Science.gov

Sample records for chemically modified oligonucleotides

  1. Characterization of chemically modified oligonucleotides targeting a pathogenic mutation in human mitochondrial DNA.

    PubMed

    Tonin, Yann; Heckel, Anne-Marie; Dovydenko, Ilya; Meschaninova, Mariya; Comte, Caroline; Venyaminova, Alya; Pyshnyi, Dmitrii; Tarassov, Ivan; Entelis, Nina

    2014-05-01

    Defects in mitochondrial genome can cause a wide range of clinical disorders, mainly neuromuscular diseases. Most of the deleterious mitochondrial mutations are heteroplasmic, meaning that wild type and mutated forms of mtDNA coexist in the same cell. Therefore, a shift in the proportion between mutant and wild type molecules could restore mitochondrial functions. The anti-replicative strategy aims to induce such a shift in heteroplasmy by mitochondrial targeting specifically designed molecules in order to inhibit replication of mutant mtDNA. Recently, we developed mitochondrial RNA vectors that can be used to address anti-replicative oligoribonucleotides into human mitochondria and impact heteroplasmy level, however, the effect was mainly transient, probably due to a rapid degradation of RNA molecules. In the present study, we introduced various chemically modified oligonucleotides in anti-replicative RNAs. We show that the most important increase of anti-replicative molecules' lifetime can be achieved by using synthetic RNA-DNA chimerical molecules or by ribose 2'-O-methylation in nuclease-sensitive sites. The presence of inverted thymidine at 3' terminus and modifications of 2'-OH ribose group did not prevent the mitochondrial uptake of the recombinant molecules. All the modified oligonucleotides were able to anneal specifically with the mutant mtDNA fragment, but not with the wild-type one. Nevertheless, the modified oligonucleotides did not cause a significant effect on the heteroplasmy level in transfected transmitochondrial cybrid cells bearing a pathogenic mtDNA deletion, proving to be less efficient than non-modified RNA molecules.

  2. Chemical ligation of oligonucleotides using an electrophilic phosphorothioester

    PubMed Central

    Oikawa, Ryota; Hayakawa, Mayu; Takamori, Shono; Kimura, Yasuaki; Abe, Naoko; Tsuji, Genichiro; Matsuda, Akira; Shuto, Satoshi; Ito, Yoshihiro

    2017-01-01

    Abstract We developed a new approach for chemical ligation of oligonucleotides using the electrophilic phosphorothioester (EPT) group. A nucleophilic phosphorothioate group on oligonucleotides was converted into the EPT group by treatment with Sanger's reagent (1-fluoro-2,4-dinitrobenzene). EPT oligonucleotides can be isolated, stored frozen, and used for the ligation reaction. The reaction of the EPT oligonucleotide and an amino-modified oligonucleotide took place without any extra reagents at pH 7.0–8.0 at room temperature, and resulted in a ligation product with a phosphoramidate bond with a 39–85% yield. This method has potential uses in biotechnology and chemical biology. PMID:28520986

  3. Enhanced oligonucleotide-nanoparticle conjugate stability using thioctic acid modified oligonucleotides.

    PubMed

    Dougan, Jennifer A; Karlsson, Camilla; Smith, W Ewen; Graham, Duncan

    2007-01-01

    Metallic nanoparticles of gold functionalized with oligonucleotides conventionally use a terminal thiol modification and have been used in a wide range of applications. Although readily available, the oligonucleotide-nanoparticle conjugates prepared in this way suffer from a lack of stability when exposed to a variety of small molecules or elevated temperatures. If silver is used in place of gold then this lack of stability is even more pronounced. In this study we report the synthesis of highly stabilized oligonucleotide-nanoparticle conjugates using a simple oligonucleotide modification. A modified solid support was used to generate 3'-thioctic acid modified oligonucleotides by treatment with an N-hydroxysuccimidyl ester of thioctic acid. Unusually, both gold and silver nanoparticles have been investigated in this study and show that these disulphide-modified oligonucleotide probes offer significant improvements in nanoparticle stability when treated with dithiothreitol (DTT) compared with monothiol analogues. This is a significant advance in oligonucleotide-nanoparticle conjugate stability and for the first time allows silver nanoparticles to be prepared that are more stable than standard gold-thiol functionalized nanoparticles. This opens up the possibility of using silver nanoparticles functionalized with oligonucleotides as an alternative to gold.

  4. 2'-modified nucleosides for site-specific labeling of oligonucleotides

    NASA Technical Reports Server (NTRS)

    Krider, Elizabeth S.; Miller, Jeremiah E.; Meade, Thomas J.

    2002-01-01

    We report the synthesis of 2'-modified nucleosides designed specifically for incorporating labels into oligonucleotides. Conversion of these nucleosides to phosphoramidite and solid support-bound derivatives proceeds in good yield. Large-scale synthesis of 11-mer oligonucleotides possessing the 2'-modified nucleosides is achieved using these derivatives. Thermal denaturation studies indicate that the presence of 2'-modified nucleosides in 11-mer duplexes has minimal destabilizing effects on the duplex structure when the nucleosides are placed at the duplex termini. The powerful combination of phosphoramidite and support-bound derivatives of 2'-modified nucleosides affords the large-scale preparation of an entirely new class of oligonucleotides. The ability to synthesize oligonucleotides containing label attachment sites at 3', intervening, and 5' locations of a duplex is a significant advance in the development of oligonucleotide conjugates.

  5. 2'-modified nucleosides for site-specific labeling of oligonucleotides

    NASA Technical Reports Server (NTRS)

    Krider, Elizabeth S.; Miller, Jeremiah E.; Meade, Thomas J.

    2002-01-01

    We report the synthesis of 2'-modified nucleosides designed specifically for incorporating labels into oligonucleotides. Conversion of these nucleosides to phosphoramidite and solid support-bound derivatives proceeds in good yield. Large-scale synthesis of 11-mer oligonucleotides possessing the 2'-modified nucleosides is achieved using these derivatives. Thermal denaturation studies indicate that the presence of 2'-modified nucleosides in 11-mer duplexes has minimal destabilizing effects on the duplex structure when the nucleosides are placed at the duplex termini. The powerful combination of phosphoramidite and support-bound derivatives of 2'-modified nucleosides affords the large-scale preparation of an entirely new class of oligonucleotides. The ability to synthesize oligonucleotides containing label attachment sites at 3', intervening, and 5' locations of a duplex is a significant advance in the development of oligonucleotide conjugates.

  6. Monitoring integrity and localization of modified single-stranded RNA oligonucleotides using ultrasensitive fluorescence methods

    PubMed Central

    Hadwiger, Philipp; Wagner, Ernst; Lamb, Don C.

    2017-01-01

    Short single-stranded oligonucleotides represent a class of promising therapeutics with diverse application areas. Antisense oligonucleotides, for example, can interfere with various processes involved in mRNA processing through complementary base pairing. Also RNA interference can be regulated by antagomirs, single-stranded siRNA and single-stranded microRNA mimics. The increased susceptibility to nucleolytic degradation of unpaired RNAs can be counteracted by chemical modification of the sugar phosphate backbone. In order to understand the dynamics of such single-stranded RNAs, we investigated their fate after exposure to cellular environment by several fluorescence spectroscopy techniques. First, we elucidated the degradation of four differently modified, dual-dye labeled short RNA oligonucleotides in HeLa cell extracts by fluorescence correlation spectroscopy, fluorescence cross-correlation spectroscopy and Förster resonance energy transfer. We observed that the integrity of the oligonucleotide sequence correlates with the extent of chemical modifications. Furthermore, the data showed that nucleolytic degradation can only be distinguished from unspecific effects like aggregation, association with cellular proteins, or intramolecular dynamics when considering multiple measurement and analysis approaches. We also investigated the localization and integrity of the four modified oligonucleotides in cultured HeLa cells using fluorescence lifetime imaging microscopy. No intracellular accumulation could be observed for unmodified oligonucleotides, while completely stabilized oligonucleotides showed strong accumulation within HeLa cells with no changes in fluorescence lifetime over 24 h. The integrity and accumulation of partly modified oligonucleotides was in accordance with their extent of modification. In highly fluorescent cells, the oligonucleotides were transported to the nucleus. The lifetime of the RNA in the cells could be explained by a balance between

  7. The effect of organic modifiers on electrospray ionization charge-state distribution and desorption efficiency for oligonucleotides.

    PubMed

    Chen, Buyun; Mason, Sadie F; Bartlett, Michael G

    2013-02-01

    The chemical composition of the solution has a critical impact on the electrospray desorption efficiency of oligonucleotides. Several physiochemical properties of various organic modifiers were investigated with respect to their role in the desorption process of oligonucleotides. The Henry's Law Constant, which reflects the volatility of alkylamines, was found to have a prominent effect on both the electrospray charge state distribution and desorption efficiency of oligonucleotides. Alkylamines with higher k(H,cc)(aq/gas) values such as hexylamine, piperidine, and imidazole reduced the charge state distribution by forming complexes with the oligonucleotide and dissociating from it in the gas phase, while alkylamines with extremely low k(H,cc)(aq/gas) values reduced the electrospray charge state distribution by facilitating ion emission at an earlier stage of the electrospray desorption process. Ion-pairing agents with moderate k(H,cc)(aq/gas) values do not alter the electrospray charge state distribution of oligonucleotides and their ability to enhance oligonucleotide ionization followed the order of decreasing k(H,cc)(aq/gas) values. The Henry's Law Constant also correlated to the impact of the acidic modifiers on oligonucleotide ionization efficiency. Ionization enhancement effects were observed with hexafluoroisopropanol, and this effect was attributed to its low k(H,cc)(aq/gas) and moderate acidity. The comprehensive effects of both alkylamine and hexafluoroisoproapnol on the electrospray ionization desorption of oligonucleotides were also evaluated, and acid-base equilibrium was found to play a critical role in determining these effects.

  8. Chemically programmed cell adhesion with membrane-anchored oligonucleotides

    PubMed Central

    Selden, Nicholas S.; Todhunter, Michael E.; Jee, Noel Y.; Liu, Jennifer S.; Broaders, Kyle E.; Gartner, Zev J.

    2012-01-01

    Cell adhesion organizes the structures of tissues and mediates their mechanical, chemical, and electrical integration with their surroundings. Here, we describe a strategy for chemically controlling cell adhesion using membrane anchored single-stranded DNA oligonucleotides. The reagents are pure chemical species prepared from phosphoramidites synthesized in a single chemical step from commercially available starting materials. The approach enables rapid, efficient, tunable cell adhesion, independent of proteins or glycans, by facilitating interactions with complementary labeled surfaces or other cells. We demonstrate the utility of this approach by imaging drug-induced changes in the membrane dynamics of non-adherent human cells while chemically immobilized on a passivated glass surface. PMID:22176556

  9. Synthesis of 3'-, or 5'-, or internal methacrylamido-modified oligonucleotides

    DOEpatents

    Golova, Julia B.; Chernov, Boris K.

    2010-04-27

    New modifiers were synthesized for incorporation of a methacrylic function in 3'-, 5'- and internal positions of oligonucleotides during solid phase synthesis. A modifier was used for synthesis of 5'-methacrylated oligonucleotides for preparation of microarrays by a co-polymerization method.

  10. DNA-mediated Electron Transfer in Naphthalene-modified Oligonucleotides

    PubMed Central

    Tanaka, Makiko; Elias, Benjamin; Barton, Jacqueline K.

    2010-01-01

    Novel naphthalene-modified oligonucleotides have been synthesized and characterized with respect to electron transfer chemistry. Using the Sonogashira-coupling reaction, naphthalene can be covalently anchored onto a modified uridine through an ethynyl linkage. This tethering allows for effective electronic coupling with the DNA bases, resulting in a significant red shift of the absorption bands of the naphthalenic chromophore. Modification with this chromophore does not appear to affect the overall stability and structure of the DNA. Upon selective irradiation of the naphthalene moiety at 340 nm, photoreduction of a distal electron trap, 5-bromouridine, embedded in the DNA base stack occurs. This DNA-mediated reduction from a distance was found to be significantly more efficient with substitution of 5-bromouridine towards the 5′-end than towards the 3′-end. These results support a general preference for electron transfer through DNA towards the 5′-end, irrespective of the donor. In addition, differences in efficiency of photoreduction through intrastrand and interstrand pathways are observed. For DNA-mediated reduction, as with DNA-mediated oxidation, significant differences in the charge transfer reaction are apparent that depend upon subtle differences in coupling into the DNA base stack. PMID:20297784

  11. Drop drying on surfaces determines chemical reactivity - the specific case of immobilization of oligonucleotides on microarrays

    PubMed Central

    2013-01-01

    Background Drop drying is a key factor in a wide range of technical applications, including spotted microarrays. The applied nL liquid volume provides specific reaction conditions for the immobilization of probe molecules to a chemically modified surface. Results We investigated the influence of nL and μL liquid drop volumes on the process of probe immobilization and compare the results obtained to the situation in liquid solution. In our data, we observe a strong relationship between drop drying effects on immobilization and surface chemistry. In this work, we present results on the immobilization of dye labeled 20mer oligonucleotides with and without an activating 5′-aminoheptyl linker onto a 2D epoxysilane and a 3D NHS activated hydrogel surface. Conclusions Our experiments identified two basic processes determining immobilization. First, the rate of drop drying that depends on the drop volume and the ambient relative humidity. Oligonucleotides in a dried spot react unspecifically with the surface and long reaction times are needed. 3D hydrogel surfaces allow for immobilization in a liquid environment under diffusive conditions. Here, oligonucleotide immobilization is much faster and a specific reaction with the reactive linker group is observed. Second, the effect of increasing probe concentration as a result of drop drying. On a 3D hydrogel, the increasing concentration of probe molecules in nL spotting volumes accelerates immobilization dramatically. In case of μL volumes, immobilization depends on whether the drop is allowed to dry completely. At non-drying conditions, very limited immobilization is observed due to the low oligonucleotide concentration used in microarray spotting solutions. The results of our study provide a general guideline for microarray assay development. They allow for the initial definition and further optimization of reaction conditions for the immobilization of oligonucleotides and other probe molecule classes to different

  12. Effect of 2′-O-methyl/thiophosphonoacetate-modified antisense oligonucleotides on huntingtin expression in patient-derived cells

    PubMed Central

    Matsui, Masayuki; Threlfall, Richard N; Caruthers, Marvin H; Corey, David R

    2014-01-01

    ABSTRACT Optimizing oligonucleotides as therapeutics will require exploring how chemistry can be used to enhance their effects inside cells. To achieve this goal it will be necessary to fully explore chemical space around the native DNA/RNA framework to define the potential of diverse chemical modifications. In this report we examine the potential of thiophosphonoacetate (thioPACE)-modified 2′-O-methyl oligoribonucleotides as inhibitors of human huntingtin (HTT) expression. Inhibition occurred, but was less than with analogous locked nucleic acid (LNA)-substituted oligomers lacking the thioPACE modification. These data suggest that thioPACE oligonucleotides have the potential to control gene expression inside cells. However, advantages relative to other modifications were not demonstrated. Additional modifications are likely to be necessary to fully explore any potential advantages of thioPACE substitutions. PMID:26865404

  13. Inhibition Of Molecular And Biological Processes Using Modified Oligonucleotides

    DOEpatents

    Kozyavkin, Sergei A.; Malykh, Andrei G.; Polouchine, Nikolai N.; Slesarev, Alexei I.

    2003-04-15

    A method of inhibiting at least one molecular process in a sample, comprising administering to the sample an oligonucleotide or polynucleotide containing at least one monomeric unit having formula (I): wherein A is an organic moiety, n is at least 1, and each X is independently selected from the group consisting of --NRCOCONu, --NHCOCR.sub.2 CR.sub.2 CONu, --NHCOCR.dbd.CRCONu, and --NHCOSSCONu, wherein each R independently represents H or a substituted or unsubstituted alkyl group, and Nu represents a nucleophile, or a salt of the compound.

  14. Enhanced oligonucleotide–nanoparticle conjugate stability using thioctic acid modified oligonucleotides

    PubMed Central

    Dougan, Jennifer A.; Karlsson, Camilla; Smith, W. Ewen; Graham, Duncan

    2007-01-01

    Metallic nanoparticles of gold functionalized with oligonucleotides conventionally use a terminal thiol modification and have been used in a wide range of applications. Although readily available, the oligonucleotide–nanoparticle conjugates prepared in this way suffer from a lack of stability when exposed to a variety of small molecules or elevated temperatures. If silver is used in place of gold then this lack of stability is even more pronounced. In this study we report the synthesis of highly stabilized oligonucleotide–nanoparticle conjugates using a simple oligonucleotide modification. A modified solid support was used to generate 3′-thioctic acid modified oligonucleotides by treatment with an N-hydroxysuccimidyl ester of thioctic acid. Unusually, both gold and silver nanoparticles have been investigated in this study and show that these disulphide-modified oligonucleotide probes offer significant improvements in nanoparticle stability when treated with dithiothreitol (DTT) compared with monothiol analogues. This is a significant advance in oligonucleotide–nanoparticle conjugate stability and for the first time allows silver nanoparticles to be prepared that are more stable than standard gold-thiol functionalized nanoparticles. This opens up the possibility of using silver nanoparticles functionalized with oligonucleotides as an alternative to gold. PMID:17488844

  15. 2-O-[2-(Methylthio)ethyl]-Modified Oligonucleotide: An Analog of 2-O-[2-(Methoxy)ethyl]-Modified Oligonucleotide with Improved Protein Binding Properties and High Binding Affinity to Target RNA

    SciTech Connect

    Prakash, T.P.; Manoharan, M.; Fraser, A.S.; Kawasaki, A.M.; Lesnik, E.; Sioufi, N.; Leeds, J.M.; Teplova, M.; Egli, M.

    2010-03-08

    A novel 2'-modification, 2'-O-[2-(methylthio)ethyl] or 2'-O-MTE, has been incorporated into oligonucleotides and evaluated for properties relevant to antisense activity. The results were compared with the previously characterized 2'-O-[2-(methoxy)ethyl] 2'-O-MOE modification. As expected, the 2'-O-MTE modified oligonucleotides exhibited improved binding to human serum albumin compared to the 2'-O-MOE modified oligonucleotides. The 2'-O-MTE oligonucleotides maintained high binding affinity to target RNA. Nuclease digestion of 2'-O-MTE oligonucleotides showed that they have limited resistance to exonuclease degradation. We analyzed the crystal structure of a decamer DNA duplex containing the 2'-O-MTE modifcation. Analysis of the crystal structure provides insight into the improved RNA binding affinity, protein binding affinity and limited resistance of 2'-O-MTE modified oligonucleotides to exonuclease degradation.

  16. Ribonuclease H1-dependent hepatotoxicity caused by locked nucleic acid-modified gapmer antisense oligonucleotides

    PubMed Central

    Kasuya, Takeshi; Hori, Shin-ichiro; Watanabe, Ayahisa; Nakajima, Mado; Gahara, Yoshinari; Rokushima, Masatomo; Yanagimoto, Toru; Kugimiya, Akira

    2016-01-01

    Gapmer antisense oligonucleotides cleave target RNA effectively in vivo, and is considered as promising therapeutics. Especially, gapmers modified with locked nucleic acid (LNA) shows potent knockdown activity; however, they also cause hepatotoxic side effects. For developing safe and effective gapmer drugs, a deeper understanding of the mechanisms of hepatotoxicity is required. Here, we investigated the cause of hepatotoxicity derived from LNA-modified gapmers. Chemical modification of gapmer’s gap region completely suppressed both knockdown activity and hepatotoxicity, indicating that the root cause of hepatotoxicity is related to intracellular gapmer activity. Gene silencing of hepatic ribonuclease H1 (RNaseH1), which catalyses gapmer-mediated RNA knockdown, strongly supressed hepatotoxic effects. Small interfering RNA (siRNA)-mediated knockdown of a target mRNA did not result in any hepatotoxic effects, while the gapmer targeting the same position on mRNA as does the siRNA showed acute toxicity. Microarray analysis revealed that several pre-mRNAs containing a sequence similar to the gapmer target were also knocked down. These results suggest that hepatotoxicity of LNA gapmer is caused by RNAseH1 activity, presumably because of off-target cleavage of RNAs inside nuclei. PMID:27461380

  17. Sequence selective naked-eye detection of DNA harnessing extension of oligonucleotide-modified nucleotides.

    PubMed

    Verga, Daniela; Welter, Moritz; Marx, Andreas

    2016-02-01

    DNA polymerases can efficiently and sequence selectively incorporate oligonucleotide (ODN)-modified nucleotides and the incorporated oligonucleotide strand can be employed as primer in rolling circle amplification (RCA). The effective amplification of the DNA primer by Φ29 DNA polymerase allows the sequence-selective hybridisation of the amplified strand with a G-quadruplex DNA sequence that has horse radish peroxidase-like activity. Based on these findings we develop a system that allows DNA detection with single-base resolution by naked eye.

  18. Extracellular delivery of modified oligonucleotide and superparamagnetic iron oxide nanoparticles from a degradable hydrogel triggered by tumor acidosis.

    PubMed

    Lin, Ching-Wen; Tseng, S-Ja; Kempson, Ivan M; Yang, Shuenn-Chen; Hong, Tse-Ming; Yang, Pan-Chyr

    2013-06-01

    Chemically modified antisense RNA oligonucleotides (antagomir) offer promise for cancer therapies but suffer from poor therapeutic effect after systemic administration. Chemical modification or loading in degradable hydrogels can offer improvements in the accuracy and efficacy for sustained delivery at specific sites. In our approach, antagomir were entrapped with degradable poly(ethylene glycol) (PEG)-based hydrogels, with and without incorporation of imidazole. Superparamagnetic iron oxide nanoparticles (SPION) were simultaneously loaded with intent for magnetic resonance imaging (MRI). The incorporation of imidazole into the PEG hydrogels led to a tunable-pH-response that dictated hydrogel swelling ratio and release rate of antagomir and SPION. As a result, the PEG-imidazole hydrogel swelling ratio and degradation over a 5 week period changed up to 734% and 149% as the pH dropped from 7.4 to 6.7, respectively. The swelling ratio of PEG-imidazole hydrogels was completely reversible over repeatable cycles of pH change. The stimuli-responsive behavior of PEG-imidazole hydrogels was used for the release of antagomir and SPION under conditions consistent with tumor acidosis. This manuscript demonstrates feasibility in designing tunable-pH-responsive hydrogels for loading multimodality therapeutic and contrast agents to enhance the bioactivity of chemically modified antisense RNA oligonucleotide and SPION for acidosis-related tumor therapy and MRI imaging applications.

  19. Modified bases enable high-efficiency oligonucleotide-mediated allelic replacement via mismatch repair evasion

    PubMed Central

    Wang, Harris H.; Xu, George; Vonner, Ashley J.; Church, George

    2011-01-01

    Genome engineering using single-stranded oligonucleotides is an efficient method for generating small chromosomal and episomal modifications in a variety of host organisms. The efficiency of this allelic replacement strategy is highly dependent on avoidance of the endogenous mismatch repair (MMR) machinery. However, global MMR inactivation generally results in significant accumulation of undesired background mutations. Here, we present a novel strategy using oligos containing chemically modified bases (2′-Fluoro-Uridine, 5-Methyl-deoxyCytidine, 2,6-Diaminopurine or Iso-deoxyGuanosine) in place of the standard T, C, A or G to avoid mismatch detection and repair, which we tested in Escherichia coli. This strategy increases transient allelic-replacement efficiencies by up to 20-fold, while maintaining a 100-fold lower background mutation level. We further show that the mismatched bases between the full length oligo and the chromosome are often not incorporated at the target site, probably due to nuclease activity at the 5′ and 3′ termini of the oligo. These results further elucidate the mechanism of oligo-mediated allelic replacement (OMAR) and enable improved methodologies for efficient, large-scale engineering of genomes. PMID:21609953

  20. A High-Fidelity Codon Set for the T4 DNA Ligase-Catalyzed Polymerization of Modified Oligonucleotides.

    PubMed

    Lei, Yi; Kong, Dehui; Hili, Ryan

    2015-12-14

    In vitro selection of nucleic acid polymers can readily deliver highly specific receptors and catalysts for a variety of applications; however, it is suspected that the functional group deficit of nucleic acids has limited their potential with respect to proteinogenic polymers. This has stimulated research toward expanding their chemical diversity to bridge the functional gap between nucleic acids and proteins to develop a superior biopolymer. In this study, we investigate the effect of codon library size and composition on the sequence specificity of T4 DNA ligase in the DNA-templated polymerization of both unmodified and modified oligonucleotides. Using high-throughput DNA sequencing of duplex pairs, we have uncovered a 256-membered codon set that yields sequence-defined modified ssDNA polymers in high yield and with high fidelity.

  1. Generation of long, fully modified, and serum-resistant oligonucleotides by rolling circle amplification.

    PubMed

    Hollenstein, Marcel

    2015-10-14

    Rolling Circle Amplification (RCA) is an isothermal enzymatic method generating single-stranded DNA products consisting of concatemers containing multiple copies of the reverse complement of the circular template precursor. Little is known on the compatibility of modified nucleoside triphosphates (dN*TPs) with RCA, which would enable the synthesis of long, fully modified ssDNA sequences. Here, dNTPs modified at any position of the scaffold were shown to be compatible with rolling circle amplification, yielding long (>1 kb), and fully modified single-stranded DNA products. This methodology was applied for the generation of long, cytosine-rich synthetic mimics of telomeric DNA. The resulting modified oligonucleotides displayed an improved resistance to fetal bovine serum.

  2. The Role of Fluorinated Alcohols as Mobile Phase Modifiers for LC-MS Analysis of Oligonucleotides

    NASA Astrophysics Data System (ADS)

    Basiri, Babak; van Hattum, Hilde; van Dongen, William D.; Murph, Mandi M.; Bartlett, Michael G.

    2017-01-01

    Hexafluoroisopropanol (HFIP) has been widely used as an acidic modifier for mobile phases for liquid chromatography-mass spectrometry (LC-MS) analysis of oligonucleotides ever since the first report of its use for this purpose. This is not surprising, considering the exceptional performance of HFIP compared with carboxylic acids, which cause significant MS signal suppression in electrospray ionization. However, we have found that other fluorinated alcohols can also be utilized for mobile phase preparation and the choice of optimal fluorinated alcohol is determined by the ion-pairing (IP) agent. Although HFIP is a very good choice to be used alongside less hydrophobic IP agents, other fluorinated alcohols such as 1,1,1,3,3,3-hexafluoro-2-methyl-2-propanol (HFMIP) can significantly outperform HFIP when used with more hydrophobic IP agents. We also found that more acidic fluorinated alcohols assist with the transfer of oligonucleotides with secondary structure (e.g., folded strands and hairpins) into the gas phase.

  3. N-Branched acyclic nucleoside phosphonates as monomers for the synthesis of modified oligonucleotides.

    PubMed

    Hocková, Dana; Rosenbergová, Šárka; Ménová, Petra; Páv, Ondřej; Pohl, Radek; Novák, Pavel; Rosenberg, Ivan

    2015-04-21

    Protected N-branched nucleoside phosphonates containing adenine and thymine bases were prepared as the monomers for the introduction of aza-acyclic nucleotide units into modified oligonucleotides. The phosphotriester and phosphoramidite methods were used for the incorporation of modified and natural units, respectively. The solid phase synthesis of a series of nonamers containing one central modified unit was successfully performed in both 3'→5' and 5'→3' directions. Hybridization properties of the prepared oligoribonucleotides and oligodeoxyribonucleotides were evaluated. The measurement of thermal characteristics of the complexes of modified nonamers with the complementary strand revealed a considerable destabilizing effect of the introduced units. We also examined the substrate/inhibitory properties of aza-acyclic nucleoside phosphono-diphosphate derivatives (analogues of nucleoside triphosphates) but neither inhibition of human and bacterial DNA polymerases nor polymerase-mediated incorporation of these triphosphate analogues into short DNA was observed.

  4. De novo sequencing of highly modified therapeutic oligonucleotides by hydrophobic tag sequencing coupled with LC-MS.

    PubMed

    Goto, R; Miyakawa, S; Inomata, E; Takami, T; Yamaura, J; Nakamura, Y

    2017-02-01

    Correct sequences are prerequisite for quality control of therapeutic oligonucleotides. However, there is no definitive method available for determining sequences of highly modified therapeutic RNAs, and thereby, most of the oligonucleotides have been used clinically without direct sequence determination. In this study, we developed a novel sequencing method called 'hydrophobic tag sequencing'. Highly modified oligonucleotides are sequenced by partially digesting oligonucleotides conjugated with a 5'-hydrophobic tag, followed by liquid chromatography-mass spectrometry analysis. 5'-Hydrophobic tag-printed fragments (5'-tag degradates) can be separated in order of their molecular masses from tag-free oligonucleotides by reversed-phase liquid chromatography. As models for the sequencing, the anti-VEGF aptamer (Macugen) and the highly modified 38-mer RNA sequences were analyzed under blind conditions. Most nucleotides were identified from the molecular weight of hydrophobic 5'-tag degradates calculated from monoisotopic mass in simple full mass data. When monoisotopic mass could not be assigned, the nucleotide was estimated using the molecular weight of the most abundant mass. The sequences of Macugen and 38-mer RNA perfectly matched the theoretical sequences. The hydrophobic tag sequencing worked well to obtain simple full mass data, resulting in accurate and clear sequencing. The present study provides for the first time a de novo sequencing technology for highly modified RNAs and contributes to quality control of therapeutic oligonucleotides. Copyright © 2016 John Wiley & Sons, Ltd.

  5. Oligonucleotide-templated chemical reactions: pushing the boundaries of a nature-inspired process.

    PubMed

    Percivalle, Claudia; Bartolo, Jean-François; Ladame, Sylvain

    2013-01-07

    Widespread in nature, oligonucleotide-templated reactions of phosphodiester bond formation have inspired chemists who are now applying this elegant strategy to the catalysis of a broad range of otherwise inefficient reactions. This review highlights the increasing diversity of chemical reactions that can be efficiently catalysed by an oligonucleotide template, using Watson-Crick base-pairing to bring both reagents in close enough proximity to react, thus increasing significantly their effective molarity. The applications of this elegant concept for nucleic acid sensing and controlled organic synthesis will also be discussed.

  6. Automated synthesis of new ferrocenyl-modified oligonucleotides: study of their properties in solution

    PubMed Central

    Navarro, Aude-Emmanuelle; Spinelli, Nicolas; Moustrou, Corinne; Chaix, Carole; Mandrand, Bernard; Brisset, Hugues

    2004-01-01

    We have developed new ferrocenyl-modified oligonucleotide (ODN) probes for electrochemical DNA sensors. A monofunctional ferrocene containing phosphoramidite group has been prepared, and a new bisfunctional ferrocene containing phosphoramidite and dimethoxytrityl (DMT) groups has been developed. These ferrocenyl-phosphoramidites have been directly employed in an automated solid-phase DNA synthesizer using phosphoramidite chemistry. The advantages of this method are that it allows a non-specialist in nucleotide chemistry to access labeled ODNs and that it has demonstrated good results. ODNs modified at the 3′ and/or 5′ extremities have been prepared, with the incorporation of the ferrocenyl group into the chain. The 5′ position appears to be more important due to its particular behavior. The thermal stability and electrochemical properties of these new ODN ferrocenes were analyzed before and after hybridization with different ODNs. The feasibility of using these new ferrocenyl-labeled ODNs in DNA sensors has been demonstrated. PMID:15466597

  7. Synthesis and Biophysical Investigations of Oligonucleotides Containing Galactose-Modified DNA, LNA, and 2'-Amino-LNA Monomers.

    PubMed

    Ries, Annika; Kumar, Rajesh; Lou, Chenguang; Kosbar, Tamer; Vengut-Climent, Empar; Jørgensen, Per T; Morales, Juan C; Wengel, Jesper

    2016-11-18

    Galactose-modified thymidine, LNA-T, and 2'-amino-LNA-T nucleosides were synthesized, converted into the corresponding phosphoramidite derivatives and introduced into short oligonucleotides. Compared to the unmodified control strands, the galactose-modified oligonucleotides in general, and the N2'-functionalized 2'-amino-LNA derivatives in particular, showed improved duplex thermal stability against DNA and RNA complements and increased ability to discriminate mismatches. In addition, the 2'-amino-LNA-T derivatives induced remarkable 3'-exonuclease resistance. These results were further investigated using molecular modeling studies.

  8. Lipid-modified G4-decoy oligonucleotide anchored to nanoparticles: delivery and bioactivity in pancreatic cancer cells

    PubMed Central

    Cogoi, S.; Jakobsen, U.; Pedersen, E. B.; Vogel, S.; Xodo, L. E.

    2016-01-01

    KRAS is mutated in >90% of pancreatic ductal adenocarcinomas. As its inactivation leads to tumour regression, mutant KRAS is considered an attractive target for anticancer drugs. In this study we report a new delivery strategy for a G4-decoy oligonucleotide that sequesters MAZ, a transcription factor essential for KRAS transcription. It is based on the use of palmitoyl-oleyl-phosphatidylcholine (POPC) liposomes functionalized with lipid-modified G4-decoy oligonucleotides and a lipid-modified cell penetrating TAT peptide. The potency of the strategy in pancreatic cancer cells is demonstrated by cell cytometry, confocal microscopy, clonogenic and qRT-PCR assays. PMID:27929127

  9. Lipid-modified oligonucleotide conjugates: Insights into gene silencing, interaction with model membranes and cellular uptake mechanisms.

    PubMed

    Ugarte-Uribe, Begoña; Grijalvo, Santiago; Pertíñez, Samuel Núñez; Busto, Jon V; Martín, César; Alagia, Adele; Goñi, Félix M; Eritja, Ramón; Alkorta, Itziar

    2017-01-01

    The ability of oligonucleotides to silence specific genes or inhibit the biological activity of specific proteins has generated great interest in their use as research tools and therapeutic agents. Unfortunately, their biological applications meet the limitation of their poor cellular accessibility. Developing an appropriate delivery system for oligonucleotides is essential to achieve their efficient cellular uptake. In the present work a series of phosphorothioate lipid-oligonucleotide hybrids were synthesized introducing covalently single or double lipid tails at both 3'- and 5'-termini of an antisense oligonucleotide. Gene transfections in cultured cells showed antisense luciferase inhibition without the use of a transfecting agent for conjugates modified with the double-lipid tail at 5'-termini. The effect of the double lipid-tailed modification was further studied in detail in several model membrane systems as well as in cellular uptake experiments. During these studies the spontaneous formation of self-assembled microstructures is clearly observed. Lipidation allowed the efficient incorporation of the oligonucleotide in HeLa cells by a macropinocytosis mechanism without causing cytotoxicity in cells or altering the binding properties of the oligonucleotide conjugates. In addition, both single- and double-tailed compounds showed a similar behavior in lipid model membranes, making them useful in nucleotide-based technologies.

  10. Improved Genome Editing Efficiency and Flexibility Using Modified Oligonucleotides with TALEN and CRISPR-Cas9 Nucleases.

    PubMed

    Renaud, Jean-Baptiste; Boix, Charlotte; Charpentier, Marine; De Cian, Anne; Cochennec, Julien; Duvernois-Berthet, Evelyne; Perrouault, Loïc; Tesson, Laurent; Edouard, Joanne; Thinard, Reynald; Cherifi, Yacine; Menoret, Séverine; Fontanière, Sandra; de Crozé, Noémie; Fraichard, Alexandre; Sohm, Frédéric; Anegon, Ignacio; Concordet, Jean-Paul; Giovannangeli, Carine

    2016-03-08

    Genome editing has now been reported in many systems using TALEN and CRISPR-Cas9 nucleases. Precise mutations can be introduced during homology-directed repair with donor DNA carrying the wanted sequence edit, but efficiency is usually lower than for gene knockout and optimal strategies have not been extensively investigated. Here, we show that using phosphorothioate-modified oligonucleotides strongly enhances genome editing efficiency of single-stranded oligonucleotide donors in cultured cells. In addition, it provides better design flexibility, allowing insertions more than 100 bp long. Despite previous reports of phosphorothioate-modified oligonucleotide toxicity, clones of edited cells are readily isolated and targeted sequence insertions are achieved in rats and mice with very high frequency, allowing for homozygous loxP site insertion at the mouse ROSA locus in particular. Finally, when detected, imprecise knockin events exhibit indels that are asymmetrically positioned, consistent with genome editing taking place by two steps of single-strand annealing.

  11. Gene knockdown by morpholino-modified oligonucleotides in the zebrafish model: applications for developmental toxicology

    PubMed Central

    Timme-Laragy, Alicia R.; Karchner, Sibel I.; Hahn, Mark E.

    2014-01-01

    Summary The zebrafish (Danio rerio) has long been used as a model for developmental biology, making it an excellent model to use also in developmental toxicology. The many advantages of zebrafish include their small size, prolific spawning, rapid development, and transparent embryos. They can be easily manipulated genetically through the use of transgenic technology and gene knock-down via morpholino-modified antisense oligonucleotides (MOs). Knocking down specific genes to assess their role in the response to toxicant exposure provides a way to further our knowledge of how developmental toxicants work on a molecular and mechanistic level, while establishing a relationship between these molecular events and morphological, behavioral, and/or physiological effects (i.e. phenotypic anchoring). In this chapter we address important considerations for using MOs to study developmental toxicology in zebrafish embryos and provide a protocol for their use. PMID:22669659

  12. DETECTING LOW-LEVEL SYNTHESIS IMPURITIES IN MODIFIED PHOSPHOROTHIOATE OLIGONUCLEOTIDES USING LIQUID CHROMATOGRAPHY - HIGH RESOLUTION MASS SPECTROMETRY.

    PubMed

    Nikcevic, Irena; Wyrzykiewicz, Tadeusz K; Limbach, Patrick A

    2011-07-01

    An LC-MS method based on the use of high resolution Fourier transform ion cyclotron resonance mass spectrometry (FTIRCMS) for profiling oligonucleotides synthesis impurities is described.Oligonucleotide phosphorothioatediesters (phosphorothioate oligonucleotides), in which one of the non-bridging oxygen atoms at each phosphorus center is replaced by a sulfur atom, are now one of the most popular oligonucleotide modifications due to their ease of chemical synthesis and advantageous pharmacokinetic properties. Despite significant progress in the solid-phase oligomerization chemistry used in the manufacturing of these oligonucleotides, multiple classes of low-level impurities always accompany synthetic oligonucleotides. Liquid chromatography-mass spectrometry has emerged as a powerful technique for the identification of these synthesis impurities. However, impurity profiling, where the entire complement of low-level synthetic impurities is identified in a single analysis, is more challenging. Here we present an LC-MS method based the use of high resolution-mass spectrometry, specifically Fourier transform ion cyclotron resonance mass spectrometry (FTIRCMS or FTMS). The optimal LC-FTMS conditions, including the stationary phase and mobile phases for the separation and identification of phosphorothioate oligonucleotides, were found. The characteristics of FTMS enable charge state determination from single m/z values of low-level impurities. Charge state information then enables more accurate modeling of the detected isotopic distribution for identification of the chemical composition of the detected impurity. Using this approach, a number of phosphorothioate impurities can be detected by LC-FTMS including failure sequences carrying 3'-terminal phosphate monoester and 3'-terminal phosphorothioate monoester, incomplete backbone sulfurization and desulfurization products, high molecular weight impurities, and chloral, isobutyryl, and N(3) (2-cyanoethyl) adducts of the full

  13. DETECTING LOW-LEVEL SYNTHESIS IMPURITIES IN MODIFIED PHOSPHOROTHIOATE OLIGONUCLEOTIDES USING LIQUID CHROMATOGRAPHY – HIGH RESOLUTION MASS SPECTROMETRY

    PubMed Central

    Nikcevic, Irena; Wyrzykiewicz, Tadeusz K.; Limbach, Patrick A.

    2010-01-01

    Summary An LC-MS method based on the use of high resolution Fourier transform ion cyclotron resonance mass spectrometry (FTIRCMS) for profiling oligonucleotides synthesis impurities is described. Oligonucleotide phosphorothioatediesters (phosphorothioate oligonucleotides), in which one of the non-bridging oxygen atoms at each phosphorus center is replaced by a sulfur atom, are now one of the most popular oligonucleotide modifications due to their ease of chemical synthesis and advantageous pharmacokinetic properties. Despite significant progress in the solid-phase oligomerization chemistry used in the manufacturing of these oligonucleotides, multiple classes of low-level impurities always accompany synthetic oligonucleotides. Liquid chromatography-mass spectrometry has emerged as a powerful technique for the identification of these synthesis impurities. However, impurity profiling, where the entire complement of low-level synthetic impurities is identified in a single analysis, is more challenging. Here we present an LC-MS method based the use of high resolution-mass spectrometry, specifically Fourier transform ion cyclotron resonance mass spectrometry (FTIRCMS or FTMS). The optimal LC-FTMS conditions, including the stationary phase and mobile phases for the separation and identification of phosphorothioate oligonucleotides, were found. The characteristics of FTMS enable charge state determination from single m/z values of low-level impurities. Charge state information then enables more accurate modeling of the detected isotopic distribution for identification of the chemical composition of the detected impurity. Using this approach, a number of phosphorothioate impurities can be detected by LC-FTMS including failure sequences carrying 3′-terminal phosphate monoester and 3′-terminal phosphorothioate monoester, incomplete backbone sulfurization and desulfurization products, high molecular weight impurities, and chloral, isobutyryl, and N3 (2-cyanoethyl) adducts

  14. Development of a Novel Oligonucleotide Array for Genomic Screening of Chemical Warfare Agent Exposure in Guinea Pigs and Swine

    DTIC Science & Technology

    2004-04-01

    respectively. To address this gap in research tools, we have developed an oligonucleotide microarray that contains representative genes from guinea pig...To address this gap in research tools, we have developed an oligonucleotide microarray that contains representative genes from guinea pig...toxicogenomics. Toxicogenomics is focused on identifying changes in gene expression in response to a toxic chemical and then using that information to

  15. Intra-endosomal trafficking mediated by lysobisphosphatidic acid contributes to intracellular release of phosphorothioate-modified antisense oligonucleotides

    PubMed Central

    Sun, Hong; Tanowitz, Michael; Liang, Xue-hai; Crooke, Stanley T.

    2017-01-01

    Abstract Antisense oligonucleotides (ASOs) with phosphorothioate (PS) linkages are broadly used as research tools and therapeutic agents. Chemically modified PS-ASOs can mediate efficient target reduction by site-specific cleavage of RNA through RNase H1. PS-ASOs are known to be internalized via a number of endocytotic pathways and are released from membrane-enclosed endocytotic organelles, mainly late endosomes (LEs). This study was focused on the details of PS-ASO trafficking through endocytic pathways. It was found that lysobisphosphatidic acid (LBPA) is required for release of PS-ASOs from LEs. PS-ASOs exited early endosomes (EEs) rapidly after internalization and became co-localized with LBPA by 2 hours in LEs. Inside LEs, PS-ASOs and LBPA were co-localized in punctate, dot-like structures, likely intraluminal vesicles (ILVs). Deactivation of LBPA using anti-LBPA antibody significantly decreased PS-ASO activities without affecting total PS-ASO uptake. Reduction of Alix also substantially decreased PS-ASO activities without affecting total PS-ASO uptake. Furthermore, Alix reduction decreased LBPA levels and limited co-localization of LBPA with PS-ASOs at ILVs inside LEs. Thus, the fusion properties of ILVs, which are supported by LBPA, contribute to PS-ASO intracellular release from LEs. PMID:28379543

  16. Intra-endosomal trafficking mediated by lysobisphosphatidic acid contributes to intracellular release of phosphorothioate-modified antisense oligonucleotides.

    PubMed

    Wang, Shiyu; Sun, Hong; Tanowitz, Michael; Liang, Xue-Hai; Crooke, Stanley T

    2017-05-19

    Antisense oligonucleotides (ASOs) with phosphorothioate (PS) linkages are broadly used as research tools and therapeutic agents. Chemically modified PS-ASOs can mediate efficient target reduction by site-specific cleavage of RNA through RNase H1. PS-ASOs are known to be internalized via a number of endocytotic pathways and are released from membrane-enclosed endocytotic organelles, mainly late endosomes (LEs). This study was focused on the details of PS-ASO trafficking through endocytic pathways. It was found that lysobisphosphatidic acid (LBPA) is required for release of PS-ASOs from LEs. PS-ASOs exited early endosomes (EEs) rapidly after internalization and became co-localized with LBPA by 2 hours in LEs. Inside LEs, PS-ASOs and LBPA were co-localized in punctate, dot-like structures, likely intraluminal vesicles (ILVs). Deactivation of LBPA using anti-LBPA antibody significantly decreased PS-ASO activities without affecting total PS-ASO uptake. Reduction of Alix also substantially decreased PS-ASO activities without affecting total PS-ASO uptake. Furthermore, Alix reduction decreased LBPA levels and limited co-localization of LBPA with PS-ASOs at ILVs inside LEs. Thus, the fusion properties of ILVs, which are supported by LBPA, contribute to PS-ASO intracellular release from LEs. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  17. [Identification of genetically modified vegetable sources in food and feed using hydrogel oligonucleotide microchip].

    PubMed

    Griadunov, D A; Getman, I A; Chizhova, S I; Mikhaĭlovich, V M; Zasedatelev, A S; Romanov, G A

    2011-01-01

    A method of multiplex polymerase chain reaction (PCR) followed by the hybridization on a hydrogel oligonucleotide biochip was developed for simultaneous identification of ten different transgenic elements of plant DNA in feed and food products. The biochip contained 22 immobilized probes intended for (i) detection of plant DNA; (ii) plant species determination (soybean, maize, potato, rice); (iii) identification of transgenic elements, including 35S CaMV, 35S FMV, rice actine gene promoters, nos, 35S CaMV, ocs, pea rbcS1 gene terminators, and bar, gus, nptII marker genes. The limit of detection was 0.5% of genetically modified (GM) soybean and maize in analyzed samples. Identification of transgenic DNA in food and feed products using either the developed approach or real-time PCR led to virtually identical results. The assay can be used for selection of GM samples by screening food and feed products for subsequent quantitative determination of the GM component based on the identified transgene.

  18. A novel penetratin-modified complex for noninvasive intraocular delivery of antisense oligonucleotides.

    PubMed

    Tai, Lingyu; Liu, Chang; Jiang, Kuan; Chen, Xishan; Feng, Linglin; Pan, Weisan; Wei, Gang; Lu, Weiyue

    2017-08-30

    Inhibition of gene expression by nucleic acids is a promising strategy in the treatment of ocular diseases. However, intraocular delivery of nucleic acids to the posterior ocular tissues remains a great challenge due to the presence of various biological barriers. To circumvent this problem, we established a novel penetratin (P) modified poly(amidoamine) dendrimer (D)/hyaluronic acid (H) complex to deliver antisense oligonucleotides (ASOs, O). Complexes (D/O, HD/O and PHD/O) were easily prepared and modification layers (hyaluronic acid and penetratin) were respectively absorbed on the surface via electrostatic interaction. Complexes with different outer layers were characterized as spherical particles with reversed charges. In vitro cellular uptake of ASOs in PHD/O complex was significantly increased than those in other formulations. In vivo studies were carried out after topical instillation of the complexes in the conjunctival sac of mice. Compared with D/O and HD/O, PHD/O exhibited much more distribution in the posterior segment of the eyes and prolonged retention time of ASOs in retina for more than 8h. Taken together, these results indicated that PHD/O complex possessed substantially improved ocular permeability and distribution in the posterior ocular tissues. This work provided a promising noninvasive intraocular delivery strategy for nucleic acids via topical administration. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. Photografting and patterning of oligonucleotides on benzophenone-modified boron-doped diamond.

    PubMed

    Szunerits, Sabine; Shirahata, Naoto; Actis, Paolo; Nakanishi, Jun; Boukherroub, Rabah

    2007-07-19

    Irradiation of a patterned benzophenone-terminated boron-doped diamond (BDD) surface with UV light (lambda = 350 nm) in the presence of a 15(mer) oligonucleotide resulted in the covalent linking of the DNA strand to the BDD interface.

  20. Simultaneous rapid chemical synthesis of over one hundred oligonucleotides on a microscale

    PubMed Central

    Matthes, Hans W.D.; Zenke, W. Martin; Grundström, Thomas; Staub, Adrien; Wintzerith, Marguerite; Chambon, Pierre

    1984-01-01

    An inexpensive, extremely rapid manual method for simultaneous synthesis of large numbers of oligodeoxyribonucleotides on 50 or 150 nanomole scale is described. The oligonucleotides are assembled in parallel by the phosphotriester method on small cellulose paper disks in a simple gas pressure-controlled continuous-flow system. For each addition of a nucleotide the disks are sorted into four sets which are placed in four columns for addition of A, C, G and T, respectively. During one 2-week period, three rounds of synthesis by this method yielded 254 oligomers (8- to 22-mers), many of which were also purified during this time. Using 50 nanomole scale reactions the yields for 17-mers, for example, were in the range of 0.5 O.D.260 units (˜5 nmol, i.e., ˜10% yield), an amount sufficient for most purposes. The equipment required is relatively inexpensive and for the most part usually already available in molecular biology laboratories. All chemicals are commercially available and the current reagent cost per oligonucleotide (25 μg, average length 17-mer) is ˜3 US dollars. ImagesFig. 1.Fig. 3.Fig. 4.Fig. 5. PMID:16453516

  1. Oligonucleotide-modified screen-printed gold electrodes for enzyme-amplified sensing of nucleic acids.

    PubMed

    Carpini, Guido; Lucarelli, Fausto; Marrazza, Giovanna; Mascini, Marco

    2004-09-15

    An electrochemical genosensor for the detection of specific sequences of DNA has been developed using disposable screen-printed gold electrodes. Screen-printed gold electrodes were firstly modified with a mixed monolayer of a 25-mer thiol-tethered DNA probe and a spacer thiol, 6-mercapto-1-hexanol (MCH). The DNA probe sequence was internal to the sequence of the 35S promoter, which sequence is inserted in the genome of GMOs regulating the transgene expression. An enzyme-amplified detection scheme, based on the coupling of a streptavidin-alkaline phosphatase conjugate and biotinylated target sequences was then applied. The enzyme catalysed the hydrolysis of the electroinactive alpha-naphthyl phosphate to alpha-naphthol; this product is electroactive and has been detected by means of differential pulse voltammetry. The assay was, firstly, characterised using synthetic oligonucleotides. Relevant parameters, such as the probe concentration and the immobilisation time, the use of the MCH and different enzymatic conjugates, were investigated and optimised. The genosensor response was found to be linearly related to the target concentration between 0 and 25 nmol/L; the detection limit was 0.25 nmol/L. The analytical procedure was then applied for the detection of the 35S promoter sequence, which was amplified from the pBI121 plasmid by polymerase chain reaction (PCR). Hybridisation conditions (i.e., hybridisation buffer and hybridisation time) were further optimised. The selectivity of the assay was confirmed using biotinylated non-complementary amplicons and PCR blanks. The results showed that the genosensor enabled sensitive (detection limit: 1 nmol/L) and specific detection of GMO-related sequences, thus providing a useful tool for the screening analysis of bioengineered food samples.

  2. Event-specific detection of seven genetically modified soybean and maizes using multiplex-PCR coupled with oligonucleotide microarray.

    PubMed

    Xu, Jia; Zhu, Shuifang; Miao, Haizhen; Huang, Wensheng; Qiu, Minyan; Huang, Yan; Fu, Xuping; Li, Yao

    2007-07-11

    With the increasing development of genetically modified organism (GMO) detection techniques, the polymerase chain reaction (PCR) technique has been the mainstay for GMO detection. An oligonucleotide microarray is a glass chip to the surface of which an array of oligonucleotides was fixed as spots, each containing numerous copies of a sequence-specific probe that is complementary to a gene of interest. So it is used to detect ten or more targets synchronously. In this research, an event-specific detection strategy based on the unique and specific integration junction sequences between the host plant genome DNA and the integrated gene is being developed for its high specificity using multiplex-PCR together with oligonucleotide microarray. A commercial GM soybean (GTS 40-3-2) and six GM maize events (MON810, MON863, Bt176, Bt11, GA21, and T25) were detected by this method. The results indicate that it is a suitable method for the identification of these GM soybean and maizes.

  3. Efficient Targeting of Fatty-Acid Modified Oligonucleotides to Live Cell Membranes through Stepwise Assembly

    PubMed Central

    2014-01-01

    Lipid modifications provide efficient targeting of oligonucleotides to live cell membranes in a range of applications. Targeting efficiency is a function of the rate of lipid DNA insertion into the cell surface and its persistence over time. Here we show that increasing lipid hydrophobicity increases membrane persistence, but decreases the rate of membrane insertion due to the formation of nonproductive aggregates in solution. To ameliorate this effect, we split the net hydrophobicity of the membrane anchor between two complementary oligonucleotides. When prehybridized in solution, doubly anchored molecules also aggregate due to their elevated hydrophobicity. However, when added sequentially to cells, aggregation does not occur so membrane insertion is efficient. Hybridization between the two strands locks the complexes at the cell surface by increasing net hydrophobicity, increasing their total concentration and lifetime, and dramatically improving their utility in a variety of biomedical applications. PMID:25325667

  4. Detection of genetically modified canola using multiplex PCR coupled with oligonucleotide microarray hybridization.

    PubMed

    Schmidt, Anna-Mary; Sahota, Robert; Pope, Derek S; Lawrence, Tracy S; Belton, Mark P; Rott, Michael E

    2008-08-27

    A rapid method was developed for concurrent screening of transgenic elements in GM canola. This method utilizes a single multiplex PCR coupled with an oligonucleotide DNA array capable of simultaneously detecting the 12 approved GM canola lines in Canada. The assay includes construct-specific elements for identification of approved lines, common elements (e.g., CaMV 35S promoter, Agrobacterium tumefaciens nos terminator, or nptII gene) for screening of approved or unapproved lines, a canola-specific endogenous gene, and endogenous genes from heterologous crops to serve as additional controls. Oligonucleotide probes were validated individually for functionality and specificity by amplification of specific transgene sequences from appropriate GM canola lines corresponding to each probe sequence, and hybridization of amplicons to the array. Each target sequence hybridized to its corresponding oligonucleotide probe and no significant cross-hybridization was observed. The limit of detection was examined for the GM lines GT73, T45, and MS8/RF3, and was determined to be 0.1%, 0.1%, and 0.5%, respectively, well within the European food and feed labeling threshold level of 0.9% for approved GM product. Practically, the method was demonstrated to be effective for the detection of GM canola in several types of animal feed, as well as in commercial canola meal.

  5. Synthesis, hybridization characteristics, and fluorescence properties of oligonucleotides modified with nucleobase-functionalized locked nucleic acid adenosine and cytidine monomers.

    PubMed

    Kaura, Mamta; Kumar, Pawan; Hrdlicka, Patrick J

    2014-07-03

    Conformationally restricted nucleotides such as locked nucleic acid (LNA) are very popular as affinity-, specificity-, and stability-enhancing modifications in oligonucleotide chemistry to produce probes for nucleic acid targeting applications in molecular biology, biotechnology, and medicinal chemistry. Considerable efforts have been devoted in recent years to optimize the biophysical properties of LNA through additional modification of the sugar skeleton. We recently introduced C5-functionalization of LNA uridines as an alternative and synthetically more straightforward approach to improve the biophysical properties of LNA. In the present work, we set out to test the generality of this concept by studying the characteristics of oligonucleotides modified with four different C5-functionalized LNA cytidine and C8-functionalized LNA adenosine monomers. The results strongly suggest that C5-functionalization of LNA pyrimidines is indeed a viable approach for improving the binding affinity, target specificity, and/or enzymatic stability of LNA-modified ONs, whereas C8-functionalization of LNA adenosines is detrimental to binding affinity and specificity. These insights will impact the future design of conformationally restricted nucleotides for nucleic acid targeting applications.

  6. Binding of actinomycin C1 (D) and actinomin to base-modified oligonucleotide duplexes with parallel chain orientation.

    PubMed

    Li, Hong; Peng, Xiaohua; Leonard, Peter; Seela, Frank

    2006-06-15

    The binding of actinomycin D (C1, 1) and its analog actinomin (2) was studied on base-modified oligonucleotide duplexes with parallel chain orientation (ps) and with anti-parallel chains (aps) for comparison. Actinomycin D binds not only to aps duplexes containing guanine-cytosine base pairs but also to those incorporating modified bases such as 7-deazaguanine or its 6-deoxo derivative. For this, novel phosphoramidites were prepared. The new building block of 7-deaza-2'-deoxyguanosine is significantly more stable than the one currently used and allows normal oxidation conditions during solid-phase oligonucleotide synthesis. Actinomycin binds weakly to ps duplexes containing guanine-isocytosine base pairs but not to ps-DNA incorporating pairs of isoguanine-cytosine residues. On the contrary, the actinomycin D analog actinomin, which contains positively charged side chains instead of the chiral peptide rings, is strongly bound to both ps- and aps-DNA. Guanines, isoguanine, as well as other 7-deaza derivatives are accepted as nucleobases. Apparently, the pentapeptide lacton rings of actinomycin do not fit nicely into the groove of ps-DNA thereby reducing the binding strength of the antibiotic while the groove size of ps-DNA does not affect actinomin binding notably.

  7. Photouncaged Sequence-specific Interstrand DNA Cross-Linking with Photolabile 4-oxo-enal-modified Oligonucleotides

    NASA Astrophysics Data System (ADS)

    Sun, Jingjing; Tang, Xinjing

    2015-05-01

    DNA cross-linking technology is an attractive tool for the detection, regulation, and manipulation of genes. In this study, a series of photolabile 4-oxo-enal-modified oligonucleotides functionalized with photosensitive ο-nitrobenzyl derivatives were rationally designed as a new kind of photocaged cross-linking agents. A comprehensive evaluation of cross-linking reactions for different nucleobases in complementary strands under different conditions suggested that the modified DNA oligonucleotides tended to form interstrand cross-linking to nucleobases with the potential of thymidine > guanosine » cytidine ~ adenosine. Different from previous literature reports that cytidine and adenosine were preferential cross-linked nucleobases with 4-oxo-enal moieties, our study represents the first example of DNA cross-linking for T and G selectivity using 4-oxo-enal moiety. The cross-linked adducts were identified and their cross-linking mechanism was also illustrated. This greatly expands the applications of 4-oxo-enal derivatives in the studies of DNA damage and RNA structure

  8. Chemically modified graphite for electrochemical cells

    DOEpatents

    Greinke, Ronald Alfred; Lewis, Irwin Charles

    1998-01-01

    This invention relates to chemically modified graphite particles: (a) that are useful in alkali metal-containing electrode of a electrochemical cell comprising: (i) the electrode, (ii) a non-aqueous electrolytic solution comprising an organic aprotic solvent which solvent tends to decompose when the electrochemical cell is in use, and an electrically conductive salt of an alkali metal, and (iii) a counterelectrode; and (b) that are chemically modified with fluorine, chlorine, iodine or phosphorus to reduce such decomposition. This invention also relates to electrodes comprising such chemically modified graphite and a binder and to electrochemical cells containing such electrodes.

  9. Chemically modified graphite for electrochemical cells

    DOEpatents

    Greinke, R.A.; Lewis, I.C.

    1998-05-26

    This invention relates to chemically modified graphite particles: (a) that are useful in alkali metal-containing electrode of a electrochemical cell comprising: (1) the electrode, (2) a non-aqueous electrolytic solution comprising an organic aprotic solvent which solvent tends to decompose when the electrochemical cell is in use, and an electrically conductive salt of an alkali metal, and (3) a counter electrode; and (b) that are chemically modified with fluorine, chlorine, iodine or phosphorus to reduce such decomposition. This invention also relates to electrodes comprising such chemically modified graphite and a binder and to electrochemical cells containing such electrodes. 3 figs.

  10. Chemically robust fluoroalkyl phthalocyanine-oligonucleotide bioconjugates and their GRP78 oncogene photocleavage activity.

    PubMed

    Patel, Pradeepkumar; Patel, Hemantbhai H; Borland, Emily; Gorun, Sergiu M; Sabatino, David

    2014-06-18

    The first representative of functionalized fluoroalkyl phthalocyanines, F48H7(COOH)PcZn, is reported. The complex generates (1)O2 affording long-lasting photooxidation of an external substrate without self-decomposition. The carboxylic group couples with an antisense oligonucleotide targeting GRP78 oncogenes, resulting in the F48H7PcZn-cancer targeting oligonucleotide (CTO). The bioconjugated fluorophthalocyanine effectively hybridizes complementary GRP78 DNA and mRNA sequences. Piperidine cleavage assays reveal desired photochemical oligonucleotide oxidative degradation for both F48H7PcZn-CTO:DNA and F48H7PcZn-CTO:mRNA hybrids. This new materials strategy could be extended to other functional fluorinated phthalocyanines-antisense oligonucleotide combinations for long-lasting oncogene-targeting photodynamic therapy.

  11. Improved bioactivity of G-rich triplex-forming oligonucleotides containing modified guanine bases

    PubMed Central

    Rogers, Faye A; Lloyd, Janice A; Tiwari, Meetu Kaushik

    2014-01-01

    Triplex structures generated by sequence-specific triplex-forming oligonucleotides (TFOs) have proven to be promising tools for gene targeting strategies. In addition, triplex technology has been highly utilized to study the molecular mechanisms of DNA repair, recombination and mutagenesis. However, triplex formation utilizing guanine-rich oligonucleotides as third strands can be inhibited by potassium-induced self-association resulting in G-quadruplex formation. We report here that guanine-rich TFOs partially substituted with 8-aza-7-deaza-guanine (PPG) have improved target site binding in potassium compared with TFOs containing the natural guanine base. We designed PPG-substituted TFOs to bind to a polypurine sequence in the supFG1 reporter gene. The binding efficiency of PPG-substituted TFOs to the target sequence was analyzed using electrophoresis mobility gel shift assays. We have determined that in the presence of potassium, the non-substituted TFO, AG30 did not bind to its target sequence, however binding was observed with the PPG-substituted AG30 under conditions with up to 140 mM KCl. The PPG-TFOs were able to maintain their ability to induce genomic modifications as measured by an assay for gene-targeted mutagenesis. In addition, these compounds were capable of triplex-induced DNA double strand breaks, which resulted in activation of apoptosis. PMID:25483840

  12. Synthetic oligonucleotide antigens modified with locked nucleic acids detect disease specific antibodies

    PubMed Central

    Samuelsen, Simone V.; Solov’yov, Ilia A.; Balboni, Imelda M.; Mellins, Elizabeth; Nielsen, Christoffer Tandrup; Heegaard, Niels H. H.; Astakhova, Kira

    2016-01-01

    New techniques to detect and quantify antibodies to nucleic acids would provide a significant advance over current methods, which often lack specificity. We investigate the potential of novel antigens containing locked nucleic acids (LNAs) as targets for antibodies. Particularly, employing molecular dynamics we predict optimal nucleotide composition for targeting DNA-binding antibodies. As a proof of concept, we address a problem of detecting anti-DNA antibodies that are characteristic of systemic lupus erythematosus, a chronic autoimmune disease with multiple manifestations. We test the best oligonucleotide binders in surface plasmon resonance studies to analyze binding and kinetic aspects of interactions between antigens and target DNA. These DNA and LNA/DNA sequences showed improved binding in enzyme-linked immunosorbent assay using human samples of pediatric lupus patients. Our results suggest that the novel method is a promising tool to create antigens for research and point-of-care monitoring of anti-DNA antibodies. PMID:27775006

  13. Synthetic oligonucleotide antigens modified with locked nucleic acids detect disease specific antibodies

    NASA Astrophysics Data System (ADS)

    Samuelsen, Simone V.; Solov’Yov, Ilia A.; Balboni, Imelda M.; Mellins, Elizabeth; Nielsen, Christoffer Tandrup; Heegaard, Niels H. H.; Astakhova, Kira

    2016-10-01

    New techniques to detect and quantify antibodies to nucleic acids would provide a significant advance over current methods, which often lack specificity. We investigate the potential of novel antigens containing locked nucleic acids (LNAs) as targets for antibodies. Particularly, employing molecular dynamics we predict optimal nucleotide composition for targeting DNA-binding antibodies. As a proof of concept, we address a problem of detecting anti-DNA antibodies that are characteristic of systemic lupus erythematosus, a chronic autoimmune disease with multiple manifestations. We test the best oligonucleotide binders in surface plasmon resonance studies to analyze binding and kinetic aspects of interactions between antigens and target DNA. These DNA and LNA/DNA sequences showed improved binding in enzyme-linked immunosorbent assay using human samples of pediatric lupus patients. Our results suggest that the novel method is a promising tool to create antigens for research and point-of-care monitoring of anti-DNA antibodies.

  14. Gene knockdown by morpholino-modified oligonucleotides in the zebrafish (Danio rerio) model: applications for developmental toxicology.

    PubMed

    Timme-Laragy, Alicia R; Karchner, Sibel I; Hahn, Mark E

    2012-01-01

    The zebrafish (Danio rerio) has long been used as a model for developmental biology, making it an excellent model to use also in developmental toxicology. The many advantages of zebrafish include their small size, prolific spawning, rapid development, and transparent embryos. They can be easily manipulated genetically through the use of transgenic technology and gene knockdown via morpholino-modified antisense oligonucleotides (MOs). Knocking down specific genes to assess their role in the response to toxicant exposure provides a way to further our knowledge of how developmental toxicants work on a molecular and mechanistic level while establishing a relationship between these molecular events and morphological, behavioral, and/or physiological effects (i.e., phenotypic anchoring). In this chapter, we address important considerations for using MOs to study developmental toxicology in zebrafish embryos and provide a protocol for their use.

  15. Universal strategies for the DNA-encoding of libraries of small molecules using the chemical ligation of oligonucleotide tags

    PubMed Central

    Litovchick, Alexander; Clark, Matthew A; Keefe, Anthony D

    2014-01-01

    The affinity-mediated selection of large libraries of DNA-encoded small molecules is increasingly being used to initiate drug discovery programs. We present universal methods for the encoding of such libraries using the chemical ligation of oligonucleotides. These methods may be used to record the chemical history of individual library members during combinatorial synthesis processes. We demonstrate three different chemical ligation methods as examples of information recording processes (writing) for such libraries and two different cDNA-generation methods as examples of information retrieval processes (reading) from such libraries. The example writing methods include uncatalyzed and Cu(I)-catalyzed alkyne-azide cycloadditions and a novel photochemical thymidine-psoralen cycloaddition. The first reading method “relay primer-dependent bypass” utilizes a relay primer that hybridizes across a chemical ligation junction embedded in a fixed-sequence and is extended at its 3′-terminus prior to ligation to adjacent oligonucleotides. The second reading method “repeat-dependent bypass” utilizes chemical ligation junctions that are flanked by repeated sequences. The upstream repeat is copied prior to a rearrangement event during which the 3′-terminus of the cDNA hybridizes to the downstream repeat and polymerization continues. In principle these reading methods may be used with any ligation chemistry and offer universal strategies for the encoding (writing) and interpretation (reading) of DNA-encoded chemical libraries. PMID:25483841

  16. Universal strategies for the DNA-encoding of libraries of small molecules using the chemical ligation of oligonucleotide tags.

    PubMed

    Litovchick, Alexander; Clark, Matthew A; Keefe, Anthony D

    2014-01-01

    The affinity-mediated selection of large libraries of DNA-encoded small molecules is increasingly being used to initiate drug discovery programs. We present universal methods for the encoding of such libraries using the chemical ligation of oligonucleotides. These methods may be used to record the chemical history of individual library members during combinatorial synthesis processes. We demonstrate three different chemical ligation methods as examples of information recording processes (writing) for such libraries and two different cDNA-generation methods as examples of information retrieval processes (reading) from such libraries. The example writing methods include uncatalyzed and Cu(I)-catalyzed alkyne-azide cycloadditions and a novel photochemical thymidine-psoralen cycloaddition. The first reading method "relay primer-dependent bypass" utilizes a relay primer that hybridizes across a chemical ligation junction embedded in a fixed-sequence and is extended at its 3'-terminus prior to ligation to adjacent oligonucleotides. The second reading method "repeat-dependent bypass" utilizes chemical ligation junctions that are flanked by repeated sequences. The upstream repeat is copied prior to a rearrangement event during which the 3'-terminus of the cDNA hybridizes to the downstream repeat and polymerization continues. In principle these reading methods may be used with any ligation chemistry and offer universal strategies for the encoding (writing) and interpretation (reading) of DNA-encoded chemical libraries.

  17. Utilization of chemically modified lignin

    SciTech Connect

    Chem, M.J.

    1996-10-01

    A chemical modification method has been developed to convert lignin into lignin graft copolymers. The graft products are macromolecular surface active agents because, within each molecule, a hydrocarbon sidechain has been gown off of a natural oxyphenylpropyl backbone. Surface activity of the graft copolymers was indicated by their capacity to form stable emulsions between incompatible fluid phases and to adhesively bond to wood surfaces. Lignin has been grafted with ethenylbenzene (styrene), 4-methyl-2-oxy-3-oxopent-4-ene (methylmethacrylate), 2-propenamide(acrylamide), 2-propene nitrile (acrylonitrile), cationic monomers, and anionic monomers. Synthesis with anionic, cationic, or polar nonionic monomers produced water soluble, lignin copolymers that were effective dispersing, flocculating, and surface active agents. The nonionic polymers and their hydrolysis products are effective thinners and suspending agents for drilling mud formulations. In reactions with ethenylbenzene, lignin was used to make thermoplastic materials. These products have been shown to be poly(lignin-g-(1-phenylethylene))-containing materials by a series of solubility and extraction tests and are formed with 90% or more grafting efficiency for lignin. These materials have been shown to be thermoplastics, coupling agents for wood and plastic, and biodegradable plastics.

  18. Position-dependent effects on stability in tricyclo-DNA modified oligonucleotide duplexes

    PubMed Central

    Ittig, Damian; Gerber, Anna-Barbara; Leumann, Christian J.

    2011-01-01

    A series of oligodeoxyribonucleotides and oligoribonucleotides containing single and multiple tricyclo(tc)-nucleosides in various arrangements were prepared and the thermal and thermodynamic transition profiles of duplexes with complementary DNA and RNA evaluated. Tc-residues aligned in a non-continuous fashion in an RNA strand significantly decrease affinity to complementary RNA and DNA, mostly as a consequence of a loss of pairing enthalpy ΔH. Arranging the tc-residues in a continuous fashion rescues Tm and leads to higher DNA and RNA affinity. Substitution of oligodeoxyribonucleotides in the same way causes much less differences in Tm when paired to complementary DNA and leads to substantial increases in Tm when paired to complementary RNA. CD-spectroscopic investigations in combination with molecular dynamics simulations of duplexes with single modifications show that tc-residues in the RNA backbone distinctly influence the conformation of the neighboring nucleotides forcing them into higher energy conformations, while tc-residues in the DNA backbone seem to have negligible influence on the nearest neighbor conformations. These results rationalize the observed affinity differences and are of relevance for the design of tc-DNA containing oligonucleotides for applications in antisense or RNAi therapy. PMID:20719742

  19. Matrix-assisted laser desorption ionization time-of-flight mass spectrometry: a powerful tool for the mass and sequence analysis of natural and modified oligonucleotides.

    PubMed Central

    Pieles, U; Zürcher, W; Schär, M; Moser, H E

    1993-01-01

    We report the analysis and characterization of natural and modified oligonucleotides by matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF MS). The present technology was highly improved for this class of compounds by using a new matrix, 2,4,6-trihydroxy acetophenone, together with di- and triammonium salts of organic or inorganic acids to suppress peak broadening due to multiple ion adducts. This methodology can be used in combination with time dependent degradation of oligonucleotides by exonucleases as powerful tool to determine sequence compositions. PMID:8341593

  20. Systematic evaluation and optimization of modification reactions of oligonucleotides with amines and carboxylic acids for the synthesis of DNA-encoded chemical libraries.

    PubMed

    Franzini, Raphael M; Samain, Florent; Abd Elrahman, Maaly; Mikutis, Gediminas; Nauer, Angela; Zimmermann, Mauro; Scheuermann, Jörg; Hall, Jonathan; Neri, Dario

    2014-08-20

    DNA-encoded chemical libraries are collections of small molecules, attached to DNA fragments serving as identification barcodes, which can be screened against multiple protein targets, thus facilitating the drug discovery process. The preparation of large DNA-encoded chemical libraries crucially depends on the availability of robust synthetic methods, which enable the efficient conjugation to oligonucleotides of structurally diverse building blocks, sharing a common reactive group. Reactions of DNA derivatives with amines and/or carboxylic acids are particularly attractive for the synthesis of encoded libraries, in view of the very large number of building blocks that are commercially available. However, systematic studies on these reactions in the presence of DNA have not been reported so far. We first investigated conditions for the coupling of primary amines to oligonucleotides, using either a nucleophilic attack on chloroacetamide derivatives or a reductive amination on aldehyde-modified DNA. While both methods could be used for the production of secondary amines, the reductive amination approach was generally associated with higher yields and better purity. In a second endeavor, we optimized conditions for the coupling of a diverse set of 501 carboxylic acids to DNA derivatives, carrying primary and secondary amine functions. The coupling efficiency was generally higher for primary amines, compared to secondary amine substituents, but varied considerably depending on the structure of the acids and on the synthetic methods used. Optimal reaction conditions could be found for certain sets of compounds (with conversions >80%), but multiple reaction schemes are needed when assembling large libraries with highly diverse building blocks. The reactions and experimental conditions presented in this article should facilitate the synthesis of future DNA-encoded chemical libraries, while outlining the synthetic challenges that remain to be overcome.

  1. Electrochemical biosensors for detection of point mutation based on surface ligation reaction and oligonucleotides modified gold nanoparticles.

    PubMed

    Wang, Qing; Yang, Lijuan; Yang, Xiaohai; Wang, Kemin; He, Leiliang; Zhu, Jinqing

    2011-03-04

    An electrochemical method for point mutation detection based on surface ligation reaction and oligonucleotides (ODNs) modified gold nanoparticles (AuNPs) was demonstrated. Point mutation identification was achieved using Escherichia coli DNA ligase. This system for point mutation detection relied on a sandwich assay comprising capture ODN immobilized on Au electrodes, target ODN and ligation ODN. Because of the sequence-specific surface reactions of E. coli DNA ligase, the ligation ODN covalently linked to the capture ODN only in the presence of a perfectly complementary target ODN. The presence of ligation products on Au electrode was detected using chronocoulometry through hybridization with reporter ODN modified AuNPs. The use of AuNPs improved the sensitivity of chronocoulometry in this approach, a detection limit of 0.9 pM complementary ODN was obtained. For single base mismatched ODN (smODN), a negligible signal was observed. Even if the concentration ratio of complementary ODN to smODN was decreased to 1:1000, a detectable signal was observed. This work may provide a specific, sensitive and cost-efficient approach for point mutant detection.

  2. Synthesis and properties of carbohydrate-phosphate backbone-modified oligonucleotide analogues and nucleic acid mimetics

    NASA Astrophysics Data System (ADS)

    Abramova, Tatyana V.; Silnikov, Vladimir N.

    2011-05-01

    Advances in the synthesis of oligo(deoxy)ribonucleotide analogues and nucleic acid mimetics made in the last decade are summarized. Attention is focused on new methods for the synthesis of derivatives with a modified ribose-phosphate backbone (phosphorothioate, boranophosphate, and nucleoside phosphonate derivatives) and derivatives devoid of the phosphate group. Among nucleic acid mimetics, conformationally restricted modified peptide nucleic acids, including those bearing a negative or positive charge, and morpholino oligomers are considered. Advantages and drawbacks of the main types of analogues as regards the complexity of the synthesis and the possibility of their application as antisense agents or reagents for hybridization analysis are compared.

