drinking water had no apparent adverse effects on immune function.

  8. Assessment of immunotoxicity and genotoxicity in workers exposed to low concentrations of formaldehyde.

    PubMed

    Aydin, Sevtap; Canpinar, Hande; Ündeğer, Ülkü; Güç, Dicle; Çolakoğlu, Mustafa; Kars, Ayşe; Başaran, Nurşen

    2013-01-01

    Formaldehyde (FA), which is an important chemical with a wide commercial use, has been classified as carcinogenic to humans by International Research on Cancer (IARC). The genotoxic and carcinogenic potential of FA has been documented in mammalian cells and in rodents. A recent evaluation by the E.U. Scientific Committee for Occupational Exposure Limits (SCOEL) anticipated that an 8-h time-weighted average exposure to 0.2 ppm FA would not be irritating and not genotoxic in humans. In order to verify this prediction, a field study was performed that aimed at evaluating immune alterations and genetic damage in peripheral lymphocytes of workers in medium density fiberboard plants exposed to a level of FA equivalent to the OEL recommended by SCOEL (0.2 ppm). Subsets of peripheral lymphocytes, immunoglobulins (IgG, IgA, IgM), complement proteins, and tumor necrosis factor-alpha (TNF-α) levels were evaluated. DNA damage of the workers was assessed by the Comet assay. The absolute numbers and the percentages of T lymphocytes and of natural killer cells, and the levels of TNF-α were higher than the controls, whereas IgG and IgM levels were found to be lower in workers. Other examined immunological parameters were not different from those of the controls. There was no increased DNA damage in the workers compared to controls.

  9. [The effect of unithiol on the changes in immunotoxicity of 2-chloroethenylchloroarsine].

    PubMed

    Zabrodskiĭ, P F; Germanchuk, V G; Nodel', M L

    2002-01-01

    The results of experiments on Wistar rats under conditions of acute intoxication with 2-chloroethenyldichloroarsine (beta-chlorovinyldichloroarsine) (0.75 LD50) showed that unithiol increases antiinfectious nonspecific resistance (NSR) of the organism. This is manifested by improved NSR characteristics: increased activity of the natural killer cells, predominant formation of antibodies to thymus-dependent antigen, and development of delayed-type hypersensitivity. However, no complete recovery of the NSR parameters impaired by 2-chloroethenyldichloroarsine is observed.

  10. Exploratory behavior and recognition memory in medial septal electrolytic, neuro- and immunotoxic lesioned rats.

    PubMed

    Dashniani, M G; Burjanadze, M A; Naneishvili, T L; Chkhikvishvili, N C; Beselia, G V; Kruashvili, L B; Pochkhidze, N O; Chighladze, M R

    2015-01-01

    In the present study, the effect of the medial septal (MS) lesions on exploratory activity in the open field and the spatial and object recognition memory has been investigated. This experiment compares three types of MS lesions: electrolytic lesions that destroy cells and fibers of passage, neurotoxic - ibotenic acid lesions that spare fibers of passage but predominantly affect the septal noncholinergic neurons, and immunotoxin - 192 IgG-saporin infusions that only eliminate cholinergic neurons. The main results are: the MS electrolytic lesioned rats were impaired in habituating to the environment in the repeated spatial environment, but rats with immuno- or neurotoxic lesions of the MS did not differ from control ones; the MS electrolytic and ibotenic acid lesioned rats showed an increase in their exploratory activity to the objects and were impaired in habituating to the objects in the repeated spatial environment; rats with immunolesions of the MS did not differ from control rats; electrolytic lesions of the MS disrupt spatial recognition memory; rats with immuno- or neurotoxic lesions of the MS were normal in detecting spatial novelty; all of the MS-lesioned and control rats clearly reacted to the object novelty by exploring the new object more than familiar ones. Results observed across lesion techniques indicate that: (i) the deficits after nonselective damage of MS are limited to a subset of cognitive processes dependent on the hippocampus, (ii) MS is substantial for spatial, but not for object recognition memory - the object recognition memory can be supported outside the septohippocampal system; (iii) the selective loss of septohippocampal cholinergic or noncholinergic projections does not disrupt the function of the hippocampus to a sufficient extent to impair spatial recognition memory; (iv) there is dissociation between the two major components (cholinergic and noncholinergic) of the septohippocampal pathway in exploratory behavior assessed in the open field - the memory exhibited by decrements in exploration of repeated object presentations is affected by either electrolytic or ibotenic lesions, but not saporin.

  11. COMPARING IMMUNOTOXICITY IN RATS AFTER IN UTERO VERSUS AN ADULT EXPOSURE: IS DEVELOPMENTAL EXPOSURE MORE SENSITIVE?

    EPA Science Inventory

    Using a known immunosuppresant, dexamethasone (DEX), pregnant Sprague Dawley (SD) rats were given subcutaneous (s.c.) injections of DEX (0.0, 0.0375, 0.075, 0.15, 0.3 mg/kg) during gestation days 6 to 21. Both male and female offspring were tested for immune dysfunction. In a ...

  12. Systemic immunotoxicity in AJ mice following 6-month whole body inhalation exposure to diesel exhaust.

    PubMed

    Burchiel, Scott W; Lauer, Fredine T; McDonald, Jacob D; Reed, Matthew D

    2004-05-01

    The purpose of these studies was to determine the effects of subchronic diesel exposure on indicators of systemic immunity in mice. AJ mice were exposed daily for 6 months (6 h/day) to atmospheres containing one of four concentrations (30, 100, 300, and 1000 microg/m(3)) of diluted diesel exhaust (DE) in whole body exposure chambers. The effects of DE were compared to chamber exposure controls receiving fresh air. DE was assessed for effects on systemic immunity by measuring the proliferative response of spleen cells following stimulation with T cell (phytohemagglutinin, or PHA) or B cell (lipopolysaccharide, or LPS) mitogens. The results showed that DE at all exposure levels suppressed the proliferative response of T cells. B cell proliferation was increased at 30 microg/m(3) and was unaffected at the 100, 300, and 1000 microg/m(3) exposures. Polycyclic aromatic hydrocarbons (PAHs) are known to suppress spleen cell mitogenic responses, and it has been hypothesized by several groups that PAHs and perhaps benzo(a)pyrene (BaP)-quinones (BPQs) may be responsible for the effects of DE or diesel exhaust particles (DEP). Therefore, a second purpose of these studies was to determine the effects of in vitro BPQs on AJ mouse spleen cell mitogenic responses and compare to DE in preliminary studies. Unlike DE, BPQs were found to increase T cell proliferation. In addition, analysis of chamber atmospheres showed that there was little if any PAH and BPQs in DE. Therefore, these results demonstrate that because of the absence of BPQs in DE, they are likely not responsible for the immunosuppressive effect of DE on murine spleen cell responses.

  13. The mechanisms of surface chemistry effects of mesoporous silicon nanoparticles on immunotoxicity and biocompatibility.

    PubMed

    Shahbazi, Mohammad-Ali; Hamidi, Mehrdad; Mäkilä, Ermei M; Zhang, Hongbo; Almeida, Patrick V; Kaasalainen, Martti; Salonen, Jarno J; Hirvonen, Jouni T; Santos, Hélder A

    2013-10-01

    Despite steadily increasing insights on the biocompatibility of PSi nanoparticles (NPs), an extensive biosafety study on the immune and red blood cells (RBCs) is still lacking. Herein, we evaluated the impact of the PSi NPs' surface chemistry on immune cells and human RBCs both in vitro and in vivo. Negatively charged hydrophilic and hydrophobic PSi NPs caused less ATP depletion and genotoxicity than the positively charged amine modified hydrophilic PSi NPs, demonstrating the main role of PSi NPs' surface charge on the immunocompatibility profile. Furthermore, cells with lower metabolic activity, longer doubling time, and shorter half-life were more sensitive to the concentration- and time-dependent toxicity in the following order: T-cells ≈ monocytes > macrophages ≈ B-cells. RBC hemolysis and imaging assay revealed a significant correlation between the surface chemistry, the amount of the PSi NPs adsorbed on the cell surface and the extent of morphological changes. The in vivo results showed that despite mild renal steatosis, glomerular degeneration, hepatic central vein dilation and white pulp shrinkage in spleen, no notable changes were observed in the serum level of biochemical and hematological factors. This study is a comprehensive demonstration of the mechanistic direct and indirect genotoxicity effects of PSi NPs, elucidating the most influencing properties for the PSi NPs' design.

  14. Approaches and Considerations for the Assessment of Immunotoxicity for Environmental Chemicals: A Workshop Summary

    EPA Science Inventory

    As additional experience is gained with current toxicology testing approaches and as new assays and technologies are developed, it is critical for all stakeholders to engage in active dialog about potential opportunities to advance our overall testing strategies. To facilitate t...

  15. Effect of the protein corona on nanoparticles for modulating cytotoxicity and immunotoxicity

    PubMed Central

    Lee, Yeon Kyung; Choi, Eun-Ju; Webster, Thomas J; Kim, Sang-Hyun; Khang, Dongwoo

    2015-01-01

    Although the cytotoxicity of nanoparticles (NPs) is greatly influenced by their interactions with blood proteins, toxic effects resulting from blood interactions are often ignored in the development and use of nanostructured biomaterials for in vivo applications. Protein coronas created during the initial reaction with NPs can determine the subsequent immunological cascade, and protein coronas formed on NPs can either stimulate or mitigate the immune response. Along these lines, the understanding of NP-protein corona formation in terms of physiochemical surface properties of the NPs and NP interactions with the immune system components in blood is an essential step for evaluating NP toxicity for in vivo therapeutics. This article reviews the most recent developments in NP-based protein coronas through the modification of NP surface properties and discusses the associated immune responses. PMID:25565807

  16. The impact of nanoparticle protein corona on cytotoxicity, immunotoxicity and target drug delivery.

    PubMed

    Corbo, Claudia; Molinaro, Roberto; Parodi, Alessandro; Toledano Furman, Naama E; Salvatore, Francesco; Tasciotti, Ennio

    2016-01-01

    In a perfect sequence of events, nanoparticles (NPs) are injected into the bloodstream where they circulate until they reach the target tissue. The ligand on the NP surface recognizes its specific receptor expressed on the target tissue and the drug is released in a controlled manner. However, once injected in a physiological environment, NPs interact with biological components and are surrounded by a protein corona (PC). This can trigger an immune response and affect NP toxicity and targeting capabilities. In this review, we provide a survey of recent findings on the NP-PC interactions and discuss how the PC can be used to modulate both cytotoxicity and the immune response as well as to improve the efficacy of targeted delivery of nanocarriers. PMID:26653875

  17. THE COMPARATIVE IMMUNOTOXICITY OF FIVE SELCTED COMPOUNDS FOLLOWING DEVELOPMENTAL OR ADULT EXPOSURE

    EPA Science Inventory

    It is well established that human diseases associated with abnormal immune function, including some common infectious diseases and asthma, are considerably more prevalent at younger ages. Although not established absolutely, it is generally believed that development constitutes ...

  18. Immunotoxicity effect of benzo[α]pyrene on scallop Chlamys farreri

    NASA Astrophysics Data System (ADS)

    Zhang, Lin; Pan, Luqing; Liu, Jing

    2009-03-01

    The toxic effects of benzo[ α]pyrene (B[ α]P) at different concentrations (0.1, 0.5, 1, 2.5 and 7.5 μgL-1) on scallop ( Chlamy farreri) immune system were studied. The results showed that B[ α]P had significant toxic effects on the haemocyte counts, neutral red uptake, phagocytosis, bacteriolytic and antibacterial activity ( P<0.05), while the seawater control and acetone control had no significant differences. The haemocyte counts, neutral red uptake, phagocytosis and bacteriolytic activity in all B[ α]P treatment groups as well as antibacterial activity in groups of 0.5, 1, 2.5 and 7.5 μgL-1 B[ α]P decreased significantly ( P<0.05). Some of these indices tended to be stable on the sixth day and others on the ninth day, and the indices showed clear time- and concentration-response to B[ α]P. Bacteriolytic activity in 0.1μgL-1 B[ α]P treatment group and antibacterial activity in 0.1 μgL-1 and 0.5 μgL- B[ α]P treatment groups increased at the beginning of exposure and reached their peaks on day 1 and day 6, respectively. Following that, both activities decreased gradually and became stable after day 9. When all the indices reached stability, they were significantly lower than those in control group ( P<0.05), except for antibacterial activity in 0.1 μgL-1 B[ α]P treatment group ( P>0.05). Thus, B[ α] has evident toxic effects on scallop immune system, which supports the view that a relationship exists between pollution and immunomodulation in aquatic organisms.

  19. The toxicological impacts of the Fusarium mycotoxin, deoxynivalenol, in poultry flocks with special reference to immunotoxicity.

    PubMed

    Awad, Wageha; Ghareeb, Khaled; Böhm, Josef; Zentek, Jürgen

    2013-04-29

    Deoxynivalenol (DON) is a common Fusarium toxin in poultry feed. Chickens are more resistant to the adverse impacts of deoxynivalenol (DON) compared to other species. In general, the acute form of DON mycotoxicosis rarely occurs in poultry flocks under normal conditions. However, if diets contain low levels of DON (less than 5 mg DON/kg diet), lower productivity, impaired immunity and higher susceptibility to infectious diseases can occur. The molecular mechanism of action of DON has not been completely understood. A significant influence of DON in chickens is the impairment of immunological functions. It was known that low doses of DON elevated the serum IgA levels and affected both cell-mediated and humoral immunity in animals. DON is shown to suppress the antibody response to infectious bronchitis vaccine (IBV) and to Newcastle disease virus (NDV) in broilers (10 mg DON/kg feed) and laying hens (3.5 to 14 mg of DON/kg feed), respectively. Moreover, DON (10 mg DON/kg feed) decreased tumor necrosis factor alpha (TNF-α) in the plasma of broilers. DON can severely affect the immune system and, due to its negative impact on performance and productivity, can eventually result in high economic losses to poultry producers. The present review highlights the impacts of DON intoxication on cell mediated immunity, humoral immunity, gut immunity, immune organs and pro-inflammatory cytokines in chickens.

  20. Immunotoxicity of commercial-mixed glyphosate in broad snouted caiman (Caiman latirostris).

    PubMed

    Siroski, Pablo A; Poletta, Gisela L; Latorre, María A; Merchant, Mark E; Ortega, Hugo H; Mudry, Marta D

    2016-01-25

    The expansion and intensification of agriculture during the past 50 years is unprecedented, and thus environmental problems have been triggered at different scales. These transformations have caused the loss of habitat and biodiversity, and disruption of the structure and functioning of ecosystems. As a result of the expansion of the agricultural frontier in the recent past, many areas of the natural geographic distribution of the local wildlife, among them crocodilians and particularly the broad snouted caiman (Caiman latirostris), are being exposed to contaminants. The present study was designed to evaluate the effect of commercially-mixed glyphosate (RU) on some parameters of the immune system of C. latirostris. Two groups of caimans were exposed for two months to different concentrations of RU recommended for its application in the field, while one group was maintained as an unexposed control. The RU concentration was progressively decreased through the exposure period to simulate glyphosate degradation in water. After exposure, total and differential white blood cell (WBC), and complement system activity (CS) were determined. In addition, the animals were injected with a solution of lipopolysaccharide (LPS) from Escherichia coli to trigger an immune response and evaluate the parameters associated with it. The results showed that an effect of the herbicide on CS was observed, as animals exposed to RU showed a lower CS activity than animals from the negative control (NC) but not in total WBC. In the case of leukocyte population counts, differences were only found for heterophils and lymphocytes. PMID:26658029

  1. INTRODUCTION: INHALATION EXPOSURE AND SYSTEMIC IMMUNOTOXICITY: MECHANISMS LINKING THE LUNG AND IMMUNE SYSTEM

    EPA Science Inventory


    Concerns regarding inhaled compounds, immune suppression and increased risk of disease have focused primarily on suppression of local immune responses in the lung and susceptibility to respiratory infections. However, a number of studies have shown that both gaseous (O3, NO2)...

  2. THE DEVELOPMENTAL IMMUNOTOXICITY OF DIBUTYLTIN DICHLORIDE IN SPRAGUE-DAWLEY RATS

    EPA Science Inventory

    Methyl- and butyltin compounds used as stabilizers in polyvinyl chloride (PVC) pipe production are of concern as they leach from supply pipes into drinking water and have been associated with multisystem toxicity. This study assessed immune function in Sprague-Dawley (CD) rats d...

  3. The effect of diesel (DE) exposure in utero on reproductive and developmental immunotoxicity

    EPA Science Inventory

    Epidemiology studies are beginning to show that in utero exposure to traffic related pollutants might increase the incidence of immune mediated lung diseases. Time pregnant BALB/c mice were exposed to air or two concentrations of diesel exhaust (0.5 and 2 mg/m3...

  4. Vitiligo, drug induced (image)

    MedlinePlus

    ... this person's face have resulted from drug-induced vitiligo. Loss of melanin, the primary skin pigment, occasionally ... is the case with this individual. The typical vitiligo lesion is flat (macular) and depigmented, but maintains ...

  5. Exercise-induced asthma

    MedlinePlus

    Wheezing - exercise-induced; Reactive airway disease - exercise ... Having asthma symptoms when you exercise does not mean you cannot or should not exercise. But be aware of your EIA triggers. Cold or dry air may ...

  6. Drug-induced hepatitis

    MedlinePlus

    Toxic hepatitis ... to get liver damage. Some drugs can cause hepatitis with small doses, even if the liver breakdown ... liver. Many different drugs can cause drug-induced hepatitis. Painkillers and fever reducers that contain acetaminophen are ...

  7. Opioid-induced endocrinopathy.

    PubMed

    Colameco, Stephen; Coren, Joshua S

    2009-01-01

    Debilitating chronic nonmalignant pain is often managed using opioid medications. However, with increased use of this drug class comes concern about adverse effects on patients' endocrine function. In the present review, the authors discuss opioid-induced interference with the hypothalamic-pituitary-gonadal axis, effects on adrenal androgen production, and endocrine deficiency. In addition, the authors describe symptomology for opioid-induced endocrinopathy as well as diagnostic testing options. Treatment modalities for those afflicted with this condition are also described.

  8. Induced polarization response of microbial induced sulfideprecipitation

    SciTech Connect

    Ntarlagiannis, Dimitrios; Williams, Kenneth Hurst; Slater, Lee; Hubbard, Susan

    2004-06-04

    A laboratory scale experiment was conducted to examine the use of induced polarization and electrical conductivity to monitor microbial induced sulfide precipitation under anaerobic conditions in sand filled columns. Three columns were fabricated; one for electrical measurements, one for geochemical sampling and a third non-inoculated column was used as a control. A continual upward flow of nutrients and metals in solution was established in each column. Desulfovibrio vulgaris microbes were injected into the middle of the geochemical and electrical columns. Iron and zinc sulfides precipitated along a microbial action front as a result of sulfate reduction due by Desulfovibrio vulgaris. The precipitation front initially developed near the microbial injection location, and subsequently migrated towards the nutrient inlet, as a result of chemotaxis by Desulfovibrio vulgaris. Sampling during and subsequent to the experiment revealed spatiotemporal changes in the biogeochemical measurements associated with microbial sulfate reduction. Conductivity measurements were insensitive to all biogeochemical changes occurred within the column. Changes in the IP response (of up to 14 mrad)were observed to coincide in place and in time with the active microbe respiration/sulfide precipitation front as determined from geochemical sampling. The IP response is correlated with the lactate concentration gradient, an indirect measurement of microbial metabolism, suggesting the potential of IP as a method for monitoring microbial respiration/activity. Post experimental destructive sample analysis and SEM imaging verified the geochemical results and supported our hypothesis that microbe induced sulfide precipitation is directly detectable using electrical methods. Although the processes not fully understood, the IP response appears to be sensitive to this anaerobic microbial precipitation, suggesting a possible novel application for the IP method.

  9. Effects of diazinon on the lymphocytic cholinergic system of Nile tilapia fish (Oreochromis niloticus).

    PubMed

    Toledo-Ibarra, G A; Díaz-Resendiz, K J G; Pavón-Romero, L; Rojas-García, A E; Medina-Díaz, I M; Girón-Pérez, M I

    2016-08-01

    Fish rearing under intensive farming conditions can be easily disturbed by pesticides, substances that have immunotoxic properties and may predispose to infections. Organophosphorus pesticides (OPs) are widely used in agricultural activities; however, the mechanism of immunotoxicity of these substances is unclear. The aim of this study was to evaluate the effect of diazinon pesticides (OPs) on the cholinergic system of immune cells as a possible target of OP immunotoxicity. We evaluated ACh levels and cholinergic (nicotinic and muscarinic) receptor concentration. Additionally, AChE activity was evaluated in mononuclear cells of Nile tilapia (Oreochromis niloticus), a freshwater fish mostly cultivated in tropical regions around the world. The obtained results indicate that acute exposure to diazinon induces an increase in ACh concentration and a decrease in nAChR and mAChR concentrations and AChE activity in fish immune cells, This suggests that the non-neuronal lymphocytic cholinergic system may be the main target in the mechanism of OP immunotoxicity. This study contributes to the understanding of the mechanisms of immunotoxicity of pollutants and may help to take actions for animal health improvement. PMID:27260186

  10. Effects of diazinon on the lymphocytic cholinergic system of Nile tilapia fish (Oreochromis niloticus).

    PubMed

    Toledo-Ibarra, G A; Díaz-Resendiz, K J G; Pavón-Romero, L; Rojas-García, A E; Medina-Díaz, I M; Girón-Pérez, M I

    2016-08-01

    Fish rearing under intensive farming conditions can be easily disturbed by pesticides, substances that have immunotoxic properties and may predispose to infections. Organophosphorus pesticides (OPs) are widely used in agricultural activities; however, the mechanism of immunotoxicity of these substances is unclear. The aim of this study was to evaluate the effect of diazinon pesticides (OPs) on the cholinergic system of immune cells as a possible target of OP immunotoxicity. We evaluated ACh levels and cholinergic (nicotinic and muscarinic) receptor concentration. Additionally, AChE activity was evaluated in mononuclear cells of Nile tilapia (Oreochromis niloticus), a freshwater fish mostly cultivated in tropical regions around the world. The obtained results indicate that acute exposure to diazinon induces an increase in ACh concentration and a decrease in nAChR and mAChR concentrations and AChE activity in fish immune cells, This suggests that the non-neuronal lymphocytic cholinergic system may be the main target in the mechanism of OP immunotoxicity. This study contributes to the understanding of the mechanisms of immunotoxicity of pollutants and may help to take actions for animal health improvement.

  11. [Exercise-induced asthma].

    PubMed

    Dinh Xuan, A T; Marsac, J; Lockhart, A

    1988-12-10

    Exercise-induced asthma only differs from common asthma in its causative factor. It is a typical asthmatic attack which follows a strenuous and continuous physical exercise lasting 5 to 10 minutes, most often in cold and dry weather. The prevalence of exercise-induced asthma has not yet been firmly established; its pathophysiological mechanisms are still debated, and the respective roles of heat and water losses by the airways are not clearly defined. However, the influence of the type of exercise as a precipitating factor of exercise-induced asthma is now well-known. All things being equal, swimming generates less asthma than running and cycling. This enables the subjects to be directed towards the most suitable sports and encouraged to improve their physical fitness. Drug treatment of exercise-induced asthma must preferentially be preventive; it relies on cromoglycate and beta-2 adrenergic agonists, the latter being also capable of treating acute exercise-induced bronchial obstruction. Education of the patients and their family is also important.

  12. Gravitationally induced quantum transitions

    NASA Astrophysics Data System (ADS)

    Landry, A.; Paranjape, M. B.

    2016-06-01

    In this paper, we calculate the probability for resonantly inducing transitions in quantum states due to time-dependent gravitational perturbations. Contrary to common wisdom, the probability of inducing transitions is not infinitesimally small. We consider a system of ultracold neutrons, which are organized according to the energy levels of the Schrödinger equation in the presence of the Earth's gravitational field. Transitions between energy levels are induced by an oscillating driving force of frequency ω . The driving force is created by oscillating a macroscopic mass in the neighborhood of the system of neutrons. The neutron lifetime is approximately 880 sec while the probability of transitions increases as t2. Hence, the optimal strategy is to drive the system for two lifetimes. The transition amplitude then is of the order of 1.06 ×10-5, and hence with a million ultracold neutrons, one should be able to observe transitions.

