Sample records for children immunization monitoring

  1. Immunization Schedules for Infants and Children


    ... ACIP Vaccination Recommendations Why Immunize? Vaccines: The Basics Immunization Schedules for Infants and Children United States, 2017 ... any questions. View or Print a Schedule Recommended Immunizations for Children (Birth through 6 years) Schedule for ...

  2. Trend in proportions of missed children during polio supplementary immunization activities in the African Region: evidence from independent monitoring data 2010-2012.


    Okeibunor, Joseph; Gasasira, Alex; Mihigo, Richard; Salla, Mbaye; Poy, Alain; Orkeh, Godwin; Shaba, Keith; Nshimirimana, Deo


    This is a comparative analysis of independent monitoring data collected between 2010 and 2012, following the implementation of supplementary immunization activities (SIAs) in countries in the three sub regional blocs of World Health Organization in the African Region. The sub regional blocs are Central Africa, West Africa, East and Southern Africa. In addition to the support for SIAs, the Central and West African blocs, threatened with importation and re-establishment of polio transmission received intensive coordination through weekly teleconferences. The later, East and Southern African bloc with low polio threats was not engaged in the intensive coordination through teleconferences. The key indicator of the success of SIAs is the proportion of children missed during SIAs. The results showed that generally there was a decrease in the proportion of children missed during SIAs in the region, from 7.94% in 2010 to 5.95% in 2012. However, the decrease was mainly in the Central and West African blocs. The East and Southern African bloc had countries with as much as 25% missed children. In West Africa and Central Africa, where more coordinated SIAs were conducted, there were progressive and consistent drops, from close to 20-10% at the maximum. At the country and local levels, steps were undertaken to ameliorate situation of low immunization uptake. Wherever an area is observed to have low coverage, local investigations were conducted to understand reasons for low coverage, plans to improve coverage are made and implemented in a coordinated manner. Lessons learned from close monitoring of polio eradication SIAs are will be applied to other campaigns being conducted in the African Region to accelerate control of other vaccine preventable diseases including cerebrospinal meningitis A, measles and yellow fever.

  3. Improving Immunizations in Children: A Clinical Break-even Analysis

    PubMed Central

    Jones, Kyle Bradford; Spain, Chad; Wright, Hannah; Gren, Lisa H.


    Introduction Immunizing the population is a vital public health priority. This article describes a resident-led continuous quality improvement project to improve the immunization rates of children under 3 years of age at two urban family medicine residency clinics in Salt Lake City, Utah, as well as a break-even cost analysis to the clinics for the intervention. Methods Immunization records were distributed to provider-medical assistant teamlets daily for each pediatric patient scheduled in clinic to decrease missed opportunities. An outreach intervention by letter, followed by telephone call reminders, was conducted to reach children under 3 years of age who were behind on recommended immunizations for age (total n=457; those behind on immunizations n=101). Immunization rates were monitored at 3 months following start of intervention. A break-even analysis to the clinics for the outreach intervention was performed. Results Immunizations were improved from a baseline of 75.1% (n=133) and 79.6% (n=223) at the two clinics to 92.1% (n=163) and 89.6% (n=251), respectively, at 3 months following the start of intervention (P<0.01). The average revenue per immunization given was $81.57. The financial break-even point required 36 immunizations to be administered. Conclusion Significant improvement in the immunization rate of patients under 3 years of age at two family medicine residency training clinics was achieved through decreasing missed opportunities for immunization in clinic, and with outreach through letters and follow-up phone calls. The intervention showed positive revenue to both clinics. PMID:25380614

  4. Improving the monitoring of immunization services in Kyrgyzstan.


    Weeks, R M; Svetlana, F; Noorgoul, S; Valentina, G


    Following the disbanding of the Soviet Union in 1991, the government of Kyrgyzstan was unable to maintain the previous level of health services. To revitalize the health services, the Ministry of Health (MOH) first focused on improving their immunization services, including the immunization component of the Health Management Information System (HMIS). Secondly, to increase immunization coverage, the MOH set as a priority the elimination of prescribing false contraindications to immunization. To accomplish both goals, the MOH updated the national immunization policies and established a more effective structure for managing immunization services. To support the MOH, the US Agency for International Development (USAID) Resources for Child Health (REACH) and Basic Support for Institutionalizing Child Survival (BASICS) projects provided technical assistance through a resident coordinator and consultants, and by organizing an international seminar. The improvements extended beyond systems and forms, but, instead, emphasized monitoring by the frontline health worker and supervising the quality of health information. To accomplish their objectives, the MOH appointed a Working Group to define the problems, revise record-keeping procedures, and develop monitoring tools. This group, representing both national and local levels, was composed of MOH epidemiologists, paediatricians and a management information specialist. To reduce the burden of excessive record-keeping and reporting requirements, the Working Group identified four key indicators for the service delivery level: (1) DPT3 immunization coverage rates for children less than 1 year of age; (2) contraindication rates for DPT; (3) usage of DPT vaccine; and (4) daily refrigerator temperatures. Additional indicators were included at district and provincial levels. After a successful 1-year trial, the MOH implemented the revised HMIS nationally. Not only did the quality of the information system improve, but the new approach

  5. Monitoring Regulatory Immune Responses in Tumor Immunotherapy Clinical Trials

    PubMed Central

    Olson, Brian M.; McNeel, Douglas G.


    While immune monitoring of tumor immunotherapy often focuses on the generation of productive Th1-type inflammatory immune responses, the importance of regulatory immune responses is often overlooked, despite the well-documented effects of regulatory immune responses in suppressing anti-tumor immunity. In a variety of malignancies, the frequency of regulatory cell populations has been shown to correlate with disease progression and a poor prognosis, further emphasizing the importance of characterizing the effects of immunotherapy on these populations. This review focuses on the role of suppressive immune populations (regulatory T cells, myeloid-derived suppressor cells, and tumor-associated macrophages) in inhibiting anti-tumor immunity, how these populations have been used in the immune monitoring of clinical trials, the prognostic value of these responses, and how the monitoring of these regulatory responses can be improved in the future. PMID:23653893

  6. Radon-immune air monitor for plutonium

    SciTech Connect

    Gupton, E.D.


    The gross alpha activity in particulate-associated daughters of radon in the work environments may be many times that of one MPC/sub a/ of /sup 239/Pu or /sup 238/Pu. The daughters of radon emit both alpha and beta particles. The ratio of the alpha-to-beta activity is variable and a function of several factors. In spite of this variability, the ratio changes slowly with time and has upper and lower bounds in buildings that have controlled ventilation. This provides the basis for the development of an air monitor in which the radon interference is virtually eliminated. The radon-immune air monitor has three detectors: one that detects the alpha activity on the filter, one that detects the beta activity on the filter plus gamma background, and one that observes gamma background. The counts from these detectors are fed to a computer that is programmed with an algorithm for computing the non-radon-associated alpha activity.

  7. Chemical Tools To Monitor and Manipulate Adaptive Immune Responses.


    Doran, Todd M; Sarkar, Mohosin; Kodadek, Thomas


    Methods to monitor and manipulate the immune system are of enormous clinical interest. For example, the development of vaccines represents one of the earliest and greatest accomplishments of the biomedical research enterprise. More recently, drugs capable of "reawakening" the immune system to cancer have generated enormous excitement. But, much remains to be done. All drugs available today that manipulate the immune system cannot distinguish between "good" and "bad" immune responses and thus drive general and systemic immune suppression or activation. Indeed, with the notable exception of vaccines, our ability to monitor and manipulate antigen-specific immune responses is in its infancy. Achieving this finer level of control would be highly desirable. For example, it might allow the pharmacological editing of pathogenic immune responses without restricting the ability of the immune system to defend against infection. On the diagnostic side, a method to comprehensively monitor the circulating, antigen-specific antibody population could provide a treasure trove of clinically useful biomarkers, since many diseases expose the immune system to characteristic molecules that are deemed foreign and elicit the production of antibodies against them. This Perspective will discuss the state-of-the-art of this area with a focus on what we consider seminal opportunities for the chemistry community to contribute to this important field.

  8. Validation of Procedures for Monitoring Crewmember Immune Function SDBI-1900, SMO-015 - Integrated Immune

    NASA Technical Reports Server (NTRS)

    Crucian, Brian; Stowe, Raymond; Mehta, Satish; Uchakin, Peter; Nehlsen-Cannarella, Sandra; Morukov, Boris; Pierson, Duane; Sams, Clarence


    There is ample evidence to suggest that space flight leads to immune system dysregulation. This may be a result of microgravity, confinement, physiological stress, radiation, environment or other mission-associated factors. The clinical risk from prolonged immune dysregulation during space flight are not yet determined, but may include increased incidence of infection, allergy, hypersensitivity, hematological malignancy or altered wound healing. Each of the clinical events resulting from immune dysfunction has the potential to impact mission critical objectives during exploration-class missions. To date, precious little in-flight immune data has been generated to assess this phenomenon. The majority of recent flight immune studies have been post-flight assessments, which may not accurately reflect the in-flight condition. There are no procedures currently in place to monitor immune function or its effect on crew health. The objective of this Supplemental Medical Objective (SMO) is to develop and validate an immune monitoring strategy consistent with operational flight requirements and constraints. This SMO will assess the clinical risks resulting from the adverse effects of space flight on the human immune system and will validate a flight-compatible immune monitoring strategy. Characterization of the clinical risk and the development of a monitoring strategy are necessary prerequisite activities prior to validating countermeasures. This study will determine, to the best level allowed by current technology, the in-flight status of crewmembers immune system. Pre-flight, in-flight and post-flight assessments of immune status, immune function, viral reactivation and physiological stress will be performed. The in-flight samples will allow a distinction between legitimate in-flight alterations and the physiological stresses of landing and readaptation which are believed to alter landing day assessments. The overall status of the immune system during flight (activation

  9. Monitoring of the Immune Dysfunction in Cancer Patients.


    Santegoets, Saskia J A M; Welters, Marij J P; van der Burg, Sjoerd H


    Immunotherapy shows promising clinical results in patients with different types of cancer, but its full potential is not reached due to immune dysfunction as a result of several suppressive mechanisms that play a role in cancer development and progression. Monitoring of immune dysfunction is a prerequisite for the development of strategies aiming to alleviate cancer-induced immune suppression. At this point, the level at which immune dysfunction occurs has to be established, the underlying mechanism(s) need to be known, as well as the techniques to assess this. While it is relatively easy to measure general signs of immune suppression, it turns out that accurate monitoring of the frequency and function of immune-suppressive cells is still difficult. A lack of truly specific markers, the phenotypic complexity among suppressive cells of the same lineage, but potentially with different functions and functional assays that may not cover every mechanistic aspect of immune suppression are among the reasons complicating proper assessments. Technical innovations in flow and mass cytometry will allow for more complete sets of markers to precisely determine phenotype and associated function. There is, however, a clear need for functional assays that recapitulate more of the mechanisms employed to suppress the immune system.

  10. Monitoring of the Immune Dysfunction in Cancer Patients

    PubMed Central

    Santegoets, Saskia J. A. M.; Welters, Marij J. P.; van der Burg, Sjoerd H.


    Immunotherapy shows promising clinical results in patients with different types of cancer, but its full potential is not reached due to immune dysfunction as a result of several suppressive mechanisms that play a role in cancer development and progression. Monitoring of immune dysfunction is a prerequisite for the development of strategies aiming to alleviate cancer-induced immune suppression. At this point, the level at which immune dysfunction occurs has to be established, the underlying mechanism(s) need to be known, as well as the techniques to assess this. While it is relatively easy to measure general signs of immune suppression, it turns out that accurate monitoring of the frequency and function of immune-suppressive cells is still difficult. A lack of truly specific markers, the phenotypic complexity among suppressive cells of the same lineage, but potentially with different functions and functional assays that may not cover every mechanistic aspect of immune suppression are among the reasons complicating proper assessments. Technical innovations in flow and mass cytometry will allow for more complete sets of markers to precisely determine phenotype and associated function. There is, however, a clear need for functional assays that recapitulate more of the mechanisms employed to suppress the immune system. PMID:27598210

  11. Validation of Procedures for Monitoring Crewmember Immune Function

    NASA Technical Reports Server (NTRS)

    Crucian, Brian; Stowe, Raymond; Mehta, Satish; Uchakin, Peter; Quiriarte, Heather; Pierson, Duane; Sams, Clarence


    There is ample evidence to suggest that space flight leads to immune system dysregulation. This may be a result of microgravity, confinement, physiological stress, radiation, environment or other mission-associated factors. The clinical risk (if any) from prolonged immune dysregulation during exploration-class space flight has not yet been determined, but may include increased incidence of infection, allergy, hypersensitivity, hematological malignancy or altered wound healing. Each of the clinical events resulting from immune dysfunction has the potential to impact mission critical objectives during exploration-class missions. To date, precious little in-flight immune data has been generated to assess this phenomenon. The majority of recent flight immune studies have been post-flight assessments, which may not accurately reflect the in-flight status of immunity as it resolves over prolonged flight. There are no procedures currently in place to monitor immune function or its effect on crew health. The objective of this Supplemental Medical Objective (SMO) is to develop and validate an immune monitoring strategy consistent with operational flight requirements and constraints. This SMO will assess immunity, latent viral reactivation and physiological stress during both short and long duration flights. Upon completion, it is expected that any clinical risks resulting from the adverse effects of space flight on the human immune system will have been determined. In addition, a flight-compatible immune monitoring strategy will have been developed with which countermeasures validation could be performed. This study will determine, to the best level allowed by current technology, the in-flight status of crewmembers' immune systems. The in-flight samples will allow a distinction between legitimate in-flight alterations and the physiological stresses of landing and readaptation which are believed to alter R+0 assessments. The overall status of the immune system during flight

  12. Immune reconstitution and vaccination outcome in HIV-1 infected children

    PubMed Central

    Cagigi, Alberto; Cotugno, Nicola; Giaquinto, Carlo; Nicolosi, Luciana; Bernardi, Stefania; Rossi, Paolo; Douagi, Iyadh; Palma, Paolo


    Current evidence on routine immunization of HIV-1 infected children point out the need for a special vaccine schedule in this population. However, optimal strategies for identifying individuals susceptible to infections, and then offering them sustained protection through appropriate immunization schedule, both in terms of timing and number of vaccine doses, still remain to be elucidated. Understanding the degree of immune recovery after HAART initiation is important in guiding administration of routine vaccination in HIV-1 infected children. Although quantitative measures (e.g., CD4+ T-cell counts and immunoglobulin levels) are frequently performed to evaluate immune parameters, these measures do not fully mirror functional immune recovery. Here, we will review the status of single mandatory and recommended vaccines for HIV-1 infected children in relation to immune recovery after HAART initiation with the aim of identifying new means to help design personalized vaccine schedules for this population. PMID:22906931

  13. Lasting monitoring of immune state in patients with coronary atherosclerosis

    NASA Astrophysics Data System (ADS)

    Malinova, Lidia I.; Denisova, Tatyana P.; Tuchin, Valery V.


    Immune state monitoring is an expensive, invasive and sometimes difficult necessity in patients with different disorders. Immune reaction dynamics study in patients with coronary atherosclerosis provides one of the leading components to complication development, clinical course prognosis and treatment and rehabilitation tactics. We've chosen intravenous glucose injection as metabolic irritant in the following four groups of patients: men with proved coronary atherosclerosis (CA), non insulin dependent diabetes mellitus (NIDDM), men hereditary burden by CA and NIDDM and practically healthy persons with longlivers in generation. Immune state parameters such as quantity of leukocytes and lymphocytes, circulating immune complexes levels, serum immunoglobulin levels, HLA antigen markers were studied at 0, 30 and 60 minutes during glucose loading. To obtain continues time function of studied parameters received data were approximated by polynomials of high degree with after going first derivatives. Time functions analyze elucidate principally different dynamics studied parameters in all chosen groups of patients, which couldn't be obtained from discontinuous data compare. Leukocyte and lymphocyte levels dynamics correlated HLA antigen markers in all studied groups. Analytical estimation of immune state in patients with coronary atherosclerosis shows the functional "margin of safety" of immune system state under glucose disturbance. Proposed method of analytical estimation also can be used in immune system monitoring in other groups of patients.

  14. The immunization data quality audit: verifying the quality and consistency of immunization monitoring systems.

    PubMed Central

    Ronveaux, O.; Rickert, D.; Hadler, S.; Groom, H.; Lloyd, J.; Bchir, A.; Birmingham, M.


    OBJECTIVE: To evaluate the consistency and quality of immunization monitoring systems in 27 countries during 2002-03 using standardized data quality audits (DQAs) that had been launched within the framework of the Global Alliance for Vaccines and Immunization. METHODS: The consistency of reporting systems was estimated by determining the proportion of third doses of diphtheria-tetanuspertussis (DTP-3) vaccine reported as being administered that could be verified by written documentation at health facilities and districts. The quality of monitoring systems was measured using quality indices for different components of the monitoring systems. These indices were applied to each level of the health service (health unit, district and national). FINDINGS: The proportion of verified DTP-3 doses was lower than 85% in 16 countries. Difficulties in verifying the doses administered often arose at the peripheral level of the health service, usually as the result of discrepancies in information between health units and their corresponding districts or because completed recording forms were not available from health units. All countries had weaknesses in their monitoring systems; these included the inconsistent use of monitoring charts; inadequate monitoring of vaccine stocks, injection supplies and adverse events; unsafe computer practices; and poor monitoring of completeness and timeliness of reporting. CONCLUSION: Inconsistencies in immunization data occur in many countries, hampering their ability to manage their immunization programmes. Countries should use these findings to strengthen monitoring systems so that data can reliably guide programme activities. The DQA is an innovative tool that provides a way to independently assess the quality of immunization monitoring systems at all levels of a health service and serves as a point of entry to make improvements. It provides a useful example for other global health initiatives. PMID:16175824

  15. Immunization promotion activities: are they effective in encouraging mothers to immunize their children?


    Pérez-Cuevas, R; Reyes, H; Pego, U; Tomé, P; Ceja, K; Flores, S; Gutiérrez, G


    Mass media communication is an important strategy for increasing parental uptake and to promote community participation when large-scale immunization activities are carried out. In Mexico, the National Vaccination Council (CONAVA) launches three immunization campaigns every year accompanied by three vaccination promotion campaigns. This study was conducted to assess whether communication activities to promote CONAVA's Second National Health Week (SNHW) were effective in providing information to mothers about the importance of immunizing their children under five years of age and in prompting them to seek immunization services. A probability sample of mothers living in the metropolitan area of Mexico City and having at least one child under five years old was selected for the study. Four outcome variables were defined as measuring the impact of the campaign: (1) mothers' knowledge about the SNHW; (2) mothers' comprehension indicating how well they understood the campaign messages (aware, partly aware and unaware); (3) mothers' motivation, i.e. whether or not they sought out immunizations for their children under the age of five and (4) mothers' opinion of how well they liked the messages. A total of 935 mothers were interviewed; 88.2% knew about the SNHW, 64.3% were aware that the campaign aimed to provide immunizations, and most held a favorable opinion about the messages. Among aware mothers, 87.5% of their children received immunizations. In this group 72.1% were prompted by the information in the campaign to seek immunizations for their children while 27.9% had to be personally invited to participate in the campaign. The latter occurred either when health workers or volunteers visited mothers in their homes or by soliciting mothers' participation as they visited or passed by immunization health posts. In the unaware mothers group, 72.7% of their children received immunizations; 62.5% of the mothers took their children because of information they received through

  16. Validation of Procedures for Monitoring Crewmember Immune Function - Short Duration Biological Investigation

    NASA Technical Reports Server (NTRS)

    Sams, Clarence; Crucian, Brian; Stowe, Raymond; Pierson, Duane; Mehta, Satish; Morukov, Boris; Uchakin, Peter; Nehlsen-Cannarella, Sandra


    Validation of Procedures for Monitoring Crew Member Immune Function - Short Duration Biological Investigation (Integrated Immune-SDBI) will assess the clinical risks resulting from the adverse effects of space flight on the human immune system and will validate a flightcompatible immune monitoring strategy. Immune system changes will be monitored by collecting and analyzing blood, urine and saliva samples from crewmembers before, during and after space flight.

  17. Validation of Procedures for Monitoring Crewmember Immune Function

    NASA Technical Reports Server (NTRS)

    Pierson, Duane; Crucian, Brian; Mehta, Satish; Stowe, Raymond; Uchakin, Peter; Quiriarte, Heather; Sams, Clarence


    The objective of this Supplemental Medical Objective (SMO) is to determine the status of the immune system, physiological stress and latent viral reactivation (a clinical outcome that can be measured) during both short and long-duration spaceflight. In addition, this study will develop and validate an immune monitoring strategy consistent with operational flight requirements and constraints. Pre-mission, in-flight and post-flight blood and saliva samples will be obtained from participating crewmembers. Assays included peripheral immunophenotype, T cell function, cytokine profiles, viral-specific immunity, latent viral reactivation (EBV, CMV, VZV), and stress hormone measurements. To date, 18 short duration (now completed) and 8 long-duration crewmembers have completed the study. The long-duration phase of this study is ongoing. For this presentation, the final data set for the short duration subjects will be discussed.

  18. Maternal Education and Immunization Status Among Children in Kenya.


    Onsomu, Elijah O; Abuya, Benta A; Okech, Irene N; Moore, DaKysha; Collins-McNeil, Janice


    Child morbidity and mortality due to infectious diseases continues to be a major threat and public health concern worldwide. Although global vaccination coverage reached 90 % for diphtheria, tetanus and pertussis (DTP3) across 129 countries, Kenya and other sub-Saharan countries continue to experience under-vaccination. The purpose of this study was to examine the association between maternal education and child immunization (12-23 months) in Kenya. This study used retrospective cross-sectional data from the 2008-2009 Kenya Demographic and Health Survey for women aged 15-49, who had children aged 12-23 months, and who answered questions about vaccination in the survey (n = 1,707). The majority of the children had received vaccinations, with 77 % for poliomyelitis, 74 % for measles, 94 % for tuberculosis, and 91 % for diphtheria, whooping cough (pertussis), and tetanus. After adjusting for other covariates, women with primary, secondary, and college/university education were between 2.21 (p < 0.01) and 9.10 (p < 0.001) times more likely to immunize their children than those who had less than a primary education. Maternal education is clearly crucial in ensuring good health outcomes among children, and integrating immunization knowledge with maternal and child health services is imperative. More research is needed to identify factors influencing immunization decisions among less-educated women in Kenya.

  19. Calcium ameliorates diarrhea in immune compromised children

    PubMed Central

    Cheng, Sam X.; Bai, Harrison X.; Gonzalez-Peralta, Regino; Mistry, Pramod K.; Gorelick, Fred S.


    Treatment of infectious diarrheas remains a challenge, particularly in immunocompromised patients in whom infections usually persist and resultant diarrhea is often severe and protracted. Children with infectious diarrhea who become dehydrated are normally treated with oral or intravenous rehydration therapy. Although rehydration therapy can replace the loss of fluid, it does not ameliorate diarrhea. Thus, over the past decades, there has been continuous effort to search for ways to safely stop diarrhea. Herein, we report three cases of immunocompromised children who developed severe and/or protracted infectious diarrhea. Their diarrheas were successfully “halted” within 1-2 days following the administration of calcium. PMID:23343935

  20. Reasons Parents Exempt Children from Receiving Immunizations

    ERIC Educational Resources Information Center

    Luthy, Karlen E.; Beckstrand, Renea L.; Callister, Lynn C.; Cahoon, Spencer


    School nurses are on the front lines of educational efforts to promote childhood vaccinations. However, some parents still choose to exempt their children from receiving vaccinations for personal reasons. Studying the beliefs of parents who exempt vaccinations allows health care workers, including school nurses, to better understand parental…

  1. [Herd immunity against poliomyelitis in children in the Moscow Region].


    Seĭbil', V B; Malyshkina, L P; Tamazian, G V; Konopleva, T N; Uspenskaia, E S


    Herd immunity against poliomyelitis was studied in 1391 children and adolescents from 10 towns of the Moscow Region. It was ascertained that the values of herd immunity against poliomyelitis virus type 1 were high everywhere and those of herd immunity against poliomyelitis virus type 2 were high and very high in 9 towns and below the WHO minimum levels (80%). The values of herd immunity against poliomyelitis virus type 3; they were lower than the required minimum in 2 towns and very low in 2 other towns arouse alarm. The study of strain-specific antibodies to vaccine-derived and wild polioviruses has demonstrated that wild poliomyelitis viruses have not circulated in the areas of the examinees in the past decade.

  2. Ambulatory blood pressure monitoring in children.


    Sinha, Rajiv; Dionne, Janis


    Recently there have been great advances in the use of ambulatory blood pressure monitoring (ABPM) in children. A major boost has been the publication of normative data for blood pressure in children. ABPM has been able to detect significant differences in blood pressure in many disease states including chronic renal failure, polycystic kidney disease and post renal transplantation and has helped in identifying both white coat hypertension and masked hypertension. Current evidence does suggest that sole reliance on clinic blood pressure might not be always appropriate and ABPM has a definite role in pediatric hypertension.

  3. Immune response to measles vaccine in Peruvian children.

    PubMed Central

    Bautista-López, N. L.; Vaisberg, A.; Kanashiro, R.; Hernández, H.; Ward, B. J.


    OBJECTIVE: To evaluate the immune response in Peruvian children following measles vaccination. METHODS: Fifty-five Peruvian children received Schwarz measles vaccine (about 10(3) plaque forming units) at about 9 months of age. Blood samples were taken before vaccination, then twice after vaccination: one sample at between 1 and 4 weeks after vaccination and the final sample 3 months post vaccination for evaluation of immune cell phenotype and lymphoproliferative responses to measles and non-measles antigens. Measles-specific antibodies were measured by plaque reduction neutralization. FINDINGS: The humoral response developed rapidly after vaccination; only 4 of the 55 children (7%) had plaque reduction neutralization titres <200 mlU/ml 3 months after vaccination. However, only 8 out of 35 children tested (23%) had lymphoproliferative responses to measles antigens 3-4 weeks after vaccination. Children with poor lymphoproliferative responses to measles antigens had readily detectable lymphoproliferative responses to other antigens. Flow cytometric analysis of peripheral blood mononuclear cells revealed diffuse immune system activation at the time of vaccination in most children. The capacity to mount a lymphoproliferative response to measles antigens was associated with expression of CD45RO on CD4+ T-cells. CONCLUSION: The 55 Peruvian children had excellent antibody responses after measles vaccination, but only 23% (8 out of 35) generated detectable lymphoproliferative responses to measles antigens (compared with 55-67% in children in the industrialized world). This difference may contribute to the less than uniform success of measles vaccination programmes in the developing world. PMID:11731811

  4. Monitoring polio supplementary immunization activities using an automated short text messaging system in Karachi, Pakistan

    PubMed Central

    Murtaza, A; Khoja, S; Zaidi, AK; Ali, SA


    Abstract Problem Polio remains endemic in many areas of Pakistan, including large urban centres such as Karachi. Approach During each of seven supplementary immunization activities against polio in Karachi, mobile phone numbers of the caregivers of a random sample of eligible children were obtained. A computer-based system was developed to send two questions – as short message service (SMS) texts – automatically to each number after the immunization activity: “Did the vaccinator visit your house?” and “Did the enrolled child in your household receive oral polio vaccine?” Persistent non-responders were phoned directly by an investigator. Local setting A cluster sampling technique was used to select representative samples of the caregivers of young children in Karachi in general and of such caregivers in three of the six “high-risk” districts of the city where polio cases were detected in 2011. Relevant changes In most of the supplementary immunization activities investigated, vaccine coverages estimated using the SMS system were very similar to those estimated by interviewing by phone those caregivers who never responded to the SMS messages. In the high-risk districts investigated, coverages estimated using the SMS system were also similar to those recorded – using lot quality assurance sampling – by the World Health Organization. Lessons learnt For the monitoring of coverage in supplementary immunization activities, automated SMS-based systems appear to be an attractive and relatively inexpensive option. Further research is needed to determine if coverage data collected by SMS-based systems provide estimates that are sufficiently accurate. Such systems may be useful in other large-scale immunization campaigns. PMID:24700982

  5. Influenza immunization in children with cystic fibrosis.


    Adlard, P; Bryett, K


    Nineteen children with cystic fibrosis and aged between 5 and 13 years were randomized to receive two doses at monthly intervals of either a split-virion influenza vaccine (MFV-Ject, Institut Merieux) or a sub-unit vaccine (Fluvirin, Evans). In those completing the study, there was a satisfactory serological response. There was no statistically significant difference between the immunogenicity of the two vaccines as evaluated by haemagglutination inhibition or single radial haemolysis tests. The incidence of local side-effects was similar in the two groups.

  6. [Guidelines for diagnosis, treatment and monitoring of primary immune thrombocytopenia].


    Sanz, Miguel Ángel; Vicente García, Vicente; Fernández, Antonio; López, M Fernanda; Grande, Carlos; Jarque, Isidro; Martínez, Rafael; Mingot, María Eva; Monteagudo, Emilio; Ribera, Josep M A; Valcárcel, David


    The consensus document on the diagnosis, treatment and monitoring of primary immune thrombocytopenia was developed in 2010 by specialists with recognized expertise in this disease under the auspices of the Spanish Society of Hematology and Hemotherapy and the Spanish Society of Pediatric Hematology and Oncology, with the aim to adapt to Spain the recommendations of the recently published international consensus documents. The decision to start treatment is based on bleeding manifestations and platelet count (<20×10(9)/L). The first-line treatment is corticosteroids, albeit for a limited period of 4-6 weeks. The addition of intravenous immunoglobulin is reserved to patients with severe bleeding. Splenectomy is the most effective second-line treatment. For patients refractory to splenectomy and those with contraindications or patient refusal, the new thrombopoietic agents are the drugs of choice due to their efficacy and excellent safety profile. The other treatment options have highly variable response rates, and the absence of controlled studies does not allow to establish clear recommendations. Monitoring should be individualized. In patients without active treatment, blood counts are recommended every 3-6 months, and the patient should be instructed to consult in case of bleeding, surgery or invasive procedure and pregnancy. In most of the pediatric population, the disease tends to spontaneous remission. High-dose corticosteroids in short course and intravenous immunoglobulin are the treatment of choice. Second- and further-line treatments should be monitored in specialized centers.

  7. Validation of Procedures for Monitoring Crewmember Immune Function

    NASA Technical Reports Server (NTRS)

    Crucian, Brian; Stowe, Raymond; Mehta, Satish; Uchakin, Peter; Quiriarte, Heather; Pierson, Duane; Sams, Clarence


    There is ample evidence to suggest that space flight leads to immune system dysregulation, however the nature of the phenomenon as it equilibrates over longer flights has not been determined. This dysregulation may be a result of microgravity, confinement, physiological stress, radiation, environment or other mission-associated factors. The clinical risk (if any) for exploration-class space flight is unknown, but may include increased incidence of infection, allergy, hypersensitivity, hematological malignancy or altered wound healing. The objective of this Supplemental Medical Objective (SMO) is to determine the status of the immune system, physiological stress and latent viral reactivation (a clinical outcome that can be measured) during both short and long-duration spaceflight. In addition, this study will develop and validate an immune monitoring strategy consistent with operational flight requirements and constraints. Pre-mission, in-flight and post-flight blood and saliva samples will be obtained from participating crewmembers. Assays included peripheral immunophenotype, T cell function, cytokine profiles (RNA, intracellular, secreted), viral-specific immunity, latent viral reactivation (EBV, CMV, VZV), and stress hormone measurements. This study is currently ongoing. To date, 10 short duration and 5 long-duration crewmembers have completed the study. Technically, the study is progressing well. In-flight blood samples are being collected, and returned for analysis, including functional assays that require live cells. For all in-flight samples to date, sample viability has been acceptable. Preliminary data (n = 4/7; long/short duration, respectively) indicate that distribution of most peripheral leukocyte subsets is largely unaltered during flight. Exceptions include elevated T cells, reduced B/NK cells, increased memory T cells and increased central memory CD8+ T cells. General T cell function, early blastogenesis response to mitogenic stimulation, is markedly

  8. Immunization.

    ERIC Educational Resources Information Center

    Guerin, Nicole; And Others


    Contents of this double journal issue concern immunization and primary health care of children. The issue decribes vaccine storage and sterilization techniques, giving particular emphasis to the role of the cold chain, i.e., the maintenance of a specific temperature range to assure potency of vaccines as they are moved from a national storage…

  9. Premature aging and immune senescence in HIV-infected children

    PubMed Central

    Gianesin, Ketty; Noguera-Julian, Antoni; Zanchetta, Marisa; Del Bianco, Paola; Petrara, Maria Raffaella; Freguja, Riccardo; Rampon, Osvalda; Fortuny, Clàudia; Camós, Mireia; Mozzo, Elena; Giaquinto, Carlo; De Rossi, Anita


    Objective: Several pieces of evidence indicate that HIV-infected adults undergo premature aging. The effect of HIV and antiretroviral therapy (ART) exposure on the aging process of HIV-infected children may be more deleterious since their immune system coevolves from birth with HIV. Design: Seventy-one HIV-infected (HIV+), 65 HIV-exposed-uninfected (HEU), and 56 HIV-unexposed-uninfected (HUU) children, all aged 0–5 years, were studied for biological aging and immune senescence. Methods: Telomere length and T-cell receptor rearrangement excision circle levels were quantified in peripheral blood cells by real-time PCR. CD4+ and CD8+ cells were analysed for differentiation, senescence, and activation/exhaustion markers by flow cytometry. Results: Telomere lengths were significantly shorter in HIV+ than in HEU and HUU children (overall, P < 0.001 adjusted for age); HIV+ ART-naive (42%) children had shorter telomere length compared with children on ART (P = 0.003 adjusted for age). T-cell receptor rearrangement excision circle levels and CD8+ recent thymic emigrant cells (CD45RA+CD31+) were significantly lower in the HIV+ than in control groups (overall, P = 0.025 and P = 0.005, respectively). Percentages of senescent (CD28−CD57+), activated (CD38+HLA-DR+), and exhausted (PD1+) CD8+ cells were significantly higher in HIV+ than in HEU and HUU children (P = 0.004, P < 0.001, and P < 0.001, respectively). Within the CD4+ cell subset, the percentage of senescent cells did not differ between HIV+ and controls, but programmed cell death receptor-1 expression was upregulated in the former. Conclusions: HIV-infected children exhibit premature biological aging with accelerated immune senescence, which particularly affects the CD8+ cell subset. HIV infection per se seems to influence the aging process, rather than exposure to ART for prophylaxis or treatment. PMID:26990630

  10. Modeling flow cytometry data for cancer vaccine immune monitoring.


    Frelinger, Jacob; Ottinger, Janet; Gouttefangeas, Cécile; Chan, Cliburn


    Flow cytometry (FCM) is widely used in cancer research for diagnosis, detection of minimal residual disease, as well as immune monitoring and profiling following immunotherapy. In all these applications, the challenge is to detect extremely rare cell subsets while avoiding spurious positive events. To achieve this objective, it helps to be able to analyze FCM data using multiple markers simultaneously, since the additional information provided often helps to minimize the number of false positive and false negative events, hence increasing both sensitivity and specificity. However, with manual gating, at most two markers can be examined in a single dot plot, and a sequential strategy is often used. As the sequential strategy discards events that fall outside preceding gates at each stage, the effectiveness of the strategy is difficult to evaluate without laborious and painstaking back-gating. Model-based analysis is a promising computational technique that works using information from all marker dimensions simultaneously, and offers an alternative approach to flow analysis that can usefully complement manual gating in the design of optimal gating strategies. Results from model-based analysis will be illustrated with examples from FCM assays commonly used in cancer immunotherapy laboratories.

  11. Brief Report: Dysregulated Immune System in Children with Autism: Beneficial Effects of Intravenous Immune Globulin on Autistic Characteristics.

    ERIC Educational Resources Information Center

    Gupta, Sudhir; And Others


    Children (ages 3-12) with autism (n=25) were given intravenous immune globulin (IVIG) treatments at 4-week intervals for at least 6 months. Marked abnormality of immune parameters was observed in subjects, compared to age-matched controls. IVIG treatment resulted in improved eye contact, speech, behavior, echolalia, and other autistic features.…

  12. Children monitor individuals' expertise for word learning.


    Sobel, David M; Corriveau, Kathleen H


    Two experiments examined preschoolers' ability to learn novel words using others' expertise about objects' nonobvious properties. In Experiment 1, 4-year-olds (n = 24) endorsed individuals' labels for objects based on their differing causal knowledge about those objects. Experiment 2 examined the robustness of this inference and its development. Four-year-olds (n = 40) endorsed labels from confederates who accurately predicted objects' nonobvious internal properties but not nonobvious external properties. Three-year-olds (n = 40) performed at chance levels in both cases and were less likely to recognize the informants' expertise, suggesting that they might be unable to monitor individuals' expertise. These data suggest that children's ability to learn from testimony is necessary for their understanding of the relevance of an individual's expertise.

  13. A Conceptual Framework for Monitoring Children's Services. Discussion Draft.

    ERIC Educational Resources Information Center

    Fiene, Richard

    This discussion draft of a conceptual framework for monitoring children's services was prepared by Peat, Marwick and Co. for the Children's Services Monitoring Transfer Consortium (CFMCS), an organization spanning five states: California, Michigan, Pennsylvania, Texas, and West Virginia. The primary purpose of this conceptual framework was to…

  14. Managing Multi-center Flow Cytometry Data for Immune Monitoring.


    White, Scott; Laske, Karoline; Welters, Marij Jp; Bidmon, Nicole; van der Burg, Sjoerd H; Britten, Cedrik M; Enzor, Jennifer; Staats, Janet; Weinhold, Kent J; Gouttefangeas, Cécile; Chan, Cliburn


    With the recent results of promising cancer vaccines and immunotherapy1-5, immune monitoring has become increasingly relevant for measuring treatment-induced effects on T cells, and an essential tool for shedding light on the mechanisms responsible for a successful treatment. Flow cytometry is the canonical multi-parameter assay for the fine characterization of single cells in solution, and is ubiquitously used in pre-clinical tumor immunology and in cancer immunotherapy trials. Current state-of-the-art polychromatic flow cytometry involves multi-step, multi-reagent assays followed by sample acquisition on sophisticated instruments capable of capturing up to 20 parameters per cell at a rate of tens of thousands of cells per second. Given the complexity of flow cytometry assays, reproducibility is a major concern, especially for multi-center studies. A promising approach for improving reproducibility is the use of automated analysis borrowing from statistics, machine learning and information visualization21-23, as these methods directly address the subjectivity, operator-dependence, labor-intensive and low fidelity of manual analysis. However, it is quite time-consuming to investigate and test new automated analysis techniques on large data sets without some centralized information management system. For large-scale automated analysis to be practical, the presence of consistent and high-quality data linked to the raw FCS files is indispensable. In particular, the use of machine-readable standard vocabularies to characterize channel metadata is essential when constructing analytic pipelines to avoid errors in processing, analysis and interpretation of results. For automation, this high-quality metadata needs to be programmatically accessible, implying the need for a consistent Application Programming Interface (API). In this manuscript, we propose that upfront time spent normalizing flow cytometry data to conform to carefully designed data models enables automated

  15. Managing Multi-center Flow Cytometry Data for Immune Monitoring

    PubMed Central

    White, Scott; Laske, Karoline; Welters, Marij JP; Bidmon, Nicole; van der Burg, Sjoerd H; Britten, Cedrik M; Enzor, Jennifer; Staats, Janet; Weinhold, Kent J; Gouttefangeas, Cécile; Chan, Cliburn


    With the recent results of promising cancer vaccines and immunotherapy1–5, immune monitoring has become increasingly relevant for measuring treatment-induced effects on T cells, and an essential tool for shedding light on the mechanisms responsible for a successful treatment. Flow cytometry is the canonical multi-parameter assay for the fine characterization of single cells in solution, and is ubiquitously used in pre-clinical tumor immunology and in cancer immunotherapy trials. Current state-of-the-art polychromatic flow cytometry involves multi-step, multi-reagent assays followed by sample acquisition on sophisticated instruments capable of capturing up to 20 parameters per cell at a rate of tens of thousands of cells per second. Given the complexity of flow cytometry assays, reproducibility is a major concern, especially for multi-center studies. A promising approach for improving reproducibility is the use of automated analysis borrowing from statistics, machine learning and information visualization21–23, as these methods directly address the subjectivity, operator-dependence, labor-intensive and low fidelity of manual analysis. However, it is quite time-consuming to investigate and test new automated analysis techniques on large data sets without some centralized information management system. For large-scale automated analysis to be practical, the presence of consistent and high-quality data linked to the raw FCS files is indispensable. In particular, the use of machine-readable standard vocabularies to characterize channel metadata is essential when constructing analytic pipelines to avoid errors in processing, analysis and interpretation of results. For automation, this high-quality metadata needs to be programmatically accessible, implying the need for a consistent Application Programming Interface (API). In this manuscript, we propose that upfront time spent normalizing flow cytometry data to conform to carefully designed data models enables

  16. Performance Monitoring in Children following Traumatic Brain Injury

    ERIC Educational Resources Information Center

    Ornstein, Tisha J.; Levin, Harvey S.; Chen, Shirley; Hanten, Gerri; Ewing-Cobbs, Linda; Dennis, Maureen; Barnes, Marcia; Max, Jeffrey E.; Logan, Gordon D.; Schachar, Russell


    Background: Executive control deficits are common sequelae of childhood traumatic brain injury (TBI). The goal of the current study was to assess a specific executive control function, performance monitoring, in children following TBI. Methods: Thirty-one children with mild-moderate TBI, 18 with severe TBI, and 37 control children without TBI, of…

  17. Immunization of newborn children with living oral trivalent poliovirus vaccine.




    Campillo-Sainz, C. (Instituto Nacional de Virología de la S.S.A., México, D.F.), A. Ornelas Hernandez, J. de Mucha Macías, and S. E. Nava. Immunization of newborn children with living oral trivalent poliovirus vaccine. J. Bacteriol. 84:446-450. 1962.-The serological response to one dose of living oral trivalent polio-virus vaccine was compared in two groups of children, 49 vaccinated at birth and 44 vaccinated at the age of 4 months. Of those vaccinated at birth, 44 (90%) responded to the vaccine strains of type 1 and type 3 and 30 (61%) to the type 2 strain. Of those vaccinated at 4 months of age; 64% responded to type 1, 52% to type 2, and 82% to type 3. The difference between the responses of the two groups, which for type 1 is significant, may result from the interference of other enteric viruses in the 4-month-old children. A second dose of vaccine, administered to the children vaccinated at birth when they reached the age of 4 months, increased the over-all immunological response to 100% for types 1 and 3 and 96% for type 2, and showed that no immunological tolerance had been developed. The vaccine produced no undesirable effects in any of the children, and no paralytic poliomyelitis occurred among them. The observation of other investigators, that a high titer of maternal antibody inhibits immunological response to vaccination, was confirmed, but breast feeding apparently had no unfavorable effect on response.

  18. Immunity to Polyomavirus BK Infection: Immune Monitoring to Regulate the Balance between Risk of BKV Nephropathy and Induction of Alloimmunity

    PubMed Central

    Cioni, Michela; Basso, Sabrina; Gagliardone, Chiara; Potenza, Leonardo; Verrina, Enrico; Luppi, Mario; Zecca, Marco; Ghiggeri, Gian Marco; Ginevri, Fabrizio


    Polyomavirus BK-associated nephropathy (PyVAN) is the main infectious cause of allograft damage after kidney transplantation. A number of studies revealed an association between the presence of BKV-specific cellular immunity and BK viral clearance, with patients failing to recover specific T cells progressing to PyVAN. Evolution to allograft dysfunction can be prevented by restoration of BKV-specific immunity through a stepwise reduction of maintenance immunosuppressive drugs. Prospective monitoring of BK viral load and specific immunity, together with B-cell alloimmune surveillance, may allow a targeted modification/reduction of immunosuppression, with the aim of obtaining viral clearance while preventing graft injury due to deposition of de novo donor-specific HLA antibodies and late/chronic antibody-mediated allograft injury. Innovative, immune-based therapies may further contribute to BKV infection prevention and control. PMID:24000288

  19. Immune response to sublingual immunotherapy in children allergic to mites.


    Barberi, S; Villa, M P; Pajno, G B; La Penna, F; Barreto, M; Cardelli, P; Amodeo, R; Tabacco, F; Caminiti, L; Ciprandi, G


    Allergic rhinitis (AR) is characterized by Th2 polarized immune response. Specific immunotherapy modifies this arrangement restoring a physiologic Th1 profile. Sublingual immunotherapy (SLIT) is widely prescribed, but there is no early marker of response. The aim of this study is to investigate possible marker of SLIT effectiveness. Thirty children with mite allergy were studied: 15 were treated with drugs alone, 15 with SLIT and drugs on demand. The study lasted 2 years. Visual analogue scale (VAS) for symptoms and medication score were evaluated. Serum cytokines (IL-2, IL-4, IL-6, IL-8, IL-10, IFN-gamma, MCP-1, and TNF-alpha) were assessed by ELISA before and after 1 and 2 year SLIT. SLIT-treated children obtained a significant improvement of symptoms and a reduction of drug use, whereas children treated with a drug alone did not obtained any change. IL-10 significantly increased, whereas Th2-dependent and pro-inflammatory cytokines significantly decreased. In conclusion, the present study demonstrates that 2-year SLIT is capable of inducing immunologic hyporeactivity to mites.

  20. Recommended immunization schedule for children and adolescents: Immunization Guideline (8th edition) released by the Korean Pediatric Society in 2015

    PubMed Central

    Kim, Jong-Hyun; Choi, Eun Hwa; Park, Su Eun; Kim, Yae-Jean; Jo, Dae Sun; Kim, Yun-Kyung; Eun, Byung-Wook; Lee, Jina; Lee, Soo-Young; Lee, Hyunju; Kim, Ki Hwan


    This report includes the recommended immunization schedule table for children and adolescents based on the 8th (2015) and revised 7th (2012) Immunization Guidelines released by the Committee on Infectious Diseases of the Korean Pediatric Society (KPS). Notable revised recommendations include: reorganization of the immunization table with a list of vaccines on the vertical axis and the corresponding age on the horizontal axis; reflecting the inclusion of Haemophilus influenzae type b vaccine, pneumococcal conjugate vaccine, and hepatitis A vaccine into the National Immunization Program since 2012; addition of general recommendations for 2 new Japanese encephalitis (JE) vaccines and their interchangeability with existing JE vaccines; addition of general recommendations for quadrivalent meningococcal conjugate vaccines and scope of the recommended targets for vaccination; and emphasizing catch-up immunization of Tdap vaccine. Detailed recommendations for each vaccine may be obtained from the full KPS 8th Immunization Guidelines. PMID:28194210

  1. Monitoring the Immune Competence of Cancer Patients to Predict Outcome

    PubMed Central

    Chang, Serena; Kohrt, Holbrook; Maecker, Holden T.


    A new era of cancer immunotherapy has brought not only successful cancer vaccines but also immunomodulators, such as those that target checkpoint blockade in order to induce endogenous host immune responses. However, the immune system of cancer patients can be compromised through multiple means, including immune suppression by the tumor and by prior therapies such as chemotherapy and radiation. Therefore, a comprehensive means of assessing patient immunocompetence would seem helpful for determining whether patients are ready to benefit from immunotherapy, and perhaps even which immunotherapy might be most appropriate for them. Unfortunately, there are no standardized tests for immune competence, nor is there agreement on what to measure and what will be predictive of outcome. In this review, we will discuss the technologies and assays that might be most useful for this purpose. We argue for a comprehensive approach that should maximize the chances of developing predictive biomarkers for eventual clinical use. PMID:24487923

  2. Immunization Services for Adolescents within Comprehensive School Health Programs.

    ERIC Educational Resources Information Center

    Vernon, Mary E.; Bryan, Gloria; Hunt, Pete; Allensworth, Diane; Bradley, Beverly


    Discusses school health services, adolescent immunization, current school immunization practices, and support for school-based immunization programs. Children and adolescents can receive preventive health services, including immunizations and monitoring of immunization levels. Expanding school health services could improve the immunization levels…

  3. Proteomic Mapping of the Immune Response to Gluten in Children with Autism

    DTIC Science & Technology


    AWARD NUMBER: W81XWH-14-1-0293 TITLE: Proteomic Mapping of the Immune Response to Gluten in Children with Autism PRINCIPAL INVESTIGATOR...Sep 2014 – 29 Sep 2015 4. TITLE AND SUBTITLE Proteomic Mapping of the Immune Response to Gluten in Children with Autism 5a. CONTRACT NUMBER 5b. GRANT...gastrointestinal (GI) symptoms and defects in GI function in the context of autism . Our newly published data indicate that children with autism exhibit

  4. Microarray analysis for a comprehensive immunological-status evaluation during cancer vaccine immune monitoring.


    Monsurrò, Vladia; Marincola, Francesco M


    Anticancer immune responses can be enhanced by immune intervention that promotes complex biological mechanisms involving several cellular populations. The classical immune monitoring for biological-based cancer clinical trials is often based on single-cell analysis. However, the overall effect could be lost by such a reductionist approach explaining the lack of correlation among clinical and immunological endpoints often reported. Microarray technology could give the possibility of studying in a multiparametric setting the immune therapy effects. The application of microarray is leading to an improved understanding of the immune responses to tumor immunotherapy. In fact, analysis of cancer vaccine-induced host responses using microarrays is proposed as valuable alternative to the standard cell-based methods. This paper shows successful examples of how high-throughput gene expression profiling contributed to the understanding of anticancer immune responses during biological therapy, introducing as well the integrative platforms that allow the network analysis in molecular biology studies.

  5. Heterogeneity of humoral immune abnormalities in children with Nijmegen breakage syndrome: an 8-year follow-up study in a single centre.


    Gregorek, H; Chrzanowska, K H; Michałkiewicz, J; Syczewska, M; Madaliński, K


    During an 8-year period of observation, defects of immune responses were characterized and monitored in 40 of 50 Polish children with Nijmegen breakage syndrome referred to the Children's Memorial Health Institute in Warsaw. The following parameters were determined at diagnosis: (1) concentrations of serum IgM, IgG, IgA; (2) concentrations of IgG subclasses; and (3) lymphocyte subpopulations. In addition, naturally acquired specific antibodies against Streptococcus pneumoniae were determined in 20 patients with a history of recurrent respiratory infections. During follow-up, total serum immunoglobulins and IgG subclasses were monitored systematically in 17 patients who did not receive immunomodulatory therapy. Moreover, anti-HBs antibody response was measured after vaccination of 20 children against HBV. We found that the immune deficiency in NBS is profound, highly variable, with a tendency to progress over time. Systematic monitoring of the humoral response, despite good clinical condition, is essential for early medical intervention.

  6. Role of platelet function and platelet membrane glycoproteins in children with primary immune thrombocytopenia

    PubMed Central

    Liu, Wen-Jun; Bai, Jing; Guo, Qu-Lian; Huang, Zhe; Yang, Hong; Bai, Yong-Qi


    The aim of the present study was to examine and understand changes in platelet functions prior to and after the treatment of primary immune thrombocytopenia (ITP) in children. An automatic hematology analyzer and whole blood flow cytometry were used to detect immature platelet fraction (IPF), IPC and membrane glycoproteins (CD62p, PAC-1 and CD42b) in ITP children (ITP group), children with complete response after ITP treatment (ITP-CR group) and children with elective surgery (normal control group). The results showed that, levels of platelet count (PLT) and plateletcrit in the ITP group were lower alhtough the levels of mean platelet volume, platelet distribution width and platelet-large cell ratio (P-LCR) were higher than those in the normal control and ITP-CR groups. PLT in the ITP-CR group was lower than that in the normal controls. Additionally, IPF% was higher in the normal control and ITP-CR groups, IPC was lower in the ITP group compared to the normal control and ITP-CR groups. Furthermore, prior to ADP activation, the expression levels of CD62p, PAC-1 and CD42b in the ITP group were lower in ITP group than those in the normal control and ITP-CR groups. The expression level of PAC-1 was lower in the ITP-CR and normal control groups. No differences were identified in CD62p and CD42b expression levels. Following ATP activation, CD62p, PAC-1 and CD42b expression in the ITP group was lower than that in the normal control and ITP-CR groups. PAC-1 expression was lower while CD62p expression was higher in the ITP-CR group compared to the normal control group. In conclusion, the activation of platelets in ITP children was low. Decreased platelet function, platelet parameters and platelet glycoproteins may be used as markers for monitoring the treatment efficacy in ITP children. PMID:27431926

  7. [Experimental research on the electromagnetic radiation immunity of a kind of portable monitor].


    Yuan, Jun; Xiao, Dongping; Jian, Xin


    The paper is focused on a kind of portable monitor that is widely used in military hospitals. In order to study the electromagnetic radiation immunity of the monitor, the experiments of electromagnetic radiation caused by radio frequency continuous wave in reverberation chamber and by ultra wide band (UWB) electromagnetic pulse have been done. The study results show that UWB electromagnetic pulse interferes observably the operating state of the monitor. It should be paid high attention to take protective measures. The monitor tested has some electromagnetic immunity ability for radio frequency continuous wave radiation. The frequent abnormal phenomena are baseline drift and waveform distortion. The electromagnetic sensitivity of the monitor is related to the frequency of interference source. The monitor tested is most sensitive to the frequency of 390 MHz.

  8. Heart Rate Monitors Promote Physical Education for Children

    ERIC Educational Resources Information Center

    Tipton, Jan; Sander, Allan N.


    National health and fitness data suggests that a significant percentage of children are not on a pathway to leading healthy, physically active lifestyles. Many children are leading sedentary lifestyles due to a lack of opportunity, success, or self-motivation in physical activity. Programs that highlight the use of heart rate monitors offer a…

  9. Comprehension Monitoring in Normal and Language-Impaired Children.

    ERIC Educational Resources Information Center

    Dollaghan, Christine A.


    The article reviews the literature on metacomprehension, offers a model of the process of comprehension monitoring, and suggests guidelines for assessment and intervention with language-disordered children such as controlling the complexity of monitoring tasks by manipulating message and listener variables. (DB)

  10. How Focus at Encoding Affects Children's Source Monitoring

    ERIC Educational Resources Information Center

    Crawley, Stacie L.; Newcombe, Nora S.; Bingman, Hannah


    Retention of source information is enhanced by focus on speakers' feelings about statements even though recognition is reduced for both adults and children. However, does any focus on another person lead to enhanced source monitoring, or is a particular kind of focus required? Does other-focus enhance source monitoring, or does self-focus detract…

  11. Advisory Committee on Immunization Practices Recommended Immunization Schedule for Children and Adolescents Aged 18 Years or Younger - United States, 2017.


    Robinson, Candice L; Romero, José R; Kempe, Allison; Pellegrini, Cynthia


    In October 2016, the Advisory Committee on Immunization Practices (ACIP) approved the Recommended Immunization Schedule for Children and Adolescents Aged 18 Years or Younger-United States, 2017. The 2017 child and adolescent immunization schedule summarizes ACIP recommendations, including several changes from the 2016 immunization schedules, in three figures, and footnotes for the figures. These documents can be found on the CDC immunization schedule website ( These immunization schedules are approved by ACIP (, the American Academy of Pediatrics (, the American Academy of Family Physicians (, and the American College of Obstetricians and Gynecologists ( Health care providers are advised to use the figures and the combined footnotes together. The full ACIP recommendations for each vaccine, including contraindications and precautions, can be found at Providers should be aware that changes in recommendations for specific vaccines can occur between annual updates to the childhood/adolescent immunization schedules. If errors or omissions are discovered within the child and adolescent schedule, CDC posts revised versions on the CDC immunization schedule website.

  12. Evaluation of a Social Marketing Campaign to Increase Awareness of Immunizations for Urban Low-Income Children

    PubMed Central

    Ngui, Emmanuel M.; Hamilton, Chelsea; Nugent, Melodee; Simpson, Pippa; Willis, Earnestine


    Objective To assess community awareness of childhood immunizations and intent to immunize children after a social marketing immunization campaign. Methods We used 2 interviewer-assisted street-intercept surveys to evaluate awareness of childhood immunizations and intent to immunize low-income children. The “Take Control! Immunize” social marketing campaign was developed using a community-based participatory research approach and used billboards, flyers, and various “walking billboard” (eg, backpacks, pens) to deliver immunization messages in the community settings. Results Over 85% of community members recalled the “Take Control! Immunize” message. Almost half of those who saw the immunization message indicated that the message motivated them to act, including getting their children immunized or calling their physician to inquire about their children's immunizations status. All respondents indicated that immunizations were important for children and that they were likely or very likely to immunize their children. Respondents who reported that “Take Control!” messages motivated them to act in the first intercept survey were significantly more likely than those in the second intercept to report being likely or very likely to immunize their children. Conclusion Culturally appropriate social marketing immunization messages in targeted urban settings can increase parental awareness and behavioral intention to immunize children. PMID:25845130

  13. [Immunization for children travelling to the tropics: neglected vaccines].


    Imbert, P; Guérin, N; Sorge, F


    Each year hundreds of thousands of children leave France to travel to developing countries where they are exposed to infectious agents that can be prevented by vaccination. During the child's pre-travel check-up, practitioners should check that all mandatory immunizations are up-to-date and provide advice on relevant vaccines in function of the epidemiological situation at the chosen destination. However various factors hinder full compliance with this approach and some vaccines are underused. Underused vaccines are referred to as neglected vaccines. In the French vaccination schedule three vaccinations can be considered as neglected. The first is the hepatitis B vaccine that has a low coverage level in France due to strong reluctance to its use despite the fact that the virus is widespread in tropical areas. The second is pneumococcal vaccine that should be administered to all infants less than 2 years of age, especially for travel to areas where pneumonia and meningitis are frequent. The third is BCG vaccine that is now at greater risk of being neglected in child travellers because its use has been downgraded from a general requirement to a recommendation only for children at risk. A serious limitation on the use of travel vaccinations is cost that can lead families to neglect some infectious risk such as hepatitis A that is a major risk for child travellers as well as for their relatives during or after the trip and typhoid fever that is essentially an imported disease. Rabies vaccine is also underused due to its cost and to poor understanding of the risk by many practitioners and families. The purpose of this article is to underline the need to improve information and access to vaccines that are all too often neglected in child travellers.

  14. Validation of assays to monitor immune responses in the Syrian golden hamster (Mesocricetus auratus).


    Zivcec, Marko; Safronetz, David; Haddock, Elaine; Feldmann, Heinz; Ebihara, Hideki


    The Syrian golden hamster (Mesocricetus auratus) is a valuable but under-utilized animal model for studies of human viral pathogens such as bunyaviruses, arenaviruses, flaviviruses, henipaviruses, and SARS-coronavirus. A lack of suitable reagents and specific assays for monitoring host responses has limited the use of this animal model to clinical observations, pathology and humoral immune responses. The objective of this study was to establish and validate assays to monitor host immune responses in the hamster including important pro-inflammatory, anti-inflammatory and innate immune responses, as well as markers of apoptosis, cell proliferation, cell junction integrity and coagulation. Commercially available mouse and rat ELISA and luminex panels were screened for potential cross-reactivity, but were found to be of limited value for studying host responses in hamsters. Subsequently, quantitative reverse transcriptase polymerase chain reaction (qRT-PCR) assays for the detection of 51 immune-related and four internal reference genes were developed. To validate the immune-related assays, hamsters were infected with vesicular stomatitis virus (VSV), Indiana species, or treated with lipopolysaccharide (LPS) and host immune responses were monitored in selected organs. Ribosomal protein L18 was identified as the most stable internal reference gene. In conclusion, these new assays will greatly improve the use of the hamster as an important small animal model in infectious disease research.

  15. [Immune monitoring in SIRS and sepsis based on the PIRO model].


    Meisel, C; Höflich, C; Volk, H-D


    Sepsis is a life-threatening disease characterized by a complex interaction between pathogens and the immune system. The analysis of immune parameters in patients with sepsis or at risk for sepsis may help to identify predisposing factors and infection-specific reaction patterns, as well as to monitor the current functional state of the immune system. This may lead to personalized therapeutic strategies for improving outcome in sepsis. Based on the PIRO model (predisposition, insult, response, organ dysfunction), a pathophysiologically-oriented concept for the development of a new sepsis classification, this article reviews currently used and new parameters for immunomonitoring in SIRS (systemic inflammatory response syndrome) and sepsis.

  16. Immunization Uptake in Younger Siblings of Children with Autism Spectrum Disorder

    ERIC Educational Resources Information Center

    Kuwaik, Ghassan Abu; Roberts, Wendy; Zwaigenbaum, Lonnie; Bryson, Susan; Smith, Isabel M.; Szatmari, Peter; Modi, Bonnie M.; Tanel, Nadia; Brian, Jessica


    Background: Parental concerns persist that immunization increases the risk of autism spectrum disorder, resulting in the potential for reduced uptake by parents of younger siblings of children with autism spectrum disorder ("younger sibs"). Objective: To compare immunization uptake by parents for their younger child relative to their…

  17. Evaluation of an Intervention Program to Increase Immunization Compliance among School Children

    ERIC Educational Resources Information Center

    Luthy, Karlen E.; Thorpe, Aubrey; Dymock, Leah Clark; Connely, Samantha


    State immunization laws necessitate compliance for students enrolling in a public or private school system. In support of state laws, school nurses expend hours to achieve immunization compliance with school-age children. For the purpose of creating a more efficient system, researchers implemented an educational and incentive program in local…

  18. [Characteristics of the clinical and immunologic safety of inactivated influenza vaccines in children undergoing multiple immunizations].


    Vasil'eva, R I; Merkur'eva, L A; Iatsenko, V G; Vasil'eva, A M; Shvager, M M


    In a strictly controlled epidemiological trial on 12,643 school children aged 11-14 years the reactogenic properties and safety of killed influenza chromatographic vaccine under the conditions of multiple immunization were studied. A single immunization dose of the vaccine (0.2 ml) contained the hemagglutinins of influenza viruses A/Philippines/82 (H3N3) and A/Kiev/59/79 (H1N1), 3.5 micrograms each. The preparation was introduced by means of a jet injector. The vaccine was shown to be clinically and immunologically safe under the conditions of the regular multiple immunization of children over the period of 4 years.

  19. Immunization of children at risk of infection with human immunodeficiency virus.

    PubMed Central

    Moss, William J.; Clements, C. John; Halsey, Neal A.


    This paper reviews the English language literature on the safety, immunogenicity and effectiveness in children infected with the human immunodeficiency virus (HIV) of vaccines currently recommended by WHO for use in national immunization programmes. Immunization is generally safe and beneficial for children infected with HIV, although HIV-induced immune suppression reduces the benefit compared with that obtained in HIV-uninfected children. However, serious complications can occur following immunization of severely immunocompromised children with bacillus Calmette-Gu rin (BCG) vaccine. The risk of serious complications attributable to yellow fever vaccine in HIV-infected persons has not been determined. WHO guidelines for immunizing children with HIV infection and infants born to HIV-infected women differ only slightly from the general guidelines. BCG and yellow fever vaccines should be withheld from symptomatic HIV-infected children. Only one serious complication (fatal pneumonia) has been attributed to measles vaccine administered to a severely immunocompromised adult. Although two HIV-infected infants have developed vaccine-associated paralytic poliomyelitis, several million infected children have been vaccinated and the evidence does not suggest that there is an increased risk. The benefits of measles and poliovirus vaccines far outweigh the potential risks in HIV-infected children. The policy of administering routine vaccines to all children, regardless of possible HIV exposure, has been very effective in obtaining high immunization coverage and control of preventable diseases. Any changes in this policy would have to be carefully examined for a potential negative impact on disease control programmes in many countries. PMID:12640478

  20. Children's comprehension monitoring of multiple situational dimensions of a narrative.


    Wassenburg, Stephanie I; Beker, Katinka; van den Broek, Paul; van der Schoot, Menno

    Narratives typically consist of information on multiple aspects of a situation. In order to successfully create a coherent representation of the described situation, readers are required to monitor all these situational dimensions during reading. However, little is known about whether these dimensions differ in the ease with which they can be monitored. In the present study, we examined whether children in Grades 4 and 6 monitor four different dimensions (i.e., emotion, causation, time, and space) during reading, using a self-paced reading task containing inconsistencies. Furthermore, to explore what causes failure in inconsistency detection, we differentiated between monitoring processes related to availability and validation of information by manipulating the distance between two pieces of conflicting information. The results indicated that the monitoring processes varied as a function of dimension. Children were able to validate emotional and causal information when it was still active in working memory, but this was not the case for temporal and spatial information. When context and target information were more distant from each other, only emotionally charged information remained available for further monitoring processes. These findings show that the influence of different situational dimensions should be taken into account when studying children's reading comprehension.

  1. Comparative assessment of immunization coverage of migrant children between national immunization program vaccines and non-national immunization program vaccines in East China.


    Hu, Yu; Luo, Shuying; Tang, Xuewen; Lou, Linqiao; Chen, Yaping; Guo, Jing


    This study aimed to describe the disparities in immunization coverage between National Immunization Program (NIP) vaccines and non-NIP vaccines in Yiwu and to identify potential determinants. A face-to-face interview-based questionnaire survey among 423 migrant children born from 1 June 2010 to 31 May 2013 was conducted. Immunization coverage was estimated according to the vaccines scheduled at different age, the birth cohorts, and socio- demographic characteristics. Single-level logistic regression analysis was applied to identify the determinants of coverage of non-NIP vaccines. We found that NIP vaccines recorded higher immunization coverage compared with non-NIP vaccines (87.9100%- vs 0%-74.8%). Among the non-NIP vaccines, varicella vaccine (VarV) recorded the highest coverage of 85.4%, which was introduced in 1998; while 7-valent pneumococcal conjugate vaccine(PCV7) recorded the lowest coverage of 0% for primary series, which was introduced recently. Lower coverage rate of non-NIP vaccines was significantly associated with more siblings in household, shorter duration of living in the surveyed areas, lower family income, mother with a job, mother with poor awareness of vaccination, and mother with lower education level. We found the immunization coverage rate of non-NIP vaccines was significant lower than that of NIP vaccines. Expansion of NIP to include non-NIP vaccines can provide better protection against the vaccine preventable diseases through increased immunization coverage.

  2. Comparative assessment of immunization coverage of migrant children between national immunization program vaccines and non-national immunization program vaccines in East China

    PubMed Central

    Hu, Yu; Luo, Shuying; Tang, Xuewen; Lou, Linqiao; Chen, Yaping; Guo, Jing


    This study aimed to describe the disparities in immunization coverage between National Immunization Program (NIP) vaccines and non-NIP vaccines in Yiwu and to identify potential determinants. A face-to-face interview-based questionnaire survey among 423 migrant children born from 1 June 2010 to 31 May 2013 was conducted. Immunization coverage was estimated according to the vaccines scheduled at different age, the birth cohorts, and socio- demographic characteristics. Single-level logistic regression analysis was applied to identify the determinants of coverage of non-NIP vaccines. We found that NIP vaccines recorded higher immunization coverage compared with non-NIP vaccines (87.9100%– vs 0%-74.8%). Among the non-NIP vaccines, varicella vaccine (VarV) recorded the highest coverage of 85.4%, which was introduced in 1998; while 7-valent pneumococcal conjugate vaccine(PCV7) recorded the lowest coverage of 0% for primary series, which was introduced recently. Lower coverage rate of non-NIP vaccines was significantly associated with more siblings in household, shorter duration of living in the surveyed areas, lower family income, mother with a job, mother with poor awareness of vaccination, and mother with lower education level. We found the immunization coverage rate of non-NIP vaccines was significant lower than that of NIP vaccines. Expansion of NIP to include non-NIP vaccines can provide better protection against the vaccine preventable diseases through increased immunization coverage. PMID:25760670

  3. Immune Monitoring in Cancer Vaccine Clinical Trials: Critical Issues of Functional Flow Cytometry-Based Assays

    PubMed Central

    Urbani, Francesca; Proietti, Enrico


    The development of immune monitoring assays is essential to determine the immune responses against tumor-specific antigens (TSAs) and tumor-associated antigens (TAAs) and their possible correlation with clinical outcome in cancer patients receiving immunotherapies. Despite the wide range of techniques used, to date these assays have not shown consistent results among clinical trials and failed to define surrogate markers of clinical efficacy to antitumor vaccines. Multiparameter flow cytometry- (FCM-) based assays combining different phenotypic and functional markers have been developed in the past decade for informative and longitudinal analysis of polyfunctional T-cells. These technologies were designed to address the complexity and functional heterogeneity of cancer biology and cellular immunity and to define biomarkers predicting clinical response to anticancer treatment. So far, there is still a lack of standardization of some of these immunological tests. The aim of this review is to overview the latest technologies for immune monitoring and to highlight critical steps involved in some of the FCM-based cellular immune assays. In particular, our laboratory is focused on melanoma vaccine research and thus our main goal was the validation of a functional multiparameter test (FMT) combining different functional and lineage markers to be applied in clinical trials involving patients with melanoma. PMID:24195078

  4. Audiovisual Vowel Monitoring and the Word Superiority Effect in Children

    ERIC Educational Resources Information Center

    Fort, Mathilde; Spinelli, Elsa; Savariaux, Christophe; Kandel, Sonia


    The goal of this study was to explore whether viewing the speaker's articulatory gestures contributes to lexical access in children (ages 5-10) and in adults. We conducted a vowel monitoring task with words and pseudo-words in audio-only (AO) and audiovisual (AV) contexts with white noise masking the acoustic signal. The results indicated that…

  5. The clinician's guide on monitoring children with asthma.


    Brand, Paul L P


    Based on a review of the evidence on the usefulness of monitoring disease outcome parameters in childhood asthma and the author's 20-yr clinical experience in managing childhood asthma, this article provides the clinician with up-to-date recommendations on how to monitor childhood asthma in everyday clinical practice. Monitoring should be focused on patient-centered outcomes, such as exacerbations and impact on sports and play. Composite asthma control measures, although reasonably validated, do not take exacerbations into account and have a short recall window, limiting their usefulness as a routine monitoring tool in clinical practice. Lung function, airways hyperresponsiveness, exhaled nitric oxide, and inflammatory markers in sputum are surrogate end points, of little if any interest to patients. There is no evidence to support their use as a monitoring tool in clinical practice; office spirometry may be used as additional information. Rather than monitoring surrogate end points, clinicians should focus on showing a genuine interest in the impact of asthma on children's daily lives, and building and maintaining a partnership by monitoring those characteristics of asthma which have the biggest impact on children (exacerbations and limitations in sports and play), and adjusting treatment accordingly.

  6. Early clearance of Chikungunya virus in children is associated with a strong innate immune response.


    Simarmata, Diane; Ng, David Chun Ern; Kam, Yiu-Wing; Lee, Bernett; Sum, Magdline Sia Henry; Her, Zhisheng; Chow, Angela; Leo, Yee-Sin; Cardosa, Jane; Perera, David; Ooi, Mong H; Ng, Lisa F P


    Chikungunya fever (CHIKF) is a global infectious disease which can affect a wide range of age groups. The pathological and immunological response upon Chikungunya virus (CHIKV) infection have been reported over the last few years. However, the clinical profile and immune response upon CHIKV infection in children remain largely unknown. In this study, we analyzed the clinical and immunological response, focusing on the cytokine/chemokine profile in a CHIKV-infected pediatric cohort from Sarawak, Malaysia. Unique immune mediators triggered upon CHIKV infection were identified through meta-analysis of the immune signatures between this pediatric group and cohorts from previous outbreaks. The data generated from this study revealed that a broad spectrum of cytokines/chemokines is up-regulated in a sub-group of virus-infected children stratified according to their viremic status during hospitalization. Furthermore, different immune mediator profiles (the levels of pro-inflammatory cytokines, chemokines and growth and other factors) were observed between children and adults. This study gives an important insight to understand the immune response of CHIKV infection in children and would aid in the development of better prognostics and clinical management for children.

  7. Early clearance of Chikungunya virus in children is associated with a strong innate immune response

    PubMed Central

    Simarmata, Diane; Ng, David Chun Ern; Kam, Yiu-Wing; Lee, Bernett; Sum, Magdline Sia Henry; Her, Zhisheng; Chow, Angela; Leo, Yee-Sin; Cardosa, Jane; Perera, David; Ooi, Mong H.; Ng, Lisa F. P.