  3. Probing the microenvironments in the grooves of Z-DNA using dan-modified oligonucleotides.

    PubMed

    Kimura, Takumi; Kawai, Kiyohiko; Majima, Tetsuro

    2006-04-14

    The environment-sensitive fluorophore dan (6-dimethylamino-2-acyl-naphthalene)- modified dC or dG bases were introduced into the Z-DNA forming sequence. It was demonstrated that both grooves of Z-DNA are more hydrated than those of B-DNA. Dan will be useful for probing the microenvironments in the grooves among the DNA polymorphs.

  4. Pharmacology of a Central Nervous System Delivered 2′-O-Methoxyethyl–Modified Survival of Motor Neuron Splicing Oligonucleotide in Mice and Nonhuman Primates

    PubMed Central

    Chun, Seung J.; Norris, Daniel A.; Hung, Gene; Lee, Sam; Matson, John; Fey, Robert A.; Gaus, Hans; Hua, Yimin; Grundy, John S.; Krainer, Adrian R.; Henry, Scott P.; Bennett, C. Frank

    2014-01-01

    Spinal muscular atrophy (SMA) is a debilitating neuromuscular disease caused by the loss of survival of motor neuron (SMN) protein. Previously, we demonstrated that ISIS 396443, an antisense oligonucleotide (ASO) targeted to the SMN2 pre-mRNA, is a potent inducer of SMN2 exon 7 inclusion and SMN protein expression, and improves function and survival of mild and severe SMA mouse models. Here, we demonstrate that ISIS 396443 is the most potent ASO in central nervous system (CNS) tissues of adult mice, compared with several other chemically modified ASOs. We evaluated methods of ISIS 396443 delivery to the CNS and characterized its pharmacokinetics and pharmacodynamics in rodents and nonhuman primates (NHPs). Intracerebroventricular bolus injection is a more efficient method of delivering ISIS 396443 to the CNS of rodents, compared with i.c.v. infusion. For both methods of delivery, the duration of ISIS 396443–mediated SMN2 splicing correction is long lasting, with maximal effects still observed 6 months after treatment discontinuation. Administration of ISIS 396443 to the CNS of NHPs by a single intrathecal bolus injection results in widespread distribution throughout the spinal cord. Based upon these preclinical studies, we have advanced ISIS 396443 into clinical development. PMID:24784568

  5. Detection of Plasmodium Lactate Dehydrogenase Antigen in Buffer Using Aptamer-Modified Magnetic Microparticles for Capture, Oligonucleotide-Modified Quantum Dots for Detection, and Oligonucleotide-Modified Gold Nanoparticles for Signal Amplification.

    PubMed

    Kim, Chloe; Searson, Peter C

    2017-09-20

    To overcome the limitations associated with antibody-based sensors, we describe a proof-of-concept of an aptamer-based sandwich assay for detection of lactate dehydrogenase, an antigen associated with malaria. We show a detection limit of Plasmodium falciparum lactate dehydrogenase and Plasmodium vivax lactate dehydrogenase of 0.5 fmole in buffer, comparable to an antibody-based assay, using a magnetic particle-aptamer construct for capture and a quantum dot-aptamer construct for detection. We then demonstrate a detection limit of 10 amole (50-fold amplification) using oligonucleotide-functionalized gold nanoparticles to allow the conjugation of multiple quantum dots for each target antigen.

  6. Interplay of Structure, Hydration and Thermal Stability in Formacetal Modified Oligonucleotides: RNA May Tolerate Nonionic Modifications Better than DNA

    SciTech Connect

    Kolarovic, A.; Schweizer, E; Greene, E; Gironda, M; Pallan, P; Egli, M; Rozners, E

    2009-01-01

    DNA and RNA oligonucleotides having formacetal internucleoside linkages between uridine and adenosine nucleosides have been prepared and studied using UV thermal melting, osmotic stress, and X-ray crystallography. Formacetal modifications have remarkably different effects on double helical RNA and DNAethe formacetal stabilizes the RNA helix by +0.7 C but destabilizes the DNA helix by -1.6 C per modification. The apparently hydrophobic formacetal has little effect on hydration of RNA but decreases the hydration of DNA, which suggests that at least part of the difference in thermal stability may be related to differences in hydration. A crystal structure of modified DNA shows that two isolated formacetal linkages fit almost perfectly in an A-type helix (decamer). Taken together, the data suggest that RNA may tolerate nonionic backbone modifications better than DNA. Overall, formacetal appears to be an excellent mimic of phosphate linkage in RNA and an interesting modification for potential applications in fundamental studies and RNA-based gene control strategies, such as RNA interference.

  7. Binding specificity and stability of duplexes formed by modified oligonucleotides with a 4096-hexanucleotide microarray

    PubMed Central

    Timofeev, Edward; Mirzabekov, Andrei

    2001-01-01

    The binding of oligodeoxynucleotides modified with adenine 2′-O-methyl riboside, 2,6-diaminopurine 2′-O-methyl riboside, cytosine 2′-O-methyl riboside, 2,6-diaminopurine deoxyriboside or 5-bromodeoxyuridine was studied with a microarray containing all possible (4096) polyacrylamide-bound hexadeoxynucleotides (a generic microchip). The generic microchip was manufactured by using reductive immobilization of aminooligonucleotides in the activated copolymer of acrylamide, bis-acrylamide and N-(2,2-dimethoxyethyl) acrylamide. The binding of the fluorescently labeled modified octanucleotides to the array was analyzed with the use of both melting profiles and the fluorescence distribution at selected temperatures. Up to three substitutions of adenosines in the octamer sequence by adenine 2′-O-methyl ribosides (Am), 2,6-diaminopurine 2′-O-methyl ribosides (Dm) or 2,6-diaminopurine deoxyribosides (D) resulted in increased mismatch discrimination measured at the melting temperature of the corresponding perfect duplex. The stability of complexes formed by 2′-O-methyl-adenosine-modified oligodeoxynucleotides was slightly decreased with every additional substitution, yielding ∼4°C of total loss in melting temperature for three modifications, as followed from microchip thermal denaturation experiments. 2,6-Diaminopurine 2′-O-methyl riboside modifications led to considerable duplex stabilization. The cytosine 2′-O-methyl riboside and 5-bromodeoxyuridine modifications generally did not change either duplex stability or mismatch resolution. Denaturation experiments conducted with selected perfect duplexes on microchips and in solution showed similar results on thermal stabilities. Some hybridization artifacts were observed that might indicate the formation of parallel DNA. PMID:11410672

  8. 2'-O-methyl-modified phosphorothioate antisense oligonucleotides have reduced non-specific effects in vitro.

    PubMed

    Yoo, Byong Hoon; Bochkareva, Elena; Bochkarev, Alexey; Mou, Tung-Chung; Gray, Donald M

    2004-01-01

    Antisense oligodeoxynucleotides (ODNs) have biological activity in treating various forms of cancer. The antisense effects of two types of 20mer ODNs, phosphorothioate-modified ODNs (S-ODNs) and S-ODNs with 12 2'-O-methyl groups (Me-S-ODNs), targeted to sites 109 and 277 of bcl-2 mRNA, were compared. Both types were at least as effective as G3139 (Genta, Inc.) in reducing the level of Bcl-2 protein in T24 cells following a 4 h transfection at a dose of 0.1 micro M. Circular dichroism spectra showed that both types formed A-form duplexes with the complementary RNA, and the melting temperatures were in the order of Me-S-ODN.RNA > normal DNA.RNA > S-ODN.RNA. In comparison with the S-ODN, the Me-S-ODN had reduced toxic growth inhibitory effects, was less prone to bind the DNA-binding domain A of human replication protein A, and was as resistant to serum nucleases. Neither type of oligomer induced apoptosis, according to a PARP-cleavage assay. Hybrids formed with Me-S-ODN sequences were less sensitive to RNase H degradation than those formed with S-ODN sequences. Despite this latter disadvantage, the addition of 2'-O-methyl groups to a phosphorothioate-modified ODN is advantageous because of increased stability of binding and reduced non-specific effects.

  9. Screening genetically modified organisms using multiplex-PCR coupled with oligonucleotide microarray.

    PubMed

    Xu, Jia; Miao, Haizhen; Wu, Houfei; Huang, Wensheng; Tang, Rong; Qiu, Minyan; Wen, Jianguo; Zhu, Shuifang; Li, Yao

    2006-07-15

    In this research, we developed a multiplex polymerase chain reaction (multiplex-PCR) coupled with a DNA microarray system simultaneously aiming at many targets in a consecutive reaction to detect a genetically modified organism (GMO). There are a total of 20 probes for detecting a GMO in a DNA microarray which can be classified into three categories according to their purpose: the first for screening GMO from un-transgenic plants based on the common elements such as promoter, reporter and terminator genes; the second for specific gene confirmation based on the target gene sequences such as herbicide-resistance or insect-resistance genes; the third for species-specific genes which the sequences are unique for different plant species. To ensure the reliability of this method, different kinds of positive and negative controls were used in DNA microarray. Commercial GM soybean, maize, rapeseed and cotton were identified by means of this method and further confirmed by PCR analysis and sequencing. The results indicate that this method discriminates between the GMOs very quickly and in a cost-saving and more time efficient way. It can detect more than 95% of currently commercial GMO plants and the limits of detection are 0.5% for soybean and 1% for maize. This method is proved to be a new method for routine analysis of GMOs.

  10. Molecular beacon modified sensor chips for oligonucleotide detection with optical readout.

    PubMed

    Su, Qiang; Wesner, Daniel; Schönherr, Holger; Nöll, Gilbert

    2014-12-02

    Three different surface bound molecular beacons (MBs) were investigated using surface plasmon fluorescence spectroscopy (SPFS) as an optical readout technique. While MB1 and MB2, both consisting of 36 bases, differed only in the length of the linker for surface attachment, the significantly longer MB3, consisting of 56 bases, comprised an entirely different sequence. For sensor chip preparation, the MBs were chemisorbed on gold via thiol anchors together with different thiol spacers. The influence of important parameters, such as the length of the MBs, the length of the linker between the MBs and the gold surface, the length and nature of the thiol spacers, and the ratio between the MBs and the thiol spacers was studied. After hybridization with the target, the fluorophore of the longer MB3 was oriented close to the surface, and the shorter MBs were standing more or less upright, leading to a larger increase in fluorescence intensity. Fluorescence microscopy revealed a homogeneous distribution of the MBs on the surface. The sensor chips could be used for simple and fast detection of target molecules with a limit of detection in the larger picomolar range. The response time was between 5 and 20 min. Furthermore, it was possible to distinguish between fully complementary and singly mismatched targets. While rinsing with buffer solution after hybridization with target did not result in any signal decrease, complete dehybridization could be carried out by intense rinsing with pure water. The MB modified sensor chips could be prepared in a repeatable manner and reused many times without significant decrease in performance.

  11. Properties Characterization of Chemically Modified Hemp Hurds

    PubMed Central

    Stevulova, Nadezda; Cigasova, Julia; Estokova, Adriana; Terpakova, Eva; Geffert, Anton; Kacik, Frantisek; Singovszka, Eva; Holub, Marian

    2014-01-01

    The effect of chemical treatment of hemp hurds slices in three solutions (EDTA (Ethylenediaminetetraacetic acid), NaOH and Ca(OH)2) on the properties of natural material was discussed in this paper. Changes in the morphology, chemical composition and structure as well as thermal stability of hemp hurds before and after their modification were investigated by using FTIR (Fourier transform infrared spectroscopy), XRD (X-ray powder diffraction analysis) and TG (thermogravimetry)/DSC (differential scanning calorimetry). Size exclusion chromatography (SEC) measurements were used for determination of degree of cellulose polymerization of hemp hurd samples. Chemical modification is related to the partial removal of non-cellulosic components of lignin, hemicellulose and pectin as well as waxes from the surface of hemp hurd slices. Another effect of the chemical treatment applied is connected with increasing the crystallinity index of cellulose determined by FTIR and XRD methods. Decrease in degree of cellulose polymerization and polydispersity index in chemically modified hemp hurds compared to the original sample was observed. Increase in thermal stability of treated hemp hurd was found. The most significant changes were observed in alkaline treated hemp hurds by NaOH. PMID:28788294

  12. Quality of chemically modified hemp fibers.

    PubMed

    Kostic, Mirjana; Pejic, Biljana; Skundric, Petar

    2008-01-01

    Hemp fibers are very interesting natural material for textile and technical applications now. Applying hemp fibers to the apparel sector requires improved quality fibers. In this paper, hemp fibers were modified with sodium hydroxide solutions (5% and 18% w/v), at room and boiling temperature, for different periods of time, and both under tension and slack, in order to partially extract noncellulosic substances, and separate the fiber bundles. The quality of hemp fibers was characterised by determining their chemical composition, fineness, mechanical and sorption properties. The modified hemp fibers were finer, with lower content of lignin, increased flexibility, and in some cases tensile properties were improved. An original method for evaluation of tensile properties of hemp fibers was developed.

  13. The mechanism of the chemical synthesis of oligonucleotides and its synthetic consequences.

    PubMed Central

    Knorre, D G; Zarytova, V F

    1976-01-01

    The data obtained mainly by pulsed NMR spectroscopy on phosphorus nuclei on the mechanism of the internucleotide phosphodiester (PDE) group formation are summarised. With arylsulphonyl chloride as condensing reagent monomeric nucleotide derivative B (nucleoside metaphosphate or its pyridinium adduct) is the highly reactive intermediate. In the presence of PDE groups in nucleoside or nucleotide component the significantly less reactive derivatives with trisubstituted pyrophosphoryl residues are formed both with arylsulphonyl chloride and dicyclohexylcarbodiimide (DCC). The reactive B form of nucleotide component may be obtained using greater excess of arylsulphonyl chloride with simultaneous convertion of PDE groups to tetrasubstituted pyrophosphates amenable to side reactions. The convertion of PDE groups to easily hydrolysable dicyclohexylurea derivatives by reaction with DCC is proposed to reversible blocking of PDE groups of nucleoside component. The B type derivatives of mononucleotides or oligonucleotides with blocked PDE groups seems to be the best nucleotide components. PMID:186762

  14. Chemical Synthesis of Modified Hyaluronic Acid Disaccharides.

    PubMed

    Mende, Marco; Nieger, Martin; Bräse, Stefan

    2017-09-07

    Herein we report a chemical synthesis towards new modified hyaluronic acid oligomers by using only commercially available d-glucose and d-glucosamine hydrochloride. The various protected hyaluronic acid disaccharides were synthesized bearing new functional groups at C-6 of the β-d-glucuronic acid moiety with a view to structure-related biological activity tests. The orthogonal protecting group pattern allows ready access to the corresponding higher oligomers. Also, (1) H NMR studies of the new derivatives demonstrated the effect of the various functional groups on the intramolecular electronic environment. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. Polycationic ligands of different chemical classes stimulate DNA strand displacement between short oligonucleotides in a protein-free system.

    PubMed

    Volodin, Alexander A; Bocharova, Tatiana N; Smirnova, Elena A

    2016-09-01

    The ability of polycationic ligands to stimulate DNA strand displacement between short oligonucleotides in a protein-free system is demonstrated. We show that two ligands, tetracationic aliphatic amine (spermine) and a dicationic intercalating drug (chloroquine), promote strand displacement in a concentration-dependent manner. At low concentrations both ligands decelerate spontaneous strand displacement because of their impact on the stability of the DNA duplex. At elevated concentrations they accelerate strand displacement via formation of intermediate structures containing three DNA strands. The rate of the last process does not correlate with the thermal dissociation rate of the entire DNA duplex. It indicates that, possibly, the action of these agents cannot be explained by their influence on the stability of the DNA duplex. In general, our results suggest that the ability to stimulate DNA strand displacement appears to be a common feature of polycations of different chemical and structural classes. © 2016 Wiley Periodicals, Inc. Biopolymers 105: 633-641, 2016.

  16. Encoded libraries of chemically modified peptides.

    PubMed

    Heinis, Christian; Winter, Greg

    2015-06-01

    The use of powerful technologies for generating and screening DNA-encoded protein libraries has helped drive the development of proteins as pharmaceutical ligands. However the development of peptides as pharmaceutical ligands has been more limited. Although encoded peptide libraries are typically several orders of magnitude larger than classical chemical libraries, can be more readily screened, and can give rise to higher affinity ligands, their use as pharmaceutical ligands is limited by their intrinsic properties. Two of the intrinsic limitations include the rotational flexibility of the peptide backbone and the limited number (20) of natural amino acids. However these limitations can be overcome by use of chemical modification. For example, the libraries can be modified to introduce topological constraints such as cyclization linkers, or to introduce new chemical entities such as small molecule ligands, fluorophores and photo-switchable compounds. This article reviews the chemistry involved, the properties of the peptide ligands, and the new opportunities offered by chemical modification of DNA-encoded peptide libraries.

  17. In vitro evolution of chemically-modified nucleic acid aptamers: Pros and cons, and comprehensive selection strategies.

    PubMed

    Lipi, Farhana; Chen, Suxiang; Chakravarthy, Madhuri; Rakesh, Shilpa; Veedu, Rakesh N

    2016-12-01

    Nucleic acid aptamers are single-stranded DNA or RNA oligonucleotide sequences that bind to a specific target molecule with high affinity and specificity through their ability to adopt 3-dimensional structure in solution. Aptamers have huge potential as targeted therapeutics, diagnostics, delivery agents and as biosensors. However, aptamers composed of natural nucleotide monomers are quickly degraded in vivo and show poor pharmacodynamic properties. To overcome this, chemically-modified nucleic acid aptamers are developed by incorporating modified nucleotides after or during the selection process by Systematic Evolution of Ligands by EXponential enrichment (SELEX). This review will discuss the development of chemically-modified aptamers and provide the pros and cons, and new insights on in vitro aptamer selection strategies by using chemically-modified nucleic acid libraries.

  18. In vitro evolution of chemically-modified nucleic acid aptamers: Pros and cons, and comprehensive selection strategies

    PubMed Central

    Chen, Suxiang; Chakravarthy, Madhuri; Rakesh, Shilpa; Veedu, Rakesh N.

    2016-01-01

    ABSTRACT Nucleic acid aptamers are single-stranded DNA or RNA oligonucleotide sequences that bind to a specific target molecule with high affinity and specificity through their ability to adopt 3-dimensional structure in solution. Aptamers have huge potential as targeted therapeutics, diagnostics, delivery agents and as biosensors. However, aptamers composed of natural nucleotide monomers are quickly degraded in vivo and show poor pharmacodynamic properties. To overcome this, chemically-modified nucleic acid aptamers are developed by incorporating modified nucleotides after or during the selection process by Systematic Evolution of Ligands by EXponential enrichment (SELEX). This review will discuss the development of chemically-modified aptamers and provide the pros and cons, and new insights on in vitro aptamer selection strategies by using chemically-modified nucleic acid libraries. PMID:27715478

  19. XPS studies of chemically modified banana fibers.

    PubMed

    Pothan, L A; Simon, F; Spange, S; Thomas, S

    2006-03-01

    Banana fibers obtained from the sheath of the banana plant (Musa Sapientum) whose major constituent is cellulose were modified using various chemical agents in order to improve their compatibility with the polymer matrix. The change in the surface composition of the raw and chemically modified fiber was investigated using various techniques such as solvatochromism, electrokinetic measurements, and XPS. Surface characterization by XPS showed the presence of numerous elements on the surface of the fiber. Investigation of the surface after alkali treatment on the other hand showed the removal of most of the elements. Silane treatment was found to introduce a considerable amount of silicon on the surface of the fiber. The [O]/[C] ratio was found to decrease in all cases except for the fluorinated and vinyl silane treated fibers. Detailed investigation of the deconvoluted C 1s spectra revealed the change in the percentage atomic concentration of the various elements on the fiber surface. The dissolution of the various surface components by alkali treatment, which was earlier revealed by SEM, was further confirmed by XPS. The XPS results were found to perfectly agree with the solvatochromic and electrokinetic measurements.

  20. Discrimination of oligonucleotides of different lengths with a wild-type aerolysin nanopore

    NASA Astrophysics Data System (ADS)

    Cao, Chan; Ying, Yi-Lun; Hu, Zheng-Li; Liao, Dong-Fang; Tian, He; Long, Yi-Tao

    2016-08-01

    Protein nanopores offer an inexpensive, label-free method of analysing single oligonucleotides. The sensitivity of the approach is largely determined by the characteristics of the pore-forming protein employed, and typically relies on nanopores that have been chemically modified or incorporate molecular motors. Effective, high-resolution discrimination of oligonucleotides using wild-type biological nanopores remains difficult to achieve. Here, we show that a wild-type aerolysin nanopore can resolve individual short oligonucleotides that are 2 to 10 bases long. The sensing capabilities are attributed to the geometry of aerolysin and the electrostatic interactions between the nanopore and the oligonucleotides. We also show that the wild-type aerolysin nanopores can distinguish individual oligonucleotides from mixtures and can monitor the stepwise cleavage of oligonucleotides by exonuclease I.

  1. Functionalization of silicon oxide using supercritical fluid deposition of 3,4-epoxybutyltrimethoxysilane for the immobilization of amino-modified oligonucleotide

    NASA Astrophysics Data System (ADS)

    Rull, Jordi; Nonglaton, Guillaume; Costa, Guillaume; Fontelaye, Caroline; Marchi-Delapierre, Caroline; Ménage, Stéphane; Marchand, Gilles

    2015-11-01

    The functionalization of silicon oxide based substrates using silanes is generally performed through liquid phase methodologies. These processes involve a huge quantity of potentially toxic solvents and present some important disadvantages for the functionalization of microdevices or porous materials, for example the low diffusion. To overcome this drawback, solvent-free methodologies like molecular vapor deposition (MVD) or supercritical fluid deposition (SFD) have been developed. In this paper, the deposition process of 3,4-epoxybutyltrimethoxysilane (EBTMOS) on silicon oxide using supercritical carbon dioxide (scCO2) as a solvent is studied for the first time. The oxirane ring of epoxy silanes readily reacts with amine group and is of particular interest for the grafting of amino-modified oligonucleotides or antibodies for diagnostic application. Then the ability of this specific EBTMOS layer to react with amine functions has been evaluated using the immobilization of amino-modified oligonucleotide probes. The presence of the probes is revealed by fluorescence using hybridization with a fluorescent target oligonucleotide. The performances of SFD of EBTMOS have been optimized and then compared with the dip coating and molecular vapor deposition methods, evidencing a better grafting efficiency and homogeneity, a lower reaction time in addition to the eco-friendly properties of the supercritical carbon dioxide. The epoxysilane layers have been characterized by surface enhanced ellipsometric contrast optical technique, atomic force microscopy, multiple internal reflection infrared spectroscopy and X-ray photoelectron spectroscopy. The shelf life of the 3,4-epoxybutyltrimethoxysilane coating layer has also been studied. Finally, two different strategies of NH2-oligonucleotide grafting on EBTMOS coating layer have been compared, i.e. reductive amination and nucleophilic substitution, SN2. This EBTMOS based coating layer can be used for a wide range of applications

  2. Chemically modified carbonic anhydrases useful in carbon capture systems

    DOEpatents

    Novick, Scott J; Alvizo, Oscar

    2013-10-29

    The present disclosure relates to chemically modified carbonic anhydrase polypeptides and soluble compositions, homogenous liquid formulations comprising them. The chemically modified carbonic anhydrase polypeptides have improved properties relative to the same carbonic anhydrase polypeptide that is not chemically modified including the improved properties of increased activity and/or stability in the presence of amine compounds, ammonia, or carbonate ion. The present disclosure also provides methods of preparing the chemically modified polypeptides and methods of using the chemically modified polypeptides for accelerating the absorption of carbon dioxide from a gas stream into a solution as well as for the release of the absorbed carbon dioxide for further treatment and/or sequestering.

  3. Chemically modified carbonic anhydrases useful in carbon capture systems

    DOEpatents

    Novick, Scott; Alvizo, Oscar

    2013-01-15

    The present disclosure relates to chemically modified carbonic anhydrase polypeptides and soluble compositions, homogenous liquid formulations comprising them. The chemically modified carbonic anhydrase polypeptides have improved properties relative to the same carbonic anhydrase polypeptide that is not chemically modified including the improved properties of increased activity and/or stability in the presence of amine compounds, ammonia, or carbonate ion. The present disclosure also provides methods of preparing the chemically modified polypeptides and methods of using the chemically modified polypeptides for accelerating the absorption of carbon dioxide from a gas stream into a solution as well as for the release of the absorbed carbon dioxide for further treatment and/or sequestering.

  4. Inhibition of microRNA with antisense oligonucleotides.

    PubMed

    Esau, Christine C

    2008-01-01

    Antisense inhibition of microRNA (miRNA) function has been an important tool for uncovering miRNA biology. Chemical modification of anti-miRNA oligonucleotides (AMOs) is necessary to improve affinity for target miRNA, stabilize the AMO to nuclease degradation, and to promote tissue uptake for in vivo delivery. Here I summarize the work done to evaluate the effectiveness of various chemically modified AMOs for use in cultured cells and rodent models, and outline important issues to consider when inhibiting miRNAs with antisense oligonucleotides.

  5. Double-stranded DNA-templated cleavage of oligonucleotides containing a P3'->N5' linkage triggered by triplex formation: the effects of chemical modifications and remarkable enhancement in reactivity.

    PubMed

    Ito, Kosuke Ramon; Kodama, Tetsuya; Tomizu, Masaharu; Negoro, Yoshinori; Orita, Ayako; Osaki, Tomohisa; Hosoki, Noritsugu; Tanaka, Takaya; Imanishi, Takeshi; Obika, Satoshi

    2010-11-01

    We recently reported double-stranded DNA-templated cleavage of oligonucleotides as a sequence-specific DNA-detecting method. In this method, triplex-forming oligonucleotides (TFOs) modified with 5'-amino-2',4'-BNA were used as a DNA-detecting probe. This modification introduced a P3'→N5' linkage (P-N linkage) in the backbone of the TFO, which was quickly cleaved under acidic conditions when it formed a triplex. The prompt fission of the P-N linkage was assumed to be driven by a conformational strain placed on the linkage upon triplex formation. Therefore, chemical modifications around the P-N linkage should change the reactivity by altering the microenvironment. We synthesized 5'-aminomethyl type nucleic acids, and incorporated them into TFOs instead of 5'-amino-2',4'-BNA to investigate the effect of 5'-elongation. In addition, 2',4'-BNA/LNA or 2',5'-linked DNA were introduced at the 3'- and/or 5'-neighboring residues of 5'-amino-2',4'-BNA to reveal neighboring residual effects. We evaluated the triplex stability and reaction properties of these TFOs, and found out that chemical modifications around the P-N linkage greatly affected their reaction properties. Notably, 2',5'-linked DNA at the 3' position flanking 5'-amino-2',4'-BNA brought significantly higher reactivity, and we succeeded in indicating that a TFO with this modification is promising as a DNA analysis tool.

  6. Pentopyranosyl Oligonucleotide Systems

    NASA Technical Reports Server (NTRS)

    Reck, Folkert; Kudick, Rene; Krishnamurthy, Ramanarayanan; Eschenmoser, Albert; Wippo, Harald

    2001-01-01

    To determine whether the remarkable chemical properties of the pyranosyl isomer of RNA as an informational Watson-Crick base-pairing system are unique to the pentopyranosyl-(4 + 2)-oligonucleotide isomer derived from the RNA-building block D-ribose, studies on the entire family of diastereoisomeric pyranosyL(4 - Z)-oligonucleotide systems deriving from D-ribose. L-lyxose. D-xylose, and L-arabinose were carried out. The result of these extended studies is unambiguous: not only pyranosyl-RNA, but all members of the pentopyranosyl(4 + 2)-oligonucleotide family are highly efficient Watson-Crick base-pairing systems. Their synthesis and pairing properties will be described in a series of publications in this journal.

  7. Renal uptake and tolerability of a 2'-O-methoxyethyl modified antisense oligonucleotide (ISIS 113715) in monkey.

    PubMed

    Henry, Scott P; Johnson, Mark; Zanardi, Thomas A; Fey, Robert; Auyeung, Diana; Lappin, Patrick B; Levin, Arthur A

    2012-11-15

    The primary target organ for uptake of systemically administered phosphorothioate oligonucleotides is the kidney cortex and the proximal tubular epithelium in particular. To determine the effect of oligonucleotide uptake on renal function, a detailed renal physiology study was performed in cynomolgus monkeys treated with 10-40 mg/kg/week ISIS 113715 for 4 weeks. The concentrations of oligonucleotide in the kidney cortex ranged from 1400 to 2600 μg/g. These concentrations were associated with histologic changes in proximal tubular epithelial cells that ranged from the appearance of cytoplasmic basophilic granules to atrophic and degenerative changes at higher concentrations. However, there were no renal functional abnormalities as determined by the typical measurements of blood urea nitrogen, serum creatinine, creatinine clearance, or urine specific gravity. Nor were there changes in glomerular filtration rate, or renal blood flow. Specific urinary markers of tubular epithelial cell damage, such as N-acetyl-glucosaminidase, and α-glutathione-s-transferase were not affected. Tubular function was further evaluated by monitoring the urinary excretion of amino acids, β(2)-microglobulin, or glucose. Renal function was challenged by administering a glucose load and by examining concentrating ability after a 4-h water deprivation. Neither challenge produced any evidence of change in renal function. The only change observed was a low incidence of increased urine protein/creatinine ratio in monkeys treated with ≥40 mg/kg/week which was rapidly reversible. Collectively, these data indicate that ISIS 113715-uptake by the proximal tubular epithelium has little or no effect on renal function at concentrations of 2600 μg/g. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

  8. New Concepts of Fluorescent Probes for Specific Detection of DNA Sequences: Bis-Modified Oligonucleotides in Excimer and Exciplex Detection

    PubMed Central

    Gbaj, A; Bichenkova, EV; Walsh, L; Savage, HE; Sardarian, AR; Etchells, LL; Gulati, A; Hawisa, S; Douglas, KT

    2009-01-01

    The detection of single base mismatches in DNA is important for diagnostics, treatment of genetic diseases, and identification of single nucleotide polymorphisms. Highly sensitive, specific assays are needed to investigate genetic samples from patients. The use of a simple fluorescent nucleoside analogue in detection of DNA sequence and point mutations by hybridisation in solution is described in this study. The 5′-bispyrene and 3′-naphthalene oligonucleotide probes form an exciplex on hybridisation to target in water and the 5′-bispyrene oligonucleotide alone is an adequate probe to determine concentration of target present. It was also indicated that this system has a potential to identify mismatches and insertions. The aim of this work was to investigate experimental structures and conditions that permit strong exciplex emission for nucleic acid detectors, and show how such exciplexes can register the presence of mismatches as required in SNP analysis. This study revealed that the hybridisation of 5′-bispyrenyl fluorophore to a DNA target results in formation of a fluorescent probe with high signal intensity change and specificity for detecting a complementary target in a homogeneous system. Detection of SNP mutations using this split-probe system is a highly specific, simple, and accessible method to meet the rigorous requirements of pharmacogenomic studies. Thus, it is possible for the system to act as SNP detectors and it shows promise for future applications in genetic testing. PMID:21483539

  9. Versatile functionalization of nanoelectrodes by oligonucleotides via pyrrole electrochemistry.

    PubMed

    Descamps, Emeline; Nguyen, Khoa; Bouchain-Gautier, Christelle; Filoramo, Arianna; Goux-Capes, Laurence; Goffman, Marcello; Bourgoin, Jean-Philippe; Mailley, Pascal; Livache, Thierry

    2010-11-15

    Surface modification at the nanometer scale is a challenge for the future of molecular electronics. In particular, the precise anchoring and electrical addressing of biological scaffolds such as complex DNA nanonetworks is of importance for generating bio-directed assemblies of nano-objects for nanocircuit purposes. Herein, we consider the individual modification of nanoelectrodes with different oligonucleotide sequences by an electrochemically driven co-polymerization process of pyrrole and modified oligonucleotide sequences bearing pyrrole monomers. We demonstrate that this one-step technique presents the advantages of simplicity, localization of surface modification, mechanical, biological and chemical stability of the coatings, and high lateral resolution.

  10. Synthesis, Improved Antisense Activity and Structural Rationale for the Divergent RNA Affinities of 3′-Fluoro Hexitol Nucleic Acid (FHNA and Ara-FHNA) Modified Oligonucleotides

    PubMed Central

    Egli, Martin; Pallan, Pradeep S.; Allerson, Charles R.; Prakash, Thazha P.; Berdeja, Andres; Yu, Jinghua; Lee, Sam; Watt, Andrew; Gaus, Hans; Bhat, Balkrishen; Swayze, Eric E.; Seth, Punit P.

    2011-01-01

    The synthesis, biophysical, structural and biological properties of both isomers of 3′-fluoro hexitol nucleic acid (FHNA and Ara-FHNA) modified oligonucleotides are reported. Synthesis of the FHNA and Ara-FHNA thymine phosphoramidites was efficiently accomplished starting from known sugar precursors. Optimal RNA affinities were observed with 3′-fluorine atom and nucleobase in a trans-diaxial orientation. The Ara-FHNA analog with an equatorial fluorine was found to be destabilizing. However, the magnitude of destabilization was sequence-dependent. Thus, the loss of stability is sharply reduced when Ara-FHNA residues were inserted at pyrimidine-purine (Py-Pu) steps compared to placement within a stretch of pyrimidines (Py-Py). Crystal structures of A-type DNA duplexes modified with either monomer, provide a rationalization for the opposing stability effects and point to a steric origin of the destabilization caused by the Ara-FHNA analog. The sequence dependent effect can be explained by the formation of an inter-nucleotide C-F…H-C pseudo hydrogen bond between F3′ of Ara-FHNA and C8-H of the nucleobase from the 3′-adjacent adenosine that is absent at Py-Py steps. In animal experiments, FHNA-modified antisense oligonucleotides formulated in saline showed potent downregulation of gene expression in liver tissue without producing hepatotoxicity. Our data establish FHNA as a useful modification for antisense therapeutics and also confirm the stabilizing influence of F(Py)…H-C(Pu) pseudo hydrogen bonds in nucleic acid structures. PMID:21919455

  11. Synthesis, Improved Antisense Activity and Structural Rationale for the Divergent RNA Affinities of 3;#8242;-Fluoro Hexitol Nucleic Acid (FHNA and Ara-FHNA) Modified Oligonucleotides

    SciTech Connect

    Egli, Martin; Pallan, Pradeep S.; Allerson, Charles R.; Prakash, Thazha P.; Berdeja, Andres; Yu, Jinghua; Lee, Sam; Watt, Andrew; Gaus, Hans; Bhat, Balkrishen; Swayze, Eric E.; Seth, Punit P.

    2012-03-16

    The synthesis, biophysical, structural, and biological properties of both isomers of 3'-fluoro hexitol nucleic acid (FHNA and Ara-FHNA) modified oligonucleotides are reported. Synthesis of the FHNA and Ara-FHNA thymine phosphoramidites was efficiently accomplished starting from known sugar precursors. Optimal RNA affinities were observed with a 3'-fluorine atom and nucleobase in a trans-diaxial orientation. The Ara-FHNA analog with an equatorial fluorine was found to be destabilizing. However, the magnitude of destabilization was sequence-dependent. Thus, the loss of stability is sharply reduced when Ara-FHNA residues were inserted at pyrimidine-purine (Py-Pu) steps compared to placement within a stretch of pyrimidines (Py-Py). Crystal structures of A-type DNA duplexes modified with either monomer provide a rationalization for the opposing stability effects and point to a steric origin of the destabilization caused by the Ara-FHNA analog. The sequence dependent effect can be explained by the formation of an internucleotide C-F {hor_ellipsis} H-C pseudo hydrogen bond between F3' of Ara-FHNA and C8-H of the nucleobase from the 3'-adjacent adenosine that is absent at Py-Py steps. In animal experiments, FHNA-modified antisense oligonucleotides formulated in saline showed a potent downregulation of gene expression in liver tissue without producing hepatotoxicity. Our data establish FHNA as a useful modification for antisense therapeutics and also confirm the stabilizing influence of F(Py) {hor_ellipsis} H-C(Pu) pseudo hydrogen bonds in nucleic acid structures.

  12. A temperature-tolerant multiplex elements and genes screening system for genetically modified organisms based on dual priming oligonucleotide primers and capillary electrophoresis.

    PubMed

    Fu, Wei; Wei, Shuang; Wang, Chenguang; Du, Zhixin; Zhu, Pengyu; Wu, Xiyang; Wu, Gang; Zhu, Shuifang

    2017-08-15

    High throughput screening systems are the preferred solution to meet the urgent requirement of increasing number of genetically modified organisms (GMOs). In this study, we have successfully developed a multiplex GMO element screening system with dual priming oligonucleotide (DPO) primers. This system can detect the cauliflower mosaic virus 35S (CaMV 35S), terminator of nopaline synthase gene (NOS), figwort mosaic virus 35S (FMV 35S) promoter, neomycin phosphotransferaseII (NPTII), Bt Cry 1Ab, phosphinothricin acetyltransferase genes (bar) and Streptomyces viridochromogenes (pat) simultaneously, which covers more than 90% of all authorized GMO species worldwide. This system exhibits a high tolerance to annealing temperatures, high specificity and a limit of detection equal to conventional PCR. A total of 214 samples from markets, national entry-exit agencies, the Institute for Reference Materials and Measurement (IRMM) and the American Oil Chemists' Society (AOCS) were also tested for applicability. This screening system is therefore suitable for GMO screening.

  13. Chemically Modifying Viruses for Diverse Applications

    PubMed Central

    Mohan, Kritika; Weiss, Gregory Alan

    2017-01-01

    Long fascinating to biologists, viruses offer nanometer-scale benchtops for building molecular-scale devices and materials. Viruses tolerate a wide-range of chemical modifications including reaction conditions, pH values, and temperatures. Recent examples of non-genetic manipulation of viral surfaces have extended viruses into applications ranging from biomedical imaging, drug delivery, tissue regeneration, and biosensors to materials for catalysis and energy generation. Chemical reactions on the phage surface include both covalent and non-covalent modifications, including some applied in conjunction with genetic modifications. Here, we survey viruses chemically augmented with capabilities limited only by imagination. PMID:26930417

  14. Structural Transformations in Chemically Modified Graphene

    DTIC Science & Technology

    2012-07-16

    unclassified Standard Form 298 (Rev. 8-98) Prescribed by ANSI Std Z39-18 graphene oxide (GO) [13], chemical vapor deposition ( CVD ) onto transition metals [14...significantly. Here we focus on the mechanical aspects of graphene materials primarily using multilayer GO, but we also use single-layer CVD graphene grown on...pressure CVD growth on Cu foils [16] and subsequently transfer graphene from Cu using wet chemical approaches [14]. This includes the use of a poly

  15. Phase I trial of ISIS 104838, a 2'-methoxyethyl modified antisense oligonucleotide targeting tumor necrosis factor-alpha.

    PubMed

    Sewell, K Lea; Geary, Richard S; Baker, Brenda F; Glover, Josephine M; Mant, Timothy G K; Yu, Rosie Z; Tami, Joseph A; Dorr, F Andrew

    2002-12-01

    ISIS 104838 is a 20-mer phosphorothioate antisense oligonucleotide (ASO) that binds tumor necrosis factor-alpha (TNF-alpha) mRNA. It carries a 2'-methoxyethyl modification on the five 3' and 5' nucleotide sugars, with 10 central unmodified deoxynucleotides. ISIS 104838 was identified from a 264 ASO screen in phorbol myristate acetate-activated keratinocytes, and the dose response was assessed in lipopolysaccharide (LPS)-activated monocytes. Healthy males received multiple intravenous (i.v.) ISIS 104838 infusions in a placebo-controlled dose escalation trial (0.1-6 mg/kg). Additional volunteers received single or multiple subcutaneous (s.c.) injections. ISIS 104838 suppressed TNF-alpha protein by 85% in stimulated keratinocytes. The IC50 for TNF-alpha mRNA inhibition in stimulated monocytes was <1 microM. For i.v., C(max) occurred at the end of infusion. The effective plasma half-life was 15 to 45 min at 0.1 to 0.5 mg/kg and 1 to 1.8 h for higher doses. The apparent terminal plasma elimination half-life approximated 25 days. Obese subjects had higher plasma levels following equivalent mg/kg doses. For s.c. injections, C(max) occurred at 2 to 4 h and was lower than with equivalent i.v. dosing. Plasma bioavailability compared with i.v. was 82% following a 200 mg/ml s.c. injection. Transient activated partial thromboplastin time prolongation occurred after i.v. infusions and minimally after s.c. injections. Two subjects experienced rash, one a reversible platelet decrease, and mild injection site tenderness was noted. TNF-alpha production by peripheral blood leukocytes, induced ex vivo by LPS, was decreased by ISIS 104838 (p < 0.01). ISIS 104838, a second-generation antisense oligonucleotide, was generally well tolerated intravenously and subcutaneously. The pharmacokinetics support an infrequent dosing interval. Inhibition of TNF-alpha production ex vivo was demonstrated.

  16. Chemical and semisynthesis of modified histones.

    PubMed

    Maity, Suman Kumar; Jbara, Muhammad; Brik, Ashraf

    2016-05-01

    Post-translational modifications (PTMs) of histones play critical roles in the epigenetic regulation of eukaryotic genome by directly altering the biophysical properties of chromatin or by recruiting effector proteins. The large number of PTMs and the inherent complexity in their population and signaling processes make it highly challenging to understand epigenetics-related processes. To address these challenges, accesses to homogeneously modified histones are obligatory. Over the last decade, synthetic protein chemists have been devising novel synthetic tools and applying state-of-the-art chemoselective ligation strategies to prepare precious materials useful in answering fundamental questions in this area. In this short review, we cover some of the recent breakthroughs in these directions in particular the synthesis and semi-synthesis of modified histones and their use to unravel the mysteries of epigenetics. Copyright © 2016 European Peptide Society and John Wiley & Sons, Ltd.

  17. Photoacoustic Spectroscopy of Chemically Modified Surfaces.

    DTIC Science & Technology

    1981-08-01

    silica gel (Baker column chromotography grade, 60-200 mesh) was dried overnight at 1100C in an evacuated oven. The surface area 105 of the silica gel was...modified silica gel in the proportion of 5 mL of solution per gram of silica gel . The silica gel was recovered by filtration , washed with methanol and air...25.0 mL aliquots of the copper (II) solutions. After separation of the silica gel by filtration , the silica gel was air dried. The copper loading was

  18. Antimicrobial activity of chemically modified dextran derivatives.

    PubMed

    Tuchilus, Cristina G; Nichifor, Marieta; Mocanu, Georgeta; Stanciu, Magdalena C

    2017-04-01

    Cationic amphiphilic dextran derivatives with a long alkyl group attached to the reductive end of the polysaccharide chain and quaternary ammonium groups attached as pendent groups to the main dextran backbone were synthesized and tested for their antimicrobial properties against several bacteria and fungi strains. Dependence of antimicrobial activity on both polymer chemical composition (dextran molar mass, length of end alkyl group and chemical structure of ammonium groups) and type of microbes was highlighted by disc-diffusion method (diameter of inhibition zone) and broth microdilution method (minimum inhibitory concentrations). Polymers had antimicrobial activity for all strains studied, except for Pseudomonas aeruginosa ATCC 27853. The best activity against Staphylococcus aureus (Minimun Inhibitory Concentration 60μg/mL) was provided by polymers obtained from dextran with lower molecular mass (Mn=4500), C12H25 or C18H37 end groups, and N,N-dimethyl-N-benzylammonium pendent groups.

  19. Chemically modified opals as thin permselective nanoporous membranes.

    PubMed

    Newton, Michael R; Bohaty, Andrew K; White, Henry S; Zharov, Ilya

    2005-05-25

    Thin-film opals comprising three layers of 440 nm diameter SiO2 spheres were assembled on Pt electrodes and modified with amino groups on the silica surface. Diffusion of anionic, cationic, and neutral redox species through the opals was studied by cyclic voltammetry. The chemically modified opal membranes demonstrate high molecular throughput and, at low pH, selectively block transport of a cationic redox species relative to that of anionic and neutral redox species. This permselective behavior is attributed to the electrostatic interactions that are enhanced by the tortuous pathway within the opal and by the high surface area of the chemically modified spheres.

  20. Synthesis and application of a triazene-ferrocene modifier for immobilization and characterization of oligonucleotides at electrodes.

    PubMed

    Hansen, Majken N; Farjami, Elaheh; Kristiansen, Martin; Clima, Lilia; Pedersen, Steen Uttrup; Daasbjerg, Kim; Ferapontova, Elena E; Gothelf, Kurt V

    2010-04-16

    A new DNA modifier containing triazene, ferrocene, and activated ester functionalities was synthesized and applied for electrochemical grafting and characterization of DNA at glassy carbon (GC) and gold electrodes. The modifier was synthesized from ferrocenecarboxylic acid by attaching a phenyltriazene derivative to one of the ferrocene Cp rings, while the other Cp ring containing the carboxylic acid was converted to an activated ester. The modifier was conjugated to an amine-modified DNA sequence. For immobilization of the conjugate at Au or GC electrodes, the triazene was activated by dimethyl sulfate for release of the diazonium salt. The salt was reductively converted to the aryl radical which was readily immobilized at the surface. DNA grafted onto electrodes exhibited remarkable hybridization properties, as detected through a reversible shift in the redox potential of the Fc redox label upon repeated hybridization/denaturation procedures with a complementary target DNA sequence. By using a methylene blue (MB) labeled target DNA sequence the hybridization could also be followed through the MB redox potential. Electrochemical studies demonstrated that grafting through the triazene modifier can successfully compete with existing protocols for DNA immobilization through the commonly used alkanethiol linkers and diazonium salts. Furthermore, the triazene modifier provides a practical one-step immobilization procedure.

  1. Increasing the Analytical Sensitivity by Oligonucleotides Modified with Para- and Ortho-Twisted Intercalating Nucleic Acids – TINA

    PubMed Central

    Schneider, Uffe V.; Géci, Imrich; Jøhnk, Nina; Mikkelsen, Nikolaj D.; Pedersen, Erik B.; Lisby, Gorm

    2011-01-01

    The sensitivity and specificity of clinical diagnostic assays using DNA hybridization techniques are limited by the dissociation of double-stranded DNA (dsDNA) antiparallel duplex helices. This situation can be improved by addition of DNA stabilizing molecules such as nucleic acid intercalators. Here, we report the synthesis of a novel ortho-Twisted Intercalating Nucleic Acid (TINA) amidite utilizing the phosphoramidite approach, and examine the stabilizing effect of ortho- and para-TINA molecules in antiparallel DNA duplex formation. In a thermal stability assay, ortho- and para-TINA molecules increased the melting point (Tm) of Watson-Crick based antiparallel DNA duplexes. The increase in Tm was greatest when the intercalators were placed at the 5′ and 3′ termini (preferable) or, if placed internally, for each half or whole helix turn. Terminally positioned TINA molecules improved analytical sensitivity in a DNA hybridization capture assay targeting the Escherichia coli rrs gene. The corresponding sequence from the Pseudomonas aeruginosa rrs gene was used as cross-reactivity control. At 150 mM ionic strength, analytical sensitivity was improved 27-fold by addition of ortho-TINA molecules and 7-fold by addition of para-TINA molecules (versus the unmodified DNA oligonucleotide), with a 4-fold increase retained at 1 M ionic strength. Both intercalators sustained the discrimination of mismatches in the dsDNA (indicated by ΔTm), unless placed directly adjacent to the mismatch – in which case they partly concealed ΔTm (most pronounced for para-TINA molecules). We anticipate that the presented rules for placement of TINA molecules will be broadly applicable in hybridization capture assays and target amplification systems. PMID:21673988

  2. Chemically modified diamondoids as biosensors for DNA

    NASA Astrophysics Data System (ADS)

    Sivaraman, Ganesh; Fyta, Maria

    2014-03-01

    Understanding the interaction of biological molecules with materials is essential in view of the novel potential applications arising when these two are combined. To this end, we investigate the interaction of DNA with diamondoids, a broad family of tiny hydrogen-terminated diamond clusters with high technological potential. We model this interaction through quantum-mechanical computer simulations and focus on the hydrogen bonding possibilities of the different DNA nucleobases to the lower amine-modified diamondoids with respect to their relative distance and orientation. Our aim is to promote the binding between these two units, and probe this through the association energy, the electronic structure of the nucleobase-diamondoid system, and the specific role of their frontier orbitals. We discuss the relevance of our results in view of biosensing applications and specifically nanopore sequencing of DNA.

  3. Sensitometric properties of chemically modified bacteriorhodopsin films

    NASA Astrophysics Data System (ADS)

    Lindvold, Lars R.; Imam, Husain; Ramanujam, P. S.

    1994-12-01

    Bacteriorhodopsin (bR) originating from the purple membrane of the bacterium Halobacterium Halobium has been extensively studied during the last few years for a number of optical applications. Extending the lifetime of the intermediate M-state in bR chemically, has been found to improve the sensitometric properties of bR. In this paper, a new method of extending the lifetime of the M-state in the bacteriorhodopsin photocycle is presented. The method pertains to the use of 18- crown-6 ether as an agent to extend the M-state lifetime.

  4. Chemically modified graphene based supercapacitors for flexible and miniature devices

    NASA Astrophysics Data System (ADS)

    Ghosh, Debasis; Kim, Sang Ouk

    2015-09-01

    Rapid progress in the portable and flexible electronic devises has stimulated supercapacitor research towards the design and fabrication of high performance flexible devices. Recent research efforts for flexible supercapacitor electrode materials are highly focusing on graphene and chemically modified graphene owing to the unique properties, including large surface area, high electrical and thermal conductivity, excellent mechanical flexibility, and outstanding chemical stability. This invited review article highlights current status of the flexible electrode material research based on chemically modified graphene for supercapacitor application. A variety of electrode architectures prepared from chemically modified graphene are summarized in terms of their structural dimensions. Novel prototypes for the supercapacitor aiming at flexible miniature devices, i.e. microsupercapacitor with high energy and power density are highlighted. Future challenges relevant to graphene-based flexible supercapacitors are also suggested. [Figure not available: see fulltext.

  5. In vitro correction of a pseudoexon-generating deep intronic mutation in LGMD2A by antisense oligonucleotides and modified small nuclear RNAs.

    PubMed

    Blázquez, Lorea; Aiastui, Ana; Goicoechea, Maria; Martins de Araujo, Mafalda; Avril, Aurélie; Beley, Cyriaque; García, Luis; Valcárcel, Juan; Fortes, Puri; López de Munain, Adolfo

    2013-10-01

    Limb-girdle muscular dystrophy type 2A (LGMD2A) is the most frequent autosomal recessive muscular dystrophy. It is caused by mutations in the calpain-3 (CAPN3) gene. The majority of the mutations described to date are located in the coding sequence of the gene. However, it is estimated that 25% of the mutations are present at exon-intron boundaries and modify the pre-mRNA splicing of the CAPN3 transcript. We have previously described the first deep intronic mutation in the CAPN3 gene: c.1782+1072G>C mutation. This mutation causes the pseudoexonization of an intronic sequence of the CAPN3 gene in the mature mRNA. In the present work, we show that the point mutation generates the inclusion of the pseudoexon in the mRNA using a minigene assay. In search of a treatment that restores normal splicing, splicing modulation was induced by RNA-based strategies, which included antisense oligonucleotides and modified small-nuclear RNAs. The best effect was observed with antisense sequences, which induced pseudoexon skipping in both HeLa cells cotransfected with mutant minigene and in fibroblasts from patients. Finally, transfection of antisense sequences and siRNA downregulation of serine/arginine-rich splicing factor 1 (SRSF1) indicate that binding of this factor to splicing enhancer sequences is involved in pseudoexon activation.

  6. Phage T4 DNA [N6-adenine] methyltransferase: kinetic studies using oligonucleotides containing native or modified recognition sites.

    PubMed

    Zinoviev, V V; Evdokimov, A A; Gorbunov, Y A; Malygin, E G; Kossykh, V G; Hattman, S

    1998-01-01

    The DNA-[N6-adenine] methyltransferase of T4 phage (T4 Dam MTase) catalyzes methyl group transfer from S-adenosyl-L-methionine (AdoMet) to the N6-position of adenine in the palindromic sequence, GATC. We have investigated the effect of eliminating different structural components of the recognition site on the ability of a substrate to be bound and methylated by T4 Dam. For this purpose, steady state binding (by gel shift assays) and kinetic parameters of methylation (using the methyl donor, [3H-CH3]-AdoMet, at 25 degrees C) were studied using various synthetic duplex oligonucleotides containing some defect in the DNA-target site; e.g., the absence of an internucleotide phosphate or a nucleotide(s) within the recognition site, or a single stranded region. The salient results are summarized as follows: (1) Addition of T4 Dam to a complete reaction mixture (with a 20-mer duplex as substrate) resulted in a 'burst' of 3H-methylated product, followed by a constant rate of product formation that reflected establishment of steady-state conditions. This suggests that the rate-limiting step is release of product methylated DNA from the enzyme [and not the transfer of the methyl group]. (2) A number of the defects in duplex structure had only a weak influence on the binding and Km values, but strongly reduced the kcat. At the same time, several poorly bound duplexes retained good substrate characteristics, especially duplexes having uninterrupted GAT-sequences in both strands. Whereas having only one half of the recognition site element intact was sufficient for stable complex formation, the catalytic turnover process had a strict requirement for an uninterrupted GAT-sequence on both strands. (3) There was no correlation between Km and binding capability; the apparent Kd for some duplexes was 5-70 times higher than Km. This indicates that the T4 Dam methylation reaction can not be explained by a simple Michaelian scheme.

  7. Nature of the chemical reaction for furfural modified asphalt

    SciTech Connect

    Memon, G.M.; Chollar, B.H.

    1994-12-31

    Three of the most serious problems of asphalt pavements today are rutting, cracking, and susceptibility to moisture damage (stripping). Asphalt manufacturers have been mixing asphalts with polymers to produce polymer-modified asphalts with improved rheological properties. However, the costs for these improved polymer-modified asphalts are almost double that of regular asphalts. FHWA researchers have found that asphalt modified by the chemical, furfural (which is prepared by simple elimination reaction of aldopentoses obtained from oat hulls), exhibited better stripping properties and was less temperature susceptible than the virgin asphalt while costing less than polymer-modified asphalts. This paper discusses the possible structure of the furfural-modified asphalt, data for the virgin and furfural-modified asphalts and their Corbett fractions, data from a model reaction between phenol and furfural, and a possible explanation of this structure based on these data.

  8. Lubricants from chemically modified vegetable oils.

    PubMed

    Campanella, Alejandrina; Rustoy, Eduardo; Baldessari, Alicia; Baltanás, Miguel A

    2010-01-01

    This work reports laboratory results obtained from the production of polyols with branched ether and ester compounds from epoxidized vegetable oils pertaining to annual, temperate climate crops (soybean, sunflower and high-oleic sunflower oils), focusing on their possible use as components of lubricant base stocks. To this end, two different opening reactions of the epoxide ring were studied. The first caused by the attack with glacial acetic acid (exclusively in a single organic phase) and the second using short-chain aliphatic alcohols, methanol and ethanol, in acid media. Both reactions proceed under mild conditions: low synthesis temperature and short reaction times and with conversions above 99%. Spectroscopic (NMR), thermal (DSC) and rheological techniques were used to characterize the oils, their epoxides and polyols, to assess the impact of the nature of the vegetable oil and the chemical modifications introduced, including long-term storage conditions. Several correlations were employed to predict the viscosity of the vegetable oils with temperature, and good agreement with the experimental data was obtained.

  9. [Adsorption of phenol chemicals by surfactant-modified zeolites].

    PubMed

    Xie, Jie; Wang, Zhe; Wu, De-Yi; Li, Chun-Jie

    2012-12-01

    Two kinds of zeolites were prepared from fly ash and modified by surfactant subsequently. Surfactant-modified zeolites were studied for adsorption of phenol chemicals (phenol, p-chlorphenol, bisphenol A). It showed that the adsorption affinity of zeolite to phenol chemicals was significantly improved after surfactant modification. The adsorption isotherms of phenol chemicals were well fitted by the Langmuir isotherm. For the two surfactant-surfactant modified zeolites, the maximum adsorption amounts of phenol, p-chlorphenol, and bisphenol A calculated from the Langmuir equation were 37.7, 52.36, 90.9 mg x g(-1) and 10.7, 22.83, 56.8 mg x g(-1), respectively. When pH values of solutions were higher than the pK(a) values of phenol chemicals, the removal efficiencies were getting higher with the increase of pH values. The octanol/water partition coefficient (K(ow)) was also found to be an important factor affecting adsorption of phenol chemicals by the modified zeolites. Higher K(ow) value, which means the greater hydrophobicity of the chemicals, resulted in a higher removal.

  10. Identification and Characterization of Modified Antisense Oligonucleotides Targeting DMPK in Mice and Nonhuman Primates for the Treatment of Myotonic Dystrophy Type 1

    PubMed Central

    Wheeler, Thurman M.; Justice, Samantha L.; Kim, Aneeza; Younis, Husam S.; Gattis, Danielle; Jauvin, Dominic; Puymirat, Jack; Swayze, Eric E.; Freier, Susan M.; Bennett, C. Frank; Thornton, Charles A.; MacLeod, A. Robert

    2015-01-01

    Myotonic dystrophy type 1 (DM1) is the most common form of muscular dystrophy in adults. DM1 is caused by an expanded CTG repeat in the 3′-untranslated region of DMPK, the gene encoding dystrophia myotonica protein kinase (DMPK). Antisense oligonucleotides (ASOs) containing 2′,4′-constrained ethyl-modified (cEt) residues exhibit a significantly increased RNA binding affinity and in vivo potency relative to those modified with other 2′-chemistries, which we speculated could translate to enhanced activity in extrahepatic tissues, such as muscle. Here, we describe the design and characterization of a cEt gapmer DMPK ASO (ISIS 486178), with potent activity in vitro and in vivo against mouse, monkey, and human DMPK. Systemic delivery of unformulated ISIS 486718 to wild-type mice decreased DMPK mRNA levels by up to 90% in liver and skeletal muscle. Similarly, treatment of either human DMPK transgenic mice or cynomolgus monkeys with ISIS 486178 led to up to 70% inhibition of DMPK in multiple skeletal muscles and ∼50% in cardiac muscle in both species. Importantly, inhibition of DMPK was well tolerated and was not associated with any skeletal muscle or cardiac toxicity. Also interesting was the demonstration that the inhibition of DMPK mRNA levels in muscle was maintained for up to 16 and 13 weeks post-treatment in mice and monkeys, respectively. These results demonstrate that cEt-modified ASOs show potent activity in skeletal muscle, and that this attractive therapeutic approach warrants further clinical investigation to inhibit the gain-of-function toxic RNA underlying the pathogenesis of DM1. PMID:26330536

  11. Chemically-modified cellulose paper as a microstructured catalytic reactor.

    PubMed

    Koga, Hirotaka; Kitaoka, Takuya; Isogai, Akira

    2015-01-15

    We discuss the successful use of chemically-modified cellulose paper as a microstructured catalytic reactor for the production of useful chemicals. The chemical modification of cellulose paper was achieved using a silane-coupling technique. Amine-modified paper was directly used as a base catalyst for the Knoevenagel condensation reaction. Methacrylate-modified paper was used for the immobilization of lipase and then in nonaqueous transesterification processes. These catalytic paper materials offer high reaction efficiencies and have excellent practical properties. We suggest that the paper-specific interconnected microstructure with pulp fiber networks provides fast mixing of the reactants and efficient transport of the reactants to the catalytically-active sites. This concept is expected to be a promising route to green and sustainable chemistry.

  12. Solid-phase helicase dependent amplification and electrochemical detection of Salmonella on highly stable oligonucleotide-modified ITO electrodes.

    PubMed

    Barreda-García, S; Miranda-Castro, R; de-Los-Santos-Álvarez, N; Miranda-Ordieres, A J; Lobo-Castañón, M J

    2017-08-29

    An on-surface isothermal helicase-dependent amplification is devised for simple, point-of-need quantification of bacterial genomes. The method relies on the enzyme-extension of a thiol-modified reverse primer anchored to indium tin oxide electrodes, which shows strikingly high thermal and storage stability. Amplification and electrochemical detection of only 10 genomes are thus performed on the same platform without thermal cycling.

  13. Thermoreversible gelation in aqueous binary solvents of chemically modified agarose.

    PubMed

    Dahmani, Mohammed; Ramzi, Mohamed; Rochas, Cyrille; Guenet, Jean-Michel

    2003-01-15

    The thermoreversible gelation of chemically modified agarose has been studied in aqueous binary solvents (dimethyl sulfoxide and a series of formamide) by differential calorimetry, mechanical testing, and small-angle neutron scattering. The temperature-composition phase diagrams have been established. It is concluded that gelation is promoted by the formation of ternary complexes modified agarose/water/cosolvent, wherein the cosolvent mediates the interaction between chains through the formation of electrostatic interactions.

  14. Stabilin-1 and Stabilin-2 are specific receptors for the cellular internalization of phosphorothioate-modified antisense oligonucleotides (ASOs) in the liver

    PubMed Central

    Miller, Colton M.; Donner, Aaron J.; Blank, Emma E.; Egger, Andrew W.; Kellar, Brianna M.; Østergaard, Michael E.; Seth, Punit P.; Harris, Edward N.

    2016-01-01

    Phosphorothioate (PS)-modified antisense oligonucleotides (ASOs) have been extensively investigated over the past three decades as pharmacological and therapeutic agents. One second generation ASO, Kynamro™, was recently approved by the FDA for the treatment of homozygous familial hypercholesterolemia and over 35 second generation PS ASOs are at various stages of clinical development. In this report, we show that the Stabilin class of scavenger receptors, which were not previously thought to bind DNA, do bind and internalize PS ASOs. With the use of primary cells from mouse and rat livers and recombinant cell lines each expressing Stabilin-1 and each isoform of Stabilin-2 (315-HARE and 190-HARE), we have determined that PS ASOs bind with high affinity and these receptors are responsible for bulk, clathrin-mediated endocytosis within the cell. Binding is primarily dependent on salt-bridge formation and correct folding of the intact protein receptor. Increased internalization rates also enhanced ASO potency for reducing expression of the non-coding RNA Malat-1, in Stabilin-expressing cell lines. A more thorough understanding of mechanisms by which ASOs are internalized in cells and their intracellular trafficking pathways will aid in the design of next generation antisense agents with improved therapeutic properties. PMID:26908652

  15. 2′-O-methyl-modified phosphorothioate antisense oligonucleotides have reduced non-specific effects in vitro

    PubMed Central

    Yoo, Byong Hoon; Bochkareva, Elena; Bochkarev, Alexey; Mou, Tung-Chung; Gray, Donald M.

    2004-01-01

    Antisense oligodeoxynucleotides (ODNs) have biological activity in treating various forms of cancer. The antisense effects of two types of 20mer ODNs, phosphorothioate-modified ODNs (S-ODNs) and S-ODNs with 12 2′-O-methyl groups (Me-S-ODNs), targeted to sites 109 and 277 of bcl-2 mRNA, were compared. Both types were at least as effective as G3139 (Genta, Inc.) in reducing the level of Bcl-2 protein in T24 cells following a 4 h transfection at a dose of 0.1 µM. Circular dichroism spectra showed that both types formed A-form duplexes with the complementary RNA, and the melting temperatures were in the order of Me-S-ODN·RNA > normal DNA·RNA > S-ODN·RNA. In comparison with the S-ODN, the Me-S-ODN had reduced toxic growth inhibitory effects, was less prone to bind the DNA-binding domain A of human replication protein A, and was as resistant to serum nucleases. Neither type of oligomer induced apoptosis, according to a PARP-cleavage assay. Hybrids formed with Me-S-ODN sequences were less sensitive to RNase H degradation than those formed with S-ODN sequences. Despite this latter disadvantage, the addition of 2′-O-methyl groups to a phosphorothioate-modified ODN is advantageous because of increased stability of binding and reduced non-specific effects. PMID:15064360

  16. Molecular Dynamics Investigations of the Local Structural Characteristics of DNA Oligonucleotides: Studies of Helical Axis Deformations, Conformational Sequence Dependence and Modified Nucleoside Perturbations.

    NASA Astrophysics Data System (ADS)

    Louise-May, Shirley

    The present DNA studies investigate the local structure of DNA oligonucleotides in order to characterize helical axis deformations, sequence dependent fine structure and modified nucleoside perturbations of selected oligonucleotide sequences. The molecular dynamics method is used to generate an ensemble of energetically feasible DNA conformations which can then be analyzed for dynamical conformational properties, some of which can be compared to experimentally derived values. A theory and graphical presentation for the analysis of helical deformations of DNA based on the configurational statistics of polymers, called "Persistence Analysis", was designed. The results of the analysis on prototype forms, static crystal structures and two solvated MD simulations of the sequence d(CGCGAATTCGCG) indicate that all of the expected features of bending can be sensitively and systematically identified by this approach. Comparison of the relative performance of three molecular dynamics potential functions commonly used for dynamical modeling of biological macromolecules; CHARMm, AMBER and GROMOS was investigated via in vacuo MD simulations on the dodecamer sequence d(CGCGAATTCGCG)_2 with respect to the conformational properties of each dynamical model and their ability to support A and B families of DNA. Vacuum molecular dynamics simulations using the CHARMm force field carried out on simple homo- and heteropolymers of DNA led to the conclusion that sequence dependent fine structure appears to be well defined for adenine-thymine rich sequences both at the base pair and base step level whereas much of the the fine structure found in cytosine -guanine rich sequences appears to be context dependent. The local conformational properties of the homopolymer poly (dA) -poly (dT) revealed one dynamical model which was found in general agreement with fiber models currently available. Investigation of the relative structural static and dynamical effect of the misincorporation of

  17. Modified NASA-Lewis chemical equilibrium code for MHD applications

    NASA Technical Reports Server (NTRS)

    Sacks, R. A.; Geyer, H. K.; Grammel, S. J.; Doss, E. D.

    1979-01-01

    A substantially modified version of the NASA-Lewis Chemical Equilibrium Code was recently developed. The modifications were designed to extend the power and convenience of the Code as a tool for performing combustor analysis for MHD systems studies. The effect of the programming details is described from a user point of view.

  18. Lubricant base stock potential of chemically modified vegetable oils.

    PubMed

    Erhan, Sevim Z; Sharma, Brajendra K; Liu, Zengshe; Adhvaryu, Atanu

    2008-10-08

    The environment must be protected against pollution caused by lubricants based on petroleum oils. The pollution problem is so severe that approximately 50% of all lubricants sold worldwide end up in the environment via volatility, spills, or total loss applications. This threat to the environment can be avoided by either preventing undesirable losses, reclaiming and recycling mineral oil lubricants, or using environmentally friendly lubricants. Vegetable oils are recognized as rapidly biodegradable and are thus promising candidates as base fluids in environment friendly lubricants. Lubricants based on vegetable oils display excellent tribological properties, high viscosity indices, and flash points. To compete with mineral-oil-based lubricants, some of their inherent disadvantages, such as poor oxidation and low-temperature stability, must be corrected. One way to address these problems is chemical modification of vegetable oils at the sites of unsaturation. After a one-step chemical modification, the chemically modified soybean oil derivatives were studied for thermo-oxidative stability using pressurized differential scanning calorimetry and a thin-film micro-oxidation test, low-temperature fluid properties using pour-point measurements, and friction-wear properties using four-ball and ball-on-disk configurations. The lubricants formulated with chemically modified soybean oil derivatives exhibit superior low-temperature flow properties, improved thermo-oxidative stability, and better friction and wear properties. The chemically modified soybean oil derivatives having diester substitution at the sites of unsaturation have potential in the formulation of industrial lubricants.

  19. Intercalator conjugates of pyrimidine locked nucleic acid-modified triplex-forming oligonucleotides: improving DNA binding properties and reaching cellular activities

    PubMed Central

    Brunet, Erika; Corgnali, Maddalena; Perrouault, Loïc; Roig, Victoria; Asseline, Ulysse; Sørensen, Mads D.; Babu, B. Ravindra; Wengel, Jesper; Giovannangeli, Carine

    2005-01-01

    Triplex-forming oligonucleotides (TFOs) are powerful tools to interfere sequence-specifically with DNA-associated biological functions. (A/T,G)-containing TFOs are more commonly used in cells than (T,C)-containing TFOs, especially C-rich sequences; indeed the low intracellular stability of the non-covalent pyrimidine triplexes make the latter less active. In this work we studied the possibility to enhance DNA binding of (T,C)-containing TFOs, aiming to reach cellular activities; to this end, we used locked nucleic acid-modified TFOs (TFO/LNAs) in association with 5′-conjugation of an intercalating agent, an acridine derivative. In vitro a stable triplex was formed with the TFO-acridine conjugate: by SPR measurements at 37°C and neutral pH, the dissociation equilibrium constant was found in the nanomolar range and the triplex half-life ∼10 h (50-fold longer compared with the unconjugated TFO/LNA). Moreover to further understand DNA binding of (T,C)-containing TFO/LNAs, hybridization studies were performed at different pH values: triplex stabilization associated with pH decrease was mainly due to a slower dissociation process. Finally, biological activity of pyrimidine TFO/LNAs was evaluated in a cellular context: it occurred at concentrations ∼0.1 μM for acridine-conjugated TFO/LNA (or ∼2 μM for the unconjugated TFO/LNA) whereas the corresponding phosphodiester TFO was inactive, and it was demonstrated to be triplex-mediated. PMID:16049028

  20. Visualized detection of single-base difference in multiplexed loop-mediated isothermal amplification amplicons by invasive reaction coupled with oligonucleotide probe-modified gold nanoparticles.

    PubMed

    Lu, Yan; Ma, Xueping; Wang, Jianping; Sheng, Nan; Dong, Tianhui; Song, Qinxin; Rui, Jianzhong; Zou, Bingjie; Zhou, Guohua

    2017-04-15

    Loop-mediated isothermal amplification (LAMP) is a well-developed DNA amplification method with an ultra-high sensitivity, but it is difficult to recognize a single-base difference (like genotyping) in target-specific amplicons by conventional detection ways, such as the intercalation of dyes into dsDNA amplicons or the increase of solution turbidity along with the polymerization process. To allow genotyping based on LAMP suitable for POCT (point-of-care testing) or on-site testing, here we proposed a highly specific and cost-effective method for detecting a single-base difference in LAMP amplicons. The method includes three key steps, sequence amplifier to amplify multiple fragments containing the single nucleotide polymorphisms (SNPs) of interest, allele identifier to recognize a targeted base in the amplicons by invasive reaction, and signal generator to yield signals by hybridization-induced assembly of oligonucleotide probe-modified gold nanoparticles. Because the allele identifier is sensitive to one base difference, it is possible to use multiplexed LAMP (mLAMP) to generate amplicon mixtures for multiple SNP typing. Genotyping of 3 different SNPs (CYP2C19*2, CYP2C19*3 and MDR1-C3435T) for guiding the dosage of clopidogrel is successfully carried out in a 3-plex LAMP on real clinical samples. As our method relies on the naked-eye detection and constant-temperature reaction, no expensive instrument is required for both target amplification and sequence identification, thus much suitable for inexpensive gene-guided personalized medicine in source-limited regions.

  1. Gene silencing by chemically modified siRNAs.

    PubMed

    Engels, Joachim W

    2013-03-25

    RNA interference (RNAi) has not only already risen as a gold standard for validating gene function in basic science studies, but also holds great promise as a new therapeutic paradigm. Advantages of RNAi-based therapeutics include relatively fast initial screening and the ability to target proteins not yet addressable by traditional drug design strategies. In this review we describe the development of chemically modified small inhibiting siRNAs and their application as potential therapeutics during the past decade. Focus is on proper siRNA design, choice of chemical modification and how to circumvent immunogenicity as well as off-target effects.

  2. ZnS nanoflakes deposition by modified chemical method

    SciTech Connect

    Desai, Mangesh A. Sartale, S. D.

    2014-04-24

    We report deposition of zinc sulfide nanoflakes on glass substrates by modified chemical method. The modified chemical method involves adsorption of zinc–thiourea complex on the substrate and its dissociation in presence of hydroxide ions to release sulfur ions from thiourea which react with zinc ions present in the complex to form zinc sulfide nanoflakes at room temperature. Influence of zinc salt and thiourea concentrations ratios on the morphology of the films was investigated by scanning electron microscope (SEM). The ratio of zinc and thiourea in the zinc–thiourea complex significantly affect the size of the zinc sulfide nanoflakes, especially width and density of the nanoflakes. The X-ray diffraction analysis exhibits polycrystalline nature of the zinc sulfide nanoflakes with hexagonal phase.

  3. ZnS nanoflakes deposition by modified chemical method

    NASA Astrophysics Data System (ADS)

    Desai, Mangesh A.; Sartale, S. D.

    2014-04-01

    We report deposition of zinc sulfide nanoflakes on glass substrates by modified chemical method. The modified chemical method involves adsorption of zinc-thiourea complex on the substrate and its dissociation in presence of hydroxide ions to release sulfur ions from thiourea which react with zinc ions present in the complex to form zinc sulfide nanoflakes at room temperature. Influence of zinc salt and thiourea concentrations ratios on the morphology of the films was investigated by scanning electron microscope (SEM). The ratio of zinc and thiourea in the zinc-thiourea complex significantly affect the size of the zinc sulfide nanoflakes, especially width and density of the nanoflakes. The X-ray diffraction analysis exhibits polycrystalline nature of the zinc sulfide nanoflakes with hexagonal phase.

  4. Impedimetric thrombin aptasensor based on chemically modified graphenes

    NASA Astrophysics Data System (ADS)

    Loo, Adeline Huiling; Bonanni, Alessandra; Pumera, Martin

    2011-12-01

    Highly sensitive biosensors are of high importance to the biomedical field. Graphene represents a promising transducing platform for construction of biosensors. Here for the first time we compare the biosensing performance of a wide set of graphenes prepared by different methods. In this work, we present a simple and label-free electrochemical impedimetric aptasensor for thrombin based on chemically modified graphene (CMG) platforms such as graphite oxide (GPO), graphene oxide (GO), thermally reduced graphene oxide (TR-GO) and electrochemically reduced graphene oxide (ER-GO). Disposable screen-printed electrodes were first modified with chemically modified graphene (CMG) materials and used to immobilize a DNA aptamer which is specific to thrombin. The basis of detection relies on the changes in impedance spectra of redox probe after the binding of thrombin to the aptamer. It was discovered that graphene oxide (GO) is the most suitable material to be used as compared to the other three CMG materials. Furthermore, the optimum concentration of aptamer to be immobilized onto the modified electrode surface was determined to be 10 μM and the linear detection range of thrombin was 10-50 nM. Lastly, the aptasensor was found to demonstrate selectivity for thrombin. Such simply fabricated graphene oxide aptasensor shows high promise for clinical diagnosis of biomarkers and point-of-care analysis.

  5. Electrical and structural properties of chemically modified graphene sheets

    NASA Astrophysics Data System (ADS)

    Dikin, Dmitriy A.; Jung, Inhwa; Ruoff, Rodney S.

    2009-03-01

    The chemical exfoliation of graphite through oxidation and then dispersion in a solvent is one of the methods of achieving scalable production of single graphene sheets. We use this method for making chemically modified graphene (CMG) sheets with tunable electronic properties, which can be placed flat on any surface or dispersed in various matrices. CMG sheets share some similarities with pristine graphene and with carbon nanotubes, e.g. tunable electron- and hole-type conductivity is observed in single CMG sheets just above the percolation threshold. CMGs may also be considered as a template for a bottom up development of a new class of materials. We have performed electrical measurements of individual CMG sheets and will discuss their electronic properties and the possible mechanisms of the charge transport in relation to their atomic structure and chemical composition.