  13. The multi-xenobiotic resistance (MXR) efflux activity in hemocytes of Mytilus edulis is mediated by an ATP binding cassette transporter of class C (ABCC) principally inducible in eosinophilic granulocytes.

    PubMed

    Rioult, Damien; Pasquier, Jennifer; Boulangé-Lecomte, Céline; Poret, Agnès; Abbas, Imane; Marin, Matthieu; Minier, Christophe; Le Foll, Frank

    2014-08-01

    In marine and estuarine species, immunotoxic and/or immunomodulatory mechanisms are the crossroad of interactions between xenobiotics, microorganisms and physicochemical variations of the environment. In mussels, immunity relies exclusively on innate responses carried out by cells collectively called hemocytes and found in the open hemolymphatic circulatory system of these organisms. However, hemocytes do not form a homogenous population of immune cells since distinct subtypes of mussel blood cells can be distinguished by cytochemistry, flow cytometry or cell motility analysis. Previous studies have also shown that these cells are able to efflux xenobiotics by means of ATP binding cassette (ABC) transporter activities conferring a multixenobiotic resistance (MXR) phenotype. ABC transporters corresponding to vertebrate class B/P-glycoprotein (P-gp) and to class C/multidrug resistance related protein (MRP) are characterized in Mytilidae. Herein, we have investigated the relative contributions of ABCB- and ABCC-mediated efflux within the different hemocyte subpopulations of Mytilus edulis mussels, collected from areas differentially impacted by chemical contaminants in Normandy (France). RT-PCR analyses provide evidence for the presence of ABCB and ABCC transporters transcripts in hemocytes. Immunodetection of ABCB/P-gp with the monoclonal antibody UIC2 in living hemocytes revealed that expression was restricted to granular structures of spread cells. Efflux transporter activities, with calcein-AM as fluorescent probe, were measured by combining flow cytometry to accurate Coulter cell size measurements in order to get a cell-volume normalized fluorescence concentration. In these conditions, basal fluorescence levels were higher in hemocytes originating from Yport (control site) than in cells collected from the harbor of Le Havre, where mussels are more exposed to with persistent pollutants. By using specific ABCB/P-gp (verapamil, PSC833, zosuquidar) and ABCC/MRP (MK

  14. Exercise-induced rhabdomyolysis.

    PubMed

    Hutton, Joseph; Wellington, Daniel; Miller, Steven

    2016-01-01

    We report the case of a 34 year-old man who developed exercise-induced rhabdomyolysis after unaccustomed high-intensity exercise. Subclinical rhabdomyolysis is common after heavy exercise, yet it is uncommon for patients to seek medical advice. The presentation is variable and despite potentially life-threatening complications the diagnosis may be easily missed by patients and healthcare professionals. A high-index of suspicion is critical to avoid missing the diagnosis. We summarise the current knowledge, clinical course, complications and management of exercise-induced rhabdomyolysis. PMID:27657164

  15. Food-induced anaphylaxis.

    PubMed

    Cianferoni, Antonella; Muraro, Antonella

    2012-02-01

    Food-induced anaphylaxis (FIA) is a serious allergic reaction that may cause death rapidly in otherwise healthy individuals. There is no universal agreement on its definition or criteria for diagnosis. Hospital admissions for FIA have more than doubled in the last decade. Food is one of the most common causes of anaphylaxis, with most surveys indicating that food-induced reactions account for 30% to 50% of cases. The most commonly implicated foods are peanut, tree nuts, milk, eggs, sesame seeds, fish, and shellfish. The only life-saving treatment for anaphylaxis is allergen avoidance, and epinephrine injection if an anaphylactic event occurs.

  16. Benzocaine-induced methemoglobinemia.

    PubMed

    Gupta, P M; Lala, D S; Arsura, E L

    2000-01-01

    Methemoglobinemia is an uncommon but important complication associated with the use of topical anesthetics. We describe four cases of methemoglobinemia induced by topical benzocaine use. We review pathophysiology, early diagnosis, and therapy for this reversible yet potentially fatal condition. Physicians who use procedures involving the application of topical anesthetics need to be aware of this side effect to prevent significant morbidity and mortality.

  17. Radiation-induced pneumothorax

    SciTech Connect

    Epstein, D.M.; Littman, P.; Gefter, W.B.; Miller, W.T.; Raney, R.B. Jr.

    1983-01-01

    Pneumothorax is an uncommon complication of radiation therapy to the chest. The proposed pathogenesis is radiation-induced fibrosis promoting subpleural bleb formation that ruptures resulting in pneumothorax. We report on two young patients with primary sarcomas without pulmonary metastases who developed spontaneous pneumothorax after irradiation. Neither patient had antecedent radiographic evidence of pulmonary fibrosis.

  18. Cocaine induced hippocampi infarction

    PubMed Central

    Morales Vidal, Sarkis Gibran; Hornik, Alejandro; Morgan, Christopher

    2012-01-01

    A middle age man presented with disorientation and memory impairment due to bilateral hippocampal strokes secondary to cocaine use. This is the second report of cocaine induced hippocampi ischaemic strokes. In contrast to the previous report, this middle age man did not have cardiac arrest. PMID:22761214

  19. Statin-induced Myopathy.

    PubMed

    Fitzgerald, Kara; Redmond, Elizabeth; Harbor, Cathryn

    2012-05-01

    Heart disease (HD) is the number one killer in the United States.(1) In 2006, the direct and indirect costs associated with cardiovascular disease in the United States were estimated at 400 billion dollars.(2) Statin therapy for cholesterol reduction is a mainstay intervention for cardiovascular disease (CVD) as reflected in atorvastatin's status as the number one prescribed medication in the United States.(3) Statin therapy, however, is also associated with side effects that signal mitochondrial distress. A commonly reported statin-induced symptom is myalgia, which is defined as muscle pain without an associated elevation of serum creatine kinase (CK). In clinical trials, the reports of myalgia vary from less than 1% to 25% of patients.(4) Myopathy is a general term defined as an abnormal condition or disease of muscle tissue. Myopathy includes myalgia, myositis (inflammation of muscle tissue associated with elevated CK) and the very serious condition rhabdomyolysis (extreme myositis). Histological findings in statin-induced myopathy demonstrate electron chain dysfunction making "mitochondrial myopathy" the more precise term.(5) Mitochondrial myopathy has been associated with statin-induced CoQ10 depletion.(5) Given the density of mitochondria in cardiomyocytes, and CoQ10's role in mitochondrial energy production, depletion has long been associated with increased risk for heart disease.(6-7) In the case below, mitochondrial-specific organic acids, serum CoQ10, vitamin D and clinical history all suggest statin-induced mitochondrial myopathy, despite normal serum CK.

  20. Does formaldehyde induce aneuploidy?

    PubMed

    Speit, Günter; Kühner, Stefanie; Linsenmeyer, Regina; Schütz, Petra

    2011-11-01

    Formaldehyde (FA) was tested for a potential aneugenic activity in mammalian cells. We employed tests to discriminate between aneugenic and clastogenic effects in accordance with international guidelines for genotoxicity testing. The cytokinesis-block micronucleus test (CBMNT) in combination with fluorescence in situ hybridisation (FISH) with a pan-centromeric probe was performed with cultured human lymphocytes and the human A549 lung cell line. FA induced micronuclei (MN) in binuclear cells of both cell types under standard in vitro test conditions following the OECD guideline 487. FISH analysis revealed that the vast majority of induced MN were centromere negative, thus indicating a clastogenic effect. A similar result was obtained for MN induced by γ-irradiation, whereas the typical aneugens colcemid (COL) and vincristine (VCR) predominantly induced centromere-positive MN. Furthermore, COL and VCR clearly enhanced the MN frequency in mononuclear lymphocytes in the CBMNT, whereas such an effect was not observed for γ-irradiation and FA. In experiments with the Chinese hamster V79 cell line, the aneugens COL and VCR clearly increased the frequency of tetraploid second division metaphases, whereas FA did not cause such an effect. Altogether, our results confirm the clastogenicity of FA in cultured mammalian cells but exclude a significant aneugenic activity. PMID:21804075

  1. Drug-induced hyperkalemia.

    PubMed

    Ben Salem, Chaker; Badreddine, Atef; Fathallah, Neila; Slim, Raoudha; Hmouda, Houssem

    2014-09-01

    Hyperkalemia is a common clinical condition that can be defined as a serum potassium concentration exceeding 5.0 mmol/L. Drug-induced hyperkalemia is the most important cause of increased potassium levels in everyday clinical practice. Drug-induced hyperkalemia may be asymptomatic. However, it may be dramatic and life threatening, posing diagnostic and management problems. A wide range of drugs can cause hyperkalemia by a variety of mechanisms. Drugs can interfere with potassium homoeostasis either by promoting transcellular potassium shift or by impairing renal potassium excretion. Drugs may also increase potassium supply. The reduction in renal potassium excretion due to inhibition of the renin-angiotensin-aldosterone system represents the most important mechanism by which drugs are known to cause hyperkalemia. Medications that alter transmembrane potassium movement include amino acids, beta-blockers, calcium channel blockers, suxamethonium, and mannitol. Drugs that impair renal potassium excretion are mainly represented by angiotensin-converting enzyme inhibitors, angiotensin-II receptor blockers, direct renin inhibitors, nonsteroidal anti-inflammatory drugs, calcineurin inhibitors, heparin and derivatives, aldosterone antagonists, potassium-sparing diuretics, trimethoprim, and pentamidine. Potassium-containing agents represent another group of medications causing hyperkalemia. Increased awareness of drugs that can induce hyperkalemia, and monitoring and prevention are key elements for reducing the number of hospital admissions, morbidity, and mortality related to drug-induced hyperkalemia.

  2. Bacteriocin Inducer Peptides

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Novel peptides produced by bacteriocin-producing bacteria stimulate the production of bacteriocins in vitro. The producer bacteria are cultured in the presence of a novel inducer bacteria and a peptide having a carboxy terminal sequence of VKGLT in order to achieve an increase in bacteriocin produc...

  3. Heparin-induced thrombocytopenia.

    PubMed

    2013-05-01

    Patients can develop thrombocytopenia during heparin therapy.The most frequent form, type I heparin-induced thrombocytopenia, does not require cessation of therapy. Type II heparin-induced thrombocytopenia is immune-mediated. It can cause venous or arterial thrombosis, which may be fatal or require amputation. Type II thrombocytopenia typically develops 5 to 10 days after initiation of treatment, sometimes earlier in patients previously exposed to heparins. The recommendations on platelet-count monitoring during heparin therapy are not based on high-level evidence. The main risk factors for type II thrombocytopenia must be taken into account: unfractionated heparin, previous heparin exposure, surgery, female patient. For patients considered at high risk for heparin-induced thrombocytopenia, platelet-count monitoring is usually recommended at least twice a week for at least 2 weeks. The treatment of immune-mediated heparin-induced thrombocytopenia is based on stopping heparin and replacing it with danaparoid or argatroban. In practice, the decision to initiate treatment with unfractionated or low-molecular-weight heparin is not a trivial one. In addition to the bleeding risk, the risk of type II thrombocytopenia in the short- term, or during subsequent heparin therapy, should be taken into account when assessing the harm-benefit balance. PMID:23819174

  4. Injection-induced earthquakes

    USGS Publications Warehouse

    Ellsworth, William L.

    2013-01-01

    Earthquakes in unusual locations have become an important topic of discussion in both North America and Europe, owing to the concern that industrial activity could cause damaging earthquakes. It has long been understood that earthquakes can be induced by impoundment of reservoirs, surface and underground mining, withdrawal of fluids and gas from the subsurface, and injection of fluids into underground formations. Injection-induced earthquakes have, in particular, become a focus of discussion as the application of hydraulic fracturing to tight shale formations is enabling the production of oil and gas from previously unproductive formations. Earthquakes can be induced as part of the process to stimulate the production from tight shale formations, or by disposal of wastewater associated with stimulation and production. Here, I review recent seismic activity that may be associated with industrial activity, with a focus on the disposal of wastewater by injection in deep wells; assess the scientific understanding of induced earthquakes; and discuss the key scientific challenges to be met for assessing this hazard.

  5. Shrouded inducer pump

    DOEpatents

    Meng, Sen Y.

    1989-01-01

    An improvement in a pump including a shrouded inducer, the improvement comprising first and second sealing means 32,36 which cooperate with a first vortex cell 38 and a series of secondary vortex cells 40 to remove any tangential velocity components from the recirculation flow.

  6. Methacholine induced headache.

    PubMed Central

    Carratala, C.; Gea, J. G.; Aguar, M. C.; Grau, S.; Espadaler-Medina, J. M.; Broquetas, J. M.

    1995-01-01

    A lung function technician developed episodes of headache, probably related to the use of methacholine. The headache disappeared with breathing 100% oxygen. Cholinergic agents are known to induce headaches but the mechanism remains unclear. Vascular factors could be implicated. PMID:7660351

  7. Methacholine induced headache.

    PubMed

    Carratala, C; Gea, J G; Aguar, M C; Grau, S; Espadaler-Medina, J M; Broquetas, J M

    1995-03-01

    A lung function technician developed episodes of headache, probably related to the use of methacholine. The headache disappeared with breathing 100% oxygen. Cholinergic agents are known to induce headaches but the mechanism remains unclear. Vascular factors could be implicated. PMID:7660351

  8. Induced Angular Momentum

    ERIC Educational Resources Information Center

    Parker, G. W.

    1978-01-01

    Discusses, classically and quantum mechanically, the angular momentum induced in the bound motion of an electron by an external magnetic field. Calculates the current density and its magnetic moment, and then uses two methods to solve the first-order perturbation theory equation for the required eigenfunction. (Author/GA)

  9. Geomagnetism and Induced Voltage

    ERIC Educational Resources Information Center

    Abdul-Razzaq, W.; Biller, R. D.

    2010-01-01

    Introductory physics laboratories have seen an influx of "conceptual integrated science" over time in their classrooms with elements of other sciences such as chemistry, biology, Earth science, and astronomy. We describe a laboratory to introduce this development, as it attracts attention to the voltage induced in the human brain as it is…

  10. PAH- and PCB-induced Alterations of Protein Tyrosine Kinase and Cytokine Gene Transcription in Harbor Seal (Phoca Vitulina) PBMC

    PubMed Central

    Neale, Jennifer C. C.; Kenny, Thomas P.; Tjeerdema, Ronald S.; Gershwin, M. Eric

    2005-01-01

    Mechanisms underlying in vitro immunomodulatory effects of polycyclic aromatic hydrocarbons (PAHs) and polychlorinated biphenyls (PCBs) were investigated in harbor seal peripheral leukocytes, via real-time PCR. We examined the relative genetic expression of the protein tyrosine kinases (PTKs) Fyn and Itk, which play a critical role in T cell activation, and IL-2, a cytokine of central importance in initiating adaptive immune responses. IL-1, the macrophage-derived pro-inflammatory cytokine of innate immunity, was also included as a measure of macrophage function. Harbor seal PBMC were exposed to the prototypic immunotoxic PAH benzo[a]pyrene (BaP), 3,3',4,4',5,5'-hexachlorobiphenyl (CB-169), a model immunotoxic PCB, or DMSO (vehicle control). Exposure of Con A-stimulated harbor seal PBMC to both BaP and CB-169 produced significantly altered expression in all four targets relative to vehicle controls. The PTKs Fyn and Itk were both up-regulated following exposure to BaP and CB-169. In contrast, transcripts for IL-2 and IL-1 were decreased relative to controls by both treatments. Our findings are consistent with those of previous researchers working with human and rodent systems and support a hypothesis of contaminant-altered lymphocyte function mediated (at least in part) by disruption of T cell receptor (TCR) signaling and cytokine production. PMID:16050139

  11. Asthma induced by enkephalin.

    PubMed Central

    Leslie, R D; Bellamy, D; Pyke, D A

    1980-01-01

    A total of 291 diabetics were studied to see whether an asthmatic reaction was associated with facial flushing induced by chlorpropamide and alcohol. Of these patients, 191 reported facial flushing, of whom 12 reported breathlessness as well. Of these 12, five also described wheezing, and respiratory function tests showed them to have asthma. Three of these five patients underwent further tests, which showed that the asthmatic reaction could be prevented by giving disodium cromoglycate and the specific opiate antagonist naloxone. One patient developed wheezing when given an enkephalin analogue with opiate-like activity. Asthma induced by chlorpropamide and alcohol was concluded to be mediated by endogenous peptides with opiate-like activity such as enkephalin. PMID:7357255

  12. Tulipalin A induced phytotoxicity.

    PubMed

    McCluskey, James; Bourgeois, Marie; Harbison, Raymond

    2014-04-01

    Tulipalin A induced phytotoxicity is a persistent allergic contact dermatitides documented in floral workers exposed to Alstroemeria and its cultivars.[1] The causative allergen is tulipalin A, a toxic glycoside named for the tulip bulbs from which it was first isolated.[2] The condition is characterized by fissured acropulpitis, often accompanied by hyperpigmentation, onychorrhexis, and paronychia. More of the volar surface may be affected in sensitized florists. Dermatitis and paronychia are extremely common conditions and diagnostic errors may occur. A thorough patient history, in conjunction with confirmatory patch testing with a bulb sliver and tuliposide A exposure, can prevent misdiagnosis. We report a case of Tulipalin A induced phytotoxicity misdiagnosed as an unresolved tinea manuum infection in a patient evaluated for occupational exposure. PMID:25024947

  13. Sepsis-induced Cardiomyopathy

    PubMed Central

    Romero-Bermejo, Francisco J; Ruiz-Bailen, Manuel; Gil-Cebrian, Julián; Huertos-Ranchal, María J

    2011-01-01

    Myocardial dysfunction is one of the main predictors of poor outcome in septic patients, with mortality rates next to 70%. During the sepsis-induced myocardial dysfunction, both ventricles can dilate and diminish its ejection fraction, having less response to fluid resuscitation and catecholamines, but typically is assumed to be reversible within 7-10 days. In the last 30 years, It´s being subject of substantial research; however no explanation of its etiopathogenesis or effective treatment have been proved yet. The aim of this manuscript is to review on the most relevant aspects of the sepsis-induced myocardial dysfunction, discuss its clinical presentation, pathophysiology, etiopathogenesis, diagnostic tools and therapeutic strategies proposed in recent years. PMID:22758615

  14. Sunitinib Induced Immune Thrombocytopenia.

    PubMed

    Shekarriz, Ramin; Koulaeinejad, Neda; Nosrati, Anahita; Salehifa, Ebrahim

    2015-01-01

    Sunitinib is an oral tyrosine kinase inhibitor which prevents tumor growth and metastatic progression. It was approved for treatment of advanced renal cell cancer, gastrointestinal stromal tumor and advanced pancreatic neuroendocrine tumors. It has several adverse reactions on multi organ systems including hematologic system. Although the neutropenia and thrombocytopenia commonly happens as Grade 3 or 4 abnormalities following bone marrow suppression, in the rare cases, the immune mediated abnormality may drive the sunitinib-induced hematologic disorder. In this report, we present a case of immune-mediated thrombocytopenia induced by sunitinib. One month after first treatment cycle with sunitinib, leucopenia and thrombocytopenia were occurred. The patient had a normal bone marrow aspiration and biopsy, the thrombocytopenia was resistant to platelet transfusion which successfully was treated with prednisolone. PMID:26664400

  15. Sunitinib Induced Immune Thrombocytopenia

    PubMed Central

    Shekarriz, Ramin; Koulaeinejad, Neda; Nosrati, Anahita; Salehifa, Ebrahim

    2015-01-01

    Sunitinib is an oral tyrosine kinase inhibitor which prevents tumor growth and metastatic progression. It was approved for treatment of advanced renal cell cancer, gastrointestinal stromal tumor and advanced pancreatic neuroendocrine tumors. It has several adverse reactions on multi organ systems including hematologic system. Although the neutropenia and thrombocytopenia commonly happens as Grade 3 or 4 abnormalities following bone marrow suppression, in the rare cases, the immune mediated abnormality may drive the sunitinib-induced hematologic disorder. In this report, we present a case of immune-mediated thrombocytopenia induced by sunitinib. One month after first treatment cycle with sunitinib, leucopenia and thrombocytopenia were occurred. The patient had a normal bone marrow aspiration and biopsy, the thrombocytopenia was resistant to platelet transfusion which successfully was treated with prednisolone. PMID:26664400

  16. Polarization induced doped transistor

    DOEpatents

    Xing, Huili; Jena, Debdeep; Nomoto, Kazuki; Song, Bo; Zhu, Mingda; Hu, Zongyang

    2016-06-07

    A nitride-based field effect transistor (FET) comprises a compositionally graded and polarization induced doped p-layer underlying at least one gate contact and a compositionally graded and doped n-channel underlying a source contact. The n-channel is converted from the p-layer to the n-channel by ion implantation, a buffer underlies the doped p-layer and the n-channel, and a drain underlies the buffer.

  17. Radiation-induced schwannomas

    SciTech Connect

    Rubinstein, A.B.; Reichenthal, E.; Borohov, H.

    1989-06-01

    The histopathology and clinical course of three patients with schwannomas of the brain and high cervical cord after therapeutic irradiation for intracranial malignancy and for ringworm of the scalp are described. Earlier reports in the literature indicated that radiation of the scalp may induce tumors in the head and neck. It is therefore suggested that therapeutic irradiation in these instances was a causative factor in the genesis of these tumors.

  18. Levetiracetam-induced pancytopenia.

    PubMed

    Alzahrani, Talal; Kay, Dana; Alqahtani, Saeed A; Makke, Yamane; Lesky, Linda; Koubeissi, Mohamad Z

    2015-01-01

    Pancytopenia is a rare side effect of levetiracetam (LEV) that is associated with severe morbidity that requires hospitalization. Here, we report a patient with a right temporoparietal tumor who underwent a temporal craniotomy with resection of the mass and was started on LEV for seizure prophylaxis per the neurosurgery local protocol. The patient developed LEV-induced pancytopenia, which was successfully managed by discontinuation of this medication. Our report aims to increase awareness of this rare cause of pancytopenia among clinicians. PMID:26744695

  19. [Induced autotetraploid grape mutants].

    PubMed

    Kuliev, V M

    2011-01-01

    The methods of experimental mitotic and meiotic polyploidy in grapes are represented in the article. Results of cytological, histo-anatomical, biomorphological researches of induced autotetraploids are shown. Genetic characteristics, parameters of generative organs, quantitative and structural genome changes were studied. Comparative quantitative changes in the content of chloroplast and mitochondrion DNAs and RNAs in diploids and autotetraploids were defined. Also are shown. The biology-economic evaluation of autotetraploids on comparison with the initial grape variety is represented. PMID:21774401

  20. Ketamine-Induced Hallucinations

    PubMed Central

    Powers, A.R.; Gancsos, M.G.; Finn, E.S.; Morgan, P.T.; Corlett, P.R.