    Chikungunya fever (CHIKF) is a global infectious disease which can affect a wide range of age groups. The pathological and immunological response upon Chikungunya virus (CHIKV) infection have been reported over the last few years. However, the clinical profile and immune response upon CHIKV infection in children remain largely unknown. In this study, we analyzed the clinical and immunological response, focusing on the cytokine/chemokine profile in a CHIKV-infected pediatric cohort from Sarawak, Malaysia. Unique immune mediators triggered upon CHIKV infection were identified through meta-analysis of the immune signatures between this pediatric group and cohorts from previous outbreaks. The data generated from this study revealed that a broad spectrum of cytokines/chemokines is up-regulated in a sub-group of virus-infected children stratified according to their viremic status during hospitalization. Furthermore, different immune mediator profiles (the levels of pro-inflammatory cytokines, chemokines and growth and other factors) were observed between children and adults. This study gives an important insight to understand the immune response of CHIKV infection in children and would aid in the development of better prognostics and clinical management for children. PMID:27180811

  8. Malnutrition and infectious disease morbidity among children missed by the childhood immunization program in Indonesia.


    Semba, Richard D; de Pee, Saskia; Berger, Sarah G; Martini, Elviyanti; Ricks, Michelle O; Bloem, Martin W


    Although it has been thought that child immunization programs may miss the children who are in greatest need, there are little published quantitative data to support this idea. We sought to characterize malnutrition and morbidity among children who are missed by the childhood immunization program in Indonesia. Vaccination and morbidity histories, anthropometry, and other data were collected for 286,500 children, aged 12-59 months, in rural Indonesia. Seventy-three point nine percent of children received complete immunizations (3 doses of diphtheria-pertussis-tetanus, 3 doses of oral poliovirus, and measles), 16.8% had partial coverage (1-6 of 7 vaccine doses), and 9.3% received no vaccines. Of children with complete, partial, and no immunization coverage, respectively, the prevalence of severe underweight (weight-for-age Z score < -3) was 5.4, 9.9, and 12.6%, severe stunting (height-for-age Z score < -3) was 10.2, 16.2, and 21.5%, and current diarrhea was 3.8, 7.3, and 8.6% (all p < 0.0001), respectively. In families where the child had complete, partial, and no immunizations, the history of infant mortality was 6.4, 11.4, and 16.5%, and under-five child mortality was 7.3, 13.4, and 19.2% (both p < 0.0001). Expanded programmatic coverage is needed to reach children who are missed by childhood immunizations in rural Indonesia, as missed children are at higher risk of morbidity and mortality.

  9. Immunizations


    ... Get Weight Loss Surgery? A Week of Healthy Breakfasts Shyness Immunizations KidsHealth > For Teens > Immunizations Print A A A What's in this article? Why Are Vaccinations Important? Why Do I Need Shots? Which Vaccinations Do ...

  10. Hepatitis in children with acquired immune deficiency syndrome. Histopathologic and immunocytologic features.


    Duffy, L F; Daum, F; Kahn, E; Teichberg, S; Pahwa, R; Fagin, J; Kenigsberg, K; Kaplan, M; Fisher, S E; Pahwa, S


    Hepatic morphology and immunocytology were evaluated in 4 children with clinical and immunologic characteristics of the acquired immune deficiency syndrome or acquired immune deficiency syndrome related complex. All 4 children had hepatomegaly and increased serum alanine and aspartate aminotransferase activity. Both lobular and portal changes were noted. Lymphocytic infiltration, piecemeal necrosis, hepatocellular and bile duct damage, sinusoidal cell hyperplasia, and endothelialitis were prominent. Vesicular rosettes in sinusoidal lymphocytes and tubuloreticular structures in sinusoidal endothelial cells were demonstrated by electron microscopy. The lymphocytic infiltrate in both the lobular and portal spaces was characterized by a relative increase of cytotoxic/suppressor (T8) cells. Hepatitis may be a common feature of pediatric acquired immune deficiency syndrome and acquired immune deficiency syndrome-related complex. Although the histopathologic changes are consistent with chronic active hepatitis, the specific pathogenesis remains to be determined.

  11. Immune function biomarker QuantiFERON-monitor is associated with infection risk in cirrhotic patients

    PubMed Central

    Sood, Siddharth; Yu, Lijia; Visvanathan, Kumar; Angus, Peter William; Gow, Paul John; Testro, Adam Gareth


    AIM To investigate whether a novel immune function biomarker QuantiFERON-Monitor (QFM) can identify cirrhotic patients at greatest risk of infection. METHODS Adult cirrhotic patients on the liver transplant waiting list were recruited for this observational cohort study from a tertiary liver transplant referral unit. The immune function biomarker, QFM was performed using the same method as the widely available Quantiferon-gold assay, and measures output in interferon gamma in IU/mL after dual stimulation of the innate and adaptive immune systems. Ninety-one cirrhotic patients were recruited, with 47 (52%) transplanted on the day of their QFM. The remaining 44 (48%) were monitored for infections until transplant, death, or census date of 1st February 2014. RESULTS Cirrhotic patients express a median QFM significantly lower than healthy controls (94.5 IU/mL vs 423 IU/mL), demonstrating that they are severely immunosuppressed. Several factors including model for end stage liver disease, presence of hepatocellular carcinoma, bilirubin, international normalized ratio and haemoglobin were associated with QFM on univariate analysis. Disease aetiology did not appear to impact QFM. On multivariate analysis, only Child-Pugh score and urea were significantly associated with a patient’s immune function as objectively measured by QFM. In the 44 patients who were not transplanted immediately after their blood test and could be monitored for subsequent infection risk, 13 (29.5%) experienced a pre-transplant infection a median 20 d (range 2-182) post-test. QFM < 214 IU/mL was associated with HR = 4.1 (P = 0.01) for infection. A very low QFM < 30 IU/mL was significantly associated (P = 0.003) with death in three patients who died while awaiting transplantation (HR = 56.6). CONCLUSION QFM is lower in cirrhotics, allowing objective determinations of an individual’s unique level of immune dysfunction. Low QFM was associated with increased susceptibility to infection. PMID:28050238

  12. Cellular immune activation in children with acute dengue virus infections is modulated by apoptosis.


    Myint, Khin S; Endy, Timothy P; Mongkolsirichaikul, Duangrat; Manomuth, Choompun; Kalayanarooj, Siripen; Vaughn, David W; Nisalak, Ananda; Green, Sharone; Rothman, Alan L; Ennis, Francis A; Libraty, Daniel H


    Apoptosis is an important modulator of cellular immune responses during systemic viral infections. Peripheral-blood mononuclear cell (PBMC) apoptosis and plasma soluble levels of CD95, a mediator of apoptosis, were determined in sequential samples from children participating in a prospective study of dengue virus (DV) infections. During the period of defervescence, levels of PBMC apoptosis were higher in children developing dengue hemorrhagic fever (DHF), the most severe form of illness, than in those with dengue fever (DF) and other, nondengue, febrile illnesses. CD8(+) T lymphocytes made up approximately half of the peak circulating apoptotic PBMCs in DHF and DF. Maximum plasma levels of soluble CD95 were also higher in children with DHF than in those with DF. The level of PBMC apoptosis correlated with dengue disease severity. Apoptosis appears to be involved in modulation of the innate and adaptive immune responses to DV infection and is likely involved in the evolution of immune responses in other viral hemorrhagic fevers.

  13. Monitoring of health care personnel employee and occupational health immunization program practices in the United States.


    Carrico, Ruth M; Sorrells, Nikka; Westhusing, Kelly; Wiemken, Timothy


    Recent studies have identified concerns with various elements of health care personnel immunization programs, including the handling and management of the vaccine. The purpose of this study was to assess monitoring processes that support evaluation of the care of vaccines in health care settings. An 11-question survey instrument was developed for use in scripted telephone surveys. State health departments in all 50 states in the United States and the District of Columbia were the target audience for the surveys. Data from a total of 47 states were obtained and analyzed. No states reported an existing monitoring process for evaluation of health care personnel immunization programs in their states. Our assessment indicates that vaccine evaluation processes for health care facilities are rare to nonexistent in the United States. Identifying existing practice gaps and resultant opportunities for improvements may be an important safety initiative that protects patients and health care personnel.

  14. Rotavirus-associated immune thrombocytopenic purpura in children: A retrospective study.


    Ai, Qi; Yin, Jing; Chen, Sen; Qiao, Lijin; Luo, Na


    Certain studies have previously indicated that an association may exist between rotavirus infection and primary immune thrombocytopenic purpura (ITP). The present retrospective study aimed to investigate whether rotavirus may cause ITP in children. Firstly, the incidence of ITP in children with or without rotavirus diarrhea was compared. A 14.58% incident rate was observed in children with rotavirus diarrhea compared with a 7.22% incident rate in children without rotavirus diarrhea. Subsequently, the clinical features of ITP children with or without rotavirus infection were compared. The results indicated that ITP children with rotavirus infection were significantly younger, showed significantly decreased mean platelet volume (MPV) levels and presented a significantly higher frequency of bleeding score of 3 against ITP children without rotavirus infection. In conclusion, these findings suggest that rotavirus serves a causative role in ITP.

  15. Five-year-old children's tuning-in and negotiation strategies in an immunization situation.


    Harder, Maria; Christensson, Kyllike; Coyne, Imelda; Söderbäck, Maja


    In this article, we have explored 5-year-old children's expressions when they as actors took part in an immunization situation in the Primary Child Health Care (PCHC) service in Sweden. Although children's health and development are the main concern in the PCHC service, their perspectives in such a setting have not been explored fully. To capture children's perspectives we used a hermeneutic design and video observations. The findings revealed children as competent and active participants, contributing to the construction of the PCHC situation in mutuality with the nurse and the parent. The conceptualization of children's expressions and actions revealed how they influenced and dealt with a PCHC situation by using strategies of tuning-in, affirmative negotiation, and delaying negotiation. Understanding children's actions will assist nurses to act with sensitivity when they encounter and support children.

  16. Delayed adaptive immunity is related to higher MMR vaccine-induced antibody titers in children.


    Strömbeck, Anna; Lundell, Anna-Carin; Nordström, Inger; Andersson, Kerstin; Adlerberth, Ingegerd; Wold, Agnes E; Rudin, Anna


    There are notable inter-individual variations in vaccine-specific antibody responses in vaccinated children. The aim of our study was to investigate whether early-life environmental factors and adaptive immune maturation prior and close to measles-mumps-rubella (MMR) immunization relate to magnitudes of vaccine-specific antibody titers. In the FARMFLORA birth cohort, including both farming and non-farming families, children were immunized with the MMR vaccine at 18 months of age. MMR vaccine-induced antibody titers were measured in plasma samples obtained at 36 months of age. Infants' blood samples obtained at birth, 3-5 days and at 4 and 18 months of age were analyzed for T- and B-cell numbers, proportions of naive and memory T and B cells, and fractions of putative regulatory T cells. Multivariate factor analyses show that higher anti-MMR antibody titers were associated with a lower degree of adaptive immune maturation, that is, lower proportions of memory T cells and a lower capacity of mononuclear cells to produce cytokines, but with higher proportions of putative regulatory T cells. Further, children born by cesarean section (CS) had significantly higher anti-measles titers than vaginally-born children; and CS was found to be associated with delayed adaptive immunity. Also, girls presented with significantly higher anti-mumps and anti-rubella antibody levels than boys at 36 months of age. These results indicate that delayed adaptive immune maturation before and in close proximity to immunization seems to be advantageous for the ability of children to respond with higher anti-MMR antibody levels after vaccination.

  17. Delayed adaptive immunity is related to higher MMR vaccine-induced antibody titers in children

    PubMed Central

    Strömbeck, Anna; Lundell, Anna-Carin; Nordström, Inger; Andersson, Kerstin; Adlerberth, Ingegerd; Wold, Agnes E; Rudin, Anna


    There are notable inter-individual variations in vaccine-specific antibody responses in vaccinated children. The aim of our study was to investigate whether early-life environmental factors and adaptive immune maturation prior and close to measles–mumps–rubella (MMR) immunization relate to magnitudes of vaccine-specific antibody titers. In the FARMFLORA birth cohort, including both farming and non-farming families, children were immunized with the MMR vaccine at 18 months of age. MMR vaccine-induced antibody titers were measured in plasma samples obtained at 36 months of age. Infants' blood samples obtained at birth, 3–5 days and at 4 and 18 months of age were analyzed for T- and B-cell numbers, proportions of naive and memory T and B cells, and fractions of putative regulatory T cells. Multivariate factor analyses show that higher anti-MMR antibody titers were associated with a lower degree of adaptive immune maturation, that is, lower proportions of memory T cells and a lower capacity of mononuclear cells to produce cytokines, but with higher proportions of putative regulatory T cells. Further, children born by cesarean section (CS) had significantly higher anti-measles titers than vaginally-born children; and CS was found to be associated with delayed adaptive immunity. Also, girls presented with significantly higher anti-mumps and anti-rubella antibody levels than boys at 36 months of age. These results indicate that delayed adaptive immune maturation before and in close proximity to immunization seems to be advantageous for the ability of children to respond with higher anti-MMR antibody levels after vaccination. PMID:27195118

  18. A vaccine study design selection framework for the postlicensure rapid immunization safety monitoring program.


    Baker, Meghan A; Lieu, Tracy A; Li, Lingling; Hua, Wei; Qiang, Yandong; Kawai, Alison Tse; Fireman, Bruce H; Martin, David B; Nguyen, Michael D


    The Postlicensure Rapid Immunization Safety Monitoring Program, the vaccination safety monitoring component of the US Food and Drug Administration's Mini-Sentinel project, is currently the largest cohort in the US general population for vaccine safety surveillance. We developed a study design selection framework to provide a roadmap and description of methods that may be utilized to evaluate potential associations between vaccines and health outcomes of interest in the Postlicensure Rapid Immunization Safety Monitoring Program and other systems using administrative data. The strengths and weaknesses of designs for vaccine safety monitoring, including the cohort design, the case-centered design, the risk interval design, the case-control design, the self-controlled risk interval design, the self-controlled case series method, and the case-crossover design, are described and summarized in tabular form. A structured decision table is provided to aid in planning of future vaccine safety monitoring activities, and the data components comprising the structured decision table are delineated. The study design selection framework provides a starting point for planning vaccine safety evaluations using claims-based data sources.

  19. Immune responses in children infected with the pinworm Enterobius vermicularis in central Greece.


    Patsantara, G G; Piperaki, E-T; Tzoumaka-Bakoula, C; Kanariou, M G


    Previous studies have suggested an immunomodulatory and even protective role for Enterobius vermicularis, the least pathogenic human intestinal helminth. Here, in a study using haematological and serological parameters, we tested a total of 215 children from central Greece, with a mean age of 8.39, of whom 105 (48.84%) were infected with E. vermicularis and 110 (51.16%) were matched healthy controls. In particular, we analysed eosinophil counts (EO), serum eosinophil cationic protein (ECP), total and specific serum immunoglobulin E (IgE) and the ECP/EO ratio. The atopic status and the potential occurrence of clinically expressed allergic diseases were both taken into account. Eosinophils, ECP and IgE were found to be higher in infected than in uninfected children, indicating a type-2 immune response activation during infection. Atopic infected children exhibited higher IgE levels compared to non-atopic ones. EO and ECP were found to be lower in atopic children who had a history of allergic disease than in those with no such history. The type-2 oriented immune response elicited against E. vermicularis could contribute to a balanced activation of the immune system in the examined children. Interestingly, although the atopic children showed a stronger activation, they did not exhibit any symptoms and, moreover, there seemed to be some indication of immunosuppression in those children with a positive history of allergic disease.

  20. Addressing the immunization coverage paradox: A matter of children's rights and social justice.


    Durrheim, David N; Cashman, Patrick


    The Convention on the Rights of the Child and the principles of social justice demand that all children have equal access to effective childhood immunization. Although there has been substantial progress in increasing global childhood immunization coverage, routinely reported data conceal marked disparities between and within countries. As a global community we still fall substantially short of our moral obligation to guarantee all children equal access to effective vaccines. Governments of developed and less-developed nations must unite to ensure the leadership planning, governance, and human and financial resources necessary to deliver on this critical global equity agenda.

  1. Immunity of PCB transplacental Yu-Cheng children in Taiwan

    SciTech Connect

    Lan, Shou Jen; Yen, Yea Yin; Chen, Eng Rin; Ko, Ying Chin ); Lan, Joung Liang )


    Up to now, there has been no studies about the immune status of PCB transplacental Yu-Cheng babies. In an earlier study, Yu-Cheng babies were reported to have a high infant mortality rate. It was reported that these babies would easily catch cold, experience diarrhea and abdominal pains. Recently, it was found that the bronchitis rate of Yu-Cheng babies is higher than in control babies. Because of high risk of infection, it is presumed that these babies might suffer immunosuppression to a certain extent. According to these findings, investigations into the immune functions of PCB transplacental Yu-Cheng babies are needed.

  2. Family Adversity and Autonomic Reactivity Association With Immune Changes in HIV-Affected School Children

    PubMed Central

    Thomas, Melanie; Wara, Diane; Saxton, Katherine; Truskier, Mary; Chesney, Margaret; Boyce, W. Thomas


    Objective To explore whether primary school entry is associated with changes in immune system parameters in HIV-affected children. HIV-affected children are vulnerable to psychosocial stressors, regardless of their own HIV serological status. Methods Data from 38 HIV+ and 29 HIV− children born to seropositive women were obtained before and after school entry. Measures included family adversity questionnaires, autonomic nervous system (ANS) reactivity (based on mean arterial responses to challenge tasks), and enumerative and functional changes in peripheral blood immune parameters. Results In comparison to children who were HIV−, children who were HIV+ at baseline had fewer CD4+ T lymphocytes (M = 916 vs. 1206 cells/mm3 × 103; F = 7.8, p = .007), more CD8+ cells (M = 1046 vs. 720 cells/mm3 ×103; F = 7.98, p = .006), and diminished NK cell cytotoxicity (M =−.29 vs. .41; F = 8.87, p = .004). School entry was associated with changes in immune parameters, but HIV status was not associated with the magnitude of changes. Changes in immune parameters following school entry were associated with family stress and pre school entry ANS reactivity. Highly ANS reactive children had either the greatest increase in CD8+ cells following school entry or the greatest decrease, depending upon reported levels of family adversity (B = 215.35; t = 3.74, p < .001). Changes in functional immune assays were significantly associated with the interactions between HIV status and ANS reactivity. Conclusions These results suggest that autonomic reactivity is associated with increased immunological sensitivity to adverse or challenging social contexts among children affected by HIV. PMID:23766380



    Ivanova, O N; Argunova, E F; Alekseev, S N; Ystugina, T V; Varfolomeev, A R; Troev, I P; Kononova, I V; Egorova, V E


    This article is devoted to the probleme of modern Pediatrics pathology of the immune system in children with complicated viral infections. The aim of this study was to investigate the immune and cytokine status in children with complicated acute respiratory viral infections. The study included 100 children are often ill respiratory virus infections (more than 8 times per year) from age 0 to 7 years, and 30 children with upper respiratory tract infection; no more than 1 time per year-the control group. The standards of indicators developed by the staff of Immunological laboratory Diagnostic center of the Ministry of health of Republic Sakha (Yakutia ) together with the Institute of health of the Republic Sakha (Yakutia). Statistical calculations made on the basis of applied programs "SAS"and "SPSS"In the analysis of contingency tables (estimates of the correlation of the characteristic and evaluation of significance of differences between groups) used the criterion of 2 (Pearson and likelihood ratio and Fisher's exact test. Comparison of mean values was performed univariate analysis of variance using T-student criterion for assessing the equality of mean F-Fisher test to assess equality of variance. Extreme climatic conditions ofthe far North have an impact on immunological mechanisms. In the analysis of changes ofthe immune status revealed the greatest decline in T-cell level and components of complement in children with complications of viral respiratory infections. In children with complicated respiratory viral infections reduced cellular immunity (CD3+, CD41, CD81, CD+, CD 22+). In children with complicated respiratory viral infections decrease levels ofcytokines (IFN-y FN0-d), indicating about the risk of the formation of complications of respiratory viral infections. As a result of drug therapy of broncho-vaxom marked improvement in immune status and the absence of recurrence of respiratory viral infections within the next 3 months after therapy.

  4. CINCH: an urban coalition for empowerment and action. Consortium for the Immunization of Norfolk's Children.


    Butterfoss, F D; Morrow, A L; Rosenthal, J; Dini, E; Crews, R C; Webster, J D; Louis, P


    CINCH (Consortium for the Immunization of Norfolk's Children) is an urban coalition that was developed in 1993 to improve childhood immunization rates in Norfolk, Virginia. CINCH involves diverse citizens and institutions in effective community-based assessment, planning, and action. A needs assessment from 1993 found that only 49% of Norfolk 2-year-olds were adequately immunized. Using this data, CINCH developed a plan focused on education and communication, support for at-risk families, increased access to immunizations, and improved immunization delivery. After federal funding ended in 1995, members voted to expand the scope of the coalition to address additional child health needs and to broaden the membership. CINCH is a model for a sustainable city-citizen learning environment that intervenes to "help families help themselves to better health." The coalition is presented as an organization that focuses on community empowerment and development. The stages of coalition development and implications for coalition implementation in other sites are discussed.

  5. Waning of vaccine-induced immunity to measles in kidney transplanted children.


    Rocca, Salvatore; Santilli, Veronica; Cotugno, Nicola; Concato, Carlo; Manno, Emma Concetta; Nocentini, Giulia; Macchiarulo, Giulia; Cancrini, Caterina; Finocchi, Andrea; Guzzo, Isabella; Dello Strologo, Luca; Palma, Paolo


    Vaccine-preventable diseases are a significant cause of morbidity and mortality in solid organ transplant recipients who undergo immunosuppression after transplantation. Data on immune responses and long-term maintenance after vaccinations in such population are still limited.We cross-sectionally evaluated the maintenance of immune response to measles vaccine in kidney transplanted children on immunosuppressive therapy. Measles-specific enzyme-linked immunosorbent assay and B-cell enzyme-linked immunosorbent spot were performed in 74 kidney transplant patients (Tps) and in 23 healthy controls (HCs) previously vaccinated and tested for humoral protection against measles. The quality of measles antibody response was measured by avidity test. B-cell phenotype, investigated via flow cytometry, was further correlated to the ability of Tps to maintain protective humoral responses to measles over time.We observed the loss of vaccine-induced immunity against measles in 19% of Tps. Nonseroprotected children showed signs of impaired B-cell distribution as well as immune senescence and lower antibody avidity. We further reported as time elapsed between vaccination and transplantation, as well as the vaccine administration during dialysis are clinical factors affecting the maintenance of the immune memory response against measles.Tps present both quantitative and qualitative alterations in the maintenance of protective immunity to measles vaccine. Prospective studies are needed to optimize the vaccination schedules in kidney transplant recipients in order to increase the immunization coverage over time in this population.

  6. Program on immunization and cold chain monitoring: the status in eight health districts in Cameroon

    PubMed Central


    Background Cold chain monitoring is a precondition to ensure immunization quality, efficacy and safety. In Cameroon, the Expanded Program on Immunization (EPI) has National Standard Operating Procedure (SOP) that describes the vaccines, the cold chain system and equipment, its use and recommended procedures to control and monitor the temperatures and the cold chain. This study was conducted to assess the status of cold chain in eight health districts in Cameroon. Findings The study was carried out in eight health districts out of fifty with poor immunization coverage rate. Data were collected using a validated form by observation and consultation of related documents. District Health Services (DHS) and four Integrated. Health Centers (IHC) randomly selected were targeted per health district. Forty health facilities were included. Twenty eight (70.0%) had at least one functional refrigerator for EPI activities. The power supply was reported to be permanent in 7 (20.6%) out of 34. (85.0%) health facilities with access to power supply. The temperature monitoring chart was pasted on 27 (96.4%) of the cold chain equipment. On 16 (59.3%) of these charts, the temperature was recorded twice daily as recommended. Seven (25.9%) of 27 refrigerators assessed had temperature out of the recommended range of 2 to 8°C. Almost 23.30% of health centers did not received any supervision on cold chain monitoring during a vaccination campaign. Conclusion This study documents failure of the cold chain maintenance and questions the efficacy and safety of vaccines administered during EPI activities in Cameroun. These findings indicate that appropriate actions are needed to ensure monitoring of EPI cold chain in the country. PMID:23497720

  7. The relationship between undernutrition and humoral immune status in children with pneumonia in Papua New Guinea.


    Cripps, Allan W; Otczyk, Diana C; Barker, Jane; Lehmann, Deborah; Alpers, Michael P


    Malnutrition is a significant risk factor for childhood infectious diseases in developing countries, including Papua New Guinea (PNG). Whilst the mechanisms are not fully understood there is little doubt that impairment of immune function is a major contributing factor in enhancing disease susceptibility in malnourished children. This susceptibility has been clearly shown for pneumonia in PNG. The aim of this study was to examine the effect of undernutrition on the humoral immune profile in children less than 60 months of age with pneumonia. The study was cross-sectional with measurements of nutritional status and parameters of the immune response being assessed simultaneously. The children were grouped according to age for the purpose of comparative analysis. The children were from the Goroka region of the Eastern Highlands Province of PNG and had been admitted to hospital with moderate-severe pneumonia. They were classified as undernourished (less than 80% weight for age) or nourished (greater than or equal to 80% weight for age). Serum albumin, IgG, IgA and IgM and salivary albumin and IgA were measured. Antibodies to nontypeable Haemophilus influenzae outer membrane protein and Escherichia coli O antigen were also determined in serum and saliva. Undernourished children aged less than 49 months had lower levels of serum albumin than nourished children throughout this age range. Lower values of salivary IgA were observed in infants (less than 13 months of age) than in older children, with a larger proportion of younger children having no detectable IgA. The age-related immunological profile was similar in undernourished and nourished children. At different age intervals the concentration of immunoglobulins in serum and saliva from undernourished children was generally found to be less than or the same as that from nourished children. In most cases undernourished children had lower levels of specific antibodies than nourished children but for some antibodies in

  8. Relationship between cytomegalovirus (CMV) reactivation, CMV-driven immunity, overall immune recovery and graft-versus-leukaemia effect in children.


    Jeljeli, Mohamed; Guérin-El Khourouj, Valérie; Porcher, Raphael; Fahd, Mony; Leveillé, Sandrine; Yakouben, Karima; Ouachée-Chardin, Marie; LeGoff, Jerome; Cordeiro, Debora Jorge; Pédron, Beatrice; Baruchel, Andre; Dalle, Jean-Hugues; Sterkers, Ghislaine


    The interplay between immune recovery, cytomegalovirus (CMV)-reactivation, CMV-driven immunity and graft-versus-leukaemia effect (GVL) was analysed in 108 children (median age: 8 years) who underwent haematopoietic-stem cell transplantation (HSCT) for acute leukaemia. Follow-up was 2 years unless death or relapse occurred. CMV-polymerase chain reaction (PCR) was programmed weekly until month +3 post-HSCT. Immunomonitoring consisted of sequential lymphocyte subset enumerations and analyses of T-cell proliferative and γ-interferon responses to CMV and to adenovirus. In the 108 recipients, the 2-year relapse rate (RR) was 25% (median time to onset 4·5 months; range: 24 d-17 months). CMV reactivation occurrence was 31% (median time to onset 26 d). Donor/recipient CMV serostatus did not influence RR. Among the 89 recipients disease-free after day +120, i) early CMV-reactivation before day +30 was more frequent (P = 0·01) in the relapse recipient group opposed to the non-relapse group. ii) CD8(+) /CD28(-) and CD4(+) CD45RA(-) T-cell expansions induced by CMV did not influence RR, iii) Recovery of anti-CMV and also anti-adenovirus immunity and of naïve CD4(+) T-cells was faster in the non-relapse group (P = 0·008; 0·009 and 0·002 respectively). In contrast to adult acute myeloid leukaemia, CMV reactivation was associated with increased RR in this paediatric series. Accelerated overall immune recovery rather than CMV-driven immunity had a favourable impact on RR.

  9. The Immune System in Children with Malnutrition—A Systematic Review

    PubMed Central

    Rytter, Maren Johanne Heilskov; Kolte, Lilian; Briend, André; Friis, Henrik; Christensen, Vibeke Brix


    Background Malnourished children have increased risk of dying, with most deaths caused by infectious diseases. One mechanism behind this may be impaired immune function. However, this immune deficiency of malnutrition has not previously been systematically reviewed. Objectives To review the scientific literature about immune function in children with malnutrition. Methods A systematic literature search was done in PubMed, and additional articles identified in reference lists and by correspondence with experts in the field. The inclusion criteria were studies investigating immune parameters in children aged 1–60 months, in relation to malnutrition, defined as wasting, underweight, stunting, or oedematous malnutrition. Results The literature search yielded 3402 articles, of which 245 met the inclusion criteria. Most were published between 1970 and 1990, and only 33 after 2003. Malnutrition is associated with impaired gut-barrier function, reduced exocrine secretion of protective substances, and low levels of plasma complement. Lymphatic tissue, particularly the thymus, undergoes atrophy, and delayed-type hypersensitivity responses are reduced. Levels of antibodies produced after vaccination are reduced in severely malnourished children, but intact in moderate malnutrition. Cytokine patterns are skewed towards a Th2-response. Other immune parameters seem intact or elevated: leukocyte and lymphocyte counts are unaffected, and levels of immunoglobulins, particularly immunoglobulin A, are high. The acute phase response appears intact, and sometimes present in the absence of clinical infection. Limitations to the studies include their observational and often cross-sectional design and frequent confounding by infections in the children studied. Conclusion The immunological alterations associated with malnutrition in children may contribute to increased mortality. However, the underlying mechanisms are still inadequately understood, as well as why different types of

  10. Caregivers Who Refuse Preventive Care for Their Children: The Relationship Between Immunization and Topical Fluoride Refusal

    PubMed Central


    Objectives. The aim of this study was to examine caregivers’ refusal of preventive medical and dental care for children. Methods. Prevalence rates of topical fluoride refusal based on dental records and caregiver self-reports were estimated for children treated in 3 dental clinics in Washington State. A 60-item survey was administered to 1024 caregivers to evaluate the association between immunization and topical fluoride refusal. Modified Poisson regression models were used to estimate prevalence rate ratios (PRRs). Results. The prevalence of topical fluoride refusal was 4.9% according to dental records and 12.7% according to caregiver self-reports. The rate of immunization refusal was 27.4%. In the regression models, immunization refusal was significantly associated with topical fluoride refusal (dental record PRR = 1.61; 95% confidence interval [CI] = 1.32, 1.96; P < .001; caregiver self-report PRR = 6.20; 95% CI = 3.21, 11.98; P < .001). Caregivers younger than 35 years were significantly more likely than older caregivers to refuse both immunizations and topical fluoride (P < .05). Conclusions. Caregiver refusal of immunizations is associated with topical fluoride refusal. Future research should identify the behavioral and social factors related to caregiver refusal of preventive care with the goal of developing multidisciplinary strategies to help caregivers make optimal preventive care decisions for children. PMID:24832428

  11. Acute psychosis in children: do not miss immune-mediated causes

    PubMed Central

    AlHakeem, Afnan S.; Mekki, Mohamed S.; AlShahwan, Saad M.; Tabarki, Brahim M.


    New-onset psychosis in children represents a complex presenting symptom. Psychosis can be attributable to a combination of factors and etiologies, and all possible causes must be systematically examined. There is growing evidence that a proportion of psychosis/psychiatric manifestations in children may be immune-mediated, and physicians should consider this etiology in each presentation of first-episode psychosis. Immune-mediated encephalopathies/encephalitis are increasingly being recognized in children with antibodies to N-methyl-D-aspartate receptor, Leucine-rich glioma-inactivated 1 or other central nervous system antigens such as Contactin-associated protein-like 2, glutamic acid decarboxylase, alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid or Gamma-aminobutyric acid B. In this study, we describe 3 cases of immune-mediated encephalopathy/encephalitis with prominent psychiatric symptoms at presentation, and suggest a practical diagnostic and treatment approach for children with acute psychosis of an immune-mediated cause. PMID:27356658

  12. Interaction of Socioeconomic Status and Provider Practices as Predictors of Immunization Coverage in Virginia Children.

    ERIC Educational Resources Information Center

    Williams, Ian T.; And Others


    Found that beginning the immunization schedule at the recommended age was crucial to appropriate vaccination later in life, and that health provider practices (such as failure to administer vaccinations simultaneously) were important predictors of underimmunization. Serious delays in vaccine administration were observed for poor children in all…

  13. Innate Immune Markers in Mothers and Fathers of Children Newly Diagnosed with Cancer

    PubMed Central

    Lutz Stehl, Meredith J.; Kazak, Anne E.; Hwang, Wei-Ting; Pai, Ahna L.H.; Reilly, Anne F.; Douglas, Steven D.


    Objective The diagnosis of a life-threatening illness in a child is one of the most stressful events imaginable for parents and is associated with increased anxiety and distress. Despite associations between stress and immune function in animal and human models, the immune function in caregivers of children at the time of a child-related potentially traumatic event, like cancer, is not known. Methods Nineteen parents (11 mothers, 8 fathers), representing six caregiver pairs, provided blood for natural killer (NK) cell count by flow cytometry and function assays [% NK whole blood, absolute NK whole blood, LU20 (lytic unit) peripheral blood mononuclear cells, LU20 NK cells] and completed self-report measures (acute stress) within 2 weeks of learning their child had cancer. The NK cell assay was also completed with a sample of healthy adults, the immune reference group. Results There were similar levels of NK cell activity between caregivers and the immune reference group. Immune level and psychological outcomes were not associated. LU20 peripheral blood mononuclear cells and LU20 NK cells were each correlated at r = 0.83 between mothers and fathers in the same family. Conclusions Although based on a small sample, these preliminary results suggest that knowledge about stress responses in parents of children with life-threatening illness may be important and provide novel data regarding the shared impact of stress on immune function within caregiver dyads. PMID:18679048

  14. Humoral immunity to tetanus, measles and rubella in children with acute lymphoblastic leukemia after chemotherapy.


    Onorateli, Myriam; Botana, Claudia; Peralta, Laura; Rebollo, Magali; Ruvinsky, Silvina; Guitter, Myriam; Felice, Maria S; Posadas, Mercedes; Evangelista, Silvina; Villar, Maria V; Golluscio, Mariana; Molina, Agustina; Fraquelli, Lidia


    Chemotherapy regimens and clinical support advances have improved survival in children with acute lymphoblastic leukemia. The after-effects of treatment are a reason for concern, including damage to the immune system induced by immunosuppressive therapy which is reflected in the loss of antibody protection provided by prior immunizations. Our goal was to assess the presence of measles, rubella, and tetanus protective antibody titers among patients with acute lymphoblastic leukemia after completing chemotherapy. Sixty-one children with acute lymphoblastic leukemia seen at the Hospital Garrahan were included; patients had finished their chemotherapy at least 6 months earlier and had a complete immunization schedule before diagnosis. The rates of protective antibodies were 46% (CI: 32-59) for measles, 53% (CI 40-67) for tetanus, and 60% (CI 47-63) for rubella. These results strengthen the need to reconsider revaccination in this group of patients.

  15. [Immunity status in early postoperative complications in children with anomalies of kidneys and upper urinary tract].


    Panikratov, K D; Polozov, V V; Strel'nikov, A I; Sotnikova, N Iu


    31 children aged 1 to 9 years with malformations of the kidneys and upper urinary tracts were preoperatively examined for immune status. After plastic operation 14 children developed early postoperative infectious-inflammatory complications. It is suggested that early postoperative complications in some children with renal and upper urinary tract maldevelopments may arise because of weak compensatory abilities and immunodeficiency resultant from the operative stress. These created favourable conditions for activation of latent infection. Immunological assessment of the patient prior to surgery predicts early postoperative complications and thus enables proper preventive measures.

  16. MMR vaccination status of children exempted from school-entry immunization mandates

    PubMed Central

    Sethuraman, Karthik; Omer, Saad B.; Hanlon, Alexandra L.; Levy, Michael Z.; Salmon, Daniel


    BACKGROUND Child immunizations are one of the most successful public health interventions of the past century. Still, parental vaccine hesitancy is widespread and increasing. One manifestation of this are rising rates of nonmedical or “personal beliefs” exemptions (PBEs) from school-entry immunization mandates. Exemptions have been shown to be associated with increased risk of disease outbreak, but the strength of this association depends critically on the true vaccination status of exempted children, which has not been assessed. OBJECTIVE To estimate the true measles-mumps-rubella (MMR) vaccination status of children with PBEs. METHODS We use administrative data collected by the California Department of Public Health in 2009 and imputation to estimate the MMR vaccination status of children with PBEs under varying scenarios. RESULTS Results from 2009 surveillance data indicate MMR1/MMR2 coverage of 18–47% among children with PBEs at typical schools and 11–34% among children with PBEs at schools with high PBE rates. Imputation scenarios point to much higher coverage (64–92% for MMR1 and 25–58% for MMR2 at typical schools; 49–90% for MMR1 and 16–63% for MMR2 at high PBE schools) but still below levels needed to maintain herd immunity against measles. CONCLUSIONS These coverage estimates suggest that prior analyses of the relative risk of measles associated with vaccine refusal underestimate that risk by an order of magnitude of 2–10 times. PMID:26431991

  17. Immunization of Children Receiving Immunosuppressive Therapy for Cancer or Hematopoietic Stem Cell Transplantation

    PubMed Central

    Shetty, Avinash K.; Winter, Mary A.


    In the past 3 decades, the number of immunocompromised children has increased steadily because of dramatic improvement in survival rates in certain malignancies as a result of intensive curative treatment regimens and an increase in the number of children undergoing life-saving hematopoietic stem cell transplantation (HSCT). Children receiving immunosuppressive therapy for cancer, as well as HSCT recipients, will benefit from vaccination but warrant close evaluation for a variety of reasons, such as the risk of developing severe infections, serious adverse events following certain vaccines, and decreased vaccine efficacy caused by poor immune response to vaccination. Various professional organizations have published vaccination guidelines for immunocompromised patients. Given their heterogeneity, recommendations for the immunization of immunocompromised patients may not be universally applicable. The safety of many commonly used vaccines has not been established in immunocompromised children. In addition, no large-scale vaccine studies have evaluated the clinical outcome of disease prevention in this population. All killed vaccines are generally safe, while live vaccines may be administered to immunocompromised children in select circumstances, depending on the degree of altered immunocompetence and the underlying primary condition. Healthcare providers should be knowledgeable about the indications, contraindications, and precautions for vaccine administration in immunocompromised patients. To protect immunocompromised patients, all family, household contacts, and healthcare workers should also be immunized with all routinely recommended vaccines. Pediatricians play a crucial role in identifying and effectively communicating the risks and benefits of vaccines to immunocompromised patients and their parents. PMID:23049460

  18. Infection and immunity on a chip: a compartmentalised microfluidic platform to monitor immune cell behaviour in real time.


    Gopalakrishnan, N; Hannam, R; Casoni, G P; Barriet, D; Ribe, J M; Haug, M; Halaas, Ø


    Cells respond to their environments and self-organise into multicellular assemblies with dedicated functions. The migratory and homing response of cells to soluble ligands can be studied by using different techniques, but for real time studies of complex multicellular self-organisation, novel and simpler systems are required. We fabricated a flexible open access microsystem and tested the design by studying cell recruitment from an immune cell reservoir towards an infectious compartment. The two compartments were connected by a network of bifurcated microchannels allowing diffusion of signalling molecules and migration of cells. Bacterial filters were incorporated in the design to prevent bacteria and activated cells from entering the network, permitting migration only from the recruitment reservoir. The fabricated microsystem allows real-time continuous monitoring of cellular decision-making based on biologically produced gradients of cytokines and chemokines. It is a valuable tool for studying cellular migration and self-organisation in relation to infections, autoimmunity, cancer, stem cell homing, and tissue and wound repair.

  19. Humoral and cellular immune responses to influenza vaccination in children with cancer receiving chemotherapy

    PubMed Central



    The immune response to influenza vaccination in children with cancer is controversial. The objective of this study was to characterize the cellular and humoral immune responses to an influenza vaccine in children with cancer who were receiving chemotherapy. In this study, children with cancer, who were not previously immunized, received an influenza vaccine via intramuscular injection. Blood samples were obtained prior to and at 4 weeks after immunization. Antibodies were measured using a hemagglutination inhibition (HI) assay. Cell-mediated immunity was measured by specific lymphoproliferation with 3H-thymidine incorporation and by measuring cell frequencies following staining with monoclonal antibodies (CD8, CD4, CD19, CD45RA and CD27) using flow cytometry following incubation with the influenza antigen for 5 days. Geometric mean titers (GMT), mean counts per minute (cpm), cell frequencies prior to and following vaccination and percentage patient responses were compared using the Mann-Whitney non-parametric U and Chi-square tests; where p<0.05 was considered to indicate a statistically significant result. A total of 56 children were included. Their mean age was 6.64±3.61 years. Acute lymphoblastic leukemia (ALL) was diagnosed in 75, solid tumors in 23 and lymphoma in 2% of the children. Subjects with titers ≥40 hemagglutination units (HU) increased from 43% prior to vaccination to 73% following vaccination (p=0.01), whereas the GMT increased from 31.35 [95% confidence interval (CI), 29–111] to 143.45 HU (95% CI, 284–640) following vaccination (p<0.001). An increase in CD45RA expression in CD8+ T cells was observed following vaccination (p=0.01). An increase in CD27 expression was observed in the CD4/8-negative cell population stimulated with the influenza antigen following vaccination (p<0.05). No serious adverse effects were observed. An increase in the seropositivity rate and GMT values following influenza vaccination were also observed. Influenza

  20. Immunization


    ... remembers" the germ and can fight it again. Vaccines contain germs that have been killed or weakened. When given to a healthy person, the vaccine triggers the immune system to respond and thus ...

  1. Safety and Immune Responses in Children After Concurrent or Sequential 2009 H1N1 and 2009–2010 Seasonal Trivalent Influenza Vaccinations

    PubMed Central

    Frey, Sharon E.; Bernstein, David I.; Gerber, Michael A.; Keyserling, Harry L.; Munoz, Flor M.; Winokur, Patricia L.; Turley, Christine B.; Rupp, Richard E.; Hill, Heather; Wolff, Mark; Noah, Diana L.; Ross, Allison C.; Cress, Gretchen; Belshe, Robert B.


    Background. Administering 2 separate vaccines for seasonal and pandemic influenza was necessary in 2009. Therefore, we conducted a randomized trial of monovalent 2009 H1N1 influenza vaccine (2009 H1N1 vaccine) and seasonal trivalent inactivated influenza vaccine (TIV; split virion) given sequentially or concurrently in previously vaccinated children. Methods. Children randomized to 4 study groups and stratified by age received 1 dose of seasonal TIV and 2 doses of 2009 H1N1 vaccine in 1 of 4 combinations. Injections were given at 21-day intervals and serum samples for hemagglutination inhibition antibody responses were obtained prior to and 21 days after each vaccination. Reactogenicity and adverse events were monitored. Results. All combinations of vaccines were safe in the 531 children enrolled. Generally, 1 dose of 2009 H1N1 vaccine and 1 dose of TIV, regardless of sequence or concurrency of administration, was immunogenic in children ≥10 years of age; children <10 years of age required 2 doses of 2009 H1N1 vaccine. Conclusions. Vaccines were generally well tolerated. The immune responses to 2009 H1N1 vaccine were adequate regardless of the sequence of vaccination in all age groups but the sequence affected titers to TIV antigens. Two doses of 2009 H1N1 vaccine were required to achieve a protective immune response in children <10 years of age. Clinical Trials Registration. NCT00943202. PMID:22802432

  2. Modulation of the immune response by infection with Cryptosporidium spp. in children with allergic diseases.


    Guangorena-Gómez, J O; Maravilla-Domínguez, A; García-Arenas, G; Cervantes-Flores, M; Meza-Velázquez, R; Rivera-Guillén, M; Acosta-Saavedra, L C; Goytia-Acevedo, R C


    It has been demonstrated that the allergic response can be ameliorated by the administration of pathogen derivatives that activate Toll-like receptors and induce a Th1-type immune response (IR). Cryptosporidium is a parasite that promotes an IR via Toll-like receptors and elicits the production of Th1-type cytokines, which limit cryptosporidiosis. The aim of this study was to investigate allergy-related immune markers in children naturally infected with Cryptosporidium. In a cross-sectional study, 49 children with or without clinical diagnosis of allergies, oocysts of Cryptosporidium spp. in the faeces were screened microscopically. We microscopically screened for leucocytes, examined T and B cells for allergy-related activation markers using flow cytometry and evaluated serum for total IgE using chemiluminescence. Children with allergies and Cryptosporidium in the faeces had significantly lower levels of total IgE, B cells, CD19(+) CD23(+) and CD19(+) CD124(+) cells as well as a greater percentage of interferon-gamma (IFN-γ(+) ) and IL-4(+) CD4(+) cells than children with allergies without Cryptosporidium. This is the first description of the modulation of the IR in children with allergic diseases in the setting of natural Cryptosporidium infection. Our findings suggest the involvement of CD4(+) cells producing IL-4 and IFN-γ in the IR to Cryptosporidium in naturally infected children.

  3. Innate Immunity and Asthma Risk in Amish and Hutterite Farm Children

    PubMed Central

    Igartua, Catherine; Pivniouk, Vadim; Murray, Sean E.; Ledford, Julie G.; Marques dos Santos, Mauricius; Anderson, Rebecca L.; Metwali, Nervana; Neilson, Julia W.; Maier, Raina M.; Gilbert, Jack A.; Holbreich, Mark; Thorne, Peter S.; Martinez, Fernando D.


    BACKGROUND The Amish and Hutterites are U.S. agricultural populations whose lifestyles are remarkably similar in many respects but whose farming practices, in particular, are distinct; the former follow traditional farming practices whereas the latter use industrialized farming practices. The populations also show striking disparities in the prevalence of asthma, and little is known about the immune responses underlying these disparities. METHODS We studied environmental exposures, genetic ancestry, and immune profiles among 60 Amish and Hutterite children, measuring levels of allergens and endotoxins and assessing the microbiome composition of indoor dust samples. Whole blood was collected to measure serum IgE levels, cytokine responses, and gene expression, and peripheral-blood leukocytes were phenotyped with flow cytometry. The effects of dust extracts obtained from Amish and Hutterite homes on immune and airway responses were assessed in a murine model of experimental allergic asthma. RESULTS Despite the similar genetic ancestries and lifestyles of Amish and Hutterite children, the prevalence of asthma and allergic sensitization was 4 and 6 times as low in the Amish, whereas median endotoxin levels in Amish house dust was 6.8 times as high. Differences in microbial composition were also observed in dust samples from Amish and Hutterite homes. Profound differences in the proportions, phenotypes, and functions of innate immune cells were also found between the two groups of children. In a mouse model of experimental allergic asthma, the intranasal instillation of dust extracts from Amish but not Hutterite homes significantly inhibited airway hyperreactivity and eosinophilia. These protective effects were abrogated in mice that were deficient in MyD88 and Trif, molecules that are critical in innate immune signaling. CONCLUSIONS The results of our studies in humans and mice indicate that the Amish environment provides protection against asthma by engaging and

  4. Effects of Malnutrition on Children's Immunity to Bacterial Antigens in Northern Senegal

    PubMed Central

    Gaayeb, Lobna; Sarr, Jean B.; Cames, Cecile; Pinçon, Claire; Hanon, Jean-Baptiste; Ndiath, Mamadou O.; Seck, Modou; Herbert, Fabien; Sagna, Andre B.; Schacht, Anne-Marie; Remoue, Franck; Riveau, Gilles; Hermann, Emmanuel


    To evaluate immunity to vaccine-preventable diseases according to nutritional status, a longitudinal study was conducted in Senegalese children ages 1–9 years old. A linear regression analysis predicted that weight for age was positively associated with immunoglobulin G (IgG) response to tetanus toxoid in children born during the rainy season or at the beginning of the dry season. A relationship between village, time of visits, and levels of antibodies to tetanus showed that environmental factors played a role in modulating humoral immunity to tetanus vaccine over time. Moreover, a whole-blood stimulation assay highlighted that the production of interferon-γ (IFN-γ) in response to tetanus toxoid was compromised in stunted children. However, the absence of cytokine modulation in response to Mycobacterium tuberculosis-purified protein derivatives and phytohemagglutinin suggests that the overall ability to produce IFN-γ was preserved in stunted children. Therefore, these results show that nutritional status can specifically alter the efficacy of long-lasting immunity to tetanus. PMID:24445198

  5. Vitamin A supplementation reduces the monocyte chemoattractant protein-1 intestinal immune response of Mexican children.


    Long, Kurt Z; Santos, Jose Ignacio; Estrada Garcia, Teresa; Haas, Meredith; Firestone, Mathew; Bhagwat, Jui; Dupont, Herbert L; Hertzmark, Ellen; Rosado, Jorge L; Nanthakumar, Nanda N


    The impact of vitamin A supplementation on childhood diarrhea may be determined by the regulatory effect supplementation has on the mucosal immune response in the gut. Previous studies have not addressed the impact of vitamin A supplementation on the production of monocyte chemoattractant protein 1 (MCP-1), an essential chemokine involved in pathogen-specific mucosal immune response. Fecal MCP-1 concentrations, determined by an enzyme-linked immuno absorption assay, were compared among 127 Mexican children 5-15 mo of age randomized to receive a vitamin A supplement (<12 mo of age, 20,000 IU of retinol; > or =12 mo, 45,000 iu) every 2 mo or a placebo as part of a larger vitamin A supplementation trial. Stools collected during the summer months were screened for MCP-1 and gastrointestinal pathogens. Values of MCP-1 were categorized into 3 levels (nondetectable, or =median). Multinomial logistic regression models were used to determine whether vitamin A-supplemented children had different categorical values of MCP-1 compared with children in the placebo group. Differences in categorical values were also analyzed stratified by gastrointestinal pathogen infections and by diarrheal symptoms. Overall, children who received the vitamin A supplement had reduced fecal concentrations of MCP-1 compared with children in the placebo group (median pg/mg protein +/- interquartile range: 284.88 +/- 885.35 vs. 403.39 +/- 913.16; odds ratio 0.64, 95% CI 0.42-97, P = 0.03). Vitamin A supplemented children infected with enteropathogenic Escherichia coli (EPEC) had reduced MCP-1 levels (odds ratio = 0.38, 95% CI 0.18-0.80) compared with children in the placebo group. Among children not infected with Ascaris lumbricoides vitamin A supplemented children had reduced MCP-1 levels (OR = 0.62, 95% CI 0.41-0.94). These findings suggest that vitamin A has an anti-inflammatory effect in the gastrointestinal tract by reducing MCP-1 concentrations.

  6. Indirect Effects of Pneumococcal Conjugate Vaccines in National Immunization Programs for Children on Adult Pneumococcal Disease

    PubMed Central


    The pneumococcal conjugate vaccine (PCV) was developed to overcome the limitations of the pneumococcal polysaccharide vaccine, which produces poor immunogenicity in infants younger than 2 years. As many countries have included PCVs in national immunization programs for children, the incidence of invasive pneumococcal disease caused by vaccine type Streptococcus pneumoniae has declined markedly, not only among the vaccinated pediatric population, but also among unvaccinated adults. In this review, we present a concise overview of the indirect effects of mass pediatric PCV immunization on unvaccinated adults. PMID:28032483

  7. Monitoring food and non-alcoholic beverage promotions to children.


    Kelly, B; King, L; Baur, L; Rayner, M; Lobstein, T; Monteiro, C; Macmullan, J; Mohan, S; Barquera, S; Friel, S; Hawkes, C; Kumanyika, S; L'Abbé, M; Lee, A; Ma, J; Neal, B; Sacks, G; Sanders, D; Snowdon, W; Swinburn, B; Vandevijvere, S; Walker, C


    Food and non-alcoholic beverage marketing is recognized as an important factor influencing food choices related to non-communicable diseases. The monitoring of populations' exposure to food and non-alcoholic beverage promotions, and the content of these promotions, is necessary to generate evidence to understand the extent of the problem, and to determine appropriate and effective policy responses. A review of studies measuring the nature and extent of exposure to food promotions was conducted to identify approaches to monitoring food promotions via dominant media platforms. A step-wise approach, comprising 'minimal', 'expanded' and 'optimal' monitoring activities, was designed. This approach can be used to assess the frequency and level of exposure of population groups (especially children) to food promotions, the persuasive power of techniques used in promotional communications (power of promotions) and the nutritional composition of promoted food products. Detailed procedures for data sampling, data collection and data analysis for a range of media types are presented, as well as quantifiable measurement indicators for assessing exposure to and power of food and non-alcoholic beverage promotions. The proposed framework supports the development of a consistent system for monitoring food and non-alcoholic beverage promotions for comparison between countries and over time.

  8. Correlates of Immunity to Influenza as Determined by Challenge of Children with Live, Attenuated Influenza Vaccine

    PubMed Central

    Wright, Peter F.; Hoen, Anne G.; Ilyushina, Natalia A.; Brown, Eric P.; Ackerman, Margaret E.; Wieland-Alter, Wendy; Connor, Ruth I.; Jegaskanda, Sinthujan; Rosenberg-Hasson, Yael; Haynes, Brenda C.; Luke, Catherine J.; Subbarao, Kanta; Treanor, John J.


    Background. The efficacy of live, attenuated live attenuated influenza vaccine(LAIV) and inactivated influenza vaccine(IIV) is poorly explained by either single or composite immune responses to vaccination. Protective biomarkers were therefore studied in response to LAIV or IIV followed by LAIV challenge in children. Methods. Serum and mucosal responses to LAIV or IIV were analyzed using immunologic assays to assess both quantitative and functional responses. Cytokines and chemokines were measured in nasal washes collected before vaccination, on days 2, 4, and 7 after initial LAIV, and again after LAIV challenge using a 63-multiplex Luminex panel. Results. Patterns of immunity induced by LAIV and IIV were significantly different. Serum responses induced by IIV, including hemagglutination inhibition, did not correlate with detection or quantitation of LAIV on subsequent challenge. Modalities that induced sterilizing immunity seen after LAIV challenge could not be defined by any measurements of mucosal or serum antibodies induced by the initial LAIV immunization. No single cytokine or chemokine was predictive of protection. Conclusions. The mechanism of protective immunity observed after LAIV could not be defined, and traditional measurements of immunity to IIV did not correlate with protection against an LAIV challenge. PMID:27419180

  9. Evaluation of the Universal Immunization Program and Challenges in Coverage of Migrant Children in Haridwar, Uttarakhand, India

    PubMed Central

    Nath, Latika; Kaur, Prabhdeep; Tripathi, Saurabh


    Background: Studies show that immunization among migrant children is poor. India has a dropout rate of 17.7% between Bacillus Calmette-Guιrin (BCG) and measles (District Level Household Survey (DLHS)-3). Haridwar district had the highest dropout rate of 27.4% from BCG to diphtheria, pertussis, and tetanus (DPT) 3 (DLHS-3) in Uttarakhand. We evaluated the Universal Immunization Programme (UIP) among migrants in Haridwar in two blocks. Materials and Methods: We developed input, process, and output indicators on infrastructure, human resources, and service delivery. A facility, session site and cross-sectional survey of 180 children were done and proportions for various indicators were estimated. We determined factors associated with not taking vaccination using multivariate analysis. Results: We surveyed 11 cold chain centers, 25 subcenters, 14 sessions, and interviewed 180 mothers. Dropouts were supposed to be tracked using vaccination card counterfoils and tracking registers. The dropout rate from BCG to DPT3 was 30%. Lack of knowledge (adjusted odds ratio (AOR) 6.6,95% confidence interval (CI) 2.6–16.7), mother not being decision maker (AOR 4.0,95%CI 1.7–9.2), lack of contact by Accredited Social Health Activist (ASHA; AOR 3.0,95%CI 1.1–7.7), not being given four post-vaccination messages (AOR 7.7, 95% CI 2.9–20.2), and longer duration of stay in Haridwar (AOR 3.0 95% 1.9–7.6) were risk factors for nonimmunization. The reasons stated by mothers included lack of awareness of session site location (67%) and belief that child should only be vaccinated in their resident district (43%). Conclusions: There was low immunization coverage among migrants within adequate supervision, poor cold chain maintenance, and improper tracking of dropouts. Mobile immunization teams, prelisting of migrant children, and change in incentives of ASHAs for child tracking were needed. A monitoring plan for sessions and cold chain needed enforcement. PMID:26435596

  10. Zinc influences innate immune responses in children with enterotoxigenic Escherichia coli-induced diarrhea.


    Sheikh, Alaullah; Shamsuzzaman, Sohel; Ahmad, Shaikh Meshbahuddin; Nasrin, Dilruba; Nahar, Setarun; Alam, Mohammad Murshid; Al Tarique, Abdullah; Begum, Yasmin Ara; Qadri, Syed Saleheen; Chowdhury, Mohiul Islam; Saha, Amit; Larson, Charles P; Qadri, Firdausi


    Information is limited on the effect of zinc on immune responses in children with diarrhea due to enterotoxigenic Escherichia coli (ETEC), the most common bacterial pathogen in children. We studied the immunological effect of zinc treatment (20 mg/d) and supplementation (10 mg/d) in children with diarrhea due to ETEC. A total of 148 children aged 6-24 mo were followed up for 9 mo after a 10-d zinc treatment (ZT; n = 74) or a 10-d zinc treatment plus 3-mo supplementation (ZT+S; n = 74), as well as 50 children with ETEC-induced diarrhea that were not treated with zinc (UT). Fifty control children (HC) of the same age group from the same location were also studied. Serum zinc concentrations were higher in both the ZT (P < 0.001) and ZT+S groups (P < 0.001) than in the UT group but did not differ from the HC group. We found higher serum complement C3 immediately after zinc administration in both ZT (P < 0.001) and ZT+S (P < 0.001) groups than in the UT group. Phagocytic activity in children in both ZT (P < 0.01) and ZT+S (P < 0.01) groups was greater than in the UT group. However, oxidative burst capacity was lower in zinc-receiving groups (ZT, P < 0.001 and ZT+S, P < 0.001) than in the UT group. The naïve:memory T cell ratio in both ZT (P < 0.05) and ZT+S (P < 0.01) groups was higher than in the UT group from d 2 to 15. Increased responses, including complement C3, phagocytic activity, and changes in T cell phenotypes, suggest that zinc administration enhances innate immunity against ETEC infection in children.

  11. Health maintenance in school-aged children: Part I. History, physical examination, screening, and immunizations.


    Riley, Margaret; Locke, Amy B; Skye, Eric P


    The goals of the well-child examination in school-aged children (kindergarten through early adolescence) are promoting health, detecting disease, and counseling to prevent injury and future health problems. A complete history should address any concerns from the patient and family and screen for lifestyle habits, including diet, physical activity, daily screen time (e.g., television, computer, video games), hours of sleep per night, dental care, and safety habits. School performance can be used for developmental surveillance. A full physical examination should be performed; however, the U.S. Preventive Services Task Force recommends against routine scoliosis screening and testicular examination. Children should be screened for obesity, which is defined as a body mass index at or above the 95th percentile for age and sex, and resources for comprehensive, intensive behavioral interventions should be provided to children with obesity. Although the evidence is mixed regarding screening for hypertension before 18 years of age, many experts recommend checking blood pressure annually beginning at three years of age. The American Academy of Pediatrics recommends vision and hearing screening annually or every two years in school-aged children. There is insufficient evidence to recommend screening for dyslipidemia in children of any age, or screening for depression before 12 years of age. All children should receive at least 400 IU of vitamin D daily, with higher doses indicated in children with vitamin D deficiency. Children who live in areas with inadequate fluoride in the water (less than 0.6 ppm) should receive a daily fluoride supplement. Age-appropriate immunizations should be given, as well as any missed immunizations.

  12. Local Immune Responses in Children and Adults with Allergic and Nonallergic Rhinitis

    PubMed Central

    Choi, Hana; Jang, Man-Young; Kim, Kyung Rae; Choi, Jae-Hoon; Cho, Seok Hyun


    Background Allergic rhinitis (AR) is the most common allergic disease but little is known about the difference of local immune responses in children and adults with AR. Objective To compare local immune responses between children and adults with AR and nonallergic rhinitis (NAR), and to investigate whether the association of local and systemic immune responses is different between the two age groups. Methods Fifty-one patients with chronic rhinitis were enrolled and grouped into children (N = 27, mean age 7.2 years) and adults (N = 24, mean age 29.9 years). Diagnosis of AR was based on symptoms, skin prick tests and serum specific IgEs. Nasal lavage (NAL) fluids were collected from all subjects and used to measure the levels of total IgE, specific IgEs to house dust mites (Dp and Df), and cytokines (TNF-α, IL-4, IL-10, IL-17A and IFN-γ). Flow cytometry was used to measure inflammatory cell types in NAL fluids. Results AR had significantly increased local levels of total IgE and specific IgEs to Dp and Df compared with NAR in both age groups (P < 0.05). Nasal eosinophils % (P = 0.01) was significantly increased only in children with AR. Local-systemic correlations of total IgE (r = 0.662, P = 0.000) and eosinophil % (r = 0.461, P = 0.015) between the peripheral blood and NAL fluids were found only in children. Moreover, children had correlations between total IgE and eosinophil % in the peripheral blood (r = 0.629, P = 0.001) and in NAL fluids (r = 0.373, P = 0.061). Conclusion Elevated local IgE is a common feature of AR in children and adults. Local measures in NAR showed naïve state of immune response which disagree with the hypothesis of local allergic rhinitis. Children showed intense local inflammation and close local-systemic interactions compared to adults supporting pediatric AR as a distinct feature. PMID:27281182

  13. Monitoring temperature in children undergoing anaesthesia: a comparison of methods.


    Drake-Brockman, T F E; Hegarty, M; Chambers, N A; von Ungern-Sternberg, B S


    Children undergoing anaesthesia are prone to hypothermia. Perioperative monitoring of patient temperature is, therefore, standard practice. Postoperative temperature is regarded as a key anaesthetic performance indicator in Australian hospitals. Many different methods and sites of temperature measurement are used perioperatively. It is unclear to what degree these methods might be interchangeable. The aim of this study was to determine the relationships between temperatures measured at different sites in anaesthetised children. Two hundred children, 0 to 17 years, undergoing general anaesthesia for elective non-cardiac surgery, were prospectively recruited. Temperature measurements were taken in the operating theatre concurrently at the nasopharynx, tympanic membranes, temporal artery, axilla and skin (chest). Patient age and weight were documented. Temperatures varied according to site of measurement. The mean difference from nasopharyngeal temperature to temperatures at left and right tympanic, temporal, axillary and cutaneous sites were +0.24°C, +0.24°C, +0.35°C, -0.38°C and -1.70°C, respectively. Levels of agreement to nasopharyngeal temperature were similar at tympanic, temporal and axillary sites. Tympanic and temporal temperatures were superior to axillary temperatures for detection of mild hypothermia (<36°C). Skin temperature showed a large variation from nasopharyngeal measurements. Our findings indicate that measured temperatures vary between sites. Understanding these variations is important for interpreting temperature readings.

  14. Continuous improvement in the immune system of HIV-infected children on prolonged antiretroviral therapy

    PubMed Central

    Weinberg, Adriana; Dickover, Ruth; Britto, Paula; Hu, Chengcheng; Patterson-Bartlett, Julie; Kraimer, Joyce; Gutzman, Howard; Shearer, William T.; Rathore, Mobeen; McKinney, Ross


    Background The goal of HAART is to promote reconstitution of CD4+ T cells and other immune responses. We evaluated the extent and the kinetics of immune reconstitution in HIV-infected children over 144 weeks of successful HAART. Methods Thirty-seven children receiving their first HAART regimen had plasma HIV RNA; T cells and subpopulations; T-cell rearrangement excision circles (TREC) DNA; candida, HIVCD4 and HIVCD8 enzyme-linked immunospot measured at regular intervals. Results Plasma HIV RNA became undetectable in 81% of patients at 24 weeks and remained undetectable in 77% at 144 weeks. In contrast, CD4+% continuously increased. Distribution of T-cell subpopulations changed rapidly during the first 48 weeks of HAART and more slowly thereafter. At 144 weeks, total, naive and activated CD4+% and naive CD8+% of HIV-infected children were not significantly different from those of healthy age-matched controls, whereas total and activated CD8+% remained elevated. CD4+ and CD8+ TREC content increased only during the first 48 weeks of HAART. They positively correlated with each other and with total CD4+%, naive CD4+% and naive CD8+%. Candida and HIVCD4 enzyme-linked immunospot increased over time reaching peak values at 48 weeks and 144 weeks, respectively. HIVCD8 enzyme-linked immunospot decreased in magnitude over 144 weeks of HAART but retained its breadth. Baseline CD4+% positively correlated with CD4+% and with functional immune reconstitution at week 144, whereas baseline TREC correlated with TREC at week 144. Conclusion HIV-infected children acquired normal distribution of CD4+ T cells and other subpopulations and recovered CD4-mediated HIV immunity after 144 weeks of HAART. PMID:18981766

  15. Persistence of antibody and immunologic memory in children immunized with hepatitis B vaccine at birth.


    Seto, Dexter; West, David J; Ioli, Virginia A


    Forty-two healthy children immunized with a course of hepatitis B vaccine beginning at birth were tested at 6 years of age for persistence of anti-hepatitis B antibody (anti-HBs) and then given a booster dose of vaccine. Although nearly one-half had become seronegative, all retained robust immunologic memory and rapidly regained a protective anti-HBs titer of at least 10 mIU/ml after booster vaccination.

  16. Disparities between white and African-American children in immunization coverage.

    PubMed Central

    Barker, Lawrence E.; Chu, Susan Y.; Li, Qian; Shaw, Kate M.; Santoli, Jeanne M.


    INTRODUCTION: A recent study has shown that the national-scale difference in immunization coverage between non-Hispanic white (abbreviated "white") and non-Hispanic African-American (abbreviated "African-American") children aged 19-35 months in the United States has increased by about 1 percentage point annually. We examined how this widening gap differs with geography and income. METHODS: We used data from the National Immunization Survey, 1998-2003, a national telephone survey. We examined differences between white and African-American children in immunization coverage within income groups (at or above versus below the federal poverty level) for each census region (northeast, south, midwest and west). We tested the hypothesis of constant disparity over time. RESULTS: Among households at or above the federal poverty level in the northeast census region, disparity is widening (white coverage minus African-American coverage was -0.5 in 1998 but 15.5 in 2003). Among household at or above the federal poverty level in the midwest census region, disparity is narrowing (white coverage minus African-American coverage was 13.9 in 1998 but 2.5 in 2003). We found no significant evidence of a trend in other groups. CONCLUSIONS: Widening national-level disparity in immunization coverage is primarily attributable to trends in the northeast census region. Addressing the widening disparity in coverage requires new strategies that consider current social and economic contexts. PMID:16708496

  17. Immune status of children with obstructive sleep apnea/hypopnea syndrome

    PubMed Central

    Zhang, Zihe; Wang, Chunguang


    Objective: We aimed to evaluate the immune status of children with obstructive sleep apnea/hypopnea syndrome (OSAHS). Methods: Fifty children with OSAHS having the symptoms of “snoring, mouth breathing and suffocating during sleep”, who were admitted in our hospital from May 2014 to May 2016, were randomly selected. Another 52 healthy, age- and gender-matched children were enrolled as control subjects after taking informed consent. After admission, the peripheral venous blood was collected. T cell subsets and cytokines were analyzed by flow cytometry. Immunoglobulin and complement levels were detected by immunoassay analyzer. Results: The percentage of CD8+ T lymphocytes in children with OSAHS was (26.47 ± 1.52)% which was significantly higher than that of control group ((21.94 ± 1.92)%) (P<0.05). OSAHS group had a significantly lower CD4+/CD8+ ratio (1.24 ± 0.12) than that of control group (1.45 ± 0.11) (P<0.05). The two groups had similar percentages of CD3+ and CD4+ T lymphocytes (P>0.05). OSAHS group had significantly higher serum levels of IL-4, IL-6, IL-10 and IFN-γ than those of control group (P<0.05), but their IL-2 and TNF-α levels were similar (P>0.05). The serum IgA and C3 levels of OSAHS group significantly exceeded those of control group (P<0.05), but their IgG, IgM and C4 levels were similar (P>0.05). Conclusion: Children with OSAHS had increased percentage of CD8+ T lymphocytes and decreased CD4+/CD8+ ratio, suggesting this group had poor immune function. Increase in humoral immune-related indices IL-4, IL-6, IL-10 and IFN-γ indicated the occurrence of oxidative stress and systemic inflammatory status. PMID:28367199

  18. Immunizations in Children with Inflammatory Bowel Disease Treated with Immunosuppressive Therapy

    PubMed Central

    Bousvaros, Athos


    The vast majority of patients with inflammatory bowel disease (IBD) will receive immunosuppressive therapy at some point for their disease, whether for the short term (such as a course of corticosteroids) or long term (such as maintenance therapy with immunomodulators or biologics). The systemic immunosuppression places patients at increased risk for infections. Therefore, it is important that patients are up-to-date with immunizations to minimize vaccine-preventable infections. However, the literature shows that the rate of immunization in patients with IBD is low. Ideally, the vaccination status is checked at diagnosis, and patients are immunized with the vaccines they need. Drawing titers is helpful in cases in which vaccination history is unclear or to confirm that titers are at an adequate level in cases in which patients have been vaccinated. Current guidelines recommend that patients with IBD follow the same routine immunization schedule as healthy children, but patients should not be administered live vaccines if they are receiving immunosuppressive therapy. Therefore, it is ideal to administer any necessary vaccinations as early as possible, prior to starting immunosuppressive therapy. Patients may receive inactivated vaccines regardless of immunosuppressive status. The IBD literature suggests that inactivated vaccines are safe and do not worsen disease activity. In general, patients with IBD mount an immune response to vaccines, but the response may be lower if patients are receiving immunosuppressive therapy, especially tumor necrosis factor inhibitors. PMID:25013388

  19. Evidence of cellular immune activation in children with opsoclonus-myoclonus: cerebrospinal fluid neopterin.


    Pranzatelli, Michael R; Hyland, Keith; Tate, Elizabeth D; Arnold, Lauren A; Allison, Tyler J; Soori, Gamini S


    To evaluate cellular immune activation in opsoclonus-myoclonus syndrome, we measured the inflammatory marker neopterin in the cerebrospinal fluid of 16 children with opsoclonus-myoclonus and neuroblastoma, 24 children with opsoclonus-myoclonus but no tumor, and 19 age-matched controls. The mean concentration in opsoclonus-myoclonus was 2.3-fold higher than in controls (P = .008). Neopterin was greatly elevated in four of the most neurologically severe cases, up to 8.3-fold above the highest control level. Thirteen of the 40 children with opsoclonus-myoclonus but no controls had a neopterin concentration >2 SD above the control mean (P = .005). In this high neopterin subgroup, neurologic severity was significantly greater and the duration of neurologic symptoms was less. In 16 children re-examined on immunotherapy, including adrenocorticotropic hormone (ACTH) combination therapy, treatment was associated with a significant reduction in both neopterin and neurologic severity. Neopterin did not differ significantly between the tumor and non-tumor opsoclonus-myoclonus etiologies. No abnormalities of tetrahydrobiopterin were found. Although cerebrospinal fluid neopterin lacked the sensitivity to be a biomarker of disease activity in opsoclonus-myoclonus, elevated concentrations do support a role for T-cell activation and cell-mediated immunity in its pathophysiology.

  20. Arsenic Exposure and Cell-Mediated Immunity in Pre-School Children in Rural Bangladesh

    PubMed Central

    Ahmed, Sultan; Moore, Sophie E.; Kippler, Maria; Gardner, Renee; Hawlader, M. D. H.; Wagatsuma, Yukiko; Raqib, Rubhana; Vahter, Marie


    Prenatal arsenic exposure has been associated with reduced thymic index and increased morbidity in infants, indicating arsenic-related impaired immune function. We aimed at elucidating potential effects of pre- and postnatal arsenic exposure on cell-mediated immune function in pre-school aged children. Children born in a prospective mother-child cohort in rural Bangladesh were followed up at 4.5 years of age (n = 577). Arsenic exposure was assessed by concentrations of arsenic metabolites (U-As) in child urine and maternal urine during pregnancy, using high-performance liquid chromatography online with inductively coupled plasma mass spectrometry. For assessment of delayed type hypersensitivity response, an intradermal injection of purified protein derivative (PPD) was given to Bacillus Calmette-Guerin vaccinated children. The diameter (mm) of induration was measured after 48–72 h. Plasma concentrations of 27 cytokines were analyzed by a multiplex cytokine assay. Children's concurrent, but not prenatal, arsenic exposure was associated with a weaker response to the injected PPD. The risk ratio (RR) of not responding to PPD (induration <5 mm) was 1.37 (95% confidence interval (CI): 1.07, 1.74) in children in the highest quartile of U-As (range 126–1228 μg/l), compared with the lowest (range 12–34 μg/l). The p for trend across the quartiles was 0.003. The association was stronger in undernourished children. Children's U-As in tertiles was inversely associated with two out of 27 cytokines only, i.e., IL-2 and TNF-α, both Th1 cytokines (in the highest tertile, regression coefficients (95% CI): −1.57 (−2.56, −0.57) and −4.53 (−8.62, −0.42), respectively), but not with Th2 cytokines. These associations were particularly strong in children with recent infections. In conclusion, elevated childhood arsenic exposure appeared to reduce cell-mediated immunity, possibly linked to reduced concentrations of Th1 cytokines. PMID:24924402

  1. Use of interferon-gamma ELISPOT in monitoring immune responses in humans.


    Matijevic, Mark; Urban, Robert G


    The interferon (IFN)-gamma enzyme-linked immunospot (ELISPOT) assay has become a useful tool for immunologists seeking to quantify immune responses on a per-cell basis. The assay is sensitive and allows for the enumeration of low-frequency T-cells. Many have applied this assay to clinical trials as a way to measure biological activity in a patient cohort. It is critical that each laboratory attempting to use the assay in their facility perform rigorous development and qualification work to establish an assay that suits their particular needs. This chapter serves as a demonstration of two practical and slightly different approaches to using the ELISPOT assay to monitor immune activity in the human periphery: (1) assays using whole samples of peripheral blood mononuclear cells with and without the use of additional antigen presenting cells and (2) assays using enriched T-cell populations. Detailed protocols and procedures will be covered, as well as a demonstration of results obtained from three separate applications.