  6. Chemically Modified Metal Oxide Nanostructure for Photoelectrochemical Water Splitting

    NASA Astrophysics Data System (ADS)

    Wang, Gongming

    Hydrogen gas is chemical fuel with high energy density, and represents a clean, renewable and carbon-free burning fuel, which has the potential to solve the more and more urgent energy crisis in today's society. Inspired by natural photosynthesis, artificial photosynthesis to generate hydrogen energy has attracted a lot of attentions in the field of chemistry, physics and material. Photoelectrochemical water splitting based on semiconductors represents a green and low cost method to generate hydrogen fuel. However, the current overall efficiency of solar to hydrogen is quite low, due to some intrinsic limitations such as bandgap, diffusion distance, carrier lifetime and photostability of semiconductors. Although nanostructured semiconductors can improve their photoelectrochemical water splitting performance to some extent, by increasing electrolyte accessible area and shortening minority carrier diffusion distance, nanostructure engineering cannot change their intrinsic electronic properties. Recent development in chemically modified nanostructures such as surface catalyst decoration, element doping, plasmonic modification and interfacial hetero-junction design have led to significant advancement in the photoelectrochemical water splitting, by improving surface reaction kinetics and charge separation, transportation and collection efficiency. In this thesis, I will give a detailed discussion on the chemically modified metal oxide nanostructures for photoelectrocemical hydrogen generation, with a focus on the element doping, hydrogen treatment and catalyst modification. I have demonstrated nitrogen doping on ZnO and Ti doping on hematite can improve their photoelectrochemical performance. In addition, we found hydrogen treatment is a general and effective method to improve the photocatalytic performance, by increasing their carrier desities. Hydrogen treatment has been demonstrated on TiO2, WO3 and BiVO4. In the end, we also used electrochemical catalyt to modify

  7. Pentopyranosyl Oligonucleotide Systems

    NASA Technical Reports Server (NTRS)

    Wagner, Thomas; Huyuh, Hoan K.; Krishnamurthy, Ramanarayanan; Eschenmoser, Albert

    2002-01-01

    Beta-D-Xylopyranosyl-(4 - 2 )-oligonucleotides containing adenine and thymine as nucleohases were synthesized as a part of a systematic study of the pairing properties of pentopyranosyl oligonucleotides. Contrary to earlier expectations based on qualitative conformational criteria, Beta-D-xylopyranosyl(4 - 2 )- oligonucleotides show Watson-Crick pairing comparable in strength to that shown by pyranosyl-RNA.

  8. Pentopyranosyl Oligonucleotide Systems

    NASA Technical Reports Server (NTRS)

    Wagner, Thomas; Huyuh, Hoan K.; Krishnamurthy, Ramanarayanan; Eschenmoser, Albert

    2002-01-01

    Beta-D-Xylopyranosyl-(4 - 2 )-oligonucleotides containing adenine and thymine as nucleohases were synthesized as a part of a systematic study of the pairing properties of pentopyranosyl oligonucleotides. Contrary to earlier expectations based on qualitative conformational criteria, Beta-D-xylopyranosyl(4 - 2 )- oligonucleotides show Watson-Crick pairing comparable in strength to that shown by pyranosyl-RNA.

  9. [Recent progress and prospect in oligonucleotide therapeutics].

    PubMed

    Yoshioka, Kotaro; Kuwahara, Hiroya; Nishina, Kazutaka; Nagata, Tetsuya; Yokota, Takanori

    2015-06-01

    Remarkable progress has been made in chemical modification and nonviral delivery systems that improve the properties and efficacy of therapeutics oligonucleotides therapeutics, such as antisense oligonucleotide (ASO) and small interfering RNA(siRNA). ASOs act through various mechanisms including the degradation of mRNA by RNase H (gapmer-type ASO) and the modulation alternative splicing patterns(splice switching oligonucleotide). Recent favorable outcomes in clinical trials for cancers and genetic diseases such as familial amyloid polyneuropathy and Duchenne muscular dystrophy indicate high clinical potency of oligonucleotide therapeutics. Here we reviewed recent advances in basic properties and clinical applications of ASO and siRNA, and provide future perspective on oligonucleotide therapeutics.

  10. Synthesis, thermal stability and reactivity towards 9-aminoellipticine of double-stranded oligonucleotides containing a true abasic site.

    PubMed Central

    Bertrand, J R; Vasseur, J J; Rayner, B; Imbach, J L; Paoletti, J; Paoletti, C; Malvy, C

    1989-01-01

    A 13 mers abasic oligonucleotide was synthetized. It was therefore possible to compare thermal stability and reactivity of duplex oligonucleotides either with an apurinic/apyrimidinic site or without any lesion. An important decrease in the melting temperature appeared for duplexes with an abasic site. The chemical reaction of these modified oligonucleotides with the intercalating agent 9-aminoellipticine was studied by gel electrophoresis and by fluorescence. The formation of a Schiff base between 9-aminoellipticine and abasic sites was rapid and complete with duplexes at 11 degrees C. Schiff base related fluorescence and beta-elimination cleavage were more important with the apyrimidinic sites than with the apurinic ones. When compared to previous results obtained with the model d(TprpT) some unexpected behaviours appeared with longer and duplex oligonucleotides. For instance only partial beta-elimination cleavage was observed. It is likely that stacking parameters in the double helix play a great role in the studied reaction. Images PMID:2602153

  11. Chemically modified cellulose paper as a thin film microextraction phase.

    PubMed

    Saraji, Mohammad; Farajmand, Bahman

    2013-11-01

    In this paper, chemically modified cellulose paper was introduced as a novel extracting phase for thin film microextraction (TFME). Different reagents (Octadecyltrichlorosilane, diphenyldichlorosilane, cyclohexyl isocyanate and phenyl isocyanate) were used to modify the cellulose papers. The modified papers were evaluated as a sorbent for the extraction of some synthetic and natural estrogenic hormones (17α-ethynylestradiol, estriol and estradiol) from aqueous samples. Liquid chromatography-fluorescence detection was used for the quantification of the extracted compounds. The cellulose paper modified with phenyl isocyanate showed the best affinity to the target compounds. TEME parameters such as desorption condition, shaking rate, sample ionic strength and extraction time were investigated and optimized. Limit of detections were between 0.05 and 0.23μgL(-1) and relative standard deviations were less than 11.1% under the optimized condition. The calibration curves were obtained in the range of 0.2-100μgL(-1) with a good linearity (r(2)>0.9935). Wastewater, human urine, pool and river water samples were studied as real samples for the evaluation of the method. Relative recoveries were found to be between 75% and 101%.

  12. Immobilization of urease onto chemically modified acrylonitrile copolymer membranes.

    PubMed

    Godjevargova, T; Gabrovska, K

    2003-06-26

    Poly (acrylonitrile-methylmethacrylate-sodium vinylsulfonate) membranes were subjected to seven different chemical modifications. The amounts of new groups incorporated in the membranes with the modifications were determined. Urease was covalently immobilized on the modified membranes. Both the amount of bound protein and relative activity of immobilized urease were measured. The highest activity was found for urease bound to membranes modified with hydroxylammonium sulfate (68%) and hydrazinium sulfate (67%). Optimum pH of free urease was determined to be 5.8. For positively charged membranes, pH optimum was shifted to higher values, while for negatively charged membranes-to lower pH. The charge of the matrix affected also the rate of the enzyme reaction. The highest rate was measured with urease immobilized on membranes modified with hydroxylammonium sulfate and hydrazinium sulfate. The major part of the immobilized enzyme on different modified membranes remained stable-only ca. 20% of enzyme activity was lost for 4 h at 70 degrees C while the free enzyme was totally inactivated.

  13. Adhesive and morphological characteristics of surface chemically modified polytetrafluoroethylene films

    NASA Astrophysics Data System (ADS)

    Hopp, B.; Kresz, N.; Kokavecz, J.; Smausz, T.; Schieferdecker, H.; Döring, A.; Marti, O.; Bor, Z.

    2004-01-01

    In the present paper, we report an experimental determination of adhesive and topographic characteristics of chemically modified surface of polytetrafluoroethylene (PTFE) films. The surface chemistry was modified by ArF excimer laser irradiation in presence of triethylene-tetramine photoreagent. The applied laser fluence was varied in the range of 0.4-9 mJ/cm 2, and the number of laser pulses incident on the same area was 1500. To detect the changes in the adhesive features of the treated Teflon samples, we measured receding contact angle for distilled water and adhesion strength, respectively. It was found that the receding contact angle decreased from 96° to 30-37° and the adhesion strength of two-component epoxy glue to the treated sample surface increased from 0.03 to 9 MPa in the applied laser fluence range. Additionally, it was demonstrated that the adhesion of human cells to the modified Teflon samples is far better than to the untreated ones. The contact mode and pulsed force mode atomic force microscopic investigations of the treated samples demonstrated that the measured effective contact area of the irradiated films does not differ significantly from that of the original films, but the derived adhesion force is stronger on the modified samples than on the untreated ones. Hence, the increased adhesion of the treated Teflon films is caused by the higher surface energy.

  14. The impact of ion-pairing reagents on the selectivity and sensitivity in the analysis of modified oligonucleotides in serum samples by liquid chromatography coupled with tandem mass spectrometry.

    PubMed

    Studzińska, Sylwia; Rola, Rafał; Buszewski, Bogusław

    2017-05-10

    Present study highlights the usage of various ion-pairing agents and their impact on the process of separation and ionization of oligonucleotides in the fortified human serum samples. What is more, retention studies involved different stationary phases, including: octadecyl, phenyl, pentafluorophenyl groups and ligands with embedded polar groups. It was proved that retention of oligonucleotides strongly depends on the alkyl chain branching in the structure of ion pairing reagent. Furthermore ion-pairing agents build of straight alkyl chain are more easily adsorbed on the stationary phase modified with octadecyl groups, while branching of alkyl chain caused more effective adsorption of studied compounds at phenyl groups compared to octadecyl ones. The lowest limit of quantification values were obtained for 5mMN,N-dimethylbutylamine, while the highest values are characteristic for hexylamine. Moreover it was shown that a 2-fold increase of ion-pairing agent concentration results in higher LOQ. The greatest sensitivity was obtained for 2.5mMN,N-dimethylbutylamine/150mM hexafluoroisopropanol. On the other hand Hypersil GOLD aQ column was the most appropriate in terms of time and separation effectiveness. The developed method was successfully used for the determination of studied oligonucleotides and their metabolites in human serum samples. The compounds were separated in just 3.5min with high sensitivity (0.09-0.16ng). Copyright © 2017 Elsevier B.V. All rights reserved.

  15. The oral and craniofacial relevance of chemically modified RNA therapeutics.

    PubMed

    Elangovan, Satheesh; Kormann, Michael S D; Khorsand, Behnoush; Salem, Aliasger K

    2016-01-01

    Several tissue engineering strategies in the form of protein therapy, gene therapy, cell therapy, and their combinations are currently being explored for oral and craniofacial regeneration and repair. Though each of these approaches has advantages, they all have common inherent drawbacks of being expensive and raising safety concerns. Using RNA (encoding therapeutic protein) has several advantages that have the potential to overcome these limitations. Chemically modifying the RNA improves its stability and mitigates immunogenicity allowing for the potential of RNA to become an alternative to protein and gene based therapies. This brief review article focuses on the potential of RNA therapeutics in the treatment of disorders in the oral and craniofacial regions.

  16. Detecting Chemically Modified DNA Bases Using Surface Enhanced Raman Spectroscopy.

    PubMed

    Barhoumi, Aoune; Halas, Naomi J

    2011-12-15

    Post-translational modifications of DNA- changes in the chemical structure of individual bases that occur without changes in the DNA sequence- are known to alter gene expression. They are believed to result in frequently deleterious phenotypic changes, such as cancer. Methylation of adenine, methylation and hydroxymethylation of cytosine, and guanine oxidation are the primary DNA base modifications identified to date. Here we show it is possible to use surface enhanced Raman spectroscopy (SERS) to detect these primary DNA base modifications. SERS detection of modified DNA bases is label-free and requires minimal additional sample preparation, reducing the possibility of additional chemical modifications induced prior to measurement. This approach shows the feasibility of DNA base modification assessment as a potentially routine analysis that may be further developed for clinical diagnostics.

  17. Band bending and electrical transport at chemically modified silicon surfaces

    NASA Astrophysics Data System (ADS)

    Lopinski, Greg; Ward, Tim; Hul'Ko, Oleksa; Boukherroub, Rabah

    2002-03-01

    High resolution electron energy loss spectroscopy (HREELS) and electrical transport measurements have been used to investigate how various chemical modifications give rise to band bending and alter the conductivity of Si(111) surfaces. HREELS is a sensitive probe of band bending through observations of the low frequency free carrier plasmon mode. For hydrogen terminated surfaces, prepared by the standard etch in ammonium flouride, HREELS measurements on both n and n+ substrates are consistent with nearly flat bands. Chlorination of these surfaces results in substantial upward band bending due to the strong electron withdrawing nature of the chlorine, driving the surface into inversion. The presence of this inversion layer on high resistivity n-type samples is observed through a substantial enhancement of the surface conductivity (relative to the H-terminated surface), as well as through broadening of the quasi-elastic peak in the HREELS measurements. We have also begun to examine organically modified silicon surfaces, prepared by various wet chemical reactions with the H-terminated surface. Decyl modified Si(111) surfaces are seen to exhibit a small degree of band bending, attributed to extrinsic defect states cause by a small degree of oxidation accompanying the modification reaction. The prospects of using conductivity as an in-situ monitor of the rate of these reactions will be discussed.

  18. Rolling Circle Amplification with Chemically Modified Nucleoside Triphosphates.

    PubMed

    Hollenstein, Marcel; Damha, Masad J

    2016-12-01

    Modified nucleoside triphosphates (dN*TPs) represent facile and versatile precursors for the introduction of chemical diversity into nucleic acids. While dN*TPs have been utilized in a plethora of practical applications, very little attention has been devoted to the assessment of their compatibility with isothermal amplification strategies. In this context, rolling circle amplification (RCA) is a wide-spread enzymatic replication method in which small single-stranded DNA (ssDNA) circles serve as templates in primer extension reactions yielding very long, ssDNA products. RCA is a pivotal tool for the generation of biosensor and diagnostic devices and is currently evaluated for its usefulness to create novel drug delivery systems. This unit describes the experimental procedures for the synthesis of modified RCA products using dN*TPs bearing chemical alterations at any possible location of the nucleosidic scaffold. Two ligation methods are presented for the generation of the DNA nanocircles that serve as templates for RCA, followed by a description of the RCA method itself and an assessment of the nuclease resistance of the ensuing products. © 2016 by John Wiley & Sons, Inc. Copyright © 2016 John Wiley & Sons, Inc.

  19. Mesoscale assembly of chemically modified graphene into complex cellular networks

    PubMed Central

    Barg, Suelen; Perez, Felipe Macul; Ni, Na; do Vale Pereira, Paula; Maher, Robert C.; Garcia-Tuñon, Esther; Eslava, Salvador; Agnoli, Stefano; Mattevi, Cecilia; Saiz, Eduardo

    2014-01-01

    The widespread technological introduction of graphene beyond electronics rests on our ability to assemble this two-dimensional building block into three-dimensional structures for practical devices. To achieve this goal we need fabrication approaches that are able to provide an accurate control of chemistry and architecture from nano to macroscopic levels. Here, we describe a versatile technique to build ultralight (density ≥1 mg cm−3) cellular networks based on the use of soft templates and the controlled segregation of chemically modified graphene to liquid interfaces. These novel structures can be tuned for excellent conductivity; versatile mechanical response (elastic-brittle to elastomeric, reversible deformation, high energy absorption) and organic absorption capabilities (above 600 g per gram of material). The approach can be used to uncover the basic principles that will guide the design of practical devices that by combining unique mechanical and functional performance will generate new technological opportunities. PMID:24999766

  20. Engineering chemically modified viruses for prostate cancer cell recognition.

    PubMed

    Mohan, K; Weiss, G A

    2015-12-01

    Specific detection of circulating tumor cells and characterization of their aggressiveness could improve cancer diagnostics and treatment. Metastasis results from such tumor cells, and causes the majority of cancer deaths. Chemically modified viruses could provide an inexpensive and efficient approach to detect tumor cells and quantitate their cell surface biomarkers. However, non-specific adhesion between the cell surface receptors and the virus surface presents a challenge. This report describes wrapping the virus surface with different PEG architectures, including as fusions to oligolysine, linkers, spacers and scaffolded ligands. The reported PEG wrappers can reduce by >75% the non-specific adhesion of phage to cell surfaces. Dynamic light scattering verified the non-covalent attachment by the reported wrappers as increased sizes of the virus particles. Further modifications resulted in specific detection of prostate cancer cells expressing PSMA, a key prostate cancer biomarker. The approach allowed quantification of PSMA levels on the cell surface, and could distinguish more aggressive forms of the disease.

  1. Modified chemical route for deposition of molybdenum disulphide thin films

    SciTech Connect

    Vyas, Akshay N. Sartale, S. D.

    2014-04-24

    Molybdenum disulphide (MoS{sub 2}) thin films were deposited on quartz substrates using a modified chemical route. Sodium molybdate and sodium sulphide were used as precursors for molybdenum and sulphur respectively. The route involves formation of tetrathiomolybdate ions (MoS{sub 4}{sup 2−}) and further reduction by sodium borohydride to form MoS{sub 2}. The deposition was performed at room temperature. The deposited films were annealed in argon atmosphere at 1073 K for 1 hour to improve its crystallinity. The deposited films were characterized using scanning electron microscopy (SEM) for morphology, UV-Vis absorption spectroscopy for optical studies and X-ray diffraction (XRD) for structure determination.

  2. [Physical, chemical and biological properties of food modified starches].

    PubMed

    Gapparov, M M; Sokolov, A I; Martynova, E A; Kulikova, O S; Bessonov, V V; Berketova, L V

    2007-01-01

    Aim of work was to compare the chemical and biological properties of starches modified by adipinic acid acetylation. Starches in question were: native maize starch "Novation 4600"; acetylated adipat di-starch of the cold swelling "Prejeflo CH 20"; acetylated adipat di-starch of the cold swelling "Prejeflo CH 40"; acetylated adipat di-starch of the hot swelling "Clearam CH 2020". The differences between starches were connected with number of cross-cut lacings in the structure, and with abilities to be gelatinized in the cold water. Rate of hydrolysis and water-retaining capacities were higher for cold swelling starches which contained the smaller number of resistance fractions. Acetyl value of cold swelling starches was higher under elevation of cross-cut lacing.

  3. The Oral and Craniofacial Relevance of Chemically Modified RNA Therapeutics

    PubMed Central

    Kormann, Michael S.D.; Khorsand, Behnoush

    2016-01-01

    Several tissue engineering strategies in the form of protein therapy, gene therapy, cell therapy and its combinations are currently being explored for oral and cranio-facial regeneration and repair. Though each of these approaches has advantages, they all have common inherent drawbacks of being expensive and raising safety concerns. Using RNA (encoding therapeutic protein) has several advantages that have the potential to overcome these limitations. Chemically modifying the RNA improves its stability and mitigates immunogenicity allowing for the potential of RNA to become an alternative to protein and gene based therapies. This brief review article focuses on the potential of RNA therapeutics in the treatment of disorders in the oral and craniofacial regions. PMID:26896600

  4. Impedimetric immunoglobulin G immunosensor based on chemically modified graphenes

    NASA Astrophysics Data System (ADS)

    Loo, Adeline Huiling; Bonanni, Alessandra; Ambrosi, Adriano; Poh, Hwee Ling; Pumera, Martin

    2012-01-01

    Immunosensors which display high sensitivity and selectivity are of utmost importance to the biomedical field. Graphene is a material which has immense potential for the fabrication of immunosensors. For the first time, we evaluate the immunosensing capabilities of various graphene surfaces in this work. We propose a simple and label-free electrochemical impedimetric immunosensor for immunoglobulin G (IgG) based on chemically modified graphene (CMG) surfaces such as graphite oxide, graphene oxide, thermally reduced graphene oxide and electrochemically reduced graphene oxide. Disposable electrochemical printed electrodes were first modified with CMG materials before anti-immunoglobulin G (anti-IgG), which is specific to IgG, was immobilized. The principle of detection lies in the changes in impedance spectra of the redox probe after the attachment of IgG to the immobilized anti-IgG. It was found that thermally reduced graphene oxide has the best performance when compared to the other CMG materials. In addition, the optimal concentration of anti-IgG to be deposited onto the modified electrode surface is 10 μg ml-1 and the linear range of detection of the immunosensor is from 0.3 μg ml-1 to 7 μg ml-1. Finally, the fabricated immunosensor also displays selectivity for IgG.Immunosensors which display high sensitivity and selectivity are of utmost importance to the biomedical field. Graphene is a material which has immense potential for the fabrication of immunosensors. For the first time, we evaluate the immunosensing capabilities of various graphene surfaces in this work. We propose a simple and label-free electrochemical impedimetric immunosensor for immunoglobulin G (IgG) based on chemically modified graphene (CMG) surfaces such as graphite oxide, graphene oxide, thermally reduced graphene oxide and electrochemically reduced graphene oxide. Disposable electrochemical printed electrodes were first modified with CMG materials before anti-immunoglobulin G (anti

  5. Highly efficient adsorption of chlorophenols onto chemically modified chitosan

    NASA Astrophysics Data System (ADS)

    Zhou, Liang-Chun; Meng, Xiang-Guang; Fu, Jing-Wei; Yang, Yu-Chong; Yang, Peng; Mi, Chun

    2014-02-01

    A novel chemically modified chitosan CS-SA-CD with phenol and β-cyclodextrin groups was prepared. The adsorptions of phenol, 2-chlorophenol (2-CP), 4-chlorophenol (4-CP), 2,4-dichlorophenol (DCP) and 2,4,6-trichlorophenol (TCP) on the functional chitosan from aqueous solution were investigated. CS-SA-CD exhibited excellent adsorption ability for chlorophenols especially for DCP and TCP. The maximum adsorption capacities of phenol, 2-CP, 4-CP, DCP and TCP on CS-SA-CD were 59.74, 70.52, 96.43, 315.46 and 375.94 mg/g, respectively. The scanning electron microscope and Brunauer-Emmett-Teller analyses revealed that the introduction of phenol group changed the surface morphology and surface properties of chitosan. The modified chitosan CS-SA-CD possesses larger surface areas (4.72 m2/g), pore volume (7.29 × 10-3 mL/g) and average pore diameter (59.99 Å) as compared to those of chitosan 3.27 m2/g, 2.00 × 10-3 mL/g and 15.95 Å, respectively. The enhanced adsorption of chlorophenols was also attributed to the interaction of hydrogen bond between Cl atom and sbnd OH group. The adsorption of chlorophenols on CS-SA-CD followed the pseudo-second-order kinetic model. Adsorbent could be regenerated easily and the regenerated CS-SA-CD remained 80-91% adsorption efficiency.

  6. Lack of QT Prolongation for 2'-O-Methoxyethyl-Modified Antisense Oligonucleotides Based on Retrospective Exposure/Response Analysis of Ten Phase 1 Dose-Escalation Placebo-Controlled Studies in Healthy Subjects.

    PubMed

    Yu, Rosie Z; Gunawan, Rudy; Geary, Richard S; Hughes, Steven G; Henry, Scott P; Wang, Yanfeng

    2017-10-01

    The potential of QT prolongation of ten 2'-O-methoxyethyl-modified (2'-MOE) antisense oligonucleotides (ASOs) was evaluated retrospectively via exposure/response (ER) analysis using data from Phase 1 clinical studies in healthy subjects. All Phase 1 studies were double-blind, placebo-controlled, single and multiple ascending dose studies designed to assess the safety, tolerability, pharmacokinetics (PK), and pharmacodynamics of the ASOs in healthy subjects. The active doses in these studies ranged from 50 to 450 mg administered by subcutaneous (SC) injection in single and multiple ascending dose cohorts. Two of the ten studies also included 2-h intravenous (IV) infusions up to 600 mg. Electrocardiogram (ECG) measurements were performed at baseline and selected time points (including Tmax). The correlation between QTcF intervals corrected for baseline (ΔQTcF) and the mean time-matched placebo (ΔΔQTcF) with PK plasma exposure when available was evaluated using a linear mixed-effects approach. There was no evidence for QTc prolongation associated with increasing plasma concentrations in healthy subjects, including exposures with treatment up to 450 mg administered SC or 600 mg by IV infusions, and concentrations that are 4-20 times the Cmax of the therapeutic dose, as assessed by both ΔQTcF and ΔΔQTcF. The ER analysis of the relationship between drug plasma concentration and ΔΔQTcF showed that the slope of the regression line was close to zero, and the upper bound of the 90% confidence interval at twice the mean observed (or predicted) Cmax (2 × Cmax) of the clinical therapeutic dose (ie, the highest clinically relevant plasma concentration) was well below 10 ms for all 10 compounds evaluated. Therefore, no concentration-dependent effect on QT prolongation was observed for any one of the ten 2'-MOE ASOs evaluated in Phase 1 studies. These results confirmed that 2'-MOE ASOs, as a chemical class, do not cause QT prolongation at clinically relevant

  7. Chemically Modified Bacteriophage as a Streamlined Approach to Noninvasive Breast Cancer Imaging

    DTIC Science & Technology

    2011-10-01

    AD_________________ Award Number: W81XWH-10-1-1017 TITLE: Chemically Modified Bacteriophage as a...COVERED 28 September 2010 – 27 September 2011 4. TITLE AND SUBTITLE 5a. CONTRACT NUMBER Chemically Modified Bacteriophage as a Streamlined...invasive alternative, my research involves the chemical modification and subsequent use of filamentous bacteriophage targeting specific breast cancer

  8. Enhanced multiplex genome engineering through co-operative oligonucleotide co-selection

    PubMed Central

    Carr, Peter A.; Wang, Harris H.; Sterling, Bram; Isaacs, Farren J.; Lajoie, Marc J.; Xu, George; Church, George M.; Jacobson, Joseph M.

    2012-01-01

    Genome-scale engineering of living organisms requires precise and economical methods to efficiently modify many loci within chromosomes. One such example is the directed integration of chemically synthesized single-stranded deoxyribonucleic acid (oligonucleotides) into the chromosome of Escherichia coli during replication. Herein, we present a general co-selection strategy in multiplex genome engineering that yields highly modified cells. We demonstrate that disparate sites throughout the genome can be easily modified simultaneously by leveraging selectable markers within 500 kb of the target sites. We apply this technique to the modification of 80 sites in the E. coli genome. PMID:22638574

  9. G-Quadruplex Forming Oligonucleotides as Anti-HIV Agents.

    PubMed

    Musumeci, Domenica; Riccardi, Claudia; Montesarchio, Daniela

    2015-09-22

    Though a variety of different non-canonical nucleic acids conformations have been recognized, G-quadruplex structures are probably the structural motifs most commonly found within known oligonucleotide-based aptamers. This could be ascribed to several factors, as their large conformational diversity, marked responsiveness of their folding/unfolding processes to external stimuli, high structural compactness and chemo-enzymatic and thermodynamic stability. A number of G-quadruplex-forming oligonucleotides having relevant in vitro anti-HIV activity have been discovered in the last two decades through either SELEX or rational design approaches. Improved aptamers have been obtained by chemical modifications of natural oligonucleotides, as terminal conjugations with large hydrophobic groups, replacement of phosphodiester linkages with phosphorothioate bonds or other surrogates, insertion of base-modified monomers, etc. In turn, detailed structural studies have elucidated the peculiar architectures adopted by many G-quadruplex-based aptamers and provided insight into their mechanism of action. An overview of the state-of-the-art knowledge of the relevance of putative G-quadruplex forming sequences within the viral genome and of the most studied G-quadruplex-forming aptamers, selectively targeting HIV proteins, is here presented.

  10. Magnetorheological finishing of chemical-vapor deposited zinc sulfide via chemically and mechanically modified fluids

    SciTech Connect

    Salzman, Sivan; Romanofsky, Henry J.; Giannechini, Lucca J.; Jacobs, Stephen D.; Lambropoulos, John C.

    2016-02-19

    In this study, we describe the anisotropy in the material removal rate (MRR) of the polycrystalline, chemical-vapor deposited zinc sulfide (ZnS).We define the polycrystalline anisotropy via microhardness and chemical erosion tests for four crystallographic orientations of ZnS: (100), (110), (111), and (311). Anisotropy in the MRR was studied under magnetorheological finishing (MRF) conditions. Three chemically and mechanically modified magnetorheological (MR) fluids at pH values of 4, 5, and 6 were used to test the MRR variations among the four single-crystal planes. When polishing the single-crystal planes and the polycrystalline with pH 5 and pH 6MR fluids, variations were found in the MRR among the four single-crystal planes and surface artifacts were observed on the polycrystalline material. When polishing the single-crystal planes and the polycrystalline with the modified MR fluid at pH 4, however, minimal variation was observed in the MRR among the four orientations and a reduction in surface artifacts was achieved on the polycrystalline material.

  11. Magnetorheological finishing of chemical-vapor deposited zinc sulfide via chemically and mechanically modified fluids

    DOE PAGES

    Salzman, Sivan; Romanofsky, Henry J.; Giannechini, Lucca J.; ...

    2016-02-19

    In this study, we describe the anisotropy in the material removal rate (MRR) of the polycrystalline, chemical-vapor deposited zinc sulfide (ZnS).We define the polycrystalline anisotropy via microhardness and chemical erosion tests for four crystallographic orientations of ZnS: (100), (110), (111), and (311). Anisotropy in the MRR was studied under magnetorheological finishing (MRF) conditions. Three chemically and mechanically modified magnetorheological (MR) fluids at pH values of 4, 5, and 6 were used to test the MRR variations among the four single-crystal planes. When polishing the single-crystal planes and the polycrystalline with pH 5 and pH 6MR fluids, variations were found inmore » the MRR among the four single-crystal planes and surface artifacts were observed on the polycrystalline material. When polishing the single-crystal planes and the polycrystalline with the modified MR fluid at pH 4, however, minimal variation was observed in the MRR among the four orientations and a reduction in surface artifacts was achieved on the polycrystalline material.« less

  12. Chemically modified RNA activated matrices enhance bone regeneration.

    PubMed

    Elangovan, Satheesh; Khorsand, Behnoush; Do, Anh-Vu; Hong, Liu; Dewerth, Alexander; Kormann, Michael; Ross, Ryan D; Sumner, D Rick; Allamargot, Chantal; Salem, Aliasger K

    2015-11-28

    There exists a dire need for improved therapeutics to achieve predictable bone regeneration. Gene therapy using non-viral vectors that are safe and efficient at transfecting target cells is a promising approach to overcoming the drawbacks of protein delivery of growth factors. Here, we investigated the transfection efficiency, cytotoxicity, osteogenic potential and in vivo bone regenerative capacity of chemically modified ribonucleic acid (cmRNA) (encoding BMP-2) complexed with polyethylenimine (PEI) and made comparisons with PEI complexed with conventional plasmid DNA (encoding BMP-2). The polyplexes were fabricated at an amine (N) to phosphate (P) ratio of 10 and characterized for transfection efficiency using human bone marrow stromal cells (BMSCs). The osteogenic potential of BMSCs treated with these polyplexes was validated by determining the expression of bone-specific genes, osteocalcin and alkaline phosphatase as well as through the detection of bone matrix deposition. Using a calvarial bone defect model in rats, it was shown that PEI-cmRNA (encoding BMP-2)-activated matrices promoted significantly enhanced bone regeneration compared to PEI-plasmid DNA (BMP-2)-activated matrices. Our proof of concept study suggests that scaffolds loaded with non-viral vectors harboring cmRNA encoding osteogenic proteins may be a powerful tool for stimulating bone regeneration with significant potential for clinical translation.

  13. Deformability Calculation for Estimation of the Relative Stability of Chemically Modified RNA Duplexes.

    PubMed

    Masaki, Yoshiaki; Sekine, Mitsuo; Seio, Kohji

    2017-03-02

    Chemical modification of RNA duplexes alters their stability. We have attempted to develop a computational approach to estimate the thermal stability of chemically modified duplexes. These studies revealed that the deformability of chemically modified RNA duplexes, calculated from molecular dynamics simulations, could be used as a good indicator for estimating the effect of chemical modification on duplex thermal stability. This unit describes how deformability calculation can be applied to estimate the relative stability of chemically modified RNA duplexes. © 2017 by John Wiley & Sons, Inc.

  14. P-chiral oligonucleotides in biological recognition processes.

    PubMed

    Guga, Piotr

    2007-01-01

    Internucleotide phosphodiester linkages in non-modified oligonucleotides are quickly degraded by nucleolytic enzymes present in the cells and this feature practically eliminates natural DNA and RNA molecules from medical applications and from many structural and mechanistic studies. P-chiral oligonucleotide analogs, in which one of the non-bridging phosphate oxygen atoms is substituted with another heteroatom (e.g. S, Se) or a chemical group (e.g. CH3, BH3(-)), have significantly greater nuclease resistance and also offer important possibilities for detailed studies of interactions with other biomolecules at the molecular level. Notably, these substitutions do not disrupt hydrogen bonding between nucleobases and affect the overall geometry of the oligomers to only low or moderate extent, although important changes of hydration patterns and changes of interactions with metal ions are observed. Such the probes, including isotopomeric species labeled with a heavy oxygen isotope, possessing phosphorus atoms of selected absolute configurations, have been used for elucidation of the mode of action of many enzymes (nucleases, transferases, kinases), ribozymes and DNA-zymes, as well as for investigations on thermodynamic stability of nucleic acids complexes (duplexes, triplexes, i-motif) and for studies on a mechanism of conformational changes of B-Z type. They are also useful tools for analysis of interactions of the phosphoryl oxygen atoms in natural precursors with functional groups of proteins. The synthetic routes to stereodefined forms of selected types of P-chiral oligonucleotides are presented, as well as recently developed methods for their configurational analysis at micromolar concentration. Selected examples of application of diastereomerically pure P-chiral oligonucleotides for structural, biochemical and biological experiments are discussed.

  15. Ratiometric detection of oligonucleotide stoichiometry on multifunctional gold nanoparticles by whispering gallery mode biosensing.

    PubMed

    Wu, F C; Wu, Y; Niu, Z; Vollmer, F

    2015-05-07

    A label-free method is developed to ratiometrically determine the stoichiometry of oligonucleotides attached to the surface of gold nanoparticle (GNP) by whispering gallery mode biosensing. Utilizing this scheme, it is furthermore shown that the stoichiometric ratio of GNP attached oligonucleotide species can be controlled by varying the concentration ratio of thiolated oligonucleotides that are used to modify the GNP.

  16. Synthesis of triazole-linked oligonucleotides with high affinity to DNA complements and an analysis of their compatibility with biosystems.

    PubMed

    Varizhuk, Anna M; Kaluzhny, Dmitry N; Novikov, Roman A; Chizhov, Alexandr O; Smirnov, Igor P; Chuvilin, Andrey N; Tatarinova, Olga N; Fisunov, Gleb Y; Pozmogova, Galina E; Florentiev, Vladimir L

    2013-06-21

    New oligonucleotide analogues with triazole internucleotide linkages were synthesized, and their hybridization properties were studied. The analogues demonstrated DNA binding affinities similar to those of unmodified oligonucleotides. The modification was shown to protect the oligonucleotides from nuclease hydrolysis. The modified oligonucleotides were tested as PCR primers. Modifications remote from the 3'-terminus were tolerated by polymerases. Our results suggest that these new oligonucleotide analogues are among the most promising triazole DNA mimics characterized to date.

  17. A nonantibiotic chemically modified tetracycline (CMT-3) inhibits intimal thickening.

    PubMed

    Islam, Muzharul M; Franco, Christopher D; Courtman, David W; Bendeck, Michelle P

    2003-10-01

    Recent research has shown that the tetracycline antibiotics are pluripotent drugs that inhibit the activity of matrix metalloproteinases (MMPs) and affect many cellular functions including proliferation, migration, and matrix remodeling. We have shown that doxycycline inhibits MMP activity and intimal thickening after injury of the rat carotid artery, however we do not know whether these effects are because of the antibiotic, anti-MMP, or other actions of doxycycline. Recently, chemically modified tetracyclines have been synthesized that lack antibiotic activity but retain anti-MMP activity (CMT-3), or lack both antibiotic and anti-MMP activity (CMT-5). In the current study we have assessed the effects of treatment with CMT-3 or CMT-5 on intimal thickening after balloon catheter injury of the rat carotid artery. Rats were treated by oral gavage with 15 mg/kg/day CMT-3 or CMT-5. CMT-3 significantly reduced smooth muscle cell (SMC) proliferation in both the medial and intimal layers of the injured rat carotid artery compared to CMT-5. Furthermore, CMT-3 inhibited SMC migration from the media to the intima by 86% at 4 days after injury. CMT-3 also decreased MMP-2 activity. Finally, we found that CMT-3 treatment resulted in a significant reduction in intimal cross-sectional area from 0.23 +/- 0.01 mm(2) in the CMT-5 control group to 0.19 +/- 0.01 mm(2). There was also a reduction in elastin and collagen accumulation within the intima. We conclude that CMT-3 attenuated intimal thickening after arterial injury by inhibiting SMC proliferation, migration and MMP activity, and accumulation of extracellular matrix. The inhibitory effects of CMT-3 were independent of the antibiotic properties, but were dependent on the anti-MMP activity of the tetracycline family.

  18. Biological resistance of polyethylene composites made with chemically modified fiber or flour

    Treesearch

    Rebecca E. Ibach; Craig M. Clemons

    2002-01-01

    The role of moisture in the biological decay of wood-plastic composites was investigated. Southern pine wood fiber and ponderosa pine wood flour were chemically modified using either acetic anhydride (AA), butylene oxide (BO), or propylene oxide (PO). A 50:50 mixture of high density polyethylene and either chemically modified fiber or flour, or untreated fiber or flour...

  19. The effect on biological and moisture resistance of epichlorohydrin chemically modified wood

    Treesearch

    Rebecca E. Ibach; Beom-Goo Lee

    2002-01-01

    Southern pine solid wood and fiber were chemically modified with epichlorohydrin to help in understanding the role of moisture in the mechanism of biological effectiveness of chemically modified wood. The solid wood had weight gains from 11% to 34%, while the fiber had weight gains from 9% to 75%. After modification, part of the specimens were water leached for 2 weeks...

  20. Oligonucleotide conjugates - Candidates for gene silencing therapeutics.

    PubMed

    Gooding, Matt; Malhotra, Meenakshi; Evans, James C; Darcy, Raphael; O'Driscoll, Caitriona M

    2016-10-01

    The potential therapeutic and diagnostic applications of oligonucleotides (ONs) have attracted great attention in recent years. The capability of ONs to selectively inhibit target genes through antisense and RNA interference mechanisms, without causing un-intended sideeffects has led them to be investigated for various biomedical applications, especially for the treatment of viral diseases and cancer. In recent years, many researchers have focused on enhancing the stability and target specificity of ONs by encapsulating/complexing them with polymers or lipid chains to formulate nanoparticles/nanocomplexes/micelles. Also, chemical modification of nucleic acids has emerged as an alternative to impart stability to ONs against nucleases and other degrading enzymes and proteins found in blood. In addition to chemically modifying the nucleic acids directly, another strategy that has emerged, involves conjugating polymers/peptide/aptamers/antibodies/proteins, preferably to the sense strand (3'end) of siRNAs. Conjugation to the siRNA not only enhances the stability and targeting specificity of the siRNA, but also allows for the development of self-administering siRNA formulations, with a much smaller size than what is usually observed for nanoparticle (∼200nm). This review concentrates mainly on approaches and studies involving ON-conjugates for biomedical applications.

  1. Investigation of the recognition of an important uridine in an internal loop of a hairpin ribozyme prepared using post-synthetically modified oligonucleotides.

    PubMed Central

    Komatsu, Y; Kumagai, I; Ohtsuka, E

    1999-01-01

    We introduced 4-thio- ((4S)U), 2-thio- ((2S)U), 4- O -methyluridine ((4Me)U) and cytidine substitutions for U+2, which is an important base for cleavage in a substrate RNA. Oligonucleotides containing 4-thio- and 4- O -methyluridine were prepared by a new convenient post-synthetic modification method using a 4- O - p -nitrophenyl-uridine derivative. A hairpin ribozyme cleaved the substrate RNA with either C+2, (4S)U+2 or (4Me)U+2 at approximately 14-, 6- and 4-fold lower rates, respectively, than that of the natural substrate. In contrast, the substrate with a (2S)U+2 was cleaved with the same activity as the natural substrate. These results suggest that the O4 of U+2 is involved in hydrogen bonding at loop A, but the O2 of U+2 is not recognized by the active residues. Circular dichroism data of the ribozymes containing (4S)U+2 and (2S)U+2, as well as the susceptibility of the thiocarbonyl group to hydrogen peroxide, suggest that a conformational change of U+2 occurs during the domain docking in the cleavage reaction. We propose here the conformational change of U+2 from the ground state to the active molecule during the reaction. PMID:10536137

  2. Synthesis and anti-HIV activity of thiocholesteryl-coupled phosphodiester antisense oligonucleotides incorporated into immunoliposomes.

    PubMed

    Zelphati, O; Wagner, E; Leserman, L

    1994-09-01

    Encapsulation of oligonucleotides in antibody-targeted liposomes (immunoliposomes) which bind to target cells permits intracellular delivery of the oligonucleotides. This approach circumvents problems of extracellular degradation by nucleases and poor membrane permeability which free phosphodiester oligonucleotides are subject to, but leaves unresolved the inefficiency of encapsulation of oligonucleotides in liposomes. We have coupled oligonucleotides to cholesterol via a reversible disulfide bond. This modification of oligonucleotides improved their association with immunoliposomes by a factor of about 10 in comparison to unmodified oligonucleotides. The presence of cholesteryl-modified oligonucleotides incorporated in the bilayer of liposomes did not interfere with the coupling of the targeting protein to the liposome surface. Free or cholesterol coupled oligonucleotides associated with liposomes and directed against the tat gene of HIV-1 were tested for inhibition of HIV-1 proliferation in acutely infected cells. We demonstrate that the cholesteryl-modified as well as unmodified oligonucleotides acquire the target specificity of the antibody on the liposome. Their antiviral activity when delivered into cells is sequence-specific. The activity of these modified or unmodified oligonucleotides to inhibit the replication of HIV was the same on an equimolar basis (EC50 around 0.1 microM). Cholesterol coupled oligonucleotides thus offer increased liposome association without loss of antiviral activity.

  3. Why Carba-LNA-modified oligonucleotides show considerably improved 3'-exonuclease stability compared to that of the LNA modified or the native counterparts: A Michaelis-Menten kinetic analysis.

    PubMed

    Zhou, Chuanzheng; Chattopadhyaya, Jyoti

    2010-04-02

    In this study, 12 different native or LNA, carba-LNA-modified dinucleoside phosphates were designed as simple chemical models to study how carba-LNA modifications improve the 3'-exonuclease (SVPDE in this study) resistance of internucleotidic phosphate compared to those exhibited by LNA-modified and the native counterparts. Michaelis-Menten kinetic studies for dimers 3 - 7, in which the LNA or carba-LNA modifications are located at the 5'-end, showed that (i) increased 3'-exonuclease resistance of (5')[LNA-T](p)T (3) compared to the native (5')T(p)T (1) was mainly attributed to steric hindrance imposed by the LNA modification that retards the nuclease binding (K(M)) and (ii) digestion of (5')[carba-LNA-dT](p)T (4) and (5')[LNA-T](p)T (3), however, exhibit similar K(M)s, whereas the former shows a 100x decrease in K(cat) and is hence more stable than the latter. By studying the correlation between log k(cat) and pK(a) of the departing 3'(or 6')-OHs for 3-7, we found the pK(a) of 3'-OH of carba-LNA-T was 1.4 pK(a) units higher than that of LNA-T, and this relatively less acidic character of the 3'-OH in the former leads to the 100x decrease in the catalytic efficiency for the digestion of (5')[carba-LNA-T](p)T (4). In contrast, Michaelis-Menten kinetic studies for dimers 9-12, with the LNA or carba-LNA modifications at the 3'-end, showed that the digestion of (5')T(p)[LNA-T] (9) exhibited similar K(M) but k(cat) decreased around 40 times compared to that of the native (5')T(p)T (1). Similar k(cat) values have been observed for digestion of (5')T(p)[carba-LNA-T] (10) and (5')T(p)[LNA-T] (9). The higher stability of carba-LNA modified dimer 10 compared with LNA modified dimer 9 comes solely from the increased K(M).

  4. Comparison of small molecules and oligonucleotides that target a toxic, non-coding RNA.

    PubMed

    Costales, Matthew G; Rzuczek, Suzanne G; Disney, Matthew D

    2016-06-01

    Potential RNA targets for chemical probes and therapeutic modalities are pervasive in the transcriptome. Oligonucleotide-based therapeutics are commonly used to target RNA sequence. Small molecules are emerging as a modality to target RNA structures selectively, but their development is still in its infancy. In this work, we compare the activity of oligonucleotides and several classes of small molecules that target the non-coding r(CCUG) repeat expansion (r(CCUG)(exp)) that causes myotonic dystrophy type 2 (DM2), an incurable disease that is the second-most common cause of adult onset muscular dystrophy. Small molecule types investigated include monomers, dimers, and multivalent compounds synthesized on-site by using RNA-templated click chemistry. Oligonucleotides investigated include phosphorothioates that cleave their target and vivo-morpholinos that modulate target RNA activity via binding. We show that compounds assembled on-site that recognize structure have the highest potencies amongst small molecules and are similar in potency to a vivo-morpholino modified oligonucleotide that targets sequence. These studies are likely to impact the design of therapeutic modalities targeting other repeats expansions that cause fragile X syndrome and amyotrophic lateral sclerosis, for example.

  5. Evaluation of the effects of chemically different linkers on hepatic accumulations, cell tropism and gene silencing ability of cholesterol-conjugated antisense oligonucleotides.

    PubMed

    Wada, Shunsuke; Yasuhara, Hidenori; Wada, Fumito; Sawamura, Motoki; Waki, Reiko; Yamamoto, Tsuyoshi; Harada-Shiba, Mariko; Obika, Satoshi

    2016-03-28

    Cholesterol conjugation of oligonucleotides is an attractive way to deliver the oligonucleotides specifically to the liver. However cholesterol-conjugated antisense oligonucleotides (ASOs) mainly accumulate in non-parenchymal cells (NPCs) such as Kupffer cells. In this study, to increase the hepatic accumulation of cholesterol-conjugated ASOs, we prepared a variety of linkers for cholesterol conjugation to anti-Pcsk9 ASOs and examined their effects on pharmacological parameters. Hepatic accumulation of ASO was dramatically increased with cholesterol conjugation. The increase in hepatic accumulation depended largely on the linker chemistry of each cholesterol-conjugated ASO. In addition to hepatic accumulation, the cell tropism of each cholesterol-conjugated ASO tended to depend on their linker. Although a linker bearing a disulfide bond accumulated mainly in NPCs, hexamethylene succinimide linker accumulated mainly in hepatocytes. To estimate the benefits of releasing ASO from the conjugated cholesterol in hepatocyte, we designed another linker based on hexamethylene succinimide, which has a phosphodiester bond between the linker and the ASO. The cholesterol-conjugated ASO bearing such a phosphodiester bond showed a significantly improved Pcsk9 mRNA inhibitory effect compared to its counterpart, cholesterol-conjugated ASO with a phosphorothioate bond, while the hepatic accumulation of both cholesterol-conjugated ASOs was comparable, indicating the effectiveness of removing the conjugated cholesterol for ASO activity. In toxicity analysis, some of the linkers induced lethal toxicities when they were injected at high concentrations (>600μM). These toxicities were attributed to decreased platelet levels in the blood, suggesting an interaction between cholesterol-conjugated ASO and platelets. Our findings may provide a guideline for the design of molecule-conjugated ASOs.

  6. Noncoding oligonucleotides: the belle of the ball in gene therapy.

    PubMed

    Shum, Ka-To; Rossi, John J

    2015-01-01

    Gene therapy carries the promise of cures for many diseases based on manipulating the expression of a person's genes toward the therapeutic goal. The relevance of noncoding oligonucleotides to human disease is attracting widespread attention. Noncoding oligonucleotides are not only involved in gene regulation, but can also be modified into therapeutic tools. There are many strategies that leverage noncoding oligonucleotides for gene therapy, including small interfering RNAs, antisense oligonucleotides, aptamers, ribozymes, decoys, and bacteriophage phi 29 RNAs. In this chapter, we will provide a broad, comprehensive overview of gene therapies that use noncoding oligonucleotides for disease treatment. The mechanism and development of each therapeutic will be described, with a particular focus on its clinical development. Finally, we will discuss the challenges associated with developing nucleic acid therapeutics and the prospects for future success.

  7. Chemically Modified Graphene for Sensing and Nanomechanical Applications

    DTIC Science & Technology

    2009-01-01

    chemical vapors at parts-per-billion concentrations,5 although these sensors require somewhat sophisticated electronics to realize their full...chemically (e.g., with hydrazine , N2H4) or thermally (e.g., by annealing in H2), providing a knob with which to tune the sensor response. These devices are...and mechanical devices. CMG can be fine-tuned to its specific application and has been used to produce sensors of extraordinary sensitivity

  8. The delivery of therapeutic oligonucleotides

    PubMed Central

    Juliano, Rudolph L.

    2016-01-01

    The oligonucleotide therapeutics field has seen remarkable progress over the last few years with the approval of the first antisense drug and with promising developments in late stage clinical trials using siRNA or splice switching oligonucleotides. However, effective delivery of oligonucleotides to their intracellular sites of action remains a major issue. This review will describe the biological basis of oligonucleotide delivery including the nature of various tissue barriers and the mechanisms of cellular uptake and intracellular trafficking of oligonucleotides. It will then examine a variety of current approaches for enhancing the delivery of oligonucleotides. This includes molecular scale targeted ligand-oligonucleotide conjugates, lipid- and polymer-based nanoparticles, antibody conjugates and small molecules that improve oligonucleotide delivery. The merits and liabilities of these approaches will be discussed in the context of the underlying basic biology. PMID:27084936

  9. The delivery of therapeutic oligonucleotides.

    PubMed

    Juliano, Rudolph L

    2016-08-19

    The oligonucleotide therapeutics field has seen remarkable progress over the last few years with the approval of the first antisense drug and with promising developments in late stage clinical trials using siRNA or splice switching oligonucleotides. However, effective delivery of oligonucleotides to their intracellular sites of action remains a major issue. This review will describe the biological basis of oligonucleotide delivery including the nature of various tissue barriers and the mechanisms of cellular uptake and intracellular trafficking of oligonucleotides. It will then examine a variety of current approaches for enhancing the delivery of oligonucleotides. This includes molecular scale targeted ligand-oligonucleotide conjugates, lipid- and polymer-based nanoparticles, antibody conjugates and small molecules that improve oligonucleotide delivery. The merits and liabilities of these approaches will be discussed in the context of the underlying basic biology. © The Author 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  10. Removal of phosphorus using chemically modified lignocellulosic materials

    Treesearch

    James S. Han; N. Hur; B. Choi; Soo-Hong Min

    2003-01-01

    Heavy metals from an acid mine drainage (AMD) site were precipitated on the surface of juniper fiber. The modified fiber was tested in lab-scaled batch and column tests and in the field. Elemental analysis showed that soluble iron species deposited on the fiber act as an inorganic adsorbent for anions. Sorption capacity, determined by fitting results to a Langmuir...

  11. Bromodeoxyuridine-labeled oligonucleotides as tools for oligonucleotide uptake studies.

    PubMed

    Maszewska, Maria; Kobylańska, Anna; Gendaszewska-Darmach, Edyta; Koziołkiewicz, Maria

    2002-12-01

    The mechanisms by which various oligonucleotides (ODNs) and their analogs enter cells are not fully understood. A common technique used in studies on cellular uptake of ODNs is their conjugation with fluorochromes. However, fluorescently labeled ODNs may vary from the parent compounds in charge and hydrophilicity, and they may interact differently with some components of cellular membranes. In this report, we present an alternative method based on the immunofluorescent detection of ODNs with incorporated 5-bromo-2'-deoxyuridine (BrdUrd). Localization of BrdUrd-modified ODNs has been achieved using FITC-labeled anti-BrdUrd antibodies. This technique allowed determination of the differences in cellular uptake of phosphodiester (PO) and phosphorothioate (PS) ODNs and their derivatives conjugated with cholesterol and menthol. The immunocytochemical method also has shown that the cellular uptake of some ODNs may be influenced by specific sequences that are responsible for the formation of higher-order structures.

  12. Use of inherently conducting polymers and pulsed amperometry in flow injection analysis to detect oligonucleotides.

    PubMed

    Wu, Yanzhe; Moulton, Simon E; Too, Chee O; Wallace, Gordon G; Zhou, Dezhi

    2004-07-01

    Pulsed amperometry has been used to detect and discriminate between different base-pair oligonucleotides using flow injection analysis with polypyrrole modified electrodes. Oligonucleotides with 20-repeat units were immobilized as the sole counter anion during polymerisation of pyrrole onto a glassy carbon (GC) electrode. The modified electrode was then used in a flow injection analysis (FIA) set-up to selectively detect complementary oligonucleotides. Results showed that complementary oligo(dG)(20) and non-complementary oligonucleotides can be distinguished by using the oligo(dC)(20) modified electrode.

  13. A study on the fabrication of chemically modified bacteriorhodopsin film and its photochemical properties.

    PubMed

    Zhang, Guoyan; Li, Baofang; Zhang, Jianping

    2004-01-16

    Chemically modified bacteriorhodopsin (BR) films embedded in gelatin matrix were fabricated. It was found that chemically modified BR/gelatin film remained the original conformation of BR and possessed homogeneity. Then, the photochemical conversion from all-trans O state to 9-cis P state in the chemically modified BR film/gelatin was investigated. For comparison purpose, the same conversion in the wild-type BR (BRwt) film was also presented here. To our know, it is the first report to show that the absorption changes of the P state in the chemically modified BR film were larger than in the BRwt film upon illumination with red light at the low actinic power density.

  14. Synthesis of DNA oligonucleotides containing C5-ethynylbenzenesulfonamide-modified nucleotides (EBNA) by polymerases towards the construction of base functionalized nucleic acids.

    PubMed

    Goubet, Astrid; Chardon, Antoine; Kumar, Pawan; Sharma, Pawan K; Veedu, Rakesh N

    2013-02-01

    C5-Ethynylbenzenesulfonamide-modified nucleotide (EBNA) was investigated as substrate of various DNA polymerases. The experiments revealed that KOD, Phusion and Klenow DNA polymerases successfully accepted EBNA-T nucleotide as a substrate and yielded the fully extended DNA. KOD DNA polymerase was found to be the most efficient enzyme to furnish EBNA-T containing DNA in good yields. Phusion DNA polymerase efficiently amplified the template containing EBNA-T nucleotides by PCR.

  15. Lack of pharmacokinetic interaction of mipomersen sodium (ISIS 301012), a 2'-O-methoxyethyl modified antisense oligonucleotide targeting apolipoprotein B-100 messenger RNA, with simvastatin and ezetimibe.

    PubMed

    Yu, Rosie Z; Geary, Richard S; Flaim, Joann D; Riley, Gina C; Tribble, Diane L; vanVliet, André A; Wedel, Mark K

    2009-01-01

    Mipomersen sodium (ISIS 301012) is a 20-mer phosphorothioate antisense oligonucleotide that is complementary to human apolipoprotein B-100 (apoB-100) messenger RNA and subsequently reduces translation of ApoB-100 protein, the major apolipoprotein of very low-density lipoprotein, intermediate-density lipoprotein and low-density lipoprotein (LDL). Mipomersen sodium is currently being studied in phase II/III clinical studies to determine its clinical utility as add-on therapy to HMG-CoA reductase inhibitors or other lipid-lowering agents in subjects with hypercholesterolaemia. The aim of this study was to characterize the pharmacokinetic interactions of mipomersen sodium with simvastatin and ezetimibe. Another aim was to evaluate the ability of mipomersen sodium to inhibit major cytochrome P450 (CYP) isoenzymes in vitro. In a phase I clinical study, ten healthy subjects per cohort received a single oral dose of simvastatin 40 mg or ezetimibe 10 mg followed by four 2-hour intravenous doses of mipomersen sodium 200 mg over an 8-day period, with simvastatin 40 mg or ezetimibe 10 mg being administered again with the last dose of mipomersen sodium. Mipomersen sodium pharmacokinetic profiles were assessed following the first dose (mipomersen sodium alone) and the last dose (mipomersen sodium in combination with simvastatin or ezetimibe). Plasma samples for measurement of simvastatin, simvastatin acid, and free and total ezetimibe concentrations were collected at various timepoints following their first and last oral dosing. A comparative pharmacokinetic analysis was performed to determine if there were any effects resulting from coadministration of mipomersen sodium with these lipid-lowering drugs. In addition to the clinical pharmacokinetic analysis, the ability of mipomersen sodium to inhibit the major CYP isoform enzymes (namely CYP1A2, CYP2C9, CYP2C19, CYP2D6 and CYP3A4) was evaluated in cryo-preserved human hepatocytes in vitro. The area under the plasma concentration

  16. Enhancement of gene silencing potency and nuclease stability by chemically modified duplex RNA.

    PubMed

    Kubo, Takanori; Zhelev, Zhivko; Bakalova, Rumiana; Ohba, Hideki

    2007-01-01

    In this study, we describe a development of chemically modified dsRNAs with improved biological properties. These dsRNAs possess an enhanced RNAi activity and a dramatically increased stability in cell cultured medium (containing 10% serum) in comparison with widely used 21nt siRNA. The chemically modified dsRNAs manifested a high longterm gene suppression after one week post-transfection, whereas 21nt siRNA showed a high RNAi activity only after 48 h cell transfection.

  17. a Novel Method to Synthesize N-DOPED CNTs Arrays via Chemical Modifying Porous Alumina Membrane

    NASA Astrophysics Data System (ADS)

    Li, Chengyong; He, Lei

    2014-01-01

    N-doped carbon nanotubes (CNTs) arrays were fabricated via simply chemical modifying porous alumina membrane (PAM) with dopamine. The diameter of N-doped CNTs is about 60-70 nm. The N/C atomic ratio is calculated to be 0.05 and the main functionality is pyridone/pyrrole N. This chemical modifying method can be used to fabricate mass of N-doped CNTs arrays in one step with single raw material.

  18. Chemical reactivity of twin-modified copper nanowire surfaces

    NASA Astrophysics Data System (ADS)

    Huang, Chun-Lung; Liao, Chien-Neng

    2015-07-01

    Effect of twin boundary (TB) spacing on atomic surface structure and chemical reactivity of nanotwinned Cu nanowires (NWs) is investigated. Post-etching surface structure and wire diameter of Cu NWs were examined by transmission electron microscopy. When TB spacing is less than 10 nm, the Cu NWs remain almost intact after chemical attack and show faceted surface structures with low atomic step density. A mechanism based on surface tension torque acting on TB/surface triple junctions is proposed to explain the faceted structure formation and enhanced corrosion resistance of nanotwinned Cu NWs.

  19. Chemical reactivity of twin-modified copper nanowire surfaces

    SciTech Connect

    Huang, Chun-Lung; Liao, Chien-Neng

    2015-07-13

    Effect of twin boundary (TB) spacing on atomic surface structure and chemical reactivity of nanotwinned Cu nanowires (NWs) is investigated. Post-etching surface structure and wire diameter of Cu NWs were examined by transmission electron microscopy. When TB spacing is less than 10 nm, the Cu NWs remain almost intact after chemical attack and show faceted surface structures with low atomic step density. A mechanism based on surface tension torque acting on TB/surface triple junctions is proposed to explain the faceted structure formation and enhanced corrosion resistance of nanotwinned Cu NWs.

  20. Use of Specific Chemical Reagents for Detection of Modified Nucleotides in RNA

    PubMed Central

    Behm-Ansmant, Isabelle; Helm, Mark; Motorin, Yuri

    2011-01-01

    Naturally occurring cellular RNAs contain an impressive number of chemically distinct modified residues which appear posttranscriptionally, as a result of specific action of the corresponding RNA modification enzymes. Over 100 different chemical modifications have been identified and characterized up to now. Identification of the chemical nature and exact position of these modifications is typically based on 2D-TLC analysis of nucleotide digests, on HPLC coupled with mass spectrometry, or on the use of primer extension by reverse transcriptase. However, many modified nucleotides are silent in reverse transcription, since the presence of additional chemical groups frequently does not change base-pairing properties. In this paper, we give a summary of various chemical approaches exploiting the specific reactivity of modified nucleotides in RNA for their detection. PMID:21716696

  1. Effects of chemically modified wood on bond durability

    Treesearch

    Rishawn Brandon; Rebecca E. Ibach; Charles R. Frihart

    2005-01-01

    Chemical modification of wood can improve its dimensional stability and resistance to biological degradation and moisture, but modification can also create a new surface for bonding. Acetylation of wood results in the loss of hydroxyl groups, making the wood more hydrophobic and reduces its ability to hydrogen-bond with the adhesive. In contrast, reacting wood with...

  2. 40 CFR 372.20 - Process for modifying covered chemicals and facilities.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... chemicals and facilities. 372.20 Section 372.20 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SUPERFUND, EMERGENCY PLANNING, AND COMMUNITY RIGHT-TO-KNOW PROGRAMS TOXIC CHEMICAL RELEASE REPORTING: COMMUNITY RIGHT-TO-KNOW Reporting Requirements § 372.20 Process for modifying covered...

  3. Multifunctional Pristine Chemically Modified Graphene Films as Strong as Stainless Steel.

    PubMed

    Zhang, Miao; Wang, Yanlei; Huang, Liang; Xu, Zhiping; Li, Chun; Shi, Gaoquan

    2015-11-01

    Pristine chemically modified graphene films with light weights and excellent mechanical properties can be prepared by chemically engineering the structure of the graphene oxide sheets and the microstructures of the films. Particularly, these reduced graphene oxide films are as strong as stainless steel, ultra-tough, and have high electrical and thermal conductivities.

  4. Potentiometric sensing of nucleic acids using chemically modified nanopores.

    PubMed

    Makra, István; Brajnovits, Alexandra; Jágerszki, Gyula; Fürjes, Péter; Gyurcsányi, Róbert E

    2017-01-05

    Unlike the overwhelming majority of nanopore sensors that are based on the measurement of a transpore ionic current, here we introduce a potentiometric sensing scheme and demonstrate its application for the selective detection of nucleic acids. The sensing concept uses the charge inversion that occurs in the sensing zone of a nanopore upon binding of negatively charged microRNA strands to positively charged peptide-nucleic acid (PNA) modified nanopores. The initial anionic permselectivity of PNA-modified nanopores is thus gradually changed to cationic permselectivity, which can be detected simply by measuring the nanoporous membrane potential. A quantitative theoretical treatment of the potentiometric microRNA response is provided based on the Nernst-Planck/Poisson model for the nanopore system assuming first order kinetics for the nucleic acid hybridization. An excellent correlation between the theoretical and experimental results was observed, which revealed that the binding process is focused at the nanopore entrance with contributions from both in pore and out of pore sections of the nanoporous membrane. The theoretical treatment is able to give clear guidelines for further optimization of potentiometric nanopore-based nucleic acid sensors by predicting the effect of the most important experimental parameters on the potential response.

  5. Chemically modified IR-transparent fibers and their application as chemical sensors

    SciTech Connect

    Kellner, R.A.

    1993-12-31

    With the advent of chalcogenide- (As-Se-Te), Silverhalide- (AgBrCl) and TeXAs-fibers, the optical window available for analytical chemistry was significantly extended into the MID- and FAR-IR range (2 to 20 {mu}m) recently. These fibers have been chemically modified in our laboratory at 10 cm-distances of their surfaces (A) by covering them with 10-100 {mu}m thick layers of a suitable polymer such as LDPE ({open_quotes}Thickfilm-Sensor{close_quotes}) and (B) by immobilizing specifically reacting enzyme-layers such as GOx ({open_quotes}Thinfilm-Sensor{close_quotes}). In the first case, where the penetration depth of the IR-beam is smaller than the thickness of the polymer layer, a sensor for the simultaneous in situ-determination of chlorinated hydrocarbon traces in water down to 500 ppb could be developed and tested. In the second case, a system for the determination of glucose in complex aqueous solutions was developed, based on the catalytic oxidation of glucose to gluconic acid and hydrogen peroxide by the immobilized enzyme glucose oxidase (GOx) in the physiological range. The GOx-density at the fibers could be significantly enlarged by using S-Layers instead of silanes for immobilization. Secondly, a flow injection-approach was developed recently, which allowed for an even further increase of the enzyme density by separating the reaction- and detection-part of our sensor, using controlled pore glass as carrier for the GOx and tapered chalcogenide fibers for detection. With this system, which works perfectly linear in the physiological range also for urea (with urease) a practical (multi)enzyme-based IR-sensor system is presented for the first time.

  6. Intracerebral Infusion of Antisense Oligonucleotides Into Prion-infected Mice

    PubMed Central

    Nazor Friberg, Karah; Hung, Gene; Wancewicz, Ed; Giles, Kurt; Black, Chris; Freier, Sue; Bennett, Frank; DeArmond, Stephen J; Freyman, Yevgeniy; Lessard, Pierre; Ghaemmaghami, Sina; Prusiner, Stanley B

    2012-01-01

    Mice deficient for the cellular prion protein (PrPC) do not develop prion disease; accordingly, gene-based strategies to diminish PrPC expression are of interest. We synthesized a series of chemically modified antisense oligonucleotides (ASOs) targeted against mouse Prnp messenger RNA (mRNA) and identified those that were most effective in decreasing PrPC expression. Those ASOs were also evaluated in scrapie-infected cultured cells (ScN2a) for their efficacy in diminishing the levels of the disease-causing prion protein (PrPSc). When the optimal ASO was infused intracerebrally into FVB mice over a 14-day period beginning 1 day after infection with the Rocky Mountain Laboratory (RML) strain of mouse prions, a prolongation of the incubation period of almost 2 months was observed. Whether ASOs can be used to develop an effective therapy for patients dying of Creutzfeldt–Jakob disease remains to be established. PMID:23344724

  7. Iodine derivatives of chemically modified gum Arabic microspheres.

    PubMed

    Ganie, Showkat A; Ali, Akbar; Mazumdar, Nasreen

    2015-09-20

    Acetylated gum Arabic (AGA) derivatives with different degrees of substitution (DS 0.97-2.74) were synthesized using acetyl chloride and a base under varying reaction conditions. The AGA derivatives were obtained in the form of microspheres and thereafter stable iodine products were prepared by doping the microspheres with an iodinating agent, iodine monochloride (ICl). The reaction between electrophilic iodine and polar carbonyl groups was studied by FT-IR, (1)H-NMR, and UV-VIS spectroscopies. The products were also characterized by DSC, TGA and SEM studies. The incorporated iodine was released in aqueous medium as iodide ions (I(-)). A reaction scheme has been proposed for the iodination and de-iodination of the gum derivatives. This work suggests that the iodine derivatives of modified gum Arabic could be used as a source of iodide ions which is the nutritional form of iodine. Copyright © 2015 Elsevier Ltd. All rights reserved.

  8. Interfacial characterization and analytical applications of chemically-modified surfaces

    SciTech Connect

    Wang, Jianhong

    1998-02-23

    The goal of this work is to explore several new strategies and approaches to the surface modification and the microscopic characterization of interfaces in the areas mainly targeting sensor technologies that are of interest to environmental control or monitoring, and scanning probe microscopies techniques that can monitor interfacial chemical reactions in real time. Centered on the main theme, four specific topics are presented as four chapters in this dissertation following the general introduction. Chapter 1 describes the development of two immobilization schemes for covalently immobilizing fluoresceinamine at cellulose acetate and its application as a pH sensing film. Chapter 2 investigates the applicability of SFM to following the base-hydrolysis of a dithio-bis(succinimidylundecanoate) monolayer at gold in situ. Chapter 3 studies the mechanism for the accelerated rate of hydrolysis of the dithio-bis(succinimidylundecanoate) monolayer at Au(111) surface. Chapter 4 focuses on the development of an electrochemical approach to the elimination of chloride interference in Chemical Oxygen Demand (COD) analysis of waste water. The procedures, results and conclusions are described in each chapter. This report contains the introduction, references, and general conclusions. Chapters have been processed separately for inclusion on the data base. 95 refs.

  9. The ups and downs of nucleic acid duplex stability: structure-stability studies on chemically-modified DNA:RNA duplexes.

    PubMed Central

    Freier, S M; Altmann, K H

    1997-01-01

    In an effort to discover novel oligonucleotide modifications for antisense therapeutics, we have prepared oligodeoxyribonucleotides containing more than 200 different modifications and measured their affinities for complementary RNA. These include modifications to the heterocyclic bases, the deoxy-ribose sugar and the phosphodiester linkage. From these results, we have been able to determine structure-activity relationships that correlate hybridization affinity with changes in oligonucleotide structure. Data for oligonucleotides containing modified pyrimidine nucleotides are presented. In general, modifications that resulted in the most stable duplexes contained a heteroatom at the 2'-position of the sugar. Other sugar modifications usually led to diminished hybrid stability. Most backbone modifications that led to improved hybridization restricted backbone mobility and resulted in an A-type sugar pucker for the residue 5'to the modified internucleotide linkage. Among the heterocycles, C-5-substituted pyrimidines stood out as substantially increasing duplex stability. PMID:9358149

  10. Gold Binding by Native and Chemically Modified Hops Biomasses

    DOE PAGES

    López, M. Laura; Gardea-Torresdey, J. L.; Peralta-Videa, J. R.; ...

    2005-01-01

    Heavy metals from mining, smelting operations and other industrial processing facilities pollute wastewaters worldwide. Extraction of metals from industrial effluents has been widely studied due to the economic advantages and the relative ease of technical implementation. Consequently, the search for new and improved methodologies for the recovery of gold has increased. In this particular research, the use of cone hops biomass ( Humulus lupulus ) was investigated as a new option for gold recovery. The results showed that the gold binding to native hops biomass was pH dependent from pH 2 to pH 6, with a maximum percentage bindingmore » at pH 3. Time dependency studies demonstrated that Au(III) binding to native and modified cone hops biomasses was found to be time independent at pH 2 while at pH 5, it was time dependent. Capacity experiments demonstrated that at pH 2, esterified hops biomass bound 33.4 mg Au/g of biomass, while native and hydrolyzed hops biomasses bound 28.2 and 12.0 mg Au/g of biomass, respectively. However, at pH 5 the binding capacities were 38.9, 37.8 and 11.4 mg of Au per gram of native, esterified and hydrolyzed hops biomasses, respectively.« less

  11. CO2 adsorption on chemically modified activated carbon.

    PubMed

    Caglayan, Burcu Selen; Aksoylu, A Erhan

    2013-05-15

    CO2 adsorption capacity of a commercial activated carbon was improved by using HNO3 oxidation, air oxidation, alkali impregnation and heat treatment under helium gas atmosphere. The surface functional groups produced were investigated by diffuse reflectance infrared Fourier transform spectrometer (DRIFTS). CO2 adsorption capacities of the samples were determined by gravimetric analyses for 25-200°C temperature range. DRIFTS studies revealed the formation of carboxylic acid groups on the HNO3 oxidized adsorbents. Increased aromatization and uniform distribution of the Na particles were observed on the samples prepared by Na2CO3 impregnation onto HNO3 oxidized AC support. The adsorption capacities of the nonimpregnated samples were increased by high temperature helium treatments or by increasing the adsorption temperature; both leading to decomposition of surface oxygen groups, forming sites that can easily adsorb CO2. The adsorption capacity loss due to cyclic adsorption/desorption procedures was overcome with further surface stabilization of Na2CO3 modified samples with high temperature He treatments. With Na2CO3 impregnation the mass uptakes of the adsorbents at 20 bars and 25 °C were improved by 8 and 7 folds and at 1 bar were increased 15 and 16 folds, on the average, compared to their air oxidized and nitric acid oxidized supports, respectively.

  12. Artificial Specific Binders Directly Recovered from Chemically Modified Nucleic Acid Libraries

    PubMed Central

    Kasahara, Yuuya; Kuwahara, Masayasu

    2012-01-01

    Specific binders comprised of nucleic acids, that is, RNA/DNA aptamers, are attractive functional biopolymers owing to their potential broad application in medicine, food hygiene, environmental analysis, and biological research. Despite the large number of reports on selection of natural DNA/RNA aptamers, there are not many examples of direct screening of chemically modified nucleic acid aptamers. This is because of (i) the inferior efficiency and accuracy of polymerase reactions involving transcription/reverse-transcription of modified nucleotides compared with those of natural nucleotides, (ii) technical difficulties and additional time and effort required when using modified nucleic acid libraries, and (iii) ambiguous efficacies of chemical modifications in binding properties until recently; in contrast, the effects of chemical modifications on biostability are well studied using various nucleotide analogs. Although reports on the direct screening of a modified nucleic acid library remain in the minority, chemical modifications would be essential when further functional expansion of nucleic acid aptamers, in particular for medical and biological uses, is considered. This paper focuses on enzymatic production of chemically modified nucleic acids and their application to random screenings. In addition, recent advances and possible future research are also described. PMID:23094139

  13. Mechanical and chemical properties of cysteine-modified kinesin molecules.

    PubMed

    Iwatani, S; Iwane, A H; Higuchi, H; Ishii, Y; Yanagida, T

    1999-08-10

    To probe the structural changes within kinesin molecules, we made the mutants of motor domains of two-headed kinesin (4-411 aa) in which either all the five cysteines or all except Cys45 were mutated. A residual cysteine (Cys45) of the kinesin mutant was labeled with an environment-sensitive fluorescent probe, acrylodan. ATPase activity, mechanical properties, and fluorescence intensity of the mutants were measured. Upon acrylodan-labeled kinesin binding to microtubules in the presence of 1 mM AMPPNP, the peak intensity was enhanced by 3.4-fold, indicating the structural change of the kinesin head by the binding. Substitution of cysteines decreased both the maximum microtubule-activated ATPase and the sliding velocity to the same extent. However, the maximum force and the step size were not affected; the force produced by a single molecule was 6-6.5 pN, and a step size due to the hydrolysis of one ATP molecule by kinesin molecules was about 10 nm for all kinesins. This step size was close to a unitary step size of 8 nm. Thus, the mechanical events of kinesin are tightly coupled with the chemical events.

  14. Innate Immune and Chemically Triggered Oxidative Stress Modifies Translational Fidelity

    PubMed Central

    Netzer, Nir; Goodenbour, Jeffrey M.; David, Alexandre; Dittmar, Kimberly A.; Jones, Richard B.; Schneider, Jeffrey R.; Boone, David; Eves, Eva M.; Rosner, Marsha R.; Gibbs, James S.; Embry, Alan; Dolan, Brian; Das, Suman; Hickman, Heather; Berglund, Peter; Bennink, Jack R.; Yewdell, Jonathan W.; Pan, Tao

    2009-01-01

    Translational fidelity, essential for protein and cell function, requires accurate tRNA aminoacylation. Purified aminoacyl-tRNA synthetases exhibit a fidelity of 1 error per 10,000 to 100,000 couplings 1, 2. The accuracy of tRNA aminoacylation in vivo is uncertain, however, and might be considerably lower 3–6. Here, we show that in mammalian cells, approximately 1% of methionine (Met) residues used in protein synthesis are aminoacylated to non-methionyl-tRNAs. Remarkably, Met-misacylation increases up to 10-fold upon exposing cells to live or non-infectious viruses, toll-like receptor ligands, or chemically induced oxidative stress. Met is misacylated to specific non-methionyl-tRNA families, and these Met-misacylated tRNAs are used in translation. Met-misacylation is blocked by an inhibitor of cellular oxidases, implicating reactive oxygen species (ROS) as the misacylation trigger. Among six amino acids tested, tRNA misacylation occurs exclusively with Met. As Met residues are known to protect proteins against ROS-mediated damage 7, we propose that Met-misacylation functions adaptively to increase Met incorporation into proteins to protect cells against oxidative stress. In demonstrating an unexpected conditional aspect of decoding mRNA, our findings illustrate the importance of considering alternative iterations of the genetic code. PMID:19940929

  15. Visualizing and quantifying the nanoscale hydrophobicity and chemical distribution of surface modified polyethersulfone (PES) membranes.