    2015-01-01

    Background Ketamine, the NMDA glutamate receptor antagonist drug, is increasingly employed as an experimental model of psychosis in healthy volunteers. At sub-anesthetic doses, it safely and reversibly causes delusion-like ideas, amotivation, and perceptual disruptions reminiscent of the aberrant salience experiences that characterize first-episode psychosis. However, auditory verbal hallucinations (AVHs), a hallmark symptom of schizophrenia, have not been reported consistently in healthy volunteers even at high doses of ketamine. Methods Here we present data from a set of healthy participants who received moderately dosed, placebo controlled ketamine infusions in the reduced stimulation environment of the magnetic resonance imaging scanner. We highlight the phenomenological experiences of three participants who experienced particularly vivid hallucinations. Results Participants in this series reported auditory verbal and musical hallucinations at a ketamine dose that does not induce auditory hallucination outside of the scanner. Discussion We interpret the observation of ketamine-induced AVHs in the context of the reduced perceptual environment of the magnetic resonance scanner, and offer an explanation grounded in predictive coding models of perception and psychosis: the brain fills in expected perceptual inputs and it does so more in situations of reduced perceptual input. The reduced perceptual input of the MRI scanner creates a mismatch between top-down perceptual expectations and the heightened bottom-up signals induced by ketamine; such circumstances induce aberrant percepts including musical and auditory verbal hallucinations. We suggest that these circumstances might represent a useful experimental model of AVHs and highlight the impact of ambient sensory stimuli on psychopathology. PMID:26361209

  1. Fluoroscopy-induced radionecrosis.

    PubMed

    Tchanque-Fossuo, Catherine N; Kamangar, Faranak; Ho, Baran; Chang, Shurong; Dahle, Sara E; Schulman, Joshua M; Isseroff, R Rivkah

    2016-01-01

    Complications from radiation exposure during fluoroscopic guidance of cardiac catheterization may occur. With repeated procedures, the risk for cutaneous injuries increases. Herein, we describe a 59-year-old man with extensive coronary artery disease, who had undergone multiple revascularization procedures and developed a non-healing ulcer on his left inferior scapula. The patient's medical history, physical exam findings, and histopathology gave clues to a case of radiation-induced dermatitis and necrosis. PMID:27617939

  2. Cefoperazone Induced Gastrointestinal Bleeding.

    PubMed

    Katukuri, Goutham Reddy; Maddala, Raja Naga Mahesh; Ramamoorthi, Kusugodlu; Hande, Manjunatha

    2016-08-01

    Cefoperazone is a beta-lactam antibiotic which is frequently used in treating a variety of gram positive and gram negative infections. The chemical structure of cefoperazone contains a side chain of N-methylthiotetrazole which can inhibit vitamin K metabolism resulting in hypoprothombinemia. We report a case of cefoperazone induced coagulopathy manifesting as gastrointestinal bleeding. A Naranjo assessment score of 5 was obtained, indicating a probable relationship between the patient's coagulation function disorder and her use of the suspect drug. PMID:27656491

  3. Desloratadine Induced Pill Esophagitis

    PubMed Central

    Alkim, Huseyin; Iscan, Mustafa

    2012-01-01

    Pill induced esophagitis is a rare complication mostly seen in patients using tetracycline and its derivatives or non-steroidal anti-inflammatory drugs. Here we present a 37 years old female patient experiencing pill esophagitis after taking desloratadine without liquid immediately before going to bed. This was the first pill esophagitis case related with desloratadine reported in the literature. Pill esophagitis is a preventable complication that consists of giving simple advice of how and when to take medication.

  4. Glycerol-induced hyperhydration

    NASA Technical Reports Server (NTRS)

    Riedesel, Marvin L.; Lyons, Timothy P.; Mcnamara, M. Colleen

    1991-01-01

    Maintenance of euhydration is essential for maximum work performance. Environments which induce hypohydration reduce plasma volume and cardiovascular performance progressively declines as does work capacity. Hyperhydration prior to exposure to dehydrating environments appears to be a potential countermeasure to the debilitating effects of hypohydration. The extravascular fluid space, being the largest fluid compartment in the body, is the most logical space by which significant hyperhydration can be accomplished. Volume and osmotic receptors in the vascular space result in physiological responses which counteract hyperhydration. Our hypothesis is that glycerol-induced hyperhydration (GIH) can accomplish extravascular fluid expansion because of the high solubility of glycerol in lipid and aqueous media. A hypertonic solution of glycerol is rapidly absorbed from the gastrointestinal tract, results in mild increases in plasma osmolality and is distributed to 65 percent of the body mass. A large volume of water ingested within minutes after glycerol intake results in increased total body water because of the osmotic action and distribution of glycerol. The resulting expanded extravascular fluid space can act as a reservoir to maintain plasma volume during exposure to dehydrating environments. The fluid shifts associated with exposure to microgravity result in increased urine production and is another example of an environment which induces hypohydration. Our goal is to demonstrate that GIH will facilitate maintenance of euhydration and cardiovascular performance during space flight and upon return to a 1 g environment.

  5. Allergen-induced asthma

    PubMed Central

    Cockcroft, Donald W

    2014-01-01

    It was only in the late 19th century that specific allergens, pollen, animal antigens and, later, house dust mite, were identified to cause upper and lower airway disease. Early allergen challenge studies, crudely monitored before measurement of forced expiratory volume in 1 s became widespread in the 1950s, focused on the immediate effects but noted in passing prolonged and/or recurrent asthma symptoms. The late asthmatic response, recurrent bronchoconstriction after spontaneous resolution of the early responses occurring 3 h to 8 h or more postchallenge, has been identified and well characterized over the past 50 years. The associated allergen-induced airway hyper-responsiveness (1977) and allergen-induced airway inflammation (1985) indicate that these late sequelae are important in the mechanism of allergen-induced asthma. Allergens are now recognized to be the most important cause of asthma. A standardized allergen inhalation challenge model has been developed and is proving to be a valuable research tool in the investigation of asthma pathophysiology and of potential new pharmacological agents for the treatment of asthma. PMID:24791256

  6. Ethanol-induced analgesia

    SciTech Connect

    Pohorecky, L.A.; Shah, P.

    1987-09-07

    The effect of ethanol (ET) on nociceptive sensitivity was evaluated using a new tail deflection response (TDR) method. The IP injection of ET (0.5 - 1.5 g/kg) produced raid dose-dependent analgesia. Near maximal effect (97% decrease in TDR) was produced with the 1.5 g/kg dose of ET ten minutes after injection. At ninety minutes post-injection there was still significant analgesia. Depression of ET-induced nociceptive sensitivity was partially reversed by a 1 mg/kg dose of naloxone. On the other hand, morphine (0.5 or 5.0 mg/kg IP) did not modify ET-induced analgesia, while 3.0 minutes of cold water swim (known to produce non-opioid mediated analgesia) potentiated ET-induced analgesic effect. The 0.5 g/kg dose of ET by itself did not depress motor activity in an open field test, but prevented partially the depression in motor activity produced by cold water swim (CWS). Thus, the potentiation by ET of the depression of the TDR produced by CWS cannot be ascribed to the depressant effects of ET on motor activity. 21 references, 4 figures, 1 table.

  7. Sepsis-induced myopathy

    PubMed Central

    Callahan, Leigh Ann; Supinski, Gerald S.

    2014-01-01

    Sepsis is a major cause of morbidity and mortality in critically ill patients, and despite advances in management, mortality remains high. In survivors, sepsis increases the risk for the development of persistent acquired weakness syndromes affecting both the respiratory muscles and the limb muscles. This acquired weakness results in prolonged duration of mechanical ventilation, difficulty weaning, functional impairment, exercise limitation, and poor health-related quality of life. Abundant evidence indicates that sepsis induces a myopathy characterized by reductions in muscle force-generating capacity, atrophy (loss of muscle mass), and altered bioenergetics. Sepsis elicits derangements at multiple subcellular sites involved in excitation contraction coupling, such as decreasing membrane excitability, injuring sarcolemmal membranes, altering calcium homeostasis due to effects on the sarcoplasmic reticulum, and disrupting contractile protein interactions. Muscle wasting occurs later and results from increased proteolytic degradation as well as decreased protein synthesis. In addition, sepsis produces marked abnormalities in muscle mitochondrial functional capacity and when severe, these alterations correlate with increased death. The mechanisms leading to sepsis-induced changes in skeletal muscle are linked to excessive localized elaboration of proinflammatory cytokines, marked increases in free-radical generation, and activation of proteolytic pathways that are upstream of the proteasome including caspase and calpain. Emerging data suggest that targeted inhibition of these pathways may alter the evolution and progression of sepsis-induced myopathy and potentially reduce the occurrence of sepsis-mediated acquired weakness syndromes. PMID:20046121

  8. Baby universes with induced gravity.

    NASA Astrophysics Data System (ADS)

    Gao, Yihong; Gao, Hongbo

    1989-12-01

    Some quantum effects of baby universes with induced gravity are discussed. The authors prove that the interactions between the baby-parent universes are non-local, and argue that the induced low-energy cosmological constant is zero. This argument does not depend on the detail of the induced potential.

  9. 2,5-hexanedione-induced immunomodulatory effect in mice

    SciTech Connect

    Upreti, R.K.; Shanker, R.

    1987-06-01

    The immunotoxic potential of 2,5-hexanedione (2,5-Hxdn), the end metabolite of n-hexane/methyl n-butyl ketone, was evaluated in a mouse model involving multiple pathomorphological, hematological, and immunological assays. Young adult male Swiss albino mice were given either single or seven consecutive oral doses of 0.2 x LD/sub 50/ of 2.5-Hxdn. None of the treated mice exhibited any sign of hind limb weakness up to 1 week. On the eighth day, half the animals were sacrificed for initial pathomorphological studies of various organs and the other half were subjected to several immune function tests. The results revealed treatment-related reduction in cellularity of spleen, thymus, and mesentric lymph nodes and pathotoxicological changes. Further, immune function tests such as delayed-type hypersensitivity reaction, plaque-forming cell assay, phagocytosis by adherent peritoneal exudate cells, and resistance to endotoxin shock were considerably impaired. These results suggest that 2,5-Hxdn treatment causes profound impairment of immunity in mice even before the onset of peripheral neuropathy.

  10. DETECTION OF STACHYBOTRYS CHARTARUM USING rRNA, tri5, AND Β-TUBULIN PRIMERS AND DETERMINING THEIR RELATIVE COPY NUMBER BY REAL TIME PCR

    EPA Science Inventory

    This research utilizes the quantitative polymerase chain reaction (qPCR) to determine ribosomal copy number of fungal organisms found in unhealthy indoor environments. Knowing specific copy numbers will allow for greater accuracy in quantification when utilizing current pQCR tec...

  11. Study of cavitating inducer instabilities

    NASA Technical Reports Server (NTRS)

    Young, W. E.; Murphy, R.; Reddecliff, J. M.

    1972-01-01

    An analytic and experimental investigation into the causes and mechanisms of cavitating inducer instabilities was conducted. Hydrofoil cascade tests were performed, during which cavity sizes were measured. The measured data were used, along with inducer data and potential flow predictions, to refine an analysis for the prediction of inducer blade suction surface cavitation cavity volume. Cavity volume predictions were incorporated into a linearized system model, and instability predictions for an inducer water test loop were generated. Inducer tests were conducted and instability predictions correlated favorably with measured instability data.

  12. Radiation Induced Genomic Instability

    SciTech Connect

    Morgan, William F.

    2011-03-01

    Radiation induced genomic instability can be observed in the progeny of irradiated cells multiple generations after irradiation of parental cells. The phenotype is well established both in vivo (Morgan 2003) and in vitro (Morgan 2003), and may be critical in radiation carcinogenesis (Little 2000, Huang et al. 2003). Instability can be induced by both the deposition of energy in irradiated cells as well as by signals transmitted by irradiated (targeted) cells to non-irradiated (non-targeted) cells (Kadhim et al. 1992, Lorimore et al. 1998). Thus both targeted and non-targeted cells can pass on the legacy of radiation to their progeny. However the radiation induced events and cellular processes that respond to both targeted and non-targeted radiation effects that lead to the unstable phenotype remain elusive. The cell system we have used to study radiation induced genomic instability utilizes human hamster GM10115 cells. These cells have a single copy of human chromosome 4 in a background of hamster chromosomes. Instability is evaluated in the clonal progeny of irradiated cells and a clone is considered unstable if it contains three or more metaphase sub-populations involving unique rearrangements of the human chromosome (Marder and Morgan 1993). Many of these unstable clones have been maintained in culture for many years and have been extensively characterized. As initially described by Clutton et al., (Clutton et al. 1996) many of our unstable clones exhibit persistently elevated levels of reactive oxygen species (Limoli et al. 2003), which appear to be due dysfunctional mitochondria (Kim et al. 2006, Kim et al. 2006). Interestingly, but perhaps not surprisingly, our unstable clones do not demonstrate a “mutator phenotype” (Limoli et al. 1997), but they do continue to rearrange their genomes for many years. The limiting factor with this system is the target – the human chromosome. While some clones demonstrate amplification of this chromosome and thus lend

  13. -induced continental warming

    NASA Astrophysics Data System (ADS)

    Kamae, Youichi; Watanabe, Masahiro; Kimoto, Masahide; Shiogama, Hideo

    2014-11-01

    In this the second of a two-part study, we examine the physical mechanisms responsible for the increasing contrast of the land-sea surface air temperature (SAT) in summertime over the Far East, as observed in recent decades and revealed in future climate projections obtained from a series of transient warming and sensitivity experiments conducted under the umbrella of the Coupled Model Intercomparison Project phase 5. On a global perspective, a strengthening of land-sea SAT contrast in the transient warming simulations of coupled atmosphere-ocean general circulation models is attributed to an increase in sea surface temperature (SST). However, in boreal summer, the strengthened contrast over the Far East is reproduced only by increasing atmospheric CO2 concentration. In response to SST increase alone, the tropospheric warming over the interior of the mid- to high-latitude continents including Eurasia are weaker than those over the surrounding oceans, leading to a weakening of the land-sea SAT contrast over the Far East. Thus, the increasing contrast and associated change in atmospheric circulation over East Asia is explained by CO2-induced continental warming. The degree of strengthening of the land-sea SAT contrast varies in different transient warming scenarios, but is reproduced through a combination of the CO2-induced positive and SST-induced negative contributions to the land-sea contrast. These results imply that changes of climate patterns over the land-ocean boundary regions are sensitive to future scenarios of CO2 concentration pathways including extreme cases.

  14. Cannabis induced asystole.

    PubMed

    Brancheau, Daniel; Blanco, Jessica; Gholkar, Gunjan; Patel, Brijesh; Machado, Christian

    2016-01-01

    Cannabis or marijuana is the most used recreational, and until recently illegal, drug in the United States. Although cannabis has medicinal use, its consumption has been linked to motor vehicle accidents in dose dependent fashion. Marijuana and other cannabinoids produce a multitude of effects on the human body that may result in these motor vehicle accidents. Some of the effects that marijuana has been known to cause include altered sensorium, diminished reflexes, and increased vagal tone. We present a case of cannabis induced asystole from hypervagotonia. PMID:26520167

  15. [Neuroleptic induced deficit syndrome].

    PubMed

    Szafrański, T

    1995-01-01

    Increasing interest in subjective aspects of therapy and rehabilitation focused the attention of psychiatrists, psychologists and psychopharmacologists on the mental side effects of neuroleptics. For the drug-related impairment of affective, cognitive and social function the name of neuroleptic-induced deficit syndrome (NIDS) is proposed. Patients with NIDS appear to be indifferent to the environmental stimuli, retarded and apathetic. They complain of feeling drugged and drowsy, weird, they suffer from lack of motivation, feel like "zombies". The paper presents description of NIDS and its differentiation from negative and depressive symptoms in schizophrenia and subjective perceiving of extrapyramidal syndromes.

  16. Fission induced plasmas

    NASA Technical Reports Server (NTRS)

    Harries, W. L.

    1977-01-01

    The possibility of creating a plasma from fission fragments was investigated, as well as the probability of utilizing the energy of these particles to create population inversion leading to laser action. Eventually, it is hoped that the same medium could be used for both fissioning and lasing, thus avoiding inefficiences in converting one form of energy to the other. A central problem in understanding a fission induced plasma is to obtain an accurate model of the electron behavior; some calculations are presented to this end. The calculations are simple, providing a compendium of processes for reference.

  17. Cannabis induced asystole.

    PubMed

    Brancheau, Daniel; Blanco, Jessica; Gholkar, Gunjan; Patel, Brijesh; Machado, Christian

    2016-01-01

    Cannabis or marijuana is the most used recreational, and until recently illegal, drug in the United States. Although cannabis has medicinal use, its consumption has been linked to motor vehicle accidents in dose dependent fashion. Marijuana and other cannabinoids produce a multitude of effects on the human body that may result in these motor vehicle accidents. Some of the effects that marijuana has been known to cause include altered sensorium, diminished reflexes, and increased vagal tone. We present a case of cannabis induced asystole from hypervagotonia.

  18. [Neuroleptic induced deficit syndrome].

    PubMed

    Szafrański, T

    1995-01-01

    Increasing interest in subjective aspects of therapy and rehabilitation focused the attention of psychiatrists, psychologists and psychopharmacologists on the mental side effects of neuroleptics. For the drug-related impairment of affective, cognitive and social function the name of neuroleptic-induced deficit syndrome (NIDS) is proposed. Patients with NIDS appear to be indifferent to the environmental stimuli, retarded and apathetic. They complain of feeling drugged and drowsy, weird, they suffer from lack of motivation, feel like "zombies". The paper presents description of NIDS and its differentiation from negative and depressive symptoms in schizophrenia and subjective perceiving of extrapyramidal syndromes. PMID:7652089

  19. Bupropion-induced somnambulism.

    PubMed

    Khazaal, Yasser; Krenz, Sonia; Zullino, Daniele Fabio

    2003-09-01

    Whereas there are some case reports of bupropion-induced vivid dreaming and nightmares, until now it has not been associated with somnambulism. A case is reported of a patient treated with bupropion as a smoking cessation medication, who developed somnambulism during nicotine withdrawal. Furthermore, the sleepwalking episodes were associated with eating behaviour. Amnesia was reported for all episodes. As, on one hand,bupropion is a noradrenergic and dopaminergic drug and nicotine withdrawal, on the other hand, is associated with alterations in monoaminergic functions, an interaction at the level of these neurotransmitters is suggested as the underlying mechanism. PMID:13129839

  20. [Minocycline-induced hyperpigmentation].

    PubMed

    Karrer, S; Szeimies, R M; Pfau, A; Schröder, J; Stolz, W; Landthaler, M

    1998-03-01

    A common adverse effect of minocycline therapy is cutaneous pigmentation. We describe two patients who presented with hyperpigmentation caused by minocycline. One patient, aged 54 years, had taken minocycline due to lung silicosis for 3 years before black pigmentation of the face occurred. The other 49 year-old patient developed grey-black hyperpigmentation on both lower legs after a 6-month therapy with minocycline for folliculitis. This patient was treated with the Q-switched ruby laser and the pigmentation resolved in the treated area. The different clinical and histological forms of minocycline-induced hyperpigmentation are discussed.

  1. Ifosfamide induced Fanconi syndrome

    PubMed Central

    Buttemer, Samantha; Pai, Mohan; Lau, Keith K

    2011-01-01

    Ifosfamide (IFA) is a powerful chemotherapeutic drug that is active against a variety of paediatric malignancies. However, renal toxicities such as haemorrhagic cystitis and Fanconi syndrome are major hazards that hinder its use in clinical practice. The authors present a case of a patient treated for Wilms’ tumour with IFA who developed rickets with Fanconi syndrome. Patients undergoing IFA treatment must be carefully monitored for the development of iatrogenic complications. Recent studies have improved our understanding of the underlying pathomechanism of IFA induced Fanconi syndrome, and selective renal protection against during chemotherapy with IFA may be possible soon. PMID:22669992

  2. Emotionally induced hyperhidrosis.

    PubMed

    Altman, Rachel S; Schwartz, Robert A

    2002-05-01

    Hyperhidrosis, a disorder that usually begins in childhood or adolescence, is defined as sweating in excess of what is required for normal thermoregulation. This condition may adversely affect one's quality of life by causing emotional disturbance and social embarrassment. Three forms of hyperhidrosis exist: emotionally induced, localized, and generalized. Hyperhidrosis may be either idiopathic or secondary to other diseases, metabolic disorders, febrile illnesses, or drugs. Diagnosis usually is made based on the patient's history and visible signs of excessive sweating. Various effective treatment options are available. PMID:12041810

  3. Demonstrating induced recharge

    SciTech Connect

    Caswell, B. )

    1990-03-01

    This paper describes an attempt by a New England community to explore for an aquifer that would yield 1 million gallons of ground water per day. After the discovery of a glacial sand and gravel aquifer, a demonstration of a hydraulic coupling between the aquifer and an adjacent stream was undertaken. This connection was needed to maintain recharge capacity of the well. The paper goes on to describe the techniques needed and used to determine the induced recharge caused by drawdown in these test wells.

  4. [Cannabinoid-induced hyperemesis].

    PubMed

    Lieb, Martin; Palm, Ulrich; Nicolaus, Mathias; Reibke, Roland; Baghai, Thomas C

    2011-04-01

    In this case report, we describe a 29 year-old male patient with a history of chronic cannabis abuse presenting with recurrent vomiting, intense nausea and abdominal pain. Abstinence from cannabis resolved both vomiting and abdominal pain. We conclude that in case of chronic cannabis abuse, patients presenting with severe and chronic nausea, vomiting, accompanied by abdominal pain and compulsive behaviour (hot bathing), in the absence of other obvious causes, the diagnosis of cannabinoid-induced hyperemesis syndrome should be considered. PMID:21462097

  5. Antioxidant-Induced Stress

    PubMed Central

    Villanueva, Cleva; Kross, Robert D.

    2012-01-01

    Antioxidants are among the most popular health-protecting products, sold worldwide without prescription. Indeed, there are many reports showing the benefits of antioxidants but only a few questioning the possible harmful effects of these “drugs”. The normal balance between antioxidants and free radicals in the body is offset when either of these forces prevails. The available evidence on the harmful effects of antioxidants is analyzed in this review. In summary, a hypothesis is presented that “antioxidant-induced stress” results when antioxidants overwhelm the body’s free radicals. PMID:22408440

  6. Method for inducing hypothermia

    DOEpatents

    Becker, Lance B.; Hoek, Terry Vanden; Kasza, Kenneth E.

    2003-04-15

    Systems for phase-change particulate slurry cooling equipment and methods to induce hypothermia in a patient through internal and external cooling are provided. Subcutaneous, intravascular, intraperitoneal, gastrointestinal, and lung methods of cooling are carried out using saline ice slurries or other phase-change slurries compatible with human tissue. Perfluorocarbon slurries or other slurry types compatible with human tissue are used for pulmonary cooling. And traditional external cooling methods are improved by utilizing phase-change slurry materials in cooling caps and torso blankets.

  7. Method for inducing hypothermia

    DOEpatents

    Becker, Lance B.; Hoek, Terry Vanden; Kasza, Kenneth E.

    2005-11-08

    Systems for phase-change particulate slurry cooling equipment and methods to induce hypothermia in a patient through internal and external cooling are provided. Subcutaneous, intravascular, intraperitoneal, gastrointestinal, and lung methods of cooling are carried out using saline ice slurries or other phase-change slurries compatible with human tissue. Perfluorocarbon slurries or other slurry types compatible with human tissue are used for pulmonary cooling. And traditional external cooling methods are improved by utilizing phase-change slurry materials in cooling caps and torso blankets.

  8. Method for inducing hypothermia

    DOEpatents

    Becker, Lance B.; Hoek, Terry Vanden; Kasza, Kenneth E.

    2008-09-09

    Systems for phase-change particulate slurry cooling equipment and methods to induce hypothermia in a patient through internal and external cooling are provided. Subcutaneous, intravascular, intraperitoneal, gastrointestinal, and lung methods of cooling are carried out using saline ice slurries or other phase-change slurries compatible with human tissue. Perfluorocarbon slurries or other slurry types compatible with human tissue are used for pulmonary cooling. And traditional external cooling methods are improved by utilizing phase-change slurry materials in cooling caps and torso blankets.

  9. Exercise-induced anaphylaxis.

    PubMed

    Shimizu, Taro; Tokuda, Yasuharu

    2012-01-01

    A 23-year-old man presented with acute flushing, pruritus and warmth followed by collapse after vigorous exercise in a gymnasium. After resting for 30 min and receiving a rapid infusion of 0.9% sodium chloride, he was finally stable. He admitted that he had a similar experience 5 years earlier during exercise. Based on the patient's history, his symptoms were attributed to exercise-induced anaphylaxis. None of his episodes was associated with any suspicious co-triggers of anaphylaxis. He was successfully discharged from hospital without any complications after receiving guidance on how to prevent this condition. PMID:22669856

  10. Exercise-induced anaphylaxis.

    PubMed

    Shimizu, Taro; Tokuda, Yasuharu

    2012-01-01

    A 23-year-old man presented with acute flushing, pruritus and warmth followed by collapse after vigorous exercise in a gymnasium. After resting for 30 min and receiving a rapid infusion of 0.9% sodium chloride, he was finally stable. He admitted that he had a similar experience 5 years earlier during exercise. Based on the patient's history, his symptoms were attributed to exercise-induced anaphylaxis. None of his episodes was associated with any suspicious co-triggers of anaphylaxis. He was successfully discharged from hospital without any complications after receiving guidance on how to prevent this condition.

