Science.gov

Sample records for children immunization monitoring

  1. Immunization Schedules for Infants and Children

    MedlinePlus

    ... ACIP Vaccination Recommendations Why Immunize? Vaccines: The Basics Immunization Schedules for Infants and Children Recommend on Facebook ... any questions. View or Print a Schedule Recommended Immunizations for Children (Birth through 6 years) Schedule for ...

  2. Child Indicators: Immunization of Young Children.

    ERIC Educational Resources Information Center

    Lewit, Eugene M.; Mullahy, John

    1994-01-01

    Focuses on the immunization status of children aged 19 to 35 months. Recommended immunizations are described and contrasted with the actual status of immunization. In response to unacceptably low levels of immunization among very young children, the government is aiming at 90% immunization by the year 2000. (SLD)

  3. Children's Rights: Monitoring Issues.

    ERIC Educational Resources Information Center

    Verhellen, Eugeen, Ed.; Spiesschaert, Frans, Ed.

    A number of research seminars were organized to clarify the fundamental principles underlying local, regional, and international efforts to establish a structure for monitoring and promoting children's rights. This book contains papers presented at these seminars by experts on child advocacy, promotion of children's interests by children, and…

  4. Editorial: Immune monitoring in solid organ transplantation.

    PubMed

    Shipkova, Maria; Wieland, Eberhard

    2016-03-01

    Solid organ transplantation is inevitably associated with the activation of the immune system of the graft recipient. An advanced knowledge of the immunological mechanisms leading to acute and chronic rejection, the advent of powerful immunosuppressive drugs, and refined surgical techniques have made solid organ transplantation a standard therapy to replace irretrievable loss of vital functions. The immune system is a complex network involving immune cells, cytokines, chemokines, antibodies, and the complement system. Monitoring and ideally influencing the allo-response of the organ recipient against the donor antigens may help to personalize the immunosuppressive therapy including the disclosure of those patients who are suitable for weaning or even discontinuation of immunosuppression. Immune monitoring comprises as plethora of candidate biomarkers capable of reflecting the donor specific and non-donor specific net activation state of the immune system in transplant recipients both before and after initiation of the immunosuppressive therapy. This special issue of Clinical Biochemistry on Immune Monitoring addresses the basic effects of immune activation in solid organ transplantation and critically reviews candidate biomarkers for immune monitoring and their analytical as well as clinical performance.

  5. Monitoring childhood immunizations: a Canadian approach.

    PubMed Central

    Roberts, J D; Poffenroth, L A; Roos, L L; Bebchuk, J D; Carter, A O

    1994-01-01

    In Manitoba, Canada, a centralized, computerized childhood immunization monitoring system serves a population with insured medical coverage; each individual has a unique identification number. All physicians bill a single payer, and specific billing codes are used to identify immunizations given by physicians and by public health nurses. Together with dates of service, this information is used to construct immunizations-to-date and age-at-immunization profiles for individuals and groups. Reminders seeking missing information are built into the system and executed at strategic ages. The quality of input data has been assessed as high. The approach could be used readily by health maintenance organizations in the United States. PMID:7943493

  6. Immune deficiencies in children: an overview.

    PubMed

    Jyothi, S; Lissauer, S; Welch, S; Hackett, S

    2013-12-01

    Primary immune deficiencies (PIDs) are disorders of the immune system that result in increased susceptibility to infectious disease, autoimmunity and malignancy. They are challenging to paediatricians as they can present anytime from birth to adolescence with a wide variety of signs and symptoms. It is important to diagnose PIDs promptly, especially more severe forms to prevent significant morbidity and mortality. However, significant challenges exist in deciding which children to investigate and when. We aim to give a basic understanding of the human immune system, the different presentations in a child that should alert a paediatrician about the possibility of PID and the possible underlying diagnosis. Additionally, we have developed a framework for a stepwise approach to investigating these children.

  7. Immune deficiencies in children: an overview.

    PubMed

    Jyothi, S; Lissauer, S; Welch, S; Hackett, S

    2013-10-01

    Primary immune deficiencies (PIDs) are disorders of the immune system that result in increased susceptibility to infectious disease, autoimmunity and malignancy. They are challenging to paediatricians as they can present anytime from birth to adolescence with a wide variety of signs and symptoms. It is important to diagnose PIDs promptly, especially more severe forms to prevent significant morbidity and mortality. However, significant challenges exist in deciding which children to investigate and when. We aim to give a basic understanding of the human immune system, the different presentations in a child that should alert a paediatrician about the possibility of PID and the possible underlying diagnosis. Additionally, we have developed a framework for a stepwise approach to investigating these children.

  8. Improving the monitoring of immunization services in Kyrgyzstan.

    PubMed

    Weeks, R M; Svetlana, F; Noorgoul, S; Valentina, G

    2000-09-01

    Following the disbanding of the Soviet Union in 1991, the government of Kyrgyzstan was unable to maintain the previous level of health services. To revitalize the health services, the Ministry of Health (MOH) first focused on improving their immunization services, including the immunization component of the Health Management Information System (HMIS). Secondly, to increase immunization coverage, the MOH set as a priority the elimination of prescribing false contraindications to immunization. To accomplish both goals, the MOH updated the national immunization policies and established a more effective structure for managing immunization services. To support the MOH, the US Agency for International Development (USAID) Resources for Child Health (REACH) and Basic Support for Institutionalizing Child Survival (BASICS) projects provided technical assistance through a resident coordinator and consultants, and by organizing an international seminar. The improvements extended beyond systems and forms, but, instead, emphasized monitoring by the frontline health worker and supervising the quality of health information. To accomplish their objectives, the MOH appointed a Working Group to define the problems, revise record-keeping procedures, and develop monitoring tools. This group, representing both national and local levels, was composed of MOH epidemiologists, paediatricians and a management information specialist. To reduce the burden of excessive record-keeping and reporting requirements, the Working Group identified four key indicators for the service delivery level: (1) DPT3 immunization coverage rates for children less than 1 year of age; (2) contraindication rates for DPT; (3) usage of DPT vaccine; and (4) daily refrigerator temperatures. Additional indicators were included at district and provincial levels. After a successful 1-year trial, the MOH implemented the revised HMIS nationally. Not only did the quality of the information system improve, but the new approach

  9. Immune deficiencies following cancer treatment in children.

    PubMed

    Kantar, Mehmet; Cetingül, Nazan; Kansoy, Savaş; Kütükçüler, Necil; Aksu, Güzide

    2003-10-01

    The aim of this study was to determine serum immunoglobulins, IgG subclasses, lymphocyte subsets, and serum protective antitoxin levels of tetanus and diphtheria, and to investigate specific antibody response to tetanus and diphtheria vaccines in children with cancer who have been treated for leukemias and solid tumors. Forty patients with different types of childhood malignancies were enrolled in this study and their lymphocyte subsets, serum Ig A, M, G and IgG subclass concentrations were determined at completion of chemotherapy and 6 months later. We measured serum diphtheria (D) and tetanus (T) antitoxin levels and investigated specific antibody responses against DT vaccines at 6 months. Only the leukemic children had low CD19+ cells at completion of chemotherapy and 6 months later. The patients with solid tumors had reduced CD4+ cells, but increased natural killer cells at completion of chemotherapy. Serum IgA and IgM levels were decreased in leukemic patients after chemotherapy. There were no IgG subclass deficiency. Forty-two per cent of the patients did not have protective serum T antitoxins. All patients produced high levels of DT antibodies by vaccination. Immune system changes recover by 6 months after cancer therapy in children. Children with solid tumors, as well as leukemias, should be followed-up in terms of immune deficiencies. A repeat dose of tetanus toxoid should be recommended at 6 months.

  10. Chemical Tools To Monitor and Manipulate Adaptive Immune Responses.

    PubMed

    Doran, Todd M; Sarkar, Mohosin; Kodadek, Thomas

    2016-05-18

    Methods to monitor and manipulate the immune system are of enormous clinical interest. For example, the development of vaccines represents one of the earliest and greatest accomplishments of the biomedical research enterprise. More recently, drugs capable of "reawakening" the immune system to cancer have generated enormous excitement. But, much remains to be done. All drugs available today that manipulate the immune system cannot distinguish between "good" and "bad" immune responses and thus drive general and systemic immune suppression or activation. Indeed, with the notable exception of vaccines, our ability to monitor and manipulate antigen-specific immune responses is in its infancy. Achieving this finer level of control would be highly desirable. For example, it might allow the pharmacological editing of pathogenic immune responses without restricting the ability of the immune system to defend against infection. On the diagnostic side, a method to comprehensively monitor the circulating, antigen-specific antibody population could provide a treasure trove of clinically useful biomarkers, since many diseases expose the immune system to characteristic molecules that are deemed foreign and elicit the production of antibodies against them. This Perspective will discuss the state-of-the-art of this area with a focus on what we consider seminal opportunities for the chemistry community to contribute to this important field.

  11. Immunization

    MedlinePlus

    ... a lot worse. Some are even life-threatening. Immunization shots, or vaccinations, are essential. They protect against things like measles, ... B, polio, tetanus, diphtheria, and pertussis (whooping cough). Immunizations are important for adults as well as children. ...

  12. Validation of Procedures for Monitoring Crewmember Immune Function SDBI-1900, SMO-015 - Integrated Immune

    NASA Technical Reports Server (NTRS)

    Crucian, Brian; Stowe, Raymond; Mehta, Satish; Uchakin, Peter; Nehlsen-Cannarella, Sandra; Morukov, Boris; Pierson, Duane; Sams, Clarence

    2007-01-01

    There is ample evidence to suggest that space flight leads to immune system dysregulation. This may be a result of microgravity, confinement, physiological stress, radiation, environment or other mission-associated factors. The clinical risk from prolonged immune dysregulation during space flight are not yet determined, but may include increased incidence of infection, allergy, hypersensitivity, hematological malignancy or altered wound healing. Each of the clinical events resulting from immune dysfunction has the potential to impact mission critical objectives during exploration-class missions. To date, precious little in-flight immune data has been generated to assess this phenomenon. The majority of recent flight immune studies have been post-flight assessments, which may not accurately reflect the in-flight condition. There are no procedures currently in place to monitor immune function or its effect on crew health. The objective of this Supplemental Medical Objective (SMO) is to develop and validate an immune monitoring strategy consistent with operational flight requirements and constraints. This SMO will assess the clinical risks resulting from the adverse effects of space flight on the human immune system and will validate a flight-compatible immune monitoring strategy. Characterization of the clinical risk and the development of a monitoring strategy are necessary prerequisite activities prior to validating countermeasures. This study will determine, to the best level allowed by current technology, the in-flight status of crewmembers immune system. Pre-flight, in-flight and post-flight assessments of immune status, immune function, viral reactivation and physiological stress will be performed. The in-flight samples will allow a distinction between legitimate in-flight alterations and the physiological stresses of landing and readaptation which are believed to alter landing day assessments. The overall status of the immune system during flight (activation

  13. Monitoring of the Immune Dysfunction in Cancer Patients.

    PubMed

    Santegoets, Saskia J A M; Welters, Marij J P; van der Burg, Sjoerd H

    2016-01-01

    Immunotherapy shows promising clinical results in patients with different types of cancer, but its full potential is not reached due to immune dysfunction as a result of several suppressive mechanisms that play a role in cancer development and progression. Monitoring of immune dysfunction is a prerequisite for the development of strategies aiming to alleviate cancer-induced immune suppression. At this point, the level at which immune dysfunction occurs has to be established, the underlying mechanism(s) need to be known, as well as the techniques to assess this. While it is relatively easy to measure general signs of immune suppression, it turns out that accurate monitoring of the frequency and function of immune-suppressive cells is still difficult. A lack of truly specific markers, the phenotypic complexity among suppressive cells of the same lineage, but potentially with different functions and functional assays that may not cover every mechanistic aspect of immune suppression are among the reasons complicating proper assessments. Technical innovations in flow and mass cytometry will allow for more complete sets of markers to precisely determine phenotype and associated function. There is, however, a clear need for functional assays that recapitulate more of the mechanisms employed to suppress the immune system. PMID:27598210

  14. Monitoring of the Immune Dysfunction in Cancer Patients

    PubMed Central

    Santegoets, Saskia J. A. M.; Welters, Marij J. P.; van der Burg, Sjoerd H.

    2016-01-01

    Immunotherapy shows promising clinical results in patients with different types of cancer, but its full potential is not reached due to immune dysfunction as a result of several suppressive mechanisms that play a role in cancer development and progression. Monitoring of immune dysfunction is a prerequisite for the development of strategies aiming to alleviate cancer-induced immune suppression. At this point, the level at which immune dysfunction occurs has to be established, the underlying mechanism(s) need to be known, as well as the techniques to assess this. While it is relatively easy to measure general signs of immune suppression, it turns out that accurate monitoring of the frequency and function of immune-suppressive cells is still difficult. A lack of truly specific markers, the phenotypic complexity among suppressive cells of the same lineage, but potentially with different functions and functional assays that may not cover every mechanistic aspect of immune suppression are among the reasons complicating proper assessments. Technical innovations in flow and mass cytometry will allow for more complete sets of markers to precisely determine phenotype and associated function. There is, however, a clear need for functional assays that recapitulate more of the mechanisms employed to suppress the immune system. PMID:27598210

  15. Monitoring of the Immune Dysfunction in Cancer Patients.

    PubMed

    Santegoets, Saskia J A M; Welters, Marij J P; van der Burg, Sjoerd H

    2016-09-02

    Immunotherapy shows promising clinical results in patients with different types of cancer, but its full potential is not reached due to immune dysfunction as a result of several suppressive mechanisms that play a role in cancer development and progression. Monitoring of immune dysfunction is a prerequisite for the development of strategies aiming to alleviate cancer-induced immune suppression. At this point, the level at which immune dysfunction occurs has to be established, the underlying mechanism(s) need to be known, as well as the techniques to assess this. While it is relatively easy to measure general signs of immune suppression, it turns out that accurate monitoring of the frequency and function of immune-suppressive cells is still difficult. A lack of truly specific markers, the phenotypic complexity among suppressive cells of the same lineage, but potentially with different functions and functional assays that may not cover every mechanistic aspect of immune suppression are among the reasons complicating proper assessments. Technical innovations in flow and mass cytometry will allow for more complete sets of markers to precisely determine phenotype and associated function. There is, however, a clear need for functional assays that recapitulate more of the mechanisms employed to suppress the immune system.

  16. Validation of Procedures for Monitoring Crewmember Immune Function

    NASA Technical Reports Server (NTRS)

    Crucian, Brian; Stowe, Raymond; Mehta, Satish; Uchakin, Peter; Quiriarte, Heather; Pierson, Duane; Sams, Clarence

    2008-01-01

    There is ample evidence to suggest that space flight leads to immune system dysregulation. This may be a result of microgravity, confinement, physiological stress, radiation, environment or other mission-associated factors. The clinical risk (if any) from prolonged immune dysregulation during exploration-class space flight has not yet been determined, but may include increased incidence of infection, allergy, hypersensitivity, hematological malignancy or altered wound healing. Each of the clinical events resulting from immune dysfunction has the potential to impact mission critical objectives during exploration-class missions. To date, precious little in-flight immune data has been generated to assess this phenomenon. The majority of recent flight immune studies have been post-flight assessments, which may not accurately reflect the in-flight status of immunity as it resolves over prolonged flight. There are no procedures currently in place to monitor immune function or its effect on crew health. The objective of this Supplemental Medical Objective (SMO) is to develop and validate an immune monitoring strategy consistent with operational flight requirements and constraints. This SMO will assess immunity, latent viral reactivation and physiological stress during both short and long duration flights. Upon completion, it is expected that any clinical risks resulting from the adverse effects of space flight on the human immune system will have been determined. In addition, a flight-compatible immune monitoring strategy will have been developed with which countermeasures validation could be performed. This study will determine, to the best level allowed by current technology, the in-flight status of crewmembers' immune systems. The in-flight samples will allow a distinction between legitimate in-flight alterations and the physiological stresses of landing and readaptation which are believed to alter R+0 assessments. The overall status of the immune system during flight

  17. Lasting monitoring of immune state in patients with coronary atherosclerosis

    NASA Astrophysics Data System (ADS)

    Malinova, Lidia I.; Denisova, Tatyana P.; Tuchin, Valery V.

    2007-02-01

    Immune state monitoring is an expensive, invasive and sometimes difficult necessity in patients with different disorders. Immune reaction dynamics study in patients with coronary atherosclerosis provides one of the leading components to complication development, clinical course prognosis and treatment and rehabilitation tactics. We've chosen intravenous glucose injection as metabolic irritant in the following four groups of patients: men with proved coronary atherosclerosis (CA), non insulin dependent diabetes mellitus (NIDDM), men hereditary burden by CA and NIDDM and practically healthy persons with longlivers in generation. Immune state parameters such as quantity of leukocytes and lymphocytes, circulating immune complexes levels, serum immunoglobulin levels, HLA antigen markers were studied at 0, 30 and 60 minutes during glucose loading. To obtain continues time function of studied parameters received data were approximated by polynomials of high degree with after going first derivatives. Time functions analyze elucidate principally different dynamics studied parameters in all chosen groups of patients, which couldn't be obtained from discontinuous data compare. Leukocyte and lymphocyte levels dynamics correlated HLA antigen markers in all studied groups. Analytical estimation of immune state in patients with coronary atherosclerosis shows the functional "margin of safety" of immune system state under glucose disturbance. Proposed method of analytical estimation also can be used in immune system monitoring in other groups of patients.

  18. The immunization data quality audit: verifying the quality and consistency of immunization monitoring systems.

    PubMed Central

    Ronveaux, O.; Rickert, D.; Hadler, S.; Groom, H.; Lloyd, J.; Bchir, A.; Birmingham, M.

    2005-01-01

    OBJECTIVE: To evaluate the consistency and quality of immunization monitoring systems in 27 countries during 2002-03 using standardized data quality audits (DQAs) that had been launched within the framework of the Global Alliance for Vaccines and Immunization. METHODS: The consistency of reporting systems was estimated by determining the proportion of third doses of diphtheria-tetanuspertussis (DTP-3) vaccine reported as being administered that could be verified by written documentation at health facilities and districts. The quality of monitoring systems was measured using quality indices for different components of the monitoring systems. These indices were applied to each level of the health service (health unit, district and national). FINDINGS: The proportion of verified DTP-3 doses was lower than 85% in 16 countries. Difficulties in verifying the doses administered often arose at the peripheral level of the health service, usually as the result of discrepancies in information between health units and their corresponding districts or because completed recording forms were not available from health units. All countries had weaknesses in their monitoring systems; these included the inconsistent use of monitoring charts; inadequate monitoring of vaccine stocks, injection supplies and adverse events; unsafe computer practices; and poor monitoring of completeness and timeliness of reporting. CONCLUSION: Inconsistencies in immunization data occur in many countries, hampering their ability to manage their immunization programmes. Countries should use these findings to strengthen monitoring systems so that data can reliably guide programme activities. The DQA is an innovative tool that provides a way to independently assess the quality of immunization monitoring systems at all levels of a health service and serves as a point of entry to make improvements. It provides a useful example for other global health initiatives. PMID:16175824

  19. Children as Playtime Monitors: What It Means for the Monitor

    ERIC Educational Resources Information Center

    Sharma-Stray, Leela; Creasy, Rob

    2013-01-01

    Although many schools within the United Kingdom adopt practices, such as the use of prefects or playtime monitors, there is very little research that explores how such practices are experienced by children who take on these roles. This small-scale study explores the experiences of a small group of children who volunteered to be playtime monitors…

  20. Timely immunization series completion among children of immigrants.

    PubMed

    Buelow, Victoria H; Van Hook, Jennifer

    2008-02-01

    This study examines the relationship between timely immunization series completion among children of immigrants and parental nativity, residential duration in the United States, and citizenship status. We analyzed data from the childhood immunization supplement of the 2000-2003 National Health Interview Surveys (NHIS). Combined 4:3:1:3:3 immunization series completion by 18 months of age served as the dependent variable. Nested logistic regression models were estimated to examine relationship between parental nativity and timely immunization completion. Although socio-economic and health care access partially explained parental nativity, citizenship, and residential duration differences in timely completion, having a foreign-born mother was associated with a 14% reduced odds of completing the combined series on time when compared to children with US-born mothers net of covariates. Children of non-citizen mothers who had resided in the country for less than 5 years were the least likely to complete immunizations on time. The elimination of disparities in timely immunization completion among children requires special attention to children of newly arrived and non-citizen immigrants.

  1. Immunization coverage and timeliness of vaccination in Italian children with chronic diseases.

    PubMed

    Pandolfi, E; Carloni, E; Marino, M G; Ciofi degli Atti, M L; Gesualdo, F; Romano, M; Giannattasio, A; Guarino, A; Carloni, R; Borgia, P; Volpe, E; Perrelli, F; Pizzuti, R; Tozzi, A E

    2012-07-20

    Since children with chronic diseases represent a primary target for immunization strategies, it is important that their immunization coverage and timeliness of vaccines is optimal. We performed a study to measure immunization coverage and timeliness of vaccines in children with type 1 diabetes, HIV infection, Down syndrome, cystic fibrosis, and neurological diseases. A total of 275 children aged 6 months-18 years were included in the study. Coverage for diphtheria-tetanus-pertussis (DTP), polio (Pol), and hepatitis B (HBV) vaccines approximated 85% at 24 months, while measles-mumps-rubella (MMR) coverage was 62%. Immunization coverage for seasonal influenza was 59%. The analysis of timeliness revealed that there was heterogeneity among children with different chronic diseases. A proportional hazard model showed that children with HIV infection had the longest time to complete three doses of DTP, Pol, and HBV, and those with neurological diseases received the first dose of MMR later than the other categories. Causes of missing or delayed vaccination mostly included a concurrent acute disease. Children with chronic diseases should be strictly monitored for routine and recommended vaccinations, and health care providers and families should be properly informed to avoid false contraindications.

  2. An Overlapping Syndrome of Allergy and Immune Deficiency in Children

    PubMed Central

    Szczawinska-Poplonyk, Aleksandra

    2012-01-01

    Recurrent airway inflammations in children are an important clinical problem in pediatric practice. An essential challenge is differentiation between allergic background and immune deficiency, which is a difficult task taking into consideration individual predisposition to atopy, immune system maturation in the early childhood, as well as exposition to environmental allergens and microbial antigens. In this paper relationship between selected elements of innate and adaptive immunity, such as pattern-recognition receptors, complement components, dendritic cells, as well as immunoglobulins, and regulatory T lymph cells has been discussed. Particular attention has been paid to these mechanisms of the immune response which, depending on settings and timing of activation, predispose to allergy or contribute to tolerogenic phenotype. In the context of multifactorial conditioning of the innate and adaptive immunity governing the ultimate response and associations between allergy and immune deficiencies, these phenomena should be considered as pathogenetically not precluding, but as an overlapping syndrome. PMID:21918651

  3. Validation of Procedures for Monitoring Crewmember Immune Function - Short Duration Biological Investigation

    NASA Technical Reports Server (NTRS)

    Sams, Clarence; Crucian, Brian; Stowe, Raymond; Pierson, Duane; Mehta, Satish; Morukov, Boris; Uchakin, Peter; Nehlsen-Cannarella, Sandra

    2008-01-01

    Validation of Procedures for Monitoring Crew Member Immune Function - Short Duration Biological Investigation (Integrated Immune-SDBI) will assess the clinical risks resulting from the adverse effects of space flight on the human immune system and will validate a flightcompatible immune monitoring strategy. Immune system changes will be monitored by collecting and analyzing blood, urine and saliva samples from crewmembers before, during and after space flight.

  4. Validation of Procedures for Monitoring Crewmember Immune Function

    NASA Technical Reports Server (NTRS)

    Pierson, Duane; Crucian, Brian; Mehta, Satish; Stowe, Raymond; Uchakin, Peter; Quiriarte, Heather; Sams, Clarence

    2010-01-01

    The objective of this Supplemental Medical Objective (SMO) is to determine the status of the immune system, physiological stress and latent viral reactivation (a clinical outcome that can be measured) during both short and long-duration spaceflight. In addition, this study will develop and validate an immune monitoring strategy consistent with operational flight requirements and constraints. Pre-mission, in-flight and post-flight blood and saliva samples will be obtained from participating crewmembers. Assays included peripheral immunophenotype, T cell function, cytokine profiles, viral-specific immunity, latent viral reactivation (EBV, CMV, VZV), and stress hormone measurements. To date, 18 short duration (now completed) and 8 long-duration crewmembers have completed the study. The long-duration phase of this study is ongoing. For this presentation, the final data set for the short duration subjects will be discussed.

  5. Serologic testing to verify the immune status of internationally adopted children against vaccine preventable diseases☆

    PubMed Central

    Staat, Mary Allen; Stadler, Laura Patricia; Donauer, Stephanie; Trehan, Indi; Rice, Marilyn; Salisbury, Shelia

    2010-01-01

    Definitive immunization guidelines for internationally adopted children are lacking. We examined whether these children had serologic evidence of protection against vaccine-preventable diseases. For children with ≥3 vaccine doses, overall protection was high for diphtheria (85%), tetanus (95%), polio (93%), hepatitis B (77%), and Hib (67%). For children ≥12 months of age with ≥1 dose of measles, mumps, or rubella vaccines, 95%, 72%, and 94% were immune, respectively. Children without immunization documentation had lower immunity. Serologic testing was useful in verifying the immunization status in internationally adopted children with and without documentation of immunizations. PMID:20937322

  6. Sports Participation in Children and Adolescents with Immune Thrombocytopenia (ITP).

    PubMed

    Kumar, Manjusha; Lambert, Michele P; Breakey, Vicky; Buchanan, George R; Neier, Michelle; Neufeld, Ellis J; Kempert, Pamela; Neunert, Cindy E; Nottage, Kerri; Klaassen, Robert J

    2015-12-01

    We surveyed 278 pediatric hematologists/oncologists regarding how children with immune thrombocytopenia (ITP) are counseled for participation in sports. Results show substantial variation in physician perception of contact risk for different sports, and the advice offered about restriction of sport activities of affected children. Many physicians recommend restriction of sports when platelet counts are under 50 × 10(9) /L. Such restriction may affect the child's quality of life despite their having an overall benign disease.

  7. Maternal Education and Immunization Status Among Children in Kenya.

    PubMed

    Onsomu, Elijah O; Abuya, Benta A; Okech, Irene N; Moore, DaKysha; Collins-McNeil, Janice

    2015-08-01

    Child morbidity and mortality due to infectious diseases continues to be a major threat and public health concern worldwide. Although global vaccination coverage reached 90 % for diphtheria, tetanus and pertussis (DTP3) across 129 countries, Kenya and other sub-Saharan countries continue to experience under-vaccination. The purpose of this study was to examine the association between maternal education and child immunization (12-23 months) in Kenya. This study used retrospective cross-sectional data from the 2008-2009 Kenya Demographic and Health Survey for women aged 15-49, who had children aged 12-23 months, and who answered questions about vaccination in the survey (n = 1,707). The majority of the children had received vaccinations, with 77 % for poliomyelitis, 74 % for measles, 94 % for tuberculosis, and 91 % for diphtheria, whooping cough (pertussis), and tetanus. After adjusting for other covariates, women with primary, secondary, and college/university education were between 2.21 (p < 0.01) and 9.10 (p < 0.001) times more likely to immunize their children than those who had less than a primary education. Maternal education is clearly crucial in ensuring good health outcomes among children, and integrating immunization knowledge with maternal and child health services is imperative. More research is needed to identify factors influencing immunization decisions among less-educated women in Kenya.

  8. Reasons Parents Exempt Children from Receiving Immunizations

    ERIC Educational Resources Information Center

    Luthy, Karlen E.; Beckstrand, Renea L.; Callister, Lynn C.; Cahoon, Spencer

    2012-01-01

    School nurses are on the front lines of educational efforts to promote childhood vaccinations. However, some parents still choose to exempt their children from receiving vaccinations for personal reasons. Studying the beliefs of parents who exempt vaccinations allows health care workers, including school nurses, to better understand parental…

  9. Immune Monitoring Using mRNA-Transfected Dendritic Cells.

    PubMed

    Borch, Troels Holz; Svane, Inge Marie; Met, Özcan

    2016-01-01

    Dendritic cells are known to be the most potent antigen presenting cell in the immune system and are used as cellular adjuvants in therapeutic anticancer vaccines using various tumor-associated antigens or their derivatives. One way of loading antigen into the dendritic cells is by mRNA electroporation, ensuring presentation of antigen through major histocompatibility complex I and potentially activating T cells, enabling them to kill the tumor cells. Despite extensive research in the field, only one dendritic cell-based vaccine has been approved. There is therefore a great need to elucidate and understand the immunological impact of dendritic cell vaccination in order to improve clinical benefit. In this chapter, we describe a method for performing immune monitoring using peripheral blood mononuclear cells and autologous dendritic cells transfected with tumor-associated antigen-encoding mRNA. PMID:27236804

  10. [Herd immunity against poliomyelitis in children in the Moscow Region].

    PubMed

    Seĭbil', V B; Malyshkina, L P; Tamazian, G V; Konopleva, T N; Uspenskaia, E S

    2009-01-01

    Herd immunity against poliomyelitis was studied in 1391 children and adolescents from 10 towns of the Moscow Region. It was ascertained that the values of herd immunity against poliomyelitis virus type 1 were high everywhere and those of herd immunity against poliomyelitis virus type 2 were high and very high in 9 towns and below the WHO minimum levels (80%). The values of herd immunity against poliomyelitis virus type 3; they were lower than the required minimum in 2 towns and very low in 2 other towns arouse alarm. The study of strain-specific antibodies to vaccine-derived and wild polioviruses has demonstrated that wild poliomyelitis viruses have not circulated in the areas of the examinees in the past decade.

  11. Immune response to measles vaccine in Peruvian children.

    PubMed Central

    Bautista-López, N. L.; Vaisberg, A.; Kanashiro, R.; Hernández, H.; Ward, B. J.

    2001-01-01

    OBJECTIVE: To evaluate the immune response in Peruvian children following measles vaccination. METHODS: Fifty-five Peruvian children received Schwarz measles vaccine (about 10(3) plaque forming units) at about 9 months of age. Blood samples were taken before vaccination, then twice after vaccination: one sample at between 1 and 4 weeks after vaccination and the final sample 3 months post vaccination for evaluation of immune cell phenotype and lymphoproliferative responses to measles and non-measles antigens. Measles-specific antibodies were measured by plaque reduction neutralization. FINDINGS: The humoral response developed rapidly after vaccination; only 4 of the 55 children (7%) had plaque reduction neutralization titres <200 mlU/ml 3 months after vaccination. However, only 8 out of 35 children tested (23%) had lymphoproliferative responses to measles antigens 3-4 weeks after vaccination. Children with poor lymphoproliferative responses to measles antigens had readily detectable lymphoproliferative responses to other antigens. Flow cytometric analysis of peripheral blood mononuclear cells revealed diffuse immune system activation at the time of vaccination in most children. The capacity to mount a lymphoproliferative response to measles antigens was associated with expression of CD45RO on CD4+ T-cells. CONCLUSION: The 55 Peruvian children had excellent antibody responses after measles vaccination, but only 23% (8 out of 35) generated detectable lymphoproliferative responses to measles antigens (compared with 55-67% in children in the industrialized world). This difference may contribute to the less than uniform success of measles vaccination programmes in the developing world. PMID:11731811

  12. Monitoring polio supplementary immunization activities using an automated short text messaging system in Karachi, Pakistan

    PubMed Central

    Murtaza, A; Khoja, S; Zaidi, AK; Ali, SA

    2014-01-01

    Abstract Problem Polio remains endemic in many areas of Pakistan, including large urban centres such as Karachi. Approach During each of seven supplementary immunization activities against polio in Karachi, mobile phone numbers of the caregivers of a random sample of eligible children were obtained. A computer-based system was developed to send two questions – as short message service (SMS) texts – automatically to each number after the immunization activity: “Did the vaccinator visit your house?” and “Did the enrolled child in your household receive oral polio vaccine?” Persistent non-responders were phoned directly by an investigator. Local setting A cluster sampling technique was used to select representative samples of the caregivers of young children in Karachi in general and of such caregivers in three of the six “high-risk” districts of the city where polio cases were detected in 2011. Relevant changes In most of the supplementary immunization activities investigated, vaccine coverages estimated using the SMS system were very similar to those estimated by interviewing by phone those caregivers who never responded to the SMS messages. In the high-risk districts investigated, coverages estimated using the SMS system were also similar to those recorded – using lot quality assurance sampling – by the World Health Organization. Lessons learnt For the monitoring of coverage in supplementary immunization activities, automated SMS-based systems appear to be an attractive and relatively inexpensive option. Further research is needed to determine if coverage data collected by SMS-based systems provide estimates that are sufficiently accurate. Such systems may be useful in other large-scale immunization campaigns. PMID:24700982

  13. "Immunization mobile" brings protection to children in southeastern Idaho.

    PubMed Central

    Stanger, L

    1987-01-01

    The problem that needs to be addressed is the 58 percent immunity level among 2-year-olds in southeastern Idaho, a level created by the indifference or fear of parents. Southeastern Idaho has the highest birth rate of any region in the State, and this situation has created a large group of children susceptible to vaccine-preventable diseases. The mobile unit, which consists of a specially equipped motor home, allows easy access to immunizations for groups of children and their parents. A search of the computerized record system installed in the mobile unit can provide data on past immunizations for each registered child. The target audience for the mobile unit's visits is church groups because of the particular cultural demographics of this region. In 1987, the District Seven Health Department, a State- and county-funded agency, expects to increase the number of doses of vaccine given by 3,000 over the 19,953 given in 1986. The "Shots for Tots" program is unique in the State of Idaho. Its expansion may be anticipated as the unit becomes better known in the region. The alternative to using aggressive, innovative techniques to motivate people to become immunized is disease. Images p545-a PMID:3116586

  14. [Guidelines for diagnosis, treatment and monitoring of primary immune thrombocytopenia].

    PubMed

    Sanz, Miguel Ángel; Vicente García, Vicente; Fernández, Antonio; López, M Fernanda; Grande, Carlos; Jarque, Isidro; Martínez, Rafael; Mingot, María Eva; Monteagudo, Emilio; Ribera, Josep M A; Valcárcel, David

    2012-03-17

    The consensus document on the diagnosis, treatment and monitoring of primary immune thrombocytopenia was developed in 2010 by specialists with recognized expertise in this disease under the auspices of the Spanish Society of Hematology and Hemotherapy and the Spanish Society of Pediatric Hematology and Oncology, with the aim to adapt to Spain the recommendations of the recently published international consensus documents. The decision to start treatment is based on bleeding manifestations and platelet count (<20×10(9)/L). The first-line treatment is corticosteroids, albeit for a limited period of 4-6 weeks. The addition of intravenous immunoglobulin is reserved to patients with severe bleeding. Splenectomy is the most effective second-line treatment. For patients refractory to splenectomy and those with contraindications or patient refusal, the new thrombopoietic agents are the drugs of choice due to their efficacy and excellent safety profile. The other treatment options have highly variable response rates, and the absence of controlled studies does not allow to establish clear recommendations. Monitoring should be individualized. In patients without active treatment, blood counts are recommended every 3-6 months, and the patient should be instructed to consult in case of bleeding, surgery or invasive procedure and pregnancy. In most of the pediatric population, the disease tends to spontaneous remission. High-dose corticosteroids in short course and intravenous immunoglobulin are the treatment of choice. Second- and further-line treatments should be monitored in specialized centers.

  15. Immunization.

    ERIC Educational Resources Information Center

    Guerin, Nicole; And Others

    1986-01-01

    Contents of this double journal issue concern immunization and primary health care of children. The issue decribes vaccine storage and sterilization techniques, giving particular emphasis to the role of the cold chain, i.e., the maintenance of a specific temperature range to assure potency of vaccines as they are moved from a national storage…

  16. Validation of Procedures for Monitoring Crewmember Immune Function

    NASA Technical Reports Server (NTRS)

    Crucian, Brian; Stowe, Raymond; Mehta, Satish; Uchakin, Peter; Quiriarte, Heather; Pierson, Duane; Sams, Clarence

    2009-01-01

    There is ample evidence to suggest that space flight leads to immune system dysregulation, however the nature of the phenomenon as it equilibrates over longer flights has not been determined. This dysregulation may be a result of microgravity, confinement, physiological stress, radiation, environment or other mission-associated factors. The clinical risk (if any) for exploration-class space flight is unknown, but may include increased incidence of infection, allergy, hypersensitivity, hematological malignancy or altered wound healing. The objective of this Supplemental Medical Objective (SMO) is to determine the status of the immune system, physiological stress and latent viral reactivation (a clinical outcome that can be measured) during both short and long-duration spaceflight. In addition, this study will develop and validate an immune monitoring strategy consistent with operational flight requirements and constraints. Pre-mission, in-flight and post-flight blood and saliva samples will be obtained from participating crewmembers. Assays included peripheral immunophenotype, T cell function, cytokine profiles (RNA, intracellular, secreted), viral-specific immunity, latent viral reactivation (EBV, CMV, VZV), and stress hormone measurements. This study is currently ongoing. To date, 10 short duration and 5 long-duration crewmembers have completed the study. Technically, the study is progressing well. In-flight blood samples are being collected, and returned for analysis, including functional assays that require live cells. For all in-flight samples to date, sample viability has been acceptable. Preliminary data (n = 4/7; long/short duration, respectively) indicate that distribution of most peripheral leukocyte subsets is largely unaltered during flight. Exceptions include elevated T cells, reduced B/NK cells, increased memory T cells and increased central memory CD8+ T cells. General T cell function, early blastogenesis response to mitogenic stimulation, is markedly

  17. Immunity against diphtheria among children and adults in Izmir, Turkey.

    PubMed

    Kurugöl, Zafer; Midyat, Levent; Türkoğlu, Ebru; Işler, Ayşegül

    2011-06-10

    The aim of this study was to evaluate diphtheria immunity in a sample of the Turkish population having high childhood immunization coverage, including a booster dose of diphtheria toxoid at 12-15 years of age. A total of 599 persons aged 1-70 years were selected with cluster sampling. The information on socio-demographic characteristics, vaccination status and diphtheria history was gathered for each participant. Diphtheria antitoxin levels were measured qualitatively by using micro-enzyme immune assay. Of studied population, 72.3% had fully protective antitoxin levels (≥ 0.1 IU/ml). The rate of protection was 92.5% in the children aged 0-2 years, 93.2% in the primary school children aged 7-9 years, and 86.0% in the adolescents aged 15-19 years. After 20 years of age, diphtheria protection rates showed a significant age-related decrease, reaching minimum in the 30-39 age group, in which 47.3% of these subjects had fully protective antitoxin levels. The diphtheria antitoxin geometric mean titer (GMT) was highest in the 0-2 year age group (1.18 IU/ml). In the adolescents aged 15-19 years, diphtheria antitoxin GMT was 0.71 IU/ml. Then, geometric mean titer decreased with increasing age, and reached the minimum level in the 40-59 years age group (0.18 IU/ml). The protection rate among females was significantly lower than males (67.1% vs. 80.9%). The difference was apparent in the 20-29 and the 30-39 years age group: 80% of the males and 46.2% of the females in the 20-29 years age group, and 60% of males and 44.1% of females in the 30-39 years age group were fully protected against diphtheria (p<0.0001). These results suggest that in Izmir, Turkey, full serological protection against diphtheria is only detectable in <50% of the young adult population, even though childhood immunization coverage is relatively high. Potentially, there is still risk of diphtheria outbreaks among the adults in our country. Therefore, a revaccination of adults with reduced doses of

  18. Immune Reconstitution after Allogeneic Hematopoietic Cell Transplantation in Children.

    PubMed

    de Koning, Coco; Plantinga, Maud; Besseling, Paul; Boelens, Jaap Jan; Nierkens, Stefan

    2016-02-01

    Allogeneic (allo) hematopoietic cell transplantation (HCT) has evolved into a potent curative treatment option for a variety of malignant and nonmalignant diseases. The occurrence of complications and mortality after allo-HCT is, however, still high and is strongly associated with immune reconstitution (IR). Therefore, detailed information on IR through immunomonitoring is crucial to improve survival chances after HCT. To date, information about the reconstituting immune system after allo-HCT in pediatric patients is mostly derived from routine standard-of-care measurements. More profound knowledge on IR may provide tools to better predict and modulate adverse reactions and, subsequently, improve survival chances. Here, we provide an overview of IR (eg, immune cell subsets and circulating chemokines/cytokines) after allo-HCT in children, taking into account different cell sources and serotherapy, and discuss strategies to enhance immunomonitoring. We conclude that available IR data after allo-HCT contain limited information on immune cell families (mostly only generic T, B, and NK cells), which would improve with more detailed information on reconstituting cell subsets or effector cell functionality at earlier time points (<1 month). In addition, secretome data (eg, multiplex cytokine/chemokine profiles) could add to the understanding of IR mechanisms and cell functionality and may even provide (early) biomarkers for individual disease outcome, such as viral reactivity, graft-versus-host disease, or graft-versus-leukemia. The present data and suggestions for more detailed, standardized, and harmonized immunomonitoring in future (pediatric) allo-HCT studies will pave the path to "precision transplantation:" an individualized HCT approach (including conditioning), based on detailed information on IR and biomarkers, aiming to reduce transplantation related mortality and relapse, and subsequently improve survival chances.

  19. [Holter monitoring data in children with gastroesophageal reflux disease].

    PubMed

    Apenchenko, Iu S; Shcherbakov, P L; Gnusaev, S F; Ivanova, I I; Rozov, D N

    2014-01-01

    The aim of research is to estimate the functional state of the cardiovascular system in children with gastroesophageal reflux disease (GERD) with the help of Holter monitoring. 117 children of school age were examined: 69 children with GERD and 48 children with chronic gastroduodenitis. All children passed esophagogastroduodenoscopy, 24-hour pH-monitoring, electrocardiography and Holter monitoring. According to Holter monitoring data it was revealed that children with GERD had increased low-frequency components of frequency domain analyses, increased number of nocturnal PVCs and increased time of enhanced dispertion periods. Holter monitoring in patients with GERD can be used to detect preclinical ectopic rhythm, to evaluate autonomic dysfunction by frequency domain analyses, to predict nocturnal symptoms.

  20. Immunization of newborn children with living oral trivalent poliovirus vaccine.

    PubMed

    CAMPILLO-SAINZ, C; ORNELAS HERNANDEZ, A; DE MUCHA MACIAS, J; NAVA, S E

    1962-09-01

    Campillo-Sainz, C. (Instituto Nacional de Virología de la S.S.A., México, D.F.), A. Ornelas Hernandez, J. de Mucha Macías, and S. E. Nava. Immunization of newborn children with living oral trivalent poliovirus vaccine. J. Bacteriol. 84:446-450. 1962.-The serological response to one dose of living oral trivalent polio-virus vaccine was compared in two groups of children, 49 vaccinated at birth and 44 vaccinated at the age of 4 months. Of those vaccinated at birth, 44 (90%) responded to the vaccine strains of type 1 and type 3 and 30 (61%) to the type 2 strain. Of those vaccinated at 4 months of age; 64% responded to type 1, 52% to type 2, and 82% to type 3. The difference between the responses of the two groups, which for type 1 is significant, may result from the interference of other enteric viruses in the 4-month-old children. A second dose of vaccine, administered to the children vaccinated at birth when they reached the age of 4 months, increased the over-all immunological response to 100% for types 1 and 3 and 96% for type 2, and showed that no immunological tolerance had been developed. The vaccine produced no undesirable effects in any of the children, and no paralytic poliomyelitis occurred among them. The observation of other investigators, that a high titer of maternal antibody inhibits immunological response to vaccination, was confirmed, but breast feeding apparently had no unfavorable effect on response.

  1. Managing Multi-center Flow Cytometry Data for Immune Monitoring

    PubMed Central

    White, Scott; Laske, Karoline; Welters, Marij JP; Bidmon, Nicole; van der Burg, Sjoerd H; Britten, Cedrik M; Enzor, Jennifer; Staats, Janet; Weinhold, Kent J; Gouttefangeas, Cécile; Chan, Cliburn

    2014-01-01

    With the recent results of promising cancer vaccines and immunotherapy1–5, immune monitoring has become increasingly relevant for measuring treatment-induced effects on T cells, and an essential tool for shedding light on the mechanisms responsible for a successful treatment. Flow cytometry is the canonical multi-parameter assay for the fine characterization of single cells in solution, and is ubiquitously used in pre-clinical tumor immunology and in cancer immunotherapy trials. Current state-of-the-art polychromatic flow cytometry involves multi-step, multi-reagent assays followed by sample acquisition on sophisticated instruments capable of capturing up to 20 parameters per cell at a rate of tens of thousands of cells per second. Given the complexity of flow cytometry assays, reproducibility is a major concern, especially for multi-center studies. A promising approach for improving reproducibility is the use of automated analysis borrowing from statistics, machine learning and information visualization21–23, as these methods directly address the subjectivity, operator-dependence, labor-intensive and low fidelity of manual analysis. However, it is quite time-consuming to investigate and test new automated analysis techniques on large data sets without some centralized information management system. For large-scale automated analysis to be practical, the presence of consistent and high-quality data linked to the raw FCS files is indispensable. In particular, the use of machine-readable standard vocabularies to characterize channel metadata is essential when constructing analytic pipelines to avoid errors in processing, analysis and interpretation of results. For automation, this high-quality metadata needs to be programmatically accessible, implying the need for a consistent Application Programming Interface (API). In this manuscript, we propose that upfront time spent normalizing flow cytometry data to conform to carefully designed data models enables

  2. Monitoring the immune response using real-time PCR.

    PubMed

    Stordeur, Patrick

    2009-01-01

    Induction of an immune response to a particular antigen is the basis of vaccination. This has been done for years to prevent infectious diseases, and has the potential for the treatment of cancer. The immune response is nowadays more precisely modulated rather than simply induced, like in case of immunotherapy of allergic diseases. Likewise, autoimmune diseases are associated with an inappropriate immune response, and many efforts are made for specifically inhibiting this unwanted response. A possible line of attack is the induction of an antigen-specific immune tolerance, which also has a use in the field of transplantation, where allogeneic responses are deleterious for the graft. In all of these fields of fundamental and clinical medicine, the modulation of immune response requires the assistance of laboratory tests, among which real-time PCR appears more and more helpful. This chapter describes a protocol to quantify immune-related mRNAs using reverse transcription-real-time PCR. The transcripts can be quantified in cultured cells or in cultured whole blood, after an incubation period in the presence of the antigen to which the immune response is analyzed. This is the typical approach to evaluate the efficacy of a vaccine. The transcripts can also be quantified directly in the biological sample, giving information about the in vivo immune status of the individual. The techniques to achieve these different methods are described, and are illustrated by the analysis of the response against the toxoid tetanus antigen.

  3. A Conceptual Framework for Monitoring Children's Services. Discussion Draft.

    ERIC Educational Resources Information Center

    Fiene, Richard

    This discussion draft of a conceptual framework for monitoring children's services was prepared by Peat, Marwick and Co. for the Children's Services Monitoring Transfer Consortium (CFMCS), an organization spanning five states: California, Michigan, Pennsylvania, Texas, and West Virginia. The primary purpose of this conceptual framework was to…

  4. Protecting children's health. CHA's immunization program helps organizations increase vaccination rates in their communities.

    PubMed

    Wiener, J O; Trocchio, J

    1992-09-01

    In response to the increasing outbreaks of vaccine-preventable diseases in the United States, the Catholic Health Association (CHA) has developed a new resource to help its members launch programs that will increase immunization rates among children in their service area. Vaccines are the building blocks of basic primary care. But society and the healthcare system have erected barriers that prevent children from being fully immunized. Impediments include missed opportunities, cost barriers, and facility and resource barriers. Catholic healthcare providers can help eliminate these barriers and ensure that all children in their service areas are vaccinated by assessing their immunization resources, seeking out unvaccinated children, and collaborating with community organizations and agencies. CHA's immunization campaign will guide Catholic healthcare providers as they protect children from preventable diseases. Immunization may help reduce the costs of emergency and acute care for conditions that could have been prevented. PMID:10120199

  5. Immunity to Polyomavirus BK Infection: Immune Monitoring to Regulate the Balance between Risk of BKV Nephropathy and Induction of Alloimmunity

    PubMed Central

    Cioni, Michela; Basso, Sabrina; Gagliardone, Chiara; Potenza, Leonardo; Verrina, Enrico; Luppi, Mario; Zecca, Marco; Ghiggeri, Gian Marco; Ginevri, Fabrizio

    2013-01-01

    Polyomavirus BK-associated nephropathy (PyVAN) is the main infectious cause of allograft damage after kidney transplantation. A number of studies revealed an association between the presence of BKV-specific cellular immunity and BK viral clearance, with patients failing to recover specific T cells progressing to PyVAN. Evolution to allograft dysfunction can be prevented by restoration of BKV-specific immunity through a stepwise reduction of maintenance immunosuppressive drugs. Prospective monitoring of BK viral load and specific immunity, together with B-cell alloimmune surveillance, may allow a targeted modification/reduction of immunosuppression, with the aim of obtaining viral clearance while preventing graft injury due to deposition of de novo donor-specific HLA antibodies and late/chronic antibody-mediated allograft injury. Innovative, immune-based therapies may further contribute to BKV infection prevention and control. PMID:24000288

  6. Immunization Services for Adolescents within Comprehensive School Health Programs.

    ERIC Educational Resources Information Center

    Vernon, Mary E.; Bryan, Gloria; Hunt, Pete; Allensworth, Diane; Bradley, Beverly

    1997-01-01

    Discusses school health services, adolescent immunization, current school immunization practices, and support for school-based immunization programs. Children and adolescents can receive preventive health services, including immunizations and monitoring of immunization levels. Expanding school health services could improve the immunization levels…

  7. Performance Monitoring in Children following Traumatic Brain Injury

    ERIC Educational Resources Information Center

    Ornstein, Tisha J.; Levin, Harvey S.; Chen, Shirley; Hanten, Gerri; Ewing-Cobbs, Linda; Dennis, Maureen; Barnes, Marcia; Max, Jeffrey E.; Logan, Gordon D.; Schachar, Russell

    2009-01-01

    Background: Executive control deficits are common sequelae of childhood traumatic brain injury (TBI). The goal of the current study was to assess a specific executive control function, performance monitoring, in children following TBI. Methods: Thirty-one children with mild-moderate TBI, 18 with severe TBI, and 37 control children without TBI, of…

  8. Nutrition and Immune System in Children with Simple Obesity.

    PubMed

    Czerwonogrodzka-Senczyna, Aneta; Janusz, Malgorzata; Jeznach-Steinhagen, Anna; Demkow, Urszula; Pyrzak, Beata

    2016-01-01

    The purpose of this study was to evaluate dietary factors in nutrition influencing the immune system of children and teenagers suffering from simple obesity. The study involved 100 children and teenagers aged 7-18 with simple obesity. Nutritional data were obtained from 3-day food records. The consumed nutrients, including immunomodulators and immunostimulants, were estimated based on the nutrition interview. The results were compared with the nutritional norms. On average, the proportion of n-6:n-3 fatty acids equalled 10:1. Among the amino acids, the highest intake values in the diet were observed for glutamine (13,694.6 mg/day). The study demonstrates inadequate intake levels of iron (73% of recommended dietary allowance, RDA), vitamin C (65% of RDA), and vitamin D (11% of RDA) taking into account the median values for the entire study group. The median daily intake of other nutrients exceeded the RDA values. The diets of the participants in this study were not properly balanced with respect to immunomodulators, which may contribute to the occurrence of immunological disorders and immunodeficiency in this group of patients.

  9. Comparative study of mothers' knowledge of children immunization before and after mass media.

    PubMed

    el-Shazly, M K; Farghaly, N F; Abou Khatwa, S A; Ibrahim, A G

    1991-01-01

    Past experience about immunization programs calls for continuous monitoring of a healthy attitude among users towards vaccination. The aim of this study was to assess the effect of health education messages (mass media) on knowledge and practice of mothers as regards compulsory vaccination schedule. Data were collected from 250 females attending MCH centers during the first half of 1991 for either vaccinating their children or receiving antenatal care (exposed group). These data were compared to the data collected from a group of mothers before implementation of the intense mass media campaign on immunization (1983), (non-exposed group). There was a significant increase in the mean score of knowledge among the exposed mothers. The mass media messages became the main source of information among the majority of the exposed group. Females utilizing mass media as their main source of information were largely having a satisfactory level of knowledge. This study recommends enforcement of mass media educational campaigns on childhood immunization as well as reconsideration paid to the nature and content of messages.

  10. New recommended schedule for active immunization of normal infants and children.

    PubMed

    1986-09-19

    A large, randomized, double-blind trial has made available sufficient data to recommend the simultaneous administration of combined measles-mumps-rubella (MMR), diphtheria and tetanus toxoids and pertussis (DTP), and oral poliovirus (OPV) vaccines to all children 15 months old or older who are eligible to receive these vaccines. In this trial, serologic response and clinical reaction rates following primary immunization with MMR were compared in a test group of 405 children given MMR simultaneously with DTP and OPV and a control group of 410 children given MMR followed by doses of DTP and OPV vaccine 2 months later. Seroconversion rates to each MMR component exceeded 96% in both groups, and the geometric mean titers achieved against the other 6 antigens also were similar in both groups. Rates of most of the common vaccine-associated clinical reactions to DTP and MMR were not augmented by simultaneous administration of these 2 vaccines. Some minor side effects were reported more frequently in the simultaneous-administration group, but these difference were judged to be related to artifacts of the study design rather than to differences in the safety of the 2 vaccine schedules. Data from the Center for Disease Control's Monitoring System for Adverse Events Following Immunization have been reviewed, particularly the information from Idaho, Louisiana, and Tennessee, where policies to administer MMR, DTP, and OPV simultaneously have been in effect for periods ranging from several months to years. The evidence suggests no increased risk of reactions associated with the simulaneous administration of these antigens. The overall implications of simultaneous administartion have not been fully defined, but it is anticipated that implementation of this new schedule will result in at least 3 benefits: a decrease in the number of health care provider visits required for immunization during the 2nd year of life, and accompanying decrease in costs, and an increase in the

  11. Role of platelet function and platelet membrane glycoproteins in children with primary immune thrombocytopenia

    PubMed Central

    Liu, Wen-Jun; Bai, Jing; Guo, Qu-Lian; Huang, Zhe; Yang, Hong; Bai, Yong-Qi

    2016-01-01

    The aim of the present study was to examine and understand changes in platelet functions prior to and after the treatment of primary immune thrombocytopenia (ITP) in children. An automatic hematology analyzer and whole blood flow cytometry were used to detect immature platelet fraction (IPF), IPC and membrane glycoproteins (CD62p, PAC-1 and CD42b) in ITP children (ITP group), children with complete response after ITP treatment (ITP-CR group) and children with elective surgery (normal control group). The results showed that, levels of platelet count (PLT) and plateletcrit in the ITP group were lower alhtough the levels of mean platelet volume, platelet distribution width and platelet-large cell ratio (P-LCR) were higher than those in the normal control and ITP-CR groups. PLT in the ITP-CR group was lower than that in the normal controls. Additionally, IPF% was higher in the normal control and ITP-CR groups, IPC was lower in the ITP group compared to the normal control and ITP-CR groups. Furthermore, prior to ADP activation, the expression levels of CD62p, PAC-1 and CD42b in the ITP group were lower in ITP group than those in the normal control and ITP-CR groups. The expression level of PAC-1 was lower in the ITP-CR and normal control groups. No differences were identified in CD62p and CD42b expression levels. Following ATP activation, CD62p, PAC-1 and CD42b expression in the ITP group was lower than that in the normal control and ITP-CR groups. PAC-1 expression was lower while CD62p expression was higher in the ITP-CR group compared to the normal control group. In conclusion, the activation of platelets in ITP children was low. Decreased platelet function, platelet parameters and platelet glycoproteins may be used as markers for monitoring the treatment efficacy in ITP children. PMID:27431926

  12. [Immune function alteration in children after tonsillectomy and(or) adenoidectomy].

    PubMed

    Hu, Lanye; Yang, Jun

    2016-03-01

    Tonsillectomy and(or) adenoidectomy are effective procedures for children with chronic tonsillitis, diseases associated with the tonsil and other adenotonsillar diseases, and obstructive sleep apnea-hypopnea syndrome. Since the tonsil and adenoid gland play a dual role in fluid and cell immunity, whether adenotonsillectomy results in the abnormal immune function in children after the surgery has always been the focus of attention. This review focuses on the alterations and impacts on immunity in children after tonsillectomy and/or adenoidectomy. Recent studies confirmed that in short term the immune index may be slightly reduced after the tonsil and adenoid resection in children, however, the decline has no clinical significance because the remaining mucosa-associated lymphoid tissue can compensate for removal of the tonsils and adenoids. Over time, the immune index tends to be normal. The children's postoperative short-term decline in the immune index will gradually recover to the preoperative level or there is no significant difference compared with that in normal children. Therefore, long-term immune function did not decline after tonsil and adenoid resection in children. PMID:27382697

  13. [Immunization for children travelling to the tropics: neglected vaccines].

    PubMed

    Imbert, P; Guérin, N; Sorge, F

    2008-06-01

    Each year hundreds of thousands of children leave France to travel to developing countries where they are exposed to infectious agents that can be prevented by vaccination. During the child's pre-travel check-up, practitioners should check that all mandatory immunizations are up-to-date and provide advice on relevant vaccines in function of the epidemiological situation at the chosen destination. However various factors hinder full compliance with this approach and some vaccines are underused. Underused vaccines are referred to as neglected vaccines. In the French vaccination schedule three vaccinations can be considered as neglected. The first is the hepatitis B vaccine that has a low coverage level in France due to strong reluctance to its use despite the fact that the virus is widespread in tropical areas. The second is pneumococcal vaccine that should be administered to all infants less than 2 years of age, especially for travel to areas where pneumonia and meningitis are frequent. The third is BCG vaccine that is now at greater risk of being neglected in child travellers because its use has been downgraded from a general requirement to a recommendation only for children at risk. A serious limitation on the use of travel vaccinations is cost that can lead families to neglect some infectious risk such as hepatitis A that is a major risk for child travellers as well as for their relatives during or after the trip and typhoid fever that is essentially an imported disease. Rabies vaccine is also underused due to its cost and to poor understanding of the risk by many practitioners and families. The purpose of this article is to underline the need to improve information and access to vaccines that are all too often neglected in child travellers.

  14. [Experimental research on the electromagnetic radiation immunity of a kind of portable monitor].

    PubMed

    Yuan, Jun; Xiao, Dongping; Jian, Xin

    2010-11-01

    The paper is focused on a kind of portable monitor that is widely used in military hospitals. In order to study the electromagnetic radiation immunity of the monitor, the experiments of electromagnetic radiation caused by radio frequency continuous wave in reverberation chamber and by ultra wide band (UWB) electromagnetic pulse have been done. The study results show that UWB electromagnetic pulse interferes observably the operating state of the monitor. It should be paid high attention to take protective measures. The monitor tested has some electromagnetic immunity ability for radio frequency continuous wave radiation. The frequent abnormal phenomena are baseline drift and waveform distortion. The electromagnetic sensitivity of the monitor is related to the frequency of interference source. The monitor tested is most sensitive to the frequency of 390 MHz.

  15. Single-cell technologies for monitoring immune systems

    PubMed Central

    Chattopadhyay, Pratip K; Gierahn, Todd M; Roederer, Mario; Love, J Christopher

    2014-01-01

    The complex heterogeneity of cells, and their interconnectedness with each other, are major challenges to identifying clinically relevant measurements that reflect the state and capability of the immune system. Highly multiplexed, single-cell technologies may be critical for identifying correlates of disease or immunological interventions as well as for elucidating the underlying mechanisms of immunity. Here we review limitations of bulk measurements and explore advances in single-cell technologies that overcome these problems by expanding the depth and breadth of functional and phenotypic analysis in space and time. The geometric increases in complexity of data make formidable hurdles for exploring, analyzing and presenting results. We summarize recent approaches to making such computations tractable and discuss challenges for integrating heterogeneous data obtained using these single-cell technologies. PMID:24448570

  16. Heart Rate Monitors Promote Physical Education for Children

    ERIC Educational Resources Information Center

    Tipton, Jan; Sander, Allan N.

    2004-01-01

    National health and fitness data suggests that a significant percentage of children are not on a pathway to leading healthy, physically active lifestyles. Many children are leading sedentary lifestyles due to a lack of opportunity, success, or self-motivation in physical activity. Programs that highlight the use of heart rate monitors offer a…

  17. Evaluation of an Intervention Program to Increase Immunization Compliance among School Children

    ERIC Educational Resources Information Center

    Luthy, Karlen E.; Thorpe, Aubrey; Dymock, Leah Clark; Connely, Samantha

    2011-01-01

    State immunization laws necessitate compliance for students enrolling in a public or private school system. In support of state laws, school nurses expend hours to achieve immunization compliance with school-age children. For the purpose of creating a more efficient system, researchers implemented an educational and incentive program in local…

  18. Polio immunization and serological status in children and adolescents in Jamaica (1985).

    PubMed

    Ashley, D; Fox, K; Figueroa, J P; Hull, B

    1989-03-01

    A survey of immunization status and serological immunity to polio was carried out in 5 parishes in Jamaica in 1985. A sample of 2,506 children and adolescents aged 1-19 years was chosen by selecting clusters of children in enumeration districts (EDs) in each parish from the 1980 Census. Immunization status was verified by examining immunization records. Serological assay for antibodies to Polio Types 1, 2, and 3 was done. A positive neutralization test at dilution of 1:8 was taken as immunity to the polio virus. Of the 1,819 children whose immunization status was confirmed, coverage with 3 or more doses of oral polio vaccine was highest in the 1-4 year age group with 79.7% and lowest in the 15-19-year age group with 37.4%. Of the 2,506 children 81.4%, 94.7% and 72.3% were seropositive for Polio Types 1, 2 and 3 respectively. There was a significant difference in the prevalence of seropositives between individuals with and those without a history of vaccinations. No urban/rural or sex differences were noted. The study indicated a higher level of immunization status than previous surveys and a high level of serological immunity to polio. PMID:2728430

  19. Immunization Uptake in Younger Siblings of Children with Autism Spectrum Disorder

    ERIC Educational Resources Information Center

    Kuwaik, Ghassan Abu; Roberts, Wendy; Zwaigenbaum, Lonnie; Bryson, Susan; Smith, Isabel M.; Szatmari, Peter; Modi, Bonnie M.; Tanel, Nadia; Brian, Jessica

    2014-01-01

    Background: Parental concerns persist that immunization increases the risk of autism spectrum disorder, resulting in the potential for reduced uptake by parents of younger siblings of children with autism spectrum disorder ("younger sibs"). Objective: To compare immunization uptake by parents for their younger child relative to their…

  20. How Focus at Encoding Affects Children's Source Monitoring

    ERIC Educational Resources Information Center

    Crawley, Stacie L.; Newcombe, Nora S.; Bingman, Hannah

    2010-01-01

    Retention of source information is enhanced by focus on speakers' feelings about statements even though recognition is reduced for both adults and children. However, does any focus on another person lead to enhanced source monitoring, or is a particular kind of focus required? Does other-focus enhance source monitoring, or does self-focus detract…

  1. Immunization of children at risk of infection with human immunodeficiency virus.

    PubMed Central

    Moss, William J.; Clements, C. John; Halsey, Neal A.

    2003-01-01

    This paper reviews the English language literature on the safety, immunogenicity and effectiveness in children infected with the human immunodeficiency virus (HIV) of vaccines currently recommended by WHO for use in national immunization programmes. Immunization is generally safe and beneficial for children infected with HIV, although HIV-induced immune suppression reduces the benefit compared with that obtained in HIV-uninfected children. However, serious complications can occur following immunization of severely immunocompromised children with bacillus Calmette-Gu rin (BCG) vaccine. The risk of serious complications attributable to yellow fever vaccine in HIV-infected persons has not been determined. WHO guidelines for immunizing children with HIV infection and infants born to HIV-infected women differ only slightly from the general guidelines. BCG and yellow fever vaccines should be withheld from symptomatic HIV-infected children. Only one serious complication (fatal pneumonia) has been attributed to measles vaccine administered to a severely immunocompromised adult. Although two HIV-infected infants have developed vaccine-associated paralytic poliomyelitis, several million infected children have been vaccinated and the evidence does not suggest that there is an increased risk. The benefits of measles and poliovirus vaccines far outweigh the potential risks in HIV-infected children. The policy of administering routine vaccines to all children, regardless of possible HIV exposure, has been very effective in obtaining high immunization coverage and control of preventable diseases. Any changes in this policy would have to be carefully examined for a potential negative impact on disease control programmes in many countries. PMID:12640478

  2. [State of the immune system in children with tonsillitis-induced lesions of the cardiovascular system].

    PubMed

    Smiian, O I; Mozhova, Iu A; Bynda, T P; Sichnenko, P I; Romaniuk, O K; Slyva, V V

    2013-03-01

    Purpose of work was study the state of the immune system in children with non-inflammatory tonzillogenic lesions of the cardiovascular system. The article describes the main features of the immune status of children 6-18 years with chronic tonsillitis with lesions of the cardiovascular system. We analyzed the content of serum lymphocytes, T-lymphocytes, T-helper cells, T-suppressor, null cells, B-cells, the concentration of immunoglobulin (Ig) A, G, M, immunoregulatory index. Found that children with chronic tonsillitis and tonzillogenic heart disease immune status changes were more significant in contrast to children with chronic tonsillitis without cardiac complications and manifested significant increase in T-suppressor cells, Ig M and decreased T-lymphocytes (P < 0.01).

  3. Comparative assessment of immunization coverage of migrant children between national immunization program vaccines and non-national immunization program vaccines in East China.

    PubMed

    Hu, Yu; Luo, Shuying; Tang, Xuewen; Lou, Linqiao; Chen, Yaping; Guo, Jing

    2015-01-01

    This study aimed to describe the disparities in immunization coverage between National Immunization Program (NIP) vaccines and non-NIP vaccines in Yiwu and to identify potential determinants. A face-to-face interview-based questionnaire survey among 423 migrant children born from 1 June 2010 to 31 May 2013 was conducted. Immunization coverage was estimated according to the vaccines scheduled at different age, the birth cohorts, and socio- demographic characteristics. Single-level logistic regression analysis was applied to identify the determinants of coverage of non-NIP vaccines. We found that NIP vaccines recorded higher immunization coverage compared with non-NIP vaccines (87.9100%- vs 0%-74.8%). Among the non-NIP vaccines, varicella vaccine (VarV) recorded the highest coverage of 85.4%, which was introduced in 1998; while 7-valent pneumococcal conjugate vaccine(PCV7) recorded the lowest coverage of 0% for primary series, which was introduced recently. Lower coverage rate of non-NIP vaccines was significantly associated with more siblings in household, shorter duration of living in the surveyed areas, lower family income, mother with a job, mother with poor awareness of vaccination, and mother with lower education level. We found the immunization coverage rate of non-NIP vaccines was significant lower than that of NIP vaccines. Expansion of NIP to include non-NIP vaccines can provide better protection against the vaccine preventable diseases through increased immunization coverage.

  4. Role of platelet function and platelet membrane glycoproteins in children with primary immune thrombocytopenia.

    PubMed

    Liu, Wen-Jun; Bai, Jing; Guo, Qu-Lian; Huang, Zhe; Yang, Hong; Bai, Yong-Qi

    2016-09-01

    The aim of the present study was to examine and understand changes in platelet functions prior to and after the treatment of primary immune thrombocytopenia (ITP) in children. An automatic hematology analyzer and whole blood flow cytometry were used to detect immature platelet fraction (IPF), IPC and membrane glycoproteins (CD62p, PAC-1 and CD42b) in ITP children (ITP group), children with complete response after ITP treatment (ITP-CR group) and children with elective surgery (normal control group). The results showed that, levels of platelet count (PLT) and plateletcrit in the ITP group were lower alhtough the levels of mean platelet volume, platelet distribution width and platelet-large cell ratio (P-LCR) were higher than those in the normal control and ITP-CR groups. PLT in the ITP-CR group was lower than that in the normal controls. Additionally, IPF% was higher in the normal control and ITP-CR groups, IPC was lower in the ITP group compared to the normal control and ITP-CR groups. Furthermore, prior to ADP activation, the expression levels of CD62p, PAC-1 and CD42b in the ITP group were lower in ITP group than those in the normal control and ITP-CR groups. The expression level of PAC-1 was lower in the ITP-CR and normal control groups. No differences were identified in CD62p and CD42b expression levels. Following ATP activation, CD62p, PAC-1 and CD42b expression in the ITP group was lower than that in the normal control and ITP-CR groups. PAC-1 expression was lower while CD62p expression was higher in the ITP-CR group compared to the normal control group. In conclusion, the activation of platelets in ITP children was low. Decreased platelet function, platelet parameters and platelet glycoproteins may be used as markers for monitoring the treatment efficacy in ITP children. PMID:27431926

  5. Monitoring Services to Children: Title XX

    ERIC Educational Resources Information Center

    Black Child Development Institute

    1977-01-01

    The proliferation of State offices of child development and the advent of Social Security Title XX funds have been accompanied by confusion at every level of government and in the black community. The impact of these developments on availability of good day care for children is examined and recommendations are made. (Author/AM)

  6. Early clearance of Chikungunya virus in children is associated with a strong innate immune response.

    PubMed

    Simarmata, Diane; Ng, David Chun Ern; Kam, Yiu-Wing; Lee, Bernett; Sum, Magdline Sia Henry; Her, Zhisheng; Chow, Angela; Leo, Yee-Sin; Cardosa, Jane; Perera, David; Ooi, Mong H; Ng, Lisa F P

    2016-01-01

    Chikungunya fever (CHIKF) is a global infectious disease which can affect a wide range of age groups. The pathological and immunological response upon Chikungunya virus (CHIKV) infection have been reported over the last few years. However, the clinical profile and immune response upon CHIKV infection in children remain largely unknown. In this study, we analyzed the clinical and immunological response, focusing on the cytokine/chemokine profile in a CHIKV-infected pediatric cohort from Sarawak, Malaysia. Unique immune mediators triggered upon CHIKV infection were identified through meta-analysis of the immune signatures between this pediatric group and cohorts from previous outbreaks. The data generated from this study revealed that a broad spectrum of cytokines/chemokines is up-regulated in a sub-group of virus-infected children stratified according to their viremic status during hospitalization. Furthermore, different immune mediator profiles (the levels of pro-inflammatory cytokines, chemokines and growth and other factors) were observed between children and adults. This study gives an important insight to understand the immune response of CHIKV infection in children and would aid in the development of better prognostics and clinical management for children. PMID:27180811

  7. Early clearance of Chikungunya virus in children is associated with a strong innate immune response

    PubMed Central

    Simarmata, Diane; Ng, David Chun Ern; Kam, Yiu-Wing; Lee, Bernett; Sum, Magdline Sia Henry; Her, Zhisheng; Chow, Angela; Leo, Yee-Sin; Cardosa, Jane; Perera, David; Ooi, Mong H.; Ng, Lisa F. P.

    2016-01-01

    Chikungunya fever (CHIKF) is a global infectious disease which can affect a wide range of age groups. The pathological and immunological response upon Chikungunya virus (CHIKV) infection have been reported over the last few years. However, the clinical profile and immune response upon CHIKV infection in children remain largely unknown. In this study, we analyzed the clinical and immunological response, focusing on the cytokine/chemokine profile in a CHIKV-infected pediatric cohort from Sarawak, Malaysia. Unique immune mediators triggered upon CHIKV infection were identified through meta-analysis of the immune signatures between this pediatric group and cohorts from previous outbreaks. The data generated from this study revealed that a broad spectrum of cytokines/chemokines is up-regulated in a sub-group of virus-infected children stratified according to their viremic status during hospitalization. Furthermore, different immune mediator profiles (the levels of pro-inflammatory cytokines, chemokines and growth and other factors) were observed between children and adults. This study gives an important insight to understand the immune response of CHIKV infection in children and would aid in the development of better prognostics and clinical management for children. PMID:27180811

  8. Immunizations

    MedlinePlus

    ... How Can I Help a Friend Who Cuts? Immunizations KidsHealth > For Teens > Immunizations Print A A A ... That Shot? en español Las vacunas Why Are Vaccinations Important? Measles, mumps, and whooping cough may seem ...

  9. Benefits from immunization during the vaccines for children program era - United States, 1994-2013.

    PubMed

    Whitney, Cynthia G; Zhou, Fangjun; Singleton, James; Schuchat, Anne

    2014-04-25

    The Vaccines for Children (VFC) program was created by the Omnibus Budget Reconciliation Act of 1993 and first implemented in 1994. VFC was designed to ensure that eligible children do not contract vaccine-preventable diseases because of inability to pay for vaccine and was created in response to a measles resurgence in the United States that resulted in approximately 55,000 cases reported during 1989-1991. The resurgence was caused largely by widespread failure to vaccinate uninsured children at the recommended age of 12-15 months. To summarize the impact of the U.S. immunization program on the health of all children (both VFC-eligible and not VFC-eligible) who were born during the 20 years since VFC began, CDC used information on immunization coverage from the National Immunization Survey (NIS) and a previously published cost-benefit model to estimate illnesses, hospitalizations, and premature deaths prevented and costs saved by routine childhood vaccination during 1994-2013. Coverage for many childhood vaccine series was near or above 90% for much of the period. Modeling estimated that, among children born during 1994- 2013, vaccination will prevent an estimated 322 million illnesses, 21 million hospitalizations, and 732,000 deaths over the course of their lifetimes, at a net savings of $295 billion in direct costs and $1.38 trillion in total societal costs. With support from the VFC program, immunization has been a highly effective tool for improving the health of U.S. children. PMID:24759657

  10. Benefits from immunization during the vaccines for children program era - United States, 1994-2013.

    PubMed

    Whitney, Cynthia G; Zhou, Fangjun; Singleton, James; Schuchat, Anne

    2014-04-25

    The Vaccines for Children (VFC) program was created by the Omnibus Budget Reconciliation Act of 1993 and first implemented in 1994. VFC was designed to ensure that eligible children do not contract vaccine-preventable diseases because of inability to pay for vaccine and was created in response to a measles resurgence in the United States that resulted in approximately 55,000 cases reported during 1989-1991. The resurgence was caused largely by widespread failure to vaccinate uninsured children at the recommended age of 12-15 months. To summarize the impact of the U.S. immunization program on the health of all children (both VFC-eligible and not VFC-eligible) who were born during the 20 years since VFC began, CDC used information on immunization coverage from the National Immunization Survey (NIS) and a previously published cost-benefit model to estimate illnesses, hospitalizations, and premature deaths prevented and costs saved by routine childhood vaccination during 1994-2013. Coverage for many childhood vaccine series was near or above 90% for much of the period. Modeling estimated that, among children born during 1994- 2013, vaccination will prevent an estimated 322 million illnesses, 21 million hospitalizations, and 732,000 deaths over the course of their lifetimes, at a net savings of $295 billion in direct costs and $1.38 trillion in total societal costs. With support from the VFC program, immunization has been a highly effective tool for improving the health of U.S. children.