    PubMed

    Fu, Wanyi; Carbrello, Christina; Wu, Xiaosong; Zhang, Wen

    2017-10-06

    Chemical modifications bring unique properties into polymeric membranes that may have enhanced filtration or separation efficiencies, antifouling, antimicrobial activity and selectivity. However, there is a lack of nanoscale characterization of the chemical additive distribution and the impacts of chemical modifiers or additives on membrane surface properties, especially those at the nanoscale. In this study, a series of industrially relevant polyethersulfone (PES) membranes modified with poly (ethylene glycol) (PEG) and polyvinylpyrrolidone (PVP) were analysed systematically. Particularly, hydrophobicity and chemical distribution were scrutinized by atomic force microscopy (AFM) and AFM coupled with infrared analysis capability (AFM-IR) for the first time that successfully resolved nanoscale structural and chemical properties of the chemically modified PES membranes. Our results indicated the heterogeneous spatial distribution of PVP and PEG based on their characteristic IR bands and the resulting hydrophobicity distribution on modified membrane surfaces at the nanoscale. Particularly, we established a linear correlation (R(2) = 0.9449) between the measured adhesion force and water contact angles, which enabled the examination of local surface hydrophobicity. The PES membranes became more hydrophilic with the increasing blend of PVP and PEG. With AFM-IR, trace amounts (1-4%) of PVP could be identified sensitively on PES membranes based on their unique characteristic IR bands, which were not achieved by FTIR or IR mapping. Overall, these novel characterization approaches hold paramount importance for the design and quality control of polymer membrane modification and manufacturing.

  16. A facile method for the construction of oligonucleotide microarrays.

    PubMed

    Sethi, Dalip; Kumar, A; Gupta, K C; Kumar, P

    2008-11-19

    In recent years, the oligonucleotide-based microarray technique has emerged as a powerful and promising tool for various molecular biological studies. Here, a facile protocol for the construction of an oligonucleotide microarray is demonstrated that involves immobilization of oligonucleotide-trimethoxysilyl conjugates onto virgin glass microslides. The projected immobilization strategy reflects high immobilization efficiency ( approximately 36-40%) and signal-to-noise ratio ( approximately 98), and hybridization efficiency ( approximately 32-35%). Using the proposed protocol, aminoalkyl, mercaptoalkyl, and phosphorylated oligonucleotides were immobilized onto virgin glass microslides. Briefly, modified oligonucleotides were reacted first with 3-glycidyloxypropyltriethoxysilane (GOPTS), and subsequently, the resultant conjugates were directly immobilized onto the virgin glass surface by making use of silanization chemistry. The constructed microarrays were then used for discrimination of base mismatches. On subjecting to different pH and thermal conditions, the microarray showed sufficient stability. Application of this chemistry to manufacture oligonucleotide probe-based microarrays for detection of bacterial meningitis is demonstrated. Single-step reaction for the formation of conjugates with the commercially available reagent (GOPTS), omission of capping step and surface modification, and efficient immobilization of oligonucleotides onto the virgin glass surface are the key features of the proposed strategy.

  17. Regulation of Gene Expression with Double-Stranded Phosphorothioate Oligonucleotides

    NASA Astrophysics Data System (ADS)

    Bielinska, Anna; Shivdasani, Ramesh A.; Zhang, Liquan; Nabel, Gary J.

    1990-11-01

    Alteration of gene transcription by inhibition of specific transcriptional regulatory proteins is necessary for determining how these factors participate in cellular differentiation. The functions of these proteins can be antagonized by several methods, each with specific limitations. Inhibition of sequence-specific DNA-binding proteins was achieved with double-stranded (ds) phosphorothioate oligonucleotides that contained octamer or kappaB consensus sequences. The phosphorothioate oligonucleotides specifically bound either octamer transcription factor or nuclear factor (NF)-kappaB. The modified oligonucleotides accumulated in cells more effectively than standard ds oligonucleotides and modulated gene expression in a specific manner. Octamer-dependent activation of a reporter plasmid or NF-kappaB-dependent activation of the human immunodeficiency virus (HIV) enhancer was inhibited when the appropriate phosphorothioate oligonucleotide was added to a transiently transfected B cell line. Addition of phosphorothioate oligonucleotides that contained the octamer consensus to Jurkat T leukemia cells inhibited interleukin-2 (IL-2) secretion to a degree similar to that observed with a mutated octamer site in the IL-2 enhancer. The ds phosphorothioate oligonucleotides probably compete for binding of specific transcription factors and may provide anti-viral, immunosuppressive, or other therapeutic effects.

  18. Design and analysis of mismatch probes for long oligonucleotide microarrays

    SciTech Connect

    Deng, Ye; He, Zhili; Van Nostrand, Joy D.; Zhou, Jizhong

    2008-08-15

    Nonspecific hybridization is currently a major concern with microarray technology. One of most effective approaches to estimating nonspecific hybridizations in oligonucleotide microarrays is the utilization of mismatch probes; however, this approach has not been used for longer oligonucleotide probes. Here, an oligonucleotide microarray was constructed to evaluate and optimize parameters for 50-mer mismatch probe design. A perfect match (PM) and 28 mismatch (MM) probes were designed for each of ten target genes selected from three microorganisms. The microarrays were hybridized with synthesized complementary oligonucleotide targets at different temperatures (e.g., 42, 45 and 50 C). In general, the probes with evenly distributed mismatches were more distinguishable than those with randomly distributed mismatches. MM probes with 3, 4 and 5 mismatched nucleotides were differentiated for 50-mer oligonucleotide probes hybridized at 50, 45 and 42 C, respectively. Based on the experimental data generated from this study, a modified positional dependent nearest neighbor (MPDNN) model was constructed to adjust the thermodynamic parameters of matched and mismatched dimer nucleotides in the microarray environment. The MM probes with four flexible positional mismatches were designed using the newly established MPDNN model and the experimental results demonstrated that the redesigned MM probes could yield more consistent hybridizations. Conclusions: This study provides guidance on the design of MM probes for long oligonucleotides (e.g., 50 mers). The novel MPDNN model has improved the consistency for long MM probes, and this modeling method can potentially be used for the prediction of oligonucleotide microarray hybridizations.

  19. Correlation between dynamic wetting behavior and chemical components of thermally modified wood

    NASA Astrophysics Data System (ADS)

    Wang, Wang; Zhu, Yuan; Cao, Jinzhen; Sun, Wenjing

    2015-01-01

    In order to investigate the dynamic wetting behavior of thermally modified wood, Cathay poplar (Populus cathayana Rehd.) and Scots pine (Pinus sylvestris L.) samples were thermally modified in an oven at 160, 180, 200, 220 or 240 °C for 4 h in this study. The dynamic contact angles and droplet volumes of water droplets on modified and unmodified wood surfaces were measured by sessile drop method, and their changing rates (expression index: K value and wetting slope) calculated by wetting models were illustrated for mapping the dynamic wetting process. The surface chemical components were also measured by X-ray photoelectron spectroscopy analysis (XPS), thus the relationship between dynamic wetting behavior and chemical components of thermally modified wood were determined. The results indicated that thermal modification was capable of decreasing the dynamic wettability of wood, expressed in lowing spread and penetration speed of water droplets on wood surfaces. This change was more obvious with the increased heating temperature. The K values varied linearly with the chemical components parameter (mass loss, O/C ratio, and C1/C2 ratio), indicating a strong correlation between dynamic wetting behavior and chemical components of thermally modified wood.

  20. Sequence-dependent theory of oligonucleotide hybridization kinetics

    SciTech Connect

    Marimuthu, Karthikeyan; Chakrabarti, Raj E-mail: rajc@andrew.cmu.edu

    2014-05-07

    A theoretical approach to the prediction of the sequence and temperature-dependent rate constants for oligonucleotide hybridization reactions has been developed based on the theory of relaxation kinetics. One-sided and two-sided melting reaction mechanisms for oligonucleotide hybridization reactions have been considered, analyzed, modified, and compared to select a physically consistent as well as robust model for prediction of the relaxation times of DNA hybridization reactions that agrees with the experimental evidence. The temperature- and sequence-dependent parameters of the proposed model have been estimated using available experimental data. The relaxation time model that we developed has been combined with the nearest neighbor model of hybridization thermodynamics to estimate the temperature- and sequence-dependent rate constants of an oligonucleotide hybridization reaction. The model-predicted rate constants are compared to experimentally determined rate constants for the same oligonucleotide hybridization reactions. Finally, we consider a few important applications of kinetically controlled DNA hybridization reactions.

  1. Tritium labeling of antisense oligonucleotides by exchange with tritiated water.

    PubMed Central

    Graham, M J; Freier, S M; Crooke, R M; Ecker, D J; Maslova, R N; Lesnik, E A

    1993-01-01

    We describe a simple, efficient, procedure for labeling oligonucleotides to high specific activity (< 1 x 10(8) cpm/mumol) by hydrogen exchange with tritiated water at the C8 positions of purines in the presence of beta-mercaptoethanol, an effective radical scavenger. Approximately 90% of the starting material is recovered as intact, labeled oligonucleotide. The radiolabeled compounds are stable in biological systems; greater than 90% of the specific activity is retained after 72 hr incubation at 37 degrees C in serum-containing media. Data obtained from in vitro cellular uptake experiments using oligonucleotides labeled by this method are similar to those obtained using 35S or 14C-labeled compounds. Because this protocol is solely dependent upon the existence of purine residues, it should be useful for radiolabeling modified as well as unmodified phosphodiester oligonucleotides. Images PMID:8367289

  2. Antisense oligonucleotides in therapy for neurodegenerative disorders.

    PubMed

    Evers, Melvin M; Toonen, Lodewijk J A; van Roon-Mom, Willeke M C

    2015-06-29

    Antisense oligonucleotides are synthetic single stranded strings of nucleic acids that bind to RNA and thereby alter or reduce expression of the target RNA. They can not only reduce expression of mutant proteins by breakdown of the targeted transcript, but also restore protein expression or modify proteins through interference with pre-mRNA splicing. There has been a recent revival of interest in the use of antisense oligonucleotides to treat several neurodegenerative disorders using different approaches to prevent disease onset or halt disease progression and the first clinical trials for spinal muscular atrophy and amyotrophic lateral sclerosis showing promising results. For these trials, intrathecal delivery is being used but direct infusion into the brain ventricles and several methods of passing the blood brain barrier after peripheral administration are also under investigation.

  3. Evaluating Zeolite-Modified Sensors: towards a faster set of chemical sensors

    NASA Astrophysics Data System (ADS)

    Berna, A. Z.; Vergara, A.; Trincavelli, M.; Huerta, R.; Afonja, A.; Parkin, I. P.; Binions, R.; Trowell, S.

    2011-09-01

    The responses of zeolite-modified sensors, prepared by screen printing layers of chromium titanium oxide (CTO), were compared to unmodified tin oxide sensors using amplitude and transient responses. For transient responses we used a family of features, derived from the exponential moving average (EMA), to characterize chemo-resistive responses. All sensors were tested simultaneously against 20 individual volatile compounds from four chemical groups. The responses of the two types of sensors showed some independence. The zeolite-modified CTO sensors discriminated compounds better using either amplitude response or EMA features and CTO-modified sensors also responded three times faster.

  4. Insights into the electrocatalysis of nitrobenzene using chemically-modified carbon nanotube electrodes

    PubMed Central

    Sang, Yutao; Wang, Baoyan; Wang, Qinchao; Zhao, George; Guo, Peizhi

    2014-01-01

    The electrochemical behavior of nitrobenzene and its derivatives at chemically-functionalized multi-wall carbon nanotubes (MWNTs) modified electrodes was studied. Experimental results showed that hydroxyl-containing MWNTs exhibited the highest electrocatalytic activity among the used MWNTs because of its weak capacitive features and oxygen-containing functional groups. The cycle voltammetrys of nitrobenzene derivatives on the MWNTs modified electrodes can be easily tuned by changing the substituted groups of nitrobenzene. Based on the experimental data, the electrochemical reaction mechanisms of nitrobenzene and its derivatives on the MWNTs modified electrodes have been discussed and analyzed. PMID:25204889

  5. Chemical treatment of the intra-canal dentin surface: a new approach to modify dentin hydrophobicity

    PubMed Central

    GAITAN-FONSECA, Cesar; COLLART-DUTILLEUL, Pierre-Yves; SEMETEY, Vincent; ROMIEU, Olivier; CRUZ, Roel; FLORES, Hector; CUISINIER, Frédéric; PÉREZ, Elías; POZOS-GUILLEN, Amaury

    2013-01-01

    Objective: This study evaluated the hydrophobicity of dentin surfaces that were modified through chemical silanization with octadecyltrichlorosilane (OTS). Material and Methods: An in vitro experimental study was performed using 40 human permanent incisors that were divided into the following two groups: non-silanized and silanized. The specimens were pretreated and chemically modified with OTS. After the chemical modification, the dentin hydrophobicity was examined using a water contact angle measurement (WCA). The effectiveness of the modification of hydrophobicity was verified by the fluid permeability test (FPT). Results and Conclusions: Statistically significant differences were found in the values of WCA and FPT between the two groups. After silanization, the hydrophobic intraradicular dentin surface exhibited in vitro properties that limit fluid penetration into the sealed root canal. This chemical treatment is a new approach for improving the sealing of the root canal system. PMID:23559114

  6. Expanding the chemical toolbox for the synthesis of large and uniquely modified proteins

    NASA Astrophysics Data System (ADS)

    Bondalapati, Somasekhar; Jbara, Muhammad; Brik, Ashraf

    2016-05-01

    Methods to prepare proteins that include a specific modification at a desired position are essential for understanding their cellular functions and physical properties in living systems. Chemical protein synthesis, which relies on the chemoselective ligation of unprotected peptides, enables the preparation of modified proteins that are not easily fabricated by other methods. In contrast to recombinant approaches, chemical synthesis can be used to prepare protein analogues such as D-proteins, which are useful in protein structure determination and the discovery of novel therapeutics. Post-translationally modifying proteins is another example where chemical protein synthesis proved itself as a powerful approach for preparing samples with high homogeneity and in workable quantities. In this Review, we discuss the basic principles of the field, focusing on novel chemoselective peptide ligation approaches such as native chemical ligation and the recent advances based on this method with a proven record of success in the synthesis of highly important protein targets.

  7. Modified clay minerals efficiency against chemical and biological warfare agents for civil human protection.

    PubMed

    Plachá, Daniela; Rosenbergová, Kateřina; Slabotínský, Jiří; Kutláková, Kateřina Mamulová; Studentová, Soňa; Martynková, Gražyna Simha

    2014-04-30

    Sorption efficiencies of modified montmorillonite and vermiculite of their mono ionic Na and organic HDTMA and HDP forms were studied against chemical and biological warfare agents such as yperite and selected bacterial strains. Yperite interactions with modified clay minerals were observed through its capture in low-density polyethylene foil-modified clay composites by measuring yperite gas permeation with using chemical indication and gas chromatography methods. The antibacterial activities of synthetized organoclays were tested against selected Gram-positive and Gram-negative bacterial species in minimum inhibitory concentration tests. The obtained results showed a positive influence of modified clay minerals on the significant yperite breakthrough-time increase. The most effective material was the polyethylene-Na form montmorillonite, while the polyethylene-Na form vermiculite showed the lowest efficiency. With increasing organic cations loading in the interlayer space the montmorillonite efficiency decreased, and in the case of vermiculite an opposite effect was observed. Generally the modified montmorillonites were more effective than modified vermiculites. The HDP cations seem to be more effective compare to the HDTMA. The antibacterial activity tests confirmed efficiency of all organically modified clay minerals against Gram-positive bacteria. The confirmation of antibacterial activity against Y. pestis, plague bacteria, is the most interesting result of this part of the study.

  8. Treatment of spentwash using chemically modified bagasse and colour removal studies.

    PubMed

    Mane, Jyoti D; Modi, Shweta; Nagawade, Swati; Phadnis, S P; Bhandari, V M

    2006-09-01

    Studies were carried out on derivatisation of bagasse into an ion exchange material and application of this chemically modified bagasse in the treatment of distillery wastewater. It was found that CHPTAC bagasse with HCl treatment and DEAE-bagasse in its free base form were most effective in colour removal and the mechanism of colour removal indicated significant contribution of both, the conventional ion exchange and the chemical sorption.

  9. Biotin-labeled synthetic oligodeoxyribonucleotides: chemical synthesis and uses as hybridization probes.

    PubMed Central

    Chollet, A; Kawashima, E H

    1985-01-01

    Oligodeoxynucleotides have been selectively labeled with biotin at their 5'-termini through an aminoalkylphosphoramide linker arm by an efficient chemical method. The reactions were performed in aqueous solution on unprotected oligonucleotides and were insensitive of the sequence and length of the oligonucleotide. 5'-biotin-labeled oligonucleotides were hybridized to dot, Southern and genomic blots of target plasmid DNA immobilized on nitrocellulose filters. Detection level is about 2 fmole. There is no noticeable disturbance of the strength and selectivity of hybridization of the 5'-biotin-labeled probes in comparison with non-modified DNA. Images PMID:4000941

  10. The "Clickable" Method for Oligonucleotide Immobilization Onto Azide-Functionalized Microarrays.

    PubMed

    Ratajczak, Tomasz; Uszczyńska, Barbara; Frydrych-Tomczak, Emilia; Chmielewski, Marcin K

    2016-01-01

    The DNA microarray technique was supposed to help identifying and analyzing the expression level of tens of thousands of genes in the whole genome. But there is a serious problem concerning fabrication of the microarrays by chemical synthesis, such as specific and efficient linking of probes to a solid support. Therefore, we reckon that applying "click" chemistry to covalently anchor oligonucleotides on chemically modified supports may help construct microarrays in applications such as gene identification. Silanization of the glass support with organofunctional silane makes it possible to link azide groups on glass surface and the nucleic acid probe that is equipped with a pentynyl group. This is followed by direct spotting of the nucleic acid on the azide-modified glass support in the presence of copper ions, and this is a frequently applied method of "click" chemistry.

  11. Chemical and Biological Tools for the Preparation of Modified Histone Proteins

    PubMed Central

    Howard, Cecil J.; Yu, Ruixuan R.; Gardner, Miranda L.; Shimko, John C.; Ottesen, Jennifer J.

    2016-01-01

    Eukaryotic chromatin is a complex and dynamic system in which the DNA double helix is organized and protected by interactions with histone proteins. This system is regulated through, a large network of dynamic post-translational modifications (PTMs) exists to ensure proper gene transcription, DNA repair, and other processes involving DNA. Homogenous protein samples with precisely characterized modification sites are necessary to better understand the functions of modified histone proteins. Here, we discuss sets of chemical and biological tools that have been developed for the preparation of modified histones, with a focus on the appropriate choice of tool for a given target. We start with genetic approaches for the creation of modified histones, including the incorporation of genetic mimics of histone modifications, chemical installation of modification analogs, and the use of the expanded genetic code to incorporate modified amino acids. Additionally, we will cover the chemical ligation techniques that have been invaluable in the generation of complex modified histones that are indistinguishable from the natural counterparts. Finally, we will end with a prospectus on future directions of synthetic chromatin in living systems. PMID:25863817

  12. Chemical and biological tools for the preparation of modified histone proteins.

    PubMed

    Howard, Cecil J; Yu, Ruixuan R; Gardner, Miranda L; Shimko, John C; Ottesen, Jennifer J

    2015-01-01

    Eukaryotic chromatin is a complex and dynamic system in which the DNA double helix is organized and protected by interactions with histone proteins. This system is regulated through a large network of dynamic post-translational modifications (PTMs) which ensure proper gene transcription, DNA repair, and other processes involving DNA. Homogenous protein samples with precisely characterized modification sites are necessary to understand better the functions of modified histone proteins. Here, we discuss sets of chemical and biological tools developed for the preparation of modified histones, with a focus on the appropriate choice of tool for a given target. We start with genetic approaches for the creation of modified histones, including the incorporation of genetic mimics of histone modifications, chemical installation of modification analogs, and the use of the expanded genetic code to incorporate modified amino acids. We also cover the chemical ligation techniques which have been invaluable in the generation of complex modified histones indistinguishable from their natural counterparts. We end with a prospectus on future directions.

  13. The role of chemical transport in the brown-rot decay resistance of modified wood

    Treesearch

    Samuel Zelinka; R. Ringman; A. Pilgard; E. E. Thybring; Joseph Jakes; K. Richter

    2016-01-01

    Chemical modification of wood increases decay resistance but the exact mechanisms remain poorly understood. Recently, Ringman and coauthors examined established theories addressing why modified wood has increased decay resistance and concluded that the most probable cause of inhibition and/or delay of initiation of brown-rot decay is lowering the equilibrium moisture...

  14. Reagents for the preparation of two oligonucleotides per synthesis (TOPS).

    PubMed Central

    Hardy, P M; Holland, D; Scott, S; Garman, A J; Newton, C R; McLean, M J

    1994-01-01

    In order to increase the efficiency of use of automated DNA synthesizers (i.e. the number of oligomers prepared per day), we have devised and prepared novel phosphoramidite reagents that contain a linking group which, while stable under the normal synthesis conditions, is cleaved under basic conditions. When one of these linkers is introduced at the desired position in the synthesis of an oligonucleotide, subsequent detritylation enables the synthesis of a second oligonucleotides sequence upon the first. During deprotection of the oligonucleotide with ammonium hydroxide, the chain is cleaved at either side of the points of introduction of the novel reagent, generating two oligonucleotides free in solution. These reagents are of particular use in applications where oligomers are used in pairs (such as PCR, chemical synthesis of genes etc.) and means that an automated synthesis facility can be used more efficiently, without the need for operator intervention, after the working day is over. Images PMID:8065912

  15. Comparative study of chemical modifiers for the determination of molybdenum in milk by electrothermal atomisation atomic absorption spectrometry.

    PubMed

    Bermejo-Barrera, P; Calvo, C P; Bermejo-Martinez, F

    1990-05-01

    A comparative study of various chemical modifiers for the determination of molybdenum in milk by electrothermal atomisation atomic absorption spectrometry was carried out. Methods with nitric acid or barium difluoride as the chemical modifier and in the absence of a chemical modifier were studied by introducing the milk samples directly into the graphite furnace with octyl alcohol. The graphite furnace programme, amount of modifier and the calibration and additions graphs were studied in all instances. The characteristic masses were 17.82, 18.64 and 12.08 pg of molybdenum in the absence of a chemical modifier and with nitric acid or barium difluoride as the chemical modifier, respectively. The precision, accuracy and interferences of the method were also investigated.

  16. Identification of sequence motifs in oligonucleotides whose presence is correlated with antisense activity.

    PubMed

    Matveeva, O V; Tsodikov, A D; Giddings, M; Freier, S M; Wyatt, J R; Spiridonov, A N; Shabalina, S A; Gesteland, R F; Atkins, J F

    2000-08-01

    Design of antisense oligonucleotides targeting any mRNA can be much more efficient when several activity-enhancing motifs are included and activity-decreasing motifs are avoided. This conclusion was made after statistical analysis of data collected from >1000 experiments with phosphorothioate-modified oligonucleotides. Highly significant positive correlation between the presence of motifs CCAC, TCCC, ACTC, GCCA and CTCT in the oligonucleotide and its antisense efficiency was demonstrated. In addition, negative correlation was revealed for the motifs GGGG, ACTG, AAA and TAA. It was found that the likelihood of activity of an oligonucleotide against a desired mRNA target is sequence motif content dependent.

  17. Identification of sequence motifs in oligonucleotides whose presence is correlated with antisense activity

    PubMed Central

    Matveeva, O. V.; Tsodikov, A. D.; Giddings, M.; Freier, S. M.; Wyatt, J. R.; Spiridonov, A. N.; Shabalina, S. A.; Gesteland, R. F.; Atkins, J. F.

    2000-01-01

    Design of antisense oligonucleotides targeting any mRNA can be much more efficient when several activity-enhancing motifs are included and activity-decreasing motifs are avoided. This conclusion was made after statistical analysis of data collected from >1000 experiments with phosphorothioate-modified oligonucleotides. Highly significant positive correlation between the presence of motifs CCAC, TCCC, ACTC, GCCA and CTCT in the oligonucleotide and its antisense efficiency was demonstrated. In addition, negative correlation was revealed for the motifs GGGG, ACTG, AAA and TAA. It was found that the likelihood of activity of an oligonucleotide against a desired mRNA target is sequence motif content dependent. PMID:10908347

  18. Inhibition of DNA Binding Proteins by Oligonucleotide-Directed Triple Helix Formation

    NASA Astrophysics Data System (ADS)

    Maher, Louis J.; Wold, Barbara; Dervan, Peter B.

    1989-08-01

    Oligonucleotides that bind to duplex DNA in a sequence-specific manner by triple helix formation offer an approach to the experimental manipulation of sequence-specific protein binding. Micromolar concentrations of pyrimidine oligodeoxyribonucleotides are shown to block recognition of double helical DNA by prokaryotic modifying enzymes and a eukaryotic transcription factor at a homopurine target site. Inhibition is sequence-specific. Oligonucleotides containing 5-methylcytosine provide substantially more efficient inhibition than oligonucleotides containing cytosine. The results have implications for gene-specific repression by oligonucleotides or their analogs.

  19. Diels-Alder cycloadditions in water for the straightforward preparation of peptide–oligonucleotide conjugates

    PubMed Central

    Marchán, Vicente; Ortega, Samuel; Pulido, Daniel; Pedroso, Enrique; Grandas, Anna

    2006-01-01

    The Diels-Alder reaction between diene-modified oligonucleotides and maleimide-derivatized peptides afforded peptide–oligonucleotide conjugates with high purity and yield. Synthesis of the reagents was easily accomplished by on-column derivatization of the corresponding peptides and oligonucleotides. The cycloaddition reaction was carried out in mild conditions, in aqueous solution at 37°C. The speed of the reaction was found to vary depending on the size of the reagents, but it can be completed in 8–10 h by reacting the diene-oligonucleotide with a small excess of maleimide-peptide. PMID:16478710

  20. Thermodynamic criteria for high hit rate antisense oligonucleotide design

    PubMed Central

    Matveeva, O. V.; Mathews, D. H.; Tsodikov, A. D.; Shabalina, S. A.; Gesteland, R. F.; Atkins, J. F.; Freier, S. M.

    2003-01-01

    Antisense oligonucleotides are used for therapeutic applications and in functional genomic studies. In practice, however, many of the oligonucleotides complementary to an mRNA have little or no antisense activity. Theoretical strategies to improve the ‘hit rate’ in antisense screens will reduce the cost of discovery and may lead to identification of antisense oligonucleotides with increased potency. Statistical analysis performed on data collected from more than 1000 experiments with phosphorothioate-modified oligonucleotides revealed that the oligo-probes, which form stable duplexes with RNA (ΔGo37 ≤ –30 kcal/mol) and have small self-interaction potential, are more frequently efficient than molecules that form less stable oligonucleotide–RNA hybrids or more stable self-structures. To achieve optimal statistical preference, the values for self-interaction should be (ΔGo37) ≥ –8 kcal/mol for inter-oligonucleotide pairing and (ΔGo37) ≥ –1.1 kcal/mol for intra-molecular pairing. Selection of oligonucleotides with these thermodynamic values in the analyzed experiments would have increased the ‘hit rate’ by as much as 6-fold. PMID:12930948

  1. The 5' binding MID domain of human Argonaute2 tolerates chemically modified nucleotide analogues.

    PubMed

    Deleavey, Glen F; Frank, Filipp; Hassler, Matthew; Wisnovsky, Simon; Nagar, Bhushan; Damha, Masad J

    2013-02-01

    Small interfering RNAs (siRNAs) can trigger potent gene silencing through the RNA interference (RNAi) pathway. The RNA-induced silencing complex (RISC) is key to this targeted mRNA degradation, and the human Argonaute2 (hAGO2) endonuclease component of RISC is responsible for the actual mRNA cleavage event. During RNAi, hAGO2 becomes loaded with the siRNA guide strand, making several key nucleic acid-enzyme interactions. Chemically modified siRNAs are now widely used in place of natural double-stranded RNAs, and understanding the effects chemical modifications have on guide strand-hAGO2 interactions has become particularly important. Here, interactions between the 5' nucleotide binding domain of hAGO2, MID, and chemically modified nucleotide analogues are investigated. Measured dissociation constants reveal that hAGO2 does not discriminate between nucleotide analogues during binding, regardless of the preferred sugar conformation of the nucleotide analogues. These results correlate well with cell-based gene silencing results employing siRNAs with 5'-modified guide strands. Additionally, chemical modification with 2'-deoxy-2'-fluoroarabino nucleic acid (2'F-ANA) and 2'-deoxy-2'-fluororibonucleic acid (2'F-RNA) at the passenger strand cleavage site of siRNAs has been shown to prevent hAGO2-mediated strand cleavage, an observation that appears to have little impact on overall gene silencing potency.

  2. Process for preparing chemically modified micas for removal of cesium salts from aqueous solution

    DOEpatents

    Yates, Stephen Frederic; DeFilippi, Irene; Gaita, Romulus; Clearfield, Abraham; Bortun, Lyudmila; Bortun, Anatoly

    2000-09-05

    A chemically modified mica composite formed by heating a trioctahedral mica in an aqueous solution of sodium chloride having a concentration of at least 1 mole/liter at a temperature greater than 180 degrees Centigrade for at least 20 hours, thereby replacing exchangeable ions in the mica with sodium. Formation is accomplished at temperatures and pressures which are easily accessed by industrial equipment. The reagent employed is inexpensive and non-hazardous, and generates a precipitate which is readily separated from the modified mica.

  3. DNA damage response pathway and replication fork stress during oligonucleotide directed gene editing.

    PubMed

    Bonner, Melissa; Strouse, Bryan; Applegate, Mindy; Livingston, Paula; Kmiec, Eric B

    2012-04-03

    Single-stranded DNA oligonucleotides (ODNs) can be used to direct the exchange of nucleotides in the genome of mammalian cells in a process known as gene editing. Once refined, gene editing should become a viable option for gene therapy and molecular medicine. Gene editing is regulated by a number of DNA recombination and repair pathways whose natural activities often lead to single- and double-stranded DNA breaks. It has been previously shown that introduction of a phosphorotioated ODN, designed to direct a gene-editing event, into cells results in the activation of γH2AX, a well-recognized protein biomarker for double-stranded DNA breakage. Using a single copy, integrated mutant enhanced green fluorescent protein (eGFP) gene as our target, we now demonstrate that several types of ODNs, capable of directing gene editing, also activate the DNA damage response and the post-translational modification of proliferating cell nuclear antigen (PCNA), a signature modification of replication stress. We find that the gene editing reaction itself leads to transient DNA breakage, perhaps through replication fork collapse. Unmodified specific ODNs elicit a lesser degree of replication stress than their chemically modified counterparts, but are also less active in gene editing. Modified phosphothioate oligonucleotides (PTOs) are detrimental irrespective of the DNA sequence. Such collateral damage may prove problematic for proliferation of human cells genetically modified by gene editing.

  4. Near-infrared silver cluster optically signaling oligonucleotide hybridization and assembling two DNA hosts.

    PubMed

    Petty, Jeffrey T; Nicholson, David A; Sergev, Orlin O; Graham, Stuart K

    2014-09-16

    Silver clusters with ~10 atoms form within DNA strands, and the conjugates are chemical sensors. The DNA host hybridizes with short oligonucleotides, and the cluster moieties optically respond to these analytes. Our studies focus on how the cluster adducts perturb the structure of their DNA hosts. Our sensor is comprised of an oligonucleotide with two components: a 5'-cluster domain that complexes silver clusters and a 3'-recognition site that hybridizes with a target oligonucleotide. The single-stranded sensor encapsulates an ~11 silver atom cluster with violet absorption at 400 nm and with minimal emission. The recognition site hybridizes with complementary oligonucleotides, and the violet cluster converts to an emissive near-infrared cluster with absorption at 730 nm. Our key finding is that the near-infrared cluster coordinates two of its hybridized hosts. The resulting tertiary structure was investigated using intermolecular and intramolecular variants of the same dimer. The intermolecular dimer assembles in concentrated (~5 μM) DNA solutions. Strand stoichiometries and orientations were chromatographically determined using thymine-modified complements that increase the overall conjugate size. The intramolecular dimer develops within a DNA scaffold that is founded on three linked duplexes. The high local cluster concentrations and relative strand arrangements again favor the antiparallel dimer for the near-infrared cluster. When the two monomeric DNA/violet cluster conjugates transform to one dimeric DNA/near-infrared conjugate, the DNA strands accumulate silver. We propose that these correlated changes in DNA structure and silver stoichiometry underlie the violet to near-infrared cluster transformation.

  5. Modified Nucleoside Triphosphates for In-vitro Selection Techniques.

    PubMed

    Dellafiore, María A; Montserrat, Javier M; Iribarren, Adolfo M

    2016-01-01

    The development of SELEX (Selective Enhancement of Ligands by Exponential Enrichment) provides a powerful tool for the search of functional oligonucleotides with the ability to bind ligands with high affinity and selectivity (aptamers) and for the discovery of nucleic acid sequences with diverse enzymatic activities (ribozymes and DNAzymes). This technique has been extensively applied to the selection of natural DNA or RNA molecules but, in order to improve chemical and structural diversity as well as for particular applications where further chemical or biological stability is necessary, the extension of this strategy to modified oligonucleotides is desirable. Taking into account these needs, this review intends to collect the research carried out during the past years, focusing mainly on the use of modified nucleotides in SELEX and the development of mutant enzymes for broadening nucleoside triphosphates acceptance. In addition, comments regarding the synthesis of modified nucleoside triphosphate will be briefly discussed.

  6. Modified Nucleoside Triphosphates for in-vitro Selection Techniques

    NASA Astrophysics Data System (ADS)

    Iribarren, Adolfo; Dellafiore, María; Montserrat, Javier

    2016-05-01

    The development of SELEX (Selective Enhancement of Ligands by Exponential Enrichment) provides a powerful tool for the search of functional oligonucleotides with the ability to bind ligands with high affinity and selectivity (aptamers) and for the discovery of nucleic acid sequences with diverse enzymatic activities (ribozymes and DNAzymes). This technique has been extensively applied to the selection of natural DNA or RNA molecules but, in order to improve chemical and structural diversity as well as for particular applications where further chemical or biological stability is necessary, the extension of this strategy to modified oligonucleotides is desirable. Taking into account these needs, this review intends to collect the research carried out during the past years, focusing mainly on the use of modified nucleotides in SELEX and the development of mutant enzymes for broadening nucleoside triphosphates acceptance. In addition, comments regarding the synthesis of modified nucleoside triphosphate will be briefly discussed.

  7. Modified Nucleoside Triphosphates for In-vitro Selection Techniques

    PubMed Central

    Dellafiore, María A.; Montserrat, Javier M.; Iribarren, Adolfo M.

    2016-01-01

    The development of SELEX (Selective Enhancement of Ligands by Exponential Enrichment) provides a powerful tool for the search of functional oligonucleotides with the ability to bind ligands with high affinity and selectivity (aptamers) and for the discovery of nucleic acid sequences with diverse enzymatic activities (ribozymes and DNAzymes). This technique has been extensively applied to the selection of natural DNA or RNA molecules but, in order to improve chemical and structural diversity as well as for particular applications where further chemical or biological stability is necessary, the extension of this strategy to modified oligonucleotides is desirable. Taking into account these needs, this review intends to collect the research carried out during the past years, focusing mainly on the use of modified nucleotides in SELEX and the development of mutant enzymes for broadening nucleoside triphosphates acceptance. In addition, comments regarding the synthesis of modified nucleoside triphosphate will be briefly discussed. PMID:27200340

  8. Enhanced implant stability with a chemically modified SLA surface: a randomized pilot study.

    PubMed

    Oates, Thomas W; Valderrama, Pilar; Bischof, Mark; Nedir, Rabah; Jones, Archie; Simpson, James; Toutenburg, Helge; Cochran, David L

    2007-01-01

    Chemical modification to a sandblasted, large-grit, acid-etched (SLA) implant surface has been shown to enhance the rate of osseointegration. The goal of the present study was to examine changes in stability for implants with a chemically modified SLA surface and to compare their outcomes to those of control implants. A randomized controlled trial was conducted with 31 patients. Each patient received 2 implants with the same physical properties but with surfaces that were chemically different. The control implants had a standard SLA surface, while the test implants had a chemically modified surface. Resonance frequency analysis was assessed weekly over the first 6 weeks following implant placement. All implants proved clinically successful, allowing for restoration. Most implants were placed in the mandible (50 of 62). A shift in implant stability from decreasing stability to increasing stability (P < .001), occurred after 2 weeks for the test implants and after 4 weeks for the control implants. The findings from this pilot study provide clinical support for the potential for chemical modification of the SLA surface to alter biologic events during the osseointegration process and demonstrate levels of short-term clinical success similar to those observed for implants with an SLA surface.

  9. Radiation-grafted, chemically modified membranes part I - Synthesis of a selective aluminum material

    NASA Astrophysics Data System (ADS)

    Bazante-Yamaguishi, Renata; Moura, Eduardo; Manzoli, José E.; Geraldo, Aurea B. C.

    2014-01-01

    Polymeric membranes were styrene grafted by irradiation methods and the obtained material was chemically modified to become aluminum selective. For this purpose, polymeric substrates of PVC (polyvinyl chloride) and PP (polypropylene) were styrene grafted mutually by gamma and electron beam irradiation. The modification process includes three basic reaction paths: Friedel-Crafts acylation, 2-methylanisole coupling and a final oxidation to achieve aluminum selectivity. Although this specific chemical modification in derivatives of polystyrene is not new, the new challenge is to obtain a selective material where original membrane characteristics (physical shape and mechanical resistance) are minimally conserved after such an aggressive treatment.

  10. Modern tools for the chemical ligation and synthesis of modified peptides and proteins.

    PubMed

    Gentilucci, Luca; Tosi, Pierluigi; Bauer, Adriano; Marco, Rossella De

    2016-12-01

    The ability to improve nature's capacity by introducing modification of biological interest in proteins and peptides (P&P) is one of the modern challenges in synthetic chemistry. Due to the unfavorable pharmacokinetic properties, many native P&P are of little use as therapeutic agents. Today, few methods for the preparation of modified proteins are available. Initially introduced to realize the ligation between two standard peptidic sequences, and hence to afford native proteins, the modern chemical methodologies, in other words native chemical ligation, expressed ligation, Staudinger ligation, auxiliary mediated ligation, aldehyde capture, etc., can be virtually utilized to ligate a variety of peptidomimetic partners, allowing a systematic access to modified, unnatural large P&P.

  11. Research on the chemical mechanism in the polyacrylate latex modified cement system

    SciTech Connect

    Wang, Min; Wang, Rumin; Zheng, Shuirong; Farhan, Shameel; Yao, Hao; Jiang, Hao

    2015-10-15

    In this paper, the chemical mechanism in the polyacrylate latex modified cement system was investigated by Fourier transform infrared spectra (FT-IR), X-ray photoelectron spectroscopy (XPS), gel permeation chromatography (GPC) and compact pH meter. All results have shown that the chemical reactions in the polyacrylate modified system can be divided into three stages. The hydration reactions of cement can produce large amounts of Ca(OH){sub 2} (calcium hydroxide) and lead the whole system to be alkali-rich and exothermic at the first stage. Subsequently, this environment can do great contributions to the hydrolysis of ester groups in the polyacrylate chains, resulting in the formation of carboxyl groups at the second stage. At the third stage, the final crosslinked network structure of the product was obtained by the reaction between the carboxyl groups in the polyacrylate latex chains and Ca(OH){sub 2}.

  12. Modified lignosulfonates as additives in oil recovery processes involving chemical recovery agents

    SciTech Connect

    Kalfoglou, G.

    1982-08-17

    A process for producing petroleum from subterranean formations is disclosed wherein production from the formation is obtained by driving a fluid from an injection well to a production well. The process involves injecting via the injection well into the formation an aqueous solution of modified lignosulfonate salt as a sacrificial agent to inhibit the deposition of surfactant and/or polymer on the reservoir matrix. The process may best be carried out by injecting the modified lignosulfonates into the formation through the injection well mixed with either a polymer, a surfactant solution and/or a micellar dispersion. This mixture would then be followed by a drive fluid such as water to push the chemicals to the production well. The lignosulfonates may be modified by any combination of any two or more of: reaction with chloroacetic acid, reaction with carbon dioxide, addition of the methylene sulfonate radical to the lignosulfonate molecule and oxidation with oxygen.

  13. Chemically Modified Electrodes. Part XX. Radiofrequency Plasma Polymerization of Vinylferrocene on Glassy Carbon and Platinum Electrodes.

    DTIC Science & Technology

    1980-01-29

    1978) 3222. 3 N. Oyama and F. C. Anson , J. Amer. Chem. Soc., 101 (1979) 739. 4 Symposium on Chemically Modified Electrodes, Extended Abstracts of...T. Hirotsu, J. Polym. Sci., Polym. Chem. Ed., 16 (1978) 229. 24 N. Oyama, A. P. Brown and F. C. Anson , J. Electroanal. Chem., 87 (1978) 435. 25 H...91232 Dr. Fred Saalfeld Mr. John Boyle Chemistry Division Materials Branch Naval Research Laboratory Naval Ship Engineering Center Washington, D.C

  14. Radiolabeled oligonucleotides for antisense imaging

    PubMed Central

    Iyer, Arun K; He, Jiang

    2011-01-01

    Oligonucleotides radiolabeled with isotopes emitting γ-rays (for SPECT imaging) or positrons (for PET imaging) can be useful for targeting messenger RNA (mRNA) thereby serving as non-invasive imaging tools for detection of gene expression in vivo (antisense imaging). Radiolabeled oligonucleotides may also be used for monitoring their in vivo fate, thereby helping us better understand the barriers to its delivery for antisense targeting. These developments have led to a new area of molecular imaging and targeting, utilizing radiolabeled antisense oligonucleotides. However, the success of antisense imaging relies heavily on overcoming the barriers for its targeted delivery in vivo. Furthermore, the low ability of the radiolabeled antisense oligonucleotide to subsequently internalize into the cell and hybridize with its target mRNA poses additional challenges in realizing its potentials. This review covers the advances in the antisense imaging probe development for PET and SPECT, with an emphasis on radiolabeling strategies, stability, delivery and in vivo targeting. PMID:21822406

  15. Annexin A2 facilitates endocytic trafficking of antisense oligonucleotides

    PubMed Central

    Wang, Shiyu; Sun, Hong; Tanowitz, Michael; Liang, Xue-hai; Crooke, Stanley T.

    2016-01-01

    Chemically modified antisense oligonucleotides (ASOs) designed to mediate site-specific cleavage of RNA by RNase H1 are used as research tools and as therapeutics. ASOs modified with phosphorothioate (PS) linkages enter cells via endocytotic pathways. The mechanisms by which PS-ASOs are released from membrane-enclosed endocytotic organelles to reach target RNAs remain largely unknown. We recently found that annexin A2 (ANXA2) co-localizes with PS-ASOs in late endosomes (LEs) and enhances ASO activity. Here, we show that co-localization of ANXA2 with PS-ASO is not dependent on their direct interactions or mediated by ANXA2 partner protein S100A10. Instead, ANXA2 accompanies the transport of PS-ASOs to LEs, as ANXA2/PS-ASO co-localization was observed inside LEs. Although ANXA2 appears not to affect levels of PS-ASO internalization, ANXA2 reduction caused significant accumulation of ASOs in early endosomes (EEs) and reduced localization in LEs and decreased PS-ASO activity. Importantly, the kinetics of PS-ASO activity upon free uptake show that target mRNA reduction occurs at least 4 hrs after PS-ASOs exit from EEs and is coincident with release from LEs. Taken together, our results indicate that ANXA2 facilitates PS-ASO trafficking from early to late endosomes where it may also contribute to PS-ASO release. PMID:27378781

  16. Polyamine-oligonucleotide conjugates: a promising direction for nucleic acid tools and therapeutics.

    PubMed

    Menzi, Mirjam; Lightfoot, Helen L; Hall, Jonathan

    2015-01-01

    Chemical modification and/or the conjugation of small functional molecules to oligonucleotides have significantly improved their biological and biophysical properties, addressing issues such as poor cell penetration, stability to nucleases and low affinity for their targets. Here, the authors review the literature reporting on the biophysical, biochemical and biological properties of one particular class of modification - polyamine-oligonucleotide conjugates. Naturally derived and synthetic polyamines have been grafted onto a variety of oligonucleotide formats, including antisense oligonucleotides and siRNAs. In many cases this has had beneficial effects on their properties such as target hybridization, nuclease resistance, cellular uptake and activity. Polyamine-oligonucleotide conjugation, therefore, represents a promising direction for the further development of oligonucleotide-based therapeutics and tools.

  17. Remediation of Hydrocarbon-Contaminated Soil by Washing with Novel Chemically Modified Humic Substances.

    PubMed

    García-Díaz, César; Nebbioso, Antonio; Piccolo, Alessandro; Barrera-Cortés, Josefina; Martínez-Palou, Rafael

    2015-11-01

    In this work, humic (HA) and fulvic acid (FA) were chemically modified by esterification and etherification with alkanes under microwave (MW) irradiation to improve their surfactant properties for the remediation of total petroleum hydrocarbons (TPHs)-contaminated soil. Humic acid and FA were evaluated as surfactant for the remediation of soil by means of washing an aged highly TPH-contaminated soil (50,000 mg TPH kg) sampled from a Mexican petrochemical area. The efficiency of chemical modification of HA and FA was increased and accelerated under MW irradiation with respect to that of conventional heating. Results showed that modified HA and FA were able to considerably reduce the contamination of TPH-polluted soils. The best results were obtained with HA modified by esterification with -dodecanol and FA modified with -decanol, which increased the hydrocarbon removal by 24 and 18%, respectively, with respect to amounts removed by the unmodified derivatives. Copyright © by the American Society of Agronomy, Crop Science Society of America, and Soil Science Society of America, Inc.

  18. Development of combinations of chemically modified vegetable oils as pork backfat substitutes in sausages formulation.

    PubMed

    Ospina-E, Juan Camilo; Cruz-S, Adriana; Pérez-Alvarez, José Angel; Fernández-López, Juana

    2010-03-01

    Today's consumers look for foods which provide nutrition and pleasure, while safeguarding their health, the result of which is that they increasingly avoid foods containing cholesterol and saturated and trans fatty acids. Chemically modified vegetable oils can help tailor meat products to meet this growing need and at the same time fulfil the technological needs of the meat processing industry. In this study, 16 backfat samples were characterised for their solid fat content (SFC) and melting point and these characteristics were used to design a mixture of chemically modified vegetable oils for use as a pork fat substitute for elaborating sausages. The mixtures were prepared with different vegetable oils bearing in mind with stearic acid content due to its close correlation with the SFC. The backfat was characterised as a function of its SFC and some modified vegetable oil mixtures were proposed, which led to a 10-20% diminution in saturated fatty acids and with a melting point similar to those observed in the backfat. The fatty acid profile pointed to a polyunsaturated/saturated fatty acids ratio higher than 0.4, and an n-6/n-3 fatty acid ratio of less than 4 in both modified vegetable oil mixtures proposed.

  19. Inherent electrochemistry and activation of chemically modified graphenes for electrochemical applications.

    PubMed

    Moo, James Guo Sheng; Ambrosi, Adriano; Bonanni, Alessandra; Pumera, Martin

    2012-04-01

    Graphene research is currently at the frontier of electrochemistry. Many different graphene-based materials are employed by electrochemists as electrodes in sensing and in energy-storage devices. Because the methods for their preparation are inherently different, graphene materials are expected to exhibit different electrochemical behaviors depending on the functionalities and density of defects present. Electrochemical treatment of these "chemically modified graphenes" (CMGs) represents an easy approach to alter surface functionalities and consequently tune the electrochemical performance. Herein, we report a preliminary electrochemical characterization of four common chemically modified graphenes, namely: graphene oxide, graphite oxide, chemically reduced graphene oxide, and thermally reduced graphene oxide. These CMGs were compared with graphite as a reference material. Cyclic voltammetry was used to ascertain the chemical functionalities present and to understand the potential ranges in which the materials were electroactive. Electrochemical treatment with either an oxidative or a reductive fixed potential were then carried out to activate these chemically modified graphenes. The effects of such electrochemical treatments on their electrocatalytic properties were then investigated by cyclic voltammetry in the presence of well-known redox probes, such as [Fe(CN)(6)](4-/3-), Fe(3+/2+), [Ru(NH(3))(6)](2+/3+), and ascorbic acid. Thermally reduced graphene oxide exhibited the best electrochemical behavior amongst all of the CMGs, with the fastest rate of heterogeneous electron transfer (HET) and the lowest overpotentials. These findings will have far-reaching consequences for the evaluation of different CMGs as electrode materials in electrochemical devices. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. Characterizing the effect of GalNAc and phosphorothioate backbone on binding of antisense oligonucleotides to the asialoglycoprotein receptor.

    PubMed

    Schmidt, Karsten; Prakash, Thazha P; Donner, Aaron J; Kinberger, Garth A; Gaus, Hans J; Low, Audrey; Østergaard, Michael E; Bell, Melanie; Swayze, Eric E; Seth, Punit P

    2017-03-17

    Targeted delivery of antisense oligonucleotides (ASO) to hepatocytes via the asialoglycoprotein receptor (ASGR) has improved the potency of ASO drugs ∼30-fold in the clinic (1). In order to fully characterize the effect of GalNAc valency, oligonucleotide length, flexibility and chemical composition on ASGR binding, we tested and validated a fluorescence polarization competition binding assay. The ASGR binding, and in vitro and in vivo activities of 1, 2 and 3 GalNAc conjugated single stranded and duplexed ASOs were studied. Two and three GalNAc conjugated single stranded ASOs bind the ASGR with the strongest affinity and display optimal in vitro and in vivo activities. 1 GalNAc conjugated ASOs showed 10-fold reduced ASGR binding affinity relative to three GalNAc ASOs but only 2-fold reduced activity in mice. An unexpected observation was that the ASGR also appears to play a role in the uptake of unconjugated phosphorothioate modified ASOs in the liver as evidenced by the loss of activity of GalNAc conjugated and unconjugated ASOs in ASGR knockout mice. Our results provide insights into how backbone charge and chemical composition assist in the binding and internalization of highly polar anionic single stranded oligonucleotides into cells and tissues. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  1. Characterizing the effect of GalNAc and phosphorothioate backbone on binding of antisense oligonucleotides to the asialoglycoprotein receptor

    PubMed Central

    Schmidt, Karsten; Prakash, Thazha P.; Donner, Aaron J.; Kinberger, Garth A.; Gaus, Hans J.; Low, Audrey; Østergaard, Michael E.; Bell, Melanie; Swayze, Eric E.

    2017-01-01

    Abstract Targeted delivery of antisense oligonucleotides (ASO) to hepatocytes via the asialoglycoprotein receptor (ASGR) has improved the potency of ASO drugs ∼30-fold in the clinic (1). In order to fully characterize the effect of GalNAc valency, oligonucleotide length, flexibility and chemical composition on ASGR binding, we tested and validated a fluorescence polarization competition binding assay. The ASGR binding, and in vitro and in vivo activities of 1, 2 and 3 GalNAc conjugated single stranded and duplexed ASOs were studied. Two and three GalNAc conjugated single stranded ASOs bind the ASGR with the strongest affinity and display optimal in vitro and in vivo activities. 1 GalNAc conjugated ASOs showed 10-fold reduced ASGR binding affinity relative to three GalNAc ASOs but only 2-fold reduced activity in mice. An unexpected observation was that the ASGR also appears to play a role in the uptake of unconjugated phosphorothioate modified ASOs in the liver as evidenced by the loss of activity of GalNAc conjugated and unconjugated ASOs in ASGR knockout mice. Our results provide insights into how backbone charge and chemical composition assist in the binding and internalization of highly polar anionic single stranded oligonucleotides into cells and tissues. PMID:28158620

  2. Chemically modified biochar produced from conocarpus waste increases NO3 removal from aqueous solutions.

    PubMed

    Usman, Adel R A; Ahmad, Mahtab; El-Mahrouky, Mohamed; Al-Omran, Abdulrasoul; Ok, Yong Sik; Sallam, Abdelazeem Sh; El-Naggar, Ahmed H; Al-Wabel, Mohammad I

    2016-04-01

    Biochar has emerged as a universal sorbent for the removal of contaminants from water and soil. However, its efficiency is lower than that of commercially available sorbents. Engineering biochar by chemical modification may improve its sorption efficiency. In this study, conocarpus green waste was chemically modified with magnesium and iron oxides and then subjected to thermal pyrolysis to produce biochar. These chemically modified biochars were tested for NO3 removal efficiency from aqueous solutions in batch sorption isothermal and kinetic experiments. The results revealed that MgO-biochar outperformed other biochars with a maximum NO3 sorption capacity of 45.36 mmol kg(-1) predicted by the Langmuir sorption model. The kinetics data were well described by the Type 1 pseudo-second-order model, indicating chemisorption as the dominating mechanism of NO3 sorption onto biochars. Greater efficiency of MgO-biochar was related to its high specific surface area (391.8 m(2) g(-1)) and formation of strong ionic complexes with NO3. At an initial pH of 2, more than 89 % NO3 removal efficiency was observed for all of the biochars. We conclude that chemical modification can alter the surface chemistry of biochar, thereby leading to enhanced sorption capacity compared with simple biochar.

  3. Effect of chemical heterogeneity on photoluminescence of graphite oxide treated with S-/N-containing modifiers

    NASA Astrophysics Data System (ADS)

    Ebrahim, Amani M.; Rodríguez-Castellón, Enrique; Montenegro, José María; Bandosz, Teresa J.

    2015-03-01

    Graphite oxide (GO) obtained using Hummers method was modified by hydrothermal treatment either with sulfanilic acid or polystyrene (3-ammonium) sulfonate at 100 °C or 85 °C, respectively. Both modifiers contain sulfur in the oxidized forms and nitrogen in the reduced forms. The materials were characterized using FTIR, XPS, thermal analysis, potentiometric titration and SEM. Their photoluminescent properties and their alteration with an addition of Ag+ were also measured. As a result of these modifications nitrogen was introduced to the graphene layers as amines, imides, amides, and sulfur as sulfones and sulfonic acids. Moreover, the presence of polyaniline was detected. This significantly affected the polarity, acid-base character, and conductivity of the materials. Apparently carboxylic groups of GO were involved in the surface reactions. The modified GOs lost their layered structure and the modifications resulted in the high degree of structural and chemical heterogeneity. Photoluminescence in visible light was recorded and linked to the presence of heteroatoms. For the polystyrene (3-ammonium) sulfonate modified sample addition of Ag+ quenched the photoluminescence at low wavelength showing sensitivity as a possible optical detector. No apparent effect was found for the sulfanilic acid modified sample.

  4. Chemically modified Si(111) surfaces simultaneously demonstrating hydrophilicity, resistance against oxidation, and low trap state densities

    NASA Astrophysics Data System (ADS)

    Brown, Elizabeth S.; Hlynchuk, Sofiya; Maldonado, Stephen

    2016-03-01

    Chemically modified Si(111) surfaces have been prepared through a series of wet chemical surface treatments that simultaneously show resistance towards surface oxidation, selective reactivity towards chemical reagents, and areal defect densities comparable to unannealed thermal oxides. Specifically, grazing angle attenuated total reflectance infrared and X-ray photoelectron (XP) spectroscopies were used to characterize allyl-, 3,4-methylenedioxybenzene-, or 4-[bis(trimethylsilyl)amino]phenyl-terminated surfaces and the subsequently hydroxylated surfaces. Hydroxylated surfaces were confirmed through reaction with 4-(trifluoromethyl)benzyl bromide and quantified by XP spectroscopy. Contact angle measurements indicated all surfaces remained hydrophilic, even after secondary backfilling with CH3sbnd groups. Surface recombination velocity measurements by way of microwave photoconductivity transients showed the relative defect-character of as-prepared and aged surfaces. The relative merits for each investigated surface type are discussed.

  5. Prompt activation of telomerase by chemical carcinogens in rats detected with a modified TRAP assay.

    PubMed

    Miura, M; Karasaki, Y; Abe, T; Higashi, K; Ikemura, K; Gotoh, S

    1998-05-08

    The maintenance of telomere length is crucial for survival of cells. Telomerase is an RNA-containing reverse transcriptase, which is responsible for elongation of shortened telomeres. Telomerase reactivation has been suggested to be involved in malignant progressions. To study on the involvement of telomerase activation in in vivo carcinogenesis, we first modified the original TRAP assay by changing the primer designs and the labeling method of PCR products to an end-labeling method. Second, we investigated the activation of telomerase in different organs after treatments of rats with various chemical carcinogens. Very early after the beginning of the treatment, telomerase activity in the liver, kidney, and lung was increased. In most cases, telomerase activation occurred in the primary or favorite target organs. The present results suggest that telomerase activation occurs promptly when animals are exposed to chemical carcinogens, which may contribute to in vivo chemical carcinogenesis.

  6. A modified Lagrangian-volumes method to simulate chemical transport in heterogeneous porous media

    NASA Astrophysics Data System (ADS)

    de Dreuzy, J.; Davy, P.

    2008-12-01

    Transport in subsurface environments is conditioned by physical and chemical processes in interaction, the most common being advection and dispersion for the physical processes and sorption for chemical reactions. Several numerical approaches have been developed to solve the complex set of equations governing this type of solute transport. These methods become time consuming in highly heterogeneous porous media having a broad-range velocity distribution. In this paper; we discuss a new efficient Lagrangian method. This method, modified from the Lagrangian-volumes approach, consists in dividing the aqueous phase in elementary volumes moved with the flow and interacting with the solid phase. Like in continuous time random walk algorithms, rather than keeping a constant time step, the time is adapted to the mesh velocity and computed so that an elementary volume crosses a mesh in a single numerical step. The modified Lagrangian-volume approach remains thus efficient whatever the velocity field. This approach is also highly flexible as it achieves a decoupling of the physical and chemical processes at the elementary volume scale, i.e. at the lowest considered scale, giving way to model virtually all possible chemical reactions. The modified Lagrangian volume approach can model both reactions between species in solution and sorption reactions. Reactions in solution are modeled by exchanges of solutes between Lagrangian volumes. For sorption reactions, the surface-to-volume ratio variability, a key parameter of sorption reactions, is accounted for by deforming the shape of the elementary volume. We implement and validate the algorithm on the specific case of the nonlinear Freundlich kinetic sorption in highly heterogeneous lognormal and multifractal permeability fields.

  7. Aminosilane functionalizations of mesoporous oxidized silicon for oligonucleotide synthesis and detection

    PubMed Central

    De Stefano, Luca; Oliviero, Giorgia; Amato, Jussara; Borbone, Nicola; Piccialli, Gennaro; Mayol, Luciano; Rendina, Ivo; Terracciano, Monica; Rea, Ilaria

    2013-01-01

    Direct solid phase synthesis of peptides and oligonucleotides (ONs) requires high chemical stability of the support material. In this work, we have investigated the passivation ability of porous oxidized silicon multilayered structures by two aminosilane compounds, 3-aminopropyltriethoxysilane and 3-aminopropyldimethylethoxysilane (APDMES), for optical label-free ON biosensor fabrication. We have also studied by spectroscopic reflectometry the hybridization between a 13 bases ON, directly grown on the aminosilane modified porous oxidized silicon by in situ synthesis, and its complementary sequence. Even if the results show that both devices are stable to the chemicals (carbonate/methanol) used, the porous silica structure passivated by APDMES reveals higher functionalization degree due to less steric hindrance of pores. PMID:23536541

  8. Stabilisation of silver and copper nanoparticles in a chemically modified chitosan matrix.

    PubMed

    Tiwari, Anand D; Mishra, Ajay K; Mishra, Shivani B; Kuvarega, Alex T; Mamba, Bhekie B

    2013-02-15

    This work describes the stabilisation of silver and copper nanoparticles in chemically modified chitosan colloidal solution. Chitosan-N-2-methylidene-hydroxy-pyridine-6-methylidene hydroxy thiocarbohydrazide (CSPTH) was used as a stabilising and reducing agent for silver and copper nanoparticles. The modified chitosan derivatives and the synthesised nanoparticles were characterised by Fourier transform infrared (FT-IR) spectroscopy, Ultraviolet-visible (UV-Vis) spectroscopy and X-ray diffraction (XRD). Particle size, morphology and segregation of the nanoparticles were determined by transmission electron microscopy (TEM). The size of the nanoparticles was found to be less than 20 nm and 50 nm for silver and copper nanoparticles, respectively. These nanoparticles were stabilised in a chemically modified chitosan solution and their properties were studied using fluorescence spectroscopy, photoluminescence spectroscopy and surface-enhanced Raman scattering (SERS). The optical properties of silver nanoparticles in surface plasmon band (SPB) were enhanced at 407 nm compared to those of copper nanoparticles. Fluorescence (400 nm and 756 nm), photoluminescence (450 and 504 nm) and Raman scattering (1382 and 1581 cm(-1)) properties for the copper nanoparticles were superior to those of the silver nanoparticles.

  9. Deposition of carbon nanotubes onto aramid fibers using as-received and chemically modified fibers

    NASA Astrophysics Data System (ADS)

    Rodríguez-Uicab, O.; Avilés, F.; Gonzalez-Chi, P. I.; Canché-Escamilla, G.; Duarte-Aranda, S.; Yazdani-Pedram, M.; Toro, P.; Gamboa, F.; Mazo, M. A.; Nistal, A.; Rubio, J.

    2016-11-01

    Multiwall carbon nanotubes (MWCNTs) oxidized by an acid treatment were deposited on the surface of as-received commercial aramid fibers containing a surface coating ("sizing"), and fibers modified by either a chlorosulfonic treatment or a mixture of nitric and sulfuric acids. The surface of the aramid fiber activated by the chemical treatments presents increasing density of CO, COOH and OH functional groups. However, these chemical treatments reduced the tensile mechanical properties of the fibers, especially when the nitric and sulfuric acid mixture was used. Characterization of the MWCNTs deposited on the fiber surface was conducted by scanning electron microscopy, Raman spectroscopy mapping and X-ray photoelectron spectroscopy. These characterizations showed higher areal concentration and more homogeneous distribution of MWCNTs over the aramid fibers for as-received fibers and for those modified with chlorosulfonic acid, suggesting the existence of interaction between the oxidized MWCNTs and the fiber coating. The electrical resistance of the MWCNT-modified aramid yarns comprising ∼1000 individual fibers was in the order of MΩ/cm, which renders multifunctional properties.

  10. Predicting oligonucleotide-directed mutagenesis failures in protein engineering

    PubMed Central

    Wassman, Christopher D.; Tam, Phillip Y.; Lathrop, Richard H.; Weiss, Gregory A.

    2004-01-01

    Protein engineering uses oligonucleotide-directed mutagenesis to modify DNA sequences through a two-step process of hybridization and enzymatic synthesis. Inefficient reactions confound attempts to introduce mutations, especially for the construction of vast combinatorial protein libraries. This paper applied computational approaches to the problem of inefficient mutagenesis. Several results implicated oligonucleotide annealing to non-target sites, termed ‘cross-hybridization’, as a significant contributor to mutagenesis reaction failures. Test oligonucleotides demonstrated control over reaction outcomes. A novel cross-hybridization score, quickly computable for any plasmid and oligonucleotide mixture, directly correlated with yields of deleterious mutagenesis side products. Cross-hybridization was confirmed conclusively by partial incorporation of an oligonucleotide at a predicted cross-hybridization site, and by modification of putative template secondary structure to control cross-hybridization. Even in low concentrations, cross-hybridizing species in mixtures poisoned reactions. These results provide a basis for improved mutagenesis efficiencies and increased diversities of cognate protein libraries. PMID:15585664

  11. Chemical and optical characterization of white efflorescences on dry fermented sausages under modified atmosphere packaging.

    PubMed

    Walz, Felix H; Gibis, Monika; Herrmann, Kurt; Hinrichs, Jörg; Weiss, Jochen

    2017-04-06

    Dry fermented sausages that are packed under modified atmosphere are often affected by the formation of white crystals on the surface. These so called efflorescences are rejected by consumers and lead to high financial losses for the meat processing industry. In this study, the distribution of efflorescence-causing components was investigated over the sausage profile during 8 weeks of storage under modified atmosphere at 4 °C. In addition, two visual methods (image and sensory analyses) were compared regarding the ability to quantify the efflorescence content. The initial formation of efflorescences was observed after 2 weeks (7%). After 4 weeks of storage, 23.4% of the sausage surface was covered with efflorescences, and the amount of efflorescences did not change significantly by the end of storage. Furthermore, chemical analyses revealed that magnesium (increased by 98.1%), lactate (increased by 54.2%) and creatine (increased by 51.8%) are enriched on the sausage surface during storage. Sensory and image analyses lead to comparable results (r = 0.992) and therefore both are suitable to quantify the amount of efflorescences. The moisture gradient in the interior of the sausages which is built upon drying is supposed to be the driving force for the movement of efflorescence-causing compounds. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  12. Biominetic High Density Lipoproteins for the Delivery of Therapeutic Oligonucleotides

    NASA Astrophysics Data System (ADS)

    Tripathy, Sushant

    Advances in nanotechnology have brought about novel inorganic and hybrid nanoparticles with unique physico-chemical properties that make them suitable for a broad range of applications---from nano-circuitry to drug delivery. A significant part of those advancements have led to ground-breaking discoveries that have changed the approaches to formulation of therapeutics against diseases, such as cancer. Now-a-days the focus does not lie solely on finding a candidate small-molecule therapeutic with minimal adverse effects, but researchers are looking up to nanoparticles to improve biodistribution and biocompatibility profile of clinically proven therapeutics. The plethora of conjugation chemistries offered by currently extant inorganic nanoparticles have, in recent years, led to great leaps in the field of biomimicry---a modality that promises high biocompatibility. Further, in the pursuit of highly specific therapeutic molecules, researchers have turned to silencing oligonucleotides and some have already brought together the strengths of nanoparticles and silencing oligonucleotides in search of an efficacious therapy for cancer with minimal adverse effects. This dissertation work focuses on such a biomimetic platform---a gold nanoparticle based high density lipoprotein biomimetic (HDL NP), for the delivery of therapeutic oligonucleotides. The first chapter of this body of work introduces the molecular target of the silencing oligonucleotides---VEGFR2, and its role in the progression of solid tumor cancers. The background information also covers important aspects of natural high density lipoproteins (HDL), especially their innate capacity to bind and deliver exogenous and endogenous silencing oligonucleotides to tissues that express their high affinity receptor SRB1. We subsequently describe the synthesis of the biomimetic HDL NP and its oligonucleotide conjugates, and establish their biocompatibility. Further on, experimental data demonstrate the efficacy of silencing

  13. The Use of Aryl Hydrazide Linkers for the Solid Phase Synthesis of Chemically Modified Peptides

    SciTech Connect

    Woo, Y; Mitchell, A R; Camarero, J A

    2006-11-03

    Since Merrifield introduced the concept of solid phase synthesis in 1963 for the rapid preparation of peptides, a large variety of different supports and resin-linkers have been developed that improve the efficiency of peptide assembly and expand the myriad of synthetically feasible peptides. The aryl hydrazide is one of the most useful resin-linkers for the synthesis of chemically modified peptides. This linker is completely stable during Boc- and Fmoc-based solid phase synthesis and yet it can be cleaved under very mild oxidative conditions. The present article reviews the use of this valuable linker for the rapid and efficient synthesis of C-terminal modified peptides, head-to-tail cyclic peptides and lipidated peptides.

  14. Adsorption of anionic dyes from aqueous solutions using chemically modified straw.

    PubMed

    Zhang, Wenxuan; Li, Haijiang; Kan, Xiaowei; Dong, Lei; Yan, Han; Jiang, Ziwen; Yang, Hu; Li, Aimin; Cheng, Rongshi

    2012-08-01

    The effective disposal of redundant straw is a significant work for environmental protection and full utilization of resource. In this work, the wheat straw has been modified by etherification to prepare a kind of quaternary ammonium straw adsorbents. The adsorption behaviors of the modified straw for methyl orange (MO) and acid green 25(AG25) were studied in both batch and column systems. The adsorption capacity of the straw for both dyes improved evidently after modification. The maximal MO and AG25 uptakes were more than 300 and 950 mg g(-1), respectively. Furthermore, the adsorption equilibrium, kinetics and column studies all indicated that the adsorption behavior was a monolayer chemical adsorption with an ion-exchange process. In addition, after adsorption of anionic dyes, the used adsorbents were successfully applied to adsorb a cationic dye directly at suitable conditions in the secondary adsorption. This was due to the altered surface structures of the used adsorbents.

  15. A modified method for estimation of chemical oxygen demand for samples having high suspended solids.

    PubMed

    Yadvika; Yadav, Asheesh Kumar; Sreekrishnan, T R; Satya, Santosh; Kohli, Sangeeta

    2006-03-01

    Determination of chemical oxygen demand (COD) of samples having high suspended solids concentration such as cattle dung slurry with open reflux method of APHA-AWWA-WPCF did not give consistent results. This study presents a modification of the open reflux method (APHA-AWWA-WPCF) to make it suitable for samples with high percentage of suspended solids. The new method is based on a different technique of sample preparation, modified quantities of reagents and higher reflux time as compared to the existing open reflux method. For samples having solids contents of 14.0 g/l or higher, the modified method was found to give higher value of COD with much higher consistency and accuracy as compared to the existing open reflux method.

  16. Chemically Modified Bacteriophage as a Streamlined Approach to Noninvasive Breast Cancer Imaging

    DTIC Science & Technology

    2012-10-01

    represents th (%ID/g). Erro es. coli. All p E. coli TG1 e (a tetracy haking at 3 L of the cu rpm. The at 4 °C. Th f and thoro resulting su nded...this research to include: Manuscript in publication: 1. Carrico, Z . M.*; Farkas, M. E.*; Yu, Z .; Hsiao, S. C.; Marks, J. D.; Chokhawala, H.; Clark...Carrico, Z . M.; Tong, G. J.; Wu, W.; Behrens, C. R.; Gray, J. M.; Francis, M. B. “Chemically Modified Bacteriophage as a Streamlined Approach Toward Non

  17. Highly dispersed Pd nanoparticles on chemically modified graphene with aminophenyl groups for formic acid oxidation

    NASA Astrophysics Data System (ADS)

    Yang, Su-Dong; Shen, Cheng-Min; Tong, Hao; He, Wei; Zhang, Xiao-Gang; Gao, Hong-Jun

    2011-11-01

    A novel electrode material based on chemically modified graphene (CMG) with aminophenyl groups is covalently functionalized by a nucleophilic ring-opening reaction between the epoxy groups of graphene oxide and the aminophenyl groups of p-phenylenediamine. Palladium nanoparticles with an average diameter of 4.2 nm are deposited on the CMG by a liquid-phase borohydride reduction. The electrocatalytic activity and stability of the Pd/CMG composite towards formic acid oxidation are found to be higher than those of reduced graphene oxide and commercial carbon materials such as Vulcan XC-72 supported Pd electrocatalysts.

  18. Retention of Proteins and Metalloproteins in Open Tubular Capillary Electrochromatography with Etched Chemically Modified Columns

    PubMed Central

    Pesek, Joseph J.; Matyska, Maria T.; Salgotra, Vasudha

    2010-01-01

    Etched chemically modified capillaries with two different bonded groups (pentyl and octadecyl) are compared for their migration behavior of several common proteins and metalloproteins as well as metalloproteinases. Migration times, efficiency and peak shape are evaluated over the pH range of 2.1 to 8.1 to determine any effects of the bonded group on the electrochromatographic behavior of these compounds. One goal was to determine if the relative hydrophobicity of the stationary phase has a significant effect on proteins in the open tubular format of capillary electrochromatography as it does in HPLC. Reproducibility of the migration times is also investigated. PMID:18850653

  19. Sorption of nickel (II) from aqueous system by chemically modified pungan (pongamia pinnata) seedpod carbon

    NASA Astrophysics Data System (ADS)

    Senthil, M.; Arulanantham, A.

    2013-06-01

    The adsorption of Ni (II) on chemically modified bicarbonate impregnated sulphuric acid treated pungan (pongamia pinnata) seedpod carbon (BSPAC) was investigated as a function of equilibrium time, solution pH and carbon dosage. The adsorption of nickel (II) was also studied by using Freundlich, Langmuir and Temkin isotherm models. Kinetic studies were conducted using reversible-first-order, pseudo-first-order and pseudo-second-order kinetic equations. The results obtained were compared with commercially available activated carbon (CAC) of same 20-50 ASTM mesh size.

  20. Adsorption characteristics of metal ions on chitosan chemically modified by D-galactose

    SciTech Connect

    Kondo, Kazuo; Sumi, Hisaharu; Matsumoto, Michiaki

    1996-07-01

    The adsorption characteristics of metal ions on chitosan chemically modified by D-galactose were examined. The pH dependency on the distribution ratio was found to be affected by the valency of the metal ion, and the apparent adsorption equilibrium constants of the metal ions were determined. The order of adsorption of the metal ions is Ga > In > Nd > Eu for the trivalent metal ions and Cu > Ni > Co for the divalent metal ions. It is believed that amino and hydroxyl groups in the chitosan act as a chelating ligand.

  1. Size-dependent mobility of gold nano-clusters during growth on chemically modified graphene

    NASA Astrophysics Data System (ADS)

    Bell, Gavin R.; Dawson, Peter M.; Pandey, Priyanka A.; Wilson, Neil R.; Mulheran, Paul A.

    2014-01-01

    Gold nano-clusters were grown on chemically modified graphene by direct sputter deposition. Transmission electron microscopy of the nano-clusters on these electron-transparent substrates reveals an unusual bimodal island size distribution (ISD). A kinetic Monte Carlo model of growth incorporating a size-dependent cluster mobility rule uniquely reproduces the bimodal ISD, providing strong evidence for the mobility of large clusters during surface growth. The cluster mobility exponent of -5/3 is consistent with cluster motion via one-dimensional diffusion of gold atoms around the edges of the nano-clusters.

  2. Size-dependent mobility of gold nano-clusters during growth on chemically modified graphene

    SciTech Connect

    Bell, Gavin R. Dawson, Peter M.; Pandey, Priyanka A.; Wilson, Neil R.; Mulheran, Paul A.

    2014-01-01

    Gold nano-clusters were grown on chemically modified graphene by direct sputter deposition. Transmission electron microscopy of the nano-clusters on these electron-transparent substrates reveals an unusual bimodal island size distribution (ISD). A kinetic Monte Carlo model of growth incorporating a size-dependent cluster mobility rule uniquely reproduces the bimodal ISD, providing strong evidence for the mobility of large clusters during surface growth. The cluster mobility exponent of −5/3 is consistent with cluster motion via one-dimensional diffusion of gold atoms around the edges of the nano-clusters.

  3. Oligonucleotide conjugates for therapeutic applications.

    PubMed

    Winkler, Johannes

    2013-07-01

    Insufficient pharmacokinetic properties and poor cellular uptake are the main hurdles for successful therapeutic development of oligonucleotide agents. The covalent attachment of various ligands designed to influence the biodistribution and cellular uptake or for targeting specific tissues is an attractive possibility to advance therapeutic applications and to expand development options. In contrast to advanced formulations, which often consist of multiple reagents and are sensitive to a variety of preparation conditions, oligonucleotide conjugates are defined molecules, enabling structure-based analytics and quality control techniques. This review gives an overview of current developments of oligonucleotide conjugates for therapeutic applications. Attached ligands comprise peptides, proteins, carbohydrates, aptamers and small molecules, including cholesterol, tocopherol and folic acid. Important linkage types and conjugation methods are summarized. The distinct ligands directly influence biochemical parameters, uptake mechanisms and pharmacokinetic properties.