  11. Cholesterol depletion induces autophagy

    SciTech Connect

    Cheng, Jinglei; Ohsaki, Yuki; Tauchi-Sato, Kumi; Fujita, Akikazu; Fujimoto, Toyoshi . E-mail: tfujimot@med.nagoya-u.ac.jp

    2006-12-08

    Autophagy is a mechanism to digest cells' own components, and its importance in many physiological and pathological processes is being recognized. But the molecular mechanism that regulates autophagy is not understood in detail. In the present study, we found that cholesterol depletion induces macroautophagy. The cellular cholesterol in human fibroblasts was depleted either acutely using 5 mM methyl-{beta}-cyclodextrin or 10-20 {mu}g/ml nystatin for 1 h, or metabolically by 20 {mu}M mevastatin and 200 {mu}M mevalonolactone along with 10% lipoprotein-deficient serum for 2-3 days. By any of these protocols, marked increase of LC3-II was detected by immunoblotting and by immunofluorescence microscopy, and the increase was more extensive than that caused by amino acid starvation, i.e., incubation in Hanks' solution for several hours. The induction of autophagic vacuoles by cholesterol depletion was also observed in other cell types, and the LC3-positive membranes were often seen as long tubules, >50 {mu}m in length. The increase of LC3-II by methyl-{beta}-cyclodextrin was suppressed by phosphatidylinositol 3-kinase inhibitors and was accompanied by dephosphorylation of mammalian target of rapamycin. By electron microscopy, autophagic vacuoles induced by cholesterol depletion were indistinguishable from those seen after amino acid starvation. These results demonstrate that a decrease in cholesterol activates autophagy by a phosphatidylinositol 3-kinase-dependent mechanism.

  12. Electromagnetically Induced Entanglement.

    PubMed

    Yang, Xihua; Xiao, Min

    2015-08-28

    Quantum entanglement provides an essential resource for quantum computation, quantum communication, and quantum network. How to conveniently and efficiently produce entanglement between bright light beams presents a challenging task to build realistic quantum information processing networks. Here, we present an efficient and convenient way to realize a novel quantum phenomenon, named electromagnetically induced entanglement, in the conventional Λ-type three-level atomic system driven by a strong pump field and a relatively weak probe field. Nearly perfect entanglement between the two fields can be achieved with a low coherence decay rate between the two lower levels, high pump-field intensity, and large optical depth of the atomic ensemble. The physical origin is quantum coherence between the lower doublet produced by the pump and probe fields, similar to the well-known electromagnetically induced transparency. This method would greatly facilitate the generation of nondegenerate narrow-band continuous-variable entanglement between bright light beams by using only coherent laser fields, and may find potential and broad applications in realistic quantum information processing.

  13. INTERFERON INDUCED THYROIDITIS

    PubMed Central

    Tomer, Yaron

    2009-01-01

    Autoimmune thyroid diseases (AITD) are complex diseases that develop as a result of interactions between genetic, epigenetic, and environmental factors. Significant progress has been made in our understanding of the genetic and environmental triggers contributing to AITD. The major environmental triggers of AITD include iodine, smoking, medications, pregnancy, and possibly stress. In this review we will focus on two well-documented environmental triggers of AITD, hepatitis C virus (HCV) infection and interferon alpha (IFNa) therapy. Chronic HCV infection has been shown to be associated with increased incidence of clinical and subclinical autoimmune thyroiditis (i.e. the presence of thyroid antibodies in euthyroid subjects). Moreover, IFNa therapy of chronic HCV infection is associated with subclinical or clinical thyroiditis in up to 40% of cases which can be autoimmune, or non-autoimmune thyroiditis. In some cases interferon induced thyroiditis (IIT) in chronic HCV patients may result in severe symptomatology necessitating discontinuation of therapy. While the epidemiology and clinical presentation of HCV and interferon induced thyroiditis have been well characterized, the mechanisms causing these conditions are still poorly understood. PMID:20022216

  14. Inducible fluorescent speckle microscopy.

    PubMed

    Pereira, António J; Aguiar, Paulo; Belsley, Michael; Maiato, Helder

    2016-01-18

    The understanding of cytoskeleton dynamics has benefited from the capacity to generate fluorescent fiducial marks on cytoskeleton components. Here we show that light-induced imprinting of three-dimensional (3D) fluorescent speckles significantly improves speckle signal and contrast relative to classic (random) fluorescent speckle microscopy. We predict theoretically that speckle imprinting using photobleaching is optimal when the laser energy and fluorophore responsivity are related by the golden ratio. This relation, which we confirm experimentally, translates into a 40% remaining signal after speckle imprinting and provides a rule of thumb in selecting the laser power required to optimally prepare the sample for imaging. This inducible speckle imaging (ISI) technique allows 3D speckle microscopy to be performed in readily available libraries of cell lines or primary tissues expressing fluorescent proteins and does not preclude conventional imaging before speckle imaging. As a proof of concept, we use ISI to measure metaphase spindle microtubule poleward flux in primary cells and explore a scaling relation connecting microtubule flux to metaphase duration. PMID:26783303

  15. [Drug-induced laryngospasm].

    PubMed

    Nishikawa, T; Munakata, K

    1997-02-01

    We report a case of drug-induced laryngospasm due to Chlorpromazine. A drug-induced laryngospasm has not been previously reported in the literature. A 70-year-old male with the proximal end fracture of the femur was scheduled for the operative fixation. He had a past history of alcoholism and had underwent a long-term chlorpromazine therapy for 45 years until admission to our hospital. There have been a few reports on unexplained sudden deaths of patients receiving long-term treatment with chlorpromazine. Caution was therefore needed in general anesthesia, which was thought to be safer than epidural or spinal anesthesia in this case. Accordingly for the preparation of an emergency operation, the central venous catheterization via the internal jugular vein was performed under subcutaneous injection of lidocaine. Severe dyspnea and cyanosis occurred a few minutes after the administration of lidocaine. The specific diagnosis of laryngospasm was made by inspection of the vocal cords. Immediate oral intubation was performed and no complications ensued during and after the operation. This episode strongly suggests that one reason of the unexplained sudden deaths of patients receiving long term treatment with chlorpromazine could be laryngospasm. In conclusion, anesthesiologists should be aware of the possibility of laryngospasm under similar conditions.

  16. Video game induced seizures.

    PubMed

    Ferrie, C D; De Marco, P; Grünewald, R A; Giannakodimos, S; Panayiotopoulos, C P

    1994-08-01

    Fifteen patients who experienced epileptic seizures while playing video games are described together with a review of 20 cases in the English literature. Nine of the 15 cases and all but two of the reported cases experienced their first seizure while playing video games. Two thirds of patients had idiopathic generalised epilepsy and mainly reported generalised tonic clonic seizures, but some had typical absence seizures and myoclonic jerks while playing video games. In this series, 30% with idiopathic generalised epilepsy had juvenile myoclonic epilepsy. Overall, 70% of patients with idiopathic generalised epilepsy were photosensitive to intermittent photic stimulation and the mechanism of seizure provocation was probably similar to that of television induced seizures, although sensitivity to specific patterns was sometimes important. Two children had self induced video game seizures. Non-photic factors such as excitement, fatigue, sleep deprivation, cognitive processing, and diurnal variation in susceptibility seemed to be important seizure precipitants, particularly in non-photo-sensitive patients. Twenty nine per cent of patients had partial (mainly occipital) video game associated seizures. Occipital spikes were common in the EEG of these patients. Photosensitivity to intermittent photic stimulation may have been important in two patients but in the others, who all played arcade video games, other mechanisms need to be considered. Video game associated seizures are a feature of several epileptic syndromes and differ in precipitants and appropriate management.

  17. [Drug-induced laryngospasm].

    PubMed

    Nishikawa, T; Munakata, K

    1997-02-01

    We report a case of drug-induced laryngospasm due to Chlorpromazine. A drug-induced laryngospasm has not been previously reported in the literature. A 70-year-old male with the proximal end fracture of the femur was scheduled for the operative fixation. He had a past history of alcoholism and had underwent a long-term chlorpromazine therapy for 45 years until admission to our hospital. There have been a few reports on unexplained sudden deaths of patients receiving long-term treatment with chlorpromazine. Caution was therefore needed in general anesthesia, which was thought to be safer than epidural or spinal anesthesia in this case. Accordingly for the preparation of an emergency operation, the central venous catheterization via the internal jugular vein was performed under subcutaneous injection of lidocaine. Severe dyspnea and cyanosis occurred a few minutes after the administration of lidocaine. The specific diagnosis of laryngospasm was made by inspection of the vocal cords. Immediate oral intubation was performed and no complications ensued during and after the operation. This episode strongly suggests that one reason of the unexplained sudden deaths of patients receiving long term treatment with chlorpromazine could be laryngospasm. In conclusion, anesthesiologists should be aware of the possibility of laryngospasm under similar conditions. PMID:9071116

  18. Drug-induced lupus.

    PubMed

    Rubin, Robert L

    2005-04-15

    Autoantibodies and, less commonly, systemic rheumatic symptoms are associated with treatment with numerous medications and other types of ingested compounds. Distinct syndromes can be distinguished, based on clinical and laboratory features, as well as exposure history. Drug-induced lupus has been reported as a side-effect of long-term therapy with over 40 medications. Its clinical and laboratory features are similar to systemic lupus erythematosus, except that patients fully recover after the offending medication is discontinued. This syndrome differs from typical drug hypersensitivity reactions in that drug-specific T-cells or antibodies are not involved in induction of autoimmunity, it usually requires many months to years of drug exposure, is drug dose-dependent and generally does not result in immune sensitization to the drug. Circumstantial evidence strongly suggests that oxidative metabolites of the parent compound trigger autoimmunity. Several mechanisms for induction of autoimmunity will be discussed, including bystander activation of autoreactive lymphocytes due to drug-specific immunity or to non-specific activation of lymphocytes, direct cytotoxicity with release of autoantigens and disruption of central T-cell tolerance. The latter hypothesis will be supported by a mouse model in which a reactive metabolite of procainamide introduced into the thymus results in lupus-like autoantibody induction. These findings, as well as evidence for thymic function in drug-induced lupus patients, support the concept that abnormalities during T-cell selection in the thymus initiate autoimmunity.

  19. Inducible fluorescent speckle microscopy

    PubMed Central

    Aguiar, Paulo; Belsley, Michael; Maiato, Helder

    2016-01-01

    The understanding of cytoskeleton dynamics has benefited from the capacity to generate fluorescent fiducial marks on cytoskeleton components. Here we show that light-induced imprinting of three-dimensional (3D) fluorescent speckles significantly improves speckle signal and contrast relative to classic (random) fluorescent speckle microscopy. We predict theoretically that speckle imprinting using photobleaching is optimal when the laser energy and fluorophore responsivity are related by the golden ratio. This relation, which we confirm experimentally, translates into a 40% remaining signal after speckle imprinting and provides a rule of thumb in selecting the laser power required to optimally prepare the sample for imaging. This inducible speckle imaging (ISI) technique allows 3D speckle microscopy to be performed in readily available libraries of cell lines or primary tissues expressing fluorescent proteins and does not preclude conventional imaging before speckle imaging. As a proof of concept, we use ISI to measure metaphase spindle microtubule poleward flux in primary cells and explore a scaling relation connecting microtubule flux to metaphase duration. PMID:26783303

  20. Peripherally induced oromandibular dystonia

    PubMed Central

    Sankhla, C.; Lai, E.; Jankovic, J.

    1998-01-01

    OBJECTIVES—Oromandibular dystonia (OMD) is a focal dystonia manifested by involuntary muscle contractions producing repetitive, patterned mouth, jaw, and tongue movements. Dystonia is usually idiopathic (primary), but in some cases it follows peripheral injury. Peripherally induced cervical and limb dystonia is well recognised, and the aim of this study was to characterise peripherally induced OMD.
METHODS—The following inclusion criteria were used for peripherally induced OMD: (1) the onset of the dystonia was within a few days or months (up to 1 year) after the injury; (2) the trauma was well documented by the patient's history or a review of their medical and dental records; and (3) the onset of dystonia was anatomically related to the site of injury (facial and oral).
RESULTS—Twenty seven patients were identified in the database with OMD, temporally and anatomically related to prior injury or surgery. No additional precipitant other than trauma could be detected. None of the patients had any litigation pending. The mean age at onset was 50.11 (SD 14.15) (range 23-74) years and there was a 2:1 female preponderance. Mean latency between the initial trauma and the onset of OMD was 65 days (range 1 day-1 year). Ten (37%) patients had some evidence of predisposing factors such as family history of movement disorders, prior exposure to neuroleptic drugs, and associated dystonia affecting other regions or essential tremor. When compared with 21 patients with primary OMD, there was no difference for age at onset, female preponderance, and phenomenology. The frequency of dystonic writer's cramp, spasmodic dysphonia, bruxism, essential tremor, and family history of movement disorder, however, was lower in the post-traumatic group (p<0.05). In both groups the response to botulinum toxin treatment was superior to medical therapy (p<0.005). Surgical intervention for temporomandibular disorders was more frequent in the post-traumatic group and was associated with

  1. Induced Seismicity Monitoring System

    NASA Astrophysics Data System (ADS)

    Taylor, S. R.; Jarpe, S.; Harben, P.

    2014-12-01

    There are many seismological aspects associated with monitoring of permanent storage of carbon dioxide (CO2) in geologic formations. Many of these include monitoring underground gas migration through detailed tomographic studies of rock properties, integrity of the cap rock and micro seismicity with time. These types of studies require expensive deployments of surface and borehole sensors in the vicinity of the CO2 injection wells. Another problem that may exist in CO2 sequestration fields is the potential for damaging induced seismicity associated with fluid injection into the geologic reservoir. Seismic hazard monitoring in CO2 sequestration fields requires a seismic network over a spatially larger region possibly having stations in remote settings. Expensive observatory-grade seismic systems are not necessary for seismic hazard deployments or small-scale tomographic studies. Hazard monitoring requires accurate location of induced seismicity to magnitude levels only slightly less than that which can be felt at the surface (e.g. magnitude 1), and the frequencies of interest for tomographic analysis are ~1 Hz and greater. We have developed a seismo/acoustic smart sensor system that can achieve the goals necessary for induced seismicity monitoring in CO2 sequestration fields. The unit is inexpensive, lightweight, easy to deploy, can operate remotely under harsh conditions and features 9 channels of recording (currently 3C 4.5 Hz geophone, MEMS accelerometer and microphone). An on-board processor allows for satellite transmission of parameter data to a processing center. Continuous or event-detected data is kept on two removable flash SD cards of up to 64+ Gbytes each. If available, data can be transmitted via cell phone modem or picked up via site visits. Low-power consumption allows for autonomous operation using only a 10 watt solar panel and a gel-cell battery. The system has been successfully tested for long-term (> 6 months) remote operations over a wide range

  2. Drug-Induced Hematologic Syndromes

    PubMed Central

    Mintzer, David M.; Billet, Shira N.; Chmielewski, Lauren

    2009-01-01

    Objective. Drugs can induce almost the entire spectrum of hematologic disorders, affecting white cells, red cells, platelets, and the coagulation system. This paper aims to emphasize the broad range of drug-induced hematological syndromes and to highlight some of the newer drugs and syndromes. Methods. Medline literature on drug-induced hematologic syndromes was reviewed. Most reports and reviews focus on individual drugs or cytopenias. Results. Drug-induced syndromes include hemolytic anemias, methemoglobinemia, red cell aplasia, sideroblastic anemia, megaloblastic anemia, polycythemia, aplastic anemia, leukocytosis, neutropenia, eosinophilia, immune thrombocytopenia, microangiopathic syndromes, hypercoagulability, hypoprothrombinemia, circulating anticoagulants, myelodysplasia, and acute leukemia. Some of the classic drugs known to cause hematologic abnormalities have been replaced by newer drugs, including biologics, accompanied by their own syndromes and unintended side effects. Conclusions. Drugs can induce toxicities spanning many hematologic syndromes, mediated by a variety of mechanisms. Physicians need to be alert to the potential for iatrogenic drug-induced hematologic complications. PMID:19960059

  3. Induced seismicity. Final report

    SciTech Connect

    Segall, P.

    1997-09-18

    The objective of this project has been to develop a fundamental understanding of seismicity associated with energy production. Earthquakes are known to be associated with oil, gas, and geothermal energy production. The intent is to develop physical models that predict when seismicity is likely to occur, and to determine to what extent these earthquakes can be used to infer conditions within energy reservoirs. Early work focused on earthquakes induced by oil and gas extraction. Just completed research has addressed earthquakes within geothermal fields, such as The Geysers in northern California, as well as the interactions of dilatancy, friction, and shear heating, on the generation of earthquakes. The former has involved modeling thermo- and poro-elastic effects of geothermal production and water injection. Global Positioning System (GPS) receivers are used to measure deformation associated with geothermal activity, and these measurements along with seismic data are used to test and constrain thermo-mechanical models.

  4. Radiation-Induced Bioradicals

    NASA Astrophysics Data System (ADS)

    Lahorte, Philippe; Mondelaers, Wim

    This chapter represents the second part of a review in which the production and application of radiation-induced radicals in biological matter are discussed. In part one the general aspects of the four stages (physical, physicochemical, chemical and biological) of interaction of radiation with matter in general and biological matter in particular, were discussed. Here an overview is presented of modem technologies and theoretical methods available for studying these radiation effects. The relevance is highlighted of electron paramagnetic resonance spectroscopy and quantum chemical calculations with respect to obtaining structural information on bioradicals, and a survey is given of the research studies in this field. We also discuss some basic aspects of modem accelerator technologies which can be used for creating radicals and we conclude with an overview of applications of radiation processing in biology and related fields such as biomedical and environmental engineering, food technology, medicine and pharmacy.

  5. Disorder induces explosive synchronization.

    PubMed

    Skardal, Per Sebastian; Arenas, Alex

    2014-06-01

    We study explosive synchronization, a phenomenon characterized by first-order phase transitions between incoherent and synchronized states in networks of coupled oscillators. While explosive synchronization has been the subject of many recent studies, in each case strong conditions on the heterogeneity of the network, its link weights, or its initial construction are imposed to engineer a first-order phase transition. This raises the question of how robust explosive synchronization is in view of more realistic structural and dynamical properties. Here we show that explosive synchronization can be induced in mildly heterogeneous networks by the addition of quenched disorder to the oscillators' frequencies, demonstrating that it is not only robust to, but moreover promoted by, this natural mechanism. We support these findings with numerical and analytical results, presenting simulations of a real neural network as well as a self-consistency theory used to study synthetic networks.

  6. Herbivore induced plant volatiles

    PubMed Central

    War, Abdul Rashid; Sharma, Hari Chand; Paulraj, Michael Gabriel; War, Mohd Yousf; Ignacimuthu, Savarimuthu

    2011-01-01

    Plants respond to herbivory through different defensive mechanisms. The induction of volatile emission is one of the important and immediate response of plants to herbivory. Herbivore-induced plant volatiles (HIPVs) are involved in plant communication with natural enemies of the insect herbivores, neighboring plants, and different parts of the damaged plant. Release of a wide variety of HIPVs in response to herbivore damage and their role in plant-plant, plant-carnivore and intraplant communications represents a new facet of the complex interactions among different trophic levels. HIPVs are released from leaves, flowers, and fruits into the atmosphere or into the soil from roots in response to herbivore attack. Moreover, HIPVs act as feeding and/or oviposition deterrents to insect pests. HIPVs also mediate the interactions between the plants and the microorganisms. This review presents an overview of HIPVs emitted by plants, their role in plant defense against herbivores and their implications for pest management. PMID:22105032

  7. Multiphoton electromagnetically induced transparency

    NASA Astrophysics Data System (ADS)

    Wen, Lingling; Kang, Hoonsoo; Zhu, Yifu; Wu, Ying

    2003-05-01

    We show that in multi-level atomic systems coupled by multiple laser fields, all linear and nonlinear absorptions may be completely suppressed, leading to the multiphoton electromagnetically induced transparency (EIT). Under suitable conditions, multiphoton EIT may be used to realize selective steady-state population inversion in coherently pumped atomic systems and achieve efficient nonlinear light generation at low light intensities. As examples, we will present studies of multiphoton EIT in five-level and six-level atomic systems, which demonstrate steady-state population inversion from selective nonlinear excitation. We will also present studies of resonant hyper-Raman and four-wave mixing processes that are enhanced via suppression of the lower-order linear and nonlinear absorptions, and are capable of generating short-wavelength, coherent light at low pump intensities.

  8. Laser-induced bioluminescence

    SciTech Connect

    Hickman, G.D.; Lynch, R.V. III

    1981-01-01

    A project has been initiated to determine the feasibility of developing a complete airborne remote sensing system for rapidly mapping high concentration patches of bioluminescent organisms in the world's oceans. Conceptually, this system would be composed of a laser illuminator to induce bioluminescence and a low light level image intensifier for detection of light. Initial laboratory measurements consisted of using a 2-J flash lamp pulsed optical dye laser to excite bioluminescence in the marine dinoflagellate Pyrocustis lunula at ambient temperature using Rhodamine 6G as the lasing dye (585 nm) and a laser pulse width of 1 microsec. After a latency period of 15-20 msec, the bioluminescence maximum occurred in the blue (480 nm is the wavelength maximum for most dinoflagellate bioluminescence) with the peaking occurring approximately 65 msec after the laser pulse. Planned experiments will investigate the effect of different excitation wavelengths and energies at various temperatures and salinities of the cultures.

  9. Heparin induced thrombocytopenia: review.

    PubMed

    Dasararaju, Radhika; Singh, Nirupama; Mehta, Amitkumar

    2013-08-01

    Heparin induced thrombocytopenia (HIT) is a serious, potentially life and limb threatening immune adverse reaction to heparin. IgG antibodies against platelet factor 4 and heparin multimer complexes activate platelets to create a prothrombotic state. ELISA based immunoassay to detect these antibodies is sensitive while serotonin release assay is highly specific but is not widely available. 4T score is a simple score to calculate pre-test probability of HIT. Score < 3 is highly specific to exclude the diagnosis. Alternate anticoagulants like lepirudin, argatroban or danaparoid are recommended in therapeutic dose to treat or prevent thrombotic events in HIT. Increased awareness of this condition among clinicians is important to ensure its early recognition and treatment to avoid serious complications. PMID:23991928

  10. Gadolinium-Induced Fibrosis.

    PubMed

    Todd, Derrick J; Kay, Jonathan

    2016-01-01

    Gadolinium-based contrast agents (GBCAs), once believed to be safe for patients with renal disease, have been strongly associated with nephrogenic systemic fibrosis (NSF), a severe systemic fibrosing disorder that predominantly afflicts individuals with advanced renal dysfunction. We provide a historical perspective on the appearance and disappearance of NSF, including its initial recognition as a discrete clinical entity, its association with GBCA exposure, and the data supporting a causative relationship between GBCA exposure and NSF. On the basis of this body of evidence, we propose that the name gadolinium-induced fibrosis (GIF) more accurately reflects the totality of knowledge regarding this disease. Use of high-risk GBCAs, such as formulated gadodiamide, should be avoided in patients with renal disease. Restriction of GBCA use in this population has almost completely eradicated new cases of this debilitating condition. Emerging antifibrotic therapies may be useful for patients who suffer from GIF.

  11. Discreteness induced extinction

    NASA Astrophysics Data System (ADS)

    dos Santos, Renato Vieira; da Silva, Linaena Méricy

    2015-11-01

    Two simple models based on ecological problems are discussed from the point of view of non-equilibrium statistical mechanics. It is shown how discrepant may be the results of the models that include spatial distribution with discrete interactions when compared with the continuous analogous models. In the continuous case we have, under certain circumstances, the population explosion. When we take into account the finiteness of the population, we get the opposite result, extinction. We will analyze how these results depend on the dimension d of the space and describe the phenomenon of the "Discreteness Inducing Extinction" (DIE). The results are interpreted in the context of the "paradox of sex", an old problem of evolutionary biology.

  12. Vincristine induced cranial polyneuropathy.

    PubMed

    Bay, Ali; Yilmaz, Cahide; Yilmaz, Nebi; Oner, Ahmet Faik

    2006-06-01

    We describe a 5-year-old girl showed recovery of vincristine induced cranial polyneuropathy with pyridoxine and pyridostigmine treatment. A 5-year-old girl was diagnosed preB cell Acute Lymphoblastic Leukemia (ALL). She received chemotherapy according to the previously described modified St. Jude total therapy studies XIII. Five days after the fourth dose of vincristine, she presented with bilateral ptosis. Neurological examination revealed bilateral ptosis, and complete external opthalmoplegia with normal pupillary and corneal reflexes. She received 3.8 mg cumulative dose of vincristin before development of ptosis. A neuroprotective and neuroregenerative treatment attempt with pyridoxine and pyridostigmine was initiated. The bilateral ptosis markedly improved after 7 days of pyridoxine and pyridostigmine treatment and completely resolved after two weeks. The both agents were given for 3 weeks and were well tolerated without any side effects. During the follow up period we did not observe residue or recurrence of the ptosis.