  2. Immune response to 1 and 2 dose regimens of measles vaccine in Pakistani children.


    Hussain, Hamidah; Akram, Dure Samin; Chandir, Subhash; Khan, Aamir J; Memon, Ashraf; Halsey, Neal A


    Measles is a significant problem in Pakistan despite vaccine coverage rates reported at 80%. The purpose of this study was to determine the serologic response in children after one dose of measles vaccine at 9 mo versus two doses at 9 and 15 mo of age. From March through December 2006, children were enrolled from immunization clinics and squatter settlements in Karachi. Blood samples were taken from children in Group A at 9-10 mo of age prior to measles vaccine and 8 to 11 weeks later; from children in Group B at 16-17 mo of age after receiving 2 doses of measles vaccine; and from children in Group C who had received at least one dose of measles vaccine by 5 y of age. After the first dose of measles vaccine, 107/147 (73%) of children in Group A were seropositive, 157/180 (87%) of children in Group B were seropositive after two doses and 126/200 (63%) of children in Group C were seropositive at 5 y of age. The post-vaccination geometric mean antibody concentrations were higher in females than males in groups A (irrespective of pre-vaccination antibody levels) and B. The serologic response to one and two doses of measles vaccine was lower in children in Karachi than has been reported in many other countries. Two doses of vaccine were significantly better than one dose. An in-depth investigation is needed to determine the reason for the lower-than-expected protection rates. Differences in immunogenicity between genders need to be further studied. Recent introduction of supplemental measles vaccine doses should help control measles in Pakistan.

  3. Impact of iron deficiency anemia on the function of the immune system in children

    PubMed Central

    Hassan, Tamer Hasan; Badr, Mohamed Ahmed; Karam, Nehad Ahmed; Zkaria, Marwa; El Saadany, Hosam Fathy; Abdel Rahman, Doaa Mohamed; Shahbah, Doaa Abdallah; Al Morshedy, Salah Mohamed; Fathy, Manar; Esh, Asmaa Mohamed Hosni; Selim, Amal Mohamed


    Abstract The importance of iron deficiency as a public health problem is based ultimately on the seriousness of its consequences on health. The most extensively investigated consequences of iron deficiency involve work performance and immune function. The significance of the effects on work performance is generally accepted. In contrast, data on the influence of iron deficiency on immune function are often perceived as being confusing and contradictory. We aimed to evaluate the effect of iron deficiency anemia on humoral, cellular, nonspecific immunity, and also the effect on the cytokines that are the key factors of many immunologic steps. Forty children with iron deficiency anemia and 20 age and sex-matched healthy children were included. All children were subjected to full medical history, thorough clinical examination, complete blood count, iron indices (serum iron, serum total iron-binding capacity, serum ferritin, and transferrin saturation), immunoglobulin assay (IgA, IgG, and IgM), interleukin (IL)-6 serum level, study of T-lymphocyte subsets, and evaluation of phagocytic function of macrophages and oxidative burst activity of neutrophils. Patients had significantly lower IgG levels, IL-6, phagocytic activity, and oxidative burst of neutrophils than controls, although there was no significant difference between patients and controls with regard to other immunoglobulins and CD4/CD8 ratio. There was significantly positive correlation between serum iron and IL-6 serum level. We concluded that humoral, nonspecific immunity (phagocytic activity and oxidative burst), and the IL-6 are influenced in patients with iron deficiency anemia. Study of these abnormalities after correction of iron deficiency is strongly needed. PMID:27893677

  4. Altered expression of immune-related genes in children with Down syndrome.


    Zampieri, Bruna Lancia; Biselli-Périco, Joice Matos; de Souza, Jorge Estefano Santana; Bürger, Matheus Carvalho; Silva Júnior, Wilson Araújo; Goloni-Bertollo, Eny Maria; Pavarino, Erika Cristina


    Individuals with Down syndrome (DS) have a high incidence of immunological alterations with increased susceptibility to bacterial and viral infections and high frequency of different types of hematologic malignancies and autoimmune disorders. In the current study, we profiled the expression pattern of 92 immune-related genes in peripheral blood mononuclear cells (PBMCs) of two different groups, children with DS and control children, to identify differentially expressed genes that might be of pathogenetic importance for the development and phenotype of the immunological alterations observed in individuals with DS. PBMCs samples were obtained from six DS individuals with karyotypically confirmed full trisomy 21 and six healthy control individuals (ages 2-6 years). Gene expression was profiled in duplicate according to the manufacturer's instructions provided by commercially available TaqMan Human Immune Array representing 92 immune function genes and four reference genes on a 96-plex gene card. A set of 17 differentially expressed genes, not located on chromosome 21 (HSA21), involved in immune and inflammatory pathways was identified including 13 genes (BCL2, CCL3, CCR7, CD19, CD28, CD40, CD40LG, CD80, EDN1, IKBKB, IL6, NOS2 and SKI) significantly down-regulated and four genes (BCL2L1, CCR2, CCR5 and IL10) significantly up-regulated in children with DS. These findings highlight a list of candidate genes for further investigation into the molecular mechanism underlying DS pathology and reinforce the secondary effects of the presence of a third copy of HSA21.

  5. Earlier infantile immune maturation is related to higher DTP vaccine responses in children

    PubMed Central

    Strömbeck, Anna; Lundell, Anna-Carin; Nordström, Inger; Andersson, Kerstin; Adlerberth, Ingegerd; Wold, Agnes E; Rudin, Anna


    There are large inter-individual variations in vaccine-specific antibody responses in children. We sought to investigate whether early-life environmental factors and/or adaptive immune maturation were related to diphtheria–tetanus–pertussis (DTP) vaccine-specific antibody levels at 18 months of age. In the prospective FARMFLORA birth-cohort, including both farming and non-farming families, children were immunized with DTP vaccine at 3, 5 and 12 months of age. DTP vaccine-induced antibody levels were measured in plasma at 18 months of age. Infants' blood samples obtained at birth, 3–5 days, 4, 18 and 36 months and at 8 years of age were analyzed for total CD4+ T- and B-cell counts, proportions of naïve and memory T and B cells, and fractions of putative regulatory T cells by flow cytometry. Multivariate factor analysis was used to examine associations between immune variables and vaccine responses. The most apparent multivariate pattern was that higher anti-DTP antibody titers at 18 months of age were associated with lower infantile total counts of T and B cells in the blood. Furthermore, lower infantile total T- and B-cell blood counts were associated with higher proportions of circulating CD45RO+ memory T cells and to lower proportions of α4β7+ naïve T cells later in childhood. The multivariate findings were corroborated in univariate correlation analyses. Sex, delivery mode and dairy farm exposure were unrelated to the magnitude of DTP-specific antibody responses. Our results thus suggest that children with a more mature/activated infantile adaptive immunity respond with higher vaccine-induced anti-DTP antibody levels at 18 months of age. PMID:27217956

  6. Earlier infantile immune maturation is related to higher DTP vaccine responses in children.


    Strömbeck, Anna; Lundell, Anna-Carin; Nordström, Inger; Andersson, Kerstin; Adlerberth, Ingegerd; Wold, Agnes E; Rudin, Anna


    There are large inter-individual variations in vaccine-specific antibody responses in children. We sought to investigate whether early-life environmental factors and/or adaptive immune maturation were related to diphtheria-tetanus-pertussis (DTP) vaccine-specific antibody levels at 18 months of age. In the prospective FARMFLORA birth-cohort, including both farming and non-farming families, children were immunized with DTP vaccine at 3, 5 and 12 months of age. DTP vaccine-induced antibody levels were measured in plasma at 18 months of age. Infants' blood samples obtained at birth, 3-5 days, 4, 18 and 36 months and at 8 years of age were analyzed for total CD4(+) T- and B-cell counts, proportions of naïve and memory T and B cells, and fractions of putative regulatory T cells by flow cytometry. Multivariate factor analysis was used to examine associations between immune variables and vaccine responses. The most apparent multivariate pattern was that higher anti-DTP antibody titers at 18 months of age were associated with lower infantile total counts of T and B cells in the blood. Furthermore, lower infantile total T- and B-cell blood counts were associated with higher proportions of circulating CD45RO(+) memory T cells and to lower proportions of α4β7(+) naïve T cells later in childhood. The multivariate findings were corroborated in univariate correlation analyses. Sex, delivery mode and dairy farm exposure were unrelated to the magnitude of DTP-specific antibody responses. Our results thus suggest that children with a more mature/activated infantile adaptive immunity respond with higher vaccine-induced anti-DTP antibody levels at 18 months of age.

  7. Children Become "Real Scientists" as They Help to Monitor the Health of Their Local Estuary

    ERIC Educational Resources Information Center

    Beaumont, Brent


    The author explains how the children at his primary school in New Zealand are inspired by their involvement in environmental monitoring. Shellfish surveys are conducted annually in New Zealand in order to establish the health of their estuaries. By involving the children in this national monitoring programme, prepared by the Hauraki Gulf Forum (an…

  8. Neutralizing antibody immune response in children with primary and secondary rotavirus infections.

    PubMed Central

    Arias, C F; López, S; Mascarenhas, J D; Romero, P; Cano, P; Gabbay, Y B; de Freitas, R B; Linhares, A C


    We have characterized the neutralizing antibody immune response to six human rotavirus serotypes (G1 to G4, G8, and G9) in Brazilian children with primary and secondary rotavirus infections and correlated the response with the G serotype of the infecting rotavirus strain. Twenty-five children were studied: 17 had a single rotavirus infection, 4 were reinfected once, and 4 experienced three infections. Two of the reinfections were by non-group A rotaviruses. Among the 25 primary infections, we observed homotypic as well as heterotypic responses; the serotype G1 viruses, which accounted for 13 of these infections, induced mostly a homotypic response, while infections by serotype G2 and G4 viruses induced, in addition to the homotypic, a heterotypic response directed primarily to serotype G1. Two of the primary infections induced heterotypic antibodies to 69M, a serotype G8 virus that by RNA electrophoresis analysis was found not to circulate in the population during the time of the study. The specificity of the neutralizing antibody immune response induced by a virus of a given serotype was the same in primary as well as secondary infections. These results indicate that the heterotypic immune response induced in a primary rotavirus infection is an intrinsic property of the virus strain, and although there seem to be general patterns of serotype-specific seroconversion, these may vary from serotype to serotype and from strain to strain within a serotype. PMID:7496929

  9. Impaired cellular immune response to tetanus toxoid but not to cytomegalovirus in effectively HAART-treated HIV-infected children.


    Alsina, Laia; Noguera-Julian, Antoni; Fortuny, Clàudia


    Despite of highly active antiretroviral therapy, the response to vaccines in HIV-infected children is poor and short-lived, probably due to a defect in cellular immune responses. We compared the cellular immune response (assessed in terms of IFN-γ production) to tetanus toxoid and to cytomegalovirus in a series of 13 HIV-perinatally-infected children and adolescents with optimal immunovirological response to first line antiretroviral therapy, implemented during chronic infection. A stronger cellular response to cytomegalovirus (11 out of 13 patients) was observed, as compared to tetanus toxoid (1 out of 13; p=0.003). These results suggest that the repeated exposition to CMV, as opposed to the past exposition to TT, is able to maintain an effective antigen-specific immune response in stable HIV-infected pediatric patients and strengthen current recommendations on immunization practices in these children.

  10. Immune response of children who develop persistent diarrhea following rotavirus infection.


    Azim, T; Ahmad, S M; Sefat-E-Khuda; Sarker, M S; Unicomb, L E; De, S; Hamadani, J D; Salam, M A; Wahed, M A; Albert, M J


    A prospective study was conducted with Bangladeshi children with rotavirus (RV) diarrhea to assess whether nutritional and clinical parameters, RV serotypes, levels of interleukin-10 (IL-10), tumor necrosis factor alpha (TNF-alpha), and gamma interferon (IFN-gamma), and RV-specific antibody titers in plasma and stool were associated with the development of persistent diarrhea. Children with watery diarrhea for 6 to 8 days, selected from the Dhaka Hospital of the International Centre for Diarrhoeal Disease Research, Bangladesh (ICDDR,B), were enrolled in the study and monitored until diarrhea improved. Children were classified as having acute diarrhea (AD) if diarrhea resolved within 14 days of onset and as having persistent diarrhea (PD) if diarrhea persisted for more than 14 days after onset. Uninfected, control children (n = 13) from the Nutrition Follow-Up Unit of ICDDR,B were also enrolled. Of the 149 children with diarrhea enrolled, 29 had diarrhea with RV alone, of which 19 had AD and 10 developed PD. Samples of stool and blood were collected from all children on enrollment. Stool samples were collected again from children when they developed PD. Of the 10 children who had an initial RV infection and then developed PD, only one had persistent RV infection. Plasma levels of IL-10 and TNF-alpha were higher in children with diarrhea compared to uninfected controls but were similar in children with AD and PD. Plasma IFN-gamma levels were higher in children who developed PD than in those with AD (P = 0.008) or uninfected controls (P = 0.001). In stools, the levels of TNF-alpha, the only cytokine detected, were similar in the three groups of children. RV-specific immunoglobulin G (IgG) titers in plasma were higher in uninfected children than in those with AD (P < 0.001) or PD (P = 0.024) but titers were similar in children with AD and PD. RV-specific IgA titers in plasma and stool were similar in the three groups of children. From all observed parameters, only

  11. [Correction of immune and mediator characteristics by low-frequency magnetotherapy in children who frequently fall ill].


    Useĭnova, N N


    The objective of this work was to compare characteristics of clinical condition and immune status of children with repeated respiratory diseases of different clinical and nosological forms after standard treatment and magnetotherapy. It was shown that magnetotherapy produces well-apparent immunocorrective effects in children with the affected upper and lower respiratory tracts including patients with bronchial obstruction syndrome. Positive changes of both cellular and humoral immunity characteristics were documented coupled to the improvement of serum cortisol levels. Results of the study give reason to recommend inclusion of magneotherapy in the combined treatment of children with repeated respiratory diseases.

  12. Antibody titers against vaccine and contemporary wild poliovirus type 1 in children immunized with IPV+OPV and young adults immunized with OPV.


    Lukashev, Alexander N; Yarmolskaya, Maria S; Shumilina, Elena Yu; Sychev, Daniil A; Kozlovskaya, Liubov I


    In 2010, a type 1 poliovirus outbreak in Congo with 445 lethal cases was caused by a virus that was neutralized by sera of German adults vaccinated with inactivated polio vaccine with a reduced efficiency. This seroprevalence study was done in two cohorts immunized with other vaccination schedules. Russian children aged 3-6 years immunized with a combination of inactivated and live polio vaccines were reasonably well protected against any wild type poliovirus 1, including the Congolese isolate. Adults aged 20-29 years immunized only with live vaccine were apparently protected against the vaccine strain (92% seropositive), but only 50% had detectable antibodies against the Congo-2010 isolate. Both waning immunity and serological divergence of the Congolese virus could contribute to this result.



    Peixoto Paes-Silva, Rebecca; Correia de Macedo, Érika Michelle; Oliveira Tomiya, Marília Tokiko; Machado Barbosa de Castro, Célia Maria


    The aim of the study was to compare the innate immune system of severely malnourished children admitted to the Instituto de Medicina Integral Professor Fernando Figueira and treated according to the protocol of the World Health Organization (WHO) at admission and discharge. An experimental study was conducted with 20 children under two years of age. Ten of them had severe malnutrition and ten were a control group. The malnourished group consisted of hospitalized infants and it was submitted to WHO's protocol. Children with HIV and re-admitted during the study period were excluded. A blood sample was taken at admission and at discharge. Later, an analysis of blood leukocytes, adherence index, phagocytic capacity, production of free radicals superoxide and nitric oxide was performed. Patients with severe malnutrition at hospital discharge showed improved phagocytic function, release of oxygen radicals and reduction of the number of lymphocytes when compared to the time of admission. When compared to the control group, patients at hospital discharge had lower lymphocyte values and lower production of free radicals. Thus, it can be concluded that the duration of hospitalization was insufficient to restore cell-mediated immunity and microbicide activity.

  14. [Immune reconstitution syndrome due to BCG in HIV-treated children].


    Miranda-Choque, Edwin; Candela-Herrera, Jorge; R Segura, Eddy; Farfán-Ramos, Sonia; Barriga, Aldo


    The objective of this study is to describe the clinical profile of the immune reconstitution syndrome due to Mycobacterium bovis Bacillus Calmette-Guérin (IRS-BCG) in children with HIV infection who receive highly active antiretroviral treatment (HAART) at Instituto Nacional de Salud del Niño de Lima (National Children's Health Institute of Lima), Peru. A case study was conducted, including 8 children with IRS-BCG, defined as the presence of regional lymphadenopathy or inflammation on the BCG vaccination site with at least one less logarithm in the viral load or immune improvement. All patients had AIDS (C3). The starting median age in HAART was 7.2 months and the event occurred 3 to 11 weeks after the treatment was started. 7 cases showed axillary adenitis. When compared with the Non IRS-BCG group, a significant association between the age at which HAART was started at one year, severe immunodepression, and increased viral load was found. It is concluded that IRS-BCG was related to a rapid clinical progression of the mother-to-child transmitted HIV/AIDS infection, severe immunosuppression and high viral load when the HAART began.

  15. Improving Immunization Rates Through Community-Based Participatory Research: Community Health Improvement for Milwaukee’s Children Program

    PubMed Central

    Willis, Earnestine; Sabnis, Svapna; Hamilton, Chelsea; Xiong, Fue; Coleman, Keli; Dellinger, Matt; Watts, Michelle; Cox, Richard; Harrell, Janice; Smith, Dorothy; Nugent, Melodee; Simpson, Pippa


    Background Nationally, immunization coverage for the DTaP/3HPV/1MMR/3HepB/3Hib/1VZV antigen series in children ages 19–35 months are near or above the Healthy People 2020 target (80%). However, children in lower socioeconomic families experience lower coverage rates. Objective Using a community-based participatory research (CBPR) approach, Community Health Improvement for Milwaukee Children (CHIMC) intervened to reduce disparities in childhood immunizations. Methods The CHIMC adopted a self-assessment to examine the effectiveness of adhering to CBPR principles. Using behavior change models, CHIMC implemented education, social marketing campaign, and theory of planned behavior interventions. Community residents and organizational representatives vetted all processes, messages, and data collection tools. Results Adherence to the principles of CBPR was consistently positive over the 8-year period. CHIMC enrolled 565 parents/caregivers with 1,533 children into educational and planned behavior change (PBC) interventions, and enrolled another 406 surveyed for the social marketing campaign. Retention rate was high (80%) with participants being predominately Black females (90%) and the unemployed (64%); children’s median age was 6.2 years. Increased knowledge about immunizations was consistently observed among parents/caregivers. Social marketing data revealed high recognition (85%) of the community-developed message (“Take Control: Protect Your Child with Immunizations”). Barriers and facilitators to immunize children revealed protective factors positively correlated with up-to-date (UTD) status (p < 0.007). Ultimately, children between the ages of 19 and 35 months whose parents/caregivers completed education sessions and benefitted from a community-wide social marketing message increased their immunization status from 45% baseline to 82% over 4 years. Conclusions Using multilayered interventions, CHIMC contributed to the elimination of immunization disparities in

  16. Antibody Response from Whole-Cell Pertussis Vaccine Immunized Brazilian Children against Different Strains of Bordetella pertussis

    PubMed Central

    Pereira, Alexandre; Pietro Pereira, Aparecida S.; Silva, Célio Lopes; de Melo Rocha, Gutemberg; Lebrun, Ivo; Sant'Anna, Osvaldo A.; Tambourgi, Denise V.


    Bordetella pertussis is a gram-negative bacillus that causes the highly contagious disease known as pertussis or whooping cough. Antibody response in children may vary depending on the vaccination schedule and the product used. In this study, we have analyzed the antibody response of cellular pertussis vaccinated children against B. pertussis strains and their virulence factors, such as pertussis toxin, pertactin, and filamentous hemagglutinin. After the completion of the immunization process, according to the Brazilian vaccination program, children serum samples were collected at different periods of time, and tested for the presence of specific antibodies and antigenic cross-reactivity. Results obtained show that children immunized with three doses of the Brazilian whole-cell pertussis vaccine present high levels of serum antibodies capable of recognizing the majority of the components present in vaccinal and non-vaccinal B. pertussis strains and their virulence factors for at least 2 years after the completion of the immunization procedure. PMID:20348518

  17. [Influence of helminthic infections and nutritional status on immune response in Venezuelan children].


    Ortiz, D; Afonso, C; Hagel, I; Rodriguez, O; Ortiz, C; Palenque, M; Lynch, N R


    We investigated the influence of nutritional status, as determined from anthropometric measurement, and of helminthic infections on the immune response of children of low socioeconomic status in two rural communities in Venezuela: El Cardón in the state of Nueva Esparta and San Daniel in the state of Miranda. A total of 125 boys and girls between 2 and 15 years old participated in the study. Their socioeconomic stratum was determined by a modified Graffar method. A physical examination was performed, as was also an anthropometric evaluation that took into account three indicators--weight-for-height, weight-for-age, and height-for-age--according to parameters established by the World Health Organization. Other examinations included feces, secretory IgA in saliva, total serum IgE, and anti-Ascaris-specific immunoglobulins. The children in both of the communities were in strata IV and V of the of Graffar scale, with a significantly greater number of stratum V inhabitants in San Daniel (P < 0.001). The results suggest that exposure level and individual susceptibility to the parasites are determining factors in parasitic infection and immune system behavior. The intensity of the parasitic burden plays an important role in stimulating polyclonal IgE, which diminishes the effectiveness of the specific response to those infections. On the other hand, nutritional deficiencies could change the immune mechanisms of the mucous membranes, negatively influence the synthesis of secretory IgA, and stimulate the production of polyclonal IgE. Poor sanitary and socioeconomic conditions promote more exposure to gastrointestinal parasites and a deficient nutritional status, which modulates the immune response and affects serum IgE and secretory IgA production mechanisms.

  18. Effective role of lady health workers in immunization of children in Pakistan

    PubMed Central

    Afzal, Saira; Naeem, Azka; Shahid, Unaiza; Noor Syed, Wajiha; Khan, Urva; Misal Zaidi, Nayyar


    Objective: To determine the association of Lady Health Worker’s role with immunization of children in Pakistan. Methods: Secondary analysis was conducted on data obtained from Pakistan’s Demographic and Health Survey. Children who did not receive all doses of vaccines were considered incompletely immunized or vice versa. The association between determinants was assessed by simple and multivariable binary logistic regression. Results: The mothers and fathers had a mean age of 32.7 (SD+8.6) years and 37.9 (SD +10.1) years, respectively. Age of mother greater than 35 (OR=0.93; 95% CI:0.70-1.25); born in Baluchistan (OR=3.47,95% CI:2.21-5.49); rural area dwellers (OR=2.04; 95% CI:1.65-2.51); female gender (OR=1.06; 95% CI:0.87-1.29); birth order (of last born child) greater than 7 (OR=2.21, 95% CI:1.60-3.06); delivered at home (OR=2.20, 95% CI:1.76-2.74); long distance to health care facility (OR=2.66, 95% CI:2.16-3.28); and no LHW visit in last 12 months (OR=1.91, CI:1.48-2.47) were significantly associated with incomplete immunization in bivariate analysis. In final model of multinomial regression analysis the absence of visit by LHW in last 12 months was the most significant factor when all risk factors were analyzed in last model Conclusions: This study has concluded that visit of LHW in last 12 months was significantly associated with immunization. PMID:28083053

  19. Monitoring internal training load and salivary immune-endocrine responses during an annual judo training periodization

    PubMed Central

    Agostinho, Marcus F.; Moreira, Alexandre; Julio, Ursula F.; Marcolino, Gilvan S.; Antunes, Barbara M. M.; Lira, Fabio S.; Franchini, Emerson


    The objective of this study was to examine the internal training load (TL), IgA, and salivary steroid hormone responses in elite youth judo athletes during an entire annual training periodization. Ten male judo athletes (18±2 years, 72.3±12.3 kg, and 175±6 cm) competing at a state/national level were examined for the TL and salivary imune-endocrine responses variations over an annual judo season, divided in three macrocyles composed by distinct periods denominated preparatory period (PP), competitive period (CP) and transition period (TP). At the end of PP and CP, saliva samples were collected to determine cortisol, testosterone and IgA concentrations. Throughout PP and CP the session-rating of perceived exertion and the total duration of each session were monitored, allowing the internal TL and weekly training strain (TS) calculation. During all macrocycles, significant decreases in TL and TS were observed during CP compared with PP (P<0.05), although no significant differences were observed for immune-endocrine concentrations between PP and CP (P>0.05). Specific variations were observed comparing periods with similar characteristics throughout the macrocycles as higher TL and TS (PP1 to PP2 and PP3, P<0.05), increased testosterone (CP1 to CP3, P=0.024) and decreased testosterone-cortisol ratio (PP1 to PP2, P=0.005). The present findings suggest that the internal TL variations over an annual multipeak traditional periodization did not influence the resting mucosal immune-endocrinal responses in young judo athletes. PMID:28349036

  20. Predicting Antidisease Immunity Using Proteome Arrays and Sera from Children Naturally Exposed to Malaria*

    PubMed Central

    Finney, Olivia C.; Danziger, Samuel A.; Molina, Douglas M.; Vignali, Marissa; Takagi, Aki; Ji, Ming; Stanisic, Danielle I.; Siba, Peter M.; Liang, Xiawu; Aitchison, John D.; Mueller, Ivo; Gardner, Malcolm J.; Wang, Ruobing


    Malaria remains one of the most prevalent and lethal human infectious diseases worldwide. A comprehensive characterization of antibody responses to blood stage malaria is essential to support the development of future vaccines, sero-diagnostic tests, and sero-surveillance methods. We constructed a proteome array containing 4441 recombinant proteins expressed by the blood stages of the two most common human malaria parasites, P. falciparum (Pf) and P. vivax (Pv), and used this array to screen sera of Papua New Guinea children infected with Pf, Pv, or both (Pf/Pv) that were either symptomatic (febrile), or asymptomatic but had parasitemia detectable via microscopy or PCR. We hypothesized that asymptomatic children would develop antigen-specific antibody profiles associated with antidisease immunity, as compared with symptomatic children. The sera from these children recognized hundreds of the arrayed recombinant Pf and Pv proteins. In general, responses in asymptomatic children were highest in those with high parasitemia, suggesting that antibody levels are associated with parasite burden. In contrast, symptomatic children carried fewer antibodies than asymptomatic children with infections detectable by microscopy, particularly in Pv and Pf/Pv groups, suggesting that antibody production may be impaired during symptomatic infections. We used machine-learning algorithms to investigate the relationship between antibody responses and symptoms, and we identified antibody responses to sets of Plasmodium proteins that could predict clinical status of the donors. Several of these antibody responses were identified by multiple comparisons, including those against members of the serine enriched repeat antigen family and merozoite protein 4. Interestingly, both P. falciparum serine enriched repeat antigen-5 and merozoite protein 4 have been previously investigated for use in vaccines. This machine learning approach, never previously applied to proteome arrays, can be used to

  1. Predicting antidisease immunity using proteome arrays and sera from children naturally exposed to malaria.


    Finney, Olivia C; Danziger, Samuel A; Molina, Douglas M; Vignali, Marissa; Takagi, Aki; Ji, Ming; Stanisic, Danielle I; Siba, Peter M; Liang, Xiawu; Aitchison, John D; Mueller, Ivo; Gardner, Malcolm J; Wang, Ruobing


    Malaria remains one of the most prevalent and lethal human infectious diseases worldwide. A comprehensive characterization of antibody responses to blood stage malaria is essential to support the development of future vaccines, sero-diagnostic tests, and sero-surveillance methods. We constructed a proteome array containing 4441 recombinant proteins expressed by the blood stages of the two most common human malaria parasites, P. falciparum (Pf) and P. vivax (Pv), and used this array to screen sera of Papua New Guinea children infected with Pf, Pv, or both (Pf/Pv) that were either symptomatic (febrile), or asymptomatic but had parasitemia detectable via microscopy or PCR. We hypothesized that asymptomatic children would develop antigen-specific antibody profiles associated with antidisease immunity, as compared with symptomatic children. The sera from these children recognized hundreds of the arrayed recombinant Pf and Pv proteins. In general, responses in asymptomatic children were highest in those with high parasitemia, suggesting that antibody levels are associated with parasite burden. In contrast, symptomatic children carried fewer antibodies than asymptomatic children with infections detectable by microscopy, particularly in Pv and Pf/Pv groups, suggesting that antibody production may be impaired during symptomatic infections. We used machine-learning algorithms to investigate the relationship between antibody responses and symptoms, and we identified antibody responses to sets of Plasmodium proteins that could predict clinical status of the donors. Several of these antibody responses were identified by multiple comparisons, including those against members of the serine enriched repeat antigen family and merozoite protein 4. Interestingly, both P. falciparum serine enriched repeat antigen-5 and merozoite protein 4 have been previously investigated for use in vaccines. This machine learning approach, never previously applied to proteome arrays, can be used to

  2. Modulation of the peripheral immune system after low-dose radon spa therapy: Detailed longitudinal immune monitoring of patients within the RAD-ON01 study.


    Rühle, Paul F; Wunderlich, Roland; Deloch, Lisa; Fournier, Claudia; Maier, Andreas; Klein, Gerhart; Fietkau, Rainer; Gaipl, Udo S; Frey, Benjamin


    The pain-relieving effects of low-dose radon therapies on patients suffering from chronic painful inflammatory diseases have been described for centuries. Even though it has been suggested that low doses of radiation may attenuate chronic inflammation, the underlying mechanisms remain elusive. Thus, the RAD-ON01 study was initiated to examine the effects of radon spa therapy and its low doses of alpha radiation on the human immune system. In addition to an evaluation of pain parameters, blood was drawn from 100 patients suffering from chronic painful degenerative musculoskeletal diseases before as well as 6, 12, 18, and 30 weeks after the start of therapy. We verified significant long-term pain reduction for the majority of patients which was accompanied by modulations of the peripheral immune cells. Detailed immune monitoring was performed using a multicolor flow cytometry-based whole blood assay. After therapy, the major immune cells were only marginally affected. Nevertheless, a small but long-lasting increase in T cells and monocytes was observed. Moreover, neutrophils, eosinophils and, in particular, dendritic cells were temporarily modulated after therapy. Regarding the immune cell subsets, cytotoxic T and NK cells, in particular, were altered. However, the most prominent effects were identified in a strong reduction of the activation marker CD69 on T, B, and NK cells. Simultaneously, the percentage of HLA-DR(+) T cells was elevated after therapy. The RAD-ON01 study showed for the first time a modulation of the peripheral immune cells following standard radon spa therapy. These modulations are in line with attenuation of inflammation.

  3. In vivo monitoring of transfected DNA, gene expression kinetics, and cellular immune responses in mice immunized with a human NIS gene-expressing plasmid.


    Son, Hye-Youn; Jeon, Yong-Hyun; Chung, June-Key; Kim, Chul-Woo


    In assessing the effectiveness of DNA vaccines, it is important to monitor: (1) the kinetics of target gene expression in vivo; and (2) the movement of cells that become transfected with the plasmid DNA used in the immunization of a subject. In this study, we used, as a visual imaging marker, expression of the transfected human sodium/iodide symporter (hNIS) gene, which enhances intracellular radio-pertechnetate (TcO4-) accumulation. After intradermal (i.d.) and systemic injection of mice with pcDNA-hNIS and radioactive Technetium-99m (Tc-99m), respectively, whole-body images were obtained by nuclear scintigraphy. The migration of mice cells transfected with the hNIS gene was monitored over a 2-week period by gamma-radioactivity counting of isolated cell populations and was demonstrated in peripheral lymphoid tissues, especially in the draining lymph nodes (dLNs). Beginning at 24 h after DNA inoculation and continuing for the 2-week monitoring period, hNIS-expressing cells were observed specifically in the T-cell-rich zones of the paracortical area of the dLNs. Over the same time period, high levels of INF-γ-secreting CD8 T-cells were found in the dLNs of the pcDNA-hNIS immunized mice. Tumor growth was also significantly retarded in the mice that received hNIS DNA immunization followed by inoculation with CT26 colorectal adenocarcinoma cells that had been transfected with the rat NIS gene (rNIS), which is 93% homologous to the hNIS gene. In conclusion, mouse cells transfected with hNIS DNA after i.d. immunization were found to traffic to the dLNs, and hNIS gene expression in these cells continued for at least 2 weeks post immunization. Furthermore, sequential presentation of NIS DNA to T-cells by migratory antigen presenting cells could induce NIS DNA-specific Th1 immune responses and thus retard the growth of NIS-expressing tumors.

  4. Minimal residual disease monitoring and immune profiling in multiple myeloma in elderly patients.


    Paiva, Bruno; Cedena, Maria-Teresa; Puig, Noemi; Arana, Paula; Vidriales, Maria-Belen; Cordon, Lourdes; Flores-Montero, Juan; Gutierrez, Norma C; Martín-Ramos, María-Luisa; Martinez-Lopez, Joaquin; Ocio, Enrique M; Hernandez, Miguel T; Teruel, Ana-Isabel; Rosiñol, Laura; Echeveste, María-Asunción; Martinez, Rafael; Gironella, Mercedes; Oriol, Albert; Cabrera, Carmen; Martin, Jesus; Bargay, Joan; Encinas, Cristina; Gonzalez, Yolanda; Van Dongen, Jacques J M; Orfao, Alberto; Bladé, Joan; Mateos, Maria-Victoria; Lahuerta, Juan José; San Miguel, Jesús F


    The value of minimal residual disease (MRD) in multiple myeloma (MM) has been more frequently investigated in transplant-eligible patients than in elderly patients. Because an optimal balance between treatment efficacy and toxicity is of utmost importance in patients with elderly MM, sensitive MRD monitoring might be particularly valuable in this patient population. Here, we used second-generation 8-color multiparameter-flow cytometry (MFC) to monitor MRD in 162 transplant-ineligible MM patients enrolled in the PETHEMA/GEM2010MAS65 study. The transition from first- to second-generation MFC resulted in increased sensitivity and allowed us to identify 3 patient groups according to MRD levels: MRD negative (<10(-5); n = 54, 34%), MRD positive (between <10(-4) and ≥10(-5); n = 20, 12%), and MRD positive (≥10(-4); n = 88, 54%). MRD status was an independent prognostic factor for time to progression (TTP) (hazard ratio [HR], 2.7; P = .007) and overall survival (OS) (HR, 3.1; P = .04), with significant benefit for MRD-negative patients (median TTP not reached, 70% OS at 3 years), and similar poorer outcomes for cases with MRD levels between <10(-4) and ≥10(-5) vs ≥10(-4) (both with a median TTP of 15 months; 63% and 55% OS at 3 years, respectively). Furthermore, MRD negativity significantly improved TTP of patients >75 years (HR, 4.8; P < .001), as well as those with high-risk cytogenetics (HR, 12.6; P = .01). Using second-generation MFC, immune profiling concomitant to MRD monitoring also contributed to identify patients with poor, intermediate, and favorable outcomes (25%, 61%, and 100% OS at 3 years, respectively; P = .01), the later patients being characterized by an increased compartment of mature B cells. Our results show that similarly to transplant candidates, MRD monitoring is one of the most relevant prognostic factors in elderly MM patients, irrespectively of age or cytogenetic risk. This trial was registered at as #NCT01237249.

  5. Towards measles elimination in Italy: monitoring herd immunity by Bayesian mixture modelling of serological data.


    Del Fava, Emanuele; Shkedy, Ziv; Bechini, Angela; Bonanni, Paolo; Manfredi, Piero


    The analysis of post-vaccination serological data poses nontrivial issues to the epidemiologists and policy makers who want to assess the effects of immunisation programmes. This is especially true for infections on the path to elimination as is the case for measles. We address these problems by using Bayesian Normal mixture models fitted to antibody counts data. This methodology allows us to estimate the seroprevalence of measles by age and, in contrast to conventional methods based on fixed cut-off points, to also distinguish between groups of individuals with different degrees of immunisation. We applied our methodology to two serological samples collected in Tuscany (Italy) in 2003 and in 2005-2006 respectively, i.e., before and after a large vaccination campaign targeted to school-age children. Besides showing the impact of the campaign, we were able to accurately identify a large pocket of susceptible individuals aged about 13-14 in 2005-2006, and a larger group of weakly immune individuals aged about 20 in 2005-2006. These cohorts therefore represent possible targets for further interventions towards measles elimination.

  6. Individual monitoring of immune responses in rainbow trout after cohabitation and intraperitoneal injection challenge with Yersinia ruckeri.


    M Monte, Milena; Urquhart, Katy; Secombes, Christopher J; Collet, Bertrand


    Yersinia ruckeri, the causative agent of enteric red mouth disease (ERM), is a widely studied pathogen in disease models using rainbow trout. This infection model, mostly based on intraperitoneally injection or bath immersion challenges, has an impact on both components (innate and adaptive) of the fish immune system. Although there has been much attention in studying its host-pathogen interactions, there is still a lack of knowledge regarding the impact of a cohabitation challenge. To tackle this we used a newly established non-lethal sampling method (by withdrawing a small amount of blood) in rainbow trout which allowed the individual immune monitoring before (non-infected) and after infection with Yersinia ruckeri either by intraperitoneal (i.p.) injection or by cohabitation (cohab). A range of key immune genes were monitored during the infection by real-time PCR, and results were compared between the two infection routes. Results indicated that inflammatory (IL-1β1 and IL-8) cytokines and certain antimicrobial peptides (cathelicidins) revealed a different pattern of expression between the two infected groups (i.p. vs cohab), in comparison to adaptive immune cytokines (IL-22, IFN-γ and IL-4/13A) and β-defensins. This suggests a different involvement of distinct immune markers according to the infection model, and the importance of using a cohabitation challenge as a more natural disease model that likely simulates what would occur in the environment.

  7. The Human ‘Treg MLR’: Immune Monitoring for Foxp3+ T Regulatory Cell Generation

    PubMed Central

    Levitsky, Josh; Miller, Joshua; Leventhal, Joseph; Huang, Xuemei; Flaa, Cathy; Wang, Edward; Tambur, Anat; Burt, Richard K.; Gallon, Lorenzo; Mathew, James M.


    Background Controversy exists about the conditions effecting the development of FOXP3 expressing T cells and their relevance in transplant recipients. Methods We generated CFSE-labeled CD4+CD25highFOXP3+ cells in MLRs (‘the Treg MLR’), with varying HLA disparities and cell components. Five color flow cytometry and 3H TdR uptakes were the readouts. Results 1) Despite lower Stimulation Indices (SI) than 2 DR-mismatched MLRs, 2 DR-matched MLRs generated >2 fold higher percentages when gating on proliferating CD4+CD25highFOXP3+ cells; 2) Even with low numbers of proliferating cells, autologous and HLA identical MLRs generated the highest FOXP3+ : FOXP3- cell ratios; 3) Elimination of either non-CD3+ responding cells (resulting in ‘direct presentation’ only) or responding CD25+ (Treg generating) cells increased the SI but inhibited proliferating CD4+CD25HighFOXP3+ cell development; 4) MLR-generated CD4+CD25HighFOXP3+ cells added as third components specifically inhibited the same freshly set MLR SI and caused recruitment of new CD4+CD25HighFOXP3+ cells. As an example of the ‘Treg MLR’ immune monitoring potential, addition of third component PBMC containing high percentages of CD4+CD25highFOXP3+ cells from an HLA identical kidney transplant recipient (in a tolerance protocol) caused donor-specific Treg MLR inhibition/recruitment. This was similar to the third component MLR Tregs generated entirely in vitro. Conclusion In the ‘Treg MLR’, the generation of CD4+CD25High FOXP3+ cells is more pronounced in the context of self-recognition (HLA matching, indirect presentation). These cells can be assayed for MLR inhibitory and Treg recruitment functions, so as to immunologically monitor allo-specific regulation after transplantation. PMID:19996930

  8. Platelet count recovery after intravenous immunoglobulin predicts a favorable outcome in children with immune thrombocytopenia

    PubMed Central

    Ji, Mi Hong; Kim, Sung Jin; Ahn, Hyo Seop


    Background Childhood immune thrombocytopenic purpura (ITP) is a common acquired bleeding disorder. Even though most children recover, either spontaneously or with therapy, 10-20% of newly diagnosed ITP cases have a chronic course beyond 12 months. This study evaluated whether clinical and laboratory findings can predict the response to intravenous immunoglobulin (IVIG) and progression to persistent or chronic ITP in children. Methods During the period between March 2003 and June 2015, we retrospectively analyzed 72 children, newly diagnosed with ITP, who received IVIG treatment. Peripheral blood counts were obtained at diagnosis and at 1, 3, 6, and 12 months after IVIG treatment. Results After 6 months of IVIG treatment, 14 of 72 patients (19.4%) had persistent ITP, and after 12 months, 7 of 40 patients (17.5%) had chronic ITP. Age at diagnosis, gender, history of viral infection, or vaccination before disease onset were not statistically correlated with platelet recovery at 6 and 12 months. However, a platelet count recovery of ≥100×103/µL at 1 and 3 months was significantly correlated with platelet recovery at 6 (P<0.001 and P<0.001, respectively) and 12 (P=0.007 and P=0.004, respectively) months. Conclusion This study demonstrated that early platelet count recovery, at 1 and 3 months after IVIG treatment, predicts a short disease duration and a favorable outcome in children with newly diagnosed ITP. Further investigation in a larger group of patients is warranted to validate these findings. PMID:27382553


    PubMed Central

    Moreira, A.; Lodo, L.; Nosaka, K.; Coutts, A.J.; Aoki, M.S.


    The study aim was to investigate the effect of a periodised pre-season training plan on internal training load and subsequent stress tolerance, immune-endocrine responses and physical performance in tennis players. Well-trained young tennis players (n = 10) were monitored across the pre-season period, which was divided into 4 weeks of progressive overloading training and a 1-week tapering period. Weekly measures of internal training load, training monotony and stress tolerance (sources and symptoms of stress) were taken, along with salivary testosterone, cortisol and immunoglobulin A. One repetition maximum strength, running endurance, jump height and agility were assessed before and after training. The periodised training plan led to significant weekly changes in training loads (i.e. increasing in weeks 3 and 4, decreasing in week 5) and post-training improvements in strength, endurance and agility (P < 0.05). Cortisol concentration and the symptoms of stress also increased in weeks 3 and/or 4, before returning to baseline in week 5 (P < 0.05). Conversely, the testosterone to cortisol ratio decreased in weeks 3 and 4, before returning to baseline in week 5 (P < 0.05). In conclusion, the training plan evoked adaptive changes in stress tolerance and hormonal responses, which may have mediated the improvements in physical performance. PMID:24744485

  10. Impaired cellular immune response to diphtheria and tetanus vaccines in children after thoracic transplantation.


    Urschel, Simon; Rieck, Birgit D; Birnbaum, Julia; Dalla Pozza, Robert; Rieber, Nikolaus; Januszewska, Katarzyna; Fuchs, Alexandra; West, Lori J; Netz, Heinrich; Belohradsky, Bernd H


    Safety and immunogenicity of diphtheria and tetanus booster vaccination were evaluated in 28 children after thoracic transplantation. Adverse events were documented in a patient diary. Blood was collected prior to and four wk after vaccination. Specific antibody concentrations were measured by ELISA. Lymphocytes were investigated for expression of activation markers (CD25, HLA-DR) by flow cytometry and proliferation assays with and without stimulation. Post-vaccination antibody titers were higher than prevaccination (p < 0.001), with more patients having protective antibody levels against diphtheria (p < 0.02) and tetanus (p < 0.001). There was no increased proliferation in non-stimulated or stimulated cultures after vaccination. The number of T-lymphocytes activated by the vaccination antigens was similar pre- and post-vaccination, whereas HLA-DR-expression on stimulated and non-stimulated CD4(+) T-cells increased significantly. Increase in antibodies was negatively correlated with tacrolimus dose, and impaired cellular immunity was associated with higher tacrolimus dose and steroid use. Adverse events were similar to the general population; serious adverse events and rejection did not occur. Vaccination with inactivated vaccines can be performed safely in immunosuppressed children after thoracic transplantation and induces protective antibody levels in the majority of patients. Impaired induction of specific cellular immunity is correlated with intensity of immunosuppression and may explain reduced sustainability of antibodies.

  11. Immune Dysfunction in Children with CHARGE Syndrome: A Cross-Sectional Study

    PubMed Central

    van der Burg, Mirjam; la Bastide-van Gemert, Sacha; Hogendorf, Lianne A.; van Ravenswaaij-Arts, Conny M. A.; Schölvinck, Elisabeth H.


    CHARGE syndrome is a variable, multiple congenital malformation syndrome. Patients with CHARGE syndrome have frequent infections that are presumed to be due to anatomical anomalies of the craniofacial region and upper airway, and cranial nerve problems resulting in swallowing difficulties and aspiration. The possible contribution of immunological abnormalities to these infections has not been systematically studied even though immune deficiencies have been described in patients with 22q11.2 deletion syndrome, a condition which shares remarkable clinical overlap with CHARGE syndrome. We assessed the frequency and nature of immune dysfunction in 24 children with genetically proven CHARGE syndrome. All patients, or their parents, completed a questionnaire on infectious history. Their immune system was extensively assessed through full blood counts, immunoglobulin levels, lymphocyte subpopulations, peripheral B- and T-cell differentiation, T-receptor excision circle (TREC) analysis, T-cell function, and vaccination responses. All CHARGE patients had a history of infections (often frequent), mainly otitis media and pneumonia, leading to frequent use of antibiotics and to hospital admissions. Decreased T-cell numbers were found in 12 (50%) patients, presumably caused by insufficient thymic output since TREC amounts were also diminished in CHARGE patients. Despite normal peripheral B-cell differentiation and immunoglobulin production in all patients, 83% of patients had insufficient antibody titers to one or more early childhood vaccinations. Based on our results, we recommend immunological evaluation of CHARGE patients with recurrent infections. PMID:26544072

  12. Income transfer policies and the impacts on the immunization of children: the Bolsa Família Program.


    Andrade, Mônica Viegas; Chein, Flávia; Souza, Laetícia Rodrigues de; Puig-Junoy, Jaume


    This paper investigates the impact of the Bolsa Família Program on the immunization of children from 0 to 6 years of age in Brazil and its regions. The Bolsa Família program is a conditional cash transfer program. One of its conditionalities is the compliance of children with the immunization schedule ordered by the Ministry of Health. The evaluation was performed using the Propensity Score Matching technique. We used data from a survey conducted in 2005 evaluating the program - Pesquisa de Avaliação de Impacto do Programa Bolsa Família. The main findings suggest that the Bolsa Família Program does not affect the immunization status of children.

  13. Coverage and predictors of routine immunization among 12-23 months old children in disaster affected communities in Pakistan

    PubMed Central

    Rehman, Shafiq Ur; Siddiqui, Amna Rehana; Ahmed, Jamil; Fatmi, Zafar; Shah, Sayed Masoom; Rahman, Aisha; Yousafzai, Mohammad Tahir


    Objectives: We aimed this study to determine the relationship of various factors related to poor immunization in children in an earthquake affected community. Materials and Methods: We conducted this cross-sectional study during 2007-2008 in Muzaffarabad district of Pakistani side of Kashmir. We selected 43 villages as clusters and in the second, 860 children between 12 and 24 months were selected from households through systematic sampling. Mothers of the eligible children were interviewed with a questionnaire. Logistic regression analysis was run to measure the association of various factors with appropriate immunization status of the children. Results: We found that 74% of children had completed their required doses of routine immunization. There were greater odds of a child being unvaccinated if the family lived at a distance that was to be covered in more than 10 min by any transport (odds ratio [OR]: 1.12, confidence interval [CI]: 1.08-1.17), mother of the child was not educated (OR:2.4, 1.3-4.4), child belonged to a low socioeconomic status (OR:3.5, CI: 2.1-6.3), family had any challenge or situation that where they could not take the child to a health facility for vaccination (OR: 2.3, CI: 1.4-3.7) and for a female child that belonged to minority ethnic group (OR: 1.7, CI: 1.0-2.5). Conclusion: Improvement in access of communities, especially of minority and poor in disaster-stricken, to immunization services and female education and awareness about the need for immunization in children could play a role in improving immunization coverage in such settings. PMID:28293154

  14. Association between age at antiretroviral therapy initiation and 24-month immune response in HIV-infected children in West Africa

    PubMed Central

    Desmonde, Sophie; Dicko, Fatoumata; Koueta, Fla; Eboua, Tanoh; Balestre, Eric; Amani-Bosse, Clarisse; Aka, Edmond A.; Lawson-Evi, Koko; Amorissani-Folquet, Madeleine; Kouakou, Kouadio; Koumakpai, Siriatou; Renner, Lorna; Sy, Haby Signaté; Valériane, Leroy


    Objective We describe the association between age at antiretroviral therapy (ART) initiation and 24-month CD4+ cell response in West African HIV-infected children. Methods All HIV-infected children from the IeDEA paediatric West African cohort, initiating ART, with at least two CD4+ cell count measurements, including one at ART initiation (baseline) were included. CD4+ cell gain on ART was estimated using a multivariable linear mixed model adjusted for baseline variables: age, CD4+ cell count, sex, first-line ART regimen. Kaplan-Meier survival curves and a Cox proportional hazards regression model compared immune recovery for age within 24 months post-ART. Results Of the 4808 children initiated on ART, 3014 were enrol led at a median age of 5.6 years; 61.2% were immunodeficient. After 12 months, children at least 4 years at baseline had significantly lower CD4+ cell gains compared with children less than 2 years, the reference group (P < 0.001). However, by 24 months, we observed higher CD4+cell gain in children who initiated ART between 3 and 4 years compared with those less than 2 years (P < 0.001). The 24-month CD4+ cell gain was also strongest in immunodeficient children at baseline. Among these children, 75% reached immune recovery: 12-month rates were significantly highest in all those aged 2–5 years at ART initiation compared with those less than 2 years. Beyond 12 months on ART, immune recovery was significantly lower in children initiated more than 5 years (adjusted hazard ratio: 0.69, 95% confidence interval: 0.56–0.86). Conclusion These results suggest that both the initiation of ART at the earliest age less than 5 years and before any severe immunodeficiency is needed for improving 24-month immune recovery on ART. PMID:24804858

  15. Integrated Immune

    NASA Technical Reports Server (NTRS)

    Crucian, Brian; Mehta, Satish; Stowe, Raymond; Uchakin, Peter; Quiriarte, Heather; Pierson, Duane; Sams, Clarnece


    This slide presentation reviews the program to replace several recent studies about astronaut immune systems with one comprehensive study that will include in-flight sampling. The study will address lack of in-flight data to determine the inflight status of immune systems, physiological stress, viral immunity, to determine the clinical risk related to immune dysregulation for exploration class spaceflight, and to determine the appropriate monitoring strategy for spaceflight-associated immune dysfunction, that could be used for the evaluation of countermeasures.

  16. Metacognitive monitoring and control processes in children with autism spectrum disorder: Diminished judgement of confidence accuracy.


    Grainger, Catherine; Williams, David M; Lind, Sophie E


    Metacognition consists of monitoring processes (the ability to accurately represent one's own mental states) and control processes (the ability to control one's cognitive processes effectively). Both processes play vital roles in self-regulated learning. However, currently it is unclear whether these processes are impaired in individuals with autism spectrum disorders (ASDs). This study aimed to assess metacognition in thirty-two children with ASD, and 30 IQ-/age-matched neurotypical children, using a judgment of confidence task. It was found that children with ASD showed diminished accuracy in their judgments of confidence, indicating metacognitive monitoring impairments in ASD. Children with ASD also used monitoring to influence control processes significantly less than neurotypical children, despite little evidence of impairments in overall control ability.

  17. A Cell-Based Systems Biology Assessment of Human Blood to Monitor Immune Responses after Influenza Vaccination

    PubMed Central

    Hoek, Kristen L.; Samir, Parimal; Howard, Leigh M.; Niu, Xinnan; Prasad, Nripesh; Galassie, Allison; Liu, Qi; Allos, Tara M.; Floyd, Kyle A.; Guo, Yan; Shyr, Yu; Levy, Shawn E.; Joyce, Sebastian; Edwards, Kathryn M.; Link, Andrew J.


    Systems biology is an approach to comprehensively study complex interactions within a biological system. Most published systems vaccinology studies have utilized whole blood or peripheral blood mononuclear cells (PBMC) to monitor the immune response after vaccination. Because human blood is comprised of multiple hematopoietic cell types, the potential for masking responses of under-represented cell populations is increased when analyzing whole blood or PBMC. To investigate the contribution of individual cell types to the immune response after vaccination, we established a rapid and efficient method to purify human T and B cells, natural killer (NK) cells, myeloid dendritic cells (mDC), monocytes, and neutrophils from fresh venous blood. Purified cells were fractionated and processed in a single day. RNA-Seq and quantitative shotgun proteomics were performed to determine expression profiles for each cell type prior to and after inactivated seasonal influenza vaccination. Our results show that transcriptomic and proteomic profiles generated from purified immune cells differ significantly from PBMC. Differential expression analysis for each immune cell type also shows unique transcriptomic and proteomic expression profiles as well as changing biological networks at early time points after vaccination. This cell type-specific information provides a more comprehensive approach to monitor vaccine responses. PMID:25706537

  18. A cell-based systems biology assessment of human blood to monitor immune responses after influenza vaccination.


    Hoek, Kristen L; Samir, Parimal; Howard, Leigh M; Niu, Xinnan; Prasad, Nripesh; Galassie, Allison; Liu, Qi; Allos, Tara M; Floyd, Kyle A; Guo, Yan; Shyr, Yu; Levy, Shawn E; Joyce, Sebastian; Edwards, Kathryn M; Link, Andrew J


    Systems biology is an approach to comprehensively study complex interactions within a biological system. Most published systems vaccinology studies have utilized whole blood or peripheral blood mononuclear cells (PBMC) to monitor the immune response after vaccination. Because human blood is comprised of multiple hematopoietic cell types, the potential for masking responses of under-represented cell populations is increased when analyzing whole blood or PBMC. To investigate the contribution of individual cell types to the immune response after vaccination, we established a rapid and efficient method to purify human T and B cells, natural killer (NK) cells, myeloid dendritic cells (mDC), monocytes, and neutrophils from fresh venous blood. Purified cells were fractionated and processed in a single day. RNA-Seq and quantitative shotgun proteomics were performed to determine expression profiles for each cell type prior to and after inactivated seasonal influenza vaccination. Our results show that transcriptomic and proteomic profiles generated from purified immune cells differ significantly from PBMC. Differential expression analysis for each immune cell type also shows unique transcriptomic and proteomic expression profiles as well as changing biological networks at early time points after vaccination. This cell type-specific information provides a more comprehensive approach to monitor vaccine responses.

  19. High Remission Rate of Chronic Immune Thrombocytopenia in Children: Result of 20-Year Follow-Up

    PubMed Central

    Kim, Chae Young; Lee, Eun Hye


    Purpose This study examined the outcomes of children with chronic immune thrombocytopenia (ITP). Materials and Methods We retrospectively analyzed the medical records of all patients diagnosed with ITP from January 1992 to December 2011 at our institution. Results A total of 128 patients (64%) satisfied the criteria for newly diagnosed ITP, 31 (15%) for persistent ITP, and 41 (21%) for chronic ITP. The median age at diagnosis was 4.5 years (range, 1 month to 18 years). The median platelet count at diagnosis was 32×109/L. A comparison of the initial treatment data from 2001 to 2011 with those from 1992 to 2000 showed that the number of bone marrow examinations decreased, whereas observation increased. Chronic ITP presented at an older age than newly diagnosed and persistent ITP (6.6 years vs. 3.8 years vs. 4.1 years, respectively); however, the difference did not reach statistical significance (p=0.17). The probability of complete remission of chronic ITP was 50% and 76% at 2 and 5 years after diagnosis, respectively. Patients aged <1 year at diagnosis had a significantly better prognosis than did older patients (hazard ratio, 3.86; p=0.02). Conclusion Children with chronic ITP showed a high remission rate after long-term follow-up. This study suggests that invasive treatments such as splenectomy in children with chronic ITP can be delayed for 4 to 5 years if thrombocytopenia and therapeutic medication do not affect the quality of life. PMID:26632392

  20. Altered immune parameters correlate with infection-related hospitalizations in children with Down syndrome.


    Martínez, Elizabeth; Castañeda, Diana; Jaramillo, Sonia; Iregui, Alejandro; Quiñonez, Tatiana; Rodríguez, Jairo A; Herrera, Eddy; Gómez, Ana Milena; Rondón, Martin A; Prieto, Juan Carlos; Angel, Juana; Franco, Manuel A; Mesa, Martha C


    In addition to previously studied immunological variables, the relative expression of IFNGR2, IFNAR1, CD18, and CD275 (all encoded in chromosome 21) on circulating leucocytes and multifunctional T cells (evaluated by an intracellular cytokine/proliferation assay) were compared between children with Down syndrome (DS) and healthy controls (HC). As previously reported, numbers of lymphocytes, CD4(+) T cells, Treg cells, B cells, and levels of serum IgM were decreased, and levels of IgG and IgA were increased in children with DS. Moreover, the relative expression of CD18 on T and B cells (previously and not previously reported, respectively) were elevated in DS children (p⩽0.01). Age and numbers of B and Treg cells moderately correlated with retrospectively identified infection related hospitalizations (rho: 0.300-0.460, p⩽0.003). Age and the numbers of Treg cells also correlated with prospectively identified infection related hospitalizations. Future studies are necessary to clarify the role of these parameters in the immunity of DS patients.

  1. Developing immune function assays to monitor fish health in field studies

    SciTech Connect

    Rice, C.D.; Kergosien, D.H.; Adams, S.M. |


    The East Fork Poplar Creek system, a 24km long stream in TN that receives point source discharges of contaminants near its headwaters, was chosen to evaluate a field approach to fish immunotoxicology. Previous studies in this stream have shown that cytochrome P4501A activity, liver somatic indices, macrophage aggregates, and parasitic liver lesions are significantly elevated in sunfish with the degree of impact decreasing with distance from the contaminant source. Red-breasted sunfish were collected between May 23 and June 3 of 1994. Captured fish were anesthetized in MS-222 and processed by two different methods. One group was sacrificed at each sampling station, weights and lengths recorded, and the spleen and anterior kidney tissues removed and placed in buffer on ice. The other group was kept in MS-222 for 2 hr and transported to the laboratory. The spleen and anterior kidney from each fish were then prepared as a single cell suspension and shipped overnight to Mississippi State University. Cells were then washed by centrifugation and resuspended in appropriate media to evaluate PMA-stimulated phagocyte oxidative burst and non-specific cytotoxic cell (NCC) activity against K562 tumor targets. Oxidative burst responses were dramatically suppressed in both groups at stations near the headwaters but returned to reference levels further downstream. There were no differences between treatment groups at each station. NCC activities did not follow gradient-response patterns observed with phagocyte oxidative burst data and there were inconsistent differences between treatment groups at each station. These data show that simple immune function assays, such as phagocyte oxidative burst responses, can be used as an ancillary biomarker in fish health monitoring.

  2. Immunizing the World's Children by 1990. Hearing before the International Task Force of the Select Committee on Hunger. House of Representatives, Ninety-Ninth Congress, First Session.

    ERIC Educational Resources Information Center

    Congress of the U.S., Washington, DC.

    A hearing was held to update information on progress toward immunizing the world's children against diphtheria, whooping cough, tetanus, polio, measles, and tuberculosis. Immunization programs are regarded as essential in the effort to break the infection-malnutrition cycle in children in developing nations. Witnesses at the hearing included…

  3. Exposure to Violence, Parental Monitoring, and Television Viewing as Contributors to Children's Psychological Trauma

    ERIC Educational Resources Information Center

    Singer, Mark I.; Flannery, Daniel J.; Guo, Shenyang; Miller, David; Leibbrandt, Sylvia


    This study examined the relative contributions of exposure to violence, parental monitoring, and television viewing habits to children's self-reported symptoms of psychological trauma. Children in grades 3-8 in 11 public schools completed an anonymous self-report questionnaire administered during usual school hours. The final sample was comprised…

  4. Children Can Accurately Monitor and Control Their Number-Line Estimation Performance

    ERIC Educational Resources Information Center

    Wall, Jenna L.; Thompson, Clarissa A.; Dunlosky, John; Merriman, William E.


    Accurate monitoring and control are essential for effective self-regulated learning. These metacognitive abilities may be particularly important for developing math skills, such as when children are deciding whether a math task is difficult or whether they made a mistake on a particular item. The present experiments investigate children's ability…

  5. Epidemiological characteristics and immune status of children with Respiratory Syncytial Virus.


    Ye, Qing; Shao, Wen-Xia; Shang, Shi-Qiang; Pan, Yan-Xiang; Shen, Hong-Qiang; Chen, Xue-Jun


    Respiratory Syncytial Virus (RSV) infections are the dominant cause of pneumonia in children. In order to determine the epidemiological characteristics and immune status of children with Respiratory Syncytial Virus, a prospective study was performed among patients with RSV infection. Comparisons between RSV pneumonia group and normal control group, RSV pneumonia group had lower IL-2 (median levels, pg/ml: 3.8 vs. 5.1, P < 0.01), and higher IL-4 (median levels, pg/ml: 3.2 vs. 2.4, P < 0.01), IL-10 (median levels, pg/ml: 12.2 vs. 2.3, P < 0.01), and IFN-γ (median levels, pg/ml: 13.4 vs. 4.6, P < 0.01). The level of IgE among pneumonia patients caused by RSV increased sharply (median levels, mg/L: 48.1 vs. 8.8, P < 0.01). Another amazing finding is that after birth, the degree of IgE of the children infected by RSV increases gradually with age. This effect is at its peak in 0.6 years old. The IgE and eosinophil levels were higher when patients suffered from RSV pneumonia with wheeze (IgE median levels, IU/ml: with wheeze: 72.74 vs. without wheeze: 11.5, P < 0.05; eosinophil median levels, ×10(9) /l: with wheeze: 0.21 vs. without wheeze: 0.05, P < 0.05). The main morbidity crowd is the children under the age of 1 year old. The downregulation of IL2 and the upregulation of IL-4, IL-10, IFN-γ, and IgE happen after RSV infection.

  6. A survey of children affected by ectomermal dysplasia syndromes shows an increased prevalence of atopic disorders and immune deficiency

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Ectodermal dysplasia (ED) syndromes are rare genetic disorders that affect the development of tissues derived from the embryonic ectoderm. Studies and anecdotal experience have indicated that atopic disorders (AD) and immune deficiencies (ID) may be associated with ED in children. Some ED genotypes ...

  7. Immune response to influenza vaccine in children with inflammatory bowel disease

    PubMed Central

    Lu, Ying; Jacobson, Denise L.; Ashworth, Lori A.; Grand, Richard J.; Meyer, Anthony L.; McNeal, Monica M.; Gregas, Matt C.; Burchett, Sandra K.; Bousvaros, Athos


    OBJECTIVE Patients with inflammatory bowel disease (IBD) frequently receive immunosuppressive therapy. The immune response in these patients to vaccines has not been well studied. We conducted a prospective, open label study to evaluate the serologic response to influenza vaccine in children with IBD. METHODS Serum was obtained from 146 children and young adults with IBD (96 CD, 47 UC, 3 IC) for baseline influenza titer, immediately followed by immunization with trivalent [A/Solomon Islands/3/2006 (H1N1), A/Wisconsin/67/2005 (H3N2), and B/Malaysia/2506/2004 (B)] inactivated influenza vaccine. Subjects returned for repeat titers 3-9 weeks later. Seroprotection against each influenza strain was defined as hemagglutination inhibition (HAI) titer ≥40. Patients were categorized as non-immunosuppressed [(NIS), aminosalicylates only, antibiotics only, or no therapy] or immunosuppressed [(IS), any immunosuppressive agent]. IS patients were further subcategorized as: (1) tacrolimus; (2) TNF-alpha inhibitor; (3) immunomodulator; and (4) corticosteroids only. RESULTS More patients were seroprotected against strains A/H1N1 and A/H3N2 than B strain (p<0.02), regardless of immunosuppression status. The proportion seroprotected and geometric mean titers at post-vaccination were similar between NIS and IS groups for all three strains. Subanalysis of patients not seroprotected at baseline showed that those receiving anti-TNF therapy were less likely seroprotected against strain B (14%) compared to patients in the NIS group (39%, p=0.025). There were no serious vaccine-associated adverse events. CONCLUSION Influenza vaccination produces a high prevalence of seroprotection in IBD patients, particularly against A strains. The vaccine is well tolerated. Routine influenza vaccination in IBD patients is recommended, irrespective of whether patients receive immunosuppressive medications. PMID:19174786

  8. [The probiotic correction of microecological and immune disorders in gastroduodenal pathology in children].


    Lykova, E A; Bondarenko, V M; Izachik, Iu A; Izachik, N A; Grigor'ev, A V; Murashov, A O; Abramov, N A


    The state of microbiocenosis was studied and the level of immunoglobulins was determined in the gastric juice and feces of children with chronic diseases of the digestive system. In 20% of patients an increase in the contamination of the gastric biotope with opportunistic microflora was established. The isolation rate of Helicobacter pylori was 56%. The detection of H. pylori was found to be accompanied by the aggravation of the form and course of gastritis. In cases of Helicobacter-associated pathology the deficiency of Lactobacillus sp. in the stomach was established, which was accompanied by their deficiency and absence in feces. The study also revealed a decrease in the population level of Bifidobacterium sp. with a simultaneous increase in the population of opportunistic enterobacteria and changes in the state of local immunity: the decreased level of SIgA in most samples and the decreased level of IgG in the presence of H. pylori. The correction of microecological and immune disturbances with probiotic preparations, containing bifidobacteria (bifidumbacterin-forte) and lactobacilli, yielded good results.

  9. Impact of HIV Infection and Anti-Retroviral Therapy on the Immune Profile of and Microbial Translocation in HIV-Infected Children in Vietnam

    PubMed Central

    Bi, Xiuqiong; Ishizaki, Azumi; Nguyen, Lam Van; Matsuda, Kazunori; Pham, Hung Viet; Phan, Chung Thi Thu; Ogata, Kiyohito; Giang, Thuy Thi Thanh; Phung, Thuy Thi Bich; Nguyen, Tuyen Thi; Tokoro, Masaharu; Pham, An Nhat; Khu, Dung Thi Khanh; Ichimura, Hiroshi


    CD4+ T-lymphocyte destruction, microbial translocation, and systemic immune activation are the main mechanisms of the pathogenesis of human immunodeficiency virus type 1 (HIV) infection. To investigate the impact of HIV infection and antiretroviral therapy (ART) on the immune profile of and microbial translocation in HIV-infected children, 60 HIV vertically infected children (31 without ART: HIV(+) and 29 with ART: ART(+)) and 20 HIV-uninfected children (HIV(−)) aged 2–12 years were recruited in Vietnam, and their blood samples were immunologically and bacteriologically analyzed. Among the HIV(+) children, the total CD4+-cell and their subset (type 1 helper T-cell (Th1)/Th2/Th17) counts were inversely correlated with age (all p < 0.05), whereas regulatory T-cell (Treg) counts and CD4/CD8 ratios had become lower, and the CD38+HLA (human leukocyte antigen)-DR+CD8+- (activated CD8+) cell percentage and plasma soluble CD14 (sCD14, a monocyte activation marker) levels had become higher than those of HIV(−) children by the age of 2 years; the CD4/CD8 ratio was inversely correlated with the plasma HIV RNA load and CD8+-cell activation status. Among the ART(+) children, the total CD4+-cell and Th2/Th17/Treg-subset counts and the CD4/CD8 ratio gradually increased, with estimated ART periods of normalization being 4.8–8.3 years, whereas Th1 counts and the CD8+-cell activation status normalized within 1 year of ART initiation. sCD14 levels remained high even after ART initiation. The detection frequency of bacterial 16S/23S ribosomal DNA/RNA in blood did not differ between HIV-infected and -uninfected children. Thus, in children, HIV infection caused a rapid decrease in Treg counts and the early activation of CD8+ cells and monocytes, and ART induced rapid Th1 recovery and early CD8+-cell activation normalization but had little effect on monocyte activation. The CD4/CD8 ratio could therefore be an additional marker for ART monitoring. PMID:27490536

  10. Lot quality assurance sampling to monitor supplemental immunization activity quality: an essential tool for improving performance in polio endemic countries.


    Brown, Alexandra E; Okayasu, Hiromasa; Nzioki, Michael M; Wadood, Mufti Z; Chabot-Couture, Guillaume; Quddus, Arshad; Walker, George; Sutter, Roland W


    Monitoring the quality of supplementary immunization activities (SIAs) is a key tool for polio eradication. Regular monitoring data, however, are often unreliable, showing high coverage levels in virtually all areas, including those with ongoing virus circulation. To address this challenge, lot quality assurance sampling (LQAS) was introduced in 2009 as an additional tool to monitor SIA quality. Now used in 8 countries, LQAS provides a number of programmatic benefits: identifying areas of weak coverage quality with statistical reliability, differentiating areas of varying coverage with greater precision, and allowing for trend analysis of campaign quality. LQAS also accommodates changes to survey format, interpretation thresholds, evaluations of sample size, and data collection through mobile phones to improve timeliness of reporting and allow for visualization of campaign quality. LQAS becomes increasingly important to address remaining gaps in SIA quality and help focus resources on high-risk areas to prevent the continued transmission of wild poliovirus.

  11. Parental concern about vaccine safety in Canadian children partially immunized at age 2: a multivariable model including system level factors.


    MacDonald, Shannon E; Schopflocher, Donald P; Vaudry, Wendy


    Children who begin but do not fully complete the recommended series of childhood vaccines by 2 y of age are a much larger group than those who receive no vaccines. While parents who refuse all vaccines typically express concern about vaccine safety, it is critical to determine what influences parents of 'partially' immunized children. This case-control study examined whether parental concern about vaccine safety was responsible for partial immunization, and whether other personal or system-level factors played an important role. A random sample of parents of partially and completely immunized 2 y old children were selected from a Canadian regional immunization registry and completed a postal survey assessing various personal and system-level factors. Unadjusted odds ratios (OR) and adjusted ORs (aOR) were calculated with logistic regression. While vaccine safety concern was associated with partial immunization (OR 7.338, 95% CI 4.138-13.012), other variables were more strongly associated and reduced the strength of the relationship between concern and partial immunization in multivariable analysis (aOR 2.829, 95% CI 1.151-6.957). Other important factors included perceived disease susceptibility and severity (aOR 4.629, 95% CI 2.017-10.625), residential mobility (aOR 3.908, 95% CI 2.075-7.358), daycare use (aOR 0.310, 95% CI 0.144-0.671), number of needles administered at each visit (aOR 7.734, 95% CI 2.598-23.025) and access to a regular physician (aOR 0.219, 95% CI 0.057-0.846). While concern about vaccine safety may be addressed through educational strategies, this study suggests that additional program and policy-level strategies may positively impact immunization uptake.