  4. Oligonucleotide conjugates for therapeutic applications

    PubMed Central

    Winkler, Johannes

    2013-01-01

    Insufficient pharmacokinetic properties and poor cellular uptake are the main hurdles for successful therapeutic development of oligonucleotide agents. The covalent attachment of various ligands designed to influence the biodistribution and cellular uptake or for targeting specific tissues is an attractive possibility to advance therapeutic applications and to expand development options. In contrast to advanced formulations, which often consist of multiple reagents and are sensitive to a variety of preparation conditions, oligonucleotide conjugates are defined molecules, enabling structure-based analytics and quality control techniques. This review gives an overview of current developments of oligonucleotide conjugates for therapeutic applications. Attached ligands comprise peptides, proteins, carbohydrates, aptamers and small molecules, including cholesterol, tocopherol and folic acid. Important linkage types and conjugation methods are summarized. The distinct ligands directly influence biochemical parameters, uptake machanisms and pharmacokinetic properties. PMID:23883124

  5. Peroxide-modified titanium dioxide: a chemical analog of putative Martian soil oxidants

    NASA Technical Reports Server (NTRS)

    Quinn, R. C.; Zent, A. P.

    1999-01-01

    Hydrogen peroxide chemisorbed on titanium dioxide (peroxide-modified titanium dioxide) is investigated as a chemical analog to the putative soil oxidants responsible for the chemical reactivity seen in the Viking biology experiments. When peroxide-modified titanium dioxide (anatase) was exposed to a solution similar to the Viking labeled release (LR) experiment organic medium, CO2 gas was released into the sample cell headspace. Storage of these samples at 10 degrees C for 48 hr prior to exposure to organics resulted in a positive response while storage for 7 days did not. In the Viking LR experiment, storage of the Martian surface samples for 2 sols (approximately 49 hr) resulted in a positive response while storage for 141 sols essentially eliminated the initial rapid release of CO2. Heating the peroxide-modified titanium dioxide to 50 degrees C prior to exposure to organics resulted in a negative response. This is similar to, but not identical to, the Viking samples where heating to approximately 46 degrees C diminished the response by 54-80% and heating to 51.5 apparently eliminated the response. When exposed to water vapor, the peroxide-modified titanium dioxide samples release O2 in a manner similar to the release seen in the Viking gas exchange experiment (GEx). Reactivity is retained upon heating at 50 degrees C for three hours, distinguishing this active agent from the one responsible for the release of CO2 from aqueous organics. The release of CO2 by the peroxide-modified titanium dioxide is attributed to the decomposition of organics by outer-sphere peroxide complexes associated with surface hydroxyl groups, while the release of O2 upon humidification is attributed to more stable inner-sphere peroxide complexes associated with Ti4+ cations. Heating the peroxide-modified titanium dioxide to 145 degrees C inhibited the release of O2, while in the Viking experiments heating to this temperature diminished but did not eliminated the response. Although the

  6. Peroxide-modified titanium dioxide: a chemical analog of putative Martian soil oxidants

    NASA Technical Reports Server (NTRS)

    Quinn, R. C.; Zent, A. P.

    1999-01-01

    Hydrogen peroxide chemisorbed on titanium dioxide (peroxide-modified titanium dioxide) is investigated as a chemical analog to the putative soil oxidants responsible for the chemical reactivity seen in the Viking biology experiments. When peroxide-modified titanium dioxide (anatase) was exposed to a solution similar to the Viking labeled release (LR) experiment organic medium, CO2 gas was released into the sample cell headspace. Storage of these samples at 10 degrees C for 48 hr prior to exposure to organics resulted in a positive response while storage for 7 days did not. In the Viking LR experiment, storage of the Martian surface samples for 2 sols (approximately 49 hr) resulted in a positive response while storage for 141 sols essentially eliminated the initial rapid release of CO2. Heating the peroxide-modified titanium dioxide to 50 degrees C prior to exposure to organics resulted in a negative response. This is similar to, but not identical to, the Viking samples where heating to approximately 46 degrees C diminished the response by 54-80% and heating to 51.5 apparently eliminated the response. When exposed to water vapor, the peroxide-modified titanium dioxide samples release O2 in a manner similar to the release seen in the Viking gas exchange experiment (GEx). Reactivity is retained upon heating at 50 degrees C for three hours, distinguishing this active agent from the one responsible for the release of CO2 from aqueous organics. The release of CO2 by the peroxide-modified titanium dioxide is attributed to the decomposition of organics by outer-sphere peroxide complexes associated with surface hydroxyl groups, while the release of O2 upon humidification is attributed to more stable inner-sphere peroxide complexes associated with Ti4+ cations. Heating the peroxide-modified titanium dioxide to 145 degrees C inhibited the release of O2, while in the Viking experiments heating to this temperature diminished but did not eliminated the response. Although the

  7. Peroxide-modified titanium dioxide: a chemical analog of putative Martian soil oxidants.

    PubMed

    Quinn, R C; Zent, A P

    1999-01-01

    Hydrogen peroxide chemisorbed on titanium dioxide (peroxide-modified titanium dioxide) is investigated as a chemical analog to the putative soil oxidants responsible for the chemical reactivity seen in the Viking biology experiments. When peroxide-modified titanium dioxide (anatase) was exposed to a solution similar to the Viking labeled release (LR) experiment organic medium, CO2 gas was released into the sample cell headspace. Storage of these samples at 10 degrees C for 48 hr prior to exposure to organics resulted in a positive response while storage for 7 days did not. In the Viking LR experiment, storage of the Martian surface samples for 2 sols (approximately 49 hr) resulted in a positive response while storage for 141 sols essentially eliminated the initial rapid release of CO2. Heating the peroxide-modified titanium dioxide to 50 degrees C prior to exposure to organics resulted in a negative response. This is similar to, but not identical to, the Viking samples where heating to approximately 46 degrees C diminished the response by 54-80% and heating to 51.5 apparently eliminated the response. When exposed to water vapor, the peroxide-modified titanium dioxide samples release O2 in a manner similar to the release seen in the Viking gas exchange experiment (GEx). Reactivity is retained upon heating at 50 degrees C for three hours, distinguishing this active agent from the one responsible for the release of CO2 from aqueous organics. The release of CO2 by the peroxide-modified titanium dioxide is attributed to the decomposition of organics by outer-sphere peroxide complexes associated with surface hydroxyl groups, while the release of O2 upon humidification is attributed to more stable inner-sphere peroxide complexes associated with Ti4+ cations. Heating the peroxide-modified titanium dioxide to 145 degrees C inhibited the release of O2, while in the Viking experiments heating to this temperature diminished but did not eliminated the response. Although the

  8. Chemically modified guide RNAs enhance CRISPR-Cas genome editing in human primary cells.

    PubMed

    Hendel, Ayal; Bak, Rasmus O; Clark, Joseph T; Kennedy, Andrew B; Ryan, Daniel E; Roy, Subhadeep; Steinfeld, Israel; Lunstad, Benjamin D; Kaiser, Robert J; Wilkens, Alec B; Bacchetta, Rosa; Tsalenko, Anya; Dellinger, Douglas; Bruhn, Laurakay; Porteus, Matthew H

    2015-09-01

    CRISPR-Cas-mediated genome editing relies on guide RNAs that direct site-specific DNA cleavage facilitated by the Cas endonuclease. Here we report that chemical alterations to synthesized single guide RNAs (sgRNAs) enhance genome editing efficiency in human primary T cells and CD34(+) hematopoietic stem and progenitor cells. Co-delivering chemically modified sgRNAs with Cas9 mRNA or protein is an efficient RNA- or ribonucleoprotein (RNP)-based delivery method for the CRISPR-Cas system, without the toxicity associated with DNA delivery. This approach is a simple and effective way to streamline the development of genome editing with the potential to accelerate a wide array of biotechnological and therapeutic applications of the CRISPR-Cas technology.

  9. Photoluminescence of silicon nanoparticles chemically modified by alkyl groups and dispersed in low-polar liquids

    NASA Astrophysics Data System (ADS)

    Ryabchikov, Yury V.; Alekseev, Sergei A.; Lysenko, Vladimir; Bremond, Georges; Bluet, Jean-Marie

    2013-04-01

    A detailed comparative analysis of photoluminescence behavior of silicon nanoparticles in air and dispersed in low-polar liquids is reported. Efficient dispersion and excellent stability of the chemically modified nanoparticles in low-polar liquids are achieved. Influence of the chemical functionalization and of the low-polar liquids on steady-state and time-resolved photoluminescence of the silicon nanoparticles is investigated. Role of low-polar liquids on recombination mechanisms taking place in the nanoparticles is discussed in terms of Förster resonant energy transfer processes. Effect of exciting laser power on photoluminescence spectra of the silicon nanoparticles both in air and in low-polar liquids is investigated and the electronic mechanisms involved into the observed phenomena are discussed.

  10. Chemically modified guide RNAs enhance CRISPR-Cas genome editing in human primary cells

    PubMed Central

    Clark, Joseph T; Kennedy, Andrew B; Ryan, Daniel E; Roy, Subhadeep; Steinfeld, Israel; Lunstad, Benjamin D; Kaiser, Robert J; Wilkens, Alec B; Bacchetta, Rosa; Tsalenko, Anya; Dellinger, Douglas; Bruhn, Laurakay; Porteus, Matthew H

    2016-01-01

    CRISPR-Cas-mediated genome editing relies on guide RNAs that direct site-specific DNA cleavage facilitated by the Cas endonuclease. Here we report that chemical alterations to synthesized single guide RNAs (sgRNAs) enhance genome editing efficiency in human primary T cells and CD34+ hematopoietic stem and progenitor cells. Co-delivering chemically modified sgRNAs with Cas9 mRNA or protein is an efficient RNA- or ribonucleoprotein (RNP)-based delivery method for the CRISPR-Cas system, without the toxicity associated with DNA delivery. This approach is a simple and effective way to streamline the development of genome editing with the potential to accelerate a wide array of biotechnological and therapeutic applications of the CRISPR-Cas technology. PMID:26121415

  11. A Mechanistic Study of Chemically Modified Inorganic Membranes for Gas and Liquid Separations

    SciTech Connect

    Way, J Douglas

    2011-01-21

    This final report will summarize the progress made during the period August 1, 1993 - October 31, 2010 with support from DOE grant number DE-FG03-93ER14363. The objectives of the research have been to investigate the transport mechanisms in micro- and mesoporous, metal oxide membranes and to examine the relationship between the microstructure of the membrane, the membrane surface chemistry, and the separation performance of the membrane. Examples of the membrane materials under investigation are the microporous silica hollow fiber membrane manufactured by PPG Industries, chemically modified mesoporous oxide membranes, and polymer membranes containing microporous oxides (mixed matrix membranes). Analytical techniques such as NMR, FTIR and Raman spectroscopy, thermal analysis, and gas adsorption were used to investigate membrane microstructure and to probe the chemical interactions occurring at the gas-membrane interface.

  12. Reactions templated by nucleic acids: more ways to translate oligonucleotide-based instructions into emerging function.

    PubMed

    Gorska, Katarzyna; Winssinger, Nicolas

    2013-07-01

    The programmability of oligonucleotide recognition offers an attractive platform to direct the assembly of reactive partners that can engage in chemical reactions. Recently, significant progress has been made in both the breadth of chemical transformations and in the functional output of the reaction. Herein we summarize these recent progresses and illustrate their applications to translate oligonucleotide instructions into functional materials and novel architectures (conductive polymers, nanopatterns, novel oligonucleotide junctions); into fluorescent or bioactive molecule using cellular RNA; to interrogate secondary structures or oligonucelic acids; or a synthetic oligomer. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. Determination of bisphenol A in food-simulating liquids using LCED with a chemically modified electrode.

    PubMed

    D'Antuono, A; Dall'Orto, V C; Lo Balbo, A; Sobral, S; Rezzano, I

    2001-03-01

    Liquid chromatography with electrochemical detector (LC-ED), using a chemically modified electrode coated with a metalloporphyrin film, is reported for determination of bisphenol A (BPA) migration from polycarbonate baby bottles. The extraction process of the samples was performed according to regulations of the Southern Common Market (MERCOSUR), where certain food-simulating liquids [(A) distilled water, (B) acetic acid 3% V/V in distilled water, and (C) ethanol 15% V/V in distilled water] are defined along with controlled time and temperature conditions. The baseline obtained using the naked electrode showed a considerable drift which increased the detection limit. This effect was suppressed with the chemically modified electrode. A linear range up to 450 ppb along with a detection limit of 20 ppb for the amperometric detection technique was observed. The procedure described herein allowed lowering the detection limit of the method to 0.2 ppb. The value found for BPA in the food-simulating liquid is 1.2 ppb, which is below the tolerance limit for specific migration (4.8 ppm).

  14. Covering Chemical Diversity of Genetically-Modified Tomatoes Using Metabolomics for Objective Substantial Equivalence Assessment

    PubMed Central

    Hirai, Tadayoshi; Oikawa, Akira; Matsuda, Fumio; Fukushima, Atsushi; Arita, Masanori; Watanabe, Shin; Yano, Megumu; Hiwasa-Tanase, Kyoko; Ezura, Hiroshi; Saito, Kazuki

    2011-01-01

    As metabolomics can provide a biochemical snapshot of an organism's phenotype it is a promising approach for charting the unintended effects of genetic modification. A critical obstacle for this application is the inherently limited metabolomic coverage of any single analytical platform. We propose using multiple analytical platforms for the direct acquisition of an interpretable data set of estimable chemical diversity. As an example, we report an application of our multi-platform approach that assesses the substantial equivalence of tomatoes over-expressing the taste-modifying protein miraculin. In combination, the chosen platforms detected compounds that represent 86% of the estimated chemical diversity of the metabolites listed in the LycoCyc database. Following a proof-of-safety approach, we show that % had an acceptable range of variation while simultaneously indicating a reproducible transformation-related metabolic signature. We conclude that multi-platform metabolomics is an approach that is both sensitive and robust and that it constitutes a good starting point for characterizing genetically modified organisms. PMID:21359231

  15. Covering chemical diversity of genetically-modified tomatoes using metabolomics for objective substantial equivalence assessment.

    PubMed

    Kusano, Miyako; Redestig, Henning; Hirai, Tadayoshi; Oikawa, Akira; Matsuda, Fumio; Fukushima, Atsushi; Arita, Masanori; Watanabe, Shin; Yano, Megumu; Hiwasa-Tanase, Kyoko; Ezura, Hiroshi; Saito, Kazuki

    2011-02-16

    As metabolomics can provide a biochemical snapshot of an organism's phenotype it is a promising approach for charting the unintended effects of genetic modification. A critical obstacle for this application is the inherently limited metabolomic coverage of any single analytical platform. We propose using multiple analytical platforms for the direct acquisition of an interpretable data set of estimable chemical diversity. As an example, we report an application of our multi-platform approach that assesses the substantial equivalence of tomatoes over-expressing the taste-modifying protein miraculin. In combination, the chosen platforms detected compounds that represent 86% of the estimated chemical diversity of the metabolites listed in the LycoCyc database. Following a proof-of-safety approach, we show that % had an acceptable range of variation while simultaneously indicating a reproducible transformation-related metabolic signature. We conclude that multi-platform metabolomics is an approach that is both sensitive and robust and that it constitutes a good starting point for characterizing genetically modified organisms.

  16. Aqueous dispersions of few-layer-thick chemically modified magnesium diboride nanosheets by ultrasonication assisted exfoliation

    PubMed Central

    Das, Saroj Kumar; Bedar, Amita; Kannan, Aadithya; Jasuja, Kabeer

    2015-01-01

    The discovery of graphene has led to a rising interest in seeking quasi two-dimensional allotropes of several elements and inorganic compounds. Boron, carbon’s neighbour in the periodic table, presents a curious case in its ability to be structured as graphene. Although it cannot independently constitute a honeycomb planar structure, it forms a graphenic arrangement in association with electron-donor elements. This is exemplified in magnesium diboride (MgB2): an inorganic layered compound comprising boron honeycomb planes alternated by Mg atoms. Till date, MgB2 has been primarily researched for its superconducting properties; it hasn’t been explored for the possibility of its exfoliation. Here we show that ultrasonication of MgB2 in water results in its exfoliation to yield few-layer-thick Mg-deficient hydroxyl-functionalized nanosheets. The hydroxyl groups enable an electrostatically stabilized aqueous dispersion and create a heterogeneity leading to an excitation wavelength dependent photoluminescence. These chemically modified MgB2 nanosheets exhibit an extremely small absorption coefficient of 2.9 ml mg−1 cm−1 compared to graphene and its analogs. This ability to exfoliate MgB2 to yield nanosheets with a chemically modified lattice and properties distinct from the parent material presents a fundamentally new perspective to the science of MgB2 and forms a first foundational step towards exfoliating metal borides. PMID:26041686

  17. Pharmacological profiling of zebrafish behavior using chemical and genetic classification of sleep-wake modifiers

    PubMed Central

    Nishimura, Yuhei; Okabe, Shiko; Sasagawa, Shota; Murakami, Soichiro; Ashikawa, Yoshifumi; Yuge, Mizuki; Kawaguchi, Koki; Kawase, Reiko; Tanaka, Toshio

    2015-01-01

    Sleep-wake states are impaired in various neurological disorders. Impairment of sleep-wake states can be an early condition that exacerbates these disorders. Therefore, treating sleep-wake dysfunction may prevent or slow the development of these diseases. Although many gene products are likely to be involved in the sleep-wake disturbance, hypnotics and psychostimulants clinically used are limited in terms of their mode of action and are not without side effects. Therefore, there is a growing demand for developing new hypnotics and psychostimulants with high efficacy and few side effects. Toward this end, animal models are indispensable for use in genetic and chemical screens to identify sleep-wake modifiers. As a proof-of-concept study, we performed behavioral profiling of zebrafish treated with chemical and genetic sleep-wake modifiers. We were able to demonstrate that behavioral profiling of zebrafish treated with hypnotics or psychostimulants from 9 to 10 days post-fertilization was sufficient to identify drugs with specific modes of action. We were also able to identify behavioral endpoints distinguishing GABA-A modulators and hypocretin (hcrt) receptor antagonists and between sympathomimetic and non-sympathomimetic psychostimulants. This behavioral profiling can serve to identify genes related to sleep-wake disturbance associated with various neuropsychiatric diseases and novel therapeutic compounds for insomnia and excessive daytime sleep with fewer adverse side effects. PMID:26578964

  18. Aqueous dispersions of few-layer-thick chemically modified magnesium diboride nanosheets by ultrasonication assisted exfoliation.

    PubMed

    Das, Saroj Kumar; Bedar, Amita; Kannan, Aadithya; Jasuja, Kabeer

    2015-06-04

    The discovery of graphene has led to a rising interest in seeking quasi two-dimensional allotropes of several elements and inorganic compounds. Boron, carbon's neighbour in the periodic table, presents a curious case in its ability to be structured as graphene. Although it cannot independently constitute a honeycomb planar structure, it forms a graphenic arrangement in association with electron-donor elements. This is exemplified in magnesium diboride (MgB2): an inorganic layered compound comprising boron honeycomb planes alternated by Mg atoms. Till date, MgB2 has been primarily researched for its superconducting properties; it hasn't been explored for the possibility of its exfoliation. Here we show that ultrasonication of MgB2 in water results in its exfoliation to yield few-layer-thick Mg-deficient hydroxyl-functionalized nanosheets. The hydroxyl groups enable an electrostatically stabilized aqueous dispersion and create a heterogeneity leading to an excitation wavelength dependent photoluminescence. These chemically modified MgB2 nanosheets exhibit an extremely small absorption coefficient of 2.9 ml mg(-1) cm(-1) compared to graphene and its analogs. This ability to exfoliate MgB2 to yield nanosheets with a chemically modified lattice and properties distinct from the parent material presents a fundamentally new perspective to the science of MgB2 and forms a first foundational step towards exfoliating metal borides.

  19. Adhesion mapping of chemically modified and poly(ethylene oxide)-grafted glass surfaces

    PubMed Central

    Jogikalmath, G.; Stuart, J.K.; Pungor, A.; Hlady, V.

    2012-01-01

    Two-dimensional mapping of the adhesion pull-off forces was used to study the origin of surface heterogeneity in the grafted poly(ethylene oxide) (PEO) layer. The variance of the pull-off forces measured over the μm-sized regions after each chemical step of modifying glass surfaces was taken to be a measure of the surface chemical heterogeneity. The attachment of γ-glycidoxypropyltrimethoxy silane (GPS) to glass decreased the pull-off forces relative to the clean glass and made the surface more uniform. The subsequent hydrolysis of the terminal epoxide groups resulted in a larger surface heterogeneity which was modeled by two populations of the terminal hydroxyl groups, each with its own distribution of adhesion forces and force variance. The activation of the hydroxyls with carbonyldiimmidazole (CDI) healed the surface and lowered its adhesion, however, the force variance remained rather large. Finally, the grafting of the α,ω-diamino poly(ethyleneoxide) chains to the CDI-activated glass largely eliminated adhesion except at a few discrete regions. The adhesion on the PEO grafted layer followed the Poisson distribution of the pull-off forces. With the exception of the glass surface, a correlation between the water contact angles and the mean pull-off forces measured with the Si3N4 tip surfaces was found for all modified glass surfaces. PMID:22267896

  20. Pharmacological profiling of zebrafish behavior using chemical and genetic classification of sleep-wake modifiers.

    PubMed

    Nishimura, Yuhei; Okabe, Shiko; Sasagawa, Shota; Murakami, Soichiro; Ashikawa, Yoshifumi; Yuge, Mizuki; Kawaguchi, Koki; Kawase, Reiko; Tanaka, Toshio

    2015-01-01

    Sleep-wake states are impaired in various neurological disorders. Impairment of sleep-wake states can be an early condition that exacerbates these disorders. Therefore, treating sleep-wake dysfunction may prevent or slow the development of these diseases. Although many gene products are likely to be involved in the sleep-wake disturbance, hypnotics and psychostimulants clinically used are limited in terms of their mode of action and are not without side effects. Therefore, there is a growing demand for developing new hypnotics and psychostimulants with high efficacy and few side effects. Toward this end, animal models are indispensable for use in genetic and chemical screens to identify sleep-wake modifiers. As a proof-of-concept study, we performed behavioral profiling of zebrafish treated with chemical and genetic sleep-wake modifiers. We were able to demonstrate that behavioral profiling of zebrafish treated with hypnotics or psychostimulants from 9 to 10 days post-fertilization was sufficient to identify drugs with specific modes of action. We were also able to identify behavioral endpoints distinguishing GABA-A modulators and hypocretin (hcrt) receptor antagonists and between sympathomimetic and non-sympathomimetic psychostimulants. This behavioral profiling can serve to identify genes related to sleep-wake disturbance associated with various neuropsychiatric diseases and novel therapeutic compounds for insomnia and excessive daytime sleep with fewer adverse side effects.

  1. Chemically modified inulin microparticles serving dual function as a protein antigen delivery vehicle and immunostimulatory adjuvant.

    PubMed

    Gallovic, Matthew D; Montjoy, Douglas G; Collier, Michael A; Do, Clement; Wyslouzil, Barbara E; Bachelder, Eric M; Ainslie, Kristy M

    2016-03-01

    To develop a new subunit vaccine adjuvant, we chemically modified a naturally-occurring, immunostimulatory inulin polysaccharide to produce an acid-sensitive biopolymer (acetalated inulin, Ace-IN). Various hydrophobic Ace-IN polymers were formed into microparticles (MPs) by oil-in-water emulsions followed by solvent evaporation These Ace-IN MPs possessed tunable degradation characteristics that, unlike polyesters used in FDA-approved microparticulate formulations, had only pH-neutral hydrolytic byproducts. Macrophages were passively targeted with cytocompatible Ace-IN MPs. TNF-α production by macrophages treated with Ace-IN MPs could be altered by adjusting the polymers' chemistry. Mice immunized with Ace-IN MPs encapsulating a model ovalbumin (OVA) antigen showed higher production of anti-OVA IgG antibody levels relative to soluble antigen. The antibody titers were also comparable to an alum-based formulation. This proof-of-concept establishes the potential for chemically-modified inulin MPs to simultaneously enable dual functionality as a stimuli-controlled antigen delivery vehicle and immunostimulatory adjuvant.

  2. Improved magnetic properties and growth anisotropy of chemically modified Sr ferrites

    NASA Astrophysics Data System (ADS)

    Lee, Jung W.; Cho, Yong S.; Amarakoon, Vasantha R. W.

    1999-04-01

    Magnetic properties and microstructural characteristics of SrOṡ5.9Fe2O3 chemically modified with Si and Ca were investigated by changing experimental parameters such as additive composition, the ratio of Ca/Si, and sintering condition. A novel particulate coating method utilizing sol-gel reactions was used to uniformly incorporate the additives of Si and Ca. This method was very successful in obtaining homogeneous grain growth and fine grains. A sample containing the gel additives of 0.6 wt % SiO2 and 0.7 wt % CaO and sintered at 1200 °C for 4 h was found to significantly suppress abnormal grain growth, resulting in submicron-sized grains and high density. A distinct grain boundary phase containing Si and Ca was observed by increasing the sintering temperature to 1250 °C. The resultant microstructural characteristics favorably affected magnetic properties. For example, the chemically modified sample exhibited a higher coercivity of 3530 Oe compared to a value of 2050 Oe obtained for the sample without the additives. On the other hand, an increase in the ratio of Ca/Si or in sintering temperature tended to induce a large anisotropy during grain growth.

  3. Efficient photochemical water splitting by a chemically modified n-TiO2.

    PubMed

    Khan, Shahed U M; Al-Shahry, Mofareh; Ingler, William B

    2002-09-27

    Although n-type titanium dioxide (TiO2) is a promising substrate for photogeneration of hydrogen from water, most attempts at doping this material so that it absorbs light in the visible region of the solar spectrum have met with limited success. We synthesized a chemically modified n-type TiO2 by controlled combustion of Ti metal in a natural gas flame. This material, in which carbon substitutes for some of the lattice oxygen atoms, absorbs light at wavelengths below 535 nanometers and has a lower band-gap energy than rutile (2.32 versus 3.00 electron volts). At an applied potential of 0.3 volt, chemically modified n-type TiO2 performs water splitting with a total conversion efficiency of 11% and a maximum photoconversion efficiency of 8.35% when illuminated at 40 milliwatts per square centimeter. The latter value compares favorably with a maximum photoconversion efficiency of 1% for n-type TiO2 biased at 0.6 volt.

  4. Voltammetric determination of 4-nitrophenol at a sodium montmorillonite-anthraquinone chemically modified glassy carbon electrode.

    PubMed

    Hu, S; Xu, C; Wang, G; Cui, D

    2001-03-30

    A new method for the determination of 4-nitrophenol(4-NP) by differential pulse voltammetry (DPV) based on adsorptive stripping technique was described. Cyclic voltammetry (CV) and linear scan voltammetry (LSV) were used in a comparative investigation into the electrochemical reduction of 4-NP at a Na-montmorillonite(SWy-2) and anthraquione (AQ) modified glassy carbon electrode. With this chemically modified electrode, 4-NP was first irreversibly reduced from phiNO(2) to phiNHOH at -0.78 V. A couple of well-defined redox peaks at +0.22 V (vs. SCE) were responsible for a two-electron redox peak between phiNHOH and phiNO. Studies on the effect of pH on the peak height and peak potential were carried out over the pH range 2.0-9.0 with the phosphate buffer solution. A pH of 3.4 was chosen as the optimum pH. The other experimental parameters, such as film thickness, accumulation time and potential etc. were optimized. Anodic peak currents were found to be linearly related to concentration of 4-NP over the range 0.3-45 mg l(-1), with a detection limit of 0.02 mg l(-1). The interference of organic and inorganic species on the voltammetric response have been studied. This modified electrode can be used to the determination of 4-NP in water samples.

  5. Chemical etching mechanism and properties of microstructures in sapphire modified by femtosecond laser

    NASA Astrophysics Data System (ADS)

    Liu, Manyu; Hu, Youwang; Sun, Xiaoyan; Wang, Cong; Zhou, Jianying; Dong, Xinran; Yin, Kai; Chu, Dongkai; Duan, Ji'an

    2017-01-01

    Sapphire, with extremely high hardness, high-temperature stability and wear resistance, often corroded in molten KOH at 300 °C after processing. The fabrication of microstructures on sapphire substrate performed by femtosecond laser irradiation combined with KOH solution chemical etching at room temperature is presented. It is found that this method reduces the harsh requirements of sapphire corrosion. After femtosecond irradiation, the sapphire has a high corrosion speed at room temperature. Through the analysis of Raman spectrum and XRD spectrum, a novel insight of femtosecond laser interaction with sapphire (α-Al2O3) is proposed. Results indicated that grooves on sapphire surface were formed by the lasers ablation removal, and the groove surface was modified in a certain depth. The modified area of the groove surface was changed from α-Al2O3 to γ-Al2O3. In addition, the impacts of three experimental parameters, laser power, scanning velocities and etching time, on the width and depth of microstructures are investigated, respectively. The modified area dimension is about 2 μm within limits power and speed. This work could fabricate high-quality arbitrary microstructures and enhance the performance of sapphire processing.

  6. [Oligonucleotide analogues bearing an acyclonucleoside linked by an internucleotide amide bond].

    PubMed

    Kochetkova, S V; Fillipova, E A; Kolganova, N A; Timofeev, E N; Florent'ev, V L

    2008-01-01

    Oligonucleotide analogues bearing an acyclocytidine linked to thymidine by an amide (3'-O-CH2-CO-N-5') bond were synthesized. Melting curves of duplexes formed by modified oligonucleotides and complementary natural oligomers were obtained and thermodynamic parameters of their formation were measured. Replacement of dCpT by a modified dinucleotide only moderately decreased the melting temperature of these modified duplexes in comparison with unmodified duplexes containing complementary natural bases. CD spectra of modified duplexes were studied, and the duplex spatial structures are discussed. The English version of the paper: Russian Journal of Bioorganic Chemistry, 2008, vol. 34, no. 2; see also http://www.maik.ru.

  7. Thermodynamics of Oligonucleotide Duplex Melting

    ERIC Educational Resources Information Center

    Schreiber-Gosche, Sherrie; Edwards, Robert A.

    2009-01-01

    Melting temperatures of oligonucleotides are useful for a number of molecular biology applications, such as the polymerase chain reaction (PCR). Although melting temperatures are often calculated with simplistic empirical equations, application of thermodynamics provides more accurate melting temperatures and an opportunity for students to apply…

  8. Thermodynamics of Oligonucleotide Duplex Melting

    NASA Astrophysics Data System (ADS)

    Schreiber-Gosche, Sherrie; Edwards, Robert A.

    2009-05-01

    Melting temperatures of oligonucleotides are useful for a number of molecular biology applications, such as the polymerase chain reaction (PCR). Although melting temperatures are often calculated with simplistic empirical equations, application of thermodynamics provides more accurate melting temperatures and an opportunity for students to apply rigorous thermodynamic analysis to an important biochemical problem. Because the stacking of base pairs on top of one another is a significant factor in the energetics of oligonucleotide melting, several investigators have applied van't Hoff analysis to melting temperature data using a nearest-neighbor model and have obtained entropies and enthalpies for the stacking of bases. The present article explains how the equilibrium constant for the dissociation of strands from double-stranded oligonucleotides can be expressed in terms of the total strand concentration and thus how the total strand concentration influences the melting temperature. It also presents a simplified analysis based on the entropies and enthalpies of stacking that is manually tractable so that students can work examples to help them understand the thermodynamics of oligonucleotide melting.

  9. Molecular Mechanisms of Antisense Oligonucleotides.

    PubMed

    Crooke, Stanley T

    2017-04-01

    In 1987, when I became interested in the notion of antisense technology, I returned to my roots in RNA biochemistry and began work to understand how oligonucleotides behave in biological systems. Since 1989, my research has focused primarily on this topic, although I have been involved in most areas of research in antisense technology. I believe that the art of excellent science is to frame large important questions that are perhaps not immediately answerable with existing knowledge and methods, and then conceive a long-term (multiyear) research strategy that begins by answering the most pressing answerable questions on the path to the long-term goals. Then, a step-by-step research pathway that will address the strategic questions posed must be implemented, adjusting the plan as new things are learned. This is the approach we have taken at Ionis. Obviously, to create antisense technology, we have had to address a wide array of strategic questions, for example, the medicinal chemistry of oligonucleotides, manufacturing and analytical methods, pharmacokinetics and toxicology, as well as questions about the molecular pharmacology of antisense oligonucleotides (ASOs). Each of these endeavors has consumed nearly three decades of scientific effort, is still very much a work-in-progress, and has resulted in hundreds of publications. As a recipient of the Lifetime Achievement Award 2016 granted by the Oligonucleotide Therapeutic Society, in this note, my goal is to summarize the contributions of my group to the efforts to understand the molecular mechanisms of ASOs.

  10. Molecular Mechanisms of Antisense Oligonucleotides

    PubMed Central

    2017-01-01

    In 1987, when I became interested in the notion of antisense technology, I returned to my roots in RNA biochemistry and began work to understand how oligonucleotides behave in biological systems. Since 1989, my research has focused primarily on this topic, although I have been involved in most areas of research in antisense technology. I believe that the art of excellent science is to frame large important questions that are perhaps not immediately answerable with existing knowledge and methods, and then conceive a long-term (multiyear) research strategy that begins by answering the most pressing answerable questions on the path to the long-term goals. Then, a step-by-step research pathway that will address the strategic questions posed must be implemented, adjusting the plan as new things are learned. This is the approach we have taken at Ionis. Obviously, to create antisense technology, we have had to address a wide array of strategic questions, for example, the medicinal chemistry of oligonucleotides, manufacturing and analytical methods, pharmacokinetics and toxicology, as well as questions about the molecular pharmacology of antisense oligonucleotides (ASOs). Each of these endeavors has consumed nearly three decades of scientific effort, is still very much a work-in-progress, and has resulted in hundreds of publications. As a recipient of the Lifetime Achievement Award 2016 granted by the Oligonucleotide Therapeutic Society, in this note, my goal is to summarize the contributions of my group to the efforts to understand the molecular mechanisms of ASOs. PMID:28080221

  11. Thermodynamics of Oligonucleotide Duplex Melting

    ERIC Educational Resources Information Center

    Schreiber-Gosche, Sherrie; Edwards, Robert A.

    2009-01-01

    Melting temperatures of oligonucleotides are useful for a number of molecular biology applications, such as the polymerase chain reaction (PCR). Although melting temperatures are often calculated with simplistic empirical equations, application of thermodynamics provides more accurate melting temperatures and an opportunity for students to apply…

  12. Dual-tracer method to estimate coral reef response to a plume of chemically modified seawater

    NASA Astrophysics Data System (ADS)

    Maclaren, J. K.; Caldeira, K.

    2013-12-01

    We present a new method, based on measurement of seawater samples, to estimate the response of a reef ecosystem to a plume of an additive (for example, a nutrient or other chemical). In the natural environment, where there may be natural variability in concentrations, it can be difficult to distinguish between changes in concentrations that would occur naturally and changes in concentrations that result from a chemical addition. Furthermore, in the unconfined natural environment, chemically modified water can mix with waters that have not been modified, making it difficult to distinguish between effects of dilution and effects of chemical fluxes or transformations. We present a dual-tracer method that extracts signals from observations that may be affected by both natural variability and dilution. In this dual-tracer method, a substance (in our example case, alkalinity) is added to the water in known proportion to a passive conservative tracer (in our example case, Rhodamine WT dye). The resulting plume of seawater is allowed to flow over the study site. Two transects are drawn across the plume at the front and back of the study site. If, in our example, alkalinity is plotted as a function of dye concentration for the front transect, the slope of the resulting mixing line is the ratio of alkalinity to dye in the added fluid. If a similar mixing line is measured and calculated for the back transect, the slope of this mixing line will indicate the amount of added alkalinity that remains in the water flowing out of the study site per unit of added dye. The ratio of the front and back slopes indicates the fraction of added alkalinity that was taken up by the reef. The method is demonstrated in an experiment performed on One Tree Reef (Queensland, Australia) aimed at showing that ocean acidification is already affecting coral reef growth. In an effort to chemically reverse some of the changes to seawater chemistry that have occurred over the past 200 years, we added

  13. Gene cloning based on long oligonucleotide probes

    SciTech Connect

    Wood, W.I.

    1987-01-01

    The most commonly used technique for gene cloning has been to utilize oligonucleotide probe based on protein sequence data. Of course this approach requires characterized and purified protein so that at least a portion of amino acid sequence can be determined and used to infer the corresponding DNA sequence. Based on the amino acid sequence information, either short or long oligonucleotide probes can be synthesized chemically. Long probes are typically 30-100 nucleotides long and are a single sequence based on a best guess for each codon. The long probe approach was first used to screen for three different genes: bovine trypsin inhibitor, human insulin-like growth factor I, and human factor IX. There are three advantages of long probes. (1) Any stretch of amino acid sequence 10 or longer can be used. (2) The amino acid sequence need not be absolutely correct. (3) These probes can be used to screen high-complexity libraries with fewer false positives. In spite of the uncertainties over codon selection, the long probe approach is currently the method of choice in screening for genes based on protein sequence data.

  14. Optical second-harmonic spectroscopy of chemically-modified silicon and silicon-dioxide surfaces

    NASA Astrophysics Data System (ADS)

    Downer, M. C.; Jiang, Y. Y.; Lim, D.

    2002-03-01

    The optical second-harmonic generation (SHG) response of solid interfaces depends sensitively on chemical termination. We present a spectroscopic SHG study of chemically-modified Si and SiO2 surfaces that elucidates at the atomic level how adsorbates alter the electronic structure, and thereby the SHG response, of the surface. SHG spectra were measured on reconstructed Si(001) surfaces in UHV that were exposed to atomic H or to gas-phase precursors of Ge and B, and on the surfaces of 30 angstrom-thick silicon dioxide films on silicon substrates that were chemically functionalized to nucleate silicon nanocrystal formation. Microscopic models show that adsorbate-induced alterations of the surface SHG spectra are correlated with changes in near-surface charge polarization caused by surface dimer buckling, transfer of electrons to boron acceptors in second layer substitutional sites, or transfer of electrons from the silicon substrate, through the tunneling oxide, to the surface nanocrystals [1]. 1. M. C. Downer, B. S. Mendoza and V. I. Gavrilenko, Surf. Interface Anal. 31, 966 (2001).

  15. Fabrication and long-wavelength characterization of neat and chemically modified graphene

    SciTech Connect

    Kalugin, Nikolai G.

    2014-03-31

    Graphene, a single- or several layer-thick carbon, attracts significant research activity because of its exceptional material properties. Graphene is a promising material for optoelectronic applications. Neat graphene demonstrates potential as a material for long wavelength photodetectors working at elevated temperatures. Chemical modification of graphene opens up many new applications of this material in electronics, in new composite materials, and in new catalysts for different chemical processes. Chemical vapor deposition-grown large-area graphene can be successfully modified with the creation of benzyne attachments. The investigation of microwave properties is an important part of graphene research. Two variants of near-field long wavelength microscopy were found efficient with graphene. Measurements with a probe formed by an electrically open end of a 4 GHz half-lambda parallel-strip transmission line resonator allow the implementation of an electrodynamic model of graphene microwave impedance. The results of near-field scanning superconducting quantum interference device (SQUID) RF microscopy of graphite and graphene at 200 MHz shed light on mechanisms of AC graphene response: screening currents induced in graphene by an external RF magnetic field tend to localize near structural defects.

  16. Physico-Chemical Properties and Biodegradability of Genetically Modified Populus trichocarpa and Pinus taeda

    NASA Astrophysics Data System (ADS)

    Edmunds, Charles Warren

    Increasing concerns over greenhouse gas emissions and the finite supply of fossil fuels lead to the goal of utilizing lignocellulosic feedstocks for biofuels, platform chemicals, and biocomposites. Lignin is responsible for the recalcitrance of lignocellulosic biomass and is a major barrier to its deconstruction. Great progress has been made in mapping and modifying the lignin biosynthetic pathway. However, the link between the genetic modification, resulting chemical and physical properties of the wood, and how these properties influence the thermomechanical and recalcitrance to biological and chemical degradation needs further investigation. In this dissertation, the study of modified Populus trichocarpa and Pinus taeda were utilized to accomplish this goal. Thermo-mechanical properties of genetically modified P. trichocarpa with altered lignin content and/or lignin structure were measured with a series of tools including; dynamic mechanical analysis, nuclear magnetic resonance, and wet chemistry techniques. Results demonstrated lignin content and lignin structure likely influence the glass transition temperature (Tg), and that decreased lignin content and the corresponding higher proportion of cell wall carbohydrates may contribute to increased molecular mobility in the wood polymer structure. The effect of lignin biosynthetic pathway modification on biological degradation of these transgenic wood specimens was of interest. However, experimental methods for fungal treatment on small young greenhouse-grown wood specimens are not well established. Therefore, a project was undertaken to develop a method for fungal inoculation and incubation for these unique specimens. Several parameters were tested, and a fungal treatment method was identified with sufficient weight loss after decay and significant reduction in variation of weight loss between replicates compared to previous experiments by direct inoculation of wood with liquid malt extract fungal culture

  17. Geographical and geological origin of natural graphite heavily influence the electrical and electrochemical properties of chemically modified graphenes.

    PubMed

    Wong, Colin Hong An; Sofer, Zdeněk; Pumera, Martin

    2015-06-01

    Natural graphite is an important precursor for the production of chemically modified graphenes in bulk quantities for electrochemical applications. These natural graphites have varying fundamental properties due to the different geological processes and environments at their points of origin, which are expected to affect their chemical reactivity and hence the properties of the derived graphene materials. Four different natural graphites with known geographical and geological origins were exposed to a modified Hummers oxidation method and the resulting graphite oxides were studied. The graphite oxides were shown to have different extents of oxidation and types of oxygen groups, which directly influenced their electrochemical properties. These differences were propagated further in the subsequent chemical reduction of the graphite oxides, and the reduced graphene oxides exhibited significantly different reduction efficiencies and electrical conductivities. These findings show that the choice of natural graphite of known origin is important to synthesize chemically modified graphenes with a desired set of properties.

  18. Cellular uptake and trafficking of antisense oligonucleotides.

    PubMed

    Crooke, Stanley T; Wang, Shiyu; Vickers, Timothy A; Shen, Wen; Liang, Xue-Hai

    2017-03-01

    Antisense oligonucleotides (ASOs) modified with phosphorothioate (PS) linkages and different 2' modifications can be used either as drugs (e.g., to treat homozygous familial hypercholesterolemia and spinal muscular atrophy) or as research tools to alter gene expression. PS-ASOs can enter cells without additional modification or formulation and can be designed to mediate sequence-specific cleavage of different types of RNA (including mRNA and non-coding RNA) targeted by endogenous RNase H1. Although PS-ASOs function in both the cytoplasm and nucleus, localization to different subcellular regions can affect their therapeutic potency. Cellular uptake and intracellular distribution of PS ASOs are mediated by protein interactions. The main proteins involved in these processes have been identified, and intracellular sites in which PS ASOs are active, or inactive, cataloged.

  19. Antisense Oligonucleotides: Treatment Strategies and Cellular Internalization

    PubMed Central

    Miller, Colton M.; Harris, Edward N.

    2016-01-01

    The clinical applicaton of antisense oligonucleotides (ASOs) is becoming more of a reality as several drugs have been approved for the treatment of human disorders and many others are in various phases in development and clinical trials. ASOs are short DNA/RNA oligos which are heavily modified to increase their stability in biological fluids and retain the properties of creating RNA-RNA and DNA-RNA duplexes that knock-down or correct genetic expression. This review outlines several strategies that ASOs utilize for the treatment of various congenital diseases and syndromes that develop with aging. In addition, we discuss some of the mechanisms for specific non-targeted ASO internalization within cells. PMID:28374018

  20. Conjugation of fluorescent proteins with DNA oligonucleotides.

    PubMed

    Lapiene, Vidmantas; Kukolka, Florian; Kiko, Kathrin; Arndt, Andreas; Niemeyer, Christof M

    2010-05-19

    This work describes the synthesis of covalent ssDNA conjugates of six fluorescent proteins, ECFP, EGFP, E(2)GFP, mDsRed, Dronpa, and mCherry, which were cloned with an accessible C-terminal cystein residue to enable site-selective coupling using a heterobispecific cross-linker. The resulting conjugates revealed similar fluorescence emission intensity to the unconjugated proteins, and the functionality of the tethered oligonucleotide was proven by specific Watson-Crick base pairing to cDNA-modified gold nanoparticles. Fluorescence spectroscopy analysis indicated that the fluorescence of the FP is quenched by the gold particle, and the extent of quenching varied with the intrinsic spectroscopic properties of FP as well as with the configuration of surface attachment. Since this study demonstrates that biological fluorophores can be selectively incorporated into and optically coupled with nanoparticle-based devices, applications in DNA-based nanofabrication can be foreseen.

  1. Degradation of nuclease-stabilized RNA oligonucleotides in Mycoplasma-contaminated cell culture media.

    PubMed

    Hernandez, Frank J; Stockdale, Katie R; Huang, Lingyan; Horswill, Alexander R; Behlke, Mark A; McNamara, James O

    2012-02-01

    Artificial RNA reagents such as small interfering RNAs (siRNAs) and aptamers often must be chemically modified for optimal effectiveness in environments that include ribonucleases. Mycoplasmas are common bacterial contaminants of mammalian cell cultures that are known to produce ribonucleases. Here we describe the rapid degradation of nuclease-stabilized RNA oligonucleotides in a human embryonic kidney 293 (HEK) cell culture contaminated with Mycoplasma fermentans, a common species of mycoplasma. RNA with 2'-fluoro- or 2'-O-methyl- modified pyrimidines was readily degraded in conditioned media from this culture, but was stable in conditioned media from uncontaminated HEK cells. RNA completely modified with 2'-O-methyls was not degraded in the mycoplasma-contaminated media. RNA zymogram analysis of conditioned culture media and material centrifuged from the media revealed several distinct protein bands (ranging from 30 to 68 kDa) capable of degrading RNA with 2'-fluoro- or 2'-O-methyl-modified pyrimidines. Finally, the mycoplasma-associated nuclease was detected in material centrifuged from the contaminated culture supernatants in as little as 15 minutes with an RNA oligo-containing 2'-O-methyl-modified pyrimidines and labeled with a 5'-fluorescein amidite (FAM) and 3'-quencher. These results suggest that mycoplasma contamination may be a critical confounding variable for cell culture experiments involving RNA-based reagents, with particular relevance for applications involving naked RNA (e.g., aptamer-siRNA chimeras).

  2. Functionalization of PVC membrane with ss oligonucleotides for a potentiometric biosensor.

    PubMed

    Shishkanova, T V; Volf, R; Krondak, M; Král, V

    2007-05-15

    A novel application of a single stranded (ss) oligonucleotide as an active component of polymeric membrane in an ion-selective electrode (ISE) is described. The original oligonucleotides, oligo(dA)(15), modified by cholesterol, triphenylmethyl and hexadecyl derivatives, were immobilized into poly(vinyl chloride) (PVC) membrane using extraction protocol. In parallel, the adsorption protocol was used to immobilize unmodified oligo(dA)(15) on the PVC membrane based on tridodecylmethyammonium chloride (TDDMA(+)Cl(-)). Immobilization of ss oligonucleotide probe through spacer was more effective for the potentiometric detection of the hybridization between complementary oligonucleotides. It was found that cholesterol-oligo(dA)(15) modified membranes were sensitive toward complementary oligo(dT)(15) in the concentration range 2-80 nM at pH 7. An explanation for the detection mechanism is proposed.

  3. Myeloid cells as a target for oligonucleotide therapeutics: turning obstacles into opportunities.

    PubMed

    Kortylewski, Marcin; Moreira, Dayson

    2017-08-01

    Immunotherapies emerged as an alternative for cancer treatment, yet their clinical efficacies are still limited, especially in case of solid tumors. Myeloid immune cells, such as macrophages and myeloid-derived suppressor cells (MDSCs), are often hijacked by tumors and become pivotal inhibitors of antitumor immunity. Immunosuppressive functions of tumor-associated myeloid cells result from the activity of Signal Transducer and Activator of Transcription 3 (STAT3), a transcription factor with well-defined tumorigenic and tolerogenic roles in human cancers. To overcome challenges in the development of pharmacological STAT3 inhibitors, we recently developed oligonucleotide-based strategies for cell-selective, in vivo STAT3 targeting. Conjugation of a STAT3siRNA or decoy STAT3 inhibitors to synthetic Toll-like Receptor 9 (TLR9) agonists, CpG oligonucleotides, allowed for selective delivery into TLR9-positive cells. Cellular target for CpG-STAT3 inhibitors include non-malignant, tumor-associated myeloid cells, such as polymorphonuclear MDSCs, as well as cancer cells in acute myeloid leukemia, B cell lymphoma and in certain solid tumors. The chemically modified CpG-STAT3 inhibitors resist serum nucleases and thus can be administered intravenously. Their potency relies on the intracellular gain-of-function effect: release of the central immune checkpoint regulator (STAT3) to unleash proinflammatory signaling (CpG/TLR9) in the same antigen-presenting cell. At the cellular level, CpG-STAT3 inhibitors exert two-pronged effect by rescuing T cells from the immune checkpoint control while decreasing survival of cancer cells. In this article, we review the preclinical data on CpG-STAT3 inhibitors and discuss perspectives of using TLR9-targeted delivery of oligonucleotide therapeutics for the generation of novel, more effective and safer cancer immunotherapies.

  4. Chemical synthesis and biochemical properties of oligonucleotides that contain the (5'S,5S,6S)-5',6-cyclo-5-hydroxy-5,6-dihydro-2'-deoxyuridine DNA lesion.

    PubMed

    Muller, Evelyne; Gasparutto, Didier; Cadet, Jean

    2002-06-03

    The first chemical synthesis of (5'S,5S,6S)-5',6-cyclo-5-hydroxy-5,6-dihydro-2'-deoxyuridine [(5'S,5S,6S)-cyclo-5-OH-dHdU], a radiation-induced decomposition product of 2'-deoxycytidine in aerated solution, is reported. Subsequently, 2'-deoxycytidine was incorporated into oligodeoxyribonucleotides with defined sequences by using an optimized system of protection that takes into account the reactivity and stability of the modified building blocks. After deprotection and purification, the chemical composition of the modified DNA fragments was assessed by enzymatic digestions and mass spectrometry measurements. The MS analyses confirmed the presence and integrity of the lesion within the synthesized DNA fragments. In vitro replication and repair studies showed that (5'S,5S,6S)-cyclo-5-OH-dHdU acts as a block for DNA polymerases when inserted into DNA oligomers and is not excised by any of the tested DNA N-glycosylases. Therefore, (5'S,5S,6S)-cyclo-5-OH-dHdU may represent a potential lethal lesion within the cell if it is not removed by the nucleotide excision repair machinery.

  5. Efficient ex vivo delivery of chemically modified messenger RNA using lipofection and magnetofection.

    PubMed

    Badieyan, Zohreh Sadat; Pasewald, Tamara; Mykhaylyk, Olga; Rudolph, Carsten; Plank, Christian

    2017-01-22

    Recently, chemically modified mRNA (cmRNA) therapeutics have been the subject of extensive application-oriented research in both academia and industry as a safer alternative for gene and recombinant protein therapies. However, the lack of an efficient delivery system hinders widespread application. Here we used ∼100-nm lipoplexes and magnetic lipoplexes that can protect cmRNA from RNases and efficiently deliver it into muscle and fat tissues as well as to the endothelium of the carotid artery. Establishing magnetofection for ex vivo cmRNA delivery for the first time, we suggest this method for potential enhanced and targeted delivery of cmRNA. This study introduces optimal cmRNA complexes with high ex vivo efficiency as good candidates for further in vivo cmRNA delivery.

  6. Gram-Scale Chemical Synthesis of Base-Modified Ribonucleoside-5'-O-Triphosphates.

    PubMed

    Shanmugasundaram, Muthian; Senthilvelan, Annamalai; Kore, Anilkumar R

    2016-12-01

    This unit delineates a simple, reliable, straight-forward, general, and efficient chemical method for the synthesis of modified nucleoside-5'-O-triphosphates such as 5-methylcytidine-5'-O-triphosphate (5-Me-CTP), pseudouridine-5'-O-triphosphate (pseudo-UTP), and N(1) -methylpseudouridine-5'-O-triphosphate (N(1) -methylpseudo-UTP), starting from the corresponding nucleoside. The reaction utilizes an improved protection-free "one-pot, three-step" Ludwig synthetic strategy that involves the monophosphorylation of the nucleoside with phosphorous oxychloride followed by reaction with tributylammonium pyrophosphate and subsequent hydrolysis of the resulting cyclic intermediate to furnish the corresponding ribonucleoside triphosphate (NTP) in moderate yields. It is noteworthy that the reaction affords high purity (>99.5%) NTPs after DEAE Sepharose column purification. © 2016 by John Wiley & Sons, Inc. Copyright © 2016 John Wiley & Sons, Inc.

  7. Impedance based detection of chemical warfare agent mimics using ferrocene-lysine modified carbon nanotubes.

    PubMed

    Diakowski, Piotr M; Xiao, Yizhi; Petryk, Michael W P; Kraatz, Heinz-Bernhard

    2010-04-15

    A recognition layer formed by multiwalled carbon nanotubes (MWCNTs) covalently modified with a ferrocene-lysine conjugate deposited on the indium tin oxide (ITO) was investigated as a sensor for chemical warfare agent (CWA) mimics. Electrochemical impedance spectroscopy measurements showed that upon addition of CWA mimic dramatic changes occurred in the electrical properties of the recognition layer. These changes allowed the detection of nerve agent analogues at the micromolar level, and a limited sensitivity was observed toward a sulfur mustard mimic. Experimental parameters were optimized so as to allow the detection of CWAs at single frequency, thereby significantly reducing acquisition time and simplifying data treatment. A proposed method of detection represents a significant step toward the design of an affordable and "fieldable" electrochemical CWA sensor.

  8. Noninvasive Surface Coverage Determination of Chemically Modified Conical Nanopores that Rectify Ion Transport

    SciTech Connect

    Liu, Juan; Wang, Dengchao; Kvetny, Maksim; Brown, Warren; Li, Yan; Wang, Gangli

    2012-01-01

    Surface modification will change the surface charge density (SCD) at the signal-limiting region of nanochannel devices. By fitting the measured i V curves in simulation via solving the Poisson and Nernst Planck equations, the SCD and therefore the surface coverage can be noninvasively quantified. Amine terminated organosilanes are employed to chemically modify single conical nanopores. Determined by the protonation deprotonation of the functional groups, the density and polarity of surface charges are adjusted by solution pH. The rectified current at high conductivity states is found to be proportional to the SCD near the nanopore orifice. This correlation allows the noninvasive determination of SCD and surface coverage of individual conical nanopores.

  9. Genome mining expands the chemical diversity of the cyanobactin family to include highly modified linear peptides.

    PubMed

    Leikoski, Niina; Liu, Liwei; Jokela, Jouni; Wahlsten, Matti; Gugger, Muriel; Calteau, Alexandra; Permi, Perttu; Kerfeld, Cheryl A; Sivonen, Kaarina; Fewer, David P

    2013-08-22

    Ribosomal peptides are produced through the posttranslational modification of short precursor peptides. Cyanobactins are a growing family of cyclic ribosomal peptides produced by cyanobacteria. However, a broad systematic survey of the genetic capacity to produce cyanobactins is lacking. Here we report the identification of 31 cyanobactin gene clusters from 126 genomes of cyanobacteria. Genome mining suggested a complex evolutionary history defined by horizontal gene transfer and rapid diversification of precursor genes. Extensive chemical analyses demonstrated that some cyanobacteria produce short linear cyanobactins with a chain length ranging from three to five amino acids. The linear peptides were N-prenylated and O-methylated on the N and C termini, respectively, and named aeruginosamide and viridisamide. These findings broaden the structural diversity of the cyanobactin family to include highly modified linear peptides with rare posttranslational modifications.

  10. Chemically Modified Graphene: The Influence of Structural Properties on the Assessment of Antioxidant Capacity.

    PubMed

    Hui, Kai Hwee; Pumera, Martin; Bonanni, Alessandra

    2015-08-10

    Graphene materials obtained by different synthetic routes possess dissimilar amount of defects and surface functionalities, which can influence their electrochemical performance towards the detection of electroactive probes. Oxygen-containing groups can be either detrimental to the heterogeneous charge transfer or promote favorable interactions between the graphene surface and the analyte of interest, depending on the structure of the latter. Here, we compared three chemically modified graphenes, obtained by various procedures and carrying different amounts of oxygen functionalities, for the detection of standard gallic acid, a compound commonly used as an index of the antioxidant capacity of food and beverages. We found that electrochemically reduced graphene provided the best electrochemical performance in terms of calibration sensitivity, selectivity, and linearity of response. Our findings are important in order to understand the suitability of graphene platforms for the assessment of food quality.

  11. Inhibition of anthrax lethal factor by curcumin and chemically modified curcumin derivatives

    PubMed Central

    Zhang, Yu; Golub, Lorne M.; Johnson, Francis; Simon, Sanford R.

    2014-01-01

    Curcuma longa Curcumin (diferuloylmethane), the active ingredient in the eastern spice turmeric (Curcuma longa), has been shown to inhibit the activities of numerous enzymes and signaling molecules involved in cancer, bacterial and viral infections and inflammatory diseases. We have investigated the inhibitory activities of curcumin and chemically modified curcumin (CMC) derivatives toward lethal factor (LF), the proteolytic component of anthrax toxin produced by the bacterium Bacillus anthracis. Curcumin (Compound 1) appears to inhibit the catalytic activity of LF through a mixture of inhibitory mechanisms, without significant compromise to the binding of oligopeptide substrates, and one CMC derivative in particular, Compound 3 (4-phenylaminocarbonylbis-demethoxycurcumin), is capable of inhibiting LF with potency comparable with the parent compound, while also showing improved solubility and stability. The quantitative reduction in catalytic activity achieved by the different CMC derivatives appears to be a function of the proportion of the multiple mechanisms through which they inhibit the enzyme. PMID:24102525

  12. [The isolation and characteristics of a chemically modified allergen (allergoid) from Dermatophagoides pteronyssinus mites].

    PubMed

    Petrunov, B; Nikolov, G; Konstantinova, D; Antonova, T; Iankova, R

    1996-01-01

    Chemically modified allergens (allergoids) were obtained from house dust mites (Dermatophagoides pteronyssinus). The allergenicity of allergoids in comparison with commercial mite allergen was determined by the skin prick test and by the in vitro test of degranulation of passively sensitized rat mast cells. Changes in allergoid molecules were determined with the use of gel filtration in a column packed with Sephadex G-75, isoelectric focusing in polyacrylamide gel, the determination of the concentration of end amino groups and the enzymatic activity of preparations, as well as HPLC. The possibility of using these methods for controlling the process of modification was studied. The results confirmed the fact that the modification on the allergenic preparation really occurred and the allergenic activity of allergoids was low.

  13. Oligonucleotide directed mutagenesis of Escherichia coli 5S ribosomal RNA: construction of mutant and structural analysis.

    PubMed Central

    Göringer, H U; Wagner, R; Jacob, W F; Dahlberg, A E; Zwieb, C

    1984-01-01

    The ribosomal 5S RNA gene from the rrnB operon of E. coli was mutagenised in vitro using a synthetic oligonucleotide hybridised to M13 ssDNA containing that gene. The oligonucleotide corresponded to the 5S RNA sequence positions 34 to 51 and changed the guanosine at position 41 to a cytidine. The DNA containing the desired mutation was identified by dot blot hybridisation and introduced back into the plasmid pKK 3535 which contains the total rrnB operon in pBR 322. Plasmid coded 5S rRNA was selectively labeled with 32p using a modified maxi-cell system, and the replacement of guanosine G41 by cytidine was confirmed by RNA sequencing. The growth of cells containing mutant 5S rRNA was not altered by the base change, and the 5S rRNA was processed and incorporated into 50S ribosomal subunits and 70S ribosomes. The structure of wildtype and mutant 5S rRNA was compared by chemical modification of accessible guanosines with kethoxal and limited enzymatic digestion using RNase T1 and nuclease S1. These results showed that the wildtype and mutant 5S rRNA do not differ significantly in their structure. Furthermore, the formation, interconversion and stability of the two 5S rRNA A- and B-conformers are unchanged. Images PMID:6091046

  14. A factorial analysis of silanization conditions for the immobilization of oligonucleotides on glass surfaces.

    PubMed

    Halliwell, C M; Cass, A E

    2001-06-01

    The modification of glass surfaces with (3-mercaptopropyl)trimethoxysilane and the application of this to DNA chip technology are described. A range of factors influencing the silanization method, and hence the number of surface-bound, chemically active thiol groups, were investigated using a design of experiment approach based on analysis of variance. The number of thiol groups introduced on glass substrates were measured directly using a specific radiolabel, [14C]cysteamine hydrochloride. For liquid-phase silanization, the number of surface-bound thiol groups was found to be dependent on both postsilanization thermal curing and silanization time and relatively independent of silane concentration, reaction temperature, and sample pretreatment. Depending on the conditions used in liquid-phase silanization, (1.3-9.0) x 10(12) thiol groups/cm2 on the glass samples were bound. The reliability and repeatability of liquid- and vacuum-phase silanization were also investigated. Eighteen-base oligonucleotide probes were covalently attached to the modified surfaces via a 3'-amino modification on the DNA and subsequent reaction with the cross-linking reagent N-(gamma-maleimidobutyryloxy) succinimide ester (GMBS). The resulting probe levels were determined and found to be stoichiometric with that of the introduced thiol groups. These results demonstrate that silanization of glass surfaces under specific conditions, prior to probe attachment, is of great importance in the development of DNA chips that use the simple concept of the covalent attachment of presynthesized oligonucleotides to silicon oxide surfaces.

  15. Structural resistance of chemically modified 1-D nanostructured titanates in inorganic acid environment

    SciTech Connect

    Marinkovic, Bojan A.; Fredholm, Yann C.; Morgado, Edisson

    2010-10-15

    Sodium containing one-dimensional nanostructured layered titanates (1-D NSLT) were produced both from commercial anatase powder and Brazilian natural rutile mineral sands by alkali hydrothermal process. The 1-D NSLT were chemically modified with proton, cobalt or iron via ionic exchange and all products were additionally submitted to intensive inorganic acid aging (pH = 0.5) for 28 days. The morphology and crystal structure transformations of chemically modified 1-D NSLT were followed by transmission electron microscopy, powder X-ray diffraction, selected area electron diffraction and energy dispersive spectroscopy. It was found that the original sodium rich 1-D NSLT and cobalt substituted 1-D NSLT were completely converted to rutile nanoparticles, while the protonated form was transformed in a 70%-30% (by weight) anatase-rutile nanoparticles mixture, very similar to that of the well-known TiO{sub 2}-photocatalyst P25 (Degussa). The iron substituted 1-D NSLT presented better acid resistance as 13% of the original structure and morphology remained, the rest being converted in rutile. A significant amount of remaining 1-D NSLT was also observed after the acid treatment of the product obtained from rutile sand. The results showed that phase transformation of NSLT into titanium dioxide polymorph in inorganic acid conditions were controllable by varying the exchanged cations. Finally, the possibility to transform, through acid aging, 1-D NSLT obtained from Brazilian natural rutile sand into TiO{sub 2}-polymorphs was demonstrated for the first time to the best of authors' knowledge, opening path for producing TiO{sub 2}-nanoproducts with different morphologies through a simple process and from a low cost precursor.

  16. Influence of ionizing radiation on physical properties of native and chemically modified starches

    NASA Astrophysics Data System (ADS)

    Henry, F.; Costa, L. C.; Aymes-Chodur, C.

    2010-01-01

    Cationic and anionic starches (chemically modified) and native starch (non-modified) were exposed to electron-beam irradiation at doses of 25, 75 and 150 kGy. The increasing solubility in water, due to chain scission and creation of polar groups as already mentioned in the literature, has been confirmed using several physical methodologies. Impedance Spectroscopy (IS) on water solutions was carried out in order to calculate the relaxation parameters of the Cole-Cole model and α and β parameters of the Jones-Dole equation, which show the influence of radiation dose on increasing polarity, decreasing of molecular mass and increasing of electrostatic attraction between chains. Infra-red spectroscopy (FTIR) and Differential Scanning Calorimetry (DSC) confirm the formation of polar groups that retain water. The aim of this work was to confirm that the control of chain scission and functionalization of starches with irradiation could then be used in a future work to create nanoparticles by complex coacervation in an aqueous base.

  17. Development of improved nanosilver-based antibacterial textiles via synthesis of versatile chemically modified cotton fabrics.

    PubMed

    Hebeish, A; El-Shafei, A; Sharaf, S; Zaghloul, S

    2014-11-26

    Cationization of cotton fabric form was effected by reacting the cellulose with 3-chloro-2 hydroxypropyl trimethyl ammonium chloride in presence of sodium hydroxide as per the pad dry cure method. Thus obtained cationized cotton cellulose was reacted with a reactive copolymer, namely, reactive β-cyclodextrin grafted with polyacrylic acid (MCT-βCD-g-PAA).Bridging of another copolymer, namely, β-cyclodextrin grafted with polyacrylic acid (βCD-g-PAA) to the cationized fabric using epichlorohydrin crosslinker was also performed. Inclusion of Ag nanoparticles in these three cotton substrates via treatment of the latter with colloid of Ag nanoparticles or through in situ formation of the former was exercised. Characterization of cotton fabric before and after being chemically modified was carried out using FTIR, XRD and SEM. Bacterial examination of the cationized cotton containing either (MCT-βCD-g-PAA) or (βCD-g-PAA) incorporated with Ag nanoparticles showed these substrates function against G+ve and G-ve bacteria. Ability of (MCT-βCD-g-PAA) modified cotton to include hydrophobic molecules was examined.

  18. Ca2+ Selectivity of a Chemically Modified OmpF with Reduced Pore Volume

    PubMed Central

    Miedema, Henk; Vrouenraets, Maarten; Wierenga, Jenny; Gillespie, Dirk; Eisenberg, Bob; Meijberg, Wim; Nonner, Wolfgang

    2006-01-01

    We studied an E. coli OmpF mutant (LECE) containing both an EEEE-like locus, typical of Ca2+ channels, and an accessible and reactive cysteine. After chemical modification with the cysteine-specific, negatively charged (−1e) reagents MTSES or glutathione, this LECE mutant was tested for Ca2+ versus alkali metal selectivity. Selectivity was measured by conductance and zero-current potential. Conductance measurements showed that glutathione-modified LECE had reduced conductance at Ca2+ mole fractions <10−3. MTSES-modified LECE did not. Apparently, the LECE protein is (somehow) a better Ca2+ chelator after modification with the larger glutathione. Zero-current potential measurements revealed a Ca2+ versus monovalent cation selectivity that was highest in the presence of Li+ and lowest in the presence of Cs+. Our data clearly show that after the binding of Ca2+ the LECE pore (even with the bulky glutathione present) is spacious enough to allow monovalent cations to pass. Theoretical computations based on density functional theory combined with Poisson-Nernst-Planck theory and a reduced pore model suggest a functional separation of ionic pathways in the pore, one that is specific for small and highly charged ions, and one that accepts preferentially large ions, such as Cs+. PMID:16997866

  19. Utilization of chemically modified pearl millet starches in preparation of custards with improved cold storage stability.

    PubMed

    Shaikh, Marium; Ali, Tahira Mohsin; Hasnain, Abid

    2017-11-01

    Custards were prepared using five ingredients: milk powder, modified pearl millet starch, sugar, vanilla essence and water. The effect of adding hydroxypropylated starch (HPS), succinylated starch (SUS), oxidised starch (OXS) and acetylated starch (ACS) on cold storage stability, pasting, textural and sensory properties was studied and compared to custards containing native pearl millet starch (NS). Interestingly, all chemically modified starches reduced syneresis and no water weeping was observed in custard sample incorporating hydroxypropylated starch (HPC) even after 7days of cold storage. Viscoamylographic analysis revealed that custard containing succinylated starch (SUC) had the highest peak viscosity (108.8 BU), whereas HPC showed the least set back viscosity (19.0 BU). Sensory results suggested that assessors preferred HPC over other custards. Custards are preferred for their chewy semi-solid texture. Incorporation of hydroxypropylated starch (HPS) increased hardness, gumminess and chewiness which subsequently led to higher sensory scores during subjective analysis. Also, no retrogradation peak was observed for HPS and acetylated starch (ACS) when rescanned after 14 days. Thus, it could be concluded that HPS could be used in custards to confer low temperature stability by reducing syneresis. Copyright © 2017 Elsevier B.V. All rights reserved.

  20. Chemically Modified Plastic Tube for High Volume Removal and Collection of Circulating Tumor Cells

    PubMed Central

    Gaitas, Angelo; Kim, Gwangseong

    2015-01-01

    In this preliminary effort, we use a commercially available and chemically modified tube to selectively capture circulating tumor cells (CTCs) from the blood stream by immobilizing human anti-EpCAM antibodies on the tube's interior surface. We describe the requisite and critical steps required to modify a tube into a cancer cell-capturing device. Using these simple modifications, we were able to capture or entrap about 85% of cancer cells from suspension and 44% of cancer cells from spiked whole blood. We also found that the percentage of cells captured was dependent on the tube's length and also the number of cancer cells present. It is our strong belief that with the utilization of appropriate tube lengths and procedures, we can ensure capture and removal of nearly the entire CTC population in whole blood. Importantly after a patient’s entire blood volume has circulated through the tube, the tube can then be trypsinized to release the captured live CTCs for further analysis and testing. PMID:26176235

  1. Synchrotron Infrared Confocal Microspectroscopical Detection of Heterogeneity Within Chemically Modified Single Starch Granules

    SciTech Connect

    Wetzel, D.; Shi, Y; Reffner, J

    2010-01-01

    This reports the first detection of chemical heterogeneity in octenyl succinic anhydride modified single starch granules using a Fourier transform infrared (FT-IR) microspectroscopical technique that combines diffraction-limited infrared microspectroscopy with a step size that is less than the mask projected spot size focused on the plane of the sample. The high spatial resolution was achieved with the combination of the application of a synchrotron infrared source and the confocal image plane masking system of the double-pass single-mask Continuum{reg_sign} infrared microscope. Starch from grains such as corn and wheat exists in granules. The size of the granules depends on the plant producing the starch. Granules used in this study typically had a median size of 15 {micro}m. In the production of modified starch, an acid anhydride typically is reacted with OH groups of the starch polymer. The resulting esterification adds the ester carbonyl (1723 cm{sup -1}) organic functional group to the polymer and the hydrocarbon chain of the ester contributes to the CH{sub 2} stretching vibration to enhance the intensity of the 2927 cm{sup -1} band. Detection of the relative modifying population on a single granule was accomplished by ratioing the baseline adjusted peak area of the carbonyl functional group to that of a carbohydrate band. By stepping a confocally defined infrared beam as small as 5 {micro}m x 5 {micro}m across a starch granule 1 {micro}m at a time in both the x and y directions, the heterogeneity is detected with the highest possible spatial resolution.

  2. Single and mixed chemically modified carbon paste ion-selective electrodes for determination of ketotifen fumarate.

    PubMed

    Khater, M M; Issa, Y M; Mohamed, S H

    2013-02-01

    New modified carbon paste electrodes for determination of ketotifen fumarate in its pure and pharmaceutical preparations were constructed. The used modifiers are ketotifen phosphotungestate (Keto(3) PT), and ketotifen tetraphenylborate (Keto-TPB). Single and mixed ion-associate electrodes were prepared. Both Keto-TPB and mixed (Keto-TPB and Keto(3) PT) electrodes have a linearity range of 1.00 × 10(-5) -1.00 × 10(-2) mol L(-1) . The slopes were 58.30 and 54.20 mV/decade for Keto-TPB and mixed chemically modified carbon paste electrodes (CMCPE), respectively. The limits of detection were 1.42 × 10(-6) and 1.00 × 10(-5) mol L(-1) for Keto-TPB and mixed CMCPEs, respectively. The potential variation due to pH change is considered acceptable in the pH ranges 4.44-9.11 and 2.50-9.00 for Keto-TPB and mixed ion-exchanger CMCPE, respectively. The response time was ≤10 s for both electrodes. Selectivity coefficients values towards different inorganic cations, sugars, and amino acids reflect high selectivity of the prepared electrodes. Potentiometric titrations and standard addition methods were applied for the determination of ketotifen ion in its pure samples and pharmaceutical formulations (Zaditen tablet and syrup) using proposed electrodes. The electrodes were also tested in flow injection analysis (FIA). The results obtained from both methods were statistically treated by F- and t-tests. The carbon paste electrodes have the advantages of being more easily prepared and longer life span compared to the plastic membrane electrodes previously reported.

  3. Study of permeability changes induced by external stimuli on chemically modified electrodes

    NASA Astrophysics Data System (ADS)

    Perera, Dingiri Mudiyanselage Neluni T.

    This research was focused on understanding how external stimuli affect the permeability of the chemically modified electrodes, and how the materials used in modifying the working electrodes respond to the changes in the surface charge. We adopted a voltammetric type electrochemical sensor to investigate the permeability effects induced by pH and organic solvents. The working electrodes used in this research were chemically modified with thioctic acid self assembled monolayer (TA SAM), track etched polycarbonate membranes (TEPCM) and PS-b-PMMA nanoporous films (polystyrene-block-polymethylmethacrylate). We studied the permeability behavior of each of the material upon application of external stimuli. In chapter 3, the permeability changes induced by change in surface charge of thioctic acid SAM was investigated. The surface charge of the monolayer was tuned by changing pH of the medium, which resulted in decrease of redox current of a negatively charged marker due to deprotonation of the surface --COOH groups of TA SAM. Decrease in redox current reflected a decrease in the reaction rate, and by using closed form equations the effective rate constants at several pKa values were extracted. In chapter 4, permeability changes induced by pH in TEPCM were investigated. We assessed the surface charge of these membranes via cyclic voltammetry generated for neutral and charged redox molecules. Limiting current of charged markers were affected by the surface charge induced by pH, where as the redox current for the neutral marker was not affected. Experimental redox currents were larger than the theoretical current, indicating that redox molecules preferentially distributed in a surface layer on the nanopore. Organic solvent induced permeability changes of PS-b-PMMA nanoporous films were investigated via electrochemical impedance spectroscopy and AFM. Higher response of pore resistance in the presence of organic solvents indicated either swelling of the nanoporous film or

  4. Selective recovery of precious metals by persimmon waste chemically modified with dimethylamine.

    PubMed

    Xiong, Ying; Adhikari, Chaitanya Raj; Kawakita, Hidetaka; Ohto, Keisuke; Inoue, Katsutoshi; Harada, Hiroyuki

    2009-09-01

    Persimmon waste was chemically modified with dimethylamine (DMA) to obtain a tertiary-amine-type gel, named DMA persimmon waste gel (DMA-PW). It was found to be effective for the adsorption of Au(III), Pd(II), and Pt(IV) in hydrochloric acid medium. In contrast, base metals such as Cu(II), Zn(II), Fe(III), and Ni(II) were not practically adsorbed. The formation of ion pairs of the metal chloro complex anions with the protonated adsorption gels was proposed as the main adsorption process. The gel exhibited selectivity only for precious metals with a remarkably high capacity for Au(III), i.e., 5.63 mol/kg dry gel and comparable capacities, i.e., 0.42 and 0.28 mol/kg for Pd(II) and Pt(IV), respectively. According to the kinetic and electrochemical studies, the adsorption rate of Au(III) was greatly enhanced by the chemical modification. Also, its excellent adsorption characteristics for the precious metals were confirmed by adsorption and elution tests using a column packed with the DMA-PW gel.