  11. Immune Monitoring in Cancer Vaccine Clinical Trials: Critical Issues of Functional Flow Cytometry-Based Assays

    PubMed Central

    Urbani, Francesca; Proietti, Enrico

    2013-01-01

    The development of immune monitoring assays is essential to determine the immune responses against tumor-specific antigens (TSAs) and tumor-associated antigens (TAAs) and their possible correlation with clinical outcome in cancer patients receiving immunotherapies. Despite the wide range of techniques used, to date these assays have not shown consistent results among clinical trials and failed to define surrogate markers of clinical efficacy to antitumor vaccines. Multiparameter flow cytometry- (FCM-) based assays combining different phenotypic and functional markers have been developed in the past decade for informative and longitudinal analysis of polyfunctional T-cells. These technologies were designed to address the complexity and functional heterogeneity of cancer biology and cellular immunity and to define biomarkers predicting clinical response to anticancer treatment. So far, there is still a lack of standardization of some of these immunological tests. The aim of this review is to overview the latest technologies for immune monitoring and to highlight critical steps involved in some of the FCM-based cellular immune assays. In particular, our laboratory is focused on melanoma vaccine research and thus our main goal was the validation of a functional multiparameter test (FMT) combining different functional and lineage markers to be applied in clinical trials involving patients with melanoma. PMID:24195078

  12. Cell-Mediated Immune Responses in Four-Year-Old Children after Primary Immunization with Acellular Pertussis Vaccines

    PubMed Central

    Ausiello, Clara M.; Lande, Roberto; Urbani, Francesca; la Sala, Andrea; Stefanelli, Paola; Salmaso, Stefania; Mastrantonio, Paola; Cassone, Antonio

    1999-01-01

    Cell-mediated immune (CMI) responses to Bordetella pertussis antigens (pertussis toxin [PT], pertactin [PRN], and filamentous hemagglutinin [FHA]) were assessed in 48-month-old recipients of acellular pertussis [aP] vaccines (either from Chiron-Biocine [aP-CB] or from SmithKline Beecham [aP-SB]) and compared to CMI responses to the same antigens at 7 months of age, i.e., 1 month after completion of the primary immunization cycle. None of the children enrolled in this study received any booster of pertussis vaccines or was affected by pertussis during the whole follow-up period. Overall, around 75% of 4-year-old children showed a CMI-positive response to at least one B. pertussis antigen, independently of the type of aP vaccine received, and the proportion of CMI responders were at least equal at 48 and 7 months of age. However, longitudinal examination of individual responses showed that from 20 (against PT) to 37% (against FHA) of CMI responders after primary immunization became negative at 48 months of age. This loss was more than compensated for by conversion to positive CMI responses, ranging from 36% against FHA to 69% against PRN, in other children who were CMI negative at 7 months of age. In 60 to 80% of these CMI converters, a lack of decline or even marked elevation of antibody (Ab) titers against B. pertussis antigens also occurred between 20 and 48 months of age. In particular, the frequency of seropositivity to PRN and FHA (but not to PT) was roughly three times higher in CMI converters than in nonconverters. The acquisition of CMI response to B. pertussis antigens in 48-month-old children was not associated with a greater frequency of coughing episodes lasting ≥7 days and was characterized by a prevalent type 1 cytokine profile, with high gamma interferon and low or no production of interleukin-5, reminiscent of cytokine patterns following immunization with whole-cell pertussis vaccine or natural infection. Our data imply that vaccination

  13. Delayed adaptive immunity is related to higher MMR vaccine-induced antibody titers in children.

    PubMed

    Strömbeck, Anna; Lundell, Anna-Carin; Nordström, Inger; Andersson, Kerstin; Adlerberth, Ingegerd; Wold, Agnes E; Rudin, Anna

    2016-04-01

    There are notable inter-individual variations in vaccine-specific antibody responses in vaccinated children. The aim of our study was to investigate whether early-life environmental factors and adaptive immune maturation prior and close to measles-mumps-rubella (MMR) immunization relate to magnitudes of vaccine-specific antibody titers. In the FARMFLORA birth cohort, including both farming and non-farming families, children were immunized with the MMR vaccine at 18 months of age. MMR vaccine-induced antibody titers were measured in plasma samples obtained at 36 months of age. Infants' blood samples obtained at birth, 3-5 days and at 4 and 18 months of age were analyzed for T- and B-cell numbers, proportions of naive and memory T and B cells, and fractions of putative regulatory T cells. Multivariate factor analyses show that higher anti-MMR antibody titers were associated with a lower degree of adaptive immune maturation, that is, lower proportions of memory T cells and a lower capacity of mononuclear cells to produce cytokines, but with higher proportions of putative regulatory T cells. Further, children born by cesarean section (CS) had significantly higher anti-measles titers than vaginally-born children; and CS was found to be associated with delayed adaptive immunity. Also, girls presented with significantly higher anti-mumps and anti-rubella antibody levels than boys at 36 months of age. These results indicate that delayed adaptive immune maturation before and in close proximity to immunization seems to be advantageous for the ability of children to respond with higher anti-MMR antibody levels after vaccination.

  14. Delayed adaptive immunity is related to higher MMR vaccine-induced antibody titers in children.

    PubMed

    Strömbeck, Anna; Lundell, Anna-Carin; Nordström, Inger; Andersson, Kerstin; Adlerberth, Ingegerd; Wold, Agnes E; Rudin, Anna

    2016-04-01

    There are notable inter-individual variations in vaccine-specific antibody responses in vaccinated children. The aim of our study was to investigate whether early-life environmental factors and adaptive immune maturation prior and close to measles-mumps-rubella (MMR) immunization relate to magnitudes of vaccine-specific antibody titers. In the FARMFLORA birth cohort, including both farming and non-farming families, children were immunized with the MMR vaccine at 18 months of age. MMR vaccine-induced antibody titers were measured in plasma samples obtained at 36 months of age. Infants' blood samples obtained at birth, 3-5 days and at 4 and 18 months of age were analyzed for T- and B-cell numbers, proportions of naive and memory T and B cells, and fractions of putative regulatory T cells. Multivariate factor analyses show that higher anti-MMR antibody titers were associated with a lower degree of adaptive immune maturation, that is, lower proportions of memory T cells and a lower capacity of mononuclear cells to produce cytokines, but with higher proportions of putative regulatory T cells. Further, children born by cesarean section (CS) had significantly higher anti-measles titers than vaginally-born children; and CS was found to be associated with delayed adaptive immunity. Also, girls presented with significantly higher anti-mumps and anti-rubella antibody levels than boys at 36 months of age. These results indicate that delayed adaptive immune maturation before and in close proximity to immunization seems to be advantageous for the ability of children to respond with higher anti-MMR antibody levels after vaccination. PMID:27195118

  15. Rotavirus-associated immune thrombocytopenic purpura in children: A retrospective study

    PubMed Central

    Ai, Qi; Yin, Jing; Chen, Sen; Qiao, Lijin; Luo, Na

    2016-01-01

    Certain studies have previously indicated that an association may exist between rotavirus infection and primary immune thrombocytopenic purpura (ITP). The present retrospective study aimed to investigate whether rotavirus may cause ITP in children. Firstly, the incidence of ITP in children with or without rotavirus diarrhea was compared. A 14.58% incident rate was observed in children with rotavirus diarrhea compared with a 7.22% incident rate in children without rotavirus diarrhea. Subsequently, the clinical features of ITP children with or without rotavirus infection were compared. The results indicated that ITP children with rotavirus infection were significantly younger, showed significantly decreased mean platelet volume (MPV) levels and presented a significantly higher frequency of bleeding score of 3 against ITP children without rotavirus infection. In conclusion, these findings suggest that rotavirus serves a causative role in ITP.

  16. Group I metabotropic glutamate receptor mediated dynamic immune dysfunction in children with fragile X syndrome

    PubMed Central

    2014-01-01

    Background Fragile X syndrome (FXS) is the leading cause of inheritable intellectual disability in male children, and is predominantly caused by a single gene mutation resulting in expanded trinucleotide CGG-repeats within the 5’ untranslated region of the fragile X mental retardation (FMR1) gene. Reports have suggested the presence of immune dysregulation in FXS with evidence of altered plasma cytokine levels; however, no studies have directly assessed functional cellular immune responses in children with FXS. In order to ascertain if immune dysregulation is present in children with FXS, dynamic cellular responses to immune stimulation were examined. Methods Peripheral blood mononuclear cells (PBMC) were from male children with FXS (n = 27) and from male aged-matched typically developing (TD) controls (n = 8). PBMC were cultured for 48 hours in media alone or with lipopolysaccharides (LPS; 1 μg/mL) to stimulate the innate immune response or with phytohemagglutinin (PHA; 8 μg/mL) to stimulate the adaptive T-cell response. Additionally, the group I mGluR agonist, DHPG, was added to cultures to ascertain the role of mGluR signaling in the immune response in subject with FXS. Supernatants were harvested and cytokine levels were assessed using Luminex multiplexing technology. Results Children with FXS displayed similar innate immune response following challenge with LPS alone when compared with TD controls; however, when LPS was added in the presence of a group I mGluR agonist, DHPG, increased immune response were observed in children with FXS for a number of pro-inflammatory cytokines including IL-6 (P = 0.02), and IL-12p40 (P < 0.01). Following PHA stimulation, with or without DHPG, no significant differences between subjects with FXS and TD were seen. Conclusions In unstimulated cultures, subjects with FXS did not display altered dynamic immune response to LPS or PHA alone; however, subjects with FXS showed an altered response to co

  17. Reasons for non-immunization of children in an urban, low income group in North India.

    PubMed

    Mathew, Joseph L; Babbar, Harsh; Yadav, Sangita

    2002-07-01

    A study was undertaken on 500 children under the age of 5 years belonging to a low income group. All were attending the paediatrics outpatient department of a large teaching hospital in New Delhi, India. Only 25% were found to have received complete primary immunization as per the National Immunization Schedule (bacille Calmette-Guérin at birth, three doses of diphtheria, pertussis and tetanus and oral poliovirus vaccine at 6,10 and 14 weeks and measles vaccine at 9 months). The major reasons for non-immunization of the children were: migration to a native village (26.4%); domestic problems (9.6%); the immunization centre was located too far from their home (9.6%); and the child was unwell when the vaccination was due (9%). Twelve per cent of mothers could not give any reason for non-immunization. In addition to the migration of children to rural areas, the other significant finding was an indirect effect of intensive OPV administration as part of polio eradication initiative. The lack of awareness and fear of side effects constituted a small minority of reasons for non-immunization.

  18. Time Monitoring and Executive Functioning in Children and Adults

    ERIC Educational Resources Information Center

    Mantyla, Timo; Carelli, Maria Grazia; Forman, Helen

    2007-01-01

    This study examined time-based prospective memory performance in relation to individual and developmental differences in executive functioning. School-age children and young adults completed six experimental tasks that tapped three basic components of executive functioning: inhibition, updating, and mental shifting. Monitoring performance was…

  19. Audiovisual Vowel Monitoring and the Word Superiority Effect in Children

    ERIC Educational Resources Information Center

    Fort, Mathilde; Spinelli, Elsa; Savariaux, Christophe; Kandel, Sonia

    2012-01-01

    The goal of this study was to explore whether viewing the speaker's articulatory gestures contributes to lexical access in children (ages 5-10) and in adults. We conducted a vowel monitoring task with words and pseudo-words in audio-only (AO) and audiovisual (AV) contexts with white noise masking the acoustic signal. The results indicated that…

  20. Immunity of PCB transplacental Yu-Cheng children in Taiwan

    SciTech Connect

    Lan, Shou Jen; Yen, Yea Yin; Chen, Eng Rin; Ko, Ying Chin ); Lan, Joung Liang )

    1990-02-01

    Up to now, there has been no studies about the immune status of PCB transplacental Yu-Cheng babies. In an earlier study, Yu-Cheng babies were reported to have a high infant mortality rate. It was reported that these babies would easily catch cold, experience diarrhea and abdominal pains. Recently, it was found that the bronchitis rate of Yu-Cheng babies is higher than in control babies. Because of high risk of infection, it is presumed that these babies might suffer immunosuppression to a certain extent. According to these findings, investigations into the immune functions of PCB transplacental Yu-Cheng babies are needed.

  1. Family Adversity and Autonomic Reactivity Association With Immune Changes in HIV-Affected School Children

    PubMed Central

    Thomas, Melanie; Wara, Diane; Saxton, Katherine; Truskier, Mary; Chesney, Margaret; Boyce, W. Thomas

    2013-01-01

    Objective To explore whether primary school entry is associated with changes in immune system parameters in HIV-affected children. HIV-affected children are vulnerable to psychosocial stressors, regardless of their own HIV serological status. Methods Data from 38 HIV+ and 29 HIV− children born to seropositive women were obtained before and after school entry. Measures included family adversity questionnaires, autonomic nervous system (ANS) reactivity (based on mean arterial responses to challenge tasks), and enumerative and functional changes in peripheral blood immune parameters. Results In comparison to children who were HIV−, children who were HIV+ at baseline had fewer CD4+ T lymphocytes (M = 916 vs. 1206 cells/mm3 × 103; F = 7.8, p = .007), more CD8+ cells (M = 1046 vs. 720 cells/mm3 ×103; F = 7.98, p = .006), and diminished NK cell cytotoxicity (M =−.29 vs. .41; F = 8.87, p = .004). School entry was associated with changes in immune parameters, but HIV status was not associated with the magnitude of changes. Changes in immune parameters following school entry were associated with family stress and pre school entry ANS reactivity. Highly ANS reactive children had either the greatest increase in CD8+ cells following school entry or the greatest decrease, depending upon reported levels of family adversity (B = 215.35; t = 3.74, p < .001). Changes in functional immune assays were significantly associated with the interactions between HIV status and ANS reactivity. Conclusions These results suggest that autonomic reactivity is associated with increased immunological sensitivity to adverse or challenging social contexts among children affected by HIV. PMID:23766380

  2. Waning of vaccine-induced immunity to measles in kidney transplanted children.

    PubMed

    Rocca, Salvatore; Santilli, Veronica; Cotugno, Nicola; Concato, Carlo; Manno, Emma Concetta; Nocentini, Giulia; Macchiarulo, Giulia; Cancrini, Caterina; Finocchi, Andrea; Guzzo, Isabella; Dello Strologo, Luca; Palma, Paolo

    2016-09-01

    Vaccine-preventable diseases are a significant cause of morbidity and mortality in solid organ transplant recipients who undergo immunosuppression after transplantation. Data on immune responses and long-term maintenance after vaccinations in such population are still limited.We cross-sectionally evaluated the maintenance of immune response to measles vaccine in kidney transplanted children on immunosuppressive therapy. Measles-specific enzyme-linked immunosorbent assay and B-cell enzyme-linked immunosorbent spot were performed in 74 kidney transplant patients (Tps) and in 23 healthy controls (HCs) previously vaccinated and tested for humoral protection against measles. The quality of measles antibody response was measured by avidity test. B-cell phenotype, investigated via flow cytometry, was further correlated to the ability of Tps to maintain protective humoral responses to measles over time.We observed the loss of vaccine-induced immunity against measles in 19% of Tps. Nonseroprotected children showed signs of impaired B-cell distribution as well as immune senescence and lower antibody avidity. We further reported as time elapsed between vaccination and transplantation, as well as the vaccine administration during dialysis are clinical factors affecting the maintenance of the immune memory response against measles.Tps present both quantitative and qualitative alterations in the maintenance of protective immunity to measles vaccine. Prospective studies are needed to optimize the vaccination schedules in kidney transplant recipients in order to increase the immunization coverage over time in this population. PMID:27631222

  3. Acute psychosis in children: do not miss immune-mediated causes.

    PubMed

    AlHakeem, Afnan S; Mekki, Mohamed S; AlShahwan, Saad M; Tabarki, Brahim M

    2016-07-01

    New-onset psychosis in children represents a complex presenting symptom. Psychosis can be attributable to a combination of factors and etiologies, and all possible causes must be systematically examined. There is growing evidence that a proportion of psychosis/ psychiatric manifestations in children may be immunemediated, and physicians should consider this etiology in each presentation of first-episode psychosis. Immunemediated encephalopathies/encephalitis are increasingly being recognized in children with antibodies to N-methyl-D-aspartate receptor, Leucine-rich gliomainactivated 1 or other central nervous system antigens such as Contactin-associated protein-like 2, glutamic acid decarboxylase, alpha-amino-3-hydroxy-5-methyl-4isoxazolepropionic acid or Gamma-aminobutyric acid B. In this study, we describe 3 cases of immune-mediated encephalopathy/encephalitis with prominent psychiatric symptoms at presentation, and suggest a practical diagnostic and treatment approach for children with acute psychosis of an immune-mediated cause. PMID:27356658

  4. Hepatitis B Immunization Coverage Among Vietnamese-American Children 3 to 18 Years Old

    PubMed Central

    Jenkins, Christopher N. H.; McPhee, Stephen J.; Wong, Ching; Nguyen, Thoa; Euler, Gary L.

    2006-01-01

    Objective Persons with chronic hepatitis B virus (HBV) infection are at increased risk of chronic hepatitis, cirrhosis, and liver cancer. Although HBV infection is relatively uncommon in the United States, the disease is endemic in persons born in Southeast Asia, including Vietnamese-Americans. Current US infant immunization recommendations and state-mandated school-entry programs have left many nontargeted age-cohorts unvaccinated and at risk of infection. To assess the need for catch-up hepatitis B immunizations, this study reports the hepatitis B immunization rates of Vietnamese-American children 3 to 18 years old living in the metropolitan areas of Houston and Dallas, Texas, and the Washington, DC, area. Design We conducted 1508 telephone interviews with random samples of Vietnamese households in each of the 3 study sites. We asked for hepatitis B immunization dates for a randomly selected child in each household. Attempts were made to verify immunization dates through direct contact with each child’s providers. Low and high estimates of coverage were calculated using reports from providers when reached (n = 720) and for the entire sample (n = 1508). Results Rates of having 3 hepatitis B vaccinations ranged from 13.6% (entire sample) to 24.1% (provider reports, Dallas), 10.3% to 26.4% (Houston), and 18.1% to 37.8% (Washington, DC). Children living in the Texas sites, older children, children whose families had lived in the United States for a longer time, and children whose provider was Vietnamese or who had an institutional provider were less likely to have been immunized. The odds of being immunized were greater, however, for children who had had at least 1 diphtheria, tetanus toxoid, and pertussis shot, and whose parents had heard about HBV infection, and were married. Conclusions The low rates of hepatitis B vaccine coverage among children and adolescents portend a generation which, too old to benefit from infant programs and school entry laws, will grow

  5. Monitoring of health care personnel employee and occupational health immunization program practices in the United States.

    PubMed

    Carrico, Ruth M; Sorrells, Nikka; Westhusing, Kelly; Wiemken, Timothy

    2014-01-01

    Recent studies have identified concerns with various elements of health care personnel immunization programs, including the handling and management of the vaccine. The purpose of this study was to assess monitoring processes that support evaluation of the care of vaccines in health care settings. An 11-question survey instrument was developed for use in scripted telephone surveys. State health departments in all 50 states in the United States and the District of Columbia were the target audience for the surveys. Data from a total of 47 states were obtained and analyzed. No states reported an existing monitoring process for evaluation of health care personnel immunization programs in their states. Our assessment indicates that vaccine evaluation processes for health care facilities are rare to nonexistent in the United States. Identifying existing practice gaps and resultant opportunities for improvements may be an important safety initiative that protects patients and health care personnel.

  6. Relationship between cytomegalovirus (CMV) reactivation, CMV-driven immunity, overall immune recovery and graft-versus-leukaemia effect in children.

    PubMed

    Jeljeli, Mohamed; Guérin-El Khourouj, Valérie; Porcher, Raphael; Fahd, Mony; Leveillé, Sandrine; Yakouben, Karima; Ouachée-Chardin, Marie; LeGoff, Jerome; Cordeiro, Debora Jorge; Pédron, Beatrice; Baruchel, Andre; Dalle, Jean-Hugues; Sterkers, Ghislaine

    2014-07-01

    The interplay between immune recovery, cytomegalovirus (CMV)-reactivation, CMV-driven immunity and graft-versus-leukaemia effect (GVL) was analysed in 108 children (median age: 8 years) who underwent haematopoietic-stem cell transplantation (HSCT) for acute leukaemia. Follow-up was 2 years unless death or relapse occurred. CMV-polymerase chain reaction (PCR) was programmed weekly until month +3 post-HSCT. Immunomonitoring consisted of sequential lymphocyte subset enumerations and analyses of T-cell proliferative and γ-interferon responses to CMV and to adenovirus. In the 108 recipients, the 2-year relapse rate (RR) was 25% (median time to onset 4·5 months; range: 24 d-17 months). CMV reactivation occurrence was 31% (median time to onset 26 d). Donor/recipient CMV serostatus did not influence RR. Among the 89 recipients disease-free after day +120, i) early CMV-reactivation before day +30 was more frequent (P = 0·01) in the relapse recipient group opposed to the non-relapse group. ii) CD8(+) /CD28(-) and CD4(+) CD45RA(-) T-cell expansions induced by CMV did not influence RR, iii) Recovery of anti-CMV and also anti-adenovirus immunity and of naïve CD4(+) T-cells was faster in the non-relapse group (P = 0·008; 0·009 and 0·002 respectively). In contrast to adult acute myeloid leukaemia, CMV reactivation was associated with increased RR in this paediatric series. Accelerated overall immune recovery rather than CMV-driven immunity had a favourable impact on RR.

  7. The Immune System in Children with Malnutrition—A Systematic Review

    PubMed Central

    Rytter, Maren Johanne Heilskov; Kolte, Lilian; Briend, André; Friis, Henrik; Christensen, Vibeke Brix

    2014-01-01

    Background Malnourished children have increased risk of dying, with most deaths caused by infectious diseases. One mechanism behind this may be impaired immune function. However, this immune deficiency of malnutrition has not previously been systematically reviewed. Objectives To review the scientific literature about immune function in children with malnutrition. Methods A systematic literature search was done in PubMed, and additional articles identified in reference lists and by correspondence with experts in the field. The inclusion criteria were studies investigating immune parameters in children aged 1–60 months, in relation to malnutrition, defined as wasting, underweight, stunting, or oedematous malnutrition. Results The literature search yielded 3402 articles, of which 245 met the inclusion criteria. Most were published between 1970 and 1990, and only 33 after 2003. Malnutrition is associated with impaired gut-barrier function, reduced exocrine secretion of protective substances, and low levels of plasma complement. Lymphatic tissue, particularly the thymus, undergoes atrophy, and delayed-type hypersensitivity responses are reduced. Levels of antibodies produced after vaccination are reduced in severely malnourished children, but intact in moderate malnutrition. Cytokine patterns are skewed towards a Th2-response. Other immune parameters seem intact or elevated: leukocyte and lymphocyte counts are unaffected, and levels of immunoglobulins, particularly immunoglobulin A, are high. The acute phase response appears intact, and sometimes present in the absence of clinical infection. Limitations to the studies include their observational and often cross-sectional design and frequent confounding by infections in the children studied. Conclusion The immunological alterations associated with malnutrition in children may contribute to increased mortality. However, the underlying mechanisms are still inadequately understood, as well as why different types of

  8. A vaccine study design selection framework for the postlicensure rapid immunization safety monitoring program.

    PubMed

    Baker, Meghan A; Lieu, Tracy A; Li, Lingling; Hua, Wei; Qiang, Yandong; Kawai, Alison Tse; Fireman, Bruce H; Martin, David B; Nguyen, Michael D

    2015-04-15

    The Postlicensure Rapid Immunization Safety Monitoring Program, the vaccination safety monitoring component of the US Food and Drug Administration's Mini-Sentinel project, is currently the largest cohort in the US general population for vaccine safety surveillance. We developed a study design selection framework to provide a roadmap and description of methods that may be utilized to evaluate potential associations between vaccines and health outcomes of interest in the Postlicensure Rapid Immunization Safety Monitoring Program and other systems using administrative data. The strengths and weaknesses of designs for vaccine safety monitoring, including the cohort design, the case-centered design, the risk interval design, the case-control design, the self-controlled risk interval design, the self-controlled case series method, and the case-crossover design, are described and summarized in tabular form. A structured decision table is provided to aid in planning of future vaccine safety monitoring activities, and the data components comprising the structured decision table are delineated. The study design selection framework provides a starting point for planning vaccine safety evaluations using claims-based data sources.

  9. Mechanisms of immune tolerance to allergens in children.

    PubMed

    Kucuksezer, Umut C; Ozdemir, Cevdet; Akdis, Mübeccel; Akdis, Cezmi A

    2013-12-01

    Because the prevalence of allergic diseases has significantly increased in recent years, understanding the causes and mechanisms of these disorders is of high importance, and intense investigations are ongoing. Current knowledge pinpoints immune tolerance mechanisms as indispensable for healthy immune response to allergens in daily life. It is evident that development and maintenance of allergens-pecific T cell tolerance is of vital importance for a healthy immune response to allergens. Such tolerance can be gained spontaneously by dose-dependent exposures to allergens in nature or by allergen-specific immunotherapy. Allergen-specific immunotherapy induces regulatory T cells with the capacity to secrete interleukin-10 and transforming growth factor-β, limits activation of effector cells of allergic inflammation (such as mast cells and basophils), and switches antibody isotype from IgE to the noninflammatory type IgG4. Although allergen-specific immunotherapy is the only method of tolerance induction in allergic individuals, several factors, such as long duration of treatment, compliance problems, and life-threatening side effects, have limited widespread applicability of this immunomodulatory treatment. To overcome these limitations, current research focuses on the introduction of allergens in more efficient and safer ways. Defining the endotypes and phenotypes of allergic diseases might provide the ability to select ideal patients, and novel biomarkers might ensure new custom-tailored therapy modalities.

  10. Mechanisms of immune tolerance to allergens in children

    PubMed Central

    Kucuksezer, Umut C.; Ozdemir, Cevdet; Akdis, Mübeccel

    2013-01-01

    Because the prevalence of allergic diseases has significantly increased in recent years, understanding the causes and mechanisms of these disorders is of high importance, and intense investigations are ongoing. Current knowledge pinpoints immune tolerance mechanisms as indispensable for healthy immune response to allergens in daily life. It is evident that development and maintenance of allergens-pecific T cell tolerance is of vital importance for a healthy immune response to allergens. Such tolerance can be gained spontaneously by dose-dependent exposures to allergens in nature or by allergen-specific immunotherapy. Allergen-specific immunotherapy induces regulatory T cells with the capacity to secrete interleukin-10 and transforming growth factor-β, limits activation of effector cells of allergic inflammation (such as mast cells and basophils), and switches antibody isotype from IgE to the noninflammatory type IgG4. Although allergen-specific immunotherapy is the only method of tolerance induction in allergic individuals, several factors, such as long duration of treatment, compliance problems, and life-threatening side effects, have limited widespread applicability of this immunomodulatory treatment. To overcome these limitations, current research focuses on the introduction of allergens in more efficient and safer ways. Defining the endotypes and phenotypes of allergic diseases might provide the ability to select ideal patients, and novel biomarkers might ensure new custom-tailored therapy modalities. PMID:24416044

  11. Interaction of Socioeconomic Status and Provider Practices as Predictors of Immunization Coverage in Virginia Children.

    ERIC Educational Resources Information Center

    Williams, Ian T.; And Others

    1995-01-01

    Found that beginning the immunization schedule at the recommended age was crucial to appropriate vaccination later in life, and that health provider practices (such as failure to administer vaccinations simultaneously) were important predictors of underimmunization. Serious delays in vaccine administration were observed for poor children in all…

  12. Maternal determinants of complete child immunization among children aged 12-23 months in a southern district of Nigeria.

    PubMed

    Fatiregun, Akinola Ayoola; Okoro, Anselm O

    2012-01-17

    This study was conducted to identify determinants of complete immunization status among children aged 12-23 months in a southern district of Nigeria. The World Health Organization cluster survey was used to evaluate immunization coverage of infants. Mothers of 525 children selected by the two-stage sampling method and interviewed using an adapted questionnaire responded. Completion of the immunization schedule was verified by an immunization card or by reported history indicating that the child had received full doses of four of the antigens included in the Nigeria routine immunization schedule. Multivariate logistic regression was used to identify factors associated with completion of immunization. Only 32.4% of children had completed the immunization schedule. Determinants of complete immunization status included a maternal age less than 30 years (AOR=2.26, 95% CI:1.27-4.03), availability of an immunization card at first contact (AOR=7.72, 95% CI:4.43-13.44), fewer than three children (AOR=2.22, 95% CI:11.1-4.42), completion of post secondary education (AOR=2.34, 95% CI:1.12-4.47) and maternal unemployment (AOR=1.71, 95% CI:1.01-2.89). Identifying mothers whose children are at risk of not completing the immunization schedule and educating them is an important strategy to improve antigen coverage and prevent early childhood deaths from diseases like tuberculosis, poliomyelitis, tetanus, diphtheria, pertussis and measles. PMID:22137878

  13. [Functional state of specific immunity in children and teenagers vaccinated against mumps].

    PubMed

    Otrashevskaia, E V; Bukin, E K; Krasil'nikov, I V; Ignat'ev, G M

    2010-01-01

    The functional state of immunity was evaluated from the avidity index (AI) of specific antibodies (IgG) and the level and spectrum of their neutralizing activity. The study recruited 200 subjects immunized with Russian vaccine against mumps according to the mandatory scheme. A group of vaccinees with a low AI of specific IgG was identified mainly among old children and teenagers. The vaccinees with a low AI had a significantly lower protective immunity (as shown from the level and spectrum of serum neutralizing activity) than those with a high AI. The vacinees with no humoral, incomplete, or complete postvaccination immunity, but with a low AI of specific IgG, can constitute a population stratum that preserves sensitivity to wild-type mumps viruses and serves as a favorable medium for their circulation.

  14. Humoral immune response of dengue hemorrhagic fever cases in children from Tegucigalpa, Honduras.

    PubMed

    De Rivera, Ivette Lorenzana; Parham, Leda; Murillo, Wendy; Moncada, Walter; Vazquez, Susana

    2008-08-01

    The humoral immune response in Honduran dengue hemorrhagic fever (DHF) hospitalized pediatric cases from the epidemics of 2004 and 2005 was studied in sera collected from 5 to 7 days of fever onset. A total of 145 cases were included in the study: 40 classified as primary with DHF Grade I or II and 86 classified as secondary; from them, 73 were DHF Grade I or II and 13 were dengue shock syndrome (DSS) Grade III or IV. The highest number of primary cases was found in children < 1 year of age. The highest number of secondary cases was observed in children between 5 and 10 years of age. The IgA values showed a statistically significant difference between primary and secondary groups. The relationship between antibody responses and severity grade is discussed. This is the first study related to the humoral immune response and severity grade in DHF cases in Honduran children.

  15. Characterization of the immune inflammatory profile in obese asthmatic children.

    PubMed

    Magrone, Thea; Simone, Maria; Altamura, Maria; Munno, Irene

    2014-01-01

    Asthma and obesity are two common disorders often associated in children and characterized by an inflammatory status. Growing evidences support a connection between obesity and asthma since weight reduction can improve asthmatic symptoms. In this study, we have enrolled eighty children: 17 non asthmatics and non obese, 19 obese, 28 asthmatics-obese and, 16 asthmatics non-obese, respectively. In all participants, respiratory functional tests and body mass index (BMI) were calculated. Moreover, systemic inflammation of biomarkers such as T helper (h)1-type, Th2-type and T regulatory-type serum cytokines along with major adipokines was determined. Data will show that the association between asthma and obesity leads to a predominant Th1-type response with an increase in pro-inflammatory cytokines. This inflammatory profile in asthmatics-obese children is sustained by elevated serum levels of leptin and visfatin, while adiponectin concentration is rather diminished. Finally, levels of systemic inflammatory biomarkers positively correlate with the increase in BMI values in all population subgroups.

  16. Immune Monitoring of Trans-endothelial Transport by Kidney-Resident Macrophages.

    PubMed

    Stamatiades, Efstathios G; Tremblay, Marie-Eve; Bohm, Mathieu; Crozet, Lucile; Bisht, Kanchan; Kao, Daniela; Coelho, Carolina; Fan, Xiying; Yewdell, William T; Davidson, Anne; Heeger, Peter S; Diebold, Sandra; Nimmerjahn, Falk; Geissmann, Frederic

    2016-08-11

    Small immune complexes cause type III hypersensitivity reactions that frequently result in tissue injury. The responsible mechanisms, however, remain unclear and differ depending on target organs. Here, we identify a kidney-specific anatomical and functional unit, formed by resident macrophages and peritubular capillary endothelial cells, which monitors the transport of proteins and particles ranging from 20 to 700 kDa or 10 to 200 nm into the kidney interstitium. Kidney-resident macrophages detect and scavenge circulating immune complexes "pumped" into the interstitium via trans-endothelial transport and trigger a FcγRIV-dependent inflammatory response and the recruitment of monocytes and neutrophils. In addition, FcγRIV and TLR pathways synergistically "super-activate" kidney macrophages when immune complexes contain a nucleic acid. These data identify a physiological function of tissue-resident kidney macrophages and a basic mechanism by which they initiate the inflammatory response to small immune complexes in the kidney. PMID:27477514

  17. Comparative Immune Response in Children and Adults with H. pylori Infection

    PubMed Central

    Razavi, Alireza; Bagheri, Nader; Azadegan-Dehkordi, Fatemeh; Shirzad, Mahsa; Rahimian, Ghorbanali; Rafieian-Kopaei, Mahmoud; Shirzad, Hedaytollah

    2015-01-01

    Helicobacter pylori (H. pylori) infection is generally acquired during early childhood; therefore, the immune response which usually takes place at this age may influence or even determine susceptibility to the infection contributing to the clinical outcomes in adulthood. Several cytokines including IL-6, IL-10, and TGF-β1 as well as Foxp3+ cell numbers have been shown to be higher; however, some other cytokines consisting of IL-1β, IL-17A, and IL-23 are lower in infected children than in infected adults. Immune response to H. pylori infection in children is predominant Treg instead of Th17 cell response. These results indicate that immune system responses probably play a role in persistent H. pylori infection. Childhood H. pylori infection is also associated with significantly lower levels of inflammation and ulceration compared with adults. This review, therefore, aimed to provide critical findings of the available literature about comparative immune system in children and adults with H. pylori infection. PMID:26495322

  18. The Facial Affective Scale as a Predictor for Pain Unpleasantness When Children Undergo Immunizations

    PubMed Central

    Finnström, Berit; Mörelius, Evalotte

    2014-01-01

    Needle fear is a common problem in children undergoing immunization. To ensure that the individual child's needs are met during a painful procedure it would be beneficial to be able to predict whether there is a need for extra support. The self-reporting instrument facial affective scale (FAS) could have potential for this purpose. The aim of this study was to evaluate whether the FAS can predict pain unpleasantness in girls undergoing immunization. Girls, aged 11-12 years, reported their expected pain unpleasantness on the FAS at least two weeks before and then experienced pain unpleasantness immediately before each vaccination. The experienced pain unpleasantness during the vaccination was also reported immediately after each immunization. The level of anxiety was similarly assessed during each vaccination and supplemented with stress measures in relation to the procedure in order to assess and evaluate concurrent validity. The results show that the FAS is valid to predict pain unpleasantness in 11-12-year-old girls who undergo immunizations and that it has the potential to be a feasible instrument to identify children who are in need of extra support to cope with immunization. In conclusion, the FAS measurement can facilitate caring interventions. PMID:24734174

  19. Modulation of the immune response by infection with Cryptosporidium spp. in children with allergic diseases.

    PubMed

    Guangorena-Gómez, J O; Maravilla-Domínguez, A; García-Arenas, G; Cervantes-Flores, M; Meza-Velázquez, R; Rivera-Guillén, M; Acosta-Saavedra, L C; Goytia-Acevedo, R C

    2016-08-01

    It has been demonstrated that the allergic response can be ameliorated by the administration of pathogen derivatives that activate Toll-like receptors and induce a Th1-type immune response (IR). Cryptosporidium is a parasite that promotes an IR via Toll-like receptors and elicits the production of Th1-type cytokines, which limit cryptosporidiosis. The aim of this study was to investigate allergy-related immune markers in children naturally infected with Cryptosporidium. In a cross-sectional study, 49 children with or without clinical diagnosis of allergies, oocysts of Cryptosporidium spp. in the faeces were screened microscopically. We microscopically screened for leucocytes, examined T and B cells for allergy-related activation markers using flow cytometry and evaluated serum for total IgE using chemiluminescence. Children with allergies and Cryptosporidium in the faeces had significantly lower levels of total IgE, B cells, CD19(+) CD23(+) and CD19(+) CD124(+) cells as well as a greater percentage of interferon-gamma (IFN-γ(+) ) and IL-4(+) CD4(+) cells than children with allergies without Cryptosporidium. This is the first description of the modulation of the IR in children with allergic diseases in the setting of natural Cryptosporidium infection. Our findings suggest the involvement of CD4(+) cells producing IL-4 and IFN-γ in the IR to Cryptosporidium in naturally infected children. PMID:27150641

  20. Effect of season of inoculation on immune response to rubella vaccine in children.

    PubMed

    Linder, Nehama; Abudi, Yair; Abdalla, Wafa; Badir, Mursi; Amitai, Yona; Samuels, Justin; Mendelson, Ella; Levy, Itzhak

    2011-08-01

    The yearly seasons are marked by changes in the amount of sunlight. Ultraviolet radiation (UVR) is known to adversely affect the course of viral infections, immunologic memory and cellular and humoral immune responses. Our objectives were to investigate potential differences in the immune response of the rubella vaccine after 3-4 years by season of inoculation. Children aged 4-5 years attending four kindergartens in villages in northern Israel, all of whom had been vaccinated at 1 year of age, were enrolled in the study. Participants were divided into three groups by season of the year in which the inoculation was performed: summer (N = 63), winter (N = 36) and intermediate (N = 104). Main outcome measures were mean geometrical titer of rubella antibodies and complete, partial or no immunity to rubella by season of inoculation. Of the 203 children tested, 186 (91.6%) had adequate antibody levels, 7 (3.4%) had equivocal levels and 10 (4.9%) had inadequate levels. Significantly higher mean geometrical titers were found in the winter-inoculated compared with the summer-inoculated group (73.0 ± 2.6 vs 47.6 ± 2.8; p < 0.05). The same tendency was noted in the percent of infants properly immunized. This preliminary study shows a strong correlation between the immune response to rubella vaccine and the season of vaccination. Immunogenicity may be improved by inoculating children during seasons of less sunlight or by reducing the children's exposure to sunlight following inoculation. This practice is especially important in areas with extreme seasonal variability in solar radiation and tropical areas. Further studies are needed to corroborate and expand these findings. PMID:19889749

  1. Immune responses and protection in children in developing countries induced by oral vaccines.

    PubMed

    Qadri, Firdausi; Bhuiyan, Taufiqur Rahman; Sack, David A; Svennerholm, Ann-Mari

    2013-01-01

    Oral mucosal vaccines have great promise for generating protective immunity against intestinal infections for the benefit of large numbers of people especially young children. There however appears to be a caveat since these vaccines have to overcome the inbuilt resistance of mucosal surfaces and secretions to inhibit antigen stimulation and responses. Unfortunately, these vaccines are not equally immunogenic nor protective in different populations. When compared to industrialized countries, children living in developing countries appear to have lower responses, but the reasons for these lowered responses are not clearly defined. The most likely explanations relate to undernutrition, micronutrient deficiencies, microbial overload on mucosal surfaces, alteration of microbiome and microbolom and irreversible changes on the mucosa as well as maternal antibodies in serum or breast milk may alter the mucosal pathology and lower immune responses to interventions using oral vaccines. The detrimental effect of adverse environment and malnutrition may bring about irreversible changes in the mucosa of children especially in the first 1000 days of life from conception to after birth and up to two years of age. This review aims to summarize the information available on lowered immune responses to mucosal vaccines and on interventions that may help address the constraints of these vaccines when they are used for children living under the greatest stress and under harmful adverse circumstances.

  2. 24 hour blood pressure monitoring in healthy and hypertensive children.

    PubMed Central

    Reusz, G S; Hóbor, M; Tulassay, T; Sallay, P; Miltényi, M

    1994-01-01

    24 Hour ambulatory blood pressure monitoring (ABPM) was performed to provide data on the normal daily blood pressure of healthy schoolchildren and on patients with hypertension. The subjects studied were 123 healthy schoolchildren with a mean (SD) age of 12.5 (1.6) years (range 9.5-14.5 years), 24 children with borderline or mild hypertension, 17 with renal hypertension and normal renal function, 10 with chronic renal failure, and six with a renal allograft. In eight children with definite renal disease a second measurement was performed after treatment modification. The monitor used for ABPM was validated with a mercury column manometer. The mean (SD) of the signed differences of the blood pressure measured by the two methods was -0.19 (1.75) mmHg for the systolic and -0.21 (2.11) mmHg for the diastolic blood pressure (n = 60). Normal values for daytime and night time blood pressure were determined for those aged 10-14 years. The mean (SD) blood pressure of the 123 children was 109 (7)/66 (8) mmHg (systolic/diastolic) for the daytime and 96 (8)/52 (7) mmHg at night time. Of the 24 children with borderline or mild hypertension 14 had a raised blood pressure on ABPM. The circadian rhythm was disturbed in three children of this group. Even children with normal daytime blood pressure had significantly higher systolic blood pressure in the night when compared with the controls. The incidence of disturbed circadian rhythm was higher in the groups with renal hypertension (4/17 in the subgroup with normal renal function, 5/16 in the group with renal failure and/or transplantation). All children undergoing a second ABPM measurement had a lower average blood pressure after treatment adjustment. ABPM measurements were reproducible and accurate. The method provided new data on the physiological circadian variation of blood pressure in healthy children. It proved to be a helpful tool in the diagnosis of hypertension, particularly in the detection of cases of disturbance of the

  3. Correlates of Immunity to Influenza as Determined by Challenge of Children with Live, Attenuated Influenza Vaccine.

    PubMed

    Wright, Peter F; Hoen, Anne G; Ilyushina, Natalia A; Brown, Eric P; Ackerman, Margaret E; Wieland-Alter, Wendy; Connor, Ruth I; Jegaskanda, Sinthujan; Rosenberg-Hasson, Yael; Haynes, Brenda C; Luke, Catherine J; Subbarao, Kanta; Treanor, John J

    2016-04-01

    Background.  The efficacy of live, attenuated live attenuated influenza vaccine(LAIV) and inactivated influenza vaccine(IIV) is poorly explained by either single or composite immune responses to vaccination. Protective biomarkers were therefore studied in response to LAIV or IIV followed by LAIV challenge in children. Methods.  Serum and mucosal responses to LAIV or IIV were analyzed using immunologic assays to assess both quantitative and functional responses. Cytokines and chemokines were measured in nasal washes collected before vaccination, on days 2, 4, and 7 after initial LAIV, and again after LAIV challenge using a 63-multiplex Luminex panel. Results.  Patterns of immunity induced by LAIV and IIV were significantly different. Serum responses induced by IIV, including hemagglutination inhibition, did not correlate with detection or quantitation of LAIV on subsequent challenge. Modalities that induced sterilizing immunity seen after LAIV challenge could not be defined by any measurements of mucosal or serum antibodies induced by the initial LAIV immunization. No single cytokine or chemokine was predictive of protection. Conclusions.  The mechanism of protective immunity observed after LAIV could not be defined, and traditional measurements of immunity to IIV did not correlate with protection against an LAIV challenge. PMID:27419180

  4. Evaluation of the Universal Immunization Program and Challenges in Coverage of Migrant Children in Haridwar, Uttarakhand, India

    PubMed Central

    Nath, Latika; Kaur, Prabhdeep; Tripathi, Saurabh

    2015-01-01

    Background: Studies show that immunization among migrant children is poor. India has a dropout rate of 17.7% between Bacillus Calmette-Guιrin (BCG) and measles (District Level Household Survey (DLHS)-3). Haridwar district had the highest dropout rate of 27.4% from BCG to diphtheria, pertussis, and tetanus (DPT) 3 (DLHS-3) in Uttarakhand. We evaluated the Universal Immunization Programme (UIP) among migrants in Haridwar in two blocks. Materials and Methods: We developed input, process, and output indicators on infrastructure, human resources, and service delivery. A facility, session site and cross-sectional survey of 180 children were done and proportions for various indicators were estimated. We determined factors associated with not taking vaccination using multivariate analysis. Results: We surveyed 11 cold chain centers, 25 subcenters, 14 sessions, and interviewed 180 mothers. Dropouts were supposed to be tracked using vaccination card counterfoils and tracking registers. The dropout rate from BCG to DPT3 was 30%. Lack of knowledge (adjusted odds ratio (AOR) 6.6,95% confidence interval (CI) 2.6–16.7), mother not being decision maker (AOR 4.0,95%CI 1.7–9.2), lack of contact by Accredited Social Health Activist (ASHA; AOR 3.0,95%CI 1.1–7.7), not being given four post-vaccination messages (AOR 7.7, 95% CI 2.9–20.2), and longer duration of stay in Haridwar (AOR 3.0 95% 1.9–7.6) were risk factors for nonimmunization. The reasons stated by mothers included lack of awareness of session site location (67%) and belief that child should only be vaccinated in their resident district (43%). Conclusions: There was low immunization coverage among migrants within adequate supervision, poor cold chain maintenance, and improper tracking of dropouts. Mobile immunization teams, prelisting of migrant children, and change in incentives of ASHAs for child tracking were needed. A monitoring plan for sessions and cold chain needed enforcement. PMID:26435596

  5. Health maintenance in school-aged children: Part I. History, physical examination, screening, and immunizations.

    PubMed

    Riley, Margaret; Locke, Amy B; Skye, Eric P

    2011-03-15

    The goals of the well-child examination in school-aged children (kindergarten through early adolescence) are promoting health, detecting disease, and counseling to prevent injury and future health problems. A complete history should address any concerns from the patient and family and screen for lifestyle habits, including diet, physical activity, daily screen time (e.g., television, computer, video games), hours of sleep per night, dental care, and safety habits. School performance can be used for developmental surveillance. A full physical examination should be performed; however, the U.S. Preventive Services Task Force recommends against routine scoliosis screening and testicular examination. Children should be screened for obesity, which is defined as a body mass index at or above the 95th percentile for age and sex, and resources for comprehensive, intensive behavioral interventions should be provided to children with obesity. Although the evidence is mixed regarding screening for hypertension before 18 years of age, many experts recommend checking blood pressure annually beginning at three years of age. The American Academy of Pediatrics recommends vision and hearing screening annually or every two years in school-aged children. There is insufficient evidence to recommend screening for dyslipidemia in children of any age, or screening for depression before 12 years of age. All children should receive at least 400 IU of vitamin D daily, with higher doses indicated in children with vitamin D deficiency. Children who live in areas with inadequate fluoride in the water (less than 0.6 ppm) should receive a daily fluoride supplement. Age-appropriate immunizations should be given, as well as any missed immunizations. PMID:21404978

  6. Health maintenance in school-aged children: Part I. History, physical examination, screening, and immunizations.

    PubMed

    Riley, Margaret; Locke, Amy B; Skye, Eric P

    2011-03-15

    The goals of the well-child examination in school-aged children (kindergarten through early adolescence) are promoting health, detecting disease, and counseling to prevent injury and future health problems. A complete history should address any concerns from the patient and family and screen for lifestyle habits, including diet, physical activity, daily screen time (e.g., television, computer, video games), hours of sleep per night, dental care, and safety habits. School performance can be used for developmental surveillance. A full physical examination should be performed; however, the U.S. Preventive Services Task Force recommends against routine scoliosis screening and testicular examination. Children should be screened for obesity, which is defined as a body mass index at or above the 95th percentile for age and sex, and resources for comprehensive, intensive behavioral interventions should be provided to children with obesity. Although the evidence is mixed regarding screening for hypertension before 18 years of age, many experts recommend checking blood pressure annually beginning at three years of age. The American Academy of Pediatrics recommends vision and hearing screening annually or every two years in school-aged children. There is insufficient evidence to recommend screening for dyslipidemia in children of any age, or screening for depression before 12 years of age. All children should receive at least 400 IU of vitamin D daily, with higher doses indicated in children with vitamin D deficiency. Children who live in areas with inadequate fluoride in the water (less than 0.6 ppm) should receive a daily fluoride supplement. Age-appropriate immunizations should be given, as well as any missed immunizations.

  7. Local Immune Responses in Children and Adults with Allergic and Nonallergic Rhinitis

    PubMed Central

    Choi, Hana; Jang, Man-Young; Kim, Kyung Rae; Choi, Jae-Hoon; Cho, Seok Hyun

    2016-01-01

    Background Allergic rhinitis (AR) is the most common allergic disease but little is known about the difference of local immune responses in children and adults with AR. Objective To compare local immune responses between children and adults with AR and nonallergic rhinitis (NAR), and to investigate whether the association of local and systemic immune responses is different between the two age groups. Methods Fifty-one patients with chronic rhinitis were enrolled and grouped into children (N = 27, mean age 7.2 years) and adults (N = 24, mean age 29.9 years). Diagnosis of AR was based on symptoms, skin prick tests and serum specific IgEs. Nasal lavage (NAL) fluids were collected from all subjects and used to measure the levels of total IgE, specific IgEs to house dust mites (Dp and Df), and cytokines (TNF-α, IL-4, IL-10, IL-17A and IFN-γ). Flow cytometry was used to measure inflammatory cell types in NAL fluids. Results AR had significantly increased local levels of total IgE and specific IgEs to Dp and Df compared with NAR in both age groups (P < 0.05). Nasal eosinophils % (P = 0.01) was significantly increased only in children with AR. Local-systemic correlations of total IgE (r = 0.662, P = 0.000) and eosinophil % (r = 0.461, P = 0.015) between the peripheral blood and NAL fluids were found only in children. Moreover, children had correlations between total IgE and eosinophil % in the peripheral blood (r = 0.629, P = 0.001) and in NAL fluids (r = 0.373, P = 0.061). Conclusion Elevated local IgE is a common feature of AR in children and adults. Local measures in NAR showed naïve state of immune response which disagree with the hypothesis of local allergic rhinitis. Children showed intense local inflammation and close local-systemic interactions compared to adults supporting pediatric AR as a distinct feature. PMID:27281182

  8. Persistence of antibody and immunologic memory in children immunized with hepatitis B vaccine at birth.

    PubMed

    Seto, Dexter; West, David J; Ioli, Virginia A

    2002-08-01

    Forty-two healthy children immunized with a course of hepatitis B vaccine beginning at birth were tested at 6 years of age for persistence of anti-hepatitis B antibody (anti-HBs) and then given a booster dose of vaccine. Although nearly one-half had become seronegative, all retained robust immunologic memory and rapidly regained a protective anti-HBs titer of at least 10 mIU/ml after booster vaccination.

  9. Humoral immune response of water buffalo monitored with three different antigens of Toxocara vitulorum.

    PubMed

    de Souza, E M; Starke-Buzetti, W A; Ferreira, F P; Neves, M F; Machado, R Z

    2004-06-10

    Humoral immune response of water buffalo naturally infected with Toxocara vitulorum was monitored using three different antigens of this parasite in serum and colostrum of buffalo cows and calves. Soluble extract (Ex) and excretory/secretory (ES) larval antigens and perienteric fluid antigen (Pe) of adult T. vitulorum were used to measure the antibody levels by an indirect ELISA. Serum of 7-12 buffalo cows for the first 365 days and colostrum of the same number of buffalo cows for the first 60 days of parturition, and serum of 8-10 buffalo calves for the first 365 days after birth were assayed. The ELISA detected antibodies against all three T. vitulorum antigens in the colostrum and serum of 100% of buffalo cows and calves examined. The highest antibody levels against Ex, ES and Pe antigens were detected in the buffalo cow sera during the perinatal period and were maintained at high levels through 300 days after parturition. On the other hand, colostrum antibody concentrations of all three antigens were highest on the first day post-parturition, but decreased sharply during the first 15 days. Concomitantly to the monitoring of immune response, the parasitic status of the calves was also evaluated. In calves, antibodies passively acquired were at the highest concentrations 24 h after birth and remained at high levels until 45 days coincidentally with the peak of T. vitulorum infection. The rejection of the worms by the calves occurred simultaneously with the decline of antibody levels, which reached their lowest levels between 76 and 150 days. Thereafter, probably because of the presence of adults/larvae stimulation, the calves acquired active immunity and the antibodies started to increase slightly in the serum and plateaued between the days 211 and 365. All three antigens were detected by the serum antibodies of buffalo calves; however, the concentration of anti-Pe antibody was higher than anti-EX and anti-ES, particularly after 90 days of age. By conclusion, the

  10. Assessment of antibody titers and immunity to Hepatitis B in children receiving chemotherapy

    PubMed Central

    Shams Shahemabadi, A; Salehi, F; Hashemi, A; Vakili, M; Zare, F; Esphandyari, N; Kashanian, S

    2012-01-01

    Background There is a decrease in vaccine-specific antibody to certain vaccine-preventable diseases in children after chemotherapy, but the frequency of non-immune patients is not clear. In the present case-control study, was taken under investigation protection level to Hepatitis B infection in children 6 months after completing chemotherapy. Materials and Methods In this study 68 patients with cancer and 68 healthy children were enrolled. Patients were 1.5 -12 years old with completed standard chemotherapy at least for 6 months. All the patients and healthy children were negative for HBsAg and HBeAg and had received Hepatitis B vaccination. IgG antibody concentrations against Hepatitis B Virus (HBV) were determined in the patients receiving chemotrapy and healthy subjects serum by ELISA method. IgG antibody titer > 10 mIU/ml was considered as baseline protective titer for preventing HBV infection. Results Anti-HBs antibody titer in 19.12% of patients was less than 10 mIU/ml and 11.76% of the patients had borderline antibody titer (10-20 mIU/ml). In healthy subjects, 2.94% and 5.88% had antibody titer < 10 mIU/ml and 10-20 mIU/ml, respectively. According to statistical analysis, frequency of non immune subjects in children with cancer was significantly higher than those in healthy children (P-value=0.024). Conclusion HBV vaccination post-intensive chemotherapy in the children with cancer is strongly recommended. PMID:24575253

  11. Monitoring immune responses in a mouse model of fracture fixation with and without Staphylococcus aureus osteomyelitis.

    PubMed

    Rochford, Edward T J; Sabaté Brescó, Marina; Zeiter, Stephan; Kluge, Katharina; Poulsson, Alexandra; Ziegler, Mario; Richards, R Geoff; O'Mahony, Liam; Moriarty, T Fintan

    2016-02-01

    Post-traumatic bone fractures are commonly fixed with implanted devices to restore the anatomical position of bone fragments and aid in the healing process. Bacterial infection in this situation is a challenge for clinicians due to the need for aggressive antibiotic therapy, debridement of infected tissues, and the need to maintain fracture stability. The aim of this study was to monitor immune responses that occur during healing and during Staphylococcus aureus infection, in a clinically relevant murine model of fracture fixation. Skeletally mature C57bl/6 mice received a transverse osteotomy of the femur, which was treated with commercially available titanium fracture fixation plates and screws. In the absence of infection, healing of the fracture was complete within 35days and was characterized by elevated Interleukin (IL)-4 and Interferon-gamma secretion from bone-derived cells and expression of these same genes. In contrast, mice inoculated with S. aureus could not heal the fracture within the observation period and were found to develop typical signs of implant-associated bone infection, including biofilm formation on the implant and osteolysis of surrounding bone. The immune response to infection was characterized by a TH17-led bone response, and a pro-inflammatory cytokine-led Tumor necrosis factor (TNF)-α, Interleukin (IL)-1β) soft tissue response, both of which were ineffectual in clearing implant related bone and soft tissue infections respectively. In this murine model, we characterize the kinetics of pro-inflammatory responses to infection, secondary to bone trauma and surgery. A divergent local immune polarization is evident in the infected versus non-infected animals, with the immune response ultimately unable to clear the S. aureus infection.

  12. Monitoring food and non-alcoholic beverage promotions to children.

    PubMed

    Kelly, B; King, L; Baur, L; Rayner, M; Lobstein, T; Monteiro, C; Macmullan, J; Mohan, S; Barquera, S; Friel, S; Hawkes, C; Kumanyika, S; L'Abbé, M; Lee, A; Ma, J; Neal, B; Sacks, G; Sanders, D; Snowdon, W; Swinburn, B; Vandevijvere, S; Walker, C

    2013-10-01

    Food and non-alcoholic beverage marketing is recognized as an important factor influencing food choices related to non-communicable diseases. The monitoring of populations' exposure to food and non-alcoholic beverage promotions, and the content of these promotions, is necessary to generate evidence to understand the extent of the problem, and to determine appropriate and effective policy responses. A review of studies measuring the nature and extent of exposure to food promotions was conducted to identify approaches to monitoring food promotions via dominant media platforms. A step-wise approach, comprising 'minimal', 'expanded' and 'optimal' monitoring activities, was designed. This approach can be used to assess the frequency and level of exposure of population groups (especially children) to food promotions, the persuasive power of techniques used in promotional communications (power of promotions) and the nutritional composition of promoted food products. Detailed procedures for data sampling, data collection and data analysis for a range of media types are presented, as well as quantifiable measurement indicators for assessing exposure to and power of food and non-alcoholic beverage promotions. The proposed framework supports the development of a consistent system for monitoring food and non-alcoholic beverage promotions for comparison between countries and over time.

  13. Immunization Coverage in Migrant School Children Along the Thailand-Myanmar Border.

    PubMed

    Kaji, Aiko; Parker, Daniel M; Chu, Cindy S; Thayatkawin, Wipa; Suelaor, Jiraporn; Charatrueangrongkun, Rachai; Salathibuppha, Kloloi; Nosten, Francois H; McGready, Rose

    2016-10-01

    The objective of this project was to document and increase vaccine coverage in migrant school children on the Thailand-Myanmar border. Migrant school children (n = 12,277) were enrolled in a school-based immunization program in four Thai border districts. The children were evaluated for vaccination completion and timing, for six different vaccines: Bacille Calmette-Guerin (BCG); Oral Polio vaccine (OPV); Hepatitis B vaccine (HepB); Diphtheria, Pertussis and Tetanus vaccine (DTP); Measles Containing Vaccine or Measles, Mumps and Rubella vaccine (MMR); Tetanus and Diphtheria containing vaccine (Td). Vaccine coverage proportions for BCG, OPV3, DTP3, HepB3 and measles containing vaccine were 92.3, 85.3, 63.8, 72.2, and 90.9 % respectively. Most children were able to receive vaccines in a time appropriate manner. School-based immunization programs offer a suitable vaccine delivery mechanism for hard-to-reach populations. However, these data suggest overall low vaccine coverage in migrant populations. Further efforts toward improving appropriate vaccine coverage and methods of retaining documentation of vaccination in mobile migrant populations are necessary for improved health. PMID:26483180

  14. Evidence of cellular immune activation in children with opsoclonus-myoclonus: cerebrospinal fluid neopterin.

    PubMed

    Pranzatelli, Michael R; Hyland, Keith; Tate, Elizabeth D; Arnold, Lauren A; Allison, Tyler J; Soori, Gamini S

    2004-12-01

    To evaluate cellular immune activation in opsoclonus-myoclonus syndrome, we measured the inflammatory marker neopterin in the cerebrospinal fluid of 16 children with opsoclonus-myoclonus and neuroblastoma, 24 children with opsoclonus-myoclonus but no tumor, and 19 age-matched controls. The mean concentration in opsoclonus-myoclonus was 2.3-fold higher than in controls (P = .008). Neopterin was greatly elevated in four of the most neurologically severe cases, up to 8.3-fold above the highest control level. Thirteen of the 40 children with opsoclonus-myoclonus but no controls had a neopterin concentration >2 SD above the control mean (P = .005). In this high neopterin subgroup, neurologic severity was significantly greater and the duration of neurologic symptoms was less. In 16 children re-examined on immunotherapy, including adrenocorticotropic hormone (ACTH) combination therapy, treatment was associated with a significant reduction in both neopterin and neurologic severity. Neopterin did not differ significantly between the tumor and non-tumor opsoclonus-myoclonus etiologies. No abnormalities of tetrahydrobiopterin were found. Although cerebrospinal fluid neopterin lacked the sensitivity to be a biomarker of disease activity in opsoclonus-myoclonus, elevated concentrations do support a role for T-cell activation and cell-mediated immunity in its pathophysiology.

  15. Immunization Coverage in Migrant School Children Along the Thailand-Myanmar Border.

    PubMed

    Kaji, Aiko; Parker, Daniel M; Chu, Cindy S; Thayatkawin, Wipa; Suelaor, Jiraporn; Charatrueangrongkun, Rachai; Salathibuppha, Kloloi; Nosten, Francois H; McGready, Rose

    2016-10-01

    The objective of this project was to document and increase vaccine coverage in migrant school children on the Thailand-Myanmar border. Migrant school children (n = 12,277) were enrolled in a school-based immunization program in four Thai border districts. The children were evaluated for vaccination completion and timing, for six different vaccines: Bacille Calmette-Guerin (BCG); Oral Polio vaccine (OPV); Hepatitis B vaccine (HepB); Diphtheria, Pertussis and Tetanus vaccine (DTP); Measles Containing Vaccine or Measles, Mumps and Rubella vaccine (MMR); Tetanus and Diphtheria containing vaccine (Td). Vaccine coverage proportions for BCG, OPV3, DTP3, HepB3 and measles containing vaccine were 92.3, 85.3, 63.8, 72.2, and 90.9 % respectively. Most children were able to receive vaccines in a time appropriate manner. School-based immunization programs offer a suitable vaccine delivery mechanism for hard-to-reach populations. However, these data suggest overall low vaccine coverage in migrant populations. Further efforts toward improving appropriate vaccine coverage and methods of retaining documentation of vaccination in mobile migrant populations are necessary for improved health.

  16. Impact of fatty acid status on immune function of children in low-income countries.

    PubMed

    Prentice, Andrew M; van der Merwe, Liandré

    2011-04-01

    In vitro and animal studies point to numerous mechanisms by which fatty acids, especially long-chain polyunsaturated fatty acids (LCPUFA), can modulate the innate and adaptive arms of the immune system. These data strongly suggest that improving the fatty acid supply of young children in low-income countries might have immune benefits. Unfortunately, there have been virtually no studies of fatty acid/immune interactions in such settings. Clinical trial registers list over 150 randomized controlled trials (RCTs) involving PUFAs, only one in a low-income setting (the Gambia). We summarize those results here. There was evidence for improved growth and nutritional status, but the primary end point of chronic environmental enteropathy showed no benefit, possibly because the infants were still substantially breastfed. In high-income settings, there have been RCTs with fatty acids (usually LCPUFAs) in relation to 18 disease end points, for some of which there have been numerous trials (asthma, inflammatory bowel disease and rheumatoid arthritis). For these diseases, the evidence is judged reasonable for risk reduction for childhood asthma (but not in adults), as yielding possible benefit in Crohn's disease (insufficient evidence in ulcerative colitis) and for convincing evidence for rheumatoid arthritis at sufficient dose levels, though formal meta-analyses are not yet available. This analysis suggests that fatty acid interventions could yield immune benefits in children in poor settings, especially in non-breastfed children and in relation to inflammatory conditions such as persistent enteropathy. Benefits might include improved responses to enteric vaccines, which frequently perform poorly in low-income settings, and these questions merit randomized trials.

  17. Systemic Comorbidity in Children with Cataracts in Nigeria: Advocacy for Rubella Immunization

    PubMed Central

    Duke, Roseline; Oparah, Sidney; Adio, Adedayo; Eyo, Okon; Odey, Friday

    2015-01-01

    Background. Congenital and developmental cataracts are leading causes of childhood blindness and severe visual impairment. They may be associated with systemic diseases including congenital heart diseases which are among the major causes of morbidity and mortality in childhood. The pattern of systemic comorbidities seen in children diagnosed with cataract in Calabar, Nigeria, was studied. Methods. A retrospective review was conducted on the children who had cataract surgery between 2011 and 2012. Diagnosis of the systemic condition was documented. Results. A total of 66 children were recruited for the study. Cardiac disease was seen in 26 children (39.9%), followed by delayed milestone in 16 (24.2%), intellectual disability in 14 (21.2%), deafness in 11 (16.7%), epilepsy in 4 (6.1%), and physical handicap in 3 (4.5%) of them. Clinically confirmed Congenital Rubella Syndrome was seen in 30 (45%) of the children. The pattern of CHD seen was as follows: patent ductus arteriosus in 16 (24.2%) followed by ventricular-septal defect in 5 (7.6%), atrial-septal defect in 3 (4.5%), and pulmonary stenosis in 2 (3%). Conclusion. Systemic comorbidities, especially cardiac anomalies, are common among children with cataract in Nigeria. Congenital Rubella Syndrome may be a prominent cause of childhood cataract in our environment. Routine immunization of school girls against rubella is advocated as a measure to mitigate this trend. PMID:26351577

  18. Monitoring temperature in children undergoing anaesthesia: a comparison of methods.

    PubMed

    Drake-Brockman, T F E; Hegarty, M; Chambers, N A; von Ungern-Sternberg, B S

    2014-05-01

    Children undergoing anaesthesia are prone to hypothermia. Perioperative monitoring of patient temperature is, therefore, standard practice. Postoperative temperature is regarded as a key anaesthetic performance indicator in Australian hospitals. Many different methods and sites of temperature measurement are used perioperatively. It is unclear to what degree these methods might be interchangeable. The aim of this study was to determine the relationships between temperatures measured at different sites in anaesthetised children. Two hundred children, 0 to 17 years, undergoing general anaesthesia for elective non-cardiac surgery, were prospectively recruited. Temperature measurements were taken in the operating theatre concurrently at the nasopharynx, tympanic membranes, temporal artery, axilla and skin (chest). Patient age and weight were documented. Temperatures varied according to site of measurement. The mean difference from nasopharyngeal temperature to temperatures at left and right tympanic, temporal, axillary and cutaneous sites were +0.24°C, +0.24°C, +0.35°C, -0.38°C and -1.70°C, respectively. Levels of agreement to nasopharyngeal temperature were similar at tympanic, temporal and axillary sites. Tympanic and temporal temperatures were superior to axillary temperatures for detection of mild hypothermia (<36°C). Skin temperature showed a large variation from nasopharyngeal measurements. Our findings indicate that measured temperatures vary between sites. Understanding these variations is important for interpreting temperature readings. PMID:24794470

  19. Neutralizing antibody immune response in children with primary and secondary rotavirus infections.

    PubMed Central

    Arias, C F; López, S; Mascarenhas, J D; Romero, P; Cano, P; Gabbay, Y B; de Freitas, R B; Linhares, A C

    1994-01-01

    We have characterized the neutralizing antibody immune response to six human rotavirus serotypes (G1 to G4, G8, and G9) in Brazilian children with primary and secondary rotavirus infections and correlated the response with the G serotype of the infecting rotavirus strain. Twenty-five children were studied: 17 had a single rotavirus infection, 4 were reinfected once, and 4 experienced three infections. Two of the reinfections were by non-group A rotaviruses. Among the 25 primary infections, we observed homotypic as well as heterotypic responses; the serotype G1 viruses, which accounted for 13 of these infections, induced mostly a homotypic response, while infections by serotype G2 and G4 viruses induced, in addition to the homotypic, a heterotypic response directed primarily to serotype G1. Two of the primary infections induced heterotypic antibodies to 69M, a serotype G8 virus that by RNA electrophoresis analysis was found not to circulate in the population during the time of the study. The specificity of the neutralizing antibody immune response induced by a virus of a given serotype was the same in primary as well as secondary infections. These results indicate that the heterotypic immune response induced in a primary rotavirus infection is an intrinsic property of the virus strain, and although there seem to be general patterns of serotype-specific seroconversion, these may vary from serotype to serotype and from strain to strain within a serotype. PMID:7496929

  20. Impaired cellular immune response to tetanus toxoid but not to cytomegalovirus in effectively HAART-treated HIV-infected children.

    PubMed

    Alsina, Laia; Noguera-Julian, Antoni; Fortuny, Clàudia

    2013-05-01

    Despite of highly active antiretroviral therapy, the response to vaccines in HIV-infected children is poor and short-lived, probably due to a defect in cellular immune responses. We compared the cellular immune response (assessed in terms of IFN-γ production) to tetanus toxoid and to cytomegalovirus in a series of 13 HIV-perinatally-infected children and adolescents with optimal immunovirological response to first line antiretroviral therapy, implemented during chronic infection. A stronger cellular response to cytomegalovirus (11 out of 13 patients) was observed, as compared to tetanus toxoid (1 out of 13; p=0.003). These results suggest that the repeated exposition to CMV, as opposed to the past exposition to TT, is able to maintain an effective antigen-specific immune response in stable HIV-infected pediatric patients and strengthen current recommendations on immunization practices in these children.

  1. [Correction of immune and mediator characteristics by low-frequency magnetotherapy in children who frequently fall ill].

    PubMed

    Useĭnova, N N

    2010-01-01

    The objective of this work was to compare characteristics of clinical condition and immune status of children with repeated respiratory diseases of different clinical and nosological forms after standard treatment and magnetotherapy. It was shown that magnetotherapy produces well-apparent immunocorrective effects in children with the affected upper and lower respiratory tracts including patients with bronchial obstruction syndrome. Positive changes of both cellular and humoral immunity characteristics were documented coupled to the improvement of serum cortisol levels. Results of the study give reason to recommend inclusion of magneotherapy in the combined treatment of children with repeated respiratory diseases. PMID:20737709

  2. Childhood Immunization

    MedlinePlus

    ... lowest levels in history, thanks to years of immunization. Children must get at least some vaccines before ... child provide protection for many years, adults need immunizations too. Centers for Disease Control and Prevention

  3. IMMUNE RESPONSE OF SEVERE MALNUTRITION CHILDREN TREATED ACCORDING TO THE PROTOCOL OF THE WORLD HEALTH ORGANIZATION.

    PubMed

    Peixoto Paes-Silva, Rebecca; Correia de Macedo, Érika Michelle; Oliveira Tomiya, Marília Tokiko; Machado Barbosa de Castro, Célia Maria

    2015-08-01

    The aim of the study was to compare the innate immune system of severely malnourished children admitted to the Instituto de Medicina Integral Professor Fernando Figueira and treated according to the protocol of the World Health Organization (WHO) at admission and discharge. An experimental study was conducted with 20 children under two years of age. Ten of them had severe malnutrition and ten were a control group. The malnourished group consisted of hospitalized infants and it was submitted to WHO's protocol. Children with HIV and re-admitted during the study period were excluded. A blood sample was taken at admission and at discharge. Later, an analysis of blood leukocytes, adherence index, phagocytic capacity, production of free radicals superoxide and nitric oxide was performed. Patients with severe malnutrition at hospital discharge showed improved phagocytic function, release of oxygen radicals and reduction of the number of lymphocytes when compared to the time of admission. When compared to the control group, patients at hospital discharge had lower lymphocyte values and lower production of free radicals. Thus, it can be concluded that the duration of hospitalization was insufficient to restore cell-mediated immunity and microbicide activity.

  4. Immune Function Effects of Dental Amalgam in Children: A Randomized Clinical Trial

    PubMed Central

    Shenker, Bruce J.; Maserejian, Nancy N.; Zhang, Annie; McKinlay, Sonja

    2010-01-01

    Background Dental amalgam is a widely used restorative material containing 50% elemental mercury that emits mercury vapor. No randomized clinical trials have determined whether there are adverse immunologic effects associated with this low-level mercury exposure in children. The objective of this study was to evaluate a sub-population of the New England Children’s Amalgam Trial (NECAT) for in vitro manifestations of immunotoxic effects of dental amalgam. Methods A randomized clinical trial in which children requiring dental restorative treatment were randomized to either amalgam for posterior restorations or resin composite. A total of 66 children, aged 6–10 years, were assessed for total white cell numbers, T-cell, B-cell, neutrophil and monocyte responsiveness over a five-year period. Owing to the small number of participants, the study is exploratory in nature with limited statistical power. Results The mean number of tooth surfaces restored during the five-year period was 7.8 for the amalgam group and 10.1 for composite group. In the amalgam group there was a slight, but not statistically significant, decline in responsiveness of T-cells and monocytes at 5–7 days post treatment; no differences were consistently observed at 6, 12 or 60 months. Conclusions This study confirms that treatment of children with dental amalgams leads to increased, albeit low level, exposure to mercury. In this exploratory analysis of immune function, amalgam exposure did not cause overt immune deficits, although small transient effects were observed 5–7 days post restoration. Clinical implications These findings suggest that immunotoxic effects of amalgam restorations in children need not be a concern when choosing this restorative dental material. PMID:18978388

  5. Improving Immunization Rates Through Community-Based Participatory Research: Community Health Improvement for Milwaukee’s Children Program

    PubMed Central

    Willis, Earnestine; Sabnis, Svapna; Hamilton, Chelsea; Xiong, Fue; Coleman, Keli; Dellinger, Matt; Watts, Michelle; Cox, Richard; Harrell, Janice; Smith, Dorothy; Nugent, Melodee; Simpson, Pippa

    2016-01-01

    Background Nationally, immunization coverage for the DTaP/3HPV/1MMR/3HepB/3Hib/1VZV antigen series in children ages 19–35 months are near or above the Healthy People 2020 target (80%). However, children in lower socioeconomic families experience lower coverage rates. Objective Using a community-based participatory research (CBPR) approach, Community Health Improvement for Milwaukee Children (CHIMC) intervened to reduce disparities in childhood immunizations. Methods The CHIMC adopted a self-assessment to examine the effectiveness of adhering to CBPR principles. Using behavior change models, CHIMC implemented education, social marketing campaign, and theory of planned behavior interventions. Community residents and organizational representatives vetted all processes, messages, and data collection tools. Results Adherence to the principles of CBPR was consistently positive over the 8-year period. CHIMC enrolled 565 parents/caregivers with 1,533 children into educational and planned behavior change (PBC) interventions, and enrolled another 406 surveyed for the social marketing campaign. Retention rate was high (80%) with participants being predominately Black females (90%) and the unemployed (64%); children’s median age was 6.2 years. Increased knowledge about immunizations was consistently observed among parents/caregivers. Social marketing data revealed high recognition (85%) of the community-developed message (“Take Control: Protect Your Child with Immunizations”). Barriers and facilitators to immunize children revealed protective factors positively correlated with up-to-date (UTD) status (p < 0.007). Ultimately, children between the ages of 19 and 35 months whose parents/caregivers completed education sessions and benefitted from a community-wide social marketing message increased their immunization status from 45% baseline to 82% over 4 years. Conclusions Using multilayered interventions, CHIMC contributed to the elimination of immunization disparities in

  6. Clinical trials of yeast-derived β-(1,3) glucan in children: effects on innate immunity

    PubMed Central

    Svozil, Vladimir; Král, Vlastimil; Rajnohová Dobiášová, Lucie; Stiborová, Ivana; Vetvicka, Vaclav

    2014-01-01

    Background The role of glucan in the stimulation of immune reactions is well established. In our report, we focused on the effects of orally administered glucan on nonspecific immunity of children with chronic respiratory problems. Materials and methods We measured the levels of albumin, lysozyme. C-reactive protein (CRP) and calprotectin in the saliva of 60 children ages 8-12 years and evaluated the effects of 30-day treatment with 100 mg/d oral dose of glucan. Results We found a significant increase in the production of lysozyme, CRP and calprotectin in glucan-treated children. Conclusions Short-term oral application of natural immunomodulator β-glucan significantly stimulated mucosal immunity of children with chronic respiratory problems. PMID:25332991

  7. Pathogens in children with severe combined immune deficiency disease or AIDS.

    PubMed Central

    Lauzon, D; Delage, G; Brochu, P; Michaud, J; Jasmin, G; Joncas, J H; Lapointe, N

    1986-01-01

    We evaluated the frequency and severity of illnesses caused by various microbial pathogens in 15 children with severe combined immune deficiency disease (SCID) and 8 with acquired immune deficiency syndrome (AIDS). There were 35 viral, 23 bacterial, 19 mycotic and 13 parasitic infections. Nineteen of the 23 patients died of infection; Pneumocystis carinii pneumonia, giant-cell pneumonia due to paramyxoviruses and various disseminated viral infections were responsible for most deaths in both groups. The emerging role of paramyxoviruses was illustrated by the fact that they were responsible for giant-cell pneumonia in seven patients. Viral enteric infections were frequent in both groups. The variety of infectious microorganisms and the severity of resulting illnesses in the patients with AIDS were similar to those in the patients with SCID. Images Fig. 1 PMID:3719484

  8. [Influence of helminthic infections and nutritional status on immune response in Venezuelan children].