  13. Laser induced nuclear reactions

    SciTech Connect

    Ledingham, Ken; McCanny, Tom; Graham, Paul; Fang Xiao; Singhal, Ravi; Magill, Joe; Creswell, Alan; Sanderson, David; Allott, Ric; Neely, David; Norreys, Peter; Santala, Marko; Zepf, Matthew; Watts, Ian; Clark, Eugene; Krushelnick, Karl; Tatarakis, Michael; Dangor, Bucker; Machecek, Antonin; Wark, Justin

    1998-12-16

    Dramatic improvements in laser technology since 1984 have revolutionised high power laser technology. Application of chirped-pulse amplification techniques has resulted in laser intensities in excess of 10{sup 19} W/cm{sup 2}. In the mid to late eighties, C. K. Rhodes and K. Boyer discussed the possibility of shining laser light of this intensity onto solid surfaces and to cause nuclear transitions. In particular, irradiation of a uranium target could induce electro- and photofission in the focal region of the laser. In this paper it is shown that {mu}Ci of {sup 62}Cu can be generated via the ({gamma},n) reaction by a laser with an intensity of about 10{sup 19} Wcm{sup -2}.

  14. Uncertainty-induced quantum nonlocality

    NASA Astrophysics Data System (ADS)

    Wu, Shao-xiong; Zhang, Jun; Yu, Chang-shui; Song, He-shan

    2014-01-01

    Based on the skew information, we present a quantity, uncertainty-induced quantum nonlocality (UIN) to measure the quantum correlation. It can be considered as the updated version of the original measurement-induced nonlocality (MIN) preserving the good computability but eliminating the non-contractivity problem. For 2×d-dimensional state, it is shown that UIN can be given by a closed form. In addition, we also investigate the maximal uncertainty-induced nonlocality.

  15. Laser Induced Thermal Keratoplasty

    NASA Astrophysics Data System (ADS)

    Householder, John; Horwitz, Larry S.; Lowe, Kenneth W.; Murrillo, Adolfo

    1989-09-01

    A technique of corneal surgery that is thermally induced and relatively nonenvasive has been studied by the authors, and the preliminary results of the thermal keratoplasty performed on live rabbits are reported here. A carbon dioxide laser was used with simple optical and pointing systems to thermally induce several arbitrary patterns of corneal reformation. Endothelial photographs were taken before the procedure and then again ten days after. They indicated no damage in the Descemet's membrane nor was there damage observed to the endothelium. As much, as 14 "diopters" of change occurred in the corneal keratometry with both positive and negative directions signs. The magnitude and direction of the change were recorded as functions of the pattern of the therapy produced and the laser energy deposited in the stroma. Any corneal reformation was tracked as a function of time subsequent to the procedure. A-minor decay was observed within the first three days of the procedure and the majority of the reformations have maintained at the time of this writing. Since radiation at this wavelength is highly attenuated and absorbed in cornea, no change was observed beyond mid-stroma and the lens and retina appeared uneffective. The authors believe that this technology will be a significant contributor to corneal refractive procedures in the near future. Unlike any refractive surgery currently practiced, this technology may lead to a procedure that: 1) is reversible, 2) is re.eatable, 3) stren thens rather then weakens the cornea, 4) is a..arentl more stable, 5) is more flexible in the types of corneal curvature changes it can produce, 6) results in very clean mires, 7) is painless, and 8) results in total corneal clarity.

  16. Baboon syndrome induced by hydroxyzine.

    PubMed

    Akkari, Hayet; Belhadjali, Hichem; Youssef, Monia; Mokni, Sana; Zili, Jamelediine

    2013-05-01

    Hydroxyzine-induced drug eruptions are very rare. We report here a typical case of drug-related Baboon syndrome or symmetrical drug-related intertriginous and flexural exanthema (SDRIFE) which was induced by hydroxyzine in a 60-year-old man. The diagnosis was confirmed by positive patch and oral accidental provocation tests with hydroxyzine. Patch tests and oral provocation tests with cetirizine and levocetirizine were negative. A review of the literature identified only 17 reported cases of hydroxyzine-induced drug eruptions. To the best of our knowledge, we report here the first case of hydroxyzine-induced SDRIFE. PMID:23723506

  17. Iodine-Induced hypothyroidism.

    PubMed

    Markou, K; Georgopoulos, N; Kyriazopoulou, V; Vagenakis, A G

    2001-05-01

    Iodine is an essential element for thyroid hormone synthesis. The thyroid gland has the capacity and holds the machinery to handle the iodine efficiently when the availability of iodine becomes scarce, as well as when iodine is available in excessive quantities. The latter situation is handled by the thyroid by acutely inhibiting the organification of iodine, the so-called acute Wolff-Chaikoff effect, by a mechanism not well understood 52 years after the original description. It is proposed that iodopeptide(s) are formed that temporarily inhibit thyroid peroxidase (TPO) mRNA and protein synthesis and, therefore, thyroglobulin iodinations. The Wolff-Chaikoff effect is an effective means of rejecting the large quantities of iodide and therefore preventing the thyroid from synthesizing large quantities of thyroid hormones. The acute Wolff-Chaikoff effect lasts for few a days and then, through the so-called "escape" phenomenon, the organification of intrathyroidal iodide resumes and the normal synthesis of thyroxine (T4) and triiodothyronine (T3) returns. This is achieved by decreasing the intrathyroidal inorganic iodine concentration by down regulation of the sodium iodine symporter (NIS) and therefore permits the TPO-H202 system to resume normal activity. However, in a few apparently normal individuals, in newborns and fetuses, in some patients with chronic systemic diseases, euthyroid patients with autoimmune thyroiditis, and Graves' disease patients previously treated with radioimmunoassay (RAI), surgery or antithyroid drugs, the escape from the inhibitory effect of large doses of iodides is not achieved and clinical or subclinical hypothyroidism ensues. Iodide-induced hypothyroidism has also been observed in patients with a history of postpartum thyroiditis, in euthyroid patients after a previous episode of subacute thyroiditis, and in patients treated with recombinant interferon-alpha who developed transient thyroid dysfunction during interferon-a treatment. The

  18. Bellows flow-induced vibrations

    NASA Technical Reports Server (NTRS)

    Tygielski, P. J.; Smyly, H. M.; Gerlach, C. R.

    1983-01-01

    The bellows flow excitation mechanism and results of comprehensive test program are summarized. The analytical model for predicting bellows flow induced stress is refined. The model includes the effects of an upstream elbow, arbitrary geometry, and multiple piles. A refined computer code for predicting flow induced stress is described which allows life prediction if a material S-N diagram is available.

  19. Laxative-induced rhabdomyolysis

    PubMed Central

    Merante, Alfonso; Gareri, Pietro; Marigliano, Norma Maria; De Fazio, Salvatore; Bonacci, Elvira; Torchia, Carlo; Russo, Gaetano; Lacroce, Pasquale; Lacava, Roberto; Castagna, Alberto; De Sarro, Giovambattista; Ruotolo, Giovanni

    2010-01-01

    The present study describes a case of laxative-induced rhabdomyolysis in an elderly patient. An 87-year-old woman was hospitalized for the onset of confusion, tremors, an inability to walk, and a fever that she had been experiencing for 36 hours. She often took high dosages of lactulose and sorbitol syrup as a laxative (about 70 g/day). During her physical examination, the patient was confused, drowsy, and she presented hyposthenia in her upper and lower limbs, symmetric and diffuse moderate hyporeflexia, and her temperature was 37.8°C. Laboratory tests revealed severe hyponatremia with hypokalemia, hypocalcemia, hypochloremia, and metabolic alkalosis. Moreover, rhabdomyolysis markers were found. The correction of hydroelectrolytic imbalances with saline, potassium and sodium chlorure, calcium gluconate was the first treatment. During her hospitalization the patient presented acute delirium, treated with haloperidol and prometazine chloridrate intramuscularly. She was discharged 12 days later, after resolution of symptoms, and normalized laboratory tests. Over-the-counter drugs such as laxatives are usually not considered dangerous; on the other hand, they may cause serum electrolytic imbalance and rhabdomyolysis. A careful monitoring of all the drugs taken by the elderly is one of the most important duties of a physician since drug interactions and their secondary effects may be fatal. PMID:20396636

  20. Fission-induced plasmas

    NASA Technical Reports Server (NTRS)

    Harries, W. L.; Shiu, Y. J.

    1979-01-01

    The possibility of creating a plasma from fission fragments, and to utilize the energy of the particles to create population inversion that would lead to laser action is investigated. An investigation was made of various laser materials which could be used for nuclear-pumped lasing. The most likely candidate for a fissioning material in the gaseous form is uranium hexafluoride - UF6, and experiments were performed to investigate materials that would be compatible with it. One of the central problems in understanding a fission-induced plasma is to obtain a model of the electron behavior, and some preliminary calculations are presented. In particular, the rates of various processes are discussed. A simple intuitive model of the electron energy distribution function is also shown. The results were useful for considering a mathematical model of a nuclear-pumped laser. Next a theoretical model of a (3)He-Ar nuclear-pumped laser is presented. The theory showed good qualitative agreement with the experimental results.

  1. Seizure-induced neglect.

    PubMed Central

    Heilman, K M; Howell, G J

    1980-01-01

    A man with intermittent right parieto-occipital seizures was monitored by electroencephalography while he received 60 trials of being touched on the right, left, or both hands. Half of the trials were given during a focal seizure, and half were given interictally. While the patient was having seizures, he appropriately responded to all 10 stimuli delivered to the right hand, but four of 10 responses were incorrect (allaesthetic) when he was stimulated on the left. With bilateral simultaneous stimulation he neglected the left hand in all 10 trials. His interictal performance was flawless. When given a line-bisection task on two occasions during a seizure, the patient attempted to make a mark to the left of the entire sheet of paper. Immediately postictally he made a mark at the right end of the line. The case illustrates that focal seizures may induce elements of the neglect syndrome and that attention (to contralateral stimuli) and intention to perform (in the contralateral hemispatial field) may be dissociable phenomena. PMID:6777464

  2. [Heparin-induced thrombocytopenia].

    PubMed

    Thiele, T; Althaus, K; Greinacher, A

    2010-09-01

    Heparin-induced thrombocytopenia (HIT) is an adverse drug reaction that carries an increased risk of thromboembolic complications. HIT is caused by platelet-activating antibodies directed against a complex of platelet factor 4 (PF4) and heparin. HIT typically manifests in the second week after initiation of heparin therapy with a platelet count reduction of more than 50% of the highest level after the start of heparin administration as well as thromboembolic events. The clinical probability can be calculated by the 4 T's score. The laboratory diagnosis of HIT is based on confirmation of PF4/heparin antibodies or on functional tests that provide evidence of heparin-dependent platelet-activating antibodies. A low 4 T's score and negative HIT test virtually rule out the presence of HIT. Patients with acute HIT require anticoagulation with a compatible anticoagulant in a therapeutic dose. The drugs currently available for this include the direct thrombin inhibitors argatroban, lepirudin, bivalirudin, and desirudin and the indirect factor Xa inhibitors danaparoid and fondaparinux. PMID:20694716

  3. Tumor-induced osteomalacia

    PubMed Central

    Chong, William H; Molinolo, Alfredo A; Chen, Clara C; Collins, Michael T

    2012-01-01

    Tumor-induced osteomalacia (TIO) is a rare and fascinating paraneoplastic syndrome in which patients present with bone pain, fractures, and muscle weakness. The cause is high blood levels of the recently identified phosphate and vitamin D-regulating hormone, fibroblast growth factor 23 (FGF23). In TIO, FGF23 is secreted by mesenchymal tumors that are usually benign, but are typically very small and difficult to locate. FGF23 acts primarily at the renal tubule and impairs phosphate reabsorption and 1α-hydroxylation of 25-hydroxyvitamin D, leading to hypophosphatemia and low levels of 1,25-dihydroxy vitamin D. A step-wise approach utilizing functional imaging (F-18 fluorodeoxyglucose positron emission tomography and octreotide scintigraphy) followed by anatomical imaging (computed tomography and/or magnetic resonance imaging), and, if needed, selective venous sampling with measurement of FGF23 is usually successful in locating the tumors. For tumors that cannot be located, medical treatment with phosphate supplements and active vitamin D (calcitriol or alphacalcidiol) is usually successful; however, the medical regimen can be cumbersome and associated with complications. This review summarizes the current understanding of the pathophysiology of the disease and provides guidance in evaluating and treating these patients. Novel imaging modalities and medical treatments, which hold promise for the future, are also reviewed. PMID:21490240

  4. Exercise-induced anaphylaxis.

    PubMed

    Sheffer, A L; Austen, K F

    1980-08-01

    Sixteen patients were seen because of possibly life-threatening exercise-associated symptoms similar to anaphylactic reactions. Asthma attacks, cholinergic urticaria and angioedema, and cardiac arrythmias are recognized as exertion-related phenomena in predisposed patients but are distinct from the syndrome described here. A syndrome characterized by the exertion-related onset of cutaneous pruritus and warmth, the development of generalized urticaria, and the appearance of such additional manifestations as collapse in 12 patients, gastrointestinal tract symptoms in five patients, and upper respiratory distress in 10 patients has been designated exercise-induced anaphylaxis, because of the striking similarity of this symptom complex to the anaphylactic syndrome elicited by ingestion or injection of a foreign antigenic substance. There is a family history of atopic desease for 11 patients and cold urticaria for two others and a personal history of atopy in six. The size of the wheals, the failure to develop an attack with a warm bath or shower or a fever, and the prominence of syncope rule against the diagnosis of conventional cholinergic urticaria. There is no history or evidence of an encounter with an environmental source of antigen during the exercise period. PMID:7400473

  5. Discreteness inducing coexistence

    NASA Astrophysics Data System (ADS)

    dos Santos, Renato Vieira

    2013-12-01

    Consider two species that diffuse through space. Consider further that they differ only in initial densities and, possibly, in diffusion constants. Otherwise they are identical. What happens if they compete with each other in the same environment? What is the influence of the discrete nature of the interactions on the final destination? And what are the influence of diffusion and additive fluctuations corresponding to random migration and immigration of individuals? This paper aims to answer these questions for a particular competition model that incorporates intra and interspecific competition between the species. Based on mean field theory, the model has a stationary state dependent on the initial density conditions. We investigate how this initial density dependence is affected by the presence of demographic multiplicative noise and additive noise in space and time. There are three main conclusions: (1) Additive noise favors denser populations at the expense of the less dense, ratifying the competitive exclusion principle. (2) Demographic noise, on the other hand, favors less dense populations at the expense of the denser ones, inducing equal densities at the quasi-stationary state, violating the aforementioned principle. (3) The slower species always suffers the more deleterious effects of statistical fluctuations in a homogeneous medium.

  6. Loperamide-induced hypopituitarism

    PubMed Central

    Napier, Catherine; Gan, Earn H; Pearce, Simon H S

    2016-01-01

    Loperamide is the most commonly used antidiarrhoeal medication in the UK. We report a serious and hitherto undocumented adverse effect of chronic use in a 45-year-old man with inflammatory bowel disease. He presented to the endocrine clinic with fatigue and low libido; biochemical assessment revealed hypogonadism and adrenal insufficiency without any elevated adrenocorticotropic hormone. When symptoms allowed, loperamide was reduced and a short synacthen test (SST) showed a ‘clear pass’ with a normal peak cortisol of 833 nmol/L. Later, worsening diarrhoea necessitated an escalation in loperamide use again. While taking a daily dose of 15–20 mg (recommended daily maximum 16 mg) reassessment revealed a fall in peak cortisol on SST to 483 nmol/L, a subnormal response. Clinicians should exercise caution when relying on loperamide to manage their patients’ chronic diarrhoea and remain mindful of the possibility of drug-induced life-threatening adrenal insufficiency. PMID:27681351

  7. Clofibrate-Induced Antidiuresis

    PubMed Central

    Moses, Arnold M.; Howanitz, Joan; Gemert, Marcia Van; Miller, Myron

    1973-01-01

    Normal subjects and patients with antidiuretic hormone (ADH) deficiency were studied to determine the mechanism of the antidiuretic action of clofibrate. Before clofibrate treatment, the patients' ability to concentrate urine with a standardized dehydration procedure correlated with the amount of ADH which was excreted. During clofibrate administration all six patients with ADH deficiency developed an antidiuresis which was like that of ADH, since there was no change in sodium, potassium, total solute, or creatinine excretion. There was a correlation between the patients' ability to concentrate urine during dehydration and the subsequent response to clofibrate, and the excretion of ADH during dehydration correlated with the excretion of ADH on clofibrate therapy. Clofibrate-induced antidiuresis in these patients was partially overcome by ethanol and by water loading. Clofibrate interfered with the ability of patients and subjects to excrete a water load and prevented the water load from inhibiting ADH excretion in the normal subjects. These studies suggested that clofibrate was acting through endogenous ADH and this thesis was supported by the failure of clofibrate to produce an antidiuresis when injected into rats with total ADH deficiency (Brattleboro strain) although an antidiuresis was produced in water-loaded normal rats. When the drug was injected into Brattleboro rats with exogenous ADH, clofibrate either did not alter or it inhibited the action of the ADH. The data demonstrate that clofibrate has a significant ADH-like action. This action appears to be mediated through the release of endogenous ADH. Images PMID:4685079

  8. Dialysis induced hypoxemia.

    PubMed

    Habte, B; Carter, R; Shamebo, M; Veicht, J; Boulton Jones, J M

    1982-09-01

    We investigated the mechanism by which hypoxemia is produced in patients on dialysis by studying changes in neutrophil count, blood gases and pulmonary function in a patient with only trace amounts of circulating C3 associated with Type II mesangiocapillary glomerulonephritis and a control group of 6 patients with normal C3 levels during a 4 hour hemodialysis. Fifteen minutes after the start of dialysis the neutrophil count fell to 13% of pre-dialysis values in the control group while it only fell to 71% in the study patient. A further fall to 47% occurred in the patient at 30 minutes. A drop in PaO2 by 15% of initial values occurred at 15 and 30 minutes in the controls and the patient respectively matching the trend of fall in the neutrophil count. PaCO2 fell sharply across the dialysis membrane with reciprocol changes in the dialysis bath. Alveolar oxygen tension showed a significant reduction starting at 15 minutes correlating with the reduction in PaO2. The A-a O2 gradient was not altered significantly. These data strongly suggest that the principal mechanism leading to hypoxemia during dialysis is hypoventilation resulting from CO2 loss into the dialysis bath. Complement mediated pulmonary leucostasis may play a secondary role in inducing a quicker fall in PaO2 in the early part of dialysis. PMID:7140022

  9. Glutaraldehyde-induced colitis

    PubMed Central

    Stein, Barry L.; Lamoureux, Esther; Miller, Mark; Vasilevsky, Carol-Ann; Julien, Lynne; Gordon, Philip H.

    2001-01-01

    Objective To describe the etiology and clinical course of acute colitis occurring after flexible endoscopy. Design Chart review. Setting A university teaching hospital. Patients Eight patients who sought assessment of potential colonic disease. Intervention Colonoscopy in 5 patients and flexible sigmoidoscopy in 3 patients. The indication for endoscopy was screening in 5 patients, cancer surveillance in 2 patients and preoperative evaluation of colon carcinoma in 1 patient. Outcome measures The relation of presenting symptoms to glutaraldehyde exposure, the response to therapy and the need for further therapy. Results All patients had abdominal pain, mucus diarrhea and rectal bleeding within 48 hours after endoscopy. Most patients reported that the symptoms started within 12 hours of the procedure. All patients were confirmed by sigmoidoscopy to have colitis within 72 hours of the first endoscopic procedure. One patient required hospitalization. In the first 7 patients several stool cultures were negative for Clostridium difficile using the cytotoxin assay by the cell culture method. Four patients had negative cultures for Yersinia, Salmonella and Shigella spp. Three patients were treated with metronidazole initially. Two patients underwent endoscopic biopsy and examination of the biopsy specimen showed fibrinoleukocytic exudate and ischemic type injury. One patient underwent the scheduled sigmoid resection within 48 hours of endoscopy for a Dukes’ stage B adenocarcinoma. Concomitant acute ischemic colitis limited to the mucosa and submucosa was noted in the resected specimen. Symptoms resolved in all patients and follow-up endoscopy revealed normal mucosa. Conclusion The entity of glutaraldehyde-induced colitis should be recognized and special attention should be given during instrument cleansing to minimize the risk of its development. PMID:11308232

  10. Drug-Induced Metabolic Acidosis

    PubMed Central

    Pham, Amy Quynh Trang; Xu, Li Hao Richie; Moe, Orson W.

    2015-01-01

    Metabolic acidosis could emerge from diseases disrupting acid-base equilibrium or from drugs that induce similar derangements. Occurrences are usually accompanied by comorbid conditions of drug-induced metabolic acidosis, and clinical outcomes may range from mild to fatal. It is imperative that clinicians not only are fully aware of the list of drugs that may lead to metabolic acidosis but also understand the underlying pathogenic mechanisms. In this review, we categorized drug-induced metabolic acidosis in terms of pathophysiological mechanisms, as well as individual drugs’ characteristics. PMID:26918138

  11. Drug-Induced Metabolic Acidosis.

    PubMed

    Pham, Amy Quynh Trang; Xu, Li Hao Richie; Moe, Orson W

    2015-01-01

    Metabolic acidosis could emerge from diseases disrupting acid-base equilibrium or from drugs that induce similar derangements. Occurrences are usually accompanied by comorbid conditions of drug-induced metabolic acidosis, and clinical outcomes may range from mild to fatal. It is imperative that clinicians not only are fully aware of the list of drugs that may lead to metabolic acidosis but also understand the underlying pathogenic mechanisms. In this review, we categorized drug-induced metabolic acidosis in terms of pathophysiological mechanisms, as well as individual drugs' characteristics. PMID:26918138

  12. Drug-induced cholestasis.

    PubMed

    Zimmerman, H J; Lewis, J H

    1987-01-01

    Intrahepatic cholestasis, defined as arrested bile flow, mimics extrahepatic obstruction in its biochemical, clinical and morphological features. It may be due to hepatocyte lesions of which there are three types, termed canalicular, hepatocanalicular and hepatocellular, respectively; or it may be due to ductal lesions at the level of the cholangiole or portal or septal ducts. Defective bile flow due to hepatic lesions reflects abnormal modification of the ductular bile. Defective formation of canalicular bile may involve bile acid-dependent or independent flow. It appears to result most importantly from defective secretion of bile acid-dependent flow secondary to defective uptake from sinusoidal blood, defective transcellular transport and defective secretion; or from regurgitation of secreted bile via leaky tight junctions. An independent defect in bile acid-independent flow is less clear. Defective flow of bile along the canaliculus may reflect increased viscosity and impaired canalicular contractility secondary to injury of the pericanalicular microfibrillar network. Impaired flow beyond the canaliculus may result from ductal injury. Sites of lesions that contribute to cholestasis include the sinusoidal and canalicular plasma membrane, the pericanalicular network and the tight junction and, less certainly, microtubules and microfilaments and Golgi apparatus. A number of drugs that lead to cholestasis have been found to lead to injury at one or more of these sites. Other agents (alpha-naphthylisothiocyanate, methylenedianiline, contaminated rapeseed oil, paraquat) lead to ductal injury resulting in cholestasis. Reports of inspissated casts in ductules (benoxaprofen jaundice) and injury to the major excretory tree (5-fluorouridine after hepatic artery infusion) have led to other forms of ductal cholestasis. Most instances of drug-induced cholestasis present as acute, transient illness, although important chronic forms also occur. The clinical features include the

  13. Drug-induced pulmonary disease

    MedlinePlus

    ... improve. Some drug-induced lung diseases, such as pulmonary fibrosis, may never go away. ... Complications that may develop include: Diffuse interstitial pulmonary fibrosis Hypoxemia (low blood oxygen) Respiratory failure

  14. Drug-Induced Urinary Calculi

    PubMed Central

    Matlaga, Brian R; Shah, Ojas D; Assimos, Dean G

    2003-01-01

    Urinary calculi may be induced by a number of medications used to treat a variety of conditions. These medications may lead to metabolic abnormalities that facilitate the formation of stones. Drugs that induce metabolic calculi include loop diuretics; carbonic anhydrase inhibitors; and laxatives, when abused. Correcting the metabolic abnormality may eliminate or dramatically attenuate stone activity. Urinary calculi can also be induced by medications when the drugs crystallize and become the primary component of the stones. In this case, urinary supersaturation of the agent may promote formation of the calculi. Drugs that induce calculi via this process include magnesium trisilicate; ciprofloxacin; sulfa medications; triamterene; indinavir; and ephedrine, alone or in combination with guaifenesin. When this situation occurs, discontinuation of the medication is usually necessary. PMID:16985842

  15. Irradiation Induced Creep of Graphite

    SciTech Connect

    Burchell, Timothy D; Murty, Prof K.L.; Eapen, Dr. Jacob

    2010-01-01

    The current status of graphite irradiation induced creep strain prediction is reviewed and the major creep models are described. The ability of the models to quantitatively predict the irradiation induced creep strain of graphite is reported. Potential mechanisms of in-crystal creep are reviewed as are mechanisms of pore generation under stress. The case for further experimental work is made and the need for improved creep models across multi-scales is highlighted.