  5. Efficiency of modified chemical remediation techniques for soil contaminated by organochlorine pesticides

    NASA Astrophysics Data System (ADS)

    Correa-Torres, S. N.; Kopytko, M.; Avila, S.

    2016-07-01

    This study reports the optimization of innovation chemical techniques in order to improve the remediation of soils contaminated with organochloride pesticides. The techniques used for remediation were dehalogenation and chemical oxidation in soil contaminated by pesticides. These techniques were applied sequentially and combined to evaluate the design optimize the concentration and contact time variables. The soil of this study was collect in cotton crop zone in Agustin Codazzi municipality, Colombia, and its physical properties was measure. The modified dehalogenation technique of EPA was applied on the contaminated soil by adding Sodium Bicarbonate solution at different concentrations and rates during 4, 7 and 14 days, subsequently oxidation technique was implemented by applying a solution of KMnO4 at different concentration and reaction times. Organochlorine were detected by Gas Chromatography analysis coupled Mass Spectrometry and its removals were between 85.4- 90.0% of compounds such as 4, 4’-DDT, 4,4’-DDD, 4,4-DDE, trans-Clordane y Endrin. These results demonstrate that the technique of dehalogenation with oxidation chemistry can be used for remediation soils contaminated by organochloride pesticides.

  6. In vitro and in vivo evaluation of chemically modified degradable starch microspheres for topical haemostasis.

    PubMed

    Björses, Katarina; Faxälv, Lars; Montan, Carl; Wildt-Persson, Katarina; Fyhr, Peter; Holst, Jan; Lindahl, Tomas L

    2011-06-01

    Degradable starch microspheres (DSMs) are starch chains cross-linked with epichlorhydrin, forming glycerol-ether links. DSMs have been used for many years for temporary vascular occlusion and drug delivery in treatment of malignancies. They are also approved and used for topical haemostasis by absorbing excess fluid from the blood and concentrating endogenous coagulation factors, thereby facilitating haemostasis. This mechanism of action is not sufficient for larger bleedings in current chemical formulations of DSMs, and modification of DSMs to trigger activation of platelets or coagulation would be required for use in such applications. Chemical modifications of DSMs with N-octenyl succinic anhydride, chloroacetic acid, acetic anhydride, diethylaminoethyl chloride and ellagic acid were performed and evaluated in vitro with thrombin generation and platelet adhesion tests, and in vivo using an experimental renal bleeding model in rat. DSMs modified to activate platelets in vitro were superior in haemostatic capacity in vivo. Further studies with non-toxic substances are warranted to confirm these results and develop the DSM as a more effective topical haemostatic agent.

  7. Surface chemical and biological characterization of flax fabrics modified with silver nanoparticles for biomedical applications.

    PubMed

    Paladini, F; Picca, R A; Sportelli, M C; Cioffi, N; Sannino, A; Pollini, M

    2015-01-01

    Silver nanophases are increasingly used as effective antibacterial agent for biomedical applications and wound healing. This work aims to investigate the surface chemical composition and biological properties of silver nanoparticle-modified flax substrates. Silver coatings were deposited on textiles through the in situ photo-reduction of a silver solution, by means of a large-scale apparatus. The silver-coated materials were characterized through X-ray Photoelectron Spectroscopy (XPS), to assess the surface elemental composition of the coatings, and the chemical speciation of both the substrate and the antibacterial nanophases. A detailed investigation of XPS high resolution regions outlined that silver is mainly present on nanophases' surface as Ag2O. Scanning electron microscopy and energy dispersive X-ray spectroscopy were also carried out, in order to visualize the distribution of silver particles on the fibers. The materials were also characterized from a biological point of view in terms of antibacterial capability and cytotoxicity. Agar diffusion tests and bacterial enumeration tests were performed on Gram positive and Gram negative bacteria, namely Staphylococcus aureus and Escherichia coli. In vitro cytotoxicity tests were performed through the extract method on murine fibroblasts in order to verify if the presence of the silver coating affected the cellular viability and proliferation. Durability of the coating was also assessed, thus confirming the successful scaling up of the process, which will be therefore available for large-scale production. Copyright © 2015 Elsevier B.V. All rights reserved.

  8. General principles for risk assessment of living modified organisms: lessons from chemical risk assessment.

    PubMed

    Hill, Ryan A; Sendashonga, Cyrie

    2003-01-01

    Modern biotechnology has led to the development and use of Living Modified Organisms (LMOs) for agriculture and other purposes. Regulators at the national level are increasingly depending on risk assessment as a tool for assessing potential adverse effects of LMOs on the environment and human health. In addition, the Cartagena Protocol on Biosafety, an international agreement expected to enter into force in the near future, requires risk assessment as the basis for decision-making regarding import of some LMOs. While LMO risk assessment is relatively new, there are other risk assessment disciplines which have developed over longer time periods. The field of assessment of the environmental and human health risks of chemicals is particularly well developed, and is similar in application to LMO risk assessment. This paper aims to draw lessons for LMO risk assessment from the vast experience with chemical risk assessment. Seven general principles are outlined which should serve as a useful checklist to guide assessments of risks posed by LMOs.

  9. Sequential extraction study of stability of adsorbed mercury in chemically modified activated carbons.

    PubMed

    Tong, Shitang; Fan, Mingxia; Mao, Lei; Jia, Charles Q

    2011-09-01

    Activated carbons chemically modified with sulfur and bromine are known for their greater effectiveness in capturing vapor Hg from coal combustion and other industrial flue gases. The stability of captured Hg in spent activated carbons determines the final fate of Hg and is critical to devising Hg control strategy. However, it remains a subject that is largely unknown, particularly for Br-treated activated carbons. Using a six-step sequential extraction procedure, this work evaluated the leaching potential of Hg captured with four activated carbons, one lignite-derived activated carbon, and three chemically treated with Br(2), KClO(3), and SO(2). The results demonstrated clearly the positive effect of Br- and SO(2)-treatment on the stability of captured Hg. The Hg captured with brominated activated carbon was very stable and likely in the form of mercurous bromide complex. Sulfur added at high temperature with SO(2) was able to stabilize a majority of Hg by forming sulfide and possibly sulfonate chelate. The presence of sulfate however made a small fraction of captured Hg (<10%) labile under mild conditions. Treating activated carbon with KClO(3) lowered the overall stability of captured Hg. A positive dependence of Hg stability on Hg loading temperature was observed for the first time.

  10. Chemical composition and resistance-modifying effect of the essential oil of Lantana camara Linn

    PubMed Central

    Sousa, Erlânio O.; Silva, Natálya F.; Rodrigues, Fabiola F. G.; Campos, Adriana R.; Lima, Sidney G.; Costa, José Galberto M.

    2010-01-01

    In this work, the chemical constituents, antibacterial and modulatory activities of the essential oil of Lantana camara Linn were studied. The essential oil was extracted from the leaves of L. camara by hydrodistillation method using Clevenger's apparatus and its chemical constituents were separated and identified by GC-MS, and the relative content of each constituent was determined by area normalization. Among the 25 identified components, bicyclogermacrene (19.42%), isocaryophyllene (16.70%), valecene (12.94%) and germacrene D (12.34%) were the main constituents. The oil was examined to antibacterial and modulatory activities against the multiresistant strains of Escherichia coli and Staphylococcus aureus by microdilution test. The results show an inhibitory activity to E. coli (MIC 512 μg/ml) and S. aureus (MIC 256 μg/ml). The synergism of the essential oil and aminoglycosides was verified too, with significant reduction of MICs (7 ×, 1250-5 μg/ml) against E. coli. It is suggested that the essential oil of Lantana camara Linn could be used as a source of plant-derived natural products with resistance-modifying activity. PMID:20668570

  11. Chemical composition and resistance-modifying effect of the essential oil of Lantana camara Linn.

    PubMed

    Sousa, Erlânio O; Silva, Natálya F; Rodrigues, Fabiola F G; Campos, Adriana R; Lima, Sidney G; Costa, José Galberto M

    2010-04-01

    In this work, the chemical constituents, antibacterial and modulatory activities of the essential oil of Lantana camara Linn were studied. The essential oil was extracted from the leaves of L. camara by hydrodistillation method using Clevenger's apparatus and its chemical constituents were separated and identified by GC-MS, and the relative content of each constituent was determined by area normalization. Among the 25 identified components, bicyclogermacrene (19.42%), isocaryophyllene (16.70%), valecene (12.94%) and germacrene D (12.34%) were the main constituents. The oil was examined to antibacterial and modulatory activities against the multiresistant strains of Escherichia coli and Staphylococcus aureus by microdilution test. The results show an inhibitory activity to E. coli (MIC 512 mug/ml) and S. aureus (MIC 256 mug/ml). The synergism of the essential oil and aminoglycosides was verified too, with significant reduction of MICs (7 x, 1250-5 mug/ml) against E. coli. It is suggested that the essential oil of Lantana camara Linn could be used as a source of plant-derived natural products with resistance-modifying activity.

  12. Photolithographic strategy for patterning preformed, chemically modified, porous silicon photonic crystal using click chemistry.

    PubMed

    Zhu, Ying; Gupta, Bakul; Guan, Bin; Ciampi, Simone; Reece, Peter J; Gooding, J Justin

    2013-07-24

    Porous silicon (PSi) is an ideal platform for label-free biosensing, and the development of porous silicon patterning will open a pathway to the development of highly parallel PSi biochips for detecting multiple analytes. The optical response of PSi photonic crystal is determined by the changes in the effective bulk refractive index resulting from reactions/events occurring within the internal pore space. Therefore, introducing precise chemical functionalities in the pores of PSi is essential to ensure device selectivity. Here we describe the fabrication of PSi patterns that possess discrete chemical functionalities that are restricted to precise locations. The key difference to previous patterning protocols for PSi is that the entire porous material is first modified with a self-assembled monolayer of a α,ω-diyne adsorbate prior to patterning using a microfabricated titanium mask. The distal alkyne moieties in the monolayer are then amenable to further selective modification by the archetypal "click" reaction, the copper catalyzed alkyne-azide cycloaddition (CuAAC), using the titanium mask as a resist. This type of patterning is suitable for further immobilization of biological recognition elements, and presents a new platform for highly parallel PSi biosensor for multiple detections.

  13. The effects of space radiation on a chemically modified graphite-epoxy composite material

    NASA Technical Reports Server (NTRS)

    Reed, S. M.; Herakovich, C. T.; Sykes, G. F.

    1986-01-01

    The effects of the space environment on the engineering properties and chemistry of a chemically modified T300/934 graphite-epoxy composite system are characterized. The material was subjected to 1.0 x 10 to the 10th power rads of 1.0 MeV electron irradiation under vacuum to simulate 30 years in geosynchronous earth orbit. Monotonic tension tests were performed at room temperature (75 F/24 C) and elevated temperature (250 F/121 C) on 4-ply unidirectional laminates. From these tests, inplane engineering and strength properties (E sub 1, E sub 2, Nu sub 12, G sub 12, X sub T, Y sub T) were determined. Cyclic tests were also performed to characterize energy dissipation changes due to irradiation and elevated temperature. Large diameter graphite fibers were tested to determine the effects of radiation on their stiffness and strength. No significant changes were observed. Dynamic-mechanical analysis demonstrated that the glass transition temperature was reduced by 50 F(28 C) after irradiation. Thermomechanical analysis showed the occurrence of volatile products generated upon heating of the irradiated material. The chemical modification of the epoxy did not aid in producing a material which was more radiation resistant than the standard T300/934 graphite-epoxy system. Irradiation was found to cause crosslinking and chain scission in the polymer. The latter produced low molecular weight products which plasticize the material at elevated temperatures and cause apparent material stiffening at low stresses at room temperature.

  14. On the structure and topography of free-standing chemically modified graphene

    NASA Astrophysics Data System (ADS)

    Wilson, N. R.; Pandey, P. A.; Beanland, R.; Rourke, J. P.; Lupo, U.; Rowlands, G.; Römer, R. A.

    2010-12-01

    The mechanical, electrical and chemical properties of chemically modified graphene (CMG) are intrinsically linked to its structure. Here, we report on our study of the topographic structure of free-standing CMG using atomic force microscopy (AFM) and electron diffraction. We find that, unlike graphene, suspended sheets of CMG are corrugated and distorted on nanometre length scales. AFM reveals not only long-range (100 nm) distortions induced by the support, as previously observed for graphene, but also short-range corrugations with length scales down to the resolution limit of 10 nm. These corrugations are static not dynamic, and are significantly diminished on CMG supported on atomically smooth substrates. Evidence for even shorter-range distortions, down to a few nanometres or less, is found by electron diffraction of suspended CMG. Comparison of the experimental data with simulations reveals that the mean atomic displacement from the nominal lattice position is of order 10% of the carbon-carbon bond length. Taken together, these results suggest a complex structure for CMG where heterogeneous functionalization creates local strain and distortion.

  15. Chemically and biologically modified activated carbon sorbents for the removal of lead ions from aqueous media.

    PubMed

    Mahmoud, Mohamed E; Abdel-Fattah, Tarek M; Osman, Maher M; Ahmed, Somia B

    2012-01-01

    A method is described for hybridization of the adsorption and biosorption characteristics of chemically treated commercial activated carbon and baker's yeast, respectively, for the formation of environmental friendly multifunctional sorbents. Activated carbon was loaded with baker's yeast after acid-base treatment. Scanning Electron Microscopy (SEM) and Fourier Transform Infrared (FTIR) Spectroscopy were used to characterize these sorbents. Moreover, the sorption capabilities for lead (II) ions were evaluated. A value of 90 μmol g(-1) was identified as the maximum sorption capacity of activated carbon. Acid-base treatment of activated carbon was found to double the sorption capacity (140-180 μmol g(-1)). Immobilization of baker's yeast on the surface of activated carbon sorbents was found to further improve the sorption capacity efficiency of lead to 360, 510 and 560 μmol g(-1), respectively. Several important factors such as pH, contact time, sorbent dose, lead concentration and interfering ions were examined. Lead sorption process was studied and evaluated by several adsorption isotherms and found to follow the Langmuir and BET models. The potential applications of various chemically and biologically modified sorbents and biosorbents for removal of lead from real water matrices were also investigated via multistage micro-column technique and the results referred to excellent recovery values of lead (95.0-99.0 ± 3.0-5.0 %).

  16. A Novel Family of Small Molecules that Enhance the Intracellular Delivery and Pharmacological Effectiveness of Antisense and Splice Switching Oligonucleotides.

    PubMed

    Wang, Ling; Ariyarathna, Yamuna; Ming, Xin; Yang, Bing; James, Lindsey I; Kreda, Silvia M; Porter, Melissa; Janzen, William; Juliano, Rudolph L

    2017-08-18

    The pharmacological effectiveness of oligonucleotides has been hampered by their tendency to remain entrapped in endosomes, thus limiting their access to cytosolic or nuclear targets. We have previously reported a group of small molecules that enhance the effects of oligonucleotides by causing their release from endosomes. Here, we describe a second novel family of oligonucleotide enhancing compounds (OECs) that is chemically distinct from the compounds reported previously. We demonstrate that these molecules substantially augment the actions of splice switching oligonucleotides (SSOs) and antisense oligonucleotides (ASOs) in cell culture. We also find enhancement of SSO effects in a murine model. These new compounds act by increasing endosome permeability and causing partial release of entrapped oligonucleotides. While they also affect the permeability of lysosomes, they are clearly different from typical lysosomotropic agents. Current members of this compound family display a relatively narrow window between effective dose and toxic dose. Thus, further improvements are necessary before these agents can become suitable for therapeutic use.

  17. [Oligonucleotide derivatives in the nucleic acid hybridization analysis. III. Synthesis and investigation of properties of oligonucleotides, bearing bifunctional non-nucleotide insert].

    PubMed

    Kupriushkin, M S; Pyshnyĭ, D V

    2012-01-01

    Non-nucleotide phosporamidites were synthetized, having branched backbone with different position of functional groups. Obtained phosphoramidite monomers contain intercalator moiety--6-chloro-2-methoxyacridine, and additional hydroxyl residue protected with dimethoxytrityl group or with tert-butyldimethylsilyl group for post-synthetic modification. Synthesized oligothymidilates contain one or more modified units in different positions of sequence. Melting temperature and thermodynamic parameters of formation of complementary duplexes formed by modified oligonucleotides was defined (change in enthalpy and entropy). The introduction of intercalating residue causes a significant stabilization of DNA duplexes. It is shown that the efficiency of the fluorescence of acridine residue in the oligonucleotide conjugate significantly changes upon hybridization with DNA.

  18. [The influence of chemically-modified SLA on bone defect healing around implants in dogs].

    PubMed

    Lv, Xiao-fei; Zhuang, Long-fei; Liu, Xin; Zhang, Zhi-yong; Lai, Hong-chang

    2010-06-01

    The study was designed to investigate the effect of surface chemical modification on the process of bone defect healing around implants in dogs. Six Beagle dogs were used in this study. The mandibular premolars and first molars were extracted bilaterally. Three months after tooth extraction the procedure of implant placement was performed. Four canals with a diameter of 2.8 mm and 10 mm in depth were prepared at the third premolar (P3) and the first molar (M1) sites of both sides of the mandible, of which the coronal 5 mm portion were further widened with the 5.3 mm diameter twist drill. In each side of the mandible one modSLA (chemically-modified SLA) implant and one SLA (sandblasted, large-grit, acid-etched) implant with a diameter of 3.3 mm and 10 mm in length were installed, respectively. Thus, the circumferential defect that was 5mm deep and 1mm wide created between the implant surface and the bony wall. Four implants placed in both sides of the mandible were allowed for non-submerged healing. Two dogs were sacrificed at the week 2, 4 and 8 following implant placement, respectively, and the specimens were prepared and stained with trinitrophenol- fuchsin for histological and histomorphometric analyses to acquire the bone-to-implant contact (BIC%), new bone fill (NBF%) and the distance between the most coronal level of bone-to-implant contact and the bottom of the surgically created bone defect(B-D). Statistical analysis was conducted with SPSS13.0 software package. No implant was loosen or lost during the study. The histomorphometric results demonstrated that new bone formation was observed in the defect region around both groups of implants at all time points and the newly formed bone occurred initially from the apical and lateral bony wall of the defect region, the bone defect almost was filled at week 8. At 2 and 4 weeks of healing, the BIC%, NBF% and B-D values were significantly higher for modSLA implants (P<0.05). At 8 weeks of healing, the difference

  19. Adhesion force interactions between cyclopentane hydrate and physically and chemically modified surfaces.

    PubMed

    Aman, Zachary M; Sloan, E Dendy; Sum, Amadeu K; Koh, Carolyn A

    2014-12-07

    Interfacial interactions between liquid-solid and solid-solid phases/surfaces are of fundamental importance to the formation of hydrate deposits in oil and gas pipelines. This work establishes the effect of five categories of physical and chemical modification to steel on clathrate hydrate adhesive force: oleamide, graphite, citric acid ester, nonanedithiol, and Rain-X anti-wetting agent. Hydrate adhesive forces were measured using a micromechanical force apparatus, under both dry and water-wet surface conditions. The results show that the graphite coating reduced hydrate-steel adhesion force by 79%, due to an increase in the water wetting angle from 42 ± 8° to 154 ± 7°. Two chemical surface coatings (nonanedithiol and the citric acid ester) induced rapid hydrate growth in the hydrate particles; nonanedithiol increased hydrate adhesive force by 49% from the baseline, while the citric acid ester coating reduced hydrate adhesion force by 98%. This result suggests that crystal growth may enable a strong adhesive pathway between hydrate and other crystalline structures, however this effect may be negated in cases where water-hydrocarbon interfacial tension is minimised. When a liquid water droplet was placed on the modified steel surfaces, the graphite and citric acid ester became less effective at reducing adhesive force. In pipelines containing a free water phase wetting the steel surface, chemical or physical surface modifications alone may be insufficient to eliminate hydrate deposition risk. In further tests, the citric acid ester reduced hydrate cohesive forces by 50%, suggesting mild activity as a hybrid anti-agglomerant suppressing both hydrate deposition and particle agglomeration. These results demonstrate a new capability to develop polyfunctional surfactants, which simultaneously limit the capability for hydrate particles to aggregate and deposit on the pipeline wall.

  20. Oligonucleotide-based antiviral strategies.

    PubMed

    Schubert, S; Kurreck, J

    2006-01-01

    In the age of extensive global traffic systems, the close neighborhood of man and livestock in some regions of the world, as well as inadequate prevention measures and medical care in poorer countries, greatly facilitates the emergence and dissemination of new virus strains. The appearance of avian influenza viruses that can infect humans, the spread of the severe acute respiratory syndrome (SARS) virus, and the unprecedented raging of human immunodeficiency virus (HIV) illustrate the threat of a global virus pandemic. In addition, viruses like hepatitis B and C claim more than one million lives every year for want of efficient therapy. Thus, new approaches to prevent virus propagation are urgently needed. Antisense strategies are considered a very attractive means of inhibiting viral replication, as oligonucleotides can be designed to interact with any viral RNA, provided its sequence is known. The ensuing targeted destruction of viral RNA should interfere with viral replication without entailing negative effects on ongoing cellular processes. In this review, we will give some examples of the employment of antisense oligonucleotides, ribozymes, and RNA interference strategies for antiviral purposes. Currently, in spite of encouraging results in preclinical studies, only a few antisense oligonucleotides and ribozymes have turned out to be efficient antiviral compounds in clinical trials. The advent of RNA interference now seems to be refueling hopes for decisive progress in the field of therapeutic employment of antisense strategies.

  1. Synthesis of Geranyl-2-Thiouridine-Modified RNA.

    PubMed

    Wang, Rui; Haruehanroengra, Phensinee; Sheng, Jia

    2017-03-02

    This unit describes the chemical synthesis of the S-geranyl-2-thiouridine (ges(2) U) phosphoramidite and its incorporation into RNA oligonucleotides through solid-phase synthesis. Starting from the 2-thiouracil nucleobase and the protected ribose, the 2-thiouridine is synthesized and the geranyl functionality is introduced into the 2-thio position by using geranyl bromide as the geranylating reagent before the conversion of this modified nucleoside into a phosphoramidite building block. The modified phosphoramidite is used to make the geranyl-RNA oligonucleotides with a solid-phase DNA synthesizer. These RNA strands are then purified by ion-exchange HPLC before further structural and functional studies, such as base pairing and enzyme recognition, can be done. © 2017 by John Wiley & Sons, Inc.

  2. In situ synthesis of oligonucleotide arrays by using soft lithography

    NASA Astrophysics Data System (ADS)

    Xiao, P. F.; He, N. Y.; Liu, Z. C.; He, Q. G.; Sun, X.; Lu, Z. H.

    2002-12-01

    This paper describes the in situ synthesis of oligonucleotide arrays on glass surfaces by using soft lithography. In this method, based on the standard phosphoramidite chemistry protocol, the coupling was achieved by the glass slide being printed with a set of polydimethylsiloxane (PDMS) microstamps, on which was spread nucleoside monomer and tetrazole mixed solution. The elastic characteristic of PDMS allowed it to make conformal contact with the glass slide in the printing coupling. With regard to the efficiency of the printing coupling, the hybridization microscope images of 20-mer oligonucleotide synthesized via the directly drip-dropped coupling and the contact coupling were compared; the fluorescence intensities of the two methods showed no significant differences. The coupling efficiency was also investigated via an end-labelled fluorescence nucleotide method and a stepwise yield of 97% was obtained. A high-quality, high spatial resolution and large-scale PDMS stamp, which was developed by integrating 168 different microstamps on one glass substrate for synthesizing oligonucleotide arrays. The stamp was modified to improve the surface wettability by plasma discharge treatments, so that microstamps could be used to fabricate oligonucleotide arrays. A motional printing head was developed to improve the contact effect of the glass slide with different microstamps. A higher boiling point solvent was used in the printing coupling to inhibit solvent volatilization and to maintain the consistency of reagents on different features of the microstamp. An effective method was used to eliminate residual reactive nucleosides on chips with small molecules containing a hydroxyl group. A specific oligonucleotide array of four probes both matched and mismatched with the target sequence was fabricated to identify the perfect match and mismatch sequences.

  3. Chemically-Modified Peptides Targeting the PDZ Domain of GIPC as a Therapeutic Approach for Cancer

    PubMed Central

    Patra, Chitta Ranjan; Rupasinghe, Chamila N.; Dutta, Shamit K; Bhattacharya, Santanu; Wang, Enfeng; Spaller, Mark R.; Mukhopadhyay, Debabrata

    2012-01-01

    GIPC (GAIP-interacting protein, C terminus) represents a new target class for the discovery of chemotherapeutics. While many of the current generation of anticancer agents function by directly binding to intracellular kinases or cell surface receptors, the disruption of cytosolic protein-protein interactions mediated by non-enzymatic domains is an underdeveloped avenue for inhibiting cancer growth. One such example is the PDZ domain of GIPC. Previously we developed a molecular probe, the cell permeable octapeptide CR1023 (N-myristoyl-PSQSSSEA), which diminished proliferation of pancreatic cancer cells. We have expanded upon that discovery using a chemical modification approach, and here report a series of cell permeable, side chain-modified lipopeptides that target the GIPC PDZ domain in vitro and in vivo. These peptides exhibit significant activity against pancreatic and breast cancers, both in vitro and in animal models. CR1166 (N-myristoyl-PSQSK(εN-4-bromobenzoyl)SK(εN-4-bromobenzoyl)A), bearing two halogenated aromatic units on alternate side chains, was found to be the most active compound, with pronounced down-regulation of EGFR/1GF-1R expression. We hypothesize that these organic acid-modified residues extend the productive reach of the peptide beyond the canonical binding pocket, which defines the limit of accessibility for the native proteinogenic sequences that the PDZ domain has evolved to recognize. Cell permeability is achieved with N-terminal lipidation using myristate, rather than a larger CPP (cell-penetrating peptide) sequence. This, in conjunction with optimization of targeting through side chain modification, has yielded an approach that will allow the discovery and development of next-generation cellular probes for GIPC PDZ as well as other PDZ domains. PMID:22292614

  4. Chemically modified peptides targeting the PDZ domain of GIPC as a therapeutic approach for cancer.

    PubMed

    Patra, Chitta Ranjan; Rupasinghe, Chamila N; Dutta, Shamit K; Bhattacharya, Santanu; Wang, Enfeng; Spaller, Mark R; Mukhopadhyay, Debabrata

    2012-04-20

    GIPC (GAIP-interacting protein, C terminus) represents a new target class for the discovery of chemotherapeutics. While many of the current generation of anticancer agents function by directly binding to intracellular kinases or cell surface receptors, the disruption of cytosolic protein-protein interactions mediated by non-enzymatic domains is an underdeveloped avenue for inhibiting cancer growth. One such example is the PDZ domain of GIPC. Previously we developed a molecular probe, the cell-permeable octapeptide CR1023 (N-myristoyl-PSQSSSEA), which diminished proliferation of pancreatic cancer cells. We have expanded upon that discovery using a chemical modification approach and here report a series of cell-permeable, side chain-modified lipopeptides that target the GIPC PDZ domain in vitro and in vivo. These peptides exhibit significant activity against pancreatic and breast cancers, both in cellular and animal models. CR1166 (N-myristoyl-PSQSK(εN-4-bromobenzoyl)SK(εN-4-bromobenzoyl)A), bearing two halogenated aromatic units on alternate side chains, was found to be the most active compound, with pronounced down-regulation of EGFR/1GF-1R expression. We hypothesize that these organic acid-modified residues extend the productive reach of the peptide beyond the canonical binding pocket, which defines the limit of accessibility for the native proteinogenic sequences that the PDZ domain has evolved to recognize. Cell permeability is achieved with N-terminal lipidation using myristate, rather than a larger CPP (cell-penetrating peptide) sequence. This, in conjunction with optimization of targeting through side chain modification, has yielded an approach that will allow the discovery and development of next-generation cellular probes for GIPC PDZ as well as for other PDZ domains.

  5. Atmospheric pressure MALDI-FTMS of normal and chemically modified RNA.

    PubMed

    Kellersberger, Katherine A; Yu, Eizadora T; Merenbloom, Samuel I; Fabris, Daniele

    2005-02-01

    Atmospheric pressure (AP) MALDI has been combined with Fourier transform mass spectrometry (FTMS) to obtain the unambiguous characterization of RNA samples modified by solvent accessibility reagents used in structural studies of RNA and protein-RNA complexes. The formation of cation adducts typical of MS analysis of nucleic acids was effectively reduced by extensive washing of the anionic analytes retained onto the probe surface by strong interactions with a cationic layer of poly(diallyldimethylammonium chloride) (PADMAC). This rapid desalting procedure allowed for the detection of DNA and RNA samples in high femtomole quantities distributed over a 4 x 4 mm sample well. AP MALDI-FTMS was shown to provide high-resolution spectra for analytes as large as approximately 6.4 kDa with little or no evidence of metastable decomposition. The absence of significant metastable decay observed for precursor ions selected for tandem experiments offered a further measure of the low energy content typical of ions generated by AP MALDI. This feature proved to be very beneficial in the characterization of chemically modified RNA samples, which become particularly prone to base losses upon alkylation. The high resolution offered by FTMS enabled the application of a data-reduction algorithm capable of rejecting any signal devoid of plausible isotopic distribution, thus facilitating the analysis of complex analyte mixtures produced by nuclease treatment of RNA substrates. Proper selection of nucleases and digestion conditions can ensure the production of hydrolytic fragments of manageable size, which could extend the range of applicability of this bottom-up strategy to the structural investigation of very large RNA and protein-RNA complexes.

  6. Structure and magnetic properties of detonation nanodiamond chemically modified by copper

    NASA Astrophysics Data System (ADS)

    Shames, A. I.; Panich, A. M.; Osipov, V. Yu.; Aleksenskiy, A. E.; Vul', A. Ya.; Enoki, T.; Takai, K.

    2010-01-01

    We report on detailed study of detonation nanodiamonds (DNDs) whose surface has been chemically modified by copper with the aid of ion exchange in water DND suspension. High resolution transmission electron microscopy, Raman, IR, electron magnetic resonance (EMR), nuclear magnetic resonance (NMR), and superconducting quantum interference device techniques were used for the characterization of DND. Carboxyl groups, appearing on the surface of a nanodiamond particle during its synthesis and purification processes, provide an effective binding of divalent copper ions to the surface. The binding results from the ion exchange between metal cations and protons of surface carboxyl groups in water solutions. IR data evidence the presence of multiple COC groups in the dried copper-modified DND product. Both EMR and C13 NMR provide direct evidences of the appearance of isolated Cu2+ ions on the surface of the 5 nm nanodiamond particles. EMR spectra reveal well-pronounced hyperfine structure due to C63,65u nuclear spin I =3/2 with the spectral pattern which is typical for mononuclear axially distorted Cu2+ complexes in polycrystals. Using Cu2+ ions as paramagnetic probes two-component model of carbon inherited paramagnetic centers in DND is suggested. Magnetic susceptibility for all samples follows the Curie-Weiss law above 30 K. The concentration of magnetically observable copper ions Cu2+ (spin S =1/2) localized on the nanodiamonds surface increases up to approximately 1.5-3.5 ions per nanoparticle with increasing concentration of copper acetate in starting solutions.

  7. A modified parallel artificial membrane permeability assay for evaluating the bioconcentration of highly hydrophobic chemicals in fish.

    PubMed

    Kwon, Jung-Hwan; Escher, Beate I

    2008-03-01

    Low cost in vitro tools are needed at the screening stage of assessment of bioaccumulation potential of new and existing chemicals because the number of chemical substances that needs to be tested highly exceeds the capacity of in vivo bioconcentration tests. Thus, the parallel artificial membrane permeability assay (PAMPA) system was modified to predict passive uptake/ elimination rate in fish. To overcome the difficulties associated with low aqueous solubility and high membrane affinity of highly hydrophobic chemicals, we measured the rate of permeation from the donor poly(dimethylsiloxane)(PDMS) disk to the acceptor PDMS disk through aqueous and PDMS membrane boundary layers and term the modified PAMPA system "PDMS-PAMPA". Twenty chemicals were selected for validation of PDMS-PAMPA. The measured permeability is proportional to the passive elimination rate constant in fish and was used to predict the "minimum" in vivo elimination rate constant. The in vivo data were very close to predicted values except for a few polar chemicals and metabolically active chemicals, such as pyrene and benzo[a]pyrene. Thus, PDMS-PAMPA can be an appropriate in vitro system for nonmetabolizable chemicals. Combination with metabolic clearance rates using a battery of metabolic degradation assays would enhance the applicability for metabolizable chemicals.

  8. Chemical Sensors Based on IR Spectroscopy and Surface-Modified Waveguides

    NASA Technical Reports Server (NTRS)

    Lopez, Gabriel P.; Niemczyk, Thomas

    1999-01-01

    Sol-gel processing techniques have been used to apply thin porous films to the surfaces of planar infrared (IR) waveguides to produce widely useful chemical sensors. The thin- film coating serves to diminish the concentration of water and increase the concentration of the analyte in the region probed by the evanescent IR wave. These porous films are composed of silica, and therefore, conventional silica surface modification techniques can be used to give the surface a specific functional character. The sol-gel film was surface-modified to make the film highly hydrophobic. These sensors were shown to be capable of detecting non-polar organic analytes, such as benzonitrile, in aqueous solution with detection limits in the ppb range. Further, these porous sol-gel structures allow the analytes to diffuse into and out of the films rapidly, thus reaching equilibrium in less than ten seconds. These sensors are unique because of the fact that their operation is based on the measurement of an IR absorption spectrum. Thus, these sensors are able to identify the analytes as well as measure concentration with high sensitivity. These developments have been documented in previous reports and publications. Recently, we have also targeted detection of the polar organic molecules acetone and isopropanol in aqueous solution. Polar organics are widely used in industrial and chemical processes, hence it is of interest to monitor their presence in effluents or decontamination process flows. Although large improvements in detection limits were expected with non-polar organic molecules in aqueous solutions using very hydrophobic porous sol-gel films on silicon attenuated total reflectance (Si ATR) waveguides, it was not as clear what the detection enhancements might be for polar organic molecules. This report describes the use of modified sol-gel-coated Si ATR sensors for trace detection and quantitation of small polar organic molecules in aqueous solutions. The detection of both acetone

  9. A chemically modified tetracycline (CMT-3) is a new antifungal agent.

    PubMed

    Liu, Yu; Ryan, Maria E; Lee, Hsi-Ming; Simon, Sanford; Tortora, George; Lauzon, Carol; Leung, Michael K; Golub, Lorne M

    2002-05-01

    Several chemically modified tetracycline analogs (CMTs), which were chemically modified to eliminate their antibacterial efficacy, were unexpectedly found to have antifungal properties. Of 10 CMTs screened in vitro, all exhibited antifungal activities, although their efficacies varied. Among these compounds, CMT-315, -3, and -308 were found to be the most potent as antifungal agents. The MICs of CMT-3 against 47 strains of fungi in vitro were determined by using amphotericin B (AMB) and doxycycline as positive and negative controls, respectively. The MICs of CMT-3 were generally found to be between 0.25 and 8.00 microg/ml, a range that approximates the blood levels of this drug when administrated orally to humans. Of all the yeast species tested to date, Candida albicans showed the greatest sensitivity to CMT-3. The filamentous species most susceptible to CMT-3 were found to be Epidermophyton floccosum, Microsporum gypseum, Pseudallescheria boydii, a Penicillium sp., Scedosporium apiospermum, a Tricothecium sp., and Trichophyton rubrum. Growth inhibition of C. albicans by CMT-3, determined by a turbidity assay, indicated a 50% inhibitory concentration of 1 microg/ml. Thirty-nine strains, including 20 yeasts and 19 molds, were used to measure viability (the ability to grow after treatment with a drug) inhibition by CMT-3 and AMB. CMT-3 exhibited fungicidal activity against most of these fungi, especially the filamentous fungi. Eighty-four percent (16 of 19) of the filamentous fungi tested showed more than 90% inhibition of viability by CMT-3. In contrast, AMB showed fungicidal activity against all yeasts tested. However, most of the filamentous fungi (16 of 19) showed less than 50% inhibition of viability by AMB, indicating that AMB is fungistatic against most of these filamentous fungi. To begin to identify the sites in fungal cells affected by CMT-3, C. albicans and a Penicillium sp. were incubated with the compound at 35 degrees C, and then the fluorescence of

  10. The chemical and catalytic properties of nanocrystalline metal oxides prepared through modified sol-gel synthesis

    NASA Astrophysics Data System (ADS)

    Carnes, Corrie Leigh

    The goal of this research was to synthesize, characterize and study the chemical properties of nanocrystalline metal oxides. Nanocrystalline (NC) ZnO, CuO, NiO, Al2O3, and the binary Al2O 3/MgO and ZnO/CuO were prepared through modified sol gel methods. These NC metal oxides were studied in comparison to the commercial (CM) metal oxides. The samples were characterized by XRD, TGA, FTIR, BET, and TEM. The NC samples were all accompanied by a significant increase in surface area and decrease in crystallite size. Several chemical reactions were studied to compare the NC samples to the CM samples. One of the reactions involved a high temperature reaction between carbon tetrachloride and the oxide to form carbon dioxide and the corresponding metal chloride. A similar high temperature reaction was conducted between the metal oxide and hydrogen sulfide to form water and the corresponding metal sulfide. A room temperature gas phase adsorption was studied where SO2 was adsorbed onto the oxide. A liquid phase adsorption conducted at room temperature was the destructive adsorption of paraoxon (a toxic insecticide). In all reactions the NC samples exhibited greater activity, destroying or adsorbing a larger amount of the toxins compared to the CM samples. To better study surface area effects catalytic reactions were also studied. The catalysis of methanol was studied over the nanocrystalline ZnO, CuO, NiO, and ZnO/CuO samples in comparison to their commercial counterparts. In most cases the NC samples proved to be more active catalysts, having higher percent conversions and turnover numbers. A second catalytic reaction was also studied, this reaction was investigated to look at the support effects. The catalysis of cyclopropane to propane was studied over Pt and Co catalysts. These catalysts were supported onto NC and CM alumina by impregnation. By observing differences in the catalytic behavior, support effects have become apparent.

  11. Novel photocleavable universal support for oligonucleotide synthesis.

    PubMed

    Anderson, Emma; Brown, Tom; Picken, Douglas

    2003-01-01

    A novel photocleavable universal support for the automated solid phase synthesis of oligonucleotides is described. The linker between the growing oligonucleotide chain and CPG support contains a nucleophilic amine protected with a photocleavable group. On exposure to UV light, this group is detached and the free amine affords cleavage of the oligonucleotide from the support. The use of long wavelength UV light avoids damage to the DNA.

  12. Tailoring the selectivity and stability of chemically modified platinum nanocatalysts to design highly durable anodes for PEM fuel cells.

    SciTech Connect

    Genorio, B.; Subbaraman, R.; Strmcnik, D.; Tripkovic, D.; Stamenkovic, V. R.; Markovic, N. M.

    2011-06-06

    Chemically modifying platinum with calix[4]arene yields a highly stable anode catalyst that effectively suppresses the oxidation reduction reaction without altering the maximum activity for the hydrogen oxidation reaction (see picture, Pt blue, C gray, O red, S yellow). This behavior extends from long-range-ordered stepped single-crystal surfaces to nanocatalysts.

  13. Time-resolved optical sensing of oligonucleotide hybridization via Au colloidal nanoparticles.

    PubMed

    Liu, Gang L; Rodriguez, Victoria B; Lee, Luke P

    2005-11-01

    Au nanoparticles have distinctive absorption spectra whose peak position or particle plasmon resonance wavelength is highly sensitive to molecule adsorption on their surfaces. Spherical Au nanoparticles are surface-modified by amino-functionalized self-assembly-monolayer and used as optical probes in the fluorescence-label-free spectroscopic detection of sub-nanomole oligonucleotides. Time-resolved studies of the immobilization and hybridization of oligonucleotides on the surface of Au nanoparticles were carried out. By measuring peak shift of absorption spectra of the Au colloidal nanoparticles over time, the samples of 15 nM 20 mer target and mismatched oligonucleotides are distinguished by their different influences on the particle plasmon resonance wavelength. The approach presented in this paper extends the application of Au nanoparticles as the optical probe in oligonucleotide recognitions without prior sample labeling.

  14. Overview of modifiers of methylmercury neurotoxicity: chemicals, nutrients, and the social environment.

    PubMed

    Rice, Deborah C

    2008-09-01

    It has been known for decades that methylmercury is a potent neurotoxicant, and that the developing brain is more susceptible to impairment as a result of methylmercury exposure than is the adult. Exposure to methylmercury is exclusively through consumption of fish and marine mammals. In recent years, the potential for protection against methylmercury toxicity by nutrients present in fish, particularly omega-3 fatty acids and selenium, has been explored in both epidemiological and experimental studies. There is evidence from several studies that fish consumption per se and methylmercury body burden act in opposition with regard to neuropsychological outcomes, whereas the evidence for a protective effect of specific nutrients is contradictory in both epidemiological and experimental studies published to date. The potential for methylmercury to interact with other chemicals present in marine food, particularly PCBs, has been explored in both animal models and human studies. Results may be both exposure- and endpoint-dependent. The Seychelles Islands study has explored the potential for the social environment to modify the effects of developmental methylmercury exposure. An understanding of the interactions of the multiple factors that determine the final behavioral outcome of exposure to methylmercury is crucial to risk assessment and risk management decisions.

  15. Adhesion-dependent negative friction coefficient on chemically modified graphite at the nanoscale

    NASA Astrophysics Data System (ADS)

    Deng, Zhao; Smolyanitsky, Alex; Li, Qunyang; Feng, Xi-Qiao; Cannara, Rachel J.

    2012-12-01

    From the early tribological studies of Leonardo da Vinci to Amontons’ law, friction has been shown to increase with increasing normal load. This trend continues to hold at the nanoscale, where friction can vary nonlinearly with normal load. Here we present nanoscale friction force microscopy (FFM) experiments for a nanoscale probe tip sliding on a chemically modified graphite surface in an atomic force microscope (AFM). Our results demonstrate that, when adhesion between the AFM tip and surface is enhanced relative to the exfoliation energy of graphite, friction can increase as the load decreases under tip retraction. This leads to the emergence of an effectively negative coefficient of friction in the low-load regime. We show that the magnitude of this coefficient depends on the ratio of tip-sample adhesion to the exfoliation energy of graphite. Through both atomistic- and continuum-based simulations, we attribute this unusual phenomenon to a reversible partial delamination of the topmost atomic layers, which then mimic few- to single-layer graphene. Lifting of these layers with the AFM tip leads to greater deformability of the surface with decreasing applied load. This discovery suggests that the lamellar nature of graphite yields nanoscale tribological properties outside the predictive capacity of existing continuum mechanical models.

  16. Optimizing the lanthanum adsorption process onto chemically modified biomaterials using factorial and response surface design.

    PubMed

    Gabor, Andreea; Davidescu, Corneliu Mircea; Negrea, Adina; Ciopec, Mihaela; Grozav, Ion; Negrea, Petru; Duteanu, Narcis

    2017-01-29

    The rare metals' potential to pollute air, water, soil, and especially groundwater has received lot of attention recently. One of the most common rare earth group elements, lanthanum, is used in many industrial branches, and due to its toxicity, it needs to be eliminated from all residual aqueous solutions. The goal of this study was to evaluate the control of the adsorption process for lanthanum removal from aqueous solutions, using cellulose, a known biomaterial with high adsorbent properties, cheap, and environment friendly. The cellulose was chemically modified by functionalization with sodium β-glycerophosphate. The experimental results obtained after factorial design indicate optimum adsorption parameters as pH 6, contact time 60 min, and temperature 298 K, when the equilibrium concentration of lanthanum was 250 mg L(-1), and the experimental adsorption capacity obtained was 31.58 mg g(-1). Further refinement of the optimization of the adsorption process by response surface design indicates that at pH 6 and the initial concentration of 256 mg L(-1), the adsorption capacity has maximum values between 30.87 and 36.73 mg g(-1).

  17. Changes in the Chemical Composition and Decay Resistance of Thermally-Modified Hevea brasiliensis Wood

    PubMed Central

    2016-01-01

    In this study the effect of thermal treatment on the equilibrium moisture content, chemical composition and biological resistance to decay fungi of juvenile and mature Hevea brasiliensis wood (rubber wood) was evaluated. Samples were taken from a 53-year-old rubber wood plantation located in Tabapuã, Sao Paulo, Brazil. The samples were thermally-modified at 180°C, 200°C and 220°C. Results indicate that the thermal modification caused: (1) a significant increase in the extractive content and proportional increase in the lignin content at 220°C; (2) a significant decrease in the equilibrium moisture content, holocelluloses, arabinose, galactose and xylose content, but no change in glucose content; and (3) a significant increase in wood decay resistance against both Pycnoporus sanguineus (L.) Murrill and Gloeophyllum trabeum (Pers.) Murrill decay fungi. The greatest decay resistance was achieved from treatment at 220°C which resulted in a change in wood decay resistance class from moderately resistant to resistant. Finally, this study also demonstrated that the influence of thermal treatment in mature wood was lower than in juvenile wood. PMID:26986200

  18. Specificities of a chemically modified laccase from Trametes hirsuta on soluble and cellulose-bound substrates.

    PubMed

    Schroeder, M; Heumann, S; Silva, C J S M; Cavaco-Paulo, A; Guebitz, G M

    2006-05-01

    Laccases could prevent fabrics and garments from re-deposition of dyes during washing and finishing processes by degrading the solubilized dye. However, laccase action must be restricted to solubilized dye molecules thereby avoiding decolorization of fabrics. Chemical modification of enzymes can provide a powerful tool to change the adsorption behaviour of enzymes on water insoluble polymers. Polyethylene glycol (PEG) was covalently attached onto a laccase from Trametes hirsuta. Different molecular weights of the synthetic polymer were tested in terms of adsorption behaviour and retained laccase activity. Covalent attachment of PEG onto the laccase resulted in enhanced enzyme stability while with increasing molecular weight of attached PEG the substrate affinity for the laccase conjugate decreased. The activity of the modified laccases on fibre bound dye was drastically reduced decreasing the adsorption of the enzyme on various fabrics. Compared to the 5 kDa PEG laccase conjugate (K/S value 47.60) the K/S value decreased much more (47.96-46.35) after the treatment of dyed cotton fabrics with native laccase.

  19. Laminating of chemically modified silan based nanosols for advanced functionalization of cotton textiles.

    PubMed

    Mohamed, Amina L; El-Naggar, Mehrez E; Shaheen, Th I; Hassabo, Ahmed G

    2017-02-01

    As per to silver nanoparticles/silicon dioxide nanoparticles (SiO2@AgNPs) properties (e.g., conductivity, reactant, adsorption, detachment and antimicrobial), many researchers were focused on its preparation technique. A core/shell of silicon dioxide and silver nanoparticles (SiO2@AgNPs) has been prepared by facile route. The as synthesized core/shell nanoparticles were chemically modified with two different silan compounds, nominated, vinyltriethoxysilan (VTEOS) and (3-aminopropyl)trimethoxysilan (APTEOS). World class facilities such as XRD, FT-IR, TEM, Particle size, DLS, SEM techniques were utilized for the nanoparticles characterization. The nanoparticulate system comprises SiO2@AgNPs, SiO2@AgNPs/APTEOS were applied to cotton fabric using butantetracarboxylic acid (BTCA) as across-linking agent. While UV irradiation by photo initiator was used as crosslinking agent for SiO2@AgNPs/VTEOS on cotton fabrics. The Treated cotton fabrics were evaluated for their surface morphology and heat transfer ability as well as antibacterial activity. The obtained data prove that the core/shell was successfully prepared, with AgNPs in core. In addition, both silan compounds (APTEOS, VTEOS) were successfully reacted with the outer shell SiO2. The results declared also that the treated fabrics exhibit a good antibacterial activity as well as good thermal properties.

  20. Bioremoval of arsenic (V) from aqueous solutions by chemically modified fungal biomass.

    PubMed

    Cárdenas-González, J F; Acosta-Rodríguez, I; Téran-Figueroa, Y; Rodríguez-Pérez, A S

    2017-07-01

    The biosorption of arsenic (V) on nine chemically modified biomasses (with iron oxide coated) of mycelia fungi: Aspergillus flavus III, IV and V, Aspergillus fumigatus I-II, Paecilomyces sp., Cladosporium sp., Mucor sp-1 and 2 was studied in this work. This study provides evidence that the biomasses of the fungi A. flavus, IV, III and V, Paecilomyces sp., and A. fumigatus I were very efficient at removing 1 mg/L of the metal in solution, using atomic absorption spectroscopy (AAS), achieving the following percentage of removals: 97.1, 92.3, 90.3, 89.0, and 83.4%, respectively. The results of adsorption were obtained at pH 6.0, 30 °C after 24 h of incubation, with 1 g/100 mL of fungal biomass. These results suggest the excellent potential of almost all isolated strains for bioremediation and removal of metals from contaminated sites.

  1. Chemically modified graphene films for high-performance optical NO2 sensors.

    PubMed

    Xing, Fei; Zhang, Shan; Yang, Yong; Jiang, Wenshuai; Liu, Zhibo; Zhu, Siwei; Yuan, Xiaocong

    2016-08-07

    Various graphene-based gas sensors that operate based on the electrical properties of graphene have been developed for accurate detection of gas components. However, electronic graphene-based gas sensors are unsafe under explosive atmospheres and sensitive to electromagnetic interference. Here, a novel optical graphene-based gas sensor for NO2 detection is established based on surface chemical modification of high-temperature-reduced graphene oxide (h-rGO) films with sulfo groups. Sulfo group-modified h-rGO (S-h-rGO) films with a thickness of several nanometers exhibit excellent performance in NO2 detection at room temperature and atmospheric pressure based on the polarization absorption effect of graphene. Initial slope analysis of the S-h-rGO sensor indicates that it has a limit of detection of 0.28 ppm and a response time of 300 s for NO2 gas sensing. Furthermore, the S-h-rGO sensor also possesses the advantages of good linearity, reversibility, selectivity, non-contact operation, low cost and safety. This novel optical gas sensor has the potential to serve as a general platform for the selective detection of a variety of gases with high performance.

  2. Removal of lead from aqueous solution with native and chemically modified corncobs.

    PubMed

    Tan, Guangqun; Yuan, Hongyan; Liu, Yong; Xiao, Dan

    2010-02-15

    In this study, corncobs biomass was utilized as an adsorbent to remove Pb(II) from aqueous solution. The adsorption behavior of Pb(II) was studied under different conditions, including solution pH, contact time and metal concentration. Ground corncobs were modified with CH(3)OH and NaOH to investigate the effect of chemical modification on Pb(II) binding capacity. Results showed that Pb(II) binding on the biomass is pH-dependent and the kinetics can be well described by the Lagergren-second-order model. The maximum Pb(II) binding capacity q(max) calculated from Langmuir isotherm was 0.0783 mmol/g. After base hydrolysis of the biomass, Pb(II) binding capacity increased from 0.0783 to 0.2095 mmol/g (about 43.4 mg Pb/g). However, Pb(II) binding capacity on the esterified corncobs decreased greatly from 0.0783 to 0.0381 mmol/g. Fourier transform infrared spectroscopy (FTIR) analysis showed that hydroxyl and carboxylic (COO(-)) groups on the biomass play an important role in Pb(II) binding process. The X-ray photoelectron spectroscopy (XPS) data further indicated that lead is adsorbed as Pb(2+) and is attached to oxide groups on the biomass.

  3. Soot-overcladding process for enlarging modified chemical vapor deposition preforms

    NASA Astrophysics Data System (ADS)

    Ihalainen, Heikki; Kurki, Jouko

    1995-09-01

    The equipment and the process for soot sleeving of optical fiber preforms made by the modified chemical vapor deposition (MCVD) method has been developed. The equipment consists of a soot-sleeving lathe that is used for deposition of soot glass particles onto the surface of an MCVD core preform and a separate furnace that is used for drying and sintering the deposited porous glass layer. An outline of the equipment is presented. This equipment has then been used to study the basic parameters of flame hydrolysis deposition as well as sintering of the porous layer. The raw material and the fuel gas flow as well as the substrate diameter proved to be the most important parameters affecting the process. The basic knowledge achieved is used to optimize the process for three different preform sizes. In the soot-sleeving process for 80-km optical fiber preforms, an average deposition rate of 5.2 g/min is achieved with a double burner. The overall quality of the drawn fiber proved to be good. The typical attenuations were 0.330 and 0.215 dB/km at 1310- and 1550-nm wavelengths, respectively. The geometry of the drawn fibers was found to be very good.

  4. Chemically modified tetracycline-3 (CMT-3): a novel inhibitor of the serine proteinase, elastase.

    PubMed

    Gu, Ying; Lee, Hsi-Ming; Simon, Sanford R; Golub, Lorne M

    2011-12-01

    Two classes of enzymes play an important role in connective tissue breakdown during various inflammatory diseases: serine proteinases and matrix metalloproteinases (MMPs). Tetracyclines (TCs) exhibit important anti-inflammatory and MMP-inhibitory properties that are unrelated to their antibacterial activities. Of the various TCs and their chemically modified NON-antibiotic analogs (CMTs) tested in vitro and in vivo, CMT-3 (6-demethyl-6-deoxy 4 de-dimethylamino tetracycline) has repeatedly been shown to be the most potent inhibitor of MMP activity and cytokine production. In addition to its anti-MMP function, we have shown that among all CMTs, CMT-3 is the only CMT that can also directly inhibit both the amidolytic activity of human leukocyte elastase (HLE, a serine proteinase) and the extracellular matrix degradation mediated by HLE. In addition, CMT-3 has been found to reduce leukocyte elastase activity in vivo in gingival extracts of rats with experimental periodontal disease. Thus, CMT-3 can inhibit pathologic connective tissue breakdown by (at least) two mechanisms: direct inhibition of neutral proteinases (elastase and MMPs); and protecting their endogenous inhibitors, α(1)-PI and TIMPs, from being digested and inactivated by MMPs and HLE, respectively. The pleiotropic properties of CMT-3 including (but not limited to) inhibition of serine proteinases, MMPs, and cytokines provide impressive therapeutic potential to reduce excessive connective tissue breakdown during various pathologic processes including inflammatory diseases, cancer metastasis and metabolic bone diseases. Copyright © 2011 Elsevier Ltd. All rights reserved.

  5. Adhesion-dependent negative friction coefficient on chemically modified graphite at the nanoscale.

    PubMed

    Deng, Zhao; Smolyanitsky, Alex; Li, Qunyang; Feng, Xi-Qiao; Cannara, Rachel J

    2012-12-01

    From the early tribological studies of Leonardo da Vinci to Amontons' law, friction has been shown to increase with increasing normal load. This trend continues to hold at the nanoscale, where friction can vary nonlinearly with normal load. Here we present nanoscale friction force microscopy (FFM) experiments for a nanoscale probe tip sliding on a chemically modified graphite surface in an atomic force microscope (AFM). Our results demonstrate that, when adhesion between the AFM tip and surface is enhanced relative to the exfoliation energy of graphite, friction can increase as the load decreases under tip retraction. This leads to the emergence of an effectively negative coefficient of friction in the low-load regime. We show that the magnitude of this coefficient depends on the ratio of tip-sample adhesion to the exfoliation energy of graphite. Through both atomistic- and continuum-based simulations, we attribute this unusual phenomenon to a reversible partial delamination of the topmost atomic layers, which then mimic few- to single-layer graphene. Lifting of these layers with the AFM tip leads to greater deformability of the surface with decreasing applied load. This discovery suggests that the lamellar nature of graphite yields nanoscale tribological properties outside the predictive capacity of existing continuum mechanical models.

  6. Progress in chemical treatment of LEU targets by the modified Cintichem process

    SciTech Connect

    Wu, D.; Landsberger, S.; Vandegrift, G.F.

    1996-12-31

    Presented here are recent experimental results on tests of a modified Cintichem process for producing {sup 99}Mo from low enriched uranium (LEU). Studies were focused in three areas: (1) testing the effects on {sup 99}Mo recovery and purity of dissolving LEU foil in nitric acid alone, rather than in the sulfuric/nitric acid mixture currently used, (2) measuring decontamination factors for radionuclide impurities in each purification step, and (3) testing the effects on processing of adding barrier materials to the LEU metal-foil target. The experimental results show that switching from dissolving the target in the sulfuric/nitric mixture to using nitric acid alone should cause no significant difference in {sup 99}Mo product yield or purity. Further, the results show that overall decontamination factors for gamma emitters in the LEU-target processing are high enough to meet the purity requirements for the {sup 99}Mo product. The results also show that the selected barrier materials, Cu, Fe, and Ni, do not interfere with {sup 99}Mo recovery and can be removed during chemical processing of the LEU target.

  7. Removal of methylene blue from aqueous solutions by chemically modified bamboo.

    PubMed

    Guo, Jian-Zhong; Li, Bing; Liu, Li; Lv, Kangle

    2014-09-01

    Chemically modified bamboo (CMB) was utilized for removing methylene blue (MB) from aqueous media in the present study. The adsorbent was characterized by Fourier transform infrared (FTIR) spectra and elemental analysis, which confirms that carboxyl groups and diethylenetriamine were successfully introduced into the surface of bamboo. The effects of initial MB concentration (100-900mgL(-1)), contact time (15-315min), the pH of the solution (3-10), temperature (298-318K), adsorbent dosage (0.4-2.6gL(-1)) and salt concentration on the adsorption efficiency of CMB towards MB were investigated. It was found that the adsorption of MB in CMB fits Langmuir mode well, and the maximum adsorption capacity of CMB achieved 606mgg(-1) at 298K, which is much higher than those obtained from previously investigated bioadsorbents. The adsorption kinetics can be described by pseudo-second-order kinetic model, and the adsorption of MB on CMB was an exothermic process. The results of the present study suggest that CMB is an effective biosorbent for removal of organic pollutants from aqueous solutions.

  8. Inhibitory impacts of chemically modified tetracycline-3 and underlying mechanism in human cervical cancer cells.

    PubMed

    Zhao, Lin; Xu, Jiaying; Yang, Yang; Chong, Yu; Liu, Chang; Jiao, Yang; Fan, Saijun

    2013-09-01

    Chemically modified tetracyclines (CMTs) have been rationally designed from tetracyclines. The CMTs that show the antimicrobial properties are eliminated, whereas matrix metalloproteinase inhibitory properties are retained. Interestingly, CMT-3 (COL-3, by eliminating the dimethylamino, methyl, and hydroxyl functionalities on the basic tetracycline structure), one of the CMTs, has shown strong anticancer activity. In this study, we found that CMT-3 showed dose-dependent and time-dependent cytotoxicity in HeLa and Siha cells, two human cervical cancer cell lines. HeLa cells were more sensitive to CMT-3 compared with Siha cells. The antiproliferation potential of CMT-3 was associated with the mitochondrial apoptosis pathway, increasing reactive oxygen species level, and proapoptosis protein (e.g. caspase-3) expression, but decreasing antiapoptosis protein expression (e.g. Bcl-2). N-acetylcysteine (a reactive oxygen species inhibitor) and Z-LEHD-FMK significantly reduced or blocked the apoptosis event resulting from cytotoxic effect of CMT-3. CMT-3 also induced G0/G1 phase arrest with the reduction of cell cycle regulatory protein cyclin E and the translocation of NF-κB from the cytoplasm to the nucleus. Our findings provide the important foundation for further investigation of the underlying mechanism for the anticancer activity of CMT-3 and the potential application of CMT-3 as a new therapeutic candidate for clinical cervical cancer therapy.

  9. Chemically modified peptide scaffolds target the CFTR-associated ligand PDZ domain.

    PubMed

    Amacher, Jeanine F; Zhao, Ruizhi; Spaller, Mark R; Madden, Dean R

    2014-01-01

    PDZ domains are protein-protein interaction modules that coordinate multiple signaling and trafficking pathways in the cell and that include active therapeutic targets for diseases such as cancer, cystic fibrosis, and addiction. Our previous work characterized a PDZ interaction that restricts the apical membrane half-life of the cystic fibrosis transmembrane conductance regulator (CFTR). Using iterative cycles of peptide-array and solution-binding analysis, we targeted the PDZ domain of the CFTR-Associated Ligand (CAL), and showed that an engineered peptide inhibitor rescues cell-surface expression of the most common CFTR disease mutation ΔF508. Here, we present a series of scaffolds containing chemically modifiable side chains at all non-motif positions along the CAL PDZ domain binding cleft. Concordant equilibrium dissociation constants were determined in parallel by fluorescence polarization, isothermal titration calorimetry, and surface plasmon resonance techniques, confirming robust affinity for each scaffold and revealing an enthalpically driven mode of inhibitor binding. Structural studies demonstrate a conserved binding mode for each peptide, opening the possibility of combinatorial modification. Finally, we diversified one of our peptide scaffolds with halogenated substituents that yielded modest increases in binding affinity. Overall, this work validates our approach and provides a stereochemical foundation for further CAL inhibitor design and screening.

  10. Changes in the Chemical Composition and Decay Resistance of Thermally-Modified Hevea brasiliensis Wood.

    PubMed

    Severo, Elias Taylor Durgante; Calonego, Fred Willians; Sansígolo, Cláudio Angeli; Bond, Brian

    2016-01-01

    In this study the effect of thermal treatment on the equilibrium moisture content, chemical composition and biological resistance to decay fungi of juvenile and mature Hevea brasiliensis wood (rubber wood) was evaluated. Samples were taken from a 53-year-old rubber wood plantation located in Tabapuã, Sao Paulo, Brazil. The samples were thermally-modified at 180°C, 200°C and 220°C. Results indicate that the thermal modification caused: (1) a significant increase in the extractive content and proportional increase in the lignin content at 220°C; (2) a significant decrease in the equilibrium moisture content, holocelluloses, arabinose, galactose and xylose content, but no change in glucose content; and (3) a significant increase in wood decay resistance against both Pycnoporus sanguineus (L.) Murrill and Gloeophyllum trabeum (Pers.) Murrill decay fungi. The greatest decay resistance was achieved from treatment at 220°C which resulted in a change in wood decay resistance class from moderately resistant to resistant. Finally, this study also demonstrated that the influence of thermal treatment in mature wood was lower than in juvenile wood.

  11. Chemically-modified graphenes for oxidation of DNA bases: analytical parameters.

    PubMed

    Goh, Madeline Shuhua; Bonanni, Alessandra; Ambrosi, Adriano; Sofer, Zdeněk; Pumera, Martin

    2011-11-21

    We studied the electroanalytical performances of chemically-modified graphenes (CMGs) containing different defect densities and amounts of oxygen-containing groups, namely graphite oxide (GPO), graphene oxide (GO), thermally reduced graphene oxide (TR-GO) and electrochemically reduced graphene oxide (ER-GO) by comparing the sensitivity, selectivity, linearity and repeatability towards the oxidation of DNA bases. We have observed that for differential pulse voltammetric (DPV) detection of adenine and cytosine, all CMGs showed enhanced sensitivity to oxidation, while for guanine and thymine, ER-GO and TR-GO exhibited much improved sensitivity over bare glassy carbon (GC) as well as over GPO and GO. There is also significant selectivity enhancement when using GPO for adenine and TR-GO for thymine. Our results have uncovered that the differences in surface functionalities, structure and defects of various CMGs largely influence their electrochemical behaviour in detecting the oxidation of DNA bases. The findings in this report will provide a useful guide for the future development of label-free electrochemical devices for DNA analysis.

  12. Structural and dynamical properties of water on chemically modified surfaces: The role of the instantaneous surface

    NASA Astrophysics Data System (ADS)

    Bekele, Selemon; Tsige, Mesfin

    Surfaces of polymers such as atactic polystyrene (aPS) represent very good model systems for amorphous material surfaces. Such polymer surfaces are usually modified either chemically or physically for a wide range of applications that include friction, lubrication and adhesion. It is thus quite important to understand the structural and dynamical properties of liquids that come in contact with them to achieve the desired functional properties. Using molecular dynamics (MD) simulations, we investigate the structural and dynamical properties of water molecules in a slab of water in contact with atactic polystyrene surfaces of varying polarity. We find that the density of water molecules and the number distribution of hydrogen bonds as a function of distance relative to an instantaneous surface exhibit a structure indicative of a layering of water molecules near the water/PS interface. For the dynamics, we use time correlation functions of hydrogen bonds and the incoherent structure function for the water molecules. Our results indicate that the polarity of the surface dramatically affects the dynamics of the interfacial water molecules with the dynamics slowing down with increasing polarity. This work was supported by NSF Grant DMR1410290.

  13. Palladium-catalyzed modification of unprotected nucleosides, nucleotides, and oligonucleotides.

    PubMed

    Shaughnessy, Kevin H

    2015-05-22

    Synthetic modification of nucleoside structures provides access to molecules of interest as pharmaceuticals, biochemical probes, and models to study diseases. Covalent modification of the purine and pyrimidine bases is an important strategy for the synthesis of these adducts. Palladium-catalyzed cross-coupling is a powerful method to attach groups to the base heterocycles through the formation of new carbon-carbon and carbon-heteroatom bonds. In this review, approaches to palladium-catalyzed modification of unprotected nucleosides, nucleotides, and oligonucleotides are reviewed. Polar reaction media, such as water or polar aprotic solvents, allow reactions to be performed directly on the hydrophilic nucleosides and nucleotides without the need to use protecting groups. Homogeneous aqueous-phase coupling reactions catalyzed by palladium complexes of water-soluble ligands provide a general approach to the synthesis of modified nucleosides, nucleotides, and oligonucleotides.

  14. Mechanism of Oligonucleotide Uptake by Cells: Involvement of Specific receptors?

    NASA Astrophysics Data System (ADS)

    Yakubov, Leonid A.; Deeva, Elena A.; Zarytova, Valentina F.; Ivanova, Eugenia M.; Ryte, Antonina S.; Yurchenko, Lyudmila V.; Vlassov, Valentin V.

    1989-09-01

    We have investigated the interaction of oligonucleotides and their alkylating derivatives with mammalian cells. In experiments with L929 mouse fibroblast and Krebs 2 ascites carcinoma cells, it was found that cellular uptake of oligodeoxynucleotide derivatives is achieved by an endocytosis mechanism. Uptake is considerably more efficient at low oligomer concentration (< 1 μ M), because at this concentration a significant percentage of the total oligomer pool is absorbed on the cell surface and internalized by a more efficient absorptive endocytosis process. Two modified proteins were detected in mouse fibroblasts that were treated with the alkylating oligonucleotide derivatives. The binding of the oligomers to the proteins is inhibited by other oligodeoxynucleotides, single- and double-stranded DNA, and RNA. The polyanions heparin and chondroitin sulfates A and B do not inhibit binding. These observations suggest the involvement of specific receptor proteins in binding of oligomers to mammalian cells.

  15. Determination of bismuth in environmental samples by slurry sampling graphite furnace atomic absorption spectrometry using combined chemical modifiers.

    PubMed

    Dobrowolski, Ryszard; Dobrzyńska, Joanna; Gawrońska, Barbara

    2015-01-01

    Slurry sampling graphite furnace atomic absorption spectrometry technique was applied for the determination of Bi in environmental samples. The study focused on the effect of Zr, Ti, Nb and W carbides, as permanent modifiers, on the Bi signal. Because of its highest thermal and chemical stability and ability to substantially increase Bi signal, NbC was chosen as the most effective modifier. The temperature programme applied for Bi determination was optimized based on the pyrolysis and atomization curves obtained for slurries prepared from certified reference materials (CRMs) of the soil and sediments. To overcome interferences caused by sulfur compounds, Ba(NO₃)₂ was used as a chemical modifier. Calibration was performed using the aqueous standard solutions. The analysis of the CRMs confirmed the reliability of the proposed analytical method. The characteristic mass for Bi was determined to be 16 pg with the detection limit of 50 ng/g for the optimized procedure at the 5% (w/v) slurry concentration.

  16. Effects of Zn Content on Crystal Structure, Cytocompatibility, Antibacterial Activity, and Chemical Stability in Zn-Modified Calcium Silicate Coatings

    NASA Astrophysics Data System (ADS)

    Li, Kai; Yu, Jiangming; Xie, Youtao; Huang, Liping; Ye, Xiaojian; Zheng, Xuebin

    2013-08-01

    In our previous study, Zn-modified calcium silicate coatings possess not only excellent chemical stability but also well antibacterial activity. Still, effects of zinc content on these properties and cytocompatibility remain unclear. In this paper, two kinds of Zn-modified calcium silicate coatings (ZC0.3, ZC0.5) were fabricated on Ti-6Al-4V substrates via plasma spraying technology. X-ray diffraction results and transmission electron microscopy observations showed that the ZC0.5 coating was composed of pure hardystonite (Ca2ZnSi2O7) phase, while, besides Ca2ZnSi2O7 phase, the amorphous CaSiO3 phase was also detected in the ZC0.3 coating. Chemical stability in Tris-HCl buffer solution and antibacterial activity of the Zn-modified calcium silicate coatings increased with an increase in zinc content. In vitro cytocompatibility evaluation demonstrated that the proliferation and alkaline phosphatase activity and collagen type I (COLI) secretion of osteoblast-like MC3T3-E1 cells on Zn-modified coatings were significantly enhanced compared to the Zn-free coating and Ti-6Al-4V control, and no cytotoxicity appeared on Zn-modified coatings. The better antibacterial activity and the enhanced capability to promote MC3T3-E1 cells differentiation of Zn-modified coatings should be attributed to the slow and constant Zn2+ releasing from the coatings.

  17. Properties of amphiphilic oligonucleotide films at the air/water interface and after film transfer.

    PubMed

    Keller, R; Kwak, M; de Vries, J W; Sawaryn, C; Wang, J; Anaya, M; Müllen, K; Butt, H-J; Herrmann, A; Berger, R

    2013-11-01

    The self-assembly of amphiphilic hybrid materials containing an oligonucleotide sequence at the air/water interface was investigated by means of pressure-molecular area (Π-A) isotherms. In addition, films were transferred onto solid substrates and imaged using scanning force microscopy. We used oligonucleotide molecules with lipid tails, which consisted of a single stranded oligonucleotide 11 mer containing two hydrophobically modified 5-(dodec-1-ynyl)uracil nucleobases (dU11) at the 5'-end of the oligonucleotide sequence. The air/water interface was used as confinement for the self-assembling process of dU11. Scanning force microscopy of films transferred via Langmuir-Blodgett technique revealed mono-, bi- (Π ≥ 2 mN/m) and multilayer formation (Π ≥ 30 mN/m). The first layer was 1.6 ± 0.1 nm thick. It was oriented with the hydrophilic oligonucleotide moiety facing the hydrophilic substrate while the hydrophobic alkyl chains faced air. In the second layer the oligonucleotide moiety was found to face the air. The second layer was found to cover up to 95% of the sample area. Our measurements indicated that the rearrangement of the molecules into bi- and multiple bilayers happened already at the air/water interface. Similar results were obtained with a second type of oligonucleotide amphiphile, an oligonucleotide block copolymer, which was composed of an oligonucleotide 11 mer covalently attached at the terminus to polypropyleneoxide (PPO). Copyright © 2013 Elsevier B.V. All rights reserved.

  18. The prebiotic synthesis of oligonucleotides

    NASA Technical Reports Server (NTRS)

    Oro, J.; Stephen-Sherwood, E.

    1974-01-01

    This paper is primarily a review of recent developments in the abiotic synthesis of nucleotides, short chain oligonucleotides, and their mode of replication in solution. It also presents preliminary results from this laboratory on the prebiotic synthesis of thymidine oligodeoxynucleotides. A discussion, based on the physicochemical properties of RNA and DNA oligomers, relevant to the molecular evolution of these compounds leads to the tentative hypothesis that oligodeoxyribonucleotides of about 12 units may have been of sufficient length to initiate a self replicating coding system. Two models are suggested to account for the synthesis of high molecular weight oligomers using short chain templates and primers.

  19. SOAP: short oligonucleotide alignment program.

    PubMed

    Li, Ruiqiang; Li, Yingrui; Kristiansen, Karsten; Wang, Jun

    2008-03-01

    We have developed a program SOAP for efficient gapped and ungapped alignment of short oligonucleotides onto reference sequences. The program is designed to handle the huge amounts of short reads generated by parallel sequencing using the new generation Illumina-Solexa sequencing technology. SOAP is compatible with numerous applications, including single-read or pair-end resequencing, small RNA discovery and mRNA tag sequence mapping. SOAP is a command-driven program, which supports multi-threaded parallel computing, and has a batch module for multiple query sets. http://soap.genomics.org.cn.

  20. Photoelectrocatalytic reduction of CO2 into chemicals using Pt-modified reduced graphene oxide combined with Pt-modified TiO2 nanotubes.

    PubMed

    Cheng, Jun; Zhang, Meng; Wu, Gai; Wang, Xin; Zhou, Junhu; Cen, Kefa

    2014-06-17

    The photoelectrocatalytic (PEC) reduction of CO2 into high-value chemicals is beneficial in alleviating global warming and advancing a low-carbon economy. In this work, Pt-modified reduced graphene oxide (Pt-RGO) and Pt-modified TiO2 nanotubes (Pt-TNT) were combined as cathode and photoanode catalysts, respectively, to form a PEC reactor for converting CO2 into valuable chemicals. XRD, XPS, TEM, AFM, and SEM were employed to characterize the microstructures of the Pt-RGO and Pt-TNT catalysts. Reduction products, such as C2H5OH and CH3COOH, were obtained from CO2 under band gap illumination and biased voltage. A combined liquid product generation rate (CH3OH, C2H5OH, HCOOH, and CH3COOH) of approximately 600 nmol/(h·cm(2)) was observed. Carbon atom conversion rate reached 1,130 nmol/(h·cm(2)), which were much higher than those achieved using Pt-modified carbon nanotubes and platinum carbon as cathode catalysts.

  1. Oligonucleotide therapeutics for human leukaemia.

    PubMed

    Gewirtz, A M

    1997-01-01

    The concept of antisense oligonucleotide 'therapeutics' has generated a great deal of controversy. Questions abound regarding the mechanism of action of these compounds, their reliability and their ultimate utility. These problems are compounded by the 'hype', which has attended their development, and the inability of workers in this area to meet the expectations raised by its most zealous proponents. Nevertheless, it is worth pointing out that there have been some notable gene disruption successes with this technique that have stood up to rigorous scrutiny. Our own work with c-myb as a target is perhaps a reasonable example. Though much remains to be accomplished before antisense drugs are commonly, and usefully, employed in the clinic, it is important to remember what motivates their development. Gene-targeted drugs have the promise of exquisite specificity and the potential to do much good with little toxicity. Accordingly, antisense oligonucleotides can serve as a paradigm of rational drug development. For all these reasons then, we believe that efforts should be increased to decipher the mechanism of action of antisense oligodeoxynucleotides, and to learn how they may be successfully employed in the clinic.

  2. Mutational analysis using oligonucleotide microarrays

    PubMed Central

    Hacia, J.; Collins, F.

    1999-01-01

    The development of inexpensive high throughput methods to identify individual DNA sequence differences is important to the future growth of medical genetics. This has become increasingly apparent as epidemiologists, pathologists, and clinical geneticists focus more attention on the molecular basis of complex multifactorial diseases. Such undertakings will rely upon genetic maps based upon newly discovered, common, single nucleotide polymorphisms. Furthermore, candidate gene approaches used in identifying disease associated genes necessitate screening large sequence blocks for changes tracking with the disease state. Even after such genes are isolated, large scale mutational analyses will often be needed for risk assessment studies to define the likely medical consequences of carrying a mutated gene.
This review concentrates on the use of oligonucleotide arrays for hybridisation based comparative sequence analysis. Technological advances within the past decade have made it possible to apply this technology to many different aspects of medical genetics. These applications range from the detection and scoring of single nucleotide polymorphisms to mutational analysis of large genes. Although we discuss published scientific reports, unpublished work from the private sector12 could also significantly affect the future of this technology.