    PubMed

    Ortiz, D; Afonso, C; Hagel, I; Rodriguez, O; Ortiz, C; Palenque, M; Lynch, N R

    2000-09-01

    We investigated the influence of nutritional status, as determined from anthropometric measurement, and of helminthic infections on the immune response of children of low socioeconomic status in two rural communities in Venezuela: El Cardón in the state of Nueva Esparta and San Daniel in the state of Miranda. A total of 125 boys and girls between 2 and 15 years old participated in the study. Their socioeconomic stratum was determined by a modified Graffar method. A physical examination was performed, as was also an anthropometric evaluation that took into account three indicators--weight-for-height, weight-for-age, and height-for-age--according to parameters established by the World Health Organization. Other examinations included feces, secretory IgA in saliva, total serum IgE, and anti-Ascaris-specific immunoglobulins. The children in both of the communities were in strata IV and V of the of Graffar scale, with a significantly greater number of stratum V inhabitants in San Daniel (P < 0.001). The results suggest that exposure level and individual susceptibility to the parasites are determining factors in parasitic infection and immune system behavior. The intensity of the parasitic burden plays an important role in stimulating polyclonal IgE, which diminishes the effectiveness of the specific response to those infections. On the other hand, nutritional deficiencies could change the immune mechanisms of the mucous membranes, negatively influence the synthesis of secretory IgA, and stimulate the production of polyclonal IgE. Poor sanitary and socioeconomic conditions promote more exposure to gastrointestinal parasites and a deficient nutritional status, which modulates the immune response and affects serum IgE and secretory IgA production mechanisms. PMID:11036425

  9. Children Become "Real Scientists" as They Help to Monitor the Health of Their Local Estuary

    ERIC Educational Resources Information Center

    Beaumont, Brent

    2014-01-01

    The author explains how the children at his primary school in New Zealand are inspired by their involvement in environmental monitoring. Shellfish surveys are conducted annually in New Zealand in order to establish the health of their estuaries. By involving the children in this national monitoring programme, prepared by the Hauraki Gulf Forum (an…

  10. Serum vitamin D levels in children with newly diagnosed and chronic immune thrombocytopenia.

    PubMed

    Čulić, Srđana; Markić, Joško; Petrović, Davor; Konjevoda, Paško; Pavelić, Jasminka

    2016-04-01

    The primary objective of the study was to assess the vitamin D (VD) status of patients suffering from ITP. Children from the case cohort (total 21) were recruited from chronic ITP patients (followed as outpatients) and newly diagnosed ITP (prospective study) patients. VD deficiency (values <75 nmol/L) was detected in 11 patients with newly diagnosed ITP, and seven patients with chronic ITP. Only three patients with newly diagnosed, and none with chronic ITP had normal VD values. Newly diagnosed ITP patients had statistically significantly higher values (P <.044) of VD than the patients with chronic type of ITP. Platelets values did not follow VD level. VD deficiency is very common in children with either newly diagnosed or chronic ITP form. Therefore there is a utility supplementing VD in these patients. To investigate the role of VD as an immune modulating drug for patients with ITP, a prospective randomized placebo-controlled trial needs to be performed. PMID:27312171

  11. Immune Dysfunction in Children with CHARGE Syndrome: A Cross-Sectional Study

    PubMed Central

    van der Burg, Mirjam; la Bastide-van Gemert, Sacha; Hogendorf, Lianne A.; van Ravenswaaij-Arts, Conny M. A.; Schölvinck, Elisabeth H.

    2015-01-01

    CHARGE syndrome is a variable, multiple congenital malformation syndrome. Patients with CHARGE syndrome have frequent infections that are presumed to be due to anatomical anomalies of the craniofacial region and upper airway, and cranial nerve problems resulting in swallowing difficulties and aspiration. The possible contribution of immunological abnormalities to these infections has not been systematically studied even though immune deficiencies have been described in patients with 22q11.2 deletion syndrome, a condition which shares remarkable clinical overlap with CHARGE syndrome. We assessed the frequency and nature of immune dysfunction in 24 children with genetically proven CHARGE syndrome. All patients, or their parents, completed a questionnaire on infectious history. Their immune system was extensively assessed through full blood counts, immunoglobulin levels, lymphocyte subpopulations, peripheral B- and T-cell differentiation, T-receptor excision circle (TREC) analysis, T-cell function, and vaccination responses. All CHARGE patients had a history of infections (often frequent), mainly otitis media and pneumonia, leading to frequent use of antibiotics and to hospital admissions. Decreased T-cell numbers were found in 12 (50%) patients, presumably caused by insufficient thymic output since TREC amounts were also diminished in CHARGE patients. Despite normal peripheral B-cell differentiation and immunoglobulin production in all patients, 83% of patients had insufficient antibody titers to one or more early childhood vaccinations. Based on our results, we recommend immunological evaluation of CHARGE patients with recurrent infections. PMID:26544072

  12. Income transfer policies and the impacts on the immunization of children: the Bolsa Família Program.

    PubMed

    Andrade, Mônica Viegas; Chein, Flávia; Souza, Laetícia Rodrigues de; Puig-Junoy, Jaume

    2012-07-01

    This paper investigates the impact of the Bolsa Família Program on the immunization of children from 0 to 6 years of age in Brazil and its regions. The Bolsa Família program is a conditional cash transfer program. One of its conditionalities is the compliance of children with the immunization schedule ordered by the Ministry of Health. The evaluation was performed using the Propensity Score Matching technique. We used data from a survey conducted in 2005 evaluating the program - Pesquisa de Avaliação de Impacto do Programa Bolsa Família. The main findings suggest that the Bolsa Família Program does not affect the immunization status of children.

  13. Towards measles elimination in Italy: monitoring herd immunity by Bayesian mixture modelling of serological data.

    PubMed

    Del Fava, Emanuele; Shkedy, Ziv; Bechini, Angela; Bonanni, Paolo; Manfredi, Piero

    2012-08-01

    The analysis of post-vaccination serological data poses nontrivial issues to the epidemiologists and policy makers who want to assess the effects of immunisation programmes. This is especially true for infections on the path to elimination as is the case for measles. We address these problems by using Bayesian Normal mixture models fitted to antibody counts data. This methodology allows us to estimate the seroprevalence of measles by age and, in contrast to conventional methods based on fixed cut-off points, to also distinguish between groups of individuals with different degrees of immunisation. We applied our methodology to two serological samples collected in Tuscany (Italy) in 2003 and in 2005-2006 respectively, i.e., before and after a large vaccination campaign targeted to school-age children. Besides showing the impact of the campaign, we were able to accurately identify a large pocket of susceptible individuals aged about 13-14 in 2005-2006, and a larger group of weakly immune individuals aged about 20 in 2005-2006. These cohorts therefore represent possible targets for further interventions towards measles elimination.

  14. Minimal residual disease monitoring and immune profiling in multiple myeloma in elderly patients.

    PubMed

    Paiva, Bruno; Cedena, Maria-Teresa; Puig, Noemi; Arana, Paula; Vidriales, Maria-Belen; Cordon, Lourdes; Flores-Montero, Juan; Gutierrez, Norma C; Martín-Ramos, María-Luisa; Martinez-Lopez, Joaquin; Ocio, Enrique M; Hernandez, Miguel T; Teruel, Ana-Isabel; Rosiñol, Laura; Echeveste, María-Asunción; Martinez, Rafael; Gironella, Mercedes; Oriol, Albert; Cabrera, Carmen; Martin, Jesus; Bargay, Joan; Encinas, Cristina; Gonzalez, Yolanda; Van Dongen, Jacques J M; Orfao, Alberto; Bladé, Joan; Mateos, Maria-Victoria; Lahuerta, Juan José; San Miguel, Jesús F

    2016-06-23

    The value of minimal residual disease (MRD) in multiple myeloma (MM) has been more frequently investigated in transplant-eligible patients than in elderly patients. Because an optimal balance between treatment efficacy and toxicity is of utmost importance in patients with elderly MM, sensitive MRD monitoring might be particularly valuable in this patient population. Here, we used second-generation 8-color multiparameter-flow cytometry (MFC) to monitor MRD in 162 transplant-ineligible MM patients enrolled in the PETHEMA/GEM2010MAS65 study. The transition from first- to second-generation MFC resulted in increased sensitivity and allowed us to identify 3 patient groups according to MRD levels: MRD negative (<10(-5); n = 54, 34%), MRD positive (between <10(-4) and ≥10(-5); n = 20, 12%), and MRD positive (≥10(-4); n = 88, 54%). MRD status was an independent prognostic factor for time to progression (TTP) (hazard ratio [HR], 2.7; P = .007) and overall survival (OS) (HR, 3.1; P = .04), with significant benefit for MRD-negative patients (median TTP not reached, 70% OS at 3 years), and similar poorer outcomes for cases with MRD levels between <10(-4) and ≥10(-5) vs ≥10(-4) (both with a median TTP of 15 months; 63% and 55% OS at 3 years, respectively). Furthermore, MRD negativity significantly improved TTP of patients >75 years (HR, 4.8; P < .001), as well as those with high-risk cytogenetics (HR, 12.6; P = .01). Using second-generation MFC, immune profiling concomitant to MRD monitoring also contributed to identify patients with poor, intermediate, and favorable outcomes (25%, 61%, and 100% OS at 3 years, respectively; P = .01), the later patients being characterized by an increased compartment of mature B cells. Our results show that similarly to transplant candidates, MRD monitoring is one of the most relevant prognostic factors in elderly MM patients, irrespectively of age or cytogenetic risk. This trial was registered at www.clinicaltrials.gov as #NCT01237249

  15. Immunity to Measles, Mumps, and Rubella in US Children With Perinatal HIV Infection or Perinatal HIV Exposure Without Infection

    PubMed Central

    Siberry, George K.; Patel, Kunjal; Bellini, William J.; Karalius, Brad; Purswani, Murli U.; Burchett, Sandra K.; Meyer, William A.; Sowers, Sun Bae; Ellis, Angela; Van Dyke, Russell B.

    2015-01-01

    Background. Children with perinatal human immunodeficiency virus (HIV) infection (PHIV) may not be protected against measles, mumps, and rubella (MMR) because of impaired initial vaccine response or waning immunity. Our objectives were to estimate seroimmunity in PHIV-infected and perinatally HIV-exposed but uninfected (HEU) children and identify predictors of immunity in the PHIV cohort. Methods. PHIV and HEU children were enrolled in the Pediatric HIV/AIDS Cohort Study (PHACS) at ages 7–15 years from 2007 to 2009. At annual visits, demographic, laboratory, immunization, and clinical data were abstracted and serologic specimens collected. Most recent serologic specimen was used to determine measles seroprotection by plaque reduction neutralization assay and rubella seroprotection and mumps seropositivity by enzyme immunoassay. Sustained combination antiretroviral therapy (cART) was defined as taking cART for at least 3 months. Results. Among 428 PHIV and 221 HEU PHACS participants, the prevalence was significantly lower in PHIV children for measles seroprotection (57% [95% confidence interval {CI}, 52%–62%] vs 99% [95% CI, 96%–100%]), rubella seroprotection (65% [95% CI, 60%–70%] vs 98% [95% CI, 95%–100%]), and mumps seropositivity (59% [95% CI, 55%–64%] vs 97% [95% CI, 94%–99%]). On multivariable analysis, greater number of vaccine doses while receiving sustained cART and higher nadir CD4 percentage between last vaccine dose and serologic testing independently improved the cumulative prediction of measles seroprotection in PHIV. Predictors of rubella seroprotection and mumps seropositivity were similar. Conclusions. High proportions of PHIV-infected children, but not HEU children, lack serologic evidence of immunity to MMR, despite documented immunization and current cART. Effective cART before immunization is a strong predictor of current seroimmunity. PMID:26060291

  16. Timely immunization completion among children in Vietnam from 2000 to 2011: a multilevel analysis of individual and contextual factors

    PubMed Central

    Minh An, Dao Thi; Lee, Jong-Koo; Van Minh, Hoang; Trang, Nguyen Thi Huyen; Thu Huong, Nguyen Thi; Nam, You-Seon; Van Dung, Do

    2016-01-01

    Background Since the beginning of 2014, there have been nearly 6,000 confirmed measles cases in northern Vietnam. Of these, more than 86% had neither been immunized nor was their vaccination status confirmed. Objective To establish the likelihood that children under five in Vietnam had ‘timely immunization completion’ (2000–2011) and identify factors that account for variations in timely immunization completion. Design Secondary data from the Multiple Indicator Cluster Survey (MICS), which sampled women aged 15–49 from the 1999 Vietnamese Population and Housing Census frame, were analyzed. Multilevel analysis using Poisson regression was undertaken. Results Proportions of children under five who had timely immunization completion were low, especially for HBV dose 2 and HBV dose 3, which decreased between 2000 and 2011. Among seven vaccines used in the National Expanded Program of Immunization (EPI) in 2000, 2006, and 2011, measles dose 1 had the highest timely immunization completion at 65.3%, 66.7%, and 73.6%, respectively, and hepatitis B dose 1 had the lowest at 17.5%, 19.3%, and 45.5%, respectively. Timely immunization completion was less common among children whose mothers had relatively less household wealth, were from ethnic minorities, lived in rural areas, and had less education. At the community level, the child's region of residence was the main predictor of timely immunization completion, and the availability of hospital delivery and community prenatal care in the local community were also determinants. Conclusion The EPI should include ‘timely immunization completion’ as a quality indicator. There should also be greater focus and targeting in rural areas, and among women who have relatively low education, belong to minority groups, and have less household wealth. Further research on this topic using multilevel analysis is needed to better understand how these factors interact. PMID:26950555

  17. Individual monitoring of immune responses in rainbow trout after cohabitation and intraperitoneal injection challenge with Yersinia ruckeri.

    PubMed

    M Monte, Milena; Urquhart, Katy; Secombes, Christopher J; Collet, Bertrand

    2016-08-01

    Yersinia ruckeri, the causative agent of enteric red mouth disease (ERM), is a widely studied pathogen in disease models using rainbow trout. This infection model, mostly based on intraperitoneally injection or bath immersion challenges, has an impact on both components (innate and adaptive) of the fish immune system. Although there has been much attention in studying its host-pathogen interactions, there is still a lack of knowledge regarding the impact of a cohabitation challenge. To tackle this we used a newly established non-lethal sampling method (by withdrawing a small amount of blood) in rainbow trout which allowed the individual immune monitoring before (non-infected) and after infection with Yersinia ruckeri either by intraperitoneal (i.p.) injection or by cohabitation (cohab). A range of key immune genes were monitored during the infection by real-time PCR, and results were compared between the two infection routes. Results indicated that inflammatory (IL-1β1 and IL-8) cytokines and certain antimicrobial peptides (cathelicidins) revealed a different pattern of expression between the two infected groups (i.p. vs cohab), in comparison to adaptive immune cytokines (IL-22, IFN-γ and IL-4/13A) and β-defensins. This suggests a different involvement of distinct immune markers according to the infection model, and the importance of using a cohabitation challenge as a more natural disease model that likely simulates what would occur in the environment.

  18. Individual monitoring of immune responses in rainbow trout after cohabitation and intraperitoneal injection challenge with Yersinia ruckeri.

    PubMed

    M Monte, Milena; Urquhart, Katy; Secombes, Christopher J; Collet, Bertrand

    2016-08-01

    Yersinia ruckeri, the causative agent of enteric red mouth disease (ERM), is a widely studied pathogen in disease models using rainbow trout. This infection model, mostly based on intraperitoneally injection or bath immersion challenges, has an impact on both components (innate and adaptive) of the fish immune system. Although there has been much attention in studying its host-pathogen interactions, there is still a lack of knowledge regarding the impact of a cohabitation challenge. To tackle this we used a newly established non-lethal sampling method (by withdrawing a small amount of blood) in rainbow trout which allowed the individual immune monitoring before (non-infected) and after infection with Yersinia ruckeri either by intraperitoneal (i.p.) injection or by cohabitation (cohab). A range of key immune genes were monitored during the infection by real-time PCR, and results were compared between the two infection routes. Results indicated that inflammatory (IL-1β1 and IL-8) cytokines and certain antimicrobial peptides (cathelicidins) revealed a different pattern of expression between the two infected groups (i.p. vs cohab), in comparison to adaptive immune cytokines (IL-22, IFN-γ and IL-4/13A) and β-defensins. This suggests a different involvement of distinct immune markers according to the infection model, and the importance of using a cohabitation challenge as a more natural disease model that likely simulates what would occur in the environment. PMID:27245868

  19. Association between age at antiretroviral therapy initiation and 24-month immune response in HIV-infected children in West Africa

    PubMed Central

    Desmonde, Sophie; Dicko, Fatoumata; Koueta, Fla; Eboua, Tanoh; Balestre, Eric; Amani-Bosse, Clarisse; Aka, Edmond A.; Lawson-Evi, Koko; Amorissani-Folquet, Madeleine; Kouakou, Kouadio; Koumakpai, Siriatou; Renner, Lorna; Sy, Haby Signaté; Valériane, Leroy

    2014-01-01

    Objective We describe the association between age at antiretroviral therapy (ART) initiation and 24-month CD4+ cell response in West African HIV-infected children. Methods All HIV-infected children from the IeDEA paediatric West African cohort, initiating ART, with at least two CD4+ cell count measurements, including one at ART initiation (baseline) were included. CD4+ cell gain on ART was estimated using a multivariable linear mixed model adjusted for baseline variables: age, CD4+ cell count, sex, first-line ART regimen. Kaplan-Meier survival curves and a Cox proportional hazards regression model compared immune recovery for age within 24 months post-ART. Results Of the 4808 children initiated on ART, 3014 were enrol led at a median age of 5.6 years; 61.2% were immunodeficient. After 12 months, children at least 4 years at baseline had significantly lower CD4+ cell gains compared with children less than 2 years, the reference group (P < 0.001). However, by 24 months, we observed higher CD4+cell gain in children who initiated ART between 3 and 4 years compared with those less than 2 years (P < 0.001). The 24-month CD4+ cell gain was also strongest in immunodeficient children at baseline. Among these children, 75% reached immune recovery: 12-month rates were significantly highest in all those aged 2–5 years at ART initiation compared with those less than 2 years. Beyond 12 months on ART, immune recovery was significantly lower in children initiated more than 5 years (adjusted hazard ratio: 0.69, 95% confidence interval: 0.56–0.86). Conclusion These results suggest that both the initiation of ART at the earliest age less than 5 years and before any severe immunodeficiency is needed for improving 24-month immune recovery on ART. PMID:24804858

  20. Severe bleeding events in adults and children with primary immune thrombocytopenia: a systematic review

    PubMed Central

    NEUNERT, C.; NOROOZI, N.; NORMAN, G.; BUCHANAN, G. R.; GOY, J.; NAZI, I.; KELTON, J. G.; ARNOLD, D. M.

    2016-01-01

    Summary Background The burden of severe bleeding in adults and children with immune thrombocytopenia (ITP) has not been established. Objectives To describe the frequency and severity of bleeding events in patients with ITP, and the methods used to measure bleeding in ITP studies. Patients/Methods We performed a systematic review of all prospective ITP studies that enrolled 20 or more patients. Two reviewers searched Medline, Embase, CINAHL and the Cochrane registry up to May 2014. Overall weighted proportions were estimated using a random effects model. Measurement properties of bleeding assessment tools were evaluated. Results We identified 118 studies that reported bleeding (n = 10 908 patients). Weighted proportions for intracerebral hemorrhage (ICH) were 1.4% for adults (95% confidence interval [CI], 0.9–2.1%) and 0.4% for children (95% CI, 0.2–0.7%; P < 0.01), most of whom had chronic ITP. The weighted proportion for severe (non-ICH) bleeding was 9.6% for adults (95% CI, 4.1–17.1%) and 20.2% for children (95% CI, 10.0–32.9%; P < 0.01) with newly-diagnosed or chronic ITP. Methods of reporting and definitions of severe bleeding were highly variable in primary studies. Two bleeding assessment tools (Buchanan 2002 for children; Page 2007 for adults) demonstrated adequate interrater reliability and validity in independent assessments. Conclusions ICH was more common in adults and tended to occur during chronic ITP; other severe bleeds were more common in children and occurred at all stages of disease. Reporting of non-ICH bleeding was variable across studies. Further attention to ITP-specific bleeding measurement in clinical trials is needed to improve standardization of this important outcome for patients. PMID:25495497

  1. Integrated Immune

    NASA Technical Reports Server (NTRS)

    Crucian, Brian; Mehta, Satish; Stowe, Raymond; Uchakin, Peter; Quiriarte, Heather; Pierson, Duane; Sams, Clarnece

    2010-01-01

    This slide presentation reviews the program to replace several recent studies about astronaut immune systems with one comprehensive study that will include in-flight sampling. The study will address lack of in-flight data to determine the inflight status of immune systems, physiological stress, viral immunity, to determine the clinical risk related to immune dysregulation for exploration class spaceflight, and to determine the appropriate monitoring strategy for spaceflight-associated immune dysfunction, that could be used for the evaluation of countermeasures.

  2. Nanoparticle tracking analysis monitors microvesicle and exosome secretion from immune cells

    PubMed Central

    Soo, Chin Y; Song, Yaqiong; Zheng, Ying; Campbell, Elaine C; Riches, Andrew C; Gunn-Moore, Frank; Powis, Simon J

    2012-01-01

    Nanoparticle tracking analysis permits the determination of both the size distribution and relative concentration of microvesicles, including exosomes, in the supernatants of cultured cells and biological fluids. We have studied the release of microvesicles from the human lymphoblastoid T-cell lines Jurkat and CEM. Unstimulated, both cell lines release microvesicles in the size range 70–90 nm, which can be depleted from the supernatant by ultracentrifugation at 100 000 g, and by anti-CD45 magnetic beads, and which by immunoblotting also contain the exosome-associated proteins Alix and Tsg101. Incubation with known potentiators of exosome release, the ionophores monensin and A23187, resulted in a significant increase in microvesicle release that was both time and concentration dependent. Mass spectrometric analysis of proteins isolated from ultracentrifuged supernatants of A23187-treated cells revealed the presence of exosome-associated proteins including heat-shock protein 90, tubulin, elongation factor α1, actin and glyceraldehyde 3-phosphate dehydrogenase. Additionally, treatment of peripheral blood monocyte-derived dendritic cells with bacterial lipopolysaccharide displayed an increase in secreted microvesicles. Consequently, nanoparticle tracking analysis can be effectively applied to monitor microvesicle release from cells of the immune system. PMID:22348503

  3. MONITORING TRAINING LOADS, STRESS, IMMUNE-ENDOCRINE RESPONSES AND PERFORMANCE IN TENNIS PLAYERS

    PubMed Central

    Moreira, A.; Lodo, L.; Nosaka, K.; Coutts, A.J.; Aoki, M.S.

    2013-01-01

    The study aim was to investigate the effect of a periodised pre-season training plan on internal training load and subsequent stress tolerance, immune-endocrine responses and physical performance in tennis players. Well-trained young tennis players (n = 10) were monitored across the pre-season period, which was divided into 4 weeks of progressive overloading training and a 1-week tapering period. Weekly measures of internal training load, training monotony and stress tolerance (sources and symptoms of stress) were taken, along with salivary testosterone, cortisol and immunoglobulin A. One repetition maximum strength, running endurance, jump height and agility were assessed before and after training. The periodised training plan led to significant weekly changes in training loads (i.e. increasing in weeks 3 and 4, decreasing in week 5) and post-training improvements in strength, endurance and agility (P < 0.05). Cortisol concentration and the symptoms of stress also increased in weeks 3 and/or 4, before returning to baseline in week 5 (P < 0.05). Conversely, the testosterone to cortisol ratio decreased in weeks 3 and 4, before returning to baseline in week 5 (P < 0.05). In conclusion, the training plan evoked adaptive changes in stress tolerance and hormonal responses, which may have mediated the improvements in physical performance. PMID:24744485

  4. Schistosomiasis Coinfection in Children Influences Acquired Immune Response against Plasmodium falciparum Malaria Antigens

    PubMed Central

    Gaayeb, Lobna; Schacht, Anne-Marie; Charrier, Nicole; De Clerck, Dick; Dompnier, Jean-Pierre; Pillet, Sophie; Garraud, Olivier; N'Diaye, Abdoulaye A.; Riveau, Gilles

    2010-01-01

    Background Malaria and schistosomiasis coinfection frequently occurs in tropical countries. This study evaluates the influence of Schistosoma haematobium infection on specific antibody responses and cytokine production to recombinant merozoite surface protein-1-19 (MSP1-19) and schizont extract of Plasmodium falciparum in malaria-infected children. Methodology Specific IgG1 to MSP1-19, as well as IgG1 and IgG3 to schizont extract were significantly increased in coinfected children compared to P. falciparum mono-infected children. Stimulation with MSP1-19 lead to a specific production of both interleukin-10 (IL-10) and interferon-γ (IFN-γ), whereas the stimulation with schizont extract produced an IL-10 response only in the coinfected group. Conclusions Our study suggests that schistosomiasis coinfection favours anti-malarial protective antibody responses, which could be associated with the regulation of IL-10 and IFN-γ production and seems to be antigen-dependent. This study demonstrates the importance of infectious status of the population in the evaluation of acquired immunity against malaria and highlights the consequences of a multiple infection environment during clinical trials of anti-malaria vaccine candidates. PMID:20856680

  5. Altered immune parameters correlate with infection-related hospitalizations in children with Down syndrome.

    PubMed

    Martínez, Elizabeth; Castañeda, Diana; Jaramillo, Sonia; Iregui, Alejandro; Quiñonez, Tatiana; Rodríguez, Jairo A; Herrera, Eddy; Gómez, Ana Milena; Rondón, Martin A; Prieto, Juan Carlos; Angel, Juana; Franco, Manuel A; Mesa, Martha C

    2016-07-01

    In addition to previously studied immunological variables, the relative expression of IFNGR2, IFNAR1, CD18, and CD275 (all encoded in chromosome 21) on circulating leucocytes and multifunctional T cells (evaluated by an intracellular cytokine/proliferation assay) were compared between children with Down syndrome (DS) and healthy controls (HC). As previously reported, numbers of lymphocytes, CD4(+) T cells, Treg cells, B cells, and levels of serum IgM were decreased, and levels of IgG and IgA were increased in children with DS. Moreover, the relative expression of CD18 on T and B cells (previously and not previously reported, respectively) were elevated in DS children (p⩽0.01). Age and numbers of B and Treg cells moderately correlated with retrospectively identified infection related hospitalizations (rho: 0.300-0.460, p⩽0.003). Age and the numbers of Treg cells also correlated with prospectively identified infection related hospitalizations. Future studies are necessary to clarify the role of these parameters in the immunity of DS patients.

  6. Altered immune parameters correlate with infection-related hospitalizations in children with Down syndrome.

    PubMed

    Martínez, Elizabeth; Castañeda, Diana; Jaramillo, Sonia; Iregui, Alejandro; Quiñonez, Tatiana; Rodríguez, Jairo A; Herrera, Eddy; Gómez, Ana Milena; Rondón, Martin A; Prieto, Juan Carlos; Angel, Juana; Franco, Manuel A; Mesa, Martha C

    2016-07-01

    In addition to previously studied immunological variables, the relative expression of IFNGR2, IFNAR1, CD18, and CD275 (all encoded in chromosome 21) on circulating leucocytes and multifunctional T cells (evaluated by an intracellular cytokine/proliferation assay) were compared between children with Down syndrome (DS) and healthy controls (HC). As previously reported, numbers of lymphocytes, CD4(+) T cells, Treg cells, B cells, and levels of serum IgM were decreased, and levels of IgG and IgA were increased in children with DS. Moreover, the relative expression of CD18 on T and B cells (previously and not previously reported, respectively) were elevated in DS children (p⩽0.01). Age and numbers of B and Treg cells moderately correlated with retrospectively identified infection related hospitalizations (rho: 0.300-0.460, p⩽0.003). Age and the numbers of Treg cells also correlated with prospectively identified infection related hospitalizations. Future studies are necessary to clarify the role of these parameters in the immunity of DS patients. PMID:27166175

  7. Immunizing the World's Children by 1990. Hearing before the International Task Force of the Select Committee on Hunger. House of Representatives, Ninety-Ninth Congress, First Session.

    ERIC Educational Resources Information Center

    Congress of the U.S., Washington, DC.

    A hearing was held to update information on progress toward immunizing the world's children against diphtheria, whooping cough, tetanus, polio, measles, and tuberculosis. Immunization programs are regarded as essential in the effort to break the infection-malnutrition cycle in children in developing nations. Witnesses at the hearing included…

  8. Immunization coverage and its determinants among children born in 2008-2009 by questionnaire survey in Zhejiang, China.

    PubMed

    Hu, Yu; Chen, Enfu; Li, Qian; Chen, Yaping; Qi, Xiaohua

    2015-03-01

    The study aimed to assess the determinants of immunization coverage in children born in 2008-2009, living in Zhejiang Province. The World Health Organization's cluster sampling technique was applied. Immunization coverage of 5 vaccines was assessed: BCG vaccine, diphtheria and tetanus toxoids and pertussis vaccine, poliomyelitis vaccine, hepatitis B vaccine, and measles-containing vaccine. Determinants for age-appropriate immunization coverage rates were explored using logistic regression models. Immunization coverage of 5 vaccines were all greater than 90%, but the age-appropriate immunization coverage rates for 3 months and for first dose of measles-containing vaccine was 41.3% and 64.5%, respectively. Siblings in household, mother's education level, household registration, socioeconomic level of resident areas, satisfaction with clinical immunization service, and convenient access to local immunization clinic were associated with age-appropriate coverage rates. Age-appropriate immunization coverage rates should be given more attention and should be considered as a benchmark to strive for in the future intervention.

  9. Intramuscular anti-D in chronic immune thrombocytopenia children with severe thrombocytopenia.

    PubMed

    Sirachainan, Nongnuch; Anurathapan, Usanarat; Chuansumrit, Ampaiwan; Songdej, Duantida; Wongwerawattanakoon, Pakawan; Hutspardol, Sakara; Kitpoka, Pimpun

    2013-12-01

    Nine patients with chronic immune thrombocytopenia and platelet counts <20 × 10(9) /L, with a median age of 7.8 (3.8-15.5) years, received three phases of 10 mcg/kg/dose of intramuscular anti-D. Phase 1 was anti-D daily for 5 days, followed by phase 2, anti-D weekly for 12 weeks and withheld when platelet counts ≥ 20 × 10(9) /L, and then phase 3 was anti-D once every 2 weeks for 24 weeks. According to the International Working Group criteria, in phase 1, 66.7% of patients responded to the treatment. In phases 2 and 3, 11.1% (0-41.7%) and 7.7% (0-33.3%) of total episodes of follow up, respectively, responded to the treatment. Therefore, intramuscular anti-D given at a dose of 10 mcg/kg for 5 days is an alternative method to raise platelet counts in chronic immune thrombocytopenia children with severe thrombocytopenia where the intravenous form of anti-D is not available. PMID:24330299

  10. Intramuscular anti-D in chronic immune thrombocytopenia children with severe thrombocytopenia.

    PubMed

    Sirachainan, Nongnuch; Anurathapan, Usanarat; Chuansumrit, Ampaiwan; Songdej, Duantida; Wongwerawattanakoon, Pakawan; Hutspardol, Sakara; Kitpoka, Pimpun

    2013-12-01

    Nine patients with chronic immune thrombocytopenia and platelet counts <20 × 10(9) /L, with a median age of 7.8 (3.8-15.5) years, received three phases of 10 mcg/kg/dose of intramuscular anti-D. Phase 1 was anti-D daily for 5 days, followed by phase 2, anti-D weekly for 12 weeks and withheld when platelet counts ≥ 20 × 10(9) /L, and then phase 3 was anti-D once every 2 weeks for 24 weeks. According to the International Working Group criteria, in phase 1, 66.7% of patients responded to the treatment. In phases 2 and 3, 11.1% (0-41.7%) and 7.7% (0-33.3%) of total episodes of follow up, respectively, responded to the treatment. Therefore, intramuscular anti-D given at a dose of 10 mcg/kg for 5 days is an alternative method to raise platelet counts in chronic immune thrombocytopenia children with severe thrombocytopenia where the intravenous form of anti-D is not available.

  11. Parental concern about vaccine safety in Canadian children partially immunized at age 2: a multivariable model including system level factors.

    PubMed

    MacDonald, Shannon E; Schopflocher, Donald P; Vaudry, Wendy

    2014-01-01

    Children who begin but do not fully complete the recommended series of childhood vaccines by 2 y of age are a much larger group than those who receive no vaccines. While parents who refuse all vaccines typically express concern about vaccine safety, it is critical to determine what influences parents of 'partially' immunized children. This case-control study examined whether parental concern about vaccine safety was responsible for partial immunization, and whether other personal or system-level factors played an important role. A random sample of parents of partially and completely immunized 2 y old children were selected from a Canadian regional immunization registry and completed a postal survey assessing various personal and system-level factors. Unadjusted odds ratios (OR) and adjusted ORs (aOR) were calculated with logistic regression. While vaccine safety concern was associated with partial immunization (OR 7.338, 95% CI 4.138-13.012), other variables were more strongly associated and reduced the strength of the relationship between concern and partial immunization in multivariable analysis (aOR 2.829, 95% CI 1.151-6.957). Other important factors included perceived disease susceptibility and severity (aOR 4.629, 95% CI 2.017-10.625), residential mobility (aOR 3.908, 95% CI 2.075-7.358), daycare use (aOR 0.310, 95% CI 0.144-0.671), number of needles administered at each visit (aOR 7.734, 95% CI 2.598-23.025) and access to a regular physician (aOR 0.219, 95% CI 0.057-0.846). While concern about vaccine safety may be addressed through educational strategies, this study suggests that additional program and policy-level strategies may positively impact immunization uptake.

  12. Cytomegalovirus Infection May Contribute to the Reduced Immune Function, Growth, Development, and Health of HIV-Exposed, Uninfected African Children

    PubMed Central

    Filteau, Suzanne; Rowland-Jones, Sarah

    2016-01-01

    With increasing access to antiretroviral therapy (ART) in Africa, most children born to HIV-infected mothers are not themselves HIV-infected. These HIV-exposed, uninfected (HEU) children are at increased risk of mortality and have immune, growth, development, and health deficits compared to HIV-unexposed children. HEU children are known to be at higher risk than HIV-unexposed children of acquiring cytomegalovirus (CMV) infection in early life. This risk is largely unaffected by ART and is increased by breastfeeding, which itself is critically important for child health and survival. Early CMV infection, namely in utero or during early infancy, may contribute to reduced growth, altered or impaired immune functions, and sensory and cognitive deficits. We review the evidence that CMV may be responsible for the health impairments of HEU children. There are currently no ideal safe and effective interventions to reduce postnatal CMV infection. If a clinical trial showed proof of the principle that decreasing early CMV infection improved health and development of HEU children, this could provide the impetus needed for the development of better interventions to improve the health of this vulnerable population. PMID:27446087

  13. Cytomegalovirus Infection May Contribute to the Reduced Immune Function, Growth, Development, and Health of HIV-Exposed, Uninfected African Children.

    PubMed

    Filteau, Suzanne; Rowland-Jones, Sarah

    2016-01-01

    With increasing access to antiretroviral therapy (ART) in Africa, most children born to HIV-infected mothers are not themselves HIV-infected. These HIV-exposed, uninfected (HEU) children are at increased risk of mortality and have immune, growth, development, and health deficits compared to HIV-unexposed children. HEU children are known to be at higher risk than HIV-unexposed children of acquiring cytomegalovirus (CMV) infection in early life. This risk is largely unaffected by ART and is increased by breastfeeding, which itself is critically important for child health and survival. Early CMV infection, namely in utero or during early infancy, may contribute to reduced growth, altered or impaired immune functions, and sensory and cognitive deficits. We review the evidence that CMV may be responsible for the health impairments of HEU children. There are currently no ideal safe and effective interventions to reduce postnatal CMV infection. If a clinical trial showed proof of the principle that decreasing early CMV infection improved health and development of HEU children, this could provide the impetus needed for the development of better interventions to improve the health of this vulnerable population. PMID:27446087

  14. Impact of HIV Infection and Anti-Retroviral Therapy on the Immune Profile of and Microbial Translocation in HIV-Infected Children in Vietnam.

    PubMed

    Bi, Xiuqiong; Ishizaki, Azumi; Nguyen, Lam Van; Matsuda, Kazunori; Pham, Hung Viet; Phan, Chung Thi Thu; Ogata, Kiyohito; Giang, Thuy Thi Thanh; Phung, Thuy Thi Bich; Nguyen, Tuyen Thi; Tokoro, Masaharu; Pham, An Nhat; Khu, Dung Thi Khanh; Ichimura, Hiroshi

    2016-01-01

    CD4⁺ T-lymphocyte destruction, microbial translocation, and systemic immune activation are the main mechanisms of the pathogenesis of human immunodeficiency virus type 1 (HIV) infection. To investigate the impact of HIV infection and antiretroviral therapy (ART) on the immune profile of and microbial translocation in HIV-infected children, 60 HIV vertically infected children (31 without ART: HIV(+) and 29 with ART: ART(+)) and 20 HIV-uninfected children (HIV(-)) aged 2-12 years were recruited in Vietnam, and their blood samples were immunologically and bacteriologically analyzed. Among the HIV(+) children, the total CD4⁺-cell and their subset (type 1 helper T-cell (Th1)/Th2/Th17) counts were inversely correlated with age (all p < 0.05), whereas regulatory T-cell (Treg) counts and CD4/CD8 ratios had become lower, and the CD38⁺HLA (human leukocyte antigen)-DR⁺CD8⁺- (activated CD8⁺) cell percentage and plasma soluble CD14 (sCD14, a monocyte activation marker) levels had become higher than those of HIV(-) children by the age of 2 years; the CD4/CD8 ratio was inversely correlated with the plasma HIV RNA load and CD8⁺-cell activation status. Among the ART(+) children, the total CD4⁺-cell and Th2/Th17/Treg-subset counts and the CD4/CD8 ratio gradually increased, with estimated ART periods of normalization being 4.8-8.3 years, whereas Th1 counts and the CD8⁺-cell activation status normalized within 1 year of ART initiation. sCD14 levels remained high even after ART initiation. The detection frequency of bacterial 16S/23S ribosomal DNA/RNA in blood did not differ between HIV-infected and -uninfected children. Thus, in children, HIV infection caused a rapid decrease in Treg counts and the early activation of CD8⁺ cells and monocytes, and ART induced rapid Th1 recovery and early CD8⁺-cell activation normalization but had little effect on monocyte activation. The CD4/CD8 ratio could therefore be an additional marker for ART monitoring. PMID:27490536

  15. Impact of HIV Infection and Anti-Retroviral Therapy on the Immune Profile of and Microbial Translocation in HIV-Infected Children in Vietnam

    PubMed Central

    Bi, Xiuqiong; Ishizaki, Azumi; Nguyen, Lam Van; Matsuda, Kazunori; Pham, Hung Viet; Phan, Chung Thi Thu; Ogata, Kiyohito; Giang, Thuy Thi Thanh; Phung, Thuy Thi Bich; Nguyen, Tuyen Thi; Tokoro, Masaharu; Pham, An Nhat; Khu, Dung Thi Khanh; Ichimura, Hiroshi

    2016-01-01

    CD4+ T-lymphocyte destruction, microbial translocation, and systemic immune activation are the main mechanisms of the pathogenesis of human immunodeficiency virus type 1 (HIV) infection. To investigate the impact of HIV infection and antiretroviral therapy (ART) on the immune profile of and microbial translocation in HIV-infected children, 60 HIV vertically infected children (31 without ART: HIV(+) and 29 with ART: ART(+)) and 20 HIV-uninfected children (HIV(−)) aged 2–12 years were recruited in Vietnam, and their blood samples were immunologically and bacteriologically analyzed. Among the HIV(+) children, the total CD4+-cell and their subset (type 1 helper T-cell (Th1)/Th2/Th17) counts were inversely correlated with age (all p < 0.05), whereas regulatory T-cell (Treg) counts and CD4/CD8 ratios had become lower, and the CD38+HLA (human leukocyte antigen)-DR+CD8+- (activated CD8+) cell percentage and plasma soluble CD14 (sCD14, a monocyte activation marker) levels had become higher than those of HIV(−) children by the age of 2 years; the CD4/CD8 ratio was inversely correlated with the plasma HIV RNA load and CD8+-cell activation status. Among the ART(+) children, the total CD4+-cell and Th2/Th17/Treg-subset counts and the CD4/CD8 ratio gradually increased, with estimated ART periods of normalization being 4.8–8.3 years, whereas Th1 counts and the CD8+-cell activation status normalized within 1 year of ART initiation. sCD14 levels remained high even after ART initiation. The detection frequency of bacterial 16S/23S ribosomal DNA/RNA in blood did not differ between HIV-infected and -uninfected children. Thus, in children, HIV infection caused a rapid decrease in Treg counts and the early activation of CD8+ cells and monocytes, and ART induced rapid Th1 recovery and early CD8+-cell activation normalization but had little effect on monocyte activation. The CD4/CD8 ratio could therefore be an additional marker for ART monitoring. PMID:27490536

  16. Kinetics of antibody and memory B cell responses after MMR immunization in children and young adults.

    PubMed

    Kakoulidou, Maria; Ingelman-Sundberg, Hanna; Johansson, Elin; Cagigi, Alberto; Farouk, Salah Eldin; Nilsson, Anna; Johansen, Kari

    2013-01-11

    The persistence of antigen-specific memory B-cells (MBCs) in children and young adults long time after vaccination against measles, mumps and rubella (MMR) is not known. Here we have looked at the Swedish immunization program and examined children 1-10 years after the first MMR dose in early childhood, as well as young adults 7-18 years after the second dose of MMR. We show that Ab titers and MBCs against measles and rubella have different kinetics, indicating that the MBC pool and the corresponding Ab titers are regulated independently. These data fit well with other findings that continuous IgG secretion comes from long-lived plasma cells and not MBCs. We also demonstrate that individuals with low post-vaccination Ab titers might have an adequate MBC response. It remains to be shown if memory B-cells provide the same protection as specific antibodies, but our data is a valuable complement to the incomplete knowledge about correlates of protection after vaccination. PMID:23174196

  17. Subcutaneous anti-D globulin application is a safe treatment option of immune thrombocytopenia in children.

    PubMed

    Trebo, Monika M; Frey, Eva; Gadner, Helmut; Minkov, Milen

    2010-04-01

    Subcutaneous (sc) administration of anti-D seems to offer the same efficacy as intravenous administration but with less side effects. Here we report our experience with sc anti-D for pediatric immune thrombocytopenia (ITP). A total of 12 children with a median age of 11.2 years had been treated by sc anti-D. They received a median of 2 sc anti-D applications (range 1-31) with a dosage of 250-375 IE/kg body weight. Only in one out of a total of 102 single applications, a minimal and self-limited side effect (chills) had been observed. The mean platelet count was almost doubled after sc anti-D (p < 0.0001). After a median follow-up of 11.4 months, all patients are alive without major bleeding and stay well. We conclude that sc anti-D: is not only an efficient means of treating ITP in children but is also a safe and convenient one.

  18. Vaccine administration and the development of immune thrombocytopenic purpura in children.

    PubMed

    Cecinati, Valerio; Principi, Nicola; Brescia, Letizia; Giordano, Paola; Esposito, Susanna

    2013-05-01

    The most important reasons cited by the opponents of vaccines are concerns about vaccine safety. Unlike issues such as autism for which no indisputable documentation of direct relationship with vaccine use is available, immune thrombocytopenic purpura (ITP) is an adverse event that can really follow vaccine administration, and may limit vaccine use because little is known about which vaccines it may follow, its real incidence and severity, the risk of chronic disease, or the possibility of recurrences after new doses of the same vaccine. The main aim of this review is to clarify the real importance of thrombocytopenia as an adverse event and discuss how it may interfere with recommended vaccination schedules. The available data clearly indicate that ITP is very rare and the only vaccine for which there is a demonstrated cause-effect relationship is the measles, mumps and rubella (MMR) vaccine that can occur in 1 to 3 children every 100,000 vaccine doses. However, also in this case, the incidence of ITP is significantly lower than that observed during the natural diseases that the vaccine prevents. Consequently, ITP cannot be considered a problem limiting vaccine use except in the case of children suffering from chronic ITP who have to receive MMR vaccine. In these subjects, the risk-benefit ratio of the vaccine should be weighed against the risk of measles in the community. PMID:23324619

  19. Study on the immunity to measles in pre-school children.

    PubMed

    Yang, M S; Chen, E R; Hou, H J; Ko, Y C

    1989-09-01

    One hundred and ninety-seven pre-school children, composed of 109 boys and 88 girls, who resided in a rural community in southern Taiwan were studied. The age range was from 6 months to 5 years old (y/o) and vaccination coverage was determined by home visits and the vaccination records of the health station. Immunological status was tested by an enzyme-linked immunosorbent assay (ELISA) to determine the positive rate of measles-specific IgG. The results were as follows: 1, vaccination coverage in the studied sample was 87.9%; 2, the educational level of fathers had a significant influence on vaccination; 3, the positive rate of measles antibody in the vaccinated children was 73.9%; 4, the measles immunity level in the studied sample was 67.8%; and 5, the positive rate of measles antibody, as analyzed by a stratified test, indicated that vaccination age, the current age, and the number of siblings were the significant influence factors. When adjusted to the above variables, it was found that the number of siblings was the significant influencing factor. PMID:2607558

  20. Immunizing nomadic children and livestock--Experience in North East Zone of Somalia.

    PubMed

    Kamadjeu, Raoul; Mulugeta, Abraham; Gupta, Dhananjoy; Abshir Hirsi, Abdirisak; Belayneh, Asalif; Clark-Hattingh, Marianne; Adams, Clement; Abed, Payenda; Kyeyune, Brenda; Ahmed, Tajudin; Salih, Mohamed; Biaou, Cyprien; Toure, Brigitte

    2015-01-01

    Nomads and pastoralists represent around 30% of the population of North East zone of Somalia (Puntland) and have very limited access to basic health including immunization. During the 2013-2014 polio outbreak in Somalia, an increase number of polio cases notified health services among these underserved communities highlighted the urgent need to devise innovative strategies to reach them. Harnessing the high demand for veterinary services among pastoralist communities, the Ministry of Health and the Ministry of Livestock, with support from UNICEF, WHO and FAO launched an integrated human and animal vaccination campaign on 19 October 2014. Over 30 days, 20 social mobilizers conducted shelter to shelter social mobilization and interpersonal communication for nomadic/pastoralist hamlets, 20 human vaccination teams, accompanied by local community elders, traveled with animal vaccination teams to administer polio and measles vaccination to pastoralist communities in the 5 regions of Puntland. 26,393 children (0 to 10 years) received Oral Polio Vaccine (OPV) out of which 34% for the first time ever; 23,099 were vaccinated against measles. and 12,556 Vitamin A. Despite various operational challenges and a significantly higher operational cost of $6.2 per child reached with OPV, the integrated human and animal vaccination campaign was effective in reaching the unvaccinated children from nomadic and pastoralist communities of Somalia.

  1. Immunizing nomadic children and livestock--Experience in North East Zone of Somalia.

    PubMed

    Kamadjeu, Raoul; Mulugeta, Abraham; Gupta, Dhananjoy; Abshir Hirsi, Abdirisak; Belayneh, Asalif; Clark-Hattingh, Marianne; Adams, Clement; Abed, Payenda; Kyeyune, Brenda; Ahmed, Tajudin; Salih, Mohamed; Biaou, Cyprien; Toure, Brigitte

    2015-01-01

    Nomads and pastoralists represent around 30% of the population of North East zone of Somalia (Puntland) and have very limited access to basic health including immunization. During the 2013-2014 polio outbreak in Somalia, an increase number of polio cases notified health services among these underserved communities highlighted the urgent need to devise innovative strategies to reach them. Harnessing the high demand for veterinary services among pastoralist communities, the Ministry of Health and the Ministry of Livestock, with support from UNICEF, WHO and FAO launched an integrated human and animal vaccination campaign on 19 October 2014. Over 30 days, 20 social mobilizers conducted shelter to shelter social mobilization and interpersonal communication for nomadic/pastoralist hamlets, 20 human vaccination teams, accompanied by local community elders, traveled with animal vaccination teams to administer polio and measles vaccination to pastoralist communities in the 5 regions of Puntland. 26,393 children (0 to 10 years) received Oral Polio Vaccine (OPV) out of which 34% for the first time ever; 23,099 were vaccinated against measles. and 12,556 Vitamin A. Despite various operational challenges and a significantly higher operational cost of $6.2 per child reached with OPV, the integrated human and animal vaccination campaign was effective in reaching the unvaccinated children from nomadic and pastoralist communities of Somalia. PMID:26365693

  2. Exposure to Violence, Parental Monitoring, and Television Viewing as Contributors to Children's Psychological Trauma

    ERIC Educational Resources Information Center

    Singer, Mark I.; Flannery, Daniel J.; Guo, Shenyang; Miller, David; Leibbrandt, Sylvia

    2004-01-01

    This study examined the relative contributions of exposure to violence, parental monitoring, and television viewing habits to children's self-reported symptoms of psychological trauma. Children in grades 3-8 in 11 public schools completed an anonymous self-report questionnaire administered during usual school hours. The final sample was comprised…

  3. Monitoring of antibiotic resistance rates of Helicobacter pylori in Austrian children, 2002-2009.

    PubMed

    Prechtl, Johannes; Deutschmann, Andrea; Savic, Tamara; Jahnel, Jörg; Bogiatzis, Athanasios; Muntean, Wolfgang; Hauer, Almuthe C; Hoffmann, Karl Martin

    2012-03-01

    We retrospectively studied antibiotic resistance rates of H. pylori and their temporal changes in children. Resistance rates were 21.6% for both clarithromycin and metronidazole. There was no overall difference between children with or without migrational background. Resistance rates increased over time, and patients without migrational background showed a significant increase in metronidazole resistance. Our study emphasizes antibiotic resistance monitoring of H. pylori in children.

  4. Children's understanding of the immune system: Integrating the cognitive-developmental and intuitive theories' perspectives

    NASA Astrophysics Data System (ADS)

    Landry-Boozer, Kristine L.

    Traditional cognitive-developmental researchers have provided a large body of evidence supporting the stage-like progression of children's cognitive development. Further, from this body of research comes evidence that children's understanding of HIV/AIDS develops in much the same way as their understanding of other illness-related concepts. Researchers from a newer perspective assert that biological concepts develop from intuitive theories. In general, as children are exposed to relevant content and have opportunities to organize this information, their theories become more accurate and differentiated. According to this perspective, there are no broad structural constraints on developing concepts, as asserted by cognitive developmental theorists. The purpose of the current study was two-fold: to provide support for both theoretical perspectives, while at the same time to explore children's conceptualizations of the immune system, which has not been done previously in the cognitive-developmental literature. One hundred ninety children ranging in age from 4 years old through 11 years old, and a group of adults, participated. Each participant was interviewed regarding health concepts and the body's function in maintaining health. Participants were also asked to report if they had certain experiences that would have led to relevant content exposure. Qualitative analyses were utilized to code the interviews with rubrics based on both theoretical perspectives. Quantitative analyses consisted of a series of univariate ANOVAs (and post hoc tests when appropriate) examining all three coding variables (accuracy, differentiation, and developmental level) across various age-group combinations and exposure groups. Results of these analyses provided support for both theoretical perspectives. When the data were analyzed for developmental level by all ages, a stage-like progression consistent with Piagetian stages emerged. When accuracy and differentiation were examined (intuitive

  5. Factors associated with the development of tuberculosis in BCG immunized children.

    PubMed

    Tipayamongkholgul, Mathuros; Podhipak, Amornrath; Chearskul, Sanay; Sunakorn, Pramuan

    2005-01-01

    In this hospital-based case-control study, children attending Siriraj Hospital and Queen Sirikit National Institute of Child Health from 1 December 2002 to 30 June 2003 were studied to define factors associated with TB in BCG immunized children (n = 260). Subjects of the same age and sex were divided into case and control groups by tuberculosis status. Caregivers were interviewed with a structured questionnaire. Data were analyzed by univariate analysis and multivariate analysis for biological factors (birth weight, health status, nutritional status), socioeconomic factors (parental education, education of caregiver, parental occupation, household incomes, and stability of household incomes), and environmental factors (history of contact with a tuberculosis patient, housing ventilation, child's bedroom ventilation, biomass smoke, passive smoking, crowded family and crowded in child's bedroom). Our findings show that children who had contact with TB patients had a very high risk of tuberculosis, even though they were vaccinated at birth. The risks vary according to the closeness level: very close (OR 85.67, 95%CI = 11.33-647.79), close (OR 31.11, 95%CI = 3.93-246.22) and not close (OR 32.70, 95%CI = 4.18-255.94). In order to identify the effect of others variables, the data was reanalyzed only in the group with no history of TB patient contacts (n = 192). Living in a crowded family, which was reflected by an average of 5 or more persons per room, also increased the risk (OR 11.18, 95%CI = 2.35-53.20). The other factor that increased the risk for tuberculosis was passive smoking. Children who were exposed to passive smoking had a 9.31 times increased risk of getting tuberculosis (95%CI = 3.14-27.58). These findings suggest that the public health department must develop a TB surveillance system in high TB prevalence areas, and in high density communities, and encourage smokers in every family to avoid smoking near children. Latent tuberculosis treatment

  6. Management of immune thrombocytopenic purpura in children: potential role of novel agents.

    PubMed

    Bredlau, Amy Lee; Semple, John W; Segel, George B

    2011-08-01

    The treatment of immune thrombocytopenic purpura (ITP) in children is controversial, requiring individualized assessment of the patient and consideration of treatment options. If the platelet count is >10 000/μL and the patient is asymptomatic, a 'watch and wait' strategy is appropriate since most children with ITP will recover completely without pharmacotherapy. If therapy is indicated because of bleeding or a platelet count <10 000/μL, then treatment with glucocorticoids, intravenous immunoglobulin (IVIg), or anti-D are possible initial choices. Glucocorticoid treatment is the least expensive and is our usual first choice of therapy. Its use assumes that the blood counts and blood film have been evaluated to ensure the absence of evidence of alternative diagnoses, such as thrombotic thrombocytopenic purpura or incipient acute leukemia. IVIg is expensive and often causes severe headache, nausea and vomiting, and requires hospitalization at our institution. Anti-D therapy is also expensive and can only be used in patients who are Rhesus D positive. These therapies, even if only transiently effective, can be repeated if necessary. Children usually recover from newly diagnosed ITP, with or without multiple courses of medical therapy. If the disease becomes 'persistent' with severe thrombocytopenia and/or bleeding, and is no longer responsive to the three first-line therapies, the next approach includes the use of thrombopoietin receptor agonists or rituximab. When the disease persists for more than 1 year, it is considered chronic, and, if symptomatic, it may become necessary to consider third-line therapies, including splenectomy, alternative immunosuppressive agents, or combination or investigative chemoimmunotherapy. This review considers the indications, mechanism of action, and effectiveness of the traditional and novel treatment options for patients with ITP.

  7. Immune reconstitution during maintenance therapy in children with acute lymphoblastic leukemia, relation to co-existing infection.

    PubMed

    El-Chennawi, Farha A; Al-Tonbary, Youssef A; Mossad, Youssef M; Ahmed, Mona A

    2008-08-01

    Immunosuppression is a major side effect of cancer chemotherapy. The process of immune reconstitution can be dissimilar according to the nature of the disease, type and doses of drugs, and age of the patients. Recently, several studies have examined immune reconstitution in children and young adults after intensive chemotherapy for solid tumours or stem cell transplantation. The aim of the present study is to evaluate immune reconstitution (cellular and humoral) in children with acute lymphoblastic leukemia during the maintenance phase of therapy and to correlate between the complicating infections and the abnormalities in immune system during reconstitution. To achieve this goal, 36 children with acute lymphoblastic leukemia (24 females and 12 males) in the maintenance phase of therapy with 12 healthy children of matched age and sex served as a control group were recruited in this study. The patients were taken consecutively from the Hematology/Oncology Outpatient Clinic of Mansoura University Children's Hospital (MUCH). They were subjected to thorough history taking, clinical examination and laboratory investigations in the form of: complete blood count, serum creatinine, liver function tests and evaluation of the immune system by estimation of CD3, CD4, CD8, CD19 and CD56 (cellular immunity) by flow cytometry and immunoglobulins A, M and G (humoral immunity) at the first and the third month of maintenance therapy. The results of the study documented presence and persistence of leucopenia and lymphopenia during maintenance therapy with decreased medians of CD3, CD4 and CD8 from the first to the third month of therapy and in comparison to the control group. The other markers CD19, CD56, IgA, IgM, IgG and CD4/CD8 ratio showed increasing median from the first to the third month of therapy. Also we detect a significant correlation between infection and CD19 and serum IgM at the first month and between infection and CD19, IgM and CD4/CD8 ratio at the third month of

  8. Recent trends in pediatric Haemophilus influenzae type B infections in Canada. Immunization Monitoring Program, Active (IMPACT) of the Canadian Paediatric Society and the Laboratory Centre for Disease Control.

    PubMed Central

    Scheifele, D W

    1996-01-01

    OBJECTIVE: To describe changes in the number of cases of Haemophilus influenzae type b (Hib) infections among Canadian children before and after the introductory phases of Hib vaccination. DESIGN: Multicentre case series. SETTING: All 10 pediatric tertiary care centres across Canada participating in the Immunization Monitoring Program, Active (IMPACT) of the Canadian Paediatric Society and the Laboratory Centre for Disease control. PATIENTS: Children with a Hib infection admitted to any of the participating hospitals from 1985 to 1994. Annual case totals from 1985 to 1990 were determined from records of hospital laboratories or coded discharge diagnoses, or both. From 1991 to 1994 intensive case surveillance was conducted on the wards in addition to thorough record searches as above. OUTCOME MEASURES: Estimated annual case totals for 1985-90. For 1991-94 intensive surveillance for quarterly case totals, yearly age distribution of cases, and proportion of recent cases that represent vaccination failures or missed opportunities to prevent infection. RESULTS: The total number of Hib cases from 1985 to 1990 was 2095; from 1991 to 1994, there were 326 laboratory-confirmed cases and 15 probably cases supported by Hib antigen detection. The annual number of cases declined from an estimated 485 in 1985 to 24 in 1994, a decrease of 95.1%. The steepest interannual decrease (63.7%) occurred between 1992 and 1993, following the introduction of infant-based vaccination programs across Canada. The number of Hib cases involving children most at risk (those 6 to 18 months old) decreased from 78 in 1991 to 4 in 1994. Of the 24 cases in 1994, 6 were categorized as preventable, 1 was fatal, and 8 were vaccine failures (2 of which involved currently used vaccines). CONCLUSION: The prevalence of Hib infections reported by the IMPACT centres has declined greatly since the introduction of vaccination programs. However, deaths and complications continue to occur, attesting to the need to

  9. Diagnosis, monitoring and management of immune-related adverse drug reactions of anti-PD-1 antibody therapy.

    PubMed

    Eigentler, Thomas K; Hassel, Jessica C; Berking, Carola; Aberle, Jens; Bachmann, Oliver; Grünwald, Viktor; Kähler, Katharina C; Loquai, Carmen; Reinmuth, Niels; Steins, Martin; Zimmer, Lisa; Sendl, Anna; Gutzmer, Ralf

    2016-04-01

    PD-1 checkpoint inhibitors are associated with a specific spectrum of immune-related adverse events. This spectrum is different from toxicities known for kinase inhibitors or cytotoxic drugs. Since PD-1 directed therapies show effectivity in an increasing number of malignant diseases, their clinical usage will increase rapidly. Therefore clinicians from different specialities such as medical oncology, internal medicine, family doctors and emergency unit staff should be aware of the adverse effects of PD-1 checkpoint inhibitors to avoid delays in diagnosis and treatment. Based on pooled data from pivotal trials as reported by the European Medicines Agency, the present paper reviews incidences and kinetics of onset and resolution of immune-mediated "adverse events of specific interest" (AEOSI) of both approved PD-1 inhibitors nivolumab and pembrolizumab. In general, the severity of AEOSI is mild to moderate (grade 1-2); the frequency of immune-mediated but also idiopathic grade 3-4 adverse drug reactions is ⩽2% for any event term. Recommendations for the diagnosis, monitoring and management of the relevant dermatological, gastrointestinal, pulmonary, endocrine, renal and hepatic toxicities are convened by an expert panel that consolidated and clarified treatment recommendations after the onset of AEOSI. Although the time of onset is not predictable - the medians range from 1 to 6months - the huge majority of events is reversible, with no impact of the time of onset. By the systemic use of glucocorticoids, notably methylprednisolone or equivalents, most AEOSI are well manageable. Non-steroidal immunosuppressants may be used in certain cases of refractory/recalcitrant, long-lasting immune toxicities. With regard to the outstanding clinical activity of the anti-PD-1 antibodies, therapy restart is the principal therapeutic option after recovery of grade 2 AEOSI, or diminution of higher grade skin or endocrine events to mild severity. Early diagnosis and close clinical

  10. Tacrolimus ointment does not affect the immediate response to vaccination, the generation of immune memory, or humoral and cell‐mediated immunity in children

    PubMed Central

    Hofman, T; Cranswick, N; Kuna, P; Boznanski, A; Latos, T; Gold, M; Murrell, D F; Gebauer, K; Behre, U; Machura, E; Ólafsson, J; Szalai, Z

    2006-01-01

    Background Concern exists that the prolonged application of immunomodulators to treat atopic dermatitis may cause systemic immunosuppression. Aims In a 7‐month, multicentre, randomised, controlled trial, we investigated the equivalence of response to vaccination against meningococcal serogroup C disease with a protein‐conjugate vaccine in children (2–11 years) with moderate to severe atopic dermatitis, by applying either 0.03% tacrolimus ointment (TAC‐O; n = 21) or a hydrocortisone ointment regimen (HC‐O; n = 111). Methods TAC‐O was applied twice daily (bid) for 3 weeks, and thereafter daily until clearance. 1% hydrocortisone acetate (HA) for head/neck and 0.1% hydrocortisone butyrate ointment for trunk/limbs was applied bid for 2 weeks; thereafter HA was applied bid to all affected areas. At week 1, patients were vaccinated with protein‐conjugate vaccine against meningococcal serogroup C, and challenged at month 6 with low dose meningococcal polysaccharide vaccine. The control group (44 non‐atopic dermatatits children) received the primary vaccination and challenge dose. Assessments were made at baseline, weeks 1 and 5, and months 6 and 7. The primary end point was the percentage of patients with a serum bactericidal antibody (SBA) titre ⩾8 at the week 5 visit. Results The response rate (patients with SBA titre ⩾8) was 97.5% (confidence interval (CI) approximately 97.3 to 100), 99.1% (94.8 to 100) and 97.7% (93.3 to 100) in the TAC‐O, HC‐O and control groups, respectively. Conclusions The immune response to vaccination against meningococcal serogroup C in children with atopic dermatitis applying either 0.03% TAC‐O or HC is equivalent. Ointment application does not affect the immediate response to vaccination, generation of immune memory or humoral and cell‐mediated immunity. PMID:16798785

  11. Physical and Emotional States as Memory-relevant Factors: Cognitive Monitoring by Young Children.

    ERIC Educational Resources Information Center

    Hayes, Donald S.; And Others

    1987-01-01

    The Flavell (l981) model of cognitive monitoring and metamnemonic development was tested by four experiments conducted to determine whether preschool children (1) recognize that mood, fatigue, and fear are variables that influence learning; and (2) self-monitor their internal states and adjust their study behavior when they are sad or tired. (NH)

  12. Positive Peer Pressure: The Effects of Peer Monitoring on Children's Disruptive Behavior.

    ERIC Educational Resources Information Center

    Smith, Lisa K. Carden; Fowler, Susan A.

    1984-01-01

    Two experiments examined the effectiveness of a peer-monitored token system on reducing disruption and nonparticipation during a transition period of a kinderagarten class for behaviorally impaired children. Results suggested that both teacher-and peer-monitored interventions were successful in decreasing disruption and increasing participation of…

  13. Clearance of HBV DNA in immunized children born to HBsAg-positive mothers, years after being diagnosed with occult HBV infection.

    PubMed

    Sadeghi, A; Yahyapour, Y; Poortahmasebi, V; Shahmoradi, S; Roggendorf, M; Karimzadeh, H; Alavian, S M; Jazayeri, S M

    2016-04-01

    In a previous study, we observed immunoprophylaxis failure due to occult hepatitis B virus (HBV) infection (OBI) despite the presence of adequate levels of anti-HBs in 21 (28%) of 75 children born to HBsAg-positive mothers. The aim of the study was to explore the maintenance of this cryptic condition in this population. Of 21 OBI-positive children, 17 were enrolled. HBV serological profiles were determined by enzyme-linked immunosorbent assay. Highly sensitive real-time and standard PCR followed by direct sequencing were applied in positive cases. The mean age (±SD) of studied patients was 6.57 ± 2.75 years. All children still were negative for HBsAg. All but one (94%) were negative for HBV DNA. Only two children were positive for anti-HBc. The results of the most recent anti-HBs titration showed that 4 (23.5%) and 13 (76.5%) had low (<10 IU/mL) and adequate (>10 IU/mL) levels of anti-HBs, respectively. The only still OBI-positive patient had an HBV DNA level of 50 copy/mL, carried the G145R mutation when tested in 2009 and again in 2013 in the 'a' determinant region of the surface protein. Further follow-up showed that after 18 months, he was negative for HBV DNA. In high-risk children, the initial HBV DNA positivity early in the life (vertical infection) does not necessarily indicate a prolonged persistence of HBV DNA (occult infection). Adequate levels of anti-HBs after vaccine and hepatitis B immune globulin immunoprophylaxis following birth could eventually clear the virus as time goes by. Periodic monitoring of these children at certain time intervals is highly recommended.

  14. Effect of age on the risk of Fever and seizures following immunization with measles-containing vaccines in children.

    PubMed

    Rowhani-Rahbar, Ali; Fireman, Bruce; Lewis, Edwin; Nordin, James; Naleway, Allison; Jacobsen, Steven J; Jackson, Lisa A; Tse, Alison; Belongia, Edward A; Hambidge, Simon J; Weintraub, Eric; Baxter, Roger; Klein, Nicola P

    2013-12-01

    IMPORTANCE The first dose of live attenuated measles-containing vaccines is associated with an increased risk of febrile seizures 7 to 10 days following immunization among 12- to 23-month-old children. The combination measles, mumps, rubella, and varicella vaccine is associated with a 2-fold increased risk of febrile seizures 7 to 10 days following immunization compared with the separately administered measles, mumps, and rubella and varicella vaccines. It is unknown whether the magnitude of these increased risks depends on age at immunization. OBJECTIVE To examine the potential modifying effect of age on the risk of fever and seizures following immunization with measles-containing vaccines. DESIGN, SETTING, AND PARTICIPANTS Retrospective cohort study at 8 Vaccine Safety Datalink sites of a total of 840,348 children 12 to 23 months of age who had received a measles-containing vaccine from 2001 through 2011. EXPOSURES Any measles-containing vaccines and measles-containing vaccines by type. MAIN OUTCOMES AND MEASURES Fever and seizure events occurring during a 42-day postimmunization observation period. RESULTS In the analysis of any measles-containing vaccines, the increased risk of seizures during the 7- to 10-day risk interval, using the remainder of the observation period as the control interval, was significantly greater among older children (relative risk, 6.5; 95% CI, 5.3-8.1; attributable risk, 9.5 excess cases per 10,000 doses; 95% CI, 7.6-11.5) than among younger children (relative risk, 3.4; 95% CI, 3.0-3.9; attributable risk = 4.0 excess cases per 10,000 doses; 95% CI, 3.4-4.6). The relative risk of postimmunization fever was significantly greater among older children than among younger children; however, its attributable risk was not. In the analysis of vaccine type, measles, mumps, rubella, and varicella vaccine was associated with a 1.4-fold increase in the risk of fever and 2-fold increase in the risk of seizures compared with measles, mumps, and

  15. A Study on Longevity of Immune Response after Vaccination with Salmonella Typhi Vi Conjugate Vaccine (Pedatyph™) in Children

    PubMed Central

    Sadasivam, Kanimozhi; Vivekanandhan, Aravindhan; Arunachalam, Prema; Pasupathy, Sekar

    2015-01-01

    Background and Objectives Owing to the limitations of the conventional polysaccharide vaccines, global efforts have been made to develop conjugated polysaccharide vaccines for typhoid. Duration of immune response induced by these vaccines is critical to define the efficacy and frequency of required booster dose. This study was done to determine the duration of immune response following vaccination with Salmonella Typhi Vi conjugate vaccine (Pedatyph™) in children and to assess the booster effect of second dose of conjugate typhoid vaccine. Materials and Methods Forty children were recalled from a cohort of 400 children, who received one dose or two doses of PedaTyph™, 30 months after vaccination. Ten non-vaccinated children were also recalled. Their serum samples were assessed by ELISA for anti Vi antibody. Results Significantly high titers of anti-Vi polysaccharide IgG antibodies were present in vaccinated children even after 30 months of vaccination as compared to non-vaccinated children. Geometric mean titers (GMT) with 95% confidence intervals were 14 (4.8-29.8), 17 (7.4-33) and 6.4 (0.8-12) μg/ml for single dose, two doses and control group respectively. The children in two doses group had higher antibody titers as compared to single dose group. However, the difference was not significant. Interpretation and Conclusion PedaTyph™ was found to induce long term immune response as evidenced by presence of significant anti-Vi polysaccharide antibodies after 30 months of vaccination. No significant advantage of two doses regimen over one dose was found. Hence one dose vaccination with PedaTyph™ is suggested. PMID:26155525

  16. Plasmodium falciparum Clearance Is Rapid and Pitting Independent in Immune Malian Children Treated With Artesunate for Malaria

    PubMed Central

    Ndour, Papa Alioune; Lopera-Mesa, Tatiana M.; Diakité, Seidina A. S.; Chiang, Serena; Mouri, Oussama; Roussel, Camille; Jauréguiberry, Stéphane; Biligui, Sylvestre; Kendjo, Eric; Claessens, Antoine; Ciceron, Liliane; Mazier, Dominique; Thellier, Marc; Diakité, Mahamadou; Fairhurst, Rick M.; Buffet, Pierre A.

    2015-01-01

    Background In Plasmodium falciparum–infected patients treated with artemisinins, parasitemia declines through so-called pitting, an innate splenic process that transforms infected red blood cells (iRBCs) into once-infected RBCs (O-iRBCs). Methods We measured pitting in 83 French travelers and 42 Malian children treated for malaria with artesunate. Results In travelers, O-iRBCs peaked at 107.7% initial parasitemia. In Malian children aged 1.5–4 years, O-iRBCs peaked at higher concentrations than in children aged 9–13 years (91.60% vs 31.95%; P = .0097). The parasite clearance time in older children was shorter than in younger children (P = .0001), and the decline in parasitemia in children aged 1.5–4 years often started 6 hours after treatment initiation, a lag phase generally absent in infants and older children. A 6-hour lag phase in artificial pitting of artesunate-exposed iRBCs was also observed in vitro. The proportion of iRBCs recognized by autologous immunoglobulin G (IgG) correlated with the parasite clearance time (r = −0.501; P = .0006) and peak O-iRBC concentration (r = −0.420; P = .0033). Conclusions Antimalarial immunity correlates with fast artemisinin-induced parasite clearance and low pitting rates. In nonimmune populations, artemisinin-induced P. falciparum clearance is related to pitting and starts after a 6-hour lag phase. In immune populations, passively and naturally acquired immune mechanisms operating faster than pitting may exist. This mechanism may mitigate the emergence of artemisinin-resistant P. falciparum in Africa. PMID:25183768

  17. Childhood Immunization Schedule

    MedlinePlus

    ... Recommendations Why Immunize? Vaccines: The Basics Instant Childhood Immunization Schedule Recommend on Facebook Tweet Share Compartir Get ... date. See Disclaimer for additional details. Based on Immunization Schedule for Children 0 through 6 Years of ...

  18. [Study of factors influencing hepatitis B immunization coverage in 1 to 8-years-old children in the Ouidah health district in Benin in 2007].

    PubMed

    Bossali, F; Paraiso, M; Bokossa, A; Fourn, L

    2010-04-01

    Hepatitis B is a major public health problem in Africa. The estimated prevalence in Benin is between 5.2% and 8.3%. Since 1992, the WHO has recommended immunization of all children between 0 and 12-months-old all around the world. Benin has been vaccinating children from 0 to 11 months since 1999. The purpose of this study was to identify factors influencing hepatitis B immunization coverage in children from 1 to 8-years-old in the Ouidah health district. This descriptive and analytical cross sectional study was carried out from October 25 to 31, 2007. The primary study targets were children from 1 to 8 years. Secondary targets were mothers and healthcare workers. A three-degree cluster sampling technique was used. Hepatitis immunization coverage was 72.2% (95%CI, 65.4 - 78.3). The negative factor influencing coverage in children was age over 5 years reflecting the absence of catch-up sessions for untargeted children overlooked for hepatitis B immunization. The negative factor in mothers was age over 30 years pending multivariate analysis that was not performed in this study. Regarding healthcare workers, understaffing was noted at this level of the health system. Hepatitis B immunization coverage in untargeted children was lower than in children between 0 and 11 months. In 2007, hepatitis B immunization coverage in the Ouidah health district was lower in untargeted children than children of 0 to 11 months. This study showed that immunization coverage decreased with age, thus underlining the need for catch-up sessions to ensure hepatitis B immunization in high prevalence areas.

  19. [Role of children physical development in radiation hygienic monitoring system].

    PubMed

    Kirillov, V F; Mikhaĭlov, A I; Kozlova, E Iu

    2014-01-01

    The article deals with longstanding work on studies of physical development parameters among preschoolers aged 4-7 and dwelling on territories near to objects with potential radiation danger, also on radiation-connected anxiety in parents of the examined children. The stated objects when exploited in normal mode were proved to cause no influence on the children's development. Social and economical factors appeared to play leading role in developmental parameters formation. Increased level of radiation-connected anxiety in parents of the children examined appeared to be out of proportion to real favorable radiation background of the territories examined. PMID:25069276

  20. EXPOSURE MONITORING COMPONENT FOR DETROIT CHILDREN'S HEALTH STUDY ( DCHS )

    EPA Science Inventory

    Conventional, regulatory-based air monitoring is expensive and, thus, conducted at one or few locations in a city. This provides limited info on intra-urban variability and spatial distribution of air pollution. Research-oriented urban network monitoring has progressed with inc...

  1. Nonverbal indicants of comprehension monitoring in language-disordered children.

    PubMed

    Skarakis-Doyle, E; MacLellan, N; Mullin, K

    1990-08-01

    This study investigated normal and language-disordered (LD) children's patterns of nonverbal behavior in response to messages varying in degree of ambiguity. Each LD child was matched to two normally developing children: one for comprehension level (LM) and the other for chronological age (CM). All children participated in a videotaped ambiguity detection task. Nonverbal behaviors that were produced between the time the message was completed and the examiner's acknowledgment of the response were scored for type of behavior exhibited including eye contact, hand behavior, body movement, and smile. Results demonstrated that all subjects increased their nonverbal behavior (e.g. eye contact) from unambiguous to ambiguous message conditions, suggesting awareness of the differences in these message types at a rudimentary level. Most often nonverbal indication was the only signal of ambiguity detection exhibited by the LD children and their LM peers. Only the CM children concurrently indicated awareness through more direct means (i.e., verbalization and pointing to all possible referents) in a consistent and accurate manner. The finding that LD children did differentiate inadequate from adequate messages in a rudimentary manner suggests that clinicians might promote the intentionality of these preintentional nonverbal behaviors as a possible intervention strategy. PMID:2381188

  2. Long-term antibody response and immunologic memory in children immunized with hepatitis B vaccine at birth.

    PubMed

    Saffar, M J; Rezai, M S

    2004-12-01

    Four hundred and fifty three healthy children immunized with a course of hepatitis B vaccine beginning at birth were tested at 10-11 years of age for persistence of anti-hepatitis B-S antigen antibody (anti-HBs); and responses of children without protective antibody to different doses of hepatitis B vaccine booster were evaluated. Although nearly 42% of them were not seroprotected, but most of boosted subjects (87.3%) retained robust immunologic memory and rapidly retained a protective anti-HBs antibody titer of at least 10 IU/L after booster vaccination.

  3. [Relations of melatonin level and insufficiency of T and B immune components in children with acute viral neuroinfections].

    PubMed

    Evtushenko, S K; Svechkin, O V; Samsonenko, R A

    1990-01-01

    A study was made of the content of melatonin, cortisol and indicators of cellular (E-rosette formation, 3H-lymphocyte blast transformation) and humoral (E AC-rosette formation, IgA, IgM IgG) immunity in 36 children with acute viral neuroinfections (encephalitis, encephalomyelitis, chorio-ependymitis, polyradiculoneuritis). The children's age ranged from 7 to 14 years. A significant correlation was determined between the levels of melatonin, cortisol, 3H-lymphocyte blast transformation and IgG. Variants of immunomodulating therapy are provided, bearing in mind the disorders revealed.