  16. [Induced abortion: pro and con].

    PubMed

    Balić, Adem; Balić, Devleta; Habibović, A; Adzajlić, A

    2003-01-01

    Induced abortion like a method of birth control is the most unpopular method but it is a choice of great deal women especially in our environment. In connection with very loud demands for sharpened the low of pregnancy interrupting, many authors analyse methods, complications and risk groups of women, its acceptability like a method of family planning. At the end they give conclusion with some concrete suggestions and the aim to reduce the number of induced abortions. PMID:14528715

  17. Induced resistance responses in maize.

    PubMed

    Morris, S W; Vernooij, B; Titatarn, S; Starrett, M; Thomas, S; Wiltse, C C; Frederiksen, R A; Bhandhufalck, A; Hulbert, S; Uknes, S

    1998-07-01

    Systemic acquired resistance (SAR) is a widely distributed plant defense system that confers broad-spectrum disease resistance and is accompanied by coordinate expression of the so-called SAR genes. This type of resistance and SAR gene expression can be mimicked with chemical inducers of resistance. Here, we report that chemical inducers of resistance are active in maize. Chemical induction increases resistance to downy mildew and activates expression of the maize PR-1 and PR-5 genes. These genes are also coordinately activated by pathogen infection and function as indicators of the defense reaction. Specifically, after pathogen infection, the PR-1 and PR-5 genes are induced more rapidly and more strongly in an incompatible than in a compatible interaction. In addition, we show that monocot lesion mimic plants also express these defense-related genes and that they have increased levels of salicylic acid after lesions develop, similar to pathogeninfected maize plants. The existence of chemically inducible disease resistance and PR-1 and PR-5 gene expression in maize indicates that maize is similar to dicots in many aspects of induced resistance. This reinforces the notion of an ancient plant-inducible defense pathway against pathogen attack that is shared between monocots and dicots.

  18. Victim-induced criminality.

    PubMed

    Fooner, M

    1966-09-01

    about the probable effects on the administration of criminal justice. These are pragmatic problems; there is a third problem which may at this time seem speculative, but is, nevertheless, quite important. 3) To what extent will a particular proposal for victim compensation contribute to a temptation-opportunity pattern in victim behavior? In previous studies it has been pointed out that large numbers of our fellow Americans have tended to acquire casual money-handling habits-generically designated "carelessness"-which contribute to the national growth of criminality. How the victim helps the criminal was sketched in reports of those studies (10). It was made abundantly clear that human beings in our affluent society cannot be assumed to be prudent or self-protective against the hazards of crime. Even when the "victim" is not overtly acting to commit a crime-as in the case of the property owner who hires an arsonist-he often tempts the offender. Among the victims of burglary-statistically the most prevalent crime in the United States-are a substantial number of Americans who keep cash, jewelry, and other valuables carelessly at home or in hotel rooms to which the burglar has easy access through door or window. Victims of automobile theft-one of the fastest growing classes of crime-include drivers who leave the vehicle or its contents invitingly accessible to thieves. And so on with other classes of crime. As pointed out in previous studies, when victim behavior follows a temptation-opportunity pattern, it (i) contributes to a "climate of criminal inducements," (ii) adds to the economic resources available to criminal societies, and (iii) detracts from the ability of lawenforcement agencies to suppress the growth of crime.

  19. Drug-Induced Itch Management.

    PubMed

    Ebata, Toshiya

    2016-01-01

    Drugs may cause itching as a concomitant symptom of drug-induced skin reactions or in the form of pruritus without skin lesions. Drug-induced itch is defined as generalized itching without skin lesions, caused by a drug. Itching associated with drug-induced cholestasis is among the common dermatologic adverse events (dAEs) that induce itching. Some drugs such as opioids, antimalarials, and hydroxyethyl starch are known to induce itching without skin lesions. The clinical features and underlying proposed mechanisms of itching caused by these drugs have been specifically investigated. The recent application of targeted anticancer drugs has increased the survival rate of cancer patients. These new agents cause significant dAEs such as acneiform rashes, dry skin, hand-foot syndrome, paronychia, and itching. Itching is a common side effect of epidermal growth factor receptor inhibitors. Though not life-threatening, these dAEs have a negative impact on a patient's quality of life, leading to dose reduction and possibly less effective cancer therapy. It is important to provide an effective supportive antipruritic treatment without interruption of the administration of these drugs. This chapter concludes by describing basic measures to be taken for diagnosis and treatment of drug-induced itch. The principle of treatment is discontinuation of suspected causative drugs in general except for anticancer medications. In case itching lasts long after drug withdrawal or the causative drug cannot be stopped, vigorous symptomatic antipruritic treatment and specific therapies for different types of drug-induced itch should be undertaken. PMID:27578085

  20. Bulgy tadpoles: inducible defense morph.

    PubMed

    Kishida, Osamu; Nishimura, Kinya

    2004-08-01

    Predator induced morphological defenses are marked morphological shifts induced directly by cues associated with a predator. Generally, remote cues, i.e., chemical substances emitted from predators or injured conspecifics, are considered to be ideal signals to induce morphological change in aquatic environments rather than close cues, i.e., close chemical or tactile cues, since chemical substances that can propagate over relatively long distances and persist for a long period may allow organisms to keep safe and to deliberately change their morph. In fact, most organisms adopting an inducible morphological defense utilize remote chemical cues to detect predation risk and to produce morphological defenses. In this paper, we report a unique and functionally well designed inducible morphological defense strategy where the induction process requires close cues from a predator. The tadpoles of Rana pirica exhibited a bulgy bodied morphology when threatened with predation by larval salamanders, Hynobius retardatus, in close proximity. Predation trials and a function experiment showed that the induced bulgy morph is an adaptive defense phenotype against the gape-limited predator larval H. retardatus. Furthermore, R. pirica tadpoles use two adaptive strategies in terms of cost saving, i.e., adjustment of the extent of bulginess according to predation risk and reversibility by actual shrink of bulgy body after removing the predation threat. In general, R. pirica hatch earlier than H. retardatus. In natural ponds, during the early developmental stage R. pirica tadpoles live in close proximity to young H. retardatus larvae. As they grow, the salamanders gradually become serious predators and the predator-prey interaction becomes intimate. After a while, predation, cannibalism and metamorphosis decrease the number of salamanders in the ponds, and the predator-prey interaction weakens. Such a phenology in the predator-prey interaction allows the evolution of a close

  1. Bulgy tadpoles: inducible defense morph.

    PubMed

    Kishida, Osamu; Nishimura, Kinya

    2004-08-01

    Predator induced morphological defenses are marked morphological shifts induced directly by cues associated with a predator. Generally, remote cues, i.e., chemical substances emitted from predators or injured conspecifics, are considered to be ideal signals to induce morphological change in aquatic environments rather than close cues, i.e., close chemical or tactile cues, since chemical substances that can propagate over relatively long distances and persist for a long period may allow organisms to keep safe and to deliberately change their morph. In fact, most organisms adopting an inducible morphological defense utilize remote chemical cues to detect predation risk and to produce morphological defenses. In this paper, we report a unique and functionally well designed inducible morphological defense strategy where the induction process requires close cues from a predator. The tadpoles of Rana pirica exhibited a bulgy bodied morphology when threatened with predation by larval salamanders, Hynobius retardatus, in close proximity. Predation trials and a function experiment showed that the induced bulgy morph is an adaptive defense phenotype against the gape-limited predator larval H. retardatus. Furthermore, R. pirica tadpoles use two adaptive strategies in terms of cost saving, i.e., adjustment of the extent of bulginess according to predation risk and reversibility by actual shrink of bulgy body after removing the predation threat. In general, R. pirica hatch earlier than H. retardatus. In natural ponds, during the early developmental stage R. pirica tadpoles live in close proximity to young H. retardatus larvae. As they grow, the salamanders gradually become serious predators and the predator-prey interaction becomes intimate. After a while, predation, cannibalism and metamorphosis decrease the number of salamanders in the ponds, and the predator-prey interaction weakens. Such a phenology in the predator-prey interaction allows the evolution of a close

  2. Drug-induced cutaneous vasculitides.

    PubMed

    Antiga, E; Verdelli, A; Bonciani, D; Bonciolini, V; Quintarelli, L; Volpi, W; Fabbri, P; Caproni, M

    2015-04-01

    Cutaneous vasculitides (CV) can be idiopathic or secondary to several triggers, including drugs, which account for up to 30% of all the cases of CV. Several drugs can induce CV, including some medications commonly used in dermatology, including minocycline, and several new drugs, such as anti-TNF agents. Different pathomecanisms are involved in the development of drug-induced CV, including the formation and deposition of immune complexes, the induction of neutrophil apoptosis, the formation of neoantigens between the drugs and proteins from the host, the shift of the immune response, and others. Although the diagnosis is difficult, because the clinical picture of drug-induced CV is in general indistinguishable from that of other forms of CV, it is important to recognize such entities in order to correctly manage the patient. Anamnesis, diagnostic algorithms to assess the likelihood of the association between a drug and a cutaneous reaction, skin biopsy and laboratory testing (including the search for antineutrophil cytoplasmic antibodies) are useful tools to make a diagnosis of drug-induced CV. About the therapy, while in idiopathic vasculitides the treatment is usually more aggressive and long-lasting, very often requiring a maintenance therapy with immunosuppressive drugs, in drug-induced CV the discontinuation of the suspected drug alone is usually enough to achieve complete remission, making the prognosis usually very good.

  3. Flash photography-induced maculopathy

    PubMed Central

    Veugelen, Tim; Coutteel, Carine; Leys, Anita

    2011-01-01

    Objective: To report a flash photography-induced maculopathy. Methods: A professional photographer blinded himself accidentally and he consulted 3 days after the event with a scotoma in his dominant left eye. A unilateral acute light-induced maculopathy with hemorrhage was observed. The lesion was studied with colour photography, fluorescein and indocyanin angiography, autofluorescence imaging and repeated optical coherence tomography (OCT) imaging. Results: At age 43, this professional photographer was blinded by the flash light of his camera and subsequently realized he had a scotoma in his dominant eye. Three days after the event visual acuity (VA) was 20/70 and an acute light-induced maculopathy was noted. Another three days later, VA was 20/50 and the lesions were less prominent. After one month, the photographer still had problems making sharp pictures, VA was 20/25 and a macular scar was observed. During further follow-up, he regained full vision and experienced no professional problems. Conclusions: This case illustrates that the light of flash photography can accidentally hit an eye and induce a light-induced maculopathy.

  4. Flash photography-induced maculopathy

    PubMed Central

    Veugelen, Tim; Coutteel, Carine; Leys, Anita

    2011-01-01

    Objective: To report a flash photography-induced maculopathy. Methods: A professional photographer blinded himself accidentally and he consulted 3 days after the event with a scotoma in his dominant left eye. A unilateral acute light-induced maculopathy with hemorrhage was observed. The lesion was studied with colour photography, fluorescein and indocyanin angiography, autofluorescence imaging and repeated optical coherence tomography (OCT) imaging. Results: At age 43, this professional photographer was blinded by the flash light of his camera and subsequently realized he had a scotoma in his dominant eye. Three days after the event visual acuity (VA) was 20/70 and an acute light-induced maculopathy was noted. Another three days later, VA was 20/50 and the lesions were less prominent. After one month, the photographer still had problems making sharp pictures, VA was 20/25 and a macular scar was observed. During further follow-up, he regained full vision and experienced no professional problems. Conclusions: This case illustrates that the light of flash photography can accidentally hit an eye and induce a light-induced maculopathy. PMID:27625926

  5. Immunotoxicity of perfluorooctanoic acid and perfluorooctane sulfonate and the role of peroxisome proliferator-activated receptor alpha

    EPA Science Inventory

    Peroxisome proliferators, including perfluorooctanoic acid (PFOA), are environmentally widespread and persistent and multiple toxicities have been reported in experimental animals and humans. These compounds trigger biological activity via activation of the alpha isotype of pero...

  6. Geno- and immunotoxic effects on populations living near a mine: a case study of Panasqueira mine in Portugal.

    PubMed

    Coelho, Patrícia Clara dos Santos; García-Lestón, Julia; Silva, Susana Pinho E; da Costa, Carla Sofia Trindade; da Costa, Solange Cristina Bastos; Coelho, Marta Isabel Correia; Lage, Blanca Laffon; Mendez, Eduardo Pásaro; Teixeira, João Paulo Fernandes

    2011-01-01

    Mining industry is a vital economic sector for many countries but it is also one of the most hazardous activities, both occupationally and environmentally. Existing studies point to several adverse effects on communities' health living near mines, effects such as mesothelioma and respiratory illnesses. Results achieved in a geochemical sampling campaign undertaken in the vicinity of São Francisco de Assis village showed an anomalous distribution of some heavy metals in soils and waters. To evaluate the effects of mining activities on human health produced by these conditions, a group of 28 individuals from São Francisco de Assis village was examined for some biological endpoints. A nonexposed group (30 individuals) with the same demographic characteristics without exposure to genotoxic compounds was also studied and data obtained from both groups compared. Results of the T-cell receptor mutation assay and micronucleus (MN) test showed significant increases in the frequencies of both mutations and MN in exposed subjects compared to controls. Data obtained in the analysis of the different lymphocyte subsets demonstrated significant decreases in percentages of CD3+ and CD4+ cells, and a significant increase in percentage of CD16/56+ cells, in exposed individuals. The results of the present study indicate an elevated risk of human environmental contamination resulting from mining activities, emphasizing the need to implement preventive measures, remediation, and rehabilitation plans. This would lead to a reduction in cancer risk not only for this particular population but for all populations exposed under similar conditions.

  7. IMMUNOTOXICITY OF DlBROMOACETIC ACID ADMINISTERED VIA DRINKING WATER TO FEMALE B6C3Fl MICE

    EPA Science Inventory

    Dibromoacetic acid (DBA) is a disinfection by product commonly found in drinking water as a result of chlorination/ozonation processes. The EPA estimates that more than 200 million people consume disinfected water in the U.S. (EPA 1998). This study was conducted to evaluate the p...

  8. A quantitative multiplex nuclease protection assay reveals immunotoxicity gene expression profiles in the rabbit model for vaginal drug safety evaluation.

    PubMed

    Fichorova, Raina N; Mendonca, Kevin; Yamamoto, Hidemi S; Murray, Ryan; Chandra, Neelima; Doncel, Gustavo F

    2015-06-15

    Any vaginal product that alters the mucosal environment and impairs the immune barrier increases the risk of sexually transmitted infections, especially HIV infection, which thrives on mucosal damage and inflammation. The FDA-recommended rabbit vaginal irritation (RVI) model serves as a first line selection tool for vaginal products; however, for decades it has been limited to histopathology scoring, insufficient to select safe anti-HIV microbicides. In this study we incorporate to the RVI model a novel quantitative nuclease protection assay (qNPA) to quantify mRNA levels of 25 genes representing leukocyte differentiation markers, toll-like receptors (TLR), cytokines, chemokines, epithelial repair, microbicidal and vascular markers, by designing two multiplex arrays. Tissue sections were obtained from 36 rabbits (6 per treatment arm) after 14 daily applications of a placebo gel, saline, 4% nonoxynol-9 (N-9), and three combinations of the anti-HIV microbicides tenofovir (TFV) and UC781 in escalating concentrations (highest: 10% TFV+2.5%UC781). Results showed that increased expression levels of toll-like receptor (TLR)-4, interleukin (IL)-1β, CXCL8, epithelial membrane protein (EMP)-1 (P<0.05), and decreased levels of TLR2 (P<0.05), TLR3 and bactericidal permeability increasing protein (BPI) (P<0.001) were associated with cervicovaginal mucosal alteration (histopathology). Seven markers showed a significant linear trend predicting epithelial damage (up with CD4, IL-1β, CXCL8, CCL2, CCL21, EMP1 and down with BPI). Despite the low tissue damage RVI scores, the high-dose microbicide combination gel caused activation of HIV host cells (SLC and CD4) while N-9 caused proinflammatory gene upregulation (IL-8 and TLR4) suggesting a potential for increasing risk of HIV via different mechanisms depending on the chemical nature of the test product.

  9. Stress response, biotransformation effort, and immunotoxicity in captive birds exposed to inhaled benzene, toluene, nitrogen dioxide, and sulfur dioxide.

    PubMed

    Cruz-Martinez, Luis; Smits, Judit E G; Fernie, Kim

    2015-02-01

    In the oil sands of Alberta, Canada, toxicology research has largely neglected the effects of air contaminants on biota. Captive Japanese quail (Coturnix c. japonica) and American kestrels (Falco sparverius) were exposed to mixtures of volatile organic compounds and oxidizing agents (benzene, toluene, NO2 and SO2) in a whole-body inhalation chamber, to test for toxicological responses. Hepatic biotransformation measured through 7-ethoxyresorufin-O-dealkylase (EROD) tended to be increased in exposed kestrels (p=0.06) but not in quail (p=0.15). Plasma corticosterone was increased in the low dose group for quail on the final day of exposure (p=0.0001), and midway through the exposure period in exposed kestrels (p=0.04). For both species, there was no alteration of T and B-cell responses, immune organ mass, or histology of immune organs (p>0.05). This study provides baseline information valuable to complement toxicology studies and provides a better understanding of potential health effects on wild avifauna.

  10. Immunotoxicity risks associated with land-treatment of petrochemical wastes revealed using an in situ rodent model.

    PubMed

    Rafferty, D P; Lochmiller, R L; McBee, K; Qualls, C W; Basta, N T

    2001-01-01

    Land-treatment of petrochemical wastes is a widely used method to dispose of hazardous and non-hazardous waste by biodegradation. However, no comprehensive assessment of the impact of such disposal techniques on terrestrial ecosystems has been conducted. Despite the presence of suspected immunotoxicants in the soil, wild rodents frequently reside on these waste sites after closure or abandonment. We explored the seasonal sensitivity of the immune system of the hispid cotton rat (Sigmodon hispidus) to in situ exposures on sites land-treated with petrochemical wastes. Animals were monitored on five contaminated land-treatment sites and five ecologically matched-reference sites in Oklahoma, USA, over two seasons (summer and winter). Most hematological parameters were not adversely affected by land-treatment; however, platelet counts were 26% greater in cotton rats from land-treatment sites compared to reference sites in winter. Significant treatment-related differences were observed in total serum protein concentrations, organ mass and organ cellularity, but these differences were not consistent across the five land-treatment units. Lymphoproliferative responses of cotton rat splenocytes stimulated in vitro were elevated for a T-cell mitogen and depressed for a B-cell mitogen in animals from land-treatment compared to reference sites. The ability of splenocytes to proliferate in response to interleukin-2 receptor-binding was not influenced by treatment. Total yields of peritoneal cells, yield of peritoneal macrophages, and yield of peritoneal lymphocytes were influenced to varying degrees by land-treatment. Functionally, in vitro metabolic activity of peritoneal macrophages was 114% greater in cotton rats from land-treatment sites compared to reference sites during summer. These results indicate that petrochemical wastes applied to soils on these five land-treatment sites had variable immunomodulatory effects in resident cotton rats. Immune alterations for some assays were indicative of enhancement on some land-treatment sites while suppressive on other land-treatment sites, which could have been a function of type and concentration of immunotoxicants present on each site and highlights the uniqueness of each land-treatment site.

  11. A quantitative multiplex nuclease protection assay reveals immunotoxicity gene expression profiles in the rabbit model for vaginal drug safety evaluation.

    PubMed

    Fichorova, Raina N; Mendonca, Kevin; Yamamoto, Hidemi S; Murray, Ryan; Chandra, Neelima; Doncel, Gustavo F

    2015-06-15

    Any vaginal product that alters the mucosal environment and impairs the immune barrier increases the risk of sexually transmitted infections, especially HIV infection, which thrives on mucosal damage and inflammation. The FDA-recommended rabbit vaginal irritation (RVI) model serves as a first line selection tool for vaginal products; however, for decades it has been limited to histopathology scoring, insufficient to select safe anti-HIV microbicides. In this study we incorporate to the RVI model a novel quantitative nuclease protection assay (qNPA) to quantify mRNA levels of 25 genes representing leukocyte differentiation markers, toll-like receptors (TLR), cytokines, chemokines, epithelial repair, microbicidal and vascular markers, by designing two multiplex arrays. Tissue sections were obtained from 36 rabbits (6 per treatment arm) after 14 daily applications of a placebo gel, saline, 4% nonoxynol-9 (N-9), and three combinations of the anti-HIV microbicides tenofovir (TFV) and UC781 in escalating concentrations (highest: 10% TFV+2.5%UC781). Results showed that increased expression levels of toll-like receptor (TLR)-4, interleukin (IL)-1β, CXCL8, epithelial membrane protein (EMP)-1 (P<0.05), and decreased levels of TLR2 (P<0.05), TLR3 and bactericidal permeability increasing protein (BPI) (P<0.001) were associated with cervicovaginal mucosal alteration (histopathology). Seven markers showed a significant linear trend predicting epithelial damage (up with CD4, IL-1β, CXCL8, CCL2, CCL21, EMP1 and down with BPI). Despite the low tissue damage RVI scores, the high-dose microbicide combination gel caused activation of HIV host cells (SLC and CD4) while N-9 caused proinflammatory gene upregulation (IL-8 and TLR4) suggesting a potential for increasing risk of HIV via different mechanisms depending on the chemical nature of the test product. PMID:25818602

  12. Geno- and immunotoxic effects on populations living near a mine: a case study of Panasqueira mine in Portugal.

    PubMed

    Coelho, Patrícia Clara dos Santos; García-Lestón, Julia; Silva, Susana Pinho E; da Costa, Carla Sofia Trindade; da Costa, Solange Cristina Bastos; Coelho, Marta Isabel Correia; Lage, Blanca Laffon; Mendez, Eduardo Pásaro; Teixeira, João Paulo Fernandes

    2011-01-01

    Mining industry is a vital economic sector for many countries but it is also one of the most hazardous activities, both occupationally and environmentally. Existing studies point to several adverse effects on communities' health living near mines, effects such as mesothelioma and respiratory illnesses. Results achieved in a geochemical sampling campaign undertaken in the vicinity of São Francisco de Assis village showed an anomalous distribution of some heavy metals in soils and waters. To evaluate the effects of mining activities on human health produced by these conditions, a group of 28 individuals from São Francisco de Assis village was examined for some biological endpoints. A nonexposed group (30 individuals) with the same demographic characteristics without exposure to genotoxic compounds was also studied and data obtained from both groups compared. Results of the T-cell receptor mutation assay and micronucleus (MN) test showed significant increases in the frequencies of both mutations and MN in exposed subjects compared to controls. Data obtained in the analysis of the different lymphocyte subsets demonstrated significant decreases in percentages of CD3+ and CD4+ cells, and a significant increase in percentage of CD16/56+ cells, in exposed individuals. The results of the present study indicate an elevated risk of human environmental contamination resulting from mining activities, emphasizing the need to implement preventive measures, remediation, and rehabilitation plans. This would lead to a reduction in cancer risk not only for this particular population but for all populations exposed under similar conditions. PMID:21707431

  13. Evaluation of the utility of popliteal lymph node examination in a cyclophosphamide model of immunotoxicity in the rat.