Keywords: mutational analysis; oligonucleotide microarrays; DNA chips PMID:10528850

  3. Lack of pharmacokinetic interaction for ISIS 113715, a 2'-0-methoxyethyl modified antisense oligonucleotide targeting protein tyrosine phosphatase 1B messenger RNA, with oral antidiabetic compounds metformin, glipizide or rosiglitazone.

    PubMed

    Geary, Richard S; Bradley, JoAnn D; Watanabe, Tanya; Kwon, Younggil; Wedel, Mark; van Lier, Jan J; VanVliet, André A

    2006-01-01

    ISIS 113715 is a 20-mer phosphorothioate antisense oligonucleotide (ASO) that is complementary to the protein tyrosine phosphatase 1B (PTP-1B) messenger RNA and subsequently reduces translation of the PTP-1B protein, a negative regulator of insulin receptor. ISIS 113715 is currently being studied in early phase II clinical studies to determine its ability to improve or restore insulin receptor sensitivity in patients with type 2 diabetes mellitus. Future work will investigate the combination of ISIS 113715 with antidiabetic compounds. In vitro ultrafiltration human plasma protein binding displacement studies and a phase I clinical study were used to characterise the potential for pharmacokinetic interaction of ISIS 113715 and three marketed oral antidiabetic agents. ISIS 113715 was co-incubated with glipizide and rosiglitazone in whole human plasma and tested for increased free drug concentrations. In a phase I clinical study, 23 healthy volunteers received a single oral dose of an antidiabetic compound (either metformin, glipizide or rosiglitazone) both alone and together with subcutaneous ISIS 113715 200 mg in a sequential crossover design. A comparative pharmacokinetic analysis was performed to determine if there were any effects that resulted from coadministration of ISIS 113715 with these antidiabetic compounds. In vitro human plasma protein binding displacement studies showed only minor effects on rosiglitazone and no effect on glipizide when co-incubated with ISIS 113715. The results of the phase I clinical study further indicate that there were no measurable changes in glipizide (5 mg), metformin (500 mg) or rosiglitazone (2 mg) exposure parameters, maximum plasma concentration and the area under the concentration-time curve, or pharmacokinetic parameter, elimination half-life when coadministered with ISIS 113715. Furthermore, there was no effect of ISIS 113715, administered in combination with metformin, on the urinary excretion of metformin. Conversely

  4. 40 CFR 372.20 - Process for modifying covered chemicals and facilities.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... or delete a chemical from TRI list of covered chemicals. (d) In general. (1) Any person may petition the Administrator to add or delete a chemical to or from the list described in subsection (c) of... shall take one of the following actions: (i) Initiate a rulemaking to add or delete the chemical to or...

  5. Cellular Uptake and Intracellular Trafficking of Oligonucleotides: Implications for Oligonucleotide Pharmacology

    PubMed Central

    Ming, Xin; Carver, Kyle; Laing, Brian

    2014-01-01

    One of the major constraints on the therapeutic use of oligonucleotides is inefficient delivery to their sites of action in the cytosol or nucleus. Recently it has become evident that the pathways of cellular uptake and intracellular trafficking of oligonucleotides can strongly influence their pharmacological actions. Here we provide background information on the basic processes of endocytosis and trafficking and then review recent literature on targeted delivery and subcellular trafficking of oligonucleotides in that context. A variety of approaches including molecular scale ligand-oligonucleotide conjugates, ligand-targeted nanocarriers, and the use of small molecules to enhance oligonucleotide effects are discussed. PMID:24383421

  6. Complementary addressed modification and cleavage of a single stranded DNA fragment with alkylating oligonucleotide derivatives.

    PubMed Central

    Vlassov, V V; Zarytova, V F; Kutiavin, I V; Mamaev, S V; Podyminogin, M A

    1986-01-01

    A single stranded DNA fragment was modified with alkylating derivatives of oligonucleotides complementary to a certain nucleotide sequences in the fragment. The derivatives carried aromatic 2-chloroethylamino groups at their 3'- or 5'-terminal nucleotide residues. Some of the derivatives carried both alkylating group and intercalating phenazine group which stabilized complementary complexes. It was found that these oligonucleotide derivatives modify the DNA fragment in a specific way near the target complementary nucleotide sequences, and the DNA fragment can be cleaved at the alkylated nucleotides positions. Alkylating derivatives carrying phenazine groups were found to be the most efficient in reaction with the DNA fragment. Images PMID:3714471

  7. Enzyme-linked synthetic oligonucleotide probes: non-radioactive detection of enterotoxigenic Escherichia coli in faecal specimens.

    PubMed Central

    Li, P; Medon, P P; Skingle, D C; Lanser, J A; Symons, R H

    1987-01-01

    Synthetic oligonucleotides, complementary to unique sequences in the heat stable enterotoxin gene of Escherichia coli specific for humans, were prepared with a 30-atom spacer arm and a 3' terminal sulfhydryl group which was coupled to bromoacetyl-derivatized alkaline phosphatase. The resulting direct enzyme-linked oligonucleotide probes, containing one enzyme molecule per oligonucleotide, successfully diagnosed enterotoxigenic Escherichia coli in clinical specimens by using a modified colony hybridization method and a colorimetric assay. The procedure is rapid, simple and reliable with a sensitivity equivalent to that using 5'-terminally labelled [32p]-oligonucleotide probes. The results indicate that the enzyme-labelled oligonucleotide probes should be applicable to the routine diagnosis of enterotoxigenic Escherichia coli and possess the potential for the detection of other microbial pathogens. Images PMID:3299267

  8. Automated Solid-Phase Click Synthesis of Oligonucleotide Conjugates: From Small Molecules to Diverse N-Acetylgalactosamine Clusters.

    PubMed

    Farzan, Valentina M; Ulashchik, Egor A; Martynenko-Makaev, Yury V; Kvach, Maksim V; Aparin, Ilya O; Brylev, Vladimir A; Prikazchikova, Tatiana A; Maklakova, Svetlana Yu; Majouga, Alexander G; Ustinov, Alexey V; Shipulin, German A; Shmanai, Vadim V; Korshun, Vladimir A; Zatsepin, Timofei S

    2017-10-04

    We developed a novel technique for the efficient conjugation of oligonucleotides with various alkyl azides such as fluorescent dyes, biotin, cholesterol, N-acetylgalactosamine (GalNAc), etc. using copper-catalysed alkyne-azide cycloaddition on the solid phase and CuI·P(OEt)3 as a catalyst. Conjugation is carried out in an oligonucleotide synthesizer in fully automated mode and is coupled to oligonucleotide synthesis and on-column deprotection. We also suggest a set of reagents for the construction of diverse conjugates. The sequential double-click procedure using a pentaerythritol-derived tetraazide followed by the addition of a GalNAc or Tris-GalNAc alkyne gives oligonucleotide-GalNAc dendrimer conjugates in good yields with minimal excess of sophisticated alkyne reagents. The approach is suitable for high-throughput synthesis of oligonucleotide conjugates ranging from fluorescent DNA probes to various multi-GalNAc derivatives of 2'-modified siRNA.

  9. Coarse-grained molecular dynamics simulation of DNA translocation in chemically modified nanopores.

    PubMed

    Ramachandran, Abhijit; Guo, Qingjiang; Iqbal, Samir M; Liu, Yaling

    2011-05-19

    Solid-state nanopores provide a direct means to detect and analyze DNA and proteins. In a typical setup, the DNA molecules travel through a nanopore under electrophoretic voltage bias. The nanopore is sandwiched between two chambers that are filled with ionic solution. A major challenge in using solid-state nanopores for DNA sequencing and gene detection is to improve their selectivity and detection sensitivity. To achieve these goals, one solution is to functionalize the nanopores by chemically modifying the pore walls with silanes or nucleic acids. However, little is known about molecular interactions in functionalized nanopores. This paper presents DNA translocation dynamics and the mechanism of DNA sequencing in a functionalized nanopore through a coarse-grained molecular dynamics model. The DNA nucleotide is coarse-grained into two interaction sites: one site corresponds to the base group and the other encompasses the phosphate and sugar groups. The water molecules are included in the model implicitly through Langevin dynamics. The coarse-grained model immensely improves the computational efficiency while still capturing the essential translocation dynamics. The model characterizes important physical properties of functionalized nanopores such as the effective pore diameter and effect of biasing voltage on the DNA translocation dynamics. The model reveals a nonlinear relationship between translocation speed of DNA and applied voltage. Moreover, DNA translocation in nanopores functionalized with hairpin-loop (HPL) DNA and single-stranded DNA (ss-DNA) shows significant differences: a target DNA is found to translocate through a ss-DNA coated nanopore 9 times faster than through an HPL coated one at a bias of 100 mV, putatively from lower stiffness of ss-DNA than that for HPL. The DNA translocation speed is also largely influenced by interaction potential between the DNA and surface-tethered molecules. The results reveal that such selective translocation

  10. Comparison of different antisense oligonucleotides against the BCR/ABL junction in chronic myelogenous leukemia.

    PubMed

    Kaebisch, A; Seay, U; Wicker, S; Weber, C; Lohmeyer, J; Ortigao, J; Pralle, H

    1996-05-01

    The activity of the BCR/ABL hybrid gene is associated with a growth advantage of the chronic myelogenous leukemia (CML) stem cell. Suppression of BCR/ABL hybrid gene expression can be a valuable tool for leukemic cell purging. Antisense oligonucleotides (ODNs) have the capacity to specifically downregulate gene expression. Data reported on the effect they have on BCR/ABL hybrid gene expression are controversial. We present data illustrating that prolongation of ODN half-life by means of chemical or sequence modification has only limited specific growth suppressive effect on BCR/ABL-positive clonogenic cells in vitro. Compared to unmodified phosphodiester ODNs (PO-ODNs) spanning the BCR/ABL junctions, modified ODNs with either a 3'-GC-clamp (GC-ODNs) or ODNs with one 3'-inverted nucleotide (3'-3' ODNs) to prevent 3'-exonuclease degradation, showed significantly prolonged extra- and intracellular half lives and different subcellular distributions in CML cell lines. In clonogenic assays from patients with CML, the modified ODNs were to some extent able to reduce colonies expressing BCR/ABL (GC-ODNs >3'-3'-ODNs >PO-ODNs). This difference did not become significant statistically. We demonstrate a substantially diminished hybridization efficacy of the modified antisense ODNs used, which may serve as a possible explanation for the failure to augment the leukemic cell purging efficacy.

  11. Efficacy of chemical root surface modifiers in the treatment of periodontal disease. A systematic review.

    PubMed

    Mariotti, Angelo

    2003-12-01

    Periodontal regeneration has been a relentless goal of the periodontist. Perhaps the oldest and most frequently attempted type of regeneration has involved chemical modification of the root surface. Varying results from histological and clinical studies have created controversy about the clinical effectiveness of root surface decalcification. This systematic review assesses the efficacy of root surface biomodification through the use of citric acid, tetracycline, or ethylenediaminetetraacetic acid (EDTA) in patients with chronic periodontitis. Does the use of chemical root declacification result in effective periodontal regeneration and improved clinical outcomes in patients with chronic periodontitis? The Cochrane Database of Systematic Reviews; Database of Abstracts of Reviews of Effectiveness; Cochrane Central Register of Controlled Trials; American College of Physicians Journal Club, evidence-based MEDLINE journals; and National Center for Biotechnology Information PubMed Journals, as well as Dogpile, Google, and Copernic search engines were screened. Hand searches were performed on the Journal of Clinical Periodontology, Journal of Periodontology, Journal of Periodontal Research, and Periodontology 2000. Searches were performed for relevant clinical trials published through September 25, 2002. Histological and clinical studies evaluating the effects of citric acid, tetracycline, or EDTA on root surfaces of patients with chronic periodontitis were considered for inclusion. Studies evaluating extracellular matrix proteins (e.g., fibronectin), enamel matrix proteins (e.g., amelogenins), or other proteins or growth factors applied to the root surface were not included. Primary outcome measures included changes in connective tissue attachment, cementogenesis, clinical attachment levels, probing depths, and gingival recession. Secondary outcome measures included changes in bone level, gingival inflammation, and plaque levels. Results for continuous outcome measures

  12. Oligonucleotide-based biosensors for in vitro diagnostics and environmental hazard detection.

    PubMed

    Jung, Il Young; Lee, Eun Hee; Suh, Ah Young; Lee, Seung Jin; Lee, Hyukjin

    2016-04-01

    Oligonucleotide-based biosensors have drawn much attention because of their broad applications in in vitro diagnostics and environmental hazard detection. They are particularly of interest to many researchers because of their high specificity as well as excellent sensitivity. Recently, oligonucleotide-based biosensors have been used to achieve not only genetic detection of targets but also the detection of small molecules, peptides, and proteins. This has further broadened the applications of these sensors in the medical and health care industry. In this review, we highlight various examples of oligonucleotide-based biosensors for the detection of diseases, drugs, and environmentally hazardous chemicals. Each example is provided with detailed schematics of the detection mechanism in addition to the supporting experimental results. Furthermore, future perspectives and new challenges in oligonucleotide-based biosensors are discussed.

  13. The Fidelity of Template-Directed Oligonucleotide Ligation and the Inevitability of Polymerase Function

    NASA Astrophysics Data System (ADS)

    James, Kenneth D.; Ellington, Andrew D.

    1999-08-01

    The first living systems may have employed template-directed oligonucleotide ligation for replication. The utility of oligonucleotide ligation as a mechanism for the origin and evolution of life is in part dependent on its fidelity. We have devised a method for evaluating ligation fidelity in which ligation substrates are selected from random sequence libraries. The fidelities of chemical and enzymatic ligation are compared under a variety of conditions. While reaction conditions can be found that promote high fidelity copying, departure from these conditions leads to error-prone copying. In particular, ligation reactions with shorter oligonucleotide substrates are less efficient but more faithful. These results support a model for origins in which there was selective pressure for template-directed oligonucleotide ligation to be gradually supplanted by mononucleotide polymerization.

  14. Removal of Cu(II) from aqueous solutions using chemically modified chitosan.

    PubMed

    Kannamba, B; Reddy, K Laxma; AppaRao, B V

    2010-03-15

    Chemically modified chitosan namely epichlorohydrin cross-linked xanthate chitosan (ECXCs) has been used for the removal of Cu(II) ions from aqueous medium. The influence of various operating parameters such as pH, temperature, sorbent dosage, initial concentration of Cu(II) ions and contact time on the adsorption capacity of ECXCs has been investigated. Thermodynamic parameters namely Delta G degrees, Delta H degrees and DeltaS degrees of the Cu(II) adsorption process have been calculated. Differential anodic stripping voltammetric technique was used to determine the concentration of Cu(II) in the test solution before and after adsorption. The nature of the possible adsorbent-metal ion interactions was studied by Fourier transform infrared spectroscopy and X-ray photoelectron spectroscopy. The studies showed that the adsorption of Cu(II) on ECXCs strongly depends on pH and temperature. The maximum adsorption capacity was observed at pH 5.0 and the adsorption capacity of ECXCs increased with increasing temperature indicating the endothermic nature of adsorption process. Langmuir and Freundlich adsorption equations were used to fit the experimental data. The adsorption process is found to follow the pseudo-second-order kinetic model. The maximum adsorption capacity was found to be 43.47 mg g(-1) from the Langmuir isotherm model at 50 degrees C. During desorption studies 97-100% of adsorbed copper ion is released into solution in presence of 1N EDTA, HCl and H(2)SO(4). (c) 2009 Elsevier B.V. All rights reserved.

  15. Chemically modified tetracyclines selectively inhibit IL-6 expression in osteoblasts by decreasing mRNA stability.

    PubMed

    Kirkwood, Keith; Martin, Thomas; Andreadis, Stelios T; Kim, Young Joon

    2003-11-01

    In bone biology, interleukin (IL)-6 is an autocrine/paracrine cytokine which can induce osteoclasts formation and activation to help mediate inflammatory bone destruction. Previous studies have shown that tetracycline and its derivatives have potentially beneficial therapeutic effects in the prevention and treatment of metabolic bone diseases by modulating osteoblast and osteoclast activities. Our previous studies indicated that non-antimicrobial chemically modified tetracyclines (CMTs) can dose-dependently inhibit IL-1 beta-induced IL-6 secretion in osteoblastic cells. In the present study, we explored the molecular mechanisms underlying the ability of doxycycline analogs CMT-8 and its non-chelating pyrazole derivative, CMT-5 to affect IL-6 gene expression in murine osteoblasts. Steady-state IL-6 mRNA was decreased with CMT-8 (ca. 50%) but not by CMT-5 when stimulated by IL-1 beta. CMT-8 regulation of IL-1 beta-induced IL-6 gene expression was further explored. CMT-8 did not affect IL-6 promoter activity in reporter gene assays. However, the IL-6 mRNA stability was decreased in the presence of CMT-8. These effects require de novo protein synthesis as they were inhibited by cycloheximide. Western blot analysis indicated that CMT-8 did not affect p38 mitogen-activated protein kinase, c-jun NH(2)-terminal kinases, or extracellular signal-regulated kinases (1 and 2) phosphorylation in response to IL-1 beta. These data suggest that CMT-8 can modulate inhibit IL-1 beta-induced IL-6 expression in MC3T3-E1 cells at the post-transcriptional level affecting IL-6 mRNA stability. These observations may offer a novel molecular basis for this treatment of metabolic bone diseases that are mediated by IL-6.

  16. Adsorptive separation of rhodium(III) using Fe(III)-templated oxine type of chemically modified chitosan

    SciTech Connect

    Alam, M.S.; Inoue, Katsutoshi; Yoshizuka, Kazuharu; Ishibashi, Hideaki

    1998-03-01

    The oxine type of chemically modified chitosan was prepared by the template crosslinking method using Fe(III) as a template ion. Batchwise adsorption of rhodium(III) on this chemically modified chitosan was examined from chloride media in the absence and presence of a large amount of tin(II). It was observed that the Fe(III)-templated oxine type of chemically modified chitosan shows better performance for rhodium adsorption than that of the original chitosan. When Sn(II) is absent from the solution, Rh(III) is hardly adsorbed on the modified chitosan and the order of selectivity of the adsorption of Rh(III), Pt(IV), and Cu(II) was found to be Pt(IV) > Cu(II) {approx} Rh(III). On the other hand, adsorption of rhodium is significantly increased in the presence of Sn(II) and the selectivity order of the adsorption was drastically changed to Rh(III) > Pt(IV) {much_gt} Cu(II), which ensures selective separation of Rh(III) from their mixture. Adsorption of Rh(III) increases with an increase in the concentration of Sn(II) in the aqueous solution, and maximum adsorption is achieved at a molar ratio, [Sn]/[Rh], of >6. The adsorption of Rh(III) decreases at a high concentration of hydrochloric acid. The maximum adsorption capacity was evaluated to be 0.92 mol/kg-dry adsorbent. Stripping tests of rhodium from the loaded chemically modified chitosan were carried out using different kinds of stripping agents containing some oxidizing agent. The maximum stripping of rhodium under these experimental conditions was found to be 72.5% by a single contact with 0.5 M HCl + 8 M HNO{sub 3}.

  17. Chemically and compositionally modified solid solution disordered multiphase nickel hydroxide positive electrode for alkaline rechargeable electrochemical cells

    DOEpatents

    Ovshinsky, Stanford R.; Corrigan, Dennis; Venkatesan, Srini; Young, Rosa; Fierro, Christian; Fetcenko, Michael A.

    1994-01-01

    A high capacity, long cycle life positive electrode for use in an alkaline rechargeable electrochemical cell comprising: a solid solution nickel hydroxide material having a multiphase structure that comprises at least one polycrystalline .gamma.-phase including a polycrystalline .gamma.-phase unit cell comprising spacedly disposed plates with at least one chemical modifier incorporated around the plates, the plates having a range of stable intersheet distances corresponding to a 2.sup.+ oxidation state and a 3.5.sup.+, or greater, oxidation state; and at least one compositional modifier incorporated into the solid solution nickel hydroxide material to promote the multiphase structure.

  18. Oligonucleotide-Functionalized Anisotropic Gold Nanoparticles

    NASA Astrophysics Data System (ADS)

    Jones, Matthew Robert

    In this thesis, we describe the properties of oligonucleotide-functionalized gold colloids under the unique set of conditions where the particles are geometrically anisotropic and have nanometer-scale dimensions. While nearly two decades of previous work elucidated numerous unexpected and emergent phenomena arising from the combination of inorganic nanoparticles with surface-bound DNA strands, virtually nothing was known about how these properties are altered when the shape of the nanoparticle core is chosen to be non-spherical. In particular, we are interested in understanding, and ultimately controlling, the ways in which these DNA-conjugated anisotropic nanostructures interact when their attraction is governed by programmable DNA hybridization events. Chapter 1 introduces the field of DNA-based materials assembly by discussing how nanoscale building blocks which present rigid, directional interactions can be thought of as possessing artificial versions of the familiar chemical principles of "bonds" and "valency". In chapter 2 we explore the fundamental interparticle binding thermodynamics of DNA-functionalized spherical and anisotropic nanoparticles, which reveals enormous preferences for collective ligand interactions occurring between flat surfaces over those that occur between curved surfaces. Using these insights, chapter 3 demonstrates that when syntheses produce mixtures of different nanoparticle shapes, the tailorable nature of DNA-mediated interparticle association can be used to selectively crystallize and purify the desired anisotropic nanostructure products, leaving spherical impurity particles behind. Chapter 4 leverages the principle that the flat facets of anisotropic particles generate directional DNA-based hybridization interactions to assemble a variety of tailorable nanoparticle superlattices whose symmetry and dimensionality are a direct consequence of the shape of the nanoparticle building block used in their construction. Chapter 5 explores

  19. Quantum chemical characterization of zwitterionic structures: Supramolecular complexes for modifying the wettability of oil-water-limestone system.

    PubMed

    Lopez-Chavez, Ernesto; Garcia-Quiroz, Alberto; Gonzalez-Garcia, Gerardo; Orozco-Duran, Gabriela E; Zamudio-Rivera, Luis S; Martinez-Magadan, José M; Buenrostro-Gonzalez, Eduardo; Hernandez-Altamirano, Raul

    2014-06-01

    In this work, we present a quantum chemical study pertaining to some supramolecular complexes acting as wettability modifiers of oil-water-limestone system. The complexes studied are derived from zwitterionic liquids of the types N'-alkyl-bis, N-alquenil, N-cycloalkyl, N-amyl-bis-beta amino acid or salts acting as sparkling agents. We studied two molecules of zwitterionic liquids (ZL10 and ZL13), HOMO and LUMO levels, and the energy gap between them, were calculated, as well as the electron affinity (EA) and ionization potential (IP), chemical potential, chemical hardness, chemical electrophilicity index and selectivity descriptors such Fukui indices. In this work, electrochemical comparison was realized with cocamidopropyl betaine (CPB), which is a structure zwitterionic liquid type, nowadays widely applied in enhanced recovery processes.

  20. Antisense oligonucleotide therapeutics for human leukemia.

    PubMed

    Gewirtz, A M

    1998-01-01

    The development of reliable gene disruption strategies, and their application in living cells, has proven to be an extraordinary important advance for cell and molecular biologists. Using the various available approaches, the specific functions of any given gene may now be investigated directly in the relevant cell type. Application of similar experimental tools in a clinical setting might prove to be equally valuable and could well form the basis of a monumental advance in the practice of clinical medicine. This seems particularly true at the present time because much progress has been made in understanding the molecular pathogenesis of many diseases, including cancer. For these reasons a tremendous amount of interest has been generated in the use of oligodeoxynucleotides to modify gene expression. However, in spite of some notable successes which are detailed in this review, oligonucleotides have generated controversy in regard to their mechanism of action, reliability, and ultimate therapeutic utility. Nevertheless, the potential power of the "antisense" approach remains undisputed, and its ultimate therapeutic utility is far reaching. Accordingly, the problems associated with the use of these compounds are clearly worth solving. It remains the hope of many laboratories that the day will soon come when these techniques will make an important contribution to the management of chronic myelogenous leukemia and other neoplastic disorders.

  1. Antisense oligonucleotide therapeutics for human leukemia.

    PubMed

    Gewirtz, A M

    1997-01-01

    The development of reliable gene disruption strategies, and their application in living cells, has proven to be an extraordinarily important advance for cell and molecular biologists. Using the various available approaches, the specific functions of any given gene may now be investigated directly in the relevant cell type. Application of similar experimental tools in a clinical setting might prove to be equally valuable and could well form the basis of a monumental advance in the practice of clinical medicine. This seems particularly true at the present time since much progress has been made in understanding the molecular pathogenesis of many diseases, including cancer. For these reasons a tremendous amount of interest has been generated in the use of oligodeoxynucleotides to modify gene expression. However, in spite of some notable successes which are detailed in this review, oligonucleotides have generated controversy in regards to their mechanism of action, reliability, and ultimate therapeutic utility. Nevertheless, the potential power of the "antisense" approach remains undisputed, and its ultimate therapeutic utility is far reaching. Accordingly, the problems associated with the use of these compounds are clearly worth solving. It remains the hope of many laboratories that the day will soon come when these techniques will make an important contribution to the management of CML and other neoplastic disorders.

  2. Oligonucleotide and Long Polymeric DNA Encoding

    SciTech Connect

    Miller, E; Mariella Jr., R P; Christian, A T; Gardner, S N; Williams, J M

    2003-11-24

    This report summarizes the work done at Lawrence Livermore National Laboratory for the Oligonucleotide and Long Polymeric DNA Encoding project, part of the Microelectronic Bioprocesses Program at DARPA. The goal of the project was to develop a process by which long (circa 10,000 base-pair) synthetic DNA molecules could be synthesized in a timely and economic manner. During construction of the long molecule, errors in DNA sequence occur during hybridization and/or the subsequent enzymatic process. The work done on this project has resulted in a novel synthesis scheme that we call the parallel pyramid synthesis protocol, the development of a suit of computational tools to minimize and quantify errors in the synthesized DNA sequence, and experimental proof of this technique. The modeling consists of three interrelated modules: the bioinformatics code which determines the specifics of parallel pyramid synthesis for a given chain of long DNA, the thermodynamics code which tracks the products of DNA hybridization and polymerase extension during the later steps in the process, and the kinetics model which examines the temporal and spatial processes during one thermocycle. Most importantly, we conducted the first successful syntheses of a gene using small starting oligomers (tetramers). The synthesized sequence, 813 base pairs long, contained a 725 base pair gene, modified green fluorescent protein (mGFP), which has been shown to be a functional gene by cloning into cells and observing its green fluorescent product.

  3. Adaptive resolution simulation of oligonucleotides.

    PubMed

    Netz, Paulo A; Potestio, Raffaello; Kremer, Kurt

    2016-12-21

    Nucleic acids are characterized by a complex hierarchical structure and a variety of interaction mechanisms with other molecules. These features suggest the need of multiscale simulation methods in order to grasp the relevant physical properties of deoxyribonucleic acid (DNA) and RNA using in silico experiments. Here we report an implementation of a dual-resolution modeling of a DNA oligonucleotide in physiological conditions; in the presented setup only the nucleotide molecule and the solvent and ions in its proximity are described at the atomistic level; in contrast, the water molecules and ions far from the DNA are represented as computationally less expensive coarse-grained particles. Through the analysis of several structural and dynamical parameters, we show that this setup reliably reproduces the physical properties of the DNA molecule as observed in reference atomistic simulations. These results represent a first step towards a realistic multiscale modeling of nucleic acids and provide a quantitatively solid ground for their simulation using dual-resolution methods.

  4. Adaptive resolution simulation of oligonucleotides

    NASA Astrophysics Data System (ADS)

    Netz, Paulo A.; Potestio, Raffaello; Kremer, Kurt

    2016-12-01

    Nucleic acids are characterized by a complex hierarchical structure and a variety of interaction mechanisms with other molecules. These features suggest the need of multiscale simulation methods in order to grasp the relevant physical properties of deoxyribonucleic acid (DNA) and RNA using in silico experiments. Here we report an implementation of a dual-resolution modeling of a DNA oligonucleotide in physiological conditions; in the presented setup only the nucleotide molecule and the solvent and ions in its proximity are described at the atomistic level; in contrast, the water molecules and ions far from the DNA are represented as computationally less expensive coarse-grained particles. Through the analysis of several structural and dynamical parameters, we show that this setup reliably reproduces the physical properties of the DNA molecule as observed in reference atomistic simulations. These results represent a first step towards a realistic multiscale modeling of nucleic acids and provide a quantitatively solid ground for their simulation using dual-resolution methods.

  5. An automated multiplex oligonucleotide synthesizer: development of high-throughput, low-cost DNA synthesis.

    PubMed Central

    Lashkari, D A; Hunicke-Smith, S P; Norgren, R M; Davis, R W; Brennan, T

    1995-01-01

    An automated oligonucleotide synthesizer has been developed that can simultaneously and rapidly synthesize up to 96 different oligonucleotides in a 96-well microtiter format using phosphoramidite synthesis chemistry. A modified 96-well plate is positioned under reagent valve banks, and appropriate reagents are delivered into individual wells containing the growing oligonucleotide chain, which is bound to a solid support. Each well has a filter bottom that enables the removal of spent reagents while retaining the solid support matrix. A seal design is employed to control synthesis environment and the entire instrument is automated via computer control. Synthesis cycle times for 96 couplings are < 11 min, allowing a plate of 96 20-mers to be synthesized in < 5 hr. Oligonucleotide synthesis quality is comparable to commercial machines, with average coupling efficiencies routinely > 98% across the entire 96-well plate. No significant well-to-well variations in synthesis quality have been observed in > 6000 oligonucleotides synthesized to date. The reduced reagent usage and increased capacity allow the overall synthesis cost to drop by at least a factor of 10. With the development of this instrument, it is now practical and cost-effective to synthesize thousands to tens of thousands of oligonucleotides. PMID:7644513

  6. Electrochemical impedance spectroscopy for graphene surface modification and protein translocation through the chemically modified graphene nanopore

    NASA Astrophysics Data System (ADS)

    Tiwari, Purushottam; Shan, Yuping; Wang, Xuewen; Darici, Yesim; He, Jin

    2014-03-01

    The multilayer graphene surface has been modified using mercaptohexadecanoic acid (MHA) and 1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-750] (DPPE-PEG750). The surface modifications are evaluated using electrochemical impedance spectroscopy (EIS). EIS measurements show the better graphene surface passivation with DPPE-PEG750 than with MHA. After modification with ferritin, the MHA modified surface shows greater charge transfer resistance (Rct) change than DPPE-PEG750 modified surface. Based on these results the translocations of ferritin through modified graphene nanopore with diameter 5-20 nm are studied. The translocation is more successful through DPPE-PEG750 modified graphene nanopore. This concludes that that the attachment of ferritin to DPPE-PEG750 modified graphene nanopore is not significant compared to MHA modified pore for the ferritin translocation hindrance. These results nicely correlate with the EIS data for respective Rct change of ferritin modified surfaces. P. Tiwari would like to thank FIU School of Integrated Science & Humanity, College Arts & Sciences for the research assistantship.

  7. Streptavidin-coated gold nanoparticles: critical role of oligonucleotides on stability and fractal aggregation

    PubMed Central

    D'Agata, Roberta; Palladino, Pasquale

    2017-01-01

    Gold nanoparticles (AuNPs) exhibit unique properties that can be modulated through a tailored surface functionalization, enabling their targeted use in biochemical sensing and medical diagnostics. In particular, streptavidin-modified AuNPs are increasingly used for biosensing purposes. We report here a study of AuNPs surface-functionalized with streptavidin-biotinylated oligonucleotide, focussing on the role played by the oligonucleotide probes in the stabilization/destabilization of the functionalized nanoparticle dispersion. The behaviour of the modified AuNP dispersion as a consequence of the competitive displacement of the biotinylated oligonucleotide has been investigated and the critical role of displaced oligonucletides in triggering the quasi one-dimensional aggregation of nanoparticles is demonstrated for the first time. The thorough understanding of the fundamental properties of bioconjugated AuNPs is of great importance for the design of highly sensitive and reliable functionalized AuNP-based assays. PMID:28144559

  8. Sex determination of bovine preimplantation embryos by oligonucleotide microarray.

    PubMed

    Yang, Hua; Zhong, Fagang; Yang, Yonglin; Wang, Xinhua; Liu, Shouren; Zhu, Bin

    2013-06-01

    The aim has been to set up a rapid and accurate microarray assay using sandwich mode for sex determination of bovine preimplantation embryos. Twelve sequence-specific oligonucleotide capture probes used to discriminate 12 samples were spotted onto the aldehyde-modified glass slides by Arrayer. The 2 recognition probes used to identify coding regions of the sex-determining region of the Y chromosome gene (SRY) and β-casein (CSN2) reference gene were coupled with biotin. The assay was optimized by using genomic DNA extracted from blood samples of known sex individuals. Polymerase chain reaction (PCR) was used to amplify the fragments in the HMG box region of SRY gene and CSN2 gene with sequence-specific primers. The sex of samples was identified by detecting both the SRY and CSN2 genes simultaneously in 2 reaction cells of microarrays, with the male having SRY and CSN2 signals and the female only CSN2. The sex of 20 bovine preimplantation embryos was determined by oligonucleotide microarray. The protocol was run with a blind test that showed a 100% (82/82) specificity and accuracy in sexing of leukocytes. The bovine embryos were transferred into 20 bovine recipients, with a pregnant rate of 40% (8/20). Three calves were born at term, and 5 fetuses were miscarried. Their sexes were fully in accordance with the embryonic sex predetermination predicted by oligonucleotide microarray. This suggests that the oligonucleotide microarray method of SRY gene analysis can be used in early sex prediction of bovine embryos in breeding programs.

  9. Direct determination of bismuth, indium and lead in sea water by Zeeman ETAAS using molybdenum containing chemical modifiers.

    PubMed

    Acar, O; Türker, A R; Kılıç, Z

    1999-06-01

    Direct determination of Bi, In and Pb in sea water samples has been carried out by ETAAS with Zeeman background correction using molybdenum containing chemical modifiers and tartaric acid as a reducing agent. Maximum pyrolysis temperatures and the effect of mass ratios of the mixed modifier components on analytes have been investigated. Mo+Pd+TA or Mo+Pt+TA mixture was found to be powerful for the determination of 50 mug l(-1) of Bi, In and Pb spiked into synthetic and real sea waters. The accuracy and precision of the determination were thereby enhanced. The recoveries of analytes spiked were 94-103% with Mo+Pd+TA or Mo+Pt+TA and they are only 49-61% without modifier.

  10. Investigation of chemical modifiers for phosphorus in a graphite furnace using high-resolution continuum source atomic absorption spectrometry

    NASA Astrophysics Data System (ADS)

    Lepri, Fábio G.; Dessuy, Morgana B.; Vale, Maria Goreti R.; Borges, Daniel L. G.; Welz, Bernhard; Heitmann, Uwe

    2006-08-01

    Phosphorus is not one of the elements that are typically determined by atomic absorption spectrometry, but this technique nevertheless offers several advantages that make it attractive, such as the relatively great freedom from interferences. As the main resonance lines for phosphorus are in the vacuum-ultraviolet, inaccessible by conventional atomic absorption spectrometry equipment, Ĺvov and Khartsyzov proposed to use the non-resonance doublet at 213.5 / 213.6 nm. Later it turned out that with conventional equipment it is necessary to use a chemical modifier in order to get reasonable sensitivity, and lanthanum was the first one suggested for that purpose. In the following years more than 30 modifiers have been proposed for the determination of this element, and there is no consensus about the best one. In this work high-resolution continuum source atomic absorption spectrometry has been used to investigate the determination of phosphorus without a modifier and with the addition of selected modifiers of very different nature, including the originally recommended lanthanum modifier, several palladium-based modifiers and sodium fluoride. As high-resolution continuum source atomic absorption spectrometry is revealing the spectral environment of the analytical line at high resolution, it became obvious that without the addition of a modifier essentially no atomic phosphorus is formed, even at 2700 °C. The absorption measured with line source atomic absorption spectrometry in this case is due to the PO molecule, the spectrum of which is overlapping with the atomic line. Palladium, with or without the addition of calcium or ascorbic acid, was found to be the only modifier to produce almost exclusively atomic phosphorus. Lanthanum and particularly sodium fluoride produced a mixture of P and PO, depending on the atomization temperature. This fact can explain at least some of the discrepancies found in the literature and some of the phenomena observed in the

  11. Analysing chemical attraction of gravid Anopheles gambiae sensu stricto with modified BG-Sentinel traps.

    PubMed

    Okal, Michael N; Herrera-Varela, Manuela; Ouma, Paul; Torto, Baldwyn; Lindsay, Steven W; Lindh, Jenny M; Fillinger, Ulrike

    2015-06-03

    Cues that guide gravid Anopheles gambiae sensu lato to oviposition sites can be manipulated to create new strategies for monitoring and controlling malaria vectors. However, progress towards identifying such cues is slow in part due to the lack of appropriate tools for investigating long-range attraction to putative oviposition substrates. This study aimed to develop a relatively easy-to-use bioassay system that can effectively analyse chemical attraction of gravid Anopheles gambiae sensu stricto. BG-Sentinel™ mosquito traps that use fans to dispense odourants were modified to contain aqueous substrates. Choice tests with two identical traps set in an 80 m(2) screened semi-field system were used to analyse the catch efficacy of the traps and the effectiveness of the bioassay. A different batch of 200 gravid An. gambiae s.s. was released on every experimental night. Choices tested were (1) distilled versus distilled water (baseline) and (2) distilled water versus soil infusion. Further, comparisons were made of distilled water and soil infusions both containing 150 g/l of Sodium Chloride (NaCl). Sodium Chloride is known to affect the release rate of volatiles from organic substrates. When both traps contained distilled water, 45% (95 confidence interval (CI) 33-57%) of all released mosquitoes were trapped. The proportion increased to 84% (95 CI 73-91%) when traps contained soil infusions. In choice tests, a gravid female was twice as likely to be trapped in the test trap with soil infusion as in the trap with distilled water (odds ratio (OR) 1.8, 95% CI 1.3-2.6). Furthermore, the attraction of gravid females towards the test trap with infusion more than tripled (OR 3.4, 95% CI 2.4-4.8) when salt was added to the substrates. Minor modifications of the BG-Sentinel™ mosquito trap turned it into a powerful bioassay tool for evaluating the orientation of gravid mosquitoes to putative oviposition substrates using olfaction. This study describes a useful tool for

  12. Chemically modified, non-anticoagulant heparin derivatives are potent galectin-3 binding inhibitors and inhibit circulating galectin-3-promoted metastasis.

    PubMed

    Duckworth, Carrie A; Guimond, Scott E; Sindrewicz, Paulina; Hughes, Ashley J; French, Neil S; Lian, Lu-Yun; Yates, Edwin A; Pritchard, D Mark; Rhodes, Jonathan M; Turnbull, Jeremy E; Yu, Lu-Gang

    2015-09-15

    Concentrations of circulating galectin-3, a metastasis promoter, are greatly increased in cancer patients. Here we show that 2- or 6-de-O-sulfated, N-acetylated heparin derivatives are galectin-3 binding inhibitors. These chemically modified heparin derivatives inhibited galectin-3-ligand binding and abolished galectin-3-mediated cancer cell-endothelial adhesion and angiogenesis. Unlike standard heparin, these modified heparin derivatives and their ultra-low molecular weight sub-fractions had neither anticoagulant activity nor effects on E-, L- or P-selectin binding to their ligands nor detectable cytotoxicity. Intravenous injection of such heparin derivatives (with cancer cells pre-treated with galectin-3 followed by 3 subcutaneous injections of the derivatives) abolished the circulating galectin-3-mediated increase in lung metastasis of human melanoma and colon cancer cells in nude mice. Structural analysis using nuclear magnetic resonance and synchrotron radiation circular dichroism spectroscopies showed that the modified heparin derivatives bind to the galectin-3 carbohydrate-recognition domain. Thus, these chemically modified, non-anticoagulant, low-sulfated heparin derivatives are potent galectin-3 binding inhibitors with substantial potential as anti-metastasis/cancer drugs.

  13. Chemically modified, non-anticoagulant heparin derivatives are potent galectin-3 binding inhibitors and inhibit circulating galectin-3-promoted metastasis

    PubMed Central

    Sindrewicz, Paulina; Hughes, Ashley J.; French, Neil S.; Lian, Lu-Yun; Yates, Edwin A.; Pritchard, D. Mark; Rhodes, Jonathan M.; Turnbull, Jeremy E.; Yu, Lu-Gang

    2015-01-01

    Concentrations of circulating galectin-3, a metastasis promoter, are greatly increased in cancer patients. Here we show that 2- or 6-de-O-sulfated, N-acetylated heparin derivatives are galectin-3 binding inhibitors. These chemically modified heparin derivatives inhibited galectin-3-ligand binding and abolished galectin-3-mediated cancer cell-endothelial adhesion and angiogenesis. Unlike standard heparin, these modified heparin derivatives and their ultra-low molecular weight sub-fractions had neither anticoagulant activity nor effects on E-, L- or P-selectin binding to their ligands nor detectable cytotoxicity. Intravenous injection of such heparin derivatives (with cancer cells pre-treated with galectin-3 followed by 3 subcutaneous injections of the derivatives) abolished the circulating galectin-3-mediated increase in lung metastasis of human melanoma and colon cancer cells in nude mice. Structural analysis using nuclear magnetic resonance and synchrotron radiation circular dichroism spectroscopies showed that the modified heparin derivatives bind to the galectin-3 carbohydrate-recognition domain. Thus, these chemically modified, non-anticoagulant, low-sulfated heparin derivatives are potent galectin-3 binding inhibitors with substantial potential as anti-metastasis/cancer drugs. PMID:26160844

  14. Study of the adsorption and electroadsorption process of Cu (II) ions within thermally and chemically modified activated carbon.

    PubMed

    Macías-García, A; Gómez Corzo, M; Alfaro Domínguez, M; Alexandre Franco, M; Martínez Naharro, J

    2017-04-15

    The aim of this work is to modify the porous texture and superficial groups of a commercial activated carbon through chemical and thermal treatment and subsequently study the kinetics of adsorption and electroadsorption of Cu (II) ion for these carbons. Samples of three activated carbons were used. These were a commercial activated carbon, commercial activated carbon modified thermically (C-N2-900) and finally commercial activated carbon modified chemically C-SO2-H2S-200. The activated carbons were characterized chemically and texturally and the electrical conductivity of them determined. Different kinetic models were applied. The kinetics of the adsorption and electroadsorption process of the Cu (II) ion fits a pseudo second order model and the most likely mechanism takes place in two stages. A first step through transfer of the metal mass through the boundary layer of the adsorbent and distribution of the Cu (II) on the external surface of the activated carbon and a second step that represents intraparticle diffusion and joining of the Cu (II) with the active centres of the activated carbon. Finally, the kinetics of the adsorption process are faster than the kinetics of the electroadsorption but the percentage of the Cu (II) ion retained is much higher in the electroadsorption process.

  15. Biosorption of Cr(VI) from aqueous solution by chemically modified potato starch: equilibrium and kinetic studies.

    PubMed

    Pillai, Saumya S; Mullassery, Manohar D; Fernandez, Noeline B; Girija, N; Geetha, P; Koshy, Mathew

    2013-06-01

    The biosorption capacity of chemically modified potato starch (CPS) for Cr(VI) from aqueous solution was investigated. The materials derived from carbohydrates are biodegradable and are generally regarded as safe and environmentally acceptable. The hydroxyl, carboxyl and carbonyl groups are responsible for the biosorption process. In the present study, the influence of various important parameters such as pH, time, biosorbent dose and initial Cr(VI) concentration on the biosorption capacity were investigated. The isotherms such as Langmuir, Freundlich and Tempkin were studied. The Freundlich and the Redlich-Peterson isotherms had been well fitted the biosorption of Cr(VI) with chemically modified potato starch. The kinetics of Cr(VI) removal using chemically modified potato starch was well explained by second-order kinetic model. The thermodynamic parameters were also evaluated from the biosorption measurements. Among the various desorbing agents tested, 98.2 percent chromium recovery was achieved with 0.1molL(-1) NaOH.

  16. Unraveling sorption of lead in aqueous solutions by chemically modified biochar derived from coconut fiber: A microscopic and spectroscopic investigation.

    PubMed

    Wu, Weidong; Li, Jianhong; Lan, Tian; Müller, Karin; Niazi, Nabeel Khan; Chen, Xin; Xu, Song; Zheng, Lirong; Chu, Yingchao; Li, Jianwu; Yuan, Guodong; Wang, Hailong

    2017-01-15

    In this study, we examined the efficacy of nine different types of coconut-fiber derived biochars (CFBs), prepared at different temperatures and chemically modified with ammonia, hydrogen peroxide and nitric acid, to remove lead (Pb(2+)) from aqueous solutions. Langmuir-qm values of the biochars pyrolyzed at 300°C and modified with ammonia and nitric acid increased from 49.5 to 105.5 and 85.2mgg(-1), respectively, compared to control (unmodified), whereas hydrogen peroxide treatment had no effect. The maximum amount of Pb adsorbed on biochars was in the order of CFB-700>MCFB-300-NH3·H2O>CFB-500>MCFB-300-HNO3>CFB-300. X-ray absorption fine structure (XAFS) spectroscopy results revealed that Pb-montmorillonite, Pb(C2H3O2)2, PbSO4, Pb-Al2O3 and Pb3(PO4)2 were the five most important Pb species observed in Pb-loaded biochars, and as such, favoring Pb immobilization in aqueous solutions. Overall, the sorption capacity of CFBs pyrolyzed at 300°C substantially increased for Pb(2+) with ammonia and nitric acid modification. However, these chemical modifications did not improve the sorption of Pb on CFBs pyrolyzed at temperatures ≥500°C, thereby highlighting a temperature dependent response of chemically modified biochars to Pb sorption in this study. Copyright © 2016 Elsevier B.V. All rights reserved.

  17. Detection of Aeromonas hydrophila DNA oligonucleotide sequence using a biosensor design based on Ceria nanoparticles decorated reduced graphene oxide and Fast Fourier transform square wave voltammetry.

    PubMed

    Jafari, Safiye; Faridbod, Farnoush; Norouzi, Parviz; Dezfuli, Amin Shiralizadeh; Ajloo, Davood; Mohammadipanah, Fatemeh; Ganjali, Mohammad Reza

    2015-10-01

    A new strategy was introduced for ssDNA immobilization on a modified glassy carbon electrode. The electrode surface was modified using polyaniline and chemically reduced graphene oxide decorated cerium oxide nanoparticles (CeO2NPs-RGO). A single-stranded DNA (ssDNA) probe was immobilized on the modified electrode surface. Fast Fourier transform square wave voltammetry (FFT-SWV) was applied as detection technique and [Ru(bpy)3](2+/3+) redox signal was used as electrochemical marker. The hybridization of ssDNA with its complementary target caused a dramatic decrease in [Ru(bpy)3](2+/3+) FFT-SW signal. The proposed electrochemical biosensor was able to detect Aeromonas hydrophila DNA oligonucleotide sequence encoding aerolysin protein. Under optimal conditions, the biosensor showed excellent selectivity toward complementary sequence in comparison with noncomplementary and two-base mismatch sequences. The dynamic linear range of this electrochemical DNA biosensor for detecting 20-mer oligonucleotide sequence of A. hydrophila was from 1 × 10(-15) to 1 × 10(-8) mol L(-1). The proposed biosensor was successfully applied for the detection of DNA extracted from A. hydrophila in fish pond water up to 0.01 μg mL(-1) with RSD of 5%. Besides, molecular docking was applied to consider the [Ru(bpy)3](2+/3+) interaction with ssDNA before and after hybridization.

  18. Oligonucleotide-based pharmaceuticals: Non-clinical and clinical safety signals and non-clinical testing strategies.

    PubMed

    Mustonen, Enni-Kaisa; Palomäki, Tiina; Pasanen, Markku

    2017-09-28

    Antisense oligonucleotides, short interfering RNAs (siRNAs) and aptamers are oligonucleotide-based pharmaceuticals with a promising role in targeted therapies. Currently, five oligonucleotide-based pharmaceuticals have achieved marketing authorization in Europe or USA and many more are undergoing clinical testing. However, several safety concerns have been raised in non-clinical and clinical studies. Oligonucleotides share properties with both chemical and biological pharmaceuticals and therefore they pose challenges also from the regulatory point of view. We have analyzed the safety data of oligonucleotides and evaluated the applicability of current non-clinical toxicological guidelines for assessing the safety of oligonucleotide-based pharmaceuticals. Oligonucleotide-based pharmaceuticals display a similar toxicological profile, exerting adverse effects on liver and kidney, evoking hematological alterations, as well as causing immunostimulation and prolonging the coagulation time. It is possible to extrapolate some of these effects from non-clinical studies to humans. However, evaluation strategies for genotoxicity testing of "non-natural" oligonucleotides should be revised. Additionally, the selective use of surrogates and prediction of clinical endpoints for non-clinically observed immunostimulation is complicated by its multiple potential manifestations, demanding improvements in the testing strategies. Utilizing more relevant and mechanistic-based approaches and taking better account of species differences, could possibly improve the prediction of relevant immunological/proinflammatory effects in humans. Copyright © 2017. Published by Elsevier Inc.

  19. Gallium-68-labelled NOTA-oligonucleotides: an optimized method for their preparation.

    PubMed

    Gijs, Marlies; Dammicco, Sylvestre; Warnier, Corentin; Aerts, An; Impens, Nathalie R E N; D'Huyvetter, Matthias; Léonard, Marc; Baatout, Sarah; Luxen, André

    2016-02-01

    One of the most essential aspects to the success of radiopharmaceuticals is an easy and reliable radiolabelling protocol to obtain pure and stable products. In this study, we optimized the bioconjugation and gallium-68 ((68) Ga) radiolabelling conditions for a single-stranded 40-mer DNA oligonucleotide, in order to obtain highly pure and stable radiolabelled oligonucleotides. Quantitative bioconjugation was obtained for a disulfide-functionalized oligonucleotide conjugated to the macrocylic bifunctional chelator MMA-NOTA (maleimido-mono-amide (1,4,7-triazanonane-1,4,7-triyl)triacetic acid). Next, this NOTA-oligonucleotide bioconjugate was radiolabelled at room temperature with purified and pre-concentrated (68) Ga with quantitative levels of radioactive incorporation and high radiochemical and chemical purity. In addition, high chelate stability was observed in physiological-like conditions (37 °C, PBS and serum), in the presence of a transchelator (EDTA) and transferrin. A specific activity of 51.1 MBq/nmol was reached using a 1470-fold molar excess bioconjugate over (68) Ga. This study presents a fast, straightforward and reliable protocol for the preparation of (68) Ga-radiolabelled DNA oligonucleotides under mild reaction conditions and without the use of organic solvents. The methodology herein developed will be applied to the preparation of oligonucleotidic sequences (aptamers) targeting the human epidermal growth factor receptor 2 (HER2) for cancer imaging. Copyright © 2015 John Wiley & Sons, Ltd.

  20. In vitro characterization of two novel biodegradable vectors for the delivery of radiolabeled antisense oligonucleotides.

    PubMed

    von Guggenberg, Elisabeth; Shahhosseini, Soraya; Koslowsky, Ingrid; Lavasanifar, Afsaneh; Murray, David; Mercer, John

    2010-12-01

    The development of antisense oligonucleotides suitable for tumor targeting applications is hindered by low stability and bioavailability of oligonucleotides in vivo and by the absence of efficient and safe vectors for oligonucleotide delivery. Stabilization in vivo has been achieved through chemical modification of oligonucleotides by various means, but effective approaches to enhance their intracellular delivery are lacking. This study reports on the characterization in vitro of a fully phosphorothioated 20-mer oligonucleotide, complementary to p21 mRNA, radiolabeled with fluorine-18 using a thiol reactive prosthetic group. The potential of two novel synthetic block copolymers containing grafted polyamines on their hydrophobic blocks for vector-assisted cell delivery was studied in vitro. Extensive cellular uptake studies were performed in human colon carcinoma cell lines with enhanced or deficient p21 expression to evaluate and compare the uptake mechanism of naked and vectorized radiolabeled formulations. Uptake studies with the two novel biodegradable vectors showed a moderate increase in cell uptake of the radiofluorinated antisense oligonucleotide. The two vectors show, however, promising advantages over conventional lipidic vectors regarding their biocompatibility and subcellular distribution.

  1. Conjugates of Phthalocyanines With Oligonucleotides as Reagents for Sensitized or Catalytic DNA Modification

    PubMed Central

    Chernonosov, Alexander A.; Koval, Vladimir V.; Knorre, Dmitrii G.; Chernenko, Alexander A.; Derkacheva, Valentina M.; Lukyanets, Eugenii A.; Fedorova, Olga S.

    2006-01-01

    Several conjugates of metallophthalocyanines with deoxyribooligonucleotides were synthesized to investigate sequence-specific modification of DNA by them. Oligonucleotide parts of these conjugates were responsible for the recognition of selected complementary sequences on the DNA target. Metallophthalocyanines were able to induce the DNA modification: phthalocyanines of Zn(II) and Al(III) were active as photosensitizers in the generation of singlet oxygen 1O2, while phthalocyanine of Co(II) promoted DNA oxidation by molecular oxygen through the catalysis of formation of reactive oxygen species (.O2−, H2O2, OH). Irradiation of the reaction mixture containing either Zn(II)- or Al(III)-tetracarboxyphthalocyanine conjugates of oligonucleotide pd(TCTTCCCA) with light of > 340 nm wavelength (Hg lamp or He/Ne laser) resulted in the modification of the 22-nucleotide target d(TGAATGGGAAGAGGGTCAGGTT). A conjugate of Co(II)-tetracarboxyphthalocyanine with the oligonucleotide was found to modify the DNA target in the presence of O2 and 2-mercaptoethanol or in the presence of H2O2. Under both sensitized and catalyzed conditions, the nucleotides G13–G15 were mainly modified, providing evidence that the reaction proceeded in the double-stranded oligonucleotide. These results suggest the possible use of phthalocyanine-oligonucleotide conjugates as novel artificial regulators of gene expression and therapeutic agents for treatment of cancer. PMID:17497012

  2. DNA-binding and oxidative properties of cationic phthalocyanines and their dimeric complexes with anionic phthalocyanines covalently linked to oligonucleotides.

    PubMed

    Kuznetsova, A A; Lukyanets, E A; Solovyeva, L I; Knorre, D G; Fedorova, O S

    2008-12-01

    Design of chemically modified oligonucleotides for regulation of gene expression has attracted considerable attention over the past decades. One actively pursued approach involves antisense or antigene oligonucleotide constructs carrying reactive groups, many of these based on transition metal complexes. The complexes of Fe(II) and Co(II) with phthalocyanines are extremely good catalysts of oxidation of organic compounds with molecular oxygen and hydrogen peroxide. The binding of positively charged Fe(II) and Co(II) phthalocyanines with single- and double-stranded DNA was investigated. It was shown that these phthalocyanines interact with nucleic acids through an outside binding mode. The site-directed modification of single-stranded DNA by O2 and H2O2 in the presence of dimeric complexes of negatively and positively charged Fe(II) and Co(II) phthalocyanines was investigated. These complexes were formed directly on single-stranded DNA through interaction between negatively charged phthalocyanine in conjugate and positively charged phthalocyanine in solution. The resulting oppositely charged phthalocyanine complexes showed significant increase of catalytic activity compared with monomeric forms of phthalocyanines Fe(II) and Co(II). These complexes catalyzed the DNA oxidation with high efficacy and led to direct DNA strand cleavage. It was determined that oxidation of DNA by molecular oxygen catalyzed by complex of Fe(II)-phthalocyanines proceeds with higher rate than in the case of Co(II)-phthalocyanines but the latter led to a greater extent of target DNA modification.

  3. Chemical modifiers for direct determination of cobalt in coal combustion residues by ultrasonic slurry-sampling-ETAAS.

    PubMed

    Felipe-Sotelo, M; Carlosena, A; Fernández, E; López-Mahía, P; Muniategui, S; Prada, D

    2001-12-01

    Five modifiers were tested for the direct determination of cobalt in coal fly ash and slag by ultrasonic slurry-sampling electrothermal atomic absorption spectrometry (USS-ETAAS). The furnace temperature programs and the appropriate amount for each modifier were optimized to get the highest signal and the best separation between the atomic and background signals. Nitric acid (0.5% v/v) was the most adequate chemical modifier for cobalt determination, selecting 1,450 degrees C and 2,100 degrees C as pyrolysis and atomization temperatures, respectively. This modifier also acts as liquid medium for the slurry simplifying the procedure. The remaining modifiers enhanced the background signal, totally overlapped with cobalt peak. The method optimized gave a limit of detection of 0.36 microg g(-1), a characteristic mass of 13 +/- 1 pg and an overall-method precision which is highly satisfactory (<7%, RSD). The method was validated by analyzing two certified coal fly ash materials, and satisfactory recoveries were obtained (83-90%) and no statistical differences were observed between the experimental and the certified cobalt concentrations. Additionally, certified sediment, soil and urban particulate matter were assayed; again good results were obtained. The developed methodology was used to determine cobalt in several coal combustion residues from five Spanish power plants.

  4. Binding of Co(II) and Cu(II) cations to chemically modified wool fibres: an IR investigation

    NASA Astrophysics Data System (ADS)

    Taddei, Paola; Monti, Patrizia; Freddi, Giuliano; Arai, Takayuki; Tsukada, Masuhiro

    2003-05-01

    Wool fibres were modified by treatment with tannic acid (TA) solution or by acylation with ethylenediaminetetraacetic (EDTA) dianhydride. The unmodified and modified fibres were subsequently treated with Cu 2+ and Co 2+ solutions, at alkaline pH, and analysed by Attenuated Total Reflectance, ATR/IR spectroscopy to evaluate the changes induced in the structure of the fibre by metal binding. The spectral changes were correlated to metal adsorption results obtained by Inductive Coupled Plasma-Atomic Emission Spectrometry (ICP-AES). The IR results were discussed in relation to our previous findings on the metal binding mode of Bombyx mori and Tussah silk fibres; the changes observed in the spectra were explained by considering the different affinity of the fibres for the modifying reagent and the amount of the metal absorbed. More relevant spectral changes were observed upon Cu 2+ complexation rather than Co 2+ complexation, according to the metal absorption results. The most relevant changes were observed for the EDTA-modified wool sample treated with Cu 2+, according to the higher affinity of wool for EDTA. The IR spectra were quantitatively evaluated by the intensity ratio between the Amide I and Amide II bands (I AmideI/I AmideII) and its trend as a function of metal absorption was reported. The present investigation demonstrated that the interaction between fibre and metal and the subsequent fibre modification depend on the chemical nature of the fibre, the metal cation and the modifying reagent.

  5. Considerations for the Characterization and Interpretation of Results Related to Alternative Complement Activation in Monkeys Associated with Oligonucleotide-Based Therapeutics.

    PubMed

    Henry, Scott P; Seguin, Rosanne; Cavagnaro, Joy; Berman, Cindy; Tepper, Jeff; Kornbrust, Douglas

    2016-08-01

    This article provides an overview of the discussions held by the Immunomodulatory Subcommittee of the Oligonucleotide Safety Working Group on complement activation induced by oligonucleotides, most notably the phosphorothioate-containing oligonucleotides. Alternative complement pathway activation in monkeys is a common effect of single-stranded phosphorothioate backbone oligonucleotides in toxicology studies. This article discusses the mechanism for activation, general investigational strategy, and the impact of various chemical modifications. The goal is to provide the best practice approach to characterizing this effect, understanding the implication of the species specificity, and the interpretation of clinical relevance.

  6. OSWG Recommendations for Genotoxicity Testing of Novel Oligonucleotide-Based Therapeutics.

    PubMed

    Berman, Cindy L; Barros, Scott A; Galloway, Sheila M; Kasper, Peter; Oleson, Frederick B; Priestley, Catherine C; Sweder, Kevin S; Schlosser, Michael J; Sobol, Zhanna

    2016-04-01

    The Oligonucleotide Safety Working Group subcommittee on genotoxicity testing considers therapeutic oligonucleotides (ONs) unlikely to be genotoxic based on their properties and on the negative results for ONs tested to date. Nonetheless, the subcommittee believes that genotoxicity testing of new ONs is warranted because modified monomers could be liberated from a metabolized ON and incorporated into DNA and could hypothetically cause chain termination, miscoding, and/or faulty replication or repair. The standard test battery as described in Option 1 of International Conference on Harmonisation S2(R1) is generally adequate to assess such potential. However, for the in vitro assay for gene mutations, mammalian cells are considered more relevant than bacteria for most ONs due to their known responsiveness to nucleosides and their greater potential for ON uptake; on the other hand, bacterial assays may be more appropriate for ONs containing non-ON components. Testing is not recommended for ONs with only naturally occurring chemistries or for ONs with chemistries for which there is documented lack of genotoxicity in systems with demonstrated cellular uptake. Testing is recommended for ONs that contain non-natural chemical modifications and use of the complete drug product (including linkers, conjugates, and liposomes) is suggested to provide the most clinically relevant assessment. Documentation of uptake into cells comparable to those used for genotoxicity testing is proposed because intracellular exposure cannot be assumed for these large molecules. ONs could also hypothetically cause mutations through triple helix formation with genomic DNA and no tests are available for detection of such sequence-specific mutations across the entire genome. However, because the potential for triplex formation by therapeutic ONs is extremely low, this potential can be assessed adequately by sequence analysis.

  7. Complex DNA nanostructures from oligonucleotide ensembles.

    PubMed

    Mathur, Divita; Henderson, Eric R

    2013-04-19

    The first synthetic DNA nanostructures were created by self-assembly of a small number of oligonucleotides. Introduction of the DNA origami method provided a new paradigm for designing and creating two- and three-dimensional DNA nanostructures by folding a large single-stranded DNA and 'stapling' it together with a library of oligonucleotides. Despite its power and wide-ranging implementation, the DNA origami technique suffers from some limitations. Foremost among these is the limited number of useful single-stranded scaffolds of biological origin. This report describes a new approach to creating large DNA nanostructures exclusively from synthetic oligonucleotides. The essence of this approach is to replace the single-stranded scaffold in DNA origami with a library of oligonucleotides termed "scaples" (scaffold staples). Scaples eliminate the need for scaffolds of biological origin and create new opportunities for producing larger and more diverse DNA nanostructures as well as simultaneous assembly of distinct structures in a "single-pot" reaction.

  8. Identification and characterization of intracellular proteins that bind oligonucleotides with phosphorothioate linkages

    PubMed Central

    Liang, Xue-hai; Sun, Hong; Shen, Wen; Crooke, Stanley T.

    2015-01-01

    Although the RNase H-dependent mechanism of inhibition of gene expression by chemically modified antisense oligonucleotides (ASOs) has been well characterized, little is known about the interactions between ASOs and intracellular proteins that may alter cellular localization and/or potency of ASOs. Here, we report the identification of 56 intracellular ASO-binding proteins using multi-step affinity selection approaches. Many of the tested proteins had no significant effect on ASO activity; however, some proteins, including La/SSB, NPM1, ANXA2, VARS and PC4, appeared to enhance ASO activities, likely through mechanisms related to subcellular distribution. VARS and ANXA2 co-localized with ASOs in endocytic organelles, and reduction in the level of VARS altered lysosome/ASO localization patterns, implying that these proteins may facilitate ASO release from the endocytic pathway. Depletion of La and NPM1 reduced nuclear ASO levels, suggesting potential roles in ASO nuclear accumulation. On the other hand, Ku70 and Ku80 proteins inhibited ASO activity, most likely by competition with RNase H1 for ASO/RNA duplex binding. Our results demonstrate that phosphorothioate-modified ASOs bind a set of cellular proteins that affect ASO activity via different mechanisms. PMID:25712094

  9. Cr(VI) adsorption from electroplating plating wastewater by chemically modified coir pith.

    PubMed

    Suksabye, Parinda; Thiravetyan, Paitip

    2012-07-15

    Coir pith samples were chemically modified by grafting with acrylic acid for the removal of Cr(VI) from electroplating wastewater. The presence of acrylic acid on the coir pith surface was verified by a scanning electron microscope with an electron dispersive x-ray spectrometer (SEM/EDX), Fourier transform infrared spectroscopy (FTIR) and thermogravimetry (TG). The carbonyl groups (C==O) from the carboxylic acids (COOH) increased on the coir pith surface after grafting with acrylic acid. In addition, the thermal stability of the acrylic acid-grafted coir pith also improved. The optimum conditions for grafting the acrylic acid on the coir pith consisted of 2 M acrylic acid and 0.00125 M ceric ammonium nitrate (CAN, as an initiator). The maximum Cr(VI) removal (99.99 ± 0.07%) was obtained with the following conditions: a 1.3% (w/v) dosage of acrylic acid-grafted coir pith, a system pH of 2, a contact time of 22 h, a temperature of 30 °C, a particle size of <150 μm and an initial Cr(VI) of 1,171 mg l(-1). At system pH of 2, Cr(VI) in the HCrO(4)(-) form can be adsorbed with acrylic acid-grafted coir pith via an electrostatic attraction. The adsorption isotherm of 2 M acrylic acid-grafted coir pith exhibited a good fit with the Langmuir isotherm. The maximum Cr(VI) adsorption capacity of the 2 M acrylic acid-grafted coir pith was 196.00 mg Cr(VI) g(-1) adsorbent, whereas for coir pith without grafting, the maximum Cr(VI) removal was 165.00 mg Cr(VI) g(-1) adsorbent. The adsorption capacity of the acrylic acid-grafted coir pith for Cr(VI) was higher compared to the original coir pith. This result was due to the enhancement of the carbonyl groups on the coir pith surface that may have involved the mechanism of chromium adsorption. The X-ray absorption near edged structure (XANES) and desorption studies suggested that most of the Cr(III) that presented on the acrylic acid-grafted coir pith was due to the Cr(VI) being reduced to Cr(III) on the adsorbent surface. FTIR

  10. Antisense oligonucleotides as therapeutics for malignant diseases.

    PubMed

    Ho, P T; Parkinson, D R

    1997-04-01

    The continued progress in our understanding of the biology of neoplasia and in the identification, cloning, and sequencing of genes critical to tumor cell function permits the exploitation of this information to develop specific agents that may directly modulate the function of these genes or their protein products. Antisense oligonucleotides are being investigated as a potential therapeutic modality that takes direct advantage of molecular sequencing. The antisense approach uses short oligonucleotides designed to hybridize to a target mRNA transcript through Watson-Crick base pairing. The formation of this oligonucleotide: RNA heteroduplex results in mRNA inactivation and consequent inhibition of synthesis of the protein product. A fundamental attraction of the antisense approach is that this method potentially may be applied to any gene product, in theory, for the treatment of malignant and non-malignant diseases. However, this simple and attractive model has proven to be much more complex in practice. A number of important challenges in the preclinical development of antisense oligonucleotides have been identified, including stability, sequence length, cellular uptake, target sequence selection, appropriate negative controls, oligonucleotide: protein interactions, and cost of manufacture. Although the biological activity of an oligonucleotide against its molecular target is theoretically sequence-dependent, the animal pharmacokinetics and toxicology of phosphorothioate analogues directed against vastly disparate gene products appear relatively non-sequence-specific. In oncology, a number of clinical trials have been initiated with antisense oligonucleotides directed against molecular targets including: p53; bcl-2; raf kinase; protein kinase C-alpha; c-myb. The experience gained from these early clinical trials will be applicable to the next generation of antisense agents in development. These may include molecules with novel backbones or other structural

  11. Incorporation of an aldehyde function in oligonucleotides.

    PubMed

    Tilquin, J M; Dechamps, M; Sonveaux, E

    2001-01-01

    A nucleotide-like phosphoramidite building block that has the nucleic base replaced by the tert-butyldimethylsilyl-protected styrene glycol was synthesized. After the automatic synthesis of an oligonucleotide incorporating this synthon, the benzaldehyde function was generated by fluoride deprotection and oxidation by sodium periodate. In a similar manner, an oligonucleotide where a nucleic base was replaced by the (CH2)8CH=O chain was synthesized and conjugated with biotin derivatives.

  12. In vivo site-directed mutagenesis using oligonucleotides.

    PubMed

    Storici, F; Lewis, L K; Resnick, M A

    2001-08-01

    Functional characterization of the genes of higher eukaryotes has been aided by their expression in model organisms and by analyzing site-specific changes in homologous genes in model systems such as the yeast Saccharomyces cerevisiae. Modifying sequences in yeast or other organisms such that no heterologous material is retained requires in vitro mutagenesis together with subcloning. PCR-based procedures that do not involve cloning are inefficient or require multistep reactions that increase the risk of additional mutations. An alternative approach, demonstrated in yeast, relies on transformation with an oligonucleotide, but the method is restricted to the generation of mutants with a selectable phenotype. Oligonucleotides, when combined with gap repair, have also been used to modify plasmids in yeast; however, this approach is limited by restriction-site availability. We have developed a mutagenesis approach in yeast based on transformation by unpurified oligonucleotides that allows the rapid creation of site-specific DNA mutations in vivo. A two-step, cloning-free process, referred to as delitto perfetto, generates products having only the desired mutation, such as a single or multiple base change, an insertion, a small or a large deletion, or even random mutations. The system provides for multiple rounds of mutation in a window up to 200 base pairs. The process is RAD52 dependent, is not constrained by the distribution of naturally occurring restriction sites, and requires minimal DNA sequencing. Because yeast is commonly used for random and selective cloning of genomic DNA from higher eukaryotes such as yeast artificial chromosomes, the delitto perfetto strategy also provides an efficient way to create precise changes in mammalian or other DNA sequences.

  13. Chemically Modified, α-Amino-3-hydroxy-5-methyl-4-isoxazole (AMPA) Receptor RNA Aptamers Designed for in Vivo Use.

    PubMed

    Huang, Zhen; Wen, Wei; Wu, Andrew; Niu, Li

    2017-09-05

    Glutamate ion channels have three subtypes, that is, α-amino-3-hydroxy-5-methyl-4-isoxazole (AMPA), kainate, and N-methyl-d-aspartate (NMDA) receptors. Excessive activity of these receptor subtypes either individually or collectively is involved in various neurological disorders. RNA aptamers as antagonists of these receptors are potential therapeutics. For developing aptamer therapeutics, the RNA aptamers must be chemically modified to become ribonuclease-resistant or stable in biological fluids. Using systematic evolution of ligands by exponential enrichment (SELEX) and a chemically modified library, prepared enzymatically (i.e., the library contains RNAs with 2'-fluoro modified nucleoside triphosphates or ATPs, CTPs and UTPs, but regular GTPs), we have isolated an aptamer. The short aptamer (69 nucleotides) FN1040s selectively inhibits the GluA1 and GluA2Qflip AMPA receptor subunits, whereas the full-length aptamer (101 nucleotides) FN1040 additionally inhibits GluK1, but not GluK2, kainate receptor, and GluN1a/2A and GluN1a/2B, the two major native NMDA receptors. The two aptamers show similar potency (2-4 μM) and are stable with a half-life of at least 2 days in serum-containing medium or cerebrospinal fluid. Therefore, these two aptamers are amenable for in vivo use.

  14. Magnetorheological finishing with chemically modified fluids for studying material removal of single-crystal ZnS

    NASA Astrophysics Data System (ADS)

    Salzman, S.; Romanofsky, H. J.; Clara, Y. I.; Giannechini, L. J.; West, Garrett J.; Lambropoulos, J. C.; Jacobs, S. D.

    2013-09-01

    Magnetorheological finishing (MRF) of polycrystalline, chemical-vapor-deposited (CVD) zinc sulfide (ZnS) and zinc selenide (ZnSe) can leave millimeter-size artifacts on the part surface. These pebble-like features come from the anisotropic mechanical and chemical properties of the ceramic material and from the CVD growth process itself. The resulting surface texture limits the use of MRF for polishing aspheric and other complex shapes using these important infrared (IR) ceramics. An investigation of the individual contributions of chemistry and mechanics to polishing of other polycrystalline ceramics has been employed in the past to overcome similar material anisotropy problems. The approach taken was to study the removal process for the different single-crystal orientations that comprise the ceramic, making adjustments to mechanics (polishing abrasive type and concentration) and polishing slurry chemistry (primarily pH) to equalize the removal rate for all crystal orientations. Polishing with the modified slurry was shown to prevent the development of surface texture. Here we present mechanical (microhardness testing) and chemical (acid etching) studies performed on the four single-crystal orientations of ZnS: 100, 110, 111, and 311. We found that the (111) plane is 35% to 55% harder and 30% to 40% more resistant to chemical etching than the other three planes. This relatively high degree of variation in these properties can help to explain the surface texture developed from MRF of the polycrystalline material. Theoretical calculations of microhardness, planar, and bond densities are presented and compared with the experimental data. Here surface characterization of these single-crystal orientations of ZnS for material removal and roughness with chemically modified MR fluids at various pH levels between pH 4 and pH 6 are presented for the first time.

  15. Chemical force mapping of phosphate and carbon on acid-modified tapioca starch surface.

    PubMed

    Wuttisela, Karntarat; Triampo, Wannapong; Triampo, Darapond

    2009-01-01

    Surface chemical microstructure of hydrochloric acid hydrolyzed tapioca starch producing different amylose:amylopectin (Am:Ap) ratios were studied with scanning chemical force microscopy (CFM). The chemical force probes were functionalized of two types with -OH (phosphate specific) and -CH3 (carbon specific). Lateral force trace-minus-retrace (TMR) images from -OH and -CH3 probes revealed changes in the phosphate domains and the carbon backbone for the varying acid hydrolyzed tapioca starch compared to that of the native tapioca starch. Scanning electron micrographs (SEM) showed different degree of the granule surface disruption before and after hydrolysis. The exterior structures of the acid hydrolyzed starch granules were chemically investigated with CFM to study the relationships of the surface molecular structures and the Am:Ap ratios.

  16. Synthesis and physico-chemical characterization of modified starches from banana (Musa AAB) and its biological activities in diabetic rats.

    PubMed

    Reddy, Chagam Koteswara; Suriya, M; Vidya, P V; Haripriya, Sundaramoorthy

    2017-01-01

    This study describes a simple method of preparation and physico-chemical properties of modified starches (type-3 resistant starches) from banana (Musa AAB), and the modified starches investigated as functional food with a beneficial effect on type-2 diabetes. RS3 was prepared using a method combined with debranching modification and physical modification; native and modifies starches were characterized by scanning electron microscope (SEM), powder X-ray diffraction (XRD), differential scanning calorimetry (DSC) and rapid visco analyzer (RVA). Use of the enzymatic and physical modification methodology, improved the yield of RS (26.62%) from Musa AAB. A reduced viscosity and swelling power; increased transition temperatures, water absorption capacity and solubility index with B-type crystalline pattern and loss of granular appearance were observed during the debranching modification and physical modification. The modified starches exhibited beneficial health effects in diabetic and HFD rats who consumed it. These results recommend that dietary feeding of RS3 was effective in the regulation of glucose and lipid profile in serum and suppressing the oxidative stress in rats under diabetic and HFD condition. This current study provides new bioactive starches, with potential applications in the food and non-food industries. Copyright © 2016 Elsevier B.V. All rights reserved.