  4. Immune reactions associated with silicone-based ventriculo-peritoneal shunt malfunctions in children.

    PubMed

    VandeVord, Pamela J; Gupta, Nalini; Wilson, Russell B; Vinuya, Ricardo Z; Schaefer, Caralee J; Canady, Alexa I; Wooley, Paul H

    2004-08-01

    The implantation of ventriculo-peritoneal (VP) shunting systems is the most commonly performed neurological procedure in children with hydrocephalus. Although the overall complication risk is low, the cumulative risk of shunt failure is high and unfortunately results in a high prevalence of revision surgeries. In this study, we explored the concept that some pediatric patients may develop an immune response to either the proteins attached to the silicone implant surface or to the biomaterial itself, and that this reaction may contribute to VP shunt failure in some individuals. The data displays that the sterile shunt malfunction group had a higher rate of protein deposition and increased levels of autoantibodies to the extracted surface proteins as compared to individuals with functioning shunting systems. The precise nature of the shunt-bound proteins that serve as antigens in this experiment have not yet been determined. The data also indicated that some individuals develop antibodies to polymeric substances that cross-react with partially polymerized acrylamide. The detection of significant amounts of shunt-bound protein, antibody responses to these proteins and to polymeric substances suggest that an immunological response to these proteins may play a role in the mechanism behind sterile shunt malfunctions.

  5. Polymorphisms of Immunity Genes and Susceptibility to Otitis Media in Children

    PubMed Central

    Nokso-Koivisto, Johanna; Chonmaitree, Tasnee; Jennings, Kristofer; Matalon, Reuben; Block, Stan; Patel, Janak A.

    2014-01-01

    Background Acute otitis media (OM) is a common disease which often develops through complex interactions between the host, the pathogen and environmental factors. We studied single nucleotide polymorphisms (SNPs) of genes involved in innate and adaptive immunity, and other host and environmental factors for their role in OM. Methods Using Sequenom Massarray platform, 21 SNPs were studied in 653 children from prospective (n = 202) and retrospective (n = 451) cohorts. Data were analyzed for the relationship between SNPs and upper respiratory infection (URI) frequency, risk of acute OM during URI episodes, and proneness to recurrent OM. Results Increased risk for OM proneness was associated with CX3CR1 (Thr280Met) SNP and with a jointly interactive group of IL-10 (−1082) SNP, IL-1β (−511) wild type genotype and white race. Family history of OM proneness independently increased the risk for frequent URIs, OM occurrence during URI, and OM proneness. Additionally, IL-1β (−31) SNP was associated with increased risk for frequent URIs, but IL-10 (−592), IL-1β (−511), IL-5 (−746) and IL-8 (−251) SNPs were associated with decreased risk of URI. Conclusion IL-1β (−31), CX3CR1 (Thr280Met), IL-10 (−1082) and IL-1β (−511) SNPs were associated with increased risk for frequent URIs or OM proneness. PMID:24718616

  6. Workshop to identify critical windows of exposure for children's health: immune and respiratory systems work group summary.

    PubMed Central

    Dietert, R R; Etzel, R A; Chen, D; Halonen, M; Holladay, S D; Jarabek, A M; Landreth, K; Peden, D B; Pinkerton, K; Smialowicz, R J; Zoetis, T

    2000-01-01

    Fetuses, infants, and juveniles (preadults) should not be considered simply "small adults" when it comes to toxicological risk. We present specific examples of developmental toxicants that are more toxic to children than to adults, focusing on effects on the immune and respiratory systems. We describe differences in both the pharmacokinetics of the developing immune and respiratory systems as well as changes in target organ sensitivities to toxicants. Differential windows of vulnerability during development are identified in the context of available animal models. We provide specific approaches to directly investigate differential windows of vulnerability. These approaches are based on fundamental developmental biology and the existence of discrete developmental processes within the immune and respiratory systems. The processes are likely to influence differential developmental susceptibility to toxicants, resulting in lifelong toxicological changes. We also provide a template for comparative research. Finally, we discuss the application of these data to risk assessment. PMID:10852848

  7. Experimental In Vivo Sepsis Models to Monitor Immune Cell Apoptosis and Survival in Laboratory Mice.

    PubMed

    Doerflinger, Marcel; Glab, Jason; Puthalakath, Hamsa

    2016-01-01

    Sepsis is amongst the world's biggest public health problems with more than 20 million cases worldwide and a high morbidity rate of up to 50 %. Despite advances in modern medicine in the past few decades, incidence is expected to further increase due to an aging population and accompanying comorbidities such as cancer and diabetes. Due to the complexity of the disease, available treatment options are limited. Growing evidence links apoptotic cell death of lymphocytes and concomitant immune suppression to overall patient survival. In order to establish novel therapeutic approaches targeting this life threatening immune paralysis, researchers rely heavily on animal models to decipher the molecular mechanisms underlying this high impact disease. Here we describe variations of in vivo mouse models that can be used to study inflammation, cellular apoptosis, and survival in mice subjected to experimental polymicrobial sepsis and to a secondary infection during the immune suppressive secondary stage. PMID:27108432

  8. RHD zygosity predicts degree of platelet response to anti-D immune globulin treatment in children with immune thrombocytopenia.

    PubMed

    Despotovic, Jenny M; McGann, Patrick T; Smeltzer, Matthew; Aygun, Banu; Ware, Russell E

    2013-09-01

    Anti-D immunoglobulin is a common front-line treatment for childhood immune thrombocytopenia (ITP) that typically results in a rapid and significant increase in platelet count. Unpredictable treatment responses and interpatient variability limit more widespread use. We hypothesized that anti-D response variability is influenced by RHD gene zygosity and erythrocyte D antigen expression. We compared RHD zygosity and quantitative D antigen expression to anti-D treatment results. Hemizygous RHD subjects demonstrated significantly higher platelet increases and peak platelet counts than homozygous RHD subjects. Future studies should investigate the mechanisms by which RHD zygosity and D antigen expression affect platelet responses to anti-D immunoglobulin.

  9. Perfluoroalkyl and Polyfluoroalkyl Substances and Indicators of Immune Function in Children Aged 12 – 19 years: NHANES

    PubMed Central

    Stein, Cheryl R.; McGovern, Kathleen J.; Pajak, Ashley M.; Maglione, Paul J.; Wolff, Mary S.

    2016-01-01

    Background Perfluoroalkyl and polyfluoroalkyl substances (PFAS) are immunotoxic in laboratory studies. Humans studies of immune effects are inconsistent. Using the U.S. National Health and Nutrition Examination Survey (NHANES) we examined PFAS serum concentration and indicators of prevalent immune function among 12 to 19 year old children. Methods In this cross-sectional study we examined PFAS serum concentration in relation to measles, mumps, and rubella antibody concentrations in NHANES 1999 – 2000 and 2003 – 2004 (n=1,191) and to allergic conditions and allergic sensitization in NHANES 2005 – 2006 (n=640). Results In adjusted, survey-weighted models, a doubling of perfluorooctane sulfonate (PFOS) concentration among seropositive children was associated with a 13.3% (95% CI −19.9, −6.2) decrease in rubella antibody concentration and a 5.9% decrease in mumps antibody concentration (95% CI −9.9, −1.6). We observed no adverse association between exposure and current allergic conditions, including asthma. Children with higher PFOS concentration were less likely to be sensitized to any allergen (OR 0.74, 95% CI 0.58, 0.95). Conclusion Increased exposure to several PFAS was associated with lower levels to mumps and rubella antibody concentrations, especially among seropositive individuals. These lower antibody concentrations may indicate a less robust response to vaccination or greater waning of vaccine-derived immunity over time. PMID:26492286

  10. Accurate and High-Coverage Immune Repertoire Sequencing Reveals Characteristics of Antibody Repertoire Diversification in Young Children with Malaria

    NASA Astrophysics Data System (ADS)

    Jiang, Ning

    Accurately measuring the immune repertoire sequence composition, diversity, and abundance is important in studying repertoire response in infections, vaccinations, and cancer immunology. Using molecular identifiers (MIDs) to tag mRNA molecules is an effective method in improving the accuracy of immune repertoire sequencing (IR-seq). However, it is still difficult to use IR-seq on small amount of clinical samples to achieve a high coverage of the repertoire diversities. This is especially challenging in studying infections and vaccinations where B cell subpopulations with fewer cells, such as memory B cells or plasmablasts, are often of great interest to study somatic mutation patterns and diversity changes. Here, we describe an approach of IR-seq based on the use of MIDs in combination with a clustering method that can reveal more than 80% of the antibody diversity in a sample and can be applied to as few as 1,000 B cells. We applied this to study the antibody repertoires of young children before and during an acute malaria infection. We discovered unexpectedly high levels of somatic hypermutation (SHM) in infants and revealed characteristics of antibody repertoire development in young children that would have a profound impact on immunization in children.

  11. Immunodynamics: a cancer immunotherapy trials network review of immune monitoring in immuno-oncology clinical trials.

    PubMed

    Kohrt, Holbrook E; Tumeh, Paul C; Benson, Don; Bhardwaj, Nina; Brody, Joshua; Formenti, Silvia; Fox, Bernard A; Galon, Jerome; June, Carl H; Kalos, Michael; Kirsch, Ilan; Kleen, Thomas; Kroemer, Guido; Lanier, Lewis; Levy, Ron; Lyerly, H Kim; Maecker, Holden; Marabelle, Aurelien; Melenhorst, Jos; Miller, Jeffrey; Melero, Ignacio; Odunsi, Kunle; Palucka, Karolina; Peoples, George; Ribas, Antoni; Robins, Harlan; Robinson, William; Serafini, Tito; Sondel, Paul; Vivier, Eric; Weber, Jeff; Wolchok, Jedd; Zitvogel, Laurence; Disis, Mary L; Cheever, Martin A

    2016-01-01

    The efficacy of PD-1/PD-L1 targeted therapies in addition to anti-CTLA-4 solidifies immunotherapy as a modality to add to the anticancer arsenal. Despite raising the bar of clinical efficacy, immunologically targeted agents raise new challenges to conventional drug development paradigms by highlighting the limited relevance of assessing standard pharmacokinetics (PK) and pharmacodynamics (PD). Specifically, systemic and intratumoral immune effects have not consistently correlated with standard relationships between systemic dose, toxicity, and efficacy for cytotoxic therapies. Hence, PK and PD paradigms remain inadequate to guide the selection of doses and schedules, both starting and recommended Phase 2 for immunotherapies. The promise of harnessing the immune response against cancer must also be considered in light of unique and potentially serious toxicities. Refining immune endpoints to better inform clinical trial design represents a high priority challenge. The Cancer Immunotherapy Trials Network investigators review the immunodynamic effects of specific classes of immunotherapeutic agents to focus immune assessment modalities and sites, both systemic and importantly intratumoral, which are critical to the success of the rapidly growing field of immuno-oncology.

  12. Immunodynamics: a cancer immunotherapy trials network review of immune monitoring in immuno-oncology clinical trials.

    PubMed

    Kohrt, Holbrook E; Tumeh, Paul C; Benson, Don; Bhardwaj, Nina; Brody, Joshua; Formenti, Silvia; Fox, Bernard A; Galon, Jerome; June, Carl H; Kalos, Michael; Kirsch, Ilan; Kleen, Thomas; Kroemer, Guido; Lanier, Lewis; Levy, Ron; Lyerly, H Kim; Maecker, Holden; Marabelle, Aurelien; Melenhorst, Jos; Miller, Jeffrey; Melero, Ignacio; Odunsi, Kunle; Palucka, Karolina; Peoples, George; Ribas, Antoni; Robins, Harlan; Robinson, William; Serafini, Tito; Sondel, Paul; Vivier, Eric; Weber, Jeff; Wolchok, Jedd; Zitvogel, Laurence; Disis, Mary L; Cheever, Martin A

    2016-01-01

    The efficacy of PD-1/PD-L1 targeted therapies in addition to anti-CTLA-4 solidifies immunotherapy as a modality to add to the anticancer arsenal. Despite raising the bar of clinical efficacy, immunologically targeted agents raise new challenges to conventional drug development paradigms by highlighting the limited relevance of assessing standard pharmacokinetics (PK) and pharmacodynamics (PD). Specifically, systemic and intratumoral immune effects have not consistently correlated with standard relationships between systemic dose, toxicity, and efficacy for cytotoxic therapies. Hence, PK and PD paradigms remain inadequate to guide the selection of doses and schedules, both starting and recommended Phase 2 for immunotherapies. The promise of harnessing the immune response against cancer must also be considered in light of unique and potentially serious toxicities. Refining immune endpoints to better inform clinical trial design represents a high priority challenge. The Cancer Immunotherapy Trials Network investigators review the immunodynamic effects of specific classes of immunotherapeutic agents to focus immune assessment modalities and sites, both systemic and importantly intratumoral, which are critical to the success of the rapidly growing field of immuno-oncology. PMID:26981245

  13. Time's up! Involvement of metamemory knowledge, executive functions, and time monitoring in children's prospective memory performance.

    PubMed

    Geurten, Marie; Lejeune, Caroline; Meulemans, Thierry

    2016-01-01

    This study examined time-based prospective memory (PM) in children and explored the possible involvement of metamemory knowledge and executive functions in the use of an appropriate time-monitoring strategy depending on the ongoing task's difficulty. Specifically, a sample of 72 typically developing children aged 4, 6, and 9 years old were given an original PM paradigm composed of both an ongoing procedural activity and a PM task. Half of the participants (expert group) were trained in the ongoing activity before the prospective test. As expected, results show that time monitoring had a positive effect on children's PM performance. Furthermore, mediation analyses reveal that strategic time monitoring was predicted by metamemory knowledge in the expert group but only by executive functions in the novice group. Overall, these findings provide interesting avenues to explain how metamemory knowledge, strategy use, and executive functions interact to improve PM performance during childhood.

  14. Monitoring Immune System Function and Reactivation of Latent Viruses in the Artificial Gravity Pilot Study

    NASA Technical Reports Server (NTRS)

    Mehta, Satish; Crusian, Brian; Pierson, Duane; Sams, Clarence; Stowe, Raymond

    2007-01-01

    Numerous studies have indicated that dysregulation of the immune system occurs during or after spaceflight. Using 21 day -6 deg. head-down tilt bed rest as a spaceflight analog, this study describes the effects of artificial gravity as a daily countermeasure on immunity, stress and reactivation of clinically important latent herpes viruses. The specific aims were to evaluate psychological and physiological stress, to determine the status of the immune system and to quantify reactivation of latent herpes viruses. Blood, saliva, and urine samples were collected from each participating subject at different times throughout the study. An immune assessment was performed on all treatment and control subjects that consisted of a comprehensive peripheral immunophenotype analysis, intracellular cytokine profiles and a measurement of T cell function. The treatment group displayed no differences throughout the course of the study with regards to peripheral leukocyte distribution, cytokine production or T cell function. Shedding of EBV and CMV was quantified by real time PCR in saliva and urine samples, respectively. There was no significant difference in CMV DNA in the treatment group as compared to the control group. EBV and VZV on the other hand showed a mild reactivation during the study. There were no significant differences in plasma cortisol between the control and treatment groups. In addition, no significant differences between antiviral antibody titers (EBV-VCA, -EA, -EBNA, CMV) or tetramer-positive (EBV, CMV) were found between the two groups. EBV DNA copies in blood were typically undetectable but never exceeded 1,500 copies per 10(exp 6) PBMCs. These data indicate that the artificial gravity countermeasure and the 21 day head-down tilt bed rest regimen had no observable adverse effect on immune function.

  15. Monitoring Immune System Function and Reactivation of Latent Viruses in the Artificial Gravity Pilot Study

    NASA Technical Reports Server (NTRS)

    Mehta, Satish K.; Crucian, Brian; Pierson, Duane L.; Sams, Clarence; Stowe, Raymond P.

    2007-01-01

    Numerous studies have indicated that dysregulation of the immune system occurs during or after spaceflight. Using 21 day -6 degrees head-down tilt bed rest as a spaceflight analog, this study describes the effects of artificial gravity (AG) as a daily countermeasure on immunity, stress and reactivation of clinically important latent herpes viruses. The specific aims were to evaluate psychological and physiological stress, to determine the status of the immune system, and to quantify reactivation of latent herpes viruses. Blood, saliva, and urine samples were collected from each participating subject at different times throughout the study. An immune assessment was performed on all treatment and control subjects that consisted of a comprehensive peripheral immunophenotype analysis, intracellular cytokine profiles and a measurement of T cell function. The treatment group displayed no differences throughout the course of the study with regards to peripheral leukocyte distribution, cytokine production or T cell function. Shedding of Epstein barr virus (EBV), Cytomegalovirus (CMV), and Varicella zoster virus (VZV) was quantified by real time PCR in saliva and urine samples, respectively. There was no significant difference in CMV DNA in the treatment group as compared to the control group. EBV and VZV on the other hand showed a mild reactivation during the study. There were no significant differences in cortisol between the control and treatment groups. In addition, no significant differences between antiviral antibody titers (EBV-VCA, -EA, -EBNA, CMV) or tetramer-positive (EBV, CMV) were found between the two groups. EBV DNA copies in blood were typically undetectable but never exceeded 1,500 copies per 106 PBMCs. Overall, these data indicate that the artificial gravity countermeasure and the 21 day head-down tilt bed rest regimen had no observable adverse effect on immune function.

  16. [Therapy monitoring and management of adverse events in PD-1/PD-L1 immune checkpoint inhibition].

    PubMed

    Oppel-Heuchel, H; Grimm, M-O

    2016-05-01

    Nivolumab was recently approved as the first inhibitor of the programmed death 1 (PD-1) receptor and its ligand (PD-L1) for the treatment of urological cancer, namely metastasized renal cell carcinoma after prior therapy. The use of this new immunotherapy requires special therapy monitoring and management of side effects. An increase of immune cells around the tumor can initially mimic progression (so-called pseudoprogression). Treatment-associated side effects of higher grade according to the common terminology criteria for adverse events (CTCAE grades 3 or 4) are relatively rare; however, new immune-mediated side effects can occur and affect the skin, liver (hepatitis), kidneys (nephritis), gastrointestinal tract (diarrhea and colitis), lungs (pneumonitis) and endocrine organs (hyperthyroidism, hypothyroidism and hypophysitis). Treatment has to be delayed or discontinued depending on the kind and degree of side effects; furthermore, corticosteroids can be administered as immunosuppressants. When recognized in time and with correct management, immune-mediated side effects are basically reversible. PMID:27146870

  17. Monitoring Variability and Change in Children's Spelling Strategies

    ERIC Educational Resources Information Center

    Farrington-Flint, Lee; Stash, Amanda; Stiller, James

    2008-01-01

    This study examined the role of variability and change in children's strategy performance within the context of spelling. The spelling ability of 34 eight- to nine-year-olds was examined using an experimental spelling task comprising 45 items, which varied with regard to rime unit frequency. The spelling task incorporated a series of consistent,…

  18. New Approaches to Assessment and Monitoring of Concussion in Children

    ERIC Educational Resources Information Center

    Gioia, Gerard A.; Isquith, Peter K.; Schneider, Jillian C.; Vaughan, Christopher G.

    2009-01-01

    A mild traumatic brain injury (TBI) constitutes the overwhelming majority of brain injury cases in children and adolescents. This article focuses on cerebral concussion, which can be viewed as a subset of mild TBI, which, until recently, has received limited attention in the pediatric assessment literature. Few extant measures appropriate to this…

  19. Functional state of the respiratory and immune system in children-residents of the radioactive contaminated territories.

    PubMed

    Kolpakov, I Ye; Vdovenko, V N Parkhomenko V Yu; Stepanova, Ye I; Bazyka, D A; Karmaus, W J; Svendsen, E R

    2011-01-01

    More then 25 years after the Chernobyl accident, a higher prevalence of bronchial hyperreactivity, reduced lung function, and increased levels of free radicals in exhaled breath condensates (EBC) were observed in children residing in radioactive contaminated territories. Comparing children with different residential radiation background, this study investigated fatty acids of EBC using gas liquid chromatography, counts of B-lymphocyte antigen CD19 in T-cell (CD3) and phagocytotic activity of neutrophils in blood samples. Regarding EBC, we demonstrate that lipid peroxidation was activated, antioxidant properties of pulmonary surfactant were decreased, were detected metabolic disorders of essential fatty acids at the stage of bioregulators-eicosanoids formation. Regarding the immune function of blood cells, we found a decrease of the proportions of CD3+ 19- and CD3- 19+ lymphocyte subpopulations and an unbalance of their numbers. Also the phagocytotic activity of neutrophils was reduced in higher exposed children. Children living in the radioactive contaminated territories have more alterations of surfactant properties and immune activities, which may contribute to an increased risk of respiratory problems. This research was supported by grants from the U.S. Civilian Research and Development Foundation (UKB1-2929-KV-08).

  20. Role of 24-h ambulatory blood pressure monitoring in children with chronic kidney disease

    PubMed Central

    Gupta, D.; Chaturvedi, S.; Chandy, S.; Agarwal, I.

    2015-01-01

    Hypertension is common in children with chronic kidney disease (CKD) and is a major determinant of CKD progression. Ambulatory blood pressure monitoring (ABPM) has been proposed to be better in detecting hypertension as compared to casual blood pressure (CBP). This study aims to study the usefulness of ABPM in detecting masked hypertension, evaluating the adequacy of blood pressure (BP) control and predicting left ventricular hypertrophy (LVH) amongst children with CKD. A prospective cross-sectional study of 46 children with stage 3–5 CKD was conducted at the Pediatric Nephrology department of a tertiary hospital in South India. All children underwent CBP, ABPM and an echocardiography. Results were categorized as normal BP; confirmed hypertension; masked hypertension and white coat hypertension. Out of 46 children studied, 11 were undergoing dialysis. While 39.1% children had stage 3 and 4 CKD each, 21.7% had stage 5 CKD. Masked hypertension was detected in 19.6% and 21.7% had confirmed hypertension. Thirty-four (73.9%) children were already receiving antihypertensive medication. In these, CBP was elevated in 23.5% and ABP in 47%. Among children with hypertension as defined by ABPM, LVH was detected in 32.2%. We found that higher the number of abnormal ABPM indices (assessed by BP Index, nocturnal dipping and BP Load) higher the likelihood of LVH (P = 0.046). ABPM is better in detecting hypertension and monitoring adequacy of treatment in children with CKD. The high prevalence of masked hypertension and its association with LVH supports early echocardiography and ambulatory BP monitoring to evaluate cardiovascular risks in this population. PMID:26664211

  1. Serological survey on immunity status against polioviruses in children and adolescents living in a border region, Apulia (Southern Italy)

    PubMed Central

    Tafuri, Silvio; Prato, Rosa; Martinelli, Domenico; Calvario, Agata; Bozzi, Anna; Labianca, Michele; Patti, Annamaria; Lopalco, Pietro Luigi; Germinario, Cinzia

    2008-01-01

    Background In 1988 the World Health Assembly adopted the goal to eradicate poliomyelitis by routine immunization using Oral Polio Vaccine (OPV). On 21 June 2002 the WHO European Region was declared polio-free. In 2008 poliomyelitis is still endemic in 4 countries (Nigeria, India, Pakistan, and Afghanistan), where 1201 new cases were registered in 2007; 107 sporadic cases were also notified in countries where poliovirus is not endemic. The aim of this work was to verify the level of antipoliomyelitis immunity status in children and adolescents in the Apulia region (south of Italy), which may be considered a border region due to its position. Methods 704 blood specimens from a convenience sample were collected in six laboratories. The age of subjects enrolled was 0–15 years. The immunity against poliomyelitis was evaluated by neutralizing antibody titration in tissue culture microplates. Results Seropositivity (neutralising antibodies titre ≥ 8) for polioviruses 1, 2 and 3 was detected in 100%, 99.8% and 99.4% of collected sera. Antibody titres were not lower in subjects who received either four doses of inactivated polio vaccine (IPV) or a sequential schedule consisting of two doses of IPV and two of oral polio vaccine than in subjects who received four doses of OPV. Conclusion These results confirmed current data of vaccine coverage for poliomyelitis: during the last ten years in Apulia, the coverage in 24 months old children was more than 90%. The high level of immunization found confirms the effectiveness both of the sequential schedule IPV-OPV and of the schedule all-IPV. Apulia region has to face daily arrivals of refugees and remains subject to the risk of the importation of poliovirus from endemic areas. Surveys aimed at determining anti-polio immunity in subpopulations as well as in the general population should be carried out. PMID:18973678

  2. Potential Use of Salivary Markers for Longitudinal Monitoring of Inflammatory Immune Responses to Vaccination

    PubMed Central

    Garssen, Johan; Sandalova, Elena

    2016-01-01

    Vaccination, designed to trigger a protective immune response against infection, is a trigger for mild inflammatory responses. Vaccination studies can address the question of inflammation initiation, levels, and resolution as well as its regulation for respective studied pathogens. Such studies largely based on analyzing the blood components including specific antibodies and cytokines were usually constrained by number of participants and volume of collected blood sample. Hence, blood-based studies may not be able to cover the full dynamic range of inflammation responses induced by vaccination. In this review, the potential of using saliva in addition to blood for studying the kinetics of inflammatory response studies was assessed. Saliva sampling is noninvasive and has a great potential to be used for studies aimed at analysing the magnitude, time course, and variance in immune responses, including inflammation after vaccination. Based on a literature survey of inflammatory biomarkers that can be determined in saliva and an analysis of how these biomarkers could help to understand the mechanisms and dynamics of immune reactivity and inflammation, we propose that the saliva-based approach might have potential to add substantial value to clinical studies, particularly in vulnerable populations such as infants, toddlers, and ill individuals. PMID:27022211

  3. Co-infection with Ascaris lumbricoides modulates protective immune responses against Giardia duodenalis in school Venezuelan rural children.

    PubMed

    Hagel, I; Cabrera, M; Puccio, F; Santaella, C; Buvat, E; Infante, B; Zabala, M; Cordero, R; Di Prisco, M C

    2011-03-01

    We evaluated the effect of Ascaris lumbricoides on Giardia duodenalis infection and TH1/TH2 type immune mechanisms toward this parasite in 251 rural parasitized and 70 urban non-parasitized school children. The children were classified according to light (0-5000 eggs/g faeces) or moderate (>5001-50,000 eggs/g faeces) A. lumbricoides infection. Anti G. duodenalis skin hyper-reactivity, IgE, IgG, IL-13, IFN γ, IL6 and IL-10 levels were compared among G. duodenalis infected and non-infected children according to light or moderate A. lumbricoides infection. It was found that 62% of the A. lumbricoides moderately infected children were co-infected by G. duodenalis compared to 45% of the lightly infected group. After treatment, 42% of the A. lumbricoides moderately group were infected with G. duodenalis compared to 11% of their lightly counterparts, being A. lumbricoides IL-10 levels higher (p<0.0001) in the moderately infected group. In the A. lumbricoides lightly parasitized children, G. duodenalis infection was associated to a significant increase (p<0.005) of the levels of G. duodenalis IL-13, IFN-γ, IL-6, IgE, IgG and skin test hyper reactivity. In contrast, there was no effect of G. duodenalis infection in the elevation of these parameters among the A. lumbricoides moderately parasitized group, being those levels similarly lower as those observed in the control group. Inverse correlations were found between the levels of anti G duodenalis antibodies, skin test hyper-reactivity and cytokines with the intensity of A. lumbricoides infection (p>0.0001) and A. lumbricoides IL-10 levels (p>0.0001), suggesting that co-infection with A. lumbricoides may affect both TH1 and TH2 type immunity against G. duodenalis that may play an important role in the susceptibility to the infection after chemotherapy in children from endemic areas.

  4. Children's Comprehension Monitoring of Multiple Situational Dimensions of a Narrative

    ERIC Educational Resources Information Center

    Wassenburg, Stephanie I.; Beker, Katinka; van den Broek, Paul; van der Schoot, Menno

    2015-01-01

    Narratives typically consist of information on multiple aspects of a situation. In order to successfully create a coherent representation of the described situation, readers are required to monitor all these situational dimensions during reading. However, little is known about whether these dimensions differ in the ease with which they can be…

  5. Self-Monitoring of Listening Abilities in Normal-Hearing Children, Normal-Hearing Adults, and Children with Cochlear Implants

    PubMed Central

    Rothpletz, Ann M.; Wightman, Frederic L.; Kistler, Doris J.

    2012-01-01

    Background Self-monitoring has been shown to be an essential skill for various aspects of our lives, including our health, education, and interpersonal relationships. Likewise, the ability to monitor one’s speech reception in noisy environments may be a fundamental skill for communication, particularly for those who are often confronted with challenging listening environments, such as students and children with hearing loss. Purpose The purpose of this project was to determine if normal-hearing children, normal-hearing adults, and children with cochlear implants can monitor their listening ability in noise and recognize when they are not able to perceive spoken messages. Research Design Participants were administered an Objective-Subjective listening task in which their subjective judgments of their ability to understand sentences from the Coordinate Response Measure corpus presented in speech spectrum noise were compared to their objective performance on the same task. Study Sample Participants included 41 normal-hearing children, 35 normal-hearing adults, and 10 children with cochlear implants. Data Collection and Analysis On the Objective-Subjective listening task, the level of the masker noise remained constant at 63 dB SPL, while the level of the target sentences varied over a 12 dB range in a block of trials. Psychometric functions, relating proportion correct (Objective condition) and proportion perceived as intelligible (Subjective condition) to target/masker ratio (T/M), were estimated for each participant. Thresholds were defined as the T/M required to produce 51% correct (Objective condition) and 51% perceived as intelligible (Subjective condition). Discrepancy scores between listeners’ threshold estimates in the Objective and Subjective conditions served as an index of self-monitoring ability. In addition, the normal-hearing children were administered tests of cognitive skills and academic achievement, and results from these measures were compared

  6. Dietary self-monitoring and its impact on weight loss in overweight children

    PubMed Central

    Mockus, Danyte S.; Macera, Caroline A.; Wingard, Deborah L.; Peddecord, Michael; Thomas, Ronald G.; Wilfley, Denise E.

    2013-01-01

    Objective To examine whether dietary self-monitoring is related to weight loss in overweight children and whether perceived social support or dietary self-efficacy affects this relation. Design Longitudinal, behavioral intervention study. Subjects The study population included 153 children, aged 7–12 years, with daily food records from a 20-week weight loss program in San Diego, California, USA, conducted between 1999 and 2002. Methods Self-monitoring was assessed using two methods: a weekly index as a measure of competency (possible range −7 to +35) and recording sufficiency for total compliance (percentage of days). Results Significantly greater decreases in percentage overweight were found for children with recording competency at or above the median (mean change: −13.4% vs. −8.6%; p < 0.001) or who were compliant in recording ≥50% of the days (mean change: −13.0% vs. −8.4%; p < 0.001). Using hierarchical linear regression, children who had a higher average weekly monitoring index or recorded sufficiently on more days had significantly greater decreases in percent overweight, after adjusting for age, sex, SES, race/ethnicity and baseline percent overweight (p < 0.001). Perceived social support at baseline and dietary self-efficacy were not related to self-monitoring or change in percent overweight in this sample. Conclusion As has been demonstrated with adults and adolescents, self-monitoring in children was associated with greater decreases in percent overweight. However, dietary self-efficacy and perceived social support were not related to how frequently or thoroughly they monitored dietary intake. PMID:21722068

  7. Immunity to diphtheria in children three-to-six year of age in four counties of Taiwan.

    PubMed

    Lee, H F; Wang, M C; Tseng, L R; Lu, C F; Hsu, H M; Horng, C B

    1995-02-01

    An immunization program against diphtheria has been implemented in Taiwan since 1955, using combined diphtheria, pertussis and tetanus (DPT) vaccine. Diphtheria immunoglobulin (DIG) level was assessed in serum samples obtained from 1138 children, aged 3-6 years from north, south, east and central part of Taiwan by the VERO cell neutralization method. Specimens were collected by simple random sampling of residents from Hsinchu, Taichung, Pingtung and Hwalien counties, including both aborigines and non-aborigines. The former lived in one or two villages in each county, and the latter lived in a single village next to the former. Ninety-five percent (1086/1138) had a DIG titre > or = 0.01 IU/ml. There was no significant difference by sex, or by residential area. Seventy-nine percent (901/1138) of the children had completed the primary immunization schedule (at the age of 2, 4, 6 and 18 months), and the prevalence of DIG titre > or = 0.1 IU/ml considered to be long-term protective was as follows: 74.6% for 3-year group; 74.5% for 4-year group; 67.9% for 5-year group; 84.7% for 6-year group (including 52.2% who had had a booster shot at early primary school). These findings show that the diphtheria vaccination program provides good immunity in childhood.

  8. Use of Text Messaging for Monitoring Sugar-Sweetened Beverages, Physical Activity, and Screen Time in Children: A Pilot Study

    ERIC Educational Resources Information Center

    Shapiro, Jennifer R.; Bauer, Stephanie; Hamer, Robert M.; Kordy, Hans; Ward, Dianne; Bulik, Cynthia M.

    2008-01-01

    Objective: To examine acceptability, attrition, adherence, and preliminary efficacy of mobile phone short message service (SMS; text messaging) for monitoring healthful behaviors in children. Design: All randomized children received a brief psychoeducational intervention. They then either monitored target behaviors via SMS with feedback or via…

  9. Real-Time Immune Monitoring to Guide Plasmid DNA Vaccination Schedule Targeting Prostatic Acid Phosphatase (PAP) in Patients with Castration-Resistant Prostate Cancer

    PubMed Central

    McNeel, Douglas G.; Becker, Jordan T.; Eickhoff, Jens C.; Johnson, Laura E.; Bradley, Eric; Pohlkamp, Isabel; Staab, Mary Jane; Liu, Glenn; Wilding, George; Olson, Brian M.

    2014-01-01

    BACKGROUND We have previously reported that a DNA vaccine encoding prostatic acid phosphatase (PAP) could elicit PAP-specific T cells in patients with early recurrent prostate cancer. In the current pilot trial we sought to evaluate whether prolonged immunization with regular booster immunizations, or “personalized” schedules of immunization determined using real-time immune monitoring, could elicit persistent, antigen-specific T cells, and whether treatment was associated with changes in PSA doubling time (PSA DT). METHODS 16 patients with castration-resistant, non-metastatic prostate cancer received six immunizations at two-week intervals, and then either quarterly (Arm 1) or as determined by multi-parameter immune monitoring (Arm 2). RESULTS Patients were on study a median of 16 months; four received 24 vaccinations. Only one event associated with treatment > grade 2 was observed. 6/16 (38%) remained metastasis-free at 2 years. PAP-specific T cells were elicited in 12/16 (75%), predominantly of a Th1 phenotype, which persisted in frequency and phenotype for at least one year. IFNγ-secreting T-cell responses measured by ELISPOT were detectable in 5/13 individuals at one year, and this was not statistically different between study arms. The overall median fold change in PSA DT from pre-treatment to post-treatment was 1.6 (range 0.6–7.0, p=0.036). CONCLUSIONS Repetitive immunization with a plasmid DNA vaccine was safe and elicited Th1-biased antigen-specific T cells that persisted over time. Modifications in the immunization schedule based on real-time immune monitoring did not increase the frequency of patients developing effector and memory T-cell responses with this DNA vaccine. PMID:24850844

  10. Clinical and Immune Responses to Inactivated Influenza A(H1N1)pdm09 Vaccine in Children

    PubMed Central

    Kotloff, Karen L.; Halasa, Natasha B.; Harrison, Christopher J.; Englund, Janet A.; Walter, Emmanuel B.; King, James C.; Creech, C. Buddy; Healy, Sara A.; Dolor, Rowena J.; Stephens, Ina; Edwards, Kathryn M.; Noah, Diana L.; Hill, Heather; Wolff, Mark

    2014-01-01

    Background As the influenza AH1N1 pandemic emerged in 2009, children were found to experience high morbidity and mortality and were prioritized for vaccination. This multicenter, randomized, double-blind, age-stratified trial assessed the safety and immunogenicity of inactivated influenza A(H1N1)pdm09 vaccine in healthy children aged 6 months to 17 years. Methods Children received two doses of approximately 15 μg or 30 μg hemagglutin antigen 21 days apart. Reactogenicity was assessed for 8 days after each dose, adverse events through day 42, and serious adverse events or new-onset chronic illnesses through day 201. Serum hemagglutination inhibition (HAI) titers were measured on days 0 (pre-vaccination), 8, 21, 29, and 42. Results A total of 583 children received the first dose and 571 received the second dose of vaccine. Vaccinations were generally well-tolerated and no related serious adverse events were observed. The 15 μg dosage elicited a seroprotective HAI (≥1:40) in 20%, 47%, and 93% of children in the 6-35 month, 3-9 year, and 10-17 year age strata 21 days after dose 1 and in 78%, 82%, and 98% of children 21 days after dose 2, respectively. The 30 μg vaccine dosage induced similar responses. Conclusions The inactivated influenza A(H1N1)pdm09 vaccine exhibited a favorable safety profile at both dosage levels. While a single 15 or 30 μg dose induced seroprotective antibody responses in most 10-17 year olds, younger children required 2 doses, even when receiving dosages 4-6 fold higher than recommended. Well-tolerated vaccines are needed that induce immunity after a single dose for use in young children during influenza pandemics. PMID:25222307

  11. From Space to the Patient: A New Cytokine Release Assay to Monitor the Immune Status of HIV Infected Patients and Sepsis Patients

    NASA Technical Reports Server (NTRS)

    Kaufmann, I.; Draenert, R.; Gruber, M.; Feuerecker, M.; Crucian, B. E.; Mehta, S. L.; Roider, J.; Pierson, D. L.; Briegel, J. M.; Schelling, G.; Sams, C. F.; Chouker, A.

    2013-01-01

    Monitoring of humans either in the healthy men under extreme environmental stress like space flight, in human immunodeficiency virus (HIV) infected patients or in sepsis is of critical importance with regard to the timing of adequate therapeutic (counter-)measures. The in vivo skin delayed-type hypersensitivity test (DTH) served for many years as a tool to evaluate cell mediated immunity. However, this standardised in vivo test was removed from the market in 2002 due to the risk of antigen stabilization. To the best of our knowledge an alternative test as monitoring tool to determine cell mediated immunity is not available so far. For this purpose we tested a new alternative assay using elements of the skin DTH which is based on an ex vivo cytokine release from whole blood and asked if it is suitable and applicable to monitor immune changes in HIV infected patients and in patients with septic shock.

  12. Watching Children: Describing the Use of Baby Monitors on Epinions.com

    ERIC Educational Resources Information Center

    Nelson, Margaret K.

    2008-01-01

    Popular culture today characterizes middle-class parents as being consumed with anxiety about their children. Drawing on more than 100 consumer reviews of baby monitors published on Epinions.com, the author examines how parents respond to that anxiety. Although Epinions.com reviewers are not representative of the population at large, they do…

  13. Age Differences in the Effects of Social Influence on Children's Eyewitness Performance and Their Metacognitive Monitoring

    ERIC Educational Resources Information Center

    Schwarz, Stefanie; Roebers, Claudia M.

    2006-01-01

    The current work investigated the effects of social influence on children's recall accuracy and metacognitive monitoring. Two studies were conducted in which 8-and 10-year-olds were confronted with postevent information in an interview situation. An interviewer (Study 1) or a confederate (Study 2) provided postevent information with two levels of…

  14. Differential Efficacy of Home Monitoring and Cognitive-Behavioral Treatment for Decreasing Children's Maladaptive Nighttime Fears

    ERIC Educational Resources Information Center

    Pincus, Donna B.; Weiner, Courtney L.; Friedman, Alice G.

    2012-01-01

    A number of studies have demonstrated the efficacy of brief cognitive-behavioral interventions for treating childhood nighttime fears. The purpose of the present study is to determine whether behavior changes could be initiated and maintained with home monitoring and reinforcement alone. Sixteen children, ages 6 to 11, with severe, disruptive…

  15. ERPs Associated with Monitoring and Evaluation of Monetary Reward and Punishment in Children with ADHD

    ERIC Educational Resources Information Center

    van Meel, Catharina S.; Heslenfeld, Dirk J.; Oosterlaan, Jaap; Luman, Marjolein; Sergeant, Joseph A.

    2011-01-01

    Background: Several models of attention-deficit hyperactivity disorder (ADHD) propose abnormalities in the response to behavioural contingencies. Using event-related potentials (ERPs), the present study investigated the monitoring and subsequent evaluation of performance feedback resulting in either reward or punishment in children with ADHD (N =…

  16. Oropharyngeal 24-Hour pH Monitoring in Children With Airway-Related Problems

    PubMed Central

    Mesallam, Tamer A.

    2016-01-01

    Objectives Diagnosis and clinical presentation of pediatric laryngopharyngeal reflux (LPR) is still controversial. The aims of this work were to study the possibility of performing 24-hour oropharyngeal pH monitoring for children in the outpatient clinic setup and to explore the results of this test in correlation to airway-related problems. Methods In this descriptive qualitative study, 26 children suffering from airway-related problems were included. Oropharyngeal 24-hour pH monitoring was performed for all subjects in the outpatient clinic setting. The distribution of airway diagnoses among the study group was studied versus the results of the pH monitoring. Results There were 16 males and 10 females participated in the study with a mean age of 6.88 (SD, ±5.77) years. Thirty-five percent of the patients were under the age of 3 years (range, 11 months to 3 years). Eight-five percent of the patients tolerated the pH probe insertion and completed 24-hour of pH recording. Laryngomalacia and subglottic stenosis (SGS) were more frequently reported in the positive LPR patients (77%). Conclusion Oropharyngeal 24-hour pH monitoring can be conducted for children in the outpatient setup even in young age children below 3 years old. Among the positive LPR group, SGS and laryngomalacia were the most commonly reported airway findings. PMID:27090271

  17. Monitoring of immune cell response to B cell depletion therapy and nerve root injury using SPIO enhanced MRI

    NASA Astrophysics Data System (ADS)

    Thorek, Daniel L.

    2009-12-01

    Magnetic resonance (MR) is a robust platform for non-invasive, high-resolution anatomical imaging. However, MR imaging lacks the requisite sensitivity and contrast for imaging at the cellular level. This represents a clinical impediment to greater diagnostic accuracy. Recent advances have allowed for the in vivo visualization of populations and even of individual cells using superparamagnetic iron oxide (SPIO) MR contrast agents. These nanoparticles, commonly manifested as a core of a single iron oxide crystal or cluster of crystals coated in a biocompatible shell, function to shorten proton relaxation times. In MR imaging these constructs locally dephase protons, resulting in a decrease in signal (hypointensity) localized to the region of accumulation of SPIO. In the context of immune cell imaging, SPIO can provide insight into the cellular migration patterns, trafficking, temporal dynamics and progression of diseases and their related pathological states. Furthermore, by visualizing the presence and activity of immune cells, SPIO-enabled cellular imaging can help evaluate the efficacy of therapy in immune disorders. This thesis examines the production, modification and application of SPIO in a range of in vitro and in vivo immune-response-relevant cellular systems. The role of different nanoparticle characteristics including diameter, surface charge and concentration are investigated in the labeling of T cells in culture. Following optimization of SPIO loading conditions for lymphocytes, the effect these particles have on the activation of primary B cells are elucidated. B cells are tracked using a variety of modalities, with and without the application of B cell depleting therapy. This is to evaluate the efficacy of SPIO as in vivo marker for B cell distribution. Unmodified SPIO were applied to monitor macrophage infiltration in a transient nerve root compression model, with implications for neck pain diagnosis and treatment. Nanoparticle accumulation and MR

  18. Reaching the Children: Universal Child Immunization by 1990. Development Education Kit.

    ERIC Educational Resources Information Center

    United Nations Children's Fund, New York, NY. United States Committee.

    The goal of the Universal Child Immunization Program, adopted by the World Health Organization in 1977, is to inoculate by 1990, every child in the world against measles, tetanus, whooping cough, diphtheria, tuberculosis, and polio. By 1987, nearly 80 countries had undertaken or were planning immunization programs. These diseases, combined with…

  19. Efficacy of combined intravenous immunoglobulins and steroids in children with primary immune thrombocytopenia and persistent bleeding symptoms

    PubMed Central

    Parodi, Emilia; Giordano, Paola; Rivetti, Elisa; Giraudo, Maria Teresa; Ansaldi, Giulia; Davitto, Mirella; Mondino, Anna; Farruggia, Piero; Amendola, Giovanni; Matarese, Sofia M.R.; Rossi, Francesca; Russo, Giovanna; Ramenghi, Ugo

    2014-01-01

    Background The aim of this study was to investigate the effect of the combined administration of intravenous immunoglobulins and steroids as a second-line therapy in 34 children with primary immune thrombocytopenia and persistent, symptomatic bleeding. Materials and methods Combined therapy (intravenous immunoglobulins 0.4 g/kg daily on days 1 and 2, and methylprednisolone 20 mg/kg daily on days 1–3) was administered to 12 patients with newly diagnosed ITP who did not respond to the administration of a single therapy (either intravenous immunoglobulins or steroids) and to 22 children with persistent and chronic disease who required frequent administrations (i.e. more frequently than every 30 days) of either immunoglobulins or steroids (at the same standard dosages) in order to control active bleeding. Results A response (i.e. platelet count >50×109/L and remission of active bleeding) was observed in 8/12 (67%) patients with newly diagnosed ITP. The clinical presentation of responders and non-responders did not differ apparently. Patients in the chronic/persistent phase of disease had a significantly longer median period of remission from symptoms compared with the previous longest period of remission (p=0.016). The treatment was well tolerated. Discussion Our data suggest that the combined approach described is a well-tolerated therapeutic option for children with primary immune thrombocytopenia and persistent bleeding symptoms that can be used in both emergency and/or maintenance settings. PMID:24887226

  20. [Determining asthma treatment in children by monitoring fractional exhaled nitric oxide, sputum eosinophils and leukotriene B₄].

    PubMed

    Vizmanos-Lamotte, G; Cruz, M J; Gómez-Ollés, S; Muñoz, X; de Mir Messa, I; Moreno-Galdó, A

    2015-01-01

    Sputum eosinophils and exhaled fractional nitric oxide (FENO) are markers of airway inflammation in asthma. Cytokines, cysteinyl-leukotrienes and leukotriene B4 (LTB4) are responsible for this inflammation. The aim of this study is to determine the usefulness of these markers in monitoring asthma treatment in children. FENO, sputum eosinophils, and LTB4 in induced sputum were performed in 10 children (9-15 years old). These determinations were repeated four months later, after the beginning or an increase in the treatment. FENO values tended to decrease (P=.15), pulmonary function tended to improve (P=.10), and sputum eosinophils decreased (P=.003) compared to the first determination. There were no differences in LTB4 concentrations (P=.88). Sputum eosinophils seem to be more precise than FENO in the monitoring of inflammation in asthmatic children.

  1. The role of continuous glucose monitoring in the care of children with type 1 diabetes

    PubMed Central

    2013-01-01

    Continuous glucose monitoring (CGM), while a relatively new technology, has the potential to transform care for children with type 1 diabetes. Some, but not all studies, have shown that CGM can significantly improve hemoglobin A1c levels and reduce time spent in the hypoglycemic range in children, particularly when used as part of sensor-augmented pump (SAP) therapy. Despite the publication of recent clinical practice guidelines suggesting CGM be offered to all children 8 years of age or older who are likely to benefit, and studies showing that younger children can also benefit, this technology is not yet commonly used by children with type 1 diabetes. Effects of CGM are enhanced when used on a near-daily basis (a use-dependent effect) and with insulin pump therapy. Therefore, coordinated strategies are needed to help children and their families initiate and continue to use this resource for diabetes care. This review introduces CGM to pediatric endocrinologists who are not yet familiar with the finer details of this technology, summarizes current data showing the benefits and limitations of CGM use in children, reviews specific case examples demonstrating when CGM can be helpful, and shows the value of both retrospective and real-time CGM. It is hoped that this information leads to discussion of this technology in pediatric endocrinology clinics as an important next step in improving the care of children with type 1 diabetes. PMID:23531400

  2. VALIDATION OF THE AM5600 AMBULATORY BLOOD PRESSURE MONITOR IN CHILDREN AND ADOLESCENTS

    PubMed Central

    Jones, Deborah P.; Richey, Phyllis A.; Alpert, Bruce S.

    2009-01-01

    We measured ambulatory blood pressure using the AM5600 in children and adolescents participating in a research study to assess the relationship of BP to risk factors for cardiovascular disease. Although this use of this monitor has been previously reported in adults, it has not been validated in pediatric subjects. In this study, we assess the accuracy of the monitor as compared to the mercury sphygmomanometer in children ages 7-18 years of age. We found that the mean of the difference between the monitor and the mercury device was 0.29 ± 3.5 and 0.045 ± 3.7 mmHg for systolic and diastolic BP respectively, which fulfills the AAMI standard for use of a device. The cumulative percent of readings between the two devices which differed assigned the device a grade of A according to the British Hypertension Society.. PMID:19020426

  3. Urea-induced unfolding of the immunity protein Im9 monitored by spFRET.

    PubMed

    Tezuka-Kawakami, Tomoko; Gell, Chris; Brockwell, David J; Radford, Sheena E; Smith, D Alastair

    2006-09-01

    We have studied the urea-induced unfolding of the E colicin immunity protein Im9 using diffusion single-pair fluorescence resonance energy transfer. Detailed examination of the proximity ratio of the native and denatured molecules over a wide range of urea concentrations suggests that the conformational properties of both species are denaturant-dependent. Whereas native molecules become gradually more expanded as urea concentration increases, denatured molecules show a dramatic dependence of the relationship between proximity ratio and denaturant concentration, consistent with substantial compaction of the denatured ensemble at low denaturant concentrations. Analysis of the widths of the proximity ratio distributions for each state suggests that whereas the native state ensemble is relatively narrow and homogeneous, the denatured state may possess heterogeneity in mildly denaturing conditions.

  4. Urea-Induced Unfolding of the Immunity Protein Im9 Monitored by spFRET

    PubMed Central

    Tezuka-Kawakami, Tomoko; Gell, Chris; Brockwell, David J.; Radford, Sheena E.; Smith, D. Alastair

    2006-01-01

    We have studied the urea-induced unfolding of the E colicin immunity protein Im9 using diffusion single-pair fluorescence resonance energy transfer. Detailed examination of the proximity ratio of the native and denatured molecules over a wide range of urea concentrations suggests that the conformational properties of both species are denaturant-dependent. Whereas native molecules become gradually more expanded as urea concentration increases, denatured molecules show a dramatic dependence of the relationship between proximity ratio and denaturant concentration, consistent with substantial compaction of the denatured ensemble at low denaturant concentrations. Analysis of the widths of the proximity ratio distributions for each state suggests that whereas the native state ensemble is relatively narrow and homogeneous, the denatured state may possess heterogeneity in mildly denaturing conditions. PMID:16798813

  5. [The state of humoral immunity to enterobacterial antigens in juvenile rheumatoid arthritis and reactive arthritis in children].

    PubMed

    Kuz'mina, N N; Denisov, L N; Tartakovskiĭ, I A; Shaĭkov, A V; Belen'kiĭ, A G

    1989-01-01

    Investigation findings are generalized based on quantitation of antibodies against the antigens of intestinal microorganisms of Enterobacteriaceae family conducted in 66 children with various joint disease using the enzyme-linked immunoassay (ELISA) methodology. High antibody titres were revealed in 77.1% juvenile rheumatoid arthritis cases and in 80% cases with chronic juvenile arthritis which was not defined nosologically. All the patients with reactive arthritis associated with intestinal infection showed high tension of immunity to all tested enterobacteriaceae antigens with cross reactions to them. Patients with reactive arthritis associated with oral infection, with Reiter's disease and other disorders exhibited high antibody titres at the same rate as in the control.

  6. Prevention of varicella: recommendations for use of varicella vaccines in children, including a recommendation for a routine 2-dose varicella immunization schedule.

    PubMed

    2007-07-01

    National varicella immunization coverage using the current 1-dose immunization strategy has increased among vaccine-eligible children 19 through 35 months of age from 27% in 1997 to 88% by 2005. These high immunization rates have resulted in a 71% to 84% decrease in the reported number of varicella cases, an 88% decrease in varicella-related hospitalizations, a 59% decrease in varicella-related ambulatory care visits, and a 92% decrease in varicella-related deaths in 1- to 4-year-old children when compared with data from the prevaccine era. Despite this significant decrease, the number of reported cases of varicella has remained relatively constant during the past 5 to 6 years. Since vaccine effectiveness for prevention of disease of any severity has been 80% to 85%, a large number of cases of varicella continue to occur among people who already have received the vaccine (breakthrough varicella), and outbreaks of varicella have been reported among highly immunized populations of schoolchildren. The peak age-specific incidence has shifted from 3- to 6-year-old children in the prevaccine era to 9- to 11-year-old children in the postvaccine era for cases in both immunized and unimmunized children during these outbreaks. Outbreaks of varicella are likely to continue with the current 1-dose immunization strategy. After administration of 2 doses of varicella vaccine in children, the immune response is markedly enhanced, with > 99% of children achieving an antibody concentration (determined by glycoprotein enzyme-linked immunosorbent assay) of > or = 5 U/mL (an approximate correlate of protection) and a marked increase in geometric mean antibody titers after the second vaccine dose. The estimated vaccine efficacy over a 10-year observation period of 2 doses for prevention of any varicella disease is 98% (compared with 94% for 1 dose), with 100% efficacy for prevention of severe disease. Recipients of 2 doses of varicella vaccine are 3.3-fold less likely to have

  7. Prevalence of Plasmodium falciparum transmission reducing immunity among primary school children in a malaria moderate transmission region in Zimbabwe.

    PubMed

    Paul, Noah H; Vengesai, Arthur; Mduluza, Takafira; Chipeta, James; Midzi, Nicholas; Bansal, Geetha P; Kumar, Nirbhay

    2016-11-01

    Malaria continues to cause alarming morbidity and mortality in more than 100 countries worldwide. Antigens in the various life cycle stages of malaria parasites are presented to the immune system during natural infection and it is widely recognized that after repeated malaria exposure, adults develop partially protective immunity. Specific antigens of natural immunity represent among the most important targets for the development of malaria vaccines. Immunity against the transmission stages of the malaria parasite represents an important approach to reduce malaria transmission and is believed to become an important tool for gradual elimination of malaria. Development of immunity against Plasmodium falciparum sexual stages was evaluated in primary school children aged 6-16 years in Makoni district of Zimbabwe, an area of low to modest malaria transmission. Malaria infection was screened by microscopy, rapid diagnostic tests and finally using nested PCR. Plasma samples were tested for antibodies against recombinant Pfs48/45 and Pfs47 by ELISA. Corresponding serum samples were used to test for P. falciparum transmission reducing activity in Anopheles stephensi and An. gambiae mosquitoes using the membrane feeding assay. The prevalence of malaria diagnosed by rapid diagnostic test kit (Paracheck)™ was 1.7%. However, of the randomly tested blood samples, 66% were positive by nested PCR. ELISA revealed prevalence (64% positivity at 1:500 dilution, in randomly selected 66 plasma samples) of antibodies against recombinant Pfs48/45 (mean A 405nm=0.53, CI=0.46-0.60) and Pfs47 (mean A405nm=0.91, CI=0.80-1.02); antigens specific to the sexual stages. The mosquito membrane feeding assay demonstrated measurable transmission reducing ability of the samples that were positive for Pfs48/45 antibodies by ELISA. Interestingly, 3 plasma samples revealed enhancement of infectivity of P. falciparum in An. stephensi mosquitoes. These studies revealed the presence of antibodies with

  8. Incidence of seizures on continuous EEG monitoring following traumatic brain injury in children.

    PubMed

    O'Neill, Brent R; Handler, Michael H; Tong, Suhong; Chapman, Kevin E

    2015-08-01

    OBJECT Seizures may cause diagnostic confusion and be a source of metabolic stress after traumatic brain injury (TBI) in children. The incidence of electroencephalography (EEG)-confirmed seizures and of subclinical seizures in the pediatric population with TBI is not well known. METHODS A routine protocol for continuous EEG (cEEG) monitoring was initiated for all patients with moderate or severe TBI at a Level 1 pediatric trauma center. Over a 3.5-year period, all patients with TBI who underwent cEEG monitoring, both according to protocol and those with mild head injuries who underwent cEEG monitoring at the discretion of the treating team, were identified prospectively. Clinical data were collected and analyzed. RESULTS Over the study period, 594 children were admitted with TBI, and 144 of these children underwent cEEG monitoring. One hundred two (71%) of these 144 children had moderate or severe TBI. Abusive head trauma (AHT) was the most common mechanism of injury (65 patients, 45%) in children with cEEG monitoring. Seizures were identified on cEEG in 43 patients (30%). Forty (93%) of these 43 patients had subclinical seizures, including 17 (40%) with only subclinical seizures and 23 (53%) with both clinical and subclinical seizures. Fifty-three percent of patients with seizures experienced status epilepticus. Age less than 2.4 years and AHT mechanism were strongly correlated with presence of seizures (odds ratios 8.7 and 6.0, respectively). Those patients with only subclinical seizures had the same risk factors as the other groups. The presence of seizures did not correlate with discharge disposition but was correlated with longer hospital stay and intensive care unit stay. CONCLUSIONS Continuous EEG monitoring identifies a significant number of subclinical seizures acutely after TBI. Children younger than 2.4 years of age and victims of AHT are particularly vulnerable to subclinical seizures, and seizures in general. Continuous EEG monitoring allows for

  9. Telephone advice nursing: parents' experiences of monitoring calls in children with gastroenteritis.

    PubMed

    Eriksson, Elisabeth Kvilén; Sandelius, Susanna; Wahlberg, Anna Carin

    2015-06-01

    A common reason for calling a telephone advice nurse is gastroenteritis symptoms in children. A monitoring call is a follow-up call from the telephone nurse to the care seeker in order to follow up on given advice and make a new assessment. The aim of the study was to describe the parents' experiences of monitoring calls in telephone advice nursing in children with gastroenteritis. A qualitative interview method was chosen and data were analysed inductively with a qualitative latent content analysis. Ten parents, nine mothers and one father were interviewed. Four main categories and 13 subcategories were identified and described as useful, and the main categories were convenience - parents found it convenient to get access to self-care advice at home, confirmation - the interaction between the telephone nurse and the parent seemed to become deeper and closer as a result of the monitoring call, support - in a vulnerable situation receiving further information and an opportunity to let the telephone nurse monitor the sick child and guidance - to be guided through the most acute phase in the child's gastroenteritis symptoms. Monitoring calls seemed to be experienced as a security enhancing, positive opportunity and a robust complement to seeking care at a healthcare facility. The results of the study indicate how inhabitants can receive expert advice, support and guidance for care and provide a useful basis for Swedish Healthcare Direct (SHD) to develop the modalities for monitoring calls. PMID:25236581

  10. Early Systemic Cellular Immune Response in Children and Young Adults Receiving Decellularized Fresh Allografts for Pulmonary Valve Replacement

    PubMed Central

    Neumann, Anneke; Breymann, Thomas; Cebotari, Serghei; Boethig, Dietmar; Horke, Alexander; Beerbaum, Philipp; Westhoff-Bleck, Mechthild; Bertram, Harald; Ono, Masamichi; Tudorache, Igor; Haverich, Axel; Beutel, Gernot

    2014-01-01

    Objectives: The longevity of homografts is determined by the activation of the recipients' immune system resulting from allogenic antigen exposition. Fresh decellularized pulmonary homografts (DPH) have shown promising early results in pulmonary valve replacement in children and young adults and could potentially avoid significant activation of the immune system, as more than 99% of the donor DNA is removed during the decellularization process. While the humoral immune response to decellularized allografts has been studied, detailed information on the more significant cellular immune response is currently lacking. Methods and Results: Peripheral blood samples were obtained from patients undergoing pulmonary valve replacement with DPH before, after, and for approximately 3 years after implantation. Absolute counts and percentages of mature T- (CD3+), B- (CD19+), and natural killer- (CD16+/CD56+) cells, as well as T helper- (CD4+) and cytotoxic T-cell- (CD8+) subsets, were determined by fluorescence-activated cell sorting (FACS). Between May 2009 and September 2013, 199 blood samples taken from 47 patients with a mean age at DPH implantation of 16.6±10.8 years were analyzed. The hemodynamic performance of DPH was excellent in all but one patient, and no valve-related deaths or conduit explantations were observed. The short-term follow up revealed a significant postoperative decrease in cell counts of most subtypes with reconstitution after 3 months. Continued assessment did not show any significant deviations in cell counts from their baseline values. Conclusion: The absence of cellular immune response in patients receiving DPH supports the concept that decellularization can provide a basis for autologous regeneration. PMID:24138470

  11. Similar protective immunity induced by an inactivated enterovirus 71 (EV71) vaccine in neonatal rhesus macaques and children.

    PubMed

    Zhang, Ying; Wang, Lichun; Liao, Yun; Liu, Longding; Ma, Kaili; Yang, Erxia; Wang, Jingjing; Che, Yanchun; Jiang, Li; Pu, Jing; Guo, Lei; Feng, Min; Liang, Yan; Cui, Wei; Yang, Huai; Li, Qihan

    2015-11-17

    During the development of enterovirus 71 (EV71) inactivated vaccine for preventing human hand, foot and mouth diseases (HFMD) by EV71 infection, an effective animal model is presumed to be significant and necessary. Our previous study demonstrated that the vesicles in oral regions and limbs potentially associated with viremia, which are the typical manifestations of HFMD, and remarkable pathologic changes were identified in various tissues of neonatal rhesus macaque during EV71 infection. Although an immune response in terms of neutralizing antibody and T cell memory was observed in animals infected by the virus or stimulated by viral antigen, whether such a response could be considered as an indicator to justify the immune response in individuals vaccinated or infected in a pandemic needs to be investigated. Here, a comparative analysis of the neutralizing antibody response and IFN-γ-specific T cell response in vaccinated neonatal rhesus macaques and a human clinical trial with an EV71 inactivated vaccine was performed, and the results showed the identical tendency and increased level of neutralizing antibody and the IFN-γ-specific T cell response stimulated by the EV71 antigen peptide. Importantly, the clinical protective efficacy against virus infection by the elicited immune response in the immunized population compared with the placebo control and the up-modulated gene profile associated with immune activation were similar to those in infected macaques. Further safety verification of this vaccine in neonatal rhesus macaques and children confirmed the potential use of the macaque as a reliable model for the evaluation of an EV71 candidate vaccine.

  12. Salivary cortisol monitoring: determination of reference values in healthy children and application in asthmatic children.

    PubMed

    Nagakura, Toshikazu; Tanaka, Toshiaki; Arita, Masahiko; Nishikawa, Kiyoshi; Shigeta, Makoto; Wada, Noriyuki; Matsumoto, Tsutomu; Hiraba, Kazumi; Fukuda, Norimasa

    2012-01-01

    Venipuncture testing of adrenocortical function in asthmatic infants and young children receiving inhaled corticosteroids can raise cortisol levels and mask physiological responses. This study aimed to establish reference ranges for salivary cortisol levels and evaluate the safety and effects of jet-nebulized budesonide inhalation suspension (BIS) on salivary cortisol levels and patient outcomes in infants and young children with mild or persistent asthma. Reference salivary cortisol levels were determined in healthy children aged 6 months to 4 years old. A 12-week multicenter, randomized, parallel-group, open-label study was performed involving 53 age-matched asthmatic children who received either 0.5 mg/day of BIS or 40-60 mg/day of cromolyn sodium inhalation suspension (CIS) via compressor nebulizer. The effective measuring range of salivary cortisol concentration in asthmatic children was 0.12-3.00 micrograms/dL. The upper and lower limits of the reference range were 0.827 and 0.076 micrograms/dL, respectively. No significant difference was seen from baseline through week 12 in the CIS and BIS groups. BIS was safe in these patients, with no inhibitory effects on adrenocortical function. Salivary cortisol measurement offers a useful and accurate tool for testing adrenocortical function in infants and young children. Longer-term studies that incorporate testing of the hypothalamic-pituitary-adrenal axis are warranted to confirm our findings.

  13. A Feasibility Study of Wearable Activity Monitors for Pre-Adolescent School-Age Children

    PubMed Central

    Van Loan, Marta; German, J. Bruce

    2014-01-01

    Introduction Understanding physical activity is key in the fight against childhood obesity. The objective of this study was to examine the feasibility of using certain wearable devices to measure physical activity among children. Methods A qualitative study was conducted with 25 children aged 7 to 10 years to assess acceptability and compliance of wearable activity devices in this age group. During March through August 2012, children participated in a 4-week study of 3 accelerometer models and a heart rate monitor. Children were asked to use a different device each week for 7 consecutive days. Children and their parents completed structured interviews after using each device; they also completed a final exit interview. Results The wrist-worn Polar Active was the device most preferred by children and was associated with the highest level of compliance. Devices that are comfortable to wear, fit properly, have engaging features, and are waterproof increase feasibility and are associated with higher levels of compliance. Conclusion The wrist-worn device was the most feasible for measuring physical activity among children aged 7 to 10 years. These findings will inform researchers in selecting tools for measuring children’s physical activity. PMID:24854236

  14. Handgrip strength test as a complementary tool in monitoring asthma in daily clinical practice in children.

    PubMed

    Latorre-Román, Pedro Ángel; Navarro-Martínez, Ana Vanesa; Mañas-Bastidas, Alfonso; García-Pinillos, Felipe

    2014-12-01

    The aim of this study was to demonstrate that handgrip strength test can discriminate the presence/absence of asthma and between intermittent and moderate persistent asthma in children. 140 children (70 healthy and 70 with asthma) completed the Pediatric Asthma Quality of Life Questionnaire (PAQLQ) and performed the handgrip strength test. Forty-eight hours later, subjects performed spirometry. The results showed Handgrip strength was significantly lower (p<0.001) in children with asthma compared with healthy ones. There were also significant differences (p= 0.024) according to the severity of the disease; children with moderate persistent asthma performed worse than children with intermittent asthma. Binary logistic regression analysis and ROC curve analysis revealed that the result in handgrip strength test was a predictive factor for asthma (cut-off at 16.84 kg) and for severity of pathology (cut-off at 15.06 kg). Handgrip strength was reduced in children with asthma. Handgrip strength was positively associated with lung capacity and quality of life. The fact that the handgrip strength test was able to discriminate between presence/absence of asthma and between intermittent and moderate persistent asthma in children suggested that this test could be used as a complementary tool in the monitoring of asthma in daily clinical practice.

  15. A Comparative Clinicopathologic Study of Collagenous Gastritis in Children and Adults: The Same Disorder With Associated Immune-mediated Diseases.

    PubMed

    Ma, Changqing; Park, Jason Y; Montgomery, Elizabeth A; Arnold, Christina A; McDonald, Oliver G; Liu, Ta-Chiang; Salaria, Safia N; Limketkai, Berkeley N; McGrath, Kevin M; Musahl, Tina; Singhi, Aatur D

    2015-06-01

    Collagenous gastritis is a rare condition characterized by surface epithelial damage, subepithelial collagen deposition, and a lamina propria inflammatory infiltrate. Previous studies have proposed 2 clinicopathologic subtypes: (1) children (18 y of age or younger) presenting with severe anemia, nodular gastric mucosa, and isolated gastric disease; and (2) adults with chronic watery diarrhea that is associated with diffuse collagenous involvement of the gastrointestinal tract. However, notable exceptions exist. In fact, broad variability in clinical presentation, etiology, treatment and disease course has been reported. To better define the clinicopathologic features of collagenous gastritis, we have collected 10 pediatric and 21 adult cases and describe their clinical, endoscopic, pathologic, and follow-up findings. Both children and adults presented with similar clinical symptoms such as anemia (50%, 35%, respectively), epigastric/abdominal pain (50%, 45%), and diarrhea (40%, 55%). Concomitant immune disorders were identified in 2 (20%) children and 3 (14%) adults. Further, 7 of 17 (41%) adults were taking medications associated with other immune-related gastrointestinal diseases including olmesartan and antidepressants. Histologically, there were no differences between children and adults with collagenous gastritis in the location of gastric involvement, mean collagenous layer thickness, and prominence of eosinophils (P>0.05). Extragastric collagenous involvement was also seen with comparable frequencies in each cohort (44%, 59%). Follow-up information was available for 22 of 31 (71%) patients and ranged from 2 to 122 months (mean, 33.6 mo). Despite medical management in most cases, persistence of symptoms or collagenous gastritis on subsequent biopsies was seen in 100% of children and 82% of adults. Of note, treatment for 1 adult patient involved cessation of olmesartan resulting in resolution of both symptoms and subepithelial collagen deposition on subsequent

  16. Short-course therapy for tuberculosis in infants and children. Infectious Diseases and Immunization Committee, Canadian Paediatric Society.

    PubMed Central

    1994-01-01

    OBJECTIVE: To improve efficacy of and compliance with therapy for tuberculosis in children. OPTIONS: Short-course (6-month) multi-drug therapy, either non-supervised or directly supervised, versus long-course (more than 6-month) multi-drug therapy. OUTCOMES: Success (more than 90% of cases cured without relapse or serious side effects), development of drug resistance and compliance with treatment. EVIDENCE: Review of published reports of efficacy trials of tuberculosis therapy in children, side effects and compliance studies; consensus of expert opinion. VALUES: Values were assigned to the evidence by the Infectious Disease and Immunization Committee of the Canadian Paediatric Society through review of the data and consensus. BENEFITS, HARMS AND COSTS: Improved efficacy and compliance with short-course protocols should lower the rate of treatment failure among children in Canada and the cost of tuberculosis care. RECOMMENDATIONS: A short-course (6-month) protocol of four drugs for the first 2 months and two drugs for the subsequent 4 months is recommended to treat pulmonary tuberculosis or extrapulmonary disease causing lymphadenopathy. Tuberculous meningitis, disease involving bones and joints and tuberculosis with HIV infection require longer courses of treatment. Asymptomatic tuberculosis should be treated with daily doses of isoniazid for 9 months. Intermittent directly observed therapy is recommended if compliance cannot be ensured. Routine liver function testing is not recommended for prepubescent children taking isoniazid, but monthly assessment for clinical symptoms and periodic liver function evaluation is advised in adolescent women, especially post partum. VALIDATION: This report was reviewed by the directors of the Canadian Paediatric Society, the Hepatitis and Special Pathogens Division of the Laboratory Centre for Disease Control and the Canadian Thoracic Society. The recommendations are similar to those of the American Academy of Pediatrics. SPONSOR

  17. Our Immune System

    MedlinePlus

    Our Immune System A story for children with primary immunodeficiency diseases Written by Sara LeBien IMMUNE DEFICIENCY FOUNDATION A note ... who are immune deficient to better understand their immune system. What is a “ B-cell, ” a “ T-cell, ” ...

  18. Immunization for Women

    MedlinePlus

    ... nfid.org/#sthash.eZ72dCSP.dpuf Diseases & Vaccines Overview Immunization Schedules Talk to you doctor about your immunization ... years Immunization Schedule for Children, 7-18 years Immunization News July 8, 2016 HPV-related cancers on ...

  19. [The German Health Interview and Examination Survey for Children and Adolescents (KiGGS): state of immunity against poliomyelitis in German children].

    PubMed

    Diedrich, S; Schreier, E

    2007-01-01

    One of the goals of the WHO is the worldwide eradication of poliomyelitis in the coming years. Europe was declared poliofree in 2002, but increasing migration may lead to a come-back of circulating polioviruses. A high level of population immunity protects against imported wild viruses from endemic areas. The first seroprevalence data since the switch from live to inactivated vaccine in Germany (OPV to IPV) are provided. A serum panel was tested (n=2,046) in order to study the serological status against poliomyelitis. The microneutralization test on RD cells was used. Overall, neutralizing antibodies against poliovirus types 1, 2 and 3 were detected in 97.4%, 97.6%, and 93.6% of samples, respectively. Of the test persons, 91.7% had antibodies against all three virus types. Only 26 children simultaneously lacked neutralizing antibodies for all three serotypes (1.3%). No significant correlation between gender, region (East/West)), migration status (with/without migration background) and antibody prevalence to polioviruses was found. The seroprevalence of antibodies against all three types of polioviruses indicates a very high level of population immunity in German children. It must be maintained through consequently performed vaccination programmes.

  20. Immune Responses to "Helicobacter pylori" Infection in Children with Intellectual Disabilities

    ERIC Educational Resources Information Center

    Douraghi, Masoumeh; Goudarzi, Hossein; Rostami, Mahmoud Nateghi; Nikmanesh, Bahram

    2012-01-01

    Infection with "Helicobacter pylori" was assessed through serum "H. pylori" IgG antibody in children with intellectual disabilities (ID). The sero-status of cytotoxin-associated gene A (CagA) was determined as a risk determinant for severe "H. pylori"-associated diseases. In total, 210 children with ID were included who were permanent resident of…

  1. Positive peer pressure: the effects of peer monitoring on children's disruptive behavior.

    PubMed

    Carden Smith, L K; Fowler, S A

    1984-01-01

    Classroom peers can serve as powerful sources of reinforcement in increasing or maintaining both the positive and negative behaviors of their classmates. In two experiments, we examined the effectiveness of a peer-monitored token system on reducing disruption and nonparticipation during a transition period of a kindergarten class for behaviorally impaired children. Additionally, the effect of providing and subsequently withholding corrective feedback to peer mediators on the accuracy of their point awards was evaluated. Results in Experiment 1 suggest that both teacher- and peer-monitored interventions were successful in decreasing disruption and increasing participation of monitored peers. Experiment 2 further demonstrated that peer monitors could successfully initiate the token system without prior adult implementation. Analysis of the point awards in both experiments indicates that peer monitors consistently awarded points that were earned. However, when corrective feedback was withdrawn the peer monitors frequently awarded points that were not earned, i.e., they rarely withheld points for undesirable behavior. Even so, the monitored peers' disruptive behavior was maintained at low rates. PMID:6735953

  2. Positive peer pressure: the effects of peer monitoring on children's disruptive behavior.

    PubMed

    Carden Smith, L K; Fowler, S A

    1984-01-01

    Classroom peers can serve as powerful sources of reinforcement in increasing or maintaining both the positive and negative behaviors of their classmates. In two experiments, we examined the effectiveness of a peer-monitored token system on reducing disruption and nonparticipation during a transition period of a kindergarten class for behaviorally impaired children. Additionally, the effect of providing and subsequently withholding corrective feedback to peer mediators on the accuracy of their point awards was evaluated. Results in Experiment 1 suggest that both teacher- and peer-monitored interventions were successful in decreasing disruption and increasing participation of monitored peers. Experiment 2 further demonstrated that peer monitors could successfully initiate the token system without prior adult implementation. Analysis of the point awards in both experiments indicates that peer monitors consistently awarded points that were earned. However, when corrective feedback was withdrawn the peer monitors frequently awarded points that were not earned, i.e., they rarely withheld points for undesirable behavior. Even so, the monitored peers' disruptive behavior was maintained at low rates.

  3. Individual Monitoring of Immune Response in Atlantic Salmon Salmo salar following Experimental Infection with Infectious Salmon Anaemia Virus (ISAV).

    PubMed

    Collet, Bertrand; Urquhart, Katy; Monte, Milena; Collins, Catherine; Garcia Perez, Sandro; Secombes, Chris J; Hall, Malcolm

    2015-01-01

    Monitoring the immune response in fish over the progression of a disease is traditionally carried out by experimental infection whereby animals are killed at regular intervals and samples taken. We describe here a novel approach to infectiology for salmonid fish where blood samples are collected repeatedly in a small group of PIT-tagged animals. This approach contributes to the reduction of animals used in research and to improved data quality. Two groups of 12 PIT-tagged Atlantic salmon (Salmo salar) were i.p infected with Infectious Salmon Anaemia Virus (ISAV) or culture medium and placed in 1 m3 tanks. Blood samples were collected at 0, 4, 8, 12, 16, 21 and 25 days post infection. The viral load, immune and stress response were determined in individual fish by real-time quantitative PCR (QPCR) on the blood cells, as well as the haematocrit used as an indicator of haemolysis, a clinical consequence of ISAV infection. "In-tank" anaesthesia was used in order to reduce the stress related to chase and netting prior to sampling. The data were analysed using a statistical approach which is novel with respect to its use in fish immunology. The repeated blood collection procedure did not induce stress response as measured by HSP70 and HSP90 gene expression in the un-infected animals. A strong increase in viraemia as well as a significant induction of Mx and γIP gene expression were observed in the infected group. Interleukin 10 was found induced at the later stage of the infection whereas no induction of CD8 or γ IFN could be detected. These results and the advantages of this approach are discussed. PMID:26397117

  4. Individual Monitoring of Immune Response in Atlantic Salmon Salmo salar following Experimental Infection with Infectious Salmon Anaemia Virus (ISAV).