  12. Cytomegalovirus Infection May Contribute to the Reduced Immune Function, Growth, Development, and Health of HIV-Exposed, Uninfected African Children

    PubMed Central

    Filteau, Suzanne; Rowland-Jones, Sarah


    With increasing access to antiretroviral therapy (ART) in Africa, most children born to HIV-infected mothers are not themselves HIV-infected. These HIV-exposed, uninfected (HEU) children are at increased risk of mortality and have immune, growth, development, and health deficits compared to HIV-unexposed children. HEU children are known to be at higher risk than HIV-unexposed children of acquiring cytomegalovirus (CMV) infection in early life. This risk is largely unaffected by ART and is increased by breastfeeding, which itself is critically important for child health and survival. Early CMV infection, namely in utero or during early infancy, may contribute to reduced growth, altered or impaired immune functions, and sensory and cognitive deficits. We review the evidence that CMV may be responsible for the health impairments of HEU children. There are currently no ideal safe and effective interventions to reduce postnatal CMV infection. If a clinical trial showed proof of the principle that decreasing early CMV infection improved health and development of HEU children, this could provide the impetus needed for the development of better interventions to improve the health of this vulnerable population. PMID:27446087

  13. Immunizing nomadic children and livestock – Experience in North East Zone of Somalia

    PubMed Central

    Kamadjeu, Raoul; Mulugeta, Abraham; Gupta, Dhananjoy; Abshir Hirsi, Abdirisak; Belayneh, Asalif; Clark-Hattingh, Marianne; Adams, Clement; Abed, Payenda; Kyeyune, Brenda; Ahmed, Tajudin; Salih, Mohamed; Biaou, Cyprien; Toure, Brigitte


    Nomads and pastoralists represent around 30% of the population of North East zone of Somalia (Puntland) and have very limited access to basic health including immunization. During the 2013–2014 polio outbreak in Somalia, an increase number of polio cases notified health services among these underserved communities highlighted the urgent need to devise innovative strategies to reach them. Harnessing the high demand for veterinary services among pastoralist communities, the Ministry of Health and the Ministry of Livestock, with support from UNICEF, WHO and FAO launched an integrated human and animal vaccination campaign on 19 October 2014. Over 30 days, 20 social mobilizers conducted shelter to shelter social mobilization and interpersonal communication for nomadic/pastoralist hamlets, 20 human vaccination teams, accompanied by local community elders, traveled with animal vaccination teams to administer polio and measles vaccination to pastoralist communities in the 5 regions of Puntland. 26,393 children (0 to 10 years) received Oral Polio Vaccine (OPV) out of which 34% for the first time ever; 23,099 were vaccinated against measles. and 12,556 Vitamin A. Despite various operational challenges and a significantly higher operational cost of $6.2 per child reached with OPV, the integrated human and animal vaccination campaign was effective in reaching the unvaccinated children from nomadic and pastoralist communities of Somalia. PMID:26365693

  14. Bleeding tendency and platelet function during treatment with romiplostim in children with severe immune thrombocytopenic purpura.


    Suntsova, Elena V; Demina, Irina M; Ignatova, Anastasia A; Ershov, Nikolay M; Trubina, Natalia M; Dobrynina, Juliya; Serkova, Irina V; Supik, Zhanna S; Orekhova, Ekaterina V; Hachatryan, Lili A; Kotskaya, Natalia N; Pshonkin, Aleksey V; Maschan, Aleksey A; Novichkova, Galina A; Panteleev, Mikhail A


    It has been suggested that platelet function in chronic immune thrombocytopenic purpura (ITP) may be abnormal. Thrombopoietin mimetics used for treatment can affect it, but the data remain limited. We investigated platelet function of 20 children diagnosed with severe ITP (aged 1-16 years, 12 females and eight males). Platelet functional activity in whole blood was characterized by flow cytometry before and after stimulation with SFLLRN plus collagen-related peptide. Levels of CD42b, PAC1, and CD62P, but not CD61 or annexin V, were significantly increased (P < 0.05) in resting platelets of patients before treatment compared with healthy donors. On average, PAC1 and CD62P in patients after activation were also significantly elevated, although some patients failed to activate integrins. Romiplostim (1-15 μg/kg/week s.c.) was prescribed to seven patients, with clinical improvement in six. Interestingly, one patient had clinical improvement without platelet count increase. Eltrombopag (25-75 mg/day p.o.) was given to four patients, with positive response in one. Others switched to romiplostim, with one stable positive response, one unstable positive response, and one non-responding. Platelet quality improved with romiplostim treatment, and their parameters approached the normal values. Our results suggest that platelets in children with severe ITP are pre-activated and abnormal, but improve with treatment.

  15. Subcutaneous anti-D globulin application is a safe treatment option of immune thrombocytopenia in children.


    Trebo, Monika M; Frey, Eva; Gadner, Helmut; Minkov, Milen


    Subcutaneous (sc) administration of anti-D seems to offer the same efficacy as intravenous administration but with less side effects. Here we report our experience with sc anti-D for pediatric immune thrombocytopenia (ITP). A total of 12 children with a median age of 11.2 years had been treated by sc anti-D. They received a median of 2 sc anti-D applications (range 1-31) with a dosage of 250-375 IE/kg body weight. Only in one out of a total of 102 single applications, a minimal and self-limited side effect (chills) had been observed. The mean platelet count was almost doubled after sc anti-D (p < 0.0001). After a median follow-up of 11.4 months, all patients are alive without major bleeding and stay well. We conclude that sc anti-D: is not only an efficient means of treating ITP in children but is also a safe and convenient one.

  16. Immunizing nomadic children and livestock--Experience in North East Zone of Somalia.


    Kamadjeu, Raoul; Mulugeta, Abraham; Gupta, Dhananjoy; Abshir Hirsi, Abdirisak; Belayneh, Asalif; Clark-Hattingh, Marianne; Adams, Clement; Abed, Payenda; Kyeyune, Brenda; Ahmed, Tajudin; Salih, Mohamed; Biaou, Cyprien; Toure, Brigitte


    Nomads and pastoralists represent around 30% of the population of North East zone of Somalia (Puntland) and have very limited access to basic health including immunization. During the 2013-2014 polio outbreak in Somalia, an increase number of polio cases notified health services among these underserved communities highlighted the urgent need to devise innovative strategies to reach them. Harnessing the high demand for veterinary services among pastoralist communities, the Ministry of Health and the Ministry of Livestock, with support from UNICEF, WHO and FAO launched an integrated human and animal vaccination campaign on 19 October 2014. Over 30 days, 20 social mobilizers conducted shelter to shelter social mobilization and interpersonal communication for nomadic/pastoralist hamlets, 20 human vaccination teams, accompanied by local community elders, traveled with animal vaccination teams to administer polio and measles vaccination to pastoralist communities in the 5 regions of Puntland. 26,393 children (0 to 10 years) received Oral Polio Vaccine (OPV) out of which 34% for the first time ever; 23,099 were vaccinated against measles. and 12,556 Vitamin A. Despite various operational challenges and a significantly higher operational cost of $6.2 per child reached with OPV, the integrated human and animal vaccination campaign was effective in reaching the unvaccinated children from nomadic and pastoralist communities of Somalia.

  17. Children's understanding of the immune system: Integrating the cognitive-developmental and intuitive theories' perspectives

    NASA Astrophysics Data System (ADS)

    Landry-Boozer, Kristine L.

    Traditional cognitive-developmental researchers have provided a large body of evidence supporting the stage-like progression of children's cognitive development. Further, from this body of research comes evidence that children's understanding of HIV/AIDS develops in much the same way as their understanding of other illness-related concepts. Researchers from a newer perspective assert that biological concepts develop from intuitive theories. In general, as children are exposed to relevant content and have opportunities to organize this information, their theories become more accurate and differentiated. According to this perspective, there are no broad structural constraints on developing concepts, as asserted by cognitive developmental theorists. The purpose of the current study was two-fold: to provide support for both theoretical perspectives, while at the same time to explore children's conceptualizations of the immune system, which has not been done previously in the cognitive-developmental literature. One hundred ninety children ranging in age from 4 years old through 11 years old, and a group of adults, participated. Each participant was interviewed regarding health concepts and the body's function in maintaining health. Participants were also asked to report if they had certain experiences that would have led to relevant content exposure. Qualitative analyses were utilized to code the interviews with rubrics based on both theoretical perspectives. Quantitative analyses consisted of a series of univariate ANOVAs (and post hoc tests when appropriate) examining all three coding variables (accuracy, differentiation, and developmental level) across various age-group combinations and exposure groups. Results of these analyses provided support for both theoretical perspectives. When the data were analyzed for developmental level by all ages, a stage-like progression consistent with Piagetian stages emerged. When accuracy and differentiation were examined (intuitive

  18. Immune reconstitution during maintenance therapy in children with acute lymphoblastic leukemia, relation to co-existing infection.


    El-Chennawi, Farha A; Al-Tonbary, Youssef A; Mossad, Youssef M; Ahmed, Mona A


    Immunosuppression is a major side effect of cancer chemotherapy. The process of immune reconstitution can be dissimilar according to the nature of the disease, type and doses of drugs, and age of the patients. Recently, several studies have examined immune reconstitution in children and young adults after intensive chemotherapy for solid tumours or stem cell transplantation. The aim of the present study is to evaluate immune reconstitution (cellular and humoral) in children with acute lymphoblastic leukemia during the maintenance phase of therapy and to correlate between the complicating infections and the abnormalities in immune system during reconstitution. To achieve this goal, 36 children with acute lymphoblastic leukemia (24 females and 12 males) in the maintenance phase of therapy with 12 healthy children of matched age and sex served as a control group were recruited in this study. The patients were taken consecutively from the Hematology/Oncology Outpatient Clinic of Mansoura University Children's Hospital (MUCH). They were subjected to thorough history taking, clinical examination and laboratory investigations in the form of: complete blood count, serum creatinine, liver function tests and evaluation of the immune system by estimation of CD3, CD4, CD8, CD19 and CD56 (cellular immunity) by flow cytometry and immunoglobulins A, M and G (humoral immunity) at the first and the third month of maintenance therapy. The results of the study documented presence and persistence of leucopenia and lymphopenia during maintenance therapy with decreased medians of CD3, CD4 and CD8 from the first to the third month of therapy and in comparison to the control group. The other markers CD19, CD56, IgA, IgM, IgG and CD4/CD8 ratio showed increasing median from the first to the third month of therapy. Also we detect a significant correlation between infection and CD19 and serum IgM at the first month and between infection and CD19, IgM and CD4/CD8 ratio at the third month of


    EPA Science Inventory

    Conventional, regulatory-based air monitoring is expensive and, thus, conducted at one or few locations in a city. This provides limited info on intra-urban variability and spatial distribution of air pollution. Research-oriented urban network monitoring has progressed with inc...

  20. Utility of ambulatory blood pressure monitoring in children and adolescents.


    Graves, John W; Althaf, Mohammed Mahdi


    Diagnosis of hypertension is critically dependent on accurate blood pressure measurement. "Accurate" refers to carefully following the guidelines for blood pressure measurement laid out for children and adults to minimize observer and subject errors that commonly occur in clinical blood pressure measurement. Accurate blood pressure measurement is more important in children and adolescents as the misdiagnosis of hypertension may have a life-long adverse impact on insurability and employment. Automated blood pressure measurement offers multiple advantages in achieving high-quality blood pressure determinations by reducing observer errors. The most commonly used form of automated blood pressure measurement is 24-h ambulatory blood pressure measurement (ABPM). Information on ABPM in children has grown exponentially over the last decade. Normative data exists for diagnosis of hypertension in children using ABPM including a novel method for determining normal values with the LMS method. There is further information about the utility of different determinants of 24-h blood pressure such as dipping status, morning surge and blood pressure load. ABPM has been able to detect significant differences in blood pressure in many disease states in children including chronic renal failure, polycystic kidney disease, solitary functioning kidney, and after renal transplantation. Increasingly nonambulatory automated blood pressure determinations have been used in management of hypertension in children. Although nonambulatory automated readings lack information about nocturnal blood pressure or blood pressure during daily activity, studies have suggested that home automated blood pressure measurements are a helpful adjunct to the usual office blood pressure reading.

  1. Effect of age on the risk of Fever and seizures following immunization with measles-containing vaccines in children.


    Rowhani-Rahbar, Ali; Fireman, Bruce; Lewis, Edwin; Nordin, James; Naleway, Allison; Jacobsen, Steven J; Jackson, Lisa A; Tse, Alison; Belongia, Edward A; Hambidge, Simon J; Weintraub, Eric; Baxter, Roger; Klein, Nicola P


    IMPORTANCE The first dose of live attenuated measles-containing vaccines is associated with an increased risk of febrile seizures 7 to 10 days following immunization among 12- to 23-month-old children. The combination measles, mumps, rubella, and varicella vaccine is associated with a 2-fold increased risk of febrile seizures 7 to 10 days following immunization compared with the separately administered measles, mumps, and rubella and varicella vaccines. It is unknown whether the magnitude of these increased risks depends on age at immunization. OBJECTIVE To examine the potential modifying effect of age on the risk of fever and seizures following immunization with measles-containing vaccines. DESIGN, SETTING, AND PARTICIPANTS Retrospective cohort study at 8 Vaccine Safety Datalink sites of a total of 840,348 children 12 to 23 months of age who had received a measles-containing vaccine from 2001 through 2011. EXPOSURES Any measles-containing vaccines and measles-containing vaccines by type. MAIN OUTCOMES AND MEASURES Fever and seizure events occurring during a 42-day postimmunization observation period. RESULTS In the analysis of any measles-containing vaccines, the increased risk of seizures during the 7- to 10-day risk interval, using the remainder of the observation period as the control interval, was significantly greater among older children (relative risk, 6.5; 95% CI, 5.3-8.1; attributable risk, 9.5 excess cases per 10,000 doses; 95% CI, 7.6-11.5) than among younger children (relative risk, 3.4; 95% CI, 3.0-3.9; attributable risk = 4.0 excess cases per 10,000 doses; 95% CI, 3.4-4.6). The relative risk of postimmunization fever was significantly greater among older children than among younger children; however, its attributable risk was not. In the analysis of vaccine type, measles, mumps, rubella, and varicella vaccine was associated with a 1.4-fold increase in the risk of fever and 2-fold increase in the risk of seizures compared with measles, mumps, and

  2. Influenza immunization rates in children and teenagers in Polish cities: conclusions from the 2009/2010 season.


    Kuchar, Ernest; Nitsch-Osuch, Aneta; Zycinska, Katarzyna; Miskiewicz, Katarzyna; Szenborn, Leszek; Wardyn, Kazimierz


    The aim of this study was to determine influenza vaccine coverage among children aged 0-18 years in inner city practices in Poland in the 2009/2010 season and factors that might have influenced low vaccination coverage. A retrospective review of 11,735 vaccination charts of children aged 0-18 from seven randomly selected general practices in the capital city of Warsaw and one large practice in the city of Wroclaw was performed. We calculated the numbers of children who were vaccinated in the 2009/2010 season and analyzed the age distribution of vaccinated children. We also reviewed the vaccination history in patients who were vaccinated against influenza including: previous influenza vaccinations, modification (widening) of standard immunization scheme, and a proportion of children who completed the recommended two-dose schedule of vaccination. In the calculations, 95% confidence intervals were used. Out of the total of 11,735 children surveyed, 362 (3.1%, CI: 2.8-3.4%) were vaccinated against influenza in the 2009/2010 season. For 115 of these 362 (31.8%, CI: 27.0-36.6%) children it was their first vaccination against influenza. The mean age of a vaccinated child was 6.0 ± 4.3 years. Children aged 2-5 were most commonly vaccinated (153/362, 42.3%, CI: 37.2-47.4%), while infants (aged 6-12 months) were vaccinated rarely (15/362, 4.4%, CI: 2.2-6.2%). In the group of children younger than 8 years (86/362 children) who were vaccinated for the first time in their life only 29/86 (33.7%, CI: 23.7-43.7%) completed the recommended two-dose schedule. In conclusion, the importance of vaccinating children against influenza is hugely understated in Poland. General physicians should actively recommend annual influenza immunization of children. Recommendations of National Immunization Program concerning influenza vaccine should be clearer, simpler, and easier to implement.

  3. Neurodevelopmental delay among children under the age of three years at immunization clinics in Lagos State, Nigeria - Preliminary report.


    Bakare, Muideen O; Bello-Mojeed, Mashudat A; Munir, Kerim M; Ogun, Oluwayemi C; Eaton, Julian


    Late diagnosis and interventions characterize childhood neurodevelopmental disorders in Sub-Saharan Africa. This has negatively impacted on the prognosis of the children with neurodevelopmental disorders. This study examined the prevalence and pattern of neurodevelopmental delays among children under the age of 3 years attending immunization clinics in Lagos State, Nigeria and also affords opportunity of early follow-up and interventions, which had been documented to improve prognosis. The study involved two stage assessments; which consisted of first phase screening of the children for neurodevelopmental delays in immunization clinics at primary healthcare centers Lagos State, Nigeria and second phase which consists of definitive clinical evaluation and follow-up interventions for children screened positive for neurodevelopmental delays. Twenty seven (0.9%) of a total of 3,011 children under the age of 3 years were screened positive for neurodevelopmental delays and subsequently undergoing clinical evaluation and follow-up interventions. Preliminary working diagnoses among these children include cerebral palsy, autism spectrum disorder trait, nutritional deficiency, Down syndrome and Non-specific neurodevelopmental delay with co-morbid seizure disorder accounting for 33.3%, 14.8%, 18.5%, 7.4% and 25.9% respectively. This is a preliminary report that would be followed up with information on medium and long term intervention phase.

  4. Immune response to influenza vaccination in children treated with methotrexate or/and tumor necrosis factor-alpha inhibitors.


    Woerner, Andreas; Sauvain, Marie-Josèphe; Aebi, Christoph; Otth, Margrit; Bolt, Isabel B


    In children treated with immunosuppressive medication such as methotrexate and tumor necrosis factor-alpha (TNF-α) inhibitors, additional immunizations are recommended because of increased susceptibility to infections. However, it is unclear if adequate antibody response to vaccinations can be established in children receiving methotrexate and/or TNF-α inhibitors. In a prospective open label study, we assessed seroprotection and seroconversion following influenza vaccination during 2 seasons (6 strains) in 36 children with autoimmune disease treated either with methotrexate (n=18), TNF-α inhibitors (n=10) or both (n=8) and a control group of 16 immunocompetent children. Influenza antibody titers were determined by hemagglutinin inhibition assay, before and 4-8 weeks after vaccination. Post-vaccination seroprotection (defined as a titer ≥1:40) did not significantly differ between immunosuppressed and immunocompetent subjects. Seroconversion, defined as the change from a nonprotective (< 1:40) to a protective titer (≥1:40) with at least a 4-fold titer increase, was less likely to occur in immunosuppressed patients, although no significant difference from the control group was established. Safety evaluation of vaccination showed no serious adverse events. Children receiving methotrexate and/or TNF-α inhibitors can be safely and effectively immunized against influenza, with a seroprotection after vaccination comparable to immunocompetent children.

  5. Plasmodium falciparum Clearance Is Rapid and Pitting Independent in Immune Malian Children Treated With Artesunate for Malaria

    PubMed Central

    Ndour, Papa Alioune; Lopera-Mesa, Tatiana M.; Diakité, Seidina A. S.; Chiang, Serena; Mouri, Oussama; Roussel, Camille; Jauréguiberry, Stéphane; Biligui, Sylvestre; Kendjo, Eric; Claessens, Antoine; Ciceron, Liliane; Mazier, Dominique; Thellier, Marc; Diakité, Mahamadou; Fairhurst, Rick M.; Buffet, Pierre A.


    Background In Plasmodium falciparum–infected patients treated with artemisinins, parasitemia declines through so-called pitting, an innate splenic process that transforms infected red blood cells (iRBCs) into once-infected RBCs (O-iRBCs). Methods We measured pitting in 83 French travelers and 42 Malian children treated for malaria with artesunate. Results In travelers, O-iRBCs peaked at 107.7% initial parasitemia. In Malian children aged 1.5–4 years, O-iRBCs peaked at higher concentrations than in children aged 9–13 years (91.60% vs 31.95%; P = .0097). The parasite clearance time in older children was shorter than in younger children (P = .0001), and the decline in parasitemia in children aged 1.5–4 years often started 6 hours after treatment initiation, a lag phase generally absent in infants and older children. A 6-hour lag phase in artificial pitting of artesunate-exposed iRBCs was also observed in vitro. The proportion of iRBCs recognized by autologous immunoglobulin G (IgG) correlated with the parasite clearance time (r = −0.501; P = .0006) and peak O-iRBC concentration (r = −0.420; P = .0033). Conclusions Antimalarial immunity correlates with fast artemisinin-induced parasite clearance and low pitting rates. In nonimmune populations, artemisinin-induced P. falciparum clearance is related to pitting and starts after a 6-hour lag phase. In immune populations, passively and naturally acquired immune mechanisms operating faster than pitting may exist. This mechanism may mitigate the emergence of artemisinin-resistant P. falciparum in Africa. PMID:25183768

  6. The Food and Drug Administration's Post-Licensure Rapid Immunization Safety Monitoring program: strengthening the federal vaccine safety enterprise.


    Nguyen, Michael; Ball, Robert; Midthun, Karen; Lieu, Tracy A


    In 2009, the Department of Health and Human Services created the new Post-Licensure Rapid Immunization Safety Monitoring (PRISM) program, which used data from national health insurance plans and immunization registries to monitor the safety of the H1N1 influenza vaccine. PRISM has now been integrated into the FDA's Mini-Sentinel pilot program. It strengthens the federal vaccine safety enterprise in two important ways. First, PRISM monitors the largest US general population cohort designated for active surveillance of vaccine safety. Second, PRISM links data from health plans with data from state and city immunization registries, which were a crucial source of exposure data in the H1N1 vaccine evaluation. The Mini-Sentinel data that support PRISM are updated quarterly, and PRISM can conduct medical record review for validation of computerized data. The FDA has structured PRISM as a program that includes specific vaccine evaluations, development of an operational framework to guide the design of vaccine safety evaluations, and development of new statistical methods. A human papillomavirus vaccine, Gardasil, and two rotavirus vaccines, RotaTeq and Rotarix, have been chosen for surveillance in the current cycle because their evaluations would benefit most from PRISM's large cohort size. The PRISM program creates important opportunities by offering a robust, responsive new surveillance program with features complementary to existing systems. Methodological and logistical lessons can be shared among PRISM and other surveillance systems, offering potential synergies. FDA and PRISM will work to maximize the program's unique strengths and contributions to a unified federal vaccine safety enterprise.

  7. Circulating Immune Complex Levels are Associated with Disease Severity and Seasonality in Children with Malaria from Mali

    PubMed Central

    Thomas, Bolaji N.; Diallo, Dapa A.; Noumsi, Ghislain T.; Moulds, Joann M.


    Complement receptor one (CR1) is essential for removing circulating immune complexes (CIC), with malaria infection contributing to the formation of large amounts of CIC. We investigated CIC levels in children with malaria, of varying severity and seasonality. Two hundred age and sex-matched severe and mild malaria cases were studied during and after active disease. Pediatric controls had increased CIC levels (mean = 32 μg mEq/mL) compared to adult controls (mean = 26.9 μg mEq/mL). The highest levels of CIC were reported in severe malaria (mean = 39 μg mEq/mL). Higher levels of CIC were recorded in younger children and those with low E-CR1 copy numbers. Our data suggest that low levels of E-CR1 copy numbers, found in children with severe malaria, may adversely affect the ability to remove IC. Furthermore, the high background for circulating immune complex imply that Malian children are under constant assault by other pathogens that evoke a strong immune response. PMID:22837639

  8. Instant Childhood Immunization Schedule


    ... Recommendations Why Immunize? Vaccines: The Basics Instant Childhood Immunization Schedule Recommend on Facebook Tweet Share Compartir Get ... date. See Disclaimer for additional details. Based on Immunization Schedule for Children 0 through 6 Years of ...

  9. Effects of hepatitis B vaccine boosters on anti-HBs-negative children after primary immunization.


    Lu, Shunshun; Ren, Jingjing; Li, Qian; Jiang, Zhenggang; Chen, Yongdi; Xu, Kaijin; Ruan, Bing; Yang, Shigui; Xie, Tiansheng; Yang, Linna; Li, Jing; Yao, Jun


    This study was aimed at evaluating the changes of hepatitis B surface antibody (anti-HBs) titer after booster vaccinations in 5-15-year-old children with negative antibodies (<10 mIU/mL). 225 subjects (mean age, 9.28 ± 2.95 years) included in the study consisted of 123 males and 102 females, with a complete hepatitis B vaccination during infancy. The participants were divided into 3 groups according to their pre-booster anti-HBs level: Group I, <0.1 mIU/mL; Group II, 0.1 to <1.0 mIU/mL; Group III, 1.0 to <10.0 mIU/mL. All the participants were administered 3 doses of booster hepatitis B vaccination (0-1-6 month, 20 µg), and changes in the levels of antibodies were examined at 4 time-points (one month after the first and the third dose, one year and 5 years after the third dose). The seroprotective rate (defined as anti-HBs ≥10.0 mIU/mL) among 225 subjects at the 4 time-points were 93.8%, 100%, 83.6% and 73.4%, respectively (χ(2) = 90.29, p < 0.05). The seroprotective rate (≥10 mIU/mL) and anti-HBs geometric mean titer (GMT) in Group III were always higher than those in the other 2 groups (all p < 0.05). The immune effect of a 3 -dose booster revaccination is good, and the booster-induced immune response was correlated with the pre-booster titer level, and ≥1.0 mIU/mL ensuring a robust positive response, whereas titers below this value may indicate the need for a course of booster vaccination.

  10. [Sensitivity to antibiotics monitoring of oral microflora in practically sound children and patients with chronic gastroduodenitis].


    Gavrilova, O A; Davydov, B N; Chervinets, Iu V; Chervinets, V M


    Characteristic of oral microflora in practically sound children and patients with chronic gastroduodenitis was offered. Microflora singled out from ill persons differed by pathogenicity in previously opportunistic pathogenic forms. Monitoring of sensitivity and resistivity to antibiotics of the singled out microflora in practically sound children and ill with chronic gastroduodenitis was presented. When treating oral diseases one should take into account the high resistivity to antibiotics (especially to benzilpenicillin) of opportunistic pathogenic forms.

  11. Monitoring Variability and Change in Children's Spelling Strategies

    ERIC Educational Resources Information Center

    Farrington-Flint, Lee; Stash, Amanda; Stiller, James


    This study examined the role of variability and change in children's strategy performance within the context of spelling. The spelling ability of 34 eight- to nine-year-olds was examined using an experimental spelling task comprising 45 items, which varied with regard to rime unit frequency. The spelling task incorporated a series of consistent,…

  12. New Approaches to Assessment and Monitoring of Concussion in Children

    ERIC Educational Resources Information Center

    Gioia, Gerard A.; Isquith, Peter K.; Schneider, Jillian C.; Vaughan, Christopher G.


    A mild traumatic brain injury (TBI) constitutes the overwhelming majority of brain injury cases in children and adolescents. This article focuses on cerebral concussion, which can be viewed as a subset of mild TBI, which, until recently, has received limited attention in the pediatric assessment literature. Few extant measures appropriate to this…

  13. Monitoring of regional lung ventilation using electrical impedance tomography after cardiac surgery in infants and children.


    Krause, Ulrich; Becker, Kristin; Hahn, Günter; Dittmar, Jörg; Ruschewski, Wolfgang; Paul, Thomas


    Electrical impedance tomography (EIT) is a noninvasive method to monitor regional lung ventilation in infants and children without using radiation. The objective of this prospective study was to determine the value of EIT as an additional monitoring tool to assess regional lung ventilation after pediatric cardiac surgery for congenital heart disease in infants and children. EIT monitoring was performed in a prospective study comprising 30 pediatric patients who were mechanically ventilated after cardiac surgery. Data were analyzed off-line with respect to regional lung ventilation in different clinical situations. EIT data were correlated with respirator settings and arterial carbon dioxide (CO2) partial pressure in the blood. In 29 of 30 patients, regional ventilation of the lung could sufficiently and reliably be monitored by means of EIT. The effects of the transition from mechanical ventilation to spontaneous breathing after extubation on regional lung ventilation were studied. After extubation, a significant decrease of relative impedance changes was evident. In addition, a negative correlation of arterial CO2 partial pressure and relative impedance changes could be shown. EIT was sufficient to discriminate differences of regional lung ventilation in children and adolescents after cardiac surgery. EIT reliably provided additional information on regional lung ventilation in children after cardiac surgery. Neither chest tubes nor pacemaker wires nor the intensive care unit environment interfered with the application of EIT. EIT therefore may be used as an additional real-time monitoring tool in pediatric cardiac intensive care because it is noninvasive.

  14. Monitoring Immune System Function and Reactivation of Latent Viruses in the Artificial Gravity Pilot Study

    NASA Technical Reports Server (NTRS)

    Mehta, Satish K.; Crucian, Brian; Pierson, Duane L.; Sams, Clarence; Stowe, Raymond P.


    Numerous studies have indicated that dysregulation of the immune system occurs during or after spaceflight. Using 21 day -6 degrees head-down tilt bed rest as a spaceflight analog, this study describes the effects of artificial gravity (AG) as a daily countermeasure on immunity, stress and reactivation of clinically important latent herpes viruses. The specific aims were to evaluate psychological and physiological stress, to determine the status of the immune system, and to quantify reactivation of latent herpes viruses. Blood, saliva, and urine samples were collected from each participating subject at different times throughout the study. An immune assessment was performed on all treatment and control subjects that consisted of a comprehensive peripheral immunophenotype analysis, intracellular cytokine profiles and a measurement of T cell function. The treatment group displayed no differences throughout the course of the study with regards to peripheral leukocyte distribution, cytokine production or T cell function. Shedding of Epstein barr virus (EBV), Cytomegalovirus (CMV), and Varicella zoster virus (VZV) was quantified by real time PCR in saliva and urine samples, respectively. There was no significant difference in CMV DNA in the treatment group as compared to the control group. EBV and VZV on the other hand showed a mild reactivation during the study. There were no significant differences in cortisol between the control and treatment groups. In addition, no significant differences between antiviral antibody titers (EBV-VCA, -EA, -EBNA, CMV) or tetramer-positive (EBV, CMV) were found between the two groups. EBV DNA copies in blood were typically undetectable but never exceeded 1,500 copies per 106 PBMCs. Overall, these data indicate that the artificial gravity countermeasure and the 21 day head-down tilt bed rest regimen had no observable adverse effect on immune function.

  15. Monitoring Immune System Function and Reactivation of Latent Viruses in the Artificial Gravity Pilot Study

    NASA Technical Reports Server (NTRS)

    Mehta, Satish; Crusian, Brian; Pierson, Duane; Sams, Clarence; Stowe, Raymond


    Numerous studies have indicated that dysregulation of the immune system occurs during or after spaceflight. Using 21 day -6 deg. head-down tilt bed rest as a spaceflight analog, this study describes the effects of artificial gravity as a daily countermeasure on immunity, stress and reactivation of clinically important latent herpes viruses. The specific aims were to evaluate psychological and physiological stress, to determine the status of the immune system and to quantify reactivation of latent herpes viruses. Blood, saliva, and urine samples were collected from each participating subject at different times throughout the study. An immune assessment was performed on all treatment and control subjects that consisted of a comprehensive peripheral immunophenotype analysis, intracellular cytokine profiles and a measurement of T cell function. The treatment group displayed no differences throughout the course of the study with regards to peripheral leukocyte distribution, cytokine production or T cell function. Shedding of EBV and CMV was quantified by real time PCR in saliva and urine samples, respectively. There was no significant difference in CMV DNA in the treatment group as compared to the control group. EBV and VZV on the other hand showed a mild reactivation during the study. There were no significant differences in plasma cortisol between the control and treatment groups. In addition, no significant differences between antiviral antibody titers (EBV-VCA, -EA, -EBNA, CMV) or tetramer-positive (EBV, CMV) were found between the two groups. EBV DNA copies in blood were typically undetectable but never exceeded 1,500 copies per 10(exp 6) PBMCs. These data indicate that the artificial gravity countermeasure and the 21 day head-down tilt bed rest regimen had no observable adverse effect on immune function.

  16. Role of 24-h ambulatory blood pressure monitoring in children with chronic kidney disease

    PubMed Central

    Gupta, D.; Chaturvedi, S.; Chandy, S.; Agarwal, I.


    Hypertension is common in children with chronic kidney disease (CKD) and is a major determinant of CKD progression. Ambulatory blood pressure monitoring (ABPM) has been proposed to be better in detecting hypertension as compared to casual blood pressure (CBP). This study aims to study the usefulness of ABPM in detecting masked hypertension, evaluating the adequacy of blood pressure (BP) control and predicting left ventricular hypertrophy (LVH) amongst children with CKD. A prospective cross-sectional study of 46 children with stage 3–5 CKD was conducted at the Pediatric Nephrology department of a tertiary hospital in South India. All children underwent CBP, ABPM and an echocardiography. Results were categorized as normal BP; confirmed hypertension; masked hypertension and white coat hypertension. Out of 46 children studied, 11 were undergoing dialysis. While 39.1% children had stage 3 and 4 CKD each, 21.7% had stage 5 CKD. Masked hypertension was detected in 19.6% and 21.7% had confirmed hypertension. Thirty-four (73.9%) children were already receiving antihypertensive medication. In these, CBP was elevated in 23.5% and ABP in 47%. Among children with hypertension as defined by ABPM, LVH was detected in 32.2%. We found that higher the number of abnormal ABPM indices (assessed by BP Index, nocturnal dipping and BP Load) higher the likelihood of LVH (P = 0.046). ABPM is better in detecting hypertension and monitoring adequacy of treatment in children with CKD. The high prevalence of masked hypertension and its association with LVH supports early echocardiography and ambulatory BP monitoring to evaluate cardiovascular risks in this population. PMID:26664211

  17. Long-term antibody response and immunologic memory in children immunized with hepatitis B vaccine at birth.


    Saffar, M J; Rezai, M S


    Four hundred and fifty three healthy children immunized with a course of hepatitis B vaccine beginning at birth were tested at 10-11 years of age for persistence of anti-hepatitis B-S antigen antibody (anti-HBs); and responses of children without protective antibody to different doses of hepatitis B vaccine booster were evaluated. Although nearly 42% of them were not seroprotected, but most of boosted subjects (87.3%) retained robust immunologic memory and rapidly retained a protective anti-HBs antibody titer of at least 10 IU/L after booster vaccination.

  18. Management of children and adolescents with primary immune thrombocytopenia: controversies and solutions.


    Kühne, T; Imbach, P


    The management including diagnostic procedures, prophylaxis, treatment and follow-up of patients with primary immune thrombocytopenia (ITP) in childhood is controversial due to limited clinical data, difficulties in the estimation of individual bleeding risk and heterogeneity of pathophysiology potentially causing various treatment responses. Advances in the management of children include increased international collaborations, improved quality of diagnosis and treatment, increased clinical data, refinement of consensus statements where clinical evidence is absent, new drugs and last but not least establishment of watch-and-wait strategies. The Intercontinental Cooperative ITP Study Group promotes international collaboration since more than 10 years based on a worldwide network and experience in registries. Future considerations include concentration of available resources, strengthening international collaboration, focusing on most important scientific and clinical questions, such as identification of the subgroup of patients that benefits most from prophylactic platelet-enhancing treatments and investigation of treatment endpoints other than concepts solely based on the platelet count, including bleeding symptoms, health-related quality of life and economical aspects of treatments.

  19. Biological monitoring of organophosphorus pesticide exposure among children of agricultural workers in central Washington State.

    PubMed Central

    Loewenherz, C; Fenske, R A; Simcox, N J; Bellamy, G; Kalman, D


    Children up to 6 years of age who lived with pesticide applicators were monitored for increased risk of pesticide exposure: 48 pesticide applicator and 14 reference families were recruited from an agricultural region of Washington State in June 1995. A total of 160 spot urine samples were collected from 88 children, including repeated measures 3-7 days apart. Samples were assayed by gas chromatography flame photometric detector for dimethylphosphate metabolites. Dimethylthiophosphate (DMTP) was the dominant metabolite. DMTP levels were significantly higher in applicator children than in reference children (p = 0.015), with median concentrations of 0.021 and 0.005 microg/ml, respectively; maximum concentrations were 0.44 and 0.10 microg/ml, respectively. Percentages of detectable samples were 47% for applicator children and 27% for reference children. A marginally significant trend of increasing concentration was observed with decreasing age among applicator children (p = 0.060), and younger children within these families had significantly higher concentrations when compared to their older siblings (p = 0.040). Applicator children living less than 200 feet from an orchard were associated with higher frequency of detectable DMTP levels than nonproximal applicator children (p =0.036). These results indicate that applicator children experienced higher organophosphorus pesticide exposures than did reference children in the same community and that proximity to spraying is an important contributor to such exposures. Trends related to age suggest that child activity is an important variable for exposure. It is unlikely that any of the observed exposures posed a hazard of acute intoxication. This study points to the need for a more detailed understanding of pesticide exposure pathways for children of agricultural workers. Images Figure 1. Figure 2. Figure 3. PMID:9405329

  20. Children's Comprehension Monitoring of Multiple Situational Dimensions of a Narrative

    ERIC Educational Resources Information Center

    Wassenburg, Stephanie I.; Beker, Katinka; van den Broek, Paul; van der Schoot, Menno


    Narratives typically consist of information on multiple aspects of a situation. In order to successfully create a coherent representation of the described situation, readers are required to monitor all these situational dimensions during reading. However, little is known about whether these dimensions differ in the ease with which they can be…

  1. The development of android - based children's nutritional status monitoring system

    NASA Astrophysics Data System (ADS)

    Suryanto, Agus; Paramita, Octavianti; Pribadi, Feddy Setio


    The calculation of BMI (Body Mass Index) is one of the methods to calculate the nutritional status of a person. The BMI calculation has not yet widely understood and known by the public. In addition, people should know the importance of progress in the development of child nutrition each month. Therefore, an application to determine the nutritional status of children based on Android was developed in this study. This study restricted the calculation for children with the age of 0-60 months. The application can run on a smartphone or tablet PC with android operating system due to the rapid development of a smartphone or tablet PC with android operating system and many people own and use it. The aim of this study was to produce a android app to calculate of nutritional status of children. This study was Research and Development (R & D), with a design approach using experimental studies. The steps in this study included analyzing the formula of the Body Mass Index (BMI) and developing the initial application with the help of a computer that includes the design and manufacture of display using Eclipse software. This study resulted in android application that can be used to calculate the nutritional status of children with the age 0-60 months. The results of MES or the error calculation analysis using body mass index formula was 0. In addition, the results of MAPE percentage was 0%. It shows that there is no error in the calculation of the application based on the BMI formula. The smaller value of MSE and MAPE leads to higher level of accuracy.

  2. RHD zygosity predicts degree of platelet response to anti-D immune globulin treatment in children with immune thrombocytopenia.


    Despotovic, Jenny M; McGann, Patrick T; Smeltzer, Matthew; Aygun, Banu; Ware, Russell E


    Anti-D immunoglobulin is a common front-line treatment for childhood immune thrombocytopenia (ITP) that typically results in a rapid and significant increase in platelet count. Unpredictable treatment responses and interpatient variability limit more widespread use. We hypothesized that anti-D response variability is influenced by RHD gene zygosity and erythrocyte D antigen expression. We compared RHD zygosity and quantitative D antigen expression to anti-D treatment results. Hemizygous RHD subjects demonstrated significantly higher platelet increases and peak platelet counts than homozygous RHD subjects. Future studies should investigate the mechanisms by which RHD zygosity and D antigen expression affect platelet responses to anti-D immunoglobulin.

  3. Perfluoroalkyl and Polyfluoroalkyl Substances and Indicators of Immune Function in Children Aged 12 – 19 years: NHANES

    PubMed Central

    Stein, Cheryl R.; McGovern, Kathleen J.; Pajak, Ashley M.; Maglione, Paul J.; Wolff, Mary S.


    Background Perfluoroalkyl and polyfluoroalkyl substances (PFAS) are immunotoxic in laboratory studies. Humans studies of immune effects are inconsistent. Using the U.S. National Health and Nutrition Examination Survey (NHANES) we examined PFAS serum concentration and indicators of prevalent immune function among 12 to 19 year old children. Methods In this cross-sectional study we examined PFAS serum concentration in relation to measles, mumps, and rubella antibody concentrations in NHANES 1999 – 2000 and 2003 – 2004 (n=1,191) and to allergic conditions and allergic sensitization in NHANES 2005 – 2006 (n=640). Results In adjusted, survey-weighted models, a doubling of perfluorooctane sulfonate (PFOS) concentration among seropositive children was associated with a 13.3% (95% CI −19.9, −6.2) decrease in rubella antibody concentration and a 5.9% decrease in mumps antibody concentration (95% CI −9.9, −1.6). We observed no adverse association between exposure and current allergic conditions, including asthma. Children with higher PFOS concentration were less likely to be sensitized to any allergen (OR 0.74, 95% CI 0.58, 0.95). Conclusion Increased exposure to several PFAS was associated with lower levels to mumps and rubella antibody concentrations, especially among seropositive individuals. These lower antibody concentrations may indicate a less robust response to vaccination or greater waning of vaccine-derived immunity over time. PMID:26492286

  4. Tolerability of modified tick-borne encephalitis vaccine FSME-IMMUN "NEW" in children: results of post-marketing surveillance.


    Pavlova, Borislava G; Loew-Baselli, Alexandra; Fritsch, Sandor; Poellabauer, Eva Maria; Vartian, Nina; Rinke, Ingeborg; Ehrlich, Hartmut J


    A new, highly purified, inactivated tick-borne encephalitis (TBE) vaccine FSME-IMMUN "NEW" has been developed by Baxter using a production virus seed derived from chick embryo cells instead of mouse brain. In clinical trials, the vaccine was shown to be highly immunogenic and well tolerated in adults and children. Following licensure in 2001, the tolerability of half the adult dose of FSME-IMMUN "NEW" (1.2 microg antigen/0.25 ml) was investigated in a post-marketing surveillance in 1899 children aged 6 months to 12 years. Rectal body temperature was measured daily for 3 days after the first vaccination. An overall fever rate of 20.3% (95% CI=18.5; 22%) was observed, which was mostly mild in nature (>38.0 to IMMUN "NEW" vaccine at a dose of 1.2 microg antigen/0.25 ml is safe for the first vaccination in children.

  5. Accurate and High-Coverage Immune Repertoire Sequencing Reveals Characteristics of Antibody Repertoire Diversification in Young Children with Malaria

    NASA Astrophysics Data System (ADS)

    Jiang, Ning

    Accurately measuring the immune repertoire sequence composition, diversity, and abundance is important in studying repertoire response in infections, vaccinations, and cancer immunology. Using molecular identifiers (MIDs) to tag mRNA molecules is an effective method in improving the accuracy of immune repertoire sequencing (IR-seq). However, it is still difficult to use IR-seq on small amount of clinical samples to achieve a high coverage of the repertoire diversities. This is especially challenging in studying infections and vaccinations where B cell subpopulations with fewer cells, such as memory B cells or plasmablasts, are often of great interest to study somatic mutation patterns and diversity changes. Here, we describe an approach of IR-seq based on the use of MIDs in combination with a clustering method that can reveal more than 80% of the antibody diversity in a sample and can be applied to as few as 1,000 B cells. We applied this to study the antibody repertoires of young children before and during an acute malaria infection. We discovered unexpectedly high levels of somatic hypermutation (SHM) in infants and revealed characteristics of antibody repertoire development in young children that would have a profound impact on immunization in children.

  6. Clinical Features and Treatment Outcomes of Primary Immune Thrombocytopenic Purpura in Hospitalized Children Under 2-Years Old

    PubMed Central

    Farhangi, H; Ghasemi, A; Banihashem, A; Badiei, Z; Jarahi, L; Eslami, G; Langaee, T


    Background Immune thrombocytopenic purpura (ITP) is the most prevalent cause of thrombocytopenia in children. Despite the importance of ITP in children under 2-years old, only a few publications are available in the literature.ITP usually presents itself as isolated thrombocytopenia and mucocutaneous bleeding. Materials and Methods This study was conducted on 187 under 2-year-old children diagnosed with ITP and treated at Dr. Sheikh Hospital from 2004 to 2011.In this retrospective study, clinical symptoms, laboratory findings, history of viral infections, vaccination history, and treatment efficacy in children under 2-years old with ITP were investigated.Patients were followed for one year after being discharged from the hospital. Results The risk of the disease developing into chronic form was higher in older children (0.001). ITP in children under 3-months old was significantly associated with vaccination (p=0.007). There was no significant differences between male and female patients in regards to newly diagnosed ITP, persistent, and chronic disease status (p = 0.21). No significant difference in bleeding symptoms was observed between patients under 3-months old and 3 to 24-months old (p=0.18). Conclusion Infantile ITP respond favorably to treatment. The risk of the disease developing into chronic form is higher in 3-to-24-month-old children compared to under-three-month olds. PMID:27222699

  7. Immunization-Safety Monitoring Systems for the 2009 H1N1 Monovalent Influenza Vaccination Program

    DTIC Science & Technology


    Division of Infectious Diseases and Dept of Laboratory Medicine, Boston, MA; eImmunization Safety Office, Division of Healthcare Quality Promotion...Centers for Disease Control and Prevention, Atlanta, GA; fMilitary Vaccine Agency, United States Army, Falls Church, VA; gNational Center for Patient...Department of Defense VAERS—Vaccine Adverse Event Reporting System CDC—Centers for Disease Control and Prevention VSD—Vaccine Safety Datalink RCA—rapid cycle

  8. Assessment of factors associated with complete immunization coverage in children aged 12-23 months: a cross-sectional study in Nouna district, Burkina Faso

    PubMed Central

    Sanou, Aboubakary; Simboro, Seraphin; Kouyaté, Bocar; Dugas, Marylène; Graham, Janice; Bibeau, Gilles


    Background The Expanded Program on Immunization (EPI) is still in need of improvement. In Burkina Faso in 2003, for example, the Nouna health district had an immunization coverage rate of 31.5%, compared to the national rate of 52%. This study identifies specific factors associated with immunization status in Nouna health district in order to advance improved intervention strategies in this district and in those with similar environmental and social contexts. Methods A cross-sectional study was undertaken in 41 rural communities and one semi-urban area (urban in the text). Data on 476 children aged 12 to 23 months were analyzed from a representative sample of 489, drawn from the Nouna Health Research Centre's Demographic Surveillance System (DSS) database. The vaccination history of these children was examined. The relationships between their immunization status and social, economic and various contextual variables associated with their parents and households were assessed using Chi square test, Pearson correlation and logistic regression. Results The total immunization coverage was 50.2% (CI, 45.71; 54.69). Parental knowledge of the preventive value of immunization was positively related to complete immunization status (p = 0.03) in rural areas. Children of parents who reported a perception of communication problems surrounding immunization had a lower immunization coverage rate (p < 0.001). No distance related difference exists in terms of complete immunization coverage within villages and between villages outside the site of the health centres. Children of non-educated fathers in rural areas have higher rates of complete immunization coverage than those in the urban area (p = 0.028). Good communication about immunization and the importance of availability of immunization booklets, as well as economic and religious factors appear to positively affect children's immunization status. Conclusion Vaccination sites in remote areas are intended to provide a greater

  9. Potential Use of Salivary Markers for Longitudinal Monitoring of Inflammatory Immune Responses to Vaccination

    PubMed Central

    Garssen, Johan; Sandalova, Elena


    Vaccination, designed to trigger a protective immune response against infection, is a trigger for mild inflammatory responses. Vaccination studies can address the question of inflammation initiation, levels, and resolution as well as its regulation for respective studied pathogens. Such studies largely based on analyzing the blood components including specific antibodies and cytokines were usually constrained by number of participants and volume of collected blood sample. Hence, blood-based studies may not be able to cover the full dynamic range of inflammation responses induced by vaccination. In this review, the potential of using saliva in addition to blood for studying the kinetics of inflammatory response studies was assessed. Saliva sampling is noninvasive and has a great potential to be used for studies aimed at analysing the magnitude, time course, and variance in immune responses, including inflammation after vaccination. Based on a literature survey of inflammatory biomarkers that can be determined in saliva and an analysis of how these biomarkers could help to understand the mechanisms and dynamics of immune reactivity and inflammation, we propose that the saliva-based approach might have potential to add substantial value to clinical studies, particularly in vulnerable populations such as infants, toddlers, and ill individuals. PMID:27022211

  10. Use of Text Messaging for Monitoring Sugar-Sweetened Beverages, Physical Activity, and Screen Time in Children: A Pilot Study

    ERIC Educational Resources Information Center

    Shapiro, Jennifer R.; Bauer, Stephanie; Hamer, Robert M.; Kordy, Hans; Ward, Dianne; Bulik, Cynthia M.


    Objective: To examine acceptability, attrition, adherence, and preliminary efficacy of mobile phone short message service (SMS; text messaging) for monitoring healthful behaviors in children. Design: All randomized children received a brief psychoeducational intervention. They then either monitored target behaviors via SMS with feedback or via…

  11. Parental Monitoring and Perceptions of Children's School Performance and Conduct in Dual- and Single-Earner Families.

    ERIC Educational Resources Information Center

    Crouter, Ann C.; And Others


    Findings on 77 dual- and 75 single-earner families in which the eldest child was 9 to 12 years old indicated that less well-monitored boys received lower grades than did other children. Less well-monitored boys in dual-earner families perceived their conduct more negatively than did other children. (RH)

  12. ERPs Associated with Monitoring and Evaluation of Monetary Reward and Punishment in Children with ADHD

    ERIC Educational Resources Information Center

    van Meel, Catharina S.; Heslenfeld, Dirk J.; Oosterlaan, Jaap; Luman, Marjolein; Sergeant, Joseph A.


    Background: Several models of attention-deficit hyperactivity disorder (ADHD) propose abnormalities in the response to behavioural contingencies. Using event-related potentials (ERPs), the present study investigated the monitoring and subsequent evaluation of performance feedback resulting in either reward or punishment in children with ADHD (N =…

  13. Age Differences in the Effects of Social Influence on Children's Eyewitness Performance and Their Metacognitive Monitoring

    ERIC Educational Resources Information Center

    Schwarz, Stefanie; Roebers, Claudia M.


    The current work investigated the effects of social influence on children's recall accuracy and metacognitive monitoring. Two studies were conducted in which 8-and 10-year-olds were confronted with postevent information in an interview situation. An interviewer (Study 1) or a confederate (Study 2) provided postevent information with two levels of…

  14. Differential Efficacy of Home Monitoring and Cognitive-Behavioral Treatment for Decreasing Children's Maladaptive Nighttime Fears

    ERIC Educational Resources Information Center

    Pincus, Donna B.; Weiner, Courtney L.; Friedman, Alice G.


    A number of studies have demonstrated the efficacy of brief cognitive-behavioral interventions for treating childhood nighttime fears. The purpose of the present study is to determine whether behavior changes could be initiated and maintained with home monitoring and reinforcement alone. Sixteen children, ages 6 to 11, with severe, disruptive…

  15. Binding an Event to Its Source at Encoding Improves Children's Source Monitoring

    ERIC Educational Resources Information Center

    Roberts, Kim P.; Evans, Angela D.; Duncanson, Sara


    Children learn information from a variety of sources and often remember the content but forget the source. Whereas the majority of research has focused on retrieval mechanisms for such difficulties, the present investigation examines whether the way in which sources are "encoded" influences future source monitoring. In Study 1, 86…

  16. Effects of an Inconsistency-Detection Training Aimed at Improving Comprehension Monitoring in Primary School Children

    ERIC Educational Resources Information Center

    Wassenburg, Stephanie I.; Bos, Lisanne T.; de Koning, Björn B.; van der Schoot, Menno


    Grounded within the situation model framework, this study investigated the effectiveness of a reading comprehension strategy training aimed at improving children's comprehension monitoring strategies. Sixty-four third and fourth graders received a 4-week training targeted at situation model updating, evaluative and self-regulatory strategies, and…

  17. Watching Children: Describing the Use of Baby Monitors on

    ERIC Educational Resources Information Center

    Nelson, Margaret K.


    Popular culture today characterizes middle-class parents as being consumed with anxiety about their children. Drawing on more than 100 consumer reviews of baby monitors published on, the author examines how parents respond to that anxiety. Although reviewers are not representative of the population at large, they do…

  18. Using Parents and Teachers to Monitor Progress among Children with ASD: A Review of Intervention Research

    ERIC Educational Resources Information Center

    Witmer, Sara E.; Nasamran, Amy; Parikh, Purvi J.; Schmitt, Heather A.; Clinton, Marianne C.


    Despite growing knowledge of the effectiveness of various interventions for children with autism spectrum disorders (ASD), it is never clear whether a particular intervention will be effective for a specific child with ASD. Careful monitoring of an individual child's progress is necessary to know whether an intervention is effective. In this…

  19. Children with High Functioning Autism show increased prefrontal and temporal cortex activity during error monitoring

    PubMed Central

    Goldberg, Melissa C.; Spinelli, Simona; Joel, Suresh; Pekar, James J.; Denckla, Martha B.; Mostofsky, Stewart H.


    Evidence exists for deficits in error monitoring in autism. These deficits may be particularly important because they may contribute to excessive perseveration and repetitive behavior in autism. We examined the neural correlates of error monitoring using fMRI in 8–12-year-old children with high-functioning autism (HFA, n=11) and typically developing children (TD, n=15) during performance of a Go/No-Go task by comparing the neural correlates of commission errors versus correct response inhibition trials. Compared to TD children, children with HFA showed increased BOLD fMRI signal in the anterior medial prefrontal cortex (amPFC) and the left superior temporal gyrus (STempG) during commission error (versus correct inhibition) trials. A follow-up region-of-interest analysis also showed increased BOLD signal in the right insula in HFA compared to TD controls. Our findings of increased amPFC and STempG activity in HFA, together with the increased activity in the insula, suggest a greater attention towards the internally-driven emotional state associated with making an error in children with HFA. Since error monitoring occurs across different cognitive tasks throughout daily life, an increased emotional reaction to errors may have important consequences for early learning processes. PMID:21151713

  20. [Determining asthma treatment in children by monitoring fractional exhaled nitric oxide, sputum eosinophils and leukotriene B₄].


    Vizmanos-Lamotte, G; Cruz, M J; Gómez-Ollés, S; Muñoz, X; de Mir Messa, I; Moreno-Galdó, A


    Sputum eosinophils and exhaled fractional nitric oxide (FENO) are markers of airway inflammation in asthma. Cytokines, cysteinyl-leukotrienes and leukotriene B4 (LTB4) are responsible for this inflammation. The aim of this study is to determine the usefulness of these markers in monitoring asthma treatment in children. FENO, sputum eosinophils, and LTB4 in induced sputum were performed in 10 children (9-15 years old). These determinations were repeated four months later, after the beginning or an increase in the treatment. FENO values tended to decrease (P=.15), pulmonary function tended to improve (P=.10), and sputum eosinophils decreased (P=.003) compared to the first determination. There were no differences in LTB4 concentrations (P=.88). Sputum eosinophils seem to be more precise than FENO in the monitoring of inflammation in asthmatic children.

  1. β-glucan affects mucosal immunity in children with chronic respiratory problems under physical stress: clinical trials

    PubMed Central

    Richter, Josef; Svozil, Vladimir; Král, Vlastimil; Rajnohová Dobiášová, Lucie


    Background The role of β-glucan in children with respiratory problems is getting more and more attention. In this report we focused on the effects of 30 days oral supplementation with β-glucan on physical activity and immune status of children with respiratory problems. Methods We measured the level of sIgA, eNO and physical activity [using a 6-minute walking test (6MWT)] in 77 children and evaluated the effect of 100 mg/day oral dose. Results We found a significant difference between males and females in physical endurance. In the glucan group, the positive effects of glucan were significant in both age groups. In the glucan group, we found significant decrease of eNO levels and stabilization of the sIgA levels. Conclusions Short-term oral application of natural immunomodulator β-glucan stimulated physical endurance in children with respiratory problems and, via stabilization of the sIgA levels, helps their mucosal immunity. PMID:25861607

  2. From Space to the Patient: A New Cytokine Release Assay to Monitor the Immune Status of HIV Infected Patients and Sepsis Patients

    NASA Technical Reports Server (NTRS)

    Kaufmann, I.; Draenert, R.; Gruber, M.; Feuerecker, M.; Crucian, B. E.; Mehta, S. L.; Roider, J.; Pierson, D. L.; Briegel, J. M.; Schelling, G.; Sams, C. F.; Chouker, A.


    Monitoring of humans either in the healthy men under extreme environmental stress like space flight, in human immunodeficiency virus (HIV) infected patients or in sepsis is of critical importance with regard to the timing of adequate therapeutic (counter-)measures. The in vivo skin delayed-type hypersensitivity test (DTH) served for many years as a tool to evaluate cell mediated immunity. However, this standardised in vivo test was removed from the market in 2002 due to the risk of antigen stabilization. To the best of our knowledge an alternative test as monitoring tool to determine cell mediated immunity is not available so far. For this purpose we tested a new alternative assay using elements of the skin DTH which is based on an ex vivo cytokine release from whole blood and asked if it is suitable and applicable to monitor immune changes in HIV infected patients and in patients with septic shock.

  3. Monitoring of immune cell response to B cell depletion therapy and nerve root injury using SPIO enhanced MRI

    NASA Astrophysics Data System (ADS)

    Thorek, Daniel L.


    Magnetic resonance (MR) is a robust platform for non-invasive, high-resolution anatomical imaging. However, MR imaging lacks the requisite sensitivity and contrast for imaging at the cellular level. This represents a clinical impediment to greater diagnostic accuracy. Recent advances have allowed for the in vivo visualization of populations and even of individual cells using superparamagnetic iron oxide (SPIO) MR contrast agents. These nanoparticles, commonly manifested as a core of a single iron oxide crystal or cluster of crystals coated in a biocompatible shell, function to shorten proton relaxation times. In MR imaging these constructs locally dephase protons, resulting in a decrease in signal (hypointensity) localized to the region of accumulation of SPIO. In the context of immune cell imaging, SPIO can provide insight into the cellular migration patterns, trafficking, temporal dynamics and progression of diseases and their related pathological states. Furthermore, by visualizing the presence and activity of immune cells, SPIO-enabled cellular imaging can help evaluate the efficacy of therapy in immune disorders. This thesis examines the production, modification and application of SPIO in a range of in vitro and in vivo immune-response-relevant cellular systems. The role of different nanoparticle characteristics including diameter, surface charge and concentration are investigated in the labeling of T cells in culture. Following optimization of SPIO loading conditions for lymphocytes, the effect these particles have on the activation of primary B cells are elucidated. B cells are tracked using a variety of modalities, with and without the application of B cell depleting therapy. This is to evaluate the efficacy of SPIO as in vivo marker for B cell distribution. Unmodified SPIO were applied to monitor macrophage infiltration in a transient nerve root compression model, with implications for neck pain diagnosis and treatment. Nanoparticle accumulation and MR

  4. Government Monitoring of the Mental Health of Children in Canada: Five Surveys (Part I)

    PubMed Central

    Junek, Wade


    Objective Canadian governments spend billions of dollars yearly on programmatic interventions, intended to improve the mental health of children, without recommended monitoring of children’s mental health. The Canadian Academy of Child and Adolescent Psychiatry monitored governments’ progress in producing reports. Method Five evolving surveys were done during 2002, 2004, 2005, 2006 and 2008. Initially, progress was monitored then later surveys examined challenges that inhibited monitoring, the need for a national strategy, an indicator framework and an agency to do the monitoring and the role of non-government organizations. The 2008 survey requested the three most important indicators governments desired, and created clarity in the definition of monitoring reports in contents, criteria, qualities of indicators and potential names. For comparison purposes, a Partnership Model to survey populations was evaluated. Results Over five surveys, 13 of 14 governments affirmed the desire for monitoring and 64 publications were reviewed and categorized. No reports met criteria for ‘monitoring reports’. The Partnership Model was used successfully in 11 Provincial-Territorial governments. Conclusions It was reassuring that governments supported monitoring and were producing reports. The Partnership Model may offer a suitable alternative for governments. Results of 2006 and 2008, discussion, conclusions and references are in Part II. PMID:22299012

  5. Combining GPS with heart rate monitoring to measure physical activity in children: A feasibility study.


    Duncan, J Scott; Badland, Hannah M; Schofield, Grant


    The recent development of global positioning system (GPS) receivers with integrated heart rate (HR) monitoring has provided a new method for estimating the energy expenditure associated with children's movement. The purpose of this feasibility study was to trial a combination of GPS surveillance and HR monitoring in 39 primary-aged children from New Zealand. Spatial location and HR data were recorded during a school lunch break using an integrated GPS/HR receiver (1Hz). Children averaged a total distance of 1.10+/-0.56km at speeds ranging from 0 to 18.6kmh(-1). Activity patterns were characterised by short bursts of moderate to high speeds followed by longer periods of slow speeds. In addition, boys averaged higher speeds than girls (1.77+/-0.62kmh(-1) and 1.36+/-0.50kmh(-1), respectively; p=0.003). The percentage of time spent at 0kmh(-1) (stationary) ranged from 0.1% to 21.3% with a mean of 6.4+/-4.6%. These data suggest that while children were relatively active during the lunch period, they spent a substantial portion of time engaged in slow or stationary physical activities. Furthermore, associations between HR, average speed, and stationary time demonstrated that children who moved at faster speeds expended more energy than those who moved at slower speeds. We conclude that the combined approach of GPS and HR monitoring is a promising new method for investigating children's play-related energy expenditure. There is also scope to integrate GPS data with geographic information systems to examine where children play and accumulate physical activity.

  6. Co-infection with Ascaris lumbricoides modulates protective immune responses against Giardia duodenalis in school Venezuelan rural children.


    Hagel, I; Cabrera, M; Puccio, F; Santaella, C; Buvat, E; Infante, B; Zabala, M; Cordero, R; Di Prisco, M C


    We evaluated the effect of Ascaris lumbricoides on Giardia duodenalis infection and TH1/TH2 type immune mechanisms toward this parasite in 251 rural parasitized and 70 urban non-parasitized school children. The children were classified according to light (0-5000 eggs/g faeces) or moderate (>5001-50,000 eggs/g faeces) A. lumbricoides infection. Anti G. duodenalis skin hyper-reactivity, IgE, IgG, IL-13, IFN γ, IL6 and IL-10 levels were compared among G. duodenalis infected and non-infected children according to light or moderate A. lumbricoides infection. It was found that 62% of the A. lumbricoides moderately infected children were co-infected by G. duodenalis compared to 45% of the lightly infected group. After treatment, 42% of the A. lumbricoides moderately group were infected with G. duodenalis compared to 11% of their lightly counterparts, being A. lumbricoides IL-10 levels higher (p<0.0001) in the moderately infected group. In the A. lumbricoides lightly parasitized children, G. duodenalis infection was associated to a significant increase (p<0.005) of the levels of G. duodenalis IL-13, IFN-γ, IL-6, IgE, IgG and skin test hyper reactivity. In contrast, there was no effect of G. duodenalis infection in the elevation of these parameters among the A. lumbricoides moderately parasitized group, being those levels similarly lower as those observed in the control group. Inverse correlations were found between the levels of anti G duodenalis antibodies, skin test hyper-reactivity and cytokines with the intensity of A. lumbricoides infection (p>0.0001) and A. lumbricoides IL-10 levels (p>0.0001), suggesting that co-infection with A. lumbricoides may affect both TH1 and TH2 type immunity against G. duodenalis that may play an important role in the susceptibility to the infection after chemotherapy in children from endemic areas.

  7. Effect of short-term, high-dose methylprednisolone on oxidative stress in children with acute immune thrombocytopenia

    PubMed Central

    Cura, Musa; Koç, Ahmet; Aksoy, Nurten


    Background Immune thrombocytopenia (ITP) is the most common cause of acquired childhood thrombocytopenia and is characterized by increased immune-mediated destruction of circulating thrombocytes. Oxidative damage may be involved in ITP pathogenesis; paraoxonase (PON) and arylesterase (ARE) enzymes are closely associated with the cellular antioxidant system. We investigated the effect of short-term high-dose methylprednisolone (HDMP) treatment on the total oxidant status (TOS), total antioxidant capacity (TAC), oxidative stress index (OSI), and PON and ARE enzymatic activity in children with acute ITP. Methods Thirty children with acute ITP constituted the study group and 30 healthy children constituted the control group. Children with acute ITP were treated with HDMP: 30 mg/kg for 3 days, then 20 mg/kg for 4 days. The TOS, TAC, OSI, PON, and ARE levels were determined before and after 7 days of HDMP treatment. Results The TAC level (P<0.001), and PON (P<0.001) and ARE (P=0.001) activities were lower and the TOS (P=0.003) and OSI (P<0.001) levels were higher in children with acute ITP than those in healthy children in the control group. We also observed statistically significant increases in the TAC (P<0.01), PON (P<0.001) and ARE levels (P=0.001) and decreases in the TOS (P<0.05) and OSI levels (P<0.05) with 7 days of HDMP treatment compared to their values before treatment. Conclusion Our study demonstrated increased oxidative stress (OSI and TOC) and decreased antioxidant capacity (TAC), PON, and ARE in ITP patients and that steroid treatment could be effective in reducing the oxidative stress. PMID:28090489

  8. Level of IL-16 and Reticulated Platelets Percentage during the Clinical Course of Immune Thrombocytopenic Purpura in Children.


    Abd El-Glil, Reem R; Assar, Effat H


    Immune thrombocytopenic purpura (ITP) is an immune-mediated acquired disease with transient or persistent decrease of thrombocytes number in the blood. Cytokines play important roles in the immune regulation and are known to be deregulated in autoimmune diseases. This study aimed to investigate serum IL-16 levels in relation to reticulated platelets in children with ITP and platelet count. Twenty six children with ITP (11 with newly diagnosed ITP, 9 with persistent ITP and 6 with chronic ITP) and 12 age-matched healthy children controls were studied. Serum level of IL-16 and reticulated platelets count were assessed by Enzyme Linked Immunosorbent Assay (ELISA) and flow cytometry respectively. Serum IL-16 levels were significantly higher in patients as compared to controls (P < 0.001). Within patients, the levels were higher in newly diagnosed compared to persistent and chronic ITP (P < 0.01) and (P < 0.001) respectively. IL-16 levels were also significantly higher in persistent ITP compared to chronic ITP (P < 0.001). Reticulated platelets were also elevated in patients compared to controls and the increase was significant in newly diagnosed group (P < 0.05). Negative correlation was found between IL-16 level and reticulated platelets and platelets counts (r = -0.284, P = 0.028, r = 0.274 P = 0.25) respectively. It is concluded that IL-16 may be valuable in predicting the clinical course of pediatrics ITP. Measurement of reticulated platelets may provide significant information about thrombopoietic activity during the clinical course of ITP in children.

  9. Incidence of seizures on continuous EEG monitoring following traumatic brain injury in children.


    O'Neill, Brent R; Handler, Michael H; Tong, Suhong; Chapman, Kevin E


    OBJECT Seizures may cause diagnostic confusion and be a source of metabolic stress after traumatic brain injury (TBI) in children. The incidence of electroencephalography (EEG)-confirmed seizures and of subclinical seizures in the pediatric population with TBI is not well known. METHODS A routine protocol for continuous EEG (cEEG) monitoring was initiated for all patients with moderate or severe TBI at a Level 1 pediatric trauma center. Over a 3.5-year period, all patients with TBI who underwent cEEG monitoring, both according to protocol and those with mild head injuries who underwent cEEG monitoring at the discretion of the treating team, were identified prospectively. Clinical data were collected and analyzed. RESULTS Over the study period, 594 children were admitted with TBI, and 144 of these children underwent cEEG monitoring. One hundred two (71%) of these 144 children had moderate or severe TBI. Abusive head trauma (AHT) was the most common mechanism of injury (65 patients, 45%) in children with cEEG monitoring. Seizures were identified on cEEG in 43 patients (30%). Forty (93%) of these 43 patients had subclinical seizures, including 17 (40%) with only subclinical seizures and 23 (53%) with both clinical and subclinical seizures. Fifty-three percent of patients with seizures experienced status epilepticus. Age less than 2.4 years and AHT mechanism were strongly correlated with presence of seizures (odds ratios 8.7 and 6.0, respectively). Those patients with only subclinical seizures had the same risk factors as the other groups. The presence of seizures did not correlate with discharge disposition but was correlated with longer hospital stay and intensive care unit stay. CONCLUSIONS Continuous EEG monitoring identifies a significant number of subclinical seizures acutely after TBI. Children younger than 2.4 years of age and victims of AHT are particularly vulnerable to subclinical seizures, and seizures in general. Continuous EEG monitoring allows for

  10. [Dental decay in 5-year-old children: sociodemographic factors, monitoring points and parental attitudes].


    Nunes, Vinícius Humberto; Perosa, Gimol Benzaquen


    Dental decay affects many children, especially those from the lower socioeconomic classes. In this cross-sectional study designed to investigate the role played by sociodemographic factors, parental attitudes, and monitoring points, which are an indicator of personal perception of what controls individual health, on the prevalence of tooth decay among 5-year-old pre-school children living in a midsized city in São Paulo, Brazil. The ceo-d index of 426 children was assessed; the parents reported sociodemographic characteristics and completed two questionnaires concerning monitoring points and parental attitudes. The results show that 52.35% of the children had decay; higher levels of severe decay were observed among lower E-F socioeconomic classes. Higher socioeconomic status and low externality appear to be protective factors. Low parental internality emerged as a risk factor for decay in primary teeth, possibly because the mother expects or delegates the action to others, delaying care. Parental perceptions of control over a child's health seem to impact preventive care and, consequently, the level of tooth decay among children.

  11. Polymorphisms in key innate immune genes and their effects on measles vaccine responses and vaccine failure in children from Mozambique.


    Clifford, Holly D; Hayden, Catherine M; Khoo, Siew-Kim; Naniche, Denise; Mandomando, Inacio M; Zhang, Guicheng; Richmond, Peter; Le Souëf, Peter N


    Despite an effective vaccine, measles remains a major health problem globally, particularly in developing countries. More than 30% of children show primary vaccine failure and therefore remain vulnerable to measles. Genetic variation in key innate pathogen recognition receptors, such as the measles cell entry receptors CD46 and SLAM, measles attachment receptor DC-SIGN, the antiviral toll-like receptors (TLR)3, TLR7 and TLR8, and the cytosolic antiviral receptor RIG-I, may significantly affect measles IgG antibody responses. Measles is still highly prevalent in developing countries such as those in Africa however there is no previous data on the effect of these innate immune genes in a resident African population. Polymorphisms (n=29) in the candidate genes were genotyped in a cohort of vaccinated children (n=238) aged 6 months-14 years from Mozambique, Africa who either had vaccine failure and contracted measles (cases; n=66) or controls (n=172). Contrasting previous associations with measles responses in Caucasians and/or strong evidence for candidacy, we found little indication that these key innate immune genes affect measles IgG responses in our cohort of Mozambican children. We did however identify that CD46 and TLR8 variants may be involved in the occurrence of measles vaccine failure. This study highlights the importance of genetic studies in resident, non-Caucasian populations, from areas where determining the factors that may affect measles control is of a high priority.

  12. Comparison of immune manifestations between refractory cytopenia of childhood and aplastic anemia in children: A single-center retrospective study.


    Wu, Jun; Cheng, Yifei; Zhang, Leping


    This retrospective single-center study assessed the incidence and clinical features of immune manifestations of refractory cytopenia of childhood (RCC) and childhood aplastic anemia (AA). We evaluated 72 children with RCC and 123 with AA between February 2008 and March 2013. RCC was associated with autoimmune disease in 4 children, including 1 case each with autoimmune hemolytic anemia, rheumatoid arthritis, systemic lupus erythematosus, and anaphylactoid purpura. No children with AA were diagnosed with autoimmune diseases. Immune abnormalities were common in both RCC and AA; the most significant reductions were in the relative numbers of CD3-CD56+ subsets found in RCC. Despite the many similar immunologic abnormalities in AA and RCC, the rate of autoimmune disease was significantly lower in childhood AA than RCC (p=0.008, χ2=6.976). The relative numbers of natural killer cells were significantly lower in RCC patients than AA patients. By month 6, there was no significant difference in autoimmune manifestations between RCC and AA in relation to the response to immunosuppressive therapy (p=0.907, χ2=0.014). The large overlap of analogous immunologic abnormalities indicates that RCC and childhood AA may share the same pathogenesis.

  13. Reaching the Children: Universal Child Immunization by 1990. Development Education Kit.

    ERIC Educational Resources Information Center

    United Nations Children's Fund, New York, NY. United States Committee.

    The goal of the Universal Child Immunization Program, adopted by the World Health Organization in 1977, is to inoculate by 1990, every child in the world against measles, tetanus, whooping cough, diphtheria, tuberculosis, and polio. By 1987, nearly 80 countries had undertaken or were planning immunization programs. These diseases, combined with…

  14. Spotlight on romiplostim in the treatment of children with chronic immune thrombocytopenia: design, development, and potential place in therapy.