    PubMed

    Lapointe, Jean-Martin; Valdez, Reginald A; Ryan, Anne M; Haley, Patrick J

    2016-07-01

    The objective of this study was to characterize the variability of rat lymphoid organ weights and morphology following treatment with a known immunotoxicant, with a focus on the usefulness of evaluating popliteal lymph node weight and histology. Cyclophosphamide was administered to male Sprague-Dawley rats by oral gavage at doses of 2, 7 or 12 mg/kg/day for 10 consecutive days. Left and right popliteal lymph nodes (PLN), spleen and thymus were collected at necropsy, weighed, fixed and processed for histopathology. Femoral bone marrow was also collected, fixed and processed for histology. Organ weight variability was greater for PLN than for either spleen or thymus in control animals. There was a significant but weak correlation between paired left and right PLN weights (p < 0.005; r(2) = 0.2774). Significant treatment-related decreases in lymphoid organ weights were observed in spleen and thymus at ≥ 7 mg/kg/day (p < 0.01), whereas in PLN a significant decrease (p < 0.05) was noted only at 12 mg/kg/day. The inclusion of PLN did not enhance the sensitivity of detection of systemic treatment-related changes in lymphoid organs in a rat cyclophosphamide model.

  14. Stress response, biotransformation effort, and immunotoxicity in captive birds exposed to inhaled benzene, toluene, nitrogen dioxide, and sulfur dioxide.

    PubMed

    Cruz-Martinez, Luis; Smits, Judit E G; Fernie, Kim

    2015-02-01

    In the oil sands of Alberta, Canada, toxicology research has largely neglected the effects of air contaminants on biota. Captive Japanese quail (Coturnix c. japonica) and American kestrels (Falco sparverius) were exposed to mixtures of volatile organic compounds and oxidizing agents (benzene, toluene, NO2 and SO2) in a whole-body inhalation chamber, to test for toxicological responses. Hepatic biotransformation measured through 7-ethoxyresorufin-O-dealkylase (EROD) tended to be increased in exposed kestrels (p=0.06) but not in quail (p=0.15). Plasma corticosterone was increased in the low dose group for quail on the final day of exposure (p=0.0001), and midway through the exposure period in exposed kestrels (p=0.04). For both species, there was no alteration of T and B-cell responses, immune organ mass, or histology of immune organs (p>0.05). This study provides baseline information valuable to complement toxicology studies and provides a better understanding of potential health effects on wild avifauna. PMID:25463874

  15. A quantitative multiplex nuclease protection assay reveals immunotoxicity gene expression profiles in the rabbit model for vaginal drug safety evaluation

    SciTech Connect

    Fichorova, Raina N.; Mendonca, Kevin; Yamamoto, Hidemi S.; Murray, Ryan; Chandra, Neelima; Doncel, Gustavo F.

    2015-06-15

    Any vaginal product that alters the mucosal environment and impairs the immune barrier increases the risk of sexually transmitted infections, especially HIV infection, which thrives on mucosal damage and inflammation. The FDA-recommended rabbit vaginal irritation (RVI) model serves as a first line selection tool for vaginal products; however, for decades it has been limited to histopathology scoring, insufficient to select safe anti-HIV microbicides. In this study we incorporate to the RVI model a novel quantitative nuclease protection assay (qNPA) to quantify mRNA levels of 25 genes representing leukocyte differentiation markers, toll-like receptors (TLR), cytokines, chemokines, epithelial repair, microbicidal and vascular markers, by designing two multiplex arrays. Tissue sections were obtained from 36 rabbits (6 per treatment arm) after 14 daily applications of a placebo gel, saline, 4% nonoxynol-9 (N-9), and three combinations of the anti-HIV microbicides tenofovir (TFV) and UC781 in escalating concentrations (highest: 10% TFV + 2.5%UC781). Results showed that increased expression levels of toll-like receptor (TLR)-4, interleukin (IL)-1β, CXCL8, epithelial membrane protein (EMP)-1 (P < 0.05), and decreased levels of TLR2 (P < 0.05), TLR3 and bactericidal permeability increasing protein (BPI) (P < 0.001) were associated with cervicovaginal mucosal alteration (histopathology). Seven markers showed a significant linear trend predicting epithelial damage (up with CD4, IL-1β, CXCL8, CCL2, CCL21, EMP1 and down with BPI). Despite the low tissue damage RVI scores, the high-dose microbicide combination gel caused activation of HIV host cells (SLC and CD4) while N-9 caused proinflammatory gene upregulation (IL-8 and TLR4) suggesting a potential for increasing risk of HIV via different mechanisms depending on the chemical nature of the test product. - Highlights: • A transcriptome nuclease protection assay assessed microbicides for vaginal safety. • Biomarkers were correlated with histopathology in paraffin-embedded rabbit tissues. • Compounds differed by effects on putative pathways of increased risk of HIV. • Nonsoxynol-9 caused inflammatory tissue damage involving TLR4 and IL-8. • An antiretroviral combination stimulated immune cells evidenced by SLC and CD4.

  16. Cis-urocanic acid increases immunotoxicity and lethality of dermally administered permethrin in C57BL/6N mice.

    PubMed

    Prater, M R; Gogal, R M; Blaylock, B L; Holladay, S D

    2003-01-01

    Immunomodulatory effects of a single topical permethrin exposure, 5-day exposure to cis-urocanic acid (cUCA), or a combination of the two chemicals were evaluated in 4- to 5-week-old female C57BL/6N mice. Permethrin alone decreased thymic weight and cellularity. Although cUCA alone did not affect thymic end points, coexposure to topical permethrin and cUCA exacerbated the thymolytic effects of permethrin. The single topical dose of permethrin also depressed several immune responses in isolated splenic leukocytes. This included splenic T-cell proliferative response to mitogen, splenic macrophage hydrogen peroxide production, and splenic B lymphocyte-specific antibody production. Unlike the effect of coexposure to these agents on thymic end points, cUCA did not exacerbate permethrin's adverse effect on any of the splenic end points examined. These results appear to suggest divergent mechanisms by which these compounds affect precursor and functionally mature T cells. At the doses used in this study, permethrin caused neurotoxic effects, including lethality, in a portion of the mice. For undetermined reasons, cUCA significantly increased the rate of lethality caused by permethrin. Although the permethrin doses used in this study exceed that typically used in human medicine, these results raise some concerns about the possibility that sunlight, via cUCA, may increase the risk of adverse central nervous system and immune effects caused by permethrin alone. PMID:12573947

  17. Jet-Induced Star Formation

    SciTech Connect

    van Breugel, W; Fragile, C; Anninos, P; Murray, S

    2003-12-16

    Jets from radio galaxies can have dramatic effects on the medium through which they propagate. We review observational evidence for jet-induced star formation in low ('FR-I') and high ('FR-II') luminosity radio galaxies, at low and high redshifts respectively. We then discuss numerical simulations which are aimed to explain a jet-induced starburst ('Minkowski's Object') in the nearby FR-I type radio galaxy NGC 541. We conclude that jets can induce star formation in moderately dense (10 cm{sup -3}), warm (10{sup 4} K) gas; that this may be more common in the dense environments of forming, active galaxies; and that this may provide a mechanism for 'positive' feedback from AGN in the galaxy formation process.

  18. Validating induced seismicity forecast models—Induced Seismicity Test Bench

    NASA Astrophysics Data System (ADS)

    Király-Proag, Eszter; Zechar, J. Douglas; Gischig, Valentin; Wiemer, Stefan; Karvounis, Dimitrios; Doetsch, Joseph

    2016-08-01

    Induced earthquakes often accompany fluid injection, and the seismic hazard they pose threatens various underground engineering projects. Models to monitor and control induced seismic hazard with traffic light systems should be probabilistic, forward-looking, and updated as new data arrive. In this study, we propose an Induced Seismicity Test Bench to test and rank such models; this test bench can be used for model development, model selection, and ensemble model building. We apply the test bench to data from the Basel 2006 and Soultz-sous-Forêts 2004 geothermal stimulation projects, and we assess forecasts from two models: Shapiro and Smoothed Seismicity (SaSS) and Hydraulics and Seismics (HySei). These models incorporate a different mix of physics-based elements and stochastic representation of the induced sequences. Our results show that neither model is fully superior to the other. Generally, HySei forecasts the seismicity rate better after shut-in but is only mediocre at forecasting the spatial distribution. On the other hand, SaSS forecasts the spatial distribution better and gives better seismicity rate estimates before shut-in. The shut-in phase is a difficult moment for both models in both reservoirs: the models tend to underpredict the seismicity rate around, and shortly after, shut-in.

  19. Drug-induced hair loss.

    PubMed

    2016-05-01

    Hair loss can have major psychological consequences. It can be due to a wide variety of causes, including hormonal disorders, dietary factors, infections, inflammation, trauma, emotional factors, and cancer. Drugs can also induce hair loss, by interacting with the hair growth cycle. Drug-induced hair loss may be immediate or delayed, sudden or gradual, and diffuse or localised. It is usually reversible after drug discontinuation. The drugs most often implicated in hair loss are anticancer agents, interferon, azole antifungals, lithium, immunosuppressants, and many other drugs belonging to a variety of pharmacological classes. PMID:27280198

  20. Drug-induced hair loss.

    PubMed

    2016-05-01

    Hair loss can have major psychological consequences. It can be due to a wide variety of causes, including hormonal disorders, dietary factors, infections, inflammation, trauma, emotional factors, and cancer. Drugs can also induce hair loss, by interacting with the hair growth cycle. Drug-induced hair loss may be immediate or delayed, sudden or gradual, and diffuse or localised. It is usually reversible after drug discontinuation. The drugs most often implicated in hair loss are anticancer agents, interferon, azole antifungals, lithium, immunosuppressants, and many other drugs belonging to a variety of pharmacological classes.

  1. Cefixime-induced oculogyric crisis.

    PubMed

    Bayram, Erhan; Bayram, Meral Torun; Hiz, Semra; Turkmen, Mehmet

    2012-01-01

    Oculogyric crisis is a neurologic adverse event characterized by bilateral dystonic, usually upward, conjugate eye deviations. Cefixime is a third-generation cephalosporin and is widely used in clinical practice in childhood. Confusion, encephalopathy, coma, myoclonus, nonconvulsive status epilepticus, and seizures have been described with the use of cephalosporins. We presented a cefixime-induced oculogyric crisis in a 7-year-old boy during the treatment of urinary tract infection, and this is the first case of cefixime-induced oculogyric crisis whose ocular symptoms gradually disappeared within 48 hours after the drug was discontinued.

  2. Plasma rotation induced by RF

    SciTech Connect

    Chan, V. S.; Chiu, S. C.; Lin-Liu, Y. R. [General Atomics, P.O. Box 85608, San Diego, California 92186-5698; Omelchenko, Y. A. [General Atomics, P.O. Box 85608, San Diego, California 92186-5698

    1999-09-20

    Plasma rotation has many beneficial effects on tokamak operation including stabilization of MHD and microturbulence to improve the beta limit and confinement. Contrary to present-day tokamaks, neutral beams may not be effective in driving rotation in fusion reactors; hence the investigation of radiofrequency (RF) induced plasma rotation is of great interest and potential importance. This paper reviews the experimental results of RF induced rotation and possible physical mechanisms, suggested by theories, to explain the observations. This subject is only in the infancy of its research and many challenging issues remained to be understood and resolved. (c) 1999 American Institute of Physics.

  3. Method for induced polarization logging

    SciTech Connect

    Vinegar, H.J.; Waxman, M.H.

    1987-04-14

    A method is described for generating a log of the formation phase shift, resistivity and spontaneous potential of an earth formation from data obtained from the earth formation with a multi-electrode induced polarization logging tool. The method comprises obtaining data samples from the formation at measurement points equally spaced in time of the magnitude and phase of the induced voltage and the magnitude and phase of the current supplied by a circuit through a reference resistance R/sub 0/ to a survey current electrode associated with the tool.

  4. An induced junction photovoltaic cell

    NASA Technical Reports Server (NTRS)

    Call, R. L.

    1974-01-01

    Silicon solar cells operating with induced junctions rather than diffused junctions have been fabricated and tested. Induced junctions were created by forming an inversion layer near the surface of the silicon by supplying a sheet of positive charge above the surface. Measurements of the response of the inversion layer cell to light of different wavelengths indicated it to be more sensitive to the shorter wavelengths of the sun's spectrum than conventional cells. The greater sensitivity occurs because of the shallow junction and the strong electric field at the surface.

  5. Induced radioactivity in LDEF components

    NASA Technical Reports Server (NTRS)

    Harmon, B. A.; Fishman, G. J.; Parnell, T. A.; Laird, C. E.

    1992-01-01

    A systematic study of the induced radioactivity of the Long Duration Exposure Facility (LDEF) is being carried out in order to gather information about the low earth orbit radiation environment and its effects on materials. The large mass of the LDEF spacecraft, its stabilized configuration, and long mission duration have presented an opportunity to determine space radiation-induced radioactivities with a precision not possible before. Data presented include preliminary activities for steel and aluminum structural samples, and activation subexperiment foils. Effects seen in the data show a clear indication of the trapped proton anisotropy in the South Atlantic Anomaly and suggest contributions from different sources of external radiation fluxes.

  6. Induced activation in accelerator components

    NASA Astrophysics Data System (ADS)

    Bungau, Cristian; Bungau, Adriana; Cywinski, Robert; Barlow, Roger; Edgecock, Thomas Robert; Carlsson, Patrick; Danared, Hâkan; Mezei, Ferenc; Holm, Anne Ivalu Sander; Møller, Søren Pape; Thomsen, Heine Dølrath

    2014-08-01

    The residual activity induced in particle accelerators is a serious issue from the point of view of radiation safety as the long-lived radionuclides produced by fast or moderated neutrons and impact protons cause problems of radiation exposure for staff involved in the maintenance work and when decommissioning the facility. This paper presents activation studies of the magnets and collimators in the High Energy Beam Transport line of the European Spallation Source due to the backscattered neutrons from the target and also due to the direct proton interactions and their secondaries. An estimate of the radionuclide inventory and induced activation are predicted using the GEANT4 code.

  7. Anaphylaxis induced by lentil inhalation.

    PubMed

    Ayşenur, Kaya; Akan, Ayşegül; Mustafa, Erkoçoğlu; Müge, Toyran; Kocabaş, Can Naci

    2012-06-01

    Anaphylaxis is a rapid onset serious allergic reaction which may be fatal. Foods are the most common allergens leading to anaphylaxis especially for childhood. Most of the food-induced anaphylactic reactions take place after ingestion of the allergic food and only a few cases exist with anaphylactic reactions induced by inhalation of foods such as peanut, soybean and lupine. The case we present is unusual in that an 8 1/2-year-old boy developed anaphylaxis with the inhalation of steam from boiling lentils.

  8. Propylthiouracil-induced alveolar hemorrhage

    PubMed Central

    Aydın, Bünyamin; Aksu, Oğuzhan; Kacemer, Hasret; Demirkan, Halil; Altuntaş, Atilla; Dirican, Nigar; Köroğlu, Banu Kale; Şahin, Mehmet

    2015-01-01

    Thionamide induced vasculitis is a multisystem disease. The patients may present with different clinical signs and findings due to organ involvement. These patients are almost always perinuclear antineutrophil cytoplasmic antibody (pANCA) or antimyeloperoxidase (MPO) positive. Clinical findings are not seen in all of the patients who are ANCA positive while using thionamide. Although symptoms usually resolve with drug discontinuation, some patients, however, require high-dose steroids, immunosuppressants, or plasmapheresis. We present here a case of alveolar hemorrhage induced by propilthiouracil (PTU) during treatment with PTU for Graves’ disease; patients completely recovered with corticosteroid, cyclophosphamide, and plasmapheresis.

  9. Mold-induced hypersensitivity pneumonitis.

    PubMed

    Greenberger, Paul A

    2004-01-01

    Mold-induced hypersensitivity pneumonitis results from macrophage- and lymphocyte-driven inflammation, which may be attributable to contaminated humidifiers or heating-ventilation systems or sources in homes, schools, or workplaces. A case may be suspected when there is water intrusion or inadequate drainage. Some fungal causes include species of Alternaria, Aspergillus, Cryptostroma, Penicillium, Pullularia, Rhodotorula, and Trichosporon. The differential diagnosis includes mold-induced asthma, sick building syndrome, mass psychogenic illness (epidemic hysteria), unjustified fears of "toxic" molds, and conditions causing recurrent pneumonitis. PMID:15510579

  10. 'Popper'-induced vision loss.

    PubMed

    Krilis, Matthew; Thompson, Julia; Atik, Alp; Lusthaus, Jed; Jankelowitz, Stacey

    2013-05-01

    Amyl nitrite 'poppers' are recreational drugs, which are a potent source of nitric oxide. The use of 'poppers' can cause psychoactive stimulation, reduced blood pressure, tachycardia and involuntary muscle relaxation. Their use is becoming increasingly common around the world, including approximately 60% of Australia's male homosexual community. We report the first case of 'popper'-induced vision loss in Australasia.

  11. Eosinophilic pneumonia induced by daptomycin.

    PubMed

    Hayes, Don; Anstead, Michael I; Kuhn, Robert J

    2007-04-01

    We present a case of drug-induced eosinophilic pneumonia resulting from intravenous daptomycin being used as therapy for recurrent methicillin-sensitive Staphlococcus aureus endocarditis. The patient developed hypoxic respiratory failure requiring intubation and mechanical ventilation. Daptomycin therapy was discontinued immediately, and the patient improved significantly after the administration of intravenous corticosteroids allowing for extubation 3 days later.

  12. Induced geometry from disformal transformation

    NASA Astrophysics Data System (ADS)

    Yuan, Fang-Fang; Huang, Peng

    2015-05-01

    In this note, we use the disformal transformation to induce a geometry from the manifold which is originally Riemannian. The new geometry obtained here can be considered as a generalization of Weyl integrable geometry. Based on these results, we further propose a geometry which is naturally a generalization of Weyl geometry.

  13. Toxic encephalopathy induced by capecitabine.

    PubMed

    Niemann, B; Rochlitz, C; Herrmann, R; Pless, M

    2004-01-01

    Toxic encephalopathy is a rarely described side effect of 5-fluorouracil which usually presents with cerebellar, neuropsychiatric, and focal neurological symptoms. Magnetic resonance imaging findings are described as patchy white matter alterations. We report the 1st case of capecitabine-induced toxic encephalopathy with epilepsy-like symptoms and diffuse white matter alterations on magnetic resonance imaging.

  14. Multiple Induced Abortions: Danish Experience.

    ERIC Educational Resources Information Center

    Osler, Mogens; David, Henry P.; Morgall, Janine M.

    1997-01-01

    Women having an induced abortion in an urban clinic were studied. First, second, and third time aborters (N=150) were interviewed. Variables including reasons for choosing abortion, life situations, contraceptive risk-taking, and ease of becoming pregnant were examined. Related studies and suggestions for postabortion counseling are discussed.…

  15. Adrafinil-induced orofacial dyskinesia.

    PubMed

    Thobois, Stéphane; Xie, Jing; Mollion, Helena; Benatru, Isabelle; Broussolle, Emmanuel

    2004-08-01

    We describe the first case of orofacial abnormal movements induced by adrafinil, a vigilance promoting agent of the same pharmacological class as modafinil. The dyskinesias did not spontaneously recover despite adrafinil withdrawal for a 4-month period. They were secondly dramatically improved by tetrabenazine, a presynaptic dopaminergic depleting drug which was introduced after the 4-month adrafinil-free period. PMID:15300665

  16. Adolescents and Exercise Induced Asthma

    ERIC Educational Resources Information Center

    Hansen, Pamela; Bickanse, Shanna; Bogenreif, Mike; VanSickle, Kyle

    2008-01-01

    This article defines asthma and exercise induced asthma, and provides information on the triggers, signs, and symptoms of an attack. It also gives treatments for these conditions, along with prevention guidelines on how to handle an attack in the classroom or on the practice field. (Contains 2 tables and 1 figure.)

  17. Static behaviour of induced seismicity

    NASA Astrophysics Data System (ADS)

    Mignan, Arnaud

    2016-04-01

    The standard paradigm to describe seismicity induced by fluid injection is to apply non-linear diffusion dynamics in a poroelastic medium. I show that the spatio-temporal behaviour and rate evolution of induced seismicity can, instead, be expressed by geometric operations on a static stress field produced by volume change at depth. I obtain laws similar in form to the ones derived from poroelasticity while requiring a lower description length. Although fluid flow is known to occur in the ground, it is not pertinent to the geometrical description of the spatio-temporal patterns of induced seismicity. The proposed model is equivalent to the static stress model for tectonic foreshocks generated by the Non-Critical Precursory Accelerating Seismicity Theory. This study hence verifies the explanatory power of this theory outside of its original scope and provides an alternative physical approach to poroelasticity for the modelling of induced seismicity. The applicability of the proposed geometrical approach is illustrated for the case of the 2006, Basel enhanced geothermal system stimulation experiment. Applicability to more problematic cases where the stress field may be spatially heterogeneous is also discussed.

  18. Radiation-induced genomic instability

    NASA Technical Reports Server (NTRS)

    Kronenberg, A.

    1994-01-01

    Quantitative assessment of the heritable somatic effects of ionizing radiation exposures has relied upon the assumption that radiation-induced lesions were 'fixed' in the DNA prior to the first postirradiation mitosis. Lesion conversion was thought to occur during the initial round of DNA replication or as a consequence of error-prone enzymatic processing of lesions. The standard experimental protocols for the assessment of a variety of radiation-induced endpoints (cell death, specific locus mutations, neoplastic transformation and chromosome aberrations) evaluate these various endpoints at a single snapshot in time. In contrast with the aforementioned approaches, some studies have specifically assessed radiation effects as a function of time following exposure. Evidence has accumulated in support of the hypothesis that radiation exposure induces a persistent destabilization of the genome. This instability has been observed as a delayed expression of lethal mutations, as an enhanced rate of accumulation of non-lethal heritable alterations, and as a progressive intraclonal chromosomal heterogeneity. The genetic controls and biochemical mechanisms underlying radiation-induced genomic instability have not yet been delineated. The aim is to integrate the accumulated evidence that suggests that radiation exposure has a persistent effect on the stability of the mammalian genome.

  19. Photobiomodulation on alcohol induced dysfunction

    NASA Astrophysics Data System (ADS)

    Yang, Zheng-Ping; Liu, Timon C.; Zhang, Yan; Wang, Yan-Fang

    2007-05-01

    Alcohol, which is ubiquitous today, is a major health concern. Its use was already relatively high among the youngest respondents, peaked among young adults, and declined in older age groups. Alcohol is causally related to more than 60 different medical conditions. Overall, 4% of the global burden of disease is attributable to alcohol, which accounts for about as much death and disability globally as tobacco and hypertension. Alcohol also promotes the generation of reactive oxygen species (ROS) and/or interferes with the body's normal defense mechanisms against these compounds through numerous processes, particularly in the liver. Photobiomodulation (PBM) is a cell-specific effect of low intensity monochromatic light or low intensity laser irradiation (LIL) on biological systems. The cellular effects of both alcohol and LIL are ligand-independent so that PBM might rehabilitate alcohol induced dysfunction. The PBM on alcohol induced human neutrophil dysfunction and rat chronic atrophic gastritis, the laser acupuncture on alcohol addiction, and intravascular PBM on alcoholic coma of patients and rats have been observed. The endonasal PBM (EPBM) mediated by Yangming channel, autonomic nervous systems and blood cells is suggested to treat alcohol induced dysfunction in terms of EPBM phenomena, the mechanism of alcohol induced dysfunction and our biological information model of PBM. In our opinion, the therapeutic effects of PBM might also be achieved on alcoholic myopathy.

  20. [Readers' position against induced abortion].