    PubMed

    Collet, Bertrand; Urquhart, Katy; Monte, Milena; Collins, Catherine; Garcia Perez, Sandro; Secombes, Chris J; Hall, Malcolm

    2015-01-01

    Monitoring the immune response in fish over the progression of a disease is traditionally carried out by experimental infection whereby animals are killed at regular intervals and samples taken. We describe here a novel approach to infectiology for salmonid fish where blood samples are collected repeatedly in a small group of PIT-tagged animals. This approach contributes to the reduction of animals used in research and to improved data quality. Two groups of 12 PIT-tagged Atlantic salmon (Salmo salar) were i.p infected with Infectious Salmon Anaemia Virus (ISAV) or culture medium and placed in 1 m3 tanks. Blood samples were collected at 0, 4, 8, 12, 16, 21 and 25 days post infection. The viral load, immune and stress response were determined in individual fish by real-time quantitative PCR (QPCR) on the blood cells, as well as the haematocrit used as an indicator of haemolysis, a clinical consequence of ISAV infection. "In-tank" anaesthesia was used in order to reduce the stress related to chase and netting prior to sampling. The data were analysed using a statistical approach which is novel with respect to its use in fish immunology. The repeated blood collection procedure did not induce stress response as measured by HSP70 and HSP90 gene expression in the un-infected animals. A strong increase in viraemia as well as a significant induction of Mx and γIP gene expression were observed in the infected group. Interleukin 10 was found induced at the later stage of the infection whereas no induction of CD8 or γ IFN could be detected. These results and the advantages of this approach are discussed.

  5. Individual Monitoring of Immune Response in Atlantic Salmon Salmo salar following Experimental Infection with Infectious Salmon Anaemia Virus (ISAV)

    PubMed Central

    Collet, Bertrand; Urquhart, Katy; Monte, Milena; Collins, Catherine; Garcia Perez, Sandro; Secombes, Chris J.; Hall, Malcolm

    2015-01-01

    Monitoring the immune response in fish over the progression of a disease is traditionally carried out by experimental infection whereby animals are killed at regular intervals and samples taken. We describe here a novel approach to infectiology for salmonid fish where blood samples are collected repeatedly in a small group of PIT-tagged animals. This approach contributes to the reduction of animals used in research and to improved data quality. Two groups of 12 PIT-tagged Atlantic salmon (Salmo salar) were i.p infected with Infectious Salmon Anaemia Virus (ISAV) or culture medium and placed in 1 m3 tanks. Blood samples were collected at 0, 4, 8, 12, 16, 21 and 25 days post infection. The viral load, immune and stress response were determined in individual fish by real-time quantitative PCR (QPCR) on the blood cells, as well as the haematocrit used as an indicator of haemolysis, a clinical consequence of ISAV infection. “In-tank” anaesthesia was used in order to reduce the stress related to chase and netting prior to sampling. The data were analysed using a statistical approach which is novel with respect to its use in fish immunology. The repeated blood collection procedure did not induce stress response as measured by HSP70 and HSP90 gene expression in the un-infected animals. A strong increase in viraemia as well as a significant induction of Mx and γIP gene expression were observed in the infected group. Interleukin 10 was found induced at the later stage of the infection whereas no induction of CD8 or γ IFN could be detected. These results and the advantages of this approach are discussed. PMID:26397117

  6. Parental Monitoring of Children’s Media Consumption: The Long-term Influences on Body Mass Index in Children

    PubMed Central

    Tiberio, Stacey S.; Kerr, David C. R.; Capaldi, Deborah M.; Pears, Katherine C.; Kim, Hyoun K.; Nowicka, Paulina

    2014-01-01

    Importance Although children's media consumption has been one of the most robust risk factors for childhood obesity, effects of specific parenting influences, such as parental media monitoring, have not been effectively investigated. Objectives This study examined the potential influences of maternal and paternal monitoring of child media exposure and children's general activities on children's BMI in middle childhood. Design A longitudinal study, taken from a subsample of the Three Generational Study, with assessments at children's ages of 5, 7, and/or 9 years collected from 1998-2012. Setting The Three Generational Study, a predominantly Caucasian, Pacific-Northwest U.S. community sample (overall participation rate 90%). Participants Analyses included 112 mothers, 103 fathers and their 213 children (55% girls) at ages 5, 7, and/or 9 years. Participation rates ranged from 67% to 72% of all eligible Three Generational Study children across the three assessments. Main Exposures Parents reported on their general monitoring of their children (whereabouts and activities), specific monitoring of child media exposure, children's participation in sports and recreational activities, children's media time (hours/week), annual income, and education level. Parental BMI was recorded. Main Outcome Measure Predictions to level and change in child BMI z scores were tested. Results Linear mixed-effects modeling indicated that more maternal, but not paternal, monitoring of child media exposure predicted lower child BMI z scores at age 7 years (95% CI, −.39 – −.07) and less steeply increasing child BMI z scores from ages 5-9 years (95% CI, −.11 – −.01). These effects held when controlling for more general parental monitoring, and parent BMI, income and education. Results supported that the significant negative effect of maternal media monitoring on children's BMI z scores at age 7 years was marginally accounted for by the effect of child media time. The maternal media

  7. [Postvaccinal immunity and immunological aspects of Haemophilus influenzae carrier state in children of different age groups after the administration of "Act-HIB" vaccine].

    PubMed

    Gorbunov, S G; Bondarenko, V M; Demina, A A; Spirikhina, L V; Iastrebova, N E; Vaneeva, N P; Orlova, E V; Tamazian, G V; Zakharova, N I

    2003-01-01

    The article deals with H. influenzae (different serotypes) carrier state and immune response before and after the administration of the vaccine "Act-HIB" to children of different age groups. Children aged up to 1 year and over 1 year have been found to differ in the dynamics of carrier state and in the concentration of antibodies of different classes to the antigens of this infective agent, which makes it necessary to carry out their early immunization with a view to ensure their protection from H. influenzae infection.

  8. [A state of innate and adaptive immunity in children with schizophrenia and in the high-risk group for the disease].

    PubMed

    Shcherbakova, I V; Kozlovskaia, G V; Kalinina, M A; Kliushnik, T P

    2005-01-01

    Leukocyte elastase (LE) activity, alpha1-proteinase inhibitor (alpha1-PI), C-reactive protein (CRP) as the indices of innate immunity and the level of autoantibodies to nerve growth factor (Aab-NGF) and to basic myelin protein (Aab-BMP) as the indices of adaptive immunity have been studied in the blood serum of 40 children at high risk for schizophrenia and in 32 children with schizophrenia. In the high-risk group, an increase both of the LE activity, CRP content and variance of alpha1-PI concentrations, indicating the activation of innate immunity, was found. LE activity correlated with severity of schizotypal diathesis. The development of schizophrenic process is accompanied by generalization of the immune response: along with activation of the innate immunity, there was activation of immunity acquired as an increase of the level of autoantibodies to neuroantigenes. It is suggested that activation of innate and adaptive immunity is related to the processes determining the disturbances of the nervous system development.

  9. Guillain-BarrÉ Syndrome After Immunization in Canadian Children (1996-2012).

    PubMed

    Top, Karina A; Desai, Shalini; Moore, Dorothy; Law, Barbara J; Vaudry, Wendy; Halperin, Scott A; Bettinger, Julie A

    2015-12-01

    Guillain-Barré syndrome (GBS) cases admitted to Canadian pediatric tertiary care centers were ascertained through active surveillance. From 1996 to 2012, 246 cases were identified, and 24 (10%) had onset ≤30 days after immunization. Annual rate of postimmunization GBS was 2.0 per 100,000 hospitalizations. Postimmunization GBS was an infrequent cause of pediatric hospitalization.

  10. Tumor necrosis factor-α -308G/A gene polymorphism in Egyptian children with immune thrombocytopenic purpura.

    PubMed

    El Sissy, Maha H; El Sissy, A H; Elanwary, Sherif

    2014-07-01

    Immune thrombocytopenic purpura (ITP) is an autoimmune disease characterized by increased platelet destruction. Although the cause of ITP remains unclear, it is accepted that both environmental and genetic factors play an important role in the development of the disease. Children with ITP have a T-helper 1-type cytokine pattern with elevated levels of tumor necrosis factor-alpha (TNF-α) as in most autoimmune diseases. Researchers have shown that polymorphism in the TNF-α gene at position -308 affects gene transcriptions with increased TNF-α production. The current case-control study aimed at detecting the frequency of TNF-α -308G/A gene polymorphism as genetic markers in Egyptian children with ITP, and to clear out their possible role in choosing the treatment protocols of therapy, using PCR restriction fragment length polymorphism assay. Ninety-two ITP patients and 100 age and sex-matched healthy controls were recruited in the study. The results obtained revealed that the frequency of TNF-α -308A/A homotype in ITP patients was significantly higher than that of the controls, and conferred almost six-fold increased risk of ITP acquisition. The polymorphic A allele frequency was significantly higher in ITP patients than in the controls, conferring almost two-fold increased ITP risk. In conclusion, our study suggests the possibility that TNF-α -308 gene polymorphism may contribute to the susceptibility of childhood ITP in Egyptian children.

  11. Varicella-zoster virus in children immunized with the varicella vaccine.

    PubMed

    Chesnut, Gregory; McClain, Damon; Galeckas, Kenneth

    2012-09-01

    We present the case of a 4-year-old immunocompetent girl with varicella-zoster virus (VZV) that occurred 45 months after a single dose of the varicella vaccine. Varicella-zoster virus is rare in children, particularly those who have received the varicella vaccine. Our case illustrates the need for a continued high index of suspicion, even among vaccinated children with herpetiform rashes, for varicella reactivation or reinfection.

  12. [Rubella immunity in 20-39 year-old women in Japan: monitoring by the antibody data from a commercial diagnostic laboratory].

    PubMed

    Itabashi, Yoshinori; Yamamoto, Shin-ichi; Masui, Yukio; Inoue, Sakae

    2005-06-01

    In order to know the rubella immune status of Japanese women aged 20 to 39 years old, we analyzed the hemagglutination-inhibiting antibody titration data on 264,371 sera which were sent to a commercial diagnostic laboratory from gynecology clinics all over Japan during 1999 through 2003. We found that antibody-positive rates remained at about 95% during the period, but, from 2000, geometric mean antibody titers of the positive sera gradually decreased each year. Annual analysis of the data will be useful for monitoring the trend of rubella immunity among Japanese women of childbearing age.

  13. Estimating the Number of Measles-Susceptible Children and Adolescents in the United States Using Data From the National Immunization Survey-Teen (NIS-Teen).

    PubMed

    Bednarczyk, Robert A; Orenstein, Walter A; Omer, Saad B

    2016-07-15

    Despite high measles vaccination rates in the United States, imported measles cases have led to outbreaks in the United States. These outbreaks have not led to sustained measles transmission; however, with each birth cohort of children not fully vaccinated against measles, measles-susceptible individuals accumulate in the population. The total number of measles-susceptible children and adolescents in the United States is unknown. We used age-specific measles vaccination data from the National Immunization Survey-Teen (2008-2013) to estimate the number of measles-susceptible children aged 17 years or younger, accounting for vaccine effectiveness, infant protection from maternal antibodies, and loss of immunity following childhood cancer treatment. Approximately 12.5% of US children and adolescents are susceptible to measles, with the highest levels of susceptibility being observed in children aged 3 years or younger (24.7% are susceptible to measles). In sensitivity analyses, we found that a sustained decrease in measles vaccination coverage from 91.9% (2013 level) to 90.0% (2009 level) would add nearly 1.2 million susceptible children and adolescents (thus making 14.2% of those aged 17 years or younger susceptible to measles). This reemphasizes the need for high measles vaccination coverage to support population-level immunity and prevent reestablishment of indigenous measles transmission in the United States. PMID:27338281

  14. Estimating the Number of Measles-Susceptible Children and Adolescents in the United States Using Data From the National Immunization Survey-Teen (NIS-Teen).

    PubMed

    Bednarczyk, Robert A; Orenstein, Walter A; Omer, Saad B

    2016-07-15

    Despite high measles vaccination rates in the United States, imported measles cases have led to outbreaks in the United States. These outbreaks have not led to sustained measles transmission; however, with each birth cohort of children not fully vaccinated against measles, measles-susceptible individuals accumulate in the population. The total number of measles-susceptible children and adolescents in the United States is unknown. We used age-specific measles vaccination data from the National Immunization Survey-Teen (2008-2013) to estimate the number of measles-susceptible children aged 17 years or younger, accounting for vaccine effectiveness, infant protection from maternal antibodies, and loss of immunity following childhood cancer treatment. Approximately 12.5% of US children and adolescents are susceptible to measles, with the highest levels of susceptibility being observed in children aged 3 years or younger (24.7% are susceptible to measles). In sensitivity analyses, we found that a sustained decrease in measles vaccination coverage from 91.9% (2013 level) to 90.0% (2009 level) would add nearly 1.2 million susceptible children and adolescents (thus making 14.2% of those aged 17 years or younger susceptible to measles). This reemphasizes the need for high measles vaccination coverage to support population-level immunity and prevent reestablishment of indigenous measles transmission in the United States.

  15. Performance Monitoring in Medication-Naïve Children with Tourette Syndrome

    PubMed Central

    Eichele, Heike; Eichele, Tom; Bjelland, Ingvar; Høvik, Marie F.; Sørensen, Lin; van Wageningen, Heidi; Worren, Marius Kalsås; Hugdahl, Kenneth; Plessen, Kerstin J.

    2016-01-01

    Background: Tourette syndrome (TS) is a childhood-onset neurodevelopmental disorder and its impact on cognitive development needs further study. Evidence from neuropsychological, neuroimaging and electrophysiological studies suggests that the decline in tic severity and the ability to suppress tics relate to the development of self-regulatory functions in late childhood and adolescence. Hence, tasks measuring performance monitoring might provide insight into the regulation of tics in children with TS. Method: Twenty-five children with TS, including 14 with comorbid Attention-deficit/ hyperactivity disorder (ADHD), 39 children with ADHD and 35 typically developing children aged 8–12 years were tested with a modified Eriksen-Flanker task during a 34-channel electroencephalography (EEG) recording. Task performance, as well as stimulus-locked and response-locked event-related potentials (ERP) were analyzed and compared across groups. Results: Participants did not differ in their behavioral performance. Children with TS showed higher amplitudes of an early P3 component of the stimulus-locked ERPs in ensemble averages and in separate trial outcomes, suggesting heightened orienting and/or attention during stimulus evaluation. In response-locked averages, children with TS had a slightly higher positive complex before the motor response, likely also reflecting a late P3. Groups did not differ in post-response components, particularly in the error-related negativity (ERN) and error-related positivity (Pe). Conclusions: These findings suggest that children with TS may employ additional attentional resources as a compensatory mechanism to maintain equal behavioral performance. PMID:26973443

  16. Lung ultrasound in the diagnosis and monitoring of community acquired pneumonia in children.

    PubMed

    Urbankowska, Emilia; Krenke, Katarzyna; Drobczyński, Łukasz; Korczyński, Piotr; Urbankowski, Tomasz; Krawiec, Marta; Kraj, Grażyna; Brzewski, Michał; Kulus, Marek

    2015-09-01

    Lung ultrasound (LUS) is as an easily accessible, radiation-free imaging technique that might be used as a diagnostic tool in community-acquired pneumonia (CAP). The aim of the study was to evaluate the usefulness and accuracy of LUS in the diagnosis and monitoring of childhood CAP. One hundred six consecutive children aged between 1 and 213 (median 52.5) months referred to the hospital with suspicion of CAP were enrolled. All patients underwent LUS on the day of admission, followed by chest radiograph (CXR). Lung ultrasound was also performed in 25 children between 5th-7th and 31 children between 10th-14th day after admission. Radiographic signs of pneumonia were demonstrated in 76 children, while lung ultrasound revealed pulmonary abnormalities consistent with pneumonia in 71 children. LUS gave false negative results in 5 patients with parahilar pulmonary infiltrates demonstrated by CXR. Almost perfect overall agreement between LUS and CXR was found in terms of pneumonia diagnosis (Cohen kappa coefficient of 0.89). The diagnostic performance of LUS in demonstration of lung involvement was as follows: sensitivity of 93.4%, specificity of 100%, positive predictive value of 100%, negative predictive value of 85.7% and accuracy of 95.3%. Our study showed that LUS is a sensitive and highly specific diagnostic method in children with CAP. Therefore, LUS may be considered as the first imaging test in children with suspicion of CAP. A diagnostic algorithm of CAP which includes LUS should be validated in prospective studies. Lung ultrasound can also be used to follow-up resolution of pneumonic lesions.

  17. Ambulatory EEG NeuroMonitor platform for engagement studies of children with development delays

    NASA Astrophysics Data System (ADS)

    Mahajan, Ruhi; Consul-Pacareu, Sergi; Abusaud, Mohammed; Sahadat, Md N.; Morshed, Bashir I.

    2013-05-01

    Engagement monitoring is crucial in many clinical and therapy applications such as early learning preschool classes for children with developmental delays including autism spectrum disorder (ASD), attention-deficit hyperactivity disorder (ADHD), or cerebral palsy; as it is challenging for the instructors to evaluate the individual responses of these children to determine the effectiveness of the teaching strategies due to the diverse and unique need of each child who might have difficulty in verbal or behavioral communication. This paper presents an ambulatory scalp electroencephalogram (EEG) NeuroMonitor platform to study brain engagement activities in natural settings. The developed platform is miniature (size: 2.2" x 0.8" x 0.36", weight: 41.8 gm with 800 mAh Li-ion battery and 3 snap leads) and low-power (active mode: 32 mA low power mode: under 5mA) with 2 channels (Fp1, Fp2) to record prefrontal cortex activities of the subject in natural settings while concealed within a headband. The signals from the electrodes are amplified with a low-power instrumentation amplifier; notch filtered (fc = 60Hz), then band-passed by a 2nd-order Chebyshev-I low-pass filter cascaded with a 2nd-order low-pass (fc = 125Hz). A PSoC ADC (16-bit, 256 sps) samples this filtered signal, and can either transmit it through a Class-2 Bluetooth transceiver to a remote station for real-time analysis or store it in a microSD card for offline processing. This platform is currently being evaluated to capture data in the classroom settings for engagement monitoring of children, aimed to study the effectiveness of various teaching strategies that will allow the development of personalized classroom curriculum for children with developmental delays.

  18. The use of innate immune responses as biomarkers in a programme of integrated biological effects monitoring on flounder (Platichthys flesus) from the southern North Sea

    NASA Astrophysics Data System (ADS)

    Skouras, Andreas; Broeg, Katja; Dizer, Halim; von Westernhagen, Hein; Hansen, Peter-Diedrich; Steinhagen, Dieter

    2003-10-01

    Immunological biomarkers that reflect the effects of exposure to environmental contaminants in coastal marine habitats were sought in European flounder (Platichthys flesus) from five locations in the German Bight with different anthropogenic impacts. During a 2-year period of sampling, innate immune responses were monitored from a total of 331 individual flounder of a body length of 18 to 25 cm. From the fish, plasma lysozyme, phagocytosis and respiratory burst activity of head kidney leucocytes were analysed and implemented as part of an integrated biological effects monitoring programme. As the measurements of the parameters applied here varied within wide ranges at some locations, spatial differences could not always be established, but some general trends could be drawn: plasma lysozyme activity was decreased in flounder contaminated with DDT adducts and some PCBs, while cellular functions such as phagocytosis and respiratory burst were stimulated by some chlorinated hydrocarbons. Correlation analysis also revealed connections not only between the parameters applied here and some contaminants but also with some biochemical parameters used as biomarkers in pollution monitoring: in flounder with decreased integrity of hepatocyte lysosomal membranes, immune functions also were impaired, and plasma lysozyme as well as phagocytosis activity of head kidney cells were impaired when the activity of cytochrome P450 1A was induced. The data presented here indicate that innate immune responses may be useful parameters to monitor cellular functions in a battery of biomarkers of different levels of biological organisation.

  19. Tyrosine monitoring in children with early and continuously treated phenylketonuria: results of an international practice survey.

    PubMed

    Sharman, Rachael; Sullivan, Karen A; Young, Ross McD; McGill, James J

    2010-12-01

    Investigations into the biochemical markers associated with executive function (EF) impairment in children with early and continuously treated phenylketonuria (ECT-PKU) remain largely phenylalanine-only focused, despite experimental data showing that a high phenylalanine:tyrosine (phe:tyr) ratio is more strongly associated with EF deficit than phe alone. A high phe:tyr ratio is hypothesized to lead to a reduction in dopamine synthesis within the brain, which in turn results in the development of EF impairment. This paper provides a snapshot of current practice in the monitoring and/or treatment of tyrosine levels in children with PKU, across 12 countries from Australasia, North America and Europe. Tyrosine monitoring in this population has increased over the last 5 years, with over 80% of clinics surveyed reporting routine monitoring of tyrosine levels in infancy alongside phe levels. Twenty-five percent of clinics surveyed reported actively treating/managing tyrosine levels (with supplemental tyrosine above that contained in PKU formulas) to ensure tyrosine levels remain within normal ranges. Anecdotally, supplemental tyrosine has been reported to ameliorate symptoms of both attention deficit hyperactivity disorder and depression in this population. EF assessment of children with ECT-PKU was likewise highly variable, with 50% of clinics surveyed reporting routine assessments of intellectual function. However when function was assessed, test instruments chosen tended towards global measures of IQ prior to school entry, rather than specific assessment of EF development. Further investigation of the role of tyrosine and its relationship with phe and EF development is needed to establish whether routine tyrosine monitoring and increased supplementation is recommended. PMID:20882350

  20. Viruses, anti-viral therapy, and viral vaccines in children with immune thrombocytopenia.

    PubMed

    Elalfy, Mohsen S; Nugent, Diane

    2016-04-01

    Immune thrombocytopenia (ITP) might be preceded by silent or overt viral infections. Similarly, anti-viral drugs and viral vaccines could also trigger ITP and might play a central role in its pathogenesis. The seasonal nature of childhood ITP suggests that viral infections might initiate immune responses that increase the predisposition and occurrence of ITP. Active cytomegalovirus or Epstein-Barr virus should be considered in differential diagnosis when thrombocytopenia is associated with lymphadenopathy, especially with splenomegaly. This review will focus on the specific association of ITP in association with viral disease and vaccinations, and will discuss the effectiveness of current therapies in light of our current understanding of viral-associated ITP. PMID:27312173

  1. Changes in the hormone (ACTH, insulin,epinephrine) content of immune cells in children having acute lymphocytic leukemia (ALL).

    PubMed

    Pállinger, Eva; Kovács, Gábor; Horváth, Zsuzsanna; Müller, Judit; Csaba, György

    2013-12-01

    Immune cells synthesize, store and secrete hormones, the level of which changes in ALL. In previous experiments the level of histamine, serotonin and triiodothyronine (T3)was studied, while at present that of ACTH, insulin and epinephrine, using flow cytometric analysis for the determination of cell subsets and detection of hormone content. The measurements were done in children at the time of diagnosis. ACTH was significantly elevated in each T cell subsets (total T, Th, Tc, activated T), while B and NK cells were not touched. The alterations in the insulin content (decrease in Tc and activated T cells) were uncertain, and NK cells contained significantly less insulin. The disease did not influence the cells' epinephrine content. There is not clear explanation for the importance of changes in the cells' hormone content, however, it is discussed in the text.

  2. [The state of antigen-dependent immunity system in children with chronic tonsillitis].

    PubMed

    Ponomarev, L E; Khanferian, R A; Borovikov, O V

    2001-01-01

    245 children aged 7-14 years with decompensated chronic tonsillitis were examined and treated in Anapa health resort. Before therapy the children had subnormal concentration of CD3+, CD4+/CD8+, elevated absolute and relative concentration of CD16+, low concentration of salivary IgA and SIgA combined with high serum IgM. The treatment brought a positive trend in the above indices, but CD16+, serum IgA and salivary SIgA remained higher than in controls. This may be explained by genetic predisposition of some children (primary defects of IgA and its secretory component synthesis), effects of autoimmune pathology, natural reaction to persistent viral infection.

  3. Acquisition of Antibodies against Plasmodium falciparum Merozoites and Malaria Immunity in Young Children and the Influence of Age, Force of Infection, and Magnitude of Response

    PubMed Central

    Stanisic, Danielle I.; Fowkes, Freya J. I.; Koinari, Melanie; Javati, Sarah; Lin, Enmoore; Kiniboro, Benson; Richards, Jack S.; Robinson, Leanne J.; Schofield, Louis; Kazura, James W.; King, Christopher L.; Zimmerman, Peter; Felger, Ingrid; Siba, Peter M.

    2014-01-01

    Individuals in areas of Plasmodium falciparum endemicity develop immunity to malaria after repeated exposure. Knowledge of the acquisition and nature of protective immune responses to P. falciparum is presently limited, particularly for young children. We examined antibodies (IgM, IgG, and IgG subclasses) to merozoite antigens and their relationship to the prospective risk of malaria in children 1 to 4 years of age in a region of malaria endemicity in Papua New Guinea. IgG, IgG1, and IgG3 responses generally increased with age, were higher in children with active infection, and reflected geographic heterogeneity in malaria transmission. Antigenic properties, rather than host factors, appeared to be the main determinant of the type of IgG subclass produced. High antibody levels were not associated with protection from malaria; in contrast, they were typically associated with an increased risk of malaria. Adjustment for malaria exposure, using a novel molecular measure of the force of infection by P. falciparum, accounted for much of the increased risk, suggesting that the antibodies were markers of higher exposure to P. falciparum. Comparisons between antibodies in this cohort of young children and in a longitudinal cohort of older children suggested that the lack of protective association was explained by lower antibody levels among young children and that there is a threshold level of antibodies required for protection from malaria. Our results suggest that in populations with low immunity, such as young children, antibodies to merozoite antigens may act as biomarkers of malaria exposure and that, with increasing exposure and responses of higher magnitude, antibodies may act as biomarkers of protective immunity. PMID:25422270

  4. The effects of booster vaccination on combined hepatitis A and hepatitis B vaccine in both anti-HBs and anti-HAV negative children 5-15 years after hepatitis B vaccine primary immunization.

    PubMed

    Chen, Yongdi; Gu, Hua; Cheng, Suyun; Shen, Lingzhi; Cui, Fujiang; Wang, Fuzhen; Yao, Jun; Xia, Shichang; Lv, Huakun; Liang, Xiaofeng

    2013-04-01

    In the present study, we investigated the changes in both anti-HAV lgG and anti-HBs lgG levels and compared the antibody seroconversion rates of different doses of combined hepatitis A and hepatitis B vaccine in children. Children who were vaccinated as infants with Hepatitis B vaccine were revaccinated at 5-15 y of age, then the antibody titers were monitored. Among 283 children, this study found that the anti-HAV seroconversion rates (defined as anti-HAV ≥ 1 mIU/ml) after the first and the third dose were 79.9% and 100% respectively; these observed differences were statistically significant (P<0.05); the corresponding geometric mean titers (GMTs) were 4.72 ± 2.63 mIU/ml and 13.46 ± 1.16 mIU/ml respectively. The anti-HBs seroconversion rates (defined as an anti-HBs ≥ 10 mIU/ml) were 82.3% and 99.0% respectively; these observed differences were statistically significant (P<0.05); and the corresponding titers were 319.95 ± 5.16 mIU/ml and 418.59 ± 3.89 mIU/ml respectively. After the first booster dose, the difference in anti-HAV seroconversion rate was statistically significant in children aged 5-9 y and 10-15 y (P<0.05), as was the difference of anti-HBs seroconversion, whereas after the third dose the difference was not statistically significant (P>0.05). This study demonstrated that the immunization effects of booster vaccination with combined hepatitis A and hepatitis B vaccine is successful for children. A single booster dose is adequate for younger children, while three doses are needed for older children.

  5. Smartphone applications (apps) for heart rate measurement in children: comparison with electrocardiography monitor.

    PubMed

    Ho, Chi-Lin; Fu, Yun-Ching; Lin, Ming-Chih; Chan, Sheng-Ching; Hwang, Betau; Jan, Sheng-Ling

    2014-04-01

    Heart rate (HR) measurement is essential for children with abnormal heart beats. The purpose of this study was to determine whether HR measurement by smartphone applications (apps) could be a feasible alternative to an electrocardiography (ECG) monitor. A total of 40 children, median age of 4.3 years, were studied. Using four free smartphone apps, pulse rates were measured at the finger (or toe) and earlobe, and compared with baseline HRs measured by ECG monitors. Significant correlations between measured pulse rates and baseline HRs were found. Both correlation and accuracy rate were higher in the earlobe group than the finger/toe group. When HR was <120 beats per min (bpm), the accuracy rates were not different between the two different measuring sites for each app (median of 65 vs 76%). The accuracy rates in the finger/toe group were significantly lower than those in the earlobe group for all apps when HR was ≥ 120 bpm (27 vs 65%). There were differences among apps in their abilities to measure pulse rates. Taking children's pulse rate from the earlobe would be more accurate, especially for tachycardia. However, we do not recommend that smartphone apps should not be used for routine medical use or used as the sole form of HR measurement because the results of their accuracy are not good enough.

  6. Cross-Sectional Study of Phoneme and Rhyme Monitoring Abilities in Children between 7 and 13 Years

    ERIC Educational Resources Information Center

    Sasisekaran, Jayanthi; Weber-Fox, Christine

    2012-01-01

    We investigated phonemic competence in production in three age groups of children (7 and 8, 10 and 11, 12 and 13 years) using rhyme and phoneme monitoring. Participants were required to name target pictures silently while monitoring covert speech for the presence or absence of a rhyme or phoneme match. Performance in the verbal tasks was compared…

  7. The Effect of Retention Interval Task Difficulty on Young Children's Prospective Memory: Testing the Intention Monitoring Hypothesis

    ERIC Educational Resources Information Center

    Mahy, Caitlin E. V.; Moses, Louis J.

    2015-01-01

    The current study examined the impact of retention interval task difficulty on 4- and 5-year-olds' prospective memory (PM) to test the hypothesis that children periodically monitor their intentions during the retention interval and that disrupting this monitoring may result in poorer PM performance. In addition, relations among PM, working memory,…

  8. The Costs and Benefits of Self-Monitoring for Higher Functioning Children and Adolescents with Autism

    PubMed Central

    Henderson, Heather A.; Ono, Kim E.; McMahon, Camilla; Schwartz, Caley B.; Usher, Lauren V.; Mundy, Peter C.

    2013-01-01

    The ability to regulate behaviors and emotions depends in part on the ability to flexibly monitor one’s own progress toward a goal. Atypical patterns of response monitoring have been reported in individuals with autism spectrum disorders (ASD). In the current study we examined the error related negativity (ERN), an electrophysiological index of response monitoring, in relation to behavioral, social cognitive, and emotional presentation in higher functioning children (8–16 years) diagnosed with autism (HFA: N = 38) and an age- and IQ-matched sample of children without autism (COM: N = 36). Both HFA and COM participants displayed larger amplitude responses to error compared to correct response trials and these amplitudes did not differ by diagnostic group. For participants with HFA, larger ERN amplitudes were associated with more parent-reported autistic symptoms and more self-reported internalizing problems. However, across the full sample, larger ERN amplitudes were associated with better performance on Theory of Mind tasks. The results are discussed in terms of the utility of electrophysiological measures for understanding essential moderating processes that contribute to the spectrum of behavioral expression in the development of Autism Spectrum Disorders. PMID:24682651

  9. Immunizing Children Against the Possible Antisocial Effects of Viewing Television Violence: A Curricular Intervention.

    ERIC Educational Resources Information Center

    Doolittle, John Charles

    An experimental curriculum module was designed and was tested to determine its success in helping children cope with negative influences of viewing violence on television. Instructional treatments were administered in two forms: concept presentation, in which subjects were shown how various components of production are used to create a dramatic…

  10. Excess body mass is associated with T cell differentiation indicative of immune aging in children

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Obesity has been associated with accelerated biological ageing and immunosenescence. As the prevalence of childhood obesity is increasing, we wanted to determine if associations between obesity and immunosenescence would manifest in children. We studied 123 Mexican American adolescents aged 10–14 (m...

  11. Breastfeeding Among U.S. Children Born 2000 - 2009, CDC National Immunization Survey

    MedlinePlus

    ... Any" and "exclusive" breastfeeding rates by socio-demographics Breastfeeding among U.S. Children Born 2002–2013, CDC National ... Were Breastfed, by Birth Year a,b Any Breastfeeding Exclusive Breastfeeding c a Breastfeeding rates through 2008 ...

  12. Strategies for Monitoring Outcomes in HIV-Exposed Uninfected Children in the United Kingdom

    PubMed Central

    Thorne, Claire; Tookey, Pat

    2016-01-01

    Surveillance of pregnancies in women living with HIV is carried out on a national basis in the United Kingdom (UK) through the National Study of HIV in Pregnancy and Childhood. There are currently around 1100–1200 HIV-exposed uninfected (HEU) infants born every year in the UK, where vertical transmission of HIV now occurs in fewer than 5 in every 1000 pregnancies. By the end of 2014, there was a cumulative total of more than 15,000 HEU children with any combination antiretroviral therapy (cART) exposure and more than 5000 with cART exposure from conception in the UK. HEU infants are increasingly being exposed to newer antiretroviral drugs for which less is known regarding both short- and long-term safety. In this commentary, we describe the approaches that have been taken to explore health outcomes in HEU children born in the UK. This includes the Children exposed to AntiRetroviral Therapy (CHART) Study, which was a consented follow-up study carried out in 2002–2005 of HEU children born in 1996–2004. The CHART Study showed that 4% of HEU children enrolled had a major health or development problem in early childhood; this was within expected UK norms, but the study was limited by small numbers and short-term follow-up. However, the problems with recruitment and retention that were encountered within the CHART Study demonstrated that comprehensive, clinic-based follow-up was not a feasible approach for long-term assessment of HEU children in the UK. We describe an alternative approach developed to monitor some aspects of their long-term health, involving the “flagging” of HEU infants for death and cancer registration with the UK Office for National Statistics. Some of the ethical concerns regarding investigation of long-term outcomes of in utero and perinatal exposure to antiretrovirals, including those relating to consent and confidentiality, are also discussed. PMID:27242792

  13. Strategies for Monitoring Outcomes in HIV-Exposed Uninfected Children in the United Kingdom.

    PubMed

    Thorne, Claire; Tookey, Pat

    2016-01-01

    Surveillance of pregnancies in women living with HIV is carried out on a national basis in the United Kingdom (UK) through the National Study of HIV in Pregnancy and Childhood. There are currently around 1100-1200 HIV-exposed uninfected (HEU) infants born every year in the UK, where vertical transmission of HIV now occurs in fewer than 5 in every 1000 pregnancies. By the end of 2014, there was a cumulative total of more than 15,000 HEU children with any combination antiretroviral therapy (cART) exposure and more than 5000 with cART exposure from conception in the UK. HEU infants are increasingly being exposed to newer antiretroviral drugs for which less is known regarding both short- and long-term safety. In this commentary, we describe the approaches that have been taken to explore health outcomes in HEU children born in the UK. This includes the Children exposed to AntiRetroviral Therapy (CHART) Study, which was a consented follow-up study carried out in 2002-2005 of HEU children born in 1996-2004. The CHART Study showed that 4% of HEU children enrolled had a major health or development problem in early childhood; this was within expected UK norms, but the study was limited by small numbers and short-term follow-up. However, the problems with recruitment and retention that were encountered within the CHART Study demonstrated that comprehensive, clinic-based follow-up was not a feasible approach for long-term assessment of HEU children in the UK. We describe an alternative approach developed to monitor some aspects of their long-term health, involving the "flagging" of HEU infants for death and cancer registration with the UK Office for National Statistics. Some of the ethical concerns regarding investigation of long-term outcomes of in utero and perinatal exposure to antiretrovirals, including those relating to consent and confidentiality, are also discussed. PMID:27242792

  14. Strategies for Monitoring Outcomes in HIV-Exposed Uninfected Children in the United Kingdom.

    PubMed

    Thorne, Claire; Tookey, Pat

    2016-01-01

    Surveillance of pregnancies in women living with HIV is carried out on a national basis in the United Kingdom (UK) through the National Study of HIV in Pregnancy and Childhood. There are currently around 1100-1200 HIV-exposed uninfected (HEU) infants born every year in the UK, where vertical transmission of HIV now occurs in fewer than 5 in every 1000 pregnancies. By the end of 2014, there was a cumulative total of more than 15,000 HEU children with any combination antiretroviral therapy (cART) exposure and more than 5000 with cART exposure from conception in the UK. HEU infants are increasingly being exposed to newer antiretroviral drugs for which less is known regarding both short- and long-term safety. In this commentary, we describe the approaches that have been taken to explore health outcomes in HEU children born in the UK. This includes the Children exposed to AntiRetroviral Therapy (CHART) Study, which was a consented follow-up study carried out in 2002-2005 of HEU children born in 1996-2004. The CHART Study showed that 4% of HEU children enrolled had a major health or development problem in early childhood; this was within expected UK norms, but the study was limited by small numbers and short-term follow-up. However, the problems with recruitment and retention that were encountered within the CHART Study demonstrated that comprehensive, clinic-based follow-up was not a feasible approach for long-term assessment of HEU children in the UK. We describe an alternative approach developed to monitor some aspects of their long-term health, involving the "flagging" of HEU infants for death and cancer registration with the UK Office for National Statistics. Some of the ethical concerns regarding investigation of long-term outcomes of in utero and perinatal exposure to antiretrovirals, including those relating to consent and confidentiality, are also discussed.

  15. Determinants of default to fully completion of immunization among children aged 12 to 23 months in south Ethiopia: unmatched case-control study

    PubMed Central

    Asfaw, Abiyot Getachew; Koye, Digsu Negese; Demssie, Amsalu Feleke; Zeleke, Ejigu Gebeye; Gelaw, Yalemzewod Assefa

    2016-01-01

    Introduction Immunization is a cost effective interventions of vaccine preventable disease. There is still, 2.5 million children die by vaccine preventable disease every year in developing countries. In Ethiopia, default to fully completion of child immunization is high and determinants of default to completions are not explored well in the study setting. The aim of the study was to identify determinants of default to fully completion of immunization among children between ages 12 to 23 months in Sodo Zurea District, Southern Ethiopia. Methods Community based unmatched case-control study was conducted. Census was done to identify cases and controls before the actual data collection. A total of 344 samples (172 cases and 172 controls) were selected by simple random sampling technique. Cases were children in the age group of 12 to 23 months old who missed at least one dose from the recommended schedule. Bivariable and multivariable binary logistic regression was used to identify the determinant factors. Odds ratio, 95%CI and p - value less than 0.05 was used to measure the presence and strength of the association. Results Mothers of infants who are unable to read and write (AOR=8.9; 95%CI: 2.4, 33.9) and attended primary school (AOR=4.1; 95% CI:1.4-15.8), mothers who had no postnatal care follow up (AOR=0.4; 95%CI: 0.3, 0.7), good maternal knowledge towards immunization (AOR= 0.5; 95% CI: 0.3, 0.8) and maternal favorable perception towards uses of health institution for maternal and child care (AOR= 0.2; 95% CI: 0.1, 0.6) were significant determinant factors to default to fully completion of immunization. Conclusion Working on maternal education, postnatal care follow up, promoting maternal knowledge and perception about child immunization are recommended measures to mitigate defaults to complete immunization. PMID:27222689

  16. Concordant or discordant results by the tuberculin skin test and the quantiFERON-TB test in children reflect immune biomarker profiles.

    PubMed

    Dhanasekaran, S; Jenum, S; Stavrum, R; Ritz, C; Kenneth, J; Vaz, M; Doherty, T M; Grewal, H M S

    2014-01-01

    The tuberculin skin test (TST) and QuantiFERON-TB-Gold-In-tube (QFTGIT) are adjunctive tests used in the diagnosis of pediatric tuberculosis (TB). Neither test can rule out TB; however, a positive test usually triggers preventive treatment in TB contacts aged <5 years. TST and QFTGIT can give divergent results and it is unclear how discordant results should be interpreted in terms of TB risk and preventive treatment. To understand the immune processes underlying concordant or discordant TST and QFTGIT results, we analyzed immune responses in children from Palamaner Taluk in India (a TB-endemic region with routine neonatal BCG vaccination) who were referred to a TB case verification ward on suspicion of TB. Two hundred and ten children aged <3 years were classified according to their TST and QFTGIT results, and their immune responses analyzed by dual-colour-Reverse-Transcriptase-Multiple-Ligation-dependent-Probe-Amplification, using a panel of 45 genes and a 10-plex antigen-specific enzyme-linked immunosorbent assay. We show that immune biomarkers FPR1, TNFRSF1A and interferon (IFN)-γ are upregulated (all P<0.05) in concordant test-positive children, whereas BPI is downregulated (P<0.05). In contrast, SEC14L1 (P=0.034) and Interferon gamma-induced protein 10 (IP-10) (P=0.001) are differentially expressed between the TST+QFTGIT- /TST-QFTGIT+ groups. Known TB exposure was more frequent in concordant positive children and results were consistent with elevated expression of genes associated with inflammatory responses. Children with discordant test results displayed a mixed profile with activation of both pro- and anti-inflammatory markers. TST and/or QFTGIT positivity appears to reflect distinct but overlapping aspects of host immunity.

  17. Strong Hepatitis C Virus (HCV)–specific Cell-mediated Immune Responses in the Absence of Viremia or Antibodies Among Uninfected Siblings of HCV Chronically Infected Children

    PubMed Central

    El-Karaksy, Hanaa; Shata, Mohamed T.; Sobhy, Maha; Helmy, Heba; El-Naghi, Suzan; Galal, Gehan; Ali, Zainab Z.; Esmat, Gamal; Abdelwahab, Sayed F.; Strickland, G. Thomas; El-Kamary, Samer S.

    2011-01-01

    Background. Cell-mediated immune (CMI) responses to hepatitis C virus (HCV) antigens in adults without seroconversion or viremia are biomarkers for prior transient infection. We investigated HCV-specific CMI responses in seronegative children living with HCV-infected siblings. Methods. Children 3–18 years of age living with HCV-infected siblings were screened for HCV antibodies and HCV RNA. Peripheral blood mononuclear cells (PBMCs) were evaluated for HCV-specific CMI responses by interferon γ (IFN-γ) enzyme-linked immunospot assay using 3 recombinant HCV protein antigens. Flow cytometry phenotypically characterized IFN-γ-secreting cells. Results. Forty-five seronegative children and 5 seropositive viremic siblings had functionally viable PBMCs. Among the 45 seronegative siblings, 15 (33.3%) had positive HCV-specific IFN-γ responses, and subsequent RNA testing revealed that 3 were viremic. Compared with the 5 seropositive viremic children, the median number of HCV-specific spot-forming units was significantly higher in the 12 seronegative aviremic children (P = .002) and in the 3 seronegative viremic children (P = .025). Flow cytometric analysis revealed that IFN-γ was synthesized mainly by CD4+ T cells. Conclusion. Strong HCV-specific CD4+ T cell responses were detectable in higher frequency among seronegative, aviremic children compared with persistently infected siblings. Further studies are needed to determine whether these immune responses are protective against HCV infection. PMID:21257736

  18. The influence of parent-infant cosleeping, nursing, and childcare on cortisol and SIgA immunity in a sample of British children.

    PubMed

    Waynforth, David

    2007-09-01

    Substantial variation in childcare arrangements exists both within and between populations. Research has suggested negative stress-related outcomes for children who regularly attend daycare facilities. In the present study, 122 cortisol and 94 secretory immunoglobulin A (SIgA) samples from 32 British children aged between 3 and 8 were analyzed using multilevel modeling to assess effects of daycare attendance and other childcare-related variables on children's stress and SIgA immune function. Parents' reports of children's aggression and family discord within 2 hr of saliva collection were associated with elevated cortisol levels in children. With these acute stressors statistically controlled, retrospective data on parent-child cosleeping showed that children who had coslept in their parent(s) room had lower cortisol levels, as did children who had attended less daycare in the first 4 years of life. The parenting-related variables did not predict SIgA immunity. The results are discussed in the context of theories of parenting strategies. PMID:17680611

  19. Subnormal and waning immunity to tetanus toxoid in previously vaccinated HIV-infected children and response to booster doses of the vaccine.

    PubMed

    Choudhury, Shahana A; Matin, Fazle

    2013-12-01

    Little is known regarding waning immunity to tetanus toxoid (TT) in HIV-infected children and the need for booster doses before the recommended interval of 5-10 years. Anti-tetanus antibodies were assessed by ELISA in 24 HIV-infected and 24 control children. A protective level (>0.1 IU/ml) of TT antibodies was observed in 62% of HIV-infected children and in 100% of controls. HIV-infected children with five doses had a significantly (p=0.01) lower prevalence of protective immunity compared to controls. Follow-up anti-TT antibody levels in nine HIV-infected children declined from 1.27 to 0.26 IU/ml, but levels did not decline in the seven controls; five of the seven (71%) children with a non-protective level of antibodies responded with a level>0.16 IU/ml following one booster dose of the vaccine. HIV-infected children may need TT boosters before the recommended 5-10 years.

  20. Adolescent immunization.

    PubMed

    Handal, G A

    2000-06-01

    The dramatic improvements achieved in the control of vaccine-preventable diseases in children have only been shared partially by adolescents and young adults, as today several million adolescents are not receiving the full complement of vaccines recommended by the Advisory Committee on Immunization Practices (ACIP). This article discusses the reasons for this problem and the tools to bridge this gap. In particular, medical societies and the Centers for Disease Control and Prevention (CDC) recommend a close assessment of the adolescentís immunization status between 11 and 12 years of age, inclusion of school immunization, and providing missing immunizations at any opportunity. The article also addresses other vaccines recommended for groups of adolescents with special needs, reporting information, and provides an update on the vaccines of the future.

  1. Biological monitoring of pesticide exposures among applicators and their children in Nicaragua.

    PubMed

    Rodríguez, Teresa; Younglove, Lisa; Lu, Chensheng; Funez, Aura; Weppner, Sarah; Barr, Dana B; Fenske, Richard A

    2006-01-01

    Exposures were assessed for seven small-scale farmers using chlorpyrifos on corn and ten banana plantation employees applying diazinon, and for one child of each worker. Metabolites (TCPYand IMPY) were measured in urine before and after applications. TCPY concentrations peaked at 27 and 8.5 hours post-application for applicators and children, respectively (geometric means, 26 and 3.0 microg/L). Proximity to spraying and spray mixture preparation in homes were important exposure factors. IMPY concentrations differed substantially across workers at two plantations (geometric means, 1.3 and 168 mirog/L); however, their children had little or no diazinon exposure. These workers and children were also exposed to chlorpyrifos, most likely through contact with chlorpyrifos-impregnated bags used in banana production. Several recommendations are offered: (1) monitor children's activities during applications; (2) do not store or prepare pesticides in homes; (3) institute sound occupational hygiene practices at banana plantations; (4) dispose of plastic insecticide bags properly at the worksite. PMID:17168218

  2. Evaluation of immune responses to an oral typhoid vaccine, Ty21a, in children from 2 to 5 years of age in Bangladesh.

    PubMed

    Bhuiyan, Taufiqur R; Choudhury, Feroza K; Khanam, Farhana; Saha, Amit; Sayeed, Md Abu; Salma, Umme; Lundgren, Anna; Sack, David A; Svennerholm, Ann-Mari; Qadri, Firdausi

    2014-02-19

    Young children are very susceptible to typhoid fever, emphasizing the need for vaccination in under five age groups. The parenteral Vi polysaccharide vaccine is not immunogenic in children under 2 years and the oral Ty21a vaccine (Vivotif) available in capsular formulation is only recommended for those over 5 years. We studied immune responses to a liquid formulation of Ty21a in children 2-5 years of age. Since children in developing countries are in general hypo responsive to oral vaccines, the study was designed to determine if anti-helminthic treatment prior to vaccination, improves responses. In a pilot study in 20 children aged 4-5 years, the immune responses in plasma and in antibody in lymphocyte secretions (ALS) to the enteric coated capsule formulation of Ty21a was found to be comparable to a liquid formulation (P>0.05). Based on this, children (n=252) aged ≥ 2-<3 years and ≥3-<5 years were randomized to receive a liquid formulation of Ty21a with and without previous anti-helminthic treatment. The vaccine was well tolerated with only a few mild adverse events recorded in <1% of the children. De-worming did not improve immune responses and both age groups developed 32-71% IgA, IgG, and IgM responses in plasma and 63-86% IgA responses in ALS and stool specimens to a membrane preparation (MP) of Ty21a. An early MP specific proliferative T cell response was also seen. We recommend that safety and efficacy studies with a liquid formulation of the vaccine are carried out in children under five, including those less than two years of age to determine if Ty21a is protective in these age groups and applicable as a public health tool for controlling typhoid fever in high prevalence areas of typhoid fever including Bangladesh.

  3. Evaluation of immune responses to an oral typhoid vaccine, Ty21a, in children from 2 to 5 years of age in Bangladesh.

    PubMed

    Bhuiyan, Taufiqur R; Choudhury, Feroza K; Khanam, Farhana; Saha, Amit; Sayeed, Md Abu; Salma, Umme; Lundgren, Anna; Sack, David A; Svennerholm, Ann-Mari; Qadri, Firdausi

    2014-02-19

    Young children are very susceptible to typhoid fever, emphasizing the need for vaccination in under five age groups. The parenteral Vi polysaccharide vaccine is not immunogenic in children under 2 years and the oral Ty21a vaccine (Vivotif) available in capsular formulation is only recommended for those over 5 years. We studied immune responses to a liquid formulation of Ty21a in children 2-5 years of age. Since children in developing countries are in general hypo responsive to oral vaccines, the study was designed to determine if anti-helminthic treatment prior to vaccination, improves responses. In a pilot study in 20 children aged 4-5 years, the immune responses in plasma and in antibody in lymphocyte secretions (ALS) to the enteric coated capsule formulation of Ty21a was found to be comparable to a liquid formulation (P>0.05). Based on this, children (n=252) aged ≥ 2-<3 years and ≥3-<5 years were randomized to receive a liquid formulation of Ty21a with and without previous anti-helminthic treatment. The vaccine was well tolerated with only a few mild adverse events recorded in <1% of the children. De-worming did not improve immune responses and both age groups developed 32-71% IgA, IgG, and IgM responses in plasma and 63-86% IgA responses in ALS and stool specimens to a membrane preparation (MP) of Ty21a. An early MP specific proliferative T cell response was also seen. We recommend that safety and efficacy studies with a liquid formulation of the vaccine are carried out in children under five, including those less than two years of age to determine if Ty21a is protective in these age groups and applicable as a public health tool for controlling typhoid fever in high prevalence areas of typhoid fever including Bangladesh. PMID:24440210

  4. Effectiveness of a smart phone app on improving immunization of children in rural Sichuan Province, China: study protocol for a paired cluster randomized controlled trial

    PubMed Central

    2014-01-01

    Background Although good progress has been achieved in expanding immunization of children in China, disparities exist across different provinces. Information gaps both from the service supply and demand sides hinder timely vaccination of children in rural areas. The rapid development of mobile health technology (mHealth) provides unprecedented opportunities for improving health services and reaching underserved populations. However, there is a lack of literature that rigorously evaluates the impact of mHealth interventions on immunization coverage as well as the usability and feasibility of smart phone applications (apps). This study aims to assess the effectiveness of a smart phone-based app (Expanded Program on Immunization app, or EPI app) on improving the coverage of children’s immunization. Methods/Design This cluster randomized trial will take place in Xuanhan County, Sichuan Province, China. Functionalities of the app include the following: to make appointments automatically, record and update children’s immunization information, generate a list of children who missed their vaccination appointments, and send health education information to village doctors. After pairing, 36 villages will be randomly allocated to the intervention arm (n = 18) and control arm (n = 18). The village doctors in the intervention arm will use the app while the village doctors in the control arm will record and manage immunization in the usual way in their catchment areas. A household survey will be used at baseline and at endline (8 months of implementation). The primary outcome is full-dose coverage and the secondary outcome is immunization coverage of the five vaccines that are included in the national Expanded Program on Immunization program as well as Hib vaccine, Rotavirus vaccine and Pneumococcal conjugate vaccine. Multidimensional evaluation of the app will also be conducted to assess usability and feasibility. Discussion This study is the first to evaluate the

  5. Integrated Immune Experiment

    NASA Technical Reports Server (NTRS)

    Crucian, Brian

    2009-01-01

    This viewgraph presentation reviews NASA's Integrated Immune Experiment. The objectives include: 1) Address significant lack of data regarding immune status during flight; 2) Replace several recent immune studies with one comprehensive study that will include in-flight sampling; 3) Determine the in-flight status of immunity, physiological stress, viral immunity/reactivation; 4) Determine the clinical risk related to immune dysregulation for exploration class spaceflight; and 5) Determine the appropriate monitoring strategy for spaceflight-associated immune dysfunction, that could be used for the evaluation of countermeasures.

  6. Immune response

    MedlinePlus

    Innate immunity; Humoral immunity; Cellular immunity; Immunity; Inflammatory response; Acquired (adaptive) immunity ... and usually does not react against them. INNATE IMMUNITY Innate, or nonspecific, immunity is the defense system ...

  7. Plasmodium vivax Reticulocyte Binding Proteins Are Key Targets of Naturally Acquired Immunity in Young Papua New Guinean Children

    PubMed Central

    França, Camila T.; He, Wen-Qiang; Gruszczyk, Jakub; Lim, Nicholas T. Y.; Lin, Enmoore; Kiniboro, Benson; Siba, Peter M.; Tham, Wai-Hong

    2016-01-01

    Background Major gaps in our understanding of Plasmodium vivax biology and the acquisition of immunity to this parasite hinder vaccine development. P. vivax merozoites exclusively invade reticulocytes, making parasite proteins that mediate reticulocyte binding and/or invasion potential key vaccine or drug targets. While protein interactions that mediate invasion are still poorly understood, the P. vivax Reticulocyte-Binding Protein family (PvRBP) is thought to be involved in P. vivax restricted host-cell selectivity. Methodology/Principal findings We assessed the binding specificity of five members of the PvRBP family (PvRBP1a, PvRBP1b, PvRBP2a, PvRBP2b, PvRBP2-P2 and a non-binding fragment of PvRBP2c) to normocytes or reticulocytes. PvRBP2b was identified as the only reticulocyte-specific binder (P<0.001), whereas the others preferentially bound to normocytes (PvRBP1a/b P≤0.034), or showed comparable binding to both (PvRBP2a/2-P2, P = 0.38). Furthermore, we measured levels of total and IgG subclasses 1, 2, 3 and 4 to the six PvRBPs in a cohort of young Papua New Guinean children, and assessed their relationship with prospective risk of P. vivax malaria. Children had substantial, highly correlated (rho = 0.49–0.82, P<0.001) antibody levels to all six PvRBPs, with dominant IgG1 and IgG3 subclasses. Both total IgG (Incidence Rate Ratio [IRR] 0.63–0.73, P = 0.008–0.041) and IgG1 (IRR 0.56–0.69, P = 0.001–0.035) to PvRBP2b and PvRBP1a were strongly associated with reduced risk of vivax-malaria, independently of age and exposure. Conclusion/Significance These results demonstrate a diversity of erythrocyte-binding phenotypes of PvRBPs, indicating binding to both reticulocyte-specific and normocyte-specific ligands. Our findings provide further insights into the naturally acquired immunity to P. vivax and highlight the importance of PvRBP proteins as targets of naturally acquired humoral immunity. In-depth studies of the role of PvRBPs in P. vivax invasion and

  8. Heterogeneity in the validity of administrative-based estimates of immunization coverage across health districts in Burkina Faso: implications for measurement, monitoring and planning

    PubMed Central

    Haddad, Slim; Bicaba, Abel; Feletto, Marta; Fournier, Pierre; Zunzunegui, Maria Victoria

    2010-01-01

    Background Data aggregation in national information systems begins at the district level. Decentralization has given districts a lead role in health planning and management, therefore validity of administrative-based estimates at that level is important to improve the performance of immunization information systems. Objective To assess the validity of administrative-based immunization estimates and their usability for planning and monitoring activities at district level. Methods DTP3 and measles coverage rates from administrative sources were compared with estimates from the EPI cluster survey (ECS) and Demographic and Health Survey (DHS) carried out in 2003 at national and regional levels. ECS estimates were compared with administrative rates across the 52 districts, which were classified into three groups: those where administrative rates were underestimating, overestimating or concordant with ECS estimates (differences within 95% CI of ECS rate). Results National rates provided by administrative data and ECS are similar (74% and 71% for DTP3 and 68% and 66% for measles, respectively); DHS estimates are much lower. Regional administrative data show large discrepancies when compared against ECS and DHS data (differences sometimes reaching 30 percentage points). At district level, geographical area is correlated with over- or underestimation by administrative sources, which overestimate DTP3 and measles coverage in remote areas. Underestimation is observed in districts near urban and highly populated centres. Over- and underestimation are independent of the antigen under consideration. Conclusions Variability in immunization coverage across districts highlights the limitations of using nationally aggregated indicators. If district data are to be used in monitoring and planning immunization programmes as intended by decentralization, heterogeneity in their validity must be reduced. The authors recommend: (1) strengthening administrative data systems; (2

  9. Effect of a Growing-up Milk Containing Synbiotics on Immune Function and Growth in Children: A Cluster Randomized, Multicenter, Double-blind, Placebo Controlled Study

    PubMed Central

    Xuan, Ninh Nguyen; Wang, Dantong; Grathwohl, Dominik; Lan, Phuong Nguyen Thi; Kim, Hoa Vu Thi; Goyer, Amélie; Benyacoub, Jalil

    2013-01-01

    Common infectious diseases, such as diarrhea, are still the major cause of death in children under 5-years-old, particularly in developing countries. It is known that there is a close relationship between nutrition and immune function. To evaluate the effect of a growing-up milk containing synbiotics on immune function and child growth, we conducted a cluster randomized, multicenter, double-blind, placebo controlled clinical trial in children between 18 and 36 months of age in Vietnam. Eligible children from eight and seven kindergartens were randomly assigned to receive test and isocaloric/ isoproteic control milk, respectively, for 5 months. We found that the blood immunoglobulin A (IgA) level and growth parameters were increased in the test group. Compared to the control group, there was also a trend of decreased vitamin A deficiency and fewer adverse events in the test group. These data suggest that a growing-up milk containing synbiotics may be useful in supporting immune function and promoting growth in children. PMID:24353451

  10. Symptom monitoring and dependent care during cancer treatment in children: pilot study.

    PubMed

    Williams, Phoebe D; Schmideskamp, Jami; Ridder, E Lavonne; Williams, Arthur R

    2006-01-01

    Symptom monitoring by parents/caregivers of children with cancer and what the caregiver and child did to help alleviate symptoms during chemotherapy were studied. The Therapy-Related Symptom Checklist (TRSC) child version was administered to parents/caregivers of 11 children and adolescents (mean age, 10.4 years; SD, 6.1 years; range, 2-18 years; 45% were boys). The Karnofsky scale was completed by clinicians to rate the child's functional status. The TRSC child version and functional status scores were inversely related. All children experienced nausea; the most frequent symptoms reported were in TRSC subscales: fatigue, nausea, eating, fever, oropharynx, pain, and hair loss. Care strategies that helped were distraction, massage, mouth rinses, and vitamins; some reported that their child received medications for pain, nausea, and vomiting. Using complementary medicine categories, the care strategies were diet/nutrition/lifestyle change (eg, more high-fat, high-calorie foods; new foods; any food the child likes; and much sleep and rest); mind/body control (eg, play, video games, television, reading, activity puzzle, breathing exercises, relaxation methods, and prayer); manual healing method (massage and skin-to-skin contact); and biologic treatments (vitamins). The first 2 categories were the most used. Systematic assessment with a self-report checklist enables the provider to identify and prioritize (according to reported severity) those symptoms needing intervention.

  11. Blood pressure, hypertension, and ambulatory blood pressure monitoring in children and adolescents.

    PubMed

    Morgenstern, Bruce

    2002-02-01

    Fixed essential hypertension in children is uncommon. Confusion surrounding the definitions and tools used in measuring blood pressure (BP), and the variable capacity to apply the definitions despite the device used explains this in part. In children, hypertension is defined statistically, based on a large normative population that is ethnically diverse. The standards were developed from the first BP measurement obtained in large studies, and the measurements were obtained using standard auscultatory sphygmomanometry. Technologic advances have seen the widespread introduction of oscillometric devices, which determine BP in a different fashion from auscultation, and the two values are not identical. In fact, as oscillometric devices use proprietary algorithms to calculate the BP, results are not readily interchangeable. Ambulatory BP devices have been added to this mix and offer unique opportunities for accurate diagnosis, and more effective therapies. Most ambulatory BP devices have neither been validated for use in children, nor have passed the validation process. A consensus document may be needed to optimize use and interpretation of data from ambulatory BP monitoring. PMID:11866234

  12. Community Immunity (Herd Immunity)

    MedlinePlus

    ... Content Marketing Share this: Main Content Area ​Community Immunity ("Herd" Immunity) Vaccines can prevent outbreaks of disease and save ... disease is contained. This is known as "community immunity." In the illustration below, the top box depicts ...

  13. Two models for changes of EV71 immunity in infants and young children

    PubMed Central

    Tu, Xiaoming; Wang, Yongmei; Zhu, Fengcai; Chen, Feng

    2015-01-01

    Human enterovirus 71 (EV71) has been associated with outbreaks of hand-foot-and-mouth disease (HFMD) in China. Susceptibility to EV71 is associated with age, but few studies have been accomplished to measure such a relationship. A better understanding of the connection between susceptibility and age is necessary to develop strategies for control of HFMD. In 2010, a survey of an epidemic of EV71 was conducted in a northern city of Jiangsu Province in China. Samples were tested serologically to identify the EV71 neutralizing antibody. Two different mathematical models have now been employed to describe how this antibody varied with age, and parameters in the model were estimated from survey data. Both models depicted the variations in EV71-neutralizing antibody. Seroprevalence was high for neonates but decreased to near zero at 5 months of age. Subsequently, the EV71 antibody levels increased and then remained stable after about 36 months. For models 1 and 2, values for the coefficient of determination (R2) were 0.9458 and 0.9576, and values for root mean square error (RMSE) were 0.0755 and 0.0752, respectively. Model 2, formulated from the characteristics of development of the immune system, was more reliable than model 1, formulated from survey data, because the impact of the survey on the structure of the model was removed. Moreover, model 2 provided the possibility to define the parameters in a biological sense. PMID:25906390

  14. Two models for changes of EV71 immunity in infants and young children.

    PubMed

    Tu, Xiaoming; Wang, Yongmei; Zhu, Fengcai; Chen, Feng

    2015-01-01

    Human enterovirus 71 (EV71) has been associated with outbreaks of hand-foot-and-mouth disease (HFMD) in China. Susceptibility to EV71 is associated with age, but few studies have been accomplished to measure such a relationship. A better understanding of the connection between susceptibility and age is necessary to develop strategies for control of HFMD. In 2010, a survey of an epidemic of EV71 was conducted in a northern city of Jiangsu Province in China. Samples were tested serologically to identify the EV71 neutralizing antibody. Two different mathematical models have now been employed to describe how this antibody varied with age, and parameters in the model were estimated from survey data. Both models depicted the variations in EV71-neutralizing antibody. Seroprevalence was high for neonates but decreased to near zero at 5 months of age. Subsequently, the EV71 antibody levels increased and then remained stable after about 36 months. For models 1 and 2, values for the coefficient of determination (R(2)) were 0.9458 and 0.9576, and values for root mean square error (RMSE) were 0.0755 and 0.0752, respectively. Model 2, formulated from the characteristics of development of the immune system, was more reliable than model 1, formulated from survey data, because the impact of the survey on the structure of the model was removed. Moreover, model 2 provided the possibility to define the parameters in a biological sense.

  15. National Variability in Intracranial Pressure Monitoring and Craniotomy for Children With Moderate to Severe Traumatic Brain Injury

    PubMed Central

    Van Cleve, William; Kernic, Mary A.; Ellenbogen, Richard G.; Wang, Jin; Zatzick, Douglas F.; Bell, Michael J.; Wainwright, Mark S.; Groner, Jonathan I.; Mink, Richard B.; Giza, Christopher C.; Boyle, Linda Ng; Mitchell, Pamela H.; Rivara, Frederick P.; Vavilala, Monica S.

    2014-01-01

    BACKGROUND Traumatic brain injury (TBI) is a significant cause of mortality and disability in children. Intracranial pressure monitoring (ICPM) and craniotomy/craniectomy (CRANI) may affect outcomes. Sources of variability in the use of these interventions remain incompletely understood. OBJECTIVE To analyze sources of variability in the use of ICPM and CRANI. METHODS Retrospective cross-sectional study of patients with moderate/severe pediatric TBI with the use of data submitted to the American College of Surgeons National Trauma Databank. RESULTS We analyzed data from 7140 children at 156 US hospitals during 7 continuous years. Of the children, 27.4% had ICPM, whereas 11.7% had a CRANI. Infants had lower rates of ICPM and CRANI than older children. A lower rate of ICPM was observed among children hospitalized at combined pediatric/adult trauma centers than among children treated at adult-only trauma centers (relative risk = 0.80; 95% confidence interval 0.66-0.97). For ICPM and CRANI, 18.5% and 11.6%, respectively, of residual model variance was explained by between-hospital variation in care delivery, but almost no correlation was observed between within-hospital tendency toward performing these procedures. CONCLUSION Infants received less ICPM than older children, and children hospitalized at pediatric trauma centers received less ICPM than children at adult-only trauma centers. In addition, significant between-hospital variability existed in the delivery of ICPM and CRANI to children with moderate-severe TBI. PMID:23863766

  16. [The influence of immunocorrection on the state of the anti-endotoxin immunity in children with systemic inflammatory response syndrome and gram-negative infection].

    PubMed

    Pritulo, L F

    2009-05-01

    There were examined 34 children, in whom systemic inflammatory answer syndrome (SIAS) was diagnosed. In 16 children pathogenetically substantiated immunocorrection, using donor's plasma, enhanced by antibodies (AB) to endotoxin (ET), was conducted; in 18 children--the conventional complex therapy. While presence of gram-negative infection in children, suffering SIAS, the activation o the inborn nonspeciphic factors (LBP, sCD14) and speciphic low-affinic AB (anti-ET-IgM, anti-ET-IgA) the antiendotoxin immunity in combination with selective immunodeficiency of anti-ET-IgG were revealed. While the donor's plasm application, enhanced by AB to ET, the titer of anti-ET-IgG, anti-ET-IgM, anti-ET-IgA and LBP have had achieved normal values and did not differ from such in the control on the 14th day.

  17. Comparison of three generations of ActiGraph™ activity monitors in children and adolescents

    PubMed Central

    ROBUSTO, KRISTI M.; TROST, STEWART G.

    2012-01-01

    This study evaluated agreement among three generations of ActiGraph™ accelerometers in children and adolescents. Participants (N=29, mean age = 14.2 ± 3.0 y) completed two laboratory-based activity sessions, each lasting 60 minutes. During each session, participants concurrently wore three different models of the ActiGraph accelerometers (GT1M, GT3X, GT3X+). Agreement among the three models for vertical axis (VA) counts, vector magnitude (VM) counts, and time spent in MVPA was evaluated by calculating ICCs and Bland-Altman plots. The ICCs for total VA counts, total VM counts, and estimated MVPA were 0.994 (95% C.I. = 0.989 – 0.996), 0.981 (95% C.I.= 0.969 – 0.989), and 0.996 (95% C.I.= 0.989 – 0.998), respectively. Inter-monitor differences for total VA and VM counts ranged from 0.3% to 1.5%, while inter-monitor differences for estimated MVPA were equal to or close to zero. On the basis of these findings, we conclude that there is strong agreement between the GT1M, GT3X and GT3X+ activity monitors, thus making it acceptable for researchers and practitioners to use different ActiGraph™ models within a given study. PMID:22857599

  18. Air pollution and children: neural and tight junction antibodies and combustion metals, the role of barrier breakdown and brain immunity in neurodegeneration.

    PubMed

    Calderón-Garcidueñas, Lilian; Vojdani, Aristo; Blaurock-Busch, Eleonore; Busch, Yvette; Friedle, Albrecht; Franco-Lira, Maricela; Sarathi-Mukherjee, Partha; Martínez-Aguirre, Xavier; Park, Su-Bin; Torres-Jardón, Ricardo; D'Angiulli, Amedeo

    2015-01-01

    Millions of children are exposed to concentrations of air pollutants, including fine particulate matter (PM2.5), above safety standards. In the Mexico City Metropolitan Area (MCMA) megacity, children show an early brain imbalance in oxidative stress, inflammation, innate and adaptive immune response-associated genes, and blood-brain barrier breakdown. We investigated serum and cerebrospinal fluid (CSF) antibodies to neural and tight junction proteins and environmental pollutants in 139 children ages 11.91 ± 4.2 y with high versus low air pollution exposures. We also measured metals in serum and CSF. MCMA children showed significantly higher serum actin IgG, occludin/zonulin 1 IgA, IgG, myelin oligodendrocyte glycoprotein IgG and IgM (p < 0.01), myelin basic protein IgA and IgG, S-100 IgG and IgM, and cerebellar IgG (p < 0.001). Serum IgG antibodies to formaldehyde, benzene, and bisphenol A, and concentrations of Ni and Cd were significantly higher in exposed children (p < 0.001). CSF MBP antibodies and nickel concentrations were higher in MCMA children (p = 0.03). Air pollution exposure damages epithelial and endothelial barriers and is a robust trigger of tight junction and neural antibodies. Cryptic 'self' tight junction antigens can trigger an autoimmune response potentially contributing to the neuroinflammatory and Alzheimer and Parkinson's pathology hallmarks present in megacity children. The major factor determining the impact of neural antibodies is the integrity of the blood-brain barrier. Defining the air pollution linkage of the brain/immune system interactions and damage to physical and immunological barriers with short and long term neural detrimental effects to children's brains ought to be of pressing importance for public health. PMID:25147109

  19. The Effect of Daily Co-Trimoxazole Prophylaxis on Natural Development of Antibody-Mediated Immunity against P. falciparum Malaria Infection in HIV-Exposed Uninfected Malawian Children

    PubMed Central

    Longwe, Herbert; Jambo, Kondwani C.; Phiri, Kamija S.; Mbeye, Nyanyiwe; Gondwe, Thandile; Hall, Tom; Tetteh, Kevin K. A.

    2015-01-01

    Background and Objectives Co-trimoxazole prophylaxis, currently recommended in HIV-exposed, uninfected (HEU) children as protection against opportunistic infections, also has some anti-malarial efficacy. We determined whether daily co-trimoxazole prophylaxis affects the natural development of antibody-mediated immunity to blood-stage Plasmodium falciparum malaria infection. Methods Using an enzyme-linked immunosorbent assay, we measured antibodies to 8Plasmodium falciparum antigens (AMA-1, MSP-119, MSP-3, PfSE, EBA-175RII, GLURP R0, GLURP R2 and CSP) in serum samples from 33 HEU children and 31 HIV-unexposed, uninfected (HUU) children, collected at 6, 12 and 18 months of age. Results Compared to HIV-uninfected children, HEU children had significantly lower levels of specific IgG against AMA-1 at 6 months (p = 0.001), MSP-119 at 12 months (p = 0.041) and PfSE at 6 months (p = 0.038), 12 months (p = 0.0012) and 18 months (p = 0.0097). No differences in the IgG antibody responses against the rest of the antigens were observed between the two groups at all time points. The breadth of specificity of IgG response was reduced in HEU children compared to HUU children during the follow up period. Conclusions Co-trimoxazole prophylaxis seems to reduce IgG antibody responses to P. falciparum blood stage antigens, which could be as a result of a reduction in exposure of those children under this regime. Although antibody responses were regarded as markers of exposure in this study, further studies are required to establish whether these responses are correlated in any way to clinical immunity to malaria. PMID:25807475

  20. Air pollution and children: neural and tight junction antibodies and combustion metals, the role of barrier breakdown and brain immunity in neurodegeneration.

    PubMed

    Calderón-Garcidueñas, Lilian; Vojdani, Aristo; Blaurock-Busch, Eleonore; Busch, Yvette; Friedle, Albrecht; Franco-Lira, Maricela; Sarathi-Mukherjee, Partha; Martínez-Aguirre, Xavier; Park, Su-Bin; Torres-Jardón, Ricardo; D'Angiulli, Amedeo

    2015-01-01

    Millions of children are exposed to concentrations of air pollutants, including fine particulate matter (PM2.5), above safety standards. In the Mexico City Metropolitan Area (MCMA) megacity, children show an early brain imbalance in oxidative stress, inflammation, innate and adaptive immune response-associated genes, and blood-brain barrier breakdown. We investigated serum and cerebrospinal fluid (CSF) antibodies to neural and tight junction proteins and environmental pollutants in 139 children ages 11.91 ± 4.2 y with high versus low air pollution exposures. We also measured metals in serum and CSF. MCMA children showed significantly higher serum actin IgG, occludin/zonulin 1 IgA, IgG, myelin oligodendrocyte glycoprotein IgG and IgM (p < 0.01), myelin basic protein IgA and IgG, S-100 IgG and IgM, and cerebellar IgG (p < 0.001). Serum IgG antibodies to formaldehyde, benzene, and bisphenol A, and concentrations of Ni and Cd were significantly higher in exposed children (p < 0.001). CSF MBP antibodies and nickel concentrations were higher in MCMA children (p = 0.03). Air pollution exposure damages epithelial and endothelial barriers and is a robust trigger of tight junction and neural antibodies. Cryptic 'self' tight junction antigens can trigger an autoimmune response potentially contributing to the neuroinflammatory and Alzheimer and Parkinson's pathology hallmarks present in megacity children. The major factor determining the impact of neural antibodies is the integrity of the blood-brain barrier. Defining the air pollution linkage of the brain/immune system interactions and damage to physical and immunological barriers with short and long term neural detrimental effects to children's brains ought to be of pressing importance for public health.

  1. The impact of cognitive control on children's goal monitoring in a time-based prospective memory task.

    PubMed

    Mahy, Caitlin E V; Voigt, Babett; Ballhausen, Nicola; Schnitzspahn, Katharina; Ellis, Judi; Kliegel, Matthias

    2015-01-01

    The present study investigated whether developmental changes in cognitive control may underlie improvements of time-based prospective memory. Five-, 7-, 9-, and 11-year-olds (N = 166) completed a driving simulation task (ongoing task) in which they had to refuel their vehicle at specific points in time (PM task). The availability of cognitive control resources was experimentally manipulated by imposing a secondary task that required divided attention. Children completed the driving simulation task both in a full-attention condition and a divided-attention condition where they had to carry out a secondary task. Results revealed that older children performed better than younger children on the ongoing task and PM task. Children performed worse on the ongoing and PM tasks in the divided-attention condition compared to the full-attention condition. With respect to time monitoring in the final interval prior to the PM target, divided attention interacted with age such that older children's time monitoring was more negatively affected by the secondary task compared to younger children. Results are discussed in terms of developmental shifts from reactive to proactive monitoring strategies.

  2. [Unexpectedly high proportion of preschool children immune to hepatitis A virus. Contact tracing investigation shows the need for vaccination prior to traveling abroad].

    PubMed

    Persson, Hanna; Nasta, Federico; Svensson, Ingrid; Widerström, Micael

    2014-12-02

    Hepatitis A (HAV) is a low incidence infectious disease in Sweden, and a majority of cases in this country are acquired abroad, although domestic cases are not uncommon in the day care setting. We investigated an outbreak of hepatitis A in two day care centres and found that a large proportion (23%) of the 113 unvaccinated preschool children were immune to HAV. This observation indicates that there may have been sub-clinical cases of HAV at the two centres. The results of our study underscore the importance of HAV vaccination in preschool children prior to travel to areas where this disease is common. The findings also highlight the need for up-to-date national seroepidemiological data on HAV immunity in different age groups in Sweden. Studies aimed at obtaining such information could also provide a basis for deciding whether targeted vaccination strategies against HAV are needed in the day care setting.