    Buchbinder, David; Nugent, Diane; Hsieh, Loan


    Primary immune thrombocytopenia (ITP) is an autoimmune disorder characterized by isolated thrombocytopenia. In approximately one-third of cases, the duration of thrombocytopenia will extend beyond 12 months consistent with a diagnosis of chronic ITP. Minor bleeding manifestations are common in chronic ITP while severe or life-threatening bleeding complications are uncommon. Moreover, spontaneous resolution occurs in the majority of children with chronic ITP necessitating treatment in only those children with ongoing bleeding manifestations or impairment in health-related quality of life (HRQOL). The characterization of thrombopoietin (TPO) and remarkable advancements in our understanding of the pathophysiology of ITP has led to the development of a new class of agents, the TPO-receptor agonists that have documented efficacy in the amelioration of thrombocytopenia and bleeding manifestations in chronic ITP. Romiplostim is a second-generation TPO-receptor agonist that has undergone limited evaluation in the treatment of chronic ITP in children. Evolving data suggest that romiplostim may be a safe and effective agent in the treatment of chronic ITP in children. Additional data are needed to confirm its ability to increase platelet counts, decrease bleeding manifestation, and improve the HRQOL of children and caregivers impacted by chronic ITP.

  15. Spotlight on romiplostim in the treatment of children with chronic immune thrombocytopenia: design, development, and potential place in therapy

    PubMed Central

    Buchbinder, David; Nugent, Diane; Hsieh, Loan


    Primary immune thrombocytopenia (ITP) is an autoimmune disorder characterized by isolated thrombocytopenia. In approximately one-third of cases, the duration of thrombocytopenia will extend beyond 12 months consistent with a diagnosis of chronic ITP. Minor bleeding manifestations are common in chronic ITP while severe or life-threatening bleeding complications are uncommon. Moreover, spontaneous resolution occurs in the majority of children with chronic ITP necessitating treatment in only those children with ongoing bleeding manifestations or impairment in health-related quality of life (HRQOL). The characterization of thrombopoietin (TPO) and remarkable advancements in our understanding of the pathophysiology of ITP has led to the development of a new class of agents, the TPO-receptor agonists that have documented efficacy in the amelioration of thrombocytopenia and bleeding manifestations in chronic ITP. Romiplostim is a second-generation TPO-receptor agonist that has undergone limited evaluation in the treatment of chronic ITP in children. Evolving data suggest that romiplostim may be a safe and effective agent in the treatment of chronic ITP in children. Additional data are needed to confirm its ability to increase platelet counts, decrease bleeding manifestation, and improve the HRQOL of children and caregivers impacted by chronic ITP.

  16. Positive peer pressure: the effects of peer monitoring on children's disruptive behavior.


    Carden Smith, L K; Fowler, S A


    Classroom peers can serve as powerful sources of reinforcement in increasing or maintaining both the positive and negative behaviors of their classmates. In two experiments, we examined the effectiveness of a peer-monitored token system on reducing disruption and nonparticipation during a transition period of a kindergarten class for behaviorally impaired children. Additionally, the effect of providing and subsequently withholding corrective feedback to peer mediators on the accuracy of their point awards was evaluated. Results in Experiment 1 suggest that both teacher- and peer-monitored interventions were successful in decreasing disruption and increasing participation of monitored peers. Experiment 2 further demonstrated that peer monitors could successfully initiate the token system without prior adult implementation. Analysis of the point awards in both experiments indicates that peer monitors consistently awarded points that were earned. However, when corrective feedback was withdrawn the peer monitors frequently awarded points that were not earned, i.e., they rarely withheld points for undesirable behavior. Even so, the monitored peers' disruptive behavior was maintained at low rates.

  17. Prevalence of Plasmodium falciparum transmission reducing immunity among primary school children in a malaria moderate transmission region in Zimbabwe.


    Paul, Noah H; Vengesai, Arthur; Mduluza, Takafira; Chipeta, James; Midzi, Nicholas; Bansal, Geetha P; Kumar, Nirbhay


    Malaria continues to cause alarming morbidity and mortality in more than 100 countries worldwide. Antigens in the various life cycle stages of malaria parasites are presented to the immune system during natural infection and it is widely recognized that after repeated malaria exposure, adults develop partially protective immunity. Specific antigens of natural immunity represent among the most important targets for the development of malaria vaccines. Immunity against the transmission stages of the malaria parasite represents an important approach to reduce malaria transmission and is believed to become an important tool for gradual elimination of malaria. Development of immunity against Plasmodium falciparum sexual stages was evaluated in primary school children aged 6-16 years in Makoni district of Zimbabwe, an area of low to modest malaria transmission. Malaria infection was screened by microscopy, rapid diagnostic tests and finally using nested PCR. Plasma samples were tested for antibodies against recombinant Pfs48/45 and Pfs47 by ELISA. Corresponding serum samples were used to test for P. falciparum transmission reducing activity in Anopheles stephensi and An. gambiae mosquitoes using the membrane feeding assay. The prevalence of malaria diagnosed by rapid diagnostic test kit (Paracheck)™ was 1.7%. However, of the randomly tested blood samples, 66% were positive by nested PCR. ELISA revealed prevalence (64% positivity at 1:500 dilution, in randomly selected 66 plasma samples) of antibodies against recombinant Pfs48/45 (mean A 405nm=0.53, CI=0.46-0.60) and Pfs47 (mean A405nm=0.91, CI=0.80-1.02); antigens specific to the sexual stages. The mosquito membrane feeding assay demonstrated measurable transmission reducing ability of the samples that were positive for Pfs48/45 antibodies by ELISA. Interestingly, 3 plasma samples revealed enhancement of infectivity of P. falciparum in An. stephensi mosquitoes. These studies revealed the presence of antibodies with

  18. Continuous monitoring of blood pressure in children and adolescents,a review of the literature.


    Mercado, Arlene B


    Continuous or ambulatory blood pressure monitoring (CBPM or ABPM) is becoming a useful tool in the early detection of hypertension in children and adolescents. With increased obesity in pediatrics, chronic diseases such as hypertension, diabetes, dyslipidemia and metabolic syndrome which was more commonly seen in adults in the early years, can now be seen in this population. This review provides the clinical reports of the use of CBPM for diagnosis and management of hypertension in the pediatric population.

  19. Similar protective immunity induced by an inactivated enterovirus 71 (EV71) vaccine in neonatal rhesus macaques and children.


    Zhang, Ying; Wang, Lichun; Liao, Yun; Liu, Longding; Ma, Kaili; Yang, Erxia; Wang, Jingjing; Che, Yanchun; Jiang, Li; Pu, Jing; Guo, Lei; Feng, Min; Liang, Yan; Cui, Wei; Yang, Huai; Li, Qihan


    During the development of enterovirus 71 (EV71) inactivated vaccine for preventing human hand, foot and mouth diseases (HFMD) by EV71 infection, an effective animal model is presumed to be significant and necessary. Our previous study demonstrated that the vesicles in oral regions and limbs potentially associated with viremia, which are the typical manifestations of HFMD, and remarkable pathologic changes were identified in various tissues of neonatal rhesus macaque during EV71 infection. Although an immune response in terms of neutralizing antibody and T cell memory was observed in animals infected by the virus or stimulated by viral antigen, whether such a response could be considered as an indicator to justify the immune response in individuals vaccinated or infected in a pandemic needs to be investigated. Here, a comparative analysis of the neutralizing antibody response and IFN-γ-specific T cell response in vaccinated neonatal rhesus macaques and a human clinical trial with an EV71 inactivated vaccine was performed, and the results showed the identical tendency and increased level of neutralizing antibody and the IFN-γ-specific T cell response stimulated by the EV71 antigen peptide. Importantly, the clinical protective efficacy against virus infection by the elicited immune response in the immunized population compared with the placebo control and the up-modulated gene profile associated with immune activation were similar to those in infected macaques. Further safety verification of this vaccine in neonatal rhesus macaques and children confirmed the potential use of the macaque as a reliable model for the evaluation of an EV71 candidate vaccine.

  20. A Comparative Clinicopathologic Study of Collagenous Gastritis in Children and Adults: The Same Disorder With Associated Immune-mediated Diseases.


    Ma, Changqing; Park, Jason Y; Montgomery, Elizabeth A; Arnold, Christina A; McDonald, Oliver G; Liu, Ta-Chiang; Salaria, Safia N; Limketkai, Berkeley N; McGrath, Kevin M; Musahl, Tina; Singhi, Aatur D


    Collagenous gastritis is a rare condition characterized by surface epithelial damage, subepithelial collagen deposition, and a lamina propria inflammatory infiltrate. Previous studies have proposed 2 clinicopathologic subtypes: (1) children (18 y of age or younger) presenting with severe anemia, nodular gastric mucosa, and isolated gastric disease; and (2) adults with chronic watery diarrhea that is associated with diffuse collagenous involvement of the gastrointestinal tract. However, notable exceptions exist. In fact, broad variability in clinical presentation, etiology, treatment and disease course has been reported. To better define the clinicopathologic features of collagenous gastritis, we have collected 10 pediatric and 21 adult cases and describe their clinical, endoscopic, pathologic, and follow-up findings. Both children and adults presented with similar clinical symptoms such as anemia (50%, 35%, respectively), epigastric/abdominal pain (50%, 45%), and diarrhea (40%, 55%). Concomitant immune disorders were identified in 2 (20%) children and 3 (14%) adults. Further, 7 of 17 (41%) adults were taking medications associated with other immune-related gastrointestinal diseases including olmesartan and antidepressants. Histologically, there were no differences between children and adults with collagenous gastritis in the location of gastric involvement, mean collagenous layer thickness, and prominence of eosinophils (P>0.05). Extragastric collagenous involvement was also seen with comparable frequencies in each cohort (44%, 59%). Follow-up information was available for 22 of 31 (71%) patients and ranged from 2 to 122 months (mean, 33.6 mo). Despite medical management in most cases, persistence of symptoms or collagenous gastritis on subsequent biopsies was seen in 100% of children and 82% of adults. Of note, treatment for 1 adult patient involved cessation of olmesartan resulting in resolution of both symptoms and subepithelial collagen deposition on subsequent

  1. Short-course therapy for tuberculosis in infants and children. Infectious Diseases and Immunization Committee, Canadian Paediatric Society.

    PubMed Central


    OBJECTIVE: To improve efficacy of and compliance with therapy for tuberculosis in children. OPTIONS: Short-course (6-month) multi-drug therapy, either non-supervised or directly supervised, versus long-course (more than 6-month) multi-drug therapy. OUTCOMES: Success (more than 90% of cases cured without relapse or serious side effects), development of drug resistance and compliance with treatment. EVIDENCE: Review of published reports of efficacy trials of tuberculosis therapy in children, side effects and compliance studies; consensus of expert opinion. VALUES: Values were assigned to the evidence by the Infectious Disease and Immunization Committee of the Canadian Paediatric Society through review of the data and consensus. BENEFITS, HARMS AND COSTS: Improved efficacy and compliance with short-course protocols should lower the rate of treatment failure among children in Canada and the cost of tuberculosis care. RECOMMENDATIONS: A short-course (6-month) protocol of four drugs for the first 2 months and two drugs for the subsequent 4 months is recommended to treat pulmonary tuberculosis or extrapulmonary disease causing lymphadenopathy. Tuberculous meningitis, disease involving bones and joints and tuberculosis with HIV infection require longer courses of treatment. Asymptomatic tuberculosis should be treated with daily doses of isoniazid for 9 months. Intermittent directly observed therapy is recommended if compliance cannot be ensured. Routine liver function testing is not recommended for prepubescent children taking isoniazid, but monthly assessment for clinical symptoms and periodic liver function evaluation is advised in adolescent women, especially post partum. VALIDATION: This report was reviewed by the directors of the Canadian Paediatric Society, the Hepatitis and Special Pathogens Division of the Laboratory Centre for Disease Control and the Canadian Thoracic Society. The recommendations are similar to those of the American Academy of Pediatrics. SPONSOR

  2. Biologic monitoring of exposure to organophosphorus pesticides in 195 Italian children.


    Aprea, C; Strambi, M; Novelli, M T; Lunghini, L; Bozzi, N


    One hundred ninety-five 6- to 7-year-old children who lived in the municipality of Siena (Tuscany, Italy), underwent biologic monitoring to evaluate urinary excretion of several alkylphosphates that are metabolites of organophosphorus pesticides. We evaluated dimethylphosphate (DMP), dimethylthiophosphate (DMTP), dimethyldithiophosphate (DMDTP), diethylphosphate (DEP), diethylthiophosphate (DETP), and diethyldithiophosphate (DEDTP). We obtained urine samples taken in the children's schools, and each sample was accompanied by a questionnaire about lifestyle and dietary habits. We found DMP and DMTP in detectable concentrations in the greatest number of samples (96 and 94%, respectively). The DMP values were geometric mean (GM) 116.7, [geometric standard deviation (GSD) 2.5], and a range of 7.4-1,471.5 nmol/g creatinine. The corresponding DMTP values were GM 104.3 (GSD 2.8) and a range of 4.0-1,526.0 nmol/g creatinine. DMDTP, DEP, DETP, and DEDTP concentrations were GM 14.1, (GSD 3.0), and a range of 3.3-754.6 nmol/g creatinine in 34% of the children; GM 33.2, (GSD 2.4), and a range of 5.1-360.1 nmol/g creatinine in 75% of the children; GM 16.0, (GSD 2.9), and a range of 3.1-284.7 in 48% of the children; and GM 7.7, (GSD 2.1), and a range of 2.3-140.1 in 12% of the children, respectively. The significant variable for urinary excretion of these metabolites in children was pest control operations performed inside or outside the house in the preceding month; however, the presence of a vegetable garden near the house rarely emerged. The urinary excretion of alkylphosphates in children was significantly higher than in a group of the adult population resident in the same province.

  3. Individual Monitoring of Immune Response in Atlantic Salmon Salmo salar following Experimental Infection with Infectious Salmon Anaemia Virus (ISAV).


    Collet, Bertrand; Urquhart, Katy; Monte, Milena; Collins, Catherine; Garcia Perez, Sandro; Secombes, Chris J; Hall, Malcolm


    Monitoring the immune response in fish over the progression of a disease is traditionally carried out by experimental infection whereby animals are killed at regular intervals and samples taken. We describe here a novel approach to infectiology for salmonid fish where blood samples are collected repeatedly in a small group of PIT-tagged animals. This approach contributes to the reduction of animals used in research and to improved data quality. Two groups of 12 PIT-tagged Atlantic salmon (Salmo salar) were i.p infected with Infectious Salmon Anaemia Virus (ISAV) or culture medium and placed in 1 m3 tanks. Blood samples were collected at 0, 4, 8, 12, 16, 21 and 25 days post infection. The viral load, immune and stress response were determined in individual fish by real-time quantitative PCR (QPCR) on the blood cells, as well as the haematocrit used as an indicator of haemolysis, a clinical consequence of ISAV infection. "In-tank" anaesthesia was used in order to reduce the stress related to chase and netting prior to sampling. The data were analysed using a statistical approach which is novel with respect to its use in fish immunology. The repeated blood collection procedure did not induce stress response as measured by HSP70 and HSP90 gene expression in the un-infected animals. A strong increase in viraemia as well as a significant induction of Mx and γIP gene expression were observed in the infected group. Interleukin 10 was found induced at the later stage of the infection whereas no induction of CD8 or γ IFN could be detected. These results and the advantages of this approach are discussed.

  4. Immunization for Women


    ... Diseases & Vaccines Overview Immunization Schedules Talk to you doctor about your immunization ... years Immunization Schedule for Children, 7-18 years Immunization News July 8, 2016 HPV-related cancers on ...

  5. Ambulatory blood pressure monitoring in children and adolescents: coming of age?


    Lurbe, Empar; Torró, María Isabel; Alvarez, Julio


    Over the last years, ambulatory blood pressure monitoring has been introduced into the pediatric population, contributing to a significant increase in the bulk of knowledge of crucial clinically relevant issues. Guidelines have established the currently known conditions where ambulatory blood pressure monitoring is useful and where it will provide additional information in children and adolescents. How common and important the intra-individual differences are within clinical and ambulatory blood pressure is the keystone to the use of ambulatory blood pressure monitoring as a diagnostic tool. By using not only office, but also ambulatory blood pressure, four possible situations arise. Two of these have values in agreement for normotension or hypertension. Two have values that are discrepant. The latter two are known as white coat and masked hypertension. The relationship with hypertension-induced organ damage, the prognostic value and the assessment of treatment goals are key issues of ambulatory blood pressure monitoring. In children, the accurate identification of hypertension at the earliest possible age would, therefore, give health-care providers the opportunity to initiate preventive measures, thereby reducing the chance of developing end-organ damage and its attendant morbidity and mortality.

  6. [The German Health Interview and Examination Survey for Children and Adolescents (KiGGS): state of immunity against poliomyelitis in German children].


    Diedrich, S; Schreier, E


    One of the goals of the WHO is the worldwide eradication of poliomyelitis in the coming years. Europe was declared poliofree in 2002, but increasing migration may lead to a come-back of circulating polioviruses. A high level of population immunity protects against imported wild viruses from endemic areas. The first seroprevalence data since the switch from live to inactivated vaccine in Germany (OPV to IPV) are provided. A serum panel was tested (n=2,046) in order to study the serological status against poliomyelitis. The microneutralization test on RD cells was used. Overall, neutralizing antibodies against poliovirus types 1, 2 and 3 were detected in 97.4%, 97.6%, and 93.6% of samples, respectively. Of the test persons, 91.7% had antibodies against all three virus types. Only 26 children simultaneously lacked neutralizing antibodies for all three serotypes (1.3%). No significant correlation between gender, region (East/West)), migration status (with/without migration background) and antibody prevalence to polioviruses was found. The seroprevalence of antibodies against all three types of polioviruses indicates a very high level of population immunity in German children. It must be maintained through consequently performed vaccination programmes.

  7. Nasopharyngeal pneumococcal carriage of children attending day care centers in Korea: comparison between children immunized with 7-valent pneumococcal conjugate vaccine and non-immunized.


    Kim, Kyung-Hyo; Hong, Jung Yun; Lee, Hyunju; Kwak, Ga Young; Nam, Chan Hee; Lee, Soo Young; Oh, Eunsang; Yu, Jigui; Nahm, Moon H; Kang, Jin Han


    To confirm the effect of 7-valent pneumococcal conjugate vaccine (PCV7), pneumococcal nasopharyngeal (NP) carriage was compared between vaccinated (3 + 1 doses PCV7) and non-vaccinated children. Vaccinated subjects were recruited from highly vaccinated regions (≥ 60%), Seoul and Incheon whereas control subjects were recruited from Jeju Island where vaccination rates are low (< 15%). NP swabs were obtained from 400 children aged 18-59 months. Serotype and antibiotic susceptibility was analyzed. Pneumococcal carriage rate was 18.0% (36/200) and 31.5% (63/200) for the vaccinated and control group, respectively. Among those vaccinated, 41.7% (15/36) of the serotypes were vaccine-related type (VRT: 6A, 6C, 19A) with the most common serotype 6C. The next common type was non-typable/non-capsule 30.6% (11/36) followed by non-vaccine type 16.7% (6/36) and vaccine type (VT) serotypes were found in only 11.1% (4/36). In contrast, 52.4% (33/63) of the isolates in the control group were VT. Resistance rates for penicillin and erythromycin were lower in the vaccine group (vaccine vs control; penicillin 45.2% vs 71.4%, erythromycin 74.2% vs 90.5%, P < 0.05). Multi-drug resistance was also lower in vaccinated subjects (vaccine vs control; 45.2% vs 69.8%, P < 0.05). PCV7 reduces carriage in VT which leads to replacement of pneumococci by antibiotic susceptible VRT or non-vaccine type strains.

  8. An ERP study of conflict monitoring in 4-8-year old children: associations with temperament.


    Buss, Kristin A; Dennis, Tracy A; Brooker, Rebecca J; Sippel, Lauren M


    Although there is great interest in identifying the neural correlates of cognitive processes that create risk for psychopathology, there is a paucity of research in young children. One event-related potential (ERP), the N2, is thought to index conflict monitoring and has been linked cognitive and affective risk factors for anxiety. Most of this research, however, has been conducted with adults, adolescents, and older children, but not with younger children. To address this gap, the current study examined 26 4-8-year-olds, who completed a cued flanker task while EEG was continuously recorded. We assessed whether the N2 was detectable in this group of young children and examined associations between the N2 and factors reflecting affective risk (e.g., reduced executive attention, temperamental effortful control, and temperamental surgency). We documented an N2 effect (greater N2 amplitude to incongruent versus congruent flankers), but only in children older than 6 years of age. Increases in the N2 effect were associated with less efficient executive attention and lower temperamental effortful control. We discuss the implications of these findings and consider how they may inform future studies on biomarkers for cognitive and affective risk factors for anxiety.

  9. Ambulatory and home blood pressure monitoring in children and adolescents: diagnosis of hypertension and assessment of target-organ damage.


    Karpettas, Nikos; Nasothimiou, Efthimia; Kollias, Anastasios; Vazeou, Adriani; Stergiou, George S


    The prevalence of elevated blood pressure in children and adolescents is more common than previously believed and often represents the early onset of essential hypertension, particularly in adolescents. The definition of hypertension in children is based on distribution criteria and normalcy tables that provide blood pressure percentiles for each measurement method (office, ambulatory and home) according to the individual's age, gender and body size. Owing to the white coat and masked hypertension phenomena, ambulatory blood pressure monitoring is indispensable for the diagnosis of hypertension in children. Home blood pressure monitoring in children has been less well studied, and at present, treatment decisions should not be based solely on such measurements. Hypertension-induced preclinical target-organ damage (mainly echocardiographic left ventricular hypertrophy) is not uncommon in children and should be evaluated in all hypertensive children. Other indices of target-organ damage, such as carotid intima-media thickness, pulse wave velocity and microalbuminuria, remain under investigation in pediatric hypertension.

  10. Enhanced memory B-cell immune responses after a second acellular pertussis booster vaccination in children 9 years of age.


    Hendrikx, Lotte H; Felderhof, Mariet K; Oztürk, Kemal; de Rond, Lia G H; van Houten, Marlies A; Sanders, Elisabeth A M; Berbers, Guy A M; Buisman, Anne-Marie


    Whooping cough has made its comeback and the incidence of pertussis in countries with widespread pertussis vaccination is most prominent in individuals above 9 years of age. To control the burden of infection, several countries already introduced acellular pertussis (aP) booster vaccination in adolescents and/or adults. However, antibody levels wane rapidly after vaccination even at older age. In this longitudinal study we investigated the effect of a second aP booster on the pertussis-specific memory B-cell immunity in children 9 years of age that have previously been vaccinated according to the national immunization program. Longitudinal blood samples were taken before, one month and one year after the booster. Purified B-cells were polyclonally stimulated and frequencies of memory B-cells were identified by ELISPOT-assays specific for various pertussis antigens. In addition, IgG levels and avidity indices were measured with fluorescent bead-based multiplex immunoassays. Starting with low pertussis-specific antibody and memory B-cell levels, a typical booster response was measured at one month after vaccination with increased antibody and memory B-cell responses. Although these responses declined slightly after one year, they substantially exceeded pre-booster levels and the avidity indices of the anti-pertussis antibodies remained high. Furthermore, high numbers of pertussis-specific memory B-cells at one-month post-booster correlate quite reliably with the corresponding high antibody response at one-year follow-up. In conclusion, booster vaccination in children 9 years of age induced an enhanced pertussis-specific memory immune response that sustained at least for one year. Therefore, this study supports the introduction of booster vaccination in older age groups.

  11. Ambulatory EEG NeuroMonitor platform for engagement studies of children with development delays

    NASA Astrophysics Data System (ADS)

    Mahajan, Ruhi; Consul-Pacareu, Sergi; Abusaud, Mohammed; Sahadat, Md N.; Morshed, Bashir I.


    Engagement monitoring is crucial in many clinical and therapy applications such as early learning preschool classes for children with developmental delays including autism spectrum disorder (ASD), attention-deficit hyperactivity disorder (ADHD), or cerebral palsy; as it is challenging for the instructors to evaluate the individual responses of these children to determine the effectiveness of the teaching strategies due to the diverse and unique need of each child who might have difficulty in verbal or behavioral communication. This paper presents an ambulatory scalp electroencephalogram (EEG) NeuroMonitor platform to study brain engagement activities in natural settings. The developed platform is miniature (size: 2.2" x 0.8" x 0.36", weight: 41.8 gm with 800 mAh Li-ion battery and 3 snap leads) and low-power (active mode: 32 mA low power mode: under 5mA) with 2 channels (Fp1, Fp2) to record prefrontal cortex activities of the subject in natural settings while concealed within a headband. The signals from the electrodes are amplified with a low-power instrumentation amplifier; notch filtered (fc = 60Hz), then band-passed by a 2nd-order Chebyshev-I low-pass filter cascaded with a 2nd-order low-pass (fc = 125Hz). A PSoC ADC (16-bit, 256 sps) samples this filtered signal, and can either transmit it through a Class-2 Bluetooth transceiver to a remote station for real-time analysis or store it in a microSD card for offline processing. This platform is currently being evaluated to capture data in the classroom settings for engagement monitoring of children, aimed to study the effectiveness of various teaching strategies that will allow the development of personalized classroom curriculum for children with developmental delays.

  12. Performance Monitoring in Medication-Naïve Children with Tourette Syndrome

    PubMed Central

    Eichele, Heike; Eichele, Tom; Bjelland, Ingvar; Høvik, Marie F.; Sørensen, Lin; van Wageningen, Heidi; Worren, Marius Kalsås; Hugdahl, Kenneth; Plessen, Kerstin J.


    Background: Tourette syndrome (TS) is a childhood-onset neurodevelopmental disorder and its impact on cognitive development needs further study. Evidence from neuropsychological, neuroimaging and electrophysiological studies suggests that the decline in tic severity and the ability to suppress tics relate to the development of self-regulatory functions in late childhood and adolescence. Hence, tasks measuring performance monitoring might provide insight into the regulation of tics in children with TS. Method: Twenty-five children with TS, including 14 with comorbid Attention-deficit/ hyperactivity disorder (ADHD), 39 children with ADHD and 35 typically developing children aged 8–12 years were tested with a modified Eriksen-Flanker task during a 34-channel electroencephalography (EEG) recording. Task performance, as well as stimulus-locked and response-locked event-related potentials (ERP) were analyzed and compared across groups. Results: Participants did not differ in their behavioral performance. Children with TS showed higher amplitudes of an early P3 component of the stimulus-locked ERPs in ensemble averages and in separate trial outcomes, suggesting heightened orienting and/or attention during stimulus evaluation. In response-locked averages, children with TS had a slightly higher positive complex before the motor response, likely also reflecting a late P3. Groups did not differ in post-response components, particularly in the error-related negativity (ERN) and error-related positivity (Pe). Conclusions: These findings suggest that children with TS may employ additional attentional resources as a compensatory mechanism to maintain equal behavioral performance. PMID:26973443

  13. Biomarkers of Environmental Enteropathy are Positively Associated with Immune Responses to an Oral Cholera Vaccine in Bangladeshi Children

    PubMed Central

    Uddin, Muhammad Ikhtear; Islam, Shahidul; Nishat, Naoshin S.; Hossain, Motaher; Rafique, Tanzeem Ahmed; Rashu, Rasheduzzaman; Hoq, Mohammad Rubel; Zhang, Yue; Saha, Amit; Harris, Jason B.; Calderwood, Stephen B.; Bhuiyan, Taufiqur Rahman; Ryan, Edward T.; Leung, Daniel T.; Qadri, Firdausi


    Environmental enteropathy (EE) is a poorly understood condition that refers to chronic alterations in intestinal permeability, absorption, and inflammation, which mainly affects young children in resource-limited settings. Recently, EE has been linked to suboptimal oral vaccine responses in children, although immunological mechanisms are poorly defined. The objective of this study was to determine host factors associated with immune responses to an oral cholera vaccine (OCV). We measured antibody and memory T cell immune responses to cholera antigens, micronutrient markers in blood, and EE markers in blood and stool from 40 Bangladeshi children aged 3–14 years who received two doses of OCV given 14 days apart. EE markers included stool myeloperoxidase (MPO) and alpha anti-trypsin (AAT), and plasma endotoxin core antibody (EndoCab), intestinal fatty acid binding protein (i-FABP), and soluble CD14 (sCD14). We used multiple linear regression analysis with LASSO regularization to identify host factors, including EE markers, micronutrient (nutritional) status, age, and HAZ score, predictive for each response of interest. We found stool MPO to be positively associated with IgG antibody responses to the B subunit of cholera toxin (P = 0.03) and IgA responses to LPS (P = 0.02); plasma sCD14 to be positively associated with LPS IgG responses (P = 0.07); plasma i-FABP to be positively associated with LPS IgG responses (P = 0.01) and with memory T cell responses specific to cholera toxin (P = 0.01); stool AAT to be negatively associated with IL-10 (regulatory) T cell responses specific to cholera toxin (P = 0.02), and plasma EndoCab to be negatively associated with cholera toxin-specific memory T cell responses (P = 0.02). In summary, in a cohort of children 3–14 years old, we demonstrated that the majority of biomarkers of environmental enteropathy were positively associated with immune responses after vaccination with an OCV. PMID:27824883

  14. Biomarkers of Environmental Enteropathy are Positively Associated with Immune Responses to an Oral Cholera Vaccine in Bangladeshi Children.


    Uddin, Muhammad Ikhtear; Islam, Shahidul; Nishat, Naoshin S; Hossain, Motaher; Rafique, Tanzeem Ahmed; Rashu, Rasheduzzaman; Hoq, Mohammad Rubel; Zhang, Yue; Saha, Amit; Harris, Jason B; Calderwood, Stephen B; Bhuiyan, Taufiqur Rahman; Ryan, Edward T; Leung, Daniel T; Qadri, Firdausi


    Environmental enteropathy (EE) is a poorly understood condition that refers to chronic alterations in intestinal permeability, absorption, and inflammation, which mainly affects young children in resource-limited settings. Recently, EE has been linked to suboptimal oral vaccine responses in children, although immunological mechanisms are poorly defined. The objective of this study was to determine host factors associated with immune responses to an oral cholera vaccine (OCV). We measured antibody and memory T cell immune responses to cholera antigens, micronutrient markers in blood, and EE markers in blood and stool from 40 Bangladeshi children aged 3-14 years who received two doses of OCV given 14 days apart. EE markers included stool myeloperoxidase (MPO) and alpha anti-trypsin (AAT), and plasma endotoxin core antibody (EndoCab), intestinal fatty acid binding protein (i-FABP), and soluble CD14 (sCD14). We used multiple linear regression analysis with LASSO regularization to identify host factors, including EE markers, micronutrient (nutritional) status, age, and HAZ score, predictive for each response of interest. We found stool MPO to be positively associated with IgG antibody responses to the B subunit of cholera toxin (P = 0.03) and IgA responses to LPS (P = 0.02); plasma sCD14 to be positively associated with LPS IgG responses (P = 0.07); plasma i-FABP to be positively associated with LPS IgG responses (P = 0.01) and with memory T cell responses specific to cholera toxin (P = 0.01); stool AAT to be negatively associated with IL-10 (regulatory) T cell responses specific to cholera toxin (P = 0.02), and plasma EndoCab to be negatively associated with cholera toxin-specific memory T cell responses (P = 0.02). In summary, in a cohort of children 3-14 years old, we demonstrated that the majority of biomarkers of environmental enteropathy were positively associated with immune responses after vaccination with an OCV.

  15. Immune Responses to "Helicobacter pylori" Infection in Children with Intellectual Disabilities

    ERIC Educational Resources Information Center

    Douraghi, Masoumeh; Goudarzi, Hossein; Rostami, Mahmoud Nateghi; Nikmanesh, Bahram


    Infection with "Helicobacter pylori" was assessed through serum "H. pylori" IgG antibody in children with intellectual disabilities (ID). The sero-status of cytotoxin-associated gene A (CagA) was determined as a risk determinant for severe "H. pylori"-associated diseases. In total, 210 children with ID were included…

  16. Differences in innate immune response gene regulation in the middle ear of children who are otitis prone and in those not otitis prone

    PubMed Central

    Casey, Janet; Pichichero, Michael


    Objective: Acute otitis media (AOM) causes an inflammatory response in the middle ear. We assessed differences in innate immune responses involved in bacterial defense at onset of AOM in children who were stringently defined as otitis prone (sOP) and children not otitis prone (NOP). Study Design: Innate immune genes analysis from middle ear fluid (MEF) samples of children. Methods: Genes of toll-like receptors (TLR), nod-like and retinoic acid-inducible gene-I-like receptors, downstream effectors important for inflammation and apoptosis, including cytokines and chemokines, were studied from MEF samples by using a real-time polymerase chain reaction array. Protein levels of differentially regulated genes were measured by Luminex. Results: Gene expression in MEF among children who were sOP was significantly different in upregulation of interleukin 8, secretory leukocyte peptidase inhibitor, and chemokine (C-C motif) ligand 3, and in downregulation of interferon regulatory factor 7 and its related signaling molecules interferon alpha, Toll-like receptor adaptor molecule 2, chemokine (C-C motif) ligand 5, and mitogen-activated protein kinase 8 compared with children who were NOP. Differences in innate gene regulation were similar when AOM was caused by Streptococcus pneumoniae or nontypeable Haemophilus influenzae. Conclusion: Innate-immune response genes are differentially regulated in children who were sOP compared with children with NOP. PMID:28124644

  17. The use of innate immune responses as biomarkers in a programme of integrated biological effects monitoring on flounder (Platichthys flesus) from the southern North Sea

    NASA Astrophysics Data System (ADS)

    Skouras, Andreas; Broeg, Katja; Dizer, Halim; von Westernhagen, Hein; Hansen, Peter-Diedrich; Steinhagen, Dieter


    Immunological biomarkers that reflect the effects of exposure to environmental contaminants in coastal marine habitats were sought in European flounder (Platichthys flesus) from five locations in the German Bight with different anthropogenic impacts. During a 2-year period of sampling, innate immune responses were monitored from a total of 331 individual flounder of a body length of 18 to 25 cm. From the fish, plasma lysozyme, phagocytosis and respiratory burst activity of head kidney leucocytes were analysed and implemented as part of an integrated biological effects monitoring programme. As the measurements of the parameters applied here varied within wide ranges at some locations, spatial differences could not always be established, but some general trends could be drawn: plasma lysozyme activity was decreased in flounder contaminated with DDT adducts and some PCBs, while cellular functions such as phagocytosis and respiratory burst were stimulated by some chlorinated hydrocarbons. Correlation analysis also revealed connections not only between the parameters applied here and some contaminants but also with some biochemical parameters used as biomarkers in pollution monitoring: in flounder with decreased integrity of hepatocyte lysosomal membranes, immune functions also were impaired, and plasma lysozyme as well as phagocytosis activity of head kidney cells were impaired when the activity of cytochrome P450 1A was induced. The data presented here indicate that innate immune responses may be useful parameters to monitor cellular functions in a battery of biomarkers of different levels of biological organisation.

  18. Biological monitoring of pesticide exposures among applicators and their children in Nicaragua.


    Rodríguez, Teresa; Younglove, Lisa; Lu, Chensheng; Funez, Aura; Weppner, Sarah; Barr, Dana B; Fenske, Richard A


    Exposures were assessed for seven small-scale farmers using chlorpyrifos on corn and ten banana plantation employees applying diazinon, and for one child of each worker. Metabolites (TCPYand IMPY) were measured in urine before and after applications. TCPY concentrations peaked at 27 and 8.5 hours post-application for applicators and children, respectively (geometric means, 26 and 3.0 microg/L). Proximity to spraying and spray mixture preparation in homes were important exposure factors. IMPY concentrations differed substantially across workers at two plantations (geometric means, 1.3 and 168 mirog/L); however, their children had little or no diazinon exposure. These workers and children were also exposed to chlorpyrifos, most likely through contact with chlorpyrifos-impregnated bags used in banana production. Several recommendations are offered: (1) monitor children's activities during applications; (2) do not store or prepare pesticides in homes; (3) institute sound occupational hygiene practices at banana plantations; (4) dispose of plastic insecticide bags properly at the worksite.

  19. Cutting-edge technologies for diagnosis and monitoring of snoring in children.


    Vlastos, Ioannis; Athanasopoulos, Ioannis


    Snoring is a very common problem in children and may be an indication of obstructive sleep apnea (OSA). Appropriate diagnosis is of importance due to detrimental effects of OSA. Polysomnography is considered the gold standard for the diagnosis of OSA. However, it is impractical for several reasons and this is why other tests have been developed as alternatives to formal polysomnography (PSG) for the assessment of children with snoring. In this mini-review basic features of PSG as well as alternative tests are presented and future perspectives are provided in addition to current guideline for the diagnosis and monitoring of childhood snoring. The aim of this review is to highlight briefly currently developed technologies that seem promising for the evaluation of snoring.

  20. Energy Expenditure in Playground Games in Primary School Children Measured by Accelerometer and Heart Rate Monitors.


    García-Prieto, Jorge Cañete; Martinez-Vizcaino, Vicente; García-Hermoso, Antonio; Sánchez-López, Mairena; Arias-Palencia, Natalia; Fonseca, Juan Fernando Ortega; Mora-Rodriguez, Ricardo


    The aim of this study was to examine the energy expenditure (EE) measured using indirect calorimetry (IC) during playground games and to assess the validity of heart rate (HR) and accelerometry counts as indirect indicators of EE in children´s physical activity games. 32 primary school children (9.9 ± 0.6 years old, 19.8 ± 4.9 kg · m(-2) BMI and 37.6 ± 7.2 mL · kg(-1) · min(-1) VO2max). Indirect calorimetry (IC), accelerometry and HR data were simultaneously collected for each child during a 90 min session of 30 playground games. Thirty-eight sessions were recorded in 32 different children. Each game was recorded at least in three occasions in other three children. The inter-subject coefficient of variation within a game was 27% for IC, 37% for accelerometry and 13% for HR. The overall mean EE in the games was 4.2 ± 1.4 kcals · min(-1) per game, totaling to 375 ± 122 kcals/per 90 min/session. The correlation coefficient between indirect calorimetry and accelerometer counts was 0.48 (p=0.026) for endurance games and 0.21 (p=0.574) for strength games. The correlation coefficient between indirect calorimetry and HR was 0.71 (p=0.032) for endurance games and 0.48 (p=0.026) for strength games. Our data indicate that both accelerometer and HR monitors are useful devices for estimating EE during endurance games, but only HR monitors estimates are accurate for endurance games.

  1. [Psychophysiological indicators for children using mobile phones. Communication 2. Results of four-year monitoring].


    Khorseva, N I; Grigor'ev, Iu G; Gorbunova, N V


    This study submits the results of a four-year monitoring of a complex diagnostics of the psychophysiological indicators for 196 children aged 7 to 12 years old: 147 of them are child users of mobile communication (test group) and 49 are in the control group. We have identified the following major trends of the psychophysiological indicators for child users of mobile communication: an increased number of phonemic perception disorders, abatement of efficiency, reduced indicators for the arbitrary and semantic memory, an increased fatigue. A steady decline of the parameters from high values to bottom standards has been found.

  2. The effects of booster vaccination on combined hepatitis A and hepatitis B vaccine in both anti-HBs and anti-HAV negative children 5-15 years after hepatitis B vaccine primary immunization.


    Chen, Yongdi; Gu, Hua; Cheng, Suyun; Shen, Lingzhi; Cui, Fujiang; Wang, Fuzhen; Yao, Jun; Xia, Shichang; Lv, Huakun; Liang, Xiaofeng


    In the present study, we investigated the changes in both anti-HAV lgG and anti-HBs lgG levels and compared the antibody seroconversion rates of different doses of combined hepatitis A and hepatitis B vaccine in children. Children who were vaccinated as infants with Hepatitis B vaccine were revaccinated at 5-15 y of age, then the antibody titers were monitored. Among 283 children, this study found that the anti-HAV seroconversion rates (defined as anti-HAV ≥ 1 mIU/ml) after the first and the third dose were 79.9% and 100% respectively; these observed differences were statistically significant (P<0.05); the corresponding geometric mean titers (GMTs) were 4.72 ± 2.63 mIU/ml and 13.46 ± 1.16 mIU/ml respectively. The anti-HBs seroconversion rates (defined as an anti-HBs ≥ 10 mIU/ml) were 82.3% and 99.0% respectively; these observed differences were statistically significant (P<0.05); and the corresponding titers were 319.95 ± 5.16 mIU/ml and 418.59 ± 3.89 mIU/ml respectively. After the first booster dose, the difference in anti-HAV seroconversion rate was statistically significant in children aged 5-9 y and 10-15 y (P<0.05), as was the difference of anti-HBs seroconversion, whereas after the third dose the difference was not statistically significant (P>0.05). This study demonstrated that the immunization effects of booster vaccination with combined hepatitis A and hepatitis B vaccine is successful for children. A single booster dose is adequate for younger children, while three doses are needed for older children.

  3. Cyclosporin A in the treatment of refractory immune thrombocytopenia purpura in children.


    Gesundheit, B; Cividalli, G; Freeman, A; Yatziv, S; Koren, G; Baruchel, S


    Patients with refractory autoimmune thrombocytopenia do not respond to standard therapy with high-dose corticosteroids, intravenous immunoglobulin, and splenectomy. We describe the cases of two patients with refractory autoimmune thrombocytopenia treated with oral cyclosporin A (CsA) to evaluate the efficacy of this alternative therapy. Blood pressure and hepatic and renal function were in the normal range before initiation of treatment. Induction therapy with pulses of high-dose methylprednisolone was used for 3 consecutive days to improve the initial immune suppression. Gradual dose reduction of CsA, according the platelet count, minimized the long-term adverse effects of CsA. Oral CsA with pulses of high-dose methylprednisolone induced remission of the thrombocytopenia. Gradual weaning of CsA over months, according the platelet count, produced no observable adverse effects of the CsA. Rapid dose reduction caused thrombocytopenia, which resolved with higher dosages of CsA. Our cases show the efficacy of CsA for refractory immune thrombocytopenia. This therapeutic option with oral CsA as an additional salvage option may avoid splenectomy and the adverse effects of long-term corticosteroids. Larger clinical investigations are necessary to establish the indications and therapeutic regimen for CsA in immune thrombocytopenia.

  4. Using the Immunization Information System to Determine Vaccination Coverage Rates among Children Aged 1–7 Years: A Report from Zhejiang Province, China

    PubMed Central

    Li, Qian; Hu, Yu; Zhong, Yanpeng; Chen, Yaping; Tang, Xuewen; Guo, Jing; Shen, Lingzhi


    Background: The Zhejiang Immunization Information System (ZJIIS) was established in 2004. This study described the coverage rates of NIP vaccines in Zhejiang Province using the ZJIIS. Methods: Children aged 1–7 years (born from 1 January 2005 to 31 December 2011) registered in ZJIIS were enrolled in this study. All immunization records were obtained from the ZJIIS on 31 December 2012. The cohort method had been used for identifying trends and patterns in vaccine administration. Immunization coverage estimates were analyzed for both individual NIP vaccines and “Fully immunized” by age group, birth cohort, immigration status, and geography area. We also examined the timeliness vaccination for the 2010 birth cohort. Results: A total of 3,579,896 children were registered in ZJIIS. All the vaccines and doses which scheduled to be given at ≤12 months of age exceeded 90%. There was substantial decrease trend in the vaccines scheduled at >12 months of age and most of these vaccines were below 90%. The coverage of migrant children was lower than for resident children and the coverage of WenZhou (WZ), Zhoushan (ZS) and TaiZhou (TZ) was lower than other municipalities for most of vaccines across all the birth cohorts. Nearly 20%–30% of children of 2010 birth cohort delayed for the primary series vaccination scheduled at ≤12 months of age, especially among migrant children. Conclusions: The ZJIIS is useful in tracking vaccine coverage of children aged 1–7 years and the data provided by ZJIIS reflected the fact that NIP delivery was improving in Zhejiang Province, while identifying some areas for improvement. We recommend continuing surveillance to estimate of vaccine coverage through ZJIIS. Immunization strategies such as Assessment, Feedback, Incentives, and Exchange program, reminder/recall activity, home visits, school entry requirements and school-based clinics could be used to reach a higher coverage of the population. PMID:24603495

  5. [A virological description of serous meningitis in children immunized with vaccine against epidemic parotitis].


    Goleva, O V; Kharit, S M; Cherniaeva, T V; Aksenov, O A; Davidkin, I; Kolyshkin, V M


    The morbidity structure was analyzed in children vaccinated against epidemic parotitis in 1993-2002. Eight children (4 with serous meningitis and 4 with lesions of the salivary glands) underwent virologic and immunologic examinations. The molecular typing of the SH-gene fragment of the parotitis virus showed the process in 7 cases to be provoked by the vaccination strain. Presumedly, progressing vaccine-associated meningitis inhibits antibody formation. The total incidence of vaccine-associated meningitis was shown, according to Saint Petersburg data, to be not high, which testifies to a low reactogenicity of the Russian vaccine strain.

  6. [Biological adaptation and immune status of preschool children with visual function disorders in conditions of preschool educational institutions of compensating type].


    Bannikova, L P; Koksharov, A V


    For implementation of a comprehensive approach in the elaboration of preventive and corrective measures in children with impaired visual function in conditions of preschool educational institutions of compensating type there were studied adaptation reserves of their organism, as well as indices of immune status. Biological adaptation was studied with the help ofcardiointervalography in 111 children aged 6-7years. With the use of ELISA 88 children were examined in terms of IgA, IgM, IgG, slgA in saliva.

  7. Effects of ozone on the respiratory health, allergic sensitization, and cellular immune system in children

    SciTech Connect

    Zwick, H.; Popp, W.; Wagner, C.; Reiser, K.; Schmoeger, J.B.; Boeck, A.H.; Herkner, K.; Radunsky, K. )


    To investigate the lasting effects of high ozone concentrations under environmental conditions, we examined the respiratory health, pulmonary function, bronchial hyperresponsiveness to methacholine, allergic sensitization, and lymphocyte subpopulations of 10- to 14-yr-old children. A total of 218 children recruited from an area with high ozone concentrations (Group A) were tested against 281 children coming from an area with low ozone concentrations (Group B). As to subjective complaints, categorized as 'usually cough with or without phlegm,' 'breathlessness,' and 'susceptibility to chest colds,' there was no difference between the two groups. The lung function parameters were similar, but in Group A subjects' bronchial hyperresponsiveness occurred more frequently and was found to be more severe than in Group B (29.4 versus 19.9%, p less than 0.02; PD20 2,100 {plus minus} 87 versus 2,350 {plus minus} 58 micrograms, p less than 0.05). In both groups the number of children who had been suffering from allergic diseases and sensitization to aeroallergens, found by means of the skin test, was the same. Comparison of the total IgE levels showed no difference at all between the two groups. As far as the white blood cells are concerned, the total and differential cell count was the same, whereas lymphocyte subpopulations showed readily recognizable changes.

  8. Immunity from criminal prosecution for parents who withhold medically necessary treatment from children on religious grounds.


    Dickinson, M L; Weinstein, K R


    Because child endangerment laws and their judicial interpretation are different in each state, healthcare providers should familiarize themselves with the law in their particular jurisdiction. In situations in which parents refuse on religious grounds to consent to medical treatment for their children, health care providers should consult local counsel as to the legal options available.

  9. Excess body mass is associated with T cell differentiation indicative of immune aging in children

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Obesity has been associated with accelerated biological ageing and immunosenescence. As the prevalence of childhood obesity is increasing, we wanted to determine if associations between obesity and immunosenescence would manifest in children. We studied 123 Mexican American adolescents aged 10–14 (m...

  10. Subnormal and waning immunity to tetanus toxoid in previously vaccinated HIV-infected children and response to booster doses of the vaccine.


    Choudhury, Shahana A; Matin, Fazle


    Little is known regarding waning immunity to tetanus toxoid (TT) in HIV-infected children and the need for booster doses before the recommended interval of 5-10 years. Anti-tetanus antibodies were assessed by ELISA in 24 HIV-infected and 24 control children. A protective level (>0.1 IU/ml) of TT antibodies was observed in 62% of HIV-infected children and in 100% of controls. HIV-infected children with five doses had a significantly (p=0.01) lower prevalence of protective immunity compared to controls. Follow-up anti-TT antibody levels in nine HIV-infected children declined from 1.27 to 0.26 IU/ml, but levels did not decline in the seven controls; five of the seven (71%) children with a non-protective level of antibodies responded with a level>0.16 IU/ml following one booster dose of the vaccine. HIV-infected children may need TT boosters before the recommended 5-10 years.

  11. Involvement of males in antenatal care, birth preparedness, exclusive breast feeding and immunizations for children in Kathmandu, Nepal

    PubMed Central


    Background Men in patriarchal societies of developing countries are often identified as decision makers in all aspects of day-to-day life. The study explores the factors associated with male involvement in ANC, birth plans, exclusive breastfeeding and immunization of children. Methods A cross-sectional survey was conducted among 2178 married males between May and December 2010 in Kathmandu, Nepal. Twenty one clusters were selected for data collection using structured questionnaire. Adjusted odds ratios (AORs) and 95% confidence intervals (95% CI) of associated factors were estimated by stepwise backward likelihood ratio method. Results This study determined the percentage of males who accompanied their partners for ANC (39.3%), arranged SBA (47.9%) and accompanied them for child immunization (10.9%). Factors found associated with respect to different activities were as follows: accompanied their partners on antenatal visits – uneducated or primary level education (AOR, 5.68, 95% CI, 4.44-7.27), income NPR 5001 (1USD = 85 NPR) or above (1.47, 1.20-1.80) and aged above 25 years (2.51, 1.89-3.33); arranged money for delivery – uneducated or primary level education (7.34, 5.84-9.23), income NPR 5001 or above (1.80, 1.48-2.20) and aged above 25 years (1.55, 1.18-2.03); arranged SBA – uneducated or primary level education (17.14, 12.65-23.22) and income NPR 5001 or above (2.89, 2.36-3.54); arranged transportation – uneducated or primary level education (17.65, 11.84-26.32), income NPR 5001 or above (1.69, 1.40-2.04) and aged above 25 years (1.69, 1.27-2.24); encouraged exclusive breast feeding – uneducated or primary level education (5.48, 4.39-6.83) and aged above 25 years (1.35, 1.03-1.77); accompanied their partners for immunization their children – uneducated or primary level education (3.88, 2.53-5.96) and aged above 25 years (1.72, 1.11-2.64). Conclusions Men who were uneducated or had primary level education, aged above 25 years, had higher

  12. Measles, mumps, and rubella antibody status and response to immunization in children after therapy for acute lymphoblastic leukemia.


    Aytac, Selin; Yalcin, S Songul; Cetin, Mualla; Yetgin, Sevgi; Gumruk, Fatma; Tuncer, Murat; Yurdakok, Kadriye; Gurgey, Aytemiz


    Seventy-seven patients with acute lymphoblastic leukemia (ALL) who were in complete remission and whose therapies had been stopped for at least 6 months before enrollment in this study were retrospectively analyzed regarding their antibody status for measles, mumps, and rubella, with the aim to demonstrate the seropositivity rate after treatment in the authors' group. Each patient's serum samples were analyzed by enzyme-linked immunosorbent assay (ELISA) method to determine the antibody titers before and after immunization. Measles serology was available in 77 children; 45 (58%) were seronegative. Initial ages of measle-seronegative patients were statistically lower than those of seropositive cases (median 3.29 versus 4.91 years, respectively). Mumps serology was available in 76 children; 36 (47%) were seronegative. Mumps-seropositive cases tended to have more frequent previous history of infection than seronegative cases (55.0% versus 28.6%, respectively, P = .05). Rubella serology was available in 76 children, and 20 (26.3%) were seronegative. It was determined that initial ages of rubella-seronegative patients were statistically lower than those of seropositive cases (median 3.03 versus 4.32 years, respectively). The authors concluded based on the results of their study that at a median of 3.31 years after completion of chemotherapy for ALL, the majority of cases had antibody levels lower than protective values for measles (58.4%); however, these values were 47.3% for mumps and 26.3% for rubella. Seroconversion rates after measles (55%) and mumps vaccination (57.1%) were still low. However, in the available cases, relatively adequate response to rubella vaccination (92.3%) was observed.

  13. Immune Responses to the O-Specific Polysaccharide Antigen in Children Who Received a Killed Oral Cholera Vaccine Compared to Responses following Natural Cholera Infection in Bangladesh

    PubMed Central

    Uddin, Taher; Xu, Peng; Aktar, Amena; Johnson, Russell A.; Rahman, Mohammad Arif; Alam, Mohammad Murshid; Bufano, Meagan Kelly; Eckhoff, Grace; Wu-Freeman, Ying; Yu, Yanan; Sultana, Tania; Khanam, Farhana; Saha, Amit; Chowdhury, Fahima; Khan, Ashraf I.; Charles, Richelle C.; LaRocque, Regina C.; Harris, Jason B.; Calderwood, Stephen B.; Kováč, Pavol; Qadri, Firdausi; Ryan, Edward T.


    Current oral cholera vaccines induce lower levels of protective efficacy and shorter durations of protection in young children than in adults. Immunity against cholera is serogroup specific, and immune responses to Vibrio cholerae lipopolysaccharide (LPS), the antigen that mediates serogroup-specific responses, are associated with protection against disease. Despite this, responses against V. cholerae O-specific polysaccharide (OSP), a key component of the LPS responsible for specificity, have not been characterized in children. Here, we report a comparison of polysaccharide antibody responses in children from a region in Bangladesh where cholera is endemic, including infants (6 to 23 months, n = 15), young children (24 to 59 months, n = 14), and older children (5 to 15 years, n = 23) who received two doses of a killed oral cholera vaccine 14 days apart. We found that infants and young children receiving the vaccine did not mount an IgG, IgA, or IgM antibody response to V. cholerae OSP or LPS, whereas older children showed significant responses. In comparison to the vaccinees, young children with wild-type V. cholerae O1 Ogawa infection did mount significant antibody responses against OSP and LPS. We also demonstrated that OSP responses correlated with age in vaccinees, but not in cholera patients, reflecting the ability of even young children with wild-type cholera to develop OSP responses. These differences might contribute to the lower efficacy of protection rendered by vaccination than by wild-type disease in young children and suggest that efforts to improve lipopolysaccharide-specific responses might be critical for achieving optimal cholera vaccine efficacy in this younger age group. PMID:23515016

  14. Integrated Immune Experiment

    NASA Technical Reports Server (NTRS)

    Crucian, Brian


    This viewgraph presentation reviews NASA's Integrated Immune Experiment. The objectives include: 1) Address significant lack of data regarding immune status during flight; 2) Replace several recent immune studies with one comprehensive study that will include in-flight sampling; 3) Determine the in-flight status of immunity, physiological stress, viral immunity/reactivation; 4) Determine the clinical risk related to immune dysregulation for exploration class spaceflight; and 5) Determine the appropriate monitoring strategy for spaceflight-associated immune dysfunction, that could be used for the evaluation of countermeasures.

  15. The impact of cognitive control on children's goal monitoring in a time-based prospective memory task.


    Mahy, Caitlin E V; Voigt, Babett; Ballhausen, Nicola; Schnitzspahn, Katharina; Ellis, Judi; Kliegel, Matthias


    The present study investigated whether developmental changes in cognitive control may underlie improvements of time-based prospective memory. Five-, 7-, 9-, and 11-year-olds (N = 166) completed a driving simulation task (ongoing task) in which they had to refuel their vehicle at specific points in time (PM task). The availability of cognitive control resources was experimentally manipulated by imposing a secondary task that required divided attention. Children completed the driving simulation task both in a full-attention condition and a divided-attention condition where they had to carry out a secondary task. Results revealed that older children performed better than younger children on the ongoing task and PM task. Children performed worse on the ongoing and PM tasks in the divided-attention condition compared to the full-attention condition. With respect to time monitoring in the final interval prior to the PM target, divided attention interacted with age such that older children's time monitoring was more negatively affected by the secondary task compared to younger children. Results are discussed in terms of developmental shifts from reactive to proactive monitoring strategies.

  16. Allergies, atopy, immune-related factors and childhood rhabdomyosarcoma: a report from the Children's Oncology Group.


    Lupo, Philip J; Zhou, Renke; Skapek, Stephen X; Hawkins, Douglas S; Spector, Logan G; Scheurer, Michael E; Fatih Okcu, M; Melin, Beatrice; Papworth, Karin; Erhardt, Erik B; Grufferman, Seymour


    Rhabdomyosarcoma (RMS) is a highly malignant tumor of developing muscle that can occur anywhere in the body. Due to its rarity, relatively little is known about the epidemiology of RMS. Atopic disease is hypothesized to be protective against several malignancies; however, to our knowledge, there have been no assessments of atopy and childhood RMS. Therefore, we explored this association in a case-control study of 322 childhood RMS cases and 322 pair-matched controls. Cases were enrolled in a trial run by the Intergroup Rhabdomyosarcoma Study Group. Controls were matched to cases on race, sex and age. The following atopic conditions were assessed: allergies, asthma, eczema and hives; in addition, we examined other immune-related factors: birth order, day-care attendance and breastfeeding. Conditional logistic-regression models were used to calculate an odds ratio (OR) and 95% confidence interval (CI) for each exposure, adjusted for age, race, sex, household income and parental education. As the two most common histologic types of RMS are embryonal (n=215) and alveolar (n=66), we evaluated effect heterogeneity of these exposures. Allergies (OR=0.60, 95% CI: 0.41-0.87), hives (OR = 0.61, 95% CI: 0.38-0.97), day-care attendance (OR=0.48, 95% CI: 0.32-0.71) and breastfeeding for ≥ 12 months (OR=0.36, 95% CI: 0.18-0.70) were inversely associated with childhood RMS. These exposures did not display significant effect heterogeneity between histologic types (p>0.52 for all exposures). This is the first study indicating that atopic exposures may be protective against childhood RMS, suggesting additional studies are needed to evaluate the immune system's role in the development of this tumor.

  17. Considerations for non-invasive in-flight monitoring of astronaut immune status with potential use of MEMS and NEMS devices.


    Aponte, V M; Finch, D S; Klaus, D M


    The dynamics of how astronauts' immune systems respond to space flight have been studied extensively, but the complex process has not to date been thoroughly characterized, nor have the underlying principles of what causes the immune system to change in microgravity been fully determined. Statistically significant results regarding overall immunological effects in space have not yet been established due to the relatively limited amount of experimental data available, and are further complicated by the findings not showing systematically reproducible trends. Collecting in vivo data during flight without affecting the system being measured would increase understanding of the immune response process. The aims of this paper are to briefly review the current knowledge regarding how the immune system is altered in space flight; to present a group of candidate biomarkers that could be useful for in-flight monitoring and give an overview of the current methods used to measure these markers; and finally, to further establish the need and usefulness of incorporating real-time analytical techniques for in-flight assessment of astronaut health, emphasizing the potential application of MEMS/NEMS devices.

  18. HLA type-independent method to monitor polyoma BK virus-specific CD4 and CD8 T-cell immunity.


    Hammer, M H; Brestrich, G; Andree, H; Engelmann, E; Rosenberger, C; Tillmann, H; Zwinger, S; Babel, N; Nickel, P; Volk, H-D; Reinke, P


    (Re)activation of quiescent viral diseases is a major problem in immunosuppressed transplant patients. Polyoma BK virus-associated nephropathy (PVAN) caused by active polyoma BK virus (BKV) infection became a main reason for graft loss in kidney transplantation. After diagnosis, most transplant centers react by reducing immunosuppression (IS) to allow the immune system to control the infection. However, the impact of reduced IS on BKV immunity is not well researched. Here we present an HLA type-independent method to monitor BKV-specific T-cell immunity. Applying our method, viral protein 1-specific CD4+ and CD8+ T-cell responses were detected in patients with serum BKV-DNA levels >250 000 copies/mL. In addition, specific T-cell responses were also found in allograft-infiltrating cells. The method can be used to assess the impact of decreased immunosuppression on BKV immunity and to clarify the role of specific T cells in the pathogenesis of PVAN. We strongly recommend its implementation in future clinical studies.

  19. SCT for severe autoimmune diseases: consensus guidelines of the European Society for Blood and Marrow Transplantation for immune monitoring and biobanking

    PubMed Central

    Alexander, T; Bondanza, A; Muraro, P A; Greco, R; Saccardi, R; Daikeler, T; Kazmi, M; Hawkey, C; Simoes, B P; Leblanc, K; Fibbe, W E; Moore, J; Snarski, E; Martin, T; Hiepe, F; Velardi, A; Toubert, A; Snowden, J A; Farge, D


    Over the past 15 years, SCT has emerged as a promising treatment option for patients with severe autoimmune diseases (ADs). Mechanistic studies recently provided the proof-of-concept that restoration of immunological tolerance can be achieved by haematopoietic SCT in chronic autoimmunity through eradication of the pathologic, immunologic memory and profound reconfiguration of the immune system, that is, immune ‘resetting'. Nevertheless, a number of areas remain unresolved and warrant further investigation to refine our understanding of the underlying mechanisms of action and to optimize clinical SCT protocols. Due to the low number of patients transplanted in each centre, it is essential to adequately collect and analyse biological samples in a larger cohort of patients under standardized conditions. The European society for blood and marrow transplantation Autoimmune Diseases and Immunobiology Working Parties have, therefore, undertaken a joint initiative to develop and implement guidelines for ‘good laboratory practice' in relation to procurement, processing, storage and analysis of biological specimens for immune reconstitution studies in AD patients before, during and after SCT. The aim of this document is to provide practical recommendations for biobanking of samples and laboratory immune monitoring in patients with ADs undergoing SCT, both for routine supportive care purposes and investigational studies. PMID:25387090

  20. Effect of a Growing-up Milk Containing Synbiotics on Immune Function and Growth in Children: A Cluster Randomized, Multicenter, Double-blind, Placebo Controlled Study.


    Xuan, Ninh Nguyen; Wang, Dantong; Grathwohl, Dominik; Lan, Phuong Nguyen Thi; Kim, Hoa Vu Thi; Goyer, Amélie; Benyacoub, Jalil


    Common infectious diseases, such as diarrhea, are still the major cause of death in children under 5-years-old, particularly in developing countries. It is known that there is a close relationship between nutrition and immune function. To evaluate the effect of a growing-up milk containing synbiotics on immune function and child growth, we conducted a cluster randomized, multicenter, double-blind, placebo controlled clinical trial in children between 18 and 36 months of age in Vietnam. Eligible children from eight and seven kindergartens were randomly assigned to receive test and isocaloric/ isoproteic control milk, respectively, for 5 months. We found that the blood immunoglobulin A (IgA) level and growth parameters were increased in the test group. Compared to the control group, there was also a trend of decreased vitamin A deficiency and fewer adverse events in the test group. These data suggest that a growing-up milk containing synbiotics may be useful in supporting immune function and promoting growth in children.

  1. Effect of a Growing-up Milk Containing Synbiotics on Immune Function and Growth in Children: A Cluster Randomized, Multicenter, Double-blind, Placebo Controlled Study

    PubMed Central

    Xuan, Ninh Nguyen; Wang, Dantong; Grathwohl, Dominik; Lan, Phuong Nguyen Thi; Kim, Hoa Vu Thi; Goyer, Amélie; Benyacoub, Jalil


    Common infectious diseases, such as diarrhea, are still the major cause of death in children under 5-years-old, particularly in developing countries. It is known that there is a close relationship between nutrition and immune function. To evaluate the effect of a growing-up milk containing synbiotics on immune function and child growth, we conducted a cluster randomized, multicenter, double-blind, placebo controlled clinical trial in children between 18 and 36 months of age in Vietnam. Eligible children from eight and seven kindergartens were randomly assigned to receive test and isocaloric/ isoproteic control milk, respectively, for 5 months. We found that the blood immunoglobulin A (IgA) level and growth parameters were increased in the test group. Compared to the control group, there was also a trend of decreased vitamin A deficiency and fewer adverse events in the test group. These data suggest that a growing-up milk containing synbiotics may be useful in supporting immune function and promoting growth in children. PMID:24353451

  2. The effect of vitamin A supplementation on the intestinal immune response in Mexican children is modified by pathogen infections and diarrhea.


    Long, Kurt Z; Estrada-Garcia, Teresa; Rosado, Jorge L; Ignacio Santos, Jose; Haas, Meredith; Firestone, Mathew; Bhagwat, Jui; Young, Cheryl; DuPont, Herbert L; Hertzmark, Ellen; Nanthakumar, Nanda N


    Vitamin A supplementation has consistently reduced infant mortality and the severity of pathogen-induced diarrhea. The mechanism by which vitamin A modulates the mucosal immune response to produce these effects remains poorly defined. To address this issue, stools collected during the summer months from 127 Mexican children 5-15 mo old enrolled in a larger, randomized, double-blind, placebo-controlled, vitamin A supplementation trial were screened for interleukin (IL)-4, IL-6, interferon-gamma (IFN-gamma), and gastrointestinal pathogens. Fecal cytokine values were categorized into 3 levels (undetectable, or =median). Multinomial regression models were used to determine the probability that vitamin A-supplemented children had higher categorical values of a cytokine than children in the placebo group. Differences in categorical values were also analyzed after stratification by gastrointestinal pathogen infections and diarrheal symptoms. Overall, fecal cytokine categorical levels did not differ between children randomized to the 2 arms. Vitamin A-supplemented children infected with enteropathogenic E. coli (EPEC) had reduced IL-4 and IFN-gamma levels [odds ratio (OR) = 0.3, 95% CI 0.13-0.67 and OR = 0.34, 95% CI 0.14-0.83, respectively] compared with children in the placebo group. Vitamin A-supplemented children had increased IL-4 levels when infected with A. lumbricoides (OR = 12.06, 95% CI 0.95-153.85). In contrast, IL-4 levels increased (OR = 2.14, 95% CI 0.94-4.87) and IFN-gamma levels decreased (OR = 0.51, 95% CI 0.26-0.99) among vitamin A-supplemented children with diarrhea compared with children in the placebo group. These findings suggest that the regulation of the mucosal immune response by vitamin A may depend on the type of enteric pathogen infecting the child and the presence of clinical symptoms.

  3. Immune recovery and the risk of CMV/ EBV reactivation in children post allogeneic haematopoietic stem cell transplantation

    PubMed Central

    Janeczko, Małgorzata; Mielcarek, Monika; Rybka, Blanka; Ryczan-Krawczyk, Renata; Noworolska-Sauren, Dorota


    Immune reconstitution was studied prospectively in 86 children who underwent allogeneic haematopoietic stem cell transplantation (HSCT). We analysed the risk of cytomegalovirus (CMV) and Epstein-Barr virus (EBV) reactivation in correlation with the kinetics of immune recovery and in relation to other potential risk factors that may influence the reactivation of these viruses including: diagnosis, type of HSCT, source of stem cells, type of conditioning, or the occurrence of graft-versus-host disease (GvHD). The absolute number of lymphocyte subpopulations in peripheral blood was evaluated in seven timepoints following HSCT. Significantly lower values of both CD3+ and CD3+CD8+ lymphocytes on day +14 and significantly higher values of both these subsets on day +168 post-transplant in patients with CMV reactivation were observed. Significantly lower values of CD3+CD4+ subpopulation were noted in patients with CMV reactivation on day +28 post allo-HSCT. Significantly lower lymphocyte values in the group with EBV reactivation comparing with the group without EBV reactivation were confirmed only in the case of pan-B lymphocytes (CD19+) subpopulation on day +21, +28, and +84 post allo-HSCT. We identified the impact of CMV reactivation on occurrence of the intestinal acute GvHD, which occurred more frequently in the group with CMV reactivation compared with patients without reactivation. Higher incidence of chronic GvHD was also observed in patients with CMV reactivation compared to the group without reactivation. EBV reactivation occurred more frequently in patients receiving transplants from matched unrelated donors, in particular after peripheral blood stem cell transplantation and while implementing antithymocyte globulin as GvHD prophylaxis. PMID:27833447

  4. Antibody detection in tear samples as a surrogate to monitor host immunity against papillomavirus infections in vaccinated and naturally infected hosts

    PubMed Central

    Brendle, Sarah; Balogh, Karla; Bywaters, Stephanie


    Monitoring serum antibodies against natural infections or after immunizations has been a standard clinical diagnostic procedure. However, collecting blood samples requires trained personnel, and may cause discomfort and increase the risk of complications. In this study, we investigated whether tear samples could serve as a surrogate for serum samples to measure specific antibodies. A widely used preclinical cottontail rabbit papillomavirus (CRPV)/rabbit model has been a surrogate model for high-risk human papillomavirus (HPV) infections. New Zealand white rabbits, either naturally infected with CRPV or immunized with two clinically available HPV vaccines (Gardasil and Cervarix), were examined for antibody generation in both tear and serum samples. We demonstrated that antibodies were detectable in tears from both naturally infected as well as vaccinated animals. Overall, the antibody levels in tears were ~10-fold lower than those from the corresponding serum samples, but background noise was lower in tear samples. The isotypes of antibodies in tears were predominantly IgA and IgG. These findings showed clearly that tears could be a surrogate for serum samples for monitoring antibody responses. As collecting tears causes no discomfort and poses no risk to patients, it represents a novel and promising method for monitoring future HPV epidemiological studies as well as for use in clinical practice. PMID:24903329

  5. Strain-specific Plasmodium falciparum growth inhibition among Malian children immunized with a blood-stage malaria vaccine

    PubMed Central

    Kouriba, Bourema; Bergmann-Leitner, Elke; Angov, Evelina; Coulibaly, Drissa; Diarra, Issa; Daou, Modibo; Niangaly, Amadou; Blackwelder, William C.; Wu, Yukun; Cohen, Joe; Ballou, W. Ripley; Vekemans, Johan; Lanar, David E.; Dutta, Sheetij; Diggs, Carter; Soisson, Lorraine; Heppner, D. Gray; Doumbo, Ogobara K.; Plowe, Christopher V.; Thera, Mahamadou A.


    The blood-stage malaria vaccine FMP2.1/AS02A, comprised of recombinant Plasmodium falciparum apical membrane antigen 1 (AMA1) and the adjuvant system AS02A, had strain-specific efficacy against clinical malaria caused by P. falciparum with the vaccine strain 3D7 AMA1 sequence. To evaluate a potential correlate of protection, we measured the ability of participant sera to inhibit growth of 3D7 and FVO strains in vitro using high-throughput growth inhibition assay (GIA) testing. Sera from 400 children randomized to receive either malaria vaccine or a control rabies vaccine were assessed at baseline and over two annual malaria transmission seasons after immunization. Baseline GIA against vaccine strain 3D7 and FVO strain was similar in both groups, but more children in the malaria vaccine group than in the control group had 3D7 and FVO GIA activity ≥15% 30 days after the last vaccination (day 90) (49% vs. 16%, p<0.0001; and 71.8% vs. 60.4%, p = 0.02). From baseline to day 90, 3D7 GIA in the vaccine group was 7.4 times the mean increase in the control group (p<0.0001). In AMA1 vaccinees, 3D7 GIA activity subsequently returned to baseline one year after vaccination (day 364) and did not correlate with efficacy in the extended efficacy time period to day 730. In Cox proportional hazards regression models with time-varying covariates, there was a slight suggestion of an association between 3D7 GIA activity and increased risk of clinical malaria between day 90 and day 240. We conclude that vaccination with this AMA1-based malaria vaccine increased inhibition of parasite growth, but this increase was not associated with allele-specific efficacy in the first malaria season. These results provide a framework for testing functional immune correlates of protection against clinical malaria in field trials, and will help to guide similar analyses for next-generation malaria vaccines. Clinical trials registry: This clinical trial was registered on, registry

  6. Plasma levels of soluble CD27: a simple marker to monitor immune activation during potent antiretroviral therapy in HIV-1-infected subjects

    PubMed Central



    Plasma levels of soluble CD27 (sCD27) are elevated in diseases characterized by T cell activation and are used as a marker of immune activation. We assessed the usefulness of determining plasma sCD27 as a marker for monitoring immune activation in HIV-1-infected patients treated with highly active antiretroviral therapy (HAART). A first cross-sectional examination of 68 HIV-1-infected and 18 normal subjects showed high levels of sCD27 in HIV-1 infection; plasma sCD27 was correlated to HIV-1 viraemia and inversely correlated to CD4+ T cell count. Twenty-six HIV-1-infected patients undergoing HAART were studied at baseline and after 6, 12, 18 and 24 months of therapy. Seven additional patients under HAART were analysed at baseline, during and after interruption of therapy. In the total population, HAART induced a significant and progressive reduction, but not a normalization, of plasma levels of sCD27 after 24 months. A full normalization of plasma sCD27 was observed in the virological responders (undetectable HIV-1 RNA at months 18 and 24) and also in patients with moderate immunodeficiency at baseline (CD4+ T cell count >200 cells/mm3). Changes in plasma neopterin paralleled the changes in sCD27 but only baseline sCD27 levels were predictive of a greater increase in CD4+ T cell count during the follow-up. Discontinuation of therapy resulted in a rapid increase of sCD27 plasma levels associated with viraemia rebound and drop in CD4+ T cell count. Our findings suggest that plasma sCD27 may represent an alternative and simple marker to monitor immune activation during potent antiretroviral therapy. HIV-1-induced immune activation can be normalized by HAART in successfully treated patients where the disease is not advanced. PMID:11966765

  7. Capturing PLMS and their variability in children with sickle cell disease: Does ankle activity monitoring measure up to polysomnography?