    PubMed

    1981-08-25

    Replies to the request by the Journal of Nursing on readers' positions against induced abortion indicate there is a definite personal position against induced abortion and the assistance in this procedure. Some writers expressed an emotional "no" against induced abortion. Many quoted arguments from the literature, such as a medical dictionary definition as "a premeditated criminally induced abortion." The largest group of writers quoted from the Bible, the tenor always being: "God made man, he made us with his hands; we have no right to make the decision." People with other philosophies also objected. Theosophical viewpoint considers reincarnation and the law of cause and effect (karma). This philosophy holds that induced abortion impedes the appearance of a reincarnated being. The fundamental question in the abortion problem is, "can the fetus be considered a human life?" The German anatomist Professor E. Bleckschmidt points out that from conception there is human life, hence the fertilized cell can only develop into a human being and is not merely a piece of tissue. Professional nursing interpretation is that nursing action directed towards killing of a human being (unborn child) is against the nature and the essence of the nursing profession. A different opinion states that a nurse cares for patients who have decided for the operation. The nurse doesn't judge but respects the individual's decision. Some proabortion viewpoints considered the endangering of the mother's life by the unborn child, and the case of rape. With the arguments against abortion the question arises how to help the woman with unwanted pregnancy. Psychological counseling is emphasized as well as responsible and careful assistance. Referral to the Society for Protection of the Unborn Child (VBOK) is considered as well as other agencies. Further reader comments on this subject are solicited. PMID:6913282

  1. An inducible offense: carnivore morph tadpoles induced by tadpole carnivory

    PubMed Central

    Levis, Nicholas A; de la Serna Buzón, Sofia; Pfennig, David W

    2015-01-01

    Phenotypic plasticity is commonplace, and plasticity theory predicts that organisms should often evolve mechanisms to detect and respond to environmental cues that accurately predict future environmental conditions. Here, we test this prediction in tadpoles of spadefoot toads, Spea multiplicata. These tadpoles develop into either an omnivore ecomorph, which is a dietary generalist, or a carnivore ecomorph, which specializes on anostracan shrimp and other tadpoles. We investigated a novel proximate cue – ingestion of Scaphiopus tadpoles – and its propensity to produce carnivores by rearing tadpoles on different diets. We found that diets containing tadpoles from the genus Scaphiopus produced more carnivores than diets without Scaphiopus tadpoles. We discuss why Scaphiopus tadpoles are an excellent food source and why it is therefore advantageous for S. multiplicata tadpoles to produce an inducible offense that allows them to better utilize this resource. In general, such inducible offenses provide an excellent setting for investigating the proximate and evolutionary basis of phenotypic plasticity. PMID:25897380

  2. Distinguishing warming-induced drought from drought-induced warming

    NASA Astrophysics Data System (ADS)

    Roderick, M. L.; Yin, D.

    2015-12-01

    It is usually observed that temperatures, especially maximum temperatures are higher during drought. A very widely held public perception is that the increase in temperature is a cause of drought. This represents the warming-induced drought scenario. However, the agricultural and hydrologic scientific communities have a very different interpretation with drought being the cause of increasing temperature. In essence, those communities assume the warming is a surface feedback and their interpretation is for drought-induced warming. This is a classic cause-effect problem that has resisted definitive explanation due to the lack of radiative observations at suitable spatial and temporal scales. In this presentation we first summarise the observations and then use theory to untangle the cause-effect relationships that underlie the competing interpretations. We then show how satellite data (CERES, NASA) can be used to disentangle the cause-effect relations.

  3. Does a parthenogenesis-inducing Wolbachia induce vestigial cytoplasmic incompatibility?

    NASA Astrophysics Data System (ADS)

    Kraaijeveld, Ken; Reumer, Barbara M.; Mouton, Laurence; Kremer, Natacha; Vavre, Fabrice; van Alphen, Jacques J. M.

    2011-03-01

    Wolbachia is a maternally inherited bacterium that manipulates the reproduction of its host. Recent studies have shown that male-killing strains can induce cytoplasmic incompatibility (CI) when introgressed into a resistant host. Phylogenetic studies suggest that transitions between CI and other Wolbachia phenotypes have also occurred frequently, raising the possibility that latent CI may be widespread among Wolbachia. Here, we investigate whether a parthenogenesis-inducing Wolbachia strain can also induce CI. Parthenogenetic females of the parasitoid wasp Asobara japonica regularly produce a small number of males that may be either infected or not. Uninfected males were further obtained through removal of the Wolbachia using antibiotics and from a naturally uninfected strain. Uninfected females that had mated with infected males produced a slightly, but significantly more male-biased sex ratio than uninfected females that had mated with uninfected males. This effect was strongest in females that mated with males that had a relatively high Wolbachia titer. Quantitative PCR indicated that infected males did not show higher ratios of nuclear versus mitochondrial DNA content. Wolbachia therefore does not cause diploidization of cells in infected males. While these results are consistent with CI, other alternatives such as production of abnormal sperm by infected males cannot be completely ruled out. Overall, the effect was very small (9%), suggesting that if CI is involved it may have degenerated through the accumulation of mutations.

  4. Fluid injection and induced seismicity

    NASA Astrophysics Data System (ADS)

    Kendall, Michael; Verdon, James

    2016-04-01

    The link between fluid injection, or extraction, and induced seismicity has been observed in reservoirs for many decades. In fact spatial mapping of low magnitude events is routinely used to estimate a stimulated reservoir volume. However, the link between subsurface fluid injection and larger felt seismicity is less clear and has attracted recent interest with a dramatic increase in earthquakes associated with the disposal of oilfield waste fluids. In a few cases, hydraulic fracturing has also been linked to induced seismicity. Much can be learned from past case-studies of induced seismicity so that we can better understand the risks posed. Here we examine 12 case examples and consider in particular controls on maximum event size, lateral event distributions, and event depths. Our results suggest that injection volume is a better control on maximum magnitude than past, natural seismicity in a region. This might, however, simply reflect the lack of baseline monitoring and/or long-term seismic records in certain regions. To address this in the UK, the British Geological Survey is leading the deployment of monitoring arrays in prospective shale gas areas in Lancashire and Yorkshire. In most cases, seismicity is generally located in close vicinity to the injection site. However, in some cases, the nearest events are up to 5km from the injection point. This gives an indication of the minimum radius of influence of such fluid injection projects. The most distant events are never more than 20km from the injection point, perhaps implying a maximum radius of influence. Some events are located in the target reservoir, but most occur below the injection depth. In fact, most events lie in the crystalline basement underlying the sedimentary rocks. This suggests that induced seismicity may not pose a leakage risk for fluid migration back to the surface, as it does not impact caprock integrity. A useful application for microseismic data is to try and forecast induced seismicity

  5. Coherent-state-induced transparency

    NASA Astrophysics Data System (ADS)

    Gogyan, A.; Malakyan, Yu.

    2016-04-01

    We examine electromagnetically induced transparency (EIT) in an ensemble of cold Λ -type atoms induced by a quantum control field in multimode coherent states and compare it with the transparency created by the classical light of the same intensity. We show that the perfect coincidence is achieved only in the case of a single-mode coherent state, whereas the transparency sharply decreases, when the number of the modes exceeds the mean number of control photons in the medium. The origin of the effect is the modification of photon statistics in the control field with increasing the number of the modes that weakens its interaction with atoms resulting in a strong probe absorption. For the same reason, the probe pulse transforms from EIT-based slow light into superluminal propagation caused by the absorption.

  6. Paramagnetically induced gapful topological superconductors

    NASA Astrophysics Data System (ADS)

    Daido, Akito; Yanase, Youichi

    2016-08-01

    We propose a generic scenario for realizing gapful topological superconductors (TSCs) from gapless spin-singlet superconductors (SCs). Noncentrosymmetric nodal SCs in two dimensions are shown to be gapful under a Zeeman field, as a result of the cooperation of inversion-symmetry breaking and time-reversal-symmetry breaking. In particular, non-s -wave SCs acquire a large excitation gap. Such paramagnetically induced gapful SCs may be classified into TSCs in the symmetry class D specified by the Chern number. We show nontrivial Chern numbers over a wide parameter range for spin-singlet SCs. A variety of the paramagnetically induced gapful TSCs are demonstrated, including D +p -wave TSC, extended S +p -wave TSC, p +D +f -wave TSC, and s +P -wave TSC. Natural extension toward three-dimensional Weyl SCs is also discussed.

  7. Methadone Induced Sensorineural Hearing Loss

    PubMed Central

    Saifan, Chadi; Barakat, Iskandar; El-Sayegh, Suzanne

    2013-01-01

    Background. Sudden sensorineural hearing loss (SSHL) caused by opiate abuse or overuse has been well documented in the medical literature. Most documented case reports have involved either heroin or hydrocodone/acetaminophen. Recently, case reposts of methadone induced SSHL have been published. Case Report. We present the case of a 31-year-old man who developed SSHL after a methadone overdose induced stupor. He was subsequently restarted on methadone at his regular dose. On follow-up audiometry exams, he displayed persistent moderately severe sensorineural hearing loss bilaterally. Discussion. This case is notable because unlike all but one previously reported case, the patient—who was restated on methadone—did not make a complete recovery. Conclusion. Methadone overuse in rare cases causes SSHL. PMID:23983704

  8. Dipole-Induced Electromagnetic Transparency

    NASA Astrophysics Data System (ADS)

    Puthumpally-Joseph, Raiju; Sukharev, Maxim; Atabek, Osman; Charron, Eric

    2014-10-01

    We determine the optical response of a thin and dense layer of interacting quantum emitters. We show that, in such a dense system, the Lorentz redshift and the associated interaction broadening can be used to control the transmission and reflection spectra. In the presence of overlapping resonances, a dipole-induced electromagnetic transparency (DIET) regime, similar to electromagnetically induced transparency (EIT), may be achieved. DIET relies on destructive interference between the electromagnetic waves emitted by quantum emitters. Carefully tuning material parameters allows us to achieve narrow transmission windows in, otherwise, completely opaque media. We analyze in detail this coherent and collective effect using a generalized Lorentz model and show how it can be controlled. Several potential applications of the phenomenon, such as slow light, are proposed.

  9. Drug-induced hepatic steatosis.

    PubMed

    Amacher, David E; Chalasani, Naga

    2014-05-01

    Several drugs have been associated with the potential for drug-induced hepatic steatosis (DIHS) and/or phospholipidosis (DIPL), a lysosomal storage disorder. Drug-induced hepatic steatosis is generally a chronic but reversible affliction and may involve drug accumulation in the liver. Fat accumulation may be either macrovesicular or microvesicular in nature. Commonly used medications associated with DIHS include amiodarone, valproate, tamoxifen, methotrexate, and some chemotherapeutic and antiretroviral agents. Two recently approved medications for the treatment of hereditary homozygous hypercholesterolemia have also been noted to cause hepatic steatosis. For some compounds such as methotrexate and tamoxifen, the underlying metabolic risk factors such as obesity and metabolic syndrome may exacerbate their potential to cause DIHS and its progression. In this article, the authors discuss the preclinical screening and mechanisms of DIHS and DIPL, and review specific examples of drugs commonly used in clinical practice that are known to cause DIHS. PMID:24879984

  10. Chlorine-induced cardiopulmonary injury.

    PubMed

    Carlisle, Matthew; Lam, Adam; Svendsen, Erik R; Aggarwal, Saurabh; Matalon, Sadis

    2016-06-01

    Chlorine (Cl2 ) is utilized worldwide for a diverse range of industrial applications, including pulp bleaching, sanitation, and pharmaceutical development. Though Cl2 has widespread use, little is known regarding the mechanisms of toxicity associated with Cl2 exposure, which occurs during industrial accidents or acts of terrorism. Previous instances of Cl2 exposure have led to reported episodes of respiratory distress that result in high morbidity and mortality. Furthermore, studies suggest that acute Cl2 exposure also results in systemic vascular injury and subsequent myocardial contractile dysfunction. Here, we review both lung and cardiac pathology associated with acute Cl2 inhalation and discuss recently published data that suggest that mitochondrial dysfunction underlies the pathogenesis of Cl2 -induced toxicity. Last, we discuss our findings that suggest that upregulation of autophagy protects against Cl2 -induced lung inflammation and can be a potential therapeutic target for ameliorating the toxic effects of Cl2 exposure. PMID:27303906

  11. Flow-induced vibrations-1987

    SciTech Connect

    Au-Yang, M.K.; Chen, S.S.

    1987-01-01

    This book contains 20 selections. Some of the titles are: Acoustic resonance in heat exchanger tube bundles--Part 1. Physical nature of the phenomenon; Theoretical and experimental studies on heat exchanger U-bend tube bundle vibration characteristics; Experimental model analysis of metallic pipeline conveying fluid; Leakage flow-induced vibration of an eccentric tube-in-tube slip joint; and A study on the vibrations of pipelines caused by internal pulsating flows.

  12. Acoustically-Induced Electrical Signals

    NASA Astrophysics Data System (ADS)

    Brown, S. R.

    2014-12-01

    We have observed electrical signals excited by and moving along with an acoustic pulse propagating in a sandstone sample. Using resonance we are now studying the characteristics of this acousto-electric signal and determining its origin and the controlling physical parameters. Four rock samples with a range of porosities, permeabilities, and mineralogies were chosen: Berea, Boise, and Colton sandstones and Austin Chalk. Pore water salinity was varied from deionized water to sea water. Ag-AgCl electrodes were attached to the sample and were interfaced to a 4-wire electrical resistivity system. Under computer control, the acoustic signals were excited and the electrical response was recorded. We see strong acoustically-induced electrical signals in all samples, with the magnitude of the effect for each rock getting stronger as we move from the 1st to the 3rd harmonics in resonance. Given a particular fluid salinity, each rock has its own distinct sensitivity in the induced electrical effect. For example at the 2nd harmonic, Berea Sandstone produces the largest electrical signal per acoustic power input even though Austin Chalk and Boise Sandstone tend to resonate with much larger amplitudes at the same harmonic. Two effects are potentially responsible for this acoustically-induced electrical response: one the co-seismic seismo-electric effect and the other a strain-induced resistivity change known as the acousto-electric effect. We have designed experimental tests to separate these mechanisms. The tests show that the seismo-electric effect is dominant in our studies. We note that these experiments are in a fluid viscosity dominated seismo-electric regime, leading to a simple interpretation of the signals where the electric potential developed is proportional to the local acceleration of the rock. Toward a test of this theory we have measured the local time-varying acoustic strain in our samples using a laser vibrometer.

  13. Cadmium-induced testicular injury

    SciTech Connect

    Siu, Erica R.; Mruk, Dolores D.; Porto, Catarina S.; Cheng, C. Yan

    2009-08-01

    Cadmium (Cd) is an environmental toxicant and an endocrine disruptor in humans and rodents. Several organs (e.g., kidney, liver) are affected by Cd and recent studies have illustrated that the testis is exceedingly sensitive to Cd toxicity. More important, Cd and other toxicants, such as heavy metals (e.g., lead, mercury) and estrogenic-based compounds (e.g., bisphenols) may account for the recent declining fertility in men among developed countries by reducing sperm count and testis function. In this review, we critically discuss recent data in the field that have demonstrated the Cd-induced toxicity to the testis is probably the result of interactions of a complex network of causes. This is likely to involve the disruption of the blood-testis barrier (BTB) via specific signal transduction pathways and signaling molecules, such as p38 mitogen-activated protein kinase (MAPK). We also summarize current studies on factors that confer and/or regulate the testis sensitivity to Cd, such as Cd transporters and metallothioneins, the impact of Cd on the testis as an endocrine disruptor and oxidative stress inducer, and how it may disrupt the Zn{sup 2+} and/or Ca{sup 2+} mediated cellular events. While much work is needed before a unified mechanistic pathway of Cd-induced testicular toxicity emerges, recent studies have helped to identify some of the likely mechanisms and/or events that take place during Cd-induced testis injury. Furthermore, some of the recent studies have shed lights on potential therapeutic or preventive approaches that can be developed in future studies by blocking or minimizing the destructive effects of Cd to testicular function in men.

  14. Cadmium-induced testicular injury.

    PubMed

    Siu, Erica R; Mruk, Dolores D; Porto, Catarina S; Cheng, C Yan

    2009-08-01

    Cadmium (Cd) is an environmental toxicant and an endocrine disruptor in humans and rodents. Several organs (e.g., kidney, liver) are affected by Cd and recent studies have illustrated that the testis is exceedingly sensitive to Cd toxicity. More important, Cd and other toxicants, such as heavy metals (e.g., lead, mercury) and estrogenic-based compounds (e.g., bisphenols) may account for the recent declining fertility in men among developed countries by reducing sperm count and testis function. In this review, we critically discuss recent data in the field that have demonstrated the Cd-induced toxicity to the testis is probably the result of interactions of a complex network of causes. This is likely to involve the disruption of the blood-testis barrier (BTB) via specific signal transduction pathways and signaling molecules, such as p38 mitogen-activated protein kinase (MAPK). We also summarize current studies on factors that confer and/or regulate the testis sensitivity to Cd, such as Cd transporters and metallothioneins, the impact of Cd on the testis as an endocrine disruptor and oxidative stress inducer, and how it may disrupt the Zn(2+) and/or Ca(2+) mediated cellular events. While much work is needed before a unified mechanistic pathway of Cd-induced testicular toxicity emerges, recent studies have helped to identify some of the likely mechanisms and/or events that take place during Cd-induced testis injury. Furthermore, some of the recent studies have shed lights on potential therapeutic or preventive approaches that can be developed in future studies by blocking or minimizing the destructive effects of Cd to testicular function in men. PMID:19236889

  15. Amisulpride for clozapine induced sialorrhea.

    PubMed

    Aggarwal, Ashish; Sharma, Dinesh Dutt

    2009-01-01

    Clozapine is an atypical and novel antipsychotic medication useful for patients with schizophrenia who are refractory to treatment. Its use is often associated with troublesome side effects like sialorrhea, sedation, weight gain, enuresis, dizziness, besides life threatening side effects like agranulocytosis. Drug treatments used for Clozapine induced sialorrhea (CIS) like anticholinergic drugs and alpha 2 receptor antagonists have their own added side effects. A case of CIS responding to low dose of Amisulpride is reported.

  16. Cadmium-induced Testicular Injury*

    PubMed Central

    Siu, Erica R.; Mruk, Dolores D.; Porto, Catarina S.; Cheng, C. Yan

    2009-01-01

    Cadmium (Cd) is an environmental toxicant and an endocrine disruptor in humans. Several organs (e.g., kidney, liver) are affected by Cd and recent studies have illustrated that the testis is exceedingly sensitive to Cd toxicity. More important, Cd and other toxicants, such as heavy metals (e.g., lead, mercury) and estrogenic-based compounds (e.g., bisphenols) may account for the recent declining fertility in men among developed countries by reducing sperm count and testis function. In this review, we critically discuss recent data in the field that have demonstrated the Cd-induced toxicity to the testis is probably the result of interactions of a complex network of causes. This is likely to involve the disruption of the blood-testis barrier (BTB) via specific signal transduction pathways and signaling molecules, such as p38 mitogen-activated protein kinase (MAPK). We also summarize current studies on factors that confer the testis sensitivity to Cd, such as Cd transporters and metallothioneins, and the impact of Cd on the testis as an endocrine disruptor, oxidative stress inducer and how it may disrupt the Zn+2 and/or Ca+2 mediated cellular events. While much work is needed before a unified mechanistic pathway of Cd-induced testicular toxicity is emerged, recent studies have helped to identify some of the likely mechanisms and/or events that take place during Cd-induced testis injury. Furthermore, some of the recent studies have shed lights on potential therapeutic or preventive approaches that can be developed in future studies by blocking or minimizing the destructive effects of Cd to testicular function in men. PMID:19236889

  17. Local Anesthetic-Induced Neurotoxicity

    PubMed Central

    Verlinde, Mark; Hollmann, Markus W.; Stevens, Markus F.; Hermanns, Henning; Werdehausen, Robert; Lirk, Philipp

    2016-01-01

    This review summarizes current knowledge concerning incidence, risk factors, and mechanisms of perioperative nerve injury, with focus on local anesthetic-induced neurotoxicity. Perioperative nerve injury is a complex phenomenon and can be caused by a number of clinical factors. Anesthetic risk factors for perioperative nerve injury include regional block technique, patient risk factors, and local anesthetic-induced neurotoxicity. Surgery can lead to nerve damage by use of tourniquets or by direct mechanical stress on nerves, such as traction, transection, compression, contusion, ischemia, and stretching. Current literature suggests that the majority of perioperative nerve injuries are unrelated to regional anesthesia. Besides the blockade of sodium channels which is responsible for the anesthetic effect, systemic local anesthetics can have a positive influence on the inflammatory response and the hemostatic system in the perioperative period. However, next to these beneficial effects, local anesthetics exhibit time and dose-dependent toxicity to a variety of tissues, including nerves. There is equivocal experimental evidence that the toxicity varies among local anesthetics. Even though the precise order of events during local anesthetic-induced neurotoxicity is not clear, possible cellular mechanisms have been identified. These include the intrinsic caspase-pathway, PI3K-pathway, and MAPK-pathways. Further research will need to determine whether these pathways are non-specifically activated by local anesthetics, or whether there is a single common precipitating factor. PMID:26959012

  18. Rosiglitazone-induced immune thrombocytopenia.

    PubMed

    Liu, Xiaojing; Huang, Tao; Sahud, Mervyn A

    2006-05-01

    Rosiglitazone is one of the members in the thiazolidinedione (TZD) class of anti-diabetic agents that have proven efficacy in the treatment of patients with type 2 diabetes. We studied serum from a patient who developed acute, severe thrombocytopenia after exposure to rosiglitazone maleate (Avandia) and proposed the mechanisms for rosiglitazone-induced thrombocytopenia. Tested by flow cytometry, the patient's serum was positive for rosiglitazone-induced antibody with the binding ratio of 5.93 (mean fluorescence intensity, MFI) in the presence of the patient's serum and rosiglitazone in a final concentration of 0.53 mmol/l. The antibody was found to bind both glycoprotein (GP) IIb-IIIa complex and GP Ib/IX complex by MAIPA assay using five different monoclonal antibodies (mAbs) against GP complexes Ib/IX, GPIIb/IIIa or GPIa/IIa. Immunoprecipitation studies showed that both GPIIb/IIIa and GP Ib/IX complex were precipitated by antibody in the presence, but not in the absence of rosiglitazone. These findings provide evidence that immune thrombocytopenia can be caused by sensitivity to the antidiabetic agent rosiglitazone maleate. This report documents the first case of rosiglitazone-induced immune thrombocytopenia. PMID:16702039

  19. Efficient treatment of induced dipoles

    PubMed Central

    Simmonett, Andrew C.; Pickard, Frank C.; Shao, Yihan; Cheatham, Thomas E.; Brooks, Bernard R.

    2015-01-01

    Most existing treatments of induced dipoles in polarizable molecular mechanics force field calculations use either the self-consistent variational method, which is solved iteratively, or the “direct” approximation that is non-iterative as a result of neglecting coupling between induced dipoles. The variational method is usually implemented using assumptions that are only strictly valid under tight convergence of the induced dipoles, which can be computationally demanding to enforce. In this work, we discuss the nature of the errors that result from insufficient convergence and suggest a strategy that avoids such problems. Using perturbation theory to reintroduce the mutual coupling into the direct algorithm, we present a computationally efficient method that combines the precision of the direct approach with the accuracy of the variational approach. By analyzing the convergence of this perturbation series, we derive a simple extrapolation formula that delivers a very accurate approximation to the infinite order solution at the cost of only a few iterations. We refer to the new method as extrapolated perturbation theory. Finally, we draw connections to our previously published permanent multipole algorithm to develop an efficient implementation of the electric field and Thole terms and also derive some necessary, but not sufficient, criteria that force field parameters must obey. PMID:26298123

  20. Induced radioactivity in LDEF components

    NASA Technical Reports Server (NTRS)

    Harmon, B. A.; Fishman, G. J.; Parnell, T. A.; Laird, C. E.

    1991-01-01

    The systematics of induced radioactivity on the Long Duration Exposure Facility (LDEF) were studied in a wide range of materials using low level background facilities for detection of gamma rays. Approx. 400 samples of materials processed from structural parts of the spacecraft, as well as materials from onboard experiments, were analyzed at national facilities. These measurements show the variety of radioisotopes that are produced with half-lives greater than 2 wks, most of which are characteristic of proton induced reactions above 20 MeV. For the higher activity, long lived isotopes, it was possible to map the depth and directional dependences of the activity. Due to the stabilized configuration of the LDEF, the induced radioactivity data clearly show contributions from the anisotropic trapped proton flux in the South Atlantic Anomaly. This effect is discussed, along with evidence for activation by galactic protons and thermal neutrons. The discovery of Be-7 was made on leading side parts of the spacecraft, although this was though not to be related to the in situ production of radioisotopes from external particle fluxes.