  3. Monitoring motor capacity changes of children during rehabilitation using body-worn sensors

    PubMed Central

    2013-01-01

    Background Rehabilitation services use outcome measures to track motor performance of their patients over time. State-of-the-art approaches use mainly patients’ feedback and experts’ observations for this purpose. We aim at continuously monitoring children in daily life and assessing normal activities to close the gap between movements done as instructed by caregivers and natural movements during daily life. To investigate the applicability of body-worn sensors for motor assessment in children, we investigated changes in movement capacity during defined motor tasks longitudinally. Methods We performed a longitudinal study over four weeks with 4 children (2 girls; 2 diagnosed with Cerebral Palsy and 2 with stroke, on average 10.5 years old) undergoing rehabilitation. Every week, the children performed 10 predefined motor tasks. Capacity in terms of quality and quantity was assessed by experts and movement was monitored using 10 ETH Orientation Sensors (ETHOS), a small and unobtrusive inertial measurement unit. Features such as smoothness of movement were calculated from the sensor data and a regression was used to estimate the capacity from the features and their relation to clinical data. Therefore, the target and features were normalized to range from 0 to 1. Results We achieved a mean RMS-error of 0.15 and a mean correlation value of 0.86 (p<0.05 for all tasks) between our regression estimate of motor task capacity and experts’ ratings across all tasks. We identified the most important features and were able to reduce the sensor setup from 10 to 3 sensors. We investigated features that provided a good estimate of the motor capacity independently of the task performed, e.g. smoothness of the movement. Conclusions We found that children’s task capacity can be assessed from wearable sensors and that some of the calculated features provide a good estimate of movement capacity over different tasks. This indicates the potential of using the sensors in daily

  4. Effects of immunizing school children with 2009 influenza A (H1N1) monovalent vaccine on absenteeism among students and teachers in Maine.

    PubMed

    Graitcer, Samuel B; Dube, Nancy L; Basurto-Davila, Ricardo; Smith, Peter F; Ferdinands, Jill; Thompson, Mark; Uzicanin, Amra; Gargiullo, Paul; Chaves, Sandra S; Robinson, Sara; Sears, Stephen; Tipton, Meredith; Monto, Arnold S; Mills, Dora; Shay, David K

    2012-07-01

    The overall and indirect effects of immunizing school children with influenza A (H1N1) 2009 pandemic virus vaccine prior to and during the peak of virus circulation were evaluated on student and teacher school absenteeism. We used records collected from late 2009 through early 2010 from schools in four Maine counties. Mixed logistic regression models were used to estimate the daily association between school-level immunization coverage and absenteeism by level of influenza activity, after adjusting for the proportion of students receiving reduced-cost lunches, student minority status, absences adjacent to weekends and Thanksgiving, rural school location, and the circulation of other respiratory viruses. Increasing student immunization coverage was associated with reduced absenteeism during periods of high influenza activity. For example, as immunization coverage during the peak week of pandemic virus circulation increased from 38% to 69% (the 10th and 90th percentiles of observed coverage, respectively), relative reductions in daily absenteeism among all students, unimmunized students, and teachers were 8.2% (95% confidence interval [CI]: 6.5, 9.9), 5.7% (95% CI: 4.2, 7.3), and 8.7% (95% CI: 1.3, 16), respectively. Increased vaccination coverage among school-aged Maine children had modest overall and indirect effects on student and teacher absenteeism, despite vaccination occurring just prior and during peak pandemic virus circulation.

  5. Failure to vaccinate children against measles during the second year of life. An analysis of immunization practices in two Tennessee county health departments.

    PubMed

    Guyer, B; Barid, S J; Hutcheson, R H; Strain, R S

    1976-01-01

    In many Tennessee counties, children under the care of health departments have low measles vaccination levels. An immunization survey and a health department record audit of 2-year-olds were undertaken in two counties to determine the reasons for this situation. The results indicated that faulty clinic procedures played a large part in the failure to vaccinate against measles. Nearly half of the unvaccinated 2-year-olds with health department records had been present in the health department clinic at the appropriate age for measles vaccination; the remainder had dropped out of the well-child program before their first birthday. Emphasis on tuberculin skin testing and delay in the administration of the basic series of DTP immunizations correlated with the failure to vaccinate against measles. For more than half of the children who attended the clinic after their first birthday, no reason was recorded for the failure to vaccinate them against measles. Improved clinic procedures could bring measles vaccination levels within the acceptable range. These procedures would include new methods for correcting immunization delinquency, simultaneous tuberculin skin testing and measles vaccination of children without a history of tuberculosis exposure, emphasis on vaccinating at-risk groups, and more convenient vaccination clinic hours.

  6. Bronchiolitis: Recommendations for diagnosis, monitoring and management of children one to 24 months of age

    PubMed Central

    Friedman, Jeremy N; Rieder, Michael J; Walton, Jennifer M

    2014-01-01

    Bronchiolitis is the most common reason for admission to hospital in the first year of life. There is tremendous variation in the clinical management of this condition across Canada and around the world, including significant use of unnecessary tests and ineffective therapies. This statement pertains to generally healthy children ≤2 years of age with bronchiolitis. The diagnosis of bronchiolitis is based primarily on the history of illness and physical examination findings. Laboratory investigations are generally unhelpful. Bronchiolitis is a self-limiting disease, usually managed with supportive care at home. Groups at high risk for severe disease are described and guidelines for admission to hospital are presented. Evidence for the efficacy of various therapies is discussed and recommendations are made for management. Monitoring requirements and discharge readiness from hospital are also discussed. PMID:25414585

  7. Single nucleotide polymorphisms/haplotypes associated with multiple rubella-specific immune response outcomes post-MMR immunization in healthy children.

    PubMed

    Ovsyannikova, Inna G; Salk, Hannah M; Larrabee, Beth R; Pankratz, V Shane; Poland, Gregory A

    2015-10-01

    The observed heterogeneity in rubella-specific immune response phenotypes post-MMR vaccination is thought to be explained, in part, by inter-individual genetic variation. In this study, single nucleotide polymorphisms (SNPs) and multiple haplotypes in several candidate genes were analyzed for associations with more than one rubella-specific immune response outcome, including secreted IFN-γ, secreted IL-6, and neutralizing antibody titers. Overall, we identified 23 SNPs in 10 different genes that were significantly associated with at least two rubella-specific immune responses. Of these SNPs, we detected eight in the PVRL3 gene, five in the PVRL1 gene, one in the TRIM22 gene, two in the IL10RB gene, two in the TLR4 gene, and five in other genes (PVR, ADAR, ZFP57, MX1, and BTN2A1/BTN3A3). The PVRL3 gene haplotype GACGGGGGCAGCAAAAAGAAGAGGAAAGAACAA was significantly associated with both higher IFN-γ secretion (t-statistic 4.43, p < 0.0001) and higher neutralizing antibody titers (t-statistic 3.14, p = 0.002). Our results suggest that there is evidence of multigenic associations among identified gene SNPs and that polymorphisms in these candidate genes contribute to the overall observed differences between individuals in response to live rubella virus vaccine. These results will aid our understanding of mechanisms behind rubella-specific immune response to MMR vaccine and influence the development of vaccines in the future.

  8. Single nucleotide polymorphisms/haplotypes associated with multiple rubella-specific immune response outcomes post-MMR immunization in healthy children.

    PubMed

    Ovsyannikova, Inna G; Salk, Hannah M; Larrabee, Beth R; Pankratz, V Shane; Poland, Gregory A

    2015-10-01

    The observed heterogeneity in rubella-specific immune response phenotypes post-MMR vaccination is thought to be explained, in part, by inter-individual genetic variation. In this study, single nucleotide polymorphisms (SNPs) and multiple haplotypes in several candidate genes were analyzed for associations with more than one rubella-specific immune response outcome, including secreted IFN-γ, secreted IL-6, and neutralizing antibody titers. Overall, we identified 23 SNPs in 10 different genes that were significantly associated with at least two rubella-specific immune responses. Of these SNPs, we detected eight in the PVRL3 gene, five in the PVRL1 gene, one in the TRIM22 gene, two in the IL10RB gene, two in the TLR4 gene, and five in other genes (PVR, ADAR, ZFP57, MX1, and BTN2A1/BTN3A3). The PVRL3 gene haplotype GACGGGGGCAGCAAAAAGAAGAGGAAAGAACAA was significantly associated with both higher IFN-γ secretion (t-statistic 4.43, p < 0.0001) and higher neutralizing antibody titers (t-statistic 3.14, p = 0.002). Our results suggest that there is evidence of multigenic associations among identified gene SNPs and that polymorphisms in these candidate genes contribute to the overall observed differences between individuals in response to live rubella virus vaccine. These results will aid our understanding of mechanisms behind rubella-specific immune response to MMR vaccine and influence the development of vaccines in the future. PMID:26329766

  9. The effects of long-term total parenteral nutrition on gut mucosal immunity in children with short bowel syndrome: a systematic review

    PubMed Central

    Duran, Beyhan

    2005-01-01

    Background Short bowel syndrome (SBS) is defined as the malabsorptive state that often follows massive resection of the small intestine. Most cases originate in the newborn period and result from congenital anomalies. It is associated with a high morbidity, is potentially lethal and often requires months, sometimes years, in the hospital and home on total parenteral nutrition (TPN). Long-term survival without parenteral nutrition depends upon establishing enteral nutrition and the process of intestinal adaptation through which the remaining small bowel gradually increases its absorptive capacity. The purpose of this article is to perform a descriptive systematic review of the published articles on the effects of TPN on the intestinal immune system investigating whether long-term TPN induces bacterial translocation, decreases secretory immunoglobulin A (S-IgA), impairs intestinal immunity, and changes mucosal architecture in children with SBS. Methods The databases of OVID, such as MEDLINE and CINAHL, Cochran Library, and Evidence-Based Medicine were searched for articles published from 1990 to 2001. Search terms were total parenteral nutrition, children, bacterial translocation, small bowel syndrome, short gut syndrome, intestinal immunity, gut permeability, sepsis, hyperglycemia, immunonutrition, glutamine, enteral tube feeding, and systematic reviews. The goal was to include all clinical studies conducted in children directly addressing the effects of TPN on gut immunity. Results A total of 13 studies were identified. These 13 studies included a total of 414 infants and children between the ages approximately 4 months to 17 years old, and 16 healthy adults as controls; and they varied in design and were conducted in several disciplines. The results were integrated into common themes. Five themes were identified: 1) sepsis, 2) impaired immune functions: In vitro studies, 3) mortality, 4) villous atrophy, 5) duration of dependency on TPN after bowel resection

  10. Use of a monitoring tool for growth and development in Brazilian children – systematic review

    PubMed Central

    de Almeida, Ana Claudia; Mendes, Larissa da Costa; Sad, Izabela Rocha; Ramos, Eloane Gonçalves; Fonseca, Vânia Matos; Peixoto, Maria Virginia Marques

    2016-01-01

    Abstract Objective: To assess the use of a health monitoring tool in Brazilian children, with emphasis on the variables related to growth and development, which are crucial aspects of child health care. Data source: A systematic review of the literature was carried out in studies performed in Brazil, using the Cochrane Brazil, Lilacs, SciELO and Medline databases. The descriptors and keywords used were “growth and development”, “child development”, “child health record”, “child health handbook”, “health record and child” and “child handbook”, as well as the equivalent terms in Portuguese. Studies were screened by title and summary and those considered eligible were read in full. Data synthesis: Sixty-eight articles were identified and eight articles were included in the review, as they carried out a quantitative analysis of the filling out of information. Five studies assessed the completion of the Child's Health Record and three of the Child's Health Handbook. All articles concluded that the information was not properly recorded. Growth monitoring charts were rarely filled out, reaching 96.3% in the case of weight for age. The use of the BMI chart was not reported, despite the growing rates of childhood obesity. Only two studies reported the completion of development milestones and, in these, the milestones were recorded in approximately 20% of the verified tools. Conclusions: The results of the assessed articles disclosed underutilization of the tool and reflect low awareness by health professionals regarding the recording of information in the child's health monitoring document. PMID:26705605

  11. Particular Characterisation of an In-Vitro-DTH Test to Monitor Cellular Immunity - Applications for Patient Care and Space Flight

    NASA Technical Reports Server (NTRS)

    Feurecker, M.; Mayer, W.; Gruber, M.; Muckenthaler, F.; Draenert, R.; Bogner, J.; Kaufmann, I.; Crucian, B.; Rykova, M.; Morukov, B.; Sams, C.; Chouker, A.

    2010-01-01

    Goal:i) Characterization of the role of the main immune reactive cell types contributing to the cellular immune response in the in-vitro DTH and ii) Validation of the in-vitro DTH under different clinical and field conditions. Methods:As positive control whole blood was incubated in the in-vitro DTH, supernatants were gathered after 12, 24 and 48h. Readout parameters of this test are cytokines in the assay's supernatant. To determine the role of T-cells, monocytes and natural killer (NK), these cell populations were depleted using magnetic beads prior to in-vitro-DTH incubation. Validation of the test has occurred under clinical (HIV-patients, ICU) and field-conditions (parabolic/space-flights, confinement). Results:T-cell depletion abandoned almost any IL-2 production and reduced IFN-gamma production irrespective of the type of antigen, whereas CD56 depleted cultures tended to lower IL-2 secretion and IFN-gamma and to parallel a IL-10-increase after viral challenge. This IL-10-increase was seen also in CD14-depleted setups. DTH read-out was significantly different under acute stress (parabolic flight) or chronic stress (ISS), respectively. Preliminary data of HIV infected patients demonstrate that this test can display the contemporary immune status during an antiviral therapy. Conclusion:The in-vitro DTH mirrors adaptive and innate immune activation and may serve as tool also for longitudinal follow up of Th1/Th2 weighed immune response under adverse life conditions on earth and in space. It is planned to implement the assay in the on the ISS (MoCISS).

  12. [Connection between the group factors of the blood systems ABO, MNSs, and rhesus and peculiarities of the vaccination process in children immunized against smallpox].

    PubMed

    Lebedinskiĭ, A P; Sokhin, A A; Frolov, V K; Frolov, A K; Lysakova, V I

    1975-12-01

    The ahthors present new data on the character of the vaccine process in children associated with the characteristics of the blood group ABO, MNSs and Rh systems. The greater frequency of occurrence and more manifest reactions were noted in children with blood groups A, B, AB, M and Rho (D) - in comparison with those having blood groups O, Rho (D) +, MN and N. There was a significant prevalence of chromosomal aberrations in the primarily immunized children with blood groups A in comparison with groups O, B and AB. The data obtained pointed to the negative effect of the mimi-rating antigens of the smallpox virus on the immunogenesis in smallpox. Search for methods of releasing the vaccine of these antigens is necessary for reduction of the reactogenic properties and increase of immunogenecity of the smallpox vaccines.

  13. No Differences of Immune Activation and Microbial Translocation Among HIV-infected Children Receiving Combined Antiretroviral Therapy or Protease Inhibitor Monotherapy

    PubMed Central

    Falcon-Neyra, Lola; Benmarzouk-Hidalgo, Omar J.; Madrid, Lola; Noguera-Julian, Antoni; Fortuny, Claudia; Neth, Olaf; López-Cortés, Luis

    2015-01-01

    Abstract This is a cross-sectional study of 15 aviremic chronic HIV-infected children revealing no differences in immune activation (IA; HLA-DR+CD38+ CD4+ and CD8+ T cells, and sCD14) and microbial translocation (MT; lipopolysaccharides (LPS) and 16S rDNA) among HIV-infected patients under combined antiretroviral treatment (cART; n = 10) or ritonavir-boosted protease inhibitor monotherapy (mtPI/rtv; n = 5). In both cases, IA and MT were lower in healthy control children (n = 32). This observational study suggests that ritonavir boosted protease inhibitor monotherapy (mtPI/rtv) is not associated with an increased state of IA or MT as compared with children receiving cART. PMID:25789946

  14. Immune Response and Intestinal Permeability in Children With Acute Gastroenteritis Treated With Lactobacillus rhamnosus GG: A Randomized, Double-Blind, Placebo-Controlled Trial

    PubMed Central

    Sindhu, Kulandaipalayam N. C.; Sowmyanarayanan, Thuppal V.; Paul, Anu; Babji, Sudhir; Ajjampur, Sitara S. R.; Priyadarshini, Sophia; Sarkar, Rajiv; Balasubramanian, K. A.; Wanke, Christine A.; Ward, Honorine D.; Kang, Gagandeep

    2014-01-01

    Background. Probiotics have a possible role in the treatment of pediatric acute gastroenteritis. We report the effect of the probiotic Lactobacillus rhamnosus GG (LGG) on intestinal function, immune response, and clinical outcomes in Indian children with cryptosporidial or rotavirus diarrhea. Methods. Children with gastroenteritis aged 6 months to 5 years, testing positive for either rotavirus or Cryptosporidium species in stool (coinfections were excluded), were randomized to LGG (ATCC 53103) or placebo, once daily for 4 weeks. Baseline demographic and clinical details were obtained. Sera were tested for immunoglobulin G (IgG) and immunoglobulin A (IgA) antibodies to Cryptosporidium and rotavirus, and the lactulose to mannitol ratio for intestinal permeability was determined at baseline and at the end of follow-up. Results. Of the 124 children enrolled, 82 and 42 had rotavirus and cryptosporidial diarrhea, respectively. Median diarrheal duration was 4 days; one-third of the children had severe diarrhea. Baseline and clinical parameters were comparable between children receiving LGG and placebo. At the end of follow-up, fewer children with rotavirus diarrhea on LGG had repeated diarrheal episodes (25% vs 46%; P = .048) and impaired intestinal function (48% vs 72%; P = .027). Significant increase in IgG levels postintervention (456 vs 2215 EU; P = .003) was observed in children with rotavirus diarrhea receiving LGG. Among children with cryptosporidial diarrhea, those receiving LGG showed significant improvement in intestinal permeability. Conclusions. LGG has a positive immunomodulatory effect and may be useful in decreasing repeated episodes of rotavirus diarrhea. Improvement in intestinal function in children with rotavirus and cryptosporidial gastroenteritis emphasizes the role of probiotics in treating intestinal impairment after infection. Clinical Trials Registration. CTRI/2010/091/000339. PMID:24501384

  15. Long-term outcome following splenectomy for chronic and persistent immune thrombocytopenia (ITP) in adults and children : Splenectomy in ITP.

    PubMed

    Ahmed, Rayaz; Devasia, Anup J; Viswabandya, Auro; Lakshmi, Kavitha M; Abraham, Aby; Karl, Sampath; Mathai, John; Jacob, Paul M; Abraham, Deepak; Srivastava, Alok; Mathews, Vikram; George, Biju

    2016-09-01

    The purpose of this research is to study the outcomes of splenectomy for chronic and persistent immune thrombocytopenia (ITP). This study is a retrospective analysis of 254 patients with chronic or persistent ITP who underwent splenectomy at CMC, Vellore, India between 1995 and 2009. Responses were assessed based on standard criteria. One hundred and sixty seven adults and 87 children with a median age of 29 years (range 2-64) with persistent (n = 103) or chronic ITP (n = 151) was studied. Response was seen in 229 (90.2 %) including CR in 74.4 % at a median time of 1 day (range 1-54). Infections following splenectomy were reported in 16 %. Deaths related to post splenectomy sepsis occurred in 1.57 % and major bleeding in 0.78 %. At median follow-up of 54.3 months (range 1-290), 178 (70.1 %) remain in remission. The 5-year and 10-year overall survival (OS) is 97.4 ± 1.2 % and 94.9 ± 2.1 %, respectively, while the 5-year and 10-year event-free survival (EFS) is 76.5 + 2.9 % and 71.0 + 3.9 %, respectively. Splenectomy is associated with long-term remission rates of >70 % in chronic or persistent ITP. PMID:27370992

  16. Ensuring excellence in immunization services.

    PubMed

    MacDonald, Pauline

    2016-01-01

    In order to increase uptake of measles, mumps and rubella (MMR) vaccine, a domiciliary immunization service was established in Dudley primary care trust in England in 2010. Parents of unimmunized children were offered vaccines at home. Uptake of MMR vaccine among 2 year olds rose from 89% in 2007/08 to 96.9% in 2015. Children were also given any other outstanding immunizations. The domiciliary immunization service reached vulnerable unimmunized children who may otherwise have remained unprotected against life threatening childhood illnesses. Domiciliary immunization service was set up in 2010 to reduce inequalities in uptake of MMR vaccine among children aged between 2 and 5 years. PMID:26618244

  17. Surveillance for adverse events following receipt of pandemic 2009 H1N1 vaccine in the Post-Licensure Rapid Immunization Safety Monitoring (PRISM) System, 2009-2010.

    PubMed

    Yih, W Katherine; Lee, Grace M; Lieu, Tracy A; Ball, Robert; Kulldorff, Martin; Rett, Melisa; Wahl, Peter M; McMahill-Walraven, Cheryl N; Platt, Richard; Salmon, Daniel A

    2012-06-01

    The Post-Licensure Rapid Immunization Safety Monitoring (PRISM) system is a cohort-based active surveillance network initiated by the US Department of Health and Human Services to supplement preexisting and other vaccine safety monitoring systems in tracking the safety of monovalent pandemic 2009 H1N1 influenza vaccine in the United States during 2009-2010. PRISM investigators conducted retrospective analysis to determine whether 2009 H1N1 vaccination was associated with increased risk of any of 14 prespecified outcomes. Five health insurance and associated companies with 38 million members and 9 state/city immunization registries contributed records on more than 2.6 million doses of 2009 H1N1 vaccine. Data on outcomes came from insurance claims. Complementary designs (self-controlled risk interval, case-centered, and current-vs.-historical comparison) were used to optimize control for confounding and statistical power. The self-controlled risk interval analysis of chart-confirmed Guillain-Barré syndrome found an elevated but not statistically significant incidence rate ratio following receipt of inactivated 2009 H1N1 vaccine (incidence rate ratio = 2.50, 95% confidence interval: 0.42, 15.0) and no cases following live attenuated 2009 H1N1 vaccine. The study did not control for infection prior to Guillain-Barré syndrome, which may have been a confounder. The risks of other health outcomes of interest were generally not significantly elevated after 2009 H1N1 vaccination.

  18. Assessment of some innate immune responses in dab (Limanda limanda L.) from the North Sea as part of an integrated biological effects monitoring

    NASA Astrophysics Data System (ADS)

    Skouras, Andreas; Lang, Thomas; Vobach, Michael; Danischewski, Dirk; Wosniok, Werner; Scharsack, Jörn Peter; Steinhagen, Dieter

    2003-10-01

    The marine flatfish dab (Limanda limanda), which lives in direct contact with contaminated sediments, is frequently used as a sentinel species in international monitoring programmes on the biological effects of contaminants. In this study, immune responses were recorded as indicators of sublethal chronic effects of contaminants, in addition to measurement of the induction of mono-oxygenase ethoxyresorufin O-deethylase (EROD) in liver cells, the inhibition of acetylcholin esterase (AChE) in muscle and a quantification of grossly visible diseases and parasites. In total, 336 dab were analysed from five sampling areas in the North Sea, including the German Bight, the Dogger Bank, the Firth of Forth, and two locations close to oil and gas platforms (Ekofisk and Danfield). When considering plasma lysozyme levels, pinocytosis and respiratory burst activity of head kidney leucocytes, a clear gradient could be observed with decreased levels in individuals collected from the Firth of Forth and locations near the oil or gas platforms compared with dab from the Dogger Bank or the German Bight. Individuals with induced EROD activity displayed reduced lysozyme and respiratory burst activities. Lysozyme levels were also reduced in dab with lymphocystis or with nematodes. The data obtained indicate that the assessment of innate immune parameters in a monitoring programme provides supplementary information about immunomodulatory effects associated with the exposure of fish to contaminants. In particular, concentrations of plasma lysozyme, which can be analysed in an easy and inexpensive assay, are considered to be an appropriate parameter for use in a battery of other bioindicators.

  19. Cross-sectional study of phoneme and rhyme monitoring abilities in children between 7 and 13 years

    PubMed Central

    Sasisekaran, Jayanthi; Weber-Fox, Christine

    2011-01-01

    We investigated phonemic competence in production in three age groups of children – 7 and 8 years, 10 and 11 years, 12 and 13 years—using rhyme and phoneme monitoring. Participants were required to name target pictures silently while monitoring covert speech for the presence or absence of a rhyme or phoneme match. Performance in the verbal tasks was compared to a nonverbal control task in which participants monitored tone sequence pairs for a pattern match. Repeated measures ANOVA revealed significant differences between the three age groups in phoneme monitoring while similar differences were limited to the younger age groups in rhyme monitoring. This finding supported early and on-going acquisition of rhyme- and later acquisition of segment-level units. In addition, the 7 and 8-year-olds were significantly slower in monitoring phonemes within consonant clusters compared to the 10 and 11-year-olds and in monitoring both singleton phonemes and phonemes within clusters compared to the 12 and 13-year-olds. Regression analysis revealed that age accounted for approximately 30% variance in the nonverbal and 60% variance in the verbal monitoring tasks. We attribute the observed differences to the emergence of cognitive processes such as segmentation skills that are critical to performing the verbal monitoring tasks. PMID:23204597

  20. A Bivariate Mixture Model for Natural Antibody Levels to Human Papillomavirus Types 16 and 18: Baseline Estimates for Monitoring the Herd Effects of Immunization.

    PubMed

    Vink, Margaretha A; Berkhof, Johannes; van de Kassteele, Jan; van Boven, Michiel; Bogaards, Johannes A

    2016-01-01

    Post-vaccine monitoring programs for human papillomavirus (HPV) have been introduced in many countries, but HPV serology is still an underutilized tool, partly owing to the weak antibody response to HPV infection. Changes in antibody levels among non-vaccinated individuals could be employed to monitor herd effects of immunization against HPV vaccine types 16 and 18, but inference requires an appropriate statistical model. The authors developed a four-component bivariate mixture model for jointly estimating vaccine-type seroprevalence from correlated antibody responses against HPV16 and -18 infections. This model takes account of the correlation between HPV16 and -18 antibody concentrations within subjects, caused e.g. by heterogeneity in exposure level and immune response. The model was fitted to HPV16 and -18 antibody concentrations as measured by a multiplex immunoassay in a large serological survey (3,875 females) carried out in the Netherlands in 2006/2007, before the introduction of mass immunization. Parameters were estimated by Bayesian analysis. We used the deviance information criterion for model selection; performance of the preferred model was assessed through simulation. Our analysis uncovered elevated antibody concentrations in doubly as compared to singly seropositive individuals, and a strong clustering of HPV16 and -18 seropositivity, particularly around the age of sexual debut. The bivariate model resulted in a more reliable classification of singly and doubly seropositive individuals than achieved by a combination of two univariate models, and suggested a higher pre-vaccine HPV16 seroprevalence than previously estimated. The bivariate mixture model provides valuable baseline estimates of vaccine-type seroprevalence and may prove useful in seroepidemiologic assessment of the herd effects of HPV vaccination. PMID:27537200

  1. A Bivariate Mixture Model for Natural Antibody Levels to Human Papillomavirus Types 16 and 18: Baseline Estimates for Monitoring the Herd Effects of Immunization

    PubMed Central

    Vink, Margaretha A.; Berkhof, Johannes; van de Kassteele, Jan; van Boven, Michiel; Bogaards, Johannes A.

    2016-01-01

    Post-vaccine monitoring programs for human papillomavirus (HPV) have been introduced in many countries, but HPV serology is still an underutilized tool, partly owing to the weak antibody response to HPV infection. Changes in antibody levels among non-vaccinated individuals could be employed to monitor herd effects of immunization against HPV vaccine types 16 and 18, but inference requires an appropriate statistical model. The authors developed a four-component bivariate mixture model for jointly estimating vaccine-type seroprevalence from correlated antibody responses against HPV16 and -18 infections. This model takes account of the correlation between HPV16 and -18 antibody concentrations within subjects, caused e.g. by heterogeneity in exposure level and immune response. The model was fitted to HPV16 and -18 antibody concentrations as measured by a multiplex immunoassay in a large serological survey (3,875 females) carried out in the Netherlands in 2006/2007, before the introduction of mass immunization. Parameters were estimated by Bayesian analysis. We used the deviance information criterion for model selection; performance of the preferred model was assessed through simulation. Our analysis uncovered elevated antibody concentrations in doubly as compared to singly seropositive individuals, and a strong clustering of HPV16 and -18 seropositivity, particularly around the age of sexual debut. The bivariate model resulted in a more reliable classification of singly and doubly seropositive individuals than achieved by a combination of two univariate models, and suggested a higher pre-vaccine HPV16 seroprevalence than previously estimated. The bivariate mixture model provides valuable baseline estimates of vaccine-type seroprevalence and may prove useful in seroepidemiologic assessment of the herd effects of HPV vaccination. PMID:27537200

  2. 76 FR 60500 - Advisory Committee on Immunization Practices (ACIP)

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-09-29

    ... HUMAN SERVICES Centers for Disease Control and Prevention Advisory Committee on Immunization Practices... will include discussions on: Child/adolescent immunization schedules; adult immunization schedule...; pertussis; immunization coverage among children and adolescents; and vaccine supply. Agenda items...

  3. Monitoring Pharmacologically Induced Immunosuppression by Immune Repertoire Sequencing to Detect Acute Allograft Rejection in Heart Transplant Patients: A Proof-of-Concept Diagnostic Accuracy Study

    PubMed Central

    Valantine, Hannah A.; Penland, Lolita; Luikart, Helen; Strehl, Calvin; Cohen, Garrett; Khush, Kiran K.; Quake, Stephen R.

    2015-01-01

    Background It remains difficult to predict and to measure the efficacy of pharmacological immunosuppression. We hypothesized that measuring the B-cell repertoire would enable assessment of the overall level of immunosuppression after heart transplantation. Methods and Findings In this proof-of-concept study, we implemented a molecular-barcode-based immune repertoire sequencing assay that sensitively and accurately measures the isotype and clonal composition of the circulating B cell repertoire. We used this assay to measure the temporal response of the B cell repertoire to immunosuppression after heart transplantation. We selected a subset of 12 participants from a larger prospective cohort study (ClinicalTrials.gov NCT01985412) that is ongoing at Stanford Medical Center and for which enrollment started in March 2010. This subset of 12 participants was selected to represent post-heart-transplant events, with and without acute rejection (six participants with moderate-to-severe rejection and six without). We analyzed 130 samples from these patients, with an average follow-up period of 15 mo. Immune repertoire sequencing enables the measurement of a patient’s net state of immunosuppression (correlation with tacrolimus level, r = −0.867, 95% CI −0.968 to −0.523, p = 0.0014), as well as the diagnosis of acute allograft rejection, which is preceded by increased immune activity with a sensitivity of 71.4% (95% CI 30.3% to 94.9%) and a specificity of 82.0% (95% CI 72.1% to 89.1%) (cell-free donor-derived DNA as noninvasive gold standard). To illustrate the potential of immune repertoire sequencing to monitor atypical post-transplant trajectories, we analyzed two more patients, one with chronic infections and one with amyloidosis. A larger, prospective study will be needed to validate the power of immune repertoire sequencing to predict rejection events, as this proof-of-concept study is limited to a small number of patients who were selected based on several

  4. Longevity of Genotype-Specific Immune Responses to Plasmodium falciparum Merozoite Surface Protein 1 in Kenyan Children from Regions of Different Malaria Transmission Intensity.

    PubMed

    Bowman, Natalie M; Juliano, Jonathan J; Snider, Cynthia J; Kharabora, Oksana; Meshnick, Steven R; Vulule, John; John, Chandy C; Moormann, Ann M

    2016-09-01

    Naturally acquired immunity to Plasmodium falciparum presents a changing landscape as malaria control programs and vaccine initiatives are implemented. Determining which immunologic indicators remain surrogates of past infection, as opposed to mediators of protection, led us to compare stability of immune responses across regions with divergent malaria transmission intensities. A repeat cross-sectional study of Kenyan children from a malaria-holoendemic area and an epidemic-prone area was used to examine longitudinal antibody and interferon-gamma (IFN-γ) responses to the 3D7 and FVO variants of merozoite surface protein 1 (MSP1). Antibodies to MSP1 were common in both study populations and did not significantly wane over a 21-month time period. IFN-γ responses were less frequent and rapidly disappeared in children after a prolonged period of no malaria transmission. Antibody and IFN-γ responses rarely correlated with each other; however, MSP1-specific IFN-γ response correlated with lack of concurrent P. falciparum parasitemia of the same genotype, though only statistically significantly in the malaria-holoendemic region (odds ratio = 0.31, 95% confidence interval = 0.12-0.84). This study affirms that antimalarial antibodies are informative for evaluation of history of malaria exposure within individuals, whereas cell-mediated immunity, though short lived under natural exposure conditions, might provide an assessment of recent infection and protection from parasitemia. PMID:27481054

  5. FastStats: Immunization

    MedlinePlus

    ... this? Submit What's this? Submit Button NCHS Home Immunization Recommend on Facebook Tweet Share Compartir Data are ... Percent of children 19-35 months old receiving vaccinations for: Diphtheria, Tetanus, Pertussis (4+ doses DTP, DT, ...

  6. Effectiveness of Using Mobile Phone Image Capture for Collecting Secondary Data: A Case Study on Immunization History Data Among Children in Remote Areas of Thailand

    PubMed Central

    Jandee, Kasemsak; Khamsiriwatchara, Amnat; Lawpoolsri, Saranath; Wongwit, Waranya; Wansatid, Peerawat

    2015-01-01

    Background Entering data onto paper-based forms, then digitizing them, is a traditional data-management method that might result in poor data quality, especially when the secondary data are incomplete, illegible, or missing. Transcription errors from source documents to case report forms (CRFs) are common, and subsequently the errors pass from the CRFs to the electronic database. Objective This study aimed to demonstrate the usefulness and to evaluate the effectiveness of mobile phone camera applications in capturing health-related data, aiming for data quality and completeness as compared to current routine practices exercised by government officials. Methods In this study, the concept of “data entry via phone image capture” (DEPIC) was introduced and developed to capture data directly from source documents. This case study was based on immunization history data recorded in a mother and child health (MCH) logbook. The MCH logbooks (kept by parents) were updated whenever parents brought their children to health care facilities for immunization. Traditionally, health providers are supposed to key in duplicate information of the immunization history of each child; both on the MCH logbook, which is returned to the parents, and on the individual immunization history card, which is kept at the health care unit to be subsequently entered into the electronic health care information system (HCIS). In this study, DEPIC utilized the photographic functionality of mobile phones to capture images of all immunization-history records on logbook pages and to transcribe these records directly into the database using a data-entry screen corresponding to logbook data records. DEPIC data were then compared with HCIS data-points for quality, completeness, and consistency. Results As a proof-of-concept, DEPIC captured immunization history records of 363 ethnic children living in remote areas from their MCH logbooks. Comparison of the 2 databases, DEPIC versus HCIS, revealed

  7. Patterns of physical activity determined by heart rate monitoring among diabetic children

    PubMed Central

    Massin, M; Lebrethon, M; Rocour, D; Gerard, P; Bourguignon, J

    2005-01-01

    Background: Children with type 1 diabetes should be encouraged to participate in physical activity because exercise can benefit insulin sensitivity and improve known risk factors for atherosclerosis. Methods: Physical activity patterns of 127 children and adolescents with stable type 1 diabetes were investigated by 24 hour continuous heart rate monitoring. The percentage of heart rate reserve was used to measure the amounts of physical activity at different intensities. The results were compared with normative data. Results: Diabetic preschoolchildren accumulated 192.7 (78.1), 39.1 (24.3), and 21.3 (9.4) minutes/day (mean (SD)) of light, moderate, and vigorous physical activity, respectively. At the same activity levels, diabetic schoolchildren accumulated 168.9 (76.7), 37.9 (15.9), and 19.0 (14.8) minutes/day, and diabetic teenagers accumulated 166.3 (67.5), 45.6 (26.9), and 25.2 (15.3) minutes/day. Diabetic schoolchildren were significantly more active than healthy peers when considering moderate activity; diabetic teenagers were significantly more active when considering moderate and vigorous activity. There was a negative correlation between the most recent glycated haemoglobin and the time spent in light activities in schoolchildren, and a negative correlation between mean glycated haemoglobin for one year and time spent in light and moderate activities in schoolchildren. Conclusion: The majority of our diabetic patients meet the classical paediatric guidelines for physical activity and compare favourably with their healthy peers. PMID:15941770

  8. Satellite and in-situ monitoring of urban air pollution in relation with children's asthma

    NASA Astrophysics Data System (ADS)

    Dida, Mariana R.; Zoran, Maria A.

    2013-10-01

    Urban air pollution and especially aerosols have significant negative health effects on urban population, of which children are most exposed for the rapid increase of asthma disease. An allergic reaction to different allergens is a major contributor to asthma in urban children, but new research suggests that the allergies are just one part of a more complex story. Very early exposure to certain components of air pollution can increase the risk of developing of different allergies by age 7. The epidemiological research on the mutagenic effects of airborne particulate matter pointed their capability to reach deep lung regions, being vehicles of toxic substances. The current study presents a spatio-temporal analysis of the aerosol concentrations in relation with meteorological parameters in two size fractions (PM10 and PM2.5) and possible health effects in Bucharest metropolitan area. Both in-situ monitoring data as well as MODIS Terra/Aqua time-series satellite data of particle matter PM2.5 and PM10 concentrations have been used to qualitatively assess distribution of aerosols in the greater metropolitan are of Bucharest comparative with some other little towns in Romania during 2010- 2011 period. It was found that PM2.5 and PM10 aerosols exhibit their highest concentration mostly in the central part of the towns, mainly due to road traffic as well as in the industrialized parts outside of city's centre. Pediatric asthma can be managed through medications prescribed by a healthcare provider, but the most important aspect is to avoid urban locations with high air pollution concentrations of air particles and allergens.

  9. Adult immunization

    PubMed Central

    Mehta, Bharti; Chawla, Sumit; Kumar Dharma, Vijay; Jindal, Harashish; Bhatt, Bhumika

    2014-01-01

    Vaccination is recommended throughout life to prevent vaccine-preventable diseases and their sequel. The primary focus of vaccination programs has historically been directed to childhood immunizations. For adults, chronic diseases have been the primary focus of preventive and medical health care, though there has been increased emphasis on preventing infectious diseases. Adult vaccination coverage, however, remains low for most of the routinely recommended vaccines. Though adults are less susceptible to fall prey to traditional infectious agents, the probability of exposure to infectious agents has increased manifold owing to globalization and increasing travel opportunities both within and across the countries. Thus, there is an urgent need to address the problem of adult immunization. The adult immunization enterprise is more complex, encompassing a wide variety of vaccines and a very diverse target population. There is no coordinated public health infrastructure to support an adult immunization program as there is for children. Moreover, there is little coordination among adult healthcare providers in terms of vaccine provision. Substantial improvement in adult vaccination is needed to reduce the health consequences of vaccine-preventable diseases among adults. Routine assessment of adult patient vaccination needs, recommendation, and offer of needed vaccines for adults should be incorporated into routine clinical care of adults. PMID:24128707

  10. An Immunization Education Program for Childcare Providers

    ERIC Educational Resources Information Center

    Hayney, Mary S.; Bartell, Julie C.

    2005-01-01

    The childhood immunization schedule includes at least 17 scheduled immunizations prior to the age of 24 months. Immunization laws require childcare centers to maintain immunization records and enforce immunization standards for children who attend these centers. Childcare providers generally receive little formal education about infectious…

  11. Salivary Cytokines as a Minimally-Invasive Measure of Immune Functioning in Young Children: Correlates of Individual Differences and Sensitivity to Laboratory Stress

    PubMed Central

    Riis, Jenna L.; Granger, Douglas A.; DiPietro, Janet A.; Bandeen-Roche, Karen; Johnson, Sara B.

    2015-01-01

    There is growing interest in minimally-invasive measures of environmentally-responsive biological systems in developmental science. Contributing to that endeavor, this study explores the intercorrelations, correlates, and task-sensitivity of proinflammatory salivary cytokines in childhood. Saliva was sampled from 125 healthy five-year old children (49% male) across a series of cognitive and emotional challenge laboratory tasks. Samples were assayed for cytokines (IL-1β, IL-6, IL-8, TNFα), and markers of hypothalamic–pituitary– adrenal (HPA) and autonomic nervous system (ANS) activation (salivary cortisol and alpha-amylase [sAA]). Cytokines were positively intercorrelated and task-sensitivity varied. Except IL-8, cytokines were elevated in children with oral health issues and tobacco smoke exposure. Among boys, cytokines were positively related to sAA and negatively related to cortisol. The findings suggest that in healthy children, salivary cytokine levels reflect compartmentalized oral immune activity. Associations between ANS and HPA activity and cytokines in saliva may present opportunities for minimally-invasive methods to explore neuroendocrine-immune interactions during development. PMID:25604242

  12. A significant and consistent reduction in rotavirus gastroenteritis hospitalization of children under 5 years of age, following the introduction of universal rotavirus immunization in Israel.

    PubMed

    Muhsen, Khitam; Rubenstein, Uri; Kassem, Eias; Goren, Sophy; Schachter, Yaakov; Kremer, Adi; Shulman, Lester M; Ephros, Moshe; Cohen, Dani

    2015-01-01

    Universal rotavirus vaccination with RotaTeq was introduced in Israel in December 2010. We examined hospitalization rates of children under 5 years of age due to all-cause and rotavirus gastroenteritis, both before and 3 years after universal introduction of the vaccination. An ongoing hospital-based surveillance network that was established in November 2007, accessed information regarding hospitalization of children due to gastroenteritis (n = 6205) in 3 hospitals in northern Israel, with an annual average of about 60,000 children under 5 years of age living in the catchment area of these hospitals. Stool samples were tested for rotavirus by immunochromatography. Compared to the period preceding implementation of the universal rotavirus vaccination (2008-2010), hospitalizations due to rotavirus gastroenteritis in children <5 years of age decreased significantly, by 55% (95% CI 43%-67%) during the period of universal vaccination (2011-2013), a decrease that was sustained throughout the 3 year period. This reduction was greater in children aged 0-23 months (60-61%) than in toddlers aged 24-59 months (36%). A 32% (95% CI 21%-45%) decrease in the incidence of all-cause gastroenteritis was also observed. During the period preceding universal vaccination, rotavirus diarrhea showed typical winter seasonality, with highest incidence in December. However, the winter peak was substantially blunted during the period of universal immunization. Surveillance of rotavirus gastroenteritis should continue to assess the long-term impact of such a program. Our findings are of relevance to high and middle-income countries considering the introduction of a universal rotavirus immunization program.

  13. Immunity and Nutrition.

    ERIC Educational Resources Information Center

    Dupin, Henri; Guerin, Nicole

    1990-01-01

    The three articles in this issue of a periodical focussed on various aspects of the life and health of children in the tropics concern: (1) immune defenses; (2) interactions between nutrition disorders and infection; and (3) immunity and vaccination. The science of immunology has progressed rapidly in recent years. A brief review of present…

  14. Monitoring adverse drug reactions in children using community pharmacies: a pilot study

    PubMed Central

    Stewart, Derek; Helms, Peter; McCaig, Dorothy; Bond, Christine; McLay, James

    2005-01-01

    Aims To determine the feasibility of a community pharmacy-based parental adverse drug reaction (ADR) reporting system for children. Design Prospective study of parent-reported ADRs using a questionnaire issued to the parent or guardians of children 0–11 years of age collecting prescribed medicine for amoxicillin, and/or salbutamol, and collecting prescribed medicine for, or purchasing, paracetamol or ibuprofen suspension. Setting Seven community pharmacies in Grampian, Scotland. Results During a 4-week period 360 prescriptions or purchases for the study medications occurred. Two hundred and sixty-seven parents (85.5%) agreed to participate in the study. One hundred and six participants (40%) returned a total of 122 questionnaires. The demographics of responders and nonresponders including medication, age of child, and social status as assessed by the Depcat score were similar. There was no evidence of under-representation of any socio-economic group. Possible adverse events were detected using a symptom tick list and perceived ADRs using free text entry. Using the symptom tick list approach the most commonly reported symptoms were diarrhoea (28.9%) and tiredness (31.6%) for amoxicillin. The levels of diarrhoea and tiredness reported for ibuprofen, paracetamol and salbutamol were 15% and 20%, 7.4% and 18.5%, and 20% and 0%, respectively. Using the freehand section of the questionnaire 15 specific ADRs were reported by parents (12.3%). Eight children (21.2%) reported ADRs attributed to amoxicilin [diarrhoea (n = 4), fever (n = 1), anorexia (n = 1), hyperactivity (n = 1) and nonspecific (n = 1)], five to paracetamol [diarrhoea (n = 3), anorexia, irritability, crying and very angry (n = 1) and not stated (n = 1)], two to ibuprofen [diarrhoea (n = 1), not stated (n =)]. Only one off-label prescription was identified and this was for salbutamol syrup prescribed to a child under 2 years of age. Conclusions The prospective monitoring of paediatric ADRs, using a

  15. Status of immunization and need for intensification of routine immunization in India.

    PubMed

    Vashishtha, Vipin M

    2012-05-01

    Vaccines have made a major contribution to public health but vaccines-preventable diseases (VPDs) are still responsible for significant deaths of under-five children. Despite Global efforts, the coverage in two WHO regions namely Africa and South-East Asia (SEA) still remain short of set targets for 2010. As a result, the SEA Regional Director has declared 2012 as the Year for Intensifying Routine Immunization (RI) in the Region. The recent immunization coverage surveys in India have shown gradual albeit a slow progress in the performance of RI in India over last few years but in some states the coverage is still quite low. Several new initiatives like introduction of Hepatitis B vaccine, second dose of Measles vaccine and pentavalent vaccine (two states), JE vaccine rounds, framing of the National Vaccine Policy, etc. are welcome steps. The challenges and barriers to achieve high immunization rates in the country are well recognized. Almost non-existence of an effective VPD surveillance system in the country has further compounded the problem. The need is to address all the barriers to achieve high RI rates, which should include induction of innovative methods, proper monitoring of the program, improving operational efficiency and reaching every community, and integrated delivery of health interventions along with immunization. The development of an efficient VPDs surveillance, adverse event following immunization (AEFI) monitoring and post-marketing surveillance systems will go a long way in ensuring satisfactory performance of the health system. The decades old Expanded Program of Immunization (EPI), which was adopted in India as universal Immunization Program (UIP) also needs a revamp with inclusion of certain new vaccines. Decisions on implementing new and underutilized vaccines require scientific evidence and data, a reliable supply of affordable vaccines, which are adapted to the country's immunization schedule, and an integrated disease monitoring and

  16. Management of chronic immune thrombocytopenia in children and adolescents: lessons from an Austrian national cross-sectional study of 81 patients.

    PubMed

    Sipurzynski, J; Fahrner, B; Kerbl, R; Crazzolara, R; Jones, N; Ebetsberger, G; Jauk, B; Strenger, V; Wohlmuther, B; Schwinger, W; Lackner, H; Urban, C; Holter, W; Minkov, M; Kager, L; Benesch, M; Seidel, M G

    2016-04-01

    Chronic immune thrombocytopenia (cITP) is often associated with an underlying predisposition towards autoimmunity, recognition of which is relevant to guide treatment. International recommendations on diagnostic steps and therapeutic measures of cITP in childhood exist. However, due to the low prevalence (1-2/100,000) and a variation of availability of immunological and hematological tests and treatments across pediatric units, we postulated that these guidelines are not uniformly adhered to and that immune dysregulation syndromes remained undiscovered. To delineate the current management of children and adolescents with cITP in Austria, we performed a nationwide cross-sectional study. Between 2011 and 2014, 81 children with cITP were seen at seven centers (median age 8.75 years; range 1-17; female:male ratio 47:34) at 641 visits during 180 patient years after diagnosis of cITP (>12 months ITP duration). Additional diagnoses were noted, most frequently immune or autoimmune disorders, hematologic diseases, or infections (in 37.3%, including Evans syndrome, autoimmune lymphoproliferative syndrome, systemic lupus erythematosus, and Fanconi anemia), or other symptoms like bi- or pancytopenia (n=9), lymphoproliferation or granulomatous inflammation (n = 3). Both decision to treat as well as choice of treatment varied: smaller centers tended to observe more frequently, larger centers applied a pattern of treatment modalities that appeared to depend less on bleeding tendency than on center policy. More than 50% of therapeutic interventions occurred in bleedings scores ≤2 (of 5), suggesting a strong psychosocial intention to treat. Platelet increment upon 479 therapeutic interventions of eight types was evaluated, with multiple treatment approaches being pursued sequentially in refractory patients. These data confirm the hypothesis of heterogeneous diagnostic and therapeutic management of cITP in Austrian children and corroborate the need for (1) a precise panel of

  17. Monitoring Web Site Usage of e-Bug: A Hygiene and Antibiotic Awareness Resource for Children

    PubMed Central

    Rajapandian, Vijayamaharaj; Eley, Charlotte V; Hoekstra, Beverley A; Lecky, Donna M; McNulty, Cliodna AM

    2015-01-01

    Background e-Bug is an educational resource which teaches children and young people about microbes, hygiene, infection, and prudent antibiotic use. The e-Bug resources are available in over 22 different languages and they are used widely across the globe. The resources can be accessed from the e-Bug website. Objective The objective of this study was to analyze the usage of the e-Bug website in order to understand how users access the website, where and when they access the site, and to review variation in use across the different areas of the site. Methods The usage statistics for the e-Bug website were monitored by Google Analytics between September 2010 and August 2013. Results The statistics show the website had over 324,000 visits during the three years, from just under 250,000 visitors, with the number of visitors increasing year after year. Visitors accessed the website from 211 different countries, with more than 267,000 documents downloaded. The majority of visitors were from the United Kingdom and visited the English website, although countries such as France and Portugal were also frequent visitors. Conclusions These website statistics confirm that e-Bug is frequently used across Europe and highlight that e-Bug use has expanded across the world. The findings from this report will be used to inform future modifications or updates to the materials, as well as the development of new educational resources. PMID:26567127

  18. Age-Dependent Association among Helicobacter pylori Infection, Serum Pepsinogen Levels and Immune Response of Children to Live Oral Cholera Vaccine CVD 103-HgR

    PubMed Central

    Muhsen, Khitam; Lagos, Rosanna; Reymann, Mardi K.; Graham, David Y.; Pasetti, Marcela F.; Levine, Myron M.

    2014-01-01

    Background Through its effects on gastric secretion, we hypothesized that Helicobacter pylori infection may influence oral immunization. Accordingly, we examined the association between H. pylori infection, serum pepsinogen (PG) (measures for H. pylori gastritis) and vibriocidal antibody (a correlate of protection) seroconversion following oral immunization with CVD 103-HgR live cholera vaccine among children of different ages. Methods Sera from 422 Chilean children who were vaccinated with a single dose of CVD 103-HgR were tested by ELISA for serum IgG antibodies to H. pylori, PG I and PG II levels and antibodies to Shigella flexneri 2a lipopolysaccharide and hepatitis A virus (as markers of low socioeconomic status and exposure to enteric pathogens). Results The likelihood of vibriocidal antibody seroconversion following vaccination with CVD 103-HgR was significantly decreased in H. pylori-seropositive children age 6 months to 4 years with PG II>8 µg/L (adjusted OR 0.14 (95% CI 0.03–0.61; P = 0.009), and also in H. pylori seropositives with lower PG II level (adjusted OR 0.34, 95% CI 0.14–0.83; P = 0.017), compared to H. pylori-seronegatives. H. pylori-seropositive children aged 5–9 years with serum PG I>30 µg/L (indicating more severe gastritis) had higher odds of vibriocidal seroconversion than those with lower PG I levels (adjusted OR 4.41, 95%CI 1.26–15.38; P = 0.02). There was no significant association between exposures to S. flexneri 2a or hepatitis A virus and vibriocidal seroconversion. Conclusions As H. pylori gastritis progresses with increasing pediatric age in developing country venues, changes in gastric secretion ensue that we believe explain the observed differences in age-related immune responses to immunization with live oral cholera vaccine. The effect of H. pylori and changes of gastric acid secretion on the immunogenicity of various oral vaccines should be studied in different developing, transitional and industrialized

  19. Critical assessment of the use of growth monitoring for identifying high risk children in primary health care programmes.

    PubMed Central

    Briend, A.; Bari, A.

    1989-01-01

    OBJECTIVE--To see whether change in weight was a more useful index than weight for age in assessing the risk of dying among malnourished children. DESIGN--Prospective cohort study. SETTING--Rural community in Bangladesh being served by international health organisation. PARTICIPANTS--1011 Children aged under 5, of whom 66 died. END POINT--Efficient screening method for identifying malnourished children at risk of dying. MEASUREMENTS AND MAIN RESULTS--Weight was measured every month. Weight for age and monthly change in weight averaged over one and three months were calculated. Sensitivity and specificity curves were used to compare the values of these two variables in identifying children with a high risk of dying. Weight for age was more sensitive than change in weight at all levels of specificity. Changes in weight, however, were independently related to the risk of dying even when intercurrent diseases and low weight for age were taken into account. CONCLUSIONS--For identifying children with a high risk of dying weight for age is a more efficient screening tool than a recent change in weight. Growth monitoring as currently recommended for primary health care programmes in developing countries does not seem to be the most effective approach in identifying children in need of urgent help. PMID:2503147

  20. Monitoring

    DOEpatents

    Orr, Christopher Henry; Luff, Craig Janson; Dockray, Thomas; Macarthur, Duncan Whittemore

    2004-11-23

    The invention provides apparatus and methods which facilitate movement of an instrument relative to an item or location being monitored and/or the item or location relative to the instrument, whilst successfully excluding extraneous ions from the detection location. Thus, ions generated by emissions from the item or location can successfully be monitored during movement. The technique employs sealing to exclude such ions, for instance, through an electro-field which attracts and discharges the ions prior to their entering the detecting location and/or using a magnetic field configured to repel the ions away from the detecting location.

  1. Short report: immune response and occurrence of dengue infection in thai children three to eight years after vaccination with live attenuated tetravalent dengue vaccine.

    PubMed

    Chanthavanich, Pornthep; Luxemburger, Christine; Sirivichayakul, Chukiat; Lapphra, Keswadee; Pengsaa, Krisana; Yoksan, Sutee; Sabchareon, Arunee; Lang, Jean

    2006-07-01

    From 1992 to 1997, 140 Thai children 4-15 years of age received an investigational live attenuated tetravalent dengue vaccine (LATDV). These children were contacted 3-8 years later in 2001 to assess humoral immunity and investigate whether they were subsequently at higher risk of developing severe dengue. One hundred thirteen were successfully contacted and participated in this retrospective cohort study with two age- and address-matched controls per vaccinee. The number of vaccinated subjects with neutralizing antibodies increased compared with 3-8 years earlier, which was probably due to subsequent wild-type dengue infections. There were no excess hospitalizations for clinically suspected dengue fever (DF) or dengue hemorrhagic fever (DHF) in vaccinees (one with DF and three with DHF) compared with controls (14 with DHF). Results suggest that preexisting dengue antibodies induced by LATDV do not enhance dengue illness, and the use of the vaccine in a dengue-endemic area is safe.

  2. Clustered lot quality assurance sampling: a tool to monitor immunization coverage rapidly during a national yellow fever and polio vaccination campaign in Cameroon, May 2009.

    PubMed

    Pezzoli, L; Tchio, R; Dzossa, A D; Ndjomo, S; Takeu, A; Anya, B; Ticha, J; Ronveaux, O; Lewis, R F

    2012-01-01

    We used the clustered lot quality assurance sampling (clustered-LQAS) technique to identify districts with low immunization coverage and guide mop-up actions during the last 4 days of a combined oral polio vaccine (OPV) and yellow fever (YF) vaccination campaign conducted in Cameroon in May 2009. We monitored 17 pre-selected districts at risk for low coverage. We designed LQAS plans to reject districts with YF vaccination coverage <90% and with OPV coverage <95%. In each lot the sample size was 50 (five clusters of 10) with decision values of 3 for assessing OPV and 7 for YF coverage. We 'rejected' 10 districts for low YF coverage and 14 for low OPV coverage. Hence we recommended a 2-day extension of the campaign. Clustered-LQAS proved to be useful in guiding the campaign vaccination strategy before the completion of the operations.

  3. Pneumococcal pneumonia prevention among adults: is the herd effect of pneumococcal conjugate vaccination in children as good a way as the active immunization of the elderly?

    PubMed

    Prato, Rosa; Fortunato, Francesca; Martinelli, Domenico

    2016-01-01

    The indirect protection of adults as a result of pneumococcal conjugate vaccination of infants has been discussed from different epidemiological points of view. In some countries, including Italy, even after pediatric vaccination, vaccine serotypes are still responsible for most pneumonia and invasive diseases in the elderly. Although the Community-Acquired Pneumonia Immunization Trial in Adults (CAPITA) produced encouraging results, it has not showed the efficacy of the 13-valent conjugate vaccine in preventing pneumococcal community-acquired pneumonia regardless of the number of episodes and serotype. Addressing these points by monitoring the direct impact of adult vaccination in real life distinguished from the effects of herd immunity will assist public health decision-making on the most effective adult pneumococcal vaccination strategies.

  4. Functional Bioassays for Immune Monitoring of High-Risk Neuroblastoma Patients Treated with ch14.18/CHO Anti-GD2 Antibody

    PubMed Central

    Siebert, Nikolai; Seidel, Diana; Eger, Christin; Jüttner, Madlen; Lode, Holger N.

    2014-01-01

    Effective treatment of high-risk neuroblastoma (NB) remains a major challenge in pediatric oncology. Human/mouse chimeric monoclonal anti-GD2 antibody (mAb) ch14.18 is emerging as a treatment option to improve outcome. After establishing a production process in Chinese hamster ovary (CHO) cells, ch14.18/CHO was made available in Europe for clinical trials. Here, we describe validated functional bioassays for the purpose of immune monitoring of these trials and demonstrate GD2-specific immune effector functions of ch14.18/CHO in treated patients. Two calcein-based bioassays for complement-dependent- (CDC) and antibody-dependent cellular cytotoxicity (ADCC) were set up based on patient serum and immune cells tested against NB cells. For this purpose, we identified LA-N-1 NB cells as best suited within a panel of cell lines. Assay conditions were first established using serum and cells of healthy donors. We found an effector-to-target (E:T) cell ratio of 20∶1 for PBMC preparations as best suited for GD2-specific ADCC analysis. A simplified method of effector cell preparation by lysis of erythrocytes was evaluated revealing equivalent results at an E:T ratio of 40∶1. Optimal results for CDC were found with a serum dilution at 1∶8. For validation, both within-assay and inter-assay precision were determined and coefficients of variation (CV) were below 20%. Sample quality following storage at room temperature (RT) showed that sodium-heparin-anticoagulated blood and serum are stable for 48 h and 96 h, respectively. Application of these bioassays to blood samples of three selected high-risk NB patients treated with ch14.18/CHO (100 mg/m2) revealed GD2-specific increases in CDC (4.5–9.4 fold) and ADCC (4.6–6.0 fold) on day 8 compared to baseline, indicating assay applicability for the monitoring of multicenter clinical trials requiring sample shipment at RT for central lab analysis. PMID:25226154

  5. Human Polyomavirus JC monitoring and noncoding control region analysis in dynamic cohorts of individuals affected by immune-mediated diseases under treatment with biologics: an observational study

    PubMed Central

    2013-01-01

    Background Progressive multifocal leukoencephalopathy (PML) onset, caused by Polyomavirus JC (JCPyV) in patients affected by immune-mediated diseases during biological treatment, raised concerns about the safety profile of these agents. Therefore, the aims of this study were the JCPyV reactivation monitoring and the noncoding control region (NCCR) and viral protein 1 (VP1) analysis in patients affected by different immune-mediated diseases and treated with biologics. Methods We performed JCPyV-specific quantitative PCR of biological samples collected at moment of recruitment (t0) and every 4 months (t1, t2, t3, t4). Subsequently, rearrangements’ analysis of NCCR and VP1 was carried out. Data were analyzed using χ2 test. Results Results showed that at t0 patients with chronic inflammatory rheumatic diseases presented a JCPyV load in the urine significantly higher (p≤0.05) than in patients with multiple sclerosis (MS) and Crohn’s disease (CD). It can also be observed a significant association between JC viruria and JCPyV antibodies after 1 year of natalizumab (p=0.04) in MS patients. Finally, NCCR analysis showed the presence of an archetype-like sequence in all urine samples, whereas a rearranged NCCR Type IR was found in colon-rectal biopsies collected from 2 CD patients after 16 months of infliximab. Furthermore, sequences isolated from peripheral blood mononuclear cells (PBMCs) of 2 MS patients with JCPyV antibody at t0 and t3, showed a NCCR Type IIR with a duplication of a 98 bp unit and a 66 bp insert, resulting in a boxB deletion and 37 T to G transversion into the Spi-B binding site. In all patients, a prevalence of genotypes 1A and 1B, the predominant JCPyV genotypes in Europe, was observed. Conclusions It has been important to understand whether the specific inflammatory scenario in different immune-mediated diseases could affect JCPyV reactivation from latency, in particular from kidneys. Moreover, for a more accurate PML risk stratification

  6. Immune System

    MedlinePlus

    ... How Can I Help a Friend Who Cuts? Immune System KidsHealth > For Teens > Immune System Print A A ... could put us out of commission. What the Immune System Does The immune (pronounced: ih-MYOON) system, which ...

  7. Persistence of hepatitis A virus antibodies after primary immunization and response to revaccination in children and adolescents with perinatal HIV exposure

    PubMed Central

    Gouvêa, Aída de Fátima Thomé Barbosa; Pinto, Maria Isabel de Moraes; Miyamoto, Maristela; Machado, Daisy Maria; Pessoa, Silvana Duarte; do Carmo, Fabiana Bononi; Beltrão, Suênia Cordeiro de Vasconcelos; Succi, Regina Célia de Menezes

    2015-01-01

    OBJECTIVE: To assess possible factors associated with the loss of antibodies to hepatitis A 7 years after the primary immunization in children of HIV-infected mothers and the response to revaccination in patients seronegative for hepatitis A. METHODS: Quantification of HAV antibodies by electrochemiluminescence was performed in 39 adolescents followed up at the Pediatric Aids Clinic of Federal University of São Paulo (Unifesp): 29 HIV-infected (HIV group) (median age: 12.8 years) and 10 HIV-exposed but non-infected (ENI group) (median age: 13.4 years). All of them received two doses of HAV vaccine (Havrix(r)) in 2002. RESULTS: The median age at primary immunization (PI) was 5.4 years for HIV group and 6.5 years for ENI group. All children, from both groups, had antibodies to HAV >20 mIU/mL after PI. Seven years later, the ENI group showed a median concentration of antibodies = 253.5 mIU/mL, while the HIV group = 113.0 mIU/mL (Mann-Whitney test, p=0.085). All ENI group and 23/29 (79.3%) from HIV group mantained HAV antibodies 7 years after PI. The levels of hepatitis A antibodies in the primary vaccination were the only factor independently associated with maintaining these antibodies for 7 years. The group that lost HAV seropositivity was revaccinated and 83.3% (5/6) responded with antibodies >20 mUI/mL. CONCLUSIONS: The antibodies levels acquired in the primary vaccination in the HIV group were the main factor associated with antibodies loss after HAV immunization. PMID:25918013

  8. Altered Immune Function Associated with Disordered Neural Connectivity and Executive Dysfunctions: A Neurophysiological Study on Children with Autism Spectrum Disorders

    ERIC Educational Resources Information Center

    Han, Yvonne M. Y.; Chan, Agnes S.; Sze, Sophia L.; Cheung, Mei-Chun; Wong, Chun-kwok; Lam, Joseph M. K.; Poon, Priscilla M. K.

    2013-01-01

    Previous studies have shown that children with autism spectrum disorders (ASDs) have impaired executive function, disordered neural connectivity, and abnormal immunologic function. The present study examined whether these abnormalities were associated. Seventeen high-functioning (HFA) and 17 low-functioning (LFA) children with ASD, aged 8-17…

  9. Air pollutant monitoring for the East Bay Children's Respiratory Health Study

    SciTech Connect

    Singer, Brett C.; Hotchi, Toshifumi; Hodgson, Alfred T.

    2002-11-01

    This report describes the methodology and presents the summary results of the air pollutant monitoring program conducted by Lawrence Berkeley National Laboratory in support of the East Bay Children's Respiratory Health Study. The full study is examining the effects of chronic exposure to traffic-related pollutants on respiratory health among 3rd and 4th grade children attending ten neighborhood elementary schools in the San Francisco East Bay Area (Hayward, San Leandro and Oakland, CA). The demographically similar schools are located at varying distances from the I-880 and CA-92 freeways. Several schools were selected because they are located within 300 m in the predominant downwind direction (east) from either of the freeways. Measurements of multiple pollutants were made outdoors at the schools over 1-2 week intervals for 14 weeks in spring and eight weeks in fall 2001 using a custom-designed and validated package of commercially available monitoring equipment. Particulate matter was sampled over all hours (24 h per day) or during schools hours only with battery-operated programmable pumps and inlet devices for PM{sub 10} and PM{sub 2.5}. These pumps were modified to allow for up to 10 days of continuous operation. Fine particle mass and black carbon (BC) were determined from the collected filters. Nitrogen oxides (NO{sub x} and NO{sub 2}) were measured with passive samplers. Carbon monoxide (CO) was measured continuously with an electrochemical sensor. Gasoline-related volatile organic compounds (VOCs) were measured with passive samplers during three 4-week intervals in spring 2001 and two 4-week periods in early 2002. All samplers were deployed in a metal cabinet located outside at each school. Ranges of study average pollutant concentrations (all-hours) at the ten individual schools were: NO{sub x}, 33-68 ppb; NO{sub 2}, 19-31 ppb; PM{sub 10} mass, 27-32 {micro}g/m{sup 3}; PM{sub 2.5} mass, 12-15 {micro}g/m{sup 3}; and BC associated with PM{sub 2.5}, 0

  10. Noninvasive epicutaneous transfontanelle intracranial pressure monitoring in children under the age of 1 year: a novel technique.

    PubMed

    Behmanesh, Bedjan; Setzer, Matthias; Noack, Anika; Bartels, Marco; Quick-Weller, Johanna; Seifert, Volker; Freiman, Thomas M

    2016-09-01

    Monitoring of intracranial pressure (ICP) may be indicated in children with traumatic brain injury, premature intraventricular hemorrhage, or hydrocephalus. The standard technique is either a direct measurement with invasive intracranial insertion of ICP probes or indirect noninvasive assessment using transfontanelle ultrasonography to measure blood flow. The authors have developed a new technique that allows noninvasive epicutaneous transfontanelle ICP measurement with standard ICP probes. They compared the ICP measurements obtained using the same type of standard probe used in 2 different ways in 5 infants (age < 1 year) undergoing surgery for craniosynostosis. The first ICP probe was implanted epidurally (providing control measurements) and the second probe was fixed epicutaneously on the skin over the reopened frontal fontanelle. ICP values were measured hourly for the first 24 hours after surgery and the values obtained with the 2 methods were compared using Bland-Altman 2-methods analysis. A total of 110 pairs of measurements were assessed. There was no significant difference between the ICPs measured using the epicutaneous transfontanelle method (mean 13.10 mm Hg, SEM 6.68 mm Hg) and the epidural measurements (mean 12.46 mm Hg, SEM 6.45 mm Hg; p = 0.4643). The results of this analysis indicate that epicutaneous transfontanelle measurement of ICP is a reliable method that allows noninvasive ICP monitoring in children under the age of 1 year. Such noninvasive ICP monitoring could be implemented in the therapy of children with traumatic brain injury or intraventricular hemorrhage or for screening children with elevated ICP without invasive intracranial implantation of ICP probes.

  11. A Videotaped Self-Modelling and Self-Monitoring Treatment Program to Decrease Off-Task Behaviour in Children with Autism

    ERIC Educational Resources Information Center

    Coyle, Catherine; Cole, Peter

    2004-01-01

    The value of a videotaped self-modelling and self-monitoring treatment program was investigated in the present study. The focus was the effect of the treatment program on the off-task classroom behaviour of 3 male children with autism. The participants were aged between 9 and 11 years. Two of the children were described as severely autistic and…

  12. Atopic dermatitis and association of risk for primary immune thrombocytopenia and autoimmune diseases among children: A nationwide population-based cohort study.

    PubMed

    Wei, Chang-Ching; Lin, Cheng-Li; Shen, Te-Chun; Tsai, Jeng-Dau

    2016-07-01

    Primary immune thrombocytopenia (ITP) is currently defined as an acquired autoimmune disorder with persistent thrombocytopenia. However, the temporal interaction between T helper type 2 cell (Th2)-mediated allergic diseases and T helper type 1 cell (Th1)-mediated ITP remains unknown. Atopic dermatitis (AD) is considered one of the first steps in the atopic march. Herein, we conducted a population-based cohort analysis to investigate the risk of ITP in children with AD in comparison with non-AD controls. We subsequently compared the occurrence of other autoimmune diseases in ITP children in both AD and non-AD cohorts. From 2000 to 2007, 120,704 children with newly diagnosed AD and 241,408 randomly selected non-AD controls were included in the study. By the end of 2008, incidences of ITP in both cohorts and the AD cohort to non-AD cohort hazard ratios (HRs) and confidence intervals (CIs) were measured. Comparison of the occurrence of other autoimmune diseases in ITP between children with and without AD was analyzed. The incidence of ITP during the study period was 1.72-fold greater (95% CI: 1.13-2.62) in the AD cohort than in the non-AD cohort (6.96 vs 4.00 per 100,000 person-years). The risk was greatest among male children, children >2 years, those in densely populated areas, and those with white-collar parents. The HR of ITP in AD children increased significantly with the number of AD-related clinical visits (P < 0.001). The risk of developing ITP in the AD cohort was highest within the first 3 years after the diagnosis of AD (HR: 1.78; CI: 1.14-2.78). The AD cohort with ITP had a higher occurrence rate of other autoimmune diseases than the non-AD cohort with ITP. AD children had a greater risk of developing ITP and other autoimmune diseases. Further research is needed to clarify the role of allergy in the pathogenesis of ITP and autoimmune diseases. PMID:27442647

  13. Do-Not-Resuscitate Orders and/or Hospice Care, Psychological Health, and Quality of Life among Children/Adolescents with Acquired Immune Deficiency Syndrome

    PubMed Central

    Lyon, Maureen E.; Williams, Paige L.; Woods, Elizabeth R.; Hutton, Nancy; Butler, Anne M.; Sibinga, Erica; Brady, Michael T.; Oleske, James M.

    2009-01-01

    Objective The frequency of do-not-resuscitate (DNR) orders and hospice enrollment in children/adolescents living with acquired immune deficiency syndrome (AIDS) and followed in Pediatric AIDS Clinical Trials Group (PACTG) Study 219C was examined, and evaluated for any association with racial disparities or enhanced quality of life (QOL), particularly psychological adjustment. Methods A cross-sectional analysis of children with AIDS enrolled in this prospective multicenter observational study between 2000 and 2005 was conducted to evaluate the incidence of DNR/hospice overall and by calendar time. Linear regression models were used to compare caregivers' reported QOL scores within 6 domains between those with and without DNR/hospice care, adjusting for confounders. Results Seven hundred twenty-six (726) children with AIDS had a mean age of 12.9 years (standard deviation [SD] = 4.5), 51% were male, 60% black, 25% Hispanic. Twenty-one (2.9%) had either a DNR order (n = 16), hospice enrollment (n = 7), or both (n = 2). Of 41 children who died, 80% had no DNR/hospice care. Increased odds of DNR/hospice were observed for those with CD4% less than 15%, no current antiretroviral use, and prior hospitalization. No differences by race were detected. Adjusted mean QOL scores were significantly lower for those with DNR/hospice enrollment than those without across all domains except for psychological status and health care utilization. Poorer psychological status correlated with higher symptom distress, but not with DNR/hospice enrollment after adjusting for symptoms. Conclusions Children who died of AIDS rarely had DNR/hospice enrollment. National guidelines recommend that quality palliative care be integrated routinely with HIV care. Further research is needed to explore the barriers to palliative care and advance care planning in this population. PMID:18363489

  14. Electrocortical and Behavioral Measures of Response Monitoring in Young Children During a Go/No-Go Task

    PubMed Central

    Torpey, Dana C.; Hajcak, Greg; Kim, Jiyon; Kujawa, Autumn; Klein, Daniel N.

    2012-01-01

    The current study examined behavioral measures and response-locked event-related brain potentials (ERPs) derived from a Go/No-Go task in a large (N = 328) sample of 5- to 7-year-olds in order to better understand the early development of response monitoring and the impact of child age and sex. In particular, the error-related negativity (ERN, defined on both error trials alone and the difference between error and correct trials, or ΔERN), correct response negativity (CRN), and error positivity (Pe) were examined. Overall, the ERN, CRN, and the Pe were spatially and temporally similar to those measured in adults and older children. Even within our narrow age range, older children were faster and more accurate; a more negative ΔERN and a more positive Pe were associated with: increasing age, increased accuracy, and faster reaction times on errors, suggesting these enhanced components reflected more efficient response monitoring of errors over development. Girls were slower and more accurate than boys, although both genders exhibited comparable ERPs. Younger children and girls were characterized by increased posterror slowing, although they did not demonstrate improved posterror accuracy. Posterror slowing was also related to a larger Pe and reduced posterror accuracy. Collectively, these data suggest that posterror slowing may be unrelated to cognitive control and may, like the Pe, reflect an orienting response to errors. PMID:21815136

  15. Community Monitoring Systems: Tracking and Improving the Well-Being of America's Children and Adolescents. NIH Publication No. 07-5852

    ERIC Educational Resources Information Center

    National Institute on Drug Abuse (NIDA), 2007

    2007-01-01

    Monitoring the well-being of children and adolescents is a critical component of efforts to prevent psychological, behavioral, and health problems and to promote their successful development. Research during the past 40 years has helped identify aspects of child and adolescent functioning that are important to monitor. These aspects, which…

  16. The Effect of Delayed-JOLs and Sentence Generation on Children's Monitoring Accuracy and Regulation of Idiom Study

    ERIC Educational Resources Information Center

    van Loon, Mariëtte H.; de Bruin, Anique B. H.; van Gog, Tamara; van Merriënboer, Jeroen J. G.

    2013-01-01

    When studying verbal materials, both adults and children are often poor at accurately monitoring their level of learning and regulating their subsequent restudy of materials, which leads to suboptimal test performance. The present experiment investigated how monitoring accuracy and regulation of study could be improved when learning idiomatic…

  17. What Strategies Are Appropriate for Monitoring Children outside of Family Care and Evaluating the Impact of the Programs Intended to Serve Them?

    ERIC Educational Resources Information Center

    Ager, Alastair; Zimmerman, Cathy; Unlu, Kathy; Rinehart, Richard; Nyberg, Beverly; Zeanah, Charles; Hunleth, Jean; Bastiaens, Ida; Weldy, Andre; Bachman, Gretchen; Blum, Alexander B.; Strottman, Kathleen

    2012-01-01

    Objectives: To strengthen the evidence-base for policy and practice for support of children outside of family care requires effective, efficient and sustainable mechanisms for monitoring and evaluation. Toward that end, two core questions guided a systematic review of evidence: What strategies are appropriate for monitoring the needs and…

  18. Vitamin A supplements, routine immunization, and the subsequent risk of Plasmodium infection among children under 5 years in sub-Saharan Africa

    PubMed Central

    Hollm-Delgado, Maria-Graciela; Piel, Frédéric B; Weiss, Daniel J; Howes, Rosalind E; Stuart, Elizabeth A; Hay, Simon I; Black, Robert E

    2015-01-01

    Recent studies, partly based on murine models, suggest childhood immunization and vitamin A supplements may confer protection against malaria infection, although strong evidence to support these theories in humans has so far been lacking. We analyzed national survey data from children aged 6–59 months in four sub-Saharan African countries over an 18-month time period, to determine the risk of Plasmodium spp. parasitemia (n=8390) and Plasmodium falciparum HRP-2 (PfHRP-2)-related antigenemia (n=6121) following vitamin A supplementation and standard vaccination. Bacille Calmette Guerin-vaccinated children were more likely to be PfHRP-2 positive (relative risk [RR]=4.06, 95% confidence interval [CI]=2.00–8.28). No association was identified with parasitemia. Measles and polio vaccination were not associated with malaria. Children receiving vitamin A were less likely to present with parasitemia (RR=0.46, 95% CI=0.39–0.54) and antigenemia (RR=0.23, 95% CI=0.17–0.29). Future studies focusing on climate seasonality, placental malaria and HIV are needed to characterize better the association between vitamin A and malaria infection in different settings. DOI: http://dx.doi.org/10.7554/eLife.03925.001 PMID:25647726

  19. Systematic Monitoring of Young Children's Social-Emotional Competence and Challenging Behaviors

    ERIC Educational Resources Information Center

    Classen, Audra; Cheatham, Gregory A.