    PubMed Central

    Gallagher, Paul R.; Marcus, Carole L.; Ohene-Frempong, Kwaku; Traylor, Joel T.; Mason, Thornton B. A.


    Objectives To test agreement and define differences in periodic limb movements in sleep (PLMS) measured by polysomnography and an ankle activity monitor, and to describe PLMS variability across nights, feasibility of home monitoring, and correlates of PLMS in children with sickle cell disease (SCD). Methods Twenty children with SCD and restless legs syndrome (RLS) symptoms or polysomnography-documented PLMS underwent concurrent attended polysomnography and ankle activity monitoring over 1–2 nights and home activity monitoring for 3 nights. Serum iron and ferritin were measured pre- and post-polysomnography. Results Adequate sensitivity (1.00), specificity (0.69), and mean bias (5.0±7.4 PLMS/h) for identifying elevated PLMS by activity monitor were obtained when scoring the period from sleep onset to offset rather than time in bed per manufacturer recommendation, and using a cut-point of 10 PLMS/h. Compared to activity monitor, only polysomnographic PLMS demonstrated periodicity, at inter-movement intervals (IMI) 20–35 s; the activity monitor overscored PLMS at the beginning and end of sleep and at shorter IMI (5–15 s; p≤0.003), suggesting misclassification of nonperiodic leg movements as PLMS by activity monitor. PLMS varied across 4 nights by 16.1±13.4 PLMS/h. Post-polysomnography ferritin was associated (positively) with PLMS (p=0.034); RLS symptoms were not. Conclusions Ankle activity monitoring is a valid screening measure for PLMS in children with SCD and can readily be performed at home. Interpretation should incorporate a threshold for elevated PLMS of 10/h and scoring from sleep onset to offset which could be identified with concurrent wrist actigraphy, to better account for true PLMS. PMID:22841030

  8. Potable water quality monitoring of primary schools in Magura district, Bangladesh: children's health risk assessment.


    Rahman, Aminur; Hashem, Abul; Nur-A-Tomal, Shahruk


    Safe potable water is essential for good health. Worldwide, school-aged children especially in the developing countries are suffering from various water-borne diseases. In the study, drinking water supplies for primary school children were monitored at Magura district, Bangladesh, to ensure safe potable water. APHA standard analytical methods were applied for determining the physicochemical parameters of the water samples. For determination of the essential physicochemical parameters, the samples were collected from 20 randomly selected tube wells of primary schools at Magura. The metal contents, especially arsenic (As), iron (Fe), and manganese (Mn), in the water samples were analyzed by atomic absorption spectroscopy. The range of physicochemical parameters found in water samples were as follows: pH 7.05-9.03, electrical conductivity 400-2340 μS/cm, chloride 10-640 mg/L, hardness 200-535 mg/L as CaCO3, and total dissolved solids 208-1216 mg/L. The level of metals in the tube well water samples were as follows: As 1 to 55 μg/L, Fe 40 to 9890 μg/L, and Mn 10 to 370 μg/L. Drinking water parameters of Magura district did not meet the requirement of the World Health Organization drinking water quality guideline, or the Drinking Water Quality Standards of Bangladesh.

  9. Two models for changes of EV71 immunity in infants and young children.


    Tu, Xiaoming; Wang, Yongmei; Zhu, Fengcai; Chen, Feng


    Human enterovirus 71 (EV71) has been associated with outbreaks of hand-foot-and-mouth disease (HFMD) in China. Susceptibility to EV71 is associated with age, but few studies have been accomplished to measure such a relationship. A better understanding of the connection between susceptibility and age is necessary to develop strategies for control of HFMD. In 2010, a survey of an epidemic of EV71 was conducted in a northern city of Jiangsu Province in China. Samples were tested serologically to identify the EV71 neutralizing antibody. Two different mathematical models have now been employed to describe how this antibody varied with age, and parameters in the model were estimated from survey data. Both models depicted the variations in EV71-neutralizing antibody. Seroprevalence was high for neonates but decreased to near zero at 5 months of age. Subsequently, the EV71 antibody levels increased and then remained stable after about 36 months. For models 1 and 2, values for the coefficient of determination (R(2)) were 0.9458 and 0.9576, and values for root mean square error (RMSE) were 0.0755 and 0.0752, respectively. Model 2, formulated from the characteristics of development of the immune system, was more reliable than model 1, formulated from survey data, because the impact of the survey on the structure of the model was removed. Moreover, model 2 provided the possibility to define the parameters in a biological sense.

  10. Biological monitoring involving children exposed to mercury from a barometer in a private residence.


    Scheepers, Paul T J; van Ballegooij-Gevers, Marieke; Jans, Henk


    A small spill of approximately 3 mL of mercury from a broken barometer in a residential setting resulted in blood values of 32 μg/L in a boy of 9 months and 26 μg/L in a girl of 2.5 years in samples collected within 6h after the start of the incident. A nanny who attempted to remove the spill had a blood mercury value of 20 μg/L at the same time point. These elevated blood values were attributed to inhalation rather than dermal uptake or ingestion. Exposure was aggravated by the use of a vacuum cleaner in an early attempt to remove the spill and incomplete decontamination of involved persons, leading to a continuation of exposure. Over a period of three months general cleaning was followed by targeted cleaning of hot spots until the indoor air mercury levels reached a median value of 0.090 μg/m(3) with a range of 0.032-0.140 μg/m(3). Meanwhile the family was staying in a shelter home. Human biological monitoring (HBM) was motivated by the complex exposure situation and the involvement of young children. Initially high blood values triggered alertness for clinical signs of intoxication, that (as it turned out) were not observed in any of the exposed individuals. Despite continued exposure from hair and clothes, within six weeks after the incident, blood levels returned to a background level normally seen in children. HBM contributed to reassurance of the parents of the young children that quick elimination of the mercury did not require medical treatment.

  11. Is the Autism Treatment Evaluation Checklist a Useful Tool for Monitoring Progress in Children with Autism Spectrum Disorders?

    ERIC Educational Resources Information Center

    Magiati, I.; Moss, J.; Yates, R.; Charman, T.; Howlin, P.


    Background: There are few well validated brief measures that can be used to assess the general progress of young children with autism spectrum disorders (ASD) over time. In the present study, the Autism Treatment Evaluation Checklist (ATEC) was used as part of a comprehensive assessment battery to monitor the progress of 22 school-aged children…

  12. Air pollution and children: neural and tight junction antibodies and combustion metals, the role of barrier breakdown and brain immunity in neurodegeneration.


    Calderón-Garcidueñas, Lilian; Vojdani, Aristo; Blaurock-Busch, Eleonore; Busch, Yvette; Friedle, Albrecht; Franco-Lira, Maricela; Sarathi-Mukherjee, Partha; Martínez-Aguirre, Xavier; Park, Su-Bin; Torres-Jardón, Ricardo; D'Angiulli, Amedeo


    Millions of children are exposed to concentrations of air pollutants, including fine particulate matter (PM2.5), above safety standards. In the Mexico City Metropolitan Area (MCMA) megacity, children show an early brain imbalance in oxidative stress, inflammation, innate and adaptive immune response-associated genes, and blood-brain barrier breakdown. We investigated serum and cerebrospinal fluid (CSF) antibodies to neural and tight junction proteins and environmental pollutants in 139 children ages 11.91 ± 4.2 y with high versus low air pollution exposures. We also measured metals in serum and CSF. MCMA children showed significantly higher serum actin IgG, occludin/zonulin 1 IgA, IgG, myelin oligodendrocyte glycoprotein IgG and IgM (p < 0.01), myelin basic protein IgA and IgG, S-100 IgG and IgM, and cerebellar IgG (p < 0.001). Serum IgG antibodies to formaldehyde, benzene, and bisphenol A, and concentrations of Ni and Cd were significantly higher in exposed children (p < 0.001). CSF MBP antibodies and nickel concentrations were higher in MCMA children (p = 0.03). Air pollution exposure damages epithelial and endothelial barriers and is a robust trigger of tight junction and neural antibodies. Cryptic 'self' tight junction antigens can trigger an autoimmune response potentially contributing to the neuroinflammatory and Alzheimer and Parkinson's pathology hallmarks present in megacity children. The major factor determining the impact of neural antibodies is the integrity of the blood-brain barrier. Defining the air pollution linkage of the brain/immune system interactions and damage to physical and immunological barriers with short and long term neural detrimental effects to children's brains ought to be of pressing importance for public health.

  13. Real Time Apnoea Monitoring of Children Using the Microsoft Kinect Sensor: A Pilot Study

    PubMed Central

    Al-Naji, Ali; Gibson, Kim; Lee, Sang-Heon; Chahl, Javaan


    The objective of this study was to design a non-invasive system for the observation of respiratory rates and detection of apnoea using analysis of real time image sequences captured in any given sleep position and under any light conditions (even in dark environments). A Microsoft Kinect sensor was used to visualize the variations in the thorax and abdomen from the respiratory rhythm. These variations were magnified, analyzed and detected at a distance of 2.5 m from the subject. A modified motion magnification system and frame subtraction technique were used to identify breathing movements by detecting rapid motion areas in the magnified frame sequences. The experimental results on a set of video data from five subjects (3 h for each subject) showed that our monitoring system can accurately measure respiratory rate and therefore detect apnoea in infants and young children. The proposed system is feasible, accurate, safe and low computational complexity, making it an efficient alternative for non-contact home sleep monitoring systems and advancing health care applications. PMID:28165382

  14. Real Time Apnoea Monitoring of Children Using the Microsoft Kinect Sensor: A Pilot Study.


    Al-Naji, Ali; Gibson, Kim; Lee, Sang-Heon; Chahl, Javaan


    The objective of this study was to design a non-invasive system for the observation of respiratory rates and detection of apnoea using analysis of real time image sequences captured in any given sleep position and under any light conditions (even in dark environments). A Microsoft Kinect sensor was used to visualize the variations in the thorax and abdomen from the respiratory rhythm. These variations were magnified, analyzed and detected at a distance of 2.5 m from the subject. A modified motion magnification system and frame subtraction technique were used to identify breathing movements by detecting rapid motion areas in the magnified frame sequences. The experimental results on a set of video data from five subjects (3 h for each subject) showed that our monitoring system can accurately measure respiratory rate and therefore detect apnoea in infants and young children. The proposed system is feasible, accurate, safe and low computational complexity, making it an efficient alternative for non-contact home sleep monitoring systems and advancing health care applications.

  15. [Unexpectedly high proportion of preschool children immune to hepatitis A virus. Contact tracing investigation shows the need for vaccination prior to traveling abroad].


    Persson, Hanna; Nasta, Federico; Svensson, Ingrid; Widerström, Micael


    Hepatitis A (HAV) is a low incidence infectious disease in Sweden, and a majority of cases in this country are acquired abroad, although domestic cases are not uncommon in the day care setting. We investigated an outbreak of hepatitis A in two day care centres and found that a large proportion (23%) of the 113 unvaccinated preschool children were immune to HAV. This observation indicates that there may have been sub-clinical cases of HAV at the two centres. The results of our study underscore the importance of HAV vaccination in preschool children prior to travel to areas where this disease is common. The findings also highlight the need for up-to-date national seroepidemiological data on HAV immunity in different age groups in Sweden. Studies aimed at obtaining such information could also provide a basis for deciding whether targeted vaccination strategies against HAV are needed in the day care setting.

  16. Logistics of using the Actiheart physical activity monitors in urban Mexico among 7- to 9-year-old children.


    Wilson, Hannah; Dickinson, Federico; Griffiths, Paula; Bogin, Barry; Varela-Silva, Maria Inês


    Logistics of using new measurement devices are important to understand when developing protocols. This paper discusses the logistics of using Actiheart physical activity monitors on children in an urban, tropical environment in a developing country. Actiheart monitoring of 36 children aged 7-9 years old was undertaken for 7 days in the city of Mérida, Yucatán, Mexico. The Actiheart proved fragile for children and difficult to mend in the field. The excessive sweating due to the tropical climate caused poor adherence of the electrode pads, requiring a pad change midway through and extra pads to be provided. Also extra time was needed to be allotted for increased instructions to participants and their mothers and for individual calibration. When collecting objectively measured physical activity data under harsh conditions, the protocol must accommodate local conditions and device limitations and allow increased time with participants to obtain good quality data.

  17. Use of a monitoring tool for growth and development in Brazilian children – systematic review

    PubMed Central

    de Almeida, Ana Claudia; Mendes, Larissa da Costa; Sad, Izabela Rocha; Ramos, Eloane Gonçalves; Fonseca, Vânia Matos; Peixoto, Maria Virginia Marques


    Abstract Objective: To assess the use of a health monitoring tool in Brazilian children, with emphasis on the variables related to growth and development, which are crucial aspects of child health care. Data source: A systematic review of the literature was carried out in studies performed in Brazil, using the Cochrane Brazil, Lilacs, SciELO and Medline databases. The descriptors and keywords used were “growth and development”, “child development”, “child health record”, “child health handbook”, “health record and child” and “child handbook”, as well as the equivalent terms in Portuguese. Studies were screened by title and summary and those considered eligible were read in full. Data synthesis: Sixty-eight articles were identified and eight articles were included in the review, as they carried out a quantitative analysis of the filling out of information. Five studies assessed the completion of the Child's Health Record and three of the Child's Health Handbook. All articles concluded that the information was not properly recorded. Growth monitoring charts were rarely filled out, reaching 96.3% in the case of weight for age. The use of the BMI chart was not reported, despite the growing rates of childhood obesity. Only two studies reported the completion of development milestones and, in these, the milestones were recorded in approximately 20% of the verified tools. Conclusions: The results of the assessed articles disclosed underutilization of the tool and reflect low awareness by health professionals regarding the recording of information in the child's health monitoring document. PMID:26705605

  18. Ambulatory Blood Pressure Monitoring in a Cohort of Children Referred with Suspected Hypertension: Characteristics of Children with and without Attention Deficit Hyperactivity Disorder

    PubMed Central

    Yue, Melissa W.; Mah, Justin C.; Hamiwka, Lorraine A.


    Childhood hypertension's increasing prevalence has generally been linked to the obesity epidemic. We observed that a significant proportion of children referred to our pediatric center with documented office hypertension are nonobese and have a history of attention deficit hyperactivity disorder (ADHD). To define the extent of this anecdotal observation, we performed a retrospective analysis of ambulatory blood pressure monitoring (ABPM) tests which in our center are routinely performed in newly referred children suspected of hypertension. Twenty-one percent (48 of 227 new referrals) had a history of ADHD, and 81% of them were treated with psychostimulant medications at the time of their ABPM test. Children in this group had a significantly lower average BMI z-score compared with the rest of the children (0.18 versus 0.75) and were significantly more likely to have abnormally elevated wake systolic loads on ABPM (38% versus 4%). The overall proportion of children with any abnormality on ABPM was comparable in both groups (46% versus 40%). Conclusion. A significant proportion of children suspected of hypertension have ADHD which may be related to higher wake systolic BP values. The prevalence of hypertension among children with ADHD will have to be determined in prospective studies. PMID:23970957

  19. Tracking T-cell immune reconstitution after TCRαβ/CD19-depleted hematopoietic cells transplantation in children.


    Zvyagin, I V; Mamedov, I Z; Tatarinova, O V; Komech, E A; Kurnikova, E E; Boyakova, E V; Brilliantova, V; Shelikhova, L N; Balashov, D N; Shugay, M; Sycheva, A L; Kasatskaya, S A; Lebedev, Y B; Maschan, A A; Maschan, M A; Chudakov, D M


    αβT-cell-depleted allogeneic hematopoietic cell transplantation holds promise for the safe and accessible therapy of both malignant and non-malignant blood disorders. Here we employed molecular barcoding normalized T-cell receptor (TCR) profiling to quantitatively track T-cell immune reconstitution after TCRαβ-/CD19-depleted transplantation in children. We demonstrate that seemingly early reconstitution of αβT-cell counts 2 months after transplantation is based on only several hundred rapidly expanded clones originating from non-depleted graft cells. In further months, frequency of these hyperexpanded clones declines, and after 1 year the observed T-cell counts and TCRβ diversity are mostly provided by the newly produced T cells. We also demonstrate that high TCRβ diversity at day 60 observed for some of the patients is determined by recipient T cells and intrathymic progenitors that survived conditioning regimen. Our results indicate that further efforts on optimization of TCRαβ-/CD19-depleted transplantation protocols should be directed toward providing more efficient T-cell defense in the first months after transplantation.Leukemia advance online publication, 9 December 2016; doi:10.1038/leu.2016.321.

  20. Prevalence of atopy in children with type 1 diabetes mellitus, hepatitis B virus carriers, and healthy children: role of T helper 1 (Th1)-type immune response.


    Cakir, Murat; Akcay, Seker; Karakas, Taner; Gedik, Yusuf; Okten, Aysenur; Orhan, Fazil


    The prevalence of allergic diseases such as asthma, hay fever, and atopic dermatitis has increased over the past few decades, especially in developed countries. They are characterized by a chronic inflammatory reaction mediated by T helper 2 (Th2) cells. Two common chronic diseases of childhood-an autoimmune disease, type 1 diabetes mellitus (DM), and a chronic viral infection, hepatitis B virus (HBV) carriers-are associated with a Th1-dominant and Th1-insufficient cytokine profile, respectively. The purpose of this study was to analyze the frequency of allergic disease in patients with type 1 DM and, in HBV carriers, to evaluate the role of Th1-type immune response in atopy and allergic disease. The study included patients with type 1 DM (group I, n = 52), HBV carriers (group III, n = 47), and a healthy control group (group III, n = 209). Participants were screened for allergic disease and atopic sensitization. Symptoms of asthma, eczema, and atopy were found more commonly in HBV carrier children compared with those with DM and healthy controls. This study supports the Th1/Th2 model. The prevalence of allergic disease and atopy is decreased in Th1-mediated autoimmune disease, type 1 DM, and, conversely, is increased in insufficient Th1 response, chronic HBV carriers. Additional studies are needed to evaluate the effect of atopy and allergic diseases in glycemic control and long-term complications in patients with type 1 DM and the effect of atopy on progression of chronic HBV infection.

  1. Homologous and cross-reactive immune responses to enterotoxigenic Escherichia coli colonization factors in Bangladeshi children.


    Qadri, Firdausi; Ahmed, Firoz; Ahmed, Tanvir; Svennerholm, Ann-Mari


    We have studied homologous (HoM) and cross-reacting (CR) immunoglobulin A (IgA) antibody responses to colonization factors (CFs) in Bangladeshi children with diarrhea due to enterotoxigenic E. coli (ETEC) strains of the CF antigen I (CFA/I) group (CFA/I, n = 25; coli surface antigen 4 [CS4], n = 8; CS14, n = 11) and the CS5 group (CS5, n = 15; CS7, n = 8), respectively. The responses to the HoM, CR, and heterologous (HeT) CF antigens in each group of patient were studied and compared to that seen in healthy children (n = 20). In the CFA/I group (CFA/I and CS14), patients responded with antibody-secreting cell (ASC) responses to HoM CFs (geometric mean, 156 to 329 ASCs/10(6) peripheral blood mononuclear cells [PBMCs]) and to CR CFs ( approximately 15 to 38 ASCs/10(6) PBMCs) but least of all to the HeT CS5 antigen (2 to 4 ASCs/10(6) PBMCs). For the CS5 group of patients with ETEC (CS5 and CS7), likewise, responses to HoM CFs (230 to 372 ASCs/10(6) PBMCs) and CR CFs (27 to 676 ASCs/10(6) PBMCs) were seen, along with lower responses to the HeT CFA/I antigen (9 to 38 ASCs/10(6) PBMCs). Both groups of patients responded with CF-specific IgA antibodies to HoM and CR antigens in plasma but responded less to the HeT CFs. The responses in patients were seen very soon after the onset of diarrhea and peaked around 1 week after onset. Vaccinees who had received two doses of the oral, killed whole-cell ETEC vaccine (CF-BS-ETEC) responded with plasma IgA antibodies to CFA/I, a component of the vaccine, but also to the CR CS14 antigen, which was not included in the vaccine, showing that antibody responses can be stimulated by a CFA/I-containing ETEC vaccine to a CR-reacting antigen in individuals in countries where ETEC is endemic.

  2. Monitoring the circulation of rotavirus among children after the introduction of the Rotarix™ vaccine in Goiânia, Brazil.


    Borges, Ana Maria Tavares; Dias e Souza, Menira; Fiaccadori, Fabíola Souza; Cardoso, Divina das Dores de Paula


    The epidemiological features of rotavirus A (RVA) infection differ between children from developing and developed countries which could result in differences in vaccine efficacy around the world. To evaluate the impact of Rotarix™ on RVA prevalence, we monitored RVA genotypes circulating in Goiânia by monitoring virus in faecal samples from children that had or had not been previously vaccinated. From February-November of 2008, 220 faecal samples were collected from children in seven day-care centres. RVA detection was performed by two methodologies and the results were confirmed by polyacrylamide gel electrophoresis. From the 220 samples, eight were RVA-positive (3.6%) and five were from children that had received either one or two doses of the vaccine. All positive samples were collected from children with diarrhoea during August and September. Genotyping of the RVA characterised five of the viral samples as genotype G2P[4] and one as G8P[4], suggesting that G2P[4] was the predominant circulating genotype in Goiânia during the study. The fact that vaccinated children were also infected by RVA suggests that the vaccine does not fully protect against infection by the G2[P4] RVA genotype.

  3. Antibodies against poliomyelitis and measles viruses in immunized and unimmunized children, Ghana 1976-78*

    PubMed Central

    Böttiger, M.; Litvinov, S.; Assaad, F.; Lundbeck, H.; Heller, L.; Beausoleil, E. G.


    The serological response of children to two doses of live oral poliomyelitis vaccine (the first at age 3-8 months and the second at age 9-14 months) and to one dose of measles vaccine (at age 9-14 months) was determined in two regions of Ghana. The seroconversion rates after two doses of poliomyelitis vaccine were lower than expected—24% for poliovirus type 1, 60% for type 2, and 52% for type 3; 23% of the subjects were triple negative. A third dose of the vaccine increased the seroconversion rates to 36%, 73%, and 61% for poliovirus types 1, 2, and 3, respectively; the rate for triple negatives fell to 8%. In the course of the study it was found that there was an intensive circulation of wild polioviruses and that a high proportion of 3-8 month-old infants had maternal antibodies. The seroconversion rate following one dose of measles vaccine was about 90%, a response similar to that obtained in temperate climates. The two main conclusions drawn from the study were: (1) two doses of poliomyelitis vaccine are inadequate to provide protection against poliomyelitis in developing countries; and (2) in developing countries measles vaccine should be given as soon as possible after the age of 8 months. PMID:6976234

  4. Effects of immunizing school children with 2009 influenza A (H1N1) monovalent vaccine on absenteeism among students and teachers in Maine.


    Graitcer, Samuel B; Dube, Nancy L; Basurto-Davila, Ricardo; Smith, Peter F; Ferdinands, Jill; Thompson, Mark; Uzicanin, Amra; Gargiullo, Paul; Chaves, Sandra S; Robinson, Sara; Sears, Stephen; Tipton, Meredith; Monto, Arnold S; Mills, Dora; Shay, David K


    The overall and indirect effects of immunizing school children with influenza A (H1N1) 2009 pandemic virus vaccine prior to and during the peak of virus circulation were evaluated on student and teacher school absenteeism. We used records collected from late 2009 through early 2010 from schools in four Maine counties. Mixed logistic regression models were used to estimate the daily association between school-level immunization coverage and absenteeism by level of influenza activity, after adjusting for the proportion of students receiving reduced-cost lunches, student minority status, absences adjacent to weekends and Thanksgiving, rural school location, and the circulation of other respiratory viruses. Increasing student immunization coverage was associated with reduced absenteeism during periods of high influenza activity. For example, as immunization coverage during the peak week of pandemic virus circulation increased from 38% to 69% (the 10th and 90th percentiles of observed coverage, respectively), relative reductions in daily absenteeism among all students, unimmunized students, and teachers were 8.2% (95% confidence interval [CI]: 6.5, 9.9), 5.7% (95% CI: 4.2, 7.3), and 8.7% (95% CI: 1.3, 16), respectively. Increased vaccination coverage among school-aged Maine children had modest overall and indirect effects on student and teacher absenteeism, despite vaccination occurring just prior and during peak pandemic virus circulation.

  5. Particular Characterisation of an In-Vitro-DTH Test to Monitor Cellular Immunity - Applications for Patient Care and Space Flight

    NASA Technical Reports Server (NTRS)

    Feurecker, M.; Mayer, W.; Gruber, M.; Muckenthaler, F.; Draenert, R.; Bogner, J.; Kaufmann, I.; Crucian, B.; Rykova, M.; Morukov, B.; Sams, C.; Chouker, A.


    Goal:i) Characterization of the role of the main immune reactive cell types contributing to the cellular immune response in the in-vitro DTH and ii) Validation of the in-vitro DTH under different clinical and field conditions. Methods:As positive control whole blood was incubated in the in-vitro DTH, supernatants were gathered after 12, 24 and 48h. Readout parameters of this test are cytokines in the assay's supernatant. To determine the role of T-cells, monocytes and natural killer (NK), these cell populations were depleted using magnetic beads prior to in-vitro-DTH incubation. Validation of the test has occurred under clinical (HIV-patients, ICU) and field-conditions (parabolic/space-flights, confinement). Results:T-cell depletion abandoned almost any IL-2 production and reduced IFN-gamma production irrespective of the type of antigen, whereas CD56 depleted cultures tended to lower IL-2 secretion and IFN-gamma and to parallel a IL-10-increase after viral challenge. This IL-10-increase was seen also in CD14-depleted setups. DTH read-out was significantly different under acute stress (parabolic flight) or chronic stress (ISS), respectively. Preliminary data of HIV infected patients demonstrate that this test can display the contemporary immune status during an antiviral therapy. Conclusion:The in-vitro DTH mirrors adaptive and innate immune activation and may serve as tool also for longitudinal follow up of Th1/Th2 weighed immune response under adverse life conditions on earth and in space. It is planned to implement the assay in the on the ISS (MoCISS).

  6. Monitoring of local CD8β-expressing cell populations during Eimeria tenella infection of naïve and immune chickens.


    Wattrang, E; Thebo, P; Lundén, A; Dalgaard, T S


    The purpose of this study was to monitor abundance and activation of local CD8β-expressing T-cell populations during Eimeria tenella infections of naïve chickens and chickens immune by previous infections. Chickens were infected with E. tenella up to three times. Caecal T-cell receptor (TCR) γ/δ-CD8β+ cells (cytotoxic T lymphocytes; CTL) and TCRγ/δ+CD8β+ cells were characterized with respect to activation markers (blast transformation, CD25 and cell surface CD107a). Cells were also induced to degranulate in vitro as a measure of activation potential. Major findings included a prominent long-lasting, up to 6 weeks, increase in the proportion of CTL among caecal CD45+ cells in the later stages after primary E. tenella infection. These CTL also showed clear signs of activation, that is blast transformation and increased in vitro induced degranulation. At second and third E. tenella infection, chickens showed strong protective immunity but discrete signs of cellular activation were observed, for example increased in vitro induced degranulation of CTL. Thus, primary E. tenella infection induced clear recruitment and activation of local CTL. Upon subsequent infections of strongly immune chickens cellular changes were less prominent, possibly due to lower overall numbers of cells being activated because of the severe restriction of parasite replication.

  7. Monitoring of laying capacity, immunoglobulin Y concentration, and antibody titer development in chickens immunized with ricin and botulinum toxins over a two-year period.


    Pauly, D; Dorner, M; Zhang, X; Hlinak, A; Dorner, B; Schade, R


    One of the key benefits in using chickens for immunization is the high yield of antibodies obtainable. It is known that egg production decreases over time, while animal maintenance costs remain stable. It would, however, be desirable to keep hens as long as possible to obtain maximal amounts of antibodies. To identify a suitable length of time that animals can be kept and to optimize the cost:yield ratio, we monitored the number of eggs laid, the total amount of chicken IgY, and the specific antibody titer from individually prepared eggs over a 2-yr period. The plant toxin ricin and the Clostridium botulinum neurotoxins type A and B were used to immunize 4 chickens. The number of eggs laid in 2 yr was approximately 600 per hen (about 80% of the maximum egg number), yielding about 20 to 40 g of total IgY per hen. A stable antibody titer of 1:100,000 to 1:1,000,000, as measured by ELISA, was obtained following up to 11 injections of 10 to 20 microg of immobilized native toxin. Laying capacities were found to decrease, on average, from 7 eggs/wk at the point of first immunization to 2 eggs/wk after more than 2 yr. In parallel, the yield of total and specific IgY increased over time, so that the antibody recovery remained high, even after prolonged immunization times. Using purified IgY preparations, classical immunological assays such as ELISA and Western blotting were performed. Furthermore, the IgY showed neutralizing capacity when used to block the functional activity of the toxins both in vitro and in vivo. Analysis of the total IgY content over time demonstrated a complex biological oscillation (and the antigen-specific titer), with a shorter time period of around 7 d (circaseptan rhythm). In summary, we successfully immunized chickens with ricin and botulinum neurotoxins and monitored laying capacity, IgY concentration, and specific antibody titer over an extended period of 2 yr.

  8. Assessment of some innate immune responses in dab (Limanda limanda L.) from the North Sea as part of an integrated biological effects monitoring

    NASA Astrophysics Data System (ADS)

    Skouras, Andreas; Lang, Thomas; Vobach, Michael; Danischewski, Dirk; Wosniok, Werner; Scharsack, Jörn Peter; Steinhagen, Dieter


    The marine flatfish dab (Limanda limanda), which lives in direct contact with contaminated sediments, is frequently used as a sentinel species in international monitoring programmes on the biological effects of contaminants. In this study, immune responses were recorded as indicators of sublethal chronic effects of contaminants, in addition to measurement of the induction of mono-oxygenase ethoxyresorufin O-deethylase (EROD) in liver cells, the inhibition of acetylcholin esterase (AChE) in muscle and a quantification of grossly visible diseases and parasites. In total, 336 dab were analysed from five sampling areas in the North Sea, including the German Bight, the Dogger Bank, the Firth of Forth, and two locations close to oil and gas platforms (Ekofisk and Danfield). When considering plasma lysozyme levels, pinocytosis and respiratory burst activity of head kidney leucocytes, a clear gradient could be observed with decreased levels in individuals collected from the Firth of Forth and locations near the oil or gas platforms compared with dab from the Dogger Bank or the German Bight. Individuals with induced EROD activity displayed reduced lysozyme and respiratory burst activities. Lysozyme levels were also reduced in dab with lymphocystis or with nematodes. The data obtained indicate that the assessment of innate immune parameters in a monitoring programme provides supplementary information about immunomodulatory effects associated with the exposure of fish to contaminants. In particular, concentrations of plasma lysozyme, which can be analysed in an easy and inexpensive assay, are considered to be an appropriate parameter for use in a battery of other bioindicators.

  9. Surveillance for adverse events following receipt of pandemic 2009 H1N1 vaccine in the Post-Licensure Rapid Immunization Safety Monitoring (PRISM) System, 2009-2010.


    Yih, W Katherine; Lee, Grace M; Lieu, Tracy A; Ball, Robert; Kulldorff, Martin; Rett, Melisa; Wahl, Peter M; McMahill-Walraven, Cheryl N; Platt, Richard; Salmon, Daniel A


    The Post-Licensure Rapid Immunization Safety Monitoring (PRISM) system is a cohort-based active surveillance network initiated by the US Department of Health and Human Services to supplement preexisting and other vaccine safety monitoring systems in tracking the safety of monovalent pandemic 2009 H1N1 influenza vaccine in the United States during 2009-2010. PRISM investigators conducted retrospective analysis to determine whether 2009 H1N1 vaccination was associated with increased risk of any of 14 prespecified outcomes. Five health insurance and associated companies with 38 million members and 9 state/city immunization registries contributed records on more than 2.6 million doses of 2009 H1N1 vaccine. Data on outcomes came from insurance claims. Complementary designs (self-controlled risk interval, case-centered, and current-vs.-historical comparison) were used to optimize control for confounding and statistical power. The self-controlled risk interval analysis of chart-confirmed Guillain-Barré syndrome found an elevated but not statistically significant incidence rate ratio following receipt of inactivated 2009 H1N1 vaccine (incidence rate ratio = 2.50, 95% confidence interval: 0.42, 15.0) and no cases following live attenuated 2009 H1N1 vaccine. The study did not control for infection prior to Guillain-Barré syndrome, which may have been a confounder. The risks of other health outcomes of interest were generally not significantly elevated after 2009 H1N1 vaccination.

  10. A Study to Find Out the Full Immunization Coverage of 12 to 23-month old Children and Areas of Under-Performance using LQAS Technique in a Rural Area of Tripura

    PubMed Central

    Baidya, Subrata; Datta, Srabani; Mog, Chanda; Das, Shampa


    Introduction It is very important to analyze the factors which acts as obstacle in achieving 100% immunization among children. Lot Quality Assurance Sampling (LQAS) is one of the effective method to assess such barriers. Aim To assess the full immunization coverage among 12 to 23-month old children of rural field practice area under Department of Community Medicine, Agartala Government Medical College and identify the factors for failure of full immunization. Materials and Methods A community based cross-sectional study was conducted from November 2013 to October 2014 on children aged 12 to 23 months old of area under Mohanpur Community health centre. Using LQAS technique 330 samples were selected with multi-stage sampling, each sub-centre being one lot and two calculated to be the decision value. Data was collected using pre-designed pre-tested questionnaire during home visit and verifying immunization card and analysed by computer software SPSS version 21.0. Results The full immunization coverage among 12 to 23 months old children of Mohanpur area was found as 91.67%. Out of all the 22 sub-centres, 36.36% was found under performing as per pre-fixed criteria and the main reasons for failure of full immunization in those areas are unawareness of need of subsequent doses of vaccines and illness of the children. Conclusion LQAS is an effective method to identify areas of under-performance even though overall full immunization coverage is high. PMID:28384892

  11. [The regional model of three-level system of of medical social monitoring of children and adolescents: the pilot project in the Republic of Tatarstan].


    Al'bitskii, V Iu; Ustinova, N V; Farrakhov, A Z; Shavaliev, R F; Kulikov O V; Plaksina, L V


    The absence of system of medical social monitoring of children being in difficult life situations is one of main causes of preventable losses of health and life of children and adolescents. The plan of activities of the working group No3 under the Coordination council under the President of the Russian Federation of the national strategy realization of actions in interest of children for 2012-2017 includes a point: "The development and implementation of standard model of medical social monitoring of children and adolescents in the subjects of the Russian Federation". The implementation of this task is assigned to the Department of social pediatrics of The research center of children health of Moscow and the Ministry of Health of the Republic of Tatarstan. The research methods included analysis and generalization of advanced experience of medical social monitoring of children population; expertise technique; modeling. The regional model of three-level system of medical social monitoring of children population is developed and implemented. The model includes level I (consulting rooms of medical social care of children polyclinics, feldsher obstetric stations, first-aid centers), level II--inter-municipal (departments of medical social monitoring in central district hospitals, medical institutions, clinical diagnostic centers) and level III--regional (the Republican center of medical social monitoring of children and adolescents). The immediate tasks necessary for effective functioning of system of medical social monitoring were determined. Within the framework of implementation of the pilot project the legal and normative legislative acts were developed to regulate functioning of regional model of three-level system of medical social care. The other documents necessary for effective functioning of this system were elaborated. The practical significance of this system is in the implementation of effective three-level model of medical social monitoring of children and

  12. Single nucleotide polymorphisms/haplotypes associated with multiple rubella-specific immune response outcomes post-MMR immunization in healthy children.


    Ovsyannikova, Inna G; Salk, Hannah M; Larrabee, Beth R; Pankratz, V Shane; Poland, Gregory A


    The observed heterogeneity in rubella-specific immune response phenotypes post-MMR vaccination is thought to be explained, in part, by inter-individual genetic variation. In this study, single nucleotide polymorphisms (SNPs) and multiple haplotypes in several candidate genes were analyzed for associations with more than one rubella-specific immune response outcome, including secreted IFN-γ, secreted IL-6, and neutralizing antibody titers. Overall, we identified 23 SNPs in 10 different genes that were significantly associated with at least two rubella-specific immune responses. Of these SNPs, we detected eight in the PVRL3 gene, five in the PVRL1 gene, one in the TRIM22 gene, two in the IL10RB gene, two in the TLR4 gene, and five in other genes (PVR, ADAR, ZFP57, MX1, and BTN2A1/BTN3A3). The PVRL3 gene haplotype GACGGGGGCAGCAAAAAGAAGAGGAAAGAACAA was significantly associated with both higher IFN-γ secretion (t-statistic 4.43, p < 0.0001) and higher neutralizing antibody titers (t-statistic 3.14, p = 0.002). Our results suggest that there is evidence of multigenic associations among identified gene SNPs and that polymorphisms in these candidate genes contribute to the overall observed differences between individuals in response to live rubella virus vaccine. These results will aid our understanding of mechanisms behind rubella-specific immune response to MMR vaccine and influence the development of vaccines in the future.

  13. A Bivariate Mixture Model for Natural Antibody Levels to Human Papillomavirus Types 16 and 18: Baseline Estimates for Monitoring the Herd Effects of Immunization

    PubMed Central

    Vink, Margaretha A.; Berkhof, Johannes; van de Kassteele, Jan; van Boven, Michiel; Bogaards, Johannes A.


    Post-vaccine monitoring programs for human papillomavirus (HPV) have been introduced in many countries, but HPV serology is still an underutilized tool, partly owing to the weak antibody response to HPV infection. Changes in antibody levels among non-vaccinated individuals could be employed to monitor herd effects of immunization against HPV vaccine types 16 and 18, but inference requires an appropriate statistical model. The authors developed a four-component bivariate mixture model for jointly estimating vaccine-type seroprevalence from correlated antibody responses against HPV16 and -18 infections. This model takes account of the correlation between HPV16 and -18 antibody concentrations within subjects, caused e.g. by heterogeneity in exposure level and immune response. The model was fitted to HPV16 and -18 antibody concentrations as measured by a multiplex immunoassay in a large serological survey (3,875 females) carried out in the Netherlands in 2006/2007, before the introduction of mass immunization. Parameters were estimated by Bayesian analysis. We used the deviance information criterion for model selection; performance of the preferred model was assessed through simulation. Our analysis uncovered elevated antibody concentrations in doubly as compared to singly seropositive individuals, and a strong clustering of HPV16 and -18 seropositivity, particularly around the age of sexual debut. The bivariate model resulted in a more reliable classification of singly and doubly seropositive individuals than achieved by a combination of two univariate models, and suggested a higher pre-vaccine HPV16 seroprevalence than previously estimated. The bivariate mixture model provides valuable baseline estimates of vaccine-type seroprevalence and may prove useful in seroepidemiologic assessment of the herd effects of HPV vaccination. PMID:27537200

  14. Monitoring Pharmacologically Induced Immunosuppression by Immune Repertoire Sequencing to Detect Acute Allograft Rejection in Heart Transplant Patients: A Proof-of-Concept Diagnostic Accuracy Study

    PubMed Central

    Valantine, Hannah A.; Penland, Lolita; Luikart, Helen; Strehl, Calvin; Cohen, Garrett; Khush, Kiran K.; Quake, Stephen R.


    Background It remains difficult to predict and to measure the efficacy of pharmacological immunosuppression. We hypothesized that measuring the B-cell repertoire would enable assessment of the overall level of immunosuppression after heart transplantation. Methods and Findings In this proof-of-concept study, we implemented a molecular-barcode-based immune repertoire sequencing assay that sensitively and accurately measures the isotype and clonal composition of the circulating B cell repertoire. We used this assay to measure the temporal response of the B cell repertoire to immunosuppression after heart transplantation. We selected a subset of 12 participants from a larger prospective cohort study ( NCT01985412) that is ongoing at Stanford Medical Center and for which enrollment started in March 2010. This subset of 12 participants was selected to represent post-heart-transplant events, with and without acute rejection (six participants with moderate-to-severe rejection and six without). We analyzed 130 samples from these patients, with an average follow-up period of 15 mo. Immune repertoire sequencing enables the measurement of a patient’s net state of immunosuppression (correlation with tacrolimus level, r = −0.867, 95% CI −0.968 to −0.523, p = 0.0014), as well as the diagnosis of acute allograft rejection, which is preceded by increased immune activity with a sensitivity of 71.4% (95% CI 30.3% to 94.9%) and a specificity of 82.0% (95% CI 72.1% to 89.1%) (cell-free donor-derived DNA as noninvasive gold standard). To illustrate the potential of immune repertoire sequencing to monitor atypical post-transplant trajectories, we analyzed two more patients, one with chronic infections and one with amyloidosis. A larger, prospective study will be needed to validate the power of immune repertoire sequencing to predict rejection events, as this proof-of-concept study is limited to a small number of patients who were selected based on several

  15. Monitoring

    SciTech Connect

    Orr, Christopher Henry; Luff, Craig Janson; Dockray, Thomas; Macarthur, Duncan Whittemore


    The invention provides apparatus and methods which facilitate movement of an instrument relative to an item or location being monitored and/or the item or location relative to the instrument, whilst successfully excluding extraneous ions from the detection location. Thus, ions generated by emissions from the item or location can successfully be monitored during movement. The technique employs sealing to exclude such ions, for instance, through an electro-field which attracts and discharges the ions prior to their entering the detecting location and/or using a magnetic field configured to repel the ions away from the detecting location.

  16. Performance of the DIDGET Blood Glucose Monitoring System in Children, Teens, and Young Adults

    PubMed Central

    Deeb, Larry C; Parkes, Joan L; Pardo, Scott; Schachner, Holly C; Viggiani, Maria T; Wallace, Jane; Bailey, Timothy


    Background This study evaluated the performance of the DIDGET® blood glucose monitoring system (BGMS) in the hands of its intended users: children, teens, and young adults with diabetes. Methods Finger stick capillary blood samples were tested in duplicate by subjects (with parent/guardian assistance, if needed) and health care professionals using the DIDGET BGMS, and results were compared with those obtained using a Yellow Springs Instruments (YSI) glucose analyzer. Modified venous blood samples (i.e., glycolyzed or spiked with glucose) were used to analyze meter performance under extreme glucose concentrations. Accuracy was assessed using International Organization for Standardization (ISO) 15197:2003 guidelines (i.e., 95% of meter results within ±15 mg/dl or ±20% of reference values). Results A total of 123 subjects aged 4 to 24 years with type 1 or type 2 diabetes were enrolled. The DIDGET meter achieved accuracy according to ISO 15197:2003 criteria: >97% of meter results were within ±15 mg/dl or ±20% of reference values. Regression analyses showed a high degree of correlation between meter and YSI results: coefficient of determination (R2) = 98.2% for all samples combined and 97.2% for capillary samples only. Clinical accuracy for combined samples was demonstrated by Parkes consensus error grid analyses; 100% of meter results were in zone A (98.5%) or zone B (1.5%). There was no difference in performance or accuracy across age subsets. Hematocrit values did not affect meter blood glucose results. Conclusion The DIDGET BGMS provided accurate test results across all age ranges in children, teens, and young adults with diabetes. PMID:22027310

  17. Satellite and in-situ monitoring of urban air pollution in relation with children's asthma

    NASA Astrophysics Data System (ADS)

    Dida, Mariana R.; Zoran, Maria A.


    Urban air pollution and especially aerosols have significant negative health effects on urban population, of which children are most exposed for the rapid increase of asthma disease. An allergic reaction to different allergens is a major contributor to asthma in urban children, but new research suggests that the allergies are just one part of a more complex story. Very early exposure to certain components of air pollution can increase the risk of developing of different allergies by age 7. The epidemiological research on the mutagenic effects of airborne particulate matter pointed their capability to reach deep lung regions, being vehicles of toxic substances. The current study presents a spatio-temporal analysis of the aerosol concentrations in relation with meteorological parameters in two size fractions (PM10 and PM2.5) and possible health effects in Bucharest metropolitan area. Both in-situ monitoring data as well as MODIS Terra/Aqua time-series satellite data of particle matter PM2.5 and PM10 concentrations have been used to qualitatively assess distribution of aerosols in the greater metropolitan are of Bucharest comparative with some other little towns in Romania during 2010- 2011 period. It was found that PM2.5 and PM10 aerosols exhibit their highest concentration mostly in the central part of the towns, mainly due to road traffic as well as in the industrialized parts outside of city's centre. Pediatric asthma can be managed through medications prescribed by a healthcare provider, but the most important aspect is to avoid urban locations with high air pollution concentrations of air particles and allergens.

  18. Patterns of physical activity determined by heart rate monitoring among diabetic children

    PubMed Central

    Massin, M; Lebrethon, M; Rocour, D; Gerard, P; Bourguignon, J


    Background: Children with type 1 diabetes should be encouraged to participate in physical activity because exercise can benefit insulin sensitivity and improve known risk factors for atherosclerosis. Methods: Physical activity patterns of 127 children and adolescents with stable type 1 diabetes were investigated by 24 hour continuous heart rate monitoring. The percentage of heart rate reserve was used to measure the amounts of physical activity at different intensities. The results were compared with normative data. Results: Diabetic preschoolchildren accumulated 192.7 (78.1), 39.1 (24.3), and 21.3 (9.4) minutes/day (mean (SD)) of light, moderate, and vigorous physical activity, respectively. At the same activity levels, diabetic schoolchildren accumulated 168.9 (76.7), 37.9 (15.9), and 19.0 (14.8) minutes/day, and diabetic teenagers accumulated 166.3 (67.5), 45.6 (26.9), and 25.2 (15.3) minutes/day. Diabetic schoolchildren were significantly more active than healthy peers when considering moderate activity; diabetic teenagers were significantly more active when considering moderate and vigorous activity. There was a negative correlation between the most recent glycated haemoglobin and the time spent in light activities in schoolchildren, and a negative correlation between mean glycated haemoglobin for one year and time spent in light and moderate activities in schoolchildren. Conclusion: The majority of our diabetic patients meet the classical paediatric guidelines for physical activity and compare favourably with their healthy peers. PMID:15941770

  19. Primary and rescue immune tolerance induction in children and adults: a multicentre international study with a VWF-containing plasma-derived FVIII concentrate.


    Oldenburg, J; Jiménez-Yuste, V; Peiró-Jordán, R; Aledort, L M; Santagostino, E


    Most studies on immune tolerance induction (ITI) therapy in haemophilia A patients are focused on primary ITI in children. Here we report on the ITI outcome in a large retrospective cohort, including adults and patients with rescue ITI, treated with a pdFVIII/VWF concentrate. Retrospective data from haemophilic patients (FVIII< 2%) with inhibitors from 22 centres in Spain, Italy and Germany, who underwent primary or rescue ITI with pdFVIII/VWF concentrate, were collected. Complete success (CS), partial success (PS) and failure were defined based on the criteria of the consensus recommendations of the 2006 International ITI Workshop. A total of 41 cases of primary ITI (32 children and 9 adults) and 19 cases of rescue ITI (17 children and 2 adults) were evaluated. Success (CS+PS) rate of 87% was achieved in primary ITI and 74% in the higher risk profile of rescue ITI. Eight of nine (85%) patients with poorest prognosis (three or more of the known risk factors of poor response to ITI) achieved success (CS+PS). CS of 100% was observed in eight primary ITI patients with titre at start of ITI ≤2.5 BU and inhibitor peak ≤25 BU. The favourable response rates in primary and rescue ITI in children and in adult patients, even in the presence of poor prognostic factors, should be encouraged for broadening the indication of immune tolerance therapy in haemophilia A patients with inhibitors.

  20. Immune constitution monitoring after PBMC transplantation in complete DiGeorge syndrome: an eight-year follow-up.


    Daguindau, Nicolas; Decot, Véronique; Nzietchueng, Rosine; Ferrand, Christophe; Picard, Capucine; Latger-Cannard, Véronique; Gregoire, Marie José; Beri, Mylène; Salmon, Alexandra; Stoltz, Jean François; Bordigoni, Pierre; Bensoussan, Danièle


    A young boy with a confirmed complete DiGeorge Syndrome (cDGS) underwent a peripheral blood mononuclear cell transplantation (PBMCT) from his HLA-identical sister at 4.5 years of age, without a conditioning regimen. Eight years later, he is healthy with good immunological functions in the presence of a stable mixed T-cell chimerism. Absence of recent thymic emigrants is confirmed. We observe an inverted CD4+/CD8+ ratio, related to the CD8 subset expansion, a skewing of the TCR repertoire, especially on the CD8+ subset and a telomere loss on the CD8+ cells compared to the donor. However, these anomalies do not seem to have an impact on functional immunity. PBMCT in cDGS using an HLA-matched sibling donor provides good long-lasting immunity and is an easy alternative to bone marrow transplantation and to thymic transplantation.

  1. Monitoring dynamic interactions of tumor cells with tissue and immune cells in a lab-on-a-chip.


    Charwat, Verena; Rothbauer, Mario; Tedde, Sandro F; Hayden, Oliver; Bosch, Jacobus J; Muellner, Paul; Hainberger, Rainer; Ertl, Peter


    A complementary cell analysis method has been developed to assess the dynamic interactions of tumor cells with resident tissue and immune cells using optical light scattering and impedance sensing to shed light on tumor cell behavior. The combination of electroanalytical and optical biosensing technologies integrated in a lab-on-a-chip allows for continuous, label-free, and noninvasive probing of dynamic cell-to-cell interactions between adherent and nonadherent cocultures, thus providing real-time insights into tumor cell responses under physiologically relevant conditions. While the study of adherent cocultures is important for the understanding and suppression of metastatic invasion, the analysis of tumor cell interactions with nonadherent immune cells plays a vital role in cancer immunotherapy research. For the first time, the direct cell-to-cell interactions of tumor cells with bead-activated primary T cells were continuously assessed using an effector cell to target a cell ratio of 10:1.

  2. Draw It again Sam: the effect of drawing on children's suggestibility and source monitoring ability.


    Bruck, M; Melnyk, L; Ceci, S J


    Preschool children (aged 3 to 6 years) participated in a magic show. Later, the children were given repeated true and false reminders about the show. Half the children were asked to draw these true and false reminders (drawing condition) and half the children were asked questions about the reminders but not to draw them (question condition). Later, children in the drawing condition had better recall of true reminders than children in the question group; however, children in the drawing group also recalled more false reminders than children in the question group. Finally, although children in the drawing group had better memory of the source of the reminders than children in the question group, both groups equally reported that the false reminders actually happened.

  3. No Differences of Immune Activation and Microbial Translocation Among HIV-infected Children Receiving Combined Antiretroviral Therapy or Protease Inhibitor Monotherapy

    PubMed Central

    Falcon-Neyra, Lola; Benmarzouk-Hidalgo, Omar J.; Madrid, Lola; Noguera-Julian, Antoni; Fortuny, Claudia; Neth, Olaf; López-Cortés, Luis


    Abstract This is a cross-sectional study of 15 aviremic chronic HIV-infected children revealing no differences in immune activation (IA; HLA-DR+CD38+ CD4+ and CD8+ T cells, and sCD14) and microbial translocation (MT; lipopolysaccharides (LPS) and 16S rDNA) among HIV-infected patients under combined antiretroviral treatment (cART; n = 10) or ritonavir-boosted protease inhibitor monotherapy (mtPI/rtv; n = 5). In both cases, IA and MT were lower in healthy control children (n = 32). This observational study suggests that ritonavir boosted protease inhibitor monotherapy (mtPI/rtv) is not associated with an increased state of IA or MT as compared with children receiving cART. PMID:25789946

  4. The utility of bispectral index monitoring for prevention of rocuronium-induced withdrawal movement in children

    PubMed Central

    Lim, Byung Gun; Lee, Il Ok; Kim, Young Sung; Won, Young Ju; Kim, Heezoo; Kong, Myoung Hoon


    lower in group T than in group C and significantly lower in group S than in groups C and T. Conclusion: The confirmation of a deep hypnotic state with BIS values lower than 40 using BIS monitoring can reduce the grade of rocuronium-induced WMs during anesthesia induction using thiopental sodium or sevoflurane in children. PMID:28079825

  5. Humoral immune responses and CD27+ B cells in children with DiGeorge syndrome (22q11.2 deletion syndrome).


    Finocchi, A; Di Cesare, S; Romiti, M L; Capponi, C; Rossi, P; Carsetti, R; Cancrini, C


    The spectrum of T-cell abnormalities in 22q11.2 syndrome is quite broad, ranging from profound and life threatening to non-existent defects. Humoral abnormalities have been described in some of these patients, although no data are currently available on their phenotypical and functional B cell subsets. The purpose of this study was to investigate humoral immune function in a cohort of 13 children with DiGeorge syndrome by immunophenotyping B and by analysing their functionality in vivo. Humoral immunity was assessed by serum immunoglobulin evaluation, IgG subclasses determination, and testing of specific antibody titers to recall antigens. B cells were analyzed by flow cytometry and the relevant percentage of membrane surface expression of CD27, IgM, IgD was evaluated. In our cohort, one of 13 children (7.7%) had a complete IgA deficiency, four of 13 (30.7%) had minor immunoglobulin abnormalities, and five (38%) had an impaired production of specific antibodies. Five of 13 children (38%) had recurrent infections. Interestingly, peripheral CD27+ B cells were reduced in our patients as compared with age-matched healthy controls, and this decrement was statistically significant for IgM+ IgD+ CD27+ B cells. Immunoglobulin abnormalities were associated with the occurrence of recurrent infections. We conclude that a significant proportion of patients with DiGeorge syndrome have defective humoral immunity, which may represent an additional pathogenic mechanism underlying the increased susceptibility to infections. Whether the decreased CD27+ B-cell subset might be one of the defects that contribute to impaired humoral immunity, and to susceptibility to infection remains to be elucidated.

  6. Measles vaccine coverage and immune response in children of Caiabi and Metuktire Indian tribes living in malarial endemic area: Parque indígena do Xingu, Central Brazil.


    Spindel, R; Baruzzi, R G; Souza, V A; Ferreira, A W; Avila, S L


    Measles vaccination efficiency was evaluated in children from two Indian tribes - Caiabi and Metuktire - living in the Amazon region, in the Parque Indigena do Xingu (PIX). The population sample, selected at random, made up 37 Caiabi and 28 Metuktire children, aged from 20-75 months (40%). For operational and epidemiological reasons, measles vaccine is given from 6 months of age. The average age of children when they received the vaccine was 11.5 months for the first dose and 20 months for the second. The search for IgG antibodies against measles virus and Plasmodium falciparum was made through immunofluorescence assay (IFA). Measles vaccine coverage has reached 60% at 12 months of age and 92% at 18 months, whereas post-vaccine serum conversion was 95% in Caiabi children (geometric mean of titres (GMT) 126) and 89% in Metuktire (GMT 109). The difference in GMT is not statistically significant. Seventy-three per cent of Caiabi children (GMT 101) and 100% of Metuktire children (GMT135) were plasmodium antibody positive, showing they had been exposed to malarial infection. Despite the differences detected, the immune response to measles vaccine was satisfactory in both groups, with a positive percentage consistent with that achieved in non-malarial areas in Americas. The results show the efficiency of a vaccination programme in an indigenous area despite the difficulties in reaching the villages and maintaining the cold chain, and also despite the malaria endemicity.

  7. Monitoring Web Site Usage of e-Bug: A Hygiene and Antibiotic Awareness Resource for Children

    PubMed Central

    Rajapandian, Vijayamaharaj; Eley, Charlotte V; Hoekstra, Beverley A; Lecky, Donna M; McNulty, Cliodna AM


    Background e-Bug is an educational resource which teaches children and young people about microbes, hygiene, infection, and prudent antibiotic use. The e-Bug resources are available in over 22 different languages and they are used widely across the globe. The resources can be accessed from the e-Bug website. Objective The objective of this study was to analyze the usage of the e-Bug website in order to understand how users access the website, where and when they access the site, and to review variation in use across the different areas of the site. Methods The usage statistics for the e-Bug website were monitored by Google Analytics between September 2010 and August 2013. Results The statistics show the website had over 324,000 visits during the three years, from just under 250,000 visitors, with the number of visitors increasing year after year. Visitors accessed the website from 211 different countries, with more than 267,000 documents downloaded. The majority of visitors were from the United Kingdom and visited the English website, although countries such as France and Portugal were also frequent visitors. Conclusions These website statistics confirm that e-Bug is frequently used across Europe and highlight that e-Bug use has expanded across the world. The findings from this report will be used to inform future modifications or updates to the materials, as well as the development of new educational resources. PMID:26567127

  8. Critical assessment of the use of growth monitoring for identifying high risk children in primary health care programmes.

    PubMed Central

    Briend, A.; Bari, A.


    OBJECTIVE--To see whether change in weight was a more useful index than weight for age in assessing the risk of dying among malnourished children. DESIGN--Prospective cohort study. SETTING--Rural community in Bangladesh being served by international health organisation. PARTICIPANTS--1011 Children aged under 5, of whom 66 died. END POINT--Efficient screening method for identifying malnourished children at risk of dying. MEASUREMENTS AND MAIN RESULTS--Weight was measured every month. Weight for age and monthly change in weight averaged over one and three months were calculated. Sensitivity and specificity curves were used to compare the values of these two variables in identifying children with a high risk of dying. Weight for age was more sensitive than change in weight at all levels of specificity. Changes in weight, however, were independently related to the risk of dying even when intercurrent diseases and low weight for age were taken into account. CONCLUSIONS--For identifying children with a high risk of dying weight for age is a more efficient screening tool than a recent change in weight. Growth monitoring as currently recommended for primary health care programmes in developing countries does not seem to be the most effective approach in identifying children in need of urgent help. PMID:2503147

  9. FastStats: Immunization


    ... this? Submit What's this? Submit Button NCHS Home Immunization Recommend on Facebook Tweet Share Compartir Data are ... Percent of children 19-35 months old receiving vaccinations for: Diphtheria, Tetanus, Pertussis (4+ doses DTP, DT, ...

  10. A significant and consistent reduction in rotavirus gastroenteritis hospitalization of children under 5 years of age, following the introduction of universal rotavirus immunization in Israel

    PubMed Central

    Muhsen, Khitam; Rubenstein, Uri; Kassem, Eias; Goren, Sophy; Schachter, Yaakov; Kremer, Adi; Shulman, Lester M; Ephros, Moshe; Cohen, Dani


    Universal rotavirus vaccination with RotaTeq was introduced in Israel in December 2010. We examined hospitalization rates of children under 5 years of age due to all-cause and rotavirus gastroenteritis, both before and 3 years after universal introduction of the vaccination. An ongoing hospital-based surveillance network that was established in November 2007, accessed information regarding hospitalization of children due to gastroenteritis (n = 6205) in 3 hospitals in northern Israel, with an annual average of about 60,000 children under 5 years of age living in the catchment area of these hospitals. Stool samples were tested for rotavirus by immunochromatography. Compared to the period preceding implementation of the universal rotavirus vaccination (2008–2010), hospitalizations due to rotavirus gastroenteritis in children <5 years of age decreased significantly, by 55% (95% CI 43%-67%) during the period of universal vaccination (2011–2013), a decrease that was sustained throughout the 3 year period. This reduction was greater in children aged 0–23 months (60–61%) than in toddlers aged 24–59 months (36%). A 32% (95% CI 21%-45%) decrease in the incidence of all-cause gastroenteritis was also observed. During the period preceding universal vaccination, rotavirus diarrhea showed typical winter seasonality, with highest incidence in December. However, the winter peak was substantially blunted during the period of universal immunization. Surveillance of rotavirus gastroenteritis should continue to assess the long-term impact of such a program. Our findings are of relevance to high and middle-income countries considering the introduction of a universal rotavirus immunization program. PMID:26212174

  11. A significant and consistent reduction in rotavirus gastroenteritis hospitalization of children under 5 years of age, following the introduction of universal rotavirus immunization in Israel.


    Muhsen, Khitam; Rubenstein, Uri; Kassem, Eias; Goren, Sophy; Schachter, Yaakov; Kremer, Adi; Shulman, Lester M; Ephros, Moshe; Cohen, Dani


    Universal rotavirus vaccination with RotaTeq was introduced in Israel in December 2010. We examined hospitalization rates of children under 5 years of age due to all-cause and rotavirus gastroenteritis, both before and 3 years after universal introduction of the vaccination. An ongoing hospital-based surveillance network that was established in November 2007, accessed information regarding hospitalization of children due to gastroenteritis (n = 6205) in 3 hospitals in northern Israel, with an annual average of about 60,000 children under 5 years of age living in the catchment area of these hospitals. Stool samples were tested for rotavirus by immunochromatography. Compared to the period preceding implementation of the universal rotavirus vaccination (2008-2010), hospitalizations due to rotavirus gastroenteritis in children <5 years of age decreased significantly, by 55% (95% CI 43%-67%) during the period of universal vaccination (2011-2013), a decrease that was sustained throughout the 3 year period. This reduction was greater in children aged 0-23 months (60-61%) than in toddlers aged 24-59 months (36%). A 32% (95% CI 21%-45%) decrease in the incidence of all-cause gastroenteritis was also observed. During the period preceding universal vaccination, rotavirus diarrhea showed typical winter seasonality, with highest incidence in December. However, the winter peak was substantially blunted during the period of universal immunization. Surveillance of rotavirus gastroenteritis should continue to assess the long-term impact of such a program. Our findings are of relevance to high and middle-income countries considering the introduction of a universal rotavirus immunization program.

  12. Salivary cytokines as a minimally-invasive measure of immune functioning in young children: correlates of individual differences and sensitivity to laboratory stress.


    Riis, Jenna L; Granger, Douglas A; DiPietro, Janet A; Bandeen-Roche, Karen; Johnson, Sara B


    There is growing interest in minimally-invasive measures of environmentally-responsive biological systems in developmental science. Contributing to that endeavor, this study explores the intercorrelations, correlates, and task-sensitivity of proinflammatory salivary cytokines in childhood. Saliva was sampled from 125 healthy five-year old children (49% male) across a series of cognitive and emotional challenge laboratory tasks. Samples were assayed for cytokines (IL-1β, IL-6, IL-8, TNFα), and markers of hypothalamic-pituitary-adrenal (HPA) and autonomic nervous system (ANS) activation (salivary cortisol and alpha-amylase [sAA]). Cytokines were positively intercorrelated and task-sensitivity varied. Except IL-8, cytokines were elevated in children with oral health issues and tobacco smoke exposure. Among boys, cytokines were positively related to sAA and negatively related to cortisol. The findings suggest that in healthy children, salivary cytokine levels reflect compartmentalized oral immune activity. Associations between ANS and HPA activity and cytokines in saliva may present opportunities for minimally-invasive methods to explore neuroendocrine-immune interactions during development.

  13. Humoral, Mucosal, and Cell-Mediated Immunity Against Vaccine and Nonvaccine Genotypes After Administration of Quadrivalent Human Papillomavirus Vaccine to HIV-Infected Children

    PubMed Central

    Weinberg, Adriana; Song, Lin-Ye; Saah, Alfred; Brown, Martha; Moscicki, Anna B.; Meyer, William A.; Bryan, Janine; Levin, Myron J.


    Objectives. To characterize the immunogenicity of a quadrivalent human papillomavirus vaccine (QHPV) in human immunodeficiency virus (HIV)–infected children, we studied their immune responses to 3 or 4 doses. Methods. HIV-infected children aged 7–12 years with a CD4 cell percentage of ≥15% of lymphocytes, received 3 doses of QHPV with or without a fourth dose after 72 weeks. Type-specific and cross-reactive antibodies and cell-mediated immunity were measured. Results. Type-specific antibodies to HPV6, 11, and 16 were detected in 100% and ≥94% of children at 4 and 72 weeks, respectively, after the third QHPV dose. Corresponding numbers for HPV18 were 97% and 76%, respectively. A fourth QHPV dose increased seropositivity to ≥96% for all vaccine genotypes. Four weeks after the third QHPV dose, 67% of vaccinees seroconverted to HPV31, an HPV16-related genotype not in the vaccine; 69% and 39% of vaccinees developed mucosal HPV16 and 18 immunoglobulin G antibodies, respectively; and 60% and 52% of vaccinees developed cytotoxic T lymphocytes (CTLs) for HPV16 and 31, respectively. Conclusions. Three QHPV doses generated robust and persistent antibodies to HPV6, 11, and 16 but comparatively weaker responses to HPV18. A fourth dose increased antibodies against all vaccine genotypes in an anamnestic fashion. CTLs and mucosal antibodies against vaccine genotypes, as well as cross-reactive antibodies and CTL against nonvaccine genotypes, were detected. PMID:22859825

  14. An Immunization Education Program for Childcare Providers

    ERIC Educational Resources Information Center

    Hayney, Mary S.; Bartell, Julie C.


    The childhood immunization schedule includes at least 17 scheduled immunizations prior to the age of 24 months. Immunization laws require childcare centers to maintain immunization records and enforce immunization standards for children who attend these centers. Childcare providers generally receive little formal education about infectious…

  15. Immunizations: Active vs. Passive


    ... a certain type of wild animal bites a child. Passive immunizations for hepatitis A (gamma globulin) may be helpful ... A is common. They are typically given before children or adults leave on their ... active vaccination is preferable. Keep in mind that passive immunizations ...

  16. Immunity and Nutrition.

    ERIC Educational Resources Information Center

    Dupin, Henri; Guerin, Nicole


    The three articles in this issue of a periodical focussed on various aspects of the life and health of children in the tropics concern: (1) immune defenses; (2) interactions between nutrition disorders and infection; and (3) immunity and vaccination. The science of immunology has progressed rapidly in recent years. A brief review of present…

  17. Age-Dependent Association among Helicobacter pylori Infection, Serum Pepsinogen Levels and Immune Response of Children to Live Oral Cholera Vaccine CVD 103-HgR

    PubMed Central

    Muhsen, Khitam; Lagos, Rosanna; Reymann, Mardi K.; Graham, David Y.; Pasetti, Marcela F.; Levine, Myron M.


    Background Through its effects on gastric secretion, we hypothesized that Helicobacter pylori infection may influence oral immunization. Accordingly, we examined the association between H. pylori infection, serum pepsinogen (PG) (measures for H. pylori gastritis) and vibriocidal antibody (a correlate of protection) seroconversion following oral immunization with CVD 103-HgR live cholera vaccine among children of different ages. Methods Sera from 422 Chilean children who were vaccinated with a single dose of CVD 103-HgR were tested by ELISA for serum IgG antibodies to H. pylori, PG I and PG II levels and antibodies to Shigella flexneri 2a lipopolysaccharide and hepatitis A virus (as markers of low socioeconomic status and exposure to enteric pathogens). Results The likelihood of vibriocidal antibody seroconversion following vaccination with CVD 103-HgR was significantly decreased in H. pylori-seropositive children age 6 months to 4 years with PG II>8 µg/L (adjusted OR 0.14 (95% CI 0.03–0.61; P = 0.009), and also in H. pylori seropositives with lower PG II level (adjusted OR 0.34, 95% CI 0.14–0.83; P = 0.017), compared to H. pylori-seronegatives. H. pylori-seropositive children aged 5–9 years with serum PG I>30 µg/L (indicating more severe gastritis) had higher odds of vibriocidal seroconversion than those with lower PG I levels (adjusted OR 4.41, 95%CI 1.26–15.38; P = 0.02). There was no significant association between exposures to S. flexneri 2a or hepatitis A virus and vibriocidal seroconversion. Conclusions As H. pylori gastritis progresses with increasing pediatric age in developing country venues, changes in gastric secretion ensue that we believe explain the observed differences in age-related immune responses to immunization with live oral cholera vaccine. The effect of H. pylori and changes of gastric acid secretion on the immunogenicity of various oral vaccines should be studied in different developing, transitional and industrialized

  18. Air pollutant monitoring for the East Bay Children's Respiratory Health Study

    SciTech Connect

    Singer, Brett C.; Hotchi, Toshifumi; Hodgson, Alfred T.


    This report describes the methodology and presents the summary results of the air pollutant monitoring program conducted by Lawrence Berkeley National Laboratory in support of the East Bay Children's Respiratory Health Study. The full study is examining the effects of chronic exposure to traffic-related pollutants on respiratory health among 3rd and 4th grade children attending ten neighborhood elementary schools in the San Francisco East Bay Area (Hayward, San Leandro and Oakland, CA). The demographically similar schools are located at varying distances from the I-880 and CA-92 freeways. Several schools were selected because they are located within 300 m in the predominant downwind direction (east) from either of the freeways. Measurements of multiple pollutants were made outdoors at the schools over 1-2 week intervals for 14 weeks in spring and eight weeks in fall 2001 using a custom-designed and validated package of commercially available monitoring equipment. Particulate matter was sampled over all hours (24 h per day) or during schools hours only with battery-operated programmable pumps and inlet devices for PM{sub 10} and PM{sub 2.5}. These pumps were modified to allow for up to 10 days of continuous operation. Fine particle mass and black carbon (BC) were determined from the collected filters. Nitrogen oxides (NO{sub x} and NO{sub 2}) were measured with passive samplers. Carbon monoxide (CO) was measured continuously with an electrochemical sensor. Gasoline-related volatile organic compounds (VOCs) were measured with passive samplers during three 4-week intervals in spring 2001 and two 4-week periods in early 2002. All samplers were deployed in a metal cabinet located outside at each school. Ranges of study average pollutant concentrations (all-hours) at the ten individual schools were: NO{sub x}, 33-68 ppb; NO{sub 2}, 19-31 ppb; PM{sub 10} mass, 27-32 {micro}g/m{sup 3}; PM{sub 2.5} mass, 12-15 {micro}g/m{sup 3}; and BC associated with PM{sub 2.5}, 0

  19. Pneumococcal pneumonia prevention among adults: is the herd effect of pneumococcal conjugate vaccination in children as good a way as the active immunization of the elderly?


    Prato, Rosa; Fortunato, Francesca; Martinelli, Domenico


    The indirect protection of adults as a result of pneumococcal conjugate vaccination of infants has been discussed from different epidemiological points of view. In some countries, including Italy, even after pediatric vaccination, vaccine serotypes are still responsible for most pneumonia and invasive diseases in the elderly. Although the Community-Acquired Pneumonia Immunization Trial in Adults (CAPITA) produced encouraging results, it has not showed the efficacy of the 13-valent conjugate vaccine in preventing pneumococcal community-acquired pneumonia regardless of the number of episodes and serotype. Addressing these points by monitoring the direct impact of adult vaccination in real life distinguished from the effects of herd immunity will assist public health decision-making on the most effective adult pneumococcal vaccination strategies.

  20. Patterns of physical activity defined by continuous heart rate monitoring among children from Liège.


    Massin, M M; Bourguignont, A; Lepage, Ph; Gérard, P


    Health benefits of a physically active lifestyle are well documented. We therefore investigated the physical activity patterns of 200 children from Liège. They were monitored continuously using a 24-hour Holter monitoring system during normal weekdays and the percentage of heart rate reserve (%HRR) was used to measure the amounts of physical activity at different intensities. Preschool children attained 184.3+/-54.2, 40.7+/-16.1, 15.8+/-6.9 and 6.0+/-7.2 minutes/day (mean+/-SD) between 20% to 40%, 40% to 50%, 50% to 60%, and greater than 60% of HRR, respectively. At the same %HRR intensities, schoolchildren attained 165.6+/-74.6, 32.1+/-12.1, 15.8+/-6.7 and 7.0+/-5.9 minutes/day, and teenagers attained 159.2+/-68.3, 32.1+/-23.5, 13.1+/-6.0 and 6.1+/-6.3 minutes/day. Age was a significant predictor of the intercept and slope of the time spent in physical activity and %HRR relationship. In Liège the average youth accumulates +/-30 to 40 minutes/day of moderate-intensity physical activity and +/-20 minutes/day of high-intensity physical activity. Those children meet the classical revised guidelines for physical activity but do not compare favourably with children from elsewhere. On the other hand, they get more than 2 1/2 to 3 hours/day of low-intensity physical activity. Our findings suggest that children from Liège are not engaged in sedentary behaviour but do not experience the ideal amount and type of physical activity classically believed to benefit the cardiopulmonary system. Public health strategies should be adapted to our findings.

  1. e-Monitoring of Asthma Therapy to Improve Compliance in children using a real-time medication monitoring system (RTMM): the e-MATIC study protocol

    PubMed Central


    Background Many children with asthma do not have sufficient asthma control, which leads to increased healthcare costs and productivity loss of parents. One of the causative factors are adherence problems. Effective interventions improving medication adherence may therefore improve asthma control and reduce costs. A promising solution is sending real time text-messages via the mobile phone network, when a medicine is about to be forgotten. As the effect of real time text-messages in children with asthma is unknown, the primary aim of this study is to determine the effect of a Real Time Medication Monitoring system (RTMM) with text-messages on adherence to inhaled corticosteroids (ICS). The secondary objective is to study the effects of RTMM on asthma control, quality of life and cost-effectiveness of treatment. Methods A multicenter, randomized controlled trial involving 220 children (4–11 years) using ICS for asthma. All children receive an RTMM-device for one year, which registers time and date of ICS doses. Children in the intervention group also receive tailored text-messages, sent only when a dose is at risk of omission. Primary outcome measure is the proportion of ICS dosages taken within the individually predefined time-interval. Secondary outcome measures include asthma control (monthly Asthma Control Tests), asthma exacerbations, healthcare use (collected from hospital records, patient reports and pharmacy record data), and disease-specific quality of life (PAQLQ questionnaire). Parental and children’s acceptance of RTMM is evaluated with online focus groups and patient questionnaires. An economic evaluation is performed adopting a societal perspective, including relevant healthcare costs and parental productivity loss. Furthermore, a decision-analytic model is developed in which different levels of adherence are associated with clinical and financial outcomes. Also, sensitivity analyses are carried out on different price levels for RTMM. Discussion

  2. Can Routinely Collected Early Intervention Data for Deaf and Hard-of-Hearing Children Be Used for Outcome Monitoring? A Case Example from British Columbia, Canada

    ERIC Educational Resources Information Center

    Poon, Brenda T.; Simmons, Noreen R.


    Population-based outcome monitoring could provide useful information about factors that differentially influence the developmental trajectories of deaf or hard-of-hearing children. A strong basis for population-based outcome monitoring is a coordinated, longitudinal data collection, and management infrastructure that includes quality local…

  3. What Strategies Are Appropriate for Monitoring Children outside of Family Care and Evaluating the Impact of the Programs Intended to Serve Them?

    ERIC Educational Resources Information Center

    Ager, Alastair; Zimmerman, Cathy; Unlu, Kathy; Rinehart, Richard; Nyberg, Beverly; Zeanah, Charles; Hunleth, Jean; Bastiaens, Ida; Weldy, Andre; Bachman, Gretchen; Blum, Alexander B.; Strottman, Kathleen


    Objectives: To strengthen the evidence-base for policy and practice for support of children outside of family care requires effective, efficient and sustainable mechanisms for monitoring and evaluation. Toward that end, two core questions guided a systematic review of evidence: What strategies are appropriate for monitoring the needs and…

  4. Community Monitoring Systems: Tracking and Improving the Well-Being of America's Children and Adolescents. NIH Publication No. 07-5852

    ERIC Educational Resources Information Center

    National Institute on Drug Abuse (NIDA), 2007


    Monitoring the well-being of children and adolescents is a critical component of efforts to prevent psychological, behavioral, and health problems and to promote their successful development. Research during the past 40 years has helped identify aspects of child and adolescent functioning that are important to monitor. These aspects, which…

  5. The Effect of Delayed-JOLs and Sentence Generation on Children's Monitoring Accuracy and Regulation of Idiom Study

    ERIC Educational Resources Information Center

    van Loon, Mariëtte H.; de Bruin, Anique B. H.; van Gog, Tamara; van Merriënboer, Jeroen J. G.


    When studying verbal materials, both adults and children are often poor at accurately monitoring their level of learning and regulating their subsequent restudy of materials, which leads to suboptimal test performance. The present experiment investigated how monitoring accuracy and regulation of study could be improved when learning idiomatic…

  6. Monitoring of Selected Health Indicators in Children Living in a Copper Mine Development Area in Northwestern Zambia

    PubMed Central

    Knoblauch, Astrid M.; Divall, Mark J.; Owuor, Milka; Archer, Colleen; Nduna, Kennedy; Ng’uni, Harrison; Musunka, Gertrude; Pascall, Anna; Utzinger, Jürg; Winkler, Mirko S.


    The epidemiology of malaria, anaemia and malnutrition in children is potentially altered in mining development areas. In a copper extraction project in northwestern Zambia, a health impact assessment (HIA) was commissioned to predict, manage and monitor health impacts. Two cross-sectional surveys were conducted: at baseline prior to project development (2011) and at four years into development (2015). Prevalence of Plasmodium falciparum, anaemia and stunting were assessed in under-five-year-old children, while hookworm infection was assessed in children aged 9–14 years in communities impacted and comparison communities not impacted by the project. P. falciparum prevalence was significantly higher in 2015 compared to 2011 in both impacted and comparison communities (odds ratio (OR) = 2.51 and OR = 6.97, respectively). Stunting was significantly lower in 2015 in impacted communities only (OR = 0.63). Anaemia was slightly lower in 2015 compared to baseline in both impacted and comparison communities. Resettlement due to the project and migration background (i.e., moving into the area within the past five years) were generally associated with better health outcomes in 2015. We conclude that repeated cross-sectional surveys to monitor health in communities impacted by projects should become an integral part of HIA to deepen the understanding of changing patterns of health and support implementation of setting-specific public health measures. PMID:28335490

  7. Systematic Monitoring of Young Children's Social-Emotional Competence and Challenging Behaviors

    ERIC Educational Resources Information Center

    Classen, Audra; Cheatham, Gregory A.


    Many children in preschool need support developing appropriate social-emotional competencies. Supportive early educators build confidence in young children to express and regulate emotions, develop solutions to problems, interact with peers, and persist when faced with challenges (Denham, 2006; Webster-Stratton & Reid, 2004). This article…

  8. A feasibility study of wearable activity monitors for pre-adolescent school-age children

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Understanding physical activity is the key to fighting childhood obesity. The objective of this study was to examine the feasibility of using certian wearable devices to measure physical activity among children. A qualitative study was conducted with 25 children aged 7 to 10 yearsto assess acceptabi...

  9. A feasibility study of wearable activity monitors for pre-adolescent school-aged children

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Understanding physical activity is key in the fight against childhood obesity. The objective of this study was to examine the feasibility of using certain wearable devices to measure physical activity among children. A qualitative study was conducted with 25 children aged 7 to 10 years to assess ac...

  10. Age at Assessment a Critical Factor When Monitoring Early Communicative Skills in Children with Galactosaemia

    ERIC Educational Resources Information Center

    Lewis, Fiona M.; DeJonge, Shannon M.; Coman, David J.


    Sub-optimal language development is associated with the metabolic disorder galactosaemia (GAL). Some children with GAL are identified with language impairment from the initial stages of language learning, but a subset of children may exhibit disrupted developmental gains in speech and language skill after a period of age-appropriate skill…

  11. Immune System


    ... Loss Surgery? A Week of Healthy Breakfasts Shyness Immune System KidsHealth > For Teens > Immune System A A A ... could put us out of commission. What the Immune System Does The immune (pronounced: ih-MYOON) system, which ...

  12. Persistence of hepatitis A virus antibodies after primary immunization and response to revaccination in children and adolescents with perinatal HIV exposure

    PubMed Central

    Gouvêa, Aída de Fátima Thomé Barbosa; Pinto, Maria Isabel de Moraes; Miyamoto, Maristela; Machado, Daisy Maria; Pessoa, Silvana Duarte; do Carmo, Fabiana Bononi; Beltrão, Suênia Cordeiro de Vasconcelos; Succi, Regina Célia de Menezes


    OBJECTIVE: To assess possible factors associated with the loss of antibodies to hepatitis A 7 years after the primary immunization in children of HIV-infected mothers and the response to revaccination in patients seronegative for hepatitis A. METHODS: Quantification of HAV antibodies by electrochemiluminescence was performed in 39 adolescents followed up at the Pediatric Aids Clinic of Federal University of São Paulo (Unifesp): 29 HIV-infected (HIV group) (median age: 12.8 years) and 10 HIV-exposed but non-infected (ENI group) (median age: 13.4 years). All of them received two doses of HAV vaccine (Havrix(r)) in 2002. RESULTS: The median age at primary immunization (PI) was 5.4 years for HIV group and 6.5 years for ENI group. All children, from both groups, had antibodies to HAV >20 mIU/mL after PI. Seven years later, the ENI group showed a median concentration of antibodies = 253.5 mIU/mL, while the HIV group = 113.0 mIU/mL (Mann-Whitney test, p=0.085). All ENI group and 23/29 (79.3%) from HIV group mantained HAV antibodies 7 years after PI. The levels of hepatitis A antibodies in the primary vaccination were the only factor independently associated with maintaining these antibodies for 7 years. The group that lost HAV seropositivity was revaccinated and 83.3% (5/6) responded with antibodies >20 mUI/mL. CONCLUSIONS: The antibodies levels acquired in the primary vaccination in the HIV group were the main factor associated with antibodies loss after HAV immunization. PMID:25918013

  13. Associations between Disorder-Specific Symptoms of Anxiety and Error-Monitoring Brain Activity in Young Children.


    Lo, Sharon L; Schroder, Hans S; Fisher, Megan E; Durbin, C Emily; Fitzgerald, Kate D; Danovitch, Judith H; Moser, Jason S


    Anxiety disorders are among the earliest emerging disorders and most common mental health problem across the lifespan. A common characteristic of individuals with anxiety is poor attentional and cognitive control. Therefore, researchers are interested in how cognitive functioning relates to anxiety in young children. In particular, research has demonstrated associations between anxiety and electrophysiological markers of cognitive control skills such as the error-related negativity (ERN). The nature of the anxiety-ERN relationship is not well understood, however. The purpose of the present study was to examine: 1) the association between the ERN and diagnostically-defined symptoms of different anxiety disorders; and 2) the extent to which disorder-specific symptoms of anxiety moderated the association between ERN and behavioral performance on a Go/No-Go task in a sample of 139 children 5-8 years of age (70 females and 69 males). Results suggest that more separation anxiety disorder (SAD) symptoms are associated with a smaller ΔERN, even after controlling for other anxiety disorder symptoms. Children with more SAD symptoms showed higher error rates and failed to exhibit the expected association between ΔERN and behavioral performance, suggesting ineffective error-monitoring in young children with SAD problems.

  14. Altered Immune Function Associated with Disordered Neural Connectivity and Executive Dysfunctions: A Neurophysiological Study on Children with Autism Spectrum Disorders

    ERIC Educational Resources Information Center

    Han, Yvonne M. Y.; Chan, Agnes S.; Sze, Sophia L.; Cheung, Mei-Chun; Wong, Chun-kwok; Lam, Joseph M. K.; Poon, Priscilla M. K.


    Previous studies have shown that children with autism spectrum disorders (ASDs) have impaired executive function, disordered neural connectivity, and abnormal immunologic function. The present study examined whether these abnormalities were associated. Seventeen high-functioning (HFA) and 17 low-functioning (LFA) children with ASD, aged 8-17…

  15. The effect of maternal tetanus immunization on children's schooling attainment in Matlab, Bangladesh: follow-up of a randomized trial.


    Canning, David; Razzaque, Abdur; Driessen, Julia; Walker, Damian G; Streatfield, Peter Kim; Yunus, Mohammad


    We investigate the effects of antenatal maternal vaccination against tetanus on the schooling attained by children in Bangladesh. Maternal vaccination prevents the child from acquiring tetanus at birth through blood infection and substantially reduces infant mortality and may prevent impairment in children who would otherwise acquire tetanus but survive. We follow up on a 1974 randomized trial of maternal tetanus vaccination, looking at outcomes for children born in the period 1975-1979. We find significant schooling gains from maternal tetanus vaccination for children whose parents had no schooling, showing a large impact on a small number of children. Our findings make a case for investments in maternal tetanus vaccination as a method of improving schooling and eventual economic outcomes.

  16. [Methodology and problems in home monitoring of children with sleep-related respiratory disorders--perspectives].


    Wiater, A; Götz, W; Niewerth, H J


    In a pilot study we interviewed parents of 100 formerly home monitored infants about problems during the monitoring period. The duration of home monitoring was between 1 and 48 months (median 15 months). 95% of the parents reported false alarms. 66% of the infants had real alarms, in 50% of the infants interventions were necessary. 3% of the infants had to be resuscitated. Only 47% of the parents felt safe in the practice of resuscitation even though all parents had been trained before. Perspectives of improvement of home monitoring are discussed.

  17. [The structure of intestinal dysbioses in children of preschool age during long-term period of monitoring].


    Nemchenko, U M; Rakova, E B; Popkova, S M; Savelkaeva, M V; Ivanova, E I; Kungurtseva, E A; Serduk, L V; Shabanova, N M


    The study was organized to examine long-term (1990-2011) structure of intestinal dysbioses in children of preschool age residing in Irkutsk. The significant decrease of expression of micro-ecological shifts (IV and III degrees) to the end of period of monitoring and almost total lacking of cases of eubiosis and statistically reliable (p ≤ 0.05) increasing of rate of dysbioses of I and II degrees were established. The given circumstance can be related to ongoing on the territory ecological pressure on organism of negative factors of environment including factors of anthropogenic character.

  18. Atopic dermatitis and association of risk for primary immune thrombocytopenia and autoimmune diseases among children: A nationwide population-based cohort study.


    Wei, Chang-Ching; Lin, Cheng-Li; Shen, Te-Chun; Tsai, Jeng-Dau


    Primary immune thrombocytopenia (ITP) is currently defined as an acquired autoimmune disorder with persistent thrombocytopenia. However, the temporal interaction between T helper type 2 cell (Th2)-mediated allergic diseases and T helper type 1 cell (Th1)-mediated ITP remains unknown. Atopic dermatitis (AD) is considered one of the first steps in the atopic march. Herein, we conducted a population-based cohort analysis to investigate the risk of ITP in children with AD in comparison with non-AD controls. We subsequently compared the occurrence of other autoimmune diseases in ITP children in both AD and non-AD cohorts. From 2000 to 2007, 120,704 children with newly diagnosed AD and 241,408 randomly selected non-AD controls were included in the study. By the end of 2008, incidences of ITP in both cohorts and the AD cohort to non-AD cohort hazard ratios (HRs) and confidence intervals (CIs) were measured. Comparison of the occurrence of other autoimmune diseases in ITP between children with and without AD was analyzed. The incidence of ITP during the study period was 1.72-fold greater (95% CI: 1.13-2.62) in the AD cohort than in the non-AD cohort (6.96 vs 4.00 per 100,000 person-years). The risk was greatest among male children, children >2 years, those in densely populated areas, and those with white-collar parents. The HR of ITP in AD children increased significantly with the number of AD-related clinical visits (P < 0.001). The risk of developing ITP in the AD cohort was highest within the first 3 years after the diagnosis of AD (HR: 1.78; CI: 1.14-2.78). The AD cohort with ITP had a higher occurrence rate of other autoimmune diseases than the non-AD cohort with ITP. AD children had a greater risk of developing ITP and other autoimmune diseases. Further research is needed to clarify the role of allergy in the pathogenesis of ITP and autoimmune diseases.

  19. Do-Not-Resuscitate Orders and/or Hospice Care, Psychological Health, and Quality of Life among Children/Adolescents with Acquired Immune Deficiency Syndrome

    PubMed Central

    Lyon, Maureen E.; Williams, Paige L.; Woods, Elizabeth R.; Hutton, Nancy; Butler, Anne M.; Sibinga, Erica; Brady, Michael T.; Oleske, James M.


    Objective The frequency of do-not-resuscitate (DNR) orders and hospice enrollment in children/adolescents living with acquired immune deficiency syndrome (AIDS) and followed in Pediatric AIDS Clinical Trials Group (PACTG) Study 219C was examined, and evaluated for any association with racial disparities or enhanced quality of life (QOL), particularly psychological adjustment. Methods A cross-sectional analysis of children with AIDS enrolled in this prospective multicenter observational study between 2000 and 2005 was conducted to evaluate the incidence of DNR/hospice overall and by calendar time. Linear regression models were used to compare caregivers' reported QOL scores within 6 domains between those with and without DNR/hospice care, adjusting for confounders. Results Seven hundred twenty-six (726) children with AIDS had a mean age of 12.9 years (standard deviation [SD] = 4.5), 51% were male, 60% black, 25% Hispanic. Twenty-one (2.9%) had either a DNR order (n = 16), hospice enrollment (n = 7), or both (n = 2). Of 41 children who died, 80% had no DNR/hospice care. Increased odds of DNR/hospice were observed for those with CD4% less than 15%, no current antiretroviral use, and prior hospitalization. No differences by race were detected. Adjusted mean QOL scores were significantly lower for those with DNR/hospice enrollment than those without across all domains except for psychological status and health care utilization. Poorer psychological status correlated with higher symptom distress, but not with DNR/hospice enrollment after adjusting for symptoms. Conclusions Children who died of AIDS rarely had DNR/hospice enrollment. National guidelines recommend that quality palliative care be integrated routinely with HIV care. Further research is needed to explore the barriers to palliative care and advance care planning in this population. PMID:18363489

  20. Herd immunity in adults against influenza-related illnesses with use of the trivalent-live attenuated influenza vaccine (CAIV-T) in children.


    Piedra, Pedro A; Gaglani, Manjusha J; Kozinetz, Claudia A; Herschler, Gayla; Riggs, Mark; Griffith, Melissa; Fewlass, Charles; Watts, Matt; Hessel, Colin; Cordova, Julie; Glezen, W Paul


    Highest attack rates for influenza occur in children. Immunization of schoolchildren with inactivated influenza vaccine in Michigan and Japan was associated with decreased morbidity and mortality, respectively, in older community contacts. An open-labeled, non-randomized, community-based trial in children with the cold adapted influenza vaccine, trivalent (CAIV-T) was initiated to determine the coverage necessary to reduce spread of influenza in the community. Age-specific baseline rates of medically attended acute respiratory illness (MAARI) for Scott and White Health Plan (SWHP) members at intervention (Temple and Belton) and comparison communities (Waco, Bryan, and College Station) were obtained in 1997-1998. During three subsequent vaccination years, 4298, 5251 and 5150 children received one dose per season of CAIV-T. Vaccinees represented 20-25% of the age-eligible children. Age-specific MAARI rates were compared for SWHP members in the intervention and comparison sites during the influenza outbreaks. Baseline age-specific MAARI rates per 100 persons for the influenza season were comparable between the intervention and comparison communities. In the subsequent three influenza seasons, the age groups 35-44, 45-54, 55-65 and >64 years experienced reductions in MAARI rates in the intervention communities. In adults > or =35 years of age, significant reductions in MAARI of 0.08 (95% CI: 0.04, 0.13), 0.18 (95% CI: 0.14, 0.22) and 0.15 (95% CI: 0.12, 0.19), were observed in the influenza seasons for vaccination years 1, 2 and 3, respectively. No consistent reduction in MAARI rates was detected in the younger age groups. Vaccination of approximately 20-25% of children, 1.5-18 years of age in the intervention communities resulted in an indirect protection of 8-18% against MAARI in adults > or =35 years of age.

  1. Assessment of Immunization to Hepatitis B Vaccine among Children under Five Years in Rural Areas of Taiz, Yemen

    PubMed Central

    Al-Sonboli, Najla A.; Alkumaim, Fawzi A.; Alsayaad, Nader S.; Al-Ahdal, Mohammed S.; Higazi, Tarig B.; Elagib, Atif A.


    Background. Hepatitis B virus (HBV) infection poses a major health problem worldwide. approximately 1 million deaths annually due to cirrhosis and hepatocellular carcinoma. Objectives. This study was conducted to determine the coverage rate of HBV vaccine and assess the vaccine protective response among children under five years old in rural areas of Yemen. Methods. A cross-sectional study was conducted from January to December 2015 in four districts of countryside Yemen. The target population was children aged from 6 to 59 months. 227 children were enrolled in the study. Questionnaire was used to collect of data. Serum samples were tested for anti-HBs antibodies by enzyme linked immunosorbent assay (ELISA). Anti-HBs level ≥ 10 IU/L was considered a protective response to the vaccine. Results. The coverage rate of HBV vaccine among children was 87.3%. A total of 143 (72.2%) children responded to the vaccine with anti-HBs level ≥ 10 IU/L, while 55 (27.8%) of the children had nonprotective anti-HBs levels of <10 IU/L (P = 0.003). Conclusion. This study revealed a good coverage rate of HBV vaccine in rural areas but the protective rate against HBV infection was moderate. A considerable proportion of vaccinated children should be considered for either revaccination or booster doses. PMID:28367327

  2. Performance monitoring in children and adolescents: a review of developmental changes in the error-related negativity and brain maturation.


    Tamnes, Christian K; Walhovd, Kristine B; Torstveit, Mari; Sells, Victoria T; Fjell, Anders M


    To realize our goals we continuously adapt our behavior according to internal or external feedback. Errors provide an important source for such feedback and elicit a scalp electrical potential referred to as the error-related negativity (ERN), which is a useful marker for studying typical and atypical development of cognitive control mechanisms involved in performance monitoring. In this review, we survey the available studies on age-related differences in the ERN in children and adolescents. The majority of the studies show that the ERN increases in strength throughout childhood and adolescence, suggesting continued maturation of the neural systems for performance monitoring, but there are still many unresolved questions. We further review recent research in adults that has provided important insights into the neural underpinnings of the ERN and performance monitoring, implicating distributed neural systems than include the dorsal anterior and posterior cingulate cortex, the lateral prefrontal cortex, insula, basal ganglia, thalamus and white matter connections between these regions. Finally, we discuss the possible roles of structural and functional maturation of these brain regions in the development of the ERN. Overall, we argue that future work should use multimodal approaches to give a better understanding of the neurocognitive development of performance monitoring.

  3. Validity of a Sun Safety Diary Using UV Monitors in Middle School Children

    ERIC Educational Resources Information Center

    Yaroch, Amy L.; Reynolds, Kim D.; Buller, David B.; Maloy, Julie A.; Geno, Cristy R.


    This article describes a validity study conducted among middle school students comparing self-reported sun safety behaviors from a diary with readings from ultraviolet (UV) monitors worn on different body sites. The UV monitors are stickers with panels that turn increasingly darker shades of blue in the presence of increasing amounts of UV light.…

  4. The Costs and Benefits of Self-Monitoring for Higher Functioning Children and Adolescents with Autism

    ERIC Educational Resources Information Center

    Henderson, Heather A.; Ono, Kim E.; McMahon, Camilla M.; Schwartz, Caley B.; Usher, Lauren V.; Mundy, Peter C.


    The ability to regulate behaviors and emotions depends in part on the ability to flexibly monitor one's own progress toward a goal. Atypical patterns of response monitoring have been reported in individuals with autism spectrum disorders (ASD). In the current study we examined the error related negativity (ERN), an electrophysiological index…

  5. Effects of a Self-Monitoring Intervention on Children with Traumatic Brain Injury

    ERIC Educational Resources Information Center

    Davies, Susan C.; Jones, Kevin M.; Rafoth, Mary A.


    The purpose of this study was to examine the effects of a self-monitoring intervention on teachers' direct behavior ratings of 3 students with traumatic brain injury. The authors used a multiple-baseline-across-participants design to evaluate the effect of the strategy on each child's classwork and classroom behavior. The self-monitoring strategy…

  6. The State of the World's Children 1985: A Report by United Nations Children's Fund (UNICEF).

    ERIC Educational Resources Information Center

    Early Child Development and Care, 1985


    Reports four basic strategies of the current child survival revolution in the world: use of oral rehydration therapy (ORT) for preventing and treating diarrheal dehydration (the biggest single killer of children in the modern world), growth monitoring to prevent child malnutrition, breast-feeding, and immunization to provide protection against six…

  7. Vitamin A supplements, routine immunization, and the subsequent risk of Plasmodium infection among children under 5 years in sub-Saharan Africa

    PubMed Central

    Hollm-Delgado, Maria-Graciela; Piel, Frédéric B; Weiss, Daniel J; Howes, Rosalind E; Stuart, Elizabeth A; Hay, Simon I; Black, Robert E


    Recent studies, partly based on murine models, suggest childhood immunization and vitamin A supplements may confer protection against malaria infection, although strong evidence to support these theories in humans has so far been lacking. We analyzed national survey data from children aged 6–59 months in four sub-Saharan African countries over an 18-month time period, to determine the risk of Plasmodium spp. parasitemia (n=8390) and Plasmodium falciparum HRP-2 (PfHRP-2)-related antigenemia (n=6121) following vitamin A supplementation and standard vaccination. Bacille Calmette Guerin-vaccinated children were more likely to be PfHRP-2 positive (relative risk [RR]=4.06, 95% confidence interval [CI]=2.00–8.28). No association was identified with parasitemia. Measles and polio vaccination were not associated with malaria. Children receiving vitamin A were less likely to present with parasitemia (RR=0.46, 95% CI=0.39–0.54) and antigenemia (RR=0.23, 95% CI=0.17–0.29). Future studies focusing on climate seasonality, placental malaria and HIV are needed to characterize better the association between vitamin A and malaria infection in different settings. DOI: PMID:25647726

  8. Epidemiology of children with acquired immune deficiency syndrome (stage 3): A referral hospital-based study in Iran.


    Movahedi, Zahra; Mahmoudi, Shima; Pourakbari, Babak; Keshavarz Valian, Nasrin; Sabouni, Farah; Ramezani, Amitis; Bahador, Abbas; Mamishi, Setareh


    Lack of recognition of human immunodeficiency virus (HIV) infection especially in children and delayed implementation of effective control programs makes HIV infection as a major cause for concern. Information on HIV epidemiology in Iran as well as other Islamic countries is limited. The aim of our study was to describe the clinical manifestation and laboratory finding of HIV infected children who were admitted to a referral Children Medical Center (CMC) in Tehran, Iran, during 11 years from January 2002 to January 2013. This was a retrospective study carried out over a period of 11 years. The records of all patients attending to the CMC with confirmed acquired immunodeficiency syndrome (AIDS) were screened. The patients were evaluated for social circumstance, family history, age, gender, clinical, and laboratory features. Clinical data including fever, respiratory distress, diarrhea, rash, etc. as well as laboratory tests including complete blood count, serum glucose level, electrolytes, liver function test, cultures, CD4 lymphocyte count were evaluated. During the study period, 32 HIV positive children were enrolled. The majority of patients were presented with weight loss, prolonged fever, respiratory infection and chronic diarrhea. In this study, salmonella infections as well as streptococcal pneumonia and candida infections followed by, tuberculosis and Pseudomonas aeruginosa infections were the predominant opportunistic infections. Since the number of HIV-positive children has been alarmingly increasing in recent years and perinatal transmission is the most common route of HIV infection in children, essential recommendations for prenatal HIV testing as well as appropriate antiretroviral therapy by HIV infected mothers are needed.

  9. Persistence of T-cell immune response induced by two acellular pertussis vaccines in children five years after primary vaccination.


    Palazzo, Raffaella; Carollo, Maria; Bianco, Manuela; Fedele, Giorgio; Schiavoni, Ilaria; Pandolfi, Elisabetta; Villani, Alberto; Tozzi, Alberto E; Mascart, Françoise; Ausiello, Clara M


    The resurgence of pertussis suggests the need for greater efforts to understand the long-lasting protective responses induced by vaccination. In this paper we dissect the persistence of T memory responses induced by primary vaccination with two different acellular pertussis (aP) vaccines, hexavalent Hexavac® vaccine (Hexavac) (Sanofi Pasteur MSD) and Infanrix hexa® (Infanrix) (Glaxo-SmithKline Biologicals). We evaluated magnitude and duration of T-cell responses to pertussis toxin (PT) by measuring T-cell proliferation, cytokines (IL-2 and IFNγ) production and memory subsets in two groups of children 5 years after primary vaccination. Some of the enrolled children received only primary vaccination, while others had the pre-school boost dose. Positive T-cell responses to PT were detected in 36% of children. Percentage of responsive children, T-cell proliferation and CD4IL-2+ cells were significantly higher in the children primed with Hexavac than in those who received Infanrix vaccine. No major effects of the boost on PT-specific proliferation were observed. Overall, our data documented a persistence of T-cell memory against PT in a minor fraction of children 5 years after primary vaccination. The different responses induced by Hexavac and Infanrix vaccine could rely on differences in PT inactivation process or excipients/adjuvants formulations.

  10. Community-based surveillance to monitor trends in unaccompanied and separated children in eastern DRC.


    Rubenstein, Beth L; Spencer, Craig; Mansourian, Hani; Noble, Eva; Munganga, Gustave B; Stark, Lindsay


    Children who are separated from their families and usual caregivers in emergencies face a multitude of risks. The humanitarian community lacks methods to systematically capture changes in the frequency and nature of such separations over time. A mobile phone-based community surveillance system was piloted in the Democratic Republic of the Congo. The goal was to identify new cases of unaccompanied and separated children on a weekly basis. Over an 11-week period, community focal points reported 62 cases of separation across 10 communities. The majority of children had been under the care of their parents prior to separation. More than half of the children were unaccompanied, meaning that they were living without an adult relative or customary caregiver. The pilot results suggest that implementing a mobile phone-based surveillance system in a humanitarian setting may be feasible and cost-effective and fills a critical gap in the measurement of separated and unaccompanied children in emergencies. A longer pilot to better understand how the system performs over time is recommended.

  11. Monitoring and Treatment of Acute Kidney Injury in Children with Acute Lymphoblastic Leukemia After High Dose Methotrexate Chemotherapy

    PubMed Central

    Wang, Cong-Ping


    To investigate acute kidney injury (AKI) in children with acute lymphoblastic leukemia (ALL) who received high dose methotrexate (MTX) chemotherapy and explore the corresponding treatment. Methods 180 children who received high dose MTX chemotherapy were observed with serum MTX concentration and serum creatinine. Patients with AKI of stage 3 or poor response to conventional treatment were performed on hemodialysis and assessed the treatment outcome. Results 9 patients (5%) have appeared AKI, including 7 cases of AKI of stage 3. However, there were not any significant correlation between age, gender, serum MTX concentration and AKI, respectively. Compared with normal serum MTX concentration, the patients with high serum MTX concentration easily were developed to AKI, the MTX and serum creatinine concentration had been significantly decreased in 9 patients after hemodialysis. Conclusion AKI has appeared in some children with ALL who receive high dose MTX chemotherapy, and this may due to increase of serum MTX concentration. The monitoring of serum MTX concentration and AKI index could help to find out AKI, and even to prevent the occurrence of it. Furthermore, once AKI is present, those patients with AKI stage 3 or poor response to conventional treatment should be performed on hemodialysis treatment. PMID:28243295

  12. Toward an objective indexing system for ADHD-screening using children's activity monitoring.


    Kam, Hye Jin; Choi, Jong Pil; Park, Rae Woong


    Signs of ADHD are discernible in specific situations, and usually assessed according to subjective impressions. We performed a preliminary comparative study from children's activity at a natural classroom environment with 3-axis accelerator for a feasible objective index. From a total of 157 children (7-9 yrs) and clinically diagnosed 24 children out of them, variances in 1-min epoch mean activity had shown significant differences among the subgroups: (1) ADHD=.0194, Other Diseases=.0080, Normal=.0009; (2) ADHD=.0194, non-ADHD=.0057(p<.01, respectively). There were also significant differences in high-level activity (>1.6G) features among subgroups with the same order (p<.01, respectively). ADHD patients exhibited more dispersed activities and higher high-level activity ratio than normal. Activity features can be useful to build an objective indexing system for screening ADHD patients.

  13. The interdependencies of viral load, the innate immune response, and clinical outcome in children presenting to the emergency department with respiratory syncytial virus-associated bronchiolitis

    PubMed Central

    Mei, Minghua; Mehta, Reena


    Respiratory syncytial virus (RSV) causes significant infant morbidity and mortality. For decades severe RSV-induced disease was thought to result from an uncontrolled host response to viral replication, but recent work suggests that a strong innate immune response early in infection is protective. To shed light on host-virus interactions and the viral determinants of disease, copy numbers of five RSV genes (NS1, NS2, N, G, F) were measured by quantitative real-time polymerase chain reaction (qPCR) in nasal wash samples from children with RSV-associated bronchiolitis. Correlations were sought with host cytokines/chemokines and biomarkers. Associations with disposition from the emergency department (hospitalized or sent home) and pulse oximetry O2 saturation levels were also sought. Additionally, RNase P copy number was measured and used to normalize nasal wash data. RSV gene copy numbers were found to significantly correlate with both cytokine/chemokine and biomarker levels; and RNase P-normalized viral gene copy numbers (NS1, NS2, N and G) were significantly higher in infants with less severe disease. Moreover, three of the normalized viral gene copy numbers (NS1, NS2, and N) correlated significantly with arterial O2 saturation levels. The data support a model where a higher viral load early in infection can promote a robust innate immune response that protects against progression into hypoxic RSV-induced lower respiratory tract illness. PMID:28267794

  14. The interdependencies of viral load, the innate immune response, and clinical outcome in children presenting to the emergency department with respiratory syncytial virus-associated bronchiolitis.


    Piedra, Felipe-Andrés; Mei, Minghua; Avadhanula, Vasanthi; Mehta, Reena; Aideyan, Letisha; Garofalo, Roberto P; Piedra, Pedro A


    Respiratory syncytial virus (RSV) causes significant infant morbidity and mortality. For decades severe RSV-induced disease was thought to result from an uncontrolled host response to viral replication, but recent work suggests that a strong innate immune response early in infection is protective. To shed light on host-virus interactions and the viral determinants of disease, copy numbers of five RSV genes (NS1, NS2, N, G, F) were measured by quantitative real-time polymerase chain reaction (qPCR) in nasal wash samples from children with RSV-associated bronchiolitis. Correlations were sought with host cytokines/chemokines and biomarkers. Associations with disposition from the emergency department (hospitalized or sent home) and pulse oximetry O2 saturation levels were also sought. Additionally, RNase P copy number was measured and used to normalize nasal wash data. RSV gene copy numbers were found to significantly correlate with both cytokine/chemokine and biomarker levels; and RNase P-normalized viral gene copy numbers (NS1, NS2, N and G) were significantly higher in infants with less severe disease. Moreover, three of the normalized viral gene copy numbers (NS1, NS2, and N) correlated significantly with arterial O2 saturation levels. The data support a model where a higher viral load early in infection can promote a robust innate immune response that protects against progression into hypoxic RSV-induced lower respiratory tract illness.

  15. The Effects of Summary Production and Encoding Condition on Children's Metacognitive Monitoring

    ERIC Educational Resources Information Center

    von der Linden, Nicole; Schneider, Wolfgang; Roebers, Claudia M.


    Two studies were conducted to investigate whether context variations were suitable to improve metacognitive judgments in children in a complex, everyday memory task. In the first phase of each experiment, participants were shown a short event (video) and gave judgments-of-learning (JOLs), that is, rated their certainty that they would later be…

  16. Development of Active Control within Working Memory: Active Retrieval versus Monitoring in Children

    ERIC Educational Resources Information Center

    Blain-Brière, Bénédicte; Bouchard, Caroline; Bigras, Nathalie; Cadoret, Geneviève


    This study aimed to compare children's performance on two mnemonic functions that engage the lateral prefrontal cortex. Brain imaging studies in adults have shown that the mid-ventrolateral prefrontal cortex is specifically involved in active controlled retrieval, and the mid-dorsolateral prefrontal cortex is specifically involved in monitoring…

  17. Actigraphic Monitoring during Sleep of Children with ADHD on Methylphenidate and Placebo

    ERIC Educational Resources Information Center

    Schwartz, George; Amor, Leila Ben; Grizenko, Natalie; Lageix, Philippe; Baron, Chantal; Boivin, Diane B.; Joober, Ridha


    Objective: Sleep disturbances appear as a comorbid condition in children with attention-deficit/hyperactivity disorder. The aim of this study was to investigate the relationship of activity levels during sleep and therapeutic response to methylphenidate (MPH). Method: Nightly sleep actigraphic recordings during a double-blind, placebo-controlled,…

  18. Immune Thrombocytopenia


    ... from the NHLBI on Twitter. What Is Immune Thrombocytopenia? Immune thrombocytopenia (THROM-bo-si-toe-PE-ne- ... from one person to another. Types of Immune Thrombocytopenia The two types of ITP are acute (temporary ...

  19. Associations of IL-4, IL-6, and IL-12 levels in peripheral blood with lung function, cellular immune function, and quality of life in children with moderate-to-severe asthma

    PubMed Central

    Cui, Ai-Hua; Zhao, Jing; Liu, Shu-Xiang; Hao, Ying-Shuang


    Abstract Background: Pediatric asthma has gained increasing concerns with poorly understood pathogenesis. The purpose of this study was to explore the associations of interleukin-4 (IL-4), IL-6, and IL-12 levels in peripheral blood (PB) with lung function, cellular immune function, and children's quality of life (QOL) with moderate-to-severe asthma. Methods: A total of 1158 children with moderate-to-severe asthma (the experimental group) and 1075 healthy children (the control group) were recruited for our study. Enzyme-linked immunosorbent assay was used to detect IL-4, IL-6, and IL-12 levels. T lymphocytes were detected by alkaline phosphatase antialkaline phosphatase, and erythrocyte immune was measured by red blood cell C 3b receptor (RBC-C3bR) rosette-forming test. The forced expiratory volume in 1 second (FEV1) and peak expiratory flow (PEF) were detected, after which FEV1/forced vital capacity (FVC) was calculated before and after treatment. PedsQL3.0 was used to measure the effect of asthma on QOL of children, and the correlation between IL-4, IL-6, and IL-12 levels and the lung function and QOL was measured. Logistic regression analysis was applied to detect related factors of moderate-to-severe asthma of children. Results: After treatment, the decreased IL-4 and IL-6 levels and increased IL-12 level were revealed in the experimental group. The cellular immune function's disorder was significantly decreased, and an elevated CD3, CD4, CD8, and declined CD4/CD8 level was performed in T lymphocytes. RBC-C3bR was increased, and red blood cell immune complex (RBC-IC) was reduced in erythrocyte immune in comparison with those before treatment. Lung function parameters all increased. After treatment, the symptoms of asthma in children reduced with scores of increased QOL. IL-4 was positively related to RBC-IC, but negatively associated with the QOL score. IL-6 showed negative connection with CD4/CD8, RBC-C3bR, FEV1/FVC, and QOL score, and had positive connection

  20. Testing Strategies To Raise Immunization Rates. Report of the Joyce Foundation's Special Project on Immunization.

    ERIC Educational Resources Information Center

    Fischer, Sunny; Baron, Dan

    In many low-income communities, children are not properly immunized and are left vulnerable to completely preventable illnesses. This report provides information gained as a result of a 1-year funding project in the Chicago area to determine why so many children were not being immunized and how to increase immunization rates. The project tested 5…

  1. Long-term anti-HBs antibody persistence and immune memory in children and adolescents who received routine childhood hepatitis B vaccination.


    Behre, Ulrich; Bleckmann, Gerhard; Crasta, Priya Diana; Leyssen, Maarten; Messier, Marc; Jacquet, Jeanne-Marie; Hardt, Karin


    This paper presents data from two studies that evaluated 5-y and 10-y persistence of antibodies against hepatitis B (HBV) surface antigen (anti-HBs) and immune response to an HBV vaccine challenge in children and adolescents who had received three doses of a HBV vaccine in infancy as part of routine clinical practice [NCT00519649/NCT00984139]. Anti-HBs antibody concentrations ≥ 10 mIU/ml persisted in 83.3% (95% confidence interval [CI]: 78.5–87.5) and 78.3% (95% CI: 73.1–83.0) of subjects aged 7–8 y and 12–13 y, respectively 5–10 y after infant vaccination. One month postchallenge dose, 98.2% (95% CI: 95.9–99.4) and 93.7% (95% CI: 90.2–96.2) of subjects in the two age groups, respectively had anti-HBs antibody concentrations ≥ 100 mIU/ml. Overall, 99.6% (95% CI: 98–100) and 97.2% (95% CI: 94.5–98.8) of subjects aged 7–8 y and 12–13 y mounted an anamnestic response to the HBV challenge dose, which was well-tolerated. Healthy children aged 7–8 y and adolescents aged 12–13 y received three doses of a monovalent pediatric HBV vaccine (10 μg of HBsAg) before 18 mo of age. Serum samples collected before and one month post-HBV vaccine challenge dose were tested for anti-HBs antibody concentrations. Safety assessments were made for the HBV vaccine challenge dose. A three-dose childhood HBV immunization regimen induced persistence of antibodies against HBV infection for 10 y, up to adolescence. This vaccination regimen also conferred long-term immune memory against HBV as evidenced by the strong anamnestic response to the HBV vaccine challenge, despite waning anti-HBs antibody levels.

  2. Viral and host factors determine innate immune responses in airway epithelial cells from children with wheeze and atopy

    PubMed Central

    Spann, Kirsten M; Baturcam, Engin; Schagen, Johanna; Jones, Carmen; Straub, Claire P; Preston, F Maxine; Chen, Linping; Phipps, Simon; Sly, Peter D; Fantino, Emmanuelle


    Background Airway epithelial cells (AEC) from patients with asthma, appear to have an impaired interferon (IFN)-β and -λ response to infection with rhinovirus. Objectives To determine if impaired IFN responses can be identified in young children at risk of developing asthma due to atopy and/or early life wheeze, and if the site of infection or the infecting virus influence the antiviral response. Methods Nasal (N) and tracheal (T) epithelial cells (EC) were collected from children categorised with atopy and/or wheeze based on specific IgE to locally common aeroallergens and a questionnaire concerning respiratory health. Submerged primary cultures were infected with respiratory syncytial virus (RSV) or human metapneumovirus (hMPV), and IFN production, inflammatory cytokine expression and viral replication quantified. Results Nasal epithelial cells (NEC), but not tracheal epithelial cells (TEC), from children with wheeze and/or atopy produced less IFN-β, but not IFN-λ, in response to RSV infection; this was associated with higher viral shedding. However, IFN-regulated factors IRF-7, Mx-1 and CXCL-10, and inflammatory cytokines were not differentially regulated. NECs and TECs from children with wheeze and/or atopy demonstrated no impairment of the IFN response (β or λ) to hMPV infection. Despite this, more hMPV was shed from these cells. Conclusions AECs from children with wheeze and/or atopy do not have an intrinsic defect in the production of IFN-β or -λ, however, this response is influenced by the infecting virus. Higher viral load is associated with atopy and wheeze suggesting an impaired antiviral response to RSV and hMPV that is not influenced by production of IFNs. PMID:24811725

  3. Monitoring training load, recovery-stress state, immune-endocrine responses, and physical performance in elite female basketball players during a periodized training program.


    Nunes, João A; Moreira, Alexandre; Crewther, Blair T; Nosaka, Ken; Viveiros, Luis; Aoki, Marcelo S


    This study investigated the effect of a periodized training program on internal training load (ITL), recovery-stress state, immune-endocrine responses, and physical performance in 19 elite female basketball players. The participants were monitored across a 12-week period before an international championship, which included 2 overloading and tapering phases. The first overloading phase (fourth to sixth week) was followed by a 1-week tapering, and the second overloading phase (eighth to 10th week) was followed by a 2-week tapering. ITL (session rating of perceived exertion method) and recovery-stress state (RESTQ-76 Sport questionnaire) were assessed weekly and bi-weekly, respectively. Pretraining and posttraining assessments included measures of salivary IgA, testosterone and cortisol concentrations, strength, jumping power, running endurance, and agility. Internal training load increased across all weeks from 2 to 11 (p ≤ 0.05). After the first tapering period (week 7), a further increase in ITL was observed during the second overloading phase (p ≤ 0.05). After the second tapering period, a decrease in ITL was detected (p ≤ 0.05). A disturbance in athlete stress-recovery state was noted during the second overloading period (p ≤ 0.05), before returning to baseline level in end of the second tapering period. The training program led to significant improvements in the physical performance parameters evaluated. The salivary measures did not change despite the fluctuations in ITL. In conclusion, a periodized training program evoked changes in ITL in elite female basketball players, which appeared to influence their recovery-stress state. The training plan was effective in preparing participants for competition, as indicated by improvements in recovery-stress state and physical performance after tapering.

  4. Bleeding manifestations and management of children with persistent and chronic immune thrombocytopenia: data from the Intercontinental Cooperative ITP Study Group (ICIS).


    Neunert, Cindy E; Buchanan, George R; Imbach, Paul; Bolton-Maggs, Paula H B; Bennett, Carolyn M; Neufeld, Ellis; Vesely, Sara K; Adix, Leah; Blanchette, Victor S; Kühne, Thomas


    Long-term follow-up of children with immune thrombocytopenia (ITP) indicates that the majority undergo remission and severe thrombocytopenia is infrequent. Details regarding bleeding manifestations, however, remain poorly categorized. We report here long-term data from the Intercontinental Cooperative ITP Study Group Registry II focusing on natural history, bleeding manifestations, and management. Data on 1345 subjects were collected at diagnosis and at 28 days, 6, 12, and 24 months thereafter. Median platelet counts were 214 × 10(9)/L (interquartile range [IQR] 227, range 1-748), 211 × 10(9)/L (IQR 192, range 1-594), and 215 × 10(9)/L (IQR 198, range 1-598) at 6, 12, and 24 months, respectively, and a platelet count <20 × 10(9)/L was uncommon (7%, 7%, and 4%, respectively). Remission occurred in 37% of patients between 28 days and 6 months, 16% between 6 and 12 months, and 24% between 12 and 24 months. There were no reports of intracranial hemorrhage, and the most common site of bleeding was skin. In patients with severe thrombocytopenia we observed a trend toward more drug treatment with increasing number of bleeding sites. Our data support that ITP is a benign condition for most affected children and that major hemorrhage, even with prolonged severe thrombocytopenia, is rare.

  5. Vaccination coverage levels among Alaska Native children aged 19-35 months--National Immunization Survey, United States, 2000-2001.



    In 2000, a total of 118,846 persons indicated that their race/ethnicity was Alaska Native (AN), either alone or in combination with one or more other racial/ethnic groups. AN groups comprise 19% of the population of Alaska and 0.4% of the total U.S. population. The AN grouping includes Eskimos, Aleuts, and Alaska Indians (members of the Alaska Athabaskan, Tlingit, Haida, or other AN tribes). Eskimo represented the largest AN tribal grouping, followed by Tlingit/Haida, Alaska Athabascan, and Aleut. Vaccination coverage levels among AN children have not been reported previously. This report presents data from the National Immunization Survey (NIS) for 2000-2001, which indicate that vaccination coverage levels among AN children aged 19-35 months exceeded the national health objective for 2010 (objective no. 14-22) for the majority of vaccines. This achievement indicates the effectiveness of using multiple strategies to increase vaccination coverage. Similar efforts might increase vaccination coverage in other rural regions with American Indian (AI)/AN populations.

  6. Using Self-Monitoring to Increase Attending to Task and Academic Accuracy in Children with Autism

    ERIC Educational Resources Information Center

    Holifield, Cassandra; Goodman, Janet; Hazelkorn, Michael; Heflin, L. Juane


    This study was conducted to investigate the effectiveness of a self-monitoring procedure on increasing attending to task and academic accuracy in two elementary students with autism in their self-contained classroom. A multiple baseline across participants in two academic subject areas was used to assess the effectiveness of the intervention. Both…

  7. A, B Seeing: The Role of Constructive Processes in Children's Comprehension Monitoring.

    ERIC Educational Resources Information Center

    Rubman, Claire N.; Waters, Harriet Salatas


    Using a comprehension-monitoring model, 192 skilled and less skilled readers from 3rd and 6th grade read stories containing inconsistent information. Half of the students constructed a storyboard representation of the stories and half only read the text. Results reveal that storyboard construction enhanced the integration of text propositions and…

  8. Cost Evaluation of Dried Blood Spot Home Sampling as Compared to Conventional Sampling for Therapeutic Drug Monitoring in Children

    PubMed Central

    Martial, Lisa C.; Aarnoutse, Rob E.; Schreuder, Michiel F.; Henriet, Stefanie S.; Brüggemann, Roger J. M.; Joore, Manuela A.


    Dried blood spot (DBS) sampling for the purpose of therapeutic drug monitoring can be an attractive alternative for conventional blood sampling, especially in children. This study aimed to compare all costs involved in conventional sampling versus DBS home sampling in two pediatric populations: renal transplant patients and hemato-oncology patients. Total costs were computed from a societal perspective by adding up healthcare cost, patient related costs and costs related to loss of productivity of the caregiver. Switching to DBS home sampling was associated with a cost reduction of 43% for hemato-oncology patients (€277 to €158) and 61% for nephrology patients (€259 to €102) from a societal perspective (total costs) per blood draw. From a healthcare perspective, costs reduced with 7% for hemato-oncology patients and with 21% for nephrology patients. Total savings depend on the number of hospital visits that can be avoided by using home sampling instead of conventional sampling. PMID:27941974

  9. Cost Evaluation of Dried Blood Spot Home Sampling as Compared to Conventional Sampling for Therapeutic Drug Monitoring in Children.


    Martial, Lisa C; Aarnoutse, Rob E; Schreuder, Michiel F; Henriet, Stefanie S; Brüggemann, Roger J M; Joore, Manuela A


    Dried blood spot (DBS) sampling for the purpose of therapeutic drug monitoring can be an attractive alternative for conventional blood sampling, especially in children. This study aimed to compare all costs involved in conventional sampling versus DBS home sampling in two pediatric populations: renal transplant patients and hemato-oncology patients. Total costs were computed from a societal perspective by adding up healthcare cost, patient related costs and costs related to loss of productivity of the caregiver. Switching to DBS home sampling was associated with a cost reduction of 43% for hemato-oncology patients (€277 to €158) and 61% for nephrology patients (€259 to €102) from a societal perspective (total costs) per blood draw. From a healthcare perspective, costs reduced with 7% for hemato-oncology patients and with 21% for nephrology patients. Total savings depend on the number of hospital visits that can be avoided by using home sampling instead of conventional sampling.

  10. Effect of probiotic L. plantarum IS-10506 and zinc supplementation on humoral immune response and zinc status of Indonesian pre-school children.


    Surono, Ingrid S; Martono, Pratiwi D; Kameo, Satomi; Suradji, Eka W; Koyama, Hiroshi


    A 90-day randomized, double-blind, placebo-controlled, pre-post trial was conducted in four groups of Indonesian children aged 12-24 months: placebo, probiotic, zinc, and a combination of probiotic and zinc (n=12 per group). Microencapsulated Lactobacillus plantarum IS-10506 of dadih origin was supplemented at a dose of 10(10)CFU/day as a probiotic. Zinc was supplemented as 20mg zinc sulfate monohydrate (8mg zinc elemental). Blood and stool samples were collected at baseline and at the end of the study period. Fecal sIgA was assessed by ELISA and serum zinc concentrations by ICP-MS. Fecal sIgA increased significantly in the probiotic group (30.33±3.32μg/g; p<0.01) and in the combination probiotic and zinc group (27.55±2.28μg/g; p<0.027), as compared with the placebo group (13.58±2.26μg/g). Changes in serum zinc concentrations in the combination probiotic and zinc group showed the highest elevation at the end of the study period. A combination of probiotic L. plantarum IS-10506 at a dose of 10(10)CFU/day and 8mg of elemental zinc supplementation showed a potential ability to improve the zinc status of pre-school children. Taken together, supplementation with the probiotic L. plantarum IS-10506 and zinc for 90 days resulted in a significantly increased humoral immune response, as well as improved zinc status, in young children.

  11. Accuracy and precision of minimally-invasive cardiac output monitoring in children: a systematic review and meta-analysis.


    Suehiro, Koichi; Joosten, Alexandre; Murphy, Linda Suk-Ling; Desebbe, Olivier; Alexander, Brenton; Kim, Sang-Hyun; Cannesson, Maxime


    Several minimally-invasive technologies are available for cardiac output (CO) measurement in children, but the accuracy and precision of these devices have not yet been evaluated in a systematic review and meta-analysis. We conducted a comprehensive search of the medical literature in PubMed, Cochrane Library of Clinical Trials, Scopus, and Web of Science from its inception to June 2014 assessing the accuracy and precision of all minimally-invasive CO monitoring systems used in children when compared with CO monitoring reference methods. Pooled mean bias, standard deviation, and mean percentage error of included studies were calculated using a random-effects model. The inter-study heterogeneity was also assessed using an I(2) statistic. A total of 20 studies (624 patients) were included. The overall random-effects pooled bias, and mean percentage error were 0.13 ± 0.44 l min(-1) and 29.1 %, respectively. Significant inter-study heterogeneity was detected (P < 0.0001, I(2) = 98.3 %). In the sub-analysis regarding the device, electrical cardiometry showed the smallest bias (-0.03 l min(-1)) and lowest percentage error (23.6 %). Significant residual heterogeneity remained after conducting sensitivity and subgroup analyses based on the various study characteristics. By meta-regression analysis, we found no independent effects of study characteristics on weighted mean difference between reference and tested methods. Although the pooled bias was small, the mean pooled percentage error was in the gray zone of clinical applicability. In the sub-group analysis, electrical cardiometry was the device that provided the most accurate measurement. However, a high heterogeneity between studies was found, likely due to a wide range of study characteristics.

  12. Effect of combined application insulin and insulin detemir on continous glucose monitor in children with type 1 diabetes mellitus

    PubMed Central

    Chen, Xiao-Yun; Dong, Qing; Li, Gui-Mei


    Insulin detemir is a soluble long-acting human insulin analogue at neutral pH with a unique mechanism of action, which could strengthen the effects of insulin. This study aims to explore the effects of insulin combined with insulin detemir on the continous glucose in children with type 1 diabetes mellitus. In this study, 150 patients with type 1 diabetes enrolled were included and randomly divided into 3 groups: insulin group (group A), insulin detemir group (group B) and insulin combined with insulin detemir group (group C). Each subject underwent 72 h of continuous glucose monitoring (CGM). MAGE, HbA1c and Noctumal Hypoglycemia levels were examined by using the ELISA kits. The body weight changes were also detected in this study. The results indicated that the information including age, body weight, disease duration and glucose level and HbA1c percentage on the start time point among three groups indicated no statistical differences. Insulin combined with insulin detemir decrease MAGE and HbA1c level in Group C compared to Group A and Group A (P < 0.05). Insulin combined with insulin detemir decreas noctumal hypoglycemia levels and body weight changes (P < 0.05). In conclusion, this study confirmed efficacy of insulin detemir by demonstrating non-inferiority of insulin detemir compared with insulin with respect to HbA1c, with an improved safety profile including significantly fewer hypoglycaemic episodes and less undesirable weight gain in children. PMID:26064343

  13. Progress in immunization information systems--United States, 2011.



    Immunization information systems (IIS) are confidential, computerized, population-based systems that collect and consolidate vaccination data from vaccination providers and provide important tools for designing and sustaining effective immunization strategies. A Healthy People 2020 objective (IID-18) is to increase to 95% the proportion of children aged <6 years whose immunization records are in fully operational, population-based IIS. The National Vaccine Advisory Committee (NVAC) has published goals for IIS, including required and optional core data elements for which IIS should collect information. Two of the required core data elements are vaccine manufacturer and vaccine lot number. To monitor progress toward achieving these and other program goals, CDC annually surveys 56 immunization program grantees using the IIS Annual Report (IISAR). Results from the 2011 IISAR (completed by 54 grantees) indicate that 84% (19.2 million) of U.S. children aged <6 years participated in IIS, as defined by having at least two recorded vaccinations, an increase from 82% (18.8 million) in 2010. Grantees reported that an average of 63% of vaccination records for these children contained data in the field for vaccine manufacturer and 60% contained data in the field for lot number. A new project under way to capture vaccine product information, expiration date, and lot number on two-dimensional (2D) barcodes on vaccine vials might increase completeness, accuracy, and availability of these data elements in patient medical records and IIS, which in turn might enhance vaccine safety and support vaccine inventory management.

  14. Progress in immunization information systems - United States, 2008.



    Immunization information systems (IISs) are confidential, computerized information systems that collect and consolidate vaccination data from multiple health-care providers, generate reminder and recall notifications, and assess vaccination coverage within a defined geographic area. A CDC program goal for 2010 is to achieve >or=95% participation in an IIS (defined as having two or more recorded vaccinations) among children aged <6 years. To monitor progress toward this goal, CDC annually surveys immunization grantees in 50 states, five cities, and the District of Columbia, using the Immunization Information Systems Annual Report (IISAR). All 56 grantees were asked to complete the IISAR; 52 did so for 2008. This report highlights results from the 2008 IISAR, which indicated that 75% of all U.S. children aged <6 years (approximately 18 million children) participated in an IIS in 2008, an increase from 65% in 2006. The majority of grantees (82%) reported that their IIS had the capacity to track vaccinations for persons of all ages, compared with 70% in 2006. Data-quality measures of timeliness and completeness indicated that in 2008, 67% of IIS data were received and processed within 30 days of vaccine administration, and data were reported for six of 17 core data elements in >or=90% of IIS records (both measures are similar to 2006 results). Increased provider use of electronic health record systems can benefit IISs and their users by producing immunization records that are more timely and complete.

  15. The Effects of a Self-Monitoring and Video Self-Modeling Intervention to Increase On-Task Behavior for Children with Attention-Deficit/Hyperactivity Disorder

    ERIC Educational Resources Information Center

    Schmitt, Rachel Calkins Oxnard


    Children are diagnosed with AD/HD more often than any other disorder and interventions are needed in schools to increase on-task behavior. Most studies examining on-task behavior are conducted in special education classrooms or clinical laboratories. Previous studies have not combined video self-modeling and self-monitoring as an intervention to…

  16. Predicting Parental Monitoring Behaviours for Sugar-Sweetened Beverages in Parents of School-Aged Children: An Application of the Integrative Behavioural Model

    ERIC Educational Resources Information Center

    Housely, Alexandra; Branscum, Paul; Cheney, Marshall; Hofford, Craig


    Objective: The objective of this study was to identify theory-based psychosocial and environmental determinants of parental monitoring practices related to child sugar-sweetened beverage consumption. Design: Cross-sectional design. Method: Data were obtained from a convenience sample of parents (n = 270) with children attending an after-school…

  17. Quality control of CD4+ T-lymphocyte enumeration: results from the last 9 years of the United Kingdom National External Quality Assessment Scheme for Immune Monitoring (1993-2001).


    Whitby, Liam; Granger, Viv; Storie, Ian; Goodfellow, Karen; Sawle, Alex; Reilly, John T; Barnett, David


    The human immunodeficiency virus (HIV) global epidemic has necessitated the routine enumeration of T-lymphocyte subsets, which has created a need for external quality assurance (EQA). The United Kingdom National External Quality Assessment Scheme (UK NEQAS) for Immune Monitoring provides EQA for 296 laboratories in 40 countries. In 1993, UK NEQAS developed and incorporated into its program stabilized whole blood that enables the accurate monitoring of laboratory performance. Overall, the mean interlaboratory coefficient of variation (CV) for percentage CD4(+) T-lymphocyte subset enumeration has fallen from 15% to less than 5%, as a direct result of the increased use of CD45/ side scatter (SSC) gating. Laboratories using alternative gating strategies (i.e., CD45/CD14 or forward scatter [FSC]/SSC) were about 7.4 times more likely to fail an EQA exercise. Furthermore, the adoption of single-platform technology resulted in a reduction of the overall mean interlaboratory CV for absolute CD4(+) T lymphocytes from 56% (prior to the widespread use of single-platform technology) to 9.7%. Individual laboratory deficiencies were also identified using a performance monitoring system and, through re-education by collaboration with the coordinating center, satisfactorily resolved. In conclusion, during the last 9 years, the UK NEQAS for Immune Monitoring program has highlighted the significant technological advances made by laboratories worldwide that undertake lymphocyte subset enumeration.

  18. Monitoring the autonomic nervous activity as the objective evaluation of music therapy for severely and multiply disabled children.


    Orita, Makiko; Hayashida, Naomi; Shinkawa, Tetsuko; Kudo, Takashi; Koga, Mikitoshi; Togo, Michita; Katayama, Sotetsu; Hiramatsu, Kozaburo; Mori, Shunsuke; Takamura, Noboru


    Severely and multiply disabled children (SMDC) are frequently affected in more than one area of development, resulting in multiple disabilities. The aim of the study was to evaluate the efficacy of music therapy in SMDC using monitoring changes in the autonomic nervous system, by the frequency domain analysis of heart rate variability. We studied six patients with SMDC (3 patients with cerebral palsy, 1 patient with posttraumatic syndrome after head injury, 1 patient with herpes encephalitis sequelae, and 1 patient with Lennox-Gastaut syndrome characterized by frequent seizures, developmental delay and psychological and behavioral problems), aged 18-26 (mean 22.5 ± 3.5). By frequency domain method using electrocardiography, we measured the high frequency (HF; with a frequency ranging from 0.15 to 0.4 Hz), which represents parasympathetic activity, the low frequency/high frequency ratio, which represents sympathetic activity between the sympathetic and parasympathetic activities, and heart rate. A music therapist performed therapy to all patients through the piano playing for 50 min. We monitored each study participant for 150 min before therapy, 50 min during therapy, and 10 min after therapy. Interestingly, four of 6 patients showed significantly lower HF components during music therapy than before therapy, suggesting that these four patients might react to music therapy through the suppression of parasympathetic nervous activities. Thus, music therapy can suppress parasympathetic nervous activities in some patients with SMDC. The monitoring changes in the autonomic nervous activities could be a powerful tool for the objective evaluation of music therapy in patients with SMDC.

  19. Improved Monitoring of Vulnerable Children. Hearing before the Subcommittee on Human Resources of the Committee on Ways and Means, U.S. House of Representatives, One Hundred Eighth Congress, First Session (November 19, 2003) Serial No. 108-29

    ERIC Educational Resources Information Center

    US House of Representatives, 2004


    This hearing focused on: (1) what data States collect to monitor the care and supervision of children in foster care and children for whom adoption subsidies are paid; (2) how that data is used today; and (3) what additional data or applications of these data might better ensure the safety, permanency, and well-being of children. Testimony was…

  20. Increasing the Time of Exposure to Aerosol Measles Vaccine Elicits an Immune Response Equivalent to That Seen in 9-Month-Old Mexican Children Given the Same Dose Subcutaneously

    PubMed Central

    García-León, Miguel Leonardo; Espinosa-Torres Torrija, Bogart; Hernández-Pérez, Brenda; Cardiel-Marmolejo, Lino E.; Beeler, Judy A.; Audet, Susette; Santos-Preciado, José Ignacio


    Background. A 30-second aerosol measles vaccination successfully primes children 12 months of age and older but is poorly immunogenic when given to 9-month-old children. We examined the immune responses when increasing the duration to aerosol exposure in 9-month-olds. Methods. One hundred and thirteen healthy 9-month-old children from Mexico City were enrolled; 58 received aerosol EZ measles vaccine for 2.5 minutes and 55 subcutaneously. Measles-specific neutralizing antibodies and cellular responses were measured before and at 3 and 6 months postimmunization. Results. Adaptive immunity was induced in 97% after aerosol and 98% after subcutaneous administration. Seroconversion rates and GMCs were 95% and 373 mIU/mL (95% confidence interval [CI], 441–843) following aerosol vaccination and 91% and 306 mIU/mL (95% CI, 367–597) after subcutaneous administration at 3 months. The percentage of children with a measles-specific stimulation index ≥3 was 45% and 60% in the aerosol versus 55% and 59% in the subcutaneous group at 3 and 6 months, respectively. CD8 memory cell frequencies were higher in the aerosol group at 3 months compared with the subcutaneous group. Adverse reactions were comparable in both groups. Conclusions. Increasing exposure time to aerosol measles vaccine elicits immune responses that are comparable to those seen when an equivalent dose is administered by the subcutaneous route in 9-month-old infants. PMID:21742842

  1. Safety and persistence of the humoral and cellular immune responses induced by 2 doses of an AS03-adjuvanted A(H1N1)pdm09 pandemic influenza vaccine administered to infants, children and adolescents: Two open, uncontrolled studies.


    Garcia-Sicilia, José; Arístegui, Javier; Omeñaca, Félix; Carmona, Alfonso; Tejedor, Juan C; Merino, José M; García-Corbeira, Pilar; Walravens, Karl; Bambure, Vinod; Moris, Philippe; Caplanusi, Adrian; Gillard, Paul; Dieussaert, Ilse


    In children, 2 AS03-adjuvanted A(H1N1)pdm09 vaccine doses given 21 days apart were previously shown to induce a high humoral immune response and to have an acceptable safety profile up to 42 days following the first vaccination. Here, we analyzed the persistence data from 2 open-label studies, which assessed the safety, and humoral and cell-mediated immune responses induced by 2 doses of this vaccine. The first study was a phase II, randomized trial conducted in 104 children aged 6-35 months vaccinated with the A(H1N1)pdm09 vaccine containing 1.9 µg haemagglutinin antigen (HA) and AS03B (5.93 mg tocopherol) and the second study, a phase III, non-randomized trial conducted in 210 children and adolescents aged 3-17 years vaccinated with the A(H1N1)pdm09 vaccine containing 3.75 µg HA and AS03A (11.86 mg tocopherol). Approximately one year after the first dose, all children with available data were seropositive for haemagglutinin inhibition and neutralising antibody titres, but a decline in geometric mean antibody titres was noted. The vaccine induced a cell-mediated immune response in terms of antigen-specific CD4(+) T-cells, which persisted up to one year post-vaccination. The vaccine did not raise any safety concern, though these trials were not designed to detect rare events. In conclusion, 2 doses of the AS03-adjuvanted A(H1N1)pdm09 vaccine at 2 different dosages had a clinically acceptable safety profile, and induced high and persistent humoral and cell-mediated immune responses in children aged 6-35 months and 3-17 years. These studies have been registered at NCT00971321 and NCT00964158.

  2. [Current status and recommendations on the use of continuous blood glucose monitoring systems in children and adolescents with type 1 diabetes mellitus].


    Torres Lacruz, M; Barrio Castellanos, R; García Cuartero, B; Gómez Gila, A; González Casado, I; Hermoso López, F; Luzuriaga Tomás, C; Oyarzabal Irigoyen, M; Rica Etxebarria, I; Rodríguez Rigual, M


    Glucose monitoring methods have made great advances in the last decade with the appearance of the continuous glucose monitoring systems (CGMS) that measure the glucose levels in the interstitial liquid, providing information about glucose patterns and trends, but do not replace the self-monitoring of capillary glucose. Improvement in diabetes control using the CGMS depends on the motivation and training received by the patient and family and on the continuity in its use. Due to the development and widespread use of these systems in clinical practice, the diabetes group of the Sociedad Española de Endocrinología Pediátrica has drafted a document of consensus for their indication and use in children and adolescents. Only a limited number of trials have been performed in children and adolescent populations. More data are needed on the use of this technology in order to define the impact on metabolic control.

  3. [Continuous glucose monitoring using the Glucoday system, in children and adolescents who have type one diabetes].


    López Gutiérrez, Sònia; Pavía Sesma, Carlos


    At present times, Continuous Glucose Monitoring is a recommended method to detect glucemia fluctuations in patients who have diabetes, due to the fine correlation between interstitial glucose and capillary glucemia. The objective of this project is obtain a glucose register during a 48 hour period in a group of Type I diabetes patients who have an irregular metabolic control and to evaluate effectiveness of treatment employed, as well as evaluating compliance of the therapeutic norms established for each patient. At the same time, the authors plan to test the usefulness of a graphical register for diabetic education. After applying an anesthetic cream in the lateral umbilical zone, a subcutaneous catheter connected to a GLUCODAY, Menarini Diagnostics glucose sensor is inserted which, by means of a continuous sequence taking measures in interstitial liquid, registers a value every three minutes for as long as this connection is maintained. After a maximum 48 hour period, data are transferred to a computer and by means of the corresponding computer program, a graphic register for each patient is produced. Informed consent has been obtained from each patient. There were 23 patients in this study group, each diagnosed to have Type I diabetes; eight of these patients, two girls and six boys, were pre-puberty aged while 15, six girls and nine boys, were adolescents. Two of the pre-puberty patients had pathological antecedents, in one case celiac and the other thyroid disease. Two of the puberty aged patients had a history of chronic lymphocytic thyroid disease under opo-therapeutic treatment. Individual analysis of each case permits health professionals to detect a series of facts: it is difficult to comply with glucemic objectives in this group of adolescents having diabetes, with insulin treatment installed and researchers detect postprandial hyper-glucemia which do not appear when using capillary glucemias carried out by habitual methods. Study observations manifest a

  4. Federal Immunity Law in Higher Education: A Review of the 1997 Judicial Decisions.

    ERIC Educational Resources Information Center

    Johnsen, Christopher


    Monitors developments in 1997 in federal immunity law applicable to higher education, generally public institutions. Cases touched on Eleventh Amendment immunity (abrogation, waiver, removal, entities, interlocutory appeals, discovery), qualified immunity (claims involving motivation, interlocutory appeals), and absolute immunity. (EV)

  5. Regulatory T cell-associated activity in photopheresis-induced immune tolerance in recent onset type 1 diabetes children

    PubMed Central

    Jonson, C-O; Pihl, M; Nyholm, C; Cilio, C M; Ludvigsson, J; Faresjö, M


    Extracorporeal photochemotherapy (ECP) has demonstrated immunological effects. The proposed cytotoxic lymphocyte antigen 4 (CTLA-4) involvement, together with forkhead box P3 (FoxP3) and transforming growth factor (TGF)-β are associated with regulatory T cell activity. The aim of the study was to evaluate the regulatory T cell-associated effect of ECP in recent onset type 1 diabetic (T1D) children. Children (n = 20) with T1D received photopheresis 8-methoxypsoralen + ECP or placebo + shampheresis. Peripheral blood mononuclear cells (PBMC) collected pretreatment (day 1) and post-treatment (day 90) were stimulated with phytohaemagglutinin (PHA) and T1D-associated glutamic acid decarboxylase 65 (GAD65) peptide a.a. 247–279. CTLA-4, sCTLA-4, FoxP3 and TGF-β mRNA transcription was quantified. Photopheresis-treated individuals' relative mRNA expression was generally maintained during the course of the study. Placebo individuals increased in spontaneous CTLA-4 mRNA (P< 0·05) but decreased in expression after stimulation with GAD65-peptide (P< 0·05) and PHA (P< 0·05). Spontaneous TGF-β (P< 0·05) increased whereas PHA- (P< 0·01) and GAD65-peptide (P< 0·01)-induced TGF-β expression decreased in the placebo group, whereas it was maintained in the treated group. Without intervention, expression of CTLA-4 and TGF-β, stimulated with PHA and GAD65 peptide, decreased with time, with a parallel reduction of GAD65-peptide and PHA-stimulated TGF-β expression. These parameters were counteracted by ECP. In conclusion, our results indicate that ECP maintains regulatory T cell-associated activity in recent-onset T1D. PMID:18549445

  6. Vaccination coverage and its determinants among migrant children in Guangdong, China

    PubMed Central


    Background Guangdong province attracted more than 31 million migrants in 2010. But few studies were performed to estimate the complete and age-appropriate immunization coverage and determine risk factors of migrant children. Methods 1610 migrant children aged 12–59 months from 70 villages were interviewed in Guangdong. Demographic characteristics, primary caregiver’s knowledge and attitude toward immunization, and child’s immunization history were obtained. UTD and age-appropriate immunization rates for the following five vaccines and the overall series (1:3:3:3:1 immunization series) were assessed: one dose of BCG, three doses of DTP, OPV and HepB, one dose of MCV. Risk factors for not being UTD for the 1:3:3:3:1 immunization series were explored. Results For each antigen, the UTD immunization rate was above 71%, but the age-appropriate immunization rates for BCG, HepB, OPV, DPT and MCV were only 47.8%, 45.1%, 47.1%, 46.8% and 37.2%, respectively. The 1st dose was most likely to be delayed within them. For the 1:3:3:3:1 immunization series, the UTD immunization rate and age-appropriate immunization rate were 64.9% and 12.4% respectively. Several factors as below were significantly associated with UTD immunization. The primary caregiver’s determinants were their occupation, knowledge and attitude toward immunization. The child’s determinants were sex, Hukou, birth place, residential buildings and family income. Conclusions Alarmingly low immunization coverage of migrant children should be closely monitored by NIISS. Primary caregiver and child’s determinants should be considered when taking measures. Strategies to strengthen active out-reach activities and health education for primary caregivers needed to be developed to improve their immunization coverage. PMID:24568184

  7. Epidemiology of rotavirus infection and gastroenteritis in prospectively monitored Argentine families with young children.


    Grinstein, S; Gómez, J A; Bercovich, J A; Biscotti, E L


    A prospective study was carried out in 49 families of newborns in Avellaneda District, Argentina, recruited when the mother was in the last trimester of pregnancy and followed until the newborn was aged two years, to study the epidemiology of rotavirus infection under natural conditions. Weekly surveillance of all family members for diarrhea and rotavirus-related diarrhea was carried out from May 1983 to July 1986. Serum samples were also collected every six months to study the incidence of rotavirus infection in all family members. The peak of diarrhea incidence was observed in children aged less than two years (2.1 cases per person-year). Rotavirus infection was a common rather than a sporadic phenomenon (0.63 cases per person-year, on average) in all age groups, and at least 61% of rotavirus infections were reinfections. In contrast, the peak of rotavirus infection in seronegative persons (0.58 cases per person-year) and the peak of rotavirus-related diarrhea incidence (0.25 cases per person-year) were found during the first year of life. These results showed that infants aged less than one year are the most appropriate candidates for a rotavirus vaccine in the Avellaneda population. However, improvements in sanitary conditions and personal hygiene and education of the high-risk population should be considered the primary means of reducing infectious diarrhea in Argentina.

  8. High Vaccination Coverage among Children during Influenza A(H1N1)pdm09 as a Potential Factor of Herd Immunity

    PubMed Central

    Matsuoka, Toshihiko; Sato, Tomoki; Akita, Tomoyuki; Yanagida, Jiturou; Ohge, Hiroki; Kuwabara, Masao; Tanaka, Junko


    The objective of this study was to identify factors related to the expansion of infection and prevention of influenza A(H1N1)pdm09. A retrospective non-randomized cohort study (from June 2009 to May 2010) on influenza A(H1N1)pdm09 was conducted in a sample of residents from Hiroshima Prefecture, Japan. The cumulative incidence of the influenza A(H1N1)pdm09 and the pandemic vaccine effectiveness (VE) were estimated. The response rate was 53.5% (178,669/333,892). Overall, the odds ratio of non-vaccinated group to vaccinated group for cumulative incidence of influenza A(H1N1)pdm09 was 2.18 (95% confidence interval (CI): 2.13–2.23) and the VE was 43.9% (CI: 42.8–44.9). The expansion of infection, indicating the power of transmission from infected person to susceptible person, was high in the 7–15 years age groups in each area. In conclusion, results from this survey suggested that schoolchildren-based vaccination rate participates in determining the level of herd immunity to influenza and children might be the drivers of influenza transmission. For future pandemic preparedness, vaccination of schoolchildren may help to prevent disease transmission during influenza outbreak. PMID:27763532

  9. High Vaccination Coverage among Children during Influenza A(H1N1)pdm09 as a Potential Factor of Herd Immunity.


    Matsuoka, Toshihiko; Sato, Tomoki; Akita, Tomoyuki; Yanagida, Jiturou; Ohge, Hiroki; Kuwabara, Masao; Tanaka, Junko


    The objective of this study was to identify factors related to the expansion of infection and prevention of influenza A(H1N1)pdm09. A retrospective non-randomized cohort study (from June 2009 to May 2010) on influenza A(H1N1)pdm09 was conducted in a sample of residents from Hiroshima Prefecture, Japan. The cumulative incidence of the influenza A(H1N1)pdm09 and the pandemic vaccine effectiveness (VE) were estimated. The response rate was 53.5% (178,669/333,892). Overall, the odds ratio of non-vaccinated group to vaccinated group for cumulative incidence of influenza A(H1N1)pdm09 was 2.18 (95% confidence interval (CI): 2.13-2.23) and the VE was 43.9% (CI: 42.8-44.9). The expansion of infection, indicating the power of transmission from infected person to susceptible person, was high in the 7-15 years age groups in each area. In conclusion, results from this survey suggested that schoolchildren-based vaccination rate participates in determining the level of herd immunity to influenza and children might be the drivers of influenza transmission. For future pandemic preparedness, vaccination of schoolchildren may help to prevent disease transmission during influenza outbreak.

  10. Persistence of the immune response after MenACWY-CRM vaccination and response to a booster dose, in adolescents, children and infants.


    Baxter, Roger; Keshavan, Pavitra; Welsch, Jo Anne; Han, Linda; Smolenov, Igor


    Persistence of bactericidal antibodies following vaccination is extremely important for protection against invasive meningococcal disease, given the epidemiology and rapid progression of meningococcal infection. We present an analysis of antibody persistence and booster response to MenACWY-CRM, in adolescents, children and infants, from 7 clinical studies. Immunogenicity was assessed using the serum bactericidal assay with both human and rabbit complement. Post-vaccination hSBA titers were high, with an age- and serogroup-specific decline in titers up to 1 y and stable levels up to 5 y The waning of hSBA titers over time was more pronounced among infants and toddlers and the greatest for serogroup A. However, rSBA titers against serogroup A were consistently higher and showed little decline over time, suggesting that protection against this serogroup may be sustained. A single booster dose of MenACWY-CRM administered at 3 to 5 y induced a robust immune response in all age groups.

  11. Nebraska Schools 83-84 Immunization Levels.

    ERIC Educational Resources Information Center

    Nebraska State Dept. of Health, Lincoln.

    The data contained in this report represents all of the 297,696 students, K-12, in the state of Nebraska. High levels of immunity are documented among children grades K-6. Some immunization levels of children grades 7-12 are yet below the 95 percent established as a minimum for the prevention of vaccine preventable diseases. Specifically, there…

  12. Immunity status of adults and children against poliomyelitis virus type 1 strains CHAT and Sabin (LSc-2ab) in Germany

    PubMed Central


    Background In October 2007, the working group CEN/TC 216 of the European Committee for standardisation suggested that the Sabin oral poliovirus vaccine type 1 strain (LSc-2ab) presently used for virucidal tests should be replaced by another attenuated vaccine poliovirus type 1 strain, CHAT. Both strains were historically used as oral vaccines, but the Sabin type 1 strain was acknowledged to be more attenuated. In Germany, vaccination against poliomyelitis was introduced in 1962 using the oral polio vaccine (OPV) containing Sabin strain LSc-2ab. The vaccination schedule was changed from OPV to an inactivated polio vaccine (IPV) containing wild polio virus type 1 strain Mahoney in 1998. In the present study, we assessed potential differences in neutralising antibody titres to Sabin and CHAT in persons with a history of either OPV, IPV, or OPV with IPV booster. Methods Neutralisation poliovirus antibodies against CHAT and Sabin 1 were measured in sera of 41 adults vaccinated with OPV. Additionally, sera from 28 children less than 10 years of age and immunised with IPV only were analysed. The neutralisation assay against poliovirus was performed according to WHO guidelines. Results The neutralisation activity against CHAT in adults with OPV vaccination history was significantly lower than against Sabin poliovirus type 1 strains (Wilcoxon signed-rank test P < 0.025). In eight sera, the antibody titres measured against CHAT were less than 8, although the titre against Sabin 1 varied between 8 and 64. Following IPV booster, anti-CHAT antibodies increased rapidly in sera of CHAT-negative adults with OPV history. Sera from children with IPV history neutralised CHAT and Sabin 1 strains equally. Conclusion The lack of neutralising antibodies against the CHAT strain in persons vaccinated with OPV might be associated with an increased risk of reinfection with the CHAT polio virus type 1, and this implies a putative risk of transmission of the virus to polio-free communities. We

  13. Immunization Coverage


    ... and afford to pay for them. World Immunization Week The last week of April each year is marked by WHO and partners as World Immunization Week. It aims to accelerate action to increase awareness ...

  14. Monitoring the impact of human papillomavirus vaccines on high-grade pre-invasive cervical lesions: designing a framework of linked immunization information system and cancer registry data in Michigan.


    Potter, Rachel C; Flagg, Elaine W; Datta, S Deblina; Saraiya, Mona; Copeland, Glenn


    State immunization and cancer registries contain data that, if linked, could be used to monitor the impact of human papillomavirus (HPV) vaccine on cervical cancer and precancer. Michigan is uniquely positioned to examine these outcomes using two population-based resources: the state-wide cancer registry and immunization information system (IIS). We assessed the feasibility of identifying females in the IIS who had continuous Michigan residence and linking them to the cancer registry. We considered continuous residence necessary for future studies of vaccine impact to avoid misclassifying those who may have been immunized while residing out-of-state and whose immunization therefore may not have been reported in Michigan. We identified females with 1976-1996 birthdates in the IIS and used probabilistic linkage software to match them with Michigan birth records. A stratified random sample of IIS-birth matches was provided to a commercial locator service to identify females with continuous Michigan residence. Cervical carcinoma in situ cases diagnosed in 2006 among females aged 10 through 30 years were also matched with the birth records; cancer registry-birth matches were merged with the IIS-birth matches using the birth record identifier. Overall, 68% of the 1274,282 IIS and 61% of the 1358 cancer registry records could be matched with birth records. Among the sample of IIS-birth matches, most (86%) were continuous residents. Seventy percent or more of cancer registry-birth matches merged with IIS-birth matches for cases born after 1984. This is the first effort in the U.S. to show that linking records across IIS and cancer registries is practical and reasonably efficient. The increasing proportion of matches between the registries and live birth file with birth year, and the use of population-based data, strengthen the utility of this approach. Future steps include use of this method to examine incidence of cervical cancer precursors in HPV immunization

  15. Neurologic complications of immunizations.


    Rutledge, S L; Snead, O C


    Although there does appear to be at least a temporal relationship between pertussis immunization and serious acute neurologic illness, data to suggest that children with stable preexisting neurologic disease or positive family history of neurologic disease are at increased risk for complications of pertussis immunizations are inconclusive. Furthermore, there are no firm statistical data concerning the incidence of pertussis vaccine-related encephalopathy. Rather, the literature on pertussis vaccine complications is replete with anecdotal reports and retrospective studies with a number of questionable conclusions drawn from this inadequate data base. Unfortunately, these conclusions have been sensationalized and exploited with litigious fervor to the point that the practice of pertussis immunization is being questioned in the United States. A number of points should be reiterated: pertussis is a dangerous and deadly disease, as seen in the epidemic in Great Britain; pertussis immunization is effective in protecting against the disease; and there is no conclusive proof that the incidence of complications from pertussis vaccination of children with seizure disorders or other preexisting stable neurologic abnormalities is higher, because appropriate studies have not been done to define such a risk. We would do well to keep these facts in mind in order to avoid a disaster similar to the pertussis epidemic in Great Britain. Pertussis vaccination should be given to all children except those with allergic hypersensitivity, a progressive neurologic disorder, or an adverse reaction to a previous pertussis dose.

  16. Children

    ERIC Educational Resources Information Center

    Headley, Clea; Campbell, Marilyn A.


    This study examined primary school teachers' knowledge of anxiety and excessive anxiety symptoms in children. Three hundred and fifteen primary school teachers completed a questionnaire exploring their definitions of anxiety and the indications they associated with excessive anxiety in primary school children. Results showed that teachers had an…

  17. Vaccines and Immunization Practice.


    Hogue, Michael D; Meador, Anna E


    Vaccines are among most cost-effective public health strategies. Despite effective vaccines for many bacterial and viral illnesses, tens of thousands of adults and hundreds of children die each year in the United States from vaccine-preventable diseases. Underutilization of vaccines requires rethinking the approach to incorporating vaccines into practice. Arguably, immunizations could be a part all health care encounters. Shared responsibility is paramount if deaths are to be reduced. This article reviews the available vaccines in the US market, as well as practice recommendations of the Centers for Disease Control and Prevention's Advisory Committee on Immunization Practices.

  18. Experiences in home-based growth monitoring.


    Suelan, F; Briones, H


    A growth monitoring project (GMP) of child weighing was implemented by the Philippines' Department of Health (DOH) through the Integrated Provincial Health Office to monitor either children's nutritional progress or their faltering of growth. Weaknesses, however, were found in the GMP. For example, only 31% of preschoolers included in the Nutrition Center of the Philippines (NCP) survey had growth charts. An 1990 UNICEF-DOH survey also found that the growth chart was used primarily by mothers and service providers to record infant immunization. Mothers brought their children to well-baby clinics in barangay health centers only when their children were sick. Conducted only once per year, weighing was not perceived as a tool in detecting and preventing sickness, and ensuring normal growth. Asked to help improve the GMP, the NCP consulted intended beneficiaries and cooperators to develop a plan to pilot an intensive monitoring project in four towns of Negros Occidental, starting in January 1991 and ending in December 1992. The resultant Home-Based Growth Monitoring (HBGM) project would place emphasis upon enabling rural mothers to become self-sustaining agents for child growth monitoring. A key feature was the establishment of a weighing post in a strategic place for every 2-3 family clusters. The HBGM project was piloted in 1991 in Calatrava, Toboso, Cauayan, and Sipalay. This paper describes project implementation, problems and solutions, and results.

  19. 45 CFR 1308.5 - Recruitment and enrollment of children with disabilities.

    Code of Federal Regulations, 2012 CFR


    ... immunization of preschool children. Grantees must observe applicable State laws which usually require that children entering State preschool programs complete immunizations prior to or within thirty days...

  20. 45 CFR 1308.5 - Recruitment and enrollment of children with disabilities.

    Code of Federal Regulations, 2014 CFR


    ... immunization of preschool children. Grantees must observe applicable State laws which usually require that children entering State preschool programs complete immunizations prior to or within thirty days...

  1. 45 CFR 1308.5 - Recruitment and enrollment of children with disabilities.

    Code of Federal Regulations, 2013 CFR


    ... immunization of preschool children. Grantees must observe applicable State laws which usually require that children entering State preschool programs complete immunizations prior to or within thirty days...

  2. An official American Thoracic Society workshop report: optimal lung function tests for monitoring cystic fibrosis, bronchopulmonary dysplasia, and recurrent wheezing in children less than 6 years of age.


    Rosenfeld, Margaret; Allen, Julian; Arets, Bert H G M; Aurora, Paul; Beydon, Nicole; Calogero, Claudia; Castile, Robert G; Davis, Stephanie D; Fuchs, Susanne; Gappa, Monika; Gustaffson, Per M; Hall, Graham L; Jones, Marcus H; Kirkby, Jane C; Kraemer, Richard; Lombardi, Enrico; Lum, Sooky; Mayer, Oscar H; Merkus, Peter; Nielsen, Kim G; Oliver, Cara; Oostveen, Ellie; Ranganathan, Sarath; Ren, Clement L; Robinson, Paul D; Seddon, Paul C; Sly, Peter D; Sockrider, Marianna M; Sonnappa, Samatha; Stocks, Janet; Subbarao, Padmaja; Tepper, Robert S; Vilozni, Daphna


    Although pulmonary function testing plays a key role in the diagnosis and management of chronic pulmonary conditions in children under 6 years of age, objective physiologic assessment is limited in the clinical care of infants and children less than 6 years old, due to the challenges of measuring lung function in this age range. Ongoing research in lung function testing in infants, toddlers, and preschoolers has resulted in techniques that show promise as safe, feasible, and potentially clinically useful tests. Official American Thoracic Society workshops were convened in 2009 and 2010 to review six lung function tests based on a comprehensive review of the literature (infant raised-volume rapid thoracic compression and plethysmography, preschool spirometry, specific airway resistance, forced oscillation, the interrupter technique, and multiple-breath washout). In these proceedings, the current state of the art for each of these tests is reviewed as it applies to the clinical management of infants and children under 6 years of age with cystic fibrosis, bronchopulmonary dysplasia, and recurrent wheeze, using a standardized format that allows easy comparison between the measures. Although insufficient evidence exists to recommend incorporation of these tests into the routine diagnostic evaluation and clinical monitoring of infants and young children with cystic fibrosis, bronchopulmonary dysplasia, or recurrent wheeze, they may be valuable tools with which to address specific concerns, such as ongoing symptoms or monitoring response to treatment, and as outcome measures in clinical research studies.

  3. An Integrated Approach for the Monitoring of Brain and Autonomic Response of Children with Autism Spectrum Disorders during Treatment by Wearable Technologies

    PubMed Central

    Billeci, Lucia; Tonacci, Alessandro; Tartarisco, Gennaro; Narzisi, Antonio; Di Palma, Simone; Corda, Daniele; Baldus, Giovanni; Cruciani, Federico; Anzalone, Salvatore M.; Calderoni, Sara; Pioggia, Giovanni; Muratori, Filippo


    Autism Spectrum Disorders (ASD) are associated with physiological abnormalities, which are likely to contribute to the core symptoms of the condition. Wearable technologies can provide data in a semi-naturalistic setting, overcoming the limitations given by the constrained situations in which physiological signals are usually acquired. In this study an integrated system based on wearable technologies for the acquisition and analysis of neurophysiological and autonomic parameters during treatment is proposed and an application on five children with ASD is presented. Signals were acquired during a therapeutic session based on an imitation protocol in ASD children. Data were analyzed with the aim of extracting quantitative EEG (QEEG) features from EEG signals as well as heart rate and heart rate variability (HRV) from ECG. The system allowed evidencing changes in neurophysiological and autonomic response from the state of disengagement to the state of engagement of the children, evidencing a cognitive involvement in the children in the tasks proposed. The high grade of acceptability of the monitoring platform is promising for further development and implementation of the tool. In particular if the results of this feasibility study would be confirmed in a larger sample of subjects, the system proposed could be adopted in more naturalistic paradigms that allow real world stimuli to be incorporated into EEG/psychophysiological studies for the monitoring of the effect of the treatment and for the implementation of more individualized therapeutic programs. PMID:27445652

  4. An Integrated Approach for the Monitoring of Brain and Autonomic Response of Children with Autism Spectrum Disorders during Treatment by Wearable Technologies.


    Billeci, Lucia; Tonacci, Alessandro; Tartarisco, Gennaro; Narzisi, Antonio; Di Palma, Simone; Corda, Daniele; Baldus, Giovanni; Cruciani, Federico; Anzalone, Salvatore M; Calderoni, Sara; Pioggia, Giovanni; Muratori, Filippo


    Autism Spectrum Disorders (ASD) are associated with physiological abnormalities, which are likely to contribute to the core symptoms of the condition. Wearable technologies can provide data in a semi-naturalistic setting, overcoming the limitations given by the constrained situations in which physiological signals are usually acquired. In this study an integrated system based on wearable technologies for the acquisition and analysis of neurophysiological and autonomic parameters during treatment is proposed and an application on five children with ASD is presented. Signals were acquired during a therapeutic session based on an imitation protocol in ASD children. Data were analyzed with the aim of extracting quantitative EEG (QEEG) features from EEG signals as well as heart rate and heart rate variability (HRV) from ECG. The system allowed evidencing changes in neurophysiological and autonomic response from the state of disengagement to the state of engagement of the children, evidencing a cognitive involvement in the children in the tasks proposed. The high grade of acceptability of the monitoring platform is promising for further development and implementation of the tool. In particular if the results of this feasibility study would be confirmed in a larger sample of subjects, the system proposed could be adopted in more naturalistic paradigms that allow real world stimuli to be incorporated into EEG/psychophysiological studies for the monitoring of the effect of the treatment and for the implementation of more individualized therapeutic programs.

  5. Comparison of self-report and electronic monitoring of 6MP intake in childhood ALL: A Children's Oncology Group study.


    Landier, Wendy; Chen, Yanjun; Hageman, Lindsey; Kim, Heeyoung; Bostrom, Bruce C; Casillas, Jacqueline N; Dickens, David S; Evans, William E; Maloney, Kelly W; Mascarenhas, Leo; Ritchey, A Kim; Termuhlen, Amanda M; Carroll, William L; Relling, Mary V; Wong, F Lennie; Bhatia, Smita


    Adequate exposure to oral 6-mercaptopurine (6MP) during maintenance therapy for childhood acute lymphoblastic leukemia (ALL) is critical for sustaining durable remissions; the accuracy of self-reported 6MP intake is unknown. We aimed to directly compare self-report to electronic monitoring (Medication Event Monitoring System [MEMS]), and identify predictors of over-reporting in a cohort of 416 children with ALL in first remission over 4 study months per patient (1,344 patient-months for the cohort) during maintenance therapy. Patients were classified as "perfect reporters" (self-report=MEMS), "over reporters" (self-report>MEMS by ≥5 days/month for ≥50% of study months), and "others" (all patients not meeting criteria for perfect- or over-reporter). Multivariable logistic regression examined sociodemographic and clinical characteristics, 6MP dose-intensity, TPMT genotype, TGN levels, and 6MP non-adherence (MEMs-based adherence rate <95%) associated with the over-reporter phenotype; generalized estimating equations (GEE) compared 6MP intake by self-report and MEMS over the study period. Self-reported 6MP intake exceeded MEMS at least some of the time in 84% of patients. Fifty (12%) patients were classified as perfect reporters, 98 (23.6%) as over-reporters, 2 (0.5%) as under-reporters, and 266 (63.9%) as others. Multivariable logistic regression technique identified the following variables associated with the over-reporter phenotype: i) non-white race: Hispanic, odds ratio (OR)=2.4, 95%CI, 1.1-5.1, p=0.02; Asian, OR=3.1, 95%CI, 1.2-8.3, p=0.02; African-American, OR=5.4, 95%CI, 2.3-12.8, p=0.0001; ii) paternal education

  6. Economic and clinical evaluation of a catch-up dose of 13-valent pneumococcal conjugate vaccine in children already immunized with three doses of the 7-valent vaccine in Italy.


    Boccalini, Sara; Azzari, Chiara; Resti, Massimo; Valleriani, Claudia; Cortimiglia, Martina; Tiscione, Emilia; Bechini, Angela; Bonanni, Paolo


    A new 13-valent conjugated polysaccharide vaccine (PCV13) against Streptococcus pneumoniae infections, which replaced the 7-valent vaccine (PCV7) in the regional immunization programmes for newborns and children who started but not completed the 3 doses schedule of PCV7, is available in Italy since 2010. The opportunity of administering a further dose of PCV13 to children under 5 years of age who had already completed their vaccination with PCV7, with the aim of extending the serotype coverage, triggered an animated scientific debate. The purpose of this study was to perform a clinical/economic evaluation of the administration of a dose of PCV13, in a catch-up programme, for children under 5 years of age, who had already received 3 doses of PCV7. A mathematical model of the clinical/economic impact of the adoption of 4 catch-up strategies with PCV13 (children up to 24, 36, 48 and 60 months old) was set up, with a vaccination coverage of 80%, versus immunization with 3 doses of PCV7 without the catch-up programme. The time span covered by the simulation was 5.5 years. The following clinical outcomes of infection were evaluated: hospitalised meningitis/sepsis, hospitalised bacteraemic pneumonias (complicated and uncomplicated), hospitalised non-bacteraemic pneumonias, and non-hospitalised pneumonias. The administration of one dose of PCV13 to children up to 60 months of age significantly reduces the number of cases of pneumococcal diseases (especially, non-hospitalised pneumonias, 80% of all events prevented, and hospitalised cases of non-bacteraemic pneumococcal pneumonias, 15% of all events prevented) and, subsequently, the relative cost for medical treatment. This results in savings for medical costs amounting to more than 1,000,000 Euros when vaccinating children under 24 months of age (up to almost 3 million Euros for children up to 60 months). More than half of those savings are attributable to avoided hospitalised cases of non-bacteraemic pneumococcal

  7. Immunizations, immunology, and autism.


    Chez, Michael G; Chin, Kathleen; Hung, Paul C


    Public fears of rising rates of children being diagnosed with autistic spectrum disorders has led to a fear that immunizations, specifically the measles-mumps-varicella vaccine (MMR), may trigger autism. This article reviews theories of immunization as a risk factor for autism, including thimerosal exposure. We also review theories of autoimmunity as a predisposing genetic risk in autistic patients. We summarize from multiple population-based studies and extensive review committee reports that neither immunization nor thimerosal exposure has been conclusively linked to autism. Current treatments for autoimmunity in autism are reviewed and summarized as being only anecdotally effective, with no controlled studies to conclusively determine effectiveness. The goal of this article is to allow child neurologists to effectively counsel parents of autistic patients about vaccination risks and treatment options in presumed cases of autoimmune dysfunction.

  8. Immune Therapies for Neuroblastoma

    PubMed Central

    Navid, Fariba; Armstrong, Michael; Barfield, Raymond C.


    Neuroblastoma, a solid tumor arising from developing cells of the sympathetic nervous system, is the most common extracranial tumor in children. The prognosis for high-risk neuroblastoma remains poor with conventional treatment, and new approaches are therefore being explored to treat this disease. One such alternative therapy that holds promise is immune therapy. We review here the recent advances in 4 types of immune therapy – cytokine, vaccine, antibody, and cellular therapy – to treat neuroblastoma. We present preclinical research and clinical trials on several promising candidates such as IL-12, dendritic cell vaccines, anti-GD2 antibodies, and allogeneic hematopoietic stem cell transplant. An optimal treatment plan for neuroblastoma will most likely involve multimodal approaches and combinations of immune therapies. PMID:19342881

  9. DNA Immunization

    PubMed Central

    Wang, Shixia; Lu, Shan


    DNA immunization was discovered in early 1990s and its use has been expanded from vaccine studies to a broader range of biomedical research, such as the generation of high quality polyclonal and monoclonal antibodies as research reagents. In this unit, three common DNA immunization methods are described: needle injection, electroporation and gene gun. In addition, several common considerations related to DNA immunization are discussed. PMID:24510291

  10. Closing the praziquantel treatment gap: new steps in epidemiological monitoring and control of schistosomiasis in African infants and preschool-aged children

    PubMed Central



    SUMMARY Where very young children come into contact with water containing schistosome cercariae, infections occur and schistosomiasis can be found. In high transmission environments, where mothers daily bathe their children with environmentally drawn water, many infants and preschool-aged children have schistosomiasis. This ‘new’ burden, inclusive of co-infections with Schistosoma haematobium and Schistosoma mansoni, is being formally explored as infected children are not presently targeted to receive praziquantel (PZQ) within current preventive chemotherapy campaigns. Thus an important PZQ treatment gap exists whereby infected children might wait up to 4–5 years before receiving first treatment in school. International treatment guidelines, set within national treatment platforms, are presently being modified to provide earlier access to medication(s). Although detailed pharmacokinetic studies are needed, to facilitate pragmatic dosing in the field, an extended ‘dose pole’ has been devised and epidemiological monitoring has shown that administration of PZQ (40 mg/kg), in either crushed tablet or liquid suspension, is both safe and effective in this younger age-class; drug efficacy, however, against S. mansoni appears to diminish after repeated rounds of treatment. Thus use of PZQ should be combined with appropriate health education/water hygiene improvements for both child and mother to bring forth a more enduring solution. PMID:21861945

  11. Safety and persistence of the humoral and cellular immune responses induced by 2 doses of an AS03-adjuvanted A(H1N1)pdm09 pandemic influenza vaccine administered to infants, children and adolescents: Two open, uncontrolled studies

    PubMed Central

    Garcia-Sicilia, José; Arístegui, Javier; Omeñaca, Félix; Carmona, Alfonso; Tejedor, Juan C; Merino, José M; García-Corbeira, Pilar; Walravens, Karl; Bambure, Vinod; Moris, Philippe; Caplanusi, Adrian; Gillard, Paul; Dieussaert, Ilse


    In children, 2 AS03-adjuvanted A(H1N1)pdm09 vaccine doses given 21 days apart were previously shown to induce a high humoral immune response and to have an acceptable safety profile up to 42 days following the first vaccination. Here, we analyzed the persistence data from 2 open-label studies, which assessed the safety, and humoral and cell-mediated immune responses induced by 2 doses of this vaccine. The first study was a phase II, randomized trial conducted in 104 children aged 6–35 months vaccinated with the A(H1N1)pdm09 vaccine containing 1.9 µg haemagglutinin antigen (HA) and AS03B (5.93 mg tocopherol) and the second study, a phase III, non-randomized trial conducted in 210 children and adolescents aged 3–17 years vaccinated with the A(H1N1)pdm09 vaccine containing 3.75 µg HA and AS03A (11.86 mg tocopherol). Approximately one year after the first dose, all children with available data were seropositive for haemagglutinin inhibition and neutralising antibody titres, but a decline in geometric mean antibody titres was noted. The vaccine induced a cell-mediated immune response in terms of antigen-specific CD4+ T-cells, which persisted up to one year post-vaccination. The vaccine did not raise any safety concern, though these trials were not designed to detect rare events. In conclusion, 2 doses of the AS03-adjuvanted A(H1N1)pdm09 vaccine at 2 different dosages had a clinically acceptable safety profile, and induced high and persistent humoral and cell-mediated immune responses in children aged 6–35 months and 3–17 years. These studies have been registered at NCT00971321 and NCT00964158. PMID:26176592

  12. Why parents refuse immunization?


    Kajetanowicz, Andrzej; Kajetanowicz, Aleksandra

    Rates of child immunization are falling in many countries, leading to the increase of morbidity and mortality from diseases controlled by vaccinations. The simplified model of the natural history of immunization follows a sequence of fear of the disease before vaccination, followed by acceptance of the vaccination until plateau, where the population forgets the morbidity and mortality of pre-immunization. Historical factors including withdrawals of vaccines, and publications regarding the true or falsified dangers of vaccines still resonate with parents. Building on these historical factors, unscientific sources such as naturopaths, homeopaths, chiropractors, celebrities and lay-people with anecdotal evidence and even scientific sources such as some universities and some medical doctors push their views on anti-vaccination, which proves to make the decision to vaccinate more difficult on parents. The main reason that parents refuse vaccination is a desire to protect their children. These parents believe that vaccination is harmful, or that not vaccinated children are healthier than vaccinated children. Scientific data often will lose with pseudoscientific, false or anecdotal data that have higher sensational and emotional impact on parents. With so many sources giving so many factors which sometimes contradict themselves, it is indeed difficult for a parent to make a clear decision for their child.

  13. Immunity-based diagnosis for a motherboard.


    Shida, Haruki; Okamoto, Takeshi; Ishida, Yoshiteru


    We have utilized immunity-based diagnosis to detect abnormal behavior of components on a motherboard. The immunity-based diagnostic model monitors voltages of some components, CPU temperatures, and fan speeds. We simulated abnormal behaviors of some components on the motherboard, and we utilized the immunity-based diagnostic model to evaluate motherboard sensors in two experiments. These experiments showed that the immunity-based diagnostic model was an effective method for detecting abnormal behavior of components on the motherboard.

  14. Increasing immunization coverage.


    Hammer, Lawrence D; Curry, Edward S; Harlor, Allen D; Laughlin, James J; Leeds, Andrea J; Lessin, Herschel R; Rodgers, Chadwick T; Granado-Villar, Deise C; Brown, Jeffrey M; Cotton, William H; Gaines, Beverly Marie Madry; Gambon, Thresia B; Gitterman, Benjamin A; Gorski, Peter A; Kraft, Colleen A; Marino, Ronald Vincent; Paz-Soldan, Gonzalo J; Zind, Barbara


    In 1977, the American Academy of Pediatrics issued a statement calling for universal immunization of all children for whom vaccines are not contraindicated. In 1995, the policy statement "Implementation of the Immunization Policy" was published by the American Academy of Pediatrics, followed in 2003 with publication of the first version of this statement, "Increasing Immunization Coverage." Since 2003, there have continued to be improvements in immunization coverage, with progress toward meeting the goals set forth in Healthy People 2010. Data from the 2007 National Immunization Survey showed that 90% of children 19 to 35 months of age have received recommended doses of each of the following vaccines: inactivated poliovirus (IPV), measles-mumps-rubella (MMR), varicella-zoster virus (VZB), hepatitis B virus (HBV), and Haemophilus influenzae type b (Hib). For diphtheria and tetanus and acellular pertussis (DTaP) vaccine, 84.5% have received the recommended 4 doses by 35 months of age. Nevertheless, the Healthy People 2010 goal of at least 80% coverage for the full series (at least 4 doses of DTaP, 3 doses of IPV, 1 dose of MMR, 3 doses of Hib, 3 doses of HBV, and 1 dose of varicella-zoster virus vaccine) has not yet been met, and immunization coverage of adolescents continues to lag behind the goals set forth in Healthy People 2010. Despite these encouraging data, a vast number of new challenges that threaten continued success toward the goal of universal immunization coverage have emerged. These challenges include an increase in new vaccines and new vaccine combinations as well as a significant number of vaccines currently under development; a dramatic increase in the acquisition cost of vaccines, coupled with a lack of adequate payment to practitioners to buy and administer vaccines; unanticipated manufacturing and delivery problems that have caused significant shortages of various vaccine products; and the rise of a public antivaccination movement that uses the

  15. Examining the social determinants of children's developmental health: protocol for building a pan-Canadian population-based monitoring system for early childhood development

    PubMed Central

    Guhn, Martin; Janus, Magdalena; Enns, Jennifer; Brownell, Marni; Forer, Barry; Duku, Eric; Muhajarine, Nazeem; Raos, Rob


    Introduction Early childhood is a key period to establish policies and practices that optimise children's health and development, but Canada lacks nationally representative data on social indicators of children's well-being. To address this gap, the Early Development Instrument (EDI), a teacher-administered questionnaire completed for kindergarten-age children, has been implemented across most Canadian provinces over the past 10 years. The purpose of this protocol is to describe the Canadian Neighbourhoods and Early Child Development (CanNECD) Study, the aims of which are to create a pan-Canadian EDI database to monitor trends over time in children's developmental health and to advance research examining the social determinants of health. Methods and analysis Canada-wide EDI records from 2004 to 2014 (representing over 700 000 children) will be linked to Canada Census and Income Taxfiler data. Variables of socioeconomic status derived from these databases will be used to predict neighbourhood-level EDI vulnerability rates by conducting a series of regression analyses and latent variable models at provincial/territorial and national levels. Where data are available, we will measure the neighbourhood-level change in developmental vulnerability rates over time and model the socioeconomic factors associated with those trends. Ethics and dissemination Ethics approval for this study was granted by the Behavioural Research Ethics Board at the University of British Columbia. Study findings will be disseminated to key partners, including provincial and federal ministries, schools and school districts, collaborative community groups and the early childhood development research community. The database created as part of this longitudinal population-level monitoring system will allow researchers to associate practices, programmes and policies at school and community levels with trends in developmental health outcomes. The CanNECD Study will guide future early childhood

  16. Research on Immunotherapy: Using the Immune System to Treat Cancer


    ... cells that suppress immune responses. These advances in cancer immunotherapy are the result of long-term investments in ... Engineering Patients’ Immune Cells to Treat Their Cancers Cancer immunotherapy in children: How does it differ from approaches ...

  17. Influence of health providers on pediatrics' immunization rate.


    Al-lela, Omer Q B; Baidi Bahari, Mohd; Al-abbassi, Mustafa G; Salih, Muhannad R M; Basher, Amena Y


    To identify the immunization providers' characteristics associated with immunization rate in children younger than 2 years. A cohort and a cluster sampling design were implemented; 528 children between 18 and 70 months of age were sampled in five public health clinics in Mosul-Iraq. Providers' characterizations were obtained. Immunization rate for the children was assessed. Risk factors for partial immunization were explored using both bivariate analyses and multi-level logistic regression models. Less than half of the children had one or more than one missed dose, considered as partial immunization cases. The study found significant association of immunization rate with provider's type. Two factors were found that strongly impacted on immunization rate in the presence of other factors: birthplace and immunization providers' type.

  18. Immune System

    EPA Science Inventory

    A properly functioning immune system is essential to good health. It defends the body against infectious agents and in some cases tumor cells. Individuals with immune deficiencies resulting from genetic defects, diseases (e.g., AIDS, leukemia), or drug therapies are more suscepti...

  19. Angiogenesis and immunity: a bidirectional link potentially relevant for the monitoring of antiangiogenic therapy and the development of novel therapeutic combination with immunotherapy.


    Tartour, Eric; Pere, H; Maillere, B; Terme, M; Merillon, N; Taieb, J; Sandoval, F; Quintin-Colonna, F; Lacerda, K; Karadimou, A; Badoual, C; Tedgui, A; Fridman, W H; Oudard, S


    The immune system regulates angiogenesis in cancer with both pro- and antiangiogenic activities. The induction of angiogenesis is mediated by tumor-associated macrophages and myeloid-derived suppressor cells (MDSC) which produce proinflammatory cytokines, endothelial growth factors (VEGF, bFGF…), and protease (MMP9) implicated in neoangiogenesis. Some cytokines (IL-6, IL-17…) activated Stat3 which also led to the production of VEGF and bFGF. In contrast, other cytokines (IFN, IL-12, IL-21, and IL-27) display an antiangiogenic activity. Recently, it has been shown that some antiangiogenic molecules alleviates immunosuppression associated with cancer by decreasing immunosuppressive cells (MDSC, regulatory T cells), immunosuppressive cytokines (IL-10, TGFβ), and inhibitory molecules on T cells (PD-1). Some of these broad effects may result from the ability of some antiangiogenic molecules, especially cytokines to inhibit the Stat3 transcription factor. The association often observed between angiogenesis and immunosuppression may be related to hypoxia which induces both neoangiogenesis via activation of HIF-1 and VEGF and favors the intratumor recruitment and differentiation of regulatory T cells and MDSC. Preliminary studies suggest that modulation of immune markers (intratumoral MDSC and IL-8, peripheral regulatory T cells…) may predict clinical response to antiangiogenic therapy. In preclinical models, a synergy has been observed between antiangiogenic molecules and immunotherapy which may be explained by an improvement of immune status in tumor-bearing mice after antiangiogenic therapy. In preclinical models, antiangiogenic molecules promoted intratumor trafficking of effector cells, enhance endogenous anti-tumor response, and synergyzed with immunotherapy protocols to cure established murine tumors. All these results warrant the development of clinical trials combining antiangiogenic drugs and immunotherapy.

  20. Monitoring Cortical Excitability during Repetitive Transcranial Magnetic Stimulation in Children with ADHD: A Single-Blind, Sham-Controlled TMS-EEG Study

    PubMed Central

    Helfrich, Christian; Pierau, Simone S.; Freitag, Christine M.; Roeper, Jochen; Ziemann, Ulf; Bender, Stephan


    Background Repetitive transcranial magnetic stimulation (rTMS) allows non-invasive stimulation of the human brain. However, no suitable marker has yet been established to monitor the immediate rTMS effects on cortical areas in children. Objective TMS-evoked EEG potentials (TEPs) could present a well-suited marker for real-time monitoring. Monitoring is particularly important in children where only few data about rTMS effects and safety are currently available. Methods In a single-blind sham-controlled study, twenty-five school-aged children with ADHD received subthreshold 1 Hz-rTMS to the primary motor cortex. The TMS-evoked N100 was measured by 64-channel-EEG pre, during and post rTMS, and compared to sham stimulation as an intraindividual control condition. Results TMS-evoked N100 amplitude decreased during 1 Hz-rTMS and, at the group level, reached a stable plateau after approximately 500 pulses. N100 amplitude to supra-threshold single pulses post rTMS confirmed the amplitude reduction in comparison to the pre-rTMS level while sham stimulation had no influence. EEG source analysis indicated that the TMS-evoked N100 change reflected rTMS effects in the stimulated motor cortex. Amplitude changes in TMS-evoked N100 and MEPs (pre versus post 1 Hz-rTMS) correlated significantly, but this correlation was also found for pre versus post sham stimulation. Conclusion The TMS-evoked N100 represents a promising candidate marker to monitor rTMS effects on cortical excitability in children with ADHD. TMS-evoked N100 can be employed to monitor real-time effects of TMS for subthreshold intensities. Though TMS-evoked N100 was a more sensitive parameter for rTMS-specific changes than MEPs in our sample, further studies are necessary to demonstrate whether clinical rTMS effects can be predicted from rTMS-induced changes in TMS-evoked N100 amplitude and to clarify the relationship between rTMS-induced changes in TMS-evoked N100 and MEP amplitudes. The TMS-evoked N100 amplitude

  1. Immune memory to hepatitis B persists in children aged 7-8 years, who were vaccinated in infancy with 4 doses of hexavalent DTPa-HBV-IPV/Hib (Infanrix™ hexa) vaccine.


    Van Der Meeren, Olivier; Bleckmann, Gerhard; Crasta, Priya D


    Protection against hepatitis B disease relies on either protective serum antibodies or on the ability of the immune system to mount an anamnestic response when confronted with the hepatitis B virus (HBV). This open multicenter study (EUDRACT: 2010-022538-10) measured antibodies to HBV surface antigen (anti-HBs) in 7-8-year-old children who had received 4 doses of hexavalent diphtheria-tetanus-acellular pertussis-HBV-inactivated poliovirus-Hemophilus influenzae type b conjugate vaccine (DTPa-HBV-IPV/Hib: Infanrix™ hexa; GlaxoSmithKline Vaccines) in the first 2 years of life through routine vaccine services in Germany. The ability of these children to mount an anamnestic response to a challenge dose of monovalent HBV vaccine (Engerix™ B Kinder; GlaxoSmithKline Vaccines) was also assessed. Before the challenge dose, 78.5% of children had anti-HBs levels ≥6.2 mIU/mL (seropositive) and 72.2% had anti-HBs levels ≥10 mIU/mL (seroprotected). Post-challenge, 98.9% had anti-HBs levels ≥10 mIU/mL and 95.8% had anti-HBs ≥100 mIU/mL. An anamnestic response to the challenge was observed in 96.6% of all subjects. The challenge dose was well tolerated, with a reactogenicity and safety profile consistent with published data. DTPa-HBV-IPV/Hib induces long-lasting immune memory to HBV that appears very similar to that induced by monovalent HBV vaccines. Protection against hepatitis B may be conferred through immune memory in subjects who responded to primary vaccination, even when they subsequently lose detectable levels of circulating anti-HBs antibodies.

  2. Monitoring Children with Reading Disabilities' Response to Phonics Intervention: Are There Differences between Intervention Aligned and General Skill Progress Monitoring Assessments?

    ERIC Educational Resources Information Center

    Olinghouse, Natalie G.; Lambert, Warren; Compton, Donald L.


    This study investigated whether 2 different progress monitoring assessments differentially predicted growth in reading skills associated with systematic phonics instruction. Oral reading fluency (ORE) was compared with an intervention aligned word list (IAWL) as predictors of growth in untimed and timed decoding and word identification and text…

  3. Introduction of sequential inactivated polio vaccine-oral polio vaccine schedule for routine infant immunization in Brazil's National Immunization Program.


    Domingues, Carla Magda Allan S; de Fátima Pereira, Sirlene; Cunha Marreiros, Ana Carolina; Menezes, Nair; Flannery, Brendan


    In August 2012, the Brazilian Ministry of Health introduced inactivated polio vaccine (IPV) as part of sequential polio vaccination schedule for all infants beginning their primary vaccination series. The revised childhood immunization schedule included 2 doses of IPV at 2 and 4 months of age followed by 2 doses of oral polio vaccine (OPV) at 6 and 15 months of age. One annual national polio immunization day was maintained to provide OPV to all children aged 6 to 59 months. The decision to introduce IPV was based on preventing rare cases of vaccine-associated paralytic polio, financially sustaining IPV introduction, ensuring equitable access to IPV, and preparing for future OPV cessation following global eradication. Introducing IPV during a national multivaccination campaign led to rapid uptake, despite challenges with local vaccine supply due to high wastage rates. Continuous monitoring is required to achieve high coverage with the sequential polio vaccine schedule.

  4. Maladaptive Conflict Monitoring as Evidence for Executive Dysfunction in Children with Chromosome 22q11.2 Deletion Syndrome

    ERIC Educational Resources Information Center

    Bish, Joel P.; Ferrante, Samantha M.; McDonald-McGinn, Donna; Zackai, Elaine; Simon, Tony J.


    Using an adaptation of the Attentional Networks Test, we investigated aspects of executive control in children with chromosome 22q11.2 deletion syndrome (DS22q11.2), a common but not well understood disorder that produces non-verbal cognitive deficits and a marked incidence of psychopathology. The data revealed that children with DS22q11.2…

  5. [Setting-up an epidemiological monitoring system of mortality by trauma in children under 15 years of age in metropolitan France].


    Lasbeur, L; Thélot, B


    In metropolitan France in 2009, trauma was the leading cause of death among children under 15 years of age: 459 deaths (source CépiDc), with 236 deaths by home and leisure injuries (HLI). These rough mortality data do not describe the circumstances of the trauma responsible for the death. The "Fatal home and leisure injury among children under 15 years old-MAC-15" feasibility study was set up in 2009 in France in the following regions: Île-de-France, Nord-Pas-de-Calais, and Provence-Alpes-Côte d'Azur. The main objective of the survey was to understand exactly how these accidents occurred and determine their risk factors. Its secondary objectives were to test the feasibility and analyze the possibility of extending and/or scaling up the monitoring of these deaths. Case reporting was made through death certificates, contacts with regional health agencies, and media surveillance. A detailed record was completed by the medical certifier. In 2009, 76 HLI-related deaths in under 15-year-old children were identified by the survey in the three regions. The victims were mostly boys. The most common cause of death was drowning, followed by suffocation, falls, and fires. The survey contributed to precisely determining the risk factors of HLIs in children and, most often, to identifying the cause responsible for the fatal accident. The feasibility conclusions of this survey are positive, data collection is effective and practicable, and its quality and exhaustiveness were demonstrated. Implementation of the "detailed analyses of the deaths by trauma among children under 15 years old" survey is proposed. This survey will be extended to all deaths by trauma among children in Metropolitan France.

  6. Innate immunity.


    Revillard, Jean-Pierre


    For more than half a century immunological research has been almost exclusively orientated towards the acquired immune response and the mechanisms of immune tolerance. Major discoveries have enabled us to better understand the functioning of the specific immune system: the structure of antibody molecules, the genetic mechanisms leading to the molecular diversity of B (BCR) and T (TCR) lymphocyte antigen receptors, the biological function of major histocompatibility complex (MHC) molecules in the presentation of peptides to alpha/beta receptor bearing T lymphocytes, the processes of positive and negative selection of lymphocytes during the course of their differentiation. The major role of specific or acquired immunity has been shown by the rapidly lethal character of severe combined immune deficiency diseases and various alterations in the mechanisms of tolerance have been proposed to explain the chronic inflammatory illnesses which are considered to be auto-immune. Natural or innate immunity has been known since the first description of an inflammatory reaction attributed to Cornelius Celsus. It entered into the scientific era at the end of the 19th century with the discovery of phagocytes by Metchnikoff and of the properties of the complement system by Bordet [1] but due to the vastness of the field and its lack of clear definition, it failed to excite the interest of researchers. The discovery of cytokines and progress in knowledge of the mechanisms of the inflammatory reaction have certainly helped to banish preconceived ideas about natural immunity, which was wrongly labelled as non-specific. This has led to the proposition of a wider role for immune functions beyond the level of the cell or the organism [2] and to a better understanding of the importance of the immediate defence mechanisms and their role in the later orientation of the acquired response.

  7. Monitoring the safety of a smallpox vaccination program in the United States: report of the joint Smallpox Vaccine Safety Working Group of the advisory committee on immunization practices and the Armed Forces Epidemiological Board.


    Neff, John; Modlin, John; Birkhead, Guthrie S; Poland, Gregory; Robertson, Rose Marie; Sepkowitz, Kent; Yancy, Clyde; Gardner, Pierce; Gray, Gregory C; Maurer, Toby; Siegel, Jane; Guerra, Fernando A; Berger, Tim; Flanders, W Dana; Shope, Robert


    In December 2002, the Centers for Disease Control and Prevention's Advisory Committee on Immunization Practices and the Department of Defense Armed Forces Epidemiological Board formed a joint Smallpox Vaccine Safety Working Group (SVS WG) to provide independent safety oversight for smallpox vaccination safety-monitoring systems. From January 2003 through June 2004, the SVS WG reviewed individual and aggregate safety data on postvaccination adverse events. Serious adverse events were rare because of careful education, prevaccination screening, and strict attention to vaccination-site management. Recent vaccinees safely cared for high-risk patients, adhering to recommended site care. Human immunodeficiency virus-infected individuals without severe immunosuppression had uncomplicated vaccination reactions. Epidemiological studies supported a causal relationship between myocarditis and/or pericarditis and smallpox vaccination. Data supported neutrality regarding hypothesized causal associations between vaccination and dilated cardiomyopathy or ischemic cardiac disease. The SVS WG concurs with recommendations to defer from vaccination any person with >/=3 ischemic cardiac disease risk factors.

  8. Maternal Immunization

    PubMed Central

    Chu, Helen Y.; Englund, Janet A.


    Maternal immunization has the potential to protect the pregnant woman, fetus, and infant from vaccine-preventable diseases. Maternal immunoglobulin G is actively transported across the placenta, providing passive immunity to the neonate and infant prior to the infant's ability to respond to vaccines. Currently inactivated influenza, tetanus toxoid, and acellular pertussis vaccines are recommended during pregnancy. Several other vaccines have been studied in pregnancy and found to be safe and immunogenic and to provide antibody to infants. These include pneumococcus, group B Streptococcus, Haemophilus influenzae type b, and meningococcus vaccines. Other vaccines in development for potential maternal immunization include respiratory syncytial virus, herpes simplex virus, and cytomegalovirus vaccines. PMID:24799324

  9. Brief Report: The Prevalence of Neurofibromatosis Type 1 among Children with Autism Spectrum Disorder Identified by the Autism and Developmental Disabilities Monitoring Network.


    Bilder, Deborah A; Bakian, Amanda V; Stevenson, David A; Carbone, Paul S; Cunniff, Christopher; Goodman, Alyson B; McMahon, William M; Fisher, Nicole P; Viskochil, David


    Neurofibromatosis type 1 (NF1) is an inherited neurocutaneous disorder associated with neurodevelopmental disorders including autism spectrum disorder (ASD). The frequency of ASD/NF1 co-occurrence has been subject to debate since the 1980s. This relationship was investigated in a large population-based sample of 8-year-old children identified with ASD (N = 12,271) by the Centers for Disease Control and Prevention's Autism and Developmental Disabilities Monitoring (ADDM) Network. Twenty-two (1-in-558) children with ASD had diagnosed NF1, exceeding NF1 general population estimates by four to five fold. Children with ASD/NF1 versus ASD without NF1 were significantly less likely to receive a community-based ASD diagnosis (p = 0.04) and understand non-verbal communication (p = 0.001). These findings underscore the importance of including social-communication ability among relevant developmental concerns in children with NF1.

  10. Direct measurement of peptide-specific CD8+ T cells using HLA-A2:Ig dimer for monitoring the in vivo immune response to a HER2/neu vaccine in breast and prostate cancer patients.


    Woll, Michael M; Fisher, Christine M; Ryan, Gayle B; Gurney, Jennifer M; Storrer, Catherine E; Ioannides, Constantin G; Shriver, Craig D; Moul, Judd W; McLeod, David G; Ponniah, Sathibalan; Peoples, George E


    HER2/neu is a proto-oncogene and a member of the epidermal growth factor receptor family of proteins that is overexpressed in numerous types of human cancer. We are currently conducting clinical trials with the HER2/neu E75 peptide vaccine in breast and prostate cancer patients. We have evaluated the use of HLA-A2 dimer molecule for the immunological monitoring of cancer patients receiving the E75 peptide vaccine. Peripheral blood samples from patients receiving the vaccine were stained with HLA-A2 dimers containing the vaccine peptide E75 or control peptides and analyzed by flow cytometry. We compared the HLA-A2 dimer assay to standard methods of immunologic monitoring (IFN-gamma release, lymphocyte proliferation, and cytotoxicity). The HLA-A2 dimer assay was also compared with the HLA-A2 tetramer assay. E75 peptide-specific CD8 T cells were detected directly in the peripheral blood of patients by staining with E75-HLA-A2 dimers and CD8 antibodies. T cell cultures generated by repeated stimulations using E75 peptide-pulsed dendritic cells showed increased staining with E75-peptide loaded HLA-A2 dimers. Simultaneously analysis by the dimer assay and standard immunologic assays demonstrated that the dimer-staining assay correlated well with these methods of immunologic monitoring. A direct comparison using E75-specific HLA-A2 tetramers and HLA-A2 dimers for the detection of E75-specific CD8 T cells in peripheral blood showed comparable results with the two assays. Our findings indicate that the HLA-A2 dimer is a powerful new tool for directly quantifying and monitoring immune responses of antigen-specific T cells in peptide vaccine clinical trials.

  11. Evidence for extended age dependent maternal immunity in infected children: mother to child transmission of HIV infection and potential interventions including sulfatides of the human fetal adnexa and complementary or alternative medicines.


    Bhargav, Hemant; Huilgol, Vidya; Metri, Kashinath; Sundell, I Birgitta; Tripathi, Satyam; Ramagouda, Nagaratna; Jadhav, Mahesh; Raghuram, Nagarathna; Ramarao, Nagendra Hongasandra; Koka, Prasad S


    -ART children, a significant correlation was observed between the age of the child and CD4 counts (measured separately in the months of June 2011 and December 2011). Both the CD4 counts measured in June 2011 (n=6; r=-0.82, p= 0.04) as well as in December 2011 (n=6; r=-0.97, p=0.001) showed a significant decline as the age progressed. Also, at the same center, among on-ART children, the CD4 counts in June 2011 (n=7) and December 2011 (n=8) were significantly different between the children in the age group of 8 below years, and those in the age group of 14 years and above (p= 0.005). As HIV infected children grow in age, they may lose maternal derived immunity as shown by the decrease in CD4 counts, irrespective of their ART status. It is to be expected from these results that the conferred maternal immunity (possibly primarily humoral and secondarily cytotoxic immune responses) to the virus acquired at child birth taper off and eventually overcome by the generation of mutant HIV strains in the children, as the life spans of the infected children progress. We have discussed safer therapeutic interventions whose efficacy on HIV/AIDS may be synergistic to or even substitute the existing treatment strategies. Some of such interventions may even be customized to help eliminate MTCT. Further, these virus infected pregnant mother patient blood / serum samples could prove useful in the vaccine development against HIV infection.

  12. Immune response

    MedlinePlus Videos and Cool Tools

    The immune system includes specialized white blood cells, called lymphocytes that adapt themselves to fight specific foreign invaders. These cells develop into two groups in the bone marrow. From the bone ...

  13. Progress in immunization information systems - United States, 2010.



    Immunization information systems (IIS) are confidential, computerized, population-based systems that collect and consolidate vaccination data from vaccination providers and provide important tools for designing and sustaining effective immunization strategies at the provider and immunization program levels. These tools include clinical decision support, vaccination coverage reports, interoperability with electronic health record systems, vaccine inventory management, and the ability to generate reminder and recall messages. In 2010, based on strong evidence of effectiveness, the Task Force on Community Preventive Services recommended IIS use as a means of increasing vaccination rates. A Healthy People 2020 target (IID-18) is to increase to 95% the proportion of children aged <6 years whose immunization records are in fully operational, population-based IIS. To monitor progress toward program goals, CDC annually surveys 56 immunization program grantees (50 states, five cities, and the District of Columbia) using the IIS Annual Report (IISAR). Results from the 2010 IISAR (completed by 54 grantees) indicate that 82% (18.8 million) of U.S. children aged <6 years participated in IIS, as defined by having at least two recorded vaccinations, an increase from 78% (18.0 million) in 2009. Among 52 grantees who responded to questions about the Vaccine Tracking System (VTrckS), CDC's new national vaccine ordering and inventory management system for publicly purchased vaccine, 38 (73%) indicated their intention to use the IIS in their state or city to interface with VTrckS. Use of IIS to interface with VTrckS might provide additional incentive for vaccination providers to participate in IIS and enhance IIS utility by supporting efficient and effective methods for providers to order vaccine and track inventory and by promoting greater accountability of publicly purchased vaccine.

  14. Progress in immunization information systems - United States, 2012.



    Immunization information systems (IIS) are confidential, computerized, population-based systems that collect and consolidate vaccination data from vaccination providers that can be used in designing and sustaining effective immunization strategies. To monitor progress toward achieving IIS program goals, CDC annually surveys immunization program grantees using the IIS Annual Report (IISAR). Results from the 2012 IISAR, completed by 54 of 56 grantees, indicate that 86% (19.5 million) of U.S. children aged <6 years, and 25% (57.8 million) of U.S. adults participated in IIS. Eight of 12 minimum functional standards for IIS published by the National Vaccine Advisory Committee (NVAC) have been met by ≥90% of grantees. During 2011-2012, progress was also made in meeting three additional functional standards, including the presence of core data element fields, timeliness of vaccine records, and Health Level 7 (HL7) messaging, and will be monitored in new functional standards for IIS published in 2013. Several new and ongoing initiatives, including interoperability between IIS and electronic health records (i.e., ensuring systems can work together and exchange information), the use of IIS to support vaccine ordering and inventory management, the use of two-dimensional barcodes to record vaccination information, and collaboration with pharmacies, federal agencies, and other adult vaccination providers, will support further progress in meeting functional standards and enhance reporting of adult vaccinations to IIS.

  15. Immune Responses to Circulating and Vaccine Viral Strains in HIV-Infected and Uninfected Children and Youth Who Received the 2013/2014 Quadrivalent Live-Attenuated Influenza Vaccine

    PubMed Central

    Weinberg, Adriana; Curtis, Donna; Ning, Mariangeli Freitas; Claypool, David Jeremy; Jalbert, Emilie; Patterson, Julie; Frank, Daniel N.; Ir, Diana; Armon, Carl


    The live-attenuated influenza vaccine (LAIV) has generally been more efficacious than the inactivated vaccine in children. However, LAIV is not recommended for HIV-infected children because of insufficient data. We compared cellular, humoral, and mucosal immune responses to the 2013–2014 LAIV quadrivalent (LAIV4) in HIV-infected and uninfected children 2–25 years of age (yoa). We analyzed the responses to the vaccine H1N1 (H1N1-09), to the circulating H1N1 (H1N1-14), which had significant mutations compared to H1N1-09 and to B Yamagata (BY), which had the highest effectiveness in 2013–2014. Forty-six HIV-infected and 56 uninfected participants with prior influenza immunization had blood and nasal swabs collected before and after LAIV4 for IFNγ T and IgG/IgA memory B-cell responses (ELISPOT), plasma antibodies [hemagglutination inhibition (HAI) and microneutralization (MN)], and mucosal IgA (ELISA). The HIV-infected participants had median CD4+ T cells = 645 cells/μL and plasma HIV RNA = 20 copies/mL. Eighty-four percent were on combination anti-retroviral therapy. Regardless of HIV status, significant increases in T-cell responses were observed against BY, but not against H1N1-09. H1N1-09 T-cell immunity was higher than H1N1-14 both before and after vaccination. LAIV4 significantly increased memory IgG B-cell immunity against H1N1-14 and BY in uninfected, but not in HIV-infected participants. Regardless of HIV status, H1N1-09 memory IgG B-cell immunity was higher than H1N1-14 and lower than BY. There were significant HAI titer increases after vaccination in all groups and against all viruses. However, H1N1-14 MN titers were significantly lower than H1N1-09 before and after vaccination overall and in HIV-uninfected vaccinees. Regardless of HIV status, LAIV4 increased nasal IgA concentrations against all viruses. The fold-increase in H1N1-09 IgA was lower than BY. Overall, participants <9 yoa had decreased BY-specific HAI and nasal IgA responses

  16. We Must Immunize Every Child by Two.

    ERIC Educational Resources Information Center

    Carter, Rosalynn; Bumpers, Betty F.


    Discusses the development and initial implementation of the "Every Child by Two" project. The project is designed to immunize as many newborn through two-year-old children in the United States as possible against communicable childhood diseases, such as measles, and to create a program to systematically immunize this age group in the…

  17. Vitamin A and immune function

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Vitamin A deficiency increases the risk of death from infectious diseases in infants and young children in areas of the world where vitamin A deficiency is common. This increased risk apparently results from impaired innate and adaptive immune function. Retinoic acid is the major metabolite of vit...

  18. Spatial sequence memory and spatial error monitoring in the Groton Maze Learning Task (GMLT): A validation study of GMLT sub-measures in healthy children.


    Thomas, Elizabeth; Maruff, Paul; Paul, Jacob; Reeve, Robert


    The stepping-stone variant of the hidden pathway maze learning (HPML) task paradigm has been extensively used to investigate cognitive functions in neuropsychology and neuropharmacology. Previous studies have used total error across trials, as well as rule-break errors and learning errors, to define spatial memory and/or executive function in healthy and impaired adults and children. However, the construct validity of performance measures on HPML tasks has not been established in healthy children. To assess the construct validity of measures of exploratory and rule-break errors on the Groton Maze Learning Task (GMLT) measures of spatial sequence memory (Corsi Blocks Task) and spatial error monitoring (Continuous Paired Associate Learning; CPAL) were used. The results indicate that Corsi span predicted GMLT spatial sequence memory and CPAL accuracy predicted GMLT spatial error monitoring. The construct validity of the GMLT as a measure of spatial memory and executive function are discussed with regard to prior research using HPML tasks in neuropsychological contexts.

  19. The effects of self-monitoring on the procedural integrity of a behavioral intervention for young children with developmental disabilities.


    Plavnick, Joshua B; Ferreri, Summer J; Maupin, Angela N


    The effects of self-monitoring on the procedural integrity of token economy implementation by 3 staff in a special education classroom were evaluated. The subsequent changes in academic readiness behaviors of 2 students with low-incidence disabilities were measured. Multiple baselines across staff and students showed that procedural integrity increased when staff used monitoring checklists, and students' academic readiness behavior also increased. Results are discussed with respect to the use of self-monitoring and the importance of procedural integrity in public school settings.

  20. Monitoring Local Comprehension Monitoring in Sentence Reading

    ERIC Educational Resources Information Center

    Vorstius, Christian; Radach, Ralph; Mayer, Michael B.; Lonigan, Christopher J.


    on ways to improve children's reading comprehension. However, processes and mechanisms underlying this skill are currently not well understood. This article describes one of the first attempts to study comprehension monitoring using eye-tracking methodology. Students in fifth…

  1. Monitoring Antiretroviral Therapy in HIV-Infected Children in Resource-Limited Countries: A Tale of Two Epidemics

    PubMed Central

    Paintsil, Elijah


    Twenty-nine years into the HIV epidemic, several advances have been made; however, there remain several challenges particularly with pediatric HIV in resource-limited countries. The obstacles facing pediatric antiretroviral therapy (ART) delivery in resource-limited countries are multifaceted: lack of health care infrastructure, limited availability of pediatric drug formulations, lack of early HIV diagnostic and monitoring techniques, limited manpower with expertise in pediatric HIV care, limited donor funding, and competing public health priorities with limited health care budget. In this paper, the challenges with various ART monitoring tools in resource-limited countries are discussed. Noninvasive (e.g., patient, clinical events outcome, and adherence) and invasive (e.g., immunologic and virologic) monitoring tools are discussed. Several cheap and technically less complex laboratory tests for monitoring are becoming available. Funding agencies and country programs should invest in validating the use of current technologies to optimize pediatric HIV care in resource-limited countries. PMID:21490777

  2. A Phase 3, Randomized, Double‐Blind, Placebo‐Controlled Study to Determine the Effect of Romiplostim on Health‐Related Quality of Life in Children with Primary Immune Thrombocytopenia and Associated Burden in Their Parents

    PubMed Central

    Li, Xiaoyan; Eisen, Melissa; Carpenter, Nancy; Crosby, Ross D.; Blanchette, Victor S.


    Background Chronic immune thrombocytopenia (ITP) in children can negatively impact their health‐related quality of life (HRQoL) and impose a burden on their parents. This study sought to examine the effect of romiplostim on HRQoL and parental burden in children with primary ITP. Procedure This was a phase 3, randomized, double‐blind, placebo‐controlled study. Children aged <18 years with ITP ≥6 months were randomly assigned to receive romiplostim or placebo for 24 weeks. The Kids’ ITP Tool (KIT) was used to measure HRQoL and was administered to patients and/or their parents at baseline and weeks 8, 16, and 25. Mean KIT scores at each assessment and mean changes in KIT scores from baseline were calculated overall by treatment group and platelet response status. Psychometric properties of the KIT were evaluated and the minimally important difference (MID) was estimated for different KIT versions. Results Sixty‐two patients (42 romiplostim and 20 placebo) were enrolled. Changes in KIT scores by treatment group showed numerically greater and more often statistically significant improvements from baseline to each assessment for children receiving romiplostim versus placebo. Mixed‐effects analysis demonstrated statistically significantly greater reduction in parental burden from baseline in the romiplostim group versus placebo. Ranges for the MID were estimated as 9–13 points for the Child Self‐Report version and 11–13 points for the Parent Impact version. Conclusions The treatment with romiplostim may be associated with improved HRQoL in children with primary ITP and reduced burden to their parents. PMID:27037553

  3. Evaluation of the estimated continuous cardiac output monitoring system in adults and children undergoing kidney transplant surgery: a pilot study.


    Terada, Takashi; Maemura, Yumi; Yoshida, Akiko; Muto, Rika; Ochiai, Ryoichi


    Evaluation of the estimated continuous cardiac output (esCCO) allows non-invasive and continuous assessment of cardiac output. However, the applicability of this approach in children has not been assessed thus far. We compared the correlation coefficient, bias, standard deviation (SD), and the lower and upper 95 % limits of agreement for esCCO and dye densitography-cardiac output (DDG-CO) measurements by pulse dye densitometry (PDD) in adults and children. On the basis of these assessments, we aimed to examine whether esCCO can be used in pediatric patients. DDG-CO was measured by pulse dye densitometry (PDD) using indocyanine green. Modified-pulse wave transit time, obtained using pulse oximetry and electrocardiography, was used to measure esCCO. Correlations between DDG-CO and esCCO in adults and children were analyzed using regression analysis with the least squares method. Differences between the two correlation coefficients were statistically analyzed using a correlation coefficient test. Bland-Altman plots were used to evaluate bias and SD for DDG-CO and esCCO in both adults and children, and 95 % limits of agreement (bias ± 1.96 SD) and percentage error (1.96 SD/mean DDG-CO) were calculated and compared. The average age of the adult patients (n = 10) was 39.3 ± 12.1 years, while the average age of the pediatric patients (n = 7) was 9.4 ± 3.1 years (p < 0.001). For adults, the correlation coefficient was 0.756; bias, -0.258 L/min; SD, 1.583 L/min; lower and upper 95 % limits of agreement for DDG-CO and esCCO, -3.360 and 2.844 L/min, respectively; and percentage error, 42.7 %. For children, the corresponding values were 0.904; -0.270; 0.908; -2.051 and 1.510 L/min, respectively; and 35.7 %. Due to the high percentage error values, we could not establish a correlation between esCCO and DDG-CO. However, the 95 % limits of agreement and percentage error were better in children than in adults. Due to the high percentage error, we could not confirm a correlation

  4. [Measurement of the in vitro immune response of live attenuated measles virus vaccine and antibody levels in 0 to 10-year-old children].


    Unalan, H; Ustaçelebi, S


    The present study was carried out in order to test the antigenic effectiveness of the live attenuated meales vaccine which is routinly employed in our country. Sera obtained from 11 children before and after measles vaccination were tested for measles antibodies by complement fixation and neutralization tests. Sera samples were also collected from 0-10 years old children with history of vaccination, passed measles infection and none at all. These sera were also tested for measles antibody by complement fixation test. Virus isolation and seroconversion studies in children who were admitted to the outpatient clinics of Hacettepe hospital is also presented in this communication.

  5. Use of MenACWY-CRM vaccine in children aged 2 through 23 months at increased risk for meningococcal disease: recommendations of the Advisory Committee on Immunization Practices, 2013.


    MacNeil, Jessica R; Rubin, Lorry; McNamara, Lucy; Briere, Elizabeth C; Clark, Thomas A; Cohn, Amanda C


    During its October 2013 meeting, the Advisory Committee on Immunization Practices (ACIP) recommended use of a third meningococcal conjugate vaccine, MenACWY-CRM (Menveo, Novartis), as an additional option for vaccinating infants aged 2 through 23 months at increased risk for meningococcal disease. MenACWY-CRM is the first quadrivalent meningococcal conjugate vaccine licensed for use in children aged 2 through 8 months. MenACWY-D (Menactra, Sanofi Pasteur) is recommended for use in children aged 9 through 23 months who are at increased risk for meningococcal disease, and Hib-MenCY-TT (MenHibrix, GlaxoSmithKline) is recommended for use in children aged 6 weeks through 18 months at increased risk. This report summarizes information on MenACWY-CRM administration in infants and provides recommendations for vaccine use in infants aged 2 through 23 months who are at increased risk for meningococcal disease. Because the burden of meningococcal disease in infants is low in the United States and the majority of cases that do occur are caused by serogroup B, which is not included in any vaccine licensed in the United States, only those infants who are at increased risk for meningococcal disease are recommended to receive a meningococcal vaccine.

  6. Plant Immunity

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Plants are faced with defending themselves against a multitude of pathogens, including bacteria, fungi, viruses, nematodes, etc. Immunity is multi-layered and complex. Plants can induce defenses when they recognize small peptides, proteins or double-stranded RNA associated with pathogens. Recognitio...

  7. Motivational Incentives and Methylphenidate Enhance Electrophysiological Correlates of Error Monitoring in Children with Attention Deficit/Hyperactivity Disorder

    ERIC Educational Resources Information Center

    Groom, Madeleine J.; Liddle, Elizabeth B.; Scerif, Gaia; Liddle, Peter F.; Batty, Martin J.; Liotti, Mario; Hollis, Chris P.


    Background: Children with attention deficit hyperactivity disorder (ADHD) are characterised by developmentally inappropriate levels of hyperactivity, impulsivity and/or inattention and are particularly impaired when performing tasks that require a high level of cognitive control. Methylphenidate (MPH) and motivational incentives may help improve…

  8. Monitoring air pollution effects on children for supporting public health policy: the protocol of the prospective cohort MAPEC study

    PubMed Central

    Feretti, D; Ceretti, E; De Donno, A; Moretti, M; Carducci, A; Bonetta, S; Marrese, M R; Bonetti, A; Covolo, L; Bagordo, F; Villarini, M; Verani, M; Schilirò, T; Limina, R M; Grassi, T; Monarca, S; Casini, B; Carraro, E; Zani, C; Mazzoleni, G; Levaggi, R; Gelatti, U


    Introduction Genotoxic biomarkers have been studied largely in adult population, but few studies so far have investigated them in children exposed to air pollution. Children are a high-risk group as regards the health effects of air pollution and some studies suggest that early exposure during childhood can play an important role in the development of chronic diseases in adulthood. The objective of the project is to evaluate the associations between the concentration of urban air pollutants and biomarkers of early biological effect in children, and to propose a model for estimating the global risk of early biological effects due to air pollutants and other factors in children. Methods and analysis Two biomarkers of early biological effects, DNA damage by the comet assay and the micronuclei (MN) test, will be investigated in oral mucosa cells of 6–8-year-old children. Concurrently, some toxic airborne pollutants (polycyclic aromatic hydrocarbon (PAH) and nitro-PAH) and in vitro air mutagenicity and toxicity in ultra-fine air particulates (PM0.5) will be evaluated. Furthermore, demographic and socioeconomic variables, other sources of exposures to air pollutants and lifestyle variables will be assessed by a structured questionnaire. The associations between sociodemographic, environmental and other exposure variables and biomarkers of early biological effect using univariate and multivariate models will be analysed. A tentative model for calculating the global absolute risk of having early biological effects caused by air pollution and other variables will be proposed. Ethics and dissemination The project has been approved by the Ethics Committees of the local Health Authorities. The results will be communicated to local Public Health Agencies, for supporting educational programmes and health policy strategies. LIFE+2012 Environment Policy and Governance. LIFE12 ENV/IT/000614. PMID:25227631

  9. The Cost Effectiveness of Hepatitis Immunization for US College Students

    ERIC Educational Resources Information Center

    Jacobs, R. Jake; Saab, Sammy; Meyerhoff, Allen S.


    Hepatitis B immunization is recommended for all American children, and hepatitis A immunization is recommended for children who live in areas with elevated disease rates. Because hepatitis A and B occur most commonly in young adults, the authors examined the cost effectiveness of college-based vaccination. They developed epidemiologic models to…

  10. Federal immunity Law in Higher Education.

    ERIC Educational Resources Information Center

    Johnsen, Christopher; Todd, James C.


    Monitors and analyzes developments in immunity law in 1998 applicable to higher education. The review suggests that the extent of a plaintiff's constitutional rights and the scope of a public official's qualified immunity depend to a not insignificant degree on which circuit, or even which panel, decides the case. (SLD)

  11. Standard of Care for Neuropsychological Monitoring in Pediatric Neuro-Oncology: Lessons From the Children's Oncology Group (COG).


    Walsh, Karin S; Noll, Robert B; Annett, Robert D; Patel, Sunita K; Patenaude, Andrea F; Embry, Leanne


    As the mortality of pediatric cancers has decreased, focus on neuropsychological morbidities of treatment sequelae have increased. Neuropsychological evaluations are essential diagnostic tools that assess cognitive functioning and neurobiological integrity. These tests provide vital information to support ongoing medical care, documenting cognitive morbidity and response to interventions. We frame standards for neuropsychological monitoring of pediatric patients with CNS malignancy or who received cancer-directed therapies involving the CNS and discuss billing for these services in the United States in the context of clinical research. We describe a cost-effective, efficient model of neuropsychological <