  17. GenoMass software: a tool based on electrospray ionization tandem mass spectrometry for characterization and sequencing of oligonucleotide adducts

    PubMed Central

    Sharma, Vaneet K; Glick, James; Liao, Qing; Shen, Chang; Vouros, Paul

    2012-01-01

    The analysis of DNA adducts is of importance in understanding DNA damage, and in the last few years mass spectrometry (MS) has emerged as the most comprehensive and versatile tool for routine characterization of modified oligonucleotides. The structural analysis of modified oligonucleotides, although routinely analyzed using mass spectrometry, is followed by a large amount of data, and a significant challenge is to locate the exact position of the adduct by computational spectral interpretation, which still is a bottleneck. In this report, we present an additional feature of the in-house developed GenoMass software, which determines the exact location of an adduct in modified oligonucleotides by connecting tandem mass spectrometry (MS/MS) to a combinatorial isomer library generated in silico for nucleic acids. The performance of this MS/MS approach using GenoMass software was evaluated by MS/MS data interpretation for an unadducted and its corresponding N-acetylaminofluorene (AAF) adducted 17-mer (5′OH-CCT ACC CCT TCC TTG TA-3′OH) oligonucleotide. Further computational screening of this AAF adducted 17-mer oligonucleotide (5′OH-CCT ACC CCT TCC TTG TA-3′OH) from a complex oligonucleotide mixture was performed using GenoMass. Finally, GenoMass was also used to identify the positional isomers of the AAF adducted 15-mer oligonucleotide (5′OH-ATGAACCGGAGGCCC-3′OH). GenoMass is a simple, fast, data interpretation software that uses an in silico constructed library to relate the MS/MS sequencing approach to identify the exact location of adduct on oligonucleotides. PMID:22689626

  18. The Role of Chemical Transport in the Decay Resistance of Modified Wood. In: M

    Treesearch

    Samuel L. Zelinka; Rebecka Ringman; Annica Pulgard; Emil Engelund Thybring; Joseph E. Jakes; Klaus Richter

    2015-01-01

    A 2014 review by Ringman et al. examined established theories addressing why modified wood has increased decay resistance and concluded that the most probable cause of inhibition and/or delay of the initiation of brown rot decay is lowering the equilibrium moisture content for given environmental conditions. A 2013 paper by Jakes et al...

  19. Nanogels for Oligonucleotide Delivery to the Brain

    PubMed Central

    Vinogradov, Serguei V.; Batrakova, Elena V.; Kabanov, Alexander V.

    2009-01-01

    Systemic delivery of oligonucleotides (ODN) to the central nervous system is needed for development of therapeutic and diagnostic modalities for treatment of neurodegenerative disorders. Macromolecules injected in blood are poorly transported across the blood–brain barrier (BBB) and rapidly cleared from circulation. In this work we propose a novel system for ODN delivery to the brain based on nanoscale network of cross-linked poly(ethylene glycol) and polyethylenimine (“nanogel”). The methods of synthesis of nanogel and its modification with specific targeting molecules are described. Nanogels can bind and encapsulate spontaneously negatively charged ODN, resulting in formation of stable aqueous dispersion of polyelectrolyte complex with particle sizes less than 100 nm. Using polarized monolayers of bovine brain microvessel endothelial cells as an in vitro model this study demonstrates that ODN incorporated in nanogel formulations can be effectively transported across the BBB. The transport efficacy is further increased when the surface of the nanogel is modified with transferrin or insulin. Importantly the ODN is transported across the brain microvessel cells through the transcellular pathway; after transport, ODN remains mostly incorporated in the nanogel and ODN displays little degradation compared to the free ODN. Using mouse model for biodistribution studies in vivo, this work demonstrated that as a result of incorporation into nanogel 1 h after intravenous injection the accumulation of a phosphorothioate ODN in the brain increases by over 15 fold while in liver and spleen decreases by 2-fold compared to the free ODN. Overall, this study suggests that nanogel is a promising system for delivery of ODN to the brain. PMID:14733583

  20. Cell and tissue distribution of synthetic oligonucleotides in healthy and tumor-bearing nude mice. An autoradiographic, immunohistological, and direct fluorescence microscopy study.

    PubMed Central

    Plenat, F.; Klein-Monhoven, N.; Marie, B.; Vignaud, J. M.; Duprez, A.

    1995-01-01

    Antisense oligonucleotides have the ability to inhibit individual gene expression in the potential treatment of cancer and viral diseases. However, the way parenterally administered oligonucleotides distribute themselves into healthy tissues or tumors is poorly understood. In this study, the cell and tissue distribution of two modified or unmodified phosphodiester pentadeca-beta-oligonucleotides intravenously administered to healthy or tumor-bearing nude mice was assessed by autoradiography as well as by direct fluorescence and immunoenzymatic histological methods. Resistance of oligonucleotides to degradation by nuclease activity was previously studied in vitro. Using these methods we were able to show the following: 1) within minutes, oligonucleotides permeate all cells and tissues with the exceptions of erythrocytes and intervertebral discs; 2) cell and tissue distribution does not depend on the sequence of the given oligonucleotide; 3) concentration of oligonucleotides is higher within the connective tissue cells than in the interstitial matrix; 4) after uptake, oligomers partition throughout all of the cellular compartments, including at the highest intracellular concentrations in the nuclei; 5) oligonucleotides penetrate easily the tumor cell compartments, oligonucleotide diffusion being unimpeded by the extracellular matrix. Images Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Figure 10 Figure 11 Figure 12 PMID:7604874

  1. Surface plasmon resonance detection of oligonucleotide sequences of the rpoB genes of Mycobacterium tuberculosis.

    PubMed

    Rachkov, A; Patskovsky, S; Soldatkin, A; Meunier, M

    2011-09-30

    Oligonucleotide sequences related to the normal and mutated rpoB genes of Mycobacterium tuberculosis are detected using a surface plasmon resonance (SPR) biosensor system. A bioselective element was prepared by immobilizing the thiol-modified oligonucleotides of the selected sequence (the capture probe P2) that contains the mutated TCG→TTG codon 531 (evoking drug resistance) of the rpoB gene of M. tuberculosis on a gold sensor surface. Specific hybridization between immobilized probe P2 and complementary target T2 gave the highest sensor response, single-base mismatched oligonucleotide TN (corresponding to the normal gene sequence) produced somewhat smaller response and no response was observed at injection of noncomplementary oligonucleotide TC. The P2-T2 hybridization efficiency is calculated ca. 30% (5 × 10(12) molecules cm(-2)), and the lowest detection limit of T2 was 10nM. An extended T2E oligonucleotide sequence consisting of T2 sequence and additional 24 nucleotides was shown to cause more pronounced sensor response (at least 5 nM T2E was easily detected). Injection into the sensor cell of the oligonucleotides complementary to the free additional part of T2E after P2-T2E hybridization gave a significant additional SPR response, thus showing that the sandwich hybridization format further improves the sensor sensitivity and decreases the lowest detection limit. The experimental results on surface hybridization between the studied oligonucleotides were in good agreement with thermodynamic parameters of the hybridization calculated for solution conditions. The described approach could be proposed as a basis for creating a biosensor for real-time and label-free diagnostics of drug resistant tuberculosis. Copyright © 2011 Elsevier B.V. All rights reserved.

  2. Application of pervaporation and vapor permeation processes to separate aqueous ethanol solution through chemically modified Nylon 4 membranes

    SciTech Connect

    Wang, Y.H.; Teng, M.Y.; Lee, K.R.; Wang, D.M.; Lai, J.Y.

    1998-08-01

    The pervaporation performance of a Nylon 4 membrane, chemically grafted by N,N-dimethylaminoethyl methacrylate (DMAEM), DMAEM-g-N4, was studied by measurement of the permeation ratio and the pervaporation separation index. It was found that the water permselectivity and permeation rate for the chemically modified Nylon 4 membrane were higher than those of the unmodified Nylon 4 membrane. Optimum pervaporation results, a separation factor of 28.3, and a permeation rate of 439 g/m{sup 2}{center_dot}h, were obtained when the degree of grafting was 12.7%. It was also found that all the permeation ratios at low temperature were less than unity. In addition, compared with pervaporation, vapor permeation effectively increases the permselectivity of water.

  3. Repair of Thalassemic Human β -globin mRNA in Mammalian Cells by Antisense Oligonucleotides

    NASA Astrophysics Data System (ADS)

    Sierakowska, Halina; Sambade, Maria J.; Agrawal, Sudhir; Kole, Ryszard

    1996-11-01

    In one form of β -thalassemia, a genetic blood disorder, a mutation in intron 2 of the β -globin gene (IVS2-654) causes aberrant splicing of β -globin pre-mRNA and, consequently, β -globin deficiency. Treatment of mammalian cells stably expressing the IVS2-654 human β -globin gene with antisense oligonucleotides targeted at the aberrant splice sites restored correct splicing in a dose-dependent fashion, generating correct human β -globin mRNA and polypeptide. Both products persisted for up to 72 hr posttreatment. The oligonucleotides modified splicing by a true antisense mechanism without overt unspecific effects on cell growth and splicing of other pre-mRNAs. This novel approach in which antisense oligonucleotides are used to restore rather than to down-regulate the activity of the target gene is applicable to other splicing mutants and is of potential clinical interest.

  4. Ultramild protein-mediated click chemistry creates efficient oligonucleotide probes for targeting and detecting nucleic acids.

    PubMed

    Nåbo, Lina J; Madsen, Charlotte S; Jensen, Knud J; Kongsted, Jacob; Astakhova, Kira

    2015-05-26

    Functionalized synthetic oligonucleotides are finding growing applications in research, clinical studies, and therapy. However, it is not easy to prepare them in a biocompatible and highly efficient manner. We report a new strategy to synthesize oligonucleotides with promising nucleic acid targeting and detection properties. We focus in particular on the pH sensitivity of these new probes and their high target specificity. For the first time, human copper(I)-binding chaperon Cox17 was applied to effectively catalyze click labeling of oligonucleotides. This was performed under ultramild conditions with fluorophore, peptide, and carbohydrate azide derivatives. In thermal denaturation studies, the modified probes showed specific binding to complementary DNA and RNA targets. Finally, we demonstrated the pH sensitivity of the new rhodamine-based fluorescent probes in vitro and rationalize our results by electronic structure calculations. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. New protocol for oligonucleotide microarray fabrication using SU-8-coated glass microslides.

    PubMed

    Sethi, D; Kumar, A; Gandhi, R P; Kumar, P; Gupta, K C

    2010-09-15

    Microarray technology has become an important tool for detection and analysis of nucleic acid targets. Immobilization of modified and unmodified oligonucleotides on epoxy-functionalized glass surfaces is often used in microarray fabrication. Here, we demonstrate a protocol that employs coating of SU-8 (glycidyl ether of bisphenol A) onto glass microslides to obtain high density of epoxy functions for efficient immobilization of aminoalkyl-, thiophosphoryl-, and phosphorylated oligonucleotides with uniform spot morphology. The resulting microarrays exhibited high immobilization (∼65%) and hybridization efficiency (30-36%) and were sufficiently stable over a range of temperature and pH conditions. The prominent feature of the protocol is that spots can be visualized distinctly at 0.05 μM probe (a 20-mer oligonucleotide) concentration. The constructed microarrays were subsequently used for detection of base mismatches and bacterial diseases (meningitis and typhoid).

  6. Mechanism of enhanced Sb(V) removal from aqueous solution using chemically modified aerobic granules.

    PubMed

    Wang, Li; Wan, Chun-li; Zhang, Yi; Lee, Duu-Jong; Liu, Xiang; Chen, Xiao-feng; Tay, Joo-Hwa

    2015-03-02

    Sb(V) removal using Fe-modified aerobic granules was investigated. Increasing the biomass dosage improved the Sb(V) removal rate, but lowered the adsorption quantity; the optimal biomass concentration was 20 g/L (wet basis). Adsorption equilibrium was obtained at 2h at 175 rpm; the adsorption quantity was 36.6 mg/g. NaCl and other salts inhibited Sb(V) adsorption on Fe-modified granules, and the mechanism possibly lied more with the anions. The adsorption isotherms were evaluated using the Langmuir, Freundlich, and Temkin models. The Langmuir model best described the adsorption process, and gave a maximum monolayer adsorption quantity of 125 mg/g. The ΔH value for adsorption was 16.1 kJ/mol, indicating endothermicity, and the negative ΔG values at various temperatures suggested spontaneous adsorption. Outer-sphere and inner-sphere complexations were involved in Sb(V) adsorption.

  7. Improved removal of malachite green from aqueous solution using chemically modified cellulose by anhydride.

    PubMed

    Zhou, Yanmei; Min, Yinghao; Qiao, Han; Huang, Qi; Wang, Enze; Ma, Tongsen

    2015-03-01

    Cellulose modified with maleic (M) and phthalic (P) anhydride, to be named CMA and CPA, were tested as feasible adsorbents for the removal of malachite green from aqueous solution. At the same time, the uptake ability of natural cellulose was also studied for comparison. The structure of material was characterized by FT-IR and XRD. The effects of solution pH, initial dye concentration, contact time and temperature were investigated in detail by batch adsorption experiments. The kinetic and isotherm studies suggested that the adsorption followed the pseudo-second-order model and Langmuir isotherm. The maximum adsorption capacity on CMA and CPA were 370 mg g(-1) and 111 mg g(-1), respectively. Furthermore, the thermodynamics studies indicated the spontaneous nature of adsorption of malachite green on adsorbents. All the studied results showed that the modified cellulose could be used as effective adsorption material for the removal of malachite green from aqueous solutions.

  8. Synthesis and Functionalization of Gold Nanoparticles Using Chemically Modified ssDNA

    NASA Astrophysics Data System (ADS)

    Calabrese, P. G.

    In the first part of this thesis, methods for functionalizing spherical gold nanoparticles with nucleic acid binding ligands (aptamers) that target the VEGF receptor complex were developed. In order to provide a multiplexed labeling strategy for imaging the VEGF receptor complex in electron microscopy, gold nanoparticles of distinct sizes were conjugated to modified ssDNA aptamers that target the VEGF-A cytokine, the VEGFR-2 RTK receptor and a membrane associated co-receptor, Nrp-1. The modified ssDNA gold nanoparticle conjugates were applied to a human lung carcinoma cell line (A549) which has been shown to express each of these proteins and used as a model system for VEGF signaling. Binding constants for the modified aptamers were also determined using a fluorescence polarization anisotropy assay to determine KD and KOFF for the aptamers with their respective proteins. In the latter part of this thesis, a modied ssDNA SELEX protocol was also developed in order to evolve imidazole modied ssDNA sequences that assemble gold nanoparticles from Au3+ precursor ions in aqueous solution. Active sequences bound to nanoparticles were partitioned from inactive sequences based on density via ultracentrifugation through a discontinuous sucrose gradient. Colloidal gold solutions produced by the evolved pool had a distinct absorbance spectra and produced nanoparticles with a narrower distribution of sizes compared to colloidal gold solutions produced by the starting randomized pool of imidazole modified ssDNA. Sequencing data from the evolved pool shows that conserved 5 and 6 nt motifs were shared amongst many of the isolates, which indicates that these motifs could serve as chelation sites for gold atoms or help stabilize colloidal gold solutions in a base specific manner.

  9. Influence of pyrolysis temperature on lead immobilization by chemically modified coconut fiber-derived biochars in aqueous environments.

    PubMed

    Wu, Weidong; Li, Jianhong; Niazi, Nabeel Khan; Müller, Karin; Chu, Yingchao; Zhang, Lingling; Yuan, Guodong; Lu, Kouping; Song, Zhaoliang; Wang, Hailong

    2016-11-01

    Biochar has received widespread attention as an eco-friendly and efficient material for immobilization of toxic heavy metals in aqueous environments. In the present study, three types of coconut fiber-derived biochars were obtained by pyrolyzing at three temperatures, i.e., 300, 500, and 700 °C. In addition, nine types of biochars were prepared by chemical modification with ammonia, hydrogen peroxide, and nitric acid, respectively, which were used to investigate changes in physico-chemical properties by inter alia, Fourier transformation infrared spectrophotometry (FTIR), scanning electron microscope (SEM), and BET specific surface area analysis. Batch sorption experiments were carried out to determine the sorption capacity of the biochars for lead (Pb) in aqueous solutions. Results showed that the cation exchange capacity of biochar pyrolyzed at 300 °C and modified with nitric acid increased threefold compared to the control. Loosely corrugated carbon surface and uneven carbon surface of the biochar pyrolyzed at 300 °C were produced during ammonia and nitric acid modifications. Removal rate of Pb by the coconut biochar pyrolyzed at 300 °C and modified with ammonia was increased from 71.8 to 99.6 % compared to the untreated biochar in aqueous solutions containing 100 mg L(-1) Pb. However, chemical modification did not enhance adsorption of Pb of the biochars pyrolyzed at higher temperatures (e.g., 500 or 700 °C), indicating that resistance of biochars to chemical treatment increased with pyrolysis temperature.

  10. Fabrication of BaTiO3 Thin Films Using Modified Chemical Solutions and Sintering Method

    NASA Astrophysics Data System (ADS)

    Tanaka, Kiyotaka; Suzuki, Kazuyuki; Kato, Kazumi

    2008-09-01

    BaTiO3 thin films were fabricated at 650 °C by single sintering using additive-free and diethanolamine (DEA)-modified alkoxide solutions. The BaTiO3 thin films derived from the DEA-modified solution had a flat surface and an rms roughness below 2.5 nm. The grain size on Pt/Ti/SiO2/Si substrates single-sintered at 650 °C for 100 min was estimated to be about 34 to 43 nm. We succeeded in obtaining the electric properties of Pt/BaTiO3/Pt capacitors by single sintering at 650 °C for 1 min. The dielectric constant ɛr and dielectric loss tan δ at 1 MHz were 110 and 0.05, respectively. On the other hand, the grain size on SiO2/Si substrates single-sintered at 650 °C for 100 min reached about 55 to 62 nm. For the thickness and Fourier-transform infrared (FT-IR) spectra of the gel films, it was found that the thickness of the gel films at around 200 °C derived from the DEA-modified solution became abnormally thick and that the intermediate compounds generated during the decomposition of DEA remained in the gel films.

  11. Surface modification of plasmonic nanostructured materials with thiolated oligonucleotides in 10 seconds using selective microwave heating

    PubMed Central

    Abel, Biebele; Aslan, Kadir

    2013-01-01

    This study demonstrates the proof-of-principle of rapid surface modification of plasmonic nanostructured materials with oligonucleotides using low power microwave heating. Due to their interesting optical and electronic properties, silver nanoparticle films (SNFs, 2 nm thick) deposited onto glass slides were used as the model plasmonic nanostructured materials. Rapid surface modification of SNFs with oligonucleotides was carried out using two strategies (1) Strategy 1: for ss-oligonucleotides, surface hybridization and (2) Strategy 2: for ds-oligonucleotides, solution hybridization), where the samples were exposed to 10, 15, 30 and 60 seconds microwave heating. To assess the efficacy of our new rapid surface modification technique, identical experiments carried out without the microwave heating (i.e., conventional method), which requires 24 hours for the completion of the identical steps. It was found that SNFs can be modified with ss- and ds-oligonucleotides in 10 seconds, which typically requires several hours of incubation time for the chemisorption of thiol groups on to the planar metal surface using conventional techniques. PMID:23645933

  12. Combined in vitro transcription and reverse transcription to amplify and label complex synthetic oligonucleotide probe libraries.

    PubMed

    Murgha, Yusuf; Beliveau, Brian; Semrau, Kassandra; Schwartz, Donald; Wu, Chao-Ting; Gulari, Erdogan; Rouillard, Jean-Marie

    2015-06-01

    Oligonucleotide microarrays allow the production of complex custom oligonucleotide libraries for nucleic acid detection-based applications such as fluorescence in situ hybridization (FISH). We have developed a PCR-free method to make single-stranded DNA (ssDNA) fluorescent probes through an intermediate RNA library. A double-stranded oligonucleotide library is amplified by transcription to create an RNA library. Next, dye- or hapten-conjugate primers are used to reverse transcribe the RNA to produce a dye-labeled cDNA library. Finally the RNA is hydrolyzed under alkaline conditions to obtain the single-stranded fluorescent probes library. Starting from unique oligonucleotide library constructs, we present two methods to produce single-stranded probe libraries. The two methods differ in the type of reverse transcription (RT) primer, the incorporation of fluorescent dye, and the purification of fluorescent probes. The first method employs dye-labeled reverse transcription primers to produce multiple differentially single-labeled probe subsets from one microarray library. The fluorescent probes are purified from excess primers by oligonucleotide-bead capture. The second method uses an RNA:DNA chimeric primer and amino-modified nucleotides to produce amino-allyl probes. The excess primers and RNA are hydrolyzed under alkaline conditions, followed by probe purification and labeling with amino-reactive dyes. The fluorescent probes created by the combination of transcription and reverse transcription can be used for FISH and to detect any RNA and DNA targets via hybridization.

  13. Highly sensitive ethanol chemical sensor based on nanostructured SnO2 doped ZnO modified glassy carbon electrode

    NASA Astrophysics Data System (ADS)

    Harraz, Farid A.; Ismail, Adel A.; Ibrahim, Ahmed A.; Al-Sayari, S. A.; Al-Assiri, M. S.

    2015-10-01

    Chemical sensors represent an essential strategy for the monitoring of environmental constituents at low level exposures, but are often limited by relatively low sensitivity and slow response time. Here we report highly crystalline SnO2 doped ZnO framework with a cave-shaped porous nanostructure synthesized by a facile chemical approach as a high performance ethanol chemical sensor. A simple sensing system in solution is established using the modified glassy carbon electrode and applying the current-potential (I-V) and cyclic voltammetry techniques. With unique pore channels and small crystallite size, efficient electron and ion transport occur, leading to a remarkable sensitivity of 62.56 μA cm-2 mM-1 which is, to our knowledge, 9 orders of magnitude higher than those previously reported. The calibration plot is linear (r2 = 0.9887) over ethanol concentration range 0.195-25 mM, with a limit of detection 0.137 mM. The interaction of ethanol is a diffusion dominated with fast electron-transfer kinetics. The findings can open up exciting opportunities to fabricate highly efficient chemical sensors.

  14. Oxidation of a PAH polluted soil using modified Fenton reaction in unsaturated condition affects biological and physico-chemical properties.

    PubMed

    Laurent, F; Cébron, A; Schwartz, C; Leyval, C

    2012-02-01

    A batch experiment was conducted to assess the impact of chemical oxidation using modified Fenton reaction on PAH content and on physico-chemical and biological parameters of an industrial PAH contaminated soil in unsaturated condition. Two levels of oxidant (H(2)O(2), 6 and 65 g kg(-1)) and FeSO(4) were applied. Agronomic parameters, bacterial and fungal density, microbial activity, seed germination and ryegrass growth were assessed. Partial removal of PAHs (14% and 22%) was obtained with the addition of oxidant. The impact of chemical oxidation on PAH removal and soil physico-chemical and biological parameters differed depending on the level of reagent. The treatment with the highest concentration of oxidant decreased soil pH, cation exchange capacity and extractable phosphorus content. Bacterial, fungal, and PAH degrading bacteria densities were also lower in oxidized soil. However a rebound of microbial populations and an increased microbial activity in oxidized soil were measured after 5 weeks of incubation. Plant growth on soil treated by the highest level of oxidant was negatively affected. Copyright © 2011 Elsevier Ltd. All rights reserved.

  15. An FT-raman study of softwood, hardwood, and chemically modified black spruce MWLS

    Treesearch

    Umesh P. Agarwal; James D. McSweeny; Sally A. Ralph

    1999-01-01

    Raman spectroscopy is being increasingly used to carry out in situ analysis of wood and other lignocellulosics. To obtain useful information from the spectra, the vibrational bands need to be assigned in terms of contributions from various chemical components and component sub-structures. In additional, so that the technique can be better applied as an analytical...

  16. Chemical and physical properties of Paulownia elongata biochar modified with oxidants for horticultural applications

    USDA-ARS?s Scientific Manuscript database

    Treatment of biochar with oxidants such as acids and hydrogen peroxide has been shown to alter porosity, increase adsorption of chemicals, and introduce functional groups on the biochar surfaces, all of which are desirable for their use in horticultural applications. Biochar was produced from the py...

  17. Chemically modified fatty acid methyl esters: their potential for use as lubrication fluids and surfactants

    USDA-ARS?s Scientific Manuscript database

    A review of recent developments in the synthesis and characterization of lubrication fluids and surfactants from methyl oleate. The synthesis of materials made using an epoxidation route is the focus. This versatile method of chemical modification of fatty acid methyl esters improves their oxidati...

  18. BOND: Basic OligoNucleotide Design

    PubMed Central

    2013-01-01

    Background DNA microarrays have become ubiquitous in biological and medical research. The most difficult problem that needs to be solved is the design of DNA oligonucleotides that (i) are highly specific, that is, bind only to the intended target, (ii) cover the highest possible number of genes, that is, all genes that allow such unique regions, and (iii) are computed fast. None of the existing programs meet all these criteria. Results We introduce a new approach with our software program BOND (Basic OligoNucleotide Design). According to Kane’s criteria for oligo design, BOND computes highly specific DNA oligonucleotides, for all the genes that admit unique probes, while running orders of magnitude faster than the existing programs. The same approach enables us to introduce also an evaluation procedure that correctly measures the quality of the oligonucleotides. Extensive comparison is performed to prove our claims. BOND is flexible, easy to use, requires no additional software, and is freely available for non-commercial use from http://www.csd.uwo.ca/∼ilie/BOND/. Conclusions We provide an improved solution to the important problem of oligonucleotide design, including a thorough evaluation of oligo design programs. We hope BOND will become a useful tool for researchers in biological and medical sciences by making the microarray procedures faster and more accurate. PMID:23444904

  19. An oligonucleotide hybridization approach to DNA sequencing.

    PubMed

    Khrapko, K R; Lysov YuP; Khorlyn, A A; Shick, V V; Florentiev, V L; Mirzabekov, A D

    1989-10-09

    We have proposed a DNA sequencing method based on hybridization of a DNA fragment to be sequenced with the complete set of fixed-length oligonucleotides (e.g., 4(8) = 65,536 possible 8-mers) immobilized individually as dots of a 2-D matrix [(1989) Dokl. Akad. Nauk SSSR 303, 1508-1511]. It was shown that the list of hybridizing octanucleotides is sufficient for the computer-assisted reconstruction of the structures for 80% of random-sequence fragments up to 200 bases long, based on the analysis of the octanucleotide overlapping. Here a refinement of the method and some experimental data are presented. We have performed hybridizations with oligonucleotides immobilized on a glass plate, and obtained their dissociation curves down to heptanucleotides. Other approaches, e.g., an additional hybridization of short oligonucleotides which continuously extend duplexes formed between the fragment and immobilized oligonucleotides, should considerably increase either the probability of unambiguous reconstruction, or the length of reconstructed sequences, or decrease the size of immobilized oligonucleotides.

  20. Simple Method To Prepare Oligonucleotide-Conjugated Antibodies and Its Application in Multiplex Protein Detection in Single Cells.

    PubMed

    Gong, Haibiao; Holcomb, Ilona; Ooi, Aik; Wang, Xiaohui; Majonis, Daniel; Unger, Marc A; Ramakrishnan, Ramesh

    2016-01-20

    The diversity of nucleic acid sequences enables genomics studies in a highly multiplexed format. Since multiplex protein detection is still a challenge, it would be useful to use genomics tools for this purpose. This can be accomplished by conjugating specific oligonucleotides to antibodies. Upon binding of the oligonucleotide-conjugated antibodies to their targets, the protein levels can be converted to oligonucleotide levels. In this report we describe a simple method for preparing oligonucleotide-conjugated antibodies and discuss this method's application in oligonucleotide extension reaction (OER) for multiplex protein detection. Conjugation is based on strain-promoted alkyne-azide cycloaddition (the Cu-free click reaction), in which the antibody is activated with a dibenzocyclooctyne (DBCO) moiety and subsequently linked covalently with an azide-modified oligonucleotide. In the functional test, the reaction conditions and purification processes were optimized to achieve maximum yield and best performance. The OER assay employs a pair of antibody binders (two antibodies, each conjugated with its own oligonucleotide) developed for each protein target. The two oligonucleotides contain unique six-base complementary regions at their 3' prime ends to allow annealing and extension by DNA synthesis enzymes to form a DNA template. Following preamplification, the DNA template is detected by qPCR. Distinct oligonucleotide sequences are assigned to different antibody binders to enable multiplex protein detection. When tested using recombinant proteins, some antibody binders, such as those specific to CSTB, MET, EpCAM, and CASP3, had dynamic ranges of 5-6 logs. The antibody binders were also used in a multiplexed format in OER assays, and the binders successfully detected their protein targets in cell lysates, and in single cells in combination with the C1 system. This click reaction-based antibody conjugation procedure is cost-effective, needs minimal hands-on time, and

  1. Transparent, mediator- and membrane-free enzymatic fuel cell based on nanostructured chemically modified indium tin oxide electrodes.

    PubMed

    González-Arribas, Elena; Bobrowski, Tim; Di Bari, Chiara; Sliozberg, Kirill; Ludwig, Roland; Toscano, Miguel D; De Lacey, Antonio L; Pita, Marcos; Schuhmann, Wolfgang; Shleev, Sergey

    2017-11-15

    We detail a mediator- and membrane-free enzymatic glucose/oxygen biofuel cell based on transparent and nanostructured conducting supports. Chemically modified indium tin oxide nanoparticle modified electrodes were used to substantially increase the active surface area without significantly compromising transparency. Two different procedures for surface nanostructuring were employed, viz. spray-coating and drop-coating. The spray-coated biodevice showed superior characteristics as compared to the drop-coated enzymatic fuel cell, as a result of the higher nanostructured surface area as confirmed by electrochemical characterisation, as well as scanning electron and atomic force microscopy. Subsequent chemical modification with silanes, followed by the immobilisation of either cellobiose dehydrogenase from Corynascus thermophiles or bilirubin oxidase from Myrothecium verrucaria, were performed to obtain the bioanodes and biocathodes, respectively. The optimised biodevice exhibited an OCV of 0.67V and power output of up to 1.4µW/cm(2) at an operating voltage of 0.35V. This is considered a significant step forward in the field of glucose/oxygen membrane- and mediator-free, transparent enzymatic fuel cells. Copyright © 2017 Elsevier B.V. All rights reserved.

  2. Crystal engineering of energetic materials: co-crystals of Ethylenedinitramine (EDNA) with modified performance and improved chemical stability.

    PubMed

    Aakeröy, Christer B; Wijethunga, Tharanga K; Desper, John

    2015-07-27

    In the area of energetic materials, co-crystallization is emerging as a new technology for modifying or enhancing the properties of existing energetic substances. Ethylenedinitramine (EDNA) is a known energetic material which requires attention partly due to its chemical instability originating with its two highly acidic protons. In order to stabilize EDNA, a co-crystallization approach targeting the acidic protons using a series of co-crystallizing agents with suitable hydrogen-bond acceptors was employed. Fifteen attempted co-crystallizations resulted in eight successful outcomes and six of these were crystallographically characterized and all showed evidence of hydrogen bonds to the intended protons. Calculated detonation properties and experimental thermal and impact data for the co-crystals were obtained and compared with those of pure EDNA. The co-crystal of EDNA and 1,2-bis(4-pyridyl)ethylene was recognized as a more thermally stable alternative to EDNA while the co-crystal of EDNA and pyrazine N,N'-dioxide showed comparable detonation strengths (and much improved chemical stability) compared with that of EDNA. The co-crystals EDNA:4,4'-bipyridine and EDNA:pyrazine N,N'-dioxide were found to be about 50 % less impact sensitive than EDNA, all of which illustrate how co-crystallizations can be utilized for successfully modifying specific aspects of energetic materials. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. Adsorption of hexavalent chromium from synthetic and electroplating effluent on chemically modified Swietenia mahagoni shell in a packed bed column.

    PubMed

    Rangabhashiyam, S; Nandagopal, M S Giri; Nakkeeran, E; Selvaraju, N

    2016-07-01

    Packed bed column studies were carried out to evaluate the performance of chemically modified adsorbents for the sequestration of hexavalent chromium from synthetic and electroplating industrial effluent. The effects of parameters such as bed height (3-9 cm), inlet flow rate (5-15 mL/min), and influent Cr(VI) concentration (50-200 mg/L) on the percentage removal of Cr(VI) and the adsorption capacity of the adsorbents in a packed bed column were investigated. The breakthrough time increased with increasing bed height and decreased with the increase of inlet flow rate and influent Cr(VI) concentration. The adsorption column models such as Thomas, Adams-Bohart, Yoon-Nelson, and bed depth service time (BDST) were successfully correlated with the experimental data. The Yoon-Nelson and BDST model showed good agreement with the experimental data for all the studied parameter conditions. Results of the present study indicated that the chemically modified Swietenia mahagoni shell can be used as an adsorbent for the removal of Cr(VI) from industrial wastewater in a packed bed column.

  4. Thermogravimetric Analysis of Modified Hematite by Methane (CH{sub 4}) for Chemical-Looping Combustion: A Global Kinetics Mechanism

    SciTech Connect

    Monazam, Esmail R; Breault, Ronald W; Siriwardane, Ranjani; Miller, Duane D

    2013-10-01

    Iron oxide (Fe{sub 2}O{sub 3}) or in its natural form (hematite) is a potential material to capture CO{sub 2} through the chemical-looping combustion (CLC) process. It is known that magnesium (Mg) is an effective methyl cleaving catalyst and as such it has been combined with hematite to assess any possible enhancement to the kinetic rate for the reduction of Fe{sub 2}O{sub 3} with methane. Therefore, in order to evaluate its effectiveness as a hematite additive, the behaviors of Mg-modified hematite samples (hematite –5% Mg(OH){sub 2}) have been analyzed with regard to assessing any enhancement to the kinetic rate process. The Mg-modified hematite was prepared by hydrothermal synthesis. The reactivity experiments were conducted in a thermogravimetric analyzer (TGA) using continuous stream of CH{sub 4} (5, 10, and 20%) at temperatures ranging from 700 to 825 {degrees}C over ten reduction cycles. The mass spectroscopy analysis of product gas indicated the presence of CO{sub 2}, H{sub 2}O, H{sub 2} and CO in the gaseous product. The kinetic data at reduction step obtained by isothermal experiments could be well fitted by two parallel rate equations. The modified hematite samples showed higher reactivity as compared to unmodified hematite samples during reduction at all investigated temperatures.

  5. Enhancing adsorption capacity of toxic malachite green dye through chemically modified breadnut peel: equilibrium, thermodynamics, kinetics and regeneration studies.

    PubMed

    Chieng, Hei Ing; Lim, Linda B L; Priyantha, Namal

    2015-01-01

    Breadnut skin, in both its unmodified (KS) and base-modified (BM-KS) forms, was investigated for its potential use as a low-cost adsorbent for the removal of toxic dye, malachite green (MG). Characterization of the adsorbents was carried out using scanning electron microscope, X-ray fluorescence and Fourier transform infra-red spectroscopy. Batch adsorption experiments, carried out under optimized conditions, for the adsorption of MG were fitted using five isotherm models (Langmuir, Freundlich, Dubinin-Radushkevich, Temkin and Sips) and six error functions to determine the best-fit model. The adsorption capacity was greatly enhanced when breadnut skin was chemically modified with NaOH, leading to an adsorption capacity of 353.0 mg g(-1), that was far superior to most reported adsorbents for the removal of MG. Thermodynamics studies indicated that the adsorption of MG was spontaneous on KS and BM-KS, and the reactions were endothermic and exothermic, respectively. Kinetics studies showed that both followed the pseudo-second order. Regeneration experiments on BM-KS indicated that its adsorption capacity was still maintained at>90% even after five cycles. It can be concluded that NaOH-modified breadfruit skin has great potential to be utilized in real-life application as a low-cost adsorbent for the removal of MG in wastewater treatment.

  6. The optimal one dimensional periodic table: a modified Pettifor chemical scale from data mining

    NASA Astrophysics Data System (ADS)

    Glawe, Henning; Sanna, Antonio; Gross, E. K. U.; Marques, Miguel A. L.

    2016-09-01

    Starting from the experimental data contained in the inorganic crystal structure database, we use a statistical analysis to determine the likelihood that a chemical element A can be replaced by another B in a given structure. This information can be used to construct a matrix where each entry (A,B) is a measure of this likelihood. By ordering the rows and columns of this matrix in order to reduce its bandwidth, we construct a one-dimension ordering of the chemical elements, analogous to the famous Pettifor scale. The new scale shows large similarities with the one of Pettifor, but also striking differences, especially in what comes to the ordering of the non-metals.

  7. Comparative repellent properties of certain chemicals against mosquitoes, house flies and cockroaches using modified techniques.

    PubMed

    Vartak, P H; Tungikar, V B; Sharma, R N

    1994-09-01

    Several terpenoids were assessed for their repellent/toxic properties against mosquitoes (Aedes aegypti), house flies (Musca domestica) and cockroaches (Periplaneta americana). Impregnated wide mesh netting was used in the case of the Dipterans, while treated filtered paper was employed for the bioassays with cockroaches. Persistence of the repellent chemicals was studied. Doses ranged from 5-20 gm/M2 for the Dipterans and 25-100 mg per 4 x 4 cm filter paper for the cockroaches. Dimethyl phthalate (DMP) offered the maximum protection of the chemicals tested against mosquitoes but was not so effective against house flies and cockroaches. Citral and Eugenol were effective against all the three test insects. Other test compounds afforded varying degrees of protection. Application strategy and utility of the findings are discussed.

  8. Cellular RNA is chemically modified by exposure to air pollution mixtures.

    PubMed

    Baldridge, Kevin C; Zavala, Jose; Surratt, Jason; Sexton, Kenneth G; Contreras, Lydia M

    2015-01-01

    RNAs are more susceptible to modifications than DNA, and chemical modifications in RNA have an effect on their structure and function. This study aimed to characterize chemical effects on total RNA in human A549 lung cells after exposure to elevated levels of major secondary air pollutants commonly found in urban locations, including ozone (O3), acrolein (ACR) and methacrolein (MACR). Enzyme-linked immunosorbent assays (ELISA) were used to measure levels of interleukin (IL)-8 in the growth media and 8-oxoguanine (8OG) levels in total cellular RNA, and lactate dehydrogenase (LDH) in the growth media was measured by a coupled enzymatic assay. Quantitative real-time polymerase chain reaction (qRT-PCR) was used to measure levels of microRNA 10b (miR-10b). The study found that 1-h exposure to all tested pollutant mixtures consistently caused significant increases in the levels of 8OG in total RNA. In the case of 4 ppm O3 exposures, measured levels of IL-8, LDH and miR-10b each showed consistent trends between two independent trials, but varied among these three targets. After 1-h exposures to an ACR+MACR mixture, measured levels of IL-8, LDH and miR-10b showed variable results. For mixtures of O3+ACR+MACR, IL-8 measurements showed no change; miR-10b and LDH showed variable results. The results indicate that short-term high-concentration exposures to air pollution can cause RNA chemical modifications. Chemical modifications in RNAs could represent more consistent markers of cellular stress relative to other inflammation markers, such as IL-8 and LDH, and provide a new biomarker endpoint for mechanistic studies in toxicity of air pollution exposure.

  9. Chemical Genetic Screens for TDP-43 Modifiers and ALS Drug Discovery

    DTIC Science & Technology

    2012-10-01

    libraries of several thousand clinically approved drugs for their ability to suppress the in vivo phenotypes observed in both worm and fish models upon...approaches to ALS. The screen set-up (Aim 1) began immediately for worms and fish during the first 6 months. This consisted of developing video microscopy...screens for motility. The first chemical screen (3,500 FDA-approved compounds, Aim 2) began immediately afterwards in worms and was completed

  10. 25th anniversary article: Chemically modified/doped carbon nanotubes & graphene for optimized nanostructures & nanodevices.

    PubMed

    Maiti, Uday Narayan; Lee, Won Jun; Lee, Ju Min; Oh, Youngtak; Kim, Ju Young; Kim, Ji Eun; Shim, Jongwon; Han, Tae Hee; Kim, Sang Ouk

    2014-01-08

    Outstanding pristine properties of carbon nanotubes and graphene have limited the scope for real-life applications without precise controllability of the material structures and properties. This invited article to celebrate the 25th anniversary of Advanced Materials reviews the current research status in the chemical modification/doping of carbon nanotubes and graphene and their relevant applications with optimized structures and properties. A broad aspect of specific correlations between chemical modification/doping schemes of the graphitic carbons with their novel tunable material properties is summarized. An overview of the practical benefits from chemical modification/doping, including the controllability of electronic energy level, charge carrier density, surface energy and surface reactivity for diverse advanced applications is presented, namely flexible electronics/optoelectronics, energy conversion/storage, nanocomposites, and environmental remediation, with a particular emphasis on their optimized interfacial structures and properties. Future research direction is also proposed to surpass existing technological bottlenecks and realize idealized graphitic carbon applications. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. Removal of Pb2+ from aqueous solution by adsorption on chemically modified muskmelon peel.

    PubMed

    Huang, Kai; Zhu, Hongmin

    2013-07-01

    A cost-effective biosorbent was prepared by a green chemical modification process from muskmelon peel by saponification with alkaline solution of Ca(OH)2. Its adsorption behavior for lead ions was investigated and found to exhibit excellent adsorption properties. Results showed that the optimal equilibrium pH range for 100% adsorption is from 4 up to 6.4. Adsorption equilibrium was attained within 10 min. The adsorption process can be described well by Langmuir model and pseudo-second-order kinetics equation, respectively. The maximum adsorption capacity for lead ions was found to be 0.81 mol/kg. Pectic acid contained in the muskmelon peel is the main factor responsible for the uptake of lead ions onto the gel, and the chemical modification process presented in this study can be assumed effective to prepare other similar biomaterials. The large adsorption capacity and the fast adsorption rate indicated that chemically saponified muskmelon peel gel in present study has great potential to be used as a cost-effective adsorbent for the removal of lead ions from the water.

  12. Effect of modified atmospheric packaging on chemical and microbial changes in dietetic rabri during storage.

    PubMed

    Ghayal, Gajanan; Jha, Alok; Kumar, Arvind; Gautam, Anuj Kumar; Rasane, Prasad

    2015-03-01

    Rabri is a dairy based sweet popular in the Indian subcontinent. The high sugar and fat content impose restrictions on its consumption due to health reasons. Dietetic rabri was prepared by the replacement of sugar with aspartame. Inulin was added to partially replace the milk fat and to improve the consistency of rabri. The rabri samples were packed in the polyethylene bags filled with different gaseous compositions (Air, 50 % CO2:50 % N2 and 100 % N2) and stored at 10 °C. The shelf life was evaluated on the basis of changes in the chemical quality parameters such as HMF, TBA and FFA and microbial content such as total plate count, yeast and molds and coliform counts. The chemical parameters and microbial spoilage increased in all the samples with the progression of storage period. The samples packed with air showed significantly higher chemical deterioration and microbial spoilage as compared to the other two combinations. The samples packed with 100 % N2 were more shelf stable than with air and 50 % CO2:50 % N2 combinations.

  13. Physico-chemical properties of corn starch modified with cyclodextrin glycosyltransferase.

    PubMed

    Dura, Angela; Rosell, Cristina M

    2016-06-01

    Cyclodextrin glycosyltransferase (CGTase) has been used to produce cyclodextrins (CDs) from starches, but their ability to modify starches has been barely explored. The effect of CGTase on corn starch at sub-gelatinization temperature (50°C) and at different pH conditions, pH 4.0 and pH 6.0, was evaluated. Biochemical features, thermal and structural analysis, oligosaccharides and CDs content were studied. Microscopic analysis of the granules confirmed the enzymatic modification of the starches obtaining structures with irregular surface and small pinholes. The extent of the starch modification was largely dependent on the pHs, being higher at pH 6.0. This was also confirmed by the low viscosity of the resulting pastes during a heating and cooling cycle. Thermal parameters were not affected due to enzymatic treatment. Modified starches were less susceptible to undergo α-amylase hydrolysis. CDs released were higher for samples treated at pH 4.0. Therefore, CGTase modification of corn starches at sub-gelatinization temperature offers an attractive alternative for obtaining porous starches with different properties depending on the pH conditions.

  14. Biosorption of heavy metals from aqueous solutions by chemically modified orange peel.

    PubMed

    Feng, Ningchuan; Guo, Xueyi; Liang, Sha; Zhu, Yanshu; Liu, Jianping

    2011-01-15

    Equilibrium, thermodynamic and kinetic studies were carried out for the biosorption of Pb(2+), Cd(2+) and Ni(2+) ions from aqueous solution using the grafted copolymerization-modified orange peel (OPAA). Langmuir and Freundlich isotherm models were applied to describe the biosorption of the metal ions onto OPAA. The influences of pH and contact time of solution on the biosorption were studied. Langmuir model fitted the equilibrium data better than the Freundlich isotherm. According to the Langmuir equation, the maximum uptake capacities for Pb(2+), Cd(2+) and Ni(2+) ions were 476.1, 293.3 and 162.6 mg g(-1), respectively. Compared with the unmodified orange peel, the biosorption capacity of the modified biomass increased 4.2-, 4.6- and 16.5-fold for Pb(2+), Cd(2+) and Ni(2+), respectively. The kinetics for Pb(2+), Cd(2+) and Ni(2+) ions biosorption followed the pseudo-second-order kinetics. The free energy changes (ΔG°) for Pb(2+), Cd(2+) and Ni(2+) ions biosorption process were found to be -3.77, -4.99 and -4.22 kJ mol(-1), respectively, which indicates the spontaneous nature of biosorption process. FTIR demonstrated that carboxyl and hydroxyl groups were involved in the biosorption of the metal ions. Desorption of Pb(2+), Cd(2+) and Ni(2+) ions from the biosorbent was effectively achieved in a 0.05 mol L(-1) HCl solution.

  15. Treatment of swine wastewater using chemically modified zeolite and bioflocculant from activated sludge.

    PubMed

    Guo, Junyuan; Yang, Chunping; Zeng, Guangming

    2013-09-01

    Sterilization, alkaline-thermal and acid-thermal treatments were applied to activated sludge and the pre-treated sludge was used as raw material for Rhodococcus R3 to produce polymeric substances. After 60 h of fermentation, bioflocculant of 2.7 and 4.2 g L(-1) were produced in sterilized and alkaline-thermal treated sludge as compared to that of 0.9 g L(-1) in acid-thermal treated sludge. Response surface methodology (RSM) was employed to optimize the treatment process of swine wastewater using the composite of bioflocculant and zeolite modified by calcining with MgO. The optimal flocculating conditions were bioflocculant of 24 mg L(-1), modified zeolite of 12 g L(-1), CaCl2 of 16 mg L(-1), pH of 8.3 and contact time of 55 min, and the corresponding removal rates of COD, ammonium and turbidity were 87.9%, 86.9%, and 94.8%. The use of the composite by RSM provides a feasible way to improve the pollutant removal efficiencies and recycle high-level of ammonium from wastewater.

  16. Unconventional assembly of bimetallic Au-Ni janus nanoparticles on chemically modified silica spheres.

    PubMed

    Jia, Lei; Pei, Xiaowei; Zhou, Feng; Liu, Weimin

    2014-02-10

    This paper reports that Janus Au-Ni nanoparticles (JANNPs) can self-assemble onto silica spheres in a novel way, which is different from that of single-component isotropic nanoparticles. JANNPs modified with octadecylamine (ODA) assemble onto catechol-modified silica spheres (SiO2-OH) to form a very special core-loop complex structure and finally the core-loop assemblies link each other to form large assemblies through capillary force and the hydrophobic interaction of the alkyl chains of ODA. The nanocomposites disassemble in the presence of vanillin and oleic acid because of the breakage of the catechol-metal link. Vanillin-induced disassembly enables the JANNPs to reassemble into a core-loop structure upon ODA addition. The assembly of SiO2-OH and isotropic Ni or Fe3O4 particles generates traditional core-satellite structures. This unconventional self-assembly can be attributed to the synergistic effect of Janus specificity and capillary force, which is also confirmed by the assembly of thiol-terminated silica spheres (SH-SiO2) with anisotropic JANNPs, isotropic Au, and Ni nanoparticles. These results can guide the development of novel composite materials using Janus nanoparticles as the primary building blocks.

  17. Immunoassays of chemically modified polysaccharides, glycans in glycoproteins and ribose in nucleic acids.

    PubMed

    Strmečki, Slađana; Trefulka, Mojmír; Zatloukalová, Pavlína; Durech, Michal; Vojtesek, Borivoj; Paleček, Emil

    2017-02-22

    Glycosylation of proteins plays an important role in health and diseases. At present new simple and inexpensive methods of glycoprotein analysis are sought. We developed a monoclonal antibody Manost 2.1 in mice after immunization with the adduct of mannan with Os(VI)temed complex (temed is N,N,N',N'-tetramethylethylenediamine). The specificity of this antibody to different biomolecules treated with Os(VI)temed was tested using dot blot immunoassay. Manost 2.1 showed specificity toward Os(VI)temed-modified polysaccharides, glycoproteins and ribonucleotide at the 3'-end in DNA. The antibody recognized neither the unmodified compounds nor the non-glycosylated proteins treated with Os(VI)temed. We also performed western blotting and Coomassie silver blue staining of mixtures of biomacromolecules treated with Os(VI)temed and identified specifically the modified glycoproteins. The immunochemical method using Manost 2.1 was compared with electrochemical analyses based on redox signals of the Os(VI)temed adducts, with similar results in terms of sensitivity. This new antibody-based approach opens the door for rapid and inexpensive analysis of glycans and glycoproteins in various scientific and medical fields, including cancer research and the future application of glycoprotein detection in clinical practice. Copyright © 2016 Elsevier B.V. All rights reserved.

  18. Synthesis of threose nucleic acid (TNA) triphosphates and oligonucleotides by polymerase-mediated primer extension.

    PubMed

    Zhang, Su; Yu, Hanyang; Chaput, John C

    2013-03-01

    This unit describes the chemical synthesis of α-L-threofuranosyl nucleic acid (TNA) triphosphates for thymidine (T), guanosine (G), cytidine (C), and the diaminopurine (D) analog of adenosine and their incorporation into TNA oligonucleotides by enzyme-mediated polymerization of a DNA primer-template complex. Starting from suitably protected threofuranosyl nucleosides, TNA triphosphates are synthesized in a single-pot reaction and purified by ion-exchange and HPLC chromatography. Purified TNA triphosphates are diluted into stock solutions and used as substrates for the synthesis of TNA oligonucleotides. Oligonucleotide synthesis is accomplished using Therminator DNA polymerase, a commercial variant of the 9(o)N DNA polymerase bearing the A485L mutation. © 2013 by John Wiley & Sons, Inc.

  19. Nucleosides with Transposed Base or 4'-Hydroxymethyl Moieties and Their Corresponding Oligonucleotides.

    PubMed

    Toti, Kiran; Renders, Marleen; Groaz, Elisabetta; Herdewijn, Piet; Van Calenbergh, Serge

    2015-12-23

    This review focuses on 4'-hydroxymethyl- or nucleobase-transposed nucleosides, nucleotides, and nucleoside phosphonates, their stereoisomers, and their close analogues. The biological activities of all known 4'-hydroxymethyl- or nucleobase-transposed nucleosides, nucleotides, and nucleoside phosphonates as potential antiviral or anticancer agents are compiled. The routes that have been taken for the chemical synthesis of such nucleoside derivatives are described, with special attention to the innovative strategies. The enzymatic synthesis, base-pairing properties, structure, and stability of oligonucleotides containing nucleobase- or 4'-hydroxymethyl-transposed nucleotides are discussed. The use of oligonucleotides containing nucleobase- or 4'-hydroxymethyl-transposed nucleotides as small oligonucleotide (e.g., human immunodeficiency virus integrase) inhibitors, in applications such as antisense therapy, silencing RNA (siRNA), or aptamer selections, is detailed.

  20. Nickel release behavior and surface characteristics of porous NiTi shape memory alloy modified by different chemical processes.

    PubMed

    Wu, Shuilin; Liu, Xiangmei; Chan, Y L; Chu, Paul K; Chung, C Y; Chu, Chenglin; Yeung, Kelvin W K; Lu, W W; Cheung, Kenneth M C; Luk, K D K

    2009-05-01

    As a non-line-of-sight surface modification technique, chemical treatment is an effective method to treat porous NiTi with complex surface morphologies and large exposed areas due to its liquidity and low temperature. In the work described here, three different chemical processes are used to treat porous NiTi alloys. Our results show that H(2)O(2) treatment, NaOH treatment, and H(2)O(2) pre-treatment plus subsequent NaOH treatment can mitigate leaching of nickel from the alloy. The porous NiTi samples modified by the two latter processes favor deposition of a layer composed of Ca and P due to the formation of bioactive Na(2)TiO(3) on the surface. Among the three processes, H(2)O(2) pre-treatment plus subsequent NaOH modification is the most effective in suppressing nickel release. Small area X-ray photoelectron spectroscopy reveals that the surfaces treated by different chemical processes have different structures and compositions. The sample modified by the H(2)O(2) treatment is composed of rough TiO(2) on the outer surface and an oxide transition layer underneath whereas the sample treated by NaOH comprises a surface layer of titanium oxide and Na(2)TiO(3) together with a transition layer. The sample processed by the H(2)O(2) and NaOH treatment has a pure Na(2)TiO(3) layer on the surface and a transition layer underneath. These results help to elucidate the different nickel release behavior and bioactivity of porous NiTi alloys processed by different methods.

  1. Effective Anti-miRNA Oligonucleotides Show High Releasing Rate of MicroRNA from RNA-Induced Silencing Complex.

    PubMed

    Ariyoshi, Jumpei; Matsuyama, Yohei; Kobori, Akio; Murakami, Akira; Sugiyama, Hiroshi; Yamayoshi, Asako

    2017-10-01

    MicroRNAs (miRNAs) regulate gene expression by forming RNA-induced silencing complexes (RISCs) and have been considered as promising therapeutic targets. MiRNA is an essential component of RISC for the modulation of gene expression. Therefore, the release of miRNA from RISC is considered as an effective method for the inhibition of miRNA functions. In our previous study, we reported that anti-miRNA oligonucleotides (AMOs), which are composed of the 2'-O-methyl (2'-OMe) RNA, could induce the release of miRNA from RISC. However, the mechanisms underlying the miRNA-releasing effects of chemically modified AMOs, which are conventionally used as anti-cancer drugs, are still unclear. In this study, we investigated the relationship between the miRNA releasing rate from RISC and the inhibitory effect on RISC activity (IC50) using conventional chemically modified AMOs. We demonstrated that the miRNA-releasing effects of AMOs are directly proportional to the IC50 values, and AMOs, which have an ability to promote the release of miRNA from RISC, can effectively inhibit RISC activity in living cells.

  2. Calorimetric and Spectroscopic Analysis of the Thermal Stability of Short Duplex DNA-Containing Sugar and Base-Modified Nucleotides.

    PubMed

    Fakhfakh, Kareem; Hughesman, Curtis B; Louise Creagh, A; Kao, Vincent; Haynes, Charles

    2016-01-01

    Base- and sugar-modified analogs of DNA and RNA are finding ever expanding use in medicine and biotechnology as tools to better tailor structured oligonucleotides by altering their thermal stability, nuclease resistance, base-pairing specificity, antisense activity, or cellular uptake. Proper deployment of these chemical modifications generally requires knowledge of how each affects base-pairing properties and thermal stabilities. Here, we describe in detail how differential scanning calorimetry and UV spectroscopy may be used to quantify the melting thermodynamics of short dsDNA containing chemically modified nucleosides in one or both strands. Insights are provided into why and how the presence of highly stable base pairs containing modified nucleosides can alter the nature of calorimetry or melting spectroscopy data, and how each experiment must therefore be conducted to ensure high-quality melting thermodynamics data are obtained. Strengths and weaknesses of the two methods when applied to chemically modified duplexes are also addressed.

  3. Purification and physico-chemical characterisation of genetically modified phytases expressed in Aspergillus awamori.

    PubMed

    Martin, Judith A; Murphy, Richard A; Power, Ronan F G

    2006-09-01

    Two heterologous phytases from Aspergillus awamori and Aspergillus fumigatus obtained from submerged cultures of genetically modified fungal strains in addition to two commercially available phytase preparations (Allzyme and Natuphos phytases) were purified to homogeneity using a combination of ultrafiltration, gel filtration and ion exchange. The purified preparations were used in subsequent characterisation studies, in which Western Immunoblot analysis, pH and temperature optima, thermal stability and substrate specificity were assessed. A. fumigatus phyA phytase expressed in A. awamori exhibited activity over a broad pH range together with an increased temperature optimum, and slightly enhanced thermal stability compared to the other phytases tested, and is thus a promising candidate for animal feed applications. This particular phytase retains activity over a wide range of pH values characteristic of the digestive tract and could conceivably be more suited to the increasingly higher feed processing temperatures being utilised today, than the corresponding phytases from Aspergillus niger.

  4. Clean Transformation of Ethanol to Useful Chemicals. The Behavior of a Gold-Modified Silicalite Catalyst.

    PubMed

    Falletta, Ermelinda; Rossi, Michele; Teles, Joaquim Henrique; Della Pina, Cristina

    2016-03-19

    Upon addition of gold to silicalite-1 pellets (a MFI-type zeolite), the vapor phase oxidation of ethanol could be addressed to acetaldehyde or acetic acid formation. By optimizing the catalyst composition and reaction conditions, the conversion of ethanol could be tuned to acetaldehyde with 97% selectivity at 71% conversion or to acetic acid with 78% selectivity at total conversion. Considering that unloaded silicalite-1 was found to catalyze the dehydration of ethanol to diethylether or ethene, a green approach for the integrated production of four important chemicals is herein presented. This is based on renewable ethanol as a reagent and a modular catalytic process.

  5. [Bio-based pharmaceutical polymers, possibility of their chemical modification and the applicability of modified polymers].

    PubMed

    Sebe, István; Szabó, Barnabás; Zelkó, Romána

    2012-01-01

    Different types of polymers are widely used in biomedical, pharmaceutical and cosmetic purposes. Their applications are curbed, if the polymers can not break down by the body or if the polymer itself is harmful or decompose to harmful material. Authors provide an overview of different types of pharmaceutical polymers of various sources, of the structural characterization and possibilities of their chemical modification and of the classical and instrumental analytical examination methods. The paper deals with the limitations of the use of biopolymers, as well.

  6. X-ray photoemission analysis of chemically modified TlBr surfaces for improved radiation detectors

    DOE PAGES

    Nelson, A. J.; Voss, L. F.; Beck, P. R.; ...

    2013-01-12

    We subjected device-grade TlBr to various chemical treatments used in room temperature radiation detector fabrication to determine the resulting surface composition and electronic structure. As-polished TlBr was treated separately with HCl, SOCl2, Br:MeOH and HF solutions. High-resolution photoemission measurements on the valence band electronic structure and Tl 4f, Br 3d, Cl 2p and S 2p core lines were used to evaluate surface chemistry and shallow heterojunction formation. Surface chemistry and valence band electronic structure were correlated with the goal of optimizing the long-term stability and radiation response.

  7. Chemical methods for the proteome-wide identification of posttranslationally modified proteins

    PubMed Central

    Chuh, Kelly N.; Pratt, Matthew R.

    2014-01-01

    Thousands of proteins are subjected to posttranslational modifications that can have dramatic effects on their functions. Traditional biological methods have struggled to address some of the challenges inherit in the unbiased identification of certain posttranslational modifications. As with many areas of biological discovery, the development of chemoselective and bioorthogonal reactions and chemical probes has transformed our ability to selectively label and enrich a wide variety of posttranslational modifications. Collectively, these efforts are making significant contributions to the goal of mapping the protein modification landscape. PMID:25461721

  8. Modifying culture conditions in chemical library screening identifies alternative inhibitors of mycobacteria.

    PubMed

    Miller, Christopher H; Nisa, Shahista; Dempsey, Sandi; Jack, Cameron; O'Toole, Ronan

    2009-12-01

    In this study, application of a dual absorbance/fluorescence assay to a chemical library screen identified several previously unknown inhibitors of mycobacteria. In addition, growth conditions had a significant effect on the activity profile of the library. Some inhibitors such as Se-methylselenocysteine were detected only when screening was performed under nutrient-limited culture conditions as opposed to nutrient-rich culture conditions. We propose that multiple culture condition library screening is required for complete inhibitory profiling and for maximal antimycobacterial compound detection.

  9. Nile tilapia skin collagen sponge modified with chemical cross-linkers as a biomedical hemostatic material.

    PubMed

    Sun, Leilei; Li, Bafang; Jiang, Dandan; Hou, Hu

    2017-07-26

    Nile tilapia skin collagen sponges were fabricated by freeze-drying technology and modified with 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide in the presence of N-hydroxysuccinimide (EDC/NHS), genipin+PBS, genipin+ethanol, tea polyphenol (TP), nordihydroguaiaretic acid (NDGA) and diphenyl phosphoryl azide (DPPA). Physicochemical and biological properties, micromorphology and compatibility before and after modification were investigated to evaluate collagen sponge as a hemostatic biomedical material. The mechanical property of collagen sponges strengthened after cross-linking. The elongation at break of cross-linked collagen sponges decreased except for EDC/NHS, which was close to that of non-crosslinked. The collagen sponge cross-linked with EDC/NHS exhibited the highest hygroscopicity in comparison with other cross-linkers. The resistance to collagenase biodegradation of collagen sponges after cross-linking strengthened significantly except for NDGA. Collagen sponges cross-linked with EDC/NHS, TP and NDGA maintained high porosity (97-98%), similar to non-crosslinked (98.42%). Collagen sponges could shorten the blood coagulation time. From the variations of the FTIR spectrum pattern and SEM, DPPA could change the secondary structure of collagen and destroy the spongy structure of collagen sponge, which was not suitable for the cross-linking of collagen sponge. Whereas, EDC/NHS was recognized as a perfect cross-linker owing to its excellent properties and porous microstructure. All fabricated collagen sponges were recognized to be biocompatible by the hemolysis assay in vitro. Therefore, collagen sponge modified with EDC/NHS could be used as a perfect biomedical hemostatic material. Copyright © 2017 Elsevier B.V. All rights reserved.

  10. Wrapping of a single bacterium with Functionalized - Chemically Modified Graphene (FCMG) sheets via highly specific protein-cell wall interaction

    NASA Astrophysics Data System (ADS)

    Mohanty, Nihar; Berry, Vikas

    2009-03-01

    Graphene has recently generated a lot of interest due to its unique structural and electrical properties. It's micro-scale area and sub-nano-scale thickness coupled with ballistic electronic transport at room temperature, low Johnston noise and low charge scattering, have made it a gold mine for novel applications. Since its discovery in 2004, there have been a plethora of studies on characterizing its unique physical, chemical and electrical properties of graphene as well as on integrating it with various physical/chemical systems to utilize these properties. But there have been limited or no studies on the integration of graphene with living microorganisms or mammalian cells. Here we describe the novel wrapping of a single live bacterium (Bacillus cereus) with a chemically modified graphene sheet functionalized with the protein Concanavalin-A (Con-A) via the highly specific Con-A - Teichoic acid interaction. We are investigating the structural and the electrical properties of these novel bacteria-FCMG ensembles. Further, we are also interested in characterizing this wrapping process in detail by studying the kinetics and the mechanism of action of bacterial-wrapping via 3D modelling. This is a first step towards the live-bio-nano-integration of graphene which would open up avenues for applications as diverse as bio-batteries using the Geobacter to recombinant enzyme compartmentalization.

  11. yaInChI: modified InChI string scheme for line notation of chemical structures.

    PubMed

    Cho, Y S; No, K T; Cho, K-H

    2012-01-01

    A modified InChI (International Chemical Identifier) string scheme, yaInChI (yet another InChI), is suggested as a method for including the structural information of a given molecule, making it straightforward and more easily readable. The yaInChI theme is applicable for checking the structural identity with higher sensitivity and generating three-dimensional (3-D) structures from the one-dimensional (1-D) string with less ambiguity than the general InChI method. The modifications to yaInChI provide non-rotatable single bonds, stereochemistry of organometallic compounds, allene and cumulene, and parity of atoms with a lone pair. Additionally, yaInChI better preserves the original information of the given input file (SDF) using the protonation information, hydrogen count +1, and original bond type, which are not considered or restrictively considered in InChI and SMILES. When yaInChI is used to perform a duplication check on a 3D chemical structure database, Ligand.Info, it shows more discriminating power than InChI. The structural information provided by yaInChI is in a compact format, making it a promising solution for handling large chemical structure databases.

  12. Antisense Oligonucleotide-Mediated Removal of the Polyglutamine Repeat in Spinocerebellar Ataxia Type 3 Mice.

    PubMed

    Toonen, Lodewijk J A; Rigo, Frank; van Attikum, Haico; van Roon-Mom, Willeke M C

    2017-09-15

    Spinocerebellar ataxia type 3 (SCA3) is a currently incurable neurodegenerative disorder caused by a CAG triplet expansion in exon 10 of the ATXN3 gene. The resultant expanded polyglutamine stretch in the mutant ataxin-3 protein causes a gain of toxic function, which eventually leads to neurodegeneration. One important function of ataxin-3 is its involvement in the proteasomal protein degradation pathway, and long-term downregulation of the protein may therefore not be desirable. In the current study, we made use of antisense oligonucleotides to mask predicted exonic splicing signals, resulting in exon 10 skipping from ATXN3 pre-mRNA. This led to formation of a truncated ataxin-3 protein lacking the toxic polyglutamine expansion, but retaining its ubiquitin binding and cleavage function. Repeated intracerebroventricular injections of the antisense oligonucleotides in a SCA3 mouse model led to exon skipping and formation of the modified ataxin-3 protein throughout the mouse brain. Exon skipping was long lasting, with the modified protein being detectable for at least 2.5 months after antisense oligonucleotide injection. A reduction in insoluble ataxin-3 and nuclear accumulation was observed following antisense oligonucleotide treatment, indicating a beneficial effect on pathogenicity. Together, these data suggest that exon 10 skipping is a promising therapeutic approach for SCA3. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

  13. Recent Methods for Purification and Structure Determination of Oligonucleotides

    PubMed Central

    Zhang, Qiulong; Lv, Huanhuan; Wang, Lili; Chen, Man; Li, Fangfei; Liang, Chao; Yu, Yuanyuan; Jiang, Feng; Lu, Aiping; Zhang, Ge

    2016-01-01

    Aptamers are single-stranded DNA or RNA oligonucleotides that can interact with target molecules through specific three-dimensional structures. The excellent features, such as high specificity and affinity for target proteins, small size, chemical stability, low immunogenicity, facile chemical synthesis, versatility in structural design and engineering, and accessible for site-specific modifications with functional moieties, make aptamers attractive molecules in the fields of clinical diagnostics and biopharmaceutical therapeutics. However, difficulties in purification and structural identification of aptamers remain a major impediment to their broad clinical application. In this mini-review, we present the recently attractive developments regarding the purification and identification of aptamers. We also discuss the advantages, limitations, and prospects for the major methods applied in purifying and identifying aptamers, which could facilitate the application of aptamers. PMID:27999357

  14. Modified CTAB and TRIzol protocols improve RNA extraction from chemically complex Embryophyta1

    PubMed Central

    Jordon-Thaden, Ingrid E.; Chanderbali, Andre S.; Gitzendanner, Matthew A.; Soltis, Douglas E.

    2015-01-01

    Premise of the study: Here we present a series of protocols for RNA extraction across a diverse array of plants; we focus on woody, aromatic, aquatic, and other chemically complex taxa. Methods and Results: Ninety-one taxa were subjected to RNA extraction with three methods presented here: (1) TRIzol/TURBO DNA-free kits using the manufacturer’s protocol with the addition of sarkosyl; (2) a combination method using cetyltrimethylammonium bromide (CTAB) and TRIzol/sarkosyl/TURBO DNA-free; and (3) a combination of CTAB and QIAGEN RNeasy Plant Mini Kit. Bench-ready protocols are given. Conclusions: After an iterative process of working with chemically complex taxa, we conclude that the use of TRIzol supplemented with sarkosyl and the TURBO DNA-free kit is an effective, efficient, and robust method for obtaining RNA from 100 mg of leaf tissue of land plant species (Embryophyta) examined. Our protocols can be used to provide RNA of suitable stability, quantity, and quality for transcriptome sequencing. PMID:25995975

  15. Evaluation of alkyne-modified isoprenoids as chemical reporters of protein prenylation.

    PubMed

    DeGraw, Amanda J; Palsuledesai, Charuta; Ochocki, Joshua D; Dozier, Jonathan K; Lenevich, Stepan; Rashidian, Mohammad; Distefano, Mark D

    2010-12-01

    Protein prenyltransferases catalyze the attachment of C15 (farnesyl) and C20 (geranylgeranyl) groups to proteins at specific sequences localized at or near the C-termini of specific proteins. Determination of the specific protein prenyltransferase substrates affected by the inhibition of these enzymes is critical for enhancing knowledge of the mechanism of such potential drugs. Here, we investigate the utility of alkyne-containing isoprenoid analogs for chemical proteomics experiments by showing that these compounds readily penetrate mammalian cells in culture and become incorporated into proteins that are normally prenylated. Derivatization via Cu(I) catalyzed click reaction with a fluorescent azide reagent allows the proteins to be visualized and their relative levels to be analyzed. Simultaneous treatment of cells with these probes and inhibitors of prenylation reveals decreases in the levels of some but not all of the labeled proteins. Two-dimensional electrophoretic separation of these labeled proteins followed by mass spectrometric analysis allowed several labeled proteins to be unambiguously identified. Docking experiments and density functional theory calculations suggest that the substrate specificity of protein farnesyl transferase may vary depending on whether azide- or alkyne-based isoprenoid analogs is employed. These results demonstrate the utility of alkyne-containing analogs for chemical proteomic applications.

  16. Evaluation of alkyne-modified isoprenoids as chemical reporters of protein prenylation

    PubMed Central

    DeGraw, Amanda J.; Palsuledesai, Charuta; Ochocki, Joshua D.; Dozier, Jonathan K.; Lenevich, Stepan; Rashidian, Mohammad; Distefano, Mark D.

    2010-01-01

    Protein prenyltransferases catalyze the attachment of C15 (farnesyl) and C20 (geranylgeranyl) groups to proteins at specific sequences localized at or near the C-termini of specific proteins. Determination of the specific protein prenyltransferase substrates affected by the inhibition of these enzymes is critical for enhancing knowledge of the mechanism of such potential drugs. Here we investigate the utility of alkyne-containing isoprenoid analogues for chemical proteomics experiments by showing that these compounds readily penetrate mammalian cells in culture and become incorporated into proteins that are normally prenylated. Derivatization via Cu(I) catalyzed Click reaction with a fluorescent azide reagent allows the proteins to be visualized and their relative levels to be analyzed. Simultaneous treatment of cells with these probes and inhibitors of prenylation reveals decreases in the levels of some but not all of the labeled proteins. Two-dimensional electrophoretic separation of these labeled proteins followed by mass spectrometric analysis allowed several labeled proteins to be unambiguously identified. Docking experiments and DFT calculations suggest that the substrate specificity of PFTase may vary depending on whether azide- or alkyne-based isoprenoid analogues are employed. These results demonstrate the utility of alkyne-containing analogues for chemical proteomic applications. PMID:21040496

  17. Gas-phase Dissociation of homo-DNA Oligonucleotides

    NASA Astrophysics Data System (ADS)

    Stucki, Silvan R.; Désiron, Camille; Nyakas, Adrien; Marti, Simon; Leumann, Christian J.; Schürch, Stefan

    2013-12-01

    Synthetic modified oligonucleotides are of interest for diagnostic and therapeutic applications, as their biological stability, pairing selectivity, and binding strength can be considerably increased by the incorporation of unnatural structural elements. Homo-DNA is an oligonucleotide homologue based on dideoxy-hexopyranosyl sugar moieties, which follows the Watson-Crick A-T and G-C base pairing system, but does not hybridize with complementary natural DNA and RNA. Homo-DNA has found application as a bioorthogonal element in templated chemistry applications. The gas-phase dissociation of homo-DNA has been investigated by ESI-MS/MS and MALDI-MS/MS, and mechanistic aspects of its gas-phase dissociation are discussed. Experiments revealed a charge state dependent preference for the loss of nucleobases, which are released either as neutrals or as anions. In contrast to DNA, nucleobase loss from homo-DNA was found to be decoupled from backbone cleavage, thus resulting in stable products. This renders an additional stage of ion activation necessary in order to generate sequence-defining fragment ions. Upon MS3 of the primary base-loss ion, homo-DNA was found to exhibit unspecific backbone dissociation resulting in a balanced distribution of all fragment ion series.

  18. SOMA: a single oligonucleotide mutagenesis and cloning approach.

    PubMed

    Pfirrmann, Thorsten; Lokapally, Ashwin; Andréasson, Claes; Ljungdahl, Per; Hollemann, Thomas

    2013-01-01

    Modern biology research requires simple techniques for efficient and restriction site-independent modification of genetic material. Classical cloning and mutagenesis strategies are limited by their dependency on restriction sites and the use of complementary primer pairs. Here, we describe the Single Oligonucleotide Mutagenesis and Cloning Approach (SOMA) that is independent of restriction sites and only requires a single mutagenic oligonucleotide to modify a plasmid. We demonstrate the broad application spectrum of SOMA with three examples. First, we present a novel plasmid that in a standardized and rapid fashion can be used as a template for SOMA to generate GFP-reporters. We successfully use such a reporter to assess the in vivo knock-down quality of morpholinos in Xenopus laevis embryos. In a second example, we show how to use a SOMA-based protocol for restriction-site independent cloning to generate chimeric proteins by domain swapping between the two human hRMD5a and hRMD5b isoforms. Last, we show that SOMA simplifies the generation of randomized single-site mutagenized gene libraries. As an example we random-mutagenize a single codon affecting the catalytic activity of the yeast Ssy5 endoprotease and identify a spectrum of tolerated and non-tolerated substitutions. Thus, SOMA represents a highly efficient alternative to classical cloning and mutagenesis strategies.

  19. DOTAP/UDCA vesicles: novel approach in oligonucleotide delivery.

    PubMed

    Ruozi, Barbara; Battini, Renata; Montanari, Monica; Mucci, Adele; Tosi, Giovanni; Forni, Flavio; Vandelli, Maria Angela

    2007-03-01

    The relatively hydrophilic bile acid, ursodeoxycholic acid (UDCA), was used as an additive to DOTAP cationic liposomes to evaluate the effect on the cellular uptake of an oligonucleotide. Nuclear magnetic resonance studies were applied to estimate the relative amount of incorporated UDCA into the lipidic bilayers. DOTAP or DOTAP-UDCA vesicles (MixVes; DOTAP/UDCA molar ratios 1:0.25, 1:0.5, 1:1, and 1:2) formed complexes with 5'-fluorescein conjugated 29-mer phosphorothioate oligonucleotides (PS-ODNs) and studied using gel electrophoresis. In addition, the complexes were tested after transfection to assess the cellular uptake and the localization of the oligo in a HaCaT cell line by the use of cytofluorimetric and confocal microscopic analysis. DOTAP lipid formulated in the presence of a defined amount of UDCA forms more stable, flexible, and active MixVes. In particular, the MixVes at 1:0.25 and 1:0.5 molar ratios increase and modify the cellular uptake of PS-ODNs if compared with DOTAP liposomes 3 hours after the transfection studies. Moreover, the in vitro data suggest that these new formulations are not toxic.

  20. Site-specifically modified oligodeoxynucleotides as probes for the structural and biological effect of DNA-damaging agents

    SciTech Connect

    Basu, A.K.; Essigmann, J.M.

    1988-01-01

    This review critically analyzes the state of knowledge on the preparation, characterization, and uses of site-specifically modified DNA segments. Although these substrates have begun to have an impact upon several fields, the review focuses upon their applications in site-directed mutagenesis studies and for defining the effect of chemical damage upon DNA structure. Oligonucleotides have been synthesized containing alkylated DNA bases, aromatic amine adducts, base oxidation products, cyclic nucleic acid adducts, model apurinic/apyrimidinic sites, UV and psoralen photoadducts, and several antitumor drug-DNA covalent complexes. Below, the authors shall describe the progress to date on synthesis of site-specifically modified DNA segments and how these oligonucleotides have been used to further their understanding of the roles of individual DNA adducts in toxicology. The structures of the DNA adducts and adduct-derived products discussed in this review are presented. 168 references.