    2015-01-01

    Many children in preschool need support developing appropriate social-emotional competencies. Supportive early educators build confidence in young children to express and regulate emotions, develop solutions to problems, interact with peers, and persist when faced with challenges (Denham, 2006; Webster-Stratton & Reid, 2004). This article…

  20. Age at Assessment a Critical Factor When Monitoring Early Communicative Skills in Children with Galactosaemia

    ERIC Educational Resources Information Center

    Lewis, Fiona M.; DeJonge, Shannon M.; Coman, David J.

    2014-01-01

    Sub-optimal language development is associated with the metabolic disorder galactosaemia (GAL). Some children with GAL are identified with language impairment from the initial stages of language learning, but a subset of children may exhibit disrupted developmental gains in speech and language skill after a period of age-appropriate skill…

  1. A feasibility study of wearable activity monitors for pre-adolescent school-age children

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Understanding physical activity is the key to fighting childhood obesity. The objective of this study was to examine the feasibility of using certian wearable devices to measure physical activity among children. A qualitative study was conducted with 25 children aged 7 to 10 yearsto assess acceptabi...

  2. A feasibility study of wearable activity monitors for pre-adolescent school-aged children

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Understanding physical activity is key in the fight against childhood obesity. The objective of this study was to examine the feasibility of using certain wearable devices to measure physical activity among children. A qualitative study was conducted with 25 children aged 7 to 10 years to assess ac...

  3. Persistence of T-cell immune response induced by two acellular pertussis vaccines in children five years after primary vaccination.

    PubMed

    Palazzo, Raffaella; Carollo, Maria; Bianco, Manuela; Fedele, Giorgio; Schiavoni, Ilaria; Pandolfi, Elisabetta; Villani, Alberto; Tozzi, Alberto E; Mascart, Françoise; Ausiello, Clara M

    2016-01-01

    The resurgence of pertussis suggests the need for greater efforts to understand the long-lasting protective responses induced by vaccination. In this paper we dissect the persistence of T memory responses induced by primary vaccination with two different acellular pertussis (aP) vaccines, hexavalent Hexavac® vaccine (Hexavac) (Sanofi Pasteur MSD) and Infanrix hexa® (Infanrix) (Glaxo-SmithKline Biologicals). We evaluated magnitude and duration of T-cell responses to pertussis toxin (PT) by measuring T-cell proliferation, cytokines (IL-2 and IFNγ) production and memory subsets in two groups of children 5 years after primary vaccination. Some of the enrolled children received only primary vaccination, while others had the pre-school boost dose. Positive T-cell responses to PT were detected in 36% of children. Percentage of responsive children, T-cell proliferation and CD4IL-2+ cells were significantly higher in the children primed with Hexavac than in those who received Infanrix vaccine. No major effects of the boost on PT-specific proliferation were observed. Overall, our data documented a persistence of T-cell memory against PT in a minor fraction of children 5 years after primary vaccination. The different responses induced by Hexavac and Infanrix vaccine could rely on differences in PT inactivation process or excipients/adjuvants formulations.

  4. Persistence of T-cell immune response induced by two acellular pertussis vaccines in children five years after primary vaccination.

    PubMed

    Palazzo, Raffaella; Carollo, Maria; Bianco, Manuela; Fedele, Giorgio; Schiavoni, Ilaria; Pandolfi, Elisabetta; Villani, Alberto; Tozzi, Alberto E; Mascart, Françoise; Ausiello, Clara M

    2016-01-01

    The resurgence of pertussis suggests the need for greater efforts to understand the long-lasting protective responses induced by vaccination. In this paper we dissect the persistence of T memory responses induced by primary vaccination with two different acellular pertussis (aP) vaccines, hexavalent Hexavac® vaccine (Hexavac) (Sanofi Pasteur MSD) and Infanrix hexa® (Infanrix) (Glaxo-SmithKline Biologicals). We evaluated magnitude and duration of T-cell responses to pertussis toxin (PT) by measuring T-cell proliferation, cytokines (IL-2 and IFNγ) production and memory subsets in two groups of children 5 years after primary vaccination. Some of the enrolled children received only primary vaccination, while others had the pre-school boost dose. Positive T-cell responses to PT were detected in 36% of children. Percentage of responsive children, T-cell proliferation and CD4IL-2+ cells were significantly higher in the children primed with Hexavac than in those who received Infanrix vaccine. No major effects of the boost on PT-specific proliferation were observed. Overall, our data documented a persistence of T-cell memory against PT in a minor fraction of children 5 years after primary vaccination. The different responses induced by Hexavac and Infanrix vaccine could rely on differences in PT inactivation process or excipients/adjuvants formulations. PMID:26922984

  5. Epidemiology of children with acquired immune deficiency syndrome (stage 3): A referral hospital-based study in Iran.

    PubMed

    Movahedi, Zahra; Mahmoudi, Shima; Pourakbari, Babak; Keshavarz Valian, Nasrin; Sabouni, Farah; Ramezani, Amitis; Bahador, Abbas; Mamishi, Setareh

    2016-01-01

    Lack of recognition of human immunodeficiency virus (HIV) infection especially in children and delayed implementation of effective control programs makes HIV infection as a major cause for concern. Information on HIV epidemiology in Iran as well as other Islamic countries is limited. The aim of our study was to describe the clinical manifestation and laboratory finding of HIV infected children who were admitted to a referral Children Medical Center (CMC) in Tehran, Iran, during 11 years from January 2002 to January 2013. This was a retrospective study carried out over a period of 11 years. The records of all patients attending to the CMC with confirmed acquired immunodeficiency syndrome (AIDS) were screened. The patients were evaluated for social circumstance, family history, age, gender, clinical, and laboratory features. Clinical data including fever, respiratory distress, diarrhea, rash, etc. as well as laboratory tests including complete blood count, serum glucose level, electrolytes, liver function test, cultures, CD4 lymphocyte count were evaluated. During the study period, 32 HIV positive children were enrolled. The majority of patients were presented with weight loss, prolonged fever, respiratory infection and chronic diarrhea. In this study, salmonella infections as well as streptococcal pneumonia and candida infections followed by, tuberculosis and Pseudomonas aeruginosa infections were the predominant opportunistic infections. Since the number of HIV-positive children has been alarmingly increasing in recent years and perinatal transmission is the most common route of HIV infection in children, essential recommendations for prenatal HIV testing as well as appropriate antiretroviral therapy by HIV infected mothers are needed.

  6. Time trends in pediatric Herpes zoster hospitalization rate after Varicella immunization.

    PubMed

    Critselis, Elena; Theodoridou, Kalliopi; Alexopoulou, Zoi; Theodoridou, Maria; Papaevangelou, Vassiliki

    2016-06-01

    Herpes zoster (HZ) is an emerging concern for public health officials. The aim of this study was to determine whether universal Varicella immunization implemented in 2004 had an impact on HZ hospitalization in immunocompetent children in Greece. All HZ hospitalizations were recorded during the period 1999-2011. The overall attributable hospitalization rate was 13.89 cases/1000 hospital admissions (95%CI: 11.69-16.38 cases/1000 hospital admissions). HZ hospitalization rate remained unchanged during the study period. These data provide a basis for monitoring HZ hospitalization rate among children following universal toddler immunization.

  7. The State of the World's Children 1985: A Report by United Nations Children's Fund (UNICEF).

    ERIC Educational Resources Information Center

    Early Child Development and Care, 1985

    1985-01-01

    Reports four basic strategies of the current child survival revolution in the world: use of oral rehydration therapy (ORT) for preventing and treating diarrheal dehydration (the biggest single killer of children in the modern world), growth monitoring to prevent child malnutrition, breast-feeding, and immunization to provide protection against six…

  8. Cavitron ultrasonic surgical aspirator and visual evoked potential monitoring for chiasmal gliomas in children. Report of two cases.

    PubMed

    Albright, A L; Sclabassi, R J

    1985-07-01

    The Cavitron ultrasonic surgical aspirator (CUSA) and intraoperative visual evoked potentials (VEP's) were found to be helpful in treating two children with difficult chiasmal gliomas. Approximately 60% of one tumor and 85% of the other was resected without change in the intraoperative VEP's and with no change in postoperative visual fields or acuity. The CUSA-VEP technique is useful in the infant to "buy time" for brain maturation, delaying or obviating subsequent radiotherapy. This approach may be helpful in the older child to reduce the tumor burden for subsequent chemotherapy. Chiasmal gliomas can be subtotally resected with the CUSA while visual function is monitored by intraoperative VEP's.

  9. Predicting, Monitoring, and Managing Hypercalcemia Secondary to 13-Cis-Retinoic Acid Therapy in Children With High-risk Neuroblastoma.

    PubMed

    Chen, Suet Ching; Murphy, Dermot; Sastry, Jairam; Shaikh, Mohamad G

    2015-08-01

    13-cis-retinoic acid is an established component of treatment for children with high-risk neuroblastoma. However, significant hypercalcemia is increasingly recognized as a potentially life-threatening dosage-related side effect. We present 2 patients with significant hypercalcemia secondary to 13-cis-retinoic acid and their management, and identified the predictive factors for susceptibility to hypercalcemia. Assessing glomerular filtration rate and concomitant medication help predict individual susceptibility to hypercalcemia. Calcium levels should be monitored at days 1, 7, and 14 of each course of retinoic acid. An algorithm for the management of hypercalcemia during the affected and subsequent cycles of retinoid therapy is proposed.

  10. Monitoring acetylcholinesterase levels in migrant agricultural workers and their children using a portable test kit.

    PubMed

    Higgins, G M; Muñiz, J F; McCauley, L A

    2001-02-01

    The EQM Research, Inc., portable test kit was evaluated as a surveillance tool for blood cholinesterase levels among migrant workers and their children. Laboratory validation demonstrated a linear relationship between the reference Ellman and kit methods (Ellman = 0.95 x kit result + 0.82, r2 = 0.98). Pre- and post-season cholinesterase levels measured in 70 farm workers were within normal ranges, but significantly different at 28.5 and 29.7 U/g Hb, respectively (paired t-test, p = 0.014). Results from 98 migrant farm worker children and a comparison group of 53 age-matched non-agricultural children showed that cholinesterase levels were not significantly different between the agricultural and non-agricultural children (ANOVA, p = 0.69). These data demonstrate that a portable test kit can provide useful data pesticide exposures when measurements are made in a temperature-controlled setting. PMID:11398901

  11. Higher frequency of HIV-1-specific T cell immune responses in African American children vertically infected with HIV-1.

    PubMed

    Sharp, Elizabeth R; Barbour, Jason D; Karlsson, R Karl; Jordan, Kimberly A; Sandberg, Johan K; Wiznia, Andrew; Rosenberg, Michael G; Nixon, Douglas F

    2005-11-15

    The progression of human immunodeficiency virus (HIV) disease and plasma levels of HIV may differ between racial groups. We compared HIV-specific T cell responses between vertically HIV-1-infected Hispanic and African American children. Subjects were matched for sex, age, viral load, and CD4(+) cell count in 18 pairs; T cell responses were measured by cytokine-enhanced interferon- gamma assay. Peripheral blood mononuclear cells were stimulated with HIV consensus peptides from Gag, Nef, and Tat. The influence of ethnicity, sex, age, viral load, and CD4(+) cell count on T cell responses was determined through linear regression analyses. After adjustment for CD4(+) count, age, and log(10) viral load, African American children demonstrated significantly higher Gag responses (average, 486 spot-forming cells higher; P=.01) than Hispanic children; this was significantly driven by robust responses in African American girls near the age of puberty, many of whom carried the human leukocyte antigen class I B*58 allele.

  12. 75 FR 61506 - Advisory Committee on Immunization Practices (ACIP)

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-10-05

    ... HUMAN SERVICES Centers for Disease Control and Prevention Advisory Committee on Immunization Practices...; Pertussis vaccine; Influenza vaccines; the 2011 Immunization Schedule for adults, children & adolescents... Person for More Information: Leola Mitchell, National Center for Immunization and Respiratory...

  13. Radiogenomics Monitoring in Breast Cancer Identifies Metabolism and Immune Checkpoints as Early Actionable Mechanisms of Resistance to Anti-angiogenic Treatment.

    PubMed

    Mehta, Shaveta; Hughes, Nick P; Li, Sonia; Jubb, Adrian; Adams, Rosie; Lord, Simon; Koumakis, Lefteris; van Stiphout, Ruud; Padhani, Anwar; Makris, Andreas; Buffa, Francesca M; Harris, Adrian L

    2016-08-01

    Anti-VEGF antibody bevacizumab has prolonged progression-free survival in several cancer types, however acquired resistance is common. Adaption has been observed pre-clinically, but no human study has shown timing and genes involved, enabling formulation of new clinical paradigms. In a window-of-opportunity study in 35 ductal breast cancer patients for 2weeks prior to neoadjuvant chemotherapy, we monitored bevacizumab response by Dynamic Contrast-Enhanced Magnetic Resonance [DCE-MRI], transcriptomic and pathology. Initial treatment response showed significant overall decrease in DCE-MRI median K(trans), angiogenic factors such ESM1 and FLT1, and proliferation. However, it also revealed great heterogeneity, spanning from downregulation of blood vessel density and central necrosis to continued growth with new vasculature. Crucially, significantly upregulated pathways leading to resistance included glycolysis and pH adaptation, PI3K-Akt and immune checkpoint signaling, for which inhibitors exist, making a strong case to investigate such combinations. These findings support that anti-angiogenesis trials should incorporate initial enrichment of patients with high K(trans), and a range of targeted therapeutic options to meet potential early resistance pathways. Multi-arm adaptive trials are ongoing using molecular markers for targeted agents, but our results suggest this needs to be further modified by much earlier adaptation when using drugs affecting the tumor microenvironment.

  14. Efficacy, safety, and dose response of intravenous anti-D immune globulin (WinRho SDF) for the treatment of idiopathic thrombocytopenic purpura in children.

    PubMed

    Freiberg, A; Mauger, D

    1998-01-01

    We analyzed data from 20 children treated for acute or chronic idiopathic (immune) thrombocytopenic purpura (ITP) at a single institution to determine the relationship between dose of intravenous anti-D immune globulin (WinRho SDF; Nabi, Boca Raton, FL), increase in platelet count, and decrease in hemoglobin in the therapy of ITP. Higher doses of anti-D were clearly associated with a greater therapeutic response in the platelet count, with no increase in hemolysis for both acute and chronic ITP. A significant correlation was found between dose and peak increase in platelet count measured in the 14 days following administration. This effect was present for both acute ITP (17 infusions, P = .0001) and chronic ITP (30 infusions, P = .038). Although hemolysis was seen in nearly all infusions, with a median hemoglobin fall of 1.9 g/dL (range, 0 to 4.2), the decrease in hemoglobin was greater than 2.5 for only three infusions, and the largest fall in hemoglobin (4.2) was in a child with an underlying hemolytic anemia. Furthermore, for both acute and chronic ITP there was no relationship between the decrease in hemoglobin and the dose given (P = .22), nor between the increase in platelet count and fall in hemoglobin (P = .27). This analysis supports the use of higher doses of anti-D for the treatment of ITP, and demonstrates the need for a trial of high-dose anti-D (>100 microg/kg) in acute and chronic ITP.

  15. Baicalin from the extract of Scutellaria baicalensis affects the innate immunity and apoptosis in leukocytes of children with acute lymphocytic leukemia.

    PubMed

    Orzechowska, B; Chaber, R; Wiśniewska, A; Pajtasz-Piasecka, E; Jatczak, B; Siemieniec, I; Gulanowski, B; Chybicka, A; Błach-Olszewska, Z

    2014-12-01

    Scutellariae Radix (root of Scutellaria baicalensis) has a long history of application in traditional and in modern herbal medications. The major components of Scutellariae Radix are baicalin, baicalein, wogonoside and wogonin. Accumulating evidence demonstrates that Scutellaria has immunomodulatory effects and possesses compelling anticancer potential. Treatment of peripheral blood leukocytes (PBLs) with Scutellaria extract (SBE) enriched in baicalin, reduced viability of PBLs obtained from patients with acute lymphoblastic leukemia (ALL). SBE had no impact on the survival of healthy, control leukocytes. The immune system modulation by SBE resulted in increased production of IFNγ in PBLs, and reduced TNFα and IL-10 production in bone marrow cells (BMC), in ALL patients. SBE stimulated the nonspecific antiviral immunity, assessed by resistance of PBLs and BMC to vesicular stomatitis virus (VSV) infection. SBE showed pro-apoptotic activity in NALM-6 cell line (B-type human leukemia). The number of cells expressing annexin V increased from 6% in control cultures to 29% and 52% after treatment with 100 μg/ml and 200 μg/ml respectively. Increased percentage of apoptotic cells was observed when cells were treated with corresponding concentration of baicalin. SBE enhanced apoptosis of PBLs in BMC of leukemic children. The percentage of PBLs that underwent apoptosis and mean annexin V expression increased from 11% in the control to 17% and 24% for the doses of 100 μg/ml and 200 μg/ml respectively. Importantly, SBE did not induce apoptosis of PBLs in the healthy, control group.

  16. Parental Monitoring of Children's Behavior: Variation across Stepmother, Stepfather, and Two-Parent Biological Families.

    ERIC Educational Resources Information Center

    Fisher, Philip A.; Leve, Leslie D.; O'Leary, Catherine C.; Leve, Craig

    2003-01-01

    Studies whether parental monitoring differs across two-parent biological families, stepmother families, and stepfather families. Two-parent biological families were hypothesized to have higher levels of monitoring than stepparent families. Controlling for demographic differences, two-parent biological families showed higher levels of monitoring…

  17. Effects of a Self-Monitoring Intervention on Children with Traumatic Brain Injury

    ERIC Educational Resources Information Center

    Davies, Susan C.; Jones, Kevin M.; Rafoth, Mary A.

    2010-01-01

    The purpose of this study was to examine the effects of a self-monitoring intervention on teachers' direct behavior ratings of 3 students with traumatic brain injury. The authors used a multiple-baseline-across-participants design to evaluate the effect of the strategy on each child's classwork and classroom behavior. The self-monitoring strategy…

  18. Validity of a Sun Safety Diary Using UV Monitors in Middle School Children

    ERIC Educational Resources Information Center

    Yaroch, Amy L.; Reynolds, Kim D.; Buller, David B.; Maloy, Julie A.; Geno, Cristy R.

    2006-01-01

    This article describes a validity study conducted among middle school students comparing self-reported sun safety behaviors from a diary with readings from ultraviolet (UV) monitors worn on different body sites. The UV monitors are stickers with panels that turn increasingly darker shades of blue in the presence of increasing amounts of UV light.…

  19. Immune response

    MedlinePlus

    ... cells. T cells are responsible for cell-mediated immunity. This type of immunity becomes deficient in persons with HIV, the virus ... blood. B lymphocytes provide the body with humoral immunity as they circulate in the fluids in search ...

  20. Immune Restoration

    MedlinePlus

    ... marrow cells immune to HIV infection. Letting the immune system repair itself: CD4 counts have increased for many ... have taken ART. Some scientists believe that the immune system might be able to heal and repair itself ...

  1. Analysis of 24-Hour Ambulatory Blood Pressure Monitoring in Children With Obstructive Sleep Apnea

    PubMed Central

    Kang, Kun-Tai; Chiu, Shuenn-Nan; Weng, Wen-Chin; Lee, Pei-Lin; Hsu, Wei-Chung

    2015-01-01

    Abstract In the present study, we aimed to verify associations between ambulatory blood pressure (ABP) and pediatric obstructive sleep apnea (OSA) in a hospital-based population. This was a cross-sectional observational study on children aged 4 to 16 years with OSA-related symptoms from a tertiary referral medical center. All children received overnight polysomnography and 24-hour recording of ABP. Severity of the disease was classified as primary snoring (apnea-hypopnea index, AHI <1), mild OSA (AHI 1–5), and moderate-to-severe OSA (AHI >5). For 195 children enrolled in this study (mean age, 7.8 ± 3.4 years; 69% boy), ABP increased as severity of OSA increased. During daytime, children with moderate-to-severe OSA had significantly higher systolic blood pressure (BP) (117.0 ± 12.7 vs 110.5 ± 9.3 mmHg), mean arterial pressure (MAP) (85.6 ± 8.1 vs 81.6 ± 6.8 mmHg), and diastolic BP load (12.0 ± 9.6 vs 8.4 ± 10.9 mmHg) compared with children with primary snoring. During nighttime, children with moderate-to-severe OSA had significantly higher systolic BP (108.6 ± 15.0 vs 100.0 ± 9.4 mmHg), MAP (75.9 ± 9.6 vs 71.1 ± 7.0 mmHg), systolic BP load (44.0 ± 32.6 vs 26.8 ± 24.5 mmHg), systolic BP index (0.5 ± 13.1 vs −6.8 ± 8.5 mmHg), and higher prevalence of systolic hypertension (47.6% vs 14.7 %) compared with children with primary snoring. Multiple linear regression analyses revealed an independent association between AHI and nighttime systolic BP and MAP after adjusting for adiposity variables. This large hospital-based study showed that children with moderate-to-severe OSA had a higher ABP compared with children who were primary snorers. As elevated BP in childhood predicts future cardiovascular risks, children with severe OSA should be treated properly to prevent further adverse cardiovascular outcomes. PMID:26448004

  2. 24-hour esophageal pH-monitoring in children suspected of gastroesophageal reflux disease: Analysis of intraesophageal pH monitoring values recorded in distal and proximal channel at diagnosis

    PubMed Central

    Semeniuk, Janusz; Kaczmarski, Maciej

    2007-01-01

    AIM: To assess values of 24-h esophageal pH-monitoring parameters with dual-channel probe (distal and proximal channel) in children suspected of gastroesophageal reflux disease (GERD). METHODS: 264 children suspected of gastroesophageal reflux (GER) were enrolled in a study (mean age χ = 20.78 ± 17.23 mo). The outcomes of this study, immunoallerrgological tests and positive result of oral food challenge test with a potentially noxious nutrient, enabled to qualify children into particular study groups. RESULTS: 32 (12.1%) infants (group 1) had physiological GER diagnosed. Pathological acid GER was confirmed in 138 (52.3%) children. Primary GER was diagnosed in 76 (28.8%) children (group 2) and GER secondary to allergy to cow milk protein and/or other food (CMA/FA) in 62 (23.5%) children (group 3). 32 (12.1%) of them had CMA/FA (group 4-reference group), and in remaining 62 (23.5%) children neither GER nor CMA/FA was confirmed (group 5). Mean values of pH monitoring parameters measured in distal and proximal channel were analyzed in individual groups. This analysis showed statistically significant differentiation of mean values in the case of: number of episodes of acid GER, episodes of acid GER lasting > 5 min, duration of the longest episode of acid GER in both channels, acid GER index total and supine in proximal channel. Statistically significant differences of mean values among examined groups, especially between group 2 and 3 in the case of total acid GER index (only distal channel) were confirmed. CONCLUSION: 24-h esophageal pH monitoring confirmed pathological acid GER in 52.3% of children with typical and atypical symptoms of GERD. The similar pH-monitoring values obtained in group 2 and 3 confirm the necessity of implementation of differential diagnosis for primary vs secondary cause of GER. PMID:17876877

  3. Off-label psychopharmacologic prescribing for children: History supports close clinical monitoring

    PubMed Central

    Zito, Julie M; Derivan, Albert T; Kratochvil, Christopher J; Safer, Daniel J; Fegert, Joerg M; Greenhill, Laurence L

    2008-01-01

    The review presents pediatric adverse drug events from a historical perspective and focuses on selected safety issues associated with off-label use of medications for the psychiatric treatment of youth. Clinical monitoring procedures for major psychotropic drug classes are reviewed. Prior studies suggest that systematic treatment monitoring is warranted so as to both minimize risk of unexpected adverse events and exposures to ineffective treatments. Clinical trials to establish the efficacy and safety of drugs currently being used off-label in the pediatric population are needed. In the meantime, clinicians should consider the existing evidence-base for these drugs and institute close clinical monitoring. PMID:18793403

  4. MONITORING THE EFFICACY OF MONTELUKAST USED IN CHILDREN WITH RISK OF ASTHMA.

    PubMed

    Pkhakadze, I; Alavidze, N; Gamkrelidze, S; Ekaladze, E

    2016-04-01

    The aim of the study is to evaluate the effect of Montelukast - leukotriene inhibitor in children population with risk of bronchial asthma. The research was conducted at LTD. Kutaisi Children primary care unit #3. The data were collected from January 2013 till January 2016. 104 patients (5-18 year, 43 girl, 61 boy), with potential risk of bronchial asthma were involved into the research, 47 (45%) patients out of 104 were considered as a real risk for asthma, based on Peak Expiratory Flow (PEF) and spirometry results. Patients with risk of asthma were grouped according to the method of treatment (monotherapy with inhaled glycocorticoid and inhaled glycocorticoid combined with leukotriene inhibitor). Descriptive statistics methods were used to characterize each variable. Our results indicate on positive influence of montelukast - selective leukotrien inhibitor in treatment of children with various forms of asthma. PMID:27249433

  5. Prospective molecular monitoring of BCR/ABL transcript in children with Ph+ acute lymphoblastic leukaemia unravels differences in treatment response.

    PubMed

    Cazzaniga, Giovanni; Lanciotti, Marina; Rossi, Vincenzo; Di Martino, Daniela; Aricò, Maurizio; Valsecchi, Maria Grazia; Basso, Giuseppe; Masera, Giuseppe; Micalizzi, Concetta; Biondi, Andrea

    2002-11-01

    Children with Philadelphia-chromosome-positive (Ph+) acute lymphoblastic leukaemia (ALL) represent a subgroup at very high risk for treatment failure, despite intensive chemotherapy. However, recent retrospective studies showed that Ph+ childhood ALL is a heterogeneous disease with regard to treatment response. We have prospectively monitored, by reverse transcription polymerase chain reaction (RT-PCR) during follow-up, the presence of the BCR/ABL fusion transcript in Ph+ ALL children diagnosed in the Italian multicentre Associazione Italiana Ematologia Oncologia Pediatrica ALL-AIEOP-95 therapy protocol. To our knowledge, this is the first report on the evaluation of minimal residual disease (MRD) in childhood Ph+ ALL prospectively enrolled in an intensive, Berlin-Frankfurt-Munster (BFM)-type treatment protocol. Twenty-seven of 36 (75.0%) Ph+ patients consecutively enrolled into the high-risk group of the AIEOP-ALL protocol between May 1995 and October 1999 were successfully analysed. Twenty were good responders to the pre-phase of prednisone/intrathecal methotrexate treatment (PGR) and seven were poor responders (PPR). Within the PPR group, the RT-PCR monitoring constantly showed positivity for the BCR/ABL fusion transcript and all the patients died of disease progression. In contrast, highly sensitive qualitative RT-PCR monitoring revealed heterogeneity within the PGR group of Ph+ childhood ALL patients. Three different subgroups could be defined, according to the clearance of Ph+ cells within the first 5 months of treatment. This provides useful information on the capability of chemotherapy to reduce the leukaemic clone, with prognostic implications.

  6. Antibody Avidity in Humoral Immune Responses in Bangladeshi Children and Adults following Administration of an Oral Killed Cholera Vaccine

    PubMed Central

    Alam, Mohammad Murshid; Leung, Daniel T.; Akhtar, Marjahan; Nazim, Mohammad; Akter, Sarmin; Uddin, Taher; Khanam, Farhana; Mahbuba, Deena Al; Ahmad, Shaikh Meshbahuddin; Bhuiyan, Taufiqur Rahman; Calderwood, Stephen B.; Ryan, Edward T.

    2013-01-01

    Antibody avidity for antigens following disease or vaccination increases with affinity maturation and somatic hypermutation. In this study, we followed children and adults in Bangladesh for 1 year following oral cholera vaccination and measured the avidity of antibodies to the T cell-dependent antigen cholera toxin B subunit (CTB) and the T cell-independent antigen lipopolysaccharide (LPS) in comparison with responses in other immunological measurements. Children produced CTB-specific IgG and IgA antibodies of high avidity following vaccination, which persisted for several months; the magnitudes of responses were comparable to those seen in adult vaccinees. The avidity of LPS-specific IgG and IgA antibodies in vaccinees increased significantly shortly after the second dose of vaccine but waned rapidly to baseline levels thereafter. CTB-specific memory B cells were present for only a short time following vaccination, and we did not find significant memory B cell responses to LPS in any age group. For older children, there was a significant correlation between CTB-specific memory T cell responses after the second dose of vaccine and CTB-specific IgG antibody avidity indices over the subsequent year. These findings suggest that vaccination induces a longer-lasting increase in the avidity of antibodies to a T cell-dependent antigen than is measured by a memory B cell response to that antigen and that early memory T cell responses correlate well with the subsequent development of higher-avidity antibodies. PMID:23925888

  7. The Effects of Summary Production and Encoding Condition on Children's Metacognitive Monitoring

    ERIC Educational Resources Information Center

    von der Linden, Nicole; Schneider, Wolfgang; Roebers, Claudia M.

    2011-01-01

    Two studies were conducted to investigate whether context variations were suitable to improve metacognitive judgments in children in a complex, everyday memory task. In the first phase of each experiment, participants were shown a short event (video) and gave judgments-of-learning (JOLs), that is, rated their certainty that they would later be…

  8. Development of Active Control within Working Memory: Active Retrieval versus Monitoring in Children

    ERIC Educational Resources Information Center

    Blain-Brière, Bénédicte; Bouchard, Caroline; Bigras, Nathalie; Cadoret, Geneviève

    2014-01-01

    This study aimed to compare children's performance on two mnemonic functions that engage the lateral prefrontal cortex. Brain imaging studies in adults have shown that the mid-ventrolateral prefrontal cortex is specifically involved in active controlled retrieval, and the mid-dorsolateral prefrontal cortex is specifically involved in…

  9. Actigraphic Monitoring during Sleep of Children with ADHD on Methylphenidate and Placebo

    ERIC Educational Resources Information Center

    Schwartz, George; Amor, Leila Ben; Grizenko, Natalie; Lageix, Philippe; Baron, Chantal; Boivin, Diane B.; Joober, Ridha

    2004-01-01

    Objective: Sleep disturbances appear as a comorbid condition in children with attention-deficit/hyperactivity disorder. The aim of this study was to investigate the relationship of activity levels during sleep and therapeutic response to methylphenidate (MPH). Method: Nightly sleep actigraphic recordings during a double-blind, placebo-controlled,…

  10. Children's Strategic Regulation, Metacognitive Monitoring, and Control Processes during Test Taking

    ERIC Educational Resources Information Center

    Krebs, Saskia S.; Roebers, Claudia M.

    2010-01-01

    Background: From the perspective of self-regulated learning, the interplay between learners' individual characteristics and the context of testing have been emphasized for assessing learning outcomes. Aims: The present study examined metacognitive processes in children's test-taking behaviour and explored their impacts on performance. Further, it…

  11. Quartz crystal microbalance-with dissipation monitoring (QCM-D) for real time measurements of blood coagulation density and immune complement activation on artificial surfaces.

    PubMed

    Andersson, Marcus; Andersson, Jonas; Sellborn, Anders; Berglin, Mattias; Nilsson, Bo; Elwing, Hans

    2005-07-15

    A recently developed variant of quartz crystal microbalance (QCM) called QCM-with dissipation monitoring (QCM-D) allows simultaneous and simple measurements of changes in adsorbed mass as well as the viscoelastic property (D-factor) of deposited protein layers on the sensor surface. We have taken the QCM-D technology a step further and demonstrated its advantages in the study of protein assembly as a consequence of surface induced immune complement activation, or contact activated blood coagulation. In the present study we have continued our QCM-D investigations of surface assembly of fibrin clot formation and complement activation and incubated differently modified quartz sensor surfaces in blood plasma and sera. Polymer surfaces used were spin-coated polyethylene, poly(ethylene terephtalate), poly(methylmetacrylate) and poly(dimethylsiloxane). Also used were sputtered titanium and heparin grafted surfaces. In this investigation we found that we could describe the surface induced coagulation with four independent parameters: (1) Time of onset of coagulation, (2) fibrin deposition rate, (3) total frequency shift at stable plateau, and (4) fibrin clot density. The most important finding was that the blood plasma clot density can be assessed with the use of D determinations and that the clot density varied significantly with the chemical composition of the surface. However, the D-factor did not give any new analytical information about the possible complement activation mechanisms. Nevertheless, the QCM-D was found to be a reliable tool for the analysis of surface induced complement activation. We also compared the QCM-D technique with traditional enzyme immuno assay (EIA) measurements of soluble products from the surface activation of the complement and coagulation systems. We found that the results from EIA and QCM-D measurements corresponded well for the complement activation but not for the coagulation, probably due to the biological complexity of the coagulation

  12. Monitoring training load, recovery-stress state, immune-endocrine responses, and physical performance in elite female basketball players during a periodized training program.

    PubMed

    Nunes, João A; Moreira, Alexandre; Crewther, Blair T; Nosaka, Ken; Viveiros, Luis; Aoki, Marcelo S

    2014-10-01

    This study investigated the effect of a periodized training program on internal training load (ITL), recovery-stress state, immune-endocrine responses, and physical performance in 19 elite female basketball players. The participants were monitored across a 12-week period before an international championship, which included 2 overloading and tapering phases. The first overloading phase (fourth to sixth week) was followed by a 1-week tapering, and the second overloading phase (eighth to 10th week) was followed by a 2-week tapering. ITL (session rating of perceived exertion method) and recovery-stress state (RESTQ-76 Sport questionnaire) were assessed weekly and bi-weekly, respectively. Pretraining and posttraining assessments included measures of salivary IgA, testosterone and cortisol concentrations, strength, jumping power, running endurance, and agility. Internal training load increased across all weeks from 2 to 11 (p ≤ 0.05). After the first tapering period (week 7), a further increase in ITL was observed during the second overloading phase (p ≤ 0.05). After the second tapering period, a decrease in ITL was detected (p ≤ 0.05). A disturbance in athlete stress-recovery state was noted during the second overloading period (p ≤ 0.05), before returning to baseline level in end of the second tapering period. The training program led to significant improvements in the physical performance parameters evaluated. The salivary measures did not change despite the fluctuations in ITL. In conclusion, a periodized training program evoked changes in ITL in elite female basketball players, which appeared to influence their recovery-stress state. The training plan was effective in preparing participants for competition, as indicated by improvements in recovery-stress state and physical performance after tapering.

  13. Increasing the Time of Exposure to Aerosol Measles Vaccine Elicits an Immune Response Equivalent to That Seen in 9-Month-Old Mexican Children Given the Same Dose Subcutaneously

    PubMed Central

    García-León, Miguel Leonardo; Espinosa-Torres Torrija, Bogart; Hernández-Pérez, Brenda; Cardiel-Marmolejo, Lino E.; Beeler, Judy A.; Audet, Susette; Santos-Preciado, José Ignacio

    2011-01-01

    Background. A 30-second aerosol measles vaccination successfully primes children 12 months of age and older but is poorly immunogenic when given to 9-month-old children. We examined the immune responses when increasing the duration to aerosol exposure in 9-month-olds. Methods. One hundred and thirteen healthy 9-month-old children from Mexico City were enrolled; 58 received aerosol EZ measles vaccine for 2.5 minutes and 55 subcutaneously. Measles-specific neutralizing antibodies and cellular responses were measured before and at 3 and 6 months postimmunization. Results. Adaptive immunity was induced in 97% after aerosol and 98% after subcutaneous administration. Seroconversion rates and GMCs were 95% and 373 mIU/mL (95% confidence interval [CI], 441–843) following aerosol vaccination and 91% and 306 mIU/mL (95% CI, 367–597) after subcutaneous administration at 3 months. The percentage of children with a measles-specific stimulation index ≥3 was 45% and 60% in the aerosol versus 55% and 59% in the subcutaneous group at 3 and 6 months, respectively. CD8 memory cell frequencies were higher in the aerosol group at 3 months compared with the subcutaneous group. Adverse reactions were comparable in both groups. Conclusions. Increasing exposure time to aerosol measles vaccine elicits immune responses that are comparable to those seen when an equivalent dose is administered by the subcutaneous route in 9-month-old infants. PMID:21742842

  14. Strain-specific Plasmodium falciparum multifunctional CD4(+) T cell cytokine expression in Malian children immunized with the FMP2.1/AS02A vaccine candidate.

    PubMed

    Graves, Shawna F; Kouriba, Bourema; Diarra, Issa; Daou, Modibo; Niangaly, Amadou; Coulibaly, Drissa; Keita, Yamoussa; Laurens, Matthew B; Berry, Andrea A; Vekemans, Johan; Ripley Ballou, W; Lanar, David E; Dutta, Sheetij; Gray Heppner, D; Soisson, Lorraine; Diggs, Carter L; Thera, Mahamadou A; Doumbo, Ogobara K; Plowe, Christopher V; Sztein, Marcelo B; Lyke, Kirsten E

    2016-05-17

    Based on Plasmodium falciparum (Pf) apical membrane antigen 1 (AMA1) from strain 3D7, the malaria vaccine candidate FMP2.1/AS02A showed strain-specific efficacy in a Phase 2 clinical trial in 400 Malian children randomized to 3 doses of the AMA1 vaccine candidate or control rabies vaccine on days 0, 30 and 60. A subset of 10 Pf(-) (i.e., no clinical malaria episodes) AMA1 recipients, 11 Pf(+) (clinical malaria episodes with parasites with 3D7 or Fab9-type AMA1 cluster 1 loop [c1L]) AMA1 recipients, and 10 controls were randomly chosen for analysis. Peripheral blood mononuclear cells (PBMCs) isolated on days 0, 90 and 150 were stimulated with full-length 3D7 AMA1 and c1L from strains 3D7 (c3D7) and Fab9 (cFab9). Production of IFN-γ, TNF-α, IL-2, and/or IL-17A was analyzed by flow cytometry. Among AMA1 recipients, 18/21 evaluable samples stimulated with AMA1 demonstrated increased IFN-γ, TNF-α, and IL-2 derived from CD4(+) T cells by day 150 compared to 0/10 in the control group (p<0.0001). Among AMA1 vaccines, CD4(+) cells expressing both TNF-α and IL-2 were increased in Pf(-) children compared to Pf(+) children. When PBMCs were stimulated with c3D7 and cFab9 separately, 4/18 AMA1 recipients with an AMA1-specific CD4(+) response had a significant response to one or both c1L. This suggests that recognition of the AMA1 antigen is not dependent upon c1L alone. In summary, AMA1-specific T cell responses were notably increased in children immunized with an AMA1-based vaccine candidate. The role of CD4(+)TNF-α(+)IL-2(+)-expressing T cells in vaccine-induced strain-specific protection against clinical malaria requires further exploration. Clinicaltrials.gov Identifier: NCT00460525. PMID:27087149

  15. Effects of Task Analysis and Self-Monitoring for Children with Autism in Multiple Social Settings

    ERIC Educational Resources Information Center

    Parker, Daniel; Kamps, Debra

    2011-01-01

    In this study, written task analyses with self-monitoring were used to teach functional skills and verbal interactions to two high-functioning students with autism in social settings with peers. A social script language intervention was included in two of the activities to increase the quantity of verbal interaction between the students and peers.…

  16. A, B Seeing: The Role of Constructive Processes in Children's Comprehension Monitoring.

    ERIC Educational Resources Information Center

    Rubman, Claire N.; Waters, Harriet Salatas

    2000-01-01

    Using a comprehension-monitoring model, 192 skilled and less skilled readers from 3rd and 6th grade read stories containing inconsistent information. Half of the students constructed a storyboard representation of the stories and half only read the text. Results reveal that storyboard construction enhanced the integration of text propositions and…

  17. Metacognitive Monitoring and Control Processes Involved in Primary School Children's Test Performance

    ERIC Educational Resources Information Center

    Roebers, Claudia M.; Schmid, Corinne; Roderer, Thomas

    2009-01-01

    Background: Within the context of students' self-regulated learning, the interplay between learners' individual characteristics and the context of testing have been emphasized for assessing learning outcomes. Aims: The present study examined metacognitive monitoring and control processes in elementary schoolchildren's test taking behaviour and…

  18. Meta-Immunological Profiling of Children With Type 1 Diabetes Identifies New Biomarkers to Monitor Disease Progression

    PubMed Central

    Galgani, Mario; Nugnes, Rosa; Bruzzese, Dario; Perna, Francesco; De Rosa, Veronica; Procaccini, Claudio; Mozzillo, Enza; Cilio, Corrado M.; Elding Larsson, Helena; Lernmark, Åke; La Cava, Antonio; Franzese, Adriana; Matarese, Giuseppe

    2013-01-01

    Type 1 diabetes is characterized by autoimmune destruction of pancreatic β-cells in genetically susceptible individuals. Triggers of islet autoimmunity, time course, and the precise mechanisms responsible for the progressive β-cell failure are not completely understood. The recent escalation of obesity in affluent countries has been suggested to contribute to the increased incidence of type 1 diabetes. Understanding the link between metabolism and immune tolerance could lead to the identification of new markers for the monitoring of disease onset and progression. We studied several immune cell subsets and factors with high metabolic impact as markers associated with disease progression in high-risk subjects and type 1 diabetic patients at onset and at 12 and 24 months after diagnosis. A multiple correlation matrix among different parameters was evaluated statistically and assessed visually on two-dimensional graphs. Markers to predict residual β-cell function up to 1 year after diagnosis were identified in multivariate logistic regression models. The meta-immunological profile changed significantly over time in patients, and a specific signature that was associated with worsening disease was identified. A multivariate logistic regression model measuring age, BMI, fasting C-peptide, number of circulating CD3+CD16+CD56+ cells, and the percentage of CD1c+CD19−CD14−CD303− type 1 myeloid dendritic cells at disease onset had a significant predictive value. The identification of a specific meta-immunological profile associated with disease status may contribute to our understanding of the basis of diabetes progression. PMID:23396400

  19. A New Method to Monitor the Contribution of Fast Food Restaurants to the Diets of US Children

    PubMed Central

    Rehm, Colin D.; Drewnowski, Adam

    2014-01-01

    Background American adults consume 11.3% of total daily calories from foods and beverages from fast food restaurants. The contribution of different types of fast food restaurants to the diets of US children is unknown. Objective To estimate the consumption of energy, sodium, added sugars, and solid fats among US children ages 4–19 y by fast food restaurant type. Methods Analyses used the first 24-h recall for 12,378 children in the 2003–2010 cycles of the nationally representative National Health and Nutrition Examination Survey (NHANES 2003–2010). NHANES data identify foods by location of origin, including stores and fast food restaurants (FFR). A novel custom algorithm divided FFRs into 8 segments and assigned meals and snacks to each. These included burger, pizza, sandwich, Mexican, Asian, fish, and coffee/snack restaurants. The contribution of each restaurant type to intakes of energy and other dietary constituents was then assessed by age group (4–11 y and 12–19 y) and by race/ethnicity. Results Store-bought foods and beverages provided 64.8% of energy, 61.9% of sodium, 68.9% of added sugars, and 60.1% of solid fats. FFRs provided 14.1% of energy, 15.9% of sodium, 10.4% of added sugars and 17.9% of solid fats. Among FFR segments, burger restaurants provided 6.2% of total energy, 5.8% of sodium, 6.2% of added sugars, and 7.6% of solid fats. Less energy was provided by pizza (3.3%), sandwich (1.4%), Mexican (1.3%), and chicken restaurants (1.2%). Non-Hispanic black children obtained a greater proportion of their total energy (7.4%), sodium (7.1%), and solid fats (9.5%) from burger restaurants as compared to non-Hispanic white children (6.0% of energy, 5.5% of sodium, and 7.3% of solid fat). Conclusions These novel analyses, based on consumption data by fast food market segment, allow public health stakeholders to better monitor the effectiveness of industry efforts to promote healthier menu options. PMID:25062277

  20. Accuracy and precision of minimally-invasive cardiac output monitoring in children: a systematic review and meta-analysis.

    PubMed

    Suehiro, Koichi; Joosten, Alexandre; Murphy, Linda Suk-Ling; Desebbe, Olivier; Alexander, Brenton; Kim, Sang-Hyun; Cannesson, Maxime

    2016-10-01

    Several minimally-invasive technologies are available for cardiac output (CO) measurement in children, but the accuracy and precision of these devices have not yet been evaluated in a systematic review and meta-analysis. We conducted a comprehensive search of the medical literature in PubMed, Cochrane Library of Clinical Trials, Scopus, and Web of Science from its inception to June 2014 assessing the accuracy and precision of all minimally-invasive CO monitoring systems used in children when compared with CO monitoring reference methods. Pooled mean bias, standard deviation, and mean percentage error of included studies were calculated using a random-effects model. The inter-study heterogeneity was also assessed using an I(2) statistic. A total of 20 studies (624 patients) were included. The overall random-effects pooled bias, and mean percentage error were 0.13 ± 0.44 l min(-1) and 29.1 %, respectively. Significant inter-study heterogeneity was detected (P < 0.0001, I(2) = 98.3 %). In the sub-analysis regarding the device, electrical cardiometry showed the smallest bias (-0.03 l min(-1)) and lowest percentage error (23.6 %). Significant residual heterogeneity remained after conducting sensitivity and subgroup analyses based on the various study characteristics. By meta-regression analysis, we found no independent effects of study characteristics on weighted mean difference between reference and tested methods. Although the pooled bias was small, the mean pooled percentage error was in the gray zone of clinical applicability. In the sub-group analysis, electrical cardiometry was the device that provided the most accurate measurement. However, a high heterogeneity between studies was found, likely due to a wide range of study characteristics. PMID:26315477

  1. Effect of combined application insulin and insulin detemir on continous glucose monitor in children with type 1 diabetes mellitus

    PubMed Central

    Chen, Xiao-Yun; Dong, Qing; Li, Gui-Mei

    2015-01-01

    Insulin detemir is a soluble long-acting human insulin analogue at neutral pH with a unique mechanism of action, which could strengthen the effects of insulin. This study aims to explore the effects of insulin combined with insulin detemir on the continous glucose in children with type 1 diabetes mellitus. In this study, 150 patients with type 1 diabetes enrolled were included and randomly divided into 3 groups: insulin group (group A), insulin detemir group (group B) and insulin combined with insulin detemir group (group C). Each subject underwent 72 h of continuous glucose monitoring (CGM). MAGE, HbA1c and Noctumal Hypoglycemia levels were examined by using the ELISA kits. The body weight changes were also detected in this study. The results indicated that the information including age, body weight, disease duration and glucose level and HbA1c percentage on the start time point among three groups indicated no statistical differences. Insulin combined with insulin detemir decrease MAGE and HbA1c level in Group C compared to Group A and Group A (P < 0.05). Insulin combined with insulin detemir decreas noctumal hypoglycemia levels and body weight changes (P < 0.05). In conclusion, this study confirmed efficacy of insulin detemir by demonstrating non-inferiority of insulin detemir compared with insulin with respect to HbA1c, with an improved safety profile including significantly fewer hypoglycaemic episodes and less undesirable weight gain in children. PMID:26064343

  2. The prevalence of hepatitis B virus infection in Nigerian children prior to vaccine introduction into the National Programme on Immunization schedule

    PubMed Central

    Ikobah, Joanah; Okpara, Henry; Elemi, Iwasam; Ogarepe, Yeonun; Udoh, Ekong; Ekanem, Emmanuel

    2016-01-01

    Introduction Hepatitis B virus infection is a major global health problem of public health importance. In a bid to control the infection, the Nigerian government in 2004 introduced hepatitis B vaccine into the National Program on Immunization. There are no studies on the prevalence of hepatitis B in adolescent prior to 2004. The study was aimed at determining the seroprevalence and predictors of viral Hepatitis B in Nigerian children aged 11-19 years. Methods A cross sectional analytical study was conducted in July 2014. Multi-staged sampling technique was used to select 749 children from six secondary schools in Calabar, Cross River State, Nigeria. Ethical clearance was obtained from the Cross River State Medical Ethical Committee. A validated structured interviewer administered questionnaire was used to obtain information from participants following parental consent. Blood samples were obtained for qualitative detection of HBsAg using rapid chromatographic immunoassays with test kits from ABON (China) having sensitivity, specificity and accuracy of >99%, 97% and 98.5% respectively. Data was analyzed using SPSS version 20.2. Results Nine of the749 students screened were positive for HBsAg giving an overall prevalence of 1.2%. The sex specific prevalence was 0.8% for males and 1.8% for females. After multivariate analysis, age was the predictor of hepatitis B infection (OR 3.92; 95% CI 1.22-12.63; p-value 0.02). Conclusion The prevalence of HBV infection was low. Despite the low prevalence, the introduction of the vaccine is justifiable in view of the public health importance of the infection. PMID:27279955

  3. Continuous Multimodality Monitoring in Children after Traumatic Brain Injury—Preliminary Experience

    PubMed Central

    Young, Adam M. H.; Donnelly, Joseph; Czosnyka, Marek; Jalloh, Ibrahim; Liu, Xiuyun; Aries, Marcel J.; Fernandes, Helen M.; Garnett, Matthew R.; Smielewski, Peter; Hutchinson, Peter J.; Agrawal, Shruti

    2016-01-01

    Introduction Multimodality monitoring is regularly employed in adult traumatic brain injury (TBI) patients where it provides physiologic and therapeutic insight into this heterogeneous condition. Pediatric studies are less frequent. Methods An analysis of data collected prospectively from 12 pediatric TBI patients admitted to Addenbrooke’s Hospital, Pediatric Intensive Care Unit (PICU) between August 2012 and December 2014 was performed. Patients’ intracranial pressure (ICP), mean arterial pressure (MAP), and cerebral perfusion pressure (CPP) were monitored continuously using brain monitoring software ICM+®,) Pressure reactivity index (PRx) and ‘Optimal CPP’ (CPPopt) were calculated. Patient outcome was dichotomized into survivors and non-survivors. Results At 6 months 8/12 (66%) of the cohort survived the TBI. The median (±IQR) ICP was significantly lower in survivors 13.1±3.2 mm Hg compared to non-survivors 21.6±42.9 mm Hg (p = 0.003). The median time spent with ICP over 20 mm Hg was lower in survivors (9.7+9.8% vs 60.5+67.4% in non-survivors; p = 0.003). Although there was no evidence that CPP was different between survival groups, the time spent with a CPP close (within 10 mm Hg) to the optimal CPP was significantly longer in survivors (90.7±12.6%) compared with non-survivors (70.6±21.8%; p = 0.02). PRx provided significant outcome separation with median PRx in survivors being 0.02±0.19 compared to 0.39±0.62 in non-survivors (p = 0.02). Conclusion Our observations provide evidence that multi-modality monitoring may be useful in pediatric TBI with ICP, deviation of CPP from CPPopt, and PRx correlating with patient outcome. PMID:26978532

  4. [Methylphenidate in the treatment of children with attention-deficit hyperactivity disorder: monitoring in biological matrices].

    PubMed

    Papaseit, E; García-Algar, O; Simó, S; Pichini, S; Farré, M

    2013-02-01

    Attention-deficit hyperactivity disorder (ADHD) has emerged in the last few years as the most commonly diagnosed and treated psychiatric disorder in the paediatric population. In 1980's, methylphenidate (MFD) a psychomotor stimulant drug, was approved in Spain for the symptomatic therapy of ADHD. Since then, MFD has become one of the most extensively prescribed and studied treatment for ADHD both in children and adults. In this paper, the main pharmacological issues of MFD are reviewed, focusing on its pharmacokinetics in conventional (blood and urine) and non-conventional (hair, oral fluid and sweat) biological matrices, its pharmaceutical preparations, therapeutic levels and side effects.

  5. Predicting Parental Monitoring Behaviours for Sugar-Sweetened Beverages in Parents of School-Aged Children: An Application of the Integrative Behavioural Model

    ERIC Educational Resources Information Center

    Housely, Alexandra; Branscum, Paul; Cheney, Marshall; Hofford, Craig

    2016-01-01

    Objective: The objective of this study was to identify theory-based psychosocial and environmental determinants of parental monitoring practices related to child sugar-sweetened beverage consumption. Design: Cross-sectional design. Method: Data were obtained from a convenience sample of parents (n = 270) with children attending an after-school…

  6. The Effects of a Self-Monitoring and Video Self-Modeling Intervention to Increase On-Task Behavior for Children with Attention-Deficit/Hyperactivity Disorder

    ERIC Educational Resources Information Center

    Schmitt, Rachel Calkins Oxnard

    2009-01-01

    Children are diagnosed with AD/HD more often than any other disorder and interventions are needed in schools to increase on-task behavior. Most studies examining on-task behavior are conducted in special education classrooms or clinical laboratories. Previous studies have not combined video self-modeling and self-monitoring as an intervention to…

  7. A miniature, wearable activity/fall monitor to assess the efficacy of mobility therapy for children with cerebral palsy during everyday living.

    PubMed

    Smith, Warren D; Bagley, Anita

    2010-01-01

    Children with cerebral palsy may have difficulty walking and may fall frequently, resulting in a decrease in their participation in school and community activities. It is desirable to assess the effectiveness of mobility therapies for these children on their functioning during everyday living. Over 50 hours of tri-axial accelerometer and digital video recordings from 35 children with cerebral palsy and 51 typically-developing children were analyzed to develop algorithms for automatic real-time processing of the accelerometer signals to monitor a child's level of activity and to detect falls. The present fall-detection algorithm has 100% specificity and a sensitivity of 100% for falls involving trunk rotation. Sensitivities for drops to the knees and to the bottom are 72% and 78%, respectively. The activity and fall-detection algorithms were implemented in a miniature, battery-powered microcontroller-based activity/fall monitor that the child wears in a small fanny pack during everyday living. The monitor continuously logs 1-min. activity levels and the occurrence and characteristics of each fall for two-week recording sessions. Pre-therapy and post-therapy recordings from these monitors will be used to assess the efficacies of alternative treatments for gait abnormalities.

  8. Federal Immunity Law in Higher Education: A Review of the 1997 Judicial Decisions.

    ERIC Educational Resources Information Center

    Johnsen, Christopher

    1998-01-01

    Monitors developments in 1997 in federal immunity law applicable to higher education, generally public institutions. Cases touched on Eleventh Amendment immunity (abrogation, waiver, removal, entities, interlocutory appeals, discovery), qualified immunity (claims involving motivation, interlocutory appeals), and absolute immunity. (EV)

  9. Thromboelastometric Monitoring of the Hemostatic Effect of Platelet Concentrates Transfusion in Thrombocytopenic Children Undergoing Chemotherapy

    PubMed Central

    Solomon, Cristina; Cadamuro, Janne; Jones, Neil

    2015-01-01

    Prophylactic platelet concentrates transfusion represents a therapeutic choice in patients with chemotherapy-induced thrombocytopenia. This prospective, non-interventional study evaluated the effects of platelet concentrates transfusion on thromboelastometric parameters of platelet function in 36 transfusion occasions for 11 thrombocytopenic children undergoing chemotherapy. Pre- and posttransfusion (1-2 hours) blood samples were analyzed using standard coagulation tests and thromboelastometry (ROTEM) measurements (EXTEM and FIBTEM tests). Platelet component of the clot was calculated based on the EXTEM and FIBTEM maximum clot elasticity (MCE) results. After transfusion, mean platelet count increased from 16.5 × 109/L to 43.0 × 109/L (P < .001) and platelet component increased from 34.1 to 73.0 (P < .001). Statistically significant increases for posttransfusion EXTEM parameters A10, A20, and maximum clot firmness (MCF) were observed compared to pretransfusion values (P < .001). The EXTEM α-angle values increased posttransfusion (P < .05). The FIBTEM measurements were comparable pre- and posttransfusion. The study showed that platelet concentrates transfusion in thrombocytopenic children undergoing chemotherapy improves platelet-related coagulation pattern. PMID:25525046

  10. Persistence of the immune response after MenACWY-CRM vaccination and response to a booster dose, in adolescents, children and infants.

    PubMed

    Baxter, Roger; Keshavan, Pavitra; Welsch, Jo Anne; Han, Linda; Smolenov, Igor

    2016-05-01

    Persistence of bactericidal antibodies following vaccination is extremely important for protection against invasive meningococcal disease, given the epidemiology and rapid progression of meningococcal infection. We present an analysis of antibody persistence and booster response to MenACWY-CRM, in adolescents, children and infants, from 7 clinical studies. Immunogenicity was assessed using the serum bactericidal assay with both human and rabbit complement. Post-vaccination hSBA titers were high, with an age- and serogroup-specific decline in titers up to 1 y and stable levels up to 5 y The waning of hSBA titers over time was more pronounced among infants and toddlers and the greatest for serogroup A. However, rSBA titers against serogroup A were consistently higher and showed little decline over time, suggesting that protection against this serogroup may be sustained. A single booster dose of MenACWY-CRM administered at 3 to 5 y induced a robust immune response in all age groups.

  11. High Vaccination Coverage among Children during Influenza A(H1N1)pdm09 as a Potential Factor of Herd Immunity

    PubMed Central

    Matsuoka, Toshihiko; Sato, Tomoki; Akita, Tomoyuki; Yanagida, Jiturou; Ohge, Hiroki; Kuwabara, Masao; Tanaka, Junko

    2016-01-01

    The objective of this study was to identify factors related to the expansion of infection and prevention of influenza A(H1N1)pdm09. A retrospective non-randomized cohort study (from June 2009 to May 2010) on influenza A(H1N1)pdm09 was conducted in a sample of residents from Hiroshima Prefecture, Japan. The cumulative incidence of the influenza A(H1N1)pdm09 and the pandemic vaccine effectiveness (VE) were estimated. The response rate was 53.5% (178,669/333,892). Overall, the odds ratio of non-vaccinated group to vaccinated group for cumulative incidence of influenza A(H1N1)pdm09 was 2.18 (95% confidence interval (CI): 2.13–2.23) and the VE was 43.9% (CI: 42.8–44.9). The expansion of infection, indicating the power of transmission from infected person to susceptible person, was high in the 7–15 years age groups in each area. In conclusion, results from this survey suggested that schoolchildren-based vaccination rate participates in determining the level of herd immunity to influenza and children might be the drivers of influenza transmission. For future pandemic preparedness, vaccination of schoolchildren may help to prevent disease transmission during influenza outbreak. PMID:27763532

  12. Improved Monitoring of Vulnerable Children. Hearing before the Subcommittee on Human Resources of the Committee on Ways and Means, U.S. House of Representatives, One Hundred Eighth Congress, First Session (November 19, 2003) Serial No. 108-29

    ERIC Educational Resources Information Center

    US House of Representatives, 2004

    2004-01-01

    This hearing focused on: (1) what data States collect to monitor the care and supervision of children in foster care and children for whom adoption subsidies are paid; (2) how that data is used today; and (3) what additional data or applications of these data might better ensure the safety, permanency, and well-being of children. Testimony was…

  13. Nebraska Schools 83-84 Immunization Levels.

    ERIC Educational Resources Information Center

    Nebraska State Dept. of Health, Lincoln.

    The data contained in this report represents all of the 297,696 students, K-12, in the state of Nebraska. High levels of immunity are documented among children grades K-6. Some immunization levels of children grades 7-12 are yet below the 95 percent established as a minimum for the prevention of vaccine preventable diseases. Specifically, there…

  14. Immunity status of adults and children against poliomyelitis virus type 1 strains CHAT and Sabin (LSc-2ab) in Germany

    PubMed Central

    2010-01-01

    Background In October 2007, the working group CEN/TC 216 of the European Committee for standardisation suggested that the Sabin oral poliovirus vaccine type 1 strain (LSc-2ab) presently used for virucidal tests should be replaced by another attenuated vaccine poliovirus type 1 strain, CHAT. Both strains were historically used as oral vaccines, but the Sabin type 1 strain was acknowledged to be more attenuated. In Germany, vaccination against poliomyelitis was introduced in 1962 using the oral polio vaccine (OPV) containing Sabin strain LSc-2ab. The vaccination schedule was changed from OPV to an inactivated polio vaccine (IPV) containing wild polio virus type 1 strain Mahoney in 1998. In the present study, we assessed potential differences in neutralising antibody titres to Sabin and CHAT in persons with a history of either OPV, IPV, or OPV with IPV booster. Methods Neutralisation poliovirus antibodies against CHAT and Sabin 1 were measured in sera of 41 adults vaccinated with OPV. Additionally, sera from 28 children less than 10 years of age and immunised with IPV only were analysed. The neutralisation assay against poliovirus was performed according to WHO guidelines. Results The neutralisation activity against CHAT in adults with OPV vaccination history was significantly lower than against Sabin poliovirus type 1 strains (Wilcoxon signed-rank test P < 0.025). In eight sera, the antibody titres measured against CHAT were less than 8, although the titre against Sabin 1 varied between 8 and 64. Following IPV booster, anti-CHAT antibodies increased rapidly in sera of CHAT-negative adults with OPV history. Sera from children with IPV history neutralised CHAT and Sabin 1 strains equally. Conclusion The lack of neutralising antibodies against the CHAT strain in persons vaccinated with OPV might be associated with an increased risk of reinfection with the CHAT polio virus type 1, and this implies a putative risk of transmission of the virus to polio-free communities. We

  15. Monitoring the autonomic nervous activity as the objective evaluation of music therapy for severely and multiply disabled children.

    PubMed

    Orita, Makiko; Hayashida, Naomi; Shinkawa, Tetsuko; Kudo, Takashi; Koga, Mikitoshi; Togo, Michita; Katayama, Sotetsu; Hiramatsu, Kozaburo; Mori, Shunsuke; Takamura, Noboru

    2012-01-01

    Severely and multiply disabled children (SMDC) are frequently affected in more than one area of development, resulting in multiple disabilities. The aim of the study was to evaluate the efficacy of music therapy in SMDC using monitoring changes in the autonomic nervous system, by the frequency domain analysis of heart rate variability. We studied six patients with SMDC (3 patients with cerebral palsy, 1 patient with posttraumatic syndrome after head injury, 1 patient with herpes encephalitis sequelae, and 1 patient with Lennox-Gastaut syndrome characterized by frequent seizures, developmental delay and psychological and behavioral problems), aged 18-26 (mean 22.5 ± 3.5). By frequency domain method using electrocardiography, we measured the high frequency (HF; with a frequency ranging from 0.15 to 0.4 Hz), which represents parasympathetic activity, the low frequency/high frequency ratio, which represents sympathetic activity between the sympathetic and parasympathetic activities, and heart rate. A music therapist performed therapy to all patients through the piano playing for 50 min. We monitored each study participant for 150 min before therapy, 50 min during therapy, and 10 min after therapy. Interestingly, four of 6 patients showed significantly lower HF components during music therapy than before therapy, suggesting that these four patients might react to music therapy through the suppression of parasympathetic nervous activities. Thus, music therapy can suppress parasympathetic nervous activities in some patients with SMDC. The monitoring changes in the autonomic nervous activities could be a powerful tool for the objective evaluation of music therapy in patients with SMDC.

  16. Immunizations - diabetes

    MedlinePlus

    ... this page: //medlineplus.gov/ency/patientinstructions/000331.htm Immunizations - diabetes To use the sharing features on this page, please enable JavaScript. Immunizations (vaccines or vaccinations) help protect you from some ...

  17. Vaccination coverage and its determinants among migrant children in Guangdong, China

    PubMed Central

    2014-01-01

    Background Guangdong province attracted more than 31 million migrants in 2010. But few studies were performed to estimate the complete and age-appropriate immunization coverage and determine risk factors of migrant children. Methods 1610 migrant children aged 12–59 months from 70 villages were interviewed in Guangdong. Demographic characteristics, primary caregiver’s knowledge and attitude toward immunization, and child’s immunization history were obtained. UTD and age-appropriate immunization rates for the following five vaccines and the overall series (1:3:3:3:1 immunization series) were assessed: one dose of BCG, three doses of DTP, OPV and HepB, one dose of MCV. Risk factors for not being UTD for the 1:3:3:3:1 immunization series were explored. Results For each antigen, the UTD immunization rate was above 71%, but the age-appropriate immunization rates for BCG, HepB, OPV, DPT and MCV were only 47.8%, 45.1%, 47.1%, 46.8% and 37.2%, respectively. The 1st dose was most likely to be delayed within them. For the 1:3:3:3:1 immunization series, the UTD immunization rate and age-appropriate immunization rate were 64.9% and 12.4% respectively. Several factors as below were significantly associated with UTD immunization. The primary caregiver’s determinants were their occupation, knowledge and attitude toward immunization. The child’s determinants were sex, Hukou, birth place, residential buildings and family income. Conclusions Alarmingly low immunization coverage of migrant children should be closely monitored by NIISS. Primary caregiver and child’s determinants should be considered when taking measures. Strategies to strengthen active out-reach activities and health education for primary caregivers needed to be developed to improve their immunization coverage. PMID:24568184

  18. [Current status and recommendations on the use of continuous blood glucose monitoring systems in children and adolescents with type 1 diabetes mellitus].

    PubMed

    Torres Lacruz, M; Barrio Castellanos, R; García Cuartero, B; Gómez Gila, A; González Casado, I; Hermoso López, F; Luzuriaga Tomás, C; Oyarzabal Irigoyen, M; Rica Etxebarria, I; Rodríguez Rigual, M

    2011-08-01

    Glucose monitoring methods have made great advances in the last decade with the appearance of the continuous glucose monitoring systems (CGMS) that measure the glucose levels in the interstitial liquid, providing information about glucose patterns and trends, but do not replace the self-monitoring of capillary glucose. Improvement in diabetes control using the CGMS depends on the motivation and training received by the patient and family and on the continuity in its use. Due to the development and widespread use of these systems in clinical practice, the diabetes group of the Sociedad Española de Endocrinología Pediátrica has drafted a document of consensus for their indication and use in children and adolescents. Only a limited number of trials have been performed in children and adolescent populations. More data are needed on the use of this technology in order to define the impact on metabolic control.

  19. Airborne engineered nanoparticles: potential risks and monitoring challenges for assessing their impacts on children.

    PubMed

    Biskos, G; Schmidt-Ott, A

    2012-06-01

    Engineered nanoparticles (ENPs) are the building blocks of novel materials and consumer products that hold great promise for our societies. When ENPs are released to the environment, however, they can induce irreversible processes that can affect human health. To ensure safety for all nanoparticle-based products throughout their life cycle we urgently need to develop techniques for determining their toxic effects and the exposure levels of humans to ENPs. In an attempt to estimate whether nanotechnology can threaten more sensitive parts of the population such as children, we provide a brief overview of the potential pathways of introducing ENPs into the environment and the state-of-the-art techniques for assessing human exposure, as well as our current knowledge on their toxic effects. PMID:22475252

  20. Intravenous Rh immune globulin for treating immune thrombocytopenic purpura.

    PubMed

    Sandler, S G

    2001-11-01

    Intravenous Rh [corrected] immune globulin was licensed by the U. S. Food and Drug administration in 1995 for the treatment of acute and chronic immune thrombocytopenic purpura in children and chronic immune thrombocytopenic purpura in adults. In 1996, the American Society of Hematology published a practice guideline for immune thrombocytopenic purpura, but treatment recommendations of necessity were formulated using only results of early clinical trials with intravenous Rh immune globulin. To date, there are no published results of large-scale clinical trials comparing conventional doses of intravenous immune globulin with the most promising dose range for intravenous Rh immune globulin (50-75 microg/kg). However, clinical experience is accumulating to indicate that intravenous Rh immune globulin is as effective, probably safer, and easier to administer than intravenous immune globulin. Acute intravascular hemolysis after infusions of intravenous Rh immune globulin for immune thrombocytopenic purpura has been reported with an estimated incidence of 1 in 1,115 patients. The risk factors for this adverse event have not been defined.

  1. Vaccines and Immunization Practice.

    PubMed

    Hogue, Michael D; Meador, Anna E

    2016-03-01

    Vaccines are among most cost-effective public health strategies. Despite effective vaccines for many bacterial and viral illnesses, tens of thousands of adults and hundreds of children die each year in the United States from vaccine-preventable diseases. Underutilization of vaccines requires rethinking the approach to incorporating vaccines into practice. Arguably, immunizations could be a part all health care encounters. Shared responsibility is paramount if deaths are to be reduced. This article reviews the available vaccines in the US market, as well as practice recommendations of the Centers for Disease Control and Prevention's Advisory Committee on Immunization Practices.

  2. Echinoderm immunity.

    PubMed

    Smith, L Courtney; Ghosh, Julie; Buckley, Katherine M; Clow, Lori A; Dheilly, Nolwenn M; Haug, Tor; Henson, John H; Li, Chun; Lun, Cheng Man; Majeske, Audrey J; Matranga, Valeria; Nair, Sham V; Rast, Jonathan P; Raftos, David A; Roth, Mattias; Sacchi, Sandro; Schrankel, Catherine S; Stensvåg, Klara

    2010-01-01

    A survey for immune genes in the genome for the purple sea urchin has shown that the immune system is complex and sophisticated. By inference, immune responses of all echinoderms maybe similar. The immune system is mediated by several types of coelomocytes that are also useful as sensors of environmental stresses. There are a number of large gene families in the purple sea urchin genome that function in immunity and of which at least one appears to employ novel approaches for sequence diversification. Echinoderms have a simpler complement system, a large set of lectin genes and a number of antimicrobial peptides. Profiling the immune genes expressed by coelomocytes and the proteins in the coelomic fluid provide detailed information about immune functions in the sea urchin. The importance of echinoderms in maintaining marine ecosystem stability and the disastrous effects of their removal due to disease will require future collaborations between ecologists and immunologists working towards understanding and preserving marine habitats. PMID:21528703

  3. Children

    ERIC Educational Resources Information Center

    Headley, Clea; Campbell, Marilyn A.

    2013-01-01

    This study examined primary school teachers' knowledge of anxiety and excessive anxiety symptoms in children. Three hundred and fifteen primary school teachers completed a questionnaire exploring their definitions of anxiety and the indications they associated with excessive anxiety in primary school children. Results showed that teachers had…

  4. Point of care monitoring of oral anticoagulant therapy in children: comparison of CoaguChek Plus and Thrombotest methods with venous international normalised ratio.

    PubMed

    Ignjatovic, Vera; Barnes, Chris; Newall, Fiona; Hamilton, Simone; Burgess, Janet; Monagle, Paul

    2004-10-01

    This paper reports the outcome of a research protocol aimed at optimising warfarin monitoring in a tertiary pediatric centre. The Thrombotest INR was the standard monitoring test employed to manage oral anticoagulant therapy in children at the Royal Children's Hospital (RCH), Melbourne. This study compares the results of this standard method to the novel CoaguChek INR monitor and the "gold standard" technique of venous INR sampling. The objectives were to determine 1) if point-of-care techniques of measuring the INR (Thrombotest and CoaguChek) are accurate and reliable compared to INR results obtained from venous sampling, processed in an accredited laboratory, and 2) if INR results generated by POC devices can be safely used to manage oral anticoagulant therapy in children. 18 children (10 females and 8 males) participated in the study. Ages ranged from 9 months to 21 years (Mean 11.9 years; SD 5.03 years). The agreement between CoaguChek and venous INR measurements (r = 0.885) was shown to be higher compared to Thrombotest and venous INR (r = 0.700). Compared to the venous INR, values obtained with Coaguchek and Thrombotest crossed into or out of the therapeutic range in 25% and 36% of cases respectively. In 88% of the CoaguChek cases and 57% Thrombotest cases, the difference from the venous result was less than 0.5. The CoaguChek method of INR monitoring is a more accurate and reliable method compared to Thrombotest, in the pediatric population tested, and can be safely used to manage oral anticoagulant therapy in children.

  5. Home point-of-care international normalised ratio monitoring sustained by a non-selective educational program in children.

    PubMed

    Bajolle, Fanny; Lasne, Dominique; Elie, Caroline; Cheurfi, Radhia; Grazioli, Aurélie; Traore, Maladon; Souillard, Patrick; Boudjemline, Younes; Jourdain, Patrick; Bonnet, Damien

    2012-10-01

    Adverse events related to vitamin K antagonist (VKA) therapy might be reduced by point-of-care international normalised ratio (POC INR) monitoring supported by an education program (EP). Our aim was to evaluate the efficacy of a non-selective VKA paediatric EP (regardless of the social, economic, educational or linguistic levels) by analysing the time spent in the therapeutic range (TTR), VKA adverse events and compliance to treatment, and INR control prescriptions. The EP was modified from the pediatric EP previously described but improved by a specifically devised child-focused game. One hundred four consecutive children (median age 8 years) receiving VKA were included in a standardised EP. Patients were in self-testing, and dose adjustments were made by a single physician for three tolerance ranges according to the underlying disease: [2.5-4], [1.8-3.2], and [1.5-2.5]. The median follow-up was 481 days [70-1,001]. The overall TTR was 81.4% [36-100]. The TTR were 74%, 85.6% and 89% for the ranges [2.5-4], [1.8-3.2], and [1.5-2.5], respectively. These results were sustainable during the study period. Only one serious VKA adverse event was recorded. The median number of POC INR tests was 2.5 [1.6-5.7] INR per patient and month. Patients/families performed POC INR when requested in 86.9% of the cases. More than 90% of the families found the EP supportive and wished to follow a long-term reinforcement program. In conclusion, this non-selective child-focused EP for VKA therapy, strongly supported by our dedicated game, is useful in maintaining efficacy, safety and compliance to anticoagulation and its monitoring.

  6. Neisseria meningitidis Group A IgG1 and IgG2 Subclass Immune Response in African Children Aged 12–23 Months Following Meningococcal Vaccination

    PubMed Central

    Holme, Daniel; Findlow, Helen; Sow, Samba O.; Idoko, Olubukola T.; Preziosi, Marie-Pierre; Carlone, George; Plikaytis, Brian D.; Borrow, Ray

    2015-01-01

    Background. A group A meningococcal conjugate vaccine, PsA-TT, was licensed in 2010 and was previously studied in a phase 2 clinical trial to evaluate its safety and immunogenicity in African children 12–23 months of age. Methods. Subjects received either PsA-TT; meningococcal group A, C, W, Y polysaccharide vaccine (PsACWY); or Haemophilus influenzae type b conjugate vaccine (Hib-TT). Forty weeks following primary vaccination, the 3 groups were further randomized to receive either PsA-TT, one-fifth dose of PsACWY, or Hib-TT. Group A–specific immunoglobulin G (IgG) subclass response was characterized using an enzyme-linked immunosorbent assay. Results. The predominant IgG subclass response, regardless of vaccine, was IgG1. One month following primary vaccination, the geometric mean concentrations (GMCs) of IgG1 and IgG2 in the PsA-TT group were 21.73 µg/mL and 6.27 µg/mL, whereas in the PsACWY group the mean GMCs were 2.01 µg/mL and 0.97 µg/mL, respectively (P < .0001). Group A–specific IgG1 and IgG2 GMCs remained greater in the PsA-TT group than in the PsACWY group 40 weeks following primary vaccination (P < .0001). One week following revaccination, those given 2 doses of PsA-TT had the greatest IgG1 and IgG2 GMCs of 125.23 µg/mL and 36.12 µg/mL, respectively (P = .0008), and demonstrated a significant increase in IgG1:IgG2 mean ratio, indicative of the T-cell–dependent response associated with conjugate vaccines. Conclusions. Vaccination of African children aged 12–24 months with either PsA-TT or PsACWY elicited a predominantly IgG1 response. The IgG1:IgG2 mean ratio decreased following successive vaccination with PsACWY, indicating a shift toward IgG2, suggestive of the T-cell–independent immune response commonly associated with polysaccharide antigens. Clinical Trials Registration. SRCTN78147026. PMID:26553689

  7. Ambulatory Blood Pressure Monitoring in Lean, Obese and Diabetic Children and Adolescents

    PubMed Central

    Shikha, Deep; Singla, Montish; Walia, Rachna; Potter, Natia; Umpaichitra, Vatcharapan; Mercado, Arlene; Winer, Nathaniel

    2015-01-01

    Aim To determine if children and adolescents who have obesity (Ob) or type 2 diabetes (T2DM) of relatively short duration have impaired cardiovascular function compared with lean subjects using 24-hour ambulatory blood pressure as a surrogate measure of evaluation. Methods We enrolled 100 African-Caribbean subjects (45 males/55 females), mean ages 14.4-15.2 years (range 11.8-18.5 years) and Tanner stage 4.2-4.8. Mean BMI for the Ob (n = 40), T2DM (n = 39) and lean (n = 21) groups were 40.3, 34.2 and 20.8, respectively (p < 0.01, Ob and T2DM vs. lean). Mean hemoglobin A1c in lean and Ob was 5.4 and 5.5% compared to 8.8% in T2DM (p < 0.001, T2DM vs. lean and Ob). Ambulatory blood pressure was recorded every 20 min over 24 h using Spacelabs 70207. Results Mean 24-hour, daytime and nighttime systolic blood pressure was significantly higher in Ob and T2DM compared with lean subjects (mean 24-hour 117 and 120 vs. 109 mm Hg; daytime 121 and 123 vs. 113 mm Hg; and nighttime 109 and 115 vs. 101 mm Hg; p < 0.01 for all time periods). The nocturnal systolic dip in Ob and T2DM did not differ from that of lean, whereas nocturnal diastolic dip decreased significantly in Ob and T2DM compared to lean (11.5 and 10.4 vs. 20.6 mm Hg; p < 0.01). Mean pulse pressure was significantly increased in the Ob and T2DM groups compared to lean subjects (51 and 54 vs. 45 mm Hg; p < 0.01). Conclusion Adolescent Ob and T2DM groups share adverse risk factors, which may be harbingers of adult cardiovascular events. PMID:26195970

  8. Immune therapies for neuroblastoma.

    PubMed

    Navid, Fariba; Armstrong, Michael; Barfield, Raymond C

    2009-05-01

    Neuroblastoma, a solid tumor arising from developing cells of the sympathetic nervous system, is the most common extracranial tumor in children. The prognosis for high-risk neuroblastoma remains poor with conventional treatment, and new approaches are therefore being explored to treat this disease. One such alternative therapy that holds promise is immune therapy. We review here the recent advances in four types of immune therapy-cytokine, vaccine, antibody and cellular therapy-to treat neuroblastoma. We present preclinical research and clinical trials on several promising candidates such as IL-12, dendritic cell vaccines, anti-GD2 antibodies and allogeneic hematopoietic stem cell transplant. An optimal treatment plan for neuroblastoma will most likely involve multimodal approaches and combinations of immune therapies.

  9. Immune Therapies for Neuroblastoma

    PubMed Central

    Navid, Fariba; Armstrong, Michael; Barfield, Raymond C.

    2009-01-01

    Neuroblastoma, a solid tumor arising from developing cells of the sympathetic nervous system, is the most common extracranial tumor in children. The prognosis for high-risk neuroblastoma remains poor with conventional treatment, and new approaches are therefore being explored to treat this disease. One such alternative therapy that holds promise is immune therapy. We review here the recent advances in 4 types of immune therapy – cytokine, vaccine, antibody, and cellular therapy – to treat neuroblastoma. We present preclinical research and clinical trials on several promising candidates such as IL-12, dendritic cell vaccines, anti-GD2 antibodies, and allogeneic hematopoietic stem cell transplant. An optimal treatment plan for neuroblastoma will most likely involve multimodal approaches and combinations of immune therapies. PMID:19342881

  10. Building a National Immunization System: A Guide to Immunization Services and Resources.

    ERIC Educational Resources Information Center

    Franklin, Paula; And Others

    Over the past several years, outbreaks of vaccine-preventable diseases have drawn greater attention to the problem of low immunization rates in the U.S. In response to this problem, the federal government created the Vaccines for Children program as a foundation for a new national immunization policy to ensure proper and timely immunizations for…

  11. Why parents refuse immunization?

    PubMed

    Kajetanowicz, Andrzej; Kajetanowicz, Aleksandra

    2016-01-01

    Rates of child immunization are falling in many countries, leading to the increase of morbidity and mortality from diseases controlled by vaccinations. The simplified model of the natural history of immunization follows a sequence of fear of the disease before vaccination, followed by acceptance of the vaccination until plateau, where the population forgets the morbidity and mortality of pre-immunization. Historical factors including withdrawals of vaccines, and publications regarding the true or falsified dangers of vaccines still resonate with parents. Building on these historical factors, unscientific sources such as naturopaths, homeopaths, chiropractors, celebrities and lay-people with anecdotal evidence and even scientific sources such as some universities and some medical doctors push their views on anti-vaccination, which proves to make the decision to vaccinate more difficult on parents. The main reason that parents refuse vaccination is a desire to protect their children. These parents believe that vaccination is harmful, or that not vaccinated children are healthier than vaccinated children. Scientific data often will lose with pseudoscientific, false or anecdotal data that have higher sensational and emotional impact on parents. With so many sources giving so many factors which sometimes contradict themselves, it is indeed difficult for a parent to make a clear decision for their child. PMID:27486715

  12. Safety and persistence of the humoral and cellular immune responses induced by 2 doses of an AS03-adjuvanted A(H1N1)pdm09 pandemic influenza vaccine administered to infants, children and adolescents: Two open, uncontrolled studies

    PubMed Central

    Garcia-Sicilia, José; Arístegui, Javier; Omeñaca, Félix; Carmona, Alfonso; Tejedor, Juan C; Merino, José M; García-Corbeira, Pilar; Walravens, Karl; Bambure, Vinod; Moris, Philippe; Caplanusi, Adrian; Gillard, Paul; Dieussaert, Ilse

    2015-01-01

    In children, 2 AS03-adjuvanted A(H1N1)pdm09 vaccine doses given 21 days apart were previously shown to induce a high humoral immune response and to have an acceptable safety profile up to 42 days following the first vaccination. Here, we analyzed the persistence data from 2 open-label studies, which assessed the safety, and humoral and cell-mediated immune responses induced by 2 doses of this vaccine. The first study was a phase II, randomized trial conducted in 104 children aged 6–35 months vaccinated with the A(H1N1)pdm09 vaccine containing 1.9 µg haemagglutinin antigen (HA) and AS03B (5.93 mg tocopherol) and the second study, a phase III, non-randomized trial conducted in 210 children and adolescents aged 3–17 years vaccinated with the A(H1N1)pdm09 vaccine containing 3.75 µg HA and AS03A (11.86 mg tocopherol). Approximately one year after the first dose, all children with available data were seropositive for haemagglutinin inhibition and neutralising antibody titres, but a decline in geometric mean antibody titres was noted. The vaccine induced a cell-mediated immune response in terms of antigen-specific CD4+ T-cells, which persisted up to one year post-vaccination. The vaccine did not raise any safety concern, though these trials were not designed to detect rare events. In conclusion, 2 doses of the AS03-adjuvanted A(H1N1)pdm09 vaccine at 2 different dosages had a clinically acceptable safety profile, and induced high and persistent humoral and cell-mediated immune responses in children aged 6–35 months and 3–17 years. These studies have been registered at www.clinicaltrials.gov NCT00971321 and NCT00964158. PMID:26176592

  13. Routine versus clinically driven laboratory monitoring and first-line antiretroviral therapy strategies in African children with HIV (ARROW): a 5-year open-label randomised factorial trial

    PubMed Central

    2013-01-01

    Summary Background No trials have investigated routine laboratory monitoring for children with HIV, nor four-drug induction strategies to increase durability of first-line antiretroviral therapy (ART). Methods In this open-label parallel-group trial, Ugandan and Zimbabwean children or adolescents with HIV, aged 3 months to 17 years and eligible for ART, were randomly assigned in a factorial design. Randomisation was to either clinically driven monitoring or routine laboratory and clinical monitoring for toxicity (haematology and biochemistry) and efficacy (CD4 cell counts; non-inferiority monitoring randomisation); and simultaneously to standard three-drug or to four-drug induction first-line ART, in three groups: three-drug treatment (non-nucleoside reverse transcriptase inhibitor [NNRTI], lamivudine, abacavir; group A) versus four-drug induction (NNRTI, lamivudine, abacavir, zidovudine; groups B and C), decreasing after week 36 to three-drug NNRTI, lamivudine, plus abacavir (group B) or lamivudine, abacavir, plus zidovudine (group C; superiority ART-strategy randomisation). For patients assigned to routine laboratory monitoring, results were returned every 12 weeks to clinicians; for clinically driven monitoring, toxicity results were only returned for requested clinical reasons or if grade 4. Children switched to second-line ART for WHO stage 3 or 4 events or (routine laboratory monitoring only) age-dependent WHO CD4 criteria. Randomisation used computer-generated sequentially numbered tables incorporated securely within the database. Primary efficacy endpoints were new WHO stage 4 events or death for monitoring and change in CD4 percentage at 72 and 144 weeks for ART-strategy randomisations; the co-primary toxicity endpoint was grade 3 or 4 adverse events. Analysis was by intention to treat. This trial is registered, ISRCTN24791884. Findings 1206 children were randomly assigned to clinically driven (n=606) versus routine laboratory monitoring (n=600), and

  14. Experiences in home-based growth monitoring.

    PubMed

    Suelan, F; Briones, H

    1992-01-01

    A growth monitoring project (GMP) of child weighing was implemented by the Philippines' Department of Health (DOH) through the Integrated Provincial Health Office to monitor either children's nutritional progress or their faltering of growth. Weaknesses, however, were found in the GMP. For example, only 31% of preschoolers included in the Nutrition Center of the Philippines (NCP) survey had growth charts. An 1990 UNICEF-DOH survey also found that the growth chart was used primarily by mothers and service providers to record infant immunization. Mothers brought their children to well-baby clinics in barangay health centers only when their children were sick. Conducted only once per year, weighing was not perceived as a tool in detecting and preventing sickness, and ensuring normal growth. Asked to help improve the GMP, the NCP consulted intended beneficiaries and cooperators to develop a plan to pilot an intensive monitoring project in four towns of Negros Occidental, starting in January 1991 and ending in December 1992. The resultant Home-Based Growth Monitoring (HBGM) project would place emphasis upon enabling rural mothers to become self-sustaining agents for child growth monitoring. A key feature was the establishment of a weighing post in a strategic place for every 2-3 family clusters. The HBGM project was piloted in 1991 in Calatrava, Toboso, Cauayan, and Sipalay. This paper describes project implementation, problems and solutions, and results.

  15. Immunity-based diagnosis for a motherboard.

    PubMed

    Shida, Haruki; Okamoto, Takeshi; Ishida, Yoshiteru

    2011-01-01

    We have utilized immunity-based diagnosis to detect abnormal behavior of components on a motherboard. The immunity-based diagnostic model monitors voltages of some components, CPU temperatures, and fan speeds. We simulated abnormal behaviors of some components on the motherboard, and we utilized the immunity-based diagnostic model to evaluate motherboard sensors in two experiments. These experiments showed that the immunity-based diagnostic model was an effective method for detecting abnormal behavior of components on the motherboard. PMID:22163857

  16. Immune System

    EPA Science Inventory

    A properly functioning immune system is essential to good health. It defends the body against infectious agents and in some cases tumor cells. Individuals with immune deficiencies resulting from genetic defects, diseases (e.g., AIDS, leukemia), or drug therapies are more suscepti...

  17. Protect the Circle of Life: Immunize Our Nations

    MedlinePlus

    ... Children (VFC) Stop Transmission of Polio (STOP) Vaccine Management Business Improvement Project (VMBIP) Global Immunizations & Vaccinations Immunization Program Evaluation (IPE) Assessment, Feedback, Incentives, and Exchange (AFIX) Comprehensive Clinic Assessment Software Application (CoCASA) Instant ...

  18. An Integrated Approach for the Monitoring of Brain and Autonomic Response of Children with Autism Spectrum Disorders during Treatment by Wearable Technologies.

    PubMed

    Billeci, Lucia; Tonacci, Alessandro; Tartarisco, Gennaro; Narzisi, Antonio; Di Palma, Simone; Corda, Daniele; Baldus, Giovanni; Cruciani, Federico; Anzalone, Salvatore M; Calderoni, Sara; Pioggia, Giovanni; Muratori, Filippo

    2016-01-01

    Autism Spectrum Disorders (ASD) are associated with physiological abnormalities, which are likely to contribute to the core symptoms of the condition. Wearable technologies can provide data in a semi-naturalistic setting, overcoming the limitations given by the constrained situations in which physiological signals are usually acquired. In this study an integrated system based on wearable technologies for the acquisition and analysis of neurophysiological and autonomic parameters during treatment is proposed and an application on five children with ASD is presented. Signals were acquired during a therapeutic session based on an imitation protocol in ASD children. Data were analyzed with the aim of extracting quantitative EEG (QEEG) features from EEG signals as well as heart rate and heart rate variability (HRV) from ECG. The system allowed evidencing changes in neurophysiological and autonomic response from the state of disengagement to the state of engagement of the children, evidencing a cognitive involvement in the children in the tasks proposed. The high grade of acceptability of the monitoring platform is promising for further development and implementation of the tool. In particular if the results of this feasibility study would be confirmed in a larger sample of subjects, the system proposed could be adopted in more naturalistic paradigms that allow real world stimuli to be incorporated into EEG/psychophysiological studies for the monitoring of the effect of the treatment and for the implementation of more individualized therapeutic programs. PMID:27445652

  19. An official American Thoracic Society workshop report: optimal lung function tests for monitoring cystic fibrosis, bronchopulmonary dysplasia, and recurrent wheezing in children less than 6 years of age.

    PubMed

    Rosenfeld, Margaret; Allen, Julian; Arets, Bert H G M; Aurora, Paul; Beydon, Nicole; Calogero, Claudia; Castile, Robert G; Davis, Stephanie D; Fuchs, Susanne; Gappa, Monika; Gustaffson, Per M; Hall, Graham L; Jones, Marcus H; Kirkby, Jane C; Kraemer, Richard; Lombardi, Enrico; Lum, Sooky; Mayer, Oscar H; Merkus, Peter; Nielsen, Kim G; Oliver, Cara; Oostveen, Ellie; Ranganathan, Sarath; Ren, Clement L; Robinson, Paul D; Seddon, Paul C; Sly, Peter D; Sockrider, Marianna M; Sonnappa, Samatha; Stocks, Janet; Subbarao, Padmaja; Tepper, Robert S; Vilozni, Daphna

    2013-04-01

    Although pulmonary function testing plays a key role in the diagnosis and management of chronic pulmonary conditions in children under 6 years of age, objective physiologic assessment is limited in the clinical care of infants and children less than 6 years old, due to the challenges of measuring lung function in this age range. Ongoing research in lung function testing in infants, toddlers, and preschoolers has resulted in techniques that show promise as safe, feasible, and potentially clinically useful tests. Official American Thoracic Society workshops were convened in 2009 and 2010 to review six lung function tests based on a comprehensive review of the literature (infant raised-volume rapid thoracic compression and plethysmography, preschool spirometry, specific airway resistance, forced oscillation, the interrupter technique, and multiple-breath washout). In these proceedings, the current state of the art for each of these tests is reviewed as it applies to the clinical management of infants and children under 6 years of age with cystic fibrosis, bronchopulmonary dysplasia, and recurrent wheeze, using a standardized format that allows easy comparison between the measures. Although insufficient evidence exists to recommend incorporation of these tests into the routine diagnostic evaluation and clinical monitoring of infants and young children with cystic fibrosis, bronchopulmonary dysplasia, or recurrent wheeze, they may be valuable tools with which to address specific concerns, such as ongoing symptoms or monitoring response to treatment, and as outcome measures in clinical research studies.

  20. An Integrated Approach for the Monitoring of Brain and Autonomic Response of Children with Autism Spectrum Disorders during Treatment by Wearable Technologies

    PubMed Central

    Billeci, Lucia; Tonacci, Alessandro; Tartarisco, Gennaro; Narzisi, Antonio; Di Palma, Simone; Corda, Daniele; Baldus, Giovanni; Cruciani, Federico; Anzalone, Salvatore M.; Calderoni, Sara; Pioggia, Giovanni; Muratori, Filippo

    2016-01-01

    Autism Spectrum Disorders (ASD) are associated with physiological abnormalities, which are likely to contribute to the core symptoms of the condition. Wearable technologies can provide data in a semi-naturalistic setting, overcoming the limitations given by the constrained situations in which physiological signals are usually acquired. In this study an integrated system based on wearable technologies for the acquisition and analysis of neurophysiological and autonomic parameters during treatment is proposed and an application on five children with ASD is presented. Signals were acquired during a therapeutic session based on an imitation protocol in ASD children. Data were analyzed with the aim of extracting quantitative EEG (QEEG) features from EEG signals as well as heart rate and heart rate variability (HRV) from ECG. The system allowed evidencing changes in neurophysiological and autonomic response from the state of disengagement to the state of engagement of the children, evidencing a cognitive involvement in the children in the tasks proposed. The high grade of acceptability of the monitoring platform is promising for further development and implementation of the tool. In particular if the results of this feasibility study would be confirmed in a larger sample of subjects, the system proposed could be adopted in more naturalistic paradigms that allow real world stimuli to be incorporated into EEG/psychophysiological studies for the monitoring of the effect of the treatment and for the implementation of more individualized therapeutic programs. PMID:27445652

  1. Maternal immunization

    PubMed Central

    Moniz, Michelle H; Beigi, Richard H

    2014-01-01

    Maternal immunization holds tremendous promise to improve maternal and neonatal health for a number of infectious conditions. The unique susceptibilities of pregnant women to infectious conditions, as well as the ability of maternally-derived antibody to offer vital neonatal protection (via placental transfer), together have produced the recent increased attention on maternal immunization. The Advisory Committee on Immunization Practices (ACIP) currently recommends 2 immunizations for all pregnant women lacking contraindication, inactivated Influenza and tetanus toxoid, reduced diphtheria toxoid, and acellular pertussis (Tdap). Given ongoing research the number of vaccines recommended during pregnancy is likely to increase. Thus, achieving high vaccination coverage of pregnant women for all recommended immunizations is a key public health enterprise. This review will focus on the present state of vaccine acceptance in pregnancy, with attention to currently identified barriers and determinants of vaccine acceptance. Additionally, opportunities for improvement will be considered. PMID:25483490

  2. Monitoring the immune response to vaccination with an inactivated vaccine associated to bovine neonatal pancytopenia by deep sequencing transcriptome analysis in cattle.

    PubMed

    Demasius, Wiebke; Weikard, Rosemarie; Hadlich, Frieder; Müller, Kerstin Elisabeth; Kühn, Christa

    2013-01-01

    Bovine neonatal pancytopenia (BNP) is a new fatal, alloimmune/alloantibody mediated disease of new-born calves induced by ingestion of colostrum from cows, which had been vaccinated with a specific vaccine against the Bovine Virus Diarrhoea Virus (BVDV). The hypothesis of pathogenic MHC class I molecules in the vaccine had been put up, but no formal proof of specific causal MHC class I alleles has been provided yet. However, the unique features of the vaccine obviously result in extremely high specific antibody titres in the vaccinated animals, but apparently also in further molecules inducing BNP. Thus, a comprehensive picture of the immune response to the vaccine is essential. Applying the novel approach of next generation RNA sequencing (RNAseq), our study provides a new holistic, comprehensive analysis of the blood transcriptome regulation after vaccination with the specific BVDV vaccine. Our RNAseq approach identified a novel cytokine-like gene in the bovine genome that is highly upregulated after vaccination. This gene has never been described before in any other species and might be specific to ruminant immune response. Furthermore, our data revealed a very coordinated immune response to double-stranded (ds) RNA or a dsRNA analogue after vaccination with the inactivated single-stranded (ss) RNA vaccine. This would suggest either a substantial contamination of the vaccine with dsRNA from host cells after virus culture or a dsRNA analogue applied to the vaccine. The first option would highlight the potential risks associated with virus culture on homologous cells during vaccine production; the latter option would emphasise the potential risks associated with immune stimulating adjuvants used in vaccine production. PMID:24099437

  3. The world's children.

    PubMed

    Niimi, R

    1997-01-01

    World leaders from 159 countries agreed at the 1990 World Summit for Children to specific goals which would reduce levels of child and maternal mortality, and give every child access to basic education, clean water, and proper sanitation by 2000. Major progress has since been achieved in most countries, with more than 80% of the world's children now immunized against diphtheria, tetanus, and pertussis. Moreover, the deaths of over 1 million children annually are being averted through the increased use of oral rehydration therapy against diarrheal dehydration, poliomyelitis and guinea worm have almost been eradicated, the consumption of iodized salt is protecting approximately 12 million infants annually from iodine deficiency, and access to safe drinking water is on the rise. Scientific developments in pediatrics, the strengthening of national health services, and the use of cost-effective primary health care approaches such as immunization, oral rehydration therapy, the promotion of breast feeding, and growth monitoring have helped reduce the national rate of infant mortality (IMR) in Turkey to 42 per 1000 live births compared to the urban IMR in Turkey during the 1940s of 300-350/1000. Developments in public health, the Convention on the Rights of the Child (CRC), education and child development, and child protection and the CRC are discussed.

  4. Caries-risk assessment with a chairside optical spectroscopic sensor by monitoring bacterial-mediated acidogenic-profile of saliva in children

    PubMed Central

    Shrestha, Annie; Mohamed- Tahir, MA; Hegde, Jayshree; Azarpazhooh, Amir; Kishen, Anil

    2011-01-01

    Objective: This study aimed to evaluate the ability of an optical spectroscopic sensor (OSS) to monitor bacterial-mediated acidogenic-profile of saliva resulting from bacteria-sucrose interaction. Materials and Methods: Stage-1, characterization experiments were conducted to standardize the OSS. Stage-2 clinical experiments were carried out on stimulated saliva samples from 70 children of age-group 1-12 years. The bacterial-mediated acidogenic-profile of saliva mixed with sucrose was monitored using the OSS for 180 minutes. Results: The clinical patients were categorized based on the dmfs score as caries-active, caries-inactive and caries-free. The bacterial-mediated acidogenic-profile measured in terms of t1/2 monitored using the OSS was significantly different between the caries-free and caries-active (P<0.05); and caries-free and caries-inactive groups (P<0.005). Conclusions: The significant correlation of the acidogenic-profile determined using the OSS and the caries-status highlighted the OSS as a sensitive and rapid chairside tool for the quantification of the acidogenic-profile of saliva that could help in monitoring the caries-risk in children. PMID:22144811

  5. Biologic Monitoring to Characterize Organophosphorus Pesticide Exposure among Children and Workers: An Analysis of Recent Studies in Washington State

    PubMed Central

    Fenske, Richard A.; Lu, Chensheng; Curl, Cynthia L.; Shirai, Jeffry H.; Kissel, John C.

    2005-01-01

    We examined findings from five organophosphorus pesticide biomonitoring studies conducted in Washington State between 1994 and 1999. We compared urinary dimethylthiophosphate (DMTP) concentrations for all study groups and composite dimethyl alkylphosphate (DMAP) concentrations for selected groups. Children of pesticide applicators had substantially higher metabolite levels than did Seattle children and farmworker children (median DMTP, 25 μg/L; p < 0.0001). Metabolite levels of children living in agricultural communities were elevated during periods of crop spraying. Median DMTP concentrations for Seattle children and farmworker children did not differ significantly (6.1 and 5.8 μg/L DMTP, respectively; p = 0.73); however, the DMAP concentrations were higher for Seattle children than for farmworker children (117 and 87 nmol/L DMAP, respectively; p = 0.007). DMTP concentrations of U.S. children 6–11 years of age (1999–2000 National Health and Nutrition Examination Survey population) were higher than those of Seattle children and farmworker children at the 75th, 90th, and 95th percentiles. DMTP concentrations for workers actively engaged in apple thinning were 50 times higher than DMTP concentrations for farmworkers sampled outside of peak exposure periods. We conclude that workers who have direct contact with pesticides should continue to be the focus of public health interventions and that elevated child exposures in agricultural communities may occur during active crop-spraying periods and from living with a pesticide applicator. Timing of sample collection is critical for the proper interpretation of pesticide biomarkers excreted relatively soon after exposure. We surmise that differences in dietary exposure can explain the similar exposures observed among farmworker children, children living in the Seattle metropolitan area, and children sampled nationally. PMID:16263526

  6. School-based influenza immunization.

    PubMed

    Hull, Harry F; Frauendienst, Renee S; Gundersen, Margene L; Monsen, Susan M; Fishbein, Daniel B

    2008-08-12

    Annual influenza vaccination of schoolchildren will protect individual vaccines and, with high coverage, may protect entire communities. Because schoolchildren are more difficult to reach than preschoolers, school-based immunization programs may be needed to reach a high percentage of children. We offered free live, attenuated influenza vaccine to all healthy schoolchildren (K-12) in three Minnesota counties. Counties vaccinated from 33% to 58% of students. Overall, 41% of enrolled children were vaccinated. Elementary students were vaccinated at higher rates than older students. Administrative costs averaged $9.78 per dose delivered. School-based immunization programs offer the potential to achieve higher vaccination coverage of schoolchildren at modest cost. PMID:18577411

  7. Introduction of sequential inactivated polio vaccine-oral polio vaccine schedule for routine infant immunization in Brazil's National Immunization Program.

    PubMed

    Domingues, Carla Magda Allan S; de Fátima Pereira, Sirlene; Cunha Marreiros, Ana Carolina; Menezes, Nair; Flannery, Brendan

    2014-11-01

    In August 2012, the Brazilian Ministry of Health introduced inactivated polio vaccine (IPV) as part of sequential polio vaccination schedule for all infants beginning their primary vaccination series. The revised childhood immunization schedule included 2 doses of IPV at 2 and 4 months of age followed by 2 doses of oral polio vaccine (OPV) at 6 and 15 months of age. One annual national polio immunization day was maintained to provide OPV to all children aged 6 to 59 months. The decision to introduce IPV was based on preventing rare cases of vaccine-associated paralytic polio, financially sustaining IPV introduction, ensuring equitable access to IPV, and preparing for future OPV cessation following global eradication. Introducing IPV during a national multivaccination campaign led to rapid uptake, despite challenges with local vaccine supply due to high wastage rates. Continuous monitoring is required to achieve high coverage with the sequential polio vaccine schedule.

  8. Examining the social determinants of children's developmental health: protocol for building a pan-Canadian population-based monitoring system for early childhood development

    PubMed Central

    Guhn, Martin; Janus, Magdalena; Enns, Jennifer; Brownell, Marni; Forer, Barry; Duku, Eric; Muhajarine, Nazeem; Raos, Rob

    2016-01-01

    Introduction Early childhood is a key period to establish policies and practices that optimise children's health and development, but Canada lacks nationally representative data on social indicators of children's well-being. To address this gap, the Early Development Instrument (EDI), a teacher-administered questionnaire completed for kindergarten-age children, has been implemented across most Canadian provinces over the past 10 years. The purpose of this protocol is to describe the Canadian Neighbourhoods and Early Child Development (CanNECD) Study, the aims of which are to create a pan-Canadian EDI database to monitor trends over time in children's developmental health and to advance research examining the social determinants of health. Methods and analysis Canada-wide EDI records from 2004 to 2014 (representing over 700 000 children) will be linked to Canada Census and Income Taxfiler data. Variables of socioeconomic status derived from these databases will be used to predict neighbourhood-level EDI vulnerability rates by conducting a series of regression analyses and latent variable models at provincial/territorial and national levels. Where data are available, we will measure the neighbourhood-level change in developmental vulnerability rates over time and model the socioeconomic factors associated with those trends. Ethics and dissemination Ethics approval for this study was granted by the Behavioural Research Ethics Board at the University of British Columbia. Study findings will be disseminated to key partners, including provincial and federal ministries, schools and school districts, collaborative community groups and the early childhood development research community. The database created as part of this longitudinal population-level monitoring system will allow researchers to associate practices, programmes and policies at school and community levels with trends in developmental health outcomes. The CanNECD Study will guide future early childhood

  9. Immunization Coverage

    MedlinePlus

    ... underused vaccines is increasing. Immunization currently averts an estimated 2 to 3 million deaths every year. An ... avoided, however, if global vaccination coverage improves. An estimated 19.4 million infants worldwide are still missing ...

  10. When acculturation hurts: the case of immunization.

    PubMed

    Prislin, R; Suarez, L; Simpson, D M; Simspon, D M; Dyer, J A

    1998-12-01

    The study examined the relationship between the acculturation of Mexican American mothers in Texas and immunization status of their children between 3 and 24 months of age. Mothers' acculturation, demographic characteristics, and immunization status of their children were assessed in in-person interviews with a sample of Mexican American respondents representative for Texas (n = 2193). Acculturation was measured with ten scales assessing oral and written language use, proficiency, and preference, music and TV viewing preferences, ethnic identity, place where a person was reared, and contacts with Mexico. Immunization status, defined according to the recommendation of the CDC Advisory Committee on Immunization Practices, was determined from official shot records obtained directly from respondents or, for respondents without records, obtained from their health care providers. Regression analysis revealed that acculturation significantly contributed to inadequate immunization status, even when socioeconomic status and other demographic covariates of acculturation were statistically controlled. Mediational analysis revealed that acculturation contributed to inadequate immunization through less positive attitudes toward immunization, a diminished sense of parental responsibility for children's immunization, and more perceived barriers to immunization. It is concluded that culture-specific beliefs encouraging childhood immunization should be fostered among Mexican Americans.

  11. A Single Dose of Oral BCG Moreau Fails to Boost Systemic IFN-γ Responses to Tuberculin in Children in the Rural Tropics: Evidence for a Barrier to Mucosal Immunization

    PubMed Central

    Vaca, Maritza; Moncayo, Ana-Lucia; Cosgrove, Catherine A.; Chico, Martha E.; Castello-Branco, Luiz R.; Lewis, David J.; Cooper, Philip J.

    2012-01-01

    Immune responses to oral vaccines are impaired in populations living in conditions of poverty in developing countries, and there is evidence that concurrent geohelminth infections may contribute to this effect. We vaccinated 48 children living in rural communities in Ecuador with a single oral dose of 100 mg of BCG Moreau RDJ and measured the frequencies of tuberculin-stimulated peripheral blood mononuclear cells expressing IFN-γ before and after vaccination. Vaccinated children had active ascariasis (n = 20) or had been infected but received short- (n = 13) or long-term (n = 15) repeated treatments with albendazole prior to vaccination to treat ascariasis. All children had a BCG scar from neonatal vaccination. There was no evidence of a boosting of postvaccination IFN-γ responses in any of the 3 study groups. Our data provide support for the presence of a barrier to oral vaccination among children from the rural tropics that appeared to be independent of concurrent ascariasis. PMID:22287972

  12. Monitoring Cortical Excitability during Repetitive Transcranial Magnetic Stimulation in Children with ADHD: A Single-Blind, Sham-Controlled TMS-EEG Study

    PubMed Central

    Helfrich, Christian; Pierau, Simone S.; Freitag, Christine M.; Roeper, Jochen; Ziemann, Ulf; Bender, Stephan

    2012-01-01

    Background Repetitive transcranial magnetic stimulation (rTMS) allows non-invasive stimulation of the human brain. However, no suitable marker has yet been established to monitor the immediate rTMS effects on cortical areas in children. Objective TMS-evoked EEG potentials (TEPs) could present a well-suited marker for real-time monitoring. Monitoring is particularly important in children where only few data about rTMS effects and safety are currently available. Methods In a single-blind sham-controlled study, twenty-five school-aged children with ADHD received subthreshold 1 Hz-rTMS to the primary motor cortex. The TMS-evoked N100 was measured by 64-channel-EEG pre, during and post rTMS, and compared to sham stimulation as an intraindividual control condition. Results TMS-evoked N100 amplitude decreased during 1 Hz-rTMS and, at the group level, reached a stable plateau after approximately 500 pulses. N100 amplitude to supra-threshold single pulses post rTMS confirmed the amplitude reduction in comparison to the pre-rTMS level while sham stimulation had no influence. EEG source analysis indicated that the TMS-evoked N100 change reflected rTMS effects in the stimulated motor cortex. Amplitude changes in TMS-evoked N100 and MEPs (pre versus post 1 Hz-rTMS) correlated significantly, but this correlation was also found for pre versus post sham stimulation. Conclusion The TMS-evoked N100 represents a promising candidate marker to monitor rTMS effects on cortical excitability in children with ADHD. TMS-evoked N100 can be employed to monitor real-time effects of TMS for subthreshold intensities. Though TMS-evoked N100 was a more sensitive parameter for rTMS-specific changes than MEPs in our sample, further studies are necessary to demonstrate whether clinical rTMS effects can be predicted from rTMS-induced changes in TMS-evoked N100 amplitude and to clarify the relationship between rTMS-induced changes in TMS-evoked N100 and MEP amplitudes. The TMS-evoked N100 amplitude

  13. Creating Powerful Learning Opportunities for All Children: The Development and Use of a Self-Monitoring Checklist for Teachers. Draft.

    ERIC Educational Resources Information Center

    Hague, Sally A.; Walker, Carole

    Powerful learning is the premise that the type of education provided for gifted children works well for all children. This long-range study examined the usefulness of elements from a more aggressive approach to powerful learning than the one implicit in the accelerated schools model--specifically a teacher checklist, collegial coaching, reflective…

  14. Maladaptive Conflict Monitoring as Evidence for Executive Dysfunction in Children with Chromosome 22q11.2 Deletion Syndrome

    ERIC Educational Resources Information Center

    Bish, Joel P.; Ferrante, Samantha M.; McDonald-McGinn, Donna; Zackai, Elaine; Simon, Tony J.

    2005-01-01

    Using an adaptation of the Attentional Networks Test, we investigated aspects of executive control in children with chromosome 22q11.2 deletion syndrome (DS22q11.2), a common but not well understood disorder that produces non-verbal cognitive deficits and a marked incidence of psychopathology. The data revealed that children with DS22q11.2…

  15. The Impact of Retrieval Processes, Age, General Achievement Level, and Test Scoring Scheme for Children's Metacognitive Monitoring and Controlling

    ERIC Educational Resources Information Center

    Krebs, Saskia Susanne; Roebers, Claudia Maria

    2012-01-01

    This multi-phase study examined the influence of retrieval processes on children's metacognitive processes in relation to and in interaction with achievement level and age. First, N = 150 9/10- and 11/12-year old high and low achievers watched an educational film and predicted their test performance. Children then solved a cloze test regarding the…

  16. Immune Responses to Circulating and Vaccine Viral Strains in HIV-Infected and Uninfected Children and Youth Who Received the 2013/2014 Quadrivalent Live-Attenuated Influenza Vaccine

    PubMed Central

    Weinberg, Adriana; Curtis, Donna; Ning, Mariangeli Freitas; Claypool, David Jeremy; Jalbert, Emilie; Patterson, Julie; Frank, Daniel N.; Ir, Diana; Armon, Carl

    2016-01-01

    The live-attenuated influenza vaccine (LAIV) has generally been more efficacious than the inactivated vaccine in children. However, LAIV is not recommended for HIV-infected children because of insufficient data. We compared cellular, humoral, and mucosal immune responses to the 2013–2014 LAIV quadrivalent (LAIV4) in HIV-infected and uninfected children 2–25 years of age (yoa). We analyzed the responses to the vaccine H1N1 (H1N1-09), to the circulating H1N1 (H1N1-14), which had significant mutations compared to H1N1-09 and to B Yamagata (BY), which had the highest effectiveness in 2013–2014. Forty-six HIV-infected and 56 uninfected participants with prior influenza immunization had blood and nasal swabs collected before and after LAIV4 for IFNγ T and IgG/IgA memory B-cell responses (ELISPOT), plasma antibodies [hemagglutination inhibition (HAI) and microneutralization (MN)], and mucosal IgA (ELISA). The HIV-infected participants had median CD4+ T cells = 645 cells/μL and plasma HIV RNA = 20 copies/mL. Eighty-four percent were on combination anti-retroviral therapy. Regardless of HIV status, significant increases in T-cell responses were observed against BY, but not against H1N1-09. H1N1-09 T-cell immunity was higher than H1N1-14 both before and after vaccination. LAIV4 significantly increased memory IgG B-cell immunity against H1N1-14 and BY in uninfected, but not in HIV-infected participants. Regardless of HIV status, H1N1-09 memory IgG B-cell immunity was higher than H1N1-14 and lower than BY. There were significant HAI titer increases after vaccination in all groups and against all viruses. However, H1N1-14 MN titers were significantly lower than H1N1-09 before and after vaccination overall and in HIV-uninfected vaccinees. Regardless of HIV status, LAIV4 increased nasal IgA concentrations against all viruses. The fold-increase in H1N1-09 IgA was lower than BY. Overall, participants <9 yoa had decreased BY-specific HAI and nasal IgA responses

  17. Monitoring Children with Reading Disabilities' Response to Phonics Intervention: Are There Differences between Intervention Aligned and General Skill Progress Monitoring Assessments?

    ERIC Educational Resources Information Center

    Olinghouse, Natalie G.; Lambert, Warren; Compton, Donald L.

    2006-01-01

    This study investigated whether 2 different progress monitoring assessments differentially predicted growth in reading skills associated with systematic phonics instruction. Oral reading fluency (ORE) was compared with an intervention aligned word list (IAWL) as predictors of growth in untimed and timed decoding and word identification and text…

  18. We Must Immunize Every Child by Two.

    ERIC Educational Resources Information Center

    Carter, Rosalynn; Bumpers, Betty F.

    1992-01-01

    Discusses the development and initial implementation of the "Every Child by Two" project. The project is designed to immunize as many newborn through two-year-old children in the United States as possible against communicable childhood diseases, such as measles, and to create a program to systematically immunize this age group in the future. (BB)

  19. Brief Report: The Prevalence of Neurofibromatosis Type 1 among Children with Autism Spectrum Disorder Identified by the Autism and Developmental Disabilities Monitoring Network.

    PubMed

    Bilder, Deborah A; Bakian, Amanda V; Stevenson, David A; Carbone, Paul S; Cunniff, Christopher; Goodman, Alyson B; McMahon, William M; Fisher, Nicole P; Viskochil, David

    2016-10-01

    Neurofibromatosis type 1 (NF1) is an inherited neurocutaneous disorder associated with neurodevelopmental disorders including autism spectrum disorder (ASD). The frequency of ASD/NF1 co-occurrence has been subject to debate since the 1980s. This relationship was investigated in a large population-based sample of 8-year-old children identified with ASD (N = 12,271) by the Centers for Disease Control and Prevention's Autism and Developmental Disabilities Monitoring (ADDM) Network. Twenty-two (1-in-558) children with ASD had diagnosed NF1, exceeding NF1 general population estimates by four to five fold. Children with ASD/NF1 versus ASD without NF1 were significantly less likely to receive a community-based ASD diagnosis (p = 0.04) and understand non-verbal communication (p = 0.001). These findings underscore the importance of including social-communication ability among relevant developmental concerns in children with NF1.

  20. Comparative analysis of the humoral immune response to Moraxella catarrhalis and Streptococcus pneumoniae surface antigens in children suffering from recurrent acute otitis media and chronic otitis media with effusion.

    PubMed

    Verhaegh, Suzanne J C; Stol, Kim; de Vogel, Corné P; Riesbeck, Kristian; Lafontaine, Eric R; Murphy, Timothy F; van Belkum, Alex; Hermans, Peter W M; Hays, John P

    2012-06-01

    A prospective clinical cohort study was established to investigate the humoral immune response in middle ear fluids (MEF) and serum against bacterial surface proteins in children suffering from recurrent acute otitis media (rAOM) and chronic otitis media with effusion (COME), using Luminex xMAP technology. The association between the humoral immune response and the presence of Moraxella catarrhalis and Streptococcus pneumoniae in the nasopharynx and middle ear was also studied. The levels of antigen-specific IgG, IgA, and IgM showed extensive interindividual variation. No significant differences in anti-M. catarrhalis and anti-S. pneumoniae serum and MEF median fluorescence intensity (MFI) values (anti-M. catarrhalis and antipneumococcal IgG levels) were observed between the rAOM or COME groups for all antigens tested. No significant differences were observed for M. catarrhalis and S. pneumoniae colonization and serum IgG levels against the Moraxella and pneumococcal antigens. Similar to the antibody response in serum, no significant differences in IgG, IgA, and IgM levels in MEF were observed for all M. catarrhalis and S. pneumoniae antigens between OM M. catarrhalis- or S. pneumoniae-positive and OM M. catarrhalis- or S. pneumonia-negative children suffering from either rAOM or COME. Finally, results indicated a strong correlation between antigen-specific serum and MEF IgG levels. We observed no significant in vivo expressed anti-M. catarrhalis or anti-S. pneumoniae humoral immune responses using a range of putative vaccine candidate proteins. Other factors, such as Eustachian tube dysfunction, viral load, and genetic and environmental factors, may play a more important role in the pathogenesis of OM and in particular in the development of rAOM or COME.

  1. State-of-the-art monitoring of cytomegalovirus-specific cell-mediated immunity after organ transplant: a primer for the clinician.

    PubMed

    Egli, Adrian; Humar, Atul; Kumar, Deepali

    2012-12-01

    Cytomegalovirus (CMV) is one of the most common infections after solid organ transplantation. Improved assays to predict viral replication and disease would help refine current preventive strategies. Monitoring of CMV-specific T-cell responses may help guide clinical decision making. Several techniques are now available to quantify CMV-specific T-cell responses, including flow cytometry, enzyme-linked immunosorbent spot assay, and enzyme-linked immunosorbent assay. Standardization and validation of these assays have the potential to significantly change the monitoring and treatment of CMV and further personalize CMV prevention strategies. In this review, we discuss the measurement of CMV-specific T-cell responses and their clinical impact on the management of CMV after organ transplantation.

  2. Six areas lead national early immunization drive.

    PubMed

    Woods, D R; Mason, D D

    1992-01-01

    On June 13, 1991, President George Bush announced in a White House ceremony a local planning effort to break down barriers and provide better access to immunization in six representative localities "to solve the problem of late immunization." (children need to be immunized appropriately by their second birthday, not just in time for school.). The community "Immunization Action Plans" (IAP) are one of several Federal, State, and local responses to an outbreak of measles that produced 27,600 cases and 89 deaths in 1990. The community effort and subsequent early childhood immunization plans around the country are also part of a much broader effort initiated by Secretary Sullivan as a Healthy People Year 2000 goal to increase immunization levels to at least 90 percent for the nation's children by their second birthday. These efforts also respond to 13 recommendations for improving immunization availability made by the National Vaccine Advisory Committee in January 1991. The recommendations focused on improvements in the management of immunization delivery and in methods for measuring immunization status, increasing appropriate consumer demand, and other prevention needs. Although measles prompted the action, the immunization initiative is aimed also at eight other communicable childhood diseases--diphtheria, tetanus, pertussis or whooping cough, poliomyelitis, mumps, rubella, and Haemophilus influenza type b that causes bacterial meningitis, and hepatitis B. Details are described of the immunization action plans developed by Dallas, TX; Maricopa County (Phoenix), AZ; South Dakota; Detroit, MI; San Diego, CA; and Philadelphia, PA, to ensure that children are fully immunized not just by the time they enter school but by age 2 years. The six were chosen by the Centers for Disease Control as representative of many without adequate childhood immunization coverage.

  3. A Phase 3, Randomized, Double‐Blind, Placebo‐Controlled Study to Determine the Effect of Romiplostim on Health‐Related Quality of Life in Children with Primary Immune Thrombocytopenia and Associated Burden in Their Parents

    PubMed Central

    Li, Xiaoyan; Eisen, Melissa; Carpenter, Nancy; Crosby, Ross D.; Blanchette, Victor S.

    2016-01-01

    Background Chronic immune thrombocytopenia (ITP) in children can negatively impact their health‐related quality of life (HRQoL) and impose a burden on their parents. This study sought to examine the effect of romiplostim on HRQoL and parental burden in children with primary ITP. Procedure This was a phase 3, randomized, double‐blind, placebo‐controlled study. Children aged <18 years with ITP ≥6 months were randomly assigned to receive romiplostim or placebo for 24 weeks. The Kids’ ITP Tool (KIT) was used to measure HRQoL and was administered to patients and/or their parents at baseline and weeks 8, 16, and 25. Mean KIT scores at each assessment and mean changes in KIT scores from baseline were calculated overall by treatment group and platelet response status. Psychometric properties of the KIT were evaluated and the minimally important difference (MID) was estimated for different KIT versions. Results Sixty‐two patients (42 romiplostim and 20 placebo) were enrolled. Changes in KIT scores by treatment group showed numerically greater and more often statistically significant improvements from baseline to each assessment for children receiving romiplostim versus placebo. Mixed‐effects analysis demonstrated statistically significantly greater reduction in parental burden from baseline in the romiplostim group versus placebo. Ranges for the MID were estimated as 9–13 points for the Child Self‐Report version and 11–13 points for the Parent Impact version. Conclusions The treatment with romiplostim may be associated with improved HRQoL in children with primary ITP and reduced burden to their parents. PMID:27037553

  4. Plant Immunity

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Plants are faced with defending themselves against a multitude of pathogens, including bacteria, fungi, viruses, nematodes, etc. Immunity is multi-layered and complex. Plants can induce defenses when they recognize small peptides, proteins or double-stranded RNA associated with pathogens. Recognitio...

  5. Use of MenACWY-CRM vaccine in children aged 2 through 23 months at increased risk for meningococcal disease: recommendations of the Advisory Committee on Immunization Practices, 2013.

    PubMed

    MacNeil, Jessica R; Rubin, Lorry; McNamara, Lucy; Briere, Elizabeth C; Clark, Thomas A; Cohn, Amanda C

    2014-06-20

    During its October 2013 meeting, the Advisory Committee on Immunization Practices (ACIP) recommended use of a third meningococcal conjugate vaccine, MenACWY-CRM (Menveo, Novartis), as an additional option for vaccinating infants aged 2 through 23 months at increased risk for meningococcal disease. MenACWY-CRM is the first quadrivalent meningococcal conjugate vaccine licensed for use in children aged 2 through 8 months. MenACWY-D (Menactra, Sanofi Pasteur) is recommended for use in children aged 9 through 23 months who are at increased risk for meningococcal disease, and Hib-MenCY-TT (MenHibrix, GlaxoSmithKline) is recommended for use in children aged 6 weeks through 18 months at increased risk. This report summarizes information on MenACWY-CRM administration in infants and provides recommendations for vaccine use in infants aged 2 through 23 months who are at increased risk for meningococcal disease. Because the burden of meningococcal disease in infants is low in the United States and the majority of cases that do occur are caused by serogroup B, which is not included in any vaccine licensed in the United States, only those infants who are at increased risk for meningococcal disease are recommended to receive a meningococcal vaccine.

  6. Establishing global policy recommendations: the role of the Strategic Advisory Group of Experts on immunization.

    PubMed

    Duclos, Philippe; Okwo-Bele, Jean-Marie; Salisbury, David

    2011-02-01

    The vaccine landscape has changed considerably over the last decade with many new vaccines and technological developments, unprecedented progress in reaching out to children and the development of new financing mechanisms. At the same time, there are more demands and additional expectations of national policy makers, donors and other interested parties for increased protection through immunization. The Global Immunization Vision and Strategy (GIVS), which broadens the previous scope of immunization efforts, sets a number of goals to be met by countries. The WHO has recently reviewed and adjusted both its policy making structure and processes for vaccines and immunization to include an enlarged consultation process to generate evidence-based recommendations, thereby ensuring the transparency of the decision making process and improving communications. This article describes the process of development of immunization policy recommendations at the global level and some of their impacts. It focuses on the roles and modes of operating of the Strategic Advisory Group of Experts on immunization, which is the overarching advisory group involved with the issuance of policy recommendations, monitoring and facilitating the achievement of the GIVS goals. The article also describes the process leading to the publication of WHO vaccine position papers, which provide WHO recommendations on vaccine use. WHO vaccine-related recommendations have become a necessary step in the pathway to the introduction and use of vaccines, especially in developing countries and, consequently, have a clear and significant impact.

  7. Immune Responses to Vi Capsular Polysaccharide Typhoid Vaccine in Children 2 to 16 Years Old in Karachi, Pakistan, and Kolkata, India

    PubMed Central

    Khan, M. Imran; Soofi, Sajid B.; Sur, Dipika; Kanungo, Suman; You, Young Ae; Habib, M. Atif; Sahito, Shah Muhammad; Manna, Byomkesh; Dutta, Shanta; Acosta, Camilo J.; Ali, Mohammad; Bhattacharya, Sujit K.; Bhutta, Zulfiqar A.; Clemens, John D.

    2014-01-01

    The geometric mean concentration (GMC) and the proportion maintaining a protective level (150 enzyme-linked immunosorbent assay (ELISA) units [ELU]/ml) 2 years following a single dose of 25 μg of injectable Vi capsular polysaccharide typhoid vaccine was measured against that of the control hepatitis A vaccine in children 2 to 16 years old in cluster randomized trials in Karachi and Kolkata. The GMC for the Vi group (1,428 ELU/ml) was statistically significantly different from the GMC of the control hepatitis A vaccine group (86 ELU/ml) after 6 weeks. A total of 117 children (95.1%) in the Vi group and 9 (7.5%) in the hepatitis A group showed a 4-fold rise in Vi IgG antibody concentrations at 6 weeks (P < 0.01). Protective antibody levels remained significantly different between the two groups at 2 years (38% in the Vi vaccine groups and 6% in the hepatitis A group [P < 0.01]). A very small proportion of younger children (2 to 5 years old) maintained protective Vi IgG antibody levels at 2 years, a result that was not statistically significantly different compared to that for the hepatitis A group (38.1% versus 10.5%). The GMCs of the Vi IgG antibody after 2 years were 133 ELU/ml for children 2 to <5 years old and 349 ELU/ml for children 5 to 16 years old. In conclusion, Vi capsular polysaccharide typhoid vaccine is immunogenic in children in settings of South Asia where typhoid is highly endemic. The antibody levels in children who received this vaccine remained higher than those in children who received the control vaccine but were significantly reduced at 2 years of follow-up. PMID:24599532

  8. Immune responses to Vi capsular polysaccharide typhoid vaccine in children 2 to 16 years old in Karachi, Pakistan, and Kolkata, India.

    PubMed

    Ochiai, R Leon; Khan, M Imran; Soofi, Sajid B; Sur, Dipika; Kanungo, Suman; You, Young A; Habib, M Atif; Sahito, Shah Muhammad; Manna, Byomkesh; Dutta, Shanta; Acosta, Camilo J; Ali, Mohammad; Bhattacharya, Sujit K; Bhutta, Zulfiqar A; Clemens, John D

    2014-05-01

    The geometric mean concentration (GMC) and the proportion maintaining a protective level (150 enzyme-linked immunosorbent assay (ELISA) units [ELU]/ml) 2 years following a single dose of 25 μg of injectable Vi capsular polysaccharide typhoid vaccine was measured against that of the control hepatitis A vaccine in children 2 to 16 years old in cluster randomized trials in Karachi and Kolkata. The GMC for the Vi group (1,428 ELU/ml) was statistically significantly different from the GMC of the control hepatitis A vaccine group (86 ELU/ml) after 6 weeks. A total of 117 children (95.1%) in the Vi group and 9 (7.5%) in the hepatitis A group showed a 4-fold rise in Vi IgG antibody concentrations at 6 weeks (P < 0.01). Protective antibody levels remained significantly different between the two groups at 2 years (38% in the Vi vaccine groups and 6% in the hepatitis A group [P < 0.01]). A very small proportion of younger children (2 to 5 years old) maintained protective Vi IgG antibody levels at 2 years, a result that was not statistically significantly different compared to that for the hepatitis A group (38.1% versus 10.5%). The GMCs of the Vi IgG antibody after 2 years were 133 ELU/ml for children 2 to <5 years old and 349 ELU/ml for children 5 to 16 years old. In conclusion, Vi capsular polysaccharide typhoid vaccine is immunogenic in children in settings of South Asia where typhoid is highly endemic. The antibody levels in children who received this vaccine remained higher than those in children who received the control vaccine but were significantly reduced at 2 years of follow-up.

  9. The Cost Effectiveness of Hepatitis Immunization for US College Students

    ERIC Educational Resources Information Center

    Jacobs, R. Jake; Saab, Sammy; Meyerhoff, Allen S.

    2003-01-01

    Hepatitis B immunization is recommended for all American children, and hepatitis A immunization is recommended for children who live in areas with elevated disease rates. Because hepatitis A and B occur most commonly in young adults, the authors examined the cost effectiveness of college-based vaccination. They developed epidemiologic models to…

  10. Brief Report: Immune Factors in Autism: A Critical Review.

    ERIC Educational Resources Information Center

    Krause, Ilan; He, Ziao-Song; Gershwin, M. Eric; Shoenfeld, Yehuda

    2002-01-01

    This article reviews studies linking autistic disorder with various immune factors. It concludes that although various immune system abnormalities have been reported in children with autism, previous studies are largely association based and it remains difficult to draw conclusions regarding the role of immune factors in the etiopathogenesis of…

  11. The effects of self-monitoring on the procedural integrity of a behavioral intervention for young children with developmental disabilities.

    PubMed

    Plavnick, Joshua B; Ferreri, Summer J; Maupin, Angela N

    2010-01-01

    The effects of self-monitoring on the procedural integrity of token economy implementation by 3 staff in a special education classroom were evaluated. The subsequent changes in academic readiness behaviors of 2 students with low-incidence disabilities were measured. Multiple baselines across staff and students showed that procedural integrity increased when staff used monitoring checklists, and students' academic readiness behavior also increased. Results are discussed with respect to the use of self-monitoring and the importance of procedural integrity in public school settings. PMID:21119907

  12. THE EFFECTS OF SELF-MONITORING ON THE PROCEDURAL INTEGRITY OF A BEHAVIORAL INTERVENTION FOR YOUNG CHILDREN WITH DEVELOPMENTAL DISABILITIES

    PubMed Central

    Plavnick, Joshua B; Ferreri, Summer J; Maupin, Angela N

    2010-01-01

    The effects of self-monitoring on the procedural integrity of token economy implementation by 3 staff in a special education classroom were evaluated. The subsequent changes in academic readiness behaviors of 2 students with low-incidence disabilities were measured. Multiple baselines across staff and students showed that procedural integrity increased when staff used monitoring checklists, and students' academic readiness behavior also increased. Results are discussed with respect to the use of self-monitoring and the importance of procedural integrity in public school settings. PMID:21119907

  13. The effects of self-monitoring on the procedural integrity of a behavioral intervention for young children with developmental disabilities.

    PubMed

    Plavnick, Joshua B; Ferreri, Summer J; Maupin, Angela N

    2010-01-01

    The effects of self-monitoring on the procedural integrity of token economy implementation by 3 staff in a special education classroom were evaluated. The subsequent changes in academic readiness behaviors of 2 students with low-incidence disabilities were measured. Multiple baselines across staff and students showed that procedural integrity increased when staff used monitoring checklists, and students' academic readiness behavior also increased. Results are discussed with respect to the use of self-monitoring and the importance of procedural integrity in public school settings.

  14. Evaluation of the Immune Response to Interferon Gamma Release Assay and Tuberculin Skin Test Among BCG Vaccinated Children in East of Egypt

    PubMed Central

    Beshir, Mohamed Refaat; Zidan, Alaa Ebrahim; El-Saadny, Hosam Fathi; Ramadan, Raghdaa Abdelaziz; Karam, Nehad Ahmed; Amin, Ezzat Kamel; Mohamed, Marwa Zakaria; Abdelsamad, Nahla Mohamed

    2016-01-01

    Abstract Bacille Calmette-Guérin vaccine (BCG) vaccination is used routinely in most of countries, especially developing one. The efficacy of the BCG vaccination generally decreases with time. The tuberculin skin test (TST) is a most popular diagnostic test for suspicion of tuberculosis (TB) in children till now, but it has many false positives. The interferon-gamma release assay (IGRA) is more specific than TST for detection of childhood TB, as it is more specific to Mycobacterium tuberculosis. Evaluate the interferon gamma response and TST reaction in BCG vaccinated children in east of Egypt. 150 children were included in the study aged 1 month to 12 years; the collected data from the children included, full history taking, clinical examination, examination for the presence or absence of BCG scar under direct light. All the children had performed TST, IGRA. TST was done for all studied group reveal 51.3% with size of reaction <5 mm, 39.3% with size of reaction = 5 to 9 mm while 9.3% with size of reaction ≥10 mm. Mean size of reaction was 4.07 mm. Interferon gamma release assay was done for all studied group reveal 5 children (3.3%) with positive test. There was significant difference between the size of TST reaction and age (P < 0.01) with old children were more frequent to show positive reaction. Also, children with age range 1 month to 1 year were frequently have negative IGRA test, while children with age range 4 years to 12 years were frequently have positive test (P < 0.01). There was moderate agreement between IGRA and TST results (Kappa [κ] = 0.475). With high agreement between IGRA and TST results in children with absent BCG scar (κ = 1000). Therefore, Interferon gamma release assays have higher specificity and lower cross-reactions with BCG vaccination and nontuberculous Mycobacteraie than TST. PMID:27124042

  15. Federal immunity Law in Higher Education.

    ERIC Educational Resources Information Center

    Johnsen, Christopher; Todd, James C.

    1999-01-01

    Monitors and analyzes developments in immunity law in 1998 applicable to higher education. The review suggests that the extent of a plaintiff's constitutional rights and the scope of a public official's qualified immunity depend to a not insignificant degree on which circuit, or even which panel, decides the case. (SLD)

  16. Action on low immunization uptake.

    PubMed

    Azubuike, M C; Ehiri, J E

    1998-01-01

    Despite a number of initiatives and campaigns over the years, immunization coverage in most parts of Nigeria remains low. That low coverage contributes to high morbidity and mortality levels among children. Poor transport, an ineffective cold chain, shortages of trained manpower, and inadequate community support and involvement are some of the factors which explain the underutilization of the immunization service. Aba is a city of approximately 500,000 people in eastern Nigeria in which the majority of inhabitants are traders. Aba's primary health care committee decided that immunization centers should be established in or near main trading areas to accommodate traders who did not want to leave their goods in order to take their children to primary care facilities for immunization. Traders' representatives helped to identify 8 suitable locations for vaccination sites in 3 shopping centers, the local authority provided financial and political support, and the state government gave technical and logistical assistance. The project began in September 1990 and was publicized through the traders' networks, which also helped to mobilize the relevant resources. Since many trading families were reached for the first time at the special centers, immunization coverage improved significantly for the 6 vaccine-preventable childhood diseases. Moreover, the project gave health workers the opportunity to deliver other services and counseling on matters of public health importance.

  17. Immunization Schedules for Adults

    MedlinePlus

    ... ACIP Vaccination Recommendations Why Immunize? Vaccines: The Basics Immunization Schedules for Adults in Easy-to-read Formats ... previous immunizations. View or Print a Schedule Recommended Immunizations for Adults (19 Years and Older) by Age ...

  18. Pulse immunization -- polio eradication strategy.

    PubMed

    1994-09-30

    India has 10% of the reported cases of poliomyelitis each year, and the capital city, Delhi, contributes 6% of these. The trans-Yamuna region of Delhi has the highest incidence of the disease in the world. Yet, the World Health Organization (WHO) predicts that polio will be eradicated from India in 3 years and from the world by the year 2000. Thus, the WHO is working with the government of Delhi to implement a new "pulse immunization" program. Pulse immunization is thought to be the only way to eradicate the disease in conditions with unsafe water and poor sewage disposal. Pulse immunization requires simultaneous mass vaccination (over 2-3 days) with oral polio vaccine (OPV) of all children in the susceptible age group. This mass immunization is repeated twice a year with a 6-8 week interval between doses. Pulse immunization must be continued for 3-4 years to prevent resurgence of the disease. In Delhi, the first Sundays of October and December 1994 have been earmarked for the effort which will reach 3 million children under age of 3 years. The most difficult part of the effort will be to see that mothers bring their children to receive the immunization from one of 4000 vaccination booths. Pulse immunization can be administered to children regardless of their previous vaccination status and regardless of whether they are ill or healthy at the time. One pitfall of the program which must be considered to ensure its success is the infrastructure needed to provide refrigerated transportation of the OPV to the site of use. Even minor temperature changes can destroy the effectiveness of the OPV, so it is essential to protect the vaccine. It is ironic that while Delhi, with all of its problems, attempts to provide a cold chain-dependent mass immunization, efforts in the US to commence a new national vaccine program have been questioned because of the ability and cost-effectiveness of maintaining the cold chain. If the US has trouble maintaining the cold chain, will the

  19. Longitudinal MRI and Ferritin Monitoring of Iron Overload in Chronically Transfused and Chelated Children With Sickle Cell Anemia and Thalassemia Major.

    PubMed

    Aubart, Mélodie; Ou, Phalla; Elie, Caroline; Canniffe, Carla; Kutty, Shelby; Delos, Vincent; Graffigne, Christine; de Montalembert, Mariane; Brousse, Valentine

    2016-10-01

    Iron overload is an ineluctable complication in chronically transfused children warranting accurate assessment to avoid related morbidity. We investigated longitudinally the relationships between ferritin levels and hepatic and cardiac T2* magnetic resonance imaging (MRI) in a cohort of chronically transfused children receiving chelation therapy. Thirty children with sickle cell anemia (SCA) and 7 with thalassemia major (TM) chelated similarly by deferasirox were analyzed. Sex ratio, age, median duration of transfusion programs (5 y; range, 2 to 14 y), median transfusion iron intake 0.54 mg/kg/d (range, 0.27 to 0.74 mg/kg/d), and median ferritin level (1550 mg/L; range, 184 to 6204 mg/L) were comparable in TM and SCA. A significant relation was found between ferritin level and transfusion iron intake (P<0.001) despite chelation therapy. Analysis of 73 hepatic T2* MRI performed yearly demonstrated severe hepatic iron overload (≥14 mg/g) in 38.3% cases and a strong relationship between serum ferritin level and liver iron content both in SCA and TM (P<0.001). Analysis of 55 cardiac T2* MRI measurements found no cardiac overload in patients with SCA. Cardiac iron overload was moderate in 4 cases and severe in 1 case of TM. In almost half the cases, ferritin trend correctly predicted hepatic iron trend, both in patients with SCA and TM but failed to predict cardiac iron trend, notably in TM patients. Despite chelation therapy, iron burden in chronically transfused patients remains a threat. Ferritin levels are associated with liver iron overload in chelated children with SCA and TM, but iron burden should be best monitored with MRI whenever the setting allows it. PMID:27548334

  20. Motivational Incentives and Methylphenidate Enhance Electrophysiological Correlates of Error Monitoring in Children with Attention Deficit/Hyperactivity Disorder

    ERIC Educational Resources Information Center

    Groom, Madeleine J.; Liddle, Elizabeth B.; Scerif, Gaia; Liddle, Peter F.; Batty, Martin J.; Liotti, Mario; Hollis, Chris P.

    2013-01-01

    Background: Children with attention deficit hyperactivity disorder (ADHD) are characterised by developmentally inappropriate levels of hyperactivity, impulsivity and/or inattention and are particularly impaired when performing tasks that require a high level of cognitive control. Methylphenidate (MPH) and motivational incentives may help improve…

  1. Hepatitis B revaccination in healthy non-responder Chinese children: five-year follow-up of immune response and immunologic memory.

    PubMed

    Zhuang, Gui-Hua; Yan, Hong; Wang, Xue-Liang; Hwang, Lu-Yu; Wu, Qian; Wang, Li-Rong; Gao, Hai-Yan

    2006-03-15

    To assess persistence of anti-HBs and immunologic memory of non-responders after revaccination, 40 healthy non-responder children were given a three-dose recombinant hepatitis B vaccine revaccination randomly by intramuscular (10 microg per dose) or intradermal (2 microg per dose) route and followed up to five years. All 17 intramuscular and 22 of 23 intradermal children developed a seroprotective antibody response (anti-HBs>or=10 mIU/mL) after revaccination. Children of intramuscular group had significantly higher seroprotection rates and anti-HBs geometric mean titers than the intradermal group. At year 5, 50% of children in intramuscular group, but only 18.2% of intradermal group still maintained seroprotection (P=0.075). By the end of follow-up, a booster dose (5 microg) was given to those who had lost seroprotection. All the eight intramuscular children developed an anamnestic response with increase of anti-HBs level by 215 times, but two of the 18 intradermal children failed to produce seroprotective level. Three-routine-dose intramuscular revaccination was significantly more effective than low-dose intradermal revaccination with the same number of injections. No child seroconverted to HBsAg, and 11 had transient infections indicated by seroconversion to anti-HBc. These results demonstrated that non-responders could benefit from three doses intramuscular revaccination not only in high proportion of anti-HBs conversion but also in long-term persistence of seroprotection, and more importantly in preservation of the immunologic memory years after loss of protective anti-HBs.

  2. A prototype of a novel cell phone application for tracking the vaccination coverage of children in rural communities.

    PubMed

    Katib, Anas; Rao, Deepthi; Rao, Praveen; Williams, Karen; Grant, Jim

    2015-11-01

    Immunization saves millions of lives against vaccine-preventable diseases. Yet, 24 million children born every year do not receive proper immunization during their first year. UNICEF and WHO have emphasized the need to strengthen the immunization surveillance and monitoring in developing countries to reduce childhood deaths. In this regard, we present a software application called Jeev to track the vaccination coverage of children in rural communities. Jeev synergistically combines the power of smartphones and the ubiquity of cellular infrastructure, QR codes, and national identification cards. We present the design of Jeev and highlight its unique features along with a detailed evaluation of its performance and power consumption using the National Immunization Survey datasets. We are in discussion with a non-profit organization in Haiti to pilot test Jeev in order to study its effectiveness and identify socio-cultural issues that may arise in a large-scale deployment. PMID:26363678

  3. A prototype of a novel cell phone application for tracking the vaccination coverage of children in rural communities.

    PubMed

    Katib, Anas; Rao, Deepthi; Rao, Praveen; Williams, Karen; Grant, Jim

    2015-11-01

    Immunization saves millions of lives against vaccine-preventable diseases. Yet, 24 million children born every year do not receive proper immunization during their first year. UNICEF and WHO have emphasized the need to strengthen the immunization surveillance and monitoring in developing countries to reduce childhood deaths. In this regard, we present a software application called Jeev to track the vaccination coverage of children in rural communities. Jeev synergistically combines the power of smartphones and the ubiquity of cellular infrastructure, QR codes, and national identification cards. We present the design of Jeev and highlight its unique features along with a detailed evaluation of its performance and power consumption using the National Immunization Survey datasets. We are in discussion with a non-profit organization in Haiti to pilot test Jeev in order to study its effectiveness and identify socio-cultural issues that may arise in a large-scale deployment.

  4. Assessing immunization coverage in private practice.

    PubMed Central

    Hutchins, S. S.; Sherrod, J.; Bernier, R.

    2000-01-01

    To achieve national health objectives of eliminating most childhood vaccine-preventable diseases by the year 2010, all health care providers will have to improve the immunization rates of their patients. Currently, immunization rates of children 19 to 35 months of age are less than national objectives, suggesting a need for optimized immunization services. A key strategy for improving age-appropriate immunization coverage by health care providers is the assessment of immunization coverage. Because most (62%), immunization services in the United States are delivered in the private sector, a concerted effort in private practice is critical to improving immunization rates. Assessment of immunization coverage of patients enrolled in private practice serves 1) to measure the overall performance of the practice in providing the standard of care, 2) to identify strategies for improving coverage, and 3) to document the quality of health services delivered (report card). Assessment of immunization coverage has been demonstrated in several practice settings to be highly effective in improving immunization rates. All types of physicians should benefit from assessing immunization coverage of their patients. Simple assessment tools are available at no cost to the public and can be obtained by contacting the Centers for Disease Control and Prevention. These tools include a manual self-assessment or a computerized software package (CASA) to fit the needs of the practice. PMID:10976172

  5. [Evaluation of postvaccinal pertussis immunity by using immunoenzyme analysis].

    PubMed

    Khardina, A A; Lapaeva, I A; Amelina, I P; Rusakova, E V; Kuliakina, M N

    1989-01-01

    The effectiveness of adsorbed DPT vaccine manufactured in the USSR, evaluated by its capacity of inducing the formation of the main classes of immunoglobulins and by the duration of immune response to the acellular complex of protective antigens (pertussis toxin and agglutinogen-2), was studied with the use of modified EIA. Out of 273 children immunized with adsorbed DPT vaccine in the course of this study, 87.2% had IgG-antibodies, 14.1% had IgA-antibodies and 3.2% of the children had IgM-antibodies. The level of immunity in children having received the full course of immunization with adsorbed DPT vaccine was significantly higher in comparison with children given only the primary course of immunization and nonimmunized children of the same age. Antipertussis immunity was found to decrease two years after the completion of the course of immunization with adsorbed DPT vaccine and in children over 5-6 years of age. Adsorbed DPT vaccine prevented the disease, but not infection. The level of postinfection immunity was higher than that of postvaccinal immunity. PMID:2540600

  6. Interleukin-6 Induced "Acute" Phenotypic Microenvironment Promotes Th1 Anti-Tumor Immunity in Cryo-Thermal Therapy Revealed By Shotgun and Parallel Reaction Monitoring Proteomics.

    PubMed

    Xue, Ting; Liu, Ping; Zhou, Yong; Liu, Kun; Yang, Li; Moritz, Robert L; Yan, Wei; Xu, Lisa X

    2016-01-01

    Cryo-thermal therapy has been emerged as a promising novel therapeutic strategy for advanced breast cancer, triggering higher incidence of tumor regression and enhanced remission of metastasis than routine treatments. To better understand its anti-tumor mechanism, we utilized a spontaneous metastatic mouse model and quantitative proteomics to compare N-glycoproteome changes in 94 serum samples with and without treatment. We quantified 231 highly confident N-glycosylated proteins using iTRAQ shotgun proteomics. Among them, 53 showed significantly discriminated regulatory patterns over the time course, in which the acute phase response emerged as the most enhanced pathway. The anti-tumor feature of the acute response was further investigated using parallel reaction monitoring target proteomics and flow cytometry on 23 of the 53 significant proteins. We found that cryo-thermal therapy reset the tumor chronic inflammation to an "acute" phenotype, with up-regulation of acute phase proteins including IL-6 as a key regulator. The IL-6 mediated "acute" phenotype transformed IL-4 and Treg-promoting ICOSL expression to Th1-promoting IFN-γ and IL-12 production, augmented complement system activation and CD86(+)MHCII(+) dendritic cells maturation and enhanced the proliferation of Th1 memory cells. In addition, we found an increased production of tumor progression and metastatic inhibitory proteins under such "acute" environment, favoring the anti-metastatic effect. Moreover, cryo-thermal on tumors induced the strongest "acute" response compared to cryo/hyperthermia alone or cryo-thermal on healthy tissues, accompanying by the most pronounced anti-tumor immunological effect. In summary, we demonstrated that cryo-thermal therapy induced, IL-6 mediated "acute" microenvironment shifted the tumor chronic microenvironment from Th2 immunosuppressive and pro-tumorigenic to Th1 immunostimulatory and tumoricidal state. Moreover, the magnitude of "acute" and "danger" signals play a key

  7. Estimation of immunization providers' activities cost, medication cost, and immunization dose errors cost in Iraq.

    PubMed

    Al-lela, Omer Qutaiba B; Bahari, Mohd Baidi; Al-abbassi, Mustafa G; Salih, Muhannad R M; Basher, Amena Y

    2012-06-01

    The immunization status of children is improved by interventions that increase community demand for compulsory and non-compulsory vaccines, one of the most important interventions related to immunization providers. The aim of this study is to evaluate the activities of immunization providers in terms of activities time and cost, to calculate the immunization doses cost, and to determine the immunization dose errors cost. Time-motion and cost analysis study design was used. Five public health clinics in Mosul-Iraq participated in the study. Fifty (50) vaccine doses were required to estimate activities time and cost. Micro-costing method was used; time and cost data were collected for each immunization-related activity performed by the clinic staff. A stopwatch was used to measure the duration of activity interactions between the parents and clinic staff. The immunization service cost was calculated by multiplying the average salary/min by activity time per minute. 528 immunization cards of Iraqi children were scanned to determine the number and the cost of immunization doses errors (extraimmunization doses and invalid doses). The average time for child registration was 6.7 min per each immunization dose, and the physician spent more than 10 min per dose. Nurses needed more than 5 min to complete child vaccination. The total cost of immunization activities was 1.67 US$ per each immunization dose. Measles vaccine (fifth dose) has a lower price (0.42 US$) than all other immunization doses. The cost of a total of 288 invalid doses was 744.55 US$ and the cost of a total of 195 extra immunization doses was 503.85 US$. The time spent on physicians' activities was longer than that spent on registrars' and nurses' activities. Physician total cost was higher than registrar cost and nurse cost. The total immunization cost will increase by about 13.3% owing to dose errors.

  8. Pathobiology of secondary immune thrombocytopenia

    PubMed Central

    Cines, Douglas B.; Liebman, Howard; Stasi, Roberto

    2009-01-01

    Primary immune thrombocytopenic purpura (ITP) remains a diagnosis of exclusion both from nonimmune causes of thrombocytopenia and immune thrombocytopenia that develops in the context of other disorders (secondary immune thrombocytopenia). The pathobiology, natural history, and response to therapy of the diverse causes of secondary ITP differ from each other and from primary ITP, so accurate diagnosis is essential. Immune thrombocytopenia can be secondary to medications or to a concurrent disease, such as an autoimmune condition (eg, systemic lupus erythematosus [SLE], antiphospholipid antibody syndrome [APS], immune thyroid disease, or Evans syndrome), a lymphoproliferative disease (eg, chronic lymphocytic leukemia or large granular T-lymphocyte lymphocytic leukemia), or chronic infection, eg, with Helicobacter pylori, human immunodeficiency virus (HIV), or hepatitis C virus (HCV). Response to infection may generate antibodies that cross-react with platelet antigens (HIV, H pylori) or immune complexes that bind to platelet Fcγ receptors (HCV) and platelet production may be impaired by infection of megakaryocyte bone marrow-dependent progenitor cells (HCV and HIV), decreased production of thrombopoietin (TPO), and splenic sequestration of platelets secondary to portal hypertension (HCV). Sudden and severe onset of thrombocytopenia has been observed in children after vaccination for measles, mumps, and rubella or natural viral infections, including Epstein-Barr virus, cytomegalovirus, and varicella zoster virus. This thrombocytopenia may be caused by cross-reacting antibodies and closely mimics acute ITP of childhood. Proper diagnosis and treatment of the underlying disorder, where necessary, play an important role in patient management. PMID:19245930

  9. [The theophylline test in the evaluation of the state of cellular immunity in children with different clinical courses of systemic lupus erythematosus].

    PubMed

    Belokrinitskiĭ, D V; Dudkina, L N; Tarasova, L R

    1989-01-01

    An inverse reaction of T-lymphocytes to theophylline is sometimes observed in children with systemic lupus erythematosus. In this case the disease runs a more benign course and is less resistant to prednisolone therapy. The theophylline test is recommended for the prediction of the disease course.

  10. Standard of Care for Neuropsychological Monitoring in Pediatric Neuro-Oncology: Lessons From the Children's Oncology Group (COG).

    PubMed

    Walsh, Karin S; Noll, Robert B; Annett, Robert D; Patel, Sunita K; Patenaude, Andrea F; Embry, Leanne

    2016-02-01

    As the mortality of pediatric cancers has decreased, focus on neuropsychological morbidities of treatment sequelae have increased. Neuropsychological evaluations are essential diagnostic tools that assess cognitive functioning and neurobiological integrity. These tests provide vital information to support ongoing medical care, documenting cognitive morbidity and response to interventions. We frame standards for neuropsychological monitoring of pediatric patients with CNS malignancy or who received cancer-directed therapies involving the CNS and discuss billing for these services in the United States in the context of clinical research. We describe a cost-effective, efficient model of neuropsychological monitoring that may increases access to neuropsychological care.

  11. Interleukin-6 Induced “Acute” Phenotypic Microenvironment Promotes Th1 Anti-Tumor Immunity in Cryo-Thermal Therapy Revealed By Shotgun and Parallel Reaction Monitoring Proteomics

    PubMed Central

    Xue, Ting; Liu, Ping; Zhou, Yong; Liu, Kun; Yang, Li; Moritz, Robert L.; Yan, Wei; Xu, Lisa X.

    2016-01-01

    Cryo-thermal therapy has been emerged as a promising novel therapeutic strategy for advanced breast cancer, triggering higher incidence of tumor regression